WorldWideScience

Sample records for human gene encoding

  1. Characterization of the human gene (TBXAS1) encoding thromboxane synthase.

    Science.gov (United States)

    Miyata, A; Yokoyama, C; Ihara, H; Bandoh, S; Takeda, O; Takahashi, E; Tanabe, T

    1994-09-01

    The gene encoding human thromboxane synthase (TBXAS1) was isolated from a human EMBL3 genomic library using human platelet thromboxane synthase cDNA as a probe. Nucleotide sequencing revealed that the human thromboxane synthase gene spans more than 75 kb and consists of 13 exons and 12 introns, of which the splice donor and acceptor sites conform to the GT/AG rule. The exon-intron boundaries of the thromboxane synthase gene were similar to those of the human cytochrome P450 nifedipine oxidase gene (CYP3A4) except for introns 9 and 10, although the primary sequences of these enzymes exhibited 35.8% identity each other. The 1.2-kb of the 5'-flanking region sequence contained potential binding sites for several transcription factors (AP-1, AP-2, GATA-1, CCAAT box, xenobiotic-response element, PEA-3, LF-A1, myb, basic transcription element and cAMP-response element). Primer-extension analysis indicated the multiple transcription-start sites, and the major start site was identified as an adenine residue located 142 bases upstream of the translation-initiation site. However, neither a typical TATA box nor a typical CAAT box is found within the 100-b upstream of the translation-initiation site. Southern-blot analysis revealed the presence of one copy of the thromboxane synthase gene per haploid genome. Furthermore, a fluorescence in situ hybridization study revealed that the human gene for thromboxane synthase is localized to band q33-q34 of the long arm of chromosome 7. A tissue-distribution study demonstrated that thromboxane synthase mRNA is widely expressed in human tissues and is particularly abundant in peripheral blood leukocyte, spleen, lung and liver. The low but significant levels of mRNA were observed in kidney, placenta and thymus.

  2. Cloning of human genes encoding novel G protein-coupled receptors

    Energy Technology Data Exchange (ETDEWEB)

    Marchese, A.; Docherty, J.M.; Heiber, M. [Univ. of Toronto, (Canada)] [and others

    1994-10-01

    We report the isolation and characterization of several novel human genes encoding G protein-coupled receptors. Each of the receptors contained the familiar seven transmembrane topography and most closely resembled peptide binding receptors. Gene GPR1 encoded a receptor protein that is intronless in the coding region and that shared identity (43% in the transmembrane regions) with the opioid receptors. Northern blot analysis revealed that GPR1 transcripts were expressed in the human hippocampus, and the gene was localized to chromosome 15q21.6. Gene GPR2 encoded a protein that most closely resembled an interleukin-8 receptor (51% in the transmembrane regions), and this gene, not expressed in the six brain regions examined, was localized to chromosome 17q2.1-q21.3. A third gene, GPR3, showed identity (56% in the transmembrane regions) with a previously characterized cDNA clone from rat and was localized to chromosome 1p35-p36.1. 31 refs., 5 figs., 1 tab.

  3. Molecular cloning and chromosome mapping of the human gene encoding protein phosphotyrosyl phosphatase 1B

    International Nuclear Information System (INIS)

    Brown-Shimer, S.; Johnson, K.A.; Bruskin, A.; Green, N.R.; Hill, D.E.; Lawrence, J.B.; Johnson, C.

    1990-01-01

    The inactivation of growth suppressor genes appears to play a major role in the malignant process. To assess whether protein phosphotyrosyl phosphatases function as growth suppressors, the authors have isolated a cDNA clone encoding human protein phosphotyrosyl phosphatase 1B for structural and functional characterization. The translation product deduced from the 1,305-nucleotide open reading frame predicts a protein containing 435 amino acids and having a molecular mass of 49,966 Da. The amino-terminal 321 amino acids deduced from the cDNA sequence are identical to the empirically determined sequence of protein phosphotyrosyl phosphatase 1B. A genomic clone has been isolated and used in an in situ hybridization to banded metaphase chromosomes to determine that the gene encoding protein phosphotyrosyl phosphatase 1B maps as a single-copy gene to the long arm of chromosome 20 in the region q13.1-q13.2

  4. Mutagenesis in sequence encoding of human factor VII for gene therapy of hemophilia

    Directory of Open Access Journals (Sweden)

    B Kazemi

    2009-12-01

    Full Text Available "nBackground: Current treatment of hemophilia which is one of the most common bleeding disorders, involves replacement therapy using concentrates of FVIII and FIX .However, these concentrates have been associated with viral infections and thromboembolic complications and development of antibodies. "nThe use of recombinant human factor VII (rhFVII is effective  for the treatment of patients with  hemophilia A or B, who develop antibodies ( referred as inhibitors against  replacement therapy , because it induces coagulation independent of FVIII and FIX. However, its short half-life and high cost have limited its use. One potential solution to this problem may be the use of FVIIa gene transfer, which would attain continuing therapeutic levels of expression from a single injection. The aim of this study was to engineer a novel hFVII (human FVII gene containing a cleavage site for the intracellular protease and furin, by PCR mutagenesis "nMethods: The sequence encoding light and heavy chains of hFVII, were amplified by using hFVII/pTZ57R and specific primers, separately. The PCR products were cloned in pTZ57R vector. "nResults and discussion: Cloning was confirmed by restriction analysis or PCR amplification using specific primers and plasmid universal primers. Mutagenesis of sequence encoding light and heavy chain was confirmed by restriction enzyme. "nConclusion: In the present study, it was provided recombinant plasmids based on mutant form of DNA encoding light and heavy chains.  Joining mutant form of DNA encoding light chain with mutant heavy chain led to a new variant of hFVII. This variant can be activated by furin and an increase in the proportion of activated form of FVII. This mutant form of hFVII may be used for gene therapy of hemophilia.

  5. Effect of recombinant adenovirus encoding human p53 tumor suppressor gene combined with radiation therapy on human lymphoma cells lines

    International Nuclear Information System (INIS)

    Yu Zeyang; Fan Wo; Li Dongqing; Zhu Ran; Wan Jianmei; Wang Yongqing; Wu Jinchang

    2008-01-01

    This paper analyzes the inhibitory effect and radiation sensitization of recombinant adenovirus encoding human p53 tumor suppressor gene (rAd-p53) on human lymphoma cell lines. Human lymphoma cell lines were treated with rAd-p53, radiation therapy and combined treatment, respectively. The cell growth inhibition was assessed by MTF. The cell cycle and apoptosis were detected by flow cytometry, and the p53 protein expression was detected by Western blotting. The results showed that extrinsic p53 gene have expressed to some degree, but not at high level. The role of inhibition and radiation sensitivity of rAd-p53 was not significant to human lymphoma cell lines. (authors)

  6. The Relationship Between Transcript Expression Levels of Nuclear Encoded (TFAM, NRF1 and Mitochondrial Encoded (MT-CO1 Genes in Single Human Oocytes During Oocyte Maturation

    Directory of Open Access Journals (Sweden)

    Ghaffari Novin M.

    2015-06-01

    Full Text Available In some cases of infertility in women, human oocytes fail to mature when they reach the metaphase II (MII stage. Mitochondria plays an important role in oocyte maturation. A large number of mitochondrial DNA (mtDNA, copied in oocytes, is essential for providing adenosine triphosphate (ATP during oocyte maturation. The purpose of this study was to identify the relationship between transcript expression levels of the mitochondrial encoded gene (MT-CO1 and two nuclear encoded genes, nuclear respiratory factor 1 (NRF1 and mitochondrial transcription factor A (TFAM in various stages of human oocyte maturation. Nine consenting patients, age 21-35 years old, with male factors were selected for ovarian stimulation and intracytoplasmic sperm injection (ICSI procedures. mRNA levels of mitochondrial- related genes were performed by singlecell TaqMan® quantitative real-time polymerase chain reaction (qRT-PCR. There was no significant relationship between the relative expression levels in germinal vesicle (GV stage oocytes (p = 0.62. On the contrary, a significant relationship was seen between the relative expression levels of TFAM and NRF1 and the MT-CO1 genes at the stages of metaphase I (MI and MII (p = 0.03 and p = 0.002. A relationship exists between the transcript expression levels of TFAM and NRF1, and MT-CO1 genes in various stages of human oocyte maturation.

  7. Chromosome locations of genes encoding human signal transduction adapter proteins, Nck (NCK), Shc (SHC1), and Grb2 (GRB2)

    DEFF Research Database (Denmark)

    Huebner, K; Kastury, K; Druck, T

    1994-01-01

    "adapter" proteins, which are involved in transducing signals from receptor tyrosine kinases to downstream signal recipients such as ras, because adaptor protein genes could also, logically, serve as targets of mutation, rearrangement, or other aberration in disease. Therefore, DNAs from panels of rodent-human......Abnormalities due to chromosomal aberration or point mutation in gene products of growth factor receptors or in ras gene products, which lie on the same signaling pathway, can cause disease in animals and humans. Thus, it can be important to determine chromosomal map positions of genes encoding...... hybrids carrying defined complements of human chromosomes were assayed for the presence of the cognate genes for NCK, SHC, and GRB2, three SH2 or SH2/SH3 (Src homology 2 and 3) domain-containing adapter proteins. Additionally, NCK and SHC genes were more narrowly localized by chromosomal in situ...

  8. Efficient procedure for transferring specific human genes into Chinese hamster cell mutants: interspecific transfer of the human genes encoding leucyl- and asparaginyl-tRNA synthetases

    International Nuclear Information System (INIS)

    Cirullo, R.E.; Dana, S.; Wasmuth, J.J.

    1983-01-01

    A simple and efficient procedure for transferring specific human genes into mutant Chinese hamster ovary cell recipients has been developed that does not rely on using calcium phosphate-precipitated high-molecular-weight DNA. Interspecific cell hybrids between human leukocytes and temperature-sensitive Chinese hamster cell mutants with either a thermolabile leucyl-tRNA synthetase or a thermolabile asparaginyl-tRNA synthetase were used as the starting material in these experiments. These hybrids contain only one or a few human chromosomes and require expression of the appropriate human aminoacyl-tRNA synthetase gene to grow at 39 degrees C. Hybrids were exposed to very high doses of gamma-irradiation to extensively fragment the chromosomes and re-fused immediately to the original temperature-sensitive Chinese hamster mutant, and secondary hybrids were isolated at 39 degrees C. Secondary hybrids, which had retained small fragments of the human genome containing the selected gene, were subjected to another round of irradiation, refusion, and selection at 39 degrees C to reduce the amount of human DNA even further. Using this procedure, Chinese hamster cell lines have been constructed that express the human genes encoding either asparaginyl- or leucyl-tRNA synthetase, yet less than 0.1% of their DNA is derived from the human genome, as quantitated by a sensitive dot-blot nucleic acid hybridization procedure

  9. A Drosophila gene encoding a protein resembling the human β-amyloid protein precursor

    International Nuclear Information System (INIS)

    Rosen, D.R.; Martin-Morris, L.; Luo, L.; White, K.

    1989-01-01

    The authors have isolated genomic and cDNA clones for a Drosophila gene resembling the human β-amyloid precursor protein (APP). This gene produces a nervous system-enriched 6.5-kilobase transcript. Sequencing of cDNAs derived from the 6.5-kilobase transcript predicts an 886-amino acid polypeptide. This polypeptide contains a putative transmembrane domain and exhibits strong sequence similarity to cytoplasmic and extracellular regions of the human β-amyloid precursor protein. There is a high probability that this Drosophila gene corresponds to the essential Drosophila locus vnd, a gene required for embryonic nervous system development

  10. Molecular cloning, nucleotide sequence, and expression of the gene encoding human eosinophil differentiation factor (interleukin 5)

    International Nuclear Information System (INIS)

    Campbell, H.D.; Tucker, W.Q.J.; Hort, Y.; Martinson, M.E.; Mayo, G.; Clutterbuck, E.J.; Sanderson, C.J.; Young, I.G.

    1987-01-01

    The human eosinophil differentiation factor (EDF) gene was cloned from a genomic library in λ phage EMBL3A by using a murine EDF cDNA clone as a probe. The DNA sequence of a 3.2-kilobase BamHI fragment spanning the gene was determined. The gene contains three introns. The predicted amino acid sequence of 134 amino acids is identical with that recently reported for human interleukin 5 but shows no significant homology with other known hemopoietic growth regulators. The amino acid sequence shows strong homology (∼ 70% identity) with that of murine EDF. Recombinant human EDF, expressed from the human EDF gene after transfection into monkey COS cells, stimulated the production of eosinophils and eosinophil colonies from normal human bone marrow but had no effect on the production of neutrophils or mononuclear cells (monocytes and lymphoid cells). The apparent specificity of human EDF for the eosinophil lineage in myeloid hemopoiesis contrasts with the properties of human interleukin 3 and granulocyte/macrophage and granulocyte colony-stimulating factors but is directly analogous to the biological properties of murine EDF. Human EDF therefore represents a distinct hemopoietic growth factor that could play a central role in the regulation of eosinophilia

  11. A novel human gene encoding a G-protein-coupled receptor (GPR15) is located on chromosome 3

    Energy Technology Data Exchange (ETDEWEB)

    Heiber, M.; Marchese, A.; O`Dowd, B.F. [Univ. of Toronto, Ontario (Canada)] [and others

    1996-03-05

    We used sequence similarities among G-protein-coupled receptor genes to discover a novel receptor gene. Using primers based on conserved regions of the opioid-related receptors, we isolated a PCR product that was used to locate the full-length coding region of a novel human receptor gene, which we have named GPR15. A comparison of the amino acid sequence of the receptor gene, which we have named GPR15. A comparison of the amino acid sequence of the receptor encoded by GPR15 with other receptors revealed that it shared sequence identity with the angiotensin II AT1 and AT2 receptors, the interleukin 8b receptor, and the orphan receptors GPR1 and AGTL1. GPR15 was mapped to human chromosome 3q11.2-q13.1. 12 refs., 2 figs.

  12. Genomic polymorphism, recombination, and linkage disequilibrium in human major histocompatibility complex-encoded antigen-processing genes.

    Science.gov (United States)

    van Endert, P M; Lopez, M T; Patel, S D; Monaco, J J; McDevitt, H O

    1992-01-01

    Recently, two subunits of a large cytosolic protease and two putative peptide transporter proteins were found to be encoded by genes within the class II region of the major histocompatibility complex (MHC). These genes have been suggested to be involved in the processing of antigenic proteins for presentation by MHC class I molecules. Because of the high degree of polymorphism in MHC genes, and previous evidence for both functional and polypeptide sequence polymorphism in the proteins encoded by the antigen-processing genes, we tested DNA from 27 consanguineous human cell lines for genomic polymorphism by restriction fragment length polymorphism (RFLP) analysis. These studies demonstrate a strong linkage disequilibrium between TAP1 and LMP2 RFLPs. Moreover, RFLPs, as well as a polymorphic stop codon in the telomeric TAP2 gene, appear to be in linkage disequilibrium with HLA-DR alleles and RFLPs in the HLA-DO gene. A high rate of recombination, however, seems to occur in the center of the complex, between the TAP1 and TAP2 genes. Images PMID:1360671

  13. Thermal response of rat fibroblasts stably transfected with the human 70-kDa heat shock protein-encoding gene

    International Nuclear Information System (INIS)

    Li, G.C.; Li, Ligeng; Liu, Yunkang; Mak, J.Y.; Chen, Lili; Lee, W.M.F.

    1991-01-01

    The major heat shock protein hsp70 is synthesized by cells of a wide variety of organisms in response to heat shock or other environmental stresses and is assumed to play an important role in protecting cells from thermal stress. The authors have tested this hypothesis directly by transfecting a constitutively expressed recombinant human hsp70-encoding gene into rat fibroblasts and examining the relationship between the levels of human hsp70 expressed and thermal resistance of the stably transfected rat cells. Successful transfection and expression of the gene for human hsp70 were characterized by RNA hybridization analysis, low-dimensional gel electrophoresis, and immunoblot analysis. When individual cloned cell lines were exposed to 45C and their thermal survivals were determined by colony-formation assay, they found that the expression of human hsp70 conferred heat resistance to the rat cells. These results reinforce the hypothesis that hsp70 has a protective function against thermal stress

  14. Cloning and Characterization of the Genes Encoding the Murine Homologues of the Human Melanoma Antigens MART1 and gp100

    Science.gov (United States)

    Zhai, Yifan; Yang, James C.; Spiess, Paul; Nishimura, Michael I.; Overwijk, Willem W.; Roberts, Bruce; Restifo, Nicholas P.; Rosenberg, Steven A.

    2008-01-01

    The recent identification of genes encoding melanoma-associated antigens has opened new possibilities for the development of cancer vaccines designed to cause the rejection of established tumors. To develop a syngeneic animal model for evaluating antigen-specific vaccines in cancer therapy, the murine homologues of the human melanoma antigens MART1 and gp 100, which were specifically recognized by tumor-infiltrating lymphocytes from patients with melanoma, were cloned and sequenced from a murine B16 melanoma cDNA library. The open reading frames of murine MART1 and gp 100 encode proteins of 113- and 626-amino acids with 68.8 and 77% identity to the respective human proteins. Comparison of the DNA sequences of the murine MART1 genes, derived from normal melanocytes, the immortalized nontumorgenic melanocyte line Melan-a and the B16 melanoma, showed all to be identical. Northern and Western blot analyses confirmed that both genes encoded products that were melanocyte lineage proteins. Mice immunized with murine MART1 or gp 100 using recombinant vaccinia virus failed to produce any detectable T-cell responses or protective immunity against B16 melanoma. In contrast, immunization of mice with human gp 100 using recombinant adenoviruses elicited T cells specific for hgp100, but these T cells also cross reacted with B16 tumor in vitro and induced significant but weak protection against B16 challenge. Immunization with human and mouse gp100 together [adenovirus type 2 (Ad2)-hep100 plus recombinant vaccinia virus (rVV)-mgp100], or immunization with human gp100 (Ad2-hgp100) and boosting with heterologous vector (rVV-hgp100 or rVV-mgp100) or homologous vector (Ad2-hgp100), did not significantly enhance the protective response against B16 melanoma. These results may suggest that immunization with heterologous tumor antigen, rather than self, may be more effective as an immunotherapeutic reagent in designing antigen-specific cancer vaccines. PMID:9101410

  15. Food and human gut as reservoirs of transferable antibiotic resistance encoding genes

    Directory of Open Access Journals (Sweden)

    Jean-Marc eRolain

    2013-06-01

    Full Text Available The increase and spread of antibiotic resistance (AR over the past decade in human pathogens has become a worldwide health concern. Recent genomic and metagenomic studies in humans, animals, in food and in the environment have led to the discovery of a huge reservoir of AR genes called the resistome that could be mobilized and transferred from these sources to human pathogens. AR is a natural phenomenon developed by bacteria to protect antibiotic-producing bacteria from their own products and also to increase their survival in highly competitive microbial environments. Although antibiotics are used extensively in humans and animals, there is also considerable usage of antibiotics in agriculture, especially in animal feeds and aquaculture. The aim of this review is to give an overview of the sources of AR and the use of antibiotics in these reservoirs as selectors for emergence of AR bacteria in humans via the food chain.

  16. Human coronavirus 229E encodes a single ORF4 protein between the spike and the envelope genes

    Directory of Open Access Journals (Sweden)

    Berkhout Ben

    2006-12-01

    Full Text Available Abstract Background The genome of coronaviruses contains structural and non-structural genes, including several so-called accessory genes. All group 1b coronaviruses encode a single accessory protein between the spike and envelope genes, except for human coronavirus (HCoV 229E. The prototype virus has a split gene, encoding the putative ORF4a and ORF4b proteins. To determine whether primary HCoV-229E isolates exhibit this unusual genome organization, we analyzed the ORF4a/b region of five current clinical isolates from The Netherlands and three early isolates collected at the Common Cold Unit (CCU in Salisbury, UK. Results All Dutch isolates were identical in the ORF4a/b region at amino acid level. All CCU isolates are only 98% identical to the Dutch isolates at the nucleotide level, but more closely related to the prototype HCoV-229E (>98%. Remarkably, our analyses revealed that the laboratory adapted, prototype HCoV-229E has a 2-nucleotide deletion in the ORF4a/b region, whereas all clinical isolates carry a single ORF, 660 nt in size, encoding a single protein of 219 amino acids, which is a homologue of the ORF3 proteins encoded by HCoV-NL63 and PEDV. Conclusion Thus, the genome organization of the group 1b coronaviruses HCoV-NL63, PEDV and HCoV-229E is identical. It is possible that extensive culturing of the HCoV-229E laboratory strain resulted in truncation of ORF4. This may indicate that the protein is not essential in cell culture, but the highly conserved amino acid sequence of the ORF4 protein among clinical isolates suggests that the protein plays an important role in vivo.

  17. Molecular cloning and expression of the human homologue of the murine gene encoding myeloid leukemia-inhibitory factor

    International Nuclear Information System (INIS)

    Gough, N.M.; Gearing, D.P.; King, J.A.; Willson, T.A.; Hilton, D.J.; Nicola, N.A.; Metcalf, D.

    1988-01-01

    A human homologue of the recently cloned murine leukemia-inhibitory factor (LIF) gene was isolated from a genomic library by using the marine cDNA as a hybridization probe. The nucleotide sequence of the human gene indicated that human LIF has 78% amino acid sequence identity with murine LIF, with no insertions or deletions, and that the region of the human gene encoding the mature protein has one intervening sequence. After oligonucleotide-mediated mutagenesis, the mature protein-coding region of the LIF gene was introduced into the yeast expression vector YEpsec1. Yeast cells transformed with the resulting recombinant could be induced with galactose to produce high levels of a factor that induced the differentiation of murine M1 leukemic cells in a manner analogous to murine LIF. This factor competed with 125 I-labeled native murine LIF for binding to specific cellular receptors on murine cells, compatible with a high degree of structural similarity between the murine and human factors

  18. Characterization of cDNAs encoding human leukosialin and localization of the leukosialin gene to chromosome 16

    International Nuclear Information System (INIS)

    Pallant, A.; Eskenazi, A.; Frelinger, J.G.; Mattei, M.G.; Fournier, R.E.K.; Carlsson, S.R.; Fukuda, M.

    1989-01-01

    The authors describe the isolation and characterization of cDNA clones encoding human leukosialin, a major sialoglycoprotein of human leukocytes. Leukosialin is very closely related or identical to the sialophorin molecule, which is involved in T-cell proliferation and whose expression is altered in Wiskott-Aldrich syndrome (WAS), an X-chromosome-linked immunodeficiency disease. Using a rabbit antiserum to leukosialin, a cDNA clone was isolated from a λgt11 cDNA library constructed from human peripheral blood cells. The λgt11 clone was used to isolate longer cDNA clones that correspond to the entire coding sequence of leukosialin. DNA sequence analysis reveals three domains in the predicted mature protein. The extracellular domain is enriched for Ser, Thr, and Pro and contains four contiguous 18-amino acid repeats. The transmembrane and intracellular domains of the human leukosialin molecule are highly homologous to the rat W3/13 molecule. RNA gel blot analysis reveals two polyadenylylated species of 2.3 and 8 kilobases. Southern blot analysis suggests that human leukosialin is a single-copy gene. Analysis of monochromosomal cell hybrids indicates that the leukosialin gene is not X chromosome linked and in situ hybridization shows leukosialin is located on chromosome 16. These findings demonstrate that the primary mutation in WAS is not a defect in the structural gene for leukosialin

  19. Isolation, sequencing and expression of RED, a novel human gene encoding an acidic-basic dipeptide repeat.

    Science.gov (United States)

    Assier, E; Bouzinba-Segard, H; Stolzenberg, M C; Stephens, R; Bardos, J; Freemont, P; Charron, D; Trowsdale, J; Rich, T

    1999-04-16

    A novel human gene RED, and the murine homologue, MuRED, were cloned. These genes were named after the extensive stretch of alternating arginine (R) and glutamic acid (E) or aspartic acid (D) residues that they contain. We term this the 'RED' repeat. The genes of both species were expressed in a wide range of tissues and we have mapped the human gene to chromosome 5q22-24. MuRED and RED shared 98% sequence identity at the amino acid level. The open reading frame of both genes encodes a 557 amino acid protein. RED fused to a fluorescent tag was expressed in nuclei of transfected cells and localised to nuclear dots. Co-localisation studies showed that these nuclear dots did not contain either PML or Coilin, which are commonly found in the POD or coiled body nuclear compartments. Deletion of the amino terminal 265 amino acids resulted in a failure to sort efficiently to the nucleus, though nuclear dots were formed. Deletion of a further 50 amino acids from the amino terminus generates a protein that can sort to the nucleus but is unable to generate nuclear dots. Neither construct localised to the nucleolus. The characteristics of RED and its nuclear localisation implicate it as a regulatory protein, possibly involved in transcription.

  20. Preparation of a recombinant adenoviral encoding human NIS gene and its specific expression in cardiomyocytes

    International Nuclear Information System (INIS)

    Wang Lihua; Zhang Miao; Guo Rui; Shi Shuo; Li Biao

    2012-01-01

    Objective: To construct a recombinant adenovirus vector containing the human NIS gene with the myosin light chain-2(MLC-2v) gene as the promoter and evaluate its specific expression and feasibility as a reporter gene in cardiomyocytes. Methods: MLC-2v promoter and NIS were subcloned into an adenovirus shuttle vector, and forwarded by homologous recombination in the bacteria BJ5183 containing AdEasy-1 plasmid. Positive recombinant adenovirus vector was selected, packaged and amplified in the HEK293 cells to obtain recombinant adenovirus Ad-MLC-NIS. Ad-cytomegalovirus (CMV)-NIS with cytomegalovirus as the promoter, Ad-MLC without NIS and Ad-NIS without promoter were constructed as the controls. Cardiomyocytes and non-cardiomyocytes were then infected by the adenovirus. The protein expression was tested by Western blot analysis. The function and features of NIS protein were evaluated by dynamic iodide uptake and NaClO 4 iodine uptake inhibition test in vitro. The viability and proliferation of cardiomyocytes after adenovirus transfection and radioiodine incubation were checked by trypan blue staining. Results: Recombinant NIS adenovirus was successfully constructed. Western blot analysis showed that the NIS protein was highly expressed in cardiomyocytes transfected with Ad-MLC-NIS, and all cells transfected with Ad-CMV-NIS. However, in non-cardiomyocytes transfected with Ad-MLC-NIS, little NIS protein was detected. Dynamic iodine uptake tests showed that the peaks of iodide uptake of the three different cell lines (H9C2, A549, U87 cell) transfected with Ad-MLC-NIS were 5844.0, 833.6 and 846.0 counts · min -1 , respectively. The iodide uptake function of H9C2 was inhibited by NaClO 4 . There was almost no change in cell viability and proliferation when the MOI was 100. Conclusions: Ad-MLC-NIS allows myocardial specific expression of an external gene, and the cardiomyocytes with NIS expression are capable of iodine uptake. Further research of NIS as a reporter gene in

  1. Murine and human b locus pigmentation genes encode a glycoprotein (gp75) with catalase activity

    International Nuclear Information System (INIS)

    Halaban, R.; Moellmann, G.

    1990-01-01

    Melanogenesis is regulated in large part by tyrosinase, and defective tyrosinase leads to albinism. The mechanisms for other pigmentation determinants (e.g., those operative in tyrosinase-positive albinism and in murine coat-color mutants) are not yet known. One murine pigmentation gene, the brown (b) locus, when mutated leads to a brown (b/b) or hypopigmentated (B lt /B lt ) coat versus the wild-type black (B/B). The authors show that the b locus codes for a glycoprotein with the activity of a catalase (catalase B). Only the c locus protein is a tyrosinase. Because peroxides may be by-products of melanogenic activity and hydrogen peroxide in particular is known to destroy melanin precursors and melanin, they conclude that pigmentation is controlled not only by tyrosinase but also by a hydroperoxidase. The studies indicate that catalase B is identical with gp75, a known human melanosomal glycoprotein; that the b mutation is in a heme-associated domain; and that the B lt mutation renders the protein susceptible to rapid proteolytic degradation

  2. Identification of human genes involved in cellular responses to ionizing radiation: molecular and cellular studies of gene encoding the p68 helicase in mammalian cells

    International Nuclear Information System (INIS)

    Menaa, F.

    2003-12-01

    Cells submitted to genotoxic factors -like IR- activate several and important mechanisms such as repair, cell cycle arrest or 'apoptosis' to maintain genetic integrity. So, the damaged cells will induce many and different genes. The human transcriptome analysis by 'SSH' method in a human breast carcinoma cell line MCF7 γ-irradiated versus not irradiated, allowed to identify about one hundred genes. Among of these genes, we have focused our study on a radio-induced gene encoding the p68 helicase. In the conditions of irradiation used, our results show that the kinetic and the regulation of this gene expression differs between the nature of radiations used. Indeed, in γ-irradiated mammalian cells, ATM, a protein kinase activated by DSB and IR, is required to induce quickly P68 gene via the important transcription factor p53 stabilized by IR. In the case of UVC-irradiated cells, the P68 gene induction is late and the intracellular signalling pathway that lead to this induction is independent from the p53 protein. Finally, we show that the p68 protein under-expression is responsible for an increased radiosensitivity of MCF7 cells. Consequently, we can postulate that the p68 protein is involved in cellular responses to radiations to reduce the increased radiosensitivity of cells exposed to γ-rays. (author)

  3. Identification of human microRNA-like sequences embedded within the protein-encoding genes of the human immunodeficiency virus.

    Directory of Open Access Journals (Sweden)

    Bryan Holland

    Full Text Available BACKGROUND: MicroRNAs (miRNAs are highly conserved, short (18-22 nts, non-coding RNA molecules that regulate gene expression by binding to the 3' untranslated regions (3'UTRs of mRNAs. While numerous cellular microRNAs have been associated with the progression of various diseases including cancer, miRNAs associated with retroviruses have not been well characterized. Herein we report identification of microRNA-like sequences in coding regions of several HIV-1 genomes. RESULTS: Based on our earlier proteomics and bioinformatics studies, we have identified 8 cellular miRNAs that are predicted to bind to the mRNAs of multiple proteins that are dysregulated during HIV-infection of CD4+ T-cells in vitro. In silico analysis of the full length and mature sequences of these 8 miRNAs and comparisons with all the genomic and subgenomic sequences of HIV-1 strains in global databases revealed that the first 18/18 sequences of the mature hsa-miR-195 sequence (including the short seed sequence, matched perfectly (100%, or with one nucleotide mismatch, within the envelope (env genes of five HIV-1 genomes from Africa. In addition, we have identified 4 other miRNA-like sequences (hsa-miR-30d, hsa-miR-30e, hsa-miR-374a and hsa-miR-424 within the env and the gag-pol encoding regions of several HIV-1 strains, albeit with reduced homology. Mapping of the miRNA-homologues of env within HIV-1 genomes localized these sequence to the functionally significant variable regions of the env glycoprotein gp120 designated V1, V2, V4 and V5. CONCLUSIONS: We conclude that microRNA-like sequences are embedded within the protein-encoding regions of several HIV-1 genomes. Given that the V1 to V5 regions of HIV-1 envelopes contain specific, well-characterized domains that are critical for immune responses, virus neutralization and disease progression, we propose that the newly discovered miRNA-like sequences within the HIV-1 genomes may have evolved to self-regulate survival of the

  4. Cloning and sequencing of cDNA encoding human DNA topoisomerase II and localization of the gene to chromosome region 17q21-22

    International Nuclear Information System (INIS)

    Tsai-Pflugfelder, M.; Liu, L.F.; Liu, A.A.; Tewey, K.M.; Whang-Peng, J.; Knutsen, T.; Huebner, K.; Croce, C.M.; Wang, J.C.

    1988-01-01

    Two overlapping cDNA clones encoding human DNA topoisomerase II were identified by two independent methods. In one, a human cDNA library in phage λ was screened by hybridization with a mixed oligonucleotide probe encoding a stretch of seven amino acids found in yeast and Drosophila DNA topoisomerase II; in the other, a different human cDNA library in a λgt11 expression vector was screened for the expression of antigenic determinants that are recognized by rabbit antibodies specific to human DNA topoisomerase II. The entire coding sequences of the human DNA topoisomerase II gene were determined from these and several additional clones, identified through the use of the cloned human TOP2 gene sequences as probes. Hybridization between the cloned sequences and mRNA and genomic DNA indicates that the human enzyme is encoded by a single-copy gene. The location of the gene was mapped to chromosome 17q21-22 by in situ hybridization of a cloned fragment to metaphase chromosomes and by hybridization analysis with a panel of mouse-human hybrid cell lines, each retaining a subset of human chromosomes

  5. The Human Gene SLC25A29, of Solute Carrier Family 25, Encodes a Mitochondrial Transporter of Basic Amino Acids*

    Science.gov (United States)

    Porcelli, Vito; Fiermonte, Giuseppe; Longo, Antonella; Palmieri, Ferdinando

    2014-01-01

    The human genome encodes 53 members of the solute carrier family 25 (SLC25), also called the mitochondrial carrier family, many of which have been shown to transport carboxylates, amino acids, nucleotides, and cofactors across the inner mitochondrial membrane, thereby connecting cytosolic and matrix functions. In this work, a member of this family, SLC25A29, previously reported to be a mitochondrial carnitine/acylcarnitine- or ornithine-like carrier, has been thoroughly characterized biochemically. The SLC25A29 gene was overexpressed in Escherichia coli, and the gene product was purified and reconstituted in phospholipid vesicles. Its transport properties and kinetic parameters demonstrate that SLC25A29 transports arginine, lysine, homoarginine, methylarginine and, to a much lesser extent, ornithine and histidine. Carnitine and acylcarnitines were not transported by SLC25A29. This carrier catalyzed substantial uniport besides a counter-exchange transport, exhibited a high transport affinity for arginine and lysine, and was saturable and inhibited by mercurial compounds and other inhibitors of mitochondrial carriers to various degrees. The main physiological role of SLC25A29 is to import basic amino acids into mitochondria for mitochondrial protein synthesis and amino acid degradation. PMID:24652292

  6. The human gene SLC25A29, of solute carrier family 25, encodes a mitochondrial transporter of basic amino acids.

    Science.gov (United States)

    Porcelli, Vito; Fiermonte, Giuseppe; Longo, Antonella; Palmieri, Ferdinando

    2014-05-09

    The human genome encodes 53 members of the solute carrier family 25 (SLC25), also called the mitochondrial carrier family, many of which have been shown to transport carboxylates, amino acids, nucleotides, and cofactors across the inner mitochondrial membrane, thereby connecting cytosolic and matrix functions. In this work, a member of this family, SLC25A29, previously reported to be a mitochondrial carnitine/acylcarnitine- or ornithine-like carrier, has been thoroughly characterized biochemically. The SLC25A29 gene was overexpressed in Escherichia coli, and the gene product was purified and reconstituted in phospholipid vesicles. Its transport properties and kinetic parameters demonstrate that SLC25A29 transports arginine, lysine, homoarginine, methylarginine and, to a much lesser extent, ornithine and histidine. Carnitine and acylcarnitines were not transported by SLC25A29. This carrier catalyzed substantial uniport besides a counter-exchange transport, exhibited a high transport affinity for arginine and lysine, and was saturable and inhibited by mercurial compounds and other inhibitors of mitochondrial carriers to various degrees. The main physiological role of SLC25A29 is to import basic amino acids into mitochondria for mitochondrial protein synthesis and amino acid degradation.

  7. Spatially conserved regulatory elements identified within human and mouse Cd247 gene using high-throughput sequencing data from the ENCODE project

    DEFF Research Database (Denmark)

    Pundhir, Sachin; Hannibal, Tine Dahlbæk; Bang-Berthelsen, Claus Heiner

    2014-01-01

    . In this study, we have utilized the wealth of high-throughput sequencing data produced during the Encyclopedia of DNA Elements (ENCODE) project to identify spatially conserved regulatory elements within the Cd247 gene from human and mouse. We show the presence of two transcription factor binding sites...

  8. The human homolog of S. cerevisiae CDC27, CDC27 Hs, is encoded by a highly conserved intronless gene present in multiple copies in the human genome

    Energy Technology Data Exchange (ETDEWEB)

    Devor, E.J.; Dill-Devor, R.M. [Univ. of Iowa College of Medicine, Iowa City (United States)

    1994-09-01

    We have obtained a number of unique sequences via PCR amplification of human genomic DNA using degenerate primers under low stringency (42{degrees}C). One of these, an 853 bp product, has been identified as a partial genomic sequence of the human homolog of the S. cerevisiae CDC27 gene, CDC27Hs (GenBank No. U00001). This gene, reported by Turgendreich et al. is also designated EST00556 from Adams et al. We have undertaken a more detailed examination of our sequence, MCP34N, and have found that: 1. the genomic sequence is nearly identical to CDC27Hs over its entire 853 bp length; 2. an MCP34N-specific PCR assay of several non-human primate species reveals amplification products in chimpanzee and gorilla genomes having greater than 90% sequence identity with CDC27Hs; and 3. an MCP34N-specific PCR assay of the BIOS hybrid cell line panel gives a discordancy pattern suggesting multiple loci. Based upon these data, we present the following initial characterization: 1. the complete MCP34N sequence identity with CDC27Hs indicates that the latter is encoded by an intronless gene; 2. CDC27Hs is highly conserved among higher primates; and 3. CDC27Hs is present in multiple copies in the human genome. These characteristics, taken together with those initially reported for CDC27Hs, suggest that this is an old gene that carries out an important but, as yet, unknown function in the human brain.

  9. Effect of recombinant adenovirus encoding human p53 tumor suppressor gene (rAd-p53) on the growth and radiotherapeutic sensitivity of human lymphoma cell lines

    International Nuclear Information System (INIS)

    Yu Zeyang; Fan Wo; Li Dongqing; Zhu Ran; Wang Yongqing; Wu Jinchang

    2008-01-01

    Objective: To explore the inhibitory effect and radiation sensitization of recombinant adenovirus encoding human p53 tumor suppressor gene (rAd-p53) on human lymphoma cell lines. Methods: Human lymphoma cell lines Raji and Daudi were treated with rAd-p53, radiation therapy and combined treatment, respectively. The cell growth inhibition was assessed by MTT. The p53 protein expression was detected by Western blotting, and p53 mRNA was detected by BT-PCB. Results: The MTT results showed that the inhibitory effect and radiosensitivity enhancement of rAd-p53 on human lymphoma cell lines were not obvious [Raji: (27.5±4.1)%; Daudi: (28.1±1.6)%]. The results of Western blotting and BT-PCB showed that extrinsic p53 protein and p53 mRNA were expressed to some degree, but not at high-level. In addition, the results didn't demonstrate obvious radiosensitivity enhancement. Conclusions: The role of inhibition and radiosensitivity enhancement of rAd-p53 was not significant on human lymphoma cell lines. (authors)

  10. Targeted disruption in mice of a neural stem cell-maintaining, KRAB-Zn finger-encoding gene that has rapidly evolved in the human lineage.

    Directory of Open Access Journals (Sweden)

    Huan-Chieh Chien

    Full Text Available Understanding the genetic basis of the physical and behavioral traits that separate humans from other primates is a challenging but intriguing topic. The adaptive functions of the expansion and/or reduction in human brain size have long been explored. From a brain transcriptome project we have identified a KRAB-Zn finger protein-encoding gene (M003-A06 that has rapidly evolved since the human-chimpanzee separation. Quantitative RT-PCR analysis of different human tissues indicates that M003-A06 expression is enriched in the human fetal brain in addition to the fetal heart. Furthermore, analysis with use of immunofluorescence staining, neurosphere culturing and Western blotting indicates that the mouse ortholog of M003-A06, Zfp568, is expressed mainly in the embryonic stem (ES cells and fetal as well as adult neural stem cells (NSCs. Conditional gene knockout experiments in mice demonstrates that Zfp568 is both an NSC maintaining- and a brain size-regulating gene. Significantly, molecular genetic analyses show that human M003-A06 consists of 2 equilibrated allelic types, H and C, one of which (H is human-specific. Combined contemporary genotyping and database mining have revealed interesting genetic associations between the different genotypes of M003-A06 and the human head sizes. We propose that M003-A06 is likely one of the genes contributing to the uniqueness of the human brain in comparison to other higher primates.

  11. Hypermutability of CpG dinucleotides in the propeptide-encoding sequence of the human albumin gene

    International Nuclear Information System (INIS)

    Brennan, S.O.; Peach, R.; Myles, T.; George, P.; Arai, Kunio; Madison, J.; Watkins, S.; Putnam, F.W.; Laurell, C.B.; Galliano, M.

    1990-01-01

    An electrophoretically slow albumin variant was detected with a phenotype frequency of about 1:1,000 in Sweden and was also found in a family of Scottish descent from Kaikoura, New Zealand, and in five families in Tradate, Italy. Structural study established that the major variant component was arginyl-albumin, in which arginine at the -1 position of the propeptide is still attached to the processed albumin. A minor component with the amino-terminal sequence of proalbumin was also present as 3-6% of the total albumin. After amplification of the gene segment encoding the prepro sequence of albumin, specific hybridization of DNA to an oligonucleotide probe encoding cysteine at position -2 indicated the mutation of arginine at the -2 position to cysteine (-2 Arg → Cys). This produced the propeptide sequence Arg-Gly-Val-Phe-Cys-Arg. This was confirmed by sequence analysis after pyridylethylation of the cysteine. This mutation produces an alternate signal peptidase cleavage site in the variant proalbumin precursor of arginyl-albumin giving rise to two possible products, arginyl-albumin and the variant proalbumin. Another plasma from Bremen had an alloalbumin with a previously described substitution (1 Asp → Val), which also affects propeptide cleavage. Hypermutability of two CpG dinucleotides in the codons for the diarginyl sequence may account for the frequency of mutations in the propeptide. Mutation at these two sites results in a series of recurrent proalbumin variants that have arisen independently in diverse populations

  12. Structure of the human gene encoding the associated microfibrillar protein (MFAP1) and localization to chromosome 15q15-q21

    Energy Technology Data Exchange (ETDEWEB)

    Yeh, H.; Chow, M.; Abrams, W.R. [Univ. of Pennsylvania, Philadelphia, PA (United States)] [and others

    1994-09-15

    Microfibrils with a diameter of 10-12 nm, found either in assocation with elastin or independently, are an important component of the extracellular matrix of many tissues. To extend understanding of the proteins composing these microfibrils, the cDNA and gene encoding the human associated microfibril protein (MRAP1) have been cloned and characterized. The coding portion is contained in 9 exons, and the sequence is very homologous to the previously described chick cDNA, but does not appear to share homology or domain motifs with any other known protein. Interestingly, the gene has been localized to chromosome 15q15-q21 by somatic hybrid cell and chromosome in situ analyses. This is the same chromosomal region to which the fibrillin gene, FBN1, known to be defective in the Marfan syndrome, has been mapped. MFAP1 is a candidate gene for heritable diseases affecting microfibrils. 38 refs., 6 figs.

  13. Isolation, characterization, and mapping of gene encoding dihydrolipoyl succinyltransferase (E2k) of human [alpha]-ketoglutarate dehydrogenase complex

    Energy Technology Data Exchange (ETDEWEB)

    Ali, G.; Cai, Xingang; Sheu, Kwan-Fu R.; Blass, J.P. (Cornell Univ. Medical College, White Plains, NY (United States)); Wasco, W.; Gaston, S.M.; Tanzi, R.E.; Cooper, A.J.L.; Gusella, J.F. (Massachusetts General Hospital, Charleston, MA (United States)); Szabo, P. (Cornell Univ. Medical College, New York, NY (United States))

    1994-03-01

    The authors have isolated and sequenced cDNAs representing the full-length (2987-bp) gene for dihydrolipoyl succinyltransferase (E2k component) of the human [alpha]-ketoglutarate dehydrogenase complex (KHDHC) from a human fetal brain cDNA library. The E2k cDNA was mapped to human chromosome 14 using a somatic cell hybrid panel, and more precisely to band 14q24.3 by in situ hybridization. This cDNA also cross-hybridized to an apparent E2k pseudogene on chromosome 1p31. Northern analysis revealed the E2k gene to be ubiquitously expressed in peripheral tissues and brain. Interestingly, chromosome 14q24.3 has recently been reported to contain gene defects for an early-onset form of familial Alzheimer's disease and for Machado-Joseph disease. Future studies will be necessary to determine whether the E2K gene plays a role in either of these two disorders.

  14. Structure of the human gene encoding the protein repair L-isoaspartyl (D-aspartyl) O-methyltransferase.

    Science.gov (United States)

    DeVry, C G; Tsai, W; Clarke, S

    1996-11-15

    The protein L-isoaspartyl/D-aspartyl O-methyltransferase (EC 2.1.1.77) catalyzes the first step in the repair of proteins damaged in the aging process by isomerization or racemization reactions at aspartyl and asparaginyl residues. A single gene has been localized to human chromosome 6 and multiple transcripts arising through alternative splicing have been identified. Restriction enzyme mapping, subcloning, and DNA sequence analysis of three overlapping clones from a human genomic library in bacteriophage P1 indicate that the gene spans approximately 60 kb and is composed of 8 exons interrupted by 7 introns. Analysis of intron/exon splice junctions reveals that all of the donor and acceptor splice sites are in agreement with the mammalian consensus splicing sequence. Determination of transcription initiation sites by primer extension analysis of poly(A)+ mRNA from human brain identifies multiple start sites, with a major site 159 nucleotides upstream from the ATG start codon. Sequence analysis of the 5'-untranslated region demonstrates several potential cis-acting DNA elements including SP1, ETF, AP1, AP2, ARE, XRE, CREB, MED-1, and half-palindromic ERE motifs. The promoter of this methyltransferase gene lacks an identifiable TATA box but is characterized by a CpG island which begins approximately 723 nucleotides upstream of the major transcriptional start site and extends through exon 1 and into the first intron. These features are characteristic of housekeeping genes and are consistent with the wide tissue distribution observed for this methyltransferase activity.

  15. NCYM, a Cis-antisense gene of MYCN, encodes a de novo evolved protein that inhibits GSK3β resulting in the stabilization of MYCN in human neuroblastomas.

    Directory of Open Access Journals (Sweden)

    Yusuke Suenaga

    2014-01-01

    Full Text Available The rearrangement of pre-existing genes has long been thought of as the major mode of new gene generation. Recently, de novo gene birth from non-genic DNA was found to be an alternative mechanism to generate novel protein-coding genes. However, its functional role in human disease remains largely unknown. Here we show that NCYM, a cis-antisense gene of the MYCN oncogene, initially thought to be a large non-coding RNA, encodes a de novo evolved protein regulating the pathogenesis of human cancers, particularly neuroblastoma. The NCYM gene is evolutionally conserved only in the taxonomic group containing humans and chimpanzees. In primary human neuroblastomas, NCYM is 100% co-amplified and co-expressed with MYCN, and NCYM mRNA expression is associated with poor clinical outcome. MYCN directly transactivates both NCYM and MYCN mRNA, whereas NCYM stabilizes MYCN protein by inhibiting the activity of GSK3β, a kinase that promotes MYCN degradation. In contrast to MYCN transgenic mice, neuroblastomas in MYCN/NCYM double transgenic mice were frequently accompanied by distant metastases, behavior reminiscent of human neuroblastomas with MYCN amplification. The NCYM protein also interacts with GSK3β, thereby stabilizing the MYCN protein in the tumors of the MYCN/NCYM double transgenic mice. Thus, these results suggest that GSK3β inhibition by NCYM stabilizes the MYCN protein both in vitro and in vivo. Furthermore, the survival of MYCN transgenic mice bearing neuroblastoma was improved by treatment with NVP-BEZ235, a dual PI3K/mTOR inhibitor shown to destabilize MYCN via GSK3β activation. In contrast, tumors caused in MYCN/NCYM double transgenic mice showed chemo-resistance to the drug. Collectively, our results show that NCYM is the first de novo evolved protein known to act as an oncopromoting factor in human cancer, and suggest that de novo evolved proteins may functionally characterize human disease.

  16. Identification of human rotavirus serotype by hybridization to polymerase chain reaction-generated probes derived from a hyperdivergent region of the gene encoding outer capsid protein VP7

    International Nuclear Information System (INIS)

    Flores, J.; Sears, J.; Schael, I.P.; White, L.; Garcia, D.; Lanata, C.; Kapikian, A.Z.

    1990-01-01

    We have synthesized 32 P-labeled hybridization probes from a hyperdivergent region (nucleotides 51 to 392) of the rotavirus gene encoding the VP7 glycoprotein by using the polymerase chain reaction method. Both RNA (after an initial reverse transcription step) and cloned cDNA from human rotavirus serotypes 1 through 4 could be used as templates to amplify this region. High-stringency hybridization of each of the four probes to rotavirus RNAs dotted on nylon membranes allowed the specific detection of corresponding sequences and thus permitted identification of the serotype of the strains dotted. The procedure was useful when applied to rotaviruses isolated from field studies

  17. Identification of human rotavirus serotype by hybridization to polymerase chain reaction-generated probes derived from a hyperdivergent region of the gene encoding outer capsid protein VP7

    Energy Technology Data Exchange (ETDEWEB)

    Flores, J.; Sears, J.; Schael, I.P.; White, L.; Garcia, D.; Lanata, C.; Kapikian, A.Z. (National Institutes of Health, Bethesda, MD (USA))

    1990-08-01

    We have synthesized {sup 32}P-labeled hybridization probes from a hyperdivergent region (nucleotides 51 to 392) of the rotavirus gene encoding the VP7 glycoprotein by using the polymerase chain reaction method. Both RNA (after an initial reverse transcription step) and cloned cDNA from human rotavirus serotypes 1 through 4 could be used as templates to amplify this region. High-stringency hybridization of each of the four probes to rotavirus RNAs dotted on nylon membranes allowed the specific detection of corresponding sequences and thus permitted identification of the serotype of the strains dotted. The procedure was useful when applied to rotaviruses isolated from field studies.

  18. Human cyclophilin B: A second cyclophilin gene encodes a peptidyl-prolyl isomerase with a signal sequence

    International Nuclear Information System (INIS)

    Price, E.R.; Zydowsky, L.D.; Jin, Mingjie; Baker, C.H.; McKeon, F.D.; Walsh, C.T.

    1991-01-01

    The authors report the cloning and characterization of a cDNA encoding a second human cyclosporin A-binding protein (hCyPB). Homology analyses reveal that hCyPB is a member of the cyclophilin B (CyPB) family, which includes yeast CyPB, Drosophila nina A, and rat cyclophilin-like protein. This family is distinguished from the cyclophilin A (CyPA) family by the presence of endoplasmic reticulum (ER)-directed signal sequences. hCyPB has a hydrophobic leader sequence not found in hCyPA, and its first 25 amino acids are removed upon expression in Escherichia coli. Moreover, they show that hCyPB is a peptidyl-prolyl cis-trans isomerase which can be inhibited by cyclosporin A. These observations suggest that other members of the CyPB family will have similar enzymatic properties. Sequence comparisons of the CyPB proteins show a central, 165-amino acid peptidyl-prolyl isomerase and cyclosprorin A-binding domain, flanked by variable N-terminal and C-terminal domains. These two variable regions may impart compartmental specificity and regulation to this family of cyclophilin proteins containing the conserved core domain. Northern blot analyses show that hCyPB mRNA is expressed in the Jurkat T-cell line, consistent with its possible target role in cyclosporin A-mediated immunosuppression

  19. Bacillus caldolyticus prs gene encoding phosphoribosyldiphosphate synthase

    DEFF Research Database (Denmark)

    Krath, Britta N.; Hove-Jensen, Bjarne

    1996-01-01

    The prs gene, encoding phosphoribosyl-diphosphate (PRPP) synthase, as well as the flanking DNA sequences were cloned and sequenced from the Gram-positive thermophile, Bacillus caldolyticus. Comparison with the homologous sequences from the mesophile, Bacillus subtilis, revealed a gene (gca......D) encoding N-acetylglucosamine-l-phosphate uridyltransferase upstream of prs, and a gene homologous to ctc downstream of prs. cDNA synthesis with a B. caldolyticus gcaD-prs-ctc-specified mRNA as template, followed by amplification utilising the polymerase chain reaction indicated that the three genes are co......-transcribed. Comparison of amino acid sequences revealed a high similarity among PRPP synthases across a wide phylogenetic range. An E. coli strain harbouring the B. caldolyticus prs gene in a multicopy plasmid produced PRPP synthase activity 33-fold over the activity of a haploid B. caldolyticus strain. B. caldolyticus...

  20. Impact of haloperidol and quetiapine on the expression of genes encoding antioxidant enzymes in human neuroblastoma SH-SY5Y cells.

    Science.gov (United States)

    Schmidt, Andreas Johannes; Hemmeter, Ulrich Michael; Krieg, Jürgen-Christian; Vedder, Helmut; Heiser, Philip

    2009-05-01

    Antipsychotics are known to alter antioxidant activities in vivo. Therefore, the aim of the present study was to examine in the human neuroblastoma SH-SY5Y cell line the impact of a typical (haloperidol) and an atypical (quetiapine) antipsychotic on the expression of genes encoding the key enzymes of the antioxidant metabolism (Cu, Zn superoxide dismutase; Mn superoxide dismutase; glutathione peroxidase; catalase) and enzymes of the glutathione metabolism (gamma-glutamyl cysteine synthetase, glutathione-S-transferase, gamma-glutamyltranspeptidase, glutathione reductase). The cells were incubated for 24h with 0.3, 3, 30 and 300microM haloperidol and quetiapine, respectively; mRNA levels were measured by polymerase chain reaction. In the present study, we observed mostly significant decreases of mRNA contents. With respect to the key pathways, we detected mainly effects on the mRNA levels of the hydrogen peroxide detoxifying enzymes. Among the enzymes of the glutathione metabolism, glutathione-S-transferase- and gamma-glutamyltranspeptidase-mRNA levels showed the most prominent effects. Taken together, our results demonstrate a significantly reduced expression of genes encoding for antioxidant enzymes after treatment with the antipsychotics, haloperidol and quetiapine.

  1. Characterization of TRZ1, a yeast homolog of the human candidate prostate cancer susceptibility gene ELAC2 encoding tRNase Z

    Directory of Open Access Journals (Sweden)

    Chen Yuan

    2005-05-01

    Full Text Available Abstract Background In humans, mutation of ELAC2 is associated with an increased risk of prostate cancer. ELAC2 has been shown to have tRNase Z activity and is associated with the γ-tubulin complex. Results In this work, we show that the yeast homolog of ELAC2, encoded by TRZ1 (tRNase Z 1, is involved genetically in RNA processing. The temperature sensitivity of a trz1 mutant can be rescued by multiple copies of REX2, which encodes a protein with RNA 3' processing activity, suggesting a role of Trz1p in RNA processing in vivo. Trz1p has two putative nucleotide triphosphate-binding motifs (P-loop and a conserved histidine motif. The histidine motif and the putative nucleotide binding motif at the C-domain are important for Trz1p function because mutant proteins bearing changes to the critical residues in these motifs are unable to rescue deletion of TRZ1. The growth defect exhibited by trz1 yeast is not complemented by the heterologous ELAC2, suggesting that Trz1p may have additional functions in yeast. Conclusion Our results provide genetic evidence that prostate cancer susceptibility gene ELAC2 may be involved in RNA processing, especially rRNA processing and mitochondrial function.

  2. Characterization of the human laminin beta2 chain locus (LAMB2): linkage to a gene containing a nonprocessed, transcribed LAMB2-like pseudogene (LAMB2L) and to the gene encoding glutaminyl tRNA synthetase (QARS)

    DEFF Research Database (Denmark)

    Durkin, M E; Jäger, A C; Khurana, T S

    1999-01-01

    The laminin beta2 chain is an important constituent of certain kidney and muscle basement membranes. We have generated a detailed physical map of a 110-kb genomic DNA segment surrounding the human laminin beta2 chain gene (LAMB2) on chromosome 3p21.3-->p21.2, a region paralogous with the chromosome...... 7q22-->q31 region that contains the laminin beta1 chain gene locus (LAMB1). Several CpG islands and a novel polymorphic microsatellite marker (D3S4594) were identified. The 3' end of LAMB2 lies 16 kb from the 5' end of the glutaminyl tRNA synthetase gene (QARS). About 20 kb upstream of LAMB2 we...... found a gene encoding a transcribed, non-processed LAMB2-like pseudogene (LAMB2L). The sequence of 1.75 kb of genomic DNA at the 3' end of LAMB2L was similar to exons 8-12 of the laminin beta2 chain gene. The LAMB2L-LAMB2-QARS cluster lies telomeric to the gene encoding the laminin-binding protein...

  3. The Human SLC25A33 and SLC25A36 Genes of Solute Carrier Family 25 Encode Two Mitochondrial Pyrimidine Nucleotide Transporters*

    Science.gov (United States)

    Di Noia, Maria Antonietta; Todisco, Simona; Cirigliano, Angela; Rinaldi, Teresa; Agrimi, Gennaro; Iacobazzi, Vito; Palmieri, Ferdinando

    2014-01-01

    The human genome encodes 53 members of the solute carrier family 25 (SLC25), also called the mitochondrial carrier family, many of which have been shown to transport inorganic anions, amino acids, carboxylates, nucleotides, and coenzymes across the inner mitochondrial membrane, thereby connecting cytosolic and matrix functions. Here two members of this family, SLC25A33 and SLC25A36, have been thoroughly characterized biochemically. These proteins were overexpressed in bacteria and reconstituted in phospholipid vesicles. Their transport properties and kinetic parameters demonstrate that SLC25A33 transports uracil, thymine, and cytosine (deoxy)nucleoside di- and triphosphates by an antiport mechanism and SLC25A36 cytosine and uracil (deoxy)nucleoside mono-, di-, and triphosphates by uniport and antiport. Both carriers also transported guanine but not adenine (deoxy)nucleotides. Transport catalyzed by both carriers was saturable and inhibited by mercurial compounds and other inhibitors of mitochondrial carriers to various degrees. In confirmation of their identity (i) SLC25A33 and SLC25A36 were found to be targeted to mitochondria and (ii) the phenotypes of Saccharomyces cerevisiae cells lacking RIM2, the gene encoding the well characterized yeast mitochondrial pyrimidine nucleotide carrier, were overcome by expressing SLC25A33 or SLC25A36 in these cells. The main physiological role of SLC25A33 and SLC25A36 is to import/export pyrimidine nucleotides into and from mitochondria, i.e. to accomplish transport steps essential for mitochondrial DNA and RNA synthesis and breakdown. PMID:25320081

  4. The human SLC25A33 and SLC25A36 genes of solute carrier family 25 encode two mitochondrial pyrimidine nucleotide transporters.

    Science.gov (United States)

    Di Noia, Maria Antonietta; Todisco, Simona; Cirigliano, Angela; Rinaldi, Teresa; Agrimi, Gennaro; Iacobazzi, Vito; Palmieri, Ferdinando

    2014-11-28

    The human genome encodes 53 members of the solute carrier family 25 (SLC25), also called the mitochondrial carrier family, many of which have been shown to transport inorganic anions, amino acids, carboxylates, nucleotides, and coenzymes across the inner mitochondrial membrane, thereby connecting cytosolic and matrix functions. Here two members of this family, SLC25A33 and SLC25A36, have been thoroughly characterized biochemically. These proteins were overexpressed in bacteria and reconstituted in phospholipid vesicles. Their transport properties and kinetic parameters demonstrate that SLC25A33 transports uracil, thymine, and cytosine (deoxy)nucleoside di- and triphosphates by an antiport mechanism and SLC25A36 cytosine and uracil (deoxy)nucleoside mono-, di-, and triphosphates by uniport and antiport. Both carriers also transported guanine but not adenine (deoxy)nucleotides. Transport catalyzed by both carriers was saturable and inhibited by mercurial compounds and other inhibitors of mitochondrial carriers to various degrees. In confirmation of their identity (i) SLC25A33 and SLC25A36 were found to be targeted to mitochondria and (ii) the phenotypes of Saccharomyces cerevisiae cells lacking RIM2, the gene encoding the well characterized yeast mitochondrial pyrimidine nucleotide carrier, were overcome by expressing SLC25A33 or SLC25A36 in these cells. The main physiological role of SLC25A33 and SLC25A36 is to import/export pyrimidine nucleotides into and from mitochondria, i.e. to accomplish transport steps essential for mitochondrial DNA and RNA synthesis and breakdown. © 2014 by The American Society for Biochemistry and Molecular Biology, Inc.

  5. Genomic sequences of murine gamma B- and gamma C-crystallin-encoding genes: promoter analysis and complete evolutionary pattern of mouse, rat and human gamma-crystallins.

    Science.gov (United States)

    Graw, J; Liebstein, A; Pietrowski, D; Schmitt-John, T; Werner, T

    1993-12-22

    The murine genes, gamma B-cry and gamma C-cry, encoding the gamma B- and gamma C-crystallins, were isolated from a genomic DNA library. The complete nucleotide (nt) sequences of both genes were determined from 661 and 711 bp, respectively, upstream from the first exon to the corresponding polyadenylation sites, comprising more than 2650 and 2890 bp, respectively. The new sequences were compared to the partial cDNA sequences available for the murine gamma B-cry and gamma C-cry, as well as to the corresponding genomic sequences from rat and man, at both the nt and predicted amino acid (aa) sequence levels. In the gamma B-cry promoter region, a canonical CCAAT-box, a TATA-box, putative NF-I and C/EBP sites were detected. An R-repeat is inserted 366 bp upstream from the transcription start point. In contrast, the gamma C-cry promoter does not contain a CCAAT-box, but some other putative binding sites for transcription factors (AP-2, UBP-1, LBP-1) were located by computer analysis. The promoter regions of all six gamma-cry from mouse, rat and human, except human psi gamma F-cry, were analyzed for common sequence elements. A complex sequence element of about 70-80 bp was found in the proximal promoter, which contains a gamma-cry-specific and almost invariant sequence (crygpel) of 14 nt, and ends with the also invariant TATA-box. Within the complex sequence element, a minimum of three further features specific for the gamma A-, gamma B- and gamma D/E/F-cry genes can be defined, at least two of which were recently shown to be functional. In addition to these four sequence elements, a subtype-specific structure of inverted repeats with different-sized spacers can be deduced from the multiple sequence alignment. A phylogenetic analysis based on the promoter region, as well as the complete exon 3 of all gamma-cry from mouse, rat and man, suggests separation of only five gamma-cry subtypes (gamma A-, gamma B-, gamma C-, gamma D- and gamma E/F-cry) prior to species separation.

  6. RNAi suppressors encoded by pathogenic human viruses

    NARCIS (Netherlands)

    de Vries, Walter; Berkhout, Ben

    2008-01-01

    RNA silencing or RNAi interference (RNAi) serves as an innate antiviral mechanism in plants, fungi and animals. Human viruses, like plant viruses, encode suppressor proteins or RNAs that block or modulate the RNAi pathway. This review summarizes the mechanisms by which pathogenic human viruses

  7. Metagenomic identification of a novel salt tolerance gene from the human gut microbiome which encodes a membrane protein with homology to a brp/blh-family β-carotene 15,15'-monooxygenase.

    Directory of Open Access Journals (Sweden)

    Eamonn P Culligan

    Full Text Available The human gut microbiome consists of at least 3 million non-redundant genes, 150 times that of the core human genome. Herein, we report the identification and characterisation of a novel stress tolerance gene from the human gut metagenome. The locus, assigned brpA, encodes a membrane protein with homology to a brp/blh-family β-carotene monooxygenase. Cloning and heterologous expression of brpA in Escherichia coli confers a significant salt tolerance phenotype. Furthermore, when cultured in the presence of exogenous β-carotene, cell pellets adopt a red/orange pigmentation indicating the incorporation of carotenoids in the cell membrane.

  8. Bacteriophage-encoded shiga toxin gene in atypical bacterial host

    Directory of Open Access Journals (Sweden)

    Casas Veronica

    2011-07-01

    Full Text Available Abstract Background Contamination from fecal bacteria in recreational waters is a major health concern since bacteria capable of causing human disease can be found in animal feces. The Dog Beach area of Ocean Beach in San Diego, California is a beach prone to closures due to high levels of fecal indicator bacteria (FIB. A potential source of these FIB could be the canine feces left behind by owners who do not clean up after their pets. We tested this hypothesis by screening the DNA isolated from canine feces for the bacteriophage-encoded stx gene normally found in the virulent strains of the fecal bacterium Escherichia coli. Results Twenty canine fecal samples were collected, processed for total and bacterial fraction DNA, and screened by PCR for the stx gene. The stx gene was detected in the total and bacterial fraction DNA of one fecal sample. Bacterial isolates were then cultivated from the stx-positive fecal sample. Eighty nine of these canine fecal bacterial isolates were screened by PCR for the stx gene. The stx gene was detected in five of these isolates. Sequencing and phylogenetic analyses of 16S rRNA gene PCR products from the canine fecal bacterial isolates indicated that they were Enterococcus and not E. coli. Conclusions The bacteriophage-encoded stx gene was found in multiple species of bacteria cultivated from canine fecal samples gathered at the shoreline of the Dog Beach area of Ocean Beach in San Diego, California. The canine fecal bacteria carrying the stx gene were not the typical E. coli host and were instead identified through phylogenetic analyses as Enterococcus. This suggests a large degree of horizontal gene transfer of exotoxin genes in recreational waters.

  9. Identification and validation of human papillomavirus encoded microRNAs.

    Directory of Open Access Journals (Sweden)

    Kui Qian

    Full Text Available We report here identification and validation of the first papillomavirus encoded microRNAs expressed in human cervical lesions and cell lines. We established small RNA libraries from ten human papillomavirus associated cervical lesions including cancer and two human papillomavirus harboring cell lines. These libraries were sequenced using SOLiD 4 technology. We used the sequencing data to predict putative viral microRNAs and discovered nine putative papillomavirus encoded microRNAs. Validation was performed for five candidates, four of which were successfully validated by qPCR from cervical tissue samples and cell lines: two were encoded by HPV 16, one by HPV 38 and one by HPV 68. The expression of HPV 16 microRNAs was further confirmed by in situ hybridization, and colocalization with p16INK4A was established. Prediction of cellular target genes of HPV 16 encoded microRNAs suggests that they may play a role in cell cycle, immune functions, cell adhesion and migration, development, and cancer. Two putative viral target sites for the two validated HPV 16 miRNAs were mapped to the E5 gene, one in the E1 gene, two in the L1 gene and one in the LCR region. This is the first report to show that papillomaviruses encode their own microRNA species. Importantly, microRNAs were found in libraries established from human cervical disease and carcinoma cell lines, and their expression was confirmed in additional tissue samples. To our knowledge, this is also the first paper to use in situ hybridization to show the expression of a viral microRNA in human tissue.

  10. Two Genes Encoding Uracil Phosphoribosyltransferase Are Present in Bacillus subtilis

    DEFF Research Database (Denmark)

    Martinussen, Jan; Glaser, Philippe; Andersen, Paal S.

    1995-01-01

    Uracil phosphoribosyltransferase (UPRTase) catalyzes the key reaction in the salvage of uracil in many microorganisms. Surprisingly, two genes encoding UPRTase activity were cloned from Bacillus subtilis by complementation of an Escherichia coli mutant. The genes were sequenced, and the putative...

  11. Multiple genes encode the major surface glycoprotein of Pneumocystis carinii

    DEFF Research Database (Denmark)

    Kovacs, J A; Powell, F; Edman, J C

    1993-01-01

    hydrophobic region at the carboxyl terminus. The presence of multiple related msg genes encoding the major surface glycoprotein of P. carinii suggests that antigenic variation is a possible mechanism for evading host defenses. Further characterization of this family of genes should allow the development......The major surface antigen of Pneumocystis carinii, a life-threatening opportunistic pathogen in human immunodeficiency virus-infected patients, is an abundant glycoprotein that functions in host-organism interactions. A monoclonal antibody to this antigen is protective in animals, and thus...... blot studies using chromosomal or restricted DNA, the major surface glycoproteins are the products of a multicopy family of genes. The predicted protein has an M(r) of approximately 123,000, is relatively rich in cysteine residues (5.5%) that are very strongly conserved, and contains a well conserved...

  12. Human Transcriptome and Chromatin Modifications: An ENCODE Perspective

    Directory of Open Access Journals (Sweden)

    Li Shen

    2013-06-01

    Full Text Available A decade-long project, led by several international research groups, called the Encyclopedia of DNA Elements (ENCODE, recently released an unprecedented amount of data. The ambitious project covers transcriptome, cistrome, epigenome, and interactome data from more than 1,600 sets of experiments in human. To make use of this valuable resource, it is important to understand the information it represents and the techniques that were used to generate these data. In this review, we introduce the data that ENCODE generated, summarize the observations from the data analysis, and revisit a computational approach that ENCODE used to predict gene expression, with a focus on the human transcriptome and its association with chromatin modifications.

  13. The human TREM gene cluster at 6p21.1 encodes both activating and inhibitory single IgV domain receptors and includes NKp44.

    Science.gov (United States)

    Allcock, Richard J N; Barrow, Alexander D; Forbes, Simon; Beck, Stephan; Trowsdale, John

    2003-02-01

    We have characterized a cluster of single immunoglobulin variable (IgV) domain receptors centromeric of the major histocompatibility complex (MHC) on human chromosome 6. In addition to triggering receptor expressed on myeloid cells (TREM)-1 and TREM2, the cluster contains NKp44, a triggering receptor whose expression is limited to NK cells. We identified three new related genes and two gene fragments within a cluster of approximately 200 kb. Two of the three new genes lack charged residues in their transmembrane domain tails. Further, one of the genes contains two potential immunotyrosine Inhibitory motifs in its cytoplasmic tail, suggesting that it delivers inhibitory signals. The human and mouse TREM clusters appear to have diverged such that there are unique sequences in each species. Finally, each gene in the TREM cluster was expressed in a different range of cell types.

  14. Extreme expansion of NBS-encoding genes in Rosaceae.

    Science.gov (United States)

    Jia, YanXiao; Yuan, Yang; Zhang, Yanchun; Yang, Sihai; Zhang, Xiaohui

    2015-05-03

    Nucleotide binding site leucine-rich repeats (NBS-LRR) genes encode a large class of disease resistance (R) proteins in plants. Extensive studies have been carried out to identify and investigate NBS-encoding gene families in many important plant species. However, no comprehensive research into NBS-encoding genes in the Rosaceae has been performed. In this study, five whole-genome sequenced Rosaceae species, including apple, pear, peach, mei, and strawberry, were analyzed to investigate the evolutionary pattern of NBS-encoding genes and to compare them to those of three Cucurbitaceae species, cucumber, melon, and watermelon. Considerable differences in the copy number of NBS-encoding genes were observed between Cucurbitaceae and Rosaceae species. In Rosaceae species, a large number and a high proportion of NBS-encoding genes were observed in peach (437, 1.52%), mei (475, 1.51%), strawberry (346, 1.05%) and pear (617, 1.44%), and apple contained a whopping 1303 (2.05%) NBS-encoding genes, which might be the highest number of R-genes in all of these reported diploid plant. However, no more than 100 NBS-encoding genes were identified in Cucurbitaceae. Many more species-specific gene families were classified and detected with the signature of positive selection in Rosaceae species, especially in the apple genome. Taken together, our findings indicate that NBS-encoding genes in Rosaceae, especially in apple, have undergone extreme expansion and rapid adaptive evolution. Useful information was provided for further research on the evolutionary mode of disease resistance genes in Rosaceae crops.

  15. Human TRMU encoding the mitochondrial 5-methylaminomethyl-2-thiouridylate-methyltransferase is a putative nuclear modifier gene for the phenotypic expression of the deafness-associated 12S rRNA mutations

    International Nuclear Information System (INIS)

    Yan Qingfeng; Bykhovskaya, Yelena; Li Ronghua; Mengesha, Emebet; Shohat, Mordechai; Estivill, Xavier; Fischel-Ghodsian, Nathan; Guan Minxin

    2006-01-01

    Nuclear modifier genes have been proposed to modulate the phenotypic manifestation of human mitochondrial 12S rRNA A1491G mutation associated with deafness in many families world-wide. Here we identified and characterized the putative nuclear modifier gene TRMU encoding a highly conserved mitochondrial protein related to tRNA modification. A 1937 bp TRMU cDNA has been isolated and the genomic organization of TRMU has been elucidated. The human TRMU gene containing 11 exons encodes a 421 residue protein with a strong homology to the TRMU-like proteins of bacteria and other homologs. TRMU is ubiquitously expressed in various tissues, but abundantly in tissues with high metabolic rates including heart, liver, kidney, and brain. Immunofluorescence analysis of human 143B cells expressing TRMU-GFP fusion protein demonstrated that the human Trmu localizes and functions in mitochondrion. Furthermore, we show that in families with the deafness-associated 12S rRNA A1491G mutation there is highly suggestive linkage and linkage disequilibrium between microsatellite markers adjacent to TRMU and the presence of deafness. These observations suggest that human TRMU may modulate the phenotypic manifestation of the deafness-associated mitochondrial 12S rRNA mutations

  16. Human adenovirus early region 4 open reading frame 1 genes encode growth-transforming proteins that may be distantly related to dUTP pyrophosphatase enzymes.

    OpenAIRE

    Weiss, R S; Lee, S S; Prasad, B V; Javier, R T

    1997-01-01

    An essential oncogenic determinant of subgroup D human adenovirus type 9 (Ad9), which uniquely elicits estrogen-dependent mammary tumors in rats, is encoded by early region 4 open reading frame 1 (E4 ORF1). Whereas Ad9 E4 ORF1 efficiently induces transformed foci on the established rat embryo fibroblast cell line CREF, the related subgroup A Ad12 and subgroup C Ad5 E4 ORF1s do not (R. T. Javier, J. Virol. 68:3917-3924, 1994). In this study, we found that the lack of transforming activity asso...

  17. Cloning, expression and characterisation of a novel gene encoding ...

    African Journals Online (AJOL)

    微软用户

    2012-01-12

    Jan 12, 2012 ... ... characterisation of a novel gene encoding a chemosensory protein from Bemisia ... The genomic DNA sequence comparisons revealed a 1490 bp intron ... have several conserved sequence motifs, including the. N-terminal ...

  18. cDNA for the human β2-adrenergic receptor: a protein with multiple membrane-spanning domains and encoded by a gene whose chromosomal location is shared with that of the receptor for platelet-derived growth factor

    International Nuclear Information System (INIS)

    Kobilka, B.K.; Dixon, R.A.F.; Frielle, T.

    1987-01-01

    The authors have isolated and sequenced a cDNA encoding the human β 2 -adrenergic receptor. The deduced amino acid sequence (413 residues) is that of a protein containing seven clusters of hydrophobic amino acids suggestive of membrane-spanning domains. While the protein is 87% identical overall with the previously cloned hamster β 2 -adrenergic receptor, the most highly conserved regions are the putative transmembrane helices (95% identical) and cytoplasmic loops (93% identical), suggesting that these regions of the molecule harbor important functional domains. Several of the transmembrane helices also share lesser degrees of identity with comparable regions of select members of the opsin family of visual pigments. They have localized the gene for the β 2 -adrenergic receptor to q31-q32 on chromosome 5. This is the same position recently determined for the gene encoding the receptor for platelet-derived growth factor and is adjacent to that for the FMS protooncogene, which encodes the receptor for the macrophage colony-stimulating factor

  19. Identification of the major structural and nonstructural proteins encoded by human parvovirus B19 and mapping of their genes by procaryotic expression of isolated genomic fragments

    Energy Technology Data Exchange (ETDEWEB)

    Cotmore, S.F.; McKie, V.C.; Anderson, L.J.; Astell, C.R.; Tattersall, P.

    1986-11-01

    Plasma from a child with homozygous sickle-cell disease, sampled during the early phase of an aplastic crisis, contained human parvovirus B19 virions. Plasma taken 10 days later (during the convalescent phase) contained both immunoglobulin M and immunoglobulin G antibodies directed against two viral polypeptides with apparent molecular weights for 83,000 and 58,000 which were present exclusively in the particulate fraction of the plasma taken during the acute phase. These two protein species comigrated at 110S on neutral sucrose velocity gradients with the B19 viral DNA and thus appear to constitute the viral capsid polypeptides. The B19 genome was molecularly cloned into a bacterial plasmid vector. Two expression constructs containing B19 sequences from different halves of the viral genome were obtained, which directed the synthesis, in bacteria, of segments of virally encoded protein. These polypeptide fragments were then purified and used to immunize rabbits. Antibodies against a protein sequence specified between nucleotides 2897 and 3749 recognized both the 83- and 58-kilodalton capsid polypeptides in aplastic plasma taken during the acute phase and detected similar proteins in the similar proteins in the tissues of a stillborn fetus which had been infected transplacentally with B19. Antibodies against a protein sequence encoded in the other half of the B19 genome (nucleotides 1072 through 2044) did not react specifically with any protein in plasma taken during the acute phase but recognized three nonstructural polypeptides of 71, 63, and 52 kilodaltons present in the liver and, at lower levels, in some other tissues of the transplacentally infected fetus.

  20. Identification of the major structural and nonstructural proteins encoded by human parvovirus B19 and mapping of their genes by procaryotic expression of isolated genomic fragments

    International Nuclear Information System (INIS)

    Cotmore, S.F.; McKie, V.C.; Anderson, L.J.; Astell, C.R.; Tattersall, P.

    1986-01-01

    Plasma from a child with homozygous sickle-cell disease, sampled during the early phase of an aplastic crisis, contained human parvovirus B19 virions. Plasma taken 10 days later (during the convalescent phase) contained both immunoglobulin M and immunoglobulin G antibodies directed against two viral polypeptides with apparent molecular weights for 83,000 and 58,000 which were present exclusively in the particulate fraction of the plasma taken during the acute phase. These two protein species comigrated at 110S on neutral sucrose velocity gradients with the B19 viral DNA and thus appear to constitute the viral capsid polypeptides. The B19 genome was molecularly cloned into a bacterial plasmid vector. Two expression constructs containing B19 sequences from different halves of the viral genome were obtained, which directed the synthesis, in bacteria, of segments of virally encoded protein. These polypeptide fragments were then purified and used to immunize rabbits. Antibodies against a protein sequence specified between nucleotides 2897 and 3749 recognized both the 83- and 58-kilodalton capsid polypeptides in aplastic plasma taken during the acute phase and detected similar proteins in the similar proteins in the tissues of a stillborn fetus which had been infected transplacentally with B19. Antibodies against a protein sequence encoded in the other half of the B19 genome (nucleotides 1072 through 2044) did not react specifically with any protein in plasma taken during the acute phase but recognized three nonstructural polypeptides of 71, 63, and 52 kilodaltons present in the liver and, at lower levels, in some other tissues of the transplacentally infected fetus

  1. RNAi-based silencing of genes encoding the vacuolar- ATPase ...

    African Journals Online (AJOL)

    RNAi-based silencing of genes encoding the vacuolar- ATPase subunits a and c in pink bollworm (Pectinophora gossypiella). Ahmed M. A. Mohammed. Abstract. RNA interference is a post- transcriptional gene regulation mechanism that is predominantly found in eukaryotic organisms. RNAi demonstrated a successful ...

  2. Bioinformatics analysis and detection of gelatinase encoded gene in Lysinibacillussphaericus

    Science.gov (United States)

    Repin, Rul Aisyah Mat; Mutalib, Sahilah Abdul; Shahimi, Safiyyah; Khalid, Rozida Mohd.; Ayob, Mohd. Khan; Bakar, Mohd. Faizal Abu; Isa, Mohd Noor Mat

    2016-11-01

    In this study, we performed bioinformatics analysis toward genome sequence of Lysinibacillussphaericus (L. sphaericus) to determine gene encoded for gelatinase. L. sphaericus was isolated from soil and gelatinase species-specific bacterium to porcine and bovine gelatin. This bacterium offers the possibility of enzymes production which is specific to both species of meat, respectively. The main focus of this research is to identify the gelatinase encoded gene within the bacteria of L. Sphaericus using bioinformatics analysis of partially sequence genome. From the research study, three candidate gene were identified which was, gelatinase candidate gene 1 (P1), NODE_71_length_93919_cov_158.931839_21 which containing 1563 base pair (bp) in size with 520 amino acids sequence; Secondly, gelatinase candidate gene 2 (P2), NODE_23_length_52851_cov_190.061386_17 which containing 1776 bp in size with 591 amino acids sequence; and Thirdly, gelatinase candidate gene 3 (P3), NODE_106_length_32943_cov_169.147919_8 containing 1701 bp in size with 566 amino acids sequence. Three pairs of oligonucleotide primers were designed and namely as, F1, R1, F2, R2, F3 and R3 were targeted short sequences of cDNA by PCR. The amplicons were reliably results in 1563 bp in size for candidate gene P1 and 1701 bp in size for candidate gene P3. Therefore, the results of bioinformatics analysis of L. Sphaericus resulting in gene encoded gelatinase were identified.

  3. A deep auto-encoder model for gene expression prediction.

    Science.gov (United States)

    Xie, Rui; Wen, Jia; Quitadamo, Andrew; Cheng, Jianlin; Shi, Xinghua

    2017-11-17

    Gene expression is a key intermediate level that genotypes lead to a particular trait. Gene expression is affected by various factors including genotypes of genetic variants. With an aim of delineating the genetic impact on gene expression, we build a deep auto-encoder model to assess how good genetic variants will contribute to gene expression changes. This new deep learning model is a regression-based predictive model based on the MultiLayer Perceptron and Stacked Denoising Auto-encoder (MLP-SAE). The model is trained using a stacked denoising auto-encoder for feature selection and a multilayer perceptron framework for backpropagation. We further improve the model by introducing dropout to prevent overfitting and improve performance. To demonstrate the usage of this model, we apply MLP-SAE to a real genomic datasets with genotypes and gene expression profiles measured in yeast. Our results show that the MLP-SAE model with dropout outperforms other models including Lasso, Random Forests and the MLP-SAE model without dropout. Using the MLP-SAE model with dropout, we show that gene expression quantifications predicted by the model solely based on genotypes, align well with true gene expression patterns. We provide a deep auto-encoder model for predicting gene expression from SNP genotypes. This study demonstrates that deep learning is appropriate for tackling another genomic problem, i.e., building predictive models to understand genotypes' contribution to gene expression. With the emerging availability of richer genomic data, we anticipate that deep learning models play a bigger role in modeling and interpreting genomics.

  4. Transcriptional modulation of genes encoding nitrate reductase in ...

    African Journals Online (AJOL)

    The free aluminum (Al) content in soil can reach levels that are toxic to plants, and this has frequently limited increased productivity of cultures. Four genes encoding nitrate reductase (NR) were identified, named ZmNR1–4. With the aim of evaluating NR activity and the transcriptional modulation of the ZmNR1, ZmNR2, ...

  5. Identification and characterization of a gene encoding a putative ...

    Indian Academy of Sciences (India)

    2012-10-30

    Oct 30, 2012 ... Genetic Improvement of Oil Crops, Ministry of Agriculture, Wuhan 430062, China. 2Institute of ... Its encoding gene is an essential candidate for oil crops to .... higher level in leaves than in other organs (Kim and Huang. 2004) ...

  6. RNAi-based silencing of genes encoding the vacuolar- ATPase ...

    African Journals Online (AJOL)

    2016-11-09

    Nov 9, 2016 ... Spodoptera exigua larval development by silencing chitin synthase gene with RNA interference. Bull. Entomol. Res. 98:613-619. Dow JAT (1999). The Multifunctional Drosophila melanogaster V-. ATPase is encoded by a multigene family. J. Bioenerg. Biomembr. 31:75-83. Fire A, Xu SQ, Montgomery MK, ...

  7. Environmental cycle of antibiotic resistance encoded genes: A systematic review

    Directory of Open Access Journals (Sweden)

    R. ghanbari

    2017-12-01

    Full Text Available Antibiotic-resistant bacteria and genes enter the environment in different ways. The release of these factors into the environment has increased concerns related to public health. The aim of the study was to evaluate the antibiotic resistance genes (ARGs in the environmental resources. In this systematic review, the data were extracted from valid sources of information including ScienceDirect, PubMed, Google Scholar and SID. Evaluation and selection of articles were conducted on the basis of the PRISMA checklist. A total of 39 articles were included in the study, which were chosen from a total of 1249 papers. The inclusion criterion was the identification of genes encoding antibiotic resistance against the eight important groups of antibiotics determined by using the PCR technique in the environmental sources including municipal and hospital wastewater treatment plants, animal and agricultural wastes, effluents from treatment plants, natural waters, sediments, and drinking waters. In this study, 113 genes encoding antibiotic resistance to eight groups of antibiotics (beta-lactams, aminoglycosides, tetracyclines, macrolides, sulfonamides, chloramphenicol, glycopeptides and quinolones were identified in various environments. Antibiotic resistance genes were found in all the investigated environments. The investigation of microorganisms carrying these genes shows that most of the bacteria especially gram-negative bacteria are effective in the acquisition and the dissemination of these pollutants in the environment. Discharging the raw wastewaters and effluents from wastewater treatments acts as major routes in the dissemination of ARGs into environment sources and can pose hazards to public health.

  8. Fungicidal activity of peptides encoded by immunoglobulin genes

    OpenAIRE

    Polonelli, Luciano; Ciociola, Tecla; Sperind?, Martina; Giovati, Laura; D?Adda, Tiziana; Galati, Serena; Travassos, Luiz R.; Magliani, Walter; Conti, Stefania

    2017-01-01

    Evidence from previous works disclosed the antimicrobial, antiviral, anti-tumour and/or immunomodulatory activity exerted, through different mechanisms of action, by peptides expressed in the complementarity-determining regions or even in the constant region of antibodies, independently from their specificity and isotype. Presently, we report the selection, from available databases, of peptide sequences encoded by immunoglobulin genes for the evaluation of their potential biological activitie...

  9. [High gene conversion frequency between genes encoding 2-deoxyglucose-6-phosphate phosphatase in 3 Saccharomyces species].

    Science.gov (United States)

    Piscopo, Sara-Pier; Drouin, Guy

    2014-05-01

    Gene conversions are nonreciprocal sequence exchanges between genes. They are relatively common in Saccharomyces cerevisiae, but few studies have investigated the evolutionary fate of gene conversions or their functional impacts. Here, we analyze the evolution and impact of gene conversions between the two genes encoding 2-deoxyglucose-6-phosphate phosphatase in S. cerevisiae, Saccharomyces paradoxus and Saccharomyces mikatae. Our results demonstrate that the last half of these genes are subject to gene conversions among these three species. The greater similarity and the greater percentage of GC nucleotides in the converted regions, as well as the absence of long regions of adjacent common converted sites, suggest that these gene conversions are frequent and occur independently in all three species. The high frequency of these conversions probably result from the fact that they have little impact on the protein sequences encoded by these genes.

  10. A single Danio rerio hars gene encodes both cytoplasmic and mitochondrial histidyl-tRNA synthetases.

    Directory of Open Access Journals (Sweden)

    Ashley L Waldron

    Full Text Available Histidyl tRNA Synthetase (HARS is a member of the aminoacyl tRNA synthetase (ARS family of enzymes. This family of 20 enzymes is responsible for attaching specific amino acids to their cognate tRNA molecules, a critical step in protein synthesis. However, recent work highlighting a growing number of associations between ARS genes and diverse human diseases raises the possibility of new and unexpected functions in this ancient enzyme family. For example, mutations in HARS have been linked to two different neurological disorders, Usher Syndrome Type IIIB and Charcot Marie Tooth peripheral neuropathy. These connections raise the possibility of previously undiscovered roles for HARS in metazoan development, with alterations in these functions leading to complex diseases. In an attempt to establish Danio rerio as a model for studying HARS functions in human disease, we characterized the Danio rerio hars gene and compared it to that of human HARS. Using a combination of bioinformatics, molecular biology, and cellular approaches, we found that while the human genome encodes separate genes for cytoplasmic and mitochondrial HARS protein, the Danio rerio genome encodes a single hars gene which undergoes alternative splicing to produce the respective cytoplasmic and mitochondrial versions of Hars. Nevertheless, while the HARS genes of humans and Danio differ significantly at the genomic level, we found that they are still highly conserved at the amino acid level, underscoring the potential utility of Danio rerio as a model organism for investigating HARS function and its link to human diseases in vivo.

  11. Genetic variants in nuclear-encoded mitochondrial genes influence AIDS progression.

    Directory of Open Access Journals (Sweden)

    Sher L Hendrickson

    2010-09-01

    Full Text Available The human mitochondrial genome includes only 13 coding genes while nuclear-encoded genes account for 99% of proteins responsible for mitochondrial morphology, redox regulation, and energetics. Mitochondrial pathogenesis occurs in HIV patients and genetically, mitochondrial DNA haplogroups with presumed functional differences have been associated with differential AIDS progression.Here we explore whether single nucleotide polymorphisms (SNPs within 904 of the estimated 1,500 genes that specify nuclear-encoded mitochondrial proteins (NEMPs influence AIDS progression among HIV-1 infected patients. We examined NEMPs for association with the rate of AIDS progression using genotypes generated by an Affymetrix 6.0 genotyping array of 1,455 European American patients from five US AIDS cohorts. Successfully genotyped SNPs gave 50% or better haplotype coverage for 679 of known NEMP genes. With a Bonferroni adjustment for the number of genes and tests examined, multiple SNPs within two NEMP genes showed significant association with AIDS progression: acyl-CoA synthetase medium-chain family member 4 (ACSM4 on chromosome 12 and peroxisomal D3,D2-enoyl-CoA isomerase (PECI on chromosome 6.Our previous studies on mitochondrial DNA showed that European haplogroups with presumed functional differences were associated with AIDS progression and HAART mediated adverse events. The modest influences of nuclear-encoded mitochondrial genes found in the current study add support to the idea that mitochondrial function plays a role in AIDS pathogenesis.

  12. Glycosulfatase-Encoding Gene Cluster in Bifidobacterium breve UCC2003.

    Science.gov (United States)

    Egan, Muireann; Jiang, Hao; O'Connell Motherway, Mary; Oscarson, Stefan; van Sinderen, Douwe

    2016-11-15

    Bifidobacteria constitute a specific group of commensal bacteria typically found in the gastrointestinal tract (GIT) of humans and other mammals. Bifidobacterium breve strains are numerically prevalent among the gut microbiota of many healthy breastfed infants. In the present study, we investigated glycosulfatase activity in a bacterial isolate from a nursling stool sample, B. breve UCC2003. Two putative sulfatases were identified on the genome of B. breve UCC2003. The sulfated monosaccharide N-acetylglucosamine-6-sulfate (GlcNAc-6-S) was shown to support the growth of B. breve UCC2003, while N-acetylglucosamine-3-sulfate, N-acetylgalactosamine-3-sulfate, and N-acetylgalactosamine-6-sulfate did not support appreciable growth. By using a combination of transcriptomic and functional genomic approaches, a gene cluster designated ats2 was shown to be specifically required for GlcNAc-6-S metabolism. Transcription of the ats2 cluster is regulated by a repressor open reading frame kinase (ROK) family transcriptional repressor. This study represents the first description of glycosulfatase activity within the Bifidobacterium genus. Bifidobacteria are saccharolytic organisms naturally found in the digestive tract of mammals and insects. Bifidobacterium breve strains utilize a variety of plant- and host-derived carbohydrates that allow them to be present as prominent members of the infant gut microbiota as well as being present in the gastrointestinal tract of adults. In this study, we introduce a previously unexplored area of carbohydrate metabolism in bifidobacteria, namely, the metabolism of sulfated carbohydrates. B. breve UCC2003 was shown to metabolize N-acetylglucosamine-6-sulfate (GlcNAc-6-S) through one of two sulfatase-encoding gene clusters identified on its genome. GlcNAc-6-S can be found in terminal or branched positions of mucin oligosaccharides, the glycoprotein component of the mucous layer that covers the digestive tract. The results of this study provide

  13. Recombinant vectors construction for cellobiohydrolase encoding gene constitutive expression

    Directory of Open Access Journals (Sweden)

    Leontina GURGU

    2012-12-01

    Full Text Available Cellobiohydrolases (EC 3.2.1.91 are important exo enzymes involved in cellulose hydrolysis alongside endoglucanases (EC 3.2.1.4 and β-glucosidases (EC 3.2.1.21. Heterologous cellobiohydrolase gene expression under constitutive promoter control using Saccharomyces cerevisiae as host system is of great importance for a successful SSF process. From this point of view, the main objective of the work was to use Yeplac181 expression vector as a recipient for cellobiohdrolase - cbhB encoding gene expression under the control of the actin promoter, in Saccharomyces cerevisiae. Two hybridvectors, YEplac-Actp and YEplac-Actp-CbhB, were generated usingEscherichia coli XLI Blue for the cloning experiments. Constitutive cbhB gene expression was checked by proteine gel electrophoresis (SDS-PAGE after insertion of these constructs into Saccharomyces cerevisiae.

  14. A subset of group A-like var genes encodes the malaria parasite ligands for binding to human brain endothelial cells

    DEFF Research Database (Denmark)

    Claessens, Antoine; Adams, Yvonne; Ghumra, Ashfaq

    2012-01-01

    Cerebral malaria is the most deadly manifestation of infection with Plasmodium falciparum. The pathology of cerebral malaria is characterized by the accumulation of infected erythrocytes (IEs) in the microvasculature of the brain caused by parasite adhesins on the surface of IEs binding to human...... receptors on microvascular endothelial cells. The parasite and host molecules involved in this interaction are unknown. We selected three P. falciparum strains (HB3, 3D7, and IT/FCR3) for binding to a human brain endothelial cell line (HBEC-5i). The whole transcriptome of isogenic pairs of selected.......029) but not by antibodies from controls with uncomplicated malaria (Mann-Whitney test, P = 0.58). This work describes a binding phenotype for virulence-associated group A P. falciparum erythrocyte membrane protein 1 variants and identifies targets for interventions to treat or prevent cerebral malaria....

  15. Enhancement of antitumor activity by using a fully human gene encoding a single-chain fragmented antibody specific for carcinoembryonic antigen

    Directory of Open Access Journals (Sweden)

    Shibaguchi H

    2017-08-01

    Full Text Available Hirotomo Shibaguchi,1,* Naixiang Luo,1,* Naoto Shirasu,1,* Motomu Kuroki,2 Masahide Kuroki1 1Department of Biochemistry, Faculty of Medicine, Fukuoka University, Fukuoka, Japan; 2School of Nursing, Faculty of Medicine, Fukuoka University, Fukuoka, Japan *These authors equally contributed to this work Abstract: Human leukocyte antigen and/or costimulatory molecules are frequently lacking in metastatic tumor cells, and thus tumor cells are able to escape from the immune system. Although lymphocytes with a chimeric antigen receptor (CAR is a promising approach for overcoming this challenge in cancer immunotherapy, administration of modified T cells alone often demonstrates little efficacy in patients. Therefore, in order to enhance the antitumor activity of immune cells in the cancer microenvironment, we used lymphocytes expressing CAR in combination with a fusion protein of IL-2 that contained the single-chain fragmented antibody (scFv specific for the carcinoembryonic antigen. Among a series of CAR constructs, with or without a spacer and the intracellular domain of CD28, the CAR construct containing CD8α, CD28, and CD3ζ most effectively activated and expressed INF-γ in CAR-bearing T cells. Furthermore, in comparison with free IL-2, the combination of peripheral blood mononuclear cells expressing CAR and the fusion protein containing IL-2 significantly enhanced the antitumor activity against MKN-45 cells, a human gastric cancer cell line. In conclusion, this novel combination therapy of CAR and a fusion protein consisting of a functional cytokine and a fully human scFv may be a promising approach for adoptive cancer immunotherapy. Keywords: chimeric antigen receptor, fusion protein, human scFv, CEA, combination therapy

  16. Horse cDNA clones encoding two MHC class I genes

    Energy Technology Data Exchange (ETDEWEB)

    Barbis, D.P.; Maher, J.K.; Stanek, J.; Klaunberg, B.A.; Antczak, D.F.

    1994-12-31

    Two full-length clones encoding MHC class I genes were isolated by screening a horse cDNA library, using a probe encoding in human HLA-A2.2Y allele. The library was made in the pcDNA1 vector (Invitrogen, San Diego, CA), using mRNA from peripheral blood lymphocytes obtained from a Thoroughbred stallion (No. 0834) homozygous for a common horse MHC haplotype (ELA-A2, -B2, -D2; Antczak et al. 1984; Donaldson et al. 1988). The clones were sequenced, using SP6 and T7 universal primers and horse-specific oligonucleotides designed to extend previously determined sequences.

  17. Enhanced anti-tumor effect of a gene gun-delivered DNA vaccine encoding the human papillomavirus type 16 oncoproteins genetically fused to the herpes simplex virus glycoprotein D

    Directory of Open Access Journals (Sweden)

    M.O. Diniz

    2011-05-01

    Full Text Available Anti-cancer DNA vaccines have attracted growing interest as a simple and non-invasive method for both the treatment and prevention of tumors induced by human papillomaviruses. Nonetheless, the low immunogenicity of parenterally administered vaccines, particularly regarding the activation of cytotoxic CD8+ T cell responses, suggests that further improvements in both vaccine composition and administration routes are still required. In the present study, we report the immune responses and anti-tumor effects of a DNA vaccine (pgD-E7E6E5 expressing three proteins (E7, E6, and E5 of the human papillomavirus type 16 genetically fused to the glycoprotein D of the human herpes simplex virus type 1, which was administered to mice by the intradermal (id route using a gene gun. A single id dose of pgD-E7E6E5 (2 µg/dose induced a strong activation of E7-specific interferon-γ (INF-γ-producing CD8+ T cells and full prophylactic anti-tumor effects in the vaccinated mice. Three vaccine doses inhibited tumor growth in 70% of the mice with established tumors. In addition, a single vaccine dose consisting of the co-administration of pgD-E7E6E5 and the vector encoding interleukin-12 or granulocyte-macrophage colony-stimulating factor further enhanced the therapeutic anti-tumor effects and conferred protection to 60 and 50% of the vaccinated mice, respectively. In conclusion, id administration of pgD-E7E6E5 significantly enhanced the immunogenicity and anti-tumor effects of the DNA vaccine, representing a promising administration route for future clinical trials.

  18. New recombinant bacterium comprises a heterologous gene encoding glycerol dehydrogenase and/or an up-regulated native gene encoding glycerol dehydrogenase, useful for producing ethanol

    DEFF Research Database (Denmark)

    2010-01-01

    dehydrogenase encoding region of the bacterium, or is inserted into a phosphotransacetylase encoding region of the bacterium, or is inserted into an acetate kinase encoding region of the bacterium. It is operably linked to an inducible, a regulated or a constitutive promoter. The up-regulated glycerol......TECHNOLOGY FOCUS - BIOTECHNOLOGY - Preparation (claimed): Producing recombinant bacterium having enhanced ethanol production characteristics when cultivated in growth medium comprising glycerol comprises: (a) transforming a parental bacterium by (i) the insertion of a heterologous gene encoding...... glycerol dehydrogenase; and/or (ii) up-regulating a native gene encoding glycerol dehydrogenase; and (b) obtaining the recombinant bacterium. Preferred Bacterium: In the recombinant bacterium above, the inserted heterologous gene and/or the up-regulated native gene is encoding a glycerol dehydrogenase...

  19. Cloning human DNA repair genes

    International Nuclear Information System (INIS)

    Jeggo, P.A.; Carr, A.M.; Lehmann, A.R.

    1994-01-01

    Many human genes involved in the repair of UV damage have been cloned using different procedures and they have been of great value in assisting the understanding of the mechanism of nucleotide excision-repair. Genes involved in repair of ionizing radiation damage have proved more difficult to isolate. Positional cloning has localized the XRCC5 gene to a small region of chromosome 2q33-35, and a series of yeast artificial chromosomes covering this region have been isolated. Very recent work has shown that the XRCC5 gene encodes the 80 kDa subunit of the Ku DNA-binding protein. The Ku80 gene also maps to this region. Studies with fission yeast have shown that radiation sensitivity can result not only from defective DNA repair but also from abnormal cell cycle control following DNA damage. Several genes involved in this 'check-point' control in fission yeast have been isolated and characterized in detail. It is likely that a similar checkpoint control mechanism exists in human cells. (author)

  20. Human proton/oligopeptide transporter (POT) genes

    DEFF Research Database (Denmark)

    Botka, C. W.; Wittig, T. W.; Graul, R. C.

    2000-01-01

    The proton-dependent oligopeptide transporters (POT) gene family currently consists of approximately 70 cloned cDNAs derived from diverse organisms. In mammals, two genes encoding peptide transporters, PepT1 and PepT2 have been cloned in several species including humans, in addition to a rat...... histidine/peptide transporter (rPHT1). Because the Candida elegans genome contains five putative POT genes, we searched the available protein and nucleic acid databases for additional mammalian/human POT genes, using iterative BLAST runs and the human expressed sequence tags (EST) database. The apparent...... and introns of the likely human orthologue (termed hPHT2). Northern analyses with EST clones indicated that hPHT1 is primarily expressed in skeletal muscle and spleen, whereas hPHT2 is found in spleen, placenta, lung, leukocytes, and heart. These results suggest considerable complexity of the human POT gene...

  1. Cloning and characterization of the gene encoding IMP dehydrogenase from Arabidopsis thaliana.

    Science.gov (United States)

    Collart, F R; Osipiuk, J; Trent, J; Olsen, G J; Huberman, E

    1996-10-03

    We have cloned and characterized the gene encoding inosine monophosphate dehydrogenase (IMPDH) from Arabidopsis thaliana (At). The transcription unit of the At gene spans approximately 1900 bp and specifies a protein of 503 amino acids with a calculated relative molecular mass (M(r)) of 54,190. The gene is comprised of a minimum of four introns and five exons with all donor and acceptor splice sequences conforming to previously proposed consensus sequences. The deduced IMPDH amino-acid sequence from At shows a remarkable similarity to other eukaryotic IMPDH sequences, with a 48% identity to human Type II enzyme. Allowing for conservative substitutions, the enzyme is 69% similar to human Type II IMPDH. The putative active-site sequence of At IMPDH conforms to the IMP dehydrogenase/guanosine monophosphate reductase motif and contains an essential active-site cysteine residue.

  2. The evolutionary fate of the genes encoding the purine catabolic enzymes in hominoids, birds, and reptiles.

    Science.gov (United States)

    Keebaugh, Alaine C; Thomas, James W

    2010-06-01

    Gene loss has been proposed to play a major role in adaptive evolution, and recent studies are beginning to reveal its importance in human evolution. However, the potential consequence of a single gene-loss event upon the fates of functionally interrelated genes is poorly understood. Here, we use the purine metabolic pathway as a model system in which to explore this important question. The loss of urate oxidase (UOX) activity, a necessary step in this pathway, has occurred independently in the hominoid and bird/reptile lineages. Because the loss of UOX would have removed the functional constraint upon downstream genes in this pathway, these downstream genes are generally assumed to have subsequently deteriorated. In this study, we used a comparative genomics approach to empirically determine the fate of UOX itself and the downstream genes in five hominoids, two birds, and a reptile. Although we found that the loss of UOX likely triggered the genetic deterioration of the immediate downstream genes in the hominoids, surprisingly in the birds and reptiles, the UOX locus itself and some of the downstream genes were present in the genome and predicted to encode proteins. To account for the variable pattern of gene retention and loss after the inactivation of UOX, we hypothesize that although gene loss is a common fate for genes that have been rendered obsolete due to the upstream loss of an enzyme a metabolic pathway, it is also possible that same lack of constraint will foster the evolution of new functions or allow the optimization of preexisting alternative functions in the downstream genes, thereby resulting in gene retention. Thus, adaptive single-gene losses have the potential to influence the long-term evolutionary fate of functionally interrelated genes.

  3. EWS and FUS bind a subset of transcribed genes encoding proteins enriched in RNA regulatory functions.

    Science.gov (United States)

    Luo, Yonglun; Blechingberg, Jenny; Fernandes, Ana Miguel; Li, Shengting; Fryland, Tue; Børglum, Anders D; Bolund, Lars; Nielsen, Anders Lade

    2015-11-14

    FUS (TLS) and EWS (EWSR1) belong to the FET-protein family of RNA and DNA binding proteins. FUS and EWS are structurally and functionally related and participate in transcriptional regulation and RNA processing. FUS and EWS are identified in translocation generated cancer fusion proteins and involved in the human neurological diseases amyotrophic lateral sclerosis and fronto-temporal lobar degeneration. To determine the gene regulatory functions of FUS and EWS at the level of chromatin, we have performed chromatin immunoprecipitation followed by next generation sequencing (ChIP-seq). Our results show that FUS and EWS bind to a subset of actively transcribed genes, that binding often is downstream the poly(A)-signal, and that binding overlaps with RNA polymerase II. Functional examinations of selected target genes identified that FUS and EWS can regulate gene expression at different levels. Gene Ontology analyses showed that FUS and EWS target genes preferentially encode proteins involved in regulatory processes at the RNA level. The presented results yield new insights into gene interactions of EWS and FUS and have identified a set of FUS and EWS target genes involved in pathways at the RNA regulatory level with potential to mediate normal and disease-associated functions of the FUS and EWS proteins.

  4. Cloning and Characterization of upp, a Gene Encoding Uracil Phosphoribosyltransferase from Lactococcus lactis

    DEFF Research Database (Denmark)

    Martinussen, Jan; Hammer, Karin

    1994-01-01

    Uracil phosphoribosyltransferase catalyzes the key reaction in the salvage of uracil in many microorganisms. The gene encoding uracil phosphoribosyltransferase (upp) was cloned from Lactococcus lactis subsp. cremoris MG1363 by complementation of an Escherichia coli mutant. The gene was sequenced...

  5. Duplicability of self-interacting human genes.

    LENUS (Irish Health Repository)

    Pérez-Bercoff, Asa

    2010-01-01

    BACKGROUND: There is increasing interest in the evolution of protein-protein interactions because this should ultimately be informative of the patterns of evolution of new protein functions within the cell. One model proposes that the evolution of new protein-protein interactions and protein complexes proceeds through the duplication of self-interacting genes. This model is supported by data from yeast. We examined the relationship between gene duplication and self-interaction in the human genome. RESULTS: We investigated the patterns of self-interaction and duplication among 34808 interactions encoded by 8881 human genes, and show that self-interacting proteins are encoded by genes with higher duplicability than genes whose proteins lack this type of interaction. We show that this result is robust against the system used to define duplicate genes. Finally we compared the presence of self-interactions amongst proteins whose genes have duplicated either through whole-genome duplication (WGD) or small-scale duplication (SSD), and show that the former tend to have more interactions in general. After controlling for age differences between the two sets of duplicates this result can be explained by the time since the gene duplication. CONCLUSIONS: Genes encoding self-interacting proteins tend to have higher duplicability than proteins lacking self-interactions. Moreover these duplicate genes have more often arisen through whole-genome rather than small-scale duplication. Finally, self-interacting WGD genes tend to have more interaction partners in general in the PIN, which can be explained by their overall greater age. This work adds to our growing knowledge of the importance of contextual factors in gene duplicability.

  6. Nuclear scaffold attachment sites within ENCODE regions associate with actively transcribed genes.

    Directory of Open Access Journals (Sweden)

    Mignon A Keaton

    2011-03-01

    Full Text Available The human genome must be packaged and organized in a functional manner for the regulation of DNA replication and transcription. The nuclear scaffold/matrix, consisting of structural and functional nuclear proteins, remains after extraction of nuclei and anchors loops of DNA. In the search for cis-elements functioning as chromatin domain boundaries, we identified 453 nuclear scaffold attachment sites purified by lithium-3,5-iodosalicylate extraction of HeLa nuclei across 30 Mb of the human genome studied by the ENCODE pilot project. The scaffold attachment sites mapped predominately near expressed genes and localized near transcription start sites and the ends of genes but not to boundary elements. In addition, these regions were enriched for RNA polymerase II and transcription factor binding sites and were located in early replicating regions of the genome. We believe these sites correspond to genome-interactions mediated by transcription factors and transcriptional machinery immobilized on a nuclear substructure.

  7. Intonational speech prosody encoding in the human auditory cortex.

    Science.gov (United States)

    Tang, C; Hamilton, L S; Chang, E F

    2017-08-25

    Speakers of all human languages regularly use intonational pitch to convey linguistic meaning, such as to emphasize a particular word. Listeners extract pitch movements from speech and evaluate the shape of intonation contours independent of each speaker's pitch range. We used high-density electrocorticography to record neural population activity directly from the brain surface while participants listened to sentences that varied in intonational pitch contour, phonetic content, and speaker. Cortical activity at single electrodes over the human superior temporal gyrus selectively represented intonation contours. These electrodes were intermixed with, yet functionally distinct from, sites that encoded different information about phonetic features or speaker identity. Furthermore, the representation of intonation contours directly reflected the encoding of speaker-normalized relative pitch but not absolute pitch. Copyright © 2017 The Authors, some rights reserved; exclusive licensee American Association for the Advancement of Science. No claim to original U.S. Government Works.

  8. Cloning of an epoxide hydrolase encoding gene from Rhodotorula mucilaginosa and functional expresion in Yarrowia lipolytica

    CSIR Research Space (South Africa)

    Labuschagne, M

    2007-01-01

    Full Text Available , were used to amplify the genomic EH-encoding gene from Rhodotorula mucilaginosa. The 2347 bp genomic sequence revealed a 1979 bp ORF containing nine introns. The cDNA sequence revealed an 1185 bp EH-encoding gene that translates into a 394 amino acid...

  9. Genome-wide identification of structural variants in genes encoding drug targets

    DEFF Research Database (Denmark)

    Rasmussen, Henrik Berg; Dahmcke, Christina Mackeprang

    2012-01-01

    The objective of the present study was to identify structural variants of drug target-encoding genes on a genome-wide scale. We also aimed at identifying drugs that are potentially amenable for individualization of treatments based on knowledge about structural variation in the genes encoding...

  10. Genome-wide comparative analysis of NBS-encoding genes between Brassica species and Arabidopsis thaliana.

    Science.gov (United States)

    Yu, Jingyin; Tehrim, Sadia; Zhang, Fengqi; Tong, Chaobo; Huang, Junyan; Cheng, Xiaohui; Dong, Caihua; Zhou, Yanqiu; Qin, Rui; Hua, Wei; Liu, Shengyi

    2014-01-03

    Plant disease resistance (R) genes with the nucleotide binding site (NBS) play an important role in offering resistance to pathogens. The availability of complete genome sequences of Brassica oleracea and Brassica rapa provides an important opportunity for researchers to identify and characterize NBS-encoding R genes in Brassica species and to compare with analogues in Arabidopsis thaliana based on a comparative genomics approach. However, little is known about the evolutionary fate of NBS-encoding genes in the Brassica lineage after split from A. thaliana. Here we present genome-wide analysis of NBS-encoding genes in B. oleracea, B. rapa and A. thaliana. Through the employment of HMM search and manual curation, we identified 157, 206 and 167 NBS-encoding genes in B. oleracea, B. rapa and A. thaliana genomes, respectively. Phylogenetic analysis among 3 species classified NBS-encoding genes into 6 subgroups. Tandem duplication and whole genome triplication (WGT) analyses revealed that after WGT of the Brassica ancestor, NBS-encoding homologous gene pairs on triplicated regions in Brassica ancestor were deleted or lost quickly, but NBS-encoding genes in Brassica species experienced species-specific gene amplification by tandem duplication after divergence of B. rapa and B. oleracea. Expression profiling of NBS-encoding orthologous gene pairs indicated the differential expression pattern of retained orthologous gene copies in B. oleracea and B. rapa. Furthermore, evolutionary analysis of CNL type NBS-encoding orthologous gene pairs among 3 species suggested that orthologous genes in B. rapa species have undergone stronger negative selection than those in B .oleracea species. But for TNL type, there are no significant differences in the orthologous gene pairs between the two species. This study is first identification and characterization of NBS-encoding genes in B. rapa and B. oleracea based on whole genome sequences. Through tandem duplication and whole genome

  11. A highly selective CCR2 chemokine agonist encoded by human herpesvirus 6

    DEFF Research Database (Denmark)

    Lüttichau, Hans R; Clark-Lewis, Ian; Jensen, Peter Østrup

    2003-01-01

    The chemokine-like, secreted protein product of the U83 gene from human herpesvirus 6, here named vCCL4, was chemically synthesized to be characterized in a complete library of the 18 known human chemokine receptors expressed individually in stably transfected cell lines. vCCL4 was found to cause...... being equally or more efficacious in causing cell migration than CCL2 and CCL7 and considerably more efficacious than CCL8 and CCL13. It is concluded that human herpesvirus 6 encodes a highly selective and efficacious CCR2 agonist, which will attract CCR2 expressing cells, for example macrophages...

  12. Molecular cloning and functional analysis of the gene encoding ...

    African Journals Online (AJOL)

    Here we report for the first time the cloning of a full-length cDNA encoding GGPPS (Jc-GGPPS) from Jatropha curcas L. The full-length cDNA was 1414 base pair (bp), with an 1110-bp open reading frame (ORF) encoding a 370- amino-acids polypeptide. Bioinformatic analysis revealed that Jc-GGPPS is a member of the ...

  13. Dynamic encoding of speech sequence probability in human temporal cortex.

    Science.gov (United States)

    Leonard, Matthew K; Bouchard, Kristofer E; Tang, Claire; Chang, Edward F

    2015-05-06

    Sensory processing involves identification of stimulus features, but also integration with the surrounding sensory and cognitive context. Previous work in animals and humans has shown fine-scale sensitivity to context in the form of learned knowledge about the statistics of the sensory environment, including relative probabilities of discrete units in a stream of sequential auditory input. These statistics are a defining characteristic of one of the most important sequential signals humans encounter: speech. For speech, extensive exposure to a language tunes listeners to the statistics of sound sequences. To address how speech sequence statistics are neurally encoded, we used high-resolution direct cortical recordings from human lateral superior temporal cortex as subjects listened to words and nonwords with varying transition probabilities between sound segments. In addition to their sensitivity to acoustic features (including contextual features, such as coarticulation), we found that neural responses dynamically encoded the language-level probability of both preceding and upcoming speech sounds. Transition probability first negatively modulated neural responses, followed by positive modulation of neural responses, consistent with coordinated predictive and retrospective recognition processes, respectively. Furthermore, transition probability encoding was different for real English words compared with nonwords, providing evidence for online interactions with high-order linguistic knowledge. These results demonstrate that sensory processing of deeply learned stimuli involves integrating physical stimulus features with their contextual sequential structure. Despite not being consciously aware of phoneme sequence statistics, listeners use this information to process spoken input and to link low-level acoustic representations with linguistic information about word identity and meaning. Copyright © 2015 the authors 0270-6474/15/357203-12$15.00/0.

  14. Human Gene Therapy: Genes without Frontiers?

    Science.gov (United States)

    Simon, Eric J.

    2002-01-01

    Describes the latest advancements and setbacks in human gene therapy to provide reference material for biology teachers to use in their science classes. Focuses on basic concepts such as recombinant DNA technology, and provides examples of human gene therapy such as severe combined immunodeficiency syndrome, familial hypercholesterolemia, and…

  15. The Novel Gene CRNDE Encodes a Nuclear Peptide (CRNDEP Which Is Overexpressed in Highly Proliferating Tissues.

    Directory of Open Access Journals (Sweden)

    Lukasz Michal Szafron

    Full Text Available CRNDE, recently described as the lncRNA-coding gene, is overexpressed at RNA level in human malignancies. Its role in gametogenesis, cellular differentiation and pluripotency has been suggested as well. Herein, we aimed to verify our hypothesis that the CRNDE gene may encode a protein product, CRNDEP. By using bioinformatics methods, we identified the 84-amino acid ORF encoded by one of two CRNDE transcripts, previously described by our research team. This ORF was cloned into two expression vectors, subsequently utilized in localization studies in HeLa cells. We also developed a polyclonal antibody against CRNDEP. Its specificity was confirmed in immunohistochemical, cellular localization, Western blot and immunoprecipitation experiments, as well as by showing a statistically significant decrease of endogenous CRNDEP expression in the cells with transient shRNA-mediated knockdown of CRNDE. Endogenous CRNDEP localizes predominantly to the nucleus and its expression seems to be elevated in highly proliferating tissues, like the parabasal layer of the squamous epithelium, intestinal crypts or spermatocytes. After its artificial overexpression in HeLa cells, in a fusion with either the EGFP or DsRed Monomer fluorescent tag, CRNDEP seems to stimulate the formation of stress granules and localize to them. Although the exact role of CRNDEP is unknown, our preliminary results suggest that it may be involved in the regulation of the cell proliferation. Possibly, CRNDEP also participates in oxygen metabolism, considering our in silico results, and the correlation between its enforced overexpression and the formation of stress granules. This is the first report showing the existence of a peptide encoded by the CRNDE gene.

  16. Encoding model of temporal processing in human visual cortex.

    Science.gov (United States)

    Stigliani, Anthony; Jeska, Brianna; Grill-Spector, Kalanit

    2017-12-19

    How is temporal information processed in human visual cortex? Visual input is relayed to V1 through segregated transient and sustained channels in the retina and lateral geniculate nucleus (LGN). However, there is intense debate as to how sustained and transient temporal channels contribute to visual processing beyond V1. The prevailing view associates transient processing predominately with motion-sensitive regions and sustained processing with ventral stream regions, while the opposing view suggests that both temporal channels contribute to neural processing beyond V1. Using fMRI, we measured cortical responses to time-varying stimuli and then implemented a two temporal channel-encoding model to evaluate the contributions of each channel. Different from the general linear model of fMRI that predicts responses directly from the stimulus, the encoding approach first models neural responses to the stimulus from which fMRI responses are derived. This encoding approach not only predicts cortical responses to time-varying stimuli from milliseconds to seconds but also, reveals differential contributions of temporal channels across visual cortex. Consistent with the prevailing view, motion-sensitive regions and adjacent lateral occipitotemporal regions are dominated by transient responses. However, ventral occipitotemporal regions are driven by both sustained and transient channels, with transient responses exceeding the sustained. These findings propose a rethinking of temporal processing in the ventral stream and suggest that transient processing may contribute to rapid extraction of the content of the visual input. Importantly, our encoding approach has vast implications, because it can be applied with fMRI to decipher neural computations in millisecond resolution in any part of the brain. Copyright © 2017 the Author(s). Published by PNAS.

  17. Structure and chromosomal localization of the human lymphotoxin gene

    International Nuclear Information System (INIS)

    Nedwin, G.E.; Jarrett-Nedwin, J.; Smith, D.H.; Naylor, S.L.; Sakaguchi, A.Y.; Goeddel, D.V.; Gray, P.W.

    1987-01-01

    The authors have isolated, sequenced, and determined the chromosomal localization of the gene encoding human lymphotoxin (LT). The single copy gene was isolated from a human genomic library using a /sup 32/P-labeled 116 bp synthetic DNA fragment whose sequence was based on the NH/sub 2/-terminal amino acid sequence of LT. The gene spans 3 kb of DNA and is interrupted by three intervening sequences. The LT gene is located on human chromosome 6, as determined by Southern blot analysis of human-murine hybrid DNA. Putative transcriptional control regions and areas of homology with the promoters of interferon and other genes are identified

  18. Characterization of the FKBP12-Encoding Genes in Aspergillus fumigatus.

    Directory of Open Access Journals (Sweden)

    Katie Falloon

    Full Text Available Invasive aspergillosis, largely caused by Aspergillus fumigatus, is responsible for a growing number of deaths among immunosuppressed patients. Immunosuppressants such as FK506 (tacrolimus that target calcineurin have shown promise for antifungal drug development. FK506-binding proteins (FKBPs form a complex with calcineurin in the presence of FK506 (FKBP12-FK506 and inhibit calcineurin activity. Research on FKBPs in fungi is limited, and none of the FKBPs have been previously characterized in A. fumigatus. We identified four orthologous genes of FKBP12, the human FK506 binding partner, in A. fumigatus and designated them fkbp12-1, fkbp12-2, fkbp12-3, and fkbp12-4. Deletional analysis of the four genes revealed that the Δfkbp12-1 strain was resistant to FK506, indicating FKBP12-1 as the key mediator of FK506-binding to calcineurin. The endogenously expressed FKBP12-1-EGFP fusion protein localized to the cytoplasm and nuclei under normal growth conditions but also to the hyphal septa following FK506 treatment, revealing its interaction with calcineurin. The FKBP12-1-EGFP fusion protein didn't localize at the septa in the presence of FK506 in the cnaA deletion background, confirming its interaction with calcineurin. Testing of all deletion strains in the Galleria mellonella model of aspergillosis suggested that these proteins don't play an important role in virulence. While the Δfkbp12-2 and Δfkbp12-3 strains didn't show any discernable phenotype, the Δfkbp12-4 strain displayed slight growth defect under normal growth conditions and inhibition of the caspofungin-mediated "paradoxical growth effect" at higher concentrations of the antifungal caspofungin. Together, these results indicate that while only FKBP12-1 is the bona fide binding partner of FK506, leading to the inhibition of calcineurin in A. fumigatus, FKBP12-4 may play a role in basal growth and the caspofungin-mediated paradoxical growth response. Exploitation of differences between A

  19. Characterization of the Aspergillus niger prtT, a unique regulator of extracellular protease encoding genes

    NARCIS (Netherlands)

    Punt, P.J.; Schuren, F.H.J.; Lehmbeck, J.; Christensen, T.; Hjort, C.; Hondel, C.A.M.J.J. van den

    2008-01-01

    Expression of several Aspergillus niger genes encoding major secreted, but not vacuolar, protease genes including the major acid protease gene pepA, was shown to be affected in the previously isolated A. niger protease mutant, AB1.13 [Mattern, I.E., van Noort, J.M., van den Berg, P., Archer, D.A.,

  20. Identification of Genes Encoding the Folate- and Thiamine-Binding Membrane Proteins in Firmicutes

    NARCIS (Netherlands)

    Eudes, Aymerick; Erkens, Guus B.; Slotboom, Dirk J.; Rodionov, Dmitry A.; Naponelli, Valeria; Hanson, Andrew D.

    Genes encoding high-affinity folate- and thiamine-binding proteins (FolT, ThiT) were identified in the Lactobacillus casei genome, expressed in Lactococcus lactis, and functionally characterized. Similar genes occur in many Firmicutes, sometimes next to folate or thiamine salvage genes. Most thiT

  1. Effects of deoxycycline induced lentivirus encoding FasL gene on ...

    African Journals Online (AJOL)

    Abstract. Fas/Fas ligand (FasL)-mediated apoptosis plays a critical role in deletion of activated T cells. This study aimed to construct the lentivirus encoding FasL gene induced by deoxycycline and evaluate its effects on apoptosis of Th1 cells. A plasmid expression system encoding FasL was constructed through utilizing the ...

  2. Rapid duplication and loss of nbs-encoding genes in eurosids II

    International Nuclear Information System (INIS)

    Si, W.; Gu, L.; Yang, S.; Zhang, X.; Memon, S.

    2015-01-01

    Eurosids basically evolved from the core Eudicots Rosids. The Rosids consist of two large assemblages, Eurosids I (Fabids) and Eurosids II (Malvids), which belong to the largest group of Angiosperms, comprising of >40,000 and ∼ 15,000 species, respectively. Although the evolutionary patterns of the largest class of disease resistance genes consisting of a nucleotide binding site (NBS) and leucine-rich repeats (LRRs) have been studied in many species, systemic research of NBS-encoding genes has not been performed in different orders of Eurosids II. Here, five Eurosids II species, Gossypium raimondii, Theobroma cacao, Carica papaya, Citrus clementina, and Arabidopsis thaliana, distributing in three orders, were used to gain insights into the evolutionary patterns of the NBS-encoding genes. Our data showed that frequent copy number variations of NBS-encoding genes were found among these species. Phylogenetic tree analysis and the numbers of the NBS-encoding genes in the common ancestor of these species showed that species-specific NBS clades, including multi-copy and single copy numbers are dominant among these genes. However, not a single clade was found with only five copies, which come from all of the five species, respectively, suggesting rapid turn-over with birth and death of the NBS-encoding genes among Eurosids II species. In addition, a strong positive correlation was observed between the Toll/interleukin receptor (TIR)) type NBS-encoding genes and species-specific genes, indicating rapid gene loss and duplication. Whereas, non- TIR type NBS-encoding genes in these five species showed two distinct evolutionary patterns. (author)

  3. The presence of two S-layer-protein-encoding genes is conserved among species related to Lactobacillus acidophilus

    NARCIS (Netherlands)

    Boot, H.J.; Kolen, C.P.A.M.; Pot, B.; Kersters, K.; Pouwels, P.H.

    1996-01-01

    Previously we have shown that the type strain of Lactobacillus acidophilus possesses two S-protein-encoding genes, one of which is silent, on a chromosomal segment of 6 kb. The S-protein-encoding gene in the expression site can be exchanged for the silent S-protein-encoding gene by inversion of this

  4. Gene encoding a deubiquitinating enzyme is mutated in artesunate- and chloroquine-resistant rodent malaria parasites.

    Science.gov (United States)

    Hunt, Paul; Afonso, Ana; Creasey, Alison; Culleton, Richard; Sidhu, Amar Bir Singh; Logan, John; Valderramos, Stephanie G; McNae, Iain; Cheesman, Sandra; do Rosario, Virgilio; Carter, Richard; Fidock, David A; Cravo, Pedro

    2007-07-01

    Artemisinin- and artesunate-resistant Plasmodium chabaudi mutants, AS-ART and AS-ATN, were previously selected from chloroquine-resistant clones AS-30CQ and AS-15CQ respectively. Now, a genetic cross between AS-ART and the artemisinin-sensitive clone AJ has been analysed by Linkage Group Selection. A genetic linkage group on chromosome 2 was selected under artemisinin treatment. Within this locus, we identified two different mutations in a gene encoding a deubiquitinating enzyme. A distinct mutation occurred in each of the clones AS-30CQ and AS-ATN, relative to their respective progenitors in the AS lineage. The mutations occurred independently in different clones under drug selection with chloroquine (high concentration) or artesunate. Each mutation maps to a critical residue in a homologous human deubiquitinating protein structure. Although one mutation could theoretically account for the resistance of AS-ATN to artemisinin derivates, the other cannot account solely for the resistance of AS-ART, relative to the responses of its sensitive progenitor AS-30CQ. Two lines of Plasmodium falciparum with decreased susceptibility to artemisinin were also selected. Their drug-response phenotype was not genetically stable. No mutations in the UBP-1 gene encoding the P. falciparum orthologue of the deubiquitinating enzyme were observed. The possible significance of these mutations in parasite responses to chloroquine or artemisinin is discussed.

  5. A biallelic RFLP of the human. alpha. 2-C4 adrenergic receptor gene (ADRA2RL2) localized on the short arm of chromosome 4 and encoding the putative. alpha. 2B receptor is identified with Bsu 36 L using a 1. 5 kb probe (p ADRA2RL2)

    Energy Technology Data Exchange (ETDEWEB)

    Hoeche, M.R.; Berrettini, W.H. (Clinical Neurogenetics Branch, Bethesda, MD (USA)); Regan, J.W. (Duke Univ. Medical Center, Durham, NC (USA))

    1989-12-11

    A 1.5 kb Eco RI cDNA fragment representing the human alpha2-C4 adrenergic receptor (AR) gene encoding the putative alpha2B-AR, containing approximately 1270 bp of the coding and 240 bp of the 3{prime}flanking region, inserted into pSP65, was used as a probe (p ADRA2RL2). This clone was obtained by screening a human kidney lambda GT10 cDNA library with the 0.95 kb Pst I restriction fragment derived from the coding block of the gene for the human platelet alpha2-AR. Hybridization of human genomic DNA digested with Bsu 36 I identifies a two allele polymorphism with bands at 12 kb and 5.8 kb. 20 unrelated North American caucasian subjects were evaluated with frequencies of: A allele, 0.45; B allele, 0.55, heterozygosity (obs), 0.5. This alpha2-AR gene has been mapped in a separation effort in 59 CEPH reference pedigrees to the tip of the short arm of chromosome 4 just proximal to GB (4p 16.3) reported to be linked to the Huntingston's disease gene. Codominant inheritance was observed in seven families with two and three generations, respectively. The number of meioses scored was 95.

  6. Escherichia coli rpiA gene encoding ribose phosphate isomerase A

    DEFF Research Database (Denmark)

    Hove-Jensen, Bjarne; Maigaard, Marianne

    1993-01-01

    The rpiA gene encoding ribose phosphate isomerase A was cloned from phage 1A2(471) of the Kohara gene library. Subcloning, restriction, and complementation analyses revealed an 1,800-bp SspI-generated DNA fragment that contained the entire control and coding sequences. This DNA fragment was seque......The rpiA gene encoding ribose phosphate isomerase A was cloned from phage 1A2(471) of the Kohara gene library. Subcloning, restriction, and complementation analyses revealed an 1,800-bp SspI-generated DNA fragment that contained the entire control and coding sequences. This DNA fragment...

  7. Molecular quantification of genes encoding for green-fluorescent proteins

    DEFF Research Database (Denmark)

    Felske, A; Vandieken, V; Pauling, B V

    2003-01-01

    A quantitative PCR approach is presented to analyze the amount of recombinant green fluorescent protein (gfp) genes in environmental DNA samples. The quantification assay is a combination of specific PCR amplification and temperature gradient gel electrophoresis (TGGE). Gene quantification...... PCR strategy is a highly specific and sensitive way to monitor recombinant DNA in environments like the efflux of a biotechnological plant....

  8. Genes encoding enzymes of the lignin biosynthesis pathway in Eucalyptus

    Directory of Open Access Journals (Sweden)

    Ricardo Harakava

    2005-01-01

    Full Text Available Eucalyptus ESTs libraries were screened for genes involved in lignin biosynthesis. This search was performed under the perspective of recent revisions on the monolignols biosynthetic pathway. Eucalyptus orthologues of all genes of the phenylpropanoid pathway leading to lignin biosynthesis reported in other plant species were identified. A library made with mRNAs extracted from wood was enriched for genes involved in lignin biosynthesis and allowed to infer the isoforms of each gene family that play a major role in wood lignin formation. Analysis of the wood library suggests that, besides the enzymes of the phenylpropanoids pathway, chitinases, laccases, and dirigent proteins are also important for lignification. Colocalization of several enzymes on the endoplasmic reticulum membrane, as predicted by amino acid sequence analysis, supports the existence of metabolic channeling in the phenylpropanoid pathway. This study establishes a framework for future investigations on gene expression level, protein expression and enzymatic assays, sequence polymorphisms, and genetic engineering.

  9. The neural encoding of guesses in the human brain.

    Science.gov (United States)

    Bode, Stefan; Bogler, Carsten; Soon, Chun Siong; Haynes, John-Dylan

    2012-01-16

    Human perception depends heavily on the quality of sensory information. When objects are hard to see we often believe ourselves to be purely guessing. Here we investigated whether such guesses use brain networks involved in perceptual decision making or independent networks. We used a combination of fMRI and pattern classification to test how visibility affects the signals, which determine choices. We found that decisions regarding clearly visible objects are predicted by signals in sensory brain regions, whereas different regions in parietal cortex became predictive when subjects were shown invisible objects and believed themselves to be purely guessing. This parietal network was highly overlapping with regions, which have previously been shown to encode free decisions. Thus, the brain might use a dedicated network for determining choices when insufficient sensory information is available. Copyright © 2011 Elsevier Inc. All rights reserved.

  10. A highly divergent gene cluster in honey bees encodes a novel silk family.

    Science.gov (United States)

    Sutherland, Tara D; Campbell, Peter M; Weisman, Sarah; Trueman, Holly E; Sriskantha, Alagacone; Wanjura, Wolfgang J; Haritos, Victoria S

    2006-11-01

    The pupal cocoon of the domesticated silk moth Bombyx mori is the best known and most extensively studied insect silk. It is not widely known that Apis mellifera larvae also produce silk. We have used a combination of genomic and proteomic techniques to identify four honey bee fiber genes (AmelFibroin1-4) and two silk-associated genes (AmelSA1 and 2). The four fiber genes are small, comprise a single exon each, and are clustered on a short genomic region where the open reading frames are GC-rich amid low GC intergenic regions. The genes encode similar proteins that are highly helical and predicted to form unusually tight coiled coils. Despite the similarity in size, structure, and composition of the encoded proteins, the genes have low primary sequence identity. We propose that the four fiber genes have arisen from gene duplication events but have subsequently diverged significantly. The silk-associated genes encode proteins likely to act as a glue (AmelSA1) and involved in silk processing (AmelSA2). Although the silks of honey bees and silkmoths both originate in larval labial glands, the silk proteins are completely different in their primary, secondary, and tertiary structures as well as the genomic arrangement of the genes encoding them. This implies independent evolutionary origins for these functionally related proteins.

  11. Ultraconserved regions encoding ncRNAs are altered in human leukemias and carcinomas.

    Science.gov (United States)

    Calin, George A; Liu, Chang-gong; Ferracin, Manuela; Hyslop, Terry; Spizzo, Riccardo; Sevignani, Cinzia; Fabbri, Muller; Cimmino, Amelia; Lee, Eun Joo; Wojcik, Sylwia E; Shimizu, Masayoshi; Tili, Esmerina; Rossi, Simona; Taccioli, Cristian; Pichiorri, Flavia; Liu, Xiuping; Zupo, Simona; Herlea, Vlad; Gramantieri, Laura; Lanza, Giovanni; Alder, Hansjuerg; Rassenti, Laura; Volinia, Stefano; Schmittgen, Thomas D; Kipps, Thomas J; Negrini, Massimo; Croce, Carlo M

    2007-09-01

    Noncoding RNA (ncRNA) transcripts are thought to be involved in human tumorigenesis. We report that a large fraction of genomic ultraconserved regions (UCRs) encode a particular set of ncRNAs whose expression is altered in human cancers. Genome-wide profiling revealed that UCRs have distinct signatures in human leukemias and carcinomas. UCRs are frequently located at fragile sites and genomic regions involved in cancers. We identified certain UCRs whose expression may be regulated by microRNAs abnormally expressed in human chronic lymphocytic leukemia, and we proved that the inhibition of an overexpressed UCR induces apoptosis in colon cancer cells. Our findings argue that ncRNAs and interaction between noncoding genes are involved in tumorigenesis to a greater extent than previously thought.

  12. Isolation and characterization of a gene encoding a polyethylene ...

    Indian Academy of Sciences (India)

    Prakash

    Environmental stresses such as drought, cold and salinity have an enormous ... mechanisms is that a gene must be inducible in response to an external threat, to ..... of CPs known in plants. The others are legumain (C13), calcium-dependent.

  13. Nucleotide sequence of the Agrobacterium tumefaciens octopine Ti plasmid-encoded tmr gene

    NARCIS (Netherlands)

    Heidekamp, F.; Dirkse, W.G.; Hille, J.; Ormondt, H. van

    1983-01-01

    The nucleotide sequence of the tmr gene, encoded by the octopine Ti plasmid from Agrobacterium tumefaciens (pTiAch5), was determined. The T-DNA, which encompasses this gene, is involved in tumor formation and maintenance, and probably mediates the cytokinin-independent growth of transformed plant

  14. The Schizosaccharomyces pombe mam1 gene encodes an ABC transporter mediating secretion of M-factor

    DEFF Research Database (Denmark)

    Christensen, P U; Davey, William John; Nielsen, O

    1997-01-01

    In the fission yeast Schizosaccharomyces pombe, cells of opposite mating type communicate via diffusible peptide pheromones prior to mating. We have cloned the S. pombe mam1 gene, which encodes a 1336-amino acid protein belonging to the ATP-binding cassette (ABC) superfamily. The mam1 gene is onl...

  15. The mitochondrial gene encoding ribosomal protein S12 has been translocated to the nuclear genome in Oenothera.

    Science.gov (United States)

    Grohmann, L; Brennicke, A; Schuster, W

    1992-01-01

    The Oenothera mitochondrial genome contains only a gene fragment for ribosomal protein S12 (rps12), while other plants encode a functional gene in the mitochondrion. The complete Oenothera rps12 gene is located in the nucleus. The transit sequence necessary to target this protein to the mitochondrion is encoded by a 5'-extension of the open reading frame. Comparison of the amino acid sequence encoded by the nuclear gene with the polypeptides encoded by edited mitochondrial cDNA and genomic sequences of other plants suggests that gene transfer between mitochondrion and nucleus started from edited mitochondrial RNA molecules. Mechanisms and requirements of gene transfer and activation are discussed. Images PMID:1454526

  16. Comparative metagenomic analysis of plasmid encoded functions in the human gut microbiome

    Directory of Open Access Journals (Sweden)

    Marchesi Julian R

    2010-01-01

    Full Text Available Abstract Background Little is known regarding the pool of mobile genetic elements associated with the human gut microbiome. In this study we employed the culture independent TRACA system to isolate novel plasmids from the human gut microbiota, and a comparative metagenomic analysis to investigate the distribution and relative abundance of functions encoded by these plasmids in the human gut microbiome. Results Novel plasmids were acquired from the human gut microbiome, and homologous nucleotide sequences with high identity (>90% to two plasmids (pTRACA10 and pTRACA22 were identified in the multiple human gut microbiomes analysed here. However, no homologous nucleotide sequences to these plasmids were identified in the murine gut or environmental metagenomes. Functions encoded by the plasmids pTRACA10 and pTRACA22 were found to be more prevalent in the human gut microbiome when compared to microbial communities from other environments. Among the most prevalent functions identified was a putative RelBE toxin-antitoxin (TA addiction module, and subsequent analysis revealed that this was most closely related to putative TA modules from gut associated bacteria belonging to the Firmicutes. A broad phylogenetic distribution of RelE toxin genes was observed in gut associated bacterial species (Firmicutes, Bacteroidetes, Actinobacteria and Proteobacteria, but no RelE homologues were identified in gut associated archaeal species. We also provide indirect evidence for the horizontal transfer of these genes between bacterial species belonging to disparate phylogenetic divisions, namely Gram negative Proteobacteria and Gram positive species from the Firmicutes division. Conclusions The application of a culture independent system to capture novel plasmids from the human gut mobile metagenome, coupled with subsequent comparative metagenomic analysis, highlighted the unexpected prevalence of plasmid encoded functions in the gut microbial ecosystem. In

  17. Identification and characterization of the genes encoding the core histones and histone variants of Neurospora crassa.

    OpenAIRE

    Hays, Shan M; Swanson, Johanna; Selker, Eric U

    2002-01-01

    We have identified and characterized the complete complement of genes encoding the core histones of Neurospora crassa. In addition to the previously identified pair of genes that encode histones H3 and H4 (hH3 and hH4-1), we identified a second histone H4 gene (hH4-2), a divergently transcribed pair of genes that encode H2A and H2B (hH2A and hH2B), a homolog of the F/Z family of H2A variants (hH2Az), a homolog of the H3 variant CSE4 from Saccharomyces cerevisiae (hH3v), and a highly diverged ...

  18. Escherichia coli yjjPB genes encode a succinate transporter important for succinate production.

    Science.gov (United States)

    Fukui, Keita; Nanatani, Kei; Hara, Yoshihiko; Yamakami, Suguru; Yahagi, Daiki; Chinen, Akito; Tokura, Mitsunori; Abe, Keietsu

    2017-09-01

    Under anaerobic conditions, Escherichia coli produces succinate from glucose via the reductive tricarboxylic acid cycle. To date, however, no genes encoding succinate exporters have been established in E. coli. Therefore, we attempted to identify genes encoding succinate exporters by screening an E. coli MG1655 genome library. We identified the yjjPB genes as candidates encoding a succinate transporter, which enhanced succinate production in Pantoea ananatis under aerobic conditions. A complementation assay conducted in Corynebacterium glutamicum strain AJ110655ΔsucE1 demonstrated that both YjjP and YjjB are required for the restoration of succinate production. Furthermore, deletion of yjjPB decreased succinate production in E. coli by 70% under anaerobic conditions. Taken together, these results suggest that YjjPB constitutes a succinate transporter in E. coli and that the products of both genes are required for succinate export.

  19. Molecular comparison of the structural proteins encoding gene clusters of two related Lactobacillus delbrueckii bacteriophages.

    Science.gov (United States)

    Vasala, A; Dupont, L; Baumann, M; Ritzenthaler, P; Alatossava, T

    1993-01-01

    Virulent phage LL-H and temperate phage mv4 are two related bacteriophages of Lactobacillus delbrueckii. The gene clusters encoding structural proteins of these two phages have been sequenced and further analyzed. Six open reading frames (ORF-1 to ORF-6) were detected. Protein sequencing and Western immunoblotting experiments confirmed that ORF-3 (g34) encoded the main capsid protein Gp34. The presence of a putative late promoter in front of the phage LL-H g34 gene was suggested by primer extension experiments. Comparative sequence analysis between phage LL-H and phage mv4 revealed striking similarities in the structure and organization of this gene cluster, suggesting that the genes encoding phage structural proteins belong to a highly conservative module. Images PMID:8497043

  20. Motif analysis unveils the possible co-regulation of chloroplast genes and nuclear genes encoding chloroplast proteins.

    Science.gov (United States)

    Wang, Ying; Ding, Jun; Daniell, Henry; Hu, Haiyan; Li, Xiaoman

    2012-09-01

    Chloroplasts play critical roles in land plant cells. Despite their importance and the availability of at least 200 sequenced chloroplast genomes, the number of known DNA regulatory sequences in chloroplast genomes are limited. In this paper, we designed computational methods to systematically study putative DNA regulatory sequences in intergenic regions near chloroplast genes in seven plant species and in promoter sequences of nuclear genes in Arabidopsis and rice. We found that -35/-10 elements alone cannot explain the transcriptional regulation of chloroplast genes. We also concluded that there are unlikely motifs shared by intergenic sequences of most of chloroplast genes, indicating that these genes are regulated differently. Finally and surprisingly, we found five conserved motifs, each of which occurs in no more than six chloroplast intergenic sequences, are significantly shared by promoters of nuclear-genes encoding chloroplast proteins. By integrating information from gene function annotation, protein subcellular localization analyses, protein-protein interaction data, and gene expression data, we further showed support of the functionality of these conserved motifs. Our study implies the existence of unknown nuclear-encoded transcription factors that regulate both chloroplast genes and nuclear genes encoding chloroplast protein, which sheds light on the understanding of the transcriptional regulation of chloroplast genes.

  1. Molecular characterization of rpoB gene encoding the RNA ...

    African Journals Online (AJOL)

    Polymerase chain reaction (PCR) mediated direct DNA sequencing was evaluated for rapid detection of Rifampicin resistance (RMPr) of Mycobacterium tuberculosis. After amplification of the rpoB gene, the product was sequenced using ABI 310 Genetic Analyzer and the rifampicin resistance in M. tuberculosis were ...

  2. Gene encoding virulence markers among Escherichia coli isolates ...

    African Journals Online (AJOL)

    River water sources and diarrhoeic stools of residents in the Venda Region, Limpopo Province of South Africa were analysed for the prevalence of Escherichia coli (E. coli) and the presence of virulence genes among the isolates. A control group of 100 nondiarrhoeic stool samples was included. Escherichia coli was ...

  3. Cloning and heterologous expression of a gene encoding lycopene ...

    African Journals Online (AJOL)

    This report describes the cloning and expression of a gene lycopene epsilon cyclase, (LCYE) from Camellia sinensis var assamica which is a precursor of the carotenoid lutein in tea. The 1982 bp cDNA sequence with 1599 bp open reading frame of LCYE was identified from an SSH library constructed for quality trait in tea.

  4. Molecular cloning and characterization of a gene encoding RING ...

    Indian Academy of Sciences (India)

    PRAKASH KUMAR G

    such as BRCA1 (a product of a breast cancer-associated gene) and Cb1 ... research has indicated that ubiquitination mediated by the ... environment and is unique to China. Since it is ..... benefit the normal biological function of the plant. We.

  5. A Gene Implicated in Activation of Retinoic Acid Receptor Targets Is a Novel Renal Agenesis Gene in Humans

    DEFF Research Database (Denmark)

    Brophy, Patrick D.; Rasmussen, Maria; Parida, Mrutyunjaya

    2017-01-01

    investigations have identified several gene variants that cause RA, including EYA1, LHX1, and WT1 However, whereas compound null mutations of genes encoding α and γ retinoic acid receptors (RARs) cause RA in mice, to date there have been no reports of variants in RAR genes causing RA in humans. In this study, we...... in humans....

  6. Frequency and significance of the novel single nucleotide missense polymorphism Val109Asp in the human gene encoding omentin in Caucasian patients with type 2 diabetes mellitus or chronic inflammatory bowel diseases

    Directory of Open Access Journals (Sweden)

    Buechler Christa

    2007-02-01

    Full Text Available Background The omental adipose tissue is pathogenetically involved in both type 2 diabetes mellitus (T2D and chronic inflammatory bowel diseases (IBD such as Ulcerative colitis (UC and Crohn's Disease (CD. Thus, adipokines secreted from omental adipose tissue might play an important role in these diseases. Omentin represents a new adipokine expressed in and secreted by omental adipose tissue. Therefore, it was the aim to investigate the putative role of a newly described sequence missense variation in the human omentin gene. Methods The Val109Asp single nucleotide miss-sense polymorphism and the His86His polymorphism in exon-4 of the omentin gene were newly identified by random sequencing. Only the miss-sense polymorphism was investigated further. Genotyping was performed by restriction fragment length polymorphism (RFLP analysis of amplified DNA fragments. Three different cohorts of well-characterized individuals were included in the study. 114 patients suffering from T2D, 190 patients suffering from IBD (128 with CD and 62 with UC and 276 non-diabetic healthy controls without any history for IBD were analyzed. Results The following allelic frequencies were determined: controls: Val-allele: 0.26, Asp-allele: 0.74; T2D: Val-allele: 0.3, Asp-allele: 0.7; IBD: Val-allel: 0.31, Asp-allele: 0.69. UC and CD patients did not differ in regard to the allelic frequency. Similarly, controls, T2D patients and IBD patients did not show significant differences in genotype distribution among each other. Disease manifestation and pattern of infestation were not related to genotype subgroups, neither in CD nor in UC. Furthermore, there was no significant association between genotype subgroups and anthropometric or laboratory parameters in T2D patients. Conclusion Based on sequence comparisons and homology searches, the amino acid position 109 is conserved in the omentin gene of humans, mice and chimpanzee but is not completely conserved between other omentin

  7. OVER-EXPRESSION OF GENE ENCODING FATTY ACID METABOLIC ENZYMES IN FISH

    Directory of Open Access Journals (Sweden)

    Alimuddin Alimuddin

    2008-12-01

    Full Text Available Eicosapentaenoic acid (EPA, 20:5n-3 and docosahexaenoic acid (DHA, 22:6n-3 have important nutritional benefits in humans. EPA and DHA are mainly derived from fish, but the decline in the stocks of major marine capture fishes could result in these fatty acids being consumed less. Farmed fish could serve as promising sources of EPA and DHA, but they need these fatty acids in their diets. Generation of fish strains that are capable of synthesizing enough amounts of EPA/DHA from the conversion of α-linolenic acid (LNA, 18:3n-3 rich oils can supply a new EPA/DHA source. This may be achieved by over-expression of genes encoding enzymes involved in HUFA biosynthesis. In aquaculture, the successful of this technique would open the possibility to reduce the enrichment of live food with fish oils for marine fish larvae, and to completely substitute fish oils with plant oils without reducing the quality of flesh in terms of EPA and DHA contents. Here, three genes, i.e. Δ6-desaturase-like (OmΔ6FAD, Δ5-desaturase-like (OmΔ5FAD and elongase-like (MELO encoding EPA/DHA metabolic enzymes derived from masu salmon (Oncorhynchus masou were individually transferred into zebrafish (Danio rerio as a model to increase its ability for synthesizing EPA and DHA. Fatty acid analysis showed that EPA content in whole body of the second transgenic fish generation over-expressing OmΔ6FAD gene was 1.4 fold and that of DHA was 2.1 fold higher (P<0.05 than those in non-transgenic fish. The EPA content in whole body of transgenic fish over-expressing OmΔ5FAD gene was 1.21-fold, and that of DHA was 1.24-fold higher (P<0.05 than those in nontransgenic fish. The same patterns were obtained in transgenic fish over-expressing MELO gene. EPA content was increased by 1.30-fold and DHA content by 1.33-fold higher (P<0.05 than those in non-transgenic fish. The results of studies demonstrated that fatty acid content of fish can be enhanced by over

  8. Comparative differential gene expression analysis of nucleus-encoded proteins for Rafflesia cantleyi against Arabidopsis thaliana

    Science.gov (United States)

    Ng, Siuk-Mun; Lee, Xin-Wei; Wan, Kiew-Lian; Firdaus-Raih, Mohd

    2015-09-01

    Regulation of functional nucleus-encoded proteins targeting the plastidial functions was comparatively studied for a plant parasite, Rafflesia cantleyi versus a photosynthetic plant, Arabidopsis thaliana. This study involved two species of different feeding modes and different developmental stages. A total of 30 nucleus-encoded proteins were found to be differentially-regulated during two stages in the parasite; whereas 17 nucleus-encoded proteins were differentially-expressed during two developmental stages in Arabidopsis thaliana. One notable finding observed for the two plants was the identification of genes involved in the regulation of photosynthesis-related processes where these processes, as expected, seem to be present only in the autotroph.

  9. Smoking, genes encoding dopamine pathway and risk for Parkinson's disease.

    Science.gov (United States)

    Gu, Zhuqin; Feng, Xiuli; Dong, Xiumin; Chan, Piu

    2010-09-20

    Smoking has been reported to be inversely associated with Parkinson's disease (PD) in many studies, but a recent study in China found that smoking increased the risk of PD. Variants in genes associated with dopamine metabolism found to increase the risk for PD have also been associated with smoking behavior. To investigate the association between smoking and PD in a Chinese population and determine whether the genetic variants of genes involved in dopamine metabolism influence the relationship between smoking and risk for PD. Chinese PD patients were recruited from Xuanwu Hospital. Controls were sampled from community. Detailed information on life-long smoking behavior was collected by face-to-face interview. Genotypes were determined for SLC6A3 VNTR, COMT Val108/158Met and MAO-B intron13 A/G polymorphisms by PCR-RFLP, DHPLC and sequencing. Chi-square and logistic regression model were used in the analysis. 176 PD cases and 354 controls were enrolled in this study. 23.9% cases are smokers, compared to 48.0% in controls. Ever smoking is inversely associated with PD (odds ratio=0.14, 95% CI 0.08-0.26, adjusted for age and gender). None of the above-mentioned genetic polymorphisms was associated with PD risk or smoking. When each variant was included in the logistic regression model, the inverse association between smoking and PD remained the same, and the interactions between smoking and variants were not significant in the model. Our data support a reduction of PD risk associated with smoking in a Chinese population. These variants of genes associated with DA uptake and metabolism do not affect the inverse association between smoking and PD. Copyright 2010 Elsevier Ireland Ltd. All rights reserved.

  10. Encoding of marginal utility across time in the human brain.

    Science.gov (United States)

    Pine, Alex; Seymour, Ben; Roiser, Jonathan P; Bossaerts, Peter; Friston, Karl J; Curran, H Valerie; Dolan, Raymond J

    2009-07-29

    Marginal utility theory prescribes the relationship between the objective property of the magnitude of rewards and their subjective value. Despite its pervasive influence, however, there is remarkably little direct empirical evidence for such a theory of value, let alone of its neurobiological basis. We show that human preferences in an intertemporal choice task are best described by a model that integrates marginally diminishing utility with temporal discounting. Using functional magnetic resonance imaging, we show that activity in the dorsal striatum encodes both the marginal utility of rewards, over and above that which can be described by their magnitude alone, and the discounting associated with increasing time. In addition, our data show that dorsal striatum may be involved in integrating subjective valuation systems inherent to time and magnitude, thereby providing an overall metric of value used to guide choice behavior. Furthermore, during choice, we show that anterior cingulate activity correlates with the degree of difficulty associated with dissonance between value and time. Our data support an integrative architecture for decision making, revealing the neural representation of distinct subcomponents of value that may contribute to impulsivity and decisiveness.

  11. Staphylococcus aureus nasal carriage in Ukraine: antibacterial resistance and virulence factor encoding genes.

    Science.gov (United States)

    Netsvyetayeva, Irina; Fraczek, Mariusz; Piskorska, Katarzyna; Golas, Marlena; Sikora, Magdalena; Mlynarczyk, Andrzej; Swoboda-Kopec, Ewa; Marusza, Wojciech; Palmieri, Beniamino; Iannitti, Tommaso

    2014-03-05

    The number of studies regarding the incidence of multidrug resistant strains and distribution of genes encoding virulence factors, which have colonized the post-Soviet states, is considerably limited. The aim of the study was (1) to assess the Staphylococcus (S.) aureus nasal carriage rate, including Methicillin Resistant S. aureus (MRSA) strains in adult Ukrainian population, (2) to determine antibiotic resistant pattern and (3) the occurrence of Panton Valentine Leukocidine (PVL)-, Fibronectin-Binding Protein A (FnBPA)- and Exfoliative Toxin (ET)-encoding genes. Nasal samples for S. aureus culture were obtained from 245 adults. The susceptibility pattern for several classes of antibiotics was determined by disk diffusion method according to the European Committee on Antimicrobial Susceptibility Testing (EUCAST) guidelines. The virulence factor encoding genes, mecA, lukS-lukF, eta, etb, etd, fnbA, were detected by Polymerase Chain Reaction (PCR). The S. aureus nasal carriage rate was 40%. The prevalence of nasal MRSA carriage in adults was 3.7%. LukS-lukF genes were detected in over 58% of the strains. ET-encoding genes were detected in over 39% of the strains and the most prevalent was etd. The fnbA gene was detected in over 59% of the strains. All MRSA isolates tested were positive for the mecA gene. LukS-lukF genes and the etd gene were commonly co-present in MRSA, while lukS-lukF genes and the fnbA gene were commonly co-present in Methicillin Sensitive S. aureus (MSSA) isolates. No significant difference was detected between the occurrence of lukS-lukF genes (P > 0.05) and the etd gene (P > 0.05) when comparing MRSA and MSSA. The occurrence of the fnbA gene was significantly more frequent in MSSA strains (P aureus is a common cause of infection. The prevalence of S. aureus nasal carriage in our cohort of patients from Ukraine was 40.4%. We found that 9.1% of the strains were classified as MRSA and all MRSA isolates tested positive for the mecA gene

  12. Multiple genes encode the major surface glycoprotein of Pneumocystis carinii

    DEFF Research Database (Denmark)

    Kovacs, J A; Powell, F; Edman, J C

    1993-01-01

    The major surface antigen of Pneumocystis carinii, a life-threatening opportunistic pathogen in human immunodeficiency virus-infected patients, is an abundant glycoprotein that functions in host-organism interactions. A monoclonal antibody to this antigen is protective in animals, and thus this a...

  13. A neurotransmitter transporter encoded by the Drosophila inebriated gene

    Science.gov (United States)

    Soehnge, Holly; Huang, Xi; Becker, Marie; Whitley, Penn; Conover, Diana; Stern, Michael

    1996-01-01

    Behavioral and electrophysiological studies on mutants defective in the Drosophila inebriated (ine) gene demonstrated increased excitability of the motor neuron. In this paper, we describe the cloning and sequence analysis of ine. Mutations in ine were localized on cloned DNA by restriction mapping and restriction fragment length polymorphism (RFLP) mapping of ine mutants. DNA from the ine region was then used to isolate an ine cDNA. In situ hybridization of ine transcripts to developing embryos revealed expression of this gene in several cell types, including the posterior hindgut, Malpighian tubules, anal plate, garland cells, and a subset of cells in the central nervous system. The ine cDNA contains an open reading frame of 658 amino acids with a high degree of sequence similarity to members of the Na+/Cl−-dependent neurotransmitter transporter family. Members of this family catalyze the rapid reuptake of neurotransmitters released into the synapse and thereby play key roles in controlling neuronal function. We conclude that ine mutations cause increased excitability of the Drosophila motor neuron by causing the defective reuptake of the substrate neurotransmitter of the ine transporter and thus overstimulation of the motor neuron by this neurotransmitter. From this observation comes a unique opportunity to perform a genetic dissection of the regulation of excitability of the Drosophila motor neuron. PMID:8917579

  14. Co-expression of an Erwinia chrysanthemi pectate lyase-encoding gene (pelE) and an E. carotovora polygalacturonase-encoding gene (peh1) in Saccharomyces cerevisiae.

    Science.gov (United States)

    Laing, E; Pretorius, I S

    1993-05-01

    A pectate lyase (PL)-encoding gene (pelE) from Erwinia chrysanthemi and a polygalacturonase (PG)-encoding gene (peh1) from E. carotovora were each inserted between a novel yeast expression-secretion cassette and a yeast gene terminator, and cloned separately into a yeast-centromeric shuttle vector (YCp50), generating recombinant plasmids pAMS12 and pAMS13. Transcription initiation signals present in the expression-secretion cassette were derived from the yeast alcohol dehydrogenase gene promoter (ADC1P), whereas the transcription termination signals were derived from the yeast tryptophan synthase gene terminator (TRP5T). Secretion of PL and PG was directed by the signal sequence of the yeast mating pheromone alpha-factor (MF alpha 1s). A pectinase cassette comprising ADC1P-MF alpha 1s-pelE-TRP5T and ADC1P-MF alpha 1s-peh1-TRP5T was subcloned into YCp50, generating plasmid pAMS14. Subsequently, the dominant selectable Geneticin G418-resistance (GtR) marker, APH1, inserted between the yeast uridine diphosphoglucose 4-epimerase gene promoter (GAL10P) and yeast orotidine-5'-phosphate carboxylase gene terminator (URA3T), was cloned into pAMS14, resulting in plasmid pAMS15. Plasmids pAMS12, pAMS13 and pAMS14 were transformed into a laboratory strain of Saccharomyces cerevisiae, whereas pAMS15 was stably introduced into two commercial wine yeast strains. DNA-DNA and DNA-RNA hybridization analyses revealed the presence of these plasmids, and the pelE and peh1 transcripts in the yeast transformants, respectively. A polypectate agarose assay indicated the extracellular production of biologically active PL and PG by the S. cerevisiae transformants and confirmed that co-expression of the pelE and peh1 genes synergistically enhanced pectate degradation.

  15. Molecular evolution of the Paramyxoviridae and Rhabdoviridae multiple-protein-encoding P gene.

    Science.gov (United States)

    Jordan, I K; Sutter, B A; McClure, M A

    2000-01-01

    Presented here is an analysis of the molecular evolutionary dynamics of the P gene among 76 representative sequences of the Paramyxoviridae and Rhabdoviridae RNA virus families. In a number of Paramyxoviridae taxa, as well as in vesicular stomatitis viruses of the Rhabdoviridae, the P gene encodes multiple proteins from a single genomic RNA sequence. These products include the phosphoprotein (P), as well as the C and V proteins. The complexity of the P gene makes it an intriguing locus to study from an evolutionary perspective. Amino acid sequence alignments of the proteins encoded at the P and N loci were used in independent phylogenetic reconstructions of the Paramyxoviridae and Rhabdoviridae families. P-gene-coding capacities were mapped onto the Paramyxoviridae phylogeny, and the most parsimonious path of multiple-coding-capacity evolution was determined. Levels of amino acid variation for Paramyxoviridae and Rhabdoviridae P-gene-encoded products were also analyzed. Proteins encoded in overlapping reading frames from the same nucleotides have different levels of amino acid variation. The nucleotide architecture that underlies the amino acid variation was determined in order to evaluate the role of selection in the evolution of the P gene overlapping reading frames. In every case, the evolution of one of the proteins encoded in the overlapping reading frames has been constrained by negative selection while the other has evolved more rapidly. The integrity of the overlapping reading frame that represents a derived state is generally maintained at the expense of the ancestral reading frame encoded by the same nucleotides. The evolution of such multicoding sequences is likely a response by RNA viruses to selective pressure to maximize genomic information content while maintaining small genome size. The ability to evolve such a complex genomic strategy is intimately related to the dynamics of the viral quasispecies, which allow enhanced exploration of the adaptive

  16. Cellulolytic (cel) genes of Clostridium thermocellum F7 and the proteins encoded by them

    International Nuclear Information System (INIS)

    Piruzyan, E.S.; Mogutov, M.A.; Velikodvorskaya, G.A.; Pushkarskaya, T.A.

    1988-01-01

    This study is concerned with genes cell, ce12, and ce13 encoding the endoglucanase of the cellulolytic complex of the anaerobic thermophilic Clostridium thermocellum F7 bacteria, these genes having been closed by us earlier. The authors present the characteristics of proteins synthesized by the cel genes in the minicell system of the strain Escherichia coli K-12 X925. The molecular weights of the proteins encoded by genes cell, ce12, and ce13 are 30,000, 45,000, and 50,000 dalton, respectively. The study of the homology of the cloned section of the C. thermocellum DNA containing the endoglucanase genes, using Southern's blot-hybridization method, did not reveal their physical linkage in the genome. The authors detected a plasmid with a size of about 30 kb in the cells of the C. thermocellum F7 strain investigated

  17. A conserved gene family encodes transmembrane proteins with fibronectin, immunoglobulin and leucine-rich repeat domains (FIGLER

    Directory of Open Access Journals (Sweden)

    Haga Christopher L

    2007-09-01

    Full Text Available Abstract Background In mouse the cytokine interleukin-7 (IL-7 is required for generation of B lymphocytes, but human IL-7 does not appear to have this function. A bioinformatics approach was therefore used to identify IL-7 receptor related genes in the hope of identifying the elusive human cytokine. Results Our database search identified a family of nine gene candidates, which we have provisionally named fibronectin immunoglobulin leucine-rich repeat (FIGLER. The FIGLER 1–9 genes are predicted to encode type I transmembrane glycoproteins with 6–12 leucine-rich repeats (LRR, a C2 type Ig domain, a fibronectin type III domain, a hydrophobic transmembrane domain, and a cytoplasmic domain containing one to four tyrosine residues. Members of this multichromosomal gene family possess 20–47% overall amino acid identity and are differentially expressed in cell lines and primary hematopoietic lineage cells. Genes for FIGLER homologs were identified in macaque, orangutan, chimpanzee, mouse, rat, dog, chicken, toad, and puffer fish databases. The non-human FIGLER homologs share 38–99% overall amino acid identity with their human counterpart. Conclusion The extracellular domain structure and absence of recognizable cytoplasmic signaling motifs in members of the highly conserved FIGLER gene family suggest a trophic or cell adhesion function for these molecules.

  18. The euryhaline yeast Debaryomyces hansenii has two catalase genes encoding enzymes with differential activity profile.

    Science.gov (United States)

    Segal-Kischinevzky, Claudia; Rodarte-Murguía, Beatriz; Valdés-López, Victor; Mendoza-Hernández, Guillermo; González, Alicia; Alba-Lois, Luisa

    2011-03-01

    Debaryomyces hansenii is a spoilage yeast able to grow in a variety of ecological niches, from seawater to dairy products. Results presented in this article show that (i) D. hansenii has an inherent resistance to H2O2 which could be attributed to the fact that this yeast has a basal catalase activity which is several-fold higher than that observed in Saccharomyces cerevisiae under the same culture conditions, (ii) D. hansenii has two genes (DhCTA1 and DhCTT1) encoding two catalase isozymes with a differential enzymatic activity profile which is not strictly correlated with a differential expression profile of the encoding genes.

  19. Genes encoding calmodulin-binding proteins in the Arabidopsis genome

    Science.gov (United States)

    Reddy, Vaka S.; Ali, Gul S.; Reddy, Anireddy S N.

    2002-01-01

    Analysis of the recently completed Arabidopsis genome sequence indicates that approximately 31% of the predicted genes could not be assigned to functional categories, as they do not show any sequence similarity with proteins of known function from other organisms. Calmodulin (CaM), a ubiquitous and multifunctional Ca(2+) sensor, interacts with a wide variety of cellular proteins and modulates their activity/function in regulating diverse cellular processes. However, the primary amino acid sequence of the CaM-binding domain in different CaM-binding proteins (CBPs) is not conserved. One way to identify most of the CBPs in the Arabidopsis genome is by protein-protein interaction-based screening of expression libraries with CaM. Here, using a mixture of radiolabeled CaM isoforms from Arabidopsis, we screened several expression libraries prepared from flower meristem, seedlings, or tissues treated with hormones, an elicitor, or a pathogen. Sequence analysis of 77 positive clones that interact with CaM in a Ca(2+)-dependent manner revealed 20 CBPs, including 14 previously unknown CBPs. In addition, by searching the Arabidopsis genome sequence with the newly identified and known plant or animal CBPs, we identified a total of 27 CBPs. Among these, 16 CBPs are represented by families with 2-20 members in each family. Gene expression analysis revealed that CBPs and CBP paralogs are expressed differentially. Our data suggest that Arabidopsis has a large number of CBPs including several plant-specific ones. Although CaM is highly conserved between plants and animals, only a few CBPs are common to both plants and animals. Analysis of Arabidopsis CBPs revealed the presence of a variety of interesting domains. Our analyses identified several hypothetical proteins in the Arabidopsis genome as CaM targets, suggesting their involvement in Ca(2+)-mediated signaling networks.

  20. The Expression of Genes Encoding Secreted Proteins in Medicago truncatula A17 Inoculated Roots

    Directory of Open Access Journals (Sweden)

    LUCIA KUSUMAWATI

    2013-09-01

    Full Text Available Subtilisin-like serine protease (MtSBT, serine carboxypeptidase (MtSCP, MtN5, non-specific lipid transfer protein (MtnsLTP, early nodulin2-like protein (MtENOD2-like, FAD-binding domain containing protein (MtFAD-BP1, and rhicadhesin receptor protein (MtRHRE1 were among 34 proteins found in the supernatant of M. truncatula 2HA and sickle cell suspension cultures. This study investigated the expression of genes encoding those proteins in roots and developing nodules. Two methods were used: quantitative real time RT-PCR and gene expression analysis (with promoter:GUS fusion in roots. Those proteins are predicted as secreted proteins which is indirectly supported by the findings that promoter:GUS fusions of six of the seven genes encoding secreted proteins were strongly expressed in the vascular bundle of transgenic hairy roots. All six genes have expressed in 14-day old nodule. The expression levels of the selected seven genes were quantified in Sinorhizobium-inoculated and control plants using quantitative real time RT-PCR. In conclusion, among seven genes encoding secreted proteins analyzed, the expression level of only one gene, MtN5, was up-regulated significantly in inoculated root segments compared to controls. The expression of MtSBT1, MtSCP1, MtnsLTP, MtFAD-BP1, MtRHRE1 and MtN5 were higher in root tip than in other tissues examined.

  1. Identification of a mammalian nuclear factor and human cDNA-encoded proteins that recognize DNA containing apurinic sites

    International Nuclear Information System (INIS)

    Lenz, J.; Okenquist, S.A.; LoSardo, J.E.; Hamilton, K.K.; Doetsch, P.W.

    1990-01-01

    Damage to DNA can have lethal or mutagenic consequences for cells unless it is detected and repaired by cellular proteins. Repair depends on the ability of cellular factors to distinguish the damaged sites. Electrophoretic binding assays were used to identify a factor from the nuclei of mammalian cells that bound to DNA containing apurinic sites. A binding assay based on the use of β-galactosidase fusion proteins was subsequently used to isolate recombinant clones of human cDNAs that encoded apurinic DNA-binding proteins. Two distinct human cDNAs were identified that encoded proteins that bound apurinic DNA preferentially over undamaged, methylated, or UV-irradiated DNA. These approaches may offer a general method for the detection of proteins that recognize various types of DNA damage and for the cloning of genes encoding such proteins

  2. Genes, Environment, and Human Behavior.

    Science.gov (United States)

    Bloom, Mark V.; Cutter, Mary Ann; Davidson, Ronald; Dougherty, Michael J.; Drexler, Edward; Gelernter, Joel; McCullough, Laurence B.; McInerney, Joseph D.; Murray, Jeffrey C.; Vogler, George P.; Zola, John

    This curriculum module explores genes, environment, and human behavior. This book provides materials to teach about the nature and methods of studying human behavior, raise some of the ethical and public policy dilemmas emerging from the Human Genome Project, and provide professional development for teachers. An extensive Teacher Background…

  3. Multi-species sequence comparison reveals conservation of ghrelin gene-derived splice variants encoding a truncated ghrelin peptide.

    Science.gov (United States)

    Seim, Inge; Jeffery, Penny L; Thomas, Patrick B; Walpole, Carina M; Maugham, Michelle; Fung, Jenny N T; Yap, Pei-Yi; O'Keeffe, Angela J; Lai, John; Whiteside, Eliza J; Herington, Adrian C; Chopin, Lisa K

    2016-06-01

    The peptide hormone ghrelin is a potent orexigen produced predominantly in the stomach. It has a number of other biological actions, including roles in appetite stimulation, energy balance, the stimulation of growth hormone release and the regulation of cell proliferation. Recently, several ghrelin gene splice variants have been described. Here, we attempted to identify conserved alternative splicing of the ghrelin gene by cross-species sequence comparisons. We identified a novel human exon 2-deleted variant and provide preliminary evidence that this splice variant and in1-ghrelin encode a C-terminally truncated form of the ghrelin peptide, termed minighrelin. These variants are expressed in humans and mice, demonstrating conservation of alternative splicing spanning 90 million years. Minighrelin appears to have similar actions to full-length ghrelin, as treatment with exogenous minighrelin peptide stimulates appetite and feeding in mice. Forced expression of the exon 2-deleted preproghrelin variant mirrors the effect of the canonical preproghrelin, stimulating cell proliferation and migration in the PC3 prostate cancer cell line. This is the first study to characterise an exon 2-deleted preproghrelin variant and to demonstrate sequence conservation of ghrelin gene-derived splice variants that encode a truncated ghrelin peptide. This adds further impetus for studies into the alternative splicing of the ghrelin gene and the function of novel ghrelin peptides in vertebrates.

  4. Proanthocyanidin synthesis in Theobroma cacao: genes encoding anthocyanidin synthase, anthocyanidin reductase, and leucoanthocyanidin reductase.

    Science.gov (United States)

    Liu, Yi; Shi, Zi; Maximova, Siela; Payne, Mark J; Guiltinan, Mark J

    2013-12-05

    The proanthocyanidins (PAs), a subgroup of flavonoids, accumulate to levels of approximately 10% total dry weight of cacao seeds. PAs have been associated with human health benefits and also play important roles in pest and disease defense throughout the plant. To dissect the genetic basis of PA biosynthetic pathway in cacao (Theobroma cacao), we have isolated three genes encoding key PA synthesis enzymes, anthocyanidin synthase (ANS), anthocyanidin reductase (ANR) and leucoanthocyanidin reductase (LAR). We measured the expression levels of TcANR, TcANS and TcLAR and PA content in cacao leaves, flowers, pod exocarp and seeds. In all tissues examined, all three genes were abundantly expressed and well correlated with PA accumulation levels, suggesting their active roles in PA synthesis. Overexpression of TcANR in an Arabidopsis ban mutant complemented the PA deficient phenotype in seeds and resulted in reduced anthocyanidin levels in hypocotyls. Overexpression of TcANS in tobacco resulted in increased content of both anthocyanidins and PAs in flower petals. Overexpression of TcANS in an Arabidopsis ldox mutant complemented its PA deficient phenotype in seeds. Recombinant TcLAR protein converted leucoanthocyanidin to catechin in vitro. Transgenic tobacco overexpressing TcLAR had decreased amounts of anthocyanidins and increased PAs. Overexpressing TcLAR in Arabidopsis ldox mutant also resulted in elevated synthesis of not only catechin but also epicatechin. Our results confirm the in vivo function of cacao ANS and ANR predicted based on sequence homology to previously characterized enzymes from other species. In addition, our results provide a clear functional analysis of a LAR gene in vivo.

  5. Nucleotide sequences of the genes encoding fructosebisphosphatase and phosphoribulokinase from Xanthobacter flavus H4-14

    NARCIS (Netherlands)

    Meijer, Wilhelmus; Enequist, H.G.; Terpstra, Peter; Dijkhuizen, L.

    The genes encoding fructosebisphosphatase and phosphoribulokinase present on a 2.5 kb SalI fragment from Xanthobacter flavus H4-14 were sequenced. Two large open reading frames (ORFs) were identified, preceded by plausible ribosome-binding sites. The ORFs were transcribed in the same direction and

  6. Cloning and characterization of an epoxide hydrolase-encoding gene from Rhodotorula glutinis

    NARCIS (Netherlands)

    Visser, H.; Vreugdenhil, S.; Bont, de J.A.M.; Verdoes, J.C.

    2000-01-01

    We cloned and characterized the epoxide hydrolase gene, EPH1, from Rhodotorula glutinis. The EPH1 open reading frame of 1230 bp was interrupted by nine introns and encoded a polypeptide of 409 amino acids with a calculated molecular mass of 46.3 kDa. The amino acid sequence was similar to that of

  7. Cloning and expression of clt genes encoding milk-clotting proteases from Myxococcus xanthus 422.

    Science.gov (United States)

    Poza, M; Prieto-Alcedo, M; Sieiro, C; Villa, T G

    2004-10-01

    The screening of a gene library of the milk-clotting strain Myxococcus xanthus 422 constructed in Escherichia coli allowed the description of eight positive clones containing 26 open reading frames. Only three of them (cltA, cltB, and cltC) encoded proteins that exhibited intracellular milk-clotting ability in E. coli, Saccharomyces cerevisiae, and Pichia pastoris expression systems.

  8. Characterization of Genes Encoding Key Enzymes Involved in Anthocyanin Metabolism of Kiwifruit during Storage Period.

    Science.gov (United States)

    Li, Boqiang; Xia, Yongxiu; Wang, Yuying; Qin, Guozheng; Tian, Shiping

    2017-01-01

    'Hongyang' is a red fleshed kiwifruit with high anthocyanin content. In this study, we mainly investigated effects of different temperatures (25 and 0°C) on anthocyanin biosynthesis in harvested kiwifruit, and characterized the genes encoding key enzymes involved in anthocyanin metabolism, as well as evaluated the mode of the action, by which low temperature regulates anthocyanin accumulation in 'Hongyang' kiwifruit during storage period. The results showed that low temperature could effectively enhance the anthocyanin accumulation of kiwifruit in the end of storage period (90 days), which related to the increase in mRNA levels of ANS1, ANS2, DRF1, DRF2 , and UGFT2 . Moreover, the transcript abundance of MYBA1-1 and MYB5-1 , the genes encoding an important component of MYB-bHLH-WD40 (MBW) complex, was up-regulated, possibly contributing to the induction of specific anthocyanin biosynthesis genes under the low temperature. To further investigate the roles of AcMYB5-1/5-2/A1-1 in regulation of anthocyanin biosynthesis, genes encoding the three transcription factors were transiently transformed in Nicotiana benthamiana leaves. Overexpression of AcMYB5-1/5-2/A1-1 activated the gene expression of NtANS and NtDFR in tobacco. Our results suggested that low temperature storage could stimulate the anthocyanin accumulation in harvested kiwifruit via regulating several structural and regulatory genes involved in anthocyanin biosynthesis.

  9. Identification of chitinolytic bacteria isolated from shrimp pond sediment and characterization of their chitinase encoding gene

    Science.gov (United States)

    Triwijayani, A. U.; Puspita, I. D.; Murwantoko; Ustadi

    2018-03-01

    Chitinolytic bacteria are a group of bacteria owning enzymes that able to hydrolyze chitin. Previously, we isolated chitinolytic bacteria from shrimp pond sediment in Bantul, Yogyakarta, and obtained five isolates showing high chitinolytic index named as isolate PT1, PT2, PT5, PT6 and PB2. The aims of this study were to identify chitinolytic bacteria isolated from shrimp pond sediment and to characterize the chitinase encoding gene from each isolate. The molecular technique was performed by amplification of 16S rDNA, amplification of chitinase encoding gene and sequence analysis. Two chitinolytic bacteria of PT1 and PT2 were similar to Aeromonas bivalvium strain D15, PT5 to Pseudomonas stutzeri strain BD-2.2.1, PT6 to Serratia marcescens strain FZSF02 and PB2 to Streptomyces misionensis strain OsiRt-1. The comparison of chitinase encoding gene between three isolates with those in Gen Bank shows that PT1 had similar sequences with the chi1 gene in Aeromonas sp. 17m, PT2 with chi1 gene in A. caviae (CB101) and PT6 with chiB gene in S. Marcescens (BJL200).

  10. Further characterization of a highly attenuated Yersinia pestis CO92 mutant deleted for the genes encoding Braun lipoprotein and plasminogen activator protease in murine alveolar and primary human macrophages.

    Science.gov (United States)

    van Lier, Christina J; Tiner, Bethany L; Chauhan, Sadhana; Motin, Vladimir L; Fitts, Eric C; Huante, Matthew B; Endsley, Janice J; Ponnusamy, Duraisamy; Sha, Jian; Chopra, Ashok K

    2015-03-01

    We recently characterized the Δlpp Δpla double in-frame deletion mutant of Yersinia pestis CO92 molecularly, biologically, and immunologically. While Braun lipoprotein (Lpp) activates toll-like receptor-2 to initiate an inflammatory cascade, plasminogen activator (Pla) protease facilitates bacterial dissemination in the host. The Δlpp Δpla double mutant was highly attenuated in evoking bubonic and pneumonic plague, was rapidly cleared from mouse organs, and generated humoral and cell-mediated immune responses to provide subsequent protection to mice against a lethal challenge dose of wild-type (WT) CO92. Here, we further characterized the Δlpp Δpla double mutant in two murine macrophage cell lines as well as in primary human monocyte-derived macrophages to gauge its potential as a live-attenuated vaccine candidate. We first demonstrated that the Δpla single and the Δlpp Δpla double mutant were unable to survive efficiently in murine and human macrophages, unlike WT CO92. We observed that the levels of Pla and its associated protease activity were not affected in the Δlpp single mutant, and, likewise, deletion of the pla gene from WT CO92 did not alter Lpp levels. Further, our study revealed that both Lpp and Pla contributed to the intracellular survival of WT CO92 via different mechanisms. Importantly, the ability of the Δlpp Δpla double mutant to be phagocytized by macrophages, to stimulate production of tumor necrosis factor-α and interleukin-6, and to activate the nitric oxide killing pathways of the host cells remained unaltered when compared to the WT CO92-infected macrophages. Finally, macrophages infected with either the WT CO92 or the Δlpp Δpla double mutant were equally efficient in their uptake of zymosan particles as determined by flow cytometric analysis. Overall, our data indicated that although the Δlpp Δpla double mutant of Y. pestis CO92 was highly attenuated, it retained the ability to elicit innate and subsequent acquired immune

  11. Gene set of nuclear-encoded mitochondrial regulators is enriched for common inherited variation in obesity.

    Directory of Open Access Journals (Sweden)

    Nadja Knoll

    Full Text Available There are hints of an altered mitochondrial function in obesity. Nuclear-encoded genes are relevant for mitochondrial function (3 gene sets of known relevant pathways: (1 16 nuclear regulators of mitochondrial genes, (2 91 genes for oxidative phosphorylation and (3 966 nuclear-encoded mitochondrial genes. Gene set enrichment analysis (GSEA showed no association with type 2 diabetes mellitus in these gene sets. Here we performed a GSEA for the same gene sets for obesity. Genome wide association study (GWAS data from a case-control approach on 453 extremely obese children and adolescents and 435 lean adult controls were used for GSEA. For independent confirmation, we analyzed 705 obesity GWAS trios (extremely obese child and both biological parents and a population-based GWAS sample (KORA F4, n = 1,743. A meta-analysis was performed on all three samples. In each sample, the distribution of significance levels between the respective gene set and those of all genes was compared using the leading-edge-fraction-comparison test (cut-offs between the 50(th and 95(th percentile of the set of all gene-wise corrected p-values as implemented in the MAGENTA software. In the case-control sample, significant enrichment of associations with obesity was observed above the 50(th percentile for the set of the 16 nuclear regulators of mitochondrial genes (p(GSEA,50 = 0.0103. This finding was not confirmed in the trios (p(GSEA,50 = 0.5991, but in KORA (p(GSEA,50 = 0.0398. The meta-analysis again indicated a trend for enrichment (p(MAGENTA,50 = 0.1052, p(MAGENTA,75 = 0.0251. The GSEA revealed that weak association signals for obesity might be enriched in the gene set of 16 nuclear regulators of mitochondrial genes.

  12. Screening of the Enterocin-Encoding Genes and Antimicrobial Activity in Enterococcus Species.

    Science.gov (United States)

    Ogaki, Mayara Baptistucci; Rocha, Katia Real; Terra, MÁrcia Regina; Furlaneto, MÁrcia Cristina; Maia, Luciana Furlaneto

    2016-06-28

    In the current study, a total of 135 enterococci strains from different sources were screened for the presence of the enterocin-encoding genes entA, entP, entB, entL50A, and entL50B. The enterocin genes were present at different frequencies, with entA occurring the most frequently, followed by entP and entB; entL50A and L50B were not detected. The occurrence of single enterocin genes was higher than the occurrence of multiple enterocin gene combinations. The 80 isolates that harbor at least one enterocin-encoding gene (denoted "Gene(+) strains") were screened for antimicrobial activity. A total of 82.5% of the Gene(+) strains inhibited at least one of the indicator strains, and the isolates harboring multiple enterocin-encoding genes inhibited a larger number of indicator strains than isolates harboring a single gene. The indicator strains that exhibited growth inhibition included Listeria innocua strain CLIP 12612 (ATCC BAA-680), Listeria monocytogenes strain CDC 4555, Enterococcus faecalis ATCC 29212, Staphylococcus aureus ATCC 25923, S. aureus ATCC 29213, S. aureus ATCC 6538, Salmonella enteritidis ATCC 13076, Salmonella typhimurium strain UK-1 (ATCC 68169), and Escherichia coli BAC 49LT ETEC. Inhibition due to either bacteriophage lysis or cytolysin activity was excluded. The growth inhibition of antilisterial Gene+ strains was further tested under different culture conditions. Among the culture media formulations, the MRS agar medium supplemented with 2% (w/v) yeast extract was the best solidified medium for enterocin production. Our findings extend the current knowledge of enterocin-producing enterococci, which may have potential applications as biopreservatives in the food industry due to their capability of controlling food spoilage pathogens.

  13. Chromosomal localization of the human and mouse hyaluronan synthase genes

    Energy Technology Data Exchange (ETDEWEB)

    Spicer, A.P.; McDonald, J.A. [Mayo Clinic Scottsdale, AZ (United States); Seldin, M.F. [Univ. of California Davis, CA (United States)] [and others

    1997-05-01

    We have recently identified a new vertebrate gene family encoding putative hyaluronan (HA) synthases. Three highly conserved related genes have been identified, designated HAS1, HAS2, and HAS3 in humans and Has1, Has2, and Has3 in the mouse. All three genes encode predicted plasma membrane proteins with multiple transmembrane domains and approximately 25% amino acid sequence identity to the Streptococcus pyogenes HA synthase, HasA. Furthermore, expression of any one HAS gene in transfected mammalian cells leads to high levels of HA biosynthesis. We now report the chromosomal localization of the three HAS genes in human and in mouse. The genes localized to three different positions within both the human and the mouse genomes. HAS1 was localized to the human chromosome 19q13.3-q13.4 boundary and Has1 to mouse Chr 17. HAS2 was localized to human chromosome 8q24.12 and Has2 to mouse Chr 15. HAS3 was localized to human chromosome 16q22.1 and Has3 to mouse Chr 8. The map position for HAS1 reinforces the recently reported relationship between a small region of human chromosome 19q and proximal mouse chromosome 17. HAS2 mapped outside the predicted critical region delineated for the Langer-Giedion syndrome and can thus be excluded as a candidate gene for this genetic syndrome. 33 refs., 2 figs.

  14. Retrotransposon-Encoded Reverse Transcriptase in the Genesis, Progression and Cellular Plasticity of Human Cancer

    International Nuclear Information System (INIS)

    Sinibaldi-Vallebona, Paola; Matteucci, Claudia; Spadafora, Corrado

    2011-01-01

    LINE-1 (Long Interspersed Nuclear Elements) and HERVs (Human Endogenous Retroviruses) are two families of autonomously replicating retrotransposons that together account for about 28% of the human genome. Genes harbored within LINE-1 and HERV retrotransposons, particularly those encoding the reverse transcriptase (RT) enzyme, are generally expressed at low levels in differentiated cells, but their expression is upregulated in transformed cells and embryonic tissues. Here we discuss a recently discovered RT-dependent mechanism that operates in tumorigenesis and reversibly modulates phenotypic and functional variations associated with tumor progression. Downregulation of active LINE-1 elements drastically reduces the tumorigenic potential of cancer cells, paralleled by reduced proliferation and increased differentiation. Pharmacological RT inhibitors (e.g., nevirapine and efavirenz) exert similar effects on tumorigenic cell lines, both in culture and in animal models. The HERV-K family play a distinct complementary role in stress-dependent transition of melanoma cells from an adherent, non-aggressive, to a non-adherent, highly malignant, growth phenotype. In synthesis, the retrotransposon-encoded RT is increasingly emerging as a key regulator of tumor progression and a promising target in a novel anti-cancer therapy

  15. [Divergence of paralogous growth-hormone-encoding genes and their promoters in Salmonidae].

    Science.gov (United States)

    Kamenskaya, D N; Pankova, M V; Atopkin, D M; Brykov, V A

    2017-01-01

    In many fish species, including salmonids, the growth-hormone is encoded by two duplicated paralogous genes, gh1 and gh2. Both genes were already in place at the time of divergence of species in this group. A comparison of the entire sequence of these genes of salmonids has shown that their conserved regions are associated with exons, while their most variable regions correspond to introns. Introns C and D include putative regulatory elements (sites Pit-1, CRE, and ERE), that are also conserved. In chars, the degree of polymorphism of gh2 gene is 2-3 times as large as that in gh1 gene. However, a comparison across all Salmonidae species would not extent this observation to other species. In both these chars' genes, the promoters are conserved mainly because they correspond to putative regulatory sequences (TATA box, binding sites for the pituitary transcription factor Pit-1 (F1-F4), CRE, GRE and RAR/RXR elements). The promoter of gh2 gene has a greater degree of polymorphism compared with gh1 gene promoter in all investigated species of salmonids. The observed differences in the rates of accumulation of changes in growth hormone encoding paralogs could be explained by differences in the intensity of selection.

  16. Genes Encoding Aluminum-Activated Malate Transporter II and their Association with Fruit Acidity in Apple

    Directory of Open Access Journals (Sweden)

    Baiquan Ma

    2015-11-01

    Full Text Available A gene encoding aluminum-activated malate transporter (ALMT was previously reported as a candidate for the locus controlling acidity in apple ( × Borkh.. In this study, we found that apple genes can be divided into three families and the gene belongs to the family. Duplication of genes in apple is related to the polyploid origin of the apple genome. Divergence in expression has occurred between the gene and its homologs in the family and only the gene is significantly associated with malic acid content. The locus consists of two alleles, and . resides in the tonoplast and its ectopic expression in yeast was found to increase the influx of malic acid into yeast cells significantly, suggesting it may function as a vacuolar malate channel. In contrast, encodes a truncated protein because of a single nucleotide substitution of G with A in the last exon. As this truncated protein resides within the cell membrane, it is deemed to be nonfunctional as a vacuolar malate channel. The frequency of the genotype is very low in apple cultivars but is high in wild relatives, which suggests that apple domestication may be accompanied by selection for the gene. In addition, variations in the malic acid content of mature fruits were also observed between accessions with the same genotype in the locus. This suggests that the gene is not the only genetic determinant of fruit acidity in apple.

  17. Identification and Characterization of an Autolysin-Encoding Gene of Streptococcus mutans

    OpenAIRE

    Shibata, Yukie; Kawada, Miki; Nakano, Yoshio; Toyoshima, Kuniaki; Yamashita, Yoshihisa

    2005-01-01

    We identified a gene (atlA) encoding autolytic activity from Streptococcus mutans Xc. The AtlA protein predicted to be encoded by atlA is composed of 979 amino acids with a molecular weight of 107,279 and has a conserved β-1,4-N-acetylmuramidase (lysozyme) domain in the C-terminal portion. Sodium dodecyl sulfate extracts of strain Xc showed two major bacteriolytic bands with molecular masses of 107 and 79 kDa, both of which were absent from a mutant with inactivated atlA. Western blot analysi...

  18. Characterization and Expression of Genes Encoding Three Small Heat Shock Proteins in Sesamia inferens (Lepidoptera: Noctuidae)

    OpenAIRE

    Sun, Meng; Lu, Ming-Xing; Tang, Xiao-Tian; Du, Yu-Zhou

    2014-01-01

    The pink stem borer, Sesamia inferens (Walker), is a major pest of rice and is endemic in China and other parts of Asia. Small heat shock proteins (sHSPs) encompass a diverse, widespread class of stress proteins that have not been characterized in S. inferens. In the present study, we isolated and characterized three S. inferens genes that encode members of the α-crystallin/sHSP family, namely, Sihsp21.4, Sihsp20.6, and Sihsp19.6. The three cDNAs encoded proteins of 187, 183 and 174 amino a...

  19. Amtyr1: characterization of a gene from honeybee (Apis mellifera) brain encoding a functional tyramine receptor.

    Science.gov (United States)

    Blenau, W; Balfanz, S; Baumann, A

    2000-03-01

    Biogenic amine receptors are involved in the regulation and modulation of various physiological and behavioral processes in both vertebrates and invertebrates. We have cloned a member of this gene family from the CNS of the honeybee, Apis mellifera. The deduced amino acid sequence is homologous to tyramine receptors cloned from Locusta migratoria and Drosophila melanogaster as well as to an octopamine receptor cloned from Heliothis virescens. Functional properties of the honeybee receptor were studied in stably transfected human embryonic kidney 293 cells. Tyramine reduced forskolin-induced cyclic AMP production in a dose-dependent manner with an EC50 of approximately 130 nM. A similar effect of tyramine was observed in membrane homogenates of honeybee brains. Octopamine also reduced cyclic AMP production in the transfected cell line but was both less potent (EC50 of approximately 3 microM) and less efficacious than tyramine. Receptor-encoding mRNA has a wide-spread distribution in the brain and subesophageal ganglion of the honeybee, suggesting that this tyramine receptor is involved in sensory signal processing as well as in higher-order brain functions.

  20. The carB gene encoding the large subunit of carbamoylphosphate synthetase from Lactococcus lactis is transcribed monocistronically

    DEFF Research Database (Denmark)

    Martinussen, Jan; Hammer, Karin

    1998-01-01

    The biosynthesis of carbamoylphosphate is catalysed by the heterodimeric enzyme carbamoylphosphate synthetase (CPSase). The genes encoding the two subunits in procaryotes are normally transcribed as an operon, whereas in Lactococcus lactis, the gene encoding the large subunit (carB) is shown...

  1. Human visual system automatically encodes sequential regularities of discrete events.

    Science.gov (United States)

    Kimura, Motohiro; Schröger, Erich; Czigler, István; Ohira, Hideki

    2010-06-01

    For our adaptive behavior in a dynamically changing environment, an essential task of the brain is to automatically encode sequential regularities inherent in the environment into a memory representation. Recent studies in neuroscience have suggested that sequential regularities embedded in discrete sensory events are automatically encoded into a memory representation at the level of the sensory system. This notion is largely supported by evidence from investigations using auditory mismatch negativity (auditory MMN), an event-related brain potential (ERP) correlate of an automatic memory-mismatch process in the auditory sensory system. However, it is still largely unclear whether or not this notion can be generalized to other sensory modalities. The purpose of the present study was to investigate the contribution of the visual sensory system to the automatic encoding of sequential regularities using visual mismatch negativity (visual MMN), an ERP correlate of an automatic memory-mismatch process in the visual sensory system. To this end, we conducted a sequential analysis of visual MMN in an oddball sequence consisting of infrequent deviant and frequent standard stimuli, and tested whether the underlying memory representation of visual MMN generation contains only a sensory memory trace of standard stimuli (trace-mismatch hypothesis) or whether it also contains sequential regularities extracted from the repetitive standard sequence (regularity-violation hypothesis). The results showed that visual MMN was elicited by first deviant (deviant stimuli following at least one standard stimulus), second deviant (deviant stimuli immediately following first deviant), and first standard (standard stimuli immediately following first deviant), but not by second standard (standard stimuli immediately following first standard). These results are consistent with the regularity-violation hypothesis, suggesting that the visual sensory system automatically encodes sequential

  2. Recombinant DNA specifying the human amyloid. beta. precursor protein (ABPP) encodes a 95-kDa polypeptide

    Energy Technology Data Exchange (ETDEWEB)

    Mita, S; Sadlock, J; Herbert, J; Schon, E A

    1988-10-11

    Although the ABPP gene give rise to multiple mRNAs, the primary translation product of this gene is unknown. The longest published cDNA sequences predict a 770-aa polypeptide of 87 kDa. However, in immunoblots, ABPP migrated as a single species of >92 kDa in rat brain, and in human, as a species of 95-100 kDa in non-membrane bound form, as multiple species of 110-135 kDa in membrane-associated form and as a 130-kDa species in fibroblasts. The sizes of these larger species relative to the MW of ABPP predicted from the cDNA sequences have been attributed to postranslational modification. However, the authors have isolated a cDNA (lambdaHAP2) from a human fetal muscle lambdagt11 cDNA library encoding an 843-aa polypeptide with a deduced MW of 94,642. This cDNA contains both exons encoding an 843-aa polypeptide with a deduced MW of 94.642. This cDNA contains both exons encoding the protease inhibitor domains. Primer extension analysis indicates that the 5' terminus of this cDNA is 14 nt from a transcriptional start site. This cDNA, encoding the longest ABPP described to date, may explain some of the observations on the sizes of tissue-derived ABPP.

  3. Interferon-induced transcription of a gene encoding a 15-kDA protein depends on an upstream enhancer element

    International Nuclear Information System (INIS)

    Reich, N.; Evans, B.; Levy, D.; Fahey, D.; Knight, E. Jr.; Darnell, J.E. Jr.

    1987-01-01

    A human gene encoding an interferon-induced 15-kDa protein has been isolated from a genomic library. The gene appears to be single-copy and is composed of two exons, the first of which contains the ATG translation initiation codon. In vitro nuclear run-on assays showed that the transcription rate of the gene is stimulated after interferon treatment. To analyze transcriptional regulatory sequences, the authors constructed recombinant plasmids for use in transient transfection assays of HeLa cells. Constructs containing 115 nucleotides 5' to the transcription initiation site were found to be fully inducible by interferon. Assays of deletion mutants identified a critical element for interferon induction located between -115 and -96, just upstream of the CCAAT box. Moreover, a DNA fragment including this region can confer interferon inducibility on a heterologous promoter (thymidine kinase) when cloned in either orientation upstream of the gene or downstream of the gene. These are properties characteristic of an enhancer element that is active only after treatment with interferon. This regulatory sequence may be shared by a group of interferon-induced genes, since a very similar sequence is present within the functional region near the RNA start site of another interferon-induced gene

  4. Human papillomavirus gene expression

    International Nuclear Information System (INIS)

    Chow, L.T.; Hirochika, H.; Nasseri, M.; Stoler, M.H.; Wolinsky, S.M.; Chin, M.T.; Hirochika, R.; Arvan, D.S.; Broker, T.R.

    1987-01-01

    To determine the role of tissue differentiation on expression of each of the papillomavirus mRNA species identified by electron microscopy, the authors prepared exon-specific RNA probes that could distinguish the alternatively spliced mRNA species. Radioactively labeled single-stranded RNA probes were generated from a dual promoter vector system and individually hybridized to adjacent serial sections of formalin-fixed, paraffin-embedded biopsies of condylomata. Autoradiography showed that each of the message species had a characteristic tissue distribution and relative abundance. The authors have characterized a portion of the regulatory network of the HPVs by showing that the E2 ORF encodes a trans-acting enhancer-stimulating protein, as it does in BPV-1 (Spalholz et al. 1985). The HPV-11 enhancer was mapped to a 150-bp tract near the 3' end of the URR. Portions of this region are duplicated in some aggressive strains of HPV-6 (Boshart and zur Hausen 1986; Rando et al. 1986). To test the possible biological relevance of these duplications, they cloned tandem arrays of the enhancer and demonstrated, using a chloramphenicol acetyltransferase (CAT) assay, that they led to dramatically increased transcription proportional to copy number. Using the CAT assays, the authors found that the E2 proteins of several papillomavirus types can cross-stimulate the enhancers of most other types. This suggests that prior infection of a tissue with one papillomavirus type may provide a helper effect for superinfection and might account fo the HPV-6/HPV-16 coinfections in condylomata that they have observed

  5. Nomenclature for alleles of the human carboxylesterase 1 gene

    DEFF Research Database (Denmark)

    Rasmussen, Henrik B.; Madsen, Majbritt B.; Bjerre, Ditte

    2017-01-01

    The carboxylesterase 1 gene (CES1) in humans encodes a hydrolase, which is implicated in the metabolism of several commonly used drugs 1. This gene is located on chromosome 16 with a highly homologous pseudogene, CES1P1, in its proximity. A duplicated segment of CES1 replaces most of CES1P1 in some...... appears to be low 8,13. The formation of hybrids consisting of a gene and a related pseudogene has been reported for other genes than CES1. This includes the hybrids of the gene encoding cytochrome P450 2D6 (CYP2D6) and pseudogene CYP2D7, that is, the so-called CYP2D7/D6 hybrids 14......,15. These are categorized as CYP2D6 variants and not as variants of pseudogene CYP2D716....

  6. Bioinformatics Analysis of NBS-LRR Encoding Resistance Genes in Setaria italica.

    Science.gov (United States)

    Zhao, Yan; Weng, Qiaoyun; Song, Jinhui; Ma, Hailian; Yuan, Jincheng; Dong, Zhiping; Liu, Yinghui

    2016-06-01

    In plants, resistance (R) genes are involved in pathogen recognition and subsequent activation of innate immune responses. The nucleotide-binding site-leucine-rich repeat (NBS-LRR) genes family forms the largest R-gene family among plant genomes and play an important role in plant disease resistance. In this paper, comprehensive analysis of NBS-encoding genes is performed in the whole Setaria italica genome. A total of 96 NBS-LRR genes are identified, and comprehensive overview of the NBS-LRR genes is undertaken, including phylogenetic analysis, chromosome locations, conserved motifs of proteins, and gene expression. Based on the domain, these genes are divided into two groups and distributed in all Setaria italica chromosomes. Most NBS-LRR genes are located at the distal tip of the long arms of the chromosomes. Setaria italica NBS-LRR proteins share at least one nucleotide-biding domain and one leucine-rich repeat domain. Our results also show the duplication of NBS-LRR genes in Setaria italica is related to their gene structure.

  7. Characterization of Urtica dioica agglutinin isolectins and the encoding gene family.

    Science.gov (United States)

    Does, M P; Ng, D K; Dekker, H L; Peumans, W J; Houterman, P M; Van Damme, E J; Cornelissen, B J

    1999-01-01

    Urtica dioica agglutinin (UDA) has previously been found in roots and rhizomes of stinging nettles as a mixture of UDA-isolectins. Protein and cDNA sequencing have shown that mature UDA is composed of two hevein domains and is processed from a precursor protein. The precursor contains a signal peptide, two in-tandem hevein domains, a hinge region and a carboxyl-terminal chitinase domain. Genomic fragments encoding precursors for UDA-isolectins have been amplified by five independent polymerase chain reactions on genomic DNA from stinging nettle ecotype Weerselo. One amplified gene was completely sequenced. As compared to the published cDNA sequence, the genomic sequence contains, besides two basepair substitutions, two introns located at the same positions as in other plant chitinases. By partial sequence analysis of 40 amplified genes, 16 different genes were identified which encode seven putative UDA-isolectins. The deduced amino acid sequences share 78.9-98.9% identity. In extracts of roots and rhizomes of stinging nettle ecotype Weerselo six out of these seven isolectins were detected by mass spectrometry. One of them is an acidic form, which has not been identified before. Our results demonstrate that UDA is encoded by a large gene family.

  8. Cloning and characterization of largemouth bass ( Micropterus salmoides) myostatin encoding gene and its promoter

    Science.gov (United States)

    Li, Shengjie; Bai, Junjie; Wang, Lin

    2008-08-01

    Myostatin or GDF-8, a member of the transforming growth factor-β (TGF-β) superfamily, has been demonstrated to be a negative regulator of skeletal muscle mass in mammals. In the present study, we obtained a 5.64 kb sequence of myostatin encoding gene and its promoter from largemouth bass ( Micropterus salmoides). The myostatin encoding gene consisted of three exons (488 bp, 371 bp and 1779 bp, respectively) and two introns (390 bp and 855 bp, respectively). The intron-exon boundaries were conservative in comparison with those of mammalian myostatin encoding genes, whereas the size of introns was smaller than that of mammals. Sequence analysis of 1.569 kb of the largemouth bass myostatin gene promoter region revealed that it contained two TATA boxes, one CAAT box and nine putative E-boxes. Putative muscle growth response elements for myocyte enhancer factor 2 (MEF2), serum response factor (SRF), activator protein 1 (AP1), etc., and muscle-specific Mt binding site (MTBF) were also detected. Some of the transcription factor binding sites were conserved among five teleost species. This information will be useful for studying the transcriptional regulation of myostatin in fish.

  9. Structure and chromosomal localization of the human renal kallikrein gene

    International Nuclear Information System (INIS)

    Evans, B.A.; Yun, Z.X.; Close, J.A.

    1988-01-01

    Glandular kallikreins are a family of proteases encoded by a variable number of genes in different mammalian species. In all species examined, however, one particular kallikrein is functionally conserved in its capacity to release the vasoactive peptide, Lys-bradykinin, from low molecular weight kininogen. This kallikrein is found in the kidney, pancreas, and salivary gland, showing a unique pattern of tissue-specific expression relative to other members of the family. The authors have isolated a genomic clone carrying the human renal kallikrein gene and compared the nucleotide sequence of its promoter region with those of the mouse renal kallikrein gene and another mouse kallikrein gene expressed in a distinct cell type. They find four sequence elements conserved between renal kallikrein genes from the two species. They have also shown that the human gene is localized to 19q13, a position analogous to that of the kallikrein gene family on mouse chromosome 7

  10. Genome-Wide Identification and Analysis of Genes Encoding PHD-Finger Protein in Tomato

    International Nuclear Information System (INIS)

    Hayat, S.; Cheng, Z.; Chen, X.

    2016-01-01

    The PHD-finger proteins are conserved in eukaryotic organisms and are involved in a variety of important functions in different biological processes in plants. However, the function of PHD fingers are poorly known in tomato (Solanum lycopersicum L.). In current study, we identified 45 putative genes coding Phd finger protein in tomato distributed on 11 chromosomes except for chromosome 8. Some of the genes encode other conserved key domains besides Phd-finger. Phylogenetic analysis of these 45 proteins resulted in seven clusters. Most Phd finger proteins were predicted to PML body location. These PHD-finger genes displayed differential expression either in various organs, at different development stages and under stresses in tomato. Our study provides the first systematic analysis of PHD-finger genes and proteins in tomato. This preliminary study provides a very useful reference information for Phd-finger proteins in tomato. They will be helpful for cloning and functional study of tomato PHD-finger genes. (author)

  11. Chicken genome analysis reveals novel genes encoding biotin-binding proteins related to avidin family

    Directory of Open Access Journals (Sweden)

    Nordlund Henri R

    2005-03-01

    Full Text Available Abstract Background A chicken egg contains several biotin-binding proteins (BBPs, whose complete DNA and amino acid sequences are not known. In order to identify and characterise these genes and proteins we studied chicken cDNAs and genes available in the NCBI database and chicken genome database using the reported N-terminal amino acid sequences of chicken egg-yolk BBPs as search strings. Results Two separate hits showing significant homology for these N-terminal sequences were discovered. For one of these hits, the chromosomal location in the immediate proximity of the avidin gene family was found. Both of these hits encode proteins having high sequence similarity with avidin suggesting that chicken BBPs are paralogous to avidin family. In particular, almost all residues corresponding to biotin binding in avidin are conserved in these putative BBP proteins. One of the found DNA sequences, however, seems to encode a carboxy-terminal extension not present in avidin. Conclusion We describe here the predicted properties of the putative BBP genes and proteins. Our present observations link BBP genes together with avidin gene family and shed more light on the genetic arrangement and variability of this family. In addition, comparative modelling revealed the potential structural elements important for the functional and structural properties of the putative BBP proteins.

  12. Nucleotide sequence of the human N-myc gene

    International Nuclear Information System (INIS)

    Stanton, L.W.; Schwab, M.; Bishop, J.M.

    1986-01-01

    Human neuroblastomas frequently display amplification and augmented expression of a gene known as N-myc because of its similarity to the protooncogene c-myc. It has therefore been proposed that N-myc is itself a protooncogene, and subsequent tests have shown that N-myc and c-myc have similar biological activities in cell culture. The authors have now detailed the kinship between N-myc and c-myc by determining the nucleotide sequence of human N-myc and deducing the amino acid sequence of the protein encoded by the gene. The topography of N-myc is strikingly similar to that of c-myc: both genes contain three exons of similar lengths; the coding elements of both genes are located in the second and third exons; and both genes have unusually long 5' untranslated regions in their mRNAs, with features that raise the possibility that expression of the genes may be subject to similar controls of translation. The resemblance between the proteins encoded by N-myc and c-myc sustains previous suspicions that the genes encode related functions

  13. The promoter of the glucoamylase-encoding gene of Aspergillus niger functions in Ustilago maydis

    Energy Technology Data Exchange (ETDEWEB)

    Smith, T.L. (Dept. of Agriculture, Madison, WI (United States) Univ. of Wisconsin, Madison (United States)); Gaskell, J.; Cullen, D. (Dept. of Agriculture, Madison, WI (United States)); Berka, R.M.; Yang, M.; Henner, D.J. (Genentech Inc., San Francisco, CA (United States))

    1990-01-01

    Promoter sequences from the Aspergillus niger glucoamylase-encoding gene (glaA) were linked to the bacterial hygromycin (Hy) phosphotransferase-encoding gene (hph) and this chimeric marker was used to select Hy-resistant (Hy[sup R]) Ustilago maydis transformants. This is an example of an Ascomycete promoter functioning in a Basidiomycete. Hy[sup R] transformants varied with respect to copy number of integrated vector, mitotic stability, and tolerance to Hy. Only 216 bp of glaA promoter sequence is required for expression in U. maydis but this promoter is not induced by starch as it is in Aspergillus spp. The transcription start points are the same in U. maydis and A. niger.

  14. Gene Disruption in Scedosporium aurantiacum: Proof of Concept with the Disruption of SODC Gene Encoding a Cytosolic Cu,Zn-Superoxide Dismutase.

    Science.gov (United States)

    Pateau, Victoire; Razafimandimby, Bienvenue; Vandeputte, Patrick; Thornton, Christopher R; Guillemette, Thomas; Bouchara, Jean-Philippe; Giraud, Sandrine

    2018-02-01

    Scedosporium species are opportunistic pathogens responsible for a large variety of infections in humans. An increasing occurrence was observed in patients with underlying conditions such as immunosuppression or cystic fibrosis. Indeed, the genus Scedosporium ranks the second among the filamentous fungi colonizing the respiratory tracts of the CF patients. To date, there is very scarce information on the pathogenic mechanisms, at least in part because of the limited genetic tools available. In the present study, we successfully developed an efficient transformation and targeted gene disruption approach on the species Scedosporium aurantiacum. The disruption cassette was constructed using double-joint PCR procedure, and resistance to hygromycin B as the selection marker. This proof of concept was performed on the functional gene SODC encoding the Cu,Zn-superoxide dismutase. Disruption of the SODC gene improved susceptibility of the fungus to oxidative stress. This technical advance should open new research areas and help to better understand the biology of Scedosporium species.

  15. Characterization of Genes Encoding Key Enzymes Involved in Anthocyanin Metabolism of Kiwifruit during Storage Period

    OpenAIRE

    Li, Boqiang; Xia, Yongxiu; Wang, Yuying; Qin, Guozheng; Tian, Shiping

    2017-01-01

    ‘Hongyang’ is a red fleshed kiwifruit with high anthocyanin content. In this study, we mainly investigated effects of different temperatures (25 and 0°C) on anthocyanin biosynthesis in harvested kiwifruit, and characterized the genes encoding key enzymes involved in anthocyanin metabolism, as well as evaluated the mode of the action, by which low temperature regulates anthocyanin accumulation in ‘Hongyang’ kiwifruit during storage period. The results showed that low temperature could effectiv...

  16. Cloning and Sequence Analysis of Vibrio halioticoli Genes Encoding Three Types of Polyguluronate Lyase.

    Science.gov (United States)

    Sugimura; Sawabe; Ezura

    2000-01-01

    The alginate lyase-coding genes of Vibrio halioticoli IAM 14596(T), which was isolated from the gut of the abalone Haliotis discus hannai, were cloned using plasmid vector pUC 18, and expressed in Escherichia coli. Three alginate lyase-positive clones, pVHB, pVHC, and pVHE, were obtained, and all clones expressed the enzyme activity specific for polyguluronate. Three genes, alyVG1, alyVG2, and alyVG3, encoding polyguluronate lyase were sequenced: alyVG1 from pVHB was composed of a 1056-bp open reading frame (ORF) encoding 352 amino acid residues; alyVG2 gene from pVHC was composed of a 993-bp ORF encoding 331 amino acid residues; and alyVG3 gene from pVHE was composed of a 705-bp ORF encoding 235 amino acid residues. Comparison of nucleotide and deduced amino acid sequences among AlyVG1, AlyVG2, and AlyVG3 revealed low homologies. The identity value between AlyVG1 and AlyVG2 was 18.7%, and that between AlyVG2 and AlyVG3 was 17.0%. A higher identity value (26.0%) was observed between AlyVG1 and AlyVG3. Sequence comparison among known polyguluronate lyases including AlyVG1, AlyVG2, and AlyVG3 also did not reveal an identical region in these sequences. However, AlyVG1 showed the highest identity value (36.2%) and the highest similarity (73.3%) to AlyA from Klebsiella pneumoniae. A consensus region comprising nine amino acid (YFKAGXYXQ) in the carboxy-terminal region previously reported by Mallisard and colleagues was observed only in AlyVG1 and AlyVG2.

  17. Heterogeneous genetic diversity pattern in Plasmodium vivax genes encoding merozoite surface proteins (MSP) -7E, -7F and -7L.

    Science.gov (United States)

    Garzón-Ospina, Diego; Forero-Rodríguez, Johanna; Patarroyo, Manuel A

    2014-12-13

    The msp-7 gene has become differentially expanded in the Plasmodium genus; Plasmodium vivax has the highest copy number of this gene, several of which encode antigenic proteins in merozoites. DNA sequences from thirty-six Colombian clinical isolates from P. vivax (pv) msp-7E, -7F and -7L genes were analysed for characterizing and studying the genetic diversity of these pvmsp-7 members which are expressed during the intra-erythrocyte stage; natural selection signals producing the variation pattern so observed were evaluated. The pvmsp-7E gene was highly polymorphic compared to pvmsp-7F and pvmsp-7L which were seen to have limited genetic diversity; pvmsp-7E polymorphism was seen to have been maintained by different types of positive selection. Even though these copies seemed to be species-specific duplications, a search in the Plasmodium cynomolgi genome (P. vivax sister taxon) showed that both species shared the whole msp-7 repertoire. This led to exploring the long-term effect of natural selection by comparing the orthologous sequences which led to finding signatures for lineage-specific positive selection. The results confirmed that the P. vivax msp-7 family has a heterogeneous genetic diversity pattern; some members are highly conserved whilst others are highly diverse. The results suggested that the 3'-end of these genes encode MSP-7 proteins' functional region whilst the central region of pvmsp-7E has evolved rapidly. The lineage-specific positive selection signals found suggested that mutations occurring in msp-7s genes during host switch may have succeeded in adapting the ancestral P. vivax parasite population to humans.

  18. A novel gene encoding a TIG multiple domain protein is a positional candidate for autosomal recessive polycystic kidney disease.

    Science.gov (United States)

    Xiong, Huaqi; Chen, Yongxiong; Yi, Yajun; Tsuchiya, Karen; Moeckel, Gilbert; Cheung, Joseph; Liang, Dan; Tham, Kyi; Xu, Xiaohu; Chen, Xing-Zhen; Pei, York; Zhao, Zhizhuang Jeo; Wu, Guanqing

    2002-07-01

    Autosomal recessive polycystic kidney disease (ARPKD) is a common hereditary renal cystic disease in infants and children. By genetic linkage analyses, the gene responsible for this disease, termed polycystic kidney and hepatic disease 1 (PKHD1), was mapped on human chromosome 6p21.1-p12, and has been further localized to a 1-cM genetic interval flanked by the D6S1714/D6S243 (telomeric) and D6S1024 (centromeric) markers. We recently identified a novel gene in this genetic interval from kidney cDNA, using cloning strategies. The gene PKHD1 (PKHD1-tentative) encodes a novel 3396-amino-acid protein with no apparent homology with any known proteins. We named its gene product "tigmin" because it contains multiple TIG domains, which usually are seen in proteins containing immunoglobulin-like folds. PKHD1 encodes an 11.6-kb transcript and is composed of 61 exons spanning an approximately 365-kb genomic region on chromosome 6p12-p11.2 adjacent to the marker D6S1714. Northern blot analyses demonstrated that the gene has discrete bands with one peak signal at approximately 11 kb, indicating that PKHD1 is likely to have multiple alternative transcripts. PKHD1 is highly expressed in adult and infant kidneys and weakly expressed in liver in northern blot analysis. This expression pattern parallels the tissue involvement observed in ARPKD. In situ hybridization analysis further revealed that the expression of PKHD1 in the kidney is mainly localized to the epithelial cells of the collecting duct, the specific tubular segment involved in cyst formation in ARPKD. These features of PKHD1 make it a strong positional candidate gene for ARPKD.

  19. Isolation and Cloning of cDNA Fragment of Gene Encoding for Multidrug Resistance Associated Protein from M. affine.

    Directory of Open Access Journals (Sweden)

    Utut Widyastuti Suharsono

    2008-11-01

    Full Text Available Isolation and Cloning of cDNA Fragment of Gene Encoding for Multidrug Resistance Associated Protein from M. affine. M. affine can grow well in acid soil with high level of soluble aluminum. One of the important proteins in the detoxifying xenobiotic stress including acid and Al stresses is a multidrug resistance associated protein (MRP encoded by mrp gene. The objective of this research is to isolate and clone the cDNA fragment of MaMrp encoding MRP from M. affine. By reverse transcription, total cDNA had been synthesized from the total RNA as template. The fragment of cDNA MaMrp had been successfully isolated by PCR by using total cDNA as template and mrp primer designed from A. thaliana, yeast, and human. This fragment was successfully inserted into pGEM-T Easy and the recombinant plasmid was successfully introduced into E. coli DH5α. Nucleotide sequence analysis showed that the lenght of MaMrp fragment is 633 bp encoding 208 amino acids. Local alignment analysis based on nucleotide of mRNA showed that MaMrp fragment is 69% identical to AtMrp1 and 63% to AtMrp from A. thaliana. Based on deduced amino acid sequence, MaMRP is 84% identical to part of AtMRP13, 77% to AtMRP12, and 73% to AtMRP1 from A. thaliana respectively. Alignment analysis with AtMRP1 showed that MaMRP fragment is located in TM1 and NBF1 domains and has a specific amino acid sequence QCKAQLQNMEEE.

  20. Sieve element occlusion (SEO) genes encode structural phloem proteins involved in wound sealing of the phloem.

    Science.gov (United States)

    Ernst, Antonia M; Jekat, Stephan B; Zielonka, Sascia; Müller, Boje; Neumann, Ulla; Rüping, Boris; Twyman, Richard M; Krzyzanek, Vladislav; Prüfer, Dirk; Noll, Gundula A

    2012-07-10

    The sieve element occlusion (SEO) gene family originally was delimited to genes encoding structural components of forisomes, which are specialized crystalloid phloem proteins found solely in the Fabaceae. More recently, SEO genes discovered in various non-Fabaceae plants were proposed to encode the common phloem proteins (P-proteins) that plug sieve plates after wounding. We carried out a comprehensive characterization of two tobacco (Nicotiana tabacum) SEO genes (NtSEO). Reporter genes controlled by the NtSEO promoters were expressed specifically in immature sieve elements, and GFP-SEO fusion proteins formed parietal agglomerates in intact sieve elements as well as sieve plate plugs after wounding. NtSEO proteins with and without fluorescent protein tags formed agglomerates similar in structure to native P-protein bodies when transiently coexpressed in Nicotiana benthamiana, and the analysis of these protein complexes by electron microscopy revealed ultrastructural features resembling those of native P-proteins. NtSEO-RNA interference lines were essentially devoid of P-protein structures and lost photoassimilates more rapidly after injury than control plants, thus confirming the role of P-proteins in sieve tube sealing. We therefore provide direct evidence that SEO genes in tobacco encode P-protein subunits that affect translocation. We also found that peptides recently identified in fascicular phloem P-protein plugs from squash (Cucurbita maxima) represent cucurbit members of the SEO family. Our results therefore suggest a common evolutionary origin for P-proteins found in the sieve elements of all dicotyledonous plants and demonstrate the exceptional status of extrafascicular P-proteins in cucurbits.

  1. Cloning of the gene encoding the δ subunit of the human T-cell receptor reveals its physical organization within the α-subunit locus and its involvement in chromosome translocations in T-cell malignancy

    International Nuclear Information System (INIS)

    Isobe, M.; Russo, G.; Haluska, F.G.; Croce, C.M.

    1988-01-01

    By taking advantage of chromosomal walking techniques, the authors have obtained clones that encompass the T-cell receptor (TCR) δ-chain gene. They analyzed clones spanning the entire J α region extending 115 kilobases 5' of the TCR α-chain constant region and have shown that the TCR δ-chain gene is located over 80 kilobases 5' of C α . TCR δ-chain gene is rearranged in the γ/δ-expressing T-cell line Peer and is deleted in α/β-expressing T-cell lines. Sequence analysis of portions of this genomic region demonstrates its identity with previously described cDNA clones corresponding to the C δ and J δ segments. Furthermore, they have analyzed a t(8;14)-(q24;q11) chromosome translocation from a T-cell leukemia and have shown that the J δ segment is rearranged in cells deriving from this tumor and probably directly involved in the translocation. Thus, the newly clones TCR δ chain is implicated in the genesis of chromosome translocations in T-cell malignancies carrying cytogenetic abnormalities of band 14q11

  2. Isolation of Clostridium difficile and Detection of A and B Toxins Encoding Genes

    Directory of Open Access Journals (Sweden)

    Abbas Ali Imani Fooladi

    2014-02-01

    Full Text Available Background: Clostridium difficile is the most important anaerobic, gram positive, spore forming bacillus which is known as a prevalent factor leading to antibiotic associated diarrheas and is the causative agent of pseudomembrane colitis. The role of this bacterium along with the over use of antibiotics have been proved to result in colitis. The major virulence factors of these bacteria are the A and B toxins. Objectives: The purpose of this study was to isolate C. difficile from stool samples and detect A and B toxins encoding genes, in order toserve as a routine method for clinical diagnosis. Materials and Methods: Recognition of A and B toxins encoding genes by uniplex and multiplex PCR using two pairs of primers from 136 accumulated stool samples. Results: Results of the present study showed that out of 136 stool samples, three C. difficile were isolated and these strains contained A and B toxins encoding genes. Conclusions: It was concluded that although detection of C. difficile from stool samples based on PCR (polymerase chain reaction is expensive, yet this method is more sensitive and less time-consuming than culture methods and can be used as a clinical laboratory test.

  3. Expression-based clustering of CAZyme-encoding genes of Aspergillus niger.

    Science.gov (United States)

    Gruben, Birgit S; Mäkelä, Miia R; Kowalczyk, Joanna E; Zhou, Miaomiao; Benoit-Gelber, Isabelle; De Vries, Ronald P

    2017-11-23

    The Aspergillus niger genome contains a large repertoire of genes encoding carbohydrate active enzymes (CAZymes) that are targeted to plant polysaccharide degradation enabling A. niger to grow on a wide range of plant biomass substrates. Which genes need to be activated in certain environmental conditions depends on the composition of the available substrate. Previous studies have demonstrated the involvement of a number of transcriptional regulators in plant biomass degradation and have identified sets of target genes for each regulator. In this study, a broad transcriptional analysis was performed of the A. niger genes encoding (putative) plant polysaccharide degrading enzymes. Microarray data focusing on the initial response of A. niger to the presence of plant biomass related carbon sources were analyzed of a wild-type strain N402 that was grown on a large range of carbon sources and of the regulatory mutant strains ΔxlnR, ΔaraR, ΔamyR, ΔrhaR and ΔgalX that were grown on their specific inducing compounds. The cluster analysis of the expression data revealed several groups of co-regulated genes, which goes beyond the traditionally described co-regulated gene sets. Additional putative target genes of the selected regulators were identified, based on their expression profile. Notably, in several cases the expression profile puts questions on the function assignment of uncharacterized genes that was based on homology searches, highlighting the need for more extensive biochemical studies into the substrate specificity of enzymes encoded by these non-characterized genes. The data also revealed sets of genes that were upregulated in the regulatory mutants, suggesting interaction between the regulatory systems and a therefore even more complex overall regulatory network than has been reported so far. Expression profiling on a large number of substrates provides better insight in the complex regulatory systems that drive the conversion of plant biomass by fungi. In

  4. Open reading frame 176 in the photosynthesis gene cluster of Rhodobacter capsulatus encodes idi, a gene for isopentenyl diphosphate isomerase.

    OpenAIRE

    Hahn, F M; Baker, J A; Poulter, C D

    1996-01-01

    Isopentenyl diphosphate (IPP) isomerase catalyzes an essential activation step in the isoprenoid biosynthetic pathway. A database search based on probes from the highly conserved regions in three eukaryotic IPP isomerases revealed substantial similarity with ORF176 in the photosynthesis gene cluster in Rhodobacter capsulatus. The open reading frame was cloned into an Escherichia coli expression vector. The encoded 20-kDa protein, which was purified in two steps by ion exchange and hydrophobic...

  5. Molecular characterization of genes encoding leucoanthocyanidin reductase involved in proanthocyanidin biosynthesis in apple

    Directory of Open Access Journals (Sweden)

    Yuepeng eHan

    2015-04-01

    Full Text Available Proanthocyanidins (PAs are the major component of phenolics in apple, but mechanisms involved in PA biosynthesis remain unclear. Here, the relationship between the PA biosynthesis and the expression of genes encoding leucoanthocyanidin reductase (LAR and anthocyanidin reductase (ANR was investigated in fruit skin of one apple cultivar and three crabapples. Transcript levels of LAR1 and ANR2 genes were significantly correlated with the contents of catechin and epicatechin, respectively, which suggests their active roles in PA synthesis. Surprisingly, transcript levels for both LAR1 and LAR2 genes were almost undetectable in two crabapples that accumulated both flavan-3-ols and PAs. This contradicts the previous finding that LAR1 gene is a strong candidate regulating the accumulation of metabolites such as epicatechin and PAs in apple. Ectopic expression of apple MdLAR1 gene in tobacco suppresses expression of the late genes in anthocyanin biosynthetic pathway, resulting in loss of anthocyanin in flowers. Interestingly, a decrease in PA biosynthesis was also observed in flowers of transgenic tobacco plants overexpressing the MdLAR1 gene, which could be attributed to decreased expression of both the NtANR1 and NtANR2 genes. Our study not only confirms the in vivo function of apple LAR1 gene, but it is also helpful for understanding the mechanism of PA biosynthesis.

  6. The Sporothrix schenckii Gene Encoding for the Ribosomal Protein L6 Has Constitutive and Stable Expression and Works as an Endogenous Control in Gene Expression Analysis

    Directory of Open Access Journals (Sweden)

    Elías Trujillo-Esquivel

    2017-09-01

    Full Text Available Sporothrix schenckii is one of the causative agents of sporotrichosis, a worldwide-distributed mycosis that affects humans and other mammals. The interest in basic and clinical features of this organism has significantly increased in the last years, yet little progress in molecular aspects has been reported. Gene expression analysis is a set of powerful tools that helps to assess the cell response to changes in the extracellular environment, the genetic networks controlling metabolic pathways, and the adaptation to different growth conditions. Most of the quantitative methodologies used nowadays require data normalization, and this is achieved measuring the expression of endogenous control genes. Reference genes, whose expression is assumed to suffer minimal changes regardless the cell morphology, the stage of the cell cycle or the presence of harsh extracellular conditions are commonly used as controls in Northern blotting assays, microarrays, and semi-quantitative or quantitative RT-PCR. Since the biology of the organisms is usually species specific, it is difficult to find a reliable group of universal genes that can be used as controls for data normalization in experiments addressing the gene expression, regardless the taxonomic classification of the organism under study. Here, we compared the transcriptional stability of the genes encoding for elongation factor 1A, Tfc1, a protein involved in transcription initiation on Pol III promoters, ribosomal protein L6, histone H2A, β-actin, β-tubulin, glyceraldehyde 3-phosphate dehydrogenase, UAF30, the upstream activating factor 30, and the transcription initiation factor TFIID subunit 10, during the fungal growth in different culture media and cell morphologies. Our results indicated that only the gene encoding for the ribosomal protein L6 showed a stable and constant expression. Furthermore, it displayed not transcriptional changes when S. schenckii infected larvae of Galleria mellonella or

  7. Genome analysis and identification of gelatinase encoded gene in Enterobacter aerogenes

    Science.gov (United States)

    Shahimi, Safiyyah; Mutalib, Sahilah Abdul; Khalid, Rozida Abdul; Repin, Rul Aisyah Mat; Lamri, Mohd Fadly; Bakar, Mohd Faizal Abu; Isa, Mohd Noor Mat

    2016-11-01

    In this study, bioinformatic analysis towards genome sequence of E. aerogenes was done to determine gene encoded for gelatinase. Enterobacter aerogenes was isolated from hot spring water and gelatinase species-specific bacterium to porcine and fish gelatin. This bacterium offers the possibility of enzymes production which is specific to both species gelatine, respectively. Enterobacter aerogenes was partially genome sequenced resulting in 5.0 mega basepair (Mbp) total size of sequence. From pre-process pipeline, 87.6 Mbp of total reads, 68.8 Mbp of total high quality reads and 78.58 percent of high quality percentage was determined. Genome assembly produced 120 contigs with 67.5% of contigs over 1 kilo base pair (kbp), 124856 bp of N50 contig length and 55.17 % of GC base content percentage. About 4705 protein gene was identified from protein prediction analysis. Two candidate genes selected have highest similarity identity percentage against gelatinase enzyme available in Swiss-Prot and NCBI online database. They were NODE_9_length_26866_cov_148.013245_12 containing 1029 base pair (bp) sequence with 342 amino acid sequence and NODE_24_length_155103_cov_177.082458_62 which containing 717 bp sequence with 238 amino acid sequence, respectively. Thus, two paired of primers (forward and reverse) were designed, based on the open reading frame (ORF) of selected genes. Genome analysis of E. aerogenes resulting genes encoded gelatinase were identified.

  8. EWS and FUS bind a subset of transcribed genes encoding proteins enriched in RNA regulatory functions

    DEFF Research Database (Denmark)

    Luo, Yonglun; Friis, Jenny Blechingberg; Fernandes, Ana Miguel

    2015-01-01

    at different levels. Gene Ontology analyses showed that FUS and EWS target genes preferentially encode proteins involved in regulatory processes at the RNA level. Conclusions The presented results yield new insights into gene interactions of EWS and FUS and have identified a set of FUS and EWS target genes...... involved in pathways at the RNA regulatory level with potential to mediate normal and disease-associated functions of the FUS and EWS proteins.......Background FUS (TLS) and EWS (EWSR1) belong to the FET-protein family of RNA and DNA binding proteins. FUS and EWS are structurally and functionally related and participate in transcriptional regulation and RNA processing. FUS and EWS are identified in translocation generated cancer fusion proteins...

  9. Cloning and expression of a cDNA encoding human sterol carrier protein 2

    International Nuclear Information System (INIS)

    Yamamoto, Ritsu; Kallen, C.B.; Babalola, G.O.; Rennert, H.; Strauss, J.F. III; Billheimer, J.T.

    1991-01-01

    The authors report the cloning and expression of a cDNA encoding human sterol carrier protein 2 (SCP 2 ). The 1.3-kilobase (kb) cDNA contains an open reading frame which encompasses a 143-amino acid sequence which is 89% identical to the rat SCP 2 amino acid sequence. The deduced amino acid sequence of the polypeptide reveals a 20-residue amino-terminal leader sequence in front of the mature polypeptide, which contains a carboxyl-terminal tripeptide (Ala-Lys-Leu) related to the peroxisome targeting sequence. The expressed cDNA in COS-7 cells yields a 15.3-kDa polypeptide and increased amounts of a 13.2-kDa polypeptide, both reacting with a specific rabbit antiserum to rat liver SCP 2 . The cDNA insert hybridizes with 3.2- and 1.8-kb mRNA species in human liver poly(A) + RNA. In human fibroblasts and placenta the 1.8-kb mRNA was most abundant. Southern blot analysis suggests either that there are multiple copies of the SCP 2 gene in the human genome or that the SCP 2 gene is very large. Coexpression of the SCP 2 cDNA with expression vectors for cholesterol side-chain cleavage enzyme and adrenodoxin resulted in a 2.5-fold enhancement of progestin synthesis over that obtained with expression of the steroidogenic enzyme system alone. These findings are concordant with the notion that SCP 2 plays a role in regulating steroidogenesis, among other possible functions

  10. Characterization of human cardiac myosin heavy chain genes

    International Nuclear Information System (INIS)

    Yamauchi-Takihara, K.; Sole, M.J.; Liew, J.; Ing, D.; Liew, C.C.

    1989-01-01

    The authors have isolated and analyzed the structure of the genes coding for the α and β forms of the human cardiac myosin heavy chain (MYHC). Detailed analysis of four overlapping MYHC genomic clones shows that the α-MYHC and β-MYHC genes constitute a total length of 51 kilobases and are tandemly linked. The β-MYHC-encoding gene, predominantly expressed in the normal human ventricle and also in slow-twitch skeletal muscle, is located 4.5 kilobases upstream of the α-MYHC-encoding gene, which is predominantly expressed in normal human atrium. The authors have determined the nucleotide sequences of the β form of the MYHC gene, which is 100% homologous to the cardiac MYHC cDNA clone (pHMC3). It is unlikely that the divergence of a few nucleotide sequences from the cardiac β-MYHC cDNA clone (pHMC3) reported in a MYHC cDNA clone (PSMHCZ) from skeletal muscle is due to a splicing mechanism. This finding suggests that the same β form of the cardiac MYHC gene is expressed in both ventricular and slow-twitch skeletal muscle. The promoter regions of both α- and β-MYHC genes, as well as the first four coding regions in the respective genes, have also been sequenced. The sequences in the 5'-flanking region of the α- and β-MYHC-encoding genes diverge extensively from one another, suggesting that expression of the α- and β-MYHC genes is independently regulated

  11. Transcription Factors Encoded on Core and Accessory Chromosomes of Fusarium oxysporum Induce Expression of Effector Genes

    Science.gov (United States)

    van der Does, H. Charlotte; Schmidt, Sarah M.; Langereis, Léon; Hughes, Timothy R.

    2016-01-01

    Proteins secreted by pathogens during host colonization largely determine the outcome of pathogen-host interactions and are commonly called ‘effectors’. In fungal plant pathogens, coordinated transcriptional up-regulation of effector genes is a key feature of pathogenesis and effectors are often encoded in genomic regions with distinct repeat content, histone code and rate of evolution. In the tomato pathogen Fusarium oxysporum f. sp. lycopersici (Fol), effector genes reside on one of four accessory chromosomes, known as the ‘pathogenicity’ chromosome, which can be exchanged between strains through horizontal transfer. The three other accessory chromosomes in the Fol reference strain may also be important for virulence towards tomato. Expression of effector genes in Fol is highly up-regulated upon infection and requires Sge1, a transcription factor encoded on the core genome. Interestingly, the pathogenicity chromosome itself contains 13 predicted transcription factor genes and for all except one, there is a homolog on the core genome. We determined DNA binding specificity for nine transcription factors using oligonucleotide arrays. The binding sites for homologous transcription factors were highly similar, suggesting that extensive neofunctionalization of DNA binding specificity has not occurred. Several DNA binding sites are enriched on accessory chromosomes, and expression of FTF1, its core homolog FTF2 and SGE1 from a constitutive promoter can induce expression of effector genes. The DNA binding sites of only these three transcription factors are enriched among genes up-regulated during infection. We further show that Ftf1, Ftf2 and Sge1 can activate transcription from their binding sites in yeast. RNAseq analysis revealed that in strains with constitutive expression of FTF1, FTF2 or SGE1, expression of a similar set of plant-responsive genes on the pathogenicity chromosome is induced, including most effector genes. We conclude that the Fol

  12. A Novel Complementation Assay for Quick and Specific Screen of Genes Encoding Glycerol-3-Phosphate Acyltransferases

    Directory of Open Access Journals (Sweden)

    Jie Lei

    2018-03-01

    Full Text Available The initial step in glycerolipid biosynthesis, especially in diverse allopolyploid crop species, is poorly understood, mainly due to the lack of an effective and convenient method for functional characterization of genes encoding glycerol-3-phosphate acyltransferases (GPATs catalyzing this reaction. Here we present a novel complementation assay for quick and specific characterization of GPAT-encoding genes. Its key design involves rational construction of yeast conditional lethal gat1Δgat2Δ double mutant bearing the heterologous Arabidopsis AtGPAT1 gene whose leaky expression under repressed conditions does not support any non-specific growth, thereby circumventing the false positive problem encountered with the system based on the gat1Δgat2Δ mutant harboring the native episomal GAT1 gene whose leaky expression appears to be sufficient for generating enough GPAT activities for the non-specific restoration of the mutant growth. A complementation assay developed based on this novel mutant enables quick phenotypic screen of GPAT sequences. A high degree of specificity of our assay was exemplified by its ability to differentiate effectively GPAT-encoding genes from those of other fatty acyltransferases and lipid-related sequences. Using this assay, we show that Arabidopsis AtGPAT1, AtGPAT5, and AtGPAT7 can complement the phosphatidate biosynthetic defect in the double mutants. Collectively, our assay provides a powerful tool for rapid screening, validation and optimization of GPAT sequences, aiding future engineering of the initial step of the triacylglycerol biosynthesis in oilseeds.

  13. Genes regulation encoding ADP/ATP carrier in yeasts Saccharomyces cerevisiae and Candida parapsilosis

    International Nuclear Information System (INIS)

    Nebohacova, M.

    2000-01-01

    Genes encoding a mitochondrial ADP/ATP carrier (AAC) in yeast Saccharomyces cerevisiae and Candida parapsilosis were investigated. AAC2 is coding for the major AAC isoform in S. cerevisiae. We suggest that AAC2 is a member of a syn-expression group of genes encoding oxidative phosphorylation proteins. Within our previous studies on the regulation of the AAC2 transcription an UAS (-393/-268) was identified that is essential for the expression of this gene. Two functional regulatory cis-elements are located within this UAS -binding sites for an ABFl factor and for HAP2/3/4/5 heteromeric complex. We examined relative contributions and mutual interactions of the ABFl and HAP2/3/4/5 factors in the activation of transcription from the UAS of the AAC2 gene. The whole UAS was dissected into smaller sub-fragments and tested for (i) the ability to form DNA-protein complexes with cellular proteins in vitro, (ii) the ability to confer heterologous expression using AAC3 gene lacking its own promoter, and (iii) the expression of AAC3-lacZ fusion instead of intact AAC3 gene. The obtained results demonstrated that: a) The whole UAS as well as sub-fragment containing only ABF1-binding site are able to form DNA-protein complexes with cellular proteins in oxygen- and heme- dependent manner. The experiments with antibody against the ABF1 showed that the ABF1 factor is one of the proteins binding to AAC2 promoter. We have been unsuccessful to prove the binding of cellular proteins to the HAP2/3/4/5-binding site. However, the presence of HAP2/3/4/5-binding site is necessary to drive a binding of cellular proteins to the ABF1-binding site in carbon source-dependent manner. b) The presence of both ABF1- and HAP2/3/4/5-binding sites and original spacing between them is necessary to confer the growth of Aaac2 mutant strain on non- fermentable carbon source when put in front of AAC3 gene introduced on centromeric vector to Aaac2 mutant strain. c) For the activation of AAC3-lacZ expression on

  14. Heterogenic expression of genes encoding secreted proteins at the periphery of Aspergillus niger colonies.

    Science.gov (United States)

    Vinck, Arman; de Bekker, Charissa; Ossin, Adam; Ohm, Robin A; de Vries, Ronald P; Wösten, Han A B

    2011-01-01

    Colonization of a substrate by fungi starts with the invasion of exploring hyphae. These hyphae secrete enzymes that degrade the organic material into small molecules that can be taken up by the fungus to serve as nutrients. We previously showed that only part of the exploring hyphae of Aspergillus niger highly express the glucoamylase gene glaA. This was an unexpected finding since all exploring hyphae are exposed to the same environmental conditions. Using GFP as a reporter, we here demonstrate that the acid amylase gene aamA, the α-glucuronidase gene aguA, and the feruloyl esterase gene faeA of A. niger are also subject to heterogenic expression within the exploring mycelium. Coexpression studies using GFP and dTomato as reporters showed that hyphae that highly express one of these genes also highly express the other genes encoding secreted proteins. Moreover, these hyphae also highly express the amylolytic regulatory gene amyR, and the glyceraldehyde-3-phosphate dehydrogenase gene gpdA. In situ hybridization demonstrated that the high expressers are characterized by a high 18S rRNA content. Taken together, it is concluded that two subpopulations of hyphae can be distinguished within the exploring mycelium of A. niger. The experimental data indicate that these subpopulations differ in their transcriptional and translational activity. © 2010 Society for Applied Microbiology and Blackwell Publishing Ltd.

  15. Saccharomyces cerevisiae ribosomal protein L37 is encoded by duplicate genes that are differentially expressed.

    Science.gov (United States)

    Tornow, J; Santangelo, G M

    1994-06-01

    A duplicate copy of the RPL37A gene (encoding ribosomal protein L37) was cloned and sequenced. The coding region of RPL37B is very similar to that of RPL37A, with only one conservative amino-acid difference. However, the intron and flanking sequences of the two genes are extremely dissimilar. Disruption experiments indicate that the two loci are not functionally equivalent: disruption of RPL37B was insignificant, but disruption of RPL37A severely impaired the growth rate of the cell. When both RPL37 loci are disrupted, the cell is unable to grow at all, indicating that rpL37 is an essential protein. The functional disparity between the two RPL37 loci could be explained by differential gene expression. The results of two experiments support this idea: gene fusion of RPL37A to a reporter gene resulted in six-fold higher mRNA levels than was generated by the same reporter gene fused to RPL37B, and a modest increase in gene dosage of RPL37B overcame the lack of a functional RPL37A gene.

  16. Virulence properties of methicillin-susceptible Staphylococcus aureus food isolates encoding Panton-Valentine Leukocidin gene.

    Science.gov (United States)

    Sudagidan, Mert; Aydin, Ali

    2010-04-15

    In this study, three Panton-Valentine Leukocidin gene carrying methicillin-susceptible Staphylococcus aureus (MSSA) strains (M1-AAG42B, PY30C-b and YF1B-b) were isolated from different food samples in Kesan-Edirne, Turkey. These strains were characterized on the basis of MLST type, spa type, virulence factor gene contents, antibiotic susceptibilities against 21 antibiotics and biofilm formation. The genetic relatedness of the strains was determined by PFGE. In addition, the complete gene sequences of lukS-PV and lukF-PV were also investigated. All strains were found to be susceptible to tested antibiotics and they were mecA negative. Three strains showed the same PFGE band pattern, ST152 clonal type and t355 spa type. In the detection of virulence factor genes, sea, seb, sec, sed, see, seg, seh, sei, sej, sek, sel, sem, sen, seo, sep, seq, seu, eta, etb, set1, geh and tst genes were not detected. All strains showed the positive results for alpha- and beta-haemolysin genes (hla and hlb), protease encoding genes (sspA, sspB and aur), lukE and lukD leukocidin genes (lukED). The strains were found to be non-biofilm formers. By this study, the virulence properties of the strains were described and this is one of the first reports regarding PVL-positive MSSA strains from food. (c) 2010 Elsevier B.V. All rights reserved.

  17. Trypanosoma cruzi has not lost its S-adenosylmethionine decarboxylase: characterization of the gene and the encoded enzyme.

    Science.gov (United States)

    Persson, K; Aslund, L; Grahn, B; Hanke, J; Heby, O

    1998-01-01

    All attempts to identify ornithine decarboxylase in the human pathogen Trypanosoma cruzi have failed. The parasites have instead been assumed to depend on putrescine uptake and S-adenosylmethionine decarboxylase (AdoMetDC) for their synthesis of the polyamines spermidine and spermine. We have now identified the gene encoding AdoMetDC in T. cruzi by PCR cloning, with degenerate primers corresponding to conserved amino acid sequences in AdoMetDC proteins of other trypanosomatids. The amplified DNA fragment was used as a probe to isolate the complete AdoMetDC gene from a T. cruzi genomic library. The AdoMetDC gene was located on chromosomes with a size of approx. 1.4 Mbp, and contained a coding region of 1110 bp, specifying a sequence of 370 amino acid residues. The protein showed a sequence identity of only 25% with human AdoMetDC, the major differences being additional amino acids present in the terminal regions of the T. cruzi enzyme. As expected, a higher sequence identity (68-72%) was found in comparison with trypanosomatid AdoMetDCs. When the coding region was expressed in Escherichia coli, the recombinant protein underwent autocatalytic cleavage, generating a 33-34 kDa alpha subunit and a 9 kDa beta subunit. The encoded protein catalysed the decarboxylation of AdoMet (Km 0.21 mM) and was stimulated by putrescine but inhibited by the polyamines, weakly by spermidine and strongly by spermine. Methylglyoxal-bis(guanylhydrazone) (MGBG), a potent inhibitor of human AdoMetDC, was a poor inhibitor of the T. cruzi enzyme. This differential sensitivity to MGBG suggests that the two enzymes are sufficiently different to warrant the search for compounds that might interfere with the progression of Chagas' disease by selectively inhibiting T. cruzi AdoMetDC. PMID:9677309

  18. A DNMT3B alternatively spliced exon and encoded peptide are novel biomarkers of human pluripotent stem cells.

    Directory of Open Access Journals (Sweden)

    Sailesh Gopalakrishna-Pillai

    Full Text Available A major obstacle in human stem cell research is the limited number of reagents capable of distinguishing pluripotent stem cells from partially differentiated or incompletely reprogrammed derivatives. Although human embryonic stem cells (hESCs and induced pluripotent stem cells (iPSCs express numerous alternatively spliced transcripts, little attention has been directed at developing splice variant-encoded protein isoforms as reagents for stem cell research. In this study, several genes encoding proteins involved in important signaling pathways were screened to detect alternatively spliced transcripts that exhibited differential expression in pluripotent stem cells (PSCs relative to spontaneously differentiated cells (SDCs. Transcripts containing the alternatively spliced exon 10 of the de novo DNA methyltransferase gene, DNMT3B, were identified that are expressed in PSCs. To demonstrate the utility and superiority of splice variant specific reagents for stem cell research, a peptide encoded by DNMT3B exon 10 was used to generate an antibody, SG1. The SG1 antibody detects a single DNMT3B protein isoform that is expressed only in PSCs but not in SDCs. The SG1 antibody is also demonstrably superior to other antibodies at distinguishing PSCs from SDCs in mixed cultures containing both pluripotent stem cells and partially differentiated derivatives. The tightly controlled down regulation of DNMT3B exon 10 containing transcripts (and exon 10 encoded peptide upon spontaneous differentiation of PSCs suggests that this DNMT3B splice isoform is characteristic of the pluripotent state. Alternatively spliced exons, and the proteins they encode, represent a vast untapped reservoir of novel biomarkers that can be used to develop superior reagents for stem cell research and to gain further insight into mechanisms controlling stem cell pluripotency.

  19. Genetics and Molecular Biology of Epstein-Barr Virus-Encoded BART MicroRNA: A Paradigm for Viral Modulation of Host Immune Response Genes and Genome Stability

    Directory of Open Access Journals (Sweden)

    David H. Dreyfus

    2017-01-01

    Full Text Available Epstein-Barr virus, a ubiquitous human herpesvirus, is associated through epidemiologic evidence with common autoimmune syndromes and cancers. However, specific genetic mechanisms of pathogenesis have been difficult to identify. In this review, the author summarizes evidence that recently discovered noncoding RNAs termed microRNA encoded by Epstein-Barr virus BARF (BamHI A right frame termed BART (BamHI A right transcripts are modulators of human immune response genes and genome stability in infected and bystander cells. BART expression is apparently regulated by complex feedback loops with the host immune response regulatory NF-κB transcription factors. EBV-encoded BZLF-1 (ZEBRA protein could also regulate BART since ZEBRA contains a terminal region similar to ankyrin proteins such as IκBα that regulate host NF-κB. BALF-2 (BamHI A left frame transcript, a viral homologue of the immunoglobulin and T cell receptor gene recombinase RAG-1 (recombination-activating gene-1, may also be coregulated with BART since BALF-2 regulatory sequences are located near the BART locus. Viral-encoded microRNA and viral mRNA transferred to bystander cells through vesicles, defective viral particles, or other mechanisms suggest a new paradigm in which bystander or hit-and-run mechanisms enable the virus to transiently or chronically alter human immune response genes as well as the stability of the human genome.

  20. Coevolution between Nuclear-Encoded DNA Replication, Recombination, and Repair Genes and Plastid Genome Complexity.

    Science.gov (United States)

    Zhang, Jin; Ruhlman, Tracey A; Sabir, Jamal S M; Blazier, John Chris; Weng, Mao-Lun; Park, Seongjun; Jansen, Robert K

    2016-02-17

    Disruption of DNA replication, recombination, and repair (DNA-RRR) systems has been hypothesized to cause highly elevated nucleotide substitution rates and genome rearrangements in the plastids of angiosperms, but this theory remains untested. To investigate nuclear-plastid genome (plastome) coevolution in Geraniaceae, four different measures of plastome complexity (rearrangements, repeats, nucleotide insertions/deletions, and substitution rates) were evaluated along with substitution rates of 12 nuclear-encoded, plastid-targeted DNA-RRR genes from 27 Geraniales species. Significant correlations were detected for nonsynonymous (dN) but not synonymous (dS) substitution rates for three DNA-RRR genes (uvrB/C, why1, and gyrA) supporting a role for these genes in accelerated plastid genome evolution in Geraniaceae. Furthermore, correlation between dN of uvrB/C and plastome complexity suggests the presence of nucleotide excision repair system in plastids. Significant correlations were also detected between plastome complexity and 13 of the 90 nuclear-encoded organelle-targeted genes investigated. Comparisons revealed significant acceleration of dN in plastid-targeted genes of Geraniales relative to Brassicales suggesting this correlation may be an artifact of elevated rates in this gene set in Geraniaceae. Correlation between dN of plastid-targeted DNA-RRR genes and plastome complexity supports the hypothesis that the aberrant patterns in angiosperm plastome evolution could be caused by dysfunction in DNA-RRR systems. © The Author 2016. Published by Oxford University Press on behalf of the Society for Molecular Biology and Evolution.

  1. Characterization and expression of genes encoding three small heat shock proteins in Sesamia inferens (Lepidoptera: Noctuidae).

    Science.gov (United States)

    Sun, Meng; Lu, Ming-Xing; Tang, Xiao-Tian; Du, Yu-Zhou

    2014-12-12

    The pink stem borer, Sesamia inferens (Walker), is a major pest of rice and is endemic in China and other parts of Asia. Small heat shock proteins (sHSPs) encompass a diverse, widespread class of stress proteins that have not been characterized in S. inferens. In the present study, we isolated and characterized three S. inferens genes that encode members of the α-crystallin/sHSP family, namely, Sihsp21.4, Sihsp20.6, and Sihsp19.6. The three cDNAs encoded proteins of 187, 183 and 174 amino acids with calculated molecular weights of 21.4, 20.6 and 19.6 kDa, respectively. The deduced amino acid sequences of the three genes showed strong similarity to sHSPs identified in other lepidopteran insects. Sihsp21.4 contained an intron, but Sihsp20.6 and Sihsp19.6 lacked introns. Real-time quantitative PCR analyses revealed that Sihsp21.4 was most strongly expressed in S. inferens heads; Whereas expression of Sihsp20.6 and Sihsp19.6 was highest in eggs. The three S. inferens sHSP genes were up-regulated during low temperature stress. In summary, our results show that S. inferens sHSP genes have distinct regulatory roles in the physiology of S. inferens.

  2. Characterization and Expression of Genes Encoding Three Small Heat Shock Proteins in Sesamia inferens (Lepidoptera: Noctuidae

    Directory of Open Access Journals (Sweden)

    Meng Sun

    2014-12-01

    Full Text Available The pink stem borer, Sesamia inferens (Walker, is a major pest of rice and is endemic in China and other parts of Asia. Small heat shock proteins (sHSPs encompass a diverse, widespread class of stress proteins that have not been characterized in S. inferens. In the present study, we isolated and characterized three S. inferens genes that encode members of the α-crystallin/sHSP family, namely, Sihsp21.4, Sihsp20.6, and Sihsp19.6. The three cDNAs encoded proteins of 187, 183 and 174 amino acids with calculated molecular weights of 21.4, 20.6 and 19.6 kDa, respectively. The deduced amino acid sequences of the three genes showed strong similarity to sHSPs identified in other lepidopteran insects. Sihsp21.4 contained an intron, but Sihsp20.6 and Sihsp19.6 lacked introns. Real-time quantitative PCR analyses revealed that Sihsp21.4 was most strongly expressed in S. inferens heads; Whereas expression of Sihsp20.6 and Sihsp19.6 was highest in eggs. The three S. inferens sHSP genes were up-regulated during low temperature stress. In summary, our results show that S. inferens sHSP genes have distinct regulatory roles in the physiology of S. inferens.

  3. Isolation and characterization of the gene encoding the starch debranching enzyme limit dextrinase from germinating barley

    DEFF Research Database (Denmark)

    Kristensen, Michael; Lok, Finn; Planchot, Véronique

    1999-01-01

    with a value of 105 kDa estimated by SDS;;PAGE, The coding sequence is interrupted by 26 introns varying in length from 93 bp to 825 bp. The 27 exons vary in length from 53 bp to 197 bp. Southern blot analysis shows that the limit dextrinase gene is present as a single copy in the barley genome. Gene......The gene encoding the starch debranching enzyme limit dextrinase, LD, from barley (Hordeum vulgare), was isolated from a genomic phage library using a barley cDNA clone as probe. The gene encodes a protein of 904 amino acid residues with a calculated molecular mass of 98.6 kDa. This is in agreement...... expression is high during germination and the steady state transcription level reaches a maximum at day 5 of germination. The deduced amino acid sequence corresponds to the protein sequence of limit dextrinase purified from germinating malt, as determined by automated N-terminal sequencing of tryptic...

  4. Determining the Neural Substrate for Encoding a Memory of Human Pain and the Influence of Anxiety.

    Science.gov (United States)

    Tseng, Ming-Tsung; Kong, Yazhuo; Eippert, Falk; Tracey, Irene

    2017-12-06

    To convert a painful stimulus into a briefly maintainable construct when the painful stimulus is no longer accessible is essential to guide human behavior and avoid dangerous situations. Because of the aversive nature of pain, this encoding process might be influenced by emotional aspects and could thus vary across individuals, but we have yet to understand both the basic underlying neural mechanisms as well as potential interindividual differences. Using fMRI in combination with a delayed-discrimination task in healthy volunteers of both sexes, we discovered that brain regions involved in this working memory encoding process were dissociable according to whether the to-be-remembered stimulus was painful or not, with the medial thalamus and the rostral anterior cingulate cortex encoding painful and the primary somatosensory cortex encoding nonpainful stimuli. Encoding of painful stimuli furthermore significantly enhanced functional connectivity between the thalamus and medial prefrontal cortex (mPFC). With regards to emotional aspects influencing encoding processes, we observed that more anxious participants showed significant performance advantages when encoding painful stimuli. Importantly, only during the encoding of pain, the interindividual differences in anxiety were associated with the strength of coupling between medial thalamus and mPFC, which was furthermore related to activity in the amygdala. These results indicate not only that there is a distinct signature for the encoding of a painful experience in humans, but also that this encoding process involves a strong affective component. SIGNIFICANCE STATEMENT To convert the sensation of pain into a briefly maintainable construct is essential to guide human behavior and avoid dangerous situations. Although this working memory encoding process is implicitly contained in the majority of studies, the underlying neural mechanisms remain unclear. Using fMRI in a delayed-discrimination task, we found that the

  5. Molecular cloning and functional expression of a human cDNA encoding the antimutator enzyme 8-hydroxyguanine-DNA glycosylase

    Science.gov (United States)

    Roldán-Arjona, Teresa; Wei, Ying-Fei; Carter, Kenneth C.; Klungland, Arne; Anselmino, Catherine; Wang, Rui-Ping; Augustus, Meena; Lindahl, Tomas

    1997-01-01

    The major mutagenic base lesion in DNA caused by exposure to reactive oxygen species is 8-hydroxyguanine (8-oxo-7,8-dihydroguanine). In bacteria and Saccharomyces cerevisiae, this damaged base is excised by a DNA glycosylase with an associated lyase activity for chain cleavage. We have cloned, sequenced, and expressed a human cDNA with partial sequence homology to the relevant yeast gene. The encoded 47-kDa human enzyme releases free 8-hydroxyguanine from oxidized DNA and introduces a chain break in a double-stranded oligonucleotide specifically at an 8-hydroxyguanine residue base paired with cytosine. Expression of the human protein in a DNA repair-deficient E. coli mutM mutY strain partly suppresses its spontaneous mutator phenotype. The gene encoding the human enzyme maps to chromosome 3p25. These results show that human cells have an enzyme that can initiate base excision repair at mutagenic DNA lesions caused by active oxygen. PMID:9223306

  6. A plasmid-encoded UmuD homologue regulates expression of Pseudomonas aeruginosa SOS genes.

    Science.gov (United States)

    Díaz-Magaña, Amada; Alva-Murillo, Nayeli; Chávez-Moctezuma, Martha P; López-Meza, Joel E; Ramírez-Díaz, Martha I; Cervantes, Carlos

    2015-07-01

    The Pseudomonas aeruginosa plasmid pUM505 contains the umuDC operon that encodes proteins similar to error-prone repair DNA polymerase V. The umuC gene appears to be truncated and its product is probably not functional. The umuD gene, renamed umuDpR, possesses an SOS box overlapped with a Sigma factor 70 type promoter; accordingly, transcriptional fusions revealed that the umuDpR gene promoter is activated by mitomycin C. The predicted sequence of the UmuDpR protein displays 23 % identity with the Ps. aeruginosa SOS-response LexA repressor. The umuDpR gene caused increased MMC sensitivity when transferred to the Ps. aeruginosa PAO1 strain. As expected, PAO1-derived knockout lexA-  mutant PW6037 showed resistance to MMC; however, when the umuDpR gene was transferred to PW6037, MMC resistance level was reduced. These data suggested that UmuDpR represses the expression of SOS genes, as LexA does. To test whether UmuDpR exerts regulatory functions, expression of PAO1 SOS genes was evaluated by reverse transcription quantitative PCR assays in the lexA-  mutant with or without the pUC_umuD recombinant plasmid. Expression of lexA, imuA and recA genes increased 3.4-5.3 times in the lexA-  mutant, relative to transcription of the corresponding genes in the lexA+ strain, but decreased significantly in the lexA- /umuDpR transformant. These results confirmed that the UmuDpR protein is a repressor of Ps. aeruginosa SOS genes controlled by LexA. Electrophoretic mobility shift assays, however, did not show binding of UmuDpR to 5' regions of SOS genes, suggesting an indirect mechanism of regulation.

  7. Detailed analysis of putative genes encoding small proteins in legume genomes

    Directory of Open Access Journals (Sweden)

    Gabriel eGuillén

    2013-06-01

    Full Text Available Diverse plant genome sequencing projects coupled with powerful bioinformatics tools have facilitated massive data analysis to construct specialized databases classified according to cellular function. However, there are still a considerable number of genes encoding proteins whose function has not yet been characterized. Included in this category are small proteins (SPs, 30-150 amino acids encoded by short open reading frames (sORFs. SPs play important roles in plant physiology, growth, and development. Unfortunately, protocols focused on the genome-wide identification and characterization of sORFs are scarce or remain poorly implemented. As a result, these genes are underrepresented in many genome annotations. In this work, we exploited publicly available genome sequences of Phaseolus vulgaris, Medicago truncatula, Glycine max and Lotus japonicus to analyze the abundance of annotated SPs in plant legumes. Our strategy to uncover bona fide sORFs at the genome level was centered in bioinformatics analysis of characteristics such as evidence of expression (transcription, presence of known protein regions or domains, and identification of orthologous genes in the genomes explored. We collected 6170, 10461, 30521, and 23599 putative sORFs from P. vulgaris, G. max, M. truncatula, and L. japonicus genomes, respectively. Expressed sequence tags (ESTs available in the DFCI Gene Index database provided evidence that ~one-third of the predicted legume sORFs are expressed. Most potential SPs have a counterpart in a different plant species and counterpart regions or domains in larger proteins. Potential functional sORFs were also classified according to a reduced set of GO categories, and the expression of 13 of them during P. vulgaris nodule ontogeny was confirmed by qPCR. This analysis provides a collection of sORFs that potentially encode for meaningful SPs, and offers the possibility of their further functional evaluation.

  8. Atypical DNA methylation of genes encoding cysteine-rich peptides in Arabidopsis thaliana

    Directory of Open Access Journals (Sweden)

    You Wanhui

    2012-04-01

    Full Text Available Abstract Background In plants, transposons and non-protein-coding repeats are epigenetically silenced by CG and non-CG methylation. This pattern of methylation is mediated in part by small RNAs and two specialized RNA polymerases, termed Pol IV and Pol V, in a process called RNA-directed DNA methylation. By contrast, many protein-coding genes transcribed by Pol II contain in their gene bodies exclusively CG methylation that is independent of small RNAs and Pol IV/Pol V activities. It is unclear how the different methylation machineries distinguish between transposons and genes. Here we report on a group of atypical genes that display in their coding region a transposon-like methylation pattern, which is associated with gene silencing in sporophytic tissues. Results We performed a methylation-sensitive amplification polymorphism analysis to search for targets of RNA-directed DNA methylation in Arabidopsis thaliana and identified several members of a gene family encoding cysteine-rich peptides (CRPs. In leaves, the CRP genes are silent and their coding regions contain dense, transposon-like methylation in CG, CHG and CHH contexts, which depends partly on the Pol IV/Pol V pathway and small RNAs. Methylation in the coding region is reduced, however, in the synergid cells of the female gametophyte, where the CRP genes are specifically expressed. Further demonstrating that expressed CRP genes lack gene body methylation, a CRP4-GFP fusion gene under the control of the constitutive 35 S promoter remains unmethylated in leaves and is transcribed to produce a translatable mRNA. By contrast, a CRP4-GFP fusion gene under the control of a CRP4 promoter fragment acquires CG and non-CG methylation in the CRP coding region in leaves similar to the silent endogenous CRP4 gene. Conclusions Unlike CG methylation in gene bodies, which does not dramatically affect Pol II transcription, combined CG and non-CG methylation in CRP coding regions is likely to

  9. Low nucleosome occupancy is encoded around functional human transcription factor binding sites

    Directory of Open Access Journals (Sweden)

    Daenen Floris

    2008-07-01

    Full Text Available Abstract Background Transcriptional regulation of genes in eukaryotes is achieved by the interactions of multiple transcription factors with arrays of transcription factor binding sites (TFBSs on DNA and with each other. Identification of these TFBSs is an essential step in our understanding of gene regulatory networks, but computational prediction of TFBSs with either consensus or commonly used stochastic models such as Position-Specific Scoring Matrices (PSSMs results in an unacceptably high number of hits consisting of a few true functional binding sites and numerous false non-functional binding sites. This is due to the inability of the models to incorporate higher order properties of sequences including sequences surrounding TFBSs and influencing the positioning of nucleosomes and/or the interactions that might occur between transcription factors. Results Significant improvement can be expected through the development of a new framework for the modeling and prediction of TFBSs that considers explicitly these higher order sequence properties. It would be particularly interesting to include in the new modeling framework the information present in the nucleosome positioning sequences (NPSs surrounding TFBSs, as it can be hypothesized that genomes use this information to encode the formation of stable nucleosomes over non-functional sites, while functional sites have a more open chromatin configuration. In this report we evaluate the usefulness of the latter feature by comparing the nucleosome occupancy probabilities around experimentally verified human TFBSs with the nucleosome occupancy probabilities around false positive TFBSs and in random sequences. Conclusion We present evidence that nucleosome occupancy is remarkably lower around true functional human TFBSs as compared to non-functional human TFBSs, which supports the use of this feature to improve current TFBS prediction approaches in higher eukaryotes.

  10. Relationships between protein-encoding gene abundance and corresponding process are commonly assumed yet rarely observed

    Science.gov (United States)

    Rocca, Jennifer D.; Hall, Edward K.; Lennon, Jay T.; Evans, Sarah E.; Waldrop, Mark P.; Cotner, James B.; Nemergut, Diana R.; Graham, Emily B.; Wallenstein, Matthew D.

    2015-01-01

    For any enzyme-catalyzed reaction to occur, the corresponding protein-encoding genes and transcripts are necessary prerequisites. Thus, a positive relationship between the abundance of gene or transcripts and corresponding process rates is often assumed. To test this assumption, we conducted a meta-analysis of the relationships between gene and/or transcript abundances and corresponding process rates. We identified 415 studies that quantified the abundance of genes or transcripts for enzymes involved in carbon or nitrogen cycling. However, in only 59 of these manuscripts did the authors report both gene or transcript abundance and rates of the appropriate process. We found that within studies there was a significant but weak positive relationship between gene abundance and the corresponding process. Correlations were not strengthened by accounting for habitat type, differences among genes or reaction products versus reactants, suggesting that other ecological and methodological factors may affect the strength of this relationship. Our findings highlight the need for fundamental research on the factors that control transcription, translation and enzyme function in natural systems to better link genomic and transcriptomic data to ecosystem processes.

  11. Cloning an artificial gene encoding angiostatic anginex: From designed peptide to functional recombinant protein

    International Nuclear Information System (INIS)

    Brandwijk, Ricardo J.M.G.E.; Nesmelova, Irina; Dings, Ruud P.M.; Mayo, Kevin H.; Thijssen, Victor L.J.L.; Griffioen, Arjan W.

    2005-01-01

    Anginex, a designed peptide 33-mer, is a potent angiogenesis inhibitor and anti-tumor agent in vivo. Anginex functions by inhibiting endothelial cell (EC) proliferation and migration leading to detachment and apoptosis of activated EC's. To better understand tumor endothelium targeting properties of anginex and enable its use in gene therapy, we constructed an artificial gene encoding the biologically exogenous peptide and produced the protein recombinantly in Pichia pastoris. Mass spectrometry shows recombinant anginex to be a dimer and circular dichroism shows the recombinant protein folds with β-strand structure like the synthetic peptide. Moreover, like parent anginex, the recombinant protein is active at inhibiting EC growth and migration, as well as inhibiting angiogenesis in vivo in the chorioallantoic membrane of the chick embryo. This study demonstrated that it is possible to produce a functionally active protein version of a rationally designed peptide, using an artificial gene and the recombinant protein approach

  12. Surfactant Protein-D-Encoding Gene Variant Polymorphisms Are Linked to Respiratory Outcome in Premature Infants

    DEFF Research Database (Denmark)

    Sorensen, Grith Lykke; Dahl, Marianne; Tan, Qihua

    2014-01-01

    OBJECTIVE: Associations between the genetic variation within or downstream of the surfactant protein-D-encoding gene (SFTPD), which encodes the collectin surfactant protein-D (SP-D) and may lead to respiratory distress syndrome or bronchopulmonary dysplasia, recently were reported. Our aim...... were used to associate genetic variation to SP-D, respiratory distress (RD), oxygen requirement, and respiratory support. RESULTS: The 5'-upstream SFTPD SNP rs1923534 and the 3 structural SNPs rs721917, rs2243639, and rs3088308 were associated with the SP-D level. The same SNPs were associated with RD......, a requirement for supplemental oxygen, and a requirement for respiratory support. Haplotype analyses identified 3 haplotypes that included the minor alleles of rs1923534, rs721917, and rs3088308 that exhibited highly significant associations with decreased SP-D levels and decreased ORs for RD, oxygen...

  13. Methodology for eliciting, encoding and simulating human decision making behaviour

    OpenAIRE

    Rider, Conrad Edgar Scott

    2012-01-01

    Agent-based models (ABM) are an increasingly important research tool for describing and predicting interactions among humans and their environment. A key challenge for such models is the ability to faithfully represent human decision making with respect to observed behaviour. This thesis aims to address this challenge by developing a methodology for empirical measurement and simulation of decision making in humanenvironment systems. The methodology employs the Beliefs-Desires-I...

  14. Gene encoding a deubiquitinating enzyme is mutated in artesunate- and chloroquine-resistant rodent malaria parasites§

    Science.gov (United States)

    Hunt, Paul; Afonso, Ana; Creasey, Alison; Culleton, Richard; Sidhu, Amar Bir Singh; Logan, John; Valderramos, Stephanie G; McNae, Iain; Cheesman, Sandra; do Rosario, Virgilio; Carter, Richard; Fidock, David A; Cravo, Pedro

    2007-01-01

    Artemisinin- and artesunate-resistant Plasmodium chabaudi mutants, AS-ART and AS-ATN, were previously selected from chloroquine-resistant clones AS-30CQ and AS-15CQ respectively. Now, a genetic cross between AS-ART and the artemisinin-sensitive clone AJ has been analysed by Linkage Group Selection. A genetic linkage group on chromosome 2 was selected under artemisinin treatment. Within this locus, we identified two different mutations in a gene encoding a deubiquitinating enzyme. A distinct mutation occurred in each of the clones AS-30CQ and AS-ATN, relative to their respective progenitors in the AS lineage. The mutations occurred independently in different clones under drug selection with chloroquine (high concentration) or artesunate. Each mutation maps to a critical residue in a homologous human deubiquitinating protein structure. Although one mutation could theoretically account for the resistance of AS-ATN to artemisinin derivates, the other cannot account solely for the resistance of AS-ART, relative to the responses of its sensitive progenitor AS-30CQ. Two lines of Plasmodium falciparum with decreased susceptibility to artemisinin were also selected. Their drug-response phenotype was not genetically stable. No mutations in the UBP-1 gene encoding the P. falciparum orthologue of the deubiquitinating enzyme were observed. The possible significance of these mutations in parasite responses to chloroquine or artemisinin is discussed. PMID:17581118

  15. Parametric fMRI analysis of visual encoding in the human medial temporal lobe.

    Science.gov (United States)

    Rombouts, S A; Scheltens, P; Machielson, W C; Barkhof, F; Hoogenraad, F G; Veltman, D J; Valk, J; Witter, M P

    1999-01-01

    A number of functional brain imaging studies indicate that the medial temporal lobe system is crucially involved in encoding new information into memory. However, most studies were based on differences in brain activity between encoding of familiar vs. novel stimuli. To further study the underlying cognitive processes, we applied a parametric design of encoding. Seven healthy subjects were instructed to encode complex color pictures into memory. Stimuli were presented in a parametric fashion at different rates, thus representing different loads of encoding. Functional magnetic resonance imaging (fMRI) was used to assess changes in brain activation. To determine the number of pictures successfully stored into memory, recognition scores were determined afterwards. During encoding, brain activation occurred in the medial temporal lobe, comparable to the results obtained by others. Increasing the encoding load resulted in an increase in the number of successfully stored items. This was reflected in a significant increase in brain activation in the left lingual gyrus, in the left and right parahippocampal gyrus, and in the right inferior frontal gyrus. This study shows that fMRI can detect changes in brain activation during variation of one aspect of higher cognitive tasks. Further, it strongly supports the notion that the human medial temporal lobe is involved in encoding novel visual information into memory.

  16. Real-time PCR expression profiling of genes encoding potential virulence factors in Candida albicans biofilms: identification of model-dependent and -independent gene expression

    Directory of Open Access Journals (Sweden)

    Řičicová Markéta

    2010-04-01

    Full Text Available Abstract Background Candida albicans infections are often associated with biofilm formation. Previous work demonstrated that the expression of HWP1 (hyphal wall protein and of genes belonging to the ALS (agglutinin-like sequence, SAP (secreted aspartyl protease, PLB (phospholipase B and LIP (lipase gene families is associated with biofilm growth on mucosal surfaces. We investigated using real-time PCR whether genes encoding potential virulence factors are also highly expressed in biofilms associated with abiotic surfaces. For this, C. albicans biofilms were grown on silicone in microtiter plates (MTP or in the Centres for Disease Control (CDC reactor, on polyurethane in an in vivo subcutaneous catheter rat (SCR model, and on mucosal surfaces in the reconstituted human epithelium (RHE model. Results HWP1 and genes belonging to the ALS, SAP, PLB and LIP gene families were constitutively expressed in C. albicans biofilms. ALS1-5 were upregulated in all model systems, while ALS9 was mostly downregulated. ALS6 and HWP1 were overexpressed in all models except in the RHE and MTP, respectively. The expression levels of SAP1 were more pronounced in both in vitro models, while those of SAP2, SAP4 and SAP6 were higher in the in vivo model. Furthermore, SAP5 was highly upregulated in the in vivo and RHE models. For SAP9 and SAP10 similar gene expression levels were observed in all model systems. PLB genes were not considerably upregulated in biofilms, while LIP1-3, LIP5-7 and LIP9-10 were highly overexpressed in both in vitro models. Furthermore, an elevated lipase activity was detected in supernatans of biofilms grown in the MTP and RHE model. Conclusions Our findings show that HWP1 and most of the genes belonging to the ALS, SAP and LIP gene families are upregulated in C. albicans biofilms. Comparison of the fold expression between the various model systems revealed similar expression levels for some genes, while for others model-dependent expression

  17. Genes encoding novel lipid transporters and their use to increase oil production in vegetative tissues of plants

    Science.gov (United States)

    Xu, Changcheng; Fan, Jilian; Yan, Chengshi; Shanklin, John

    2017-12-26

    The present invention discloses a novel gene encoding a transporter protein trigalactosyldiacylglycerol-5 (TGD5), mutations thereof and their use to enhance TAG production and retention in plant vegetative tissue.

  18. Identification of DNA repair genes in the human genome

    International Nuclear Information System (INIS)

    Hoeijmakers, J.H.J.; van Duin, M.; Westerveld, A.; Yasui, A.; Bootsma, D.

    1986-01-01

    To identify human DNA repair genes we have transfected human genomic DNA ligated to a dominant marker to excision repair deficient xeroderma pigmentosum (XP) and CHO cells. This resulted in the cloning of a human gene, ERCC-1, that complements the defect of a UV- and mitomycin-C sensitive CHO mutant 43-3B. The ERCC-1 gene has a size of 15 kb, consists of 10 exons and is located in the region 19q13.2-q13.3. Its primary transcript is processed into two mRNAs by alternative splicing of an internal coding exon. One of these transcripts encodes a polypeptide of 297 aminoacids. A putative DNA binding protein domain and nuclear location signal could be identified. Significant AA-homology is found between ERCC-1 and the yeast excision repair gene RAD10. 58 references, 6 figures, 1 table

  19. The porcine lymphotropic herpesvirus 1 encodes functional regulators of gene expression

    International Nuclear Information System (INIS)

    Lindner, I.; Ehlers, B.; Noack, S.; Dural, G.; Yasmum, N.; Bauer, C.; Goltz, M.

    2007-01-01

    The porcine lymphotropic herpesviruses (PLHV) are discussed as possible risk factors in xenotransplantation because of the high prevalence of PLHV-1, PLHV-2 and PLHV-3 in pig populations world-wide and the fact that PLHV-1 has been found to be associated with porcine post-transplant lymphoproliferative disease. To provide structural and functional knowledge on the PLHV immediate-early (IE) transactivator genes, the central regions of the PLHV genomes were characterized by genome walking, sequence and splicing analysis. Three spliced genes were identified (ORF50, ORFA6/BZLF1 h , ORF57) encoding putative IE transactivators, homologous to (i) ORF50 and BRLF1/Rta (ii) K8/K-bZIP and BZLF1/Zta and (iii) ORF57 and BMLF1 of HHV-8 and EBV, respectively. Expressed as myc-tag or HA-tag fusion proteins, they were located to the cellular nucleus. In reporter gene assays, several PLHV-promoters were mainly activated by PLHV-1 ORF50, to a lower level by PLHV-1 ORFA6/BZLF1 h and not by PLHV-1 ORF57. However, the ORF57-encoded protein acted synergistically on ORF50-mediated activation

  20. RAD6 gene of Saccharomyces cerevisiae encodes a protein containing a tract of 13 consecutive aspartates

    International Nuclear Information System (INIS)

    Reynolds, P.; Weber, S.; Prakash, L.

    1985-01-01

    The RAD6 gene of Saccharomyces cerevisiae is required for postreplication repair of UV-damaged DNA, for induced mutagenesis, and for sporulation. The authors have mapped the transcripts and determined the nucleotide sequence of the cloned RAD6 gene. The RAD6 gene encodes two transcripts of 0.98 and 0.86 kilobases which differ only in their 3' termini. The transcribed region contains an open reading frame of 516 nucleotides. The rad6-1 and rad6-3 mutant alleles, which the authors have cloned and sequenced, introduce amber and ochre nonsense mutations, respectively into the open reading frame, proving that it encodes the RAD6 protein. The RAD6 protein predicted by the nucleotide sequence is 172 amino acids long, has a molecular weight of 19,704, and contains 23.3% acidic and 11.6% basic residues. Its most striking feature is the highly acidic carboxyl terminus: 20 of the 23 terminal amino acids are acidic, including 13 consecutive aspartates. RAD6 protein thus resembles high mobility group proteins HMG-1 and HMG-2, which each contain a carboxyl-proximal tract of acidic amino acids. 48 references, 6 figures

  1. Identification of the Gene Encoding Isoprimeverose-producing Oligoxyloglucan Hydrolase in Aspergillus oryzae*

    Science.gov (United States)

    Matsuzawa, Tomohiko; Mitsuishi, Yasushi; Kameyama, Akihiko

    2016-01-01

    Aspergillus oryzae produces a unique β-glucosidase, isoprimeverose-producing oligoxyloglucan hydrolase (IPase), that recognizes and releases isoprimeverose (α-d-xylopyranose-(1→6)-d-glucopyranose) units from the non-reducing ends of oligoxyloglucans. A gene encoding A. oryzae IPase, termed ipeA, was identified and expressed in Pichia pastoris. With the exception of cellobiose, IpeA hydrolyzes a variety of oligoxyloglucans and is a member of the glycoside hydrolase family 3. Xylopyranosyl branching at the non-reducing ends was vital for IPase activity, and galactosylation at a α-1,6-linked xylopyranosyl side chain completely abolished IpeA activity. Hepta-oligoxyloglucan saccharide (Xyl3Glc4) substrate was preferred over tri- (Xyl1Glc2) and tetra- (Xyl2Glc2) oligoxyloglucan saccharides substrates. IpeA transferred isoprimeverose units to other saccharides, indicating transglycosylation activity. The ipeA gene was expressed in xylose and xyloglucan media and was strongly induced in the presence of xyloglucan endo-xyloglucanase-hydrolyzed products. This is the first study to report the identification of a gene encoding IPase in eukaryotes. PMID:26755723

  2. Multiple ace genes encoding acetylcholinesterases of Caenorhabditis elegans have distinct tissue expression.

    Science.gov (United States)

    Combes, Didier; Fedon, Yann; Toutant, Jean-Pierre; Arpagaus, Martine

    2003-08-01

    ace-1 and ace-2 genes encoding acetylcholinesterase in the nematode Caenorhabditis elegans present 35% identity in coding sequences but no homology in noncoding regions (introns, 5'- and 3'-untranslated regions). A 5'-region of ace-2 was defined by rescue of ace-1;ace-2 mutants. When green fluorescent protein (GFP) expression was driven by this regulatory region, the resulting pattern was distinct from that of ace-1. This latter gene is expressed in all body-wall and vulval muscle cells (Culetto et al., 1999), whereas ace-2 is expressed almost exclusively in neurons. ace-3 and ace-4 genes are located in close proximity on chromosome II (Combes et al., 2000). These two genes were first transcribed in vivo as a bicistronic messenger and thus constitute an ace-3;ace-4 operon. However, there was a very low level of monocistronic mRNA of ace-4 (the upstream gene) in vivo, and no ACE-4 enzymatic activity was ever detected. GFP expression driven by a 5' upstream region of the ace-3;ace-4 operon was detected in several muscle cells of the pharynx (pm3, pm4, pm5 and pm7) and in the two canal associated neurons (CAN cells). A dorsal row of body-wall muscle cells was intensively labelled in larval stages but no longer detected in adults. The distinct tissue-specific expression of ace-1, ace-2 and ace-3 (coexpressed only in pm5 cells) indicates that ace genes are not redundant.

  3. Regulation of dsr genes encoding proteins responsible for the oxidation of stored sulfur in Allochromatium vinosum.

    Science.gov (United States)

    Grimm, Frauke; Dobler, Nadine; Dahl, Christiane

    2010-03-01

    Sulfur globules are formed as obligatory intermediates during the oxidation of reduced sulfur compounds in many environmentally important photo- and chemolithoautotrophic bacteria. It is well established that the so-called Dsr proteins are essential for the oxidation of zero-valent sulfur accumulated in the globules; however, hardly anything is known about the regulation of dsr gene expression. Here, we present a closer look at the regulation of the dsr genes in the phototrophic sulfur bacterium Allochromatium vinosum. The dsr genes are expressed in a reduced sulfur compound-dependent manner and neither sulfite, the product of the reverse-acting dissimilatory sulfite reductase DsrAB, nor the alternative electron donor malate inhibit the gene expression. Moreover, we show the oxidation of sulfur to sulfite to be the rate-limiting step in the oxidation of sulfur to sulfate as sulfate production starts concomitantly with the upregulation of the expression of the dsr genes. Real-time RT-PCR experiments suggest that the genes dsrC and dsrS are additionally expressed from secondary internal promoters, pointing to a special function of the encoded proteins. Earlier structural analyses indicated the presence of a helix-turn-helix (HTH)-like motif in DsrC. We therefore assessed the DNA-binding capability of the protein and provide evidence for a possible regulatory function of DsrC.

  4. The precuneus may encode irrationality in human gambling.

    Science.gov (United States)

    Sacre, P; Kerr, M S D; Subramanian, S; Kahn, K; Gonzalez-Martinez, J; Johnson, M A; Sarma, S V; Gale, J T

    2016-08-01

    Humans often make irrational decisions, especially psychiatric patients who have dysfunctional cognitive and emotional circuitry. Understanding the neural basis of decision-making is therefore essential towards patient management, yet current studies suffer from several limitations. Functional magnetic resonance imaging (fMRI) studies in humans have dominated decision-making neuroscience, but have poor temporal resolution and the blood oxygenation level-dependent signal is only a proxy for neural activity. On the other hand, lesion studies in humans used to infer functionality in decision-making lack characterization of neural activity altogether. Using a combination of local field potential recordings in human subjects performing a financial decision-making task, spectral analyses, and non-parametric cluster statistics, we analyzed the activity in the precuneus. In nine subjects, the neural activity modulated significantly between rational and irrational trials in the precuneus (p decisions were made. Although preliminary, these results suggest suppression of gamma rhythms via electrical stimulation in the precuneus as a therapeutic intervention for pathological decision-making.

  5. Diversity of beetle genes encoding novel plant cell wall degrading enzymes.

    Directory of Open Access Journals (Sweden)

    Yannick Pauchet

    Full Text Available Plant cell walls are a heterogeneous mixture of polysaccharides and proteins that require a range of different enzymes to degrade them. Plant cell walls are also the primary source of cellulose, the most abundant and useful biopolymer on the planet. Plant cell wall degrading enzymes (PCWDEs are therefore important in a wide range of biotechnological processes from the production of biofuels and food to waste processing. However, despite the fact that the last common ancestor of all deuterostomes was inferred to be able to digest, or even synthesize, cellulose using endogenous genes, all model insects whose complete genomes have been sequenced lack genes encoding such enzymes. To establish if the apparent "disappearance" of PCWDEs from insects is simply a sampling problem, we used 454 mediated pyrosequencing to scan the gut transcriptomes of beetles that feed on a variety of plant derived diets. By sequencing the transcriptome of five beetles, and surveying publicly available ESTs, we describe 167 new beetle PCWDEs belonging to eight different enzyme families. This survey proves that these enzymes are not only present in non-model insects but that the multigene families that encode them are apparently undergoing complex birth-death dynamics. This reinforces the observation that insects themselves, and not just their microbial symbionts, are a rich source of PCWDEs. Further it emphasises that the apparent absence of genes encoding PCWDEs from model organisms is indeed simply a sampling artefact. Given the huge diversity of beetles alive today, and the diversity of their lifestyles and diets, we predict that beetle guts will emerge as an important new source of enzymes for use in biotechnology.

  6. Identification and characterization of an oleate hydratase-encoding gene from Bifidobacterium breve.

    Science.gov (United States)

    O'Connell, Kerry Joan; Motherway, Mary O'Connell; Hennessey, Alan A; Brodhun, Florian; Ross, R Paul; Feussner, Ivo; Stanton, Catherine; Fitzgerald, Gerald F; van Sinderen, Douwe

    2013-01-01

    Bifidobacteria are common commensals of the mammalian gastrointestinal tract. Previous studies have suggested that a bifidobacterial myosin cross reactive antigen (MCRA) protein plays a role in bacterial stress tolerance, while this protein has also been linked to the biosynthesis of conjugated linoleic acid (CLA) in bifidobacteria. In order to increase our understanding on the role of MCRA in bifidobacteria we created and analyzed an insertion mutant of the MCRA-encoding gene of B. breve NCFB 2258. Our results demonstrate that the MCRA protein of B. breve NCFB 2258 does not appear to play a role in CLA production, yet is an oleate hydratase, which contributes to bifidobacterial solvent stress protection.

  7. Expression analysis of the Theileria parva subtelomere-encoded variable secreted protein gene family.

    Directory of Open Access Journals (Sweden)

    Jacqueline Schmuckli-Maurer

    Full Text Available The intracellular protozoan parasite Theileria parva transforms bovine lymphocytes inducing uncontrolled proliferation. Proteins released from the parasite are assumed to contribute to phenotypic changes of the host cell and parasite persistence. With 85 members, genes encoding subtelomeric variable secreted proteins (SVSPs form the largest gene family in T. parva. The majority of SVSPs contain predicted signal peptides, suggesting secretion into the host cell cytoplasm.We analysed SVSP expression in T. parva-transformed cell lines established in vitro by infection of T or B lymphocytes with cloned T. parva parasites. Microarray and quantitative real-time PCR analysis revealed mRNA expression for a wide range of SVSP genes. The pattern of mRNA expression was largely defined by the parasite genotype and not by host background or cell type, and found to be relatively stable in vitro over a period of two months. Interestingly, immunofluorescence analysis carried out on cell lines established from a cloned parasite showed that expression of a single SVSP encoded by TP03_0882 is limited to only a small percentage of parasites. Epitope-tagged TP03_0882 expressed in mammalian cells was found to translocate into the nucleus, a process that could be attributed to two different nuclear localisation signals.Our analysis reveals a complex pattern of Theileria SVSP mRNA expression, which depends on the parasite genotype. Whereas in cell lines established from a cloned parasite transcripts can be found corresponding to a wide range of SVSP genes, only a minority of parasites appear to express a particular SVSP protein. The fact that a number of SVSPs contain functional nuclear localisation signals suggests that proteins released from the parasite could contribute to phenotypic changes of the host cell. This initial characterisation will facilitate future studies on the regulation of SVSP gene expression and the potential biological role of these enigmatic

  8. Effects of TCDD on the expression of nuclear encoded mitochondrial genes

    International Nuclear Information System (INIS)

    Forgacs, Agnes L.; Burgoon, Lyle D.; Lynn, Scott G.; LaPres, John J.; Zacharewski, Timothy

    2010-01-01

    Generation of mitochondrial reactive oxygen species (ROS) can be perturbed following exposure to environmental chemicals such as 2,3,7,8-tetrachlorodibenzo-p-dioxin (TCDD). Reports indicate that the aryl hydrocarbon receptor (AhR) mediates TCDD-induced sustained hepatic oxidative stress by decreasing hepatic ATP levels and through hyperpolarization of the inner mitochondrial membrane. To further elucidate the effects of TCDD on the mitochondria, high-throughput quantitative real-time PCR (HTP-QRTPCR) was used to evaluate the expression of 90 nuclear genes encoding mitochondrial proteins involved in electron transport, oxidative phosphorylation, uncoupling, and associated chaperones. HTP-QRTPCR analysis of time course (30 μg/kg TCDD at 2, 4, 8, 12, 18, 24, 72, and 168 h) liver samples obtained from orally gavaged immature, ovariectomized C57BL/6 mice identified 54 differentially expressed genes (|fold change| > 1.5 and P-value < 0.1). Of these, 8 exhibited a sigmoidal or exponential dose-response profile (0.03 to 300 μg/kg TCDD) at 4, 24 or 72 h. Dose-responsive genes encoded proteins associated with electron transport chain (ETC) complexes I (NADH dehydrogenase), III (cytochrome c reductase), IV (cytochrome c oxidase), and V (ATP synthase) and could be generally categorized as having proton gradient, ATP synthesis, and chaperone activities. In contrast, transcript levels of ETC complex II, succinate dehydrogenase, remained unchanged. Putative dioxin response elements were computationally found in the promoter regions of all 8 dose-responsive genes. This high-throughput approach suggests that TCDD alters the expression of genes associated with mitochondrial function which may contribute to TCDD-elicited mitochondrial toxicity.

  9. Nucleotide sequence of a human cDNA encoding a ras-related protein (rap1B)

    Energy Technology Data Exchange (ETDEWEB)

    Pizon, V; Lerosey, I; Chardin, P; Tavitian, A [INSERM, Paris (France)

    1988-08-11

    The authors have previously characterized two human ras-related genes rap1 and rap2. Using the rap1 clone as probe they isolated and sequenced a new rap cDNA encoding the 184aa rap1B protein. The rap1B protein is 95% identical to rap1 and shares several properties with the ras protein suggesting that it could bind GTP/GDP and have a membrane location. As for rap1, the structural characteristics of rap1B suggest that the rap and ras proteins might interact on the same effector.

  10. Expression of genes encoding multi-transmembrane proteins in specific primate taste cell populations.

    Directory of Open Access Journals (Sweden)

    Bryan D Moyer

    Full Text Available BACKGROUND: Using fungiform (FG and circumvallate (CV taste buds isolated by laser capture microdissection and analyzed using gene arrays, we previously constructed a comprehensive database of gene expression in primates, which revealed over 2,300 taste bud-associated genes. Bioinformatics analyses identified hundreds of genes predicted to encode multi-transmembrane domain proteins with no previous association with taste function. A first step in elucidating the roles these gene products play in gustation is to identify the specific taste cell types in which they are expressed. METHODOLOGY/PRINCIPAL FINDINGS: Using double label in situ hybridization analyses, we identified seven new genes expressed in specific taste cell types, including sweet, bitter, and umami cells (TRPM5-positive, sour cells (PKD2L1-positive, as well as other taste cell populations. Transmembrane protein 44 (TMEM44, a protein with seven predicted transmembrane domains with no homology to GPCRs, is expressed in a TRPM5-negative and PKD2L1-negative population that is enriched in the bottom portion of taste buds and may represent developmentally immature taste cells. Calcium homeostasis modulator 1 (CALHM1, a component of a novel calcium channel, along with family members CALHM2 and CALHM3; multiple C2 domains; transmembrane 1 (MCTP1, a calcium-binding transmembrane protein; and anoctamin 7 (ANO7, a member of the recently identified calcium-gated chloride channel family, are all expressed in TRPM5 cells. These proteins may modulate and effect calcium signalling stemming from sweet, bitter, and umami receptor activation. Synaptic vesicle glycoprotein 2B (SV2B, a regulator of synaptic vesicle exocytosis, is expressed in PKD2L1 cells, suggesting that this taste cell population transmits tastant information to gustatory afferent nerve fibers via exocytic neurotransmitter release. CONCLUSIONS/SIGNIFICANCE: Identification of genes encoding multi-transmembrane domain proteins

  11. Development and validation of a microarray for the investigation of the CAZymes encoded by the human gut microbiome.

    Directory of Open Access Journals (Sweden)

    Abdessamad El Kaoutari

    Full Text Available Distal gut bacteria play a pivotal role in the digestion of dietary polysaccharides by producing a large number of carbohydrate-active enzymes (CAZymes that the host otherwise does not produce. We report here the design of a custom microarray that we used to spot non-redundant DNA probes for more than 6,500 genes encoding glycoside hydrolases and lyases selected from 174 reference genomes from distal gut bacteria. The custom microarray was tested and validated by the hybridization of bacterial DNA extracted from the stool samples of lean, obese and anorexic individuals. Our results suggest that a microarray-based study can detect genes from low-abundance bacteria better than metagenomic-based studies. A striking example was the finding that a gene encoding a GH6-family cellulase was present in all subjects examined, whereas metagenomic studies have consistently failed to detect this gene in both human and animal gut microbiomes. In addition, an examination of eight stool samples allowed the identification of a corresponding CAZome core containing 46 families of glycoside hydrolases and polysaccharide lyases, which suggests the functional stability of the gut microbiota despite large taxonomical variations between individuals.

  12. GRN2SBML: automated encoding and annotation of inferred gene regulatory networks complying with SBML.

    Science.gov (United States)

    Vlaic, Sebastian; Hoffmann, Bianca; Kupfer, Peter; Weber, Michael; Dräger, Andreas

    2013-09-01

    GRN2SBML automatically encodes gene regulatory networks derived from several inference tools in systems biology markup language. Providing a graphical user interface, the networks can be annotated via the simple object access protocol (SOAP)-based application programming interface of BioMart Central Portal and minimum information required in the annotation of models registry. Additionally, we provide an R-package, which processes the output of supported inference algorithms and automatically passes all required parameters to GRN2SBML. Therefore, GRN2SBML closes a gap in the processing pipeline between the inference of gene regulatory networks and their subsequent analysis, visualization and storage. GRN2SBML is freely available under the GNU Public License version 3 and can be downloaded from http://www.hki-jena.de/index.php/0/2/490. General information on GRN2SBML, examples and tutorials are available at the tool's web page.

  13. Relating genes to function: identifying enriched transcription factors using the ENCODE ChIP-Seq significance tool.

    Science.gov (United States)

    Auerbach, Raymond K; Chen, Bin; Butte, Atul J

    2013-08-01

    Biological analysis has shifted from identifying genes and transcripts to mapping these genes and transcripts to biological functions. The ENCODE Project has generated hundreds of ChIP-Seq experiments spanning multiple transcription factors and cell lines for public use, but tools for a biomedical scientist to analyze these data are either non-existent or tailored to narrow biological questions. We present the ENCODE ChIP-Seq Significance Tool, a flexible web application leveraging public ENCODE data to identify enriched transcription factors in a gene or transcript list for comparative analyses. The ENCODE ChIP-Seq Significance Tool is written in JavaScript on the client side and has been tested on Google Chrome, Apple Safari and Mozilla Firefox browsers. Server-side scripts are written in PHP and leverage R and a MySQL database. The tool is available at http://encodeqt.stanford.edu. abutte@stanford.edu Supplementary material is available at Bioinformatics online.

  14. Genes encoding chimeras of Neurospora crassa erg-3 and human ...

    Indian Academy of Sciences (India)

    Unknown

    (FGSC), University of Kansas Medical Center, Kansas. City, KS 66103, USA. .... pCH1-Hph digested with the same enzymes to produce ..... Wheat coding sequences are characterized by a high GC content and by a related strong bias of codon ...

  15. Encoding of physics concepts: concreteness and presentation modality reflected by human brain dynamics.

    Directory of Open Access Journals (Sweden)

    Kevin Lai

    Full Text Available Previous research into working memory has focused on activations in different brain areas accompanying either different presentation modalities (verbal vs. non-verbal or concreteness (abstract vs. concrete of non-science concepts. Less research has been conducted investigating how scientific concepts are learned and further processed in working memory. To bridge this gap, the present study investigated human brain dynamics associated with encoding of physics concepts, taking both presentation modality and concreteness into account. Results of this study revealed greater theta and low-beta synchronization in the anterior cingulate cortex (ACC during encoding of concrete pictures as compared to the encoding of both high and low imageable words. In visual brain areas, greater theta activity accompanying stimulus onsets was observed for words as compared to pictures while stronger alpha suppression was observed in responses to pictures as compared to words. In general, the EEG oscillation patterns for encoding words of different levels of abstractness were comparable but differed significantly from encoding of pictures. These results provide insights into the effects of modality of presentation on human encoding of scientific concepts and thus might help in developing new ways to better teach scientific concepts in class.

  16. Encoding of physics concepts: concreteness and presentation modality reflected by human brain dynamics.

    Science.gov (United States)

    Lai, Kevin; She, Hsiao-Ching; Chen, Sheng-Chang; Chou, Wen-Chi; Huang, Li-Yu; Jung, Tzyy-Ping; Gramann, Klaus

    2012-01-01

    Previous research into working memory has focused on activations in different brain areas accompanying either different presentation modalities (verbal vs. non-verbal) or concreteness (abstract vs. concrete) of non-science concepts. Less research has been conducted investigating how scientific concepts are learned and further processed in working memory. To bridge this gap, the present study investigated human brain dynamics associated with encoding of physics concepts, taking both presentation modality and concreteness into account. Results of this study revealed greater theta and low-beta synchronization in the anterior cingulate cortex (ACC) during encoding of concrete pictures as compared to the encoding of both high and low imageable words. In visual brain areas, greater theta activity accompanying stimulus onsets was observed for words as compared to pictures while stronger alpha suppression was observed in responses to pictures as compared to words. In general, the EEG oscillation patterns for encoding words of different levels of abstractness were comparable but differed significantly from encoding of pictures. These results provide insights into the effects of modality of presentation on human encoding of scientific concepts and thus might help in developing new ways to better teach scientific concepts in class.

  17. Value of freedom to choose encoded by the human brain

    Science.gov (United States)

    Fujiwara, Juri; Usui, Nobuo; Park, Soyoung Q.; Williams, Tony; Iijima, Toshio; Taira, Masato; Tsutsui, Ken-Ichiro

    2013-01-01

    Humans and animals value the opportunity to choose by preferring alternatives that offer more rather than fewer choices. This preference for choice may arise not only from an increased probability of obtaining preferred outcomes but also from the freedom it provides. We used human neuroimaging to investigate the neural basis of the preference for choice as well as for the items that could be chosen. In each trial, participants chose between two options, a monetary amount option and a “choice option.” The latter consisted of a number that corresponded to the number of everyday items participants would subsequently be able to choose from. We found that the opportunity to choose from a larger number of items was equivalent to greater amounts of money, indicating that participants valued having more choice; moreover, participants varied in the degree to which they valued having the opportunity to choose, with some valuing it more than the increased probability of obtaining preferred items. Neural activations in the mid striatum increased with the value of the opportunity to choose. The same region also coded the value of the items. Conversely, activation in the dorsolateral striatum was not related to the value of the items but was elevated when participants were offered more choices, particularly in those participants who overvalued the opportunity to choose. These data suggest a functional dissociation of value representations within the striatum, with general representations in mid striatum and specific representations of the value of freedom provided by the opportunity to choose in dorsolateral striatum. PMID:23864380

  18. Three synonymous genes encode calmodulin in a reptile, the Japanese tortoise, Clemmys japonica

    Directory of Open Access Journals (Sweden)

    Kouji Shimoda

    2002-01-01

    Full Text Available Three distinct calmodulin (CaM-encoding cDNAs were isolated from a reptile, the Japanese tortoise (Clemmys japonica, based on degenerative primer PCR. Because of synonymous codon usages, the deduced amino acid (aa sequences were exactly the same in all three genes and identical to the aa sequence of vertebrate CaM. The three cDNAs, referred to as CaM-A, -B, and -C, seemed to belong to the same type as CaMI, CaMII, and CaMIII, respectively, based on their sequence identity with those of the mammalian cDNAs and the glutamate codon biases. Northern blot analysis detected CaM-A and -B as bands corresponding to 1.8 kb, with the most abundant levels in the brain and testis, while CaM-C was detected most abundantly in the brain as bands of 1.4 and 2.0 kb. Our results indicate that, in the tortoise, CaM protein is encoded by at least three non-allelic genes, and that the ‘multigene-one protein' principle of CaM synthesis is applicable to all classes of vertebrates, from fishes to mammals.

  19. Analysis of essential Arabidopsis nuclear genes encoding plastid-targeted proteins.

    Science.gov (United States)

    Savage, Linda J; Imre, Kathleen M; Hall, David A; Last, Robert L

    2013-01-01

    The Chloroplast 2010 Project (http://www.plastid.msu.edu/) identified and phenotypically characterized homozygous mutants in over three thousand genes, the majority of which encode plastid-targeted proteins. Despite extensive screening by the community, no homozygous mutant alleles were available for several hundred genes, suggesting that these might be enriched for genes of essential function. Attempts were made to generate homozygotes in ~1200 of these lines and 521 of the homozygous viable lines obtained were deposited in the Arabidopsis Biological Resource Center (http://abrc.osu.edu/). Lines that did not yield a homozygote in soil were tested as potentially homozygous lethal due to defects either in seed or seedling development. Mutants were characterized at four stages of development: developing seed, mature seed, at germination, and developing seedlings. To distinguish seed development or seed pigment-defective mutants from seedling development mutants, development of seeds was assayed in siliques from heterozygous plants. Segregating seeds from heterozygous parents were sown on supplemented media in an attempt to rescue homozygous seedlings that could not germinate or survive in soil. Growth of segregating seeds in air and air enriched to 0.3% carbon dioxide was compared to discover mutants potentially impaired in photorespiration or otherwise responsive to CO2 supplementation. Chlorophyll fluorescence measurements identified CO2-responsive mutants with altered photosynthetic parameters. Examples of genes with a viable mutant allele and one or more putative homozygous-lethal alleles were documented. RT-PCR of homozygotes for potentially weak alleles revealed that essential genes may remain undiscovered because of the lack of a true null mutant allele. This work revealed 33 genes with two or more lethal alleles and 73 genes whose essentiality was not confirmed with an independent lethal mutation, although in some cases second leaky alleles were identified.

  20. Analysis of essential Arabidopsis nuclear genes encoding plastid-targeted proteins.

    Directory of Open Access Journals (Sweden)

    Linda J Savage

    Full Text Available The Chloroplast 2010 Project (http://www.plastid.msu.edu/ identified and phenotypically characterized homozygous mutants in over three thousand genes, the majority of which encode plastid-targeted proteins. Despite extensive screening by the community, no homozygous mutant alleles were available for several hundred genes, suggesting that these might be enriched for genes of essential function. Attempts were made to generate homozygotes in ~1200 of these lines and 521 of the homozygous viable lines obtained were deposited in the Arabidopsis Biological Resource Center (http://abrc.osu.edu/. Lines that did not yield a homozygote in soil were tested as potentially homozygous lethal due to defects either in seed or seedling development. Mutants were characterized at four stages of development: developing seed, mature seed, at germination, and developing seedlings. To distinguish seed development or seed pigment-defective mutants from seedling development mutants, development of seeds was assayed in siliques from heterozygous plants. Segregating seeds from heterozygous parents were sown on supplemented media in an attempt to rescue homozygous seedlings that could not germinate or survive in soil. Growth of segregating seeds in air and air enriched to 0.3% carbon dioxide was compared to discover mutants potentially impaired in photorespiration or otherwise responsive to CO2 supplementation. Chlorophyll fluorescence measurements identified CO2-responsive mutants with altered photosynthetic parameters. Examples of genes with a viable mutant allele and one or more putative homozygous-lethal alleles were documented. RT-PCR of homozygotes for potentially weak alleles revealed that essential genes may remain undiscovered because of the lack of a true null mutant allele. This work revealed 33 genes with two or more lethal alleles and 73 genes whose essentiality was not confirmed with an independent lethal mutation, although in some cases second leaky alleles

  1. Gene Transfer and Molecular Cloning of the Human NGF Receptor

    Science.gov (United States)

    Chao, Moses V.; Bothwell, Mark A.; Ross, Alonzo H.; Koprowski, Hilary; Lanahan, Anthony A.; Buck, C. Randall; Sehgal, Amita

    1986-04-01

    Nerve growth factor (NGF) and its receptor are important in the development of cells derived from the neural crest. Mouse L cell transformants have been generated that stably express the human NGF receptor gene transfer with total human DNA. Affinity cross-linking, metabolic labeling and immunoprecipitation, and equilibrium binding with 125I-labeled NGF revealed that this NGF receptor had the same size and binding characteristics as the receptor from human melanoma cells and rat PC12 cells. The sequences encoding the NGF receptor were molecularly cloned using the human Alu repetitive sequence as a probe. A cosmid clone that contained the human NGF receptor gene allowed efficient transfection and expression of the receptor.

  2. [Cloning, prokaryotic expression and antibacterial assay of Tenecin gene encoding an antibacterial peptide from Tenebrio molitor].

    Science.gov (United States)

    Liu, Ying; Jiang, Yu-xin; Li, Chao-pin

    2011-12-01

    To clone tenecin gene, an antibacterial peptide gene, from Tenebrio molitor for its prokaryotic expression and explore the molecular mechanism for regulating the expression of antibacterial peptide in Tenebrio molitor larvae. The antibacterial peptide was induced from the larvae of Tenebrio molitor by intraperitoneal injection of Escherichia coli DH-5α (1×10(8)/ml). RT-PCR was performed 72 h after the injection to clone Tenecin gene followed by sequencing and bioinformatic analysis. The recombinant expression vector pET-28a(+)-Tenecin was constructed and transformed into E. coli BL21(DE3) cells and the expression of tenecin protein was observed after IPTG induction. Tenecin expression was detected in transformed E.coli using SDS-PAGE after 1 mmol/L IPTG induction. Tenecin gene, which was about 255 bp in length, encoded Tenecin protein with a relative molecular mass of 9 kD. Incubation of E.coli with 80, 60, 40, and 20 µg/ml tenecin for 18 h resulted in a diameter of the inhibition zone of 25.1∓0.03, 20.7∓0.06, 17.2∓0.11 and 9.3∓0.04 mm, respectively. Tenecin protein possesses strong antibacterial activity against E. coli DH-5α, which warrants further study of this protein for its potential as an antibacterial agent in clinical application.

  3. Polymorphisms in genes encoding leptin, ghrelin and their receptors in German multiple sclerosis patients.

    Science.gov (United States)

    Rey, Linda K; Wieczorek, Stefan; Akkad, Denis A; Linker, Ralf A; Chan, Andrew; Hoffjan, Sabine

    2011-01-01

    Multiple sclerosis (MS) is a neuro-inflammatory, autoimmune disease influenced by environmental and polygenic components. There is growing evidence that the peptide hormone leptin, known to regulate energy homeostasis, as well as its antagonist ghrelin play an important role in inflammatory processes in autoimmune diseases, including MS. Recently, single nucleotide polymorphisms (SNPs) in the genes encoding leptin, ghrelin and their receptors were evaluated, amongst others, in Wegener's granulomatosis and Churg-Strauss syndrome. The Lys656Asn SNP in the LEPR gene showed a significant but contrasting association with these vasculitides. We therefore aimed at investigating these polymorphisms in a German MS case-control cohort. Twelve SNPs in the LEP, LEPR, GHRL and GHSR genes were genotyped in 776 MS patients and 878 control subjects. We found an association of a haplotype in the GHSR gene with MS that could not be replicated in a second cohort. Otherwise, no significant differences in allele or genotype frequencies were observed between patients and controls in this particular cohort. Thus, the present results do not support the hypothesis that genetic variation in the leptin/ghrelin system contributes substantially to the pathogenesis of MS. However, a modest effect of GHSR variation cannot be ruled out and needs to be further evaluated in future studies. Copyright © 2011 Elsevier Ltd. All rights reserved.

  4. Regulation of the ald Gene Encoding Alanine Dehydrogenase by AldR in Mycobacterium smegmatis

    Science.gov (United States)

    Jeong, Ji-A; Baek, Eun-Young; Kim, Si Wouk; Choi, Jong-Soon

    2013-01-01

    The regulatory gene aldR was identified 95 bp upstream of the ald gene encoding l-alanine dehydrogenase in Mycobacterium smegmatis. The AldR protein shows sequence similarity to the regulatory proteins of the Lrp/AsnC family. Using an aldR deletion mutant, we demonstrated that AldR serves as both activator and repressor for the regulation of ald gene expression, depending on the presence or absence of l-alanine. The purified AldR protein exists as a homodimer in the absence of l-alanine, while it adopts the quaternary structure of a homohexamer in the presence of l-alanine. The binding affinity of AldR for the ald control region was shown to be increased significantly by l-alanine. Two AldR binding sites (O1 and O2) with the consensus sequence GA-N2-ATC-N2-TC and one putative AldR binding site with the sequence GA-N2-GTT-N2-TC were identified upstream of the ald gene. Alanine and cysteine were demonstrated to be the effector molecules directly involved in the induction of ald expression. The cellular level of l-alanine was shown to be increased in M. smegmatis cells grown under hypoxic conditions, and the hypoxic induction of ald expression appears to be mediated by AldR, which senses the intracellular level of alanine. PMID:23749971

  5. Carboxylesterase 1A2 encoding gene with increased transcription and potential rapid drug metabolism in Asian populations

    DEFF Research Database (Denmark)

    Rasmussen, Henrik Berg; Madsen, Majbritt Busk; Lyauk, Yassine Kamal

    2017-01-01

    The carboxylesterase 1 gene (CES1) encodes a hydrolase implicated in the metabolism of commonly used drugs. CES1A2, a hybrid of CES1 and a CES1-like pseudogene, has a promoter that is weak in most individuals. However, some individuals harbor a promoter haplotype of this gene with two overlapping...

  6. Isolation and characterization of the human parathyroid hormone-like peptide gene

    International Nuclear Information System (INIS)

    Mangin, M.; Ikeda, K.; Dreyer, B.E.; Broadus, A.E.

    1989-01-01

    A parathyroid hormone-like peptide (PTH-LP) has recently been identified in human tumors associated with the syndrome of humoral hypercalcemia of malignancy. The peptide appears to be encoded by a single-copy gene that gives rise to multiple mRNAs that are heterogeneous at both their 5' and their 3' ends. Alternative RNA splicing is responsible for the 3' heterogeneity and results in mRNAs encoding three different peptides, each with a unique C terminus. The authors have isolated and characterized the human PTHLP gene. The gene is a complex transcriptional unit spanning more than 12 kilobases of DNA and containing six exons. Two 5' exons encode distinct 5' untranslated regions and are separated by a putative promoter element, indicating that the gene either has two promoters or is alternatively spliced from a single promoter upstream of the first exon. The middle portion of the PTHLP gene, comprising exons 2-4, has an organizational pattern of introns and exons identical to that of the parathyroid hormone gene, consistent with a common ancestral origin of these two genes. Exon 4 of the PTHLP gene encodes the region common to all three peptides and the C terminus of the shortest peptide, and exons 5 and 6 encode the unique C termini of the other two peptides. Northern analysis of mRNAs from four human tumors of different histological types reveals the preferential use of 3' splicing patterns of individual tumors

  7. Structural organization of the human and mouse laminin beta2 chain genes, and alternative splicing at the 5' end of the human transcript

    DEFF Research Database (Denmark)

    Durkin, M E; Gautam, M; Loechel, F

    1996-01-01

    We have determined the structural organization of the human and mouse genes that encode the laminin beta2 chain (s-laminin), an essential component of the basement membranes of the neuromuscular synapse and the kidney glomerulus. The human and mouse genes have a nearly identical exon-intron organ......We have determined the structural organization of the human and mouse genes that encode the laminin beta2 chain (s-laminin), an essential component of the basement membranes of the neuromuscular synapse and the kidney glomerulus. The human and mouse genes have a nearly identical exon...

  8. Mapping of the gene encoding the. beta. -amyloid precursor protein and its relationship to the Down syndrome region of chromosome 21

    Energy Technology Data Exchange (ETDEWEB)

    Patterson, D.; Gardiner, K.; Kao, F.T.; Tanzi, R.; Watkins, P.; Gusella, J.F. (Eleanor Roosevelt Institute for Cancer Research, Denver, CO (USA))

    1988-11-01

    The gene encoding the {beta}-amyloid precursor protein has been assigned to human chromosome 21, as has a gene responsible for at least some cases of familial Alzheimer disease. Linkage studies strongly suggest that the {beta}-amyloid precursor protein and the product corresponding to familial Alzheimer disease are from two genes, or at least that several million base pairs of DNA separate the markers. The precise location of the {beta}-amyloid precursor protein gene on chromosome 21 has not yet been determined. Here the authors show, by using a somatic-cell/hybrid-cell mapping panel, in situ hybridization, and transverse-alternating-field electrophoresis, that the {beta}-amyloid precursor protein gene is located on chromosome 21 very near the 21q21/21q/22 border and probably within the region of chromosome 21 that, when trisomic, results in Down syndrome.

  9. Identification and functional analysis of the erh1(+ gene encoding enhancer of rudimentary homolog from the fission yeast Schizosaccharomyces pombe.

    Directory of Open Access Journals (Sweden)

    Marek K Krzyzanowski

    Full Text Available The ERH gene encodes a highly conserved small nuclear protein with a unique amino acid sequence and three-dimensional structure but unknown function. The gene is present in animals, plants, and protists but to date has only been found in few fungi. Here we report that ERH homologs are also present in all four species from the genus Schizosaccharomyces, S. pombe, S. octosporus, S. cryophilus, and S. japonicus, which, however, are an exception in this respect among Ascomycota and Basidiomycota. The ERH protein sequence is moderately conserved within the genus (58% identity between S. pombe and S.japonicus, but the intron-rich genes have almost identical intron-exon organizations in all four species. In S. pombe, erh1(+ is expressed at a roughly constant level during vegetative growth and adaptation to unfavorable conditions such as nutrient limitation and hyperosmotic stress caused by sorbitol. Erh1p localizes preferentially to the nucleus with the exception of the nucleolus, but is also present in the cytoplasm. Cells lacking erh1(+ have an aberrant cell morphology and a comma-like shape when cultured to the stationary phase, and exhibit a delayed recovery from this phase followed by slower growth. Loss of erh1(+ in an auxotrophic background results in enhanced arrest in the G1 phase following nutritional stress, and also leads to hypersensitivity to agents inducing hyperosmotic stress (sorbitol, inhibiting DNA replication (hydroxyurea, and destabilizing the plasma membrane (SDS; this hypersensitivity can be abolished by expression of S. pombe erh1(+ and, to a lesser extent, S. japonicus erh1(+ or human ERH. Erh1p fails to interact with the human Ciz1 and PDIP46/SKAR proteins, known molecular partners of human ERH. Our data suggest that in Schizosaccharomyces sp. erh1(+ is non-essential for normal growth and Erh1p could play a role in response to adverse environmental conditions and in cell cycle regulation.

  10. WRKY domain-encoding genes of a crop legume chickpea (Cicer arietinum): comparative analysis with Medicago truncatula WRKY family and characterization of group-III gene(s).

    Science.gov (United States)

    Kumar, Kamal; Srivastava, Vikas; Purayannur, Savithri; Kaladhar, V Chandra; Cheruvu, Purnima Jaiswal; Verma, Praveen Kumar

    2016-06-01

    The WRKY genes have been identified as important transcriptional modulators predominantly during the environmental stresses, but they also play critical role at various stages of plant life cycle. We report the identification of WRKY domain (WD)-encoding genes from galegoid clade legumes chickpea (Cicer arietinum L.) and barrel medic (Medicago truncatula). In total, 78 and 98 WD-encoding genes were found in chickpea and barrel medic, respectively. Comparative analysis suggests the presence of both conserved and unique WRKYs, and expansion of WRKY family in M. truncatula primarily by tandem duplication. Exclusively found in galegoid legumes, CaWRKY16 and its orthologues encode for a novel protein having a transmembrane and partial Exo70 domains flanking a group-III WD. Genomic region of galegoids, having CaWRKY16, is more dynamic when compared with millettioids. In onion cells, fused CaWRKY16-EYFP showed punctate fluorescent signals in cytoplasm. The chickpea WRKY group-III genes were further characterized for their transcript level modulation during pathogenic stress and treatments of abscisic acid, jasmonic acid, and salicylic acid (SA) by real-time PCR. Differential regulation of genes was observed during Ascochyta rabiei infection and SA treatment. Characterization of A. rabiei and SA inducible gene CaWRKY50 showed that it localizes to plant nucleus, binds to W-box, and have a C-terminal transactivation domain. Overexpression of CaWRKY50 in tobacco plants resulted in early flowering and senescence. The in-depth comparative account presented here for two legume WRKY genes will be of great utility in hastening functional characterization of crop legume WRKYs and will also help in characterization of Exo70Js. © The Author 2016. Published by Oxford University Press on behalf of Kazusa DNA Research Institute.

  11. Medicago truncatula contains a second gene encoding a plastid located glutamine synthetase exclusively expressed in developing seeds

    Directory of Open Access Journals (Sweden)

    Seabra Ana R

    2010-08-01

    Full Text Available Abstract Background Nitrogen is a crucial nutrient that is both essential and rate limiting for plant growth and seed production. Glutamine synthetase (GS, occupies a central position in nitrogen assimilation and recycling, justifying the extensive number of studies that have been dedicated to this enzyme from several plant sources. All plants species studied to date have been reported as containing a single, nuclear gene encoding a plastid located GS isoenzyme per haploid genome. This study reports the existence of a second nuclear gene encoding a plastid located GS in Medicago truncatula. Results This study characterizes a new, second gene encoding a plastid located glutamine synthetase (GS2 in M. truncatula. The gene encodes a functional GS isoenzyme with unique kinetic properties, which is exclusively expressed in developing seeds. Based on molecular data and the assumption of a molecular clock, it is estimated that the gene arose from a duplication event that occurred about 10 My ago, after legume speciation and that duplicated sequences are also present in closely related species of the Vicioide subclade. Expression analysis by RT-PCR and western blot indicate that the gene is exclusively expressed in developing seeds and its expression is related to seed filling, suggesting a specific function of the enzyme associated to legume seed metabolism. Interestingly, the gene was found to be subjected to alternative splicing over the first intron, leading to the formation of two transcripts with similar open reading frames but varying 5' UTR lengths, due to retention of the first intron. To our knowledge, this is the first report of alternative splicing on a plant GS gene. Conclusions This study shows that Medicago truncatula contains an additional GS gene encoding a plastid located isoenzyme, which is functional and exclusively expressed during seed development. Legumes produce protein-rich seeds requiring high amounts of nitrogen, we postulate

  12. Developing a hippocampal neural prosthetic to facilitate human memory encoding and recall

    Science.gov (United States)

    Hampson, Robert E.; Song, Dong; Robinson, Brian S.; Fetterhoff, Dustin; Dakos, Alexander S.; Roeder, Brent M.; She, Xiwei; Wicks, Robert T.; Witcher, Mark R.; Couture, Daniel E.; Laxton, Adrian W.; Munger-Clary, Heidi; Popli, Gautam; Sollman, Myriam J.; Whitlow, Christopher T.; Marmarelis, Vasilis Z.; Berger, Theodore W.; Deadwyler, Sam A.

    2018-06-01

    Objective. We demonstrate here the first successful implementation in humans of a proof-of-concept system for restoring and improving memory function via facilitation of memory encoding using the patient’s own hippocampal spatiotemporal neural codes for memory. Memory in humans is subject to disruption by drugs, disease and brain injury, yet previous attempts to restore or rescue memory function in humans typically involved only nonspecific, modulation of brain areas and neural systems related to memory retrieval. Approach. We have constructed a model of processes by which the hippocampus encodes memory items via spatiotemporal firing of neural ensembles that underlie the successful encoding of short-term memory. A nonlinear multi-input, multi-output (MIMO) model of hippocampal CA3 and CA1 neural firing is computed that predicts activation patterns of CA1 neurons during the encoding (sample) phase of a delayed match-to-sample (DMS) human short-term memory task. Main results. MIMO model-derived electrical stimulation delivered to the same CA1 locations during the sample phase of DMS trials facilitated short-term/working memory by 37% during the task. Longer term memory retention was also tested in the same human subjects with a delayed recognition (DR) task that utilized images from the DMS task, along with images that were not from the task. Across the subjects, the stimulated trials exhibited significant improvement (35%) in both short-term and long-term retention of visual information. Significance. These results demonstrate the facilitation of memory encoding which is an important feature for the construction of an implantable neural prosthetic to improve human memory.

  13. Non-interfering effects of active post-encoding tasks on episodic memory consolidation in humans

    NARCIS (Netherlands)

    Varma, S.; Takashima, A.; Krewinkel, S.C.; Kooten, M.E. van; Fu, L.; Medendorp, W.P.; Kessels, R.P.C.; Daselaar, S.M.

    2017-01-01

    So far, studies that investigated interference effects of post-learning processes on episodic memory consolidation in humans have only used tasks involving complex and meaningful information. Such tasks require reallocation of general or encoding-specific resources away from consolidation-relevant

  14. Structure of the human hepatic triglyceride lipase gene

    International Nuclear Information System (INIS)

    Cai, Shengjian; Wong, D.M.; Chen, Sanhwan; Chan, L.

    1989-01-01

    The structure of the human hepatic triglyceride lipase gene was determined from multiple cosmid clones. All the exons, exon-intron junctions, and 845 bp of the 5' and 254 bp of the 3' flanking DNA were sequenced. Comparison of the exon sequences to three previously published cDNA sequences revealed differences in the sequence of the codons for residue 133, 193, 202, and 234 that may represent sequence polymorphisms. By primer extension, hepatic lipase mRNA initiates at an adenine 77 bases upstream of the translation initiation site. The hepatic lipase gene spans over 60 kb containing 9 exons and 8 introns, the latter being all located within the region encoding the mature protein. The exons are all of average size (118-234 bp). Exon 1 encodes the signal peptide, exon 4, a region that binds to the lipoprotein substrate, and exon 5, an evolutionarily highly conserved region of potential catalytic function, and exons 6 and 9 encode sequences rich in basic amino acids thought to be important in anchoring the enzyme to the endothelial surface by interacting with acidic domains of the surface glycosaminoglycans. The human lipoprotein lipase gene has been recently reported to have an identical exon-intron organization containing the analogous structural domains. The observations strongly support the common evolutionary origin of these two lipolytic enzymes

  15. A human torque teno virus encodes a microRNA that inhibits interferon signaling.

    Directory of Open Access Journals (Sweden)

    Rodney P Kincaid

    Full Text Available Torque teno viruses (TTVs are a group of viruses with small, circular DNA genomes. Members of this family are thought to ubiquitously infect humans, although causal disease associations are currently lacking. At present, there is no understanding of how infection with this diverse group of viruses is so prevalent. Using a combined computational and synthetic approach, we predict and identify miRNA-coding regions in diverse human TTVs and provide evidence for TTV miRNA production in vivo. The TTV miRNAs are transcribed by RNA polymerase II, processed by Drosha and Dicer, and are active in RISC. A TTV mutant defective for miRNA production replicates as well as wild type virus genome; demonstrating that the TTV miRNA is dispensable for genome replication in a cell culture model. We demonstrate that a recombinant TTV genome is capable of expressing an exogenous miRNA, indicating the potential utility of TTV as a small RNA vector. Gene expression profiling of host cells identifies N-myc (and STAT interactor (NMI as a target of a TTV miRNA. NMI transcripts are directly regulated through a binding site in the 3'UTR. SiRNA knockdown of NMI contributes to a decreased response to interferon signaling. Consistent with this, we show that a TTV miRNA mediates a decreased response to IFN and increased cellular proliferation in the presence of IFN. Thus, we add Annelloviridae to the growing list of virus families that encode miRNAs, and suggest that miRNA-mediated immune evasion can contribute to the pervasiveness associated with some of these viruses.

  16. Patenting human genes: Chinese academic articles' portrayal of gene patents.

    Science.gov (United States)

    Du, Li

    2018-04-24

    The patenting of human genes has been the subject of debate for decades. While China has gradually come to play an important role in the global genomics-based testing and treatment market, little is known about Chinese scholars' perspectives on patent protection for human genes. A content analysis of academic literature was conducted to identify Chinese scholars' concerns regarding gene patents, including benefits and risks of patenting human genes, attitudes that researchers hold towards gene patenting, and any legal and policy recommendations offered for the gene patent regime in China. 57.2% of articles were written by law professors, but scholars from health sciences, liberal arts, and ethics also participated in discussions on gene patent issues. While discussions of benefits and risks were relatively balanced in the articles, 63.5% of the articles favored gene patenting in general and, of the articles (n = 41) that explored gene patents in the Chinese context, 90.2% supported patent protections for human genes in China. The patentability of human genes was discussed in 33 articles, and 75.8% of these articles reached the conclusion that human genes are patentable. Chinese scholars view the patent regime as an important legal tool to protect the interests of inventors and inventions as well as the genetic resources of China. As such, many scholars support a gene patent system in China. These attitudes towards gene patents remain unchanged following the court ruling in the Myriad case in 2013, but arguments have been raised about the scope of gene patents, in particular that the increasing numbers of gene patents may negatively impact public health in China.

  17. Genomic sequence and organization of two members of a human lectin gene family

    International Nuclear Information System (INIS)

    Gitt, M.A.; Barondes, S.H.

    1991-01-01

    The authors have isolated and sequenced the genomic DNA encoding a human dimeric soluble lactose-binding lectin. The gene has four exons, and its upstream region contains sequences that suggest control by glucocorticoids, heat (environmental) shock, metals, and other factors. They have also isolated and sequenced three exons of the gene encoding another human putative lectin, the existence of which was first indicated by isolation of its cDNA. Comparisons suggest a general pattern of genomic organization of members of this lectin gene family

  18. Overproduction of lactimidomycin by cross-overexpression of genes encoding Streptomyces antibiotic regulatory proteins.

    Science.gov (United States)

    Zhang, Bo; Yang, Dong; Yan, Yijun; Pan, Guohui; Xiang, Wensheng; Shen, Ben

    2016-03-01

    The glutarimide-containing polyketides represent a fascinating class of natural products that exhibit a multitude of biological activities. We have recently cloned and sequenced the biosynthetic gene clusters for three members of the glutarimide-containing polyketides-iso-migrastatin (iso-MGS) from Streptomyces platensis NRRL 18993, lactimidomycin (LTM) from Streptomyces amphibiosporus ATCC 53964, and cycloheximide (CHX) from Streptomyces sp. YIM56141. Comparative analysis of the three clusters identified mgsA and chxA, from the mgs and chx gene clusters, respectively, that were predicted to encode the PimR-like Streptomyces antibiotic regulatory proteins (SARPs) but failed to reveal any regulatory gene from the ltm gene cluster. Overexpression of mgsA or chxA in S. platensis NRRL 18993, Streptomyces sp. YIM56141 or SB11024, and a recombinant strain of Streptomyces coelicolor M145 carrying the intact mgs gene cluster has no significant effect on iso-MGS or CHX production, suggesting that MgsA or ChxA regulation may not be rate-limiting for iso-MGS and CHX production in these producers. In contrast, overexpression of mgsA or chxA in S. amphibiosporus ATCC 53964 resulted in a significant increase in LTM production, with LTM titer reaching 106 mg/L, which is five-fold higher than that of the wild-type strain. These results support MgsA and ChxA as members of the SARP family of positive regulators for the iso-MGS and CHX biosynthetic machinery and demonstrate the feasibility to improve glutarimide-containing polyketide production in Streptomyces strains by exploiting common regulators.

  19. Diversity and impact of rare variants in genes encoding the platelet G protein-coupled receptors.

    Science.gov (United States)

    Jones, Matthew L; Norman, Jane E; Morgan, Neil V; Mundell, Stuart J; Lordkipanidzé, Marie; Lowe, Gillian C; Daly, Martina E; Simpson, Michael A; Drake, Sian; Watson, Steve P; Mumford, Andrew D

    2015-04-01

    Platelet responses to activating agonists are influenced by common population variants within or near G protein-coupled receptor (GPCR) genes that affect receptor activity. However, the impact of rare GPCR gene variants is unknown. We describe the rare single nucleotide variants (SNVs) in the coding and splice regions of 18 GPCR genes in 7,595 exomes from the 1,000-genomes and Exome Sequencing Project databases and in 31 cases with inherited platelet function disorders (IPFDs). In the population databases, the GPCR gene target regions contained 740 SNVs (318 synonymous, 410 missense, 7 stop gain and 6 splice region) of which 70 % had global minor allele frequency (MAF) < 0.05 %. Functional annotation using six computational algorithms, experimental evidence and structural data identified 156/740 (21 %) SNVs as potentially damaging to GPCR function, most commonly in regions encoding the transmembrane and C-terminal intracellular receptor domains. In 31 index cases with IPFDs (Gi-pathway defect n=15; secretion defect n=11; thromboxane pathway defect n=3 and complex defect n=2) there were 256 SNVs in the target regions of 15 stimulatory platelet GPCRs (34 unique; 12 with MAF< 1 % and 22 with MAF≥ 1 %). These included rare variants predicting R122H, P258T and V207A substitutions in the P2Y12 receptor that were annotated as potentially damaging, but only partially explained the platelet function defects in each case. Our data highlight that potentially damaging variants in platelet GPCR genes have low individual frequencies, but are collectively abundant in the population. Potentially damaging variants are also present in pedigrees with IPFDs and may contribute to complex laboratory phenotypes.

  20. Two Paralogous Genes Encoding Auxin Efflux Carrier Differentially Expressed in Bitter Gourd (Momordica charantia

    Directory of Open Access Journals (Sweden)

    Yi-Li Li

    2017-11-01

    Full Text Available The phytohormone auxin regulates various developmental programs in plants, including cell growth, cell division and cell differentiation. The auxin efflux carriers are essential for the auxin transport. To show an involvement of auxin transporters in the coordination of fruit development in bitter gourd, a juicy fruit, we isolated novel cDNAs (referred as McPIN encoding putative auxin efflux carriers, including McPIN1, McPIN2 (allele of McPIN1 and McPIN3, from developing fruits of bitter gourd. Both McPIN1 and McPIN3 genes possess six exons and five introns. Hydropathy analysis revealed that both polypeptides have two hydrophobic regions with five transmembrane segments and a predominantly hydrophilic core. Phylogenetic analyses revealed that McPIN1 shared the highest homology to the group of Arabidopsis, cucumber and tomato PIN1, while McPIN3 belonged to another group, including Arabidopsis and tomato PIN3 as well as PIN4. This suggests different roles for McPIN1 and McPIN3 in auxin transport involved in the fruit development of bitter gourd. Maximum mRNA levels for both genes were detected in staminate and pistillate flowers. McPIN1 is expressed in a particular period of early fruit development but McPIN3 continues to be expressed until the last stage of fruit ripening. Moreover, these two genes are auxin-inducible and qualified as early auxin-response genes. Their expression patterns suggest that these two auxin transporter genes play a pivotal role in fruit setting and development.

  1. The Candida albicans-specific gene EED1 encodes a key regulator of hyphal extension.

    LENUS (Irish Health Repository)

    Martin, Ronny

    2011-04-01

    The extension of germ tubes into elongated hyphae by Candida albicans is essential for damage of host cells. The C. albicans-specific gene EED1 plays a crucial role in this extension and maintenance of filamentous growth. eed1Δ cells failed to extend germ tubes into long filaments and switched back to yeast growth after 3 h of incubation during growth on plastic surfaces. Expression of EED1 is regulated by the transcription factor Efg1 and ectopic overexpression of EED1 restored filamentation in efg1Δ. Transcriptional profiling of eed1Δ during infection of oral tissue revealed down-regulation of hyphal associated genes including UME6, encoding another key transcriptional factor. Ectopic overexpression of EED1 or UME6 rescued filamentation and damage potential in eed1Δ. Transcriptional profiling during overexpression of UME6 identified subsets of genes regulated by Eed1 or Ume6. These data suggest that Eed1 and Ume6 act in a pathway regulating maintenance of hyphal growth thereby repressing hyphal-to-yeast transition and permitting dissemination of C. albicans within epithelial tissues.

  2. Identification of genes encoding granule-bound starch synthase involved in amylose metabolism in banana fruit.

    Directory of Open Access Journals (Sweden)

    Hongxia Miao

    Full Text Available Granule-bound starch synthase (GBSS is responsible for amylose synthesis, but the role of GBSS genes and their encoded proteins remains poorly understood in banana. In this study, amylose content and GBSS activity gradually increased during development of the banana fruit, and decreased during storage of the mature fruit. GBSS protein in banana starch granules was approximately 55.0 kDa. The protein was up-regulated expression during development while it was down-regulated expression during storage. Six genes, designated as MaGBSSI-1, MaGBSSI-2, MaGBSSI-3, MaGBSSI-4, MaGBSSII-1, and MaGBSSII-2, were cloned and characterized from banana fruit. Among the six genes, the expression pattern of MaGBSSI-3 was the most consistent with the changes in amylose content, GBSS enzyme activity, GBSS protein levels, and the quantity or size of starch granules in banana fruit. These results suggest that MaGBSSI-3 might regulate amylose metabolism by affecting the variation of GBSS levels and the quantity or size of starch granules in banana fruit during development or storage.

  3. Identification of Genes Encoding Granule-Bound Starch Synthase Involved in Amylose Metabolism in Banana Fruit

    Science.gov (United States)

    Liu, Weixin; Xu, Biyu; Jin, Zhiqiang

    2014-01-01

    Granule-bound starch synthase (GBSS) is responsible for amylose synthesis, but the role of GBSS genes and their encoded proteins remains poorly understood in banana. In this study, amylose content and GBSS activity gradually increased during development of the banana fruit, and decreased during storage of the mature fruit. GBSS protein in banana starch granules was approximately 55.0 kDa. The protein was up-regulated expression during development while it was down-regulated expression during storage. Six genes, designated as MaGBSSI-1, MaGBSSI-2, MaGBSSI-3, MaGBSSI-4, MaGBSSII-1, and MaGBSSII-2, were cloned and characterized from banana fruit. Among the six genes, the expression pattern of MaGBSSI-3 was the most consistent with the changes in amylose content, GBSS enzyme activity, GBSS protein levels, and the quantity or size of starch granules in banana fruit. These results suggest that MaGBSSI-3 might regulate amylose metabolism by affecting the variation of GBSS levels and the quantity or size of starch granules in banana fruit during development or storage. PMID:24505384

  4. Cloning, expression and characterization of a gene from earthworm Eisenia fetida encoding a blood-clot dissolving protein.

    Directory of Open Access Journals (Sweden)

    GangQiang Li

    Full Text Available A lumbrokinase gene encoding a blood-clot dissolving protein was cloned from earthworm (Eisenia fetida by RT-PCR amplification. The gene designated as CST1 (GenBank No. AY840996 was sequence analyzed. The cDNA consists of 888 bp with an open reading frame of 729 bp, which encodes 242 amino acid residues. Multiple sequence alignments revealed that CST1 shares similarities and conserved amino acids with other reported lumbrokinases. The amino acid sequence of CST1 exhibits structural features similar to those found in other serine proteases, including human tissue-type (tPA, urokinase (uPA, and vampire bat (DSPAα1 plasminogen activators. CST1 has a conserved catalytic triad, found in the active sites of protease enzymes, which are important residues involved in polypeptide catalysis. CST1 was expressed as inclusion bodies in Escherichia coli BL21(DE3. The molecular mass of recombinant CST1 (rCST was 25 kDa as estimated by SDS-PAGE, and further confirmed by Western Blot analysis. His-tagged rCST1 was purified and renatured using nickel-chelating resin with a recovery rate of 50% and a purity of 95%. The purified, renatured rCST1 showed fibrinolytic activity evaluated by both a fibrin plate and a blood clot lysis assay. rCST1 degraded fibrin on the fibrin plate. A significant percentage (65.7% of blood clot lysis was observed when blood clot was treated with 80 mg/mL of rCST1 in vitro. The antithrombotic activity of rCST1 was 912 units/mg calculated by comparison with the activity of a lumbrokinase standard. These findings indicate that rCST1 has potential as a potent blood-clot treatment. Therefore, the expression and purification of a single lumbrokinase represents an important improvement in the use of lumbrokinases.

  5. The abp gene in Geobacillus stearothermophilus T-6 encodes a GH27 β-L-arabinopyranosidase.

    Science.gov (United States)

    Salama, Rachel; Alalouf, Onit; Tabachnikov, Orly; Zolotnitsky, Gennady; Shoham, Gil; Shoham, Yuval

    2012-07-30

    In this study we demonstrate that the abp gene in Geobacillus stearothermophilus T-6 encodes a family 27 glycoside hydrolase β-L-arabinopyranosidase. The catalytic constants towards the chromogenic substrate pNP-β-L-arabinopyranoside were 0.8±0.1 mM, 6.6±0.3 s(-1), and 8.2±0.3 s(-1) mM(-1) for K(m), k(cat) and k(cat)/K(m), respectively. (13)C NMR spectroscopy unequivocally showed that Abp is capable of removing β-L-arabinopyranose residues from the natural arabino-polysaccharide, larch arabinogalactan. Most family 27 enzymes are active on galactose and contain a conserved Asp residue, whereas in Abp this residue is Ile67, which shifts the specificity of the enzyme towards arabinopyranoside. Copyright © 2012 Federation of European Biochemical Societies. Published by Elsevier B.V. All rights reserved.

  6. Reduction of antinutritional glucosinolates in Brassica oilseeds by mutation of genes encoding transporters

    DEFF Research Database (Denmark)

    Nour-Eldin, Hussam Hassan; Madsen, Svend Roesen; Engelen, Steven

    2017-01-01

    The nutritional value of Brassica seed meals is reduced by the presence of glucosinolates, which are toxic compounds involved in plant defense. Mutation of the genes encoding two glucosinolate transporters (GTRs) eliminated glucosinolates from Arabidopsis thaliana seeds, but translation of loss......-of-function phenotypes into Brassica crops is challenging because Brassica is polyploid. We mutated one of seven and four of 12 GTR orthologs and reduced glucosinolate levels in seeds by 60-70% in two different Brassica species (Brassica rapa and Brassica juncea). Reduction in seed glucosinolates was stably inherited...... over multiple generations and maintained in field trials of two mutant populations at three locations. Successful translation of the gtr loss-of-function phenotype from model plant to two Brassica crops suggests that our transport engineering approach could be broadly applied to reduce seed...

  7. Evolutionary genomics of plant genes encoding N-terminal-TM-C2 domain proteins and the similar FAM62 genes and synaptotagmin genes of metazoans

    Directory of Open Access Journals (Sweden)

    Craxton Molly

    2007-07-01

    Full Text Available Abstract Background Synaptotagmin genes are found in animal genomes and are known to function in the nervous system. Genes with a similar domain architecture as well as sequence similarity to synaptotagmin C2 domains have also been found in plant genomes. The plant genes share an additional region of sequence similarity with a group of animal genes named FAM62. FAM62 genes also have a similar domain architecture. Little is known about the functions of the plant genes and animal FAM62 genes. Indeed, many members of the large and diverse Syt gene family await functional characterization. Understanding the evolutionary relationships among these genes will help to realize the full implications of functional studies and lead to improved genome annotation. Results I collected and compared plant Syt-like sequences from the primary nucleotide sequence databases at NCBI. The collection comprises six groups of plant genes conserved in embryophytes: NTMC2Type1 to NTMC2Type6. I collected and compared metazoan FAM62 sequences and identified some similar sequences from other eukaryotic lineages. I found evidence of RNA editing and alternative splicing. I compared the intron patterns of Syt genes. I also compared Rabphilin and Doc2 genes. Conclusion Genes encoding proteins with N-terminal-transmembrane-C2 domain architectures resembling synaptotagmins, are widespread in eukaryotes. A collection of these genes is presented here. The collection provides a resource for studies of intron evolution. I have classified the collection into homologous gene families according to distinctive patterns of sequence conservation and intron position. The evolutionary histories of these gene families are traceable through the appearance of family members in different eukaryotic lineages. Assuming an intron-rich eukaryotic ancestor, the conserved intron patterns distinctive of individual gene families, indicate independent origins of Syt, FAM62 and NTMC2 genes. Resemblances

  8. BcII RFLP for the human vimentin gene

    Energy Technology Data Exchange (ETDEWEB)

    Marcus, E M; Smith, B A; Telenius, H; Ponder, B A.J.; Mathew, C G.P. [Haddow Laboratories, Surrey (England); Landsvater, R M; Buys, C H.C.M. [State Univ. of Groningen (Netherlands); Ferrari, S [Temple University Medical School, Philadelphia, PA (USA)

    1988-09-26

    A 1.1 kb cDNA clone (hp4F1) encoding the human vimentin gene was identified in a human library by screening with 4F1, a hamster vimentin cDNA. BcII (TGATCA) recognizes a two allele polymorphism: bands A1 at 8.1 kb, and A2 at 3.6 kb. The allele frequency was determined in 47 unrelated Caucasian individuals. The RFLP was mapped to chromosome 10pter-10q23 using somatic cell hybrids and to 10p13 by in situ hybridization. Co-dominant segregation was observed in 2 informative families.

  9. Analysis of the structural genes encoding M-factor in the fission yeast Schizosaccharomyces pombe: identification of a third gene, mfm3

    DEFF Research Database (Denmark)

    Kjaerulff, S; Davey, William John; Nielsen, O

    1994-01-01

    We previously identified two genes, mfm1 and mfm2, with the potential to encode the M-factor mating pheromone of the fission yeast Schizosaccharomyces pombe (J. Davey, EMBO J. 11:951-960, 1992), but further analysis revealed that a mutant strain lacking both genes still produced active M-factor. ......We previously identified two genes, mfm1 and mfm2, with the potential to encode the M-factor mating pheromone of the fission yeast Schizosaccharomyces pombe (J. Davey, EMBO J. 11:951-960, 1992), but further analysis revealed that a mutant strain lacking both genes still produced active M...... that is not rescued by addition of exogenous M-factor. A mutational analysis reveals that all three mfm genes contribute to the production of M-factor. Their transcription is limited to M cells and requires the mat1-Mc and ste11 gene products. Each gene is induced when the cells are starved of nitrogen and further...

  10. MitoRes: a resource of nuclear-encoded mitochondrial genes and their products in Metazoa.

    Science.gov (United States)

    Catalano, Domenico; Licciulli, Flavio; Turi, Antonio; Grillo, Giorgio; Saccone, Cecilia; D'Elia, Domenica

    2006-01-24

    Mitochondria are sub-cellular organelles that have a central role in energy production and in other metabolic pathways of all eukaryotic respiring cells. In the last few years, with more and more genomes being sequenced, a huge amount of data has been generated providing an unprecedented opportunity to use the comparative analysis approach in studies of evolution and functional genomics with the aim of shedding light on molecular mechanisms regulating mitochondrial biogenesis and metabolism. In this context, the problem of the optimal extraction of representative datasets of genomic and proteomic data assumes a crucial importance. Specialised resources for nuclear-encoded mitochondria-related proteins already exist; however, no mitochondrial database is currently available with the same features of MitoRes, which is an update of the MitoNuc database extensively modified in its structure, data sources and graphical interface. It contains data on nuclear-encoded mitochondria-related products for any metazoan species for which this type of data is available and also provides comprehensive sequence datasets (gene, transcript and protein) as well as useful tools for their extraction and export. MitoRes http://www2.ba.itb.cnr.it/MitoRes/ consolidates information from publicly external sources and automatically annotates them into a relational database. Additionally, it also clusters proteins on the basis of their sequence similarity and interconnects them with genomic data. The search engine and sequence management tools allow the query/retrieval of the database content and the extraction and export of sequences (gene, transcript, protein) and related sub-sequences (intron, exon, UTR, CDS, signal peptide and gene flanking regions) ready to be used for in silico analysis. The tool we describe here has been developed to support lab scientists and bioinformaticians alike in the characterization of molecular features and evolution of mitochondrial targeting sequences. The

  11. Isolation and characterization of the human uracil DNA glycosylase gene

    International Nuclear Information System (INIS)

    Vollberg, T.M.; Siegler, K.M.; Cool, B.L.; Sirover, M.A.

    1989-01-01

    A series of anti-human placental uracil DNA glycosylase monoclonal antibodies was used to screen a human placental cDNA library in phage λgt11. Twenty-seven immunopositive plaques were detected and purified. One clone containing a 1.2-kilobase (kb) human cDNA insert was chosen for further study by insertion into pUC8. The resultant recombinant plasmid selected by hybridization a human placental mRNA that encoded a 37-kDa polypeptide. This protein was immunoprecipitated specifically by an anti-human placenta uracil DNA glycosylase monoclonal antibody. RNA blot-hybridization (Northern) analysis using placental poly(A) + RNA or total RNA from four different human fibroblast cell strains revealed a single 1.6-kb transcript. Genomic blots using DNA from each cell strain digested with either EcoRI or PstI revealed a complex pattern of cDNA-hydridizing restriction fragments. The genomic analysis for each enzyme was highly similar in all four human cell strains. In contrast, a single band was observed when genomic analysis was performed with the identical DNA digests with an actin gene probe. During cell proliferation there was an increase in the level of glycosylase mRNA that paralleled the increase in uracil DNA glycosylase enzyme activity. The isolation of the human uracil DNA glycosylase gene permits an examination of the structure, organization, and expression of a human DNA repair gene

  12. Genome-wide analysis reveals loci encoding anti-macrophage factors in the human pathogen Burkholderia pseudomallei K96243.

    Directory of Open Access Journals (Sweden)

    Andrea J Dowling

    2010-12-01

    Full Text Available Burkholderia pseudomallei is an important human pathogen whose infection biology is still poorly understood. The bacterium is endemic to tropical regions, including South East Asia and Northern Australia, where it causes melioidosis, a serious disease associated with both high mortality and antibiotic resistance. B. pseudomallei is a Gram-negative facultative intracellular pathogen that is able to replicate in macrophages. However despite the critical nature of its interaction with macrophages, few anti-macrophage factors have been characterized to date. Here we perform a genome-wide gain of function screen of B. pseudomallei strain K96243 to identify loci encoding factors with anti-macrophage activity. We identify a total of 113 such loci scattered across both chromosomes, with positive gene clusters encoding transporters and secretion systems, enzymes/toxins, secondary metabolite, biofilm, adhesion and signal response related factors. Further phenotypic analysis of four of these regions shows that the encoded factors cause striking cellular phenotypes relevant to infection biology, including apoptosis, formation of actin 'tails' and multi-nucleation within treated macrophages. The detailed analysis of the remaining host of loci will facilitate genetic dissection of the interaction of this important pathogen with host macrophages and thus further elucidate this critical part of its infection cycle.

  13. Deep--deeper--deepest? Encoding strategies and the recognition of human faces.

    Science.gov (United States)

    Sporer, S L

    1991-03-01

    Various encoding strategies that supposedly promote deeper processing of human faces (e.g., character judgments) have led to better recognition than more shallow processing tasks (judging the width of the nose). However, does deeper processing actually lead to an improvement in recognition, or, conversely, does shallow processing lead to a deterioration in performance when compared with naturally employed encoding strategies? Three experiments systematically compared a total of 8 different encoding strategies manipulating depth of processing, amount of elaboration, and self-generation of judgmental categories. All strategies that required a scanning of the whole face were basically equivalent but no better than natural strategy controls. The consistently worst groups were the ones that rated faces along preselected physical dimensions. This can be explained by subjects' lesser task involvement as revealed by manipulation checks.

  14. Genetic and functional analysis of the gene encoding GAP-43 in schizophrenia.

    Science.gov (United States)

    Shen, Yu-Chih; Tsai, Ho-Min; Cheng, Min-Chih; Hsu, Shih-Hsin; Chen, Shih-Fen; Chen, Chia-Hsiang

    2012-02-01

    In earlier reports, growth-associated protein 43 (GAP-43) has been shown to be critical for initial establishment or reorganization of synaptic connections, a process thought to be disrupted in schizophrenia. Additionally, abnormal GAP-43 expression in different brain regions has been linked to this disorder in postmortem brain studies. In this study, we investigated the involvement of the gene encoding GAP-43 in the susceptibility to schizophrenia. We searched for genetic variants in the promoter region and 3 exons (including both UTR ends) of the GAP-43 gene using direct sequencing in a sample of patients with schizophrenia (n=586) and non-psychotic controls (n=576), both being Han Chinese from Taiwan, and conducted an association and functional study. We identified 11 common polymorphisms in the GAP-43 gene. SNP and haplotype-based analyses displayed no associations with schizophrenia. Additionally, we identified 4 rare variants in 5 out of 586 patients, including 1 variant located at the promoter region (c.-258-4722G>T) and 1 synonymous (V110V) and 2 missense (G150R and P188L) variants located at exon 2. No rare variants were found in the control subjects. The results of the reporter gene assay demonstrated that the regulatory activity of construct containing c.-258-4722T was significantly lower as compared to the wild type construct (c.-258-4722G; panalysis also demonstrated the functional relevance of other rare variants. Our study lends support to the hypothesis of multiple rare mutations in schizophrenia, and it provides genetic clues that indicate the involvement of GAP-43 in this disorder. Copyright © 2011 Elsevier B.V. All rights reserved.

  15. Sequence variation in the alpha-toxin encoding plc gene of Clostridium perfringens strains isolated from diseased and healthy chickens

    DEFF Research Database (Denmark)

    Abildgaard, L; Engberg, RM; Pedersen, Karl

    2009-01-01

    The aim of the present study was to analyse the genetic diversity of the alpha-toxin encoding plc gene and the variation in a-toxin production of Clostridium perfringens type A strains isolated from presumably healthy chickens and chickens suffering from either necrotic enteritis (NE) or cholangio......-hepatitis. The a-toxin encoding plc genes from 60 different pulsed-field gel electrophoresis (PFGE) types (strains) of C perfringens were sequenced and translated in silico to amino acid sequences and the a-toxin production was investigated in batch cultures of 45 of the strains using an enzyme...

  16. Genes involved in meso-diaminopimelate synthesis in Bacillus subtilis: identification of the gene encoding aspartokinase I.

    Science.gov (United States)

    Roten, C A; Brandt, C; Karamata, D

    1991-04-01

    Thermosensitive mutants of Bacillus subtilis deficient in peptidoglycan synthesis were screened for mutations in the meso-diaminopimelate (LD-A2pm) metabolic pathway. Mutations in two out of five relevant linkage groups, lssB and lssD, were shown to induce, at the restrictive temperature, a deficiency in LD-A2pm synthesis and accumulation of UDP-MurNAc-dipeptide. Group lssB is heterogeneous; it encompasses mutations that confer deficiency in the deacylation of N-acetyl-LL-A2pm and accumulation of this precursor. Accordingly, these mutations are assigned to the previously identified locus dapE. Mutations in linkage group lssD entail a thermosensitive aspartokinase 1. Therefore, they are most likely to affect the structural gene of this enzyme, which we propose to designate dapG. Mutation pyc-1476, previously reported to affect the pyruvate carboxylase, was shown to confer a deficiency in aspartokinase 1, not in the carboxylase, and to belong to the dapG locus, dapG is closely linked to spoVF, the putative gene of dipicolinate synthase. In conclusion, mutations affecting only two out of eight steps known to be involved in LD-A2pm synthesis were uncovered in a large collection of thermosensitive mutants obtained by indirect selection. We propose that this surprisingly restricted distribution of the thermosensitive dap mutations isolated so far is due to the existence, in each step of the pathway, of isoenzymes encoded by separate genes. The biological role of different aspartokinases was investigated with mutants deficient in dapE and dapG genes. Growth characteristics of these mutants in the presence of various combinations of aspartate family amino acids allow a reassessment of a metabolic channel hypothesis, i.e. the proposed existence of multienzyme complexes, each specific for a given end product.

  17. The you gene encodes an EGF-CUB protein essential for Hedgehog signaling in zebrafish.

    Directory of Open Access Journals (Sweden)

    Ian G Woods

    2005-03-01

    Full Text Available Hedgehog signaling is required for many aspects of development in vertebrates and invertebrates. Misregulation of the Hedgehog pathway causes developmental abnormalities and has been implicated in certain types of cancer. Large-scale genetic screens in zebrafish have identified a group of mutations, termed you-class mutations, that share common defects in somite shape and in most cases disrupt Hedgehog signaling. These mutant embryos exhibit U-shaped somites characteristic of defects in slow muscle development. In addition, Hedgehog pathway mutations disrupt spinal cord patterning. We report the positional cloning of you, one of the original you-class mutations, and show that it is required for Hedgehog signaling in the development of slow muscle and in the specification of ventral fates in the spinal cord. The you gene encodes a novel protein with conserved EGF and CUB domains and a secretory pathway signal sequence. Epistasis experiments support an extracellular role for You upstream of the Hedgehog response mechanism. Analysis of chimeras indicates that you mutant cells can appropriately respond to Hedgehog signaling in a wild-type environment. Additional chimera analysis indicates that wild-type you gene function is not required in axial Hedgehog-producing cells, suggesting that You is essential for transport or stability of Hedgehog signals in the extracellular environment. Our positional cloning and functional studies demonstrate that You is a novel extracellular component of the Hedgehog pathway in vertebrates.

  18. An evolutionarily conserved gene family encodes proton-selective ion channels.

    Science.gov (United States)

    Tu, Yu-Hsiang; Cooper, Alexander J; Teng, Bochuan; Chang, Rui B; Artiga, Daniel J; Turner, Heather N; Mulhall, Eric M; Ye, Wenlei; Smith, Andrew D; Liman, Emily R

    2018-03-02

    Ion channels form the basis for cellular electrical signaling. Despite the scores of genetically identified ion channels selective for other monatomic ions, only one type of proton-selective ion channel has been found in eukaryotic cells. By comparative transcriptome analysis of mouse taste receptor cells, we identified Otopetrin1 (OTOP1), a protein required for development of gravity-sensing otoconia in the vestibular system, as forming a proton-selective ion channel. We found that murine OTOP1 is enriched in acid-detecting taste receptor cells and is required for their zinc-sensitive proton conductance. Two related murine genes, Otop2 and Otop3 , and a Drosophila ortholog also encode proton channels. Evolutionary conservation of the gene family and its widespread tissue distribution suggest a broad role for proton channels in physiology and pathophysiology. Copyright © 2018 The Authors, some rights reserved; exclusive licensee American Association for the Advancement of Science. No claim to original U.S. Government Works.

  19. A family of related proteins is encoded by the major Drosophila heat shock gene family

    International Nuclear Information System (INIS)

    Wadsworth, S.C.

    1982-01-01

    At least four proteins of 70,000 to 75,000 molecular weight (70-75K) were synthesized from mRNA which hybridized with a cloned heat shock gene previously shown to be localized to the 87A and 87C heat shock puff sites. These in vitro-synthesized proteins were indistinguishable from in vivo-synthesized heat shock-induced proteins when analyzed on sodium dodecyl sulfate-polyacrylamide gels. A comparison of the pattern of this group of proteins synthesized in vivo during a 5-min pulse or during continuous labeling indicates that the 72-75K proteins are probably not kinetic precursors to the major 70K heat shock protein. Partial digestion products generated with V8 protease indicated that the 70-75K heat shock proteins are closely related, but that there are clear differences between them. The partial digestion patterns obtained from heat shock proteins from the Kc cell line and from the Oregon R strain of Drosophila melanogaster are very similar. Genetic analysis of the patterns of 70-75K heat shock protein synthesis indicated that the genes encoding at least two of the three 72-75K heat shock proteins are located outside of the major 87A and 87C puff sites

  20. A single gene (Eu4) encodes the tissue-ubiquitous urease of soybean.

    Science.gov (United States)

    Torisky, R S; Griffin, J D; Yenofsky, R L; Polacco, J C

    1994-02-01

    We sought to determine the genetic basis of expression of the ubiquitous (metabolic) urease of soybean. This isozyme is termed the metabolic urease because its loss, in eu4/eu4 mutants, leads to accumulation of urea, whereas loss of the embryo-specific urease isozyme does not. The eu4 lesion eliminated the expression of the ubiquitous urease in vegetative and embryonic tissues. RFLP analysis placed urease clone LC4 near, or within, the Eu4 locus. Sequence comparison of urease proteins (ubiquitous and embryo-specific) and clones (LC4 and LS1) indicated that LC4 and LS1 encode ubiquitous and embryo-specific ureases, respectively. That LC4 is transcribed into poly(A)+ RNA in all tissues was indicated by the amplification of its transcript by an LC4-specific PCR primer. (The LS1-specific primer, on the other hand, amplified poly(A)+ RNA only from developing embryos expressing the embryo-specific urease.) These observations are consistent with Eu4 being the ubiquitous urease structural gene contained in the LC4 clone. In agreement with this notion, the mutant phenotype of eu4/eu4 callus was partially corrected by the LC4 urease gene introduced by particle bombardment.

  1. Chromosomal localization of the human vesicular amine transporter genes

    Energy Technology Data Exchange (ETDEWEB)

    Peter, D.; Finn, P.; Liu, Y.; Roghani, A.; Edwards, R.H.; Klisak, I.; Kojis, T.; Heinzmann, C.; Sparkes, R.S. (UCLA School of Medicine, Los Angeles, CA (United States))

    1993-12-01

    The physiologic and behavioral effects of pharmacologic agents that interfere with the transport of monoamine neurotransmitters into vesicles suggest that vesicular amine transport may contribute to human neuropsychiatric disease. To determine whether an alteration in the genes that encode vesicular amine transport contributes to the inherited component of these disorders, the authors have isolated a human cDNA for the brain transporter and localized the human vesciular amine transporter genes. The human brain synaptic vesicle amine transporter (SVAT) shows unexpected conservation with rat SVAT in the regions that diverge extensively between rat SVAT and the rat adrenal chromaffin granule amine transporter (CGAT). Using the cloned sequences with a panel of mouse-human hybrids and in situ hybridization for regional localization, the adrenal CGAT gene (or VAT1) maps to human chromosome 8p21.3 and the brain SVAT gene (or VAT2) maps to chromosome 10q25. Both of these sites occur very close to if not within previously described deletions that produce severe but viable phenotypes. 26 refs., 3 figs., 1 tab.

  2. Cloning of gene-encoded stem bromelain on system coming from Pichia pastoris as therapeutic protein candidate

    Science.gov (United States)

    Yusuf, Y.; Hidayati, W.

    2018-01-01

    The process of identifying bacterial recombination using PCR, and restriction, and then sequencing process was done after identifying the bacteria. This research aimed to get a yeast cell of Pichia pastoris which has an encoder gene of stem bromelain enzyme. The production of recombinant stem bromelain enzymes using yeast cells of P. pastoris can produce pure bromelain rod enzymes and have the same conformation with the enzyme’s conformation in pineapple plants. This recombinant stem bromelain enzyme can be used as a therapeutic protein in inflammatory, cancer and degenerative diseases. This study was an early stage of a step series to obtain bromelain rod protein derived from pineapple made with genetic engineering techniques. This research was started by isolating the RNA of pineapple stem which was continued with constructing cDNA using reserve transcriptase-PCR technique (RT-PCR), doing the amplification of bromelain enzyme encoder gene with PCR technique using a specific premiere couple which was designed. The process was continued by cloning into bacterium cells of Escherichia coli. A vector which brought the encoder gene of stem bromelain enzyme was inserted into the yeast cell of P. pastoris and was continued by identifying the yeast cell of P. pastoris which brought the encoder gene of stem bromelain enzyme. The research has not found enzyme gene of stem bromelain in yeast cell of P. pastoris yet. The next step is repeating the process by buying new reagent; RNase inhibitor, and buying liquid nitrogen.

  3. Theta oscillations at encoding mediate the context-dependent nature of human episodic memory.

    Science.gov (United States)

    Staudigl, Tobias; Hanslmayr, Simon

    2013-06-17

    Human episodic memory is highly context dependent. Therefore, retrieval benefits when a memory is recalled in the same context compared to a different context. This implies that items and contexts are bound together during encoding, such that the reinstatement of the initial context at test improves retrieval. Animal studies suggest that theta oscillations and theta-to-gamma cross-frequency coupling modulate such item-context binding, but direct evidence from humans is scarce. We investigated this issue by manipulating the overlap of contextual features between encoding and retrieval. Participants studied words superimposed on movie clips and were later tested by presenting the word with either the same or a different movie. The results show that memory performance and the oscillatory correlates of memory formation crucially depend on the overlap of the context between encoding and test. When the context matched, high theta power during encoding was related to successful recognition, whereas the opposite pattern emerged in the context-mismatch condition. In addition, cross-frequency coupling analysis revealed a context-dependent theta-to-gamma memory effect specifically in the left hippocampus. These results reveal for the first time that context-dependent episodic memory effects are mediated by theta oscillatory activity. Copyright © 2013 Elsevier Ltd. All rights reserved.

  4. MC148 encoded by human molluscum contagiosum poxvirus is an antagonist for human but not murine CCR8

    DEFF Research Database (Denmark)

    Lüttichau, H R; Gerstoft, J; Schwartz, T W

    2001-01-01

    The viral CC chemokines MC148, encoded by the poxvirus molluscum contagiosum, and viral macrophage inflammatory protein (vMIP)-I and vMIP-II, encoded by human herpesvirus 8, were probed on the murine CC receptor (CCR) 8 in parallel with human CCR8. In calcium mobilization assays, vMIP-I acted...... as a high-affinity agonist, whereas vMIP-II acted as a low-affinity antagonist on the murine CCR8 as well as the human CCR8. MC148 was found to bind and block responses through the human CCR8 with high affinity, but surprisingly MC148 was unable to bind and block responses through the murine CCR8. Because...

  5. Adenovirus-encoding virus-associated RNAs suppress HDGF gene expression to support efficient viral replication.

    Directory of Open Access Journals (Sweden)

    Saki Kondo

    Full Text Available Non-coding small RNAs are involved in many physiological responses including viral life cycles. Adenovirus-encoding small RNAs, known as virus-associated RNAs (VA RNAs, are transcribed throughout the replication process in the host cells, and their transcript levels depend on the copy numbers of the viral genome. Therefore, VA RNAs are abundant in infected cells after genome replication, i.e. during the late phase of viral infection. Their function during the late phase is the inhibition of interferon-inducible protein kinase R (PKR activity to prevent antiviral responses; recently, mivaRNAs, the microRNAs processed from VA RNAs, have been reported to inhibit cellular gene expression. Although VA RNA transcription starts during the early phase, little is known about its function. The reason may be because much smaller amount of VA RNAs are transcribed during the early phase than the late phase. In this study, we applied replication-deficient adenovirus vectors (AdVs and novel AdVs lacking VA RNA genes to analyze the expression changes in cellular genes mediated by VA RNAs using microarray analysis. AdVs are suitable to examine the function of VA RNAs during the early phase, since they constitutively express VA RNAs but do not replicate except in 293 cells. We found that the expression level of hepatoma-derived growth factor (HDGF significantly decreased in response to the VA RNAs under replication-deficient condition, and this suppression was also observed during the early phase under replication-competent conditions. The suppression was independent of mivaRNA-induced downregulation, suggesting that the function of VA RNAs during the early phase differs from that during the late phase. Notably, overexpression of HDGF inhibited AdV growth. This is the first report to show the function, in part, of VA RNAs during the early phase that may be contribute to efficient viral growth.

  6. Characterization of a Thioredoxin-1 Gene from Taenia solium and Its Encoding Product

    Science.gov (United States)

    Jiménez, Lucía; Rodríguez-Lima, Oscar; Ochoa-Sánchez, Alicia; Landa, Abraham

    2015-01-01

    Taenia solium thioredoxin-1 gene (TsTrx-1) has a length of 771 bp with three exons and two introns. The core promoter gene presents two putative stress transcription factor binding sites, one putative TATA box, and a transcription start site (TSS). TsTrx-1 mRNA is expressed higher in larvae than in adult. This gene encodes a protein of 107 amino acids that presents the Trx active site (CGPC), the classical secondary structure of the thioredoxin fold, and the highest degree of identity with the Echinococcus granulosus Trx. A recombinant TsTrx-1 (rTsTrx-1) was produced in Escherichia coli with redox activity. Optimal activity for rTsTrx-1 was at pH 6.5 in the range of 15 to 25°C. The enzyme conserved activity for 3 h and lost it in 24 h at 37°C. rTsTrx-1 lost 50% activity after 1 h and lost activity completely in 24 h at temperatures higher than 55°C. Best storage temperature for rTsTrx-1 was at −70°C. It was inhibited by high concentrations of H2O2 and methylglyoxal (MG), but it was inhibited neither by NaCl nor by anti-rTsTrx-1 rabbit antibodies that strongly recognized a ~12 kDa band in extracts from several parasites. These TsTrx-1 properties open the opportunity to study its role in relationship T. solium-hosts. PMID:26090410

  7. Characterization of a novel gene encoding ankyrin repeat domain from Cotesia vestalis polydnavirus (CvBV)

    International Nuclear Information System (INIS)

    Shi Min; Chen Yafeng; Huang Fang; Liu Pengcheng; Zhou Xueping; Chen Xuexin

    2008-01-01

    Cotesia vestalis (Haliday) is an endoparasitoid of Plutella xylostella (L.) larvae and injects a polydnavirus (CvBV) into its host during oviposition. In this report we describe the characterization of a gene (CvBV805) and its products. CvBV805 is located on the segment S8 of CvBV genome; it has a size of 909 bp and encodes a predicted protein of 125 amino acids. This protein contains an ankyrin repeat domain with a high degree of similarity with IκB-like genes. Gene transcripts were detected in extracts of the host as early as 2 h post-parasitization (p.p.) and continued to be detected through 24 h. Tissue-specific expression patterns showed that CvBV805 might be involved in early host immunosuppression. CvBV805 was detected in parasitized hosts at 12 h p.p. and in rBac-eGFP-CvBV805-infected Tn-5B1-4 cells at 72 h.p.i. by using western blots analysis. The size of the protein expressed in the host hemocytes and infected Tn-5B1-4 cells was 17 kDa and 56 kDa (including eGFP), respectively, which nearly corresponded with the predicted molecular weight (14.31 kDa) of CvBV805, suggesting that the protein did not undergo extensive post-translational modification. The protein was confirmed to be present within the nuclear region in hemocytes of the parasitized P. xylostella larvae at 48 h p.p. using confocal laser scanning microscopy

  8. Identification and characterization of an autolysin-encoding gene of Streptococcus mutans.

    Science.gov (United States)

    Shibata, Yukie; Kawada, Miki; Nakano, Yoshio; Toyoshima, Kuniaki; Yamashita, Yoshihisa

    2005-06-01

    We identified a gene (atlA) encoding autolytic activity from Streptococcus mutans Xc. The AtlA protein predicted to be encoded by atlA is composed of 979 amino acids with a molecular weight of 107,279 and has a conserved beta-1,4-N-acetylmuramidase (lysozyme) domain in the C-terminal portion. Sodium dodecyl sulfate extracts of strain Xc showed two major bacteriolytic bands with molecular masses of 107 and 79 kDa, both of which were absent from a mutant with inactivated atlA. Western blot analysis revealed that the 79-kDa band was derived from the 107-kDa peptide by cleavage of its N-terminal portion. The inactivation of atlA resulted in a marked decrease in autolysis and the formation of very long chains of cells compared to the case for the parent strain. Although both the parent and mutant strains formed biofilms in the presence of sucrose, the biofilms formed by the mutant had a sponge-like architecture with large gaps and contained 30% less biomass than those formed by the parent strain. Furthermore, strain Xc formed glucose-dependent, loose biofilms in the absence of sucrose, but the mutant lost this ability. These results suggest that AtlA may play an important role in biofilm formation by S. mutans. The antibody produced against the C-terminal peptide containing the beta-1,4-N-acetylmuramidase domain drastically inhibited the autolytic activity of strain Xc. This inhibition was specific among the oral streptococci to S. mutans. These results indicate that the catalytic domain of AtlA is located at the C terminus, suggesting that further characterization of this domain may provide a means to control cariogenic dental plaque formation.

  9. Evaluation of 10 genes encoding cardiac proteins in Doberman Pinschers with dilated cardiomyopathy.

    Science.gov (United States)

    O'Sullivan, M Lynne; O'Grady, Michael R; Pyle, W Glen; Dawson, John F

    2011-07-01

    To identify a causative mutation for dilated cardiomyopathy (DCM) in Doberman Pinschers by sequencing the coding regions of 10 cardiac genes known to be associated with familial DCM in humans. 5 Doberman Pinschers with DCM and congestive heart failure and 5 control mixed-breed dogs that were euthanized or died. RNA was extracted from frozen ventricular myocardial samples from each dog, and first-strand cDNA was synthesized via reverse transcription, followed by PCR amplification with gene-specific primers. Ten cardiac genes were analyzed: cardiac actin, α-actinin, α-tropomyosin, β-myosin heavy chain, metavinculin, muscle LIM protein, myosinbinding protein C, tafazzin, titin-cap (telethonin), and troponin T. Sequences for DCM-affected and control dogs and the published canine genome were compared. None of the coding sequences yielded a common causative mutation among all Doberman Pinscher samples. However, 3 variants were identified in the α-actinin gene in the DCM-affected Doberman Pinschers. One of these variants, identified in 2 of the 5 Doberman Pinschers, resulted in an amino acid change in the rod-forming triple coiled-coil domain. Mutations in the coding regions of several genes associated with DCM in humans did not appear to consistently account for DCM in Doberman Pinschers. However, an α-actinin variant was detected in some Doberman Pinschers that may contribute to the development of DCM given its potential effect on the structure of this protein. Investigation of additional candidate gene coding and noncoding regions and further evaluation of the role of α-actinin in development of DCM in Doberman Pinschers are warranted.

  10. Bioinformatic analysis of the nucleotide binding site-encoding disease-resistance genes in foxtail millet (Setaria italica (L.) Beauv.).

    Science.gov (United States)

    Zhu, Y B; Xie, X Q; Li, Z Y; Bai, H; Dong, L; Dong, Z P; Dong, J G

    2014-08-28

    The nucleotide-binding site (NBS) disease-resistance genes are the largest category of plant disease-resistance gene analogs. The complete set of disease-resistant candidate genes, which encode the NBS sequence, was filtered in the genomes of two varieties of foxtail millet (Yugu1 and 'Zhang gu'). This study investigated a number of characteristics of the putative NBS genes, such as structural diversity and phylogenetic relationships. A total of 269 and 281 NBS-coding sequences were identified in Yugu1 and 'Zhang gu', respectively. When the two databases were compared, 72 genes were found to be identical and 164 genes showed more than 90% similarity. Physical positioning and gene family analysis of the NBS disease-resistance genes in the genome revealed that the number of genes on each chromosome was similar in both varieties. The eighth chromosome contained the largest number of genes and the ninth chromosome contained the lowest number of genes. Exactly 34 gene clusters containing the 161 genes were found in the Yugu1 genome, with each cluster containing 4.7 genes on average. In comparison, the 'Zhang gu' genome possessed 28 gene clusters, which had 151 genes, with an average of 5.4 genes in each cluster. The largest gene cluster, located on the eighth chromosome, contained 12 genes in the Yugu1 database, whereas it contained 16 genes in the 'Zhang gu' database. The classification results showed that the CC-NBS-LRR gene made up the largest part of each chromosome in the two databases. Two TIR-NBS genes were also found in the Yugu1 genome.

  11. Cloning of cDNAs that encode human mast cell carboxypeptidase A, and comparison of the protein with mouse mast cell carboxypeptidase A and rat pancreatic carboxypeptidases

    International Nuclear Information System (INIS)

    Reynolds, D.S.; Gurley, D.S.; Stevens, R.L.; Austen, K.F.; Serafin, W.E.; Sugarbaker, D.J.

    1989-01-01

    Human skin and lung mast cells and rodent peritoneal cells contain a carboxypeptidase in their secretory granules. The authors have screened human lung cDNA libraries with a mouse mast cell carboxypeptidase A (MC-CPA) cDNA probe to isolate a near-full-length cDNA that encodes human MC-CPA. The 5' end of the human MC-CPA transcript was defined by direct mRNA sequencing and by isolation and partial sequencing of the human MC-CPA gene. Human MC-CPA is predicted to be translated as a 417 amino acid preproenzyme which includes a 15 amino acid signal peptide and a 94-amino acid activation peptide. The mature human MC-CPA enzyme has a predicted size of 36.1 kDa, a net positive charge of 16 at neutral pH, and 86% amino acid sequence identity with mouse MC-CPA. DNA blot analyses showed that human MC-CPA mRNA is transcribed from a single locus in the human genome. Comparison of the human MC-CPA with mouse MC-CPA and with three rat pancreatic carboxypeptidases shows that these enzymes are encoded by distinct but homologous genes

  12. Encoding of Physics Concepts: Concreteness and Presentation Modality Reflected by Human Brain Dynamics

    OpenAIRE

    Lai, Kevin; She, Hsiao-Ching; Chen, Sheng-Chang; Chou, Wen-Chi; Huang, Li-Yu; Jung, Tzyy-Ping; Gramann, Klaus

    2012-01-01

    Previous research into working memory has focused on activations in different brain areas accompanying either different presentation modalities (verbal vs. non-verbal) or concreteness (abstract vs. concrete) of non-science concepts. Less research has been conducted investigating how scientific concepts are learned and further processed in working memory. To bridge this gap, the present study investigated human brain dynamics associated with encoding of physics concepts, taking both presentati...

  13. Identification of the gene encoding the 65-kilodalton DNA-binding protein of herpes simplex virus type 1

    International Nuclear Information System (INIS)

    Parris, D.S.; Cross, A.; Orr, A.; Frame, M.C.; Murphy, M.; McGeoch, D.J.; Marsden, H.S.; Haarr, L.

    1988-01-01

    Hybrid arrest of in vitro translation was used to localize the region of the herpes simplex virus type 1 genome encoding the 65-kilodalton DNA-binding protein (65K DBP ) to between genome coordinates 0.592 and 0.649. Knowledge of the DNA sequence of this region allowed us to identify three open reading frames as likely candidates for the gene encoding 65K DBP . Two independent approaches were used to determine which of these three open reading frames encoded the protein. For the first approach a monoclonal antibody, MAb 6898, which reacted specifically with 65K DBP , was isolated. This antibody was used, with the techniques of hybrid arrest of in vitro translation and in vitro translation of selected mRNA, to identify the gene encoding 65K DBP . The second approach involved preparation of antisera directed against oligopeptides corresponding to regions of the predicted amino acid sequence of this gene. These antisera reacted specifically with 65K DBP , thus confirming the gene assignment

  14. Regulation of transcription of cellulases- and hemicellulases-encoding genes in Aspergillus niger and Hypocrea jecorina (Trichoderma reesei)

    NARCIS (Netherlands)

    Stricker, A.R.; Mach, R.L.; Graaff, de L.H.

    2008-01-01

    The filamentous fungi Aspergillus niger and Hypocrea jecorina (Trichoderma reesei) have been the subject of many studies investigating the mechanism of transcriptional regulation of hemicellulase- and cellulase-encoding genes. The transcriptional regulator XlnR that was initially identified in A.

  15. Characterization and immunological identification of cDNA clones encoding two human DNA topoisomerase II isozymes

    International Nuclear Information System (INIS)

    Chung, T.D.Y.; Drake, F.H.; Tan, K.B.; Per, S.R.; Crooke, S.T.; Mirabelli, C.K.

    1989-01-01

    Several DNA topoisomerase II partial cDNA clones obtained from a human Raji-HN2 cDNA library were sequenced and two classes of nucleotide sequences were found. One member of the first class, SP1, was identical to an internal fragment of human HeLa cell Topo II cDNA described earlier. A member of the second class, SP11, shared extensive nucleotide (75%) and predicted peptide (92%) sequence similarities with the first two-thirds of HeLa Topo II. Each class of cDNAs hybridized to unique, nonoverlapping restriction enzyme fragments of genomic DNA from several human cell lines. Synthetic 24-mer oligonucleotide probes specific for each cDNA class hybridized to 6.5-kilobase mRNAs; furthermore, hybridization of probe specific for one class was not blocked by probe specific for the other. Antibodies raised against a synthetic SP1-encoded dodecapeptide specifically recognized the 170-kDa form of Topo II, while antibodies raised against the corresponding SP11-encoded dodecapeptide, or a second unique SP11-encoded tridecapeptide, selectively recognized the 180-kDa form of Topo II. These data provide genetic and immunochemical evidence for two Topo II isozymes

  16. Subsecond dopamine fluctuations in human striatum encode superposed error signals about actual and counterfactual reward

    Science.gov (United States)

    Kishida, Kenneth T.; Saez, Ignacio; Lohrenz, Terry; Witcher, Mark R.; Laxton, Adrian W.; Tatter, Stephen B.; White, Jason P.; Ellis, Thomas L.; Phillips, Paul E. M.; Montague, P. Read

    2016-01-01

    In the mammalian brain, dopamine is a critical neuromodulator whose actions underlie learning, decision-making, and behavioral control. Degeneration of dopamine neurons causes Parkinson’s disease, whereas dysregulation of dopamine signaling is believed to contribute to psychiatric conditions such as schizophrenia, addiction, and depression. Experiments in animal models suggest the hypothesis that dopamine release in human striatum encodes reward prediction errors (RPEs) (the difference between actual and expected outcomes) during ongoing decision-making. Blood oxygen level-dependent (BOLD) imaging experiments in humans support the idea that RPEs are tracked in the striatum; however, BOLD measurements cannot be used to infer the action of any one specific neurotransmitter. We monitored dopamine levels with subsecond temporal resolution in humans (n = 17) with Parkinson’s disease while they executed a sequential decision-making task. Participants placed bets and experienced monetary gains or losses. Dopamine fluctuations in the striatum fail to encode RPEs, as anticipated by a large body of work in model organisms. Instead, subsecond dopamine fluctuations encode an integration of RPEs with counterfactual prediction errors, the latter defined by how much better or worse the experienced outcome could have been. How dopamine fluctuations combine the actual and counterfactual is unknown. One possibility is that this process is the normal behavior of reward processing dopamine neurons, which previously had not been tested by experiments in animal models. Alternatively, this superposition of error terms may result from an additional yet-to-be-identified subclass of dopamine neurons. PMID:26598677

  17. Minor abnormalities of testis development in mice lacking the gene encoding the MAPK signalling component, MAP3K1.

    Directory of Open Access Journals (Sweden)

    Nick Warr

    2011-05-01

    Full Text Available In mammals, the Y chromosome is a dominant male determinant, causing the bipotential gonad to develop as a testis. Recently, cases of familial and spontaneous 46,XY disorders of sex development (DSD have been attributed to mutations in the human gene encoding mitogen-activated protein kinase kinase kinase 1, MAP3K1, a component of the mitogen-activated protein kinase (MAPK signal transduction pathway. In individuals harbouring heterozygous mutations in MAP3K1, dysregulation of MAPK signalling was observed in lymphoblastoid cell lines, suggesting a causal role for these mutations in disrupting XY sexual development. Mice lacking the cognate gene, Map3k1, are viable and exhibit the eyes open at birth (EOB phenotype on a mixed genetic background, but on the C57BL/6J genetic background most mice die at around 14.5 dpc due to a failure of erythropoiesis in the fetal liver. However, no systematic examination of sexual development in Map3k1-deficient mice has been described, an omission that is especially relevant in the case of C57BL/6J, a genetic background that is sensitized to disruptions to testis determination. Here, we report that on a mixed genetic background mice lacking Map3k1 are fertile and exhibit no overt abnormalities of testis development. On C57BL/6J, significant non-viability is observed with very few animals surviving to adulthood. However, an examination of development in Map3k1-deficient XY embryos on this genetic background revealed no significant defects in testis determination, although minor abnormalities were observed, including an increase in gonadal length. Based on these observations, we conclude that MAP3K1 is not required for mouse testis determination. We discuss the significance of these data for the functional interpretation of sex-reversing MAP3K1 mutations in humans.

  18. [Cloning, mutagenesis and symbiotic phenotype of three lipid transfer protein encoding genes from Mesorhizobium huakuii 7653R].

    Science.gov (United States)

    Li, Yanan; Zeng, Xiaobo; Zhou, Xuejuan; Li, Youguo

    2016-12-04

    Lipid transfer protein superfamily is involved in lipid transport and metabolism. This study aimed to construct mutants of three lipid transfer protein encoding genes in Mesorhizobium huakuii 7653R, and to study the phenotypes and function of mutations during symbiosis with Astragalus sinicus. We used bioinformatics to predict structure characteristics and biological functions of lipid transfer proteins, and conducted semi-quantitative and fluorescent quantitative real-time PCR to analyze the expression levels of target genes in free-living and symbiotic conditions. Using pK19mob insertion mutagenesis to construct mutants, we carried out pot plant experiments to observe symbiotic phenotypes. MCHK-5577, MCHK-2172 and MCHK-2779 genes encoding proteins belonged to START/RHO alpha_C/PITP/Bet_v1/CoxG/CalC (SRPBCC) superfamily, involved in lipid transport or metabolism, and were identical to M. loti at 95% level. Gene relative transcription level of the three genes all increased compared to free-living condition. We obtained three mutants. Compared with wild-type 7653R, above-ground biomass of plants and nodulenitrogenase activity induced by the three mutants significantly decreased. Results indicated that lipid transfer protein encoding genes of Mesorhizobium huakuii 7653R may play important roles in symbiotic nitrogen fixation, and the mutations significantly affected the symbiotic phenotypes. The present work provided a basis to study further symbiotic function mechanism associated with lipid transfer proteins from rhizobia.

  19. Two putative subunits of a peptide pump encoded in the human major histocompatability complex class 2 region

    International Nuclear Information System (INIS)

    Bahram, S.; Arnold, D.; Bresnahan, M.; Strominger, J.L.; Spies, T.

    1991-01-01

    The class 2 region of the human major histocompatibility complex (MHC) may encode several genes controlling the processing of endogenous antigen and the presentation of peptide epitopes by MHC class 1 molecules to cytotoxic T lymphocytes. A previously described peptide supply factor (PSF1) is a member of the multidrug-resistance family of transporters and may pump cytosolic peptides into the membrane-bound compartment where class 1 molecules assemble. A second transporter gene, PSF2, was identified 10 kilobases (kb) from PSF1, near the class 2 DOB gene. The complete sequences of PSF1 and PSF2 were determined from cDNA clones. The translation products are closely related in sequence and predicted secondary structure. Both contain a highly conserved ATP-binding fold and share 25% homology in a hydrophobic domain with a tentative number of eight membrane-spanning segments. Based on the principle dimeric organization of these two domains in other transporters, PSF1 and PSF2 may function as complementary subunits, independently as homodimers, or both. Taken together with previous genetic evidence, the coregulation of PSF1 and PSF2 by γ interferon and the to-some-degree coordinate transcription of these genes suggest a common role in peptide-loading of class 1 molecules, although a distinct function of PSF2 cannot be ruled out

  20. Prevalence of enterotoxin-encoding genes and antimicrobial resistance in coagulase-negative and coagulase-positive Staphylococcus isolates from black pudding

    Directory of Open Access Journals (Sweden)

    Tiane Martin de Moura

    2012-10-01

    Full Text Available INTRODUCTION: Staphylococcal species are pathogens that are responsible for outbreaks of foodborne diseases. The aim of this study was to investigate the prevalence of enterotoxin-genes and the antimicrobial resistance profile in staphylococcus coagulase-negative (CoNS and coagulasepositive (CoPS isolates from black pudding in southern Brazil. METHODS: Two hundred typical and atypical colonies from Baird-Parker agar were inoculated on mannitol salt agar. Eighty-two mannitol-positive staphylococci were submitted to conventional biochemical tests and antimicrobial susceptibility profiling. The presence of coagulase (coa and enterotoxin (se genes was investigated by polymerase chain reaction. RESULTS: The isolates were divided into 2 groups: 75.6% (62/82 were CoNS and 24.4% (20/82 were CoPS. The biochemical tests identified 9 species, of which Staphylococcus saprophyticus (37.8% and Staphylococcus carnosus (15.9% were the most prevalent. Antimicrobial susceptibility tests showed resistance phenotypes to antibiotics widely administered in humans, such as gentamicin, tetracycline, chloramphenicol, and erythromycin. The coa gene was detected in 19.5% (16/82 of the strains and 4 polymorphic DNA fragments were observed. Five CoNS isolates carrying the coa gene were submitted for 16S rRNA sequencing and 3 showed similarity with CoNS. Forty strains were positive for at least 1 enterotoxin-encoding gene, the genes most frequently detected were sea (28.6% and seb (27.5%. CONCLUSIONS: The presence of antimicrobial resistant and enterotoxin-encoding genes in staphylococci isolates from black pudding indicated that this fermented food may represent a potential health risk, since staphylococci present in food could cause foodborne diseases or be a possible route for the transfer of antimicrobial resistance to humans.

  1. The pyrH gene of Lactococcus lactis subsp. cremoris encoding UMP kinase is transcribed as part of an operon including the frr1 gene encoding ribosomal recycling factor

    DEFF Research Database (Denmark)

    Wadskov-Hansen, Steen Lüders; Martinussen, Jan; Hammer, Karin

    2000-01-01

    establishing the ability of the encoded protein to synthesize UDP. The pyrH gene in L. lactis is flanked downstream by frr1 encoding ribosomal recycling factor 1 and upstream by an open reading frame, orfA, of unknown function. The three genes were shown to constitute an operon transcribed in the direction orf......A-pyrH-frr1 from a promoter immediately in front of orfA. This operon belongs to an evolutionary highly conserved gene cluster, since the organization of pyrH on the chromosomal level in L. lactis shows a high resemblance to that found in Bacillus subtilis as well as in Escherichia coli and several other...

  2. Identification and characterization of a novel Cut family cDNA that encodes human copper transporter protein CutC

    International Nuclear Information System (INIS)

    Li Jixi; Ji Chaoneng; Chen Jinzhong; Yang Zhenxing; Wang Yijing; Fei, Xiangwei; Zheng Mei; Gu Xing; Wen Ge; Xie Yi; Mao Yumin

    2005-01-01

    Copper is an essential heavy metal trace element that plays important roles in cell physiology. The Cut family was associated with the copper homeostasis and involved in several important metabolisms, such as uptake, storage, delivery, and efflux of copper. In this study, a novel Cut family cDNA was isolated from the human fetal brain library, which encodes a 273 amino acid protein with a molecular mass of about 29.3 kDa and a calculated pI of 8.17. It was named hCutC (human copper transporter protein CutC). The ORF of hCutC gene was cloned into pQE30 vector and expressed in Escherichia coli M15. The secreted hCutC protein was purified to a homogenicity of 95% by using the Ni-NTA affinity chromatography. RT-PCR analysis showed that the hCutC gene expressed extensively in human tissues. Subcellular location analysis of hCutC-EGFP fusion protein revealed that hCutC was distributed to cytoplasm of COS-7 cells, and both cytoplasm and nucleus of AD293 cells. The results suggest that hCutC may be one shuttle protein and play important roles in intracellular copper trafficking

  3. StAR Enhances Transcription of Genes Encoding the Mitochondrial Proteases Involved in Its Own Degradation

    Science.gov (United States)

    Bahat, Assaf; Perlberg, Shira; Melamed-Book, Naomi; Lauria, Ines; Langer, Thomas

    2014-01-01

    Steroidogenic acute regulatory protein (StAR) is essential for steroid hormone synthesis in the adrenal cortex and the gonads. StAR activity facilitates the supply of cholesterol substrate into the inner mitochondrial membranes where conversion of the sterol to a steroid is catalyzed. Mitochondrial import terminates the cholesterol mobilization activity of StAR and leads to mounting accumulation of StAR in the mitochondrial matrix. Our studies suggest that to prevent mitochondrial impairment, StAR proteolysis is executed by at least 2 mitochondrial proteases, ie, the matrix LON protease and the inner membrane complexes of the metalloproteases AFG3L2 and AFG3L2:SPG7/paraplegin. Gonadotropin administration to prepubertal rats stimulated ovarian follicular development associated with increased expression of the mitochondrial protein quality control system. In addition, enrichment of LON and AFG3L2 is evident in StAR-expressing ovarian cells examined by confocal microscopy. Furthermore, reporter studies of the protease promoters examined in the heterologous cell model suggest that StAR expression stimulates up to a 3.5-fold increase in the protease gene transcription. Such effects are StAR-specific, are independent of StAR activity, and failed to occur upon expression of StAR mutants that do not enter the matrix. Taken together, the results of this study suggest the presence of a novel regulatory loop, whereby acute accumulation of an apparent nuisance protein in the matrix provokes a mitochondria to nucleus signaling that, in turn, activates selected transcription of genes encoding the enrichment of mitochondrial proteases relevant for enhanced clearance of StAR. PMID:24422629

  4. Molecular cloning and expression analysis of the gene encoding proline dehydrogenase from Jatropha curcas L.

    Science.gov (United States)

    Wang, Haibo; Ao, Pingxing; Yang, Shuanglong; Zou, Zhurong; Wang, Shasha; Gong, Ming

    2015-03-01

    Proline dehydrogenase (ProDH) (EC 1.5.99.8) is a key enzyme in the catabolism of proline. The enzyme JcProDH and its complementary DNA (cDNA) were isolated from Jatropha curcas L., an important woody oil plant used as a raw material for biodiesels. It has been classified as a member of the Pro_dh superfamily based on multiple sequence alignment, phylogenetic characterization, and its role in proline catabolism. Its cDNA is 1674 bp in length with a complete open reading frame of 1485 bp, which encodes a polypeptide chain of 494 amino acids with a predicted molecular mass of 54 kD and a pI of 8.27. Phylogenetic analysis indicated that JcProDH showed high similarity with ProDH from other plants. Reverse transcription PCR (RT-PCR) analysis revealed that JcProDH was especially abundant in the seeds and flowers but scarcely present in the stems, roots, and leaves. In addition, the expression of JcProDH increased in leaves experiencing environmental stress such as cold (5 °C), heat (42 °C), salt (300 mM), and drought (30 % PEG6000). The JcProDH protein was successfully expressed in the yeast strain INVSc1 and showed high enzyme activity in proline catabolism. This result confirmed that the JcProDH gene negatively participated in the stress response.

  5. Idiopathic neonatal necrotising fasciitis caused by community-acquired MSSA encoding Panton Valentine Leukocidin genes.

    LENUS (Irish Health Repository)

    Dunlop, Rebecca L E

    2012-02-01

    Neonatal necrotising fasciitis is very rare in comparison to the adult presentation of the disease and a Plastic Surgeon may only encounter one such case during his or her career. Often this is initially misdiagnosed and managed as simple cellulitis. It generally affects previously healthy babies, the site is often the lower back area and a history of minor skin trauma may be elicited. The causative organism is usually Streptococcus or polymicrobial, as is the case in the adult population. We present the case of a previously healthy 11-day-old infant with idiopathic, rapidly progressive necrotising fasciitis of the back, cause by Methicillin sensitive Staphylococcus aureus (MSSA) infection. The strain was isolated and found to encode the Panton-Valentine Leukocidin genes, which have been associated with particularly severe necrotising infections in other sites, with high mortality. These strains are the subject of specific treatment and eradication guidance in the UK but awareness of this and the importance of obtaining detailed culture typing is likely to be low amongst Plastic Surgeons.

  6. Genetic analysis of the VP2-encoding gene of canine parvovirus strains from Africa.

    Science.gov (United States)

    Dogonyaro, Banenat B; Bosman, Anna-Mari; Sibeko, Kgomotso P; Venter, Estelle H; van Vuuren, Moritz

    2013-08-30

    Since the emergence of canine parvovirus type-2 (CPV-2) in the early 1970s, it has been evolving into novel genetic and antigenic variants (CPV-2a, 2b and 2c) that are unevenly distributed throughout the world. Genetic characterization of CPV-2 has not been documented in Africa since 1998 apart from the study carried out in Tunisia 2009. A total of 139 field samples were collected from South Africa and Nigeria, detected using PCR and the full length VP2-encoding gene of 27 positive samples were sequenced and genetically analyzed. Nigerian samples (n=6), South Africa (n=19) and vaccine strains (n=2) were compared with existing sequences obtained from GenBank. The results showed the presence of both CPV-2a and 2b in South Africa and only CPV-2a in Nigeria. No CPV-2c strain was detected during this study. Phylogenetic analysis showed a clustering not strictly associated with the geographical origin of the analyzed strains, although most of the South African strains tended to cluster together and the viral strains analyzed in this study were not completely distinct from CPV-2 strains from other parts of the world. Amino acid analysis showed predicted amino acid changes. Copyright © 2013 Elsevier B.V. All rights reserved.

  7. Detection of the human endogenous retrovirus ERV3-encoded Env-protein in human tissues using antibody-based proteomics.

    Science.gov (United States)

    Fei, Chen; Atterby, Christina; Edqvist, Per-Henrik; Pontén, Fredrik; Zhang, Wei Wei; Larsson, Erik; Ryan, Frank P

    2014-01-01

    There is growing evidence to suggest that human endogenous retroviruses (HERVs) have contributed to human evolution, being expressed in development, normal physiology and disease. A key difficulty in the scientific evaluation of this potential viral contribution is the accurate demonstration of virally expressed protein in specific human cells and tissues. In this study, we have adopted the endogenous retrovirus, ERV3, as our test model in developing a reliable high-capacity methodology for the expression of such endogenous retrovirus-coded protein. Two affinity-purified polyclonal antibodies to ERV3 Env-encoded protein were generated to detect the corresponding protein expression pattern in specific human cells, tissues and organs. Sampling included normal tissues from 144 individuals ranging from childhood to old age. This included more than forty different tissues and organs and some 216 different cancer tissues representing the twenty commonest forms of human cancer. The Rudbeck Laboratory, Uppsala University and Uppsala University Hospital, Uppsala, Sweden. The potential expression at likely physiological level of the ERV3Env encoded protein in a wide range of human cells, tissues and organs. We found that ERV3 encoded Env protein is expressed at substantive levels in placenta, testis, adrenal gland, corpus luteum, Fallopian tubes, sebaceous glands, astrocytes, bronchial epithelium and the ducts of the salivary glands. Substantive expression was also seen in a variety of epithelial cells as well as cells known to undergo fusion in inflammation and in normal physiology, including fused macrophages, myocardium and striated muscle. This contrasted strongly with the low levels expressed in other tissues types. These findings suggest that this virus plays a significant role in human physiology and may also play a possible role in disease. This technique can now be extended to the study of other HERV genomes within the human chromosomes that may have contributed to

  8. Cloning and sequence of the human adrenodoxin reductase gene

    International Nuclear Information System (INIS)

    Lin, Dong; Shi, Y.; Miller, W.L.

    1990-01-01

    Adrenodoxin reductase is a flavoprotein mediating electron transport to all mitochondrial forms of cytochrome P450. The authors cloned the human adrenodoxin reductase gene and characterized it by restriction endonuclease mapping and DNA sequencing. The entire gene is approximately 12 kilobases long and consists of 12 exons. The first exon encodes the first 26 of the 32 amino acids of the signal peptide, and the second exon encodes the remainder of signal peptide and the apparent FAD binding site. The remaining 10 exons are clustered in a region of only 4.3 kilobases, separated from the first two exons by a large intron of about 5.6 kilobases. Two forms of human adrenodoxin reductase mRNA, differing by the presence or absence of 18 bases in the middle of the sequence, arise from alternate splicing at the 5' end of exon 7. This alternately spliced region is directly adjacent to the NADPH binding site, which is entirely contained in exon 6. The immediate 5' flanking region lacks TATA and CAAT boxes; however, this region is rich in G+C and contains six copies of the sequence GGGCGGG, resembling promoter sequences of housekeeping genes. RNase protection experiments show that transcription is initiated from multiple sites in the 5' flanking region, located about 21-91 base pairs upstream from the AUG translational initiation codon

  9. AIB1 gene amplification and the instability of polyQ encoding sequence in breast cancer cell lines

    Directory of Open Access Journals (Sweden)

    Clarke Robert

    2006-05-01

    Full Text Available Abstract Background The poly Q polymorphism in AIB1 (amplified in breast cancer gene is usually assessed by fragment length analysis which does not reveal the actual sequence variation. The purpose of this study is to investigate the sequence variation of poly Q encoding region in breast cancer cell lines at single molecule level, and to determine if the sequence variation is related to AIB1 gene amplification. Methods The polymorphic poly Q encoding region of AIB1 gene was investigated at the single molecule level by PCR cloning/sequencing. The amplification of AIB1 gene in various breast cancer cell lines were studied by real-time quantitative PCR. Results Significant amplifications (5–23 folds of AIB1 gene were found in 2 out of 9 (22% ER positive cell lines (in BT-474 and MCF-7 but not in BT-20, ZR-75-1, T47D, BT483, MDA-MB-361, MDA-MB-468 and MDA-MB-330. The AIB1 gene was not amplified in any of the ER negative cell lines. Different passages of MCF-7 cell lines and their derivatives maintained the feature of AIB1 amplification. When the cells were selected for hormone independence (LCC1 and resistance to 4-hydroxy tamoxifen (4-OH TAM (LCC2 and R27, ICI 182,780 (LCC9 or 4-OH TAM, KEO and LY 117018 (LY-2, AIB1 copy number decreased but still remained highly amplified. Sequencing analysis of poly Q encoding region of AIB1 gene did not reveal specific patterns that could be correlated with AIB1 gene amplification. However, about 72% of the breast cancer cell lines had at least one under represented (3CAA(CAG9(CAACAG3(CAACAGCAG2CAA of the original cell line, a number of altered poly Q encoding sequences were found in the derivatives of MCF-7 cell lines. Conclusion These data suggest that poly Q encoding region of AIB1 gene is somatic unstable in breast cancer cell lines. The instability and the sequence characteristics, however, do not appear to be associated with the level of the gene amplification.

  10. CHARACTERIZATION OF 0.58 kb DNA STILBENE SYNTHASE ENCODING GENE FRAGMENT FROM MELINJO PLANT (Gnetum gnemon

    Directory of Open Access Journals (Sweden)

    Tri Joko Raharjo

    2011-12-01

    Full Text Available Resveratrol is a potent anticancer agent resulted as the main product of enzymatic reaction between common precursor in plants and Stilbene Synthase enzyme, which is expressed by sts gene. Characterization of internal fragment of Stilbene Synthase (STS encoding gene from melinjo plant (Gnetum gnemon L. has been carried out as part of a larger work to obtain a full length of Stilbene Synthase encoding gene of the plant. RT-PCR (Reverse Transcriptase Polymerase Chain Reaction was performed using two degenerated primers to amplify the gene fragment. Ten published STS conserved amino acid sequences from various plant species from genebank were utilized to construct a pair of GGF2 (5' GTTCCACCTGCGAAGCAGCC 3' and GGR2 (5' CTGGATCGCACATCC TGGTG 3' primers. Both designed primers were predicted to be in the position of 334-354 and 897-916 kb of the gene respectively. Total RNA isolated from melinjo leaves was used as template for the RT-PCR amplification process using two-step technique. A collection of 0.58 DNA fragments was generated from RT-PCR amplification and met the expected results. The obtained DNA fragments were subsequently isolated, refined and sequenced. A nucleotide sequence analysis was accomplished by comparing it to the existed sts genes available in genebank. Homology analysis of the DNA fragments with Arachis hypogaea L00952 sts gene showed high similarity level. Taken together, the results are evidence that the amplified fragment obtained in this study is part of melinjo sts gene

  11. A human-specific de novo protein-coding gene associated with human brain functions.

    Directory of Open Access Journals (Sweden)

    Chuan-Yun Li

    2010-03-01

    Full Text Available To understand whether any human-specific new genes may be associated with human brain functions, we computationally screened the genetic vulnerable factors identified through Genome-Wide Association Studies and linkage analyses of nicotine addiction and found one human-specific de novo protein-coding gene, FLJ33706 (alternative gene symbol C20orf203. Cross-species analysis revealed interesting evolutionary paths of how this gene had originated from noncoding DNA sequences: insertion of repeat elements especially Alu contributed to the formation of the first coding exon and six standard splice junctions on the branch leading to humans and chimpanzees, and two subsequent substitutions in the human lineage escaped two stop codons and created an open reading frame of 194 amino acids. We experimentally verified FLJ33706's mRNA and protein expression in the brain. Real-Time PCR in multiple tissues demonstrated that FLJ33706 was most abundantly expressed in brain. Human polymorphism data suggested that FLJ33706 encodes a protein under purifying selection. A specifically designed antibody detected its protein expression across human cortex, cerebellum and midbrain. Immunohistochemistry study in normal human brain cortex revealed the localization of FLJ33706 protein in neurons. Elevated expressions of FLJ33706 were detected in Alzheimer's brain samples, suggesting the role of this novel gene in human-specific pathogenesis of Alzheimer's disease. FLJ33706 provided the strongest evidence so far that human-specific de novo genes can have protein-coding potential and differential protein expression, and be involved in human brain functions.

  12. Non-Interfering Effects of Active Post-Encoding Tasks on Episodic Memory Consolidation in Humans.

    Science.gov (United States)

    Varma, Samarth; Takashima, Atsuko; Krewinkel, Sander; van Kooten, Maaike; Fu, Lily; Medendorp, W Pieter; Kessels, Roy P C; Daselaar, Sander M

    2017-01-01

    So far, studies that investigated interference effects of post-learning processes on episodic memory consolidation in humans have used tasks involving only complex and meaningful information. Such tasks require reallocation of general or encoding-specific resources away from consolidation-relevant activities. The possibility that interference can be elicited using a task that heavily taxes our limited brain resources, but has low semantic and hippocampal related long-term memory processing demands, has never been tested. We address this question by investigating whether consolidation could persist in parallel with an active, encoding-irrelevant, minimally semantic task, regardless of its high resource demands for cognitive processing. We distinguish the impact of such a task on consolidation based on whether it engages resources that are: (1) general/executive, or (2) specific/overlapping with the encoding modality. Our experiments compared subsequent memory performance across two post-encoding consolidation periods: quiet wakeful rest and a cognitively demanding n-Back task. Across six different experiments (total N = 176), we carefully manipulated the design of the n-Back task to target general or specific resources engaged in the ongoing consolidation process. In contrast to previous studies that employed interference tasks involving conceptual stimuli and complex processing demands, we did not find any differences between n-Back and rest conditions on memory performance at delayed test, using both recall and recognition tests. Our results indicate that: (1) quiet, wakeful rest is not a necessary prerequisite for episodic memory consolidation; and (2) post-encoding cognitive engagement does not interfere with memory consolidation when task-performance has minimal semantic and hippocampally-based episodic memory processing demands. We discuss our findings with reference to resource and reactivation-led interference theories.

  13. Detection of β-lactamase encoding genes in feces, soil and water from a Brazilian pig farm.

    Science.gov (United States)

    Furlan, João Pedro Rueda; Stehling, Eliana Guedes

    2018-01-10

    β-lactam antibiotics are widely used for the treatment of different types of infections worldwide and the resistance to these antibiotics has grown sharply, which is of great concern. Resistance to β-lactams in gram-negative bacteria is mainly due to the production of β-lactamases, which are classified according to their functional activities. The aim of this study was to verify the presence of β-lactamases encoding genes in feces, soil, and water from a Brazilian pig farm. Different β-lactamases encoding genes were found, including bla CTX-M-Gp1 , bla CTX-M-Gp9 , bla SHV , bla OXA-1-like , bla GES , and bla VEB . The bla SHV and bla CTX-M-Gp1 genes have been detected in all types of samples, indicating the spread of β-lactam resistant bacteria among farm pigs and the environment around them. These results indicate that β-lactamase encoding genes belonging to the cloxacillinase, ESBL, and carbapenemase and they have high potential to spread in different sources, due to the fact that genes are closely related to mobile genetic elements, especially plasmids.

  14. Molecular cloning and expression of the gene encoding the kinetoplast-associated type II DNA topoisomerase of Crithidia fasciculata.

    Science.gov (United States)

    Pasion, S G; Hines, J C; Aebersold, R; Ray, D S

    1992-01-01

    A type II DNA topoisomerase, topoIImt, was shown previously to be associated with the kinetoplast DNA of the trypanosomatid Crithidia fasciculata. The gene encoding this kinetoplast-associated topoisomerase has been cloned by immunological screening of a Crithidia genomic expression library with monoclonal antibodies raised against the purified enzyme. The gene CfaTOP2 is a single copy gene and is expressed as a 4.8-kb polyadenylated transcript. The nucleotide sequence of CfaTOP2 has been determined and encodes a predicted polypeptide of 1239 amino acids with a molecular mass of 138,445. The identification of the cloned gene is supported by immunoblot analysis of the beta-galactosidase-CfaTOP2 fusion protein expressed in Escherichia coli and by analysis of tryptic peptide sequences derived from purified topoIImt. CfaTOP2 shares significant homology with nuclear type II DNA topoisomerases of other eukaryotes suggesting that in Crithidia both nuclear and mitochondrial forms of topoisomerase II are encoded by the same gene.

  15. The rgg0182 gene encodes a transcriptional regulator required for the full Streptococcus thermophilus LMG18311 thermal adaptation.

    Science.gov (United States)

    Henry, Romain; Bruneau, Emmanuelle; Gardan, Rozenn; Bertin, Stéphane; Fleuchot, Betty; Decaris, Bernard; Leblond-Bourget, Nathalie

    2011-10-07

    Streptococcus thermophilus is an important starter strain for the production of yogurt and cheeses. The analysis of sequenced genomes of four strains of S. thermophilus indicates that they contain several genes of the rgg familly potentially encoding transcriptional regulators. Some of the Rgg proteins are known to be involved in bacterial stress adaptation. In this study, we demonstrated that Streptococcus thermophilus thermal stress adaptation required the rgg0182 gene which transcription depends on the culture medium and the growth temperature. This gene encoded a protein showing similarity with members of the Rgg family transcriptional regulator. Our data confirmed that Rgg0182 is a transcriptional regulator controlling the expression of its neighboring genes as well as chaperones and proteases encoding genes. Therefore, analysis of a Δrgg0182 mutant revealed that this protein played a role in the heat shock adaptation of Streptococcus thermophilus LMG18311. These data showed the importance of the Rgg0182 transcriptional regulator on the survival of S. thermophilus during dairy processes and more specifically during changes in temperature.

  16. The rgg0182 gene encodes a transcriptional regulator required for the full Streptococcus thermophilus LMG18311 thermal adaptation

    Directory of Open Access Journals (Sweden)

    Bertin Stéphane

    2011-10-01

    Full Text Available Abstract Background Streptococcus thermophilus is an important starter strain for the production of yogurt and cheeses. The analysis of sequenced genomes of four strains of S. thermophilus indicates that they contain several genes of the rgg familly potentially encoding transcriptional regulators. Some of the Rgg proteins are known to be involved in bacterial stress adaptation. Results In this study, we demonstrated that Streptococcus thermophilus thermal stress adaptation required the rgg0182 gene which transcription depends on the culture medium and the growth temperature. This gene encoded a protein showing similarity with members of the Rgg family transcriptional regulator. Our data confirmed that Rgg0182 is a transcriptional regulator controlling the expression of its neighboring genes as well as chaperones and proteases encoding genes. Therefore, analysis of a Δrgg0182 mutant revealed that this protein played a role in the heat shock adaptation of Streptococcus thermophilus LMG18311. Conclusions These data showed the importance of the Rgg0182 transcriptional regulator on the survival of S. thermophilus during dairy processes and more specifically during changes in temperature.

  17. Cloning and functional analysis of human mTERFL encoding a novel mitochondrial transcription termination factor-like protein

    International Nuclear Information System (INIS)

    Chen Yao; Zhou Guangjin; Yu Min; He Yungang; Tang Wei; Lai Jianhua; He Jie; Liu Wanguo; Tan Deyong

    2005-01-01

    Serum plays an important role in the regulation of cell cycle and cell growth. To identify novel serum-inhibitory factors and study their roles in cell cycle regulation, we performed mRNA differential display analysis of U251 cells in the presence or absence of serum and cloned a novel gene encoding the human mitochondrial transcription termination factor-like protein (mTERFL). The full-length mTERFL cDNA has been isolated and the genomic structure determined. The mTERFL gene consists of three exons and encodes 385 amino acids with 52% sequence similarity to the human mitochondrial transcription termination factor (mTERF). However, mTERFL and mTERF have an opposite expression pattern in response to serum. The expression of mTERFL is dramatically inhibited by the addition of serum in serum-starved cells while the mTERF is rather induced. Northern blot analysis detected three mTERFL transcripts of 1.7, 3.2, and 3.5 kb. Besides the 3.2 kb transcript that is unique to skeletal muscle, other two transcripts express predominant in heart, liver, pancreas, and skeletal muscle. Expression of the GFP-mTERFL fusion protein in HeLa cells localized it to the mitochondria. Furthermore, ectopic expression of mTERFL suppresses cell growth and arrests cells in the G1 stage demonstrated by MTT and flow cytometry analysis. Collectively, our data suggest that mTERFL is a novel mTERF family member and a serum-inhibitory factor probably participating in the regulation of cell growth through the modulation of mitochondrial transcription

  18. Translational Control of Host Gene Expression by a Cys-Motif Protein Encoded in a Bracovirus.

    Directory of Open Access Journals (Sweden)

    Eunseong Kim

    Full Text Available Translational control is a strategy that various viruses use to manipulate their hosts to suppress acute antiviral response. Polydnaviruses, a group of insect double-stranded DNA viruses symbiotic to some endoparasitoid wasps, are divided into two genera: ichnovirus (IV and bracovirus (BV. In IV, some Cys-motif genes are known as host translation-inhibitory factors (HTIF. The genome of endoparasitoid wasp Cotesia plutellae contains a Cys-motif gene (Cp-TSP13 homologous to an HTIF known as teratocyte-secretory protein 14 (TSP14 of Microplitis croceipes. Cp-TSP13 consists of 129 amino acid residues with a predicted molecular weight of 13.987 kDa and pI value of 7.928. Genomic DNA region encoding its open reading frame has three introns. Cp-TSP13 possesses six conserved cysteine residues as other Cys-motif genes functioning as HTIF. Cp-TSP13 was expressed in Plutella xylostella larvae parasitized by C. plutellae. C. plutellae bracovirus (CpBV was purified and injected into non-parasitized P. xylostella that expressed Cp-TSP13. Cp-TSP13 was cloned into a eukaryotic expression vector and used to infect Sf9 cells to transiently express Cp-TSP13. The synthesized Cp-TSP13 protein was detected in culture broth. An overlaying experiment showed that the purified Cp-TSP13 entered hemocytes. It was localized in the cytosol. Recombinant Cp-TSP13 significantly inhibited protein synthesis of secretory proteins when it was added to in vitro cultured fat body. In addition, the recombinant Cp-TSP13 directly inhibited the translation of fat body mRNAs in in vitro translation assay using rabbit reticulocyte lysate. Moreover, the recombinant Cp-TSP13 significantly suppressed cellular immune responses by inhibiting hemocyte-spreading behavior. It also exhibited significant insecticidal activities by both injection and feeding routes. These results indicate that Cp-TSP13 is a viral HTIF.

  19. A mutation in the gene encoding mitochondrial Mg²+ channel MRS2 results in demyelination in the rat.

    Directory of Open Access Journals (Sweden)

    Takashi Kuramoto

    2011-01-01

    Full Text Available The rat demyelination (dmy mutation serves as a unique model system to investigate the maintenance of myelin, because it provokes severe myelin breakdown in the central nervous system (CNS after normal postnatal completion of myelination. Here, we report the molecular characterization of this mutation and discuss the possible pathomechanisms underlying demyelination. By positional cloning, we found that a G-to-A transition, 177 bp downstream of exon 3 of the Mrs2 (MRS2 magnesium homeostasis factor (Saccharomyces cerevisiae gene, generated a novel splice acceptor site which resulted in functional inactivation of the mutant allele. Transgenic rescue with wild-type Mrs2-cDNA validated our findings. Mrs2 encodes an essential component of the major Mg²+ influx system in mitochondria of yeast as well as human cells. We showed that the dmy/dmy rats have major mitochondrial deficits with a markedly elevated lactic acid concentration in the cerebrospinal fluid, a 60% reduction in ATP, and increased numbers of mitochondria in the swollen cytoplasm of oligodendrocytes. MRS2-GFP recombinant BAC transgenic rats showed that MRS2 was dominantly expressed in neurons rather than oligodendrocytes and was ultrastructurally observed in the inner membrane of mitochondria. Our observations led to the conclusion that dmy/dmy rats suffer from a mitochondrial disease and that the maintenance of myelin has a different mechanism from its initial production. They also established that Mg²+ homeostasis in CNS mitochondria is essential for the maintenance of myelin.

  20. The pbrB gene encodes a laccase required for DHN-melanin synthesis in conidia of Talaromyces (Penicillium) marneffei.

    Science.gov (United States)

    Sapmak, Ariya; Boyce, Kylie J; Andrianopoulos, Alex; Vanittanakom, Nongnuch

    2015-01-01

    Talaromyces marneffei (Basionym: Penicillium marneffei) is a significant opportunistic fungal pathogen in patients infected with human immunodeficiency virus in Southeast Asia. T. marneffei cells have been shown to become melanized in vivo. Melanins are pigment biopolymers which act as a non-specific protectant against various stressors and which play an important role during virulence in fungi. The synthesis of the two most commonly found melanins in fungi, the eumelanin DOPA-melanin and the allomelanin DHN-melanin, requires the action of laccase enzymes. The T. marneffei genome encodes a number of laccases and this study describes the characterization of one of these, pbrB, during growth and development. A strain carrying a PbrB-GFP fusion shows that pbrB is expressed at high levels during asexual development (conidiation) but not in cells growing vegetatively. The pbrB gene is required for the synthesis of DHN-melanin in conidia and when deleted results in brown pigmented conidia, in contrast to the green conidia of the wild type.

  1. Cloning an expressed gene shared by the human sex chromosomes

    International Nuclear Information System (INIS)

    Darling, S.M.; Banting, G.S.; Pym, B.; Wolfe, J.; Goodfellow, P.N.

    1986-01-01

    The existence of genes shared by mammalian sex chromosomes has been predicted on both evolutionary and functional grounds. However, the only experimental evidence for such genes in humans is the cell-surface antigen encoded by loci on the X and Y chromosomes (MIC2X and MIC2Y, respectively), which is recognized by the monoclonal antibody 12E7. Using the bacteriophage λgt11 expression system in Escherichia coli and immunoscreening techniques, the authors have isolated a cDNA clone whose primary product is recognized by 12E7. Southern blot analysis using somatic cell hybrids containing only the human X or Y chromosomes shows that the sequences reacting with the cDNA clone are localized to the sex chromosomes. In addition, the clone hybridizes to DNAs isolated from mouse cells that have been transfected with human DNA and selected for 12E7 expression on the fluorescence-activated cell sorter. The authors conclude that the cDNA clone encodes the 12E7 antigen, which is the primary product of the MIC2 loci. The clone was used to explore sequence homology between MIC2X and MIC2Y; these loci are closely related, if not identical

  2. The A581G Mutation in the Gene Encoding Plasmodium falciparum Dihydropteroate Synthetase Reduces the Effectiveness of Sulfadoxine-Pyrimethamine Preventive Therapy in Malawian Pregnant Women

    NARCIS (Netherlands)

    Gutman, Julie; Kalilani, Linda; Taylor, Steve; Zhou, Zhiyong; Wiegand, Ryan E.; Thwai, Kyaw L.; Mwandama, Dyson; Khairallah, Carole; Madanitsa, Mwayi; Chaluluka, Ebbie; Dzinjalamala, Fraction; Ali, Doreen; Mathanga, Don P.; Skarbinski, Jacek; Shi, Ya Ping; Meshnick, Steve; ter Kuile, Feiko O.

    2015-01-01

    Background. The A581G mutation in the gene encoding Plasmodium falciparum dihydropteroate synthase (dhps), in combination with the quintuple mutant involving mutations in both dhps and the gene encoding dihydrofolate reductase (dhfr), the so-called sextuple mutant, has been associated with increased

  3. Cloning and characterization of the gsk gene encoding guanosine kinase of Escherichia coli

    DEFF Research Database (Denmark)

    Harlow, Kenneth W.; Nygaard, Per; Hove-Jensen, Bjarne

    1995-01-01

    The Escherichia coli gsk gene encoding guanosine kinase was cloned from the Kohara gene library by complementation of the E. coli gsk-1 mutant allele. The cloned DNA fragment was sequenced and shown to encode a putative polypeptide of 433 amino acids with a molecular mass of 48,113 Da. Minicell...

  4. Chronic granulomatous disease caused by mutations other than the common GT deletion in NCF1, the gene encoding the p47phox component of the phagocyte NADPH oxidase

    NARCIS (Netherlands)

    Roos, Dirk; de Boer, Martin; Köker, M. Yavuz; Dekker, Jan; Singh-Gupta, Vinita; Ahlin, Anders; Palmblad, Jan; Sanal, Ozden; Kurenko-Deptuch, Magdalena; Jolles, Stephen; Wolach, Baruch

    2006-01-01

    Chronic granulomatous disease (CGD) is an inherited immunodeficiency caused by defects in any of four genes encoding components of the leukocyte nicotinamide dinucleotide phosphate, reduced (NADPH) oxidase. One of these is the autosomal neutrophil cytosolic factor 1 (NCF1) gene encoding the p47phox

  5. Cloning, characterization, expression analysis and inhibition studies of a novel gene encoding Bowman-Birk type protease inhibitor from rice bean

    Science.gov (United States)

    This paper presents the first study describing the isolation, cloning and characterization of a full length gene encoding Bowman-Birk protease inhibitor (RbTI) from rice bean (Vigna umbellata). A full-length protease inhibitor gene with complete open reading frame of 327bp encoding 109 amino acids w...

  6. The Aspergillus niger faeB gene encodes a second feruloyl esterase involved in pectin and xylan degradation and is specifically induced in the presence of aromatic compounds

    NARCIS (Netherlands)

    Vries, de R.P.; vanKuyk, P.A.; Kester, H.C.M.; Visser, J.

    2002-01-01

    The faeB gene encoding a second feruloyl esterase from Aspergillus niger has been cloned and characterized. It consists of an open reading frame of 1644 bp containing one intron. The gene encodes a protein of 521 amino acids that has sequence similarity to that of an Aspergillus oryzae tannase.

  7. Evidence for the bacterial origin of genes encoding fermentation enzymes of the amitochondriate protozoan parasite Entamoeba histolytica.

    Science.gov (United States)

    Rosenthal, B; Mai, Z; Caplivski, D; Ghosh, S; de la Vega, H; Graf, T; Samuelson, J

    1997-06-01

    Entamoeba histolytica is an amitochondriate protozoan parasite with numerous bacterium-like fermentation enzymes including the pyruvate:ferredoxin oxidoreductase (POR), ferredoxin (FD), and alcohol dehydrogenase E (ADHE). The goal of this study was to determine whether the genes encoding these cytosolic E. histolytica fermentation enzymes might derive from a bacterium by horizontal transfer, as has previously been suggested for E. histolytica genes encoding heat shock protein 60, nicotinamide nucleotide transhydrogenase, and superoxide dismutase. In this study, the E. histolytica por gene and the adhE gene of a second amitochondriate protozoan parasite, Giardia lamblia, were sequenced, and their phylogenetic positions were estimated in relation to POR, ADHE, and FD cloned from eukaryotic and eubacterial organisms. The E. histolytica por gene encodes a 1,620-amino-acid peptide that contained conserved iron-sulfur- and thiamine pyrophosphate-binding sites. The predicted E. histolytica POR showed fewer positional identities to the POR of G. lamblia (34%) than to the POR of the enterobacterium Klebsiella pneumoniae (49%), the cyanobacterium Anabaena sp. (44%), and the protozoan Trichomonas vaginalis (46%), which targets its POR to anaerobic organelles called hydrogenosomes. Maximum-likelihood, neighbor-joining, and parsimony analyses also suggested as less likely E. histolytica POR sharing more recent common ancestry with G. lamblia POR than with POR of bacteria and the T. vaginalis hydrogenosome. The G. lamblia adhE encodes an 888-amino-acid fusion peptide with an aldehyde dehydrogenase at its amino half and an iron-dependent (class 3) ADH at its carboxy half. The predicted G. lamblia ADHE showed extensive positional identities to ADHE of Escherichia coli (49%), Clostridium acetobutylicum (44%), and E. histolytica (43%) and lesser identities to the class 3 ADH of eubacteria and yeast (19 to 36%). Phylogenetic analyses inferred a closer relationship of the E

  8. A study of Staphylococcus aureusnasal carriage, antibacterial resistance and virulence factor encoding genes in a tertiary care hospital, Kayseri, Turkey.

    Science.gov (United States)

    Oguzkaya-Artan, M; Artan, C; Baykan, Z; Sakalar, C; Turan, A; Aksu, H

    2015-01-01

    This study was to determine the virulence encoding genes, and the antibiotic resistance patterns of the Staphylococcus aureus isolates, which were isolated from the nasal samples of chest clinic patients. The nasal samples of the in-patients (431) and out-patients (1857) in Kayseri Training and Research Hospital's Chest Clinic, Kayseri, Turkey, were cultured on CHROMagar (Biolife, Italiana) S. aureus, and subcultured on sheep blood agar for the isolation of S. aureus. Disc diffusion method was used for antimicrobial susceptibility testing. The occurrence of the staphylococcal virulence encoding genes (enterotoksins [sea, seb, sec, see, seg, seh, sei, sej], fibronectin-binding proteins A, B [fnbA, fnbB], toxic shock syndrome toxin-1 [tst]) were detected by polymerase chain reaction. Forty-five of the 55 (81.8%) S. aureus isolates from inpatients, and 319 (90.6%) isolates from tested 352 out-patient's isolates were suspected to all the antibiotics tested. methicillin-resistant S. aureus (MRSA) was detected in 1.2% of S. aureus isolates. Rifampin, trimethoprim-sulfamethoxazole, clindamycin, erythromycin, gentamicin resistance rates were 1.2%, 1.7%, 2.0%, 8.8%, and 1.2%, respectively. The isolates were susceptible to teicoplanin and vancomycin. The genes most frequently found were tst (92.7%), seg (85.8%), sea (83.6%), fnbA (70.9%). There was no statistical significance detected between MRSA and mecA-negative S. aureus isolates in encoding genes distribution (P > 0.05). Our results show that virulence factor encoding genes were prevalent in patients with S. aureus carriage, whereas antibiotic resistance was low. These virulence determinants may increase the risk for subsequent invasive infections in carriers.

  9. The Down regulated in Adenoma (dra) gene encodes an intestine-specific membrane sulfate transport protein.

    Science.gov (United States)

    Silberg, D G; Wang, W; Moseley, R H; Traber, P G

    1995-05-19

    A gene has been described, Down Regulated in Adenoma (dra), which is expressed in normal colon but is absent in the majority of colon adenomas and adenocarcinomas. However, the function of this protein is unknown. Because of sequence similarity to a recently cloned membrane sulfate transporter in rat liver, the transport function of Dra was examined. We established that dra encodes for a Na(+)-independent transporter for both sulfate and oxalate using microinjected Xenopus oocytes as an assay system. Sulfate transport was sensitive to the anion exchange inhibitor DIDS (4,4'-diisothiocyano-2,2' disulfonic acid stilbene). Using an RNase protection assay, we found that dra mRNA expression is limited to the small intestine and colon in mouse, therefore identifying Dra as an intestine-specific sulfate transporter. dra also had a unique pattern of expression during intestinal development. Northern blot analysis revealed a low level of expression in colon at birth with a marked increase in the first 2 postnatal weeks. In contrast, there was a lower, constant level of expression in small intestine in the postnatal period. Caco-2 cells, a colon carcinoma cell line that differentiates over time in culture, demonstrated a marked induction of dra mRNA as cells progressed from the preconfluent (undifferentiated) to the postconfluent (differentiated) state. These results show that Dra is an intestine-specific Na(+)-independent sulfate transporter that has differential expression during colonic development. This functional characterization provides the foundation for investigation of the role of Dra in intestinal sulfate transport and in the malignant phenotype.

  10. Characterization of mouse UDP-glucose pyrophosphatase, a Nudix hydrolase encoded by the Nudt14 gene

    Energy Technology Data Exchange (ETDEWEB)

    Heyen, Candy A.; Tagliabracci, Vincent S.; Zhai, Lanmin [Department of Biochemistry and Molecular Biology, Indiana University School of Medicine, Indianapolis, IN 46202 (United States); Roach, Peter J., E-mail: proach@iupui.edu [Department of Biochemistry and Molecular Biology, Indiana University School of Medicine, Indianapolis, IN 46202 (United States)

    2009-12-25

    Recombinant mouse UDP-glucose pyrophosphatase (UGPPase), encoded by the Nudt14 gene, was produced in Escherichia coli and purified close to homogeneity. The enzyme catalyzed the conversion of [{beta}-{sup 32}P]UDP-glucose to [{sup 32}P]glucose-1-P and UMP, confirming that it hydrolyzed the pyrophosphate of the nucleoside diphosphate sugar to generate glucose-1-P and UMP. The enzyme was also active toward ADP-ribose. Activity is dependent on the presence of Mg{sup 2+} and was greatest at alkaline pH above 8. Kinetic analysis indicated a K{sub m} of {approx}4 mM for UDP-glucose and {approx}0.3 mM for ADP-ribose. Based on V{sub max}/K{sub m} values, the enzyme was {approx}20-fold more active toward ADP-ribose. UGPPase behaves as a dimer in solution and can be cross-linked to generate a species of M{sub r} 54,000 from a monomer of 30,000 as judged by SDS-PAGE. The dimerization was not affected by the presence of glucose-1-P or UDP-glucose. Using antibodies raised against the recombinant protein, Western analysis indicated that UGPPase was widely expressed in mouse tissues, including skeletal muscle, liver, kidney, heart, lung, fat, heart and pancreas with a lower level in brain. It was generally present as a doublet when analyzed by SDS-PAGE, suggesting the occurrence of some form of post-translational modification. Efforts to interconvert the species by adding or inhibiting phosphatase activity were unsuccessful, leaving the nature of the modification unknown. Sequence alignments and database searches revealed related proteins in species as distant as Drosophila melanogaster and Caenorhabditis elegans.

  11. Determination of ploidy level and isolation of genes encoding acetyl-CoA carboxylase in Japanese Foxtail (Alopecurus japonicus.

    Directory of Open Access Journals (Sweden)

    Hongle Xu

    Full Text Available Ploidy level is important in biodiversity studies and in developing strategies for isolating important plant genes. Many herbicide-resistant weed species are polyploids, but our understanding of these polyploid weeds is limited. Japanese foxtail, a noxious agricultural grass weed, has evolved herbicide resistance. However, most studies on this weed have ignored the fact that there are multiple copies of target genes. This may complicate the study of resistance mechanisms. Japanese foxtail was found to be a tetraploid by flow cytometer and chromosome counting, two commonly used methods in the determination of ploidy levels. We found that there are two copies of the gene encoding plastidic acetyl-CoA carboxylase (ACCase in Japanese foxtail and all the homologous genes are expressed. Additionally, no difference in ploidy levels or ACCase gene copy numbers was observed between an ACCase-inhibiting herbicide-resistant and a herbicide-sensitive population in this study.

  12. Regulation of the pT181 encoded tetracycline resistance gene in Straphylococcus aureus

    International Nuclear Information System (INIS)

    Mojumdar, M.

    1986-01-01

    pT181 is a naturally-occurring 4437 basepair (bp) plasmid isolated from Staphylococcus aureus which encodes inducible resistance to tetracycline (Tc). The DNA sequence data has identified three open reading frames (ORFs). The largest ORF B, has been found to be responsible for the Tc resistance phenotype of pT181. Since most Tc resistance systems appear to be regulated by an effector protein and a repressor protein, several Bal 31 deletion mutants of pT181 were constructed and analyzed in an effort to identify the elements involved in Tc resistance. Two transcomplementing groups of mutants were identified within the tet gene. The mechanism of Tc resistance was studied by assaying the accumulation of [7- 3 H] Tc by Tc sensitive cells, and uninduced and induced pT181-containing cells. A sharp decrease in accumulation of the drug after an initial increase was observed in Tc induced pT181-containing cells. In vivo labeling of Bacillus subtilis minicells containing pT181 was performed with 35 S-methionine to identify the polypeptide product of the tet gene. A Tc-inducible protein having a molecular weight of approximately 50,000 daltons was detected only in B. subtilis minicells carrying pT181. Cell fractionation studies of S. aureus cells with and without pT181 showed that an approximately 28,000 daltons Tc-inducible protein was present in membranes of pT181 containing cells. The amount of TET protein in Tc induced minicells was about fifteen-fold higher than that in uninduced minicells. RNA prepared from stationary phase cells analyzed by Northern blot hybridization showed that the steady-state level of the tet mRNA in induced pT181-containing cells was bout four-fold higher than that in uninduced pT181-containing cells. When RNA synthesis was blocked with rifampicin, tet mRAN was found to be much more stable in Tc induced cells as compared to that in uninduced cells over a 30 min period

  13. Pupil size reflects successful encoding and recall of memory in humans.

    Science.gov (United States)

    Kucewicz, Michal T; Dolezal, Jaromir; Kremen, Vaclav; Berry, Brent M; Miller, Laura R; Magee, Abigail L; Fabian, Vratislav; Worrell, Gregory A

    2018-03-21

    Pupil responses are known to indicate brain processes involved in perception, attention and decision-making. They can provide an accessible biomarker of human memory performance and cognitive states in general. Here we investigated changes in the pupil size during encoding and recall of word lists. Consistent patterns in the pupil response were found across and within distinct phases of the free recall task. The pupil was most constricted in the initial fixation phase and was gradually more dilated through the subsequent encoding, distractor and recall phases of the task, as the word items were maintained in memory. Within the final recall phase, retrieving memory for individual words was associated with pupil dilation in absence of visual stimulation. Words that were successfully recalled showed significant differences in pupil response during their encoding compared to those that were forgotten - the pupil was more constricted before and more dilated after the onset of word presentation. Our results suggest pupil size as a potential biomarker for probing and modulation of memory processing.

  14. Sequence of a cloned cDNA encoding human ribosomal protein S11

    Energy Technology Data Exchange (ETDEWEB)

    Lott, J B; Mackie, G A

    1988-02-11

    The authors have isolated a cloned cDNA that encodes human ribosomal protein (rp) S11 by screening a human fibroblast cDNA library with a labelled 204 bp DNA fragment encompassing residues 212-416 of pRS11, a rat rp Sll cDNA clone. The human rp S11 cloned cDNA consists of 15 residues of the 5' leader, the entire coding sequence and all 51 residues of the 3' untranslated region. The predicted amino acid sequence of 158 residues is identical to rat rpS11. The nucleotide sequence in the coding region differs, however, from that in rat in the first position in two codons and in the third position in 44 codons.

  15. The Aspergillus fumigatus siderophore biosynthetic gene sidA, encoding L-ornithine N5-oxygenase, is required for virulence.

    Science.gov (United States)

    Hissen, Anna H T; Wan, Adrian N C; Warwas, Mark L; Pinto, Linda J; Moore, Margo M

    2005-09-01

    Aspergillus fumigatus is the leading cause of invasive mold infection and is a serious problem in immunocompromised populations worldwide. We have previously shown that survival of A. fumigatus in serum may be related to secretion of siderophores. In this study, we identified and characterized the sidA gene of A. fumigatus, which encodes l-ornithine N(5)-oxygenase, the first committed step in hydroxamate siderophore biosynthesis. A. fumigatus sidA codes for a protein of 501 amino acids with significant homology to other fungal l-ornithine N(5)-oxygenases. A stable DeltasidA strain was created by deletion of A. fumigatus sidA. This strain was unable to synthesize the siderophores N',N",N'''-triacetylfusarinine C (TAF) and ferricrocin. Growth of the DeltasidA strain was the same as that of the wild type in rich media; however, the DeltasidA strain was unable to grow in low-iron defined media or media containing 10% human serum unless supplemented with TAF or ferricrocin. No significant differences in ferric reduction activities were observed between the parental strain and the DeltasidA strain, indicating that blocking siderophore secretion did not result in upregulation of this pathway. Unlike the parental strain, the DeltasidA strain was unable to remove iron from human transferrin. A rescued strain (DeltasidA + sidA) was constructed; it produced siderophores and had the same growth as the wild type on iron-limited media. Unlike the wild-type and rescued strains, the DeltasidA strain was avirulent in a mouse model of invasive aspergillosis, indicating that sidA is necessary for A. fumigatus virulence.

  16. Overexpression of Genes Encoding Glycolytic Enzymes in Corynebacterium glutamicum Enhances Glucose Metabolism and Alanine Production under Oxygen Deprivation Conditions

    Science.gov (United States)

    Yamamoto, Shogo; Gunji, Wataru; Suzuki, Hiroaki; Toda, Hiroshi; Suda, Masako; Jojima, Toru; Inui, Masayuki

    2012-01-01

    We previously reported that Corynebacterium glutamicum strain ΔldhAΔppc+alaD+gapA, overexpressing glyceraldehyde-3-phosphate dehydrogenase-encoding gapA, shows significantly improved glucose consumption and alanine formation under oxygen deprivation conditions (T. Jojima, M. Fujii, E. Mori, M. Inui, and H. Yukawa, Appl. Microbiol. Biotechnol. 87:159–165, 2010). In this study, we employ stepwise overexpression and chromosomal integration of a total of four genes encoding glycolytic enzymes (herein referred to as glycolytic genes) to demonstrate further successive improvements in C. glutamicum glucose metabolism under oxygen deprivation. In addition to gapA, overexpressing pyruvate kinase-encoding pyk and phosphofructokinase-encoding pfk enabled strain GLY2/pCRD500 to realize respective 13% and 20% improved rates of glucose consumption and alanine formation compared to GLY1/pCRD500. Subsequent overexpression of glucose-6-phosphate isomerase-encoding gpi in strain GLY3/pCRD500 further improved its glucose metabolism. Notably, both alanine productivity and yield increased after each overexpression step. After 48 h of incubation, GLY3/pCRD500 produced 2,430 mM alanine at a yield of 91.8%. This was 6.4-fold higher productivity than that of the wild-type strain. Intracellular metabolite analysis showed that gapA overexpression led to a decreased concentration of metabolites upstream of glyceraldehyde-3-phosphate dehydrogenase, suggesting that the overexpression resolved a bottleneck in glycolysis. Changing ratios of the extracellular metabolites by overexpression of glycolytic genes resulted in reduction of the intracellular NADH/NAD+ ratio, which also plays an important role on the improvement of glucose consumption. Enhanced alanine dehydrogenase activity using a high-copy-number plasmid further accelerated the overall alanine productivity. Increase in glycolytic enzyme activities is a promising approach to make drastic progress in growth-arrested bioprocesses. PMID

  17. A global evolutionary and metabolic analysis of human obesity gene risk variants.

    Science.gov (United States)

    Castillo, Joseph J; Hazlett, Zachary S; Orlando, Robert A; Garver, William S

    2017-09-05

    It is generally accepted that the selection of gene variants during human evolution optimized energy metabolism that now interacts with our obesogenic environment to increase the prevalence of obesity. The purpose of this study was to perform a global evolutionary and metabolic analysis of human obesity gene risk variants (110 human obesity genes with 127 nearest gene risk variants) identified using genome-wide association studies (GWAS) to enhance our knowledge of early and late genotypes. As a result of determining the mean frequency of these obesity gene risk variants in 13 available populations from around the world our results provide evidence for the early selection of ancestral risk variants (defined as selection before migration from Africa) and late selection of derived risk variants (defined as selection after migration from Africa). Our results also provide novel information for association of these obesity genes or encoded proteins with diverse metabolic pathways and other human diseases. The overall results indicate a significant differential evolutionary pattern for the selection of obesity gene ancestral and derived risk variants proposed to optimize energy metabolism in varying global environments and complex association with metabolic pathways and other human diseases. These results are consistent with obesity genes that encode proteins possessing a fundamental role in maintaining energy metabolism and survival during the course of human evolution. Copyright © 2017. Published by Elsevier B.V.

  18. Cloning and characterization of a mouse gene with homology to the human von Hippel-Lindau disease tumor suppressor gene: implications for the potential organization of the human von Hippel-Lindau disease gene.

    Science.gov (United States)

    Gao, J; Naglich, J G; Laidlaw, J; Whaley, J M; Seizinger, B R; Kley, N

    1995-02-15

    The human von Hippel-Lindau disease (VHL) gene has recently been identified and, based on the nucleotide sequence of a partial cDNA clone, has been predicted to encode a novel protein with as yet unknown functions [F. Latif et al., Science (Washington DC), 260: 1317-1320, 1993]. The length of the encoded protein and the characteristics of the cellular expressed protein are as yet unclear. Here we report the cloning and characterization of a mouse gene (mVHLh1) that is widely expressed in different mouse tissues and shares high homology with the human VHL gene. It predicts a protein 181 residues long (and/or 162 amino acids, considering a potential alternative start codon), which across a core region of approximately 140 residues displays a high degree of sequence identity (98%) to the predicted human VHL protein. High stringency DNA and RNA hybridization experiments and protein expression analyses indicate that this gene is the most highly VHL-related mouse gene, suggesting that it represents the mouse VHL gene homologue rather than a related gene sharing a conserved functional domain. These findings provide new insights into the potential organization of the VHL gene and nature of its encoded protein.

  19. Composition and expression of genes encoding carbohydrate-active enzymes in the straw-degrading mushroom Volvariella volvacea.

    Directory of Open Access Journals (Sweden)

    Bingzhi Chen

    Full Text Available Volvariella volvacea is one of a few commercial cultivated mushrooms mainly using straw as carbon source. In this study, the genome of V. volcacea was sequenced and assembled. A total of 285 genes encoding carbohydrate-active enzymes (CAZymes in V. volvacea were identified and annotated. Among 15 fungi with sequenced genomes, V. volvacea ranks seventh in the number of genes encoding CAZymes. In addition, the composition of glycoside hydrolases in V. volcacea is dramatically different from other basidiomycetes: it is particularly rich in members of the glycoside hydrolase families GH10 (hemicellulose degradation and GH43 (hemicellulose and pectin degradation, and the lyase families PL1, PL3 and PL4 (pectin degradation but lacks families GH5b, GH11, GH26, GH62, GH93, GH115, GH105, GH9, GH53, GH32, GH74 and CE12. Analysis of genome-wide gene expression profiles of 3 strains using 3'-tag digital gene expression (DGE reveals that 239 CAZyme genes were expressed even in potato destrose broth medium. Our data also showed that the formation of a heterokaryotic strain could dramatically increase the expression of a number of genes which were poorly expressed in its parental homokaryotic strains.

  20. Structured RNAs in the ENCODE selected regions of the human genome

    DEFF Research Database (Denmark)

    Washietl, Stefan; Pedersen, Jakob Skou; Korbel, Jan O

    2007-01-01

    Functional RNA structures play an important role both in the context of noncoding RNA transcripts as well as regulatory elements in mRNAs. Here we present a computational study to detect functional RNA structures within the ENCODE regions of the human genome. Since structural RNAs in general lack...... with the GENCODE annotation points to functional RNAs in all genomic contexts, with a slightly increased density in 3'-UTRs. While we estimate a significant false discovery rate of approximately 50%-70% many of the predictions can be further substantiated by additional criteria: 248 loci are predicted by both RNAz...

  1. The role of imprinted genes in humans

    OpenAIRE

    Ishida, Miho; Moore, Gudrun E.

    2013-01-01

    Detailed comprehensive molecular analysis using families and multiple matched tissues is essential to determine whether imprinted genes have a functional role in humans. See research article: http://genomebiology.com/2011/12/3/R25

  2. Mitochondrial and cytoplasmic isoleucyl-, glutamyl- and arginyl-tRNA synthetases of yeast are encoded by separate genes.

    Science.gov (United States)

    Tzagoloff, A; Shtanko, A

    1995-06-01

    Three complementation groups of a pet mutant collection have been found to be composed of respiratory-deficient deficient mutants with lesions in mitochondrial protein synthesis. Recombinant plasmids capable of restoring respiration were cloned by transformation of representatives of each complementation group with a yeast genomic library. The plasmids were used to characterize the complementing genes and to institute disruption of the chromosomal copies of each gene in respiratory-proficient yeast. The sequences of the cloned genes indicate that they code for isoleucyl-, arginyl- and glutamyl-tRNA synthetases. The properties of the mutants used to obtain the genes and of strains with the disrupted genes indicate that all three aminoacyl-tRNA synthetases function exclusively in mitochondrial proteins synthesis. The ISM1 gene for mitochondrial isoleucyl-tRNA synthetase has been localized to chromosome XVI next to UME5. The MSR1 gene for the arginyl-tRNA synthetase was previously located on yeast chromosome VIII. The third gene MSE1 for the mitochondrial glutamyl-tRNA synthetase has not been localized. The identification of three new genes coding for mitochondrial-specific aminoacyl-tRNA synthetases indicates that in Saccharomyces cerevisiae at least 11 members of this protein family are encoded by genes distinct from those coding for the homologous cytoplasmic enzymes.

  3. Mitochondrially-Encoded Adenosine Triphosphate Synthase 6 Gene Haplotype Variation among World Population during 2003-2013

    OpenAIRE

    Steven Steven; Yoni F Syukriani; Julius B Dewanto

    2016-01-01

    Background: Adaptation and natural selection serve as an important part of evolution. Adaptation in molecular level can lead to genetic drift which causes mutation of genetic material; one of which is polymorphism of mitochondrial DNA (mtDNA). The aim of this study is to verify the polymorphism of mitochondrially-encoded Adenosine Triphosphate synthase6gene (MT-ATP6) as one of mtDNA building blocks among tropic, sub-tropic, and polar areas. Methods: This descriptive quantitative research used...

  4. Identification of a truncated nucleoprotein in avian metapneumovirus-infected cells encoded by a second AUG, in-frame to the full-length gene

    Science.gov (United States)

    Alvarez, Rene; Seal, Bruce S

    2005-01-01

    Background Avian metapneumoviruses (aMPV) cause an upper respiratory disease with low mortality, but high morbidity primarily in commercial turkeys. There are three types of aMPV (A, B, C) of which the C type is found only in the United States. Viruses related to aMPV include human, bovine, ovine, and caprine respiratory syncytial viruses and pneumonia virus of mice, as well as the recently identified human metapneumovirus (hMPV). The aMPV and hMPV have become the type viruses of a new genus within the Metapneumovirus. The aMPV nucleoprotein (N) amino acid sequences of serotypes A, B, and C were aligned for comparative analysis. Based on predicted antigenicity of consensus protein sequences, five aMPV-specific N peptides were synthesized for development of peptide-antigens and antisera. Results The presence of two aMPV nucleoprotein (N) gene encoded polypeptides was detected in aMPV/C/US/Co and aMPV/A/UK/3b infected Vero cells. Nucleoprotein 1 (N1) encoded from the first open reading frame (ORF) was predicted to be 394 amino acids in length for aMPV/C/US/Co and 391 amino acids in length for aMPV/A/UK/3b with approximate molecular weights of 43.3 kilodaltons and 42.7 kilodaltons, respectively. Nucleoprotein 2 (N2) was hypothesized to be encoded by a second downstream ORF in-frame with ORF1 and encoded a protein predicted to contain 328 amino acids for aMPV/C/US/Co or 259 amino acids for aMPV/A/UK/3b with approximate molecular weights of 36 kilodaltons and 28.3 kilodaltons, respectively. Peptide antibodies to the N-terminal and C-terminal portions of the aMPV N protein confirmed presence of these products in both aMPV/C/US/Co- and aMPV/A/UK/3b-infected Vero cells. N1 and N2 for aMPV/C/US/Co ORFs were molecularly cloned and expressed in Vero cells utilizing eukaryotic expression vectors to confirm identity of the aMPV encoded proteins. Conclusion This is the first reported identification of potential, accessory in-frame N2 ORF gene products among members of the

  5. Identification of a truncated nucleoprotein in avian metapneumovirus-infected cells encoded by a second AUG, in-frame to the full-length gene

    Directory of Open Access Journals (Sweden)

    Alvarez Rene

    2005-04-01

    Full Text Available Abstract Background Avian metapneumoviruses (aMPV cause an upper respiratory disease with low mortality, but high morbidity primarily in commercial turkeys. There are three types of aMPV (A, B, C of which the C type is found only in the United States. Viruses related to aMPV include human, bovine, ovine, and caprine respiratory syncytial viruses and pneumonia virus of mice, as well as the recently identified human metapneumovirus (hMPV. The aMPV and hMPV have become the type viruses of a new genus within the Metapneumovirus. The aMPV nucleoprotein (N amino acid sequences of serotypes A, B, and C were aligned for comparative analysis. Based on predicted antigenicity of consensus protein sequences, five aMPV-specific N peptides were synthesized for development of peptide-antigens and antisera. Results The presence of two aMPV nucleoprotein (N gene encoded polypeptides was detected in aMPV/C/US/Co and aMPV/A/UK/3b infected Vero cells. Nucleoprotein 1 (N1 encoded from the first open reading frame (ORF was predicted to be 394 amino acids in length for aMPV/C/US/Co and 391 amino acids in length for aMPV/A/UK/3b with approximate molecular weights of 43.3 kilodaltons and 42.7 kilodaltons, respectively. Nucleoprotein 2 (N2 was hypothesized to be encoded by a second downstream ORF in-frame with ORF1 and encoded a protein predicted to contain 328 amino acids for aMPV/C/US/Co or 259 amino acids for aMPV/A/UK/3b with approximate molecular weights of 36 kilodaltons and 28.3 kilodaltons, respectively. Peptide antibodies to the N-terminal and C-terminal portions of the aMPV N protein confirmed presence of these products in both aMPV/C/US/Co- and aMPV/A/UK/3b-infected Vero cells. N1 and N2 for aMPV/C/US/Co ORFs were molecularly cloned and expressed in Vero cells utilizing eukaryotic expression vectors to confirm identity of the aMPV encoded proteins. Conclusion This is the first reported identification of potential, accessory in-frame N2 ORF gene products among

  6. Isolation and characterization of the genes for two small RNAs of herpesvirus papio and their comparison with Epstein-Barr virus-encoded EBER RNAs.

    Science.gov (United States)

    Howe, J G; Shu, M D

    1988-08-01

    Genes for the Epstein-Barr virus-encoded RNAs (EBERs), two low-molecular-weight RNAs encoded by the human gammaherpesvirus Epstein-Barr virus (EBV), hybridize to two small RNAs in a baboon cell line that contains a similar virus, herpesvirus papio (HVP). The genes for the HVP RNAs (HVP-1 and HVP-2) are located together in the small unique region at the left end of the viral genome and are transcribed by RNA polymerase III in a rightward direction, similar to the EBERs. There is significant similarity between EBER1 and HVP-1 RNA, except for an insert of 22 nucleotides which increases the length of HVP-1 RNA to 190 nucleotides. There is less similarity between the sequences of EBER2 and HVP-2 RNA, but both have a length of about 170 nucleotides. The predicted secondary structure of each HVP RNA is remarkably similar to that of the respective EBER, implying that the secondary structures are important for function. Upstream from the initiation sites of all four RNA genes are several highly conserved sequences which may function in the regulation of transcription. The HVP RNAs, together with the EBERs, are highly abundant in transformed cells and are efficiently bound by the cellular La protein.

  7. Identification of genes expressed in cultures of E. coli lysogens carrying the Shiga toxin-encoding prophage Φ24B

    Directory of Open Access Journals (Sweden)

    Riley Laura M

    2012-03-01

    Full Text Available Abstract Background Shigatoxigenic E. coli are a global and emerging health concern. Shiga toxin, Stx, is encoded on the genome of temperate, lambdoid Stx phages. Genes essential for phage maintenance and replication are encoded on approximately 50% of the genome, while most of the remaining genes are of unknown function nor is it known if these annotated hypothetical genes are even expressed. It is hypothesized that many of the latter have been maintained due to positive selection pressure, and that some, expressed in the lysogen host, have a role in pathogenicity. This study used Change Mediated Antigen Technology (CMAT™ and 2D-PAGE, in combination with RT-qPCR, to identify Stx phage genes that are expressed in E. coli during the lysogenic cycle. Results Lysogen cultures propagated for 5-6 hours produced a high cell density with a low proportion of spontaneous prophage induction events. The expression of 26 phage genes was detected in these cultures by differential 2D-PAGE of expressed proteins and CMAT. Detailed analyses of 10 of these genes revealed that three were unequivocally expressed in the lysogen, two expressed from a known lysogenic cycle promoter and one uncoupled from the phage regulatory network. Conclusion Propagation of a lysogen culture in which no cells at all are undergoing spontaneous lysis is impossible. To overcome this, RT-qPCR was used to determine gene expression profiles associated with the growth phase of lysogens. This enabled the definitive identification of three lambdoid Stx phage genes that are expressed in the lysogen and seven that are expressed during lysis. Conservation of these genes in this phage genome, and other Stx phages where they have been identified as present, indicates their importance in the phage/lysogen life cycle, with possible implications for the biology and pathogenicity of the bacterial host.

  8. The pkI gene encoding pyruvate kinase I links to the luxZ gene which enhances bioluminescence of the lux operon from Photobacterium leiognathi.

    Science.gov (United States)

    Lin, J W; Lu, H C; Chen, H Y; Weng, S F

    1997-10-09

    Partial 3'-end nucleotide sequence of the pkI gene (GenBank accession No. AF019143) from Photobacterium leiognathi ATCC 25521 has been determined, and the encoded pyruvate kinase I is deduced. Pyruvate kinase I is the key enzyme of glycolysis, which converts phosphoenol pyruvate to pyruvate. Alignment and comparison of pyruvate kinase Is from P. leiognathi, E. coli and Salmonella typhimurium show that they are homologous. Nucleotide sequence reveals that the pkI gene is linked to the luxZ gene that enhances bioluminescence of the lux operon from P. leiognathi. The gene order of the pkI and luxZ genes is-pk1-ter-->-R&R"-luxZ-ter"-->, whereas ter is transcriptional terminator for the pkI and related genes, and R&R" is the regulatory region and ter" is transcriptional terminator for the luxZ gene. It clearly elicits that the pkI gene and luxZ gene are divided to two operons. Functional analysis confirms that the potential hairpin loop omega T is the transcriptional terminator for the pkI and related genes. It infers that the pkI and related genes are simply linked to the luxZ gene in P. leiognathi genome.

  9. The frequency of genes encoding three putative group B streptococcal virulence factors among invasive and colonizing isolates

    Directory of Open Access Journals (Sweden)

    Borchardt Stephanie M

    2006-07-01

    Full Text Available Abstract Background Group B Streptococcus (GBS causes severe infections in very young infants and invasive disease in pregnant women and adults with underlying medical conditions. GBS pathogenicity varies between and within serotypes, with considerable variation in genetic content between strains. Three proteins, Rib encoded by rib, and alpha and beta C proteins encoded by bca and bac, respectively, have been suggested as potential vaccine candidates for GBS. It is not known, however, whether these genes occur more frequently in invasive versus colonizing GBS strains. Methods We screened 162 invasive and 338 colonizing GBS strains from different collections using dot blot hybridization to assess the frequency of bca, bac and rib. All strains were defined by serotyping for capsular type, and frequency differences were tested using the Chi square test. Results Genes encoding the beta C protein (bac and Rib (rib occurred at similar frequencies among invasive and colonizing isolates, bac (20% vs. 23%, and rib (28% vs. 20%, while the alpha (bca C protein was more frequently found in colonizing strains (46% vs, invasive (29%. Invasive strains were associated with specific serotype/gene combinations. Conclusion Novel virulence factors must be identified to better understand GBS disease.

  10. Mutational definition of functional domains within the Rev homolog encoded by human endogenous retrovirus K.

    Science.gov (United States)

    Bogerd, H P; Wiegand, H L; Yang, J; Cullen, B R

    2000-10-01

    Nuclear export of the incompletely spliced mRNAs encoded by several complex retroviruses, including human immunodeficiency virus type 1 (HIV-1), is dependent on a virally encoded adapter protein, termed Rev in HIV-1, that directly binds both to a cis-acting viral RNA target site and to the cellular Crm1 export factor. Human endogenous retrovirus K, a family of ancient endogenous retroviruses that is not related to the exogenous retrovirus HIV-1, was recently shown to also encode a Crm1-dependent nuclear RNA export factor, termed K-Rev. Although HIV-1 Rev and K-Rev display little sequence identity, they share the ability not only to bind to Crm1 and to RNA but also to form homomultimers and shuttle between nucleus and cytoplasm. We have used mutational analysis to identify sequences in the 105-amino-acid K-Rev protein required for each of these distinct biological activities. While mutations in K-Rev that inactivate any one of these properties also blocked K-Rev-dependent nuclear RNA export, several K-Rev mutants were comparable to wild type when assayed for any of these individual activities yet nevertheless defective for RNA export. Although several nonfunctional K-Rev mutants acted as dominant negative inhibitors of K-Rev-, but not HIV-1 Rev-, dependent RNA export, these were not defined by their inability to bind to Crm1, as is seen with HIV-1 Rev. In total, this analysis suggests a functional architecture for K-Rev that is similar to, but distinct from, that described for HIV-1 Rev and raises the possibility that viral RNA export mediated by the approximately 25 million-year-old K-Rev protein may require an additional cellular cofactor that is not required for HIV-1 Rev function.

  11. The Obesity-Associated FTO Gene Encodes a 2-Oxoglutarate–Dependent Nucleic Acid Demethylase

    Science.gov (United States)

    Gerken, Thomas; Girard, Christophe A.; Tung, Yi-Chun Loraine; Webby, Celia J.; Saudek, Vladimir; Hewitson, Kirsty S.; Yeo, Giles S. H.; McDonough, Michael A.; Cunliffe, Sharon; McNeill, Luke A.; Galvanovskis, Juris; Rorsman, Patrik; Robins, Peter; Prieur, Xavier; Coll, Anthony P.; Ma, Marcella; Jovanovic, Zorica; Farooqi, I. Sadaf; Sedgwick, Barbara; Barroso, Inês; Lindahl, Tomas; Ponting, Chris P.; Ashcroft, Frances M.; O'Rahilly, Stephen; Schofield, Christopher J.

    2009-01-01

    Variants in the FTO (fat mass and obesity associated) gene are associated with increased body mass index in humans. Here, we show by bioinformatics analysis that FTO shares sequence motifs with Fe(II)- and 2-oxoglutarate–dependent oxygenases. We find that recombinant murine Fto catalyzes the Fe(II)- and 2OG-dependent demethylation of 3-methylthymine in single-stranded DNA, with concomitant production of succinate, formaldehyde, and carbon dioxide. Consistent with a potential role in nucleic acid demethylation, Fto localizes to the nucleus in transfected cells. Studies of wild-type mice indicate that Fto messenger RNA (mRNA) is most abundant in the brain, particularly in hypothalamic nuclei governing energy balance, and that Fto mRNA levels in the arcuate nucleus are regulated by feeding and fasting. Studies can now be directed toward determining the physiologically relevant FTO substrate and how nucleic acid methylation status is linked to increased fat mass. PMID:17991826

  12. Several genes encoding enzymes with the same activity are necessary for aerobic fungal degradation of cellulose in nature

    DEFF Research Database (Denmark)

    Busk, Peter Kamp; Lange, Mette; Pilgaard, Bo

    2014-01-01

    The cellulose-degrading fungal enzymes are glycoside hydrolases of the GH families and lytic polysaccharide monooxygenases. The entanglement of glycoside hydrolase families and functions makes it difficult to predict the enzymatic activity of glycoside hydrolases based on their sequence....... In the present study we further developed the method Peptide Pattern Recognition to an automatic approach not only to find all genes encoding glycoside hydrolases and lytic polysaccharide monooxygenases in fungal genomes but also to predict the function of the genes. The functional annotation is an important...

  13. Expression of the gene encoding the ghrelin receptor in rats selected for differential alcohol preference.

    Science.gov (United States)

    Landgren, Sara; Engel, Jörgen A; Hyytiä, Petri; Zetterberg, Henrik; Blennow, Kaj; Jerlhag, Elisabet

    2011-08-01

    The mechanisms involved in alcohol use disorder, a chronic relapsing brain disorder, are complex and involve various signalling systems in the brain. Recently, the orexigenic peptide ghrelin was shown to be required for alcohol-induced reward, an effect mediated via ghrelin receptors, GHS-R1A, at the level of the cholinergic-dopaminergic reward link. Moreover, ghrelin increases and GHR-R1A antagonists reduce moderate alcohol consumption in mice, and a single nucleotide polymorphism in the GHS-R1A gene has been associated with high alcohol consumption in humans. Therefore, GHS-R1A gene expression and alcohol intake were investigated in high, AA (Alko, Alcohol), versus low, ANA (Alko, Non-Alcohol), alcohol consuming rats as well as in Wistar rats. In the AA and ANA rats plasma ghrelin levels were also measured. GHS-R1A gene expression was increased in AA compared to ANA rats in nucleus accumbens, ventral tegmental area, amygdala, prefrontal cortex and hippocampus. A similar trend was observed in the ventral tegmental area of Wistar rats consuming high amounts of alcohol. Furthermore, the AA rats had significantly smaller reduction of plasma ghrelin levels over time, after several weeks of alcohol exposure, than had the ANA rats. The present study provides further evidence for that the ghrelin signalling system, in particular at the level of the mesocortocolimbic dopamine system, is involved in alcohol consumption, and thus possibly contributes to alcohol use disorder. Therefore the GHS-R1A may constitute a novel candidate for development of new treatment strategies for alcohol dependence. Copyright © 2011 Elsevier B.V. All rights reserved.

  14. Characterization of Bombyx mori nucleopolyhedrovirus orf68 gene that encodes a novel structural protein of budded virus.

    Science.gov (United States)

    Iwanaga, Masashi; Kurihara, Masaaki; Kobayashi, Masahiko; Kang, WonKyung

    2002-05-25

    All lepidopteran baculovirus genomes sequenced to date encode a homolog of the Bombyx mori nucleopolyhedrovirus (BmNPV) orf68 gene, suggesting that it performs an important role in the virus life cycle. In this article we describe the characterization of BmNPV orf68 gene. Northern and Western analyses demonstrated that orf68 gene was expressed as a late gene and encoded a structural protein of budded virus (BV). Immunohistochemical analysis by confocal microscopy showed that ORF68 protein was localized mainly in the nucleus of infected cells. To examine the function of orf68 gene, we constructed orf68 deletion mutant (BmD68) and characterized it in BmN cells and larvae of B. mori. BV production was delayed in BmD68-infected cells. The larval bioassays also demonstrated that deletion of orf68 did not reduce the infectivity, but mutant virus took 70 h longer to kill the host than wild-type BmNPV. In addition, dot-blot analysis showed viral DNA accumulated more slowly in mutant infected cells. Further examination suggested that BmD68 was less efficient in entry and budding from cells, although it seemed to possess normal attachment ability. These results suggest that ORF68 is a BV-associated protein involved in secondary infection from cell-to-cell. (c) 2002 Elsevier Science (USA).

  15. Pupillometry as a glimpse into the neurochemical basis of human memory encoding.

    Science.gov (United States)

    Hoffing, Russell Cohen; Seitz, Aaron R

    2015-04-01

    Neurochemical systems are well studied in animal learning; however, ethical issues limit methodologies to explore these systems in humans. Pupillometry provides a glimpse into the brain's neurochemical systems, where pupil dynamics in monkeys have been linked with locus coeruleus (LC) activity, which releases norepinephrine (NE) throughout the brain. Here, we use pupil dynamics as a surrogate measure of neurochemical activity to explore the hypothesis that NE is involved in modulating memory encoding. We examine this using a task-irrelevant learning paradigm in which learning is boosted for stimuli temporally paired with task targets. We show that participants better recognize images that are paired with task targets than distractors and, in correspondence, that pupil size changes more for target-paired than distractor-paired images. To further investigate the hypothesis that NE nonspecifically guides learning for stimuli that are present with its release, a second procedure was used that employed an unexpected sound to activate the LC-NE system and induce pupil-size changes; results indicated a corresponding increase in memorization of images paired with the unexpected sounds. Together, these results suggest a relationship between the LC-NE system, pupil-size changes, and human memory encoding.

  16. A lepidopteran-specific gene family encoding valine-rich midgut proteins.

    Directory of Open Access Journals (Sweden)

    Jothini Odman-Naresh

    Full Text Available Many lepidopteran larvae are serious agricultural pests due to their feeding activity. Digestion of the plant diet occurs mainly in the midgut and is facilitated by the peritrophic matrix (PM, an extracellular sac-like structure, which lines the midgut epithelium and creates different digestive compartments. The PM is attracting increasing attention to control lepidopteran pests by interfering with this vital function. To identify novel PM components and thus potential targets for insecticides, we performed an immunoscreening with anti-PM antibodies using an expression library representing the larval midgut transcriptome of the tobacco hornworm, Manduca sexta. We identified three cDNAs encoding valine-rich midgut proteins of M. sexta (MsVmps, which appear to be loosely associated with the PM. They are members of a lepidopteran-specific family of nine VMP genes, which are exclusively expressed in larval stages in M. sexta. Most of the MsVMP transcripts are detected in the posterior midgut, with the highest levels observed for MsVMP1. To obtain further insight into Vmp function, we expressed MsVMP1 in insect cells and purified the recombinant protein. Lectin staining and glycosidase treatment indicated that MsVmp1 is highly O-glycosylated. In line with results from qPCR, immunoblots revealed that MsVmp1 amounts are highest in feeding larvae, while MsVmp1 is undetectable in starving and molting larvae. Finally using immunocytochemistry, we demonstrated that MsVmp1 localizes to the cytosol of columnar cells, which secrete MsVmp1 into the ectoperitrophic space in feeding larvae. In starving and molting larvae, MsVmp1 is found in the gut lumen, suggesting that the PM has increased its permeability. The present study demonstrates that lepidopteran species including many agricultural pests have evolved a set of unique proteins that are not found in any other taxon and thus may reflect an important adaptation in the highly specialized lepidopteran

  17. aes, the gene encoding the esterase B in Escherichia coli, is a powerful phylogenetic marker of the species

    Directory of Open Access Journals (Sweden)

    Tuffery Pierre

    2009-12-01

    Full Text Available Abstract Background Previous studies have established a correlation between electrophoretic polymorphism of esterase B, and virulence and phylogeny of Escherichia coli. Strains belonging to the phylogenetic group B2 are more frequently implicated in extraintestinal infections and include esterase B2 variants, whereas phylogenetic groups A, B1 and D contain less virulent strains and include esterase B1 variants. We investigated esterase B as a marker of phylogeny and/or virulence, in a thorough analysis of the esterase B-encoding gene. Results We identified the gene encoding esterase B as the acetyl-esterase gene (aes using gene disruption. The analysis of aes nucleotide sequences in a panel of 78 reference strains, including the E. coli reference (ECOR strains, demonstrated that the gene is under purifying selection. The phylogenetic tree reconstructed from aes sequences showed a strong correlation with the species phylogenetic history, based on multi-locus sequence typing using six housekeeping genes. The unambiguous distinction between variants B1 and B2 by electrophoresis was consistent with Aes amino-acid sequence analysis and protein modelling, which showed that substituted amino acids in the two esterase B variants occurred mostly at different sites on the protein surface. Studies in an experimental mouse model of septicaemia using mutant strains did not reveal a direct link between aes and extraintestinal virulence. Moreover, we did not find any genes in the chromosomal region of aes to be associated with virulence. Conclusion Our findings suggest that aes does not play a direct role in the virulence of E. coli extraintestinal infection. However, this gene acts as a powerful marker of phylogeny, illustrating the extensive divergence of B2 phylogenetic group strains from the rest of the species.

  18. Effect of long-term actual spaceflight on the expression of key genes encoding serotonin and dopamine system

    Science.gov (United States)

    Popova, Nina; Shenkman, Boris; Naumenko, Vladimir; Kulikov, Alexander; Kondaurova, Elena; Tsybko, Anton; Kulikova, Elisabeth; Krasnov, I. B.; Bazhenova, Ekaterina; Sinyakova, Nadezhda

    The effect of long-term spaceflight on the central nervous system represents important but yet undeveloped problem. The aim of our work was to study the effect of 30-days spaceflight of mice on Russian biosatellite BION-M1 on the expression in the brain regions of key genes of a) serotonin (5-HT) system (main enzymes in 5-HT metabolism - tryptophan hydroxylase-2 (TPH-2), monoamine oxydase A (MAO A), 5-HT1A, 5-HT2A and 5-HT3 receptors); b) pivotal enzymes in DA metabolism (tyrosine hydroxylase, COMT, MAO A, MAO B) and D1, D2 receptors. Decreased expression of genes encoding the 5-HT catabolism (MAO A) and 5-HT2A receptor in some brain regions was shown. There were no differences between “spaceflight” and control mice in the expression of TPH-2 and 5-HT1A, 5-HT3 receptor genes. Significant changes were found in genetic control of DA system. Long-term spaceflight decreased the expression of genes encoding the enzyme in DA synthesis (tyrosine hydroxylase in s.nigra), DA metabolism (MAO B in the midbrain and COMT in the striatum), and D1 receptor in hypothalamus. These data suggested that 1) microgravity affected genetic control of 5-HT and especially the nigrostriatal DA system implicated in the central regulation of muscular tonus and movement, 2) the decrease in the expression of genes encoding key enzyme in DA synthesis, DA degradation and D1 receptor contributes to the movement impairment and dyskinesia produced by the spaceflight. The study was supported by Russian Foundation for Basic Research grant No. 14-04-00173.

  19. AB126. Association between FOX03A gene polymorphisms and human longevity: a meta-analysis

    OpenAIRE

    Zhao, Shanchao; Bao, Jiming; Song, Xianlu

    2016-01-01

    Objective Numerous studies have shown associations between the FOX03A gene, encoding the forkhead box 03 transcription factor, and human or specifically male longevity. However, the associations of specific FOX03A polymorphisms with longevity remain inconclusive. We performed a meta-analysis of existing studies to clarify these potential associations. Methods A comprehensive search was conducted to identify studies of FOX03A gene polymorphisms and longevity. Pooled odds ratios (ORs) and 95% c...

  20. Association between FOXO3A gene polymorphisms and human longevity: a meta-analysis

    OpenAIRE

    Bao, Ji-Ming; Song, Xian-Lu; Hong, Ying-Qia; Zhu, Hai-Li; Li, Cui; Zhang, Tao; Chen, Wei; Zhao, Shan-Chao; Chen, Qing

    2014-01-01

    Numerous studies have shown associations between the FOXO3A gene, encoding the forkhead box O3 transcription factor, and human or specifically male longevity. However, the associations of specific FOXO3A polymorphisms with longevity remain inconclusive. We performed a meta-analysis of existing studies to clarify these potential associations. A comprehensive search was conducted to identify studies of FOXO3A gene polymorphisms and longevity. Pooled odds ratios (ORs) and 95% confidence interval...

  1. Update of the human and mouse Fanconi anemia genes.

    Science.gov (United States)

    Dong, Hongbin; Nebert, Daniel W; Bruford, Elspeth A; Thompson, David C; Joenje, Hans; Vasiliou, Vasilis

    2015-11-24

    Fanconi anemia (FA) is a recessively inherited disease manifesting developmental abnormalities, bone marrow failure, and increased risk of malignancies. Whereas FA has been studied for nearly 90 years, only in the last 20 years have increasing numbers of genes been implicated in the pathogenesis associated with this genetic disease. To date, 19 genes have been identified that encode Fanconi anemia complementation group proteins, all of which are named or aliased, using the root symbol "FANC." Fanconi anemia subtype (FANC) proteins function in a common DNA repair pathway called "the FA pathway," which is essential for maintaining genomic integrity. The various FANC mutant proteins contribute to distinct steps associated with FA pathogenesis. Herein, we provide a review update of the 19 human FANC and their mouse orthologs, an evolutionary perspective on the FANC genes, and the functional significance of the FA DNA repair pathway in association with clinical disorders. This is an example of a set of genes--known to exist in vertebrates, invertebrates, plants, and yeast--that are grouped together on the basis of shared biochemical and physiological functions, rather than evolutionary phylogeny, and have been named on this basis by the HUGO Gene Nomenclature Committee (HGNC).

  2. Encoding of Touch Intensity But Not Pleasantness in Human Primary Somatosensory Cortex

    Science.gov (United States)

    Laubacher, Claire M.; Olausson, Håkan; Wang, Binquan; Spagnolo, Primavera A.; Bushnell, M. Catherine

    2016-01-01

    Growing interest in affective touch has delineated a neural network that bypasses primary somatosensory cortex (S1). Several recent studies, however, have cast doubt on the segregation of touch discrimination and affect, suggesting that S1 also encodes affective qualities. We used functional magnetic resonance imaging (fMRI) and repetitive transcranial magnetic stimulation (rTMS) to examine the role of S1 in processing touch intensity and pleasantness. Twenty-six healthy human adults rated brushing on the hand during fMRI. Intensity ratings significantly predicted activation in S1, whereas pleasantness ratings predicted activation only in the anterior cingulate cortex. Nineteen subjects also received inhibitory rTMS over right hemisphere S1 and the vertex (control). After S1 rTMS, but not after vertex rTMS, sensory discrimination was reduced and subjects with reduced sensory discrimination rated touch as more intense. In contrast, rTMS did not alter ratings of touch pleasantness. Our findings support divergent neural processing of touch intensity and pleasantness, with affective touch encoded outside of S1. SIGNIFICANCE STATEMENT Growing interest in affective touch has identified a neural network that bypasses primary somatosensory cortex (S1). Several recent studies, however, cast doubt on the separation of touch discrimination and affect. We used functional magnetic resonance imaging and repetitive transcranial magnetic stimulation to demonstrate the representation of touch discrimination and intensity in S1, but the representation of pleasantness in the anterior cingulate cortex, not S1. Our findings support divergent neural processing of touch intensity and pleasantness, with affective touch encoded outside of S1. Our study contributes to growing delineation of the affective touch system, a crucial step in understanding its dysregulation in numerous clinical conditions such as autism, eating disorders, depression, and chronic pain. PMID:27225773

  3. Human DNA repair and recombination genes

    International Nuclear Information System (INIS)

    Thompson, L.H.; Weber, C.A.; Jones, N.J.

    1988-09-01

    Several genes involved in mammalian DNA repair pathways were identified by complementation analysis and chromosomal mapping based on hybrid cells. Eight complementation groups of rodent mutants defective in the repair of uv radiation damage are now identified. At least seven of these genes are probably essential for repair and at least six of them control the incision step. The many genes required for repair of DNA cross-linking damage show overlap with those involved in the repair of uv damage, but some of these genes appear to be unique for cross-link repair. Two genes residing on human chromosome 19 were cloned from genomic transformants using a cosmid vector, and near full-length cDNA clones of each gene were isolated and sequenced. Gene ERCC2 efficiently corrects the defect in CHO UV5, a nucleotide excision repair mutant. Gene XRCC1 normalizes repair of strand breaks and the excessive sister chromatid exchange in CHO mutant EM9. ERCC2 shows a remarkable /approximately/52% overall homology at both the amino acid and nucleotide levels with the yeast RAD3 gene. Evidence based on mutation induction frequencies suggests that ERCC2, like RAD3, might also be an essential gene for viability. 100 refs., 4 tabs

  4. Functional analysis of the Phycomyces carRA gene encoding the enzymes phytoene synthase and lycopene cyclase.

    Directory of Open Access Journals (Sweden)

    Catalina Sanz

    Full Text Available Phycomyces carRA gene encodes a protein with two domains. Domain R is characterized by red carR mutants that accumulate lycopene. Domain A is characterized by white carA mutants that do not accumulate significant amounts of carotenoids. The carRA-encoded protein was identified as the lycopene cyclase and phytoene synthase enzyme by sequence homology with other proteins. However, no direct data showing the function of this protein have been reported so far. Different Mucor circinelloides mutants altered at the phytoene synthase, the lycopene cyclase or both activities were transformed with the Phycomyces carRA gene. Fully transcribed carRA mRNA molecules were detected by Northern assays in the transformants and the correct processing of the carRA messenger was verified by RT-PCR. These results showed that Phycomyces carRA gene was correctly expressed in Mucor. Carotenoids analysis in these transformants showed the presence of ß-carotene, absent in the untransformed strains, providing functional evidence that the Phycomyces carRA gene complements the M. circinelloides mutations. Co-transformation of the carRA cDNA in E. coli with different combinations of the carotenoid structural genes from Erwinia uredovora was also performed. Newly formed carotenoids were accumulated showing that the Phycomyces CarRA protein does contain lycopene cyclase and phytoene synthase activities. The heterologous expression of the carRA gene and the functional complementation of the mentioned activities are not very efficient in E. coli. However, the simultaneous presence of both carRA and carB gene products from Phycomyces increases the efficiency of these enzymes, presumably due to an interaction mechanism.

  5. Expression profile of a Laccase2 encoding gene during the metamorphic molt in Apis mellifera (Hymenoptera,Apidae

    Directory of Open Access Journals (Sweden)

    Moysés Elias-Neto

    2013-06-01

    Full Text Available Expression profile of a Laccase2 encoding gene during the metamorphic molt in Apis mellifera (Hymenoptera, Apidae. Metamorphosis in holometabolous insects occurs through two subsequent molting cycles: pupation (metamorphic molt and adult differentiation (imaginal molt. The imaginal molt in Apis mellifera L. was recently investigated in both histological and physiological-molecular approaches. Although the metamorphic molt in this model bee is extremely important to development, it is not well-known yet. In the current study we used this stage as an ontogenetic scenario to investigate the transcriptional profile of the gene Amlac2, which encodes a laccase with an essential role in cuticle differentiation. Amlac2 expression in epidermis was contrasted with the hemolymph titer of ecdysteroid hormones and with the most evident morphological events occurring during cuticle renewal. RT-PCR semiquantitative analyses using integument samples revealed increased levels of Amlac2 transcripts right after apolysis and during the subsequent pharate period, and declining levels near pupal ecdysis. Compared with the expression of a cuticle protein gene, AmelCPR14, these results highlighted the importance of the ecdysteroid-induced apolysis as an ontogenetic marker of gene reactivation in epidermis for cuticle renewal. The obtained results strengthen the comprehension of metamorphosis in Apis mellifera. In addition, we reviewed the literature about the development of A. mellifera, and emphasize the importance of revising the terminology used to describe honey bee molting cycles.

  6. Several genes encoding enzymes with the same activity are necessary for aerobic fungal degradation of cellulose in nature.

    Directory of Open Access Journals (Sweden)

    Peter K Busk

    Full Text Available The cellulose-degrading fungal enzymes are glycoside hydrolases of the GH families and lytic polysaccharide monooxygenases. The entanglement of glycoside hydrolase families and functions makes it difficult to predict the enzymatic activity of glycoside hydrolases based on their sequence. In the present study we further developed the method Peptide Pattern Recognition to an automatic approach not only to find all genes encoding glycoside hydrolases and lytic polysaccharide monooxygenases in fungal genomes but also to predict the function of the genes. The functional annotation is an important feature as it provides a direct route to predict function from primary sequence. Furthermore, we used Peptide Pattern Recognition to compare the cellulose-degrading enzyme activities encoded by 39 fungal genomes. The results indicated that cellobiohydrolases and AA9 lytic polysaccharide monooxygenases are hallmarks of cellulose-degrading fungi except brown rot fungi. Furthermore, a high number of AA9, endocellulase and β-glucosidase genes were identified, not in what are known to be the strongest, specialized lignocellulose degraders but in saprophytic fungi that can use a wide variety of substrates whereas only few of these genes were found in fungi that have a limited number of natural, lignocellulotic substrates. This correlation suggests that enzymes with different properties are necessary for degradation of cellulose in different complex substrates. Interestingly, clustering of the fungi based on their predicted enzymes indicated that Ascomycota and Basidiomycota use the same enzymatic activities to degrade plant cell walls.

  7. Autoselection of cytoplasmic yeast virus like elements encoding toxin/antitoxin systems involves a nuclear barrier for immunity gene expression.

    Science.gov (United States)

    Kast, Alene; Voges, Raphael; Schroth, Michael; Schaffrath, Raffael; Klassen, Roland; Meinhardt, Friedhelm

    2015-05-01

    Cytoplasmic virus like elements (VLEs) from Kluyveromyces lactis (Kl), Pichia acaciae (Pa) and Debaryomyces robertsiae (Dr) are extremely A/T-rich (>75%) and encode toxic anticodon nucleases (ACNases) along with specific immunity proteins. Here we show that nuclear, not cytoplasmic expression of either immunity gene (PaORF4, KlORF3 or DrORF5) results in transcript fragmentation and is insufficient to establish immunity to the cognate ACNase. Since rapid amplification of 3' ends (RACE) as well as linker ligation of immunity transcripts expressed in the nucleus revealed polyadenylation to occur along with fragmentation, ORF-internal poly(A) site cleavage due to the high A/T content is likely to prevent functional expression of the immunity genes. Consistently, lowering the A/T content of PaORF4 to 55% and KlORF3 to 46% by gene synthesis entirely prevented transcript cleavage and permitted functional nuclear expression leading to full immunity against the respective ACNase toxin. Consistent with a specific adaptation of the immunity proteins to the cognate ACNases, cross-immunity to non-cognate ACNases is neither conferred by PaOrf4 nor KlOrf3. Thus, the high A/T content of cytoplasmic VLEs minimizes the potential of functional nuclear recruitment of VLE encoded genes, in particular those involved in autoselection of the VLEs via a toxin/antitoxin principle.

  8. Autoselection of cytoplasmic yeast virus like elements encoding toxin/antitoxin systems involves a nuclear barrier for immunity gene expression.

    Directory of Open Access Journals (Sweden)

    Alene Kast

    2015-05-01

    Full Text Available Cytoplasmic virus like elements (VLEs from Kluyveromyces lactis (Kl, Pichia acaciae (Pa and Debaryomyces robertsiae (Dr are extremely A/T-rich (>75% and encode toxic anticodon nucleases (ACNases along with specific immunity proteins. Here we show that nuclear, not cytoplasmic expression of either immunity gene (PaORF4, KlORF3 or DrORF5 results in transcript fragmentation and is insufficient to establish immunity to the cognate ACNase. Since rapid amplification of 3' ends (RACE as well as linker ligation of immunity transcripts expressed in the nucleus revealed polyadenylation to occur along with fragmentation, ORF-internal poly(A site cleavage due to the high A/T content is likely to prevent functional expression of the immunity genes. Consistently, lowering the A/T content of PaORF4 to 55% and KlORF3 to 46% by gene synthesis entirely prevented transcript cleavage and permitted functional nuclear expression leading to full immunity against the respective ACNase toxin. Consistent with a specific adaptation of the immunity proteins to the cognate ACNases, cross-immunity to non-cognate ACNases is neither conferred by PaOrf4 nor KlOrf3. Thus, the high A/T content of cytoplasmic VLEs minimizes the potential of functional nuclear recruitment of VLE encoded genes, in particular those involved in autoselection of the VLEs via a toxin/antitoxin principle.

  9. The number of genes encoding repeat domain-containing proteins positively correlates with genome size in amoebal giant viruses

    Science.gov (United States)

    Shukla, Avi; Chatterjee, Anirvan

    2018-01-01

    Abstract Curiously, in viruses, the virion volume appears to be predominantly driven by genome length rather than the number of proteins it encodes or geometric constraints. With their large genome and giant particle size, amoebal viruses (AVs) are ideally suited to study the relationship between genome and virion size and explore the role of genome plasticity in their evolutionary success. Different genomic regions of AVs exhibit distinct genealogies. Although the vertically transferred core genes and their functions are universally conserved across the nucleocytoplasmic large DNA virus (NCLDV) families and are essential for their replication, the horizontally acquired genes are variable across families and are lineage-specific. When compared with other giant virus families, we observed a near–linear increase in the number of genes encoding repeat domain-containing proteins (RDCPs) with the increase in the genome size of AVs. From what is known about the functions of RDCPs in bacteria and eukaryotes and their prevalence in the AV genomes, we envisage important roles for RDCPs in the life cycle of AVs, their genome expansion, and plasticity. This observation also supports the evolution of AVs from a smaller viral ancestor by the acquisition of diverse gene families from the environment including RDCPs that might have helped in host adaption. PMID:29308275

  10. Analysis of viral protein-2 encoding gene of avian encephalomyelitis virus from field specimens in Central Java region, Indonesia

    Directory of Open Access Journals (Sweden)

    Aris Haryanto

    2016-01-01

    Full Text Available Aim: Avian encephalomyelitis (AE is a viral disease which can infect various types of poultry, especially chicken. In Indonesia, the incidence of AE infection in chicken has been reported since 2009, the AE incidence tends to increase from year to year. The objective of this study was to analyze viral protein 2 (VP-2 encoding gene of AE virus (AEV from various species of birds in field specimen by reverse transcription polymerase chain reaction (RT-PCR amplification using specific nucleotides primer for confirmation of AE diagnosis. Materials and Methods: A total of 13 AEV samples are isolated from various species of poultry which are serologically diagnosed infected by AEV from some areas in central Java, Indonesia. Research stage consists of virus samples collection from field specimens, extraction of AEV RNA, amplification of VP-2 protein encoding gene by RT-PCR, separation of RT-PCR product by agarose gel electrophoresis, DNA sequencing and data analysis. Results: Amplification products of the VP-2 encoding gene of AEV by RT-PCR methods of various types of poultry from field specimens showed a positive results on sample code 499/4/12 which generated DNA fragment in the size of 619 bp. Sensitivity test of RT-PCR amplification showed that the minimum concentration of RNA template is 127.75 ng/μl. The multiple alignments of DNA sequencing product indicated that positive sample with code 499/4/12 has 92% nucleotide homology compared with AEV with accession number AV1775/07 and 85% nucleotide homology with accession number ZCHP2/0912695 from Genbank database. Analysis of VP-2 gene sequence showed that it found 46 nucleotides difference between isolate 499/4/12 compared with accession number AV1775/07 and 93 nucleotides different with accession number ZCHP2/0912695. Conclusions: Analyses of the VP-2 encoding gene of AEV with RT-PCR method from 13 samples from field specimen generated the DNA fragment in the size of 619 bp from one sample with

  11. Human gene therapy and imaging: cardiology

    International Nuclear Information System (INIS)

    Wu, Joseph C.; Yla-Herttuala, Seppo

    2005-01-01

    This review discusses the basics of cardiovascular gene therapy, the results of recent human clinical trials, and the rapid progress in imaging techniques in cardiology. Improved understanding of the molecular and genetic basis of coronary heart disease has made gene therapy a potential new alternative for the treatment of cardiovascular diseases. Experimental studies have established the proof-of-principle that gene transfer to the cardiovascular system can achieve therapeutic effects. First human clinical trials provided initial evidence of feasibility and safety of cardiovascular gene therapy. However, phase II/III clinical trials have so far been rather disappointing and one of the major problems in cardiovascular gene therapy has been the inability to verify gene expression in the target tissue. New imaging techniques could significantly contribute to the development of better gene therapeutic approaches. Although the exact choice of imaging modality will depend on the biological question asked, further improvement in image resolution and detection sensitivity will be needed for all modalities as we move from imaging of organs and tissues to imaging of cells and genes. (orig.)

  12. AtMRP1 gene of Arabidopsis encodes a glutathione S-conjugate pump: isolation and functional definition of a plant ATP-binding cassette transporter gene.

    Science.gov (United States)

    Lu, Y P; Li, Z S; Rea, P A

    1997-07-22

    Because plants produce cytotoxic compounds to which they, themselves, are susceptible and are exposed to exogenous toxins (microbial products, allelochemicals, and agrochemicals), cell survival is contingent on mechanisms for detoxifying these agents. One detoxification mechanism is the glutathione S-transferase-catalyzed glutathionation of the toxin, or an activated derivative, and transport of the conjugate out of the cytosol. We show here that a transporter responsible for the removal of glutathione S-conjugates from the cytosol, a specific Mg2+-ATPase, is encoded by the AtMRP1 gene of Arabidopsis thaliana. The sequence of AtMRP1 and the transport capabilities of membranes prepared from yeast cells transformed with plasmid-borne AtMRP1 demonstrate that this gene encodes an ATP-binding cassette transporter competent in the transport of glutathione S-conjugates of xenobiotics and endogenous substances, including herbicides and anthocyanins.

  13. Impact of recombination on polymorphism of genes encoding Kunitz-type protease inhibitors in the genus Solanum.

    Science.gov (United States)

    Speranskaya, Anna S; Krinitsina, Anastasia A; Kudryavtseva, Anna V; Poltronieri, Palmiro; Santino, Angelo; Oparina, Nina Y; Dmitriev, Alexey A; Belenikin, Maxim S; Guseva, Marina A; Shevelev, Alexei B

    2012-08-01

    The group of Kunitz-type protease inhibitors (KPI) from potato is encoded by a polymorphic family of multiple allelic and non-allelic genes. The previous explanations of the KPI variability were based on the hypothesis of random mutagenesis as a key factor of KPI polymorphism. KPI-A genes from the genomes of Solanum tuberosum cv. Istrinskii and the wild species Solanum palustre were amplified by PCR with subsequent cloning in plasmids. True KPI sequences were derived from comparison of the cloned copies. "Hot spots" of recombination in KPI genes were independently identified by DnaSP 4.0 and TOPALi v2.5 software. The KPI-A sequence from potato cv. Istrinskii was found to be 100% identical to the gene from Solanum nigrum. This fact illustrates a high degree of similarity of KPI genes in the genus Solanum. Pairwise comparison of KPI A and B genes unambiguously showed a non-uniform extent of polymorphism at different nt positions. Moreover, the occurrence of substitutions was not random along the strand. Taken together, these facts contradict the traditional hypothesis of random mutagenesis as a principal source of KPI gene polymorphism. The experimentally found mosaic structure of KPI genes in both plants studied is consistent with the hypothesis suggesting recombination of ancestral genes. The same mechanism was proposed earlier for other resistance-conferring genes in the nightshade family (Solanaceae). Based on the data obtained, we searched for potential motifs of site-specific binding with plant DNA recombinases. During this work, we analyzed the sequencing data reported by the Potato Genome Sequencing Consortium (PGSC), 2011 and found considerable inconsistence of their data concerning the number, location, and orientation of KPI genes of groups A and B. The key role of recombination rather than random point mutagenesis in KPI polymorphism was demonstrated for the first time. Copyright © 2012 Elsevier Masson SAS. All rights reserved.

  14. The human thyroglobulin gene is over 300 kb long and contains introns of up to 64 kb

    NARCIS (Netherlands)

    Baas, F.; van Ommen, G. J.; Bikker, H.; Arnberg, A. C.; de Vijlder, J. J.

    1986-01-01

    Thyroglobulin (Tg), the precursor of thyroid hormones, is a 660.000 Da dimeric glycoprotein synthesized exclusively in the thyroid gland. We have cloned the human thyroglobulin gene from cosmid and phage libraries and constructed a complete restriction map. The gene encodes an 8.7 kb mRNA, covers at

  15. Segregated encoding of reward-identity and stimulus-reward associations in human orbitofrontal cortex.

    Science.gov (United States)

    Klein-Flügge, Miriam Cornelia; Barron, Helen Catharine; Brodersen, Kay Henning; Dolan, Raymond J; Behrens, Timothy Edward John

    2013-02-13

    A dominant focus in studies of learning and decision-making is the neural coding of scalar reward value. This emphasis ignores the fact that choices are strongly shaped by a rich representation of potential rewards. Here, using fMRI adaptation, we demonstrate that responses in the human orbitofrontal cortex (OFC) encode a representation of the specific type of food reward predicted by a visual cue. By controlling for value across rewards and by linking each reward with two distinct stimuli, we could test for representations of reward-identity that were independent of associative information. Our results show reward-identity representations in a medial-caudal region of OFC, independent of the associated predictive stimulus. This contrasts with a more rostro-lateral OFC region encoding reward-identity representations tied to the predicate stimulus. This demonstration of adaptation in OFC to reward specific representations opens an avenue for investigation of more complex decision mechanisms that are not immediately accessible in standard analyses, which focus on correlates of average activity.

  16. A synergy-based hand control is encoded in human motor cortical areas

    Science.gov (United States)

    Leo, Andrea; Handjaras, Giacomo; Bianchi, Matteo; Marino, Hamal; Gabiccini, Marco; Guidi, Andrea; Scilingo, Enzo Pasquale; Pietrini, Pietro; Bicchi, Antonio; Santello, Marco; Ricciardi, Emiliano

    2016-01-01

    How the human brain controls hand movements to carry out different tasks is still debated. The concept of synergy has been proposed to indicate functional modules that may simplify the control of hand postures by simultaneously recruiting sets of muscles and joints. However, whether and to what extent synergic hand postures are encoded as such at a cortical level remains unknown. Here, we combined kinematic, electromyography, and brain activity measures obtained by functional magnetic resonance imaging while subjects performed a variety of movements towards virtual objects. Hand postural information, encoded through kinematic synergies, were represented in cortical areas devoted to hand motor control and successfully discriminated individual grasping movements, significantly outperforming alternative somatotopic or muscle-based models. Importantly, hand postural synergies were predicted by neural activation patterns within primary motor cortex. These findings support a novel cortical organization for hand movement control and open potential applications for brain-computer interfaces and neuroprostheses. DOI: http://dx.doi.org/10.7554/eLife.13420.001 PMID:26880543

  17. Four phosphoproteins with common amino termini are encoded by human cytomegalovirus AD169

    International Nuclear Information System (INIS)

    Wright, D.A.; Staprans, S.I.; Spector, D.H.

    1988-01-01

    In this report, the authors identify the proteins encoded by the 2.2-kilobase class of early transcripts arising from a region of the strain AD169 human cytomegalovirus genome (map units 0.682 to 0.713) which contains cell-related sequences. These transcripts, encoded by adjacent EcoRI fragments R and d, have a complex spliced structure with 5' and 3' coterminal ends. Antiserum directed against a synthetic 11-amino-acid peptide corresponding to the predicted amino terminus of the proteins was generated and found to immunoprecipitate four-infected-cell proteins of 84, 50, 43, and 34 kilodaltons. These proteins were phosphorylated and were associated predominantly with the nuclei of infected cells. The 43-kilodalton protein was the most abundant of the four proteins, and its level of expression remained relatively constant throughout the infection. Expression of the other proteins increased as the infection progressed. Pulse-chase analysis failed to show a precursor-product relationship between any of the proteins. A comparison of the [ 35 S]methionine-labeled tryptic peptide maps of the four proteins from infected cells and an in vitro-generated polypeptide derived from the putative first exon showed that all four infected-cell proteins were of viral origin and contained a common amino-terminal region

  18. Patenting Human Genes in Europe

    DEFF Research Database (Denmark)

    Minssen, Timo

    2017-01-01

    In accordance with the concept of the book and the assigned scope of the contribution, this chapter describes the European law with respect to the patent-eligibility of isolated DNA sequences. This chapter will further include a brief comparison with recent developments from the US and Australia....... It will, however, not focus on the important debates regarding the patent-eligibility of other biological material, diagnostic methods patents (as data aggregators) or abstract ideas which will be addressed by other contributions. Moreover, the analysis will merely concentrate on patent-eligibility. Other...... patentability requirement will only be briefly touched upon in the discussion part. The paper starts out in section 1.5.2 by discussing the patent-eligibility of isolated human DNA sequences on the European national level and under the Biotechnology Directive. Then the patent-eligibility of isolated human DNA...

  19. Dissemination of Genes Encoding Aminoglycoside-Modifying Enzymes and armA Among Enterobacteriaceae Isolates in Northwest Iran.

    Science.gov (United States)

    Ghotaslou, Reza; Yeganeh Sefidan, Fatemeh; Akhi, Mohammad Taghi; Asgharzadeh, Mohammad; Mohammadzadeh Asl, Yalda

    2017-10-01

    Enzymatic inactivation is one of the most important mechanisms of resistance to aminoglycosides. The aim of this study was to investigate the prevalence of armA and diversity of the genes encoding aminoglycoside-modifying enzymes (AMEs) and their associations with resistance phenotypes in Enterobacteriaceae isolates. Three hundred and seven Enterobacteriaceae isolates were collected from five hospitals in northwest Iran. The disk diffusion method for amikacin, gentamicin, tobramycin, kanamycin, and streptomycin, as well as the minimum inhibitory concentration for amikacin, gentamicin, tobramycin, and kanamycin were done for susceptibility testing. Thirteen AME genes and armA methylase were screened using the PCR and sequencing assays. Two hundred and twenty (71.7%) of isolates were resistant to aminoglycosides and 155 (70.5%) of them were positive for aminoglycoside resistance genes. The most prevalent AME genes were ant(3″)-Ia and aph(3″)-Ib with the frequency 35.9% and 30.5%, respectively. Also, 21 (9.5%) of resistant isolates were positive for armA methylase gene. The prevalence of resistance to aminoglycoside is high and AME genes frequently are disseminated in Enterobacteriaceae isolates. There is an association between phenotypic resistance and the presence of some aminoglycoside genes.

  20. On the Immortality of Television Sets: ?Function? in the Human Genome According to the Evolution-Free Gospel of ENCODE

    OpenAIRE

    Graur, Dan; Zheng, Yichen; Price, Nicholas; Azevedo, Ricardo B.R.; Zufall, Rebecca A.; Elhaik, Eran

    2013-01-01

    A recent slew of ENCyclopedia Of DNA Elements (ENCODE) Consortium publications, specifically the article signed by all Consortium members, put forward the idea that more than 80% of the human genome is functional. This claim flies in the face of current estimates according to which the fraction of the genome that is evolutionarily conserved through purifying selection is less than 10%. Thus, according to the ENCODE Consortium, a biological function can be maintained indefinitely without selec...

  1. A novel gene encoding xanthan lyase of Paenibacillus alginolyticus strain XL-1

    NARCIS (Netherlands)

    Ruijssenaars, H.J.; Hartmans, S.; Verdoes, J.C.

    2000-01-01

    Xanthan-modifying enzymes are powerful tools in studying structure-function relationships of this polysaccharide. One of these modifying enzymes is xanthan lyase, which removes the terminal side chain residue of xanthan. In this paper, the cloning and sequencing of the first xanthan lyase-encoding

  2. A Gene Encoding a DUF247 Domain Protein Cosegregates with the S Self-Incompatibility Locus in Perennial Ryegrass

    DEFF Research Database (Denmark)

    Manzanares, Chloe; Barth, Susanne; Thorogood, Daniel

    2016-01-01

    genes cosegregating with the S-locus, a highly polymorphic gene encoding for a protein containing a DUF247 was fully predictive of known S-locus genotypes at the amino acid level in the seven mapping populations. Strikingly, this gene showed a frameshift mutation in self-compatible darnel (Lolium...

  3. Zea mI, the maize homolog of the allergen-encoding Lol pI gene of rye grass.

    Science.gov (United States)

    Broadwater, A H; Rubinstein, A L; Chay, C H; Klapper, D G; Bedinger, P A

    1993-09-15

    Sequence analysis of a pollen-specific cDNA from maize has identified a homolog (Zea mI) of the gene (Lol pI) encoding the major allergen of rye-grass pollen. The protein encoded by the partial cDNA sequence is 59.3% identical and 72.7% similar to the comparable region of the reported amino acid sequence of Lol pIA. Southern analysis indicates that this cDNA represents a member of a small multigene family in maize. Northern analysis shows expression only in pollen, not in vegetative or female floral tissues. The timing of expression is developmentally regulated, occurring at a low level prior to the first pollen mitosis and at a high level after this postmeiotic division. Western analysis detects a protein in maize pollen lysates using polyclonal antiserum and monoclonal antibodies directed against purified Lolium perenne allergen.

  4. Cloning of the cDNA and gene for a human D2 dopamine receptor

    International Nuclear Information System (INIS)

    Grady, D.K.; Makam, H.; Stofko, R.E.; Bunzow, J.R.; Civelli, O.; Marchionni, M.A.; Alfano, M.; Frothingham, L.; Fischer, J.B.; Burke-Howie, K.J.; Server, A.C.

    1989-01-01

    A clone encoding a human D 2 dopamine receptor was isolated from a pituitary cDNA library and sequenced. The deduced protein sequence is 96% identical with that of the cloned rat receptor with one major difference: the human receptor contains an additional 29 amino acids in its putative third cytoplasmic loop. Southern blotting demonstrated the presence of only one human D 2 receptor gene. Two overlapping phage containing the gene were isolated and characterized. DNA sequence analysis of these clones showed that the coding sequence is interrupted by six introns and that the additional amino acids present in the human pituitary receptor are encoded by a single exon of 87 base pairs. The involvement of this sequence in alternative splicing and its biological significance are discussed

  5. The human herpes virus 8-encoded chemokine receptor is required for angioproliferation in a murine model of Kaposi's sarcoma

    DEFF Research Database (Denmark)

    Jensen, Kristian K; Manfra, Denise J; Grisotto, Marcos G

    2005-01-01

    Kaposi's sarcoma (KS)-associated herpesvirus or human herpes virus 8 is considered the etiological agent of KS, a highly vascularized neoplasm that is the most common tumor affecting HIV/AIDS patients. The KS-associated herpesvirus/human herpes virus 8 open reading frame 74 encodes a constitutively...

  6. The predominant WT1 isoform (+KTS) encodes a DNA-binding protein targeting the planar cell polarity gene Scribble in renal podocytes.

    Science.gov (United States)

    Wells, Julie; Rivera, Miguel N; Kim, Woo Jae; Starbuck, Kristen; Haber, Daniel A

    2010-07-01

    WT1 encodes a tumor suppressor first identified by its inactivation in Wilms' Tumor. Although one WT1 splicing variant encodes a well-characterized zinc finger transcription factor, little is known about the function of the most prevalent WT1 isoform, whose DNA binding domain is disrupted by a three-amino acid (KTS) insertion. Using cells that conditionally express WT1(+KTS), we undertook a genome-wide chromatin immunoprecipitation and cloning analysis to identify candidate WT1(+KTS)-regulated promoters. We identified the planar cell polarity gene Scribble (SCRB) as the first WT1(+KTS) target gene in podocytes of the kidney. WT1 and SCRB expression patterns overlap precisely in developing renal glomeruli of mice, and WT1(+KTS) binds to a 33-nucleotide region within the Scribble promoter in mouse and human cell lines and kidneys. Together, our results support a role for the predominant WT1(+KTS) isoform in transcriptional regulation and suggest a link between the WT1-dependent tumor suppressor pathway and a key component of the planar cell polarity pathway.

  7. The predominant WT1 isoform (+KTS) encodes a DNA binding protein targeting the planar cell polarity gene Scribble in renal podocytes

    Science.gov (United States)

    Wells, Julie; Rivera, Miguel N.; Kim, Woo Jae; Starbuck, Kristen; Haber, Daniel A.

    2010-01-01

    WT1 encodes a tumor suppressor, first identified by its inactivation in Wilms Tumor. While one WT1 splicing variant encodes a well-characterized zinc finger transcription factor, little is known about the function of the most prevalent WT1 isoform, whose DNA binding domain is disrupted by a three amino acid (KTS) insertion. Using cells which conditionally express WT1(+KTS), we undertook a genome-wide chromatin immunoprecipitation and cloning (ChIP-cloning) analysis to identify candidate WT1(+KTS) regulated promoters. We identified the planar cell polarity (PCP) gene Scribble (SCRB) as the first WT1(+KTS) target gene in podocytes of the kidney. WT1 and SCRB expression patterns overlap precisely in developing renal glomeruli of mice, and WT1(+KTS) binds to a 33 nucleotide region within the Scribble promoter in both mouse and human cell lines and kidneys. Together, our results support a role for the predominant WT1(+KTS) isoform in transcriptional regulation and suggest a link between the WT1-dependent tumor suppressor pathway and a key component of the planar cell polarity pathway. PMID:20571064

  8. Genome-wide associations of gene expression variation in humans.

    Directory of Open Access Journals (Sweden)

    Barbara E Stranger

    2005-12-01

    Full Text Available The exploration of quantitative variation in human populations has become one of the major priorities for medical genetics. The successful identification of variants that contribute to complex traits is highly dependent on reliable assays and genetic maps. We have performed a genome-wide quantitative trait analysis of 630 genes in 60 unrelated Utah residents with ancestry from Northern and Western Europe using the publicly available phase I data of the International HapMap project. The genes are located in regions of the human genome with elevated functional annotation and disease interest including the ENCODE regions spanning 1% of the genome, Chromosome 21 and Chromosome 20q12-13.2. We apply three different methods of multiple test correction, including Bonferroni, false discovery rate, and permutations. For the 374 expressed genes, we find many regions with statistically significant association of single nucleotide polymorphisms (SNPs with expression variation in lymphoblastoid cell lines after correcting for multiple tests. Based on our analyses, the signal proximal (cis- to the genes of interest is more abundant and more stable than distal and trans across statistical methodologies. Our results suggest that regulatory polymorphism is widespread in the human genome and show that the 5-kb (phase I HapMap has sufficient density to enable linkage disequilibrium mapping in humans. Such studies will significantly enhance our ability to annotate the non-coding part of the genome and interpret functional variation. In addition, we demonstrate that the HapMap cell lines themselves may serve as a useful resource for quantitative measurements at the cellular level.

  9. Genome-Wide Associations of Gene Expression Variation in Humans.

    Directory of Open Access Journals (Sweden)

    2005-12-01

    Full Text Available The exploration of quantitative variation in human populations has become one of the major priorities for medical genetics. The successful identification of variants that contribute to complex traits is highly dependent on reliable assays and genetic maps. We have performed a genome-wide quantitative trait analysis of 630 genes in 60 unrelated Utah residents with ancestry from Northern and Western Europe using the publicly available phase I data of the International HapMap project. The genes are located in regions of the human genome with elevated functional annotation and disease interest including the ENCODE regions spanning 1% of the genome, Chromosome 21 and Chromosome 20q12-13.2. We apply three different methods of multiple test correction, including Bonferroni, false discovery rate, and permutations. For the 374 expressed genes, we find many regions with statistically significant association of single nucleotide polymorphisms (SNPs with expression variation in lymphoblastoid cell lines after correcting for multiple tests. Based on our analyses, the signal proximal (cis- to the genes of interest is more abundant and more stable than distal and trans across statistical methodologies. Our results suggest that regulatory polymorphism is widespread in the human genome and show that the 5-kb (phase I HapMap has sufficient density to enable linkage disequilibrium mapping in humans. Such studies will significantly enhance our ability to annotate the non-coding part of the genome and interpret functional variation. In addition, we demonstrate that the HapMap cell lines themselves may serve as a useful resource for quantitative measurements at the cellular level.

  10. Methods for the Isolation of Genes Encoding Novel PHA Metabolism Enzymes from Complex Microbial Communities.

    Science.gov (United States)

    Cheng, Jiujun; Nordeste, Ricardo; Trainer, Maria A; Charles, Trevor C

    2017-01-01

    Development of different PHAs as alternatives to petrochemically derived plastics can be facilitated by mining metagenomic libraries for diverse PHA cycle genes that might be useful for synthesis of bio-plastics. The specific phenotypes associated with mutations of the PHA synthesis pathway genes in Sinorhizobium meliloti and Pseudomonas putida, allows the use of powerful selection and screening tools to identify complementing novel PHA synthesis genes. Identification of novel genes through their function rather than sequence facilitates the functional proteins that may otherwise have been excluded through sequence-only screening methodology. We present here methods that we have developed for the isolation of clones expressing novel PHA metabolism genes from metagenomic libraries.

  11. Methods for the isolation of genes encoding novel PHB cycle enzymes from complex microbial communities.

    Science.gov (United States)

    Nordeste, Ricardo F; Trainer, Maria A; Charles, Trevor C

    2010-01-01

    Development of different PHAs as alternatives to petrochemically derived plastics can be facilitated by mining metagenomic libraries for diverse PHA cycle genes that might be useful for synthesis of bioplastics. The specific phenotypes associated with mutations of the PHA synthesis pathway genes in Sinorhizobium meliloti allows for the use of powerful selection and screening tools to identify complementing novel PHA synthesis genes. Identification of novel genes through their function rather than sequence facilitates finding functional proteins that may otherwise have been excluded through sequence-only screening methodology. We present here methods that we have developed for the isolation of clones expressing novel PHA metabolism genes from metagenomic libraries.

  12. Firewalls Prevent Systemic Dissemination of Vectors Derived from Human Adenovirus Type 5 and Suppress Production of Transgene-Encoded Antigen in a Murine Model of Oral Vaccination.

    Science.gov (United States)

    Revaud, Julien; Unterfinger, Yves; Rol, Nicolas; Suleman, Muhammad; Shaw, Julia; Galea, Sandra; Gavard, Françoise; Lacour, Sandrine A; Coulpier, Muriel; Versillé, Nicolas; Havenga, Menzo; Klonjkowski, Bernard; Zanella, Gina; Biacchesi, Stéphane; Cordonnier, Nathalie; Corthésy, Blaise; Ben Arous, Juliette; Richardson, Jennifer P

    2018-01-01

    To define the bottlenecks that restrict antigen expression after oral administration of viral-vectored vaccines, we tracked vectors derived from the human adenovirus type 5 at whole body, tissue, and cellular scales throughout the digestive tract in a murine model of oral delivery. After intragastric administration of vectors encoding firefly luciferase or a model antigen, detectable levels of transgene-encoded protein or mRNA were confined to the intestine, and restricted to delimited anatomical zones. Expression of luciferase in the form of multiple small bioluminescent foci in the distal ileum, cecum, and proximal colon suggested multiple crossing points. Many foci were unassociated with visible Peyer's patches, implying that transduced cells lay in proximity to villous rather than follicle-associated epithelium, as supported by detection of transgene-encoded antigen in villous epithelial cells. Transgene-encoded mRNA but not protein was readily detected in Peyer's patches, suggesting that post-transcriptional regulation of viral gene expression might limit expression of transgene-encoded antigen in this tissue. To characterize the pathways by which the vector crossed the intestinal epithelium and encountered sentinel cells, a fluorescent-labeled vector was administered to mice by the intragastric route or inoculated into ligated intestinal loops comprising a Peyer's patch. The vector adhered selectively to microfold cells in the follicle-associated epithelium, and, after translocation to the subepithelial dome region, was captured by phagocytes that expressed CD11c and lysozyme. In conclusion, although a large number of crossing events took place throughout the intestine within and without Peyer's patches, multiple firewalls prevented systemic dissemination of vector and suppressed production of transgene-encoded protein in Peyer's patches.

  13. Firewalls Prevent Systemic Dissemination of Vectors Derived from Human Adenovirus Type 5 and Suppress Production of Transgene-Encoded Antigen in a Murine Model of Oral Vaccination

    Directory of Open Access Journals (Sweden)

    Julien Revaud

    2018-01-01

    Full Text Available To define the bottlenecks that restrict antigen expression after oral administration of viral-vectored vaccines, we tracked vectors derived from the human adenovirus type 5 at whole body, tissue, and cellular scales throughout the digestive tract in a murine model of oral delivery. After intragastric administration of vectors encoding firefly luciferase or a model antigen, detectable levels of transgene-encoded protein or mRNA were confined to the intestine, and restricted to delimited anatomical zones. Expression of luciferase in the form of multiple small bioluminescent foci in the distal ileum, cecum, and proximal colon suggested multiple crossing points. Many foci were unassociated with visible Peyer's patches, implying that transduced cells lay in proximity to villous rather than follicle-associated epithelium, as supported by detection of transgene-encoded antigen in villous epithelial cells. Transgene-encoded mRNA but not protein was readily detected in Peyer's patches, suggesting that post-transcriptional regulation of viral gene expression might limit expression of transgene-encoded antigen in this tissue. To characterize the pathways by which the vector crossed the intestinal epithelium and encountered sentinel cells, a fluorescent-labeled vector was administered to mice by the intragastric route or inoculated into ligated intestinal loops comprising a Peyer's patch. The vector adhered selectively to microfold cells in the follicle-associated epithelium, and, after translocation to the subepithelial dome region, was captured by phagocytes that expressed CD11c and lysozyme. In conclusion, although a large number of crossing events took place throughout the intestine within and without Peyer's patches, multiple firewalls prevented systemic dissemination of vector and suppressed production of transgene-encoded protein in Peyer's patches.

  14. PURA, the gene encoding Pur-alpha, member of an ancient nucleic acid-binding protein family with mammalian neurological functions.

    Science.gov (United States)

    Daniel, Dianne C; Johnson, Edward M

    2018-02-15

    The PURA gene encodes Pur-alpha, a 322 amino acid protein with repeated nucleic acid binding domains that are highly conserved from bacteria through humans. PUR genes with a single copy of this domain have been detected so far in spirochetes and bacteroides. Lower eukaryotes possess one copy of the PUR gene, whereas chordates possess 1 to 4 PUR family members. Human PUR genes encode Pur-alpha (Pura), Pur-beta (Purb) and two forms of Pur-gamma (Purg). Pur-alpha is a protein that binds specific DNA and RNA sequence elements. Human PURA, located at chromosome band 5q31, is under complex control of three promoters. The entire protein coding sequence of PURA is contiguous within a single exon. Several studies have found that overexpression or microinjection of Pura inhibits anchorage-independent growth of oncogenically transformed cells and blocks proliferation at either G1-S or G2-M checkpoints. Effects on the cell cycle may be mediated by interaction of Pura with cellular proteins including Cyclin/Cdk complexes and the Rb tumor suppressor protein. PURA knockout mice die shortly after birth with effects on brain and hematopoietic development. In humans environmentally induced heterozygous deletions of PURA have been implicated in forms of myelodysplastic syndrome and progression to acute myelogenous leukemia. Pura plays a role in AIDS through association with the HIV-1 protein, Tat. In the brain Tat and Pura association in glial cells activates transcription and replication of JC polyomavirus, the agent causing the demyelination disease, progressive multifocal leukoencephalopathy. Tat and Pura also act to stimulate replication of the HIV-1 RNA genome. In neurons Pura accompanies mRNA transcripts to sites of translation in dendrites. Microdeletions in the PURA locus have been implicated in several neurological disorders. De novo PURA mutations have been related to a spectrum of phenotypes indicating a potential PURA syndrome. The nucleic acid, G-rich Pura binding

  15. Identification and Functional Characterization of Genes Encoding Omega-3 Polyunsaturated Fatty Acid Biosynthetic Activities from Unicellular Microalgae

    Directory of Open Access Journals (Sweden)

    Royah Vaezi

    2013-12-01

    Full Text Available In order to identify novel genes encoding enzymes involved in the biosynthesis of nutritionally important omega-3 long chain polyunsaturated fatty acids, a database search was carried out in the genomes of the unicellular photoautotrophic green alga Ostreococcus RCC809 and cold-water diatom Fragilariopsis cylindrus. The search led to the identification of two putative “front-end” desaturases (Δ6 and Δ4 from Ostreococcus RCC809 and one Δ6-elongase from F. cylindrus. Heterologous expression of putative open reading frames (ORFs in yeast revealed that the encoded enzyme activities efficiently convert their respective substrates: 54.1% conversion of α-linolenic acid for Δ6-desaturase, 15.1% conversion of 22:5n-3 for Δ4-desaturase and 38.1% conversion of γ-linolenic acid for Δ6-elongase. The Δ6-desaturase from Ostreococcus RCC809 displays a very strong substrate preference resulting in the predominant synthesis of stearidonic acid (C18:4Δ6,9,12,15. These data confirm the functional characterization of omega-3 long chain polyunsaturated fatty acid biosynthetic genes from these two species which have until now not been investigated for such activities. The identification of these new genes will also serve to expand the repertoire of activities available for metabolically engineering the omega-3 trait in heterologous hosts as well as providing better insights into the synthesis of eicosapentaenoic acid (EPA and docosahexaenoic acid (DHA in marine microalgae.

  16. Biosynthesis of actinorhodin and related antibiotics: discovery of alternative routes for quinone formation encoded in the act gene cluster.

    Science.gov (United States)

    Okamoto, Susumu; Taguchi, Takaaki; Ochi, Kozo; Ichinose, Koji

    2009-02-27

    All known benzoisochromanequinone (BIQ) biosynthetic gene clusters carry a set of genes encoding a two-component monooxygenase homologous to the ActVA-ORF5/ActVB system for actinorhodin biosynthesis in Streptomyces coelicolor A3(2). Here, we conducted molecular genetic and biochemical studies of this enzyme system. Inactivation of actVA-ORF5 yielded a shunt product, actinoperylone (ACPL), apparently derived from 6-deoxy-dihydrokalafungin. Similarly, deletion of actVB resulted in accumulation of ACPL, indicating a critical role for the monooxygenase system in C-6 oxygenation, a biosynthetic step common to all BIQ biosyntheses. Furthermore, in vitro, we showed a quinone-forming activity of the ActVA-ORF5/ActVB system in addition to that of a known C-6 monooxygenase, ActVA-ORF6, by using emodinanthrone as a model substrate. Our results demonstrate that the act gene cluster encodes two alternative routes for quinone formation by C-6 oxygenation in BIQ biosynthesis.

  17. Phylogenetic analysis of fungal heterotrimeric G protein-encoding genes and their expression during dimorphism in Mucor circinelloides.

    Science.gov (United States)

    Valle-Maldonado, Marco Iván; Jácome-Galarza, Irvin Eduardo; Díaz-Pérez, Alma Laura; Martínez-Cadena, Guadalupe; Campos-García, Jesús; Ramírez-Díaz, Martha Isela; Reyes-De la Cruz, Homero; Riveros-Rosas, Héctor; Díaz-Pérez, César; Meza-Carmen, Víctor

    2015-12-01

    In fungi, heterotrimeric G proteins are key regulators of biological processes such as mating, virulence, morphology, among others. Mucor circinelloides is a model organism for many biological processes, and its genome contains the largest known repertoire of genes that encode putative heterotrimeric G protein subunits in the fungal kingdom: twelve Gα (McGpa1-12), three Gβ (McGpb1-3), and three Gγ (McGpg1-3). Phylogenetic analysis of fungal Gα showed that they are divided into four distinct groups as reported previously. Fungal Gβ and Gγ are also divided into four phylogenetic groups, and to our understanding this is the first report of a phylogenetic classification for fungal Gβ and Gγ subunits. Almost all genes that encode putative heterotrimeric G subunits in M. circinelloides are differentially expressed during dimorphic growth, except for McGpg1 (Gγ) that showed very low mRNA levels at all developmental stages. Moreover, several of the subunits are expressed in a similar pattern and at the same level, suggesting that they constitute discrete complexes. For example, McGpb3 (Gβ), and McGpg2 (Gγ), are co-expressed during mycelium growth, and McGpa1, McGpb2, and McGpg2, are co-expressed during yeast development. These findings provide the conceptual framework to study the biological role of these genes during M. circinelloides morphogenesis. Copyright © 2015 The British Mycological Society. Published by Elsevier Ltd. All rights reserved.

  18. Modulation of expression of genes encoding nuclear proteins following exposure to JANUS neutrons or γ-rays

    International Nuclear Information System (INIS)

    Woloschak, G.E.; Chang-Liu, Chin-Mei

    1994-01-01

    Previous work has shown that exposure of cells to ionizing radiations causes modulation of a variety of genes, including those encoding c-fos, interleukin-1, tumor necrosis factor, cytoskeletal elements, and many more. The experiments reported herein were designed to examine the effects of either JANUS neutron or γ-ray exposure on expression of genes encoding nucleus-associated proteins (H4-histone, c-jun, c-myc, Rb, and p53). Cycling Syrian hamster embryo cells were irradiated with varying doses and dose rates of either JANUS fission-spectrum neutrons or γ-rays; after incubation of the cell cultures for 1 h following radiation exposure, mRNA was harvested and analyzed by Northern blot. Results revealed induction of transcripts for c-jun, H4-histone, and Rb following γ-ray but not following neutron exposure. Interestingly, expression of c-myc was repressed following γ-ray but not following neutron exposure. Radiations at different doses and dose rates were compared for each of the genes studied

  19. Structure of genes for dermaseptins B, antimicrobial peptides from frog skin. Exon 1-encoded prepropeptide is conserved in genes for peptides of highly different structures and activities.

    Science.gov (United States)

    Vouille, V; Amiche, M; Nicolas, P

    1997-09-01

    We cloned the genes of two members of the dermaseptin family, broad-spectrum antimicrobial peptides isolated from the skin of the arboreal frog Phyllomedusa bicolor. The dermaseptin gene Drg2 has a 2-exon coding structure interrupted by a small 137-bp intron, wherein exon 1 encoded a 22-residue hydrophobic signal peptide and the first three amino acids of the acidic propiece; exon 2 contained the 18 additional acidic residues of the propiece plus a typical prohormone processing signal Lys-Arg and a 32-residue dermaseptin progenitor sequence. The dermaseptin genes Drg2 and Drg1g2 have conserved sequences at both untranslated ends and in the first and second coding exons. In contrast, Drg1g2 comprises a third coding exon for a short version of the acidic propiece and a second dermaseptin progenitor sequence. Structural conservation between the two genes suggests that Drg1g2 arose recently from an ancestral Drg2-like gene through amplification of part of the second coding exon and 3'-untranslated region. Analysis of the cDNAs coding precursors for several frog skin peptides of highly different structures and activities demonstrates that the signal peptides and part of the acidic propieces are encoded by conserved nucleotides encompassed by the first coding exon of the dermaseptin genes. The organization of the genes that belong to this family, with the signal peptide and the progenitor sequence on separate exons, permits strikingly different peptides to be directed into the secretory pathway. The recruitment of such a homologous 'secretory' exon by otherwise non-homologous genes may have been an early event in the evolution of amphibian.

  20. Stress tolerances of nullmutants of function-unknown genes encoding menadione stress-responsive proteins in Aspergillus nidulans.

    Science.gov (United States)

    Leiter, Éva; Bálint, Mihály; Miskei, Márton; Orosz, Erzsébet; Szabó, Zsuzsa; Pócsi, István

    2016-07-01

    A group of menadione stress-responsive function-unkown genes of Aspergillus nidulans (Locus IDs ANID_03987.1, ANID_06058.1, ANID_10219.1, and ANID_10260.1) was deleted and phenotypically characterized. Importantly, comparative and phylogenetic analyses of the tested A. nidulans genes and their orthologs shed light only on the presence of a TANGO2 domain with NRDE protein motif in the translated ANID_06058.1 gene but did not reveal any recognizable protein-encoding domains in other protein sequences. The gene deletion strains were subjected to oxidative, osmotic, and metal ion stress and, surprisingly, only the ΔANID_10219.1 mutant showed an increased sensitivity to 0.12 mmol l(-1) menadione sodium bisulfite. The gene deletions affected the stress sensitivities (tolerances) irregularly, for example, some strains grew more slowly when exposed to various oxidants and/or osmotic stress generating agents, meanwhile the ΔANID_10260.1 mutant possessed a wild-type tolerance to all stressors tested. Our results are in line with earlier studies demonstrating that the deletions of stress-responsive genes do not confer necessarily any stress-sensitivity phenotypes, which can be attributed to compensatory mechanisms based on other elements of the stress response system with overlapping functions. © 2015 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  1. Replacement of the folC gene, encoding folylpolyglutamate synthetase-dihydrofolate synthetase in Escherichia coli, with genes mutagenized in vitro.

    Science.gov (United States)

    Pyne, C; Bognar, A L

    1992-03-01

    The folylpolyglutamate synthetase-dihydrofolate synthetase gene (folC) in Escherichia coli was deleted from the bacterial chromosome and replaced by a selectable Kmr marker. The deletion strain required a complementing gene expressing folylpolyglutamate synthetase encoded on a plasmid for viability, indicating that folC is an essential gene in E. coli. The complementing folC gene was cloned into the vector pPM103 (pSC101, temperature sensitive for replication), which segregated spontaneously at 42 degrees C in the absence of selection. This complementing plasmid was replaced in the folC deletion strain by compatible pUC plasmids containing folC genes with mutations generated in vitro, producing strains which express only mutant folylpolyglutamate synthetase. Mutant folC genes expressing insufficient enzyme activity could not complement the chromosomal deletion, resulting in retention of the pPM103 plasmid. Some mutant genes expressing low levels of enzyme activity replaced the complementing plasmid, but the strains produced were auxotrophic for products of folate-dependent pathways. The folylpolyglutamate synthetase gene from Lactobacillus casei, which may lack dihydrofolate synthetase activity, replaced the complementing plasmid, but the strain was auxotrophic for all folate end products.

  2. Expression of genes encoding F-1-ATPase results in uncoupling of glycolysis from biomass production in Lactococcus lactis

    DEFF Research Database (Denmark)

    Købmann, Brian Jensen; Solem, Christian; Pedersen, M.B.

    2002-01-01

    of the genes encoding F-1-ATPase was found to decrease the intracellular energy level and resulted in a decrease in the growth rate. The yield of biomass also decreased, which showed that the incorporated F-1-ATPase activity caused glycolysis to be uncoupled from biomass production. The increase in ATPase...... threefold in nongrowing cells resuspended in buffer, but in steadily growing cells no increase in flux was observed. The latter result shows that glycolysis occurs close to its maximal capacity and indicates that control of the glycolytic flux under these conditions resides in the glycolytic reactions...

  3. Genetic association analysis of 13 nuclear-encoded mitochondrial candidate genes with type II diabetes mellitus: The DAMAGE study

    DEFF Research Database (Denmark)

    Reiling, Erwin; van Vliet-Ostaptchouk, Jana V; van 't Riet, Esther

    2009-01-01

    ). After a meta-analysis, only one SNP in SIRT4 (rs2522138) remained significant (P=0.01). Extending the second stage with samples from the Danish Steno Study (n=1220 participants) resulted in a common odds ratio (OR) of 0.92 (0.85-1.00), P=0.06. Moreover, in a large meta-analysis of three genome......Mitochondria play an important role in many processes, like glucose metabolism, fatty acid oxidation and ATP synthesis. In this study, we aimed to identify association of common polymorphisms in nuclear-encoded genes involved in mitochondrial protein synthesis and biogenesis with type II diabetes...

  4. Mosquito Passage Dramatically Changes var Gene Expression in Controlled Human Plasmodium falciparum Infections.

    Science.gov (United States)

    Bachmann, Anna; Petter, Michaela; Krumkamp, Ralf; Esen, Meral; Held, Jana; Scholz, Judith A M; Li, Tao; Sim, B Kim Lee; Hoffman, Stephen L; Kremsner, Peter G; Mordmüller, Benjamin; Duffy, Michael F; Tannich, Egbert

    2016-04-01

    Virulence of the most deadly malaria parasite Plasmodium falciparum is linked to the variant surface antigen PfEMP1, which is encoded by about 60 var genes per parasite genome. Although the expression of particular variants has been associated with different clinical outcomes, little is known about var gene expression at the onset of infection. By analyzing controlled human malaria infections via quantitative real-time PCR, we show that parasite populations from 18 volunteers expressed virtually identical transcript patterns that were dominated by the subtelomeric var gene group B and, to a lesser extent, group A. Furthermore, major changes in composition and frequency of var gene transcripts were detected between the parental parasite culture that was used to infect mosquitoes and Plasmodia recovered from infected volunteers, suggesting that P. falciparum resets its var gene expression during mosquito passage and starts with the broad expression of a specific subset of var genes when entering the human blood phase.

  5. An electrophysiological investigation of memory encoding, depth of processing, and word frequency in humans.

    Science.gov (United States)

    Guo, Chunyan; Zhu, Ying; Ding, Jinhong; Fan, Silu; Paller, Ken A

    2004-02-12

    Memory encoding can be studied by monitoring brain activity correlated with subsequent remembering. To understand brain potentials associated with encoding, we compared multiple factors known to affect encoding. Depth of processing was manipulated by requiring subjects to detect animal names (deep encoding) or boldface (shallow encoding) in a series of Chinese words. Recognition was more accurate with deep than shallow encoding, and for low- compared to high-frequency words. Potentials were generally more positive for subsequently recognized versus forgotten words; for deep compared to shallow processing; and, for remembered words only, for low- than for high-frequency words. Latency and topographic differences between these potentials suggested that several factors influence the effectiveness of encoding and can be distinguished using these methods, even with Chinese logographic symbols.

  6. Good genes, complementary genes and human mate preferences.

    Science.gov (United States)

    Roberts, S Craig; Little, Anthony C

    2008-09-01

    The past decade has witnessed a rapidly growing interest in the biological basis of human mate choice. Here we review recent studies that demonstrate preferences for traits which might reveal genetic quality to prospective mates, with potential but still largely unknown influence on offspring fitness. These include studies assessing visual, olfactory and auditory preferences for potential good-gene indicator traits, such as dominance or bilateral symmetry. Individual differences in these robust preferences mainly arise through within and between individual variation in condition and reproductive status. Another set of studies have revealed preferences for traits indicating complementary genes, focussing on discrimination of dissimilarity at genes in the major histocompatibility complex (MHC). As in animal studies, we are only just beginning to understand how preferences for specific traits vary and inter-relate, how consideration of good and compatible genes can lead to substantial variability in individual mate choice decisions and how preferences expressed in one sensory modality may reflect those in another. Humans may be an ideal model species in which to explore these interesting complexities.

  7. Identification and characterization of genes encoding polycyclic aromatic hydrocarbon dioxygenase and polycyclic aromatic hydrocarbon dihydrodiol dehydrogenase in Pseudomonas putida OUS82.

    OpenAIRE

    Takizawa, N; Kaida, N; Torigoe, S; Moritani, T; Sawada, T; Satoh, S; Kiyohara, H

    1994-01-01

    Naphthalene and phenanthrene are transformed by enzymes encoded by the pah gene cluster of Pseudomonas putida OUS82. The pahA and pahB genes, which encode the first and second enzymes, dioxygenase and cis-dihydrodiol dehydrogenase, respectively, were identified and sequenced. The DNA sequences showed that pahA and pahB were clustered and that pahA consisted of four cistrons, pahAa, pahAb, pahAc, and pahAd, which encode ferredoxin reductase, ferredoxin, and two subunits of the iron-sulfur prot...

  8. Regulatory domain or CpG site variation in SLC12A5, encoding the chloride transporter KCC2, in human autism and schizophrenia

    Directory of Open Access Journals (Sweden)

    Nancy D Merner

    2015-10-01

    Full Text Available Many encoded gene products responsible for neurodevelopmental disorders (NDs like autism spectrum disorders (ASD, schizophrenia (SCZ, intellectual disability (ID, and idiopathic generalized epilepsy (IGE converge on networks controlling synaptic function. An increase in KCC2 (SLC12A5 Cl- transporter activity drives the developmental GABA excitatory-inhibitory sequence, but the role of KCC2 in human NDs is essentially unknown. Here, we report two rare, non-synonymous (NS, functionally-impairing variants in the KCC2 C-terminal regulatory domain (CTRD in human ASD (R952H and R1049C and SCZ (R952H previously linked with IGE and familial febrile seizures, and another novel NS KCC2 variant in ASD (R1048W with highly-predicted pathogenicity. Exome data from 2517 simplex families in the ASD Simon Simplex Collection revealed significantly more KCC2 CTRD variants in ASD cases than controls, and interestingly, these were more often synonymous and predicted to disrupt or introduce a CpG site. Furthermore, full gene analysis showed ASD cases are more likely to contain rare KCC2 variants affecting CpG sites than controls. These data suggest genetically-encoded dysregulation of KCC2-dependent GABA signaling may contribute to multiple human NDs.

  9. Gene expression profiling in the inductive human hematopoietic microenvironment

    International Nuclear Information System (INIS)

    Zhao Yongjun; Chen, Edwin; Li Liheng; Gong Baiwei; Xie Wei; Nanji, Shaherose; Dube, Ian D.; Hough, Margaret R.

    2004-01-01

    Human hematopoietic stem cells (HSCs) and their progenitors can be maintained in vitro in long-term bone marrow cultures (LTBMCs) in which constituent HSCs can persist within the adherent layers for up to 2 months. Media replenishment of LTBMCs has been shown to induce transition of HSCs from a quiescent state to an active cycling state. We hypothesize that the media replenishment of the LTBMCs leads to the activation of important regulatory genes uniquely involved in HSC proliferation and differentiation. To profile the gene expression changes associated with HSC activation, we performed suppression subtractive hybridization (SSH) on day 14 human LTBMCs following 1-h media replenishment and on unmanipulated controls. The generated SSH library contained 191 differentially up-regulated expressed sequence tags (ESTs), the majority corresponding to known genes related to various intracellular processes, including signal transduction pathways, protein synthesis, and cell cycle regulation. Nineteen ESTs represented previously undescribed sequences encoding proteins of unknown function. Differential up-regulation of representative genes, including IL-8, IL-1, putative cytokine 21/HC21, MAD3, and a novel EST was confirmed by semi-quantitative RT-PCR. Levels of fibronectin, G-CSF, and stem cell factor also increased in the conditioned media of LTBMCs as assessed by ELISA, indicating increased synthesis and secretion of these factors. Analysis of our library provides insights into some of the immediate early gene changes underlying the mechanisms by which the stromal elements within the LTBMCs contribute to the induction of HSC activation and provides the opportunity to identify as yet unrecognized factors regulating HSC activation in the LTBMC milieu

  10. Reduced Neuronal Transcription of Escargot, the Drosophila Gene Encoding a Snail-Type Transcription Factor, Promotes Longevity

    Science.gov (United States)

    Symonenko, Alexander V.; Roshina, Natalia V.; Krementsova, Anna V.; Pasyukova, Elena G.

    2018-01-01

    In recent years, several genes involved in complex neuron specification networks have been shown to control life span. However, information on these genes is scattered, and studies to discover new neuronal genes and gene cascades contributing to life span control are needed, especially because of the recognized role of the nervous system in governing homeostasis, aging, and longevity. Previously, we demonstrated that several genes that encode RNA polymerase II transcription factors and that are involved in the development of the nervous system affect life span in Drosophila melanogaster. Among other genes, escargot (esg) was demonstrated to be causally associated with an increase in the life span of male flies. Here, we present new data on the role of esg in life span control. We show that esg affects the life spans of both mated and unmated males and females to varying degrees. By analyzing the survival and locomotion of the esg mutants, we demonstrate that esg is involved in the control of aging. We show that increased longevity is caused by decreased esg transcription. In particular, we demonstrate that esg knockdown in the nervous system increased life span, directly establishing the involvement of the neuronal esg function in life span control. Our data invite attention to the mechanisms regulating the esg transcription rate, which is changed by insertions of DNA fragments of different sizes downstream of the structural part of the gene, indicating the direction of further research. Our data agree with the previously made suggestion that alterations in gene expression during development might affect adult lifespan, due to epigenetic patterns inherited in cell lineages or predetermined during the development of the structural and functional properties of the nervous system. PMID:29760717

  11. High prevalence of diarrheagenic Escherichia coli carrying toxin-encoding genes isolated from children and adults in southeastern Brazil.

    Science.gov (United States)

    Spano, Liliana Cruz; da Cunha, Keyla Fonseca; Monfardini, Mariane Vedovatti; de Cássia Bergamaschi Fonseca, Rita; Scaletsky, Isabel Christina Affonso

    2017-12-18

    Diarrheagenic Escherichia coli (DEC) are important bacterial causes of childhood diarrhea in Brazil, but its impact in adults is unknown. This study aimed at investigating DEC among children and adults living in endemic areas. A total of 327 stools specimens were collected from children (n = 141) and adults (n = 186) with diarrhea attending health centers. Diarrheagenic E. coli (DEC) were identified by their virulence genes (multiplex polymerase chain reaction) and HEp-2 cell adherence patterns. DEC were detected in 56 (40%) children and 74 (39%) adults; enteroaggregative E. coli (EAEC) (23%) was the most prevalent pathotype, followed by diffusely adherent E. coli (DAEC) (13%), and occurred at similar frequencies in both diarrheal groups. Atypical enteropathogenic E. coli (aEPEC) strains were recovered more frequently from children (6%) than from adults (1%). Twenty-six percent of the EAEC were classified as typical EAEC possessing aggR gene, and carried the aap gene. EAEC strains carrying aggR-aap-aatA genes were significantly more frequent among children than adults (p < 0.05). DAEC strains possessing Afa/Dr. genes were detected from children (10%) and adults (6%). EAEC and DAEC strains harboring genes for the EAST1 (astA), Pet, Pic, and Sat toxins were common in both diarrheal groups. The astA and the porcine AE/associated adhesin (paa) genes were found in most of aEPEC strains. High levels of resistance to antimicrobial drugs were found among DAEC and aEPEC isolates. The results show a high proportion of EAEC and DAEC carrying toxin-encoding genes among adults with diarrhea.

  12. Altered expression of mitochondrial and extracellular matrix genes in the heart of human fetuses with chromosome 21 trisomy

    Directory of Open Access Journals (Sweden)

    Olla Carlo

    2007-08-01

    Full Text Available Abstract Background The Down syndrome phenotype has been attributed to overexpression of chromosome 21 (Hsa21 genes. However, the expression profile of Hsa21 genes in trisomic human subjects as well as their effects on genes located on different chromosomes are largely unknown. Using oligonucleotide microarrays we compared the gene expression profiles of hearts of human fetuses with and without Hsa21 trisomy. Results Approximately half of the 15,000 genes examined (87 of the 168 genes on Hsa21 were expressed in the heart at 18–22 weeks of gestation. Hsa21 gene expression was globally upregulated 1.5 fold in trisomic samples. However, not all genes were equally dysregulated and 25 genes were not upregulated at all. Genes located on other chromosomes were also significantly dysregulated. Functional class scoring and gene set enrichment analyses of 473 genes, differentially expressed between trisomic and non-trisomic hearts, revealed downregulation of genes encoding mitochondrial enzymes and upregulation of genes encoding extracellular matrix proteins. There were no significant differences between trisomic fetuses with and without heart defects. Conclusion We conclude that dosage-dependent upregulation of Hsa21 genes causes dysregulation of the genes responsible for mitochondrial function and for the extracellular matrix organization in the fetal heart of trisomic subjects. These alterations might be harbingers of the heart defects associated with Hsa21 trisomy, which could be based on elusive mechanisms involving genetic variability, environmental factors and/or stochastic events.

  13. Comparative structural and functional analysis of genes encoding pectin methylesterases in Phytophthora spp.

    Science.gov (United States)

    Mingora, Christina; Ewer, Jason; Ospina-Giraldo, Manuel

    2014-03-15

    We have scanned the Phytophthora infestans, P. ramorum, and P. sojae genomes for the presence of putative pectin methylesterase genes and conducted a sequence analysis of all gene models found. We also searched for potential regulatory motifs in the promoter region of the proposed P. infestans models, and investigated the gene expression levels throughout the course of P. infestans infection on potato plants, using in planta and detached leaf assays. We found that genes located on contiguous chromosomal regions contain similar motifs in the promoter region, indicating the possibility of a shared regulatory mechanism. Results of our investigations also suggest that, during the pathogenicity process, the expression levels of some of the analyzed genes vary considerably when compared to basal expression observed in in vitro cultures of non-sporulating mycelium. These results were observed both in planta and in detached leaf assays. Copyright © 2014 Elsevier B.V. All rights reserved.

  14. Unfolded Protein Response (UPR Regulator Cib1 Controls Expression of Genes Encoding Secreted Virulence Factors in Ustilago maydis.

    Directory of Open Access Journals (Sweden)

    Martin Hampel

    Full Text Available The unfolded protein response (UPR, a conserved eukaryotic signaling pathway to ensure protein homeostasis in the endoplasmic reticulum (ER, coordinates biotrophic development in the corn smut fungus Ustilago maydis. Exact timing of UPR activation is required for virulence and presumably connected to the elevated expression of secreted effector proteins during infection of the host plant Zea mays. In the baker's yeast Saccharomyces cerevisiae, expression of UPR target genes is induced upon binding of the central regulator Hac1 to unfolded protein response elements (UPREs in their promoters. While a role of the UPR in effector secretion has been described previously, we investigated a potential UPR-dependent regulation of genes encoding secreted effector proteins. In silico prediction of UPREs in promoter regions identified the previously characterized effector genes pit2 and tin1-1, as bona fide UPR target genes. Furthermore, direct binding of the Hac1-homolog Cib1 to the UPRE containing promoter fragments of both genes was confirmed by quantitative chromatin immunoprecipitation (qChIP analysis. Targeted deletion of the UPRE abolished Cib1-dependent expression of pit2 and significantly affected virulence. Furthermore, ER stress strongly increased Pit2 expression and secretion. This study expands the role of the UPR as a signal hub in fungal virulence and illustrates, how biotrophic fungi can coordinate cellular physiology, development and regulation of secreted virulence factors.

  15. The L locus, one of complementary genes required for anthocyanin production in onions (Allium cepa), encodes anthocyanidin synthase.

    Science.gov (United States)

    Kim, Sunggil; Jones, Rick; Yoo, Kil-Sun; Pike, Leonard M

    2005-06-01

    Bulb color in onions (Allium cepa) is an important trait, but its complex, unclear mechanism of inheritance has been a limiting factor in onion cultivar improvement. The identity of the L locus, which is involved in the color difference between Brazilian yellow and red onions, is revealed in this study. A cross was made between a US-type yellow breeding line and a Brazilian yellow cultivar. The segregation ratio of nine red to seven yellow onions in the F(2) population supports the involvement of two complementary genes in anthocyanin production in the F(1) hybrids. The high-performance liquid chromatography (HPLC) and reverse-transcriptase (RT)-PCR analysis of the Brazilian yellow onions indicated that the genes are involved late in the anthocyanin synthesis pathway. The genomic sequence of the anthocyanidin synthase (ANS) gene in Brazilian yellow onions showed a point mutation, which results in an amino acid change of a glycine to an arginine at residue 229. Because this residue is located adjacent to a highly conserved iron-binding active site, this mutation is likely responsible for the inactivation of the ANS gene in Brazilian yellow onions. Following the isolation of the promoter sequence of the mutant allele, a PCR-based marker for allelic selection of the ANS gene was designed. This assay is based on an insertion (larger than 3 kb) mutation. The marker perfectly co-segregated with the color phenotypes in the F(2) populations, thereby indicating that the L locus encodes ANS.

  16. Cloning and analysis of the genes encoding the type IIS restriction-modification system HphI from Haemophilus parahaemolyticus.

    Science.gov (United States)

    Lubys, A; Lubienè, J; Kulakauskas, S; Stankevicius, K; Timinskas, A; Janulaitis, A

    1996-07-15

    The genomic region encoding the type IIS restriction-modification (R-M) system HphI (enzymes recognizing the asymmetric sequence 5'-GGTGA-3'/5'-TCACC-3') from Haemophilus parahaemolyticus were cloned into Escherichia coli and sequenced. Sequence analysis of the R-M HphI system revealed three adjacent genes aligned in the same orientation: a cytosine 5 methyltransferase (gene hphIMC), an adenine N6 methyltransferase (hphIMA) and the HphI restriction endonuclease (gene hphIR). Either methyltransferase is capable of protecting plasmid DNA in vivo against the action of the cognate restriction endonuclease. hphIMA methylation renders plasmid DNA resistant to R.Hindill at overlapping sites, suggesting that the adenine methyltransferase modifies the 3'-terminal A residue on the GGTGA strand. Strong homology was found between the N-terminal part of the m6A methyltransferasease and an unidentified reading frame interrupted by an incomplete gaIE gene of Neisseria meningitidis. The HphI R-M genes are flanked by a copy of a 56 bp direct nucleotide repeat on each side. Similar sequences have also been identified in the non-coding regions of H.influenzae Rd DNA. Possible involvement of the repeat sequences in the mobility of the HphI R-M system is discussed.

  17. Cortical networks for encoding near and far space in the non-human primate.

    Science.gov (United States)

    Cléry, Justine; Guipponi, Olivier; Odouard, Soline; Wardak, Claire; Ben Hamed, Suliann

    2018-04-19

    While extra-personal space is often erroneously considered as a unique entity, early neuropsychological studies report a dissociation between near and far space processing both in humans and in monkeys. Here, we use functional MRI in a naturalistic 3D environment to describe the non-human primate near and far space cortical networks. We describe the co-occurrence of two extended functional networks respectively dedicated to near and far space processing. Specifically, far space processing involves occipital, temporal, parietal, posterior cingulate as well as orbitofrontal regions not activated by near space, possibly subserving the processing of the shape and identity of objects. In contrast, near space processing involves temporal, parietal, prefrontal and premotor regions not activated by far space, possibly subserving the preparation of an arm/hand mediated action in this proximal space. Interestingly, this network also involves somatosensory regions, suggesting a cross-modal anticipation of touch by a nearby object. Last, we also describe cortical regions that process both far and near space with a preference for one or the other. This suggests a continuous encoding of relative distance to the body, in the form of a far-to-near gradient. We propose that these cortical gradients in space representation subserve the physically delineable peripersonal spaces described in numerous psychology and psychophysics studies. Copyright © 2018 Elsevier Inc. All rights reserved.

  18. Power shifts track serial position and modulate encoding in human episodic memory.

    Science.gov (United States)

    Serruya, Mijail D; Sederberg, Per B; Kahana, Michael J

    2014-02-01

    The first events in a series exert a powerful influence on cognition and behavior in both humans and animals. This is known as the law of primacy. Here, we analyze the neural correlates of primacy in humans by analyzing electrocorticographic recordings in 84 neurosurgical patients as they studied and subsequently recalled lists of common words. We found that spectral power in the gamma frequency band (28-100 Hz) was elevated at the start of the list and gradually subsided, whereas lower frequency (2-8 Hz) delta and theta band power exhibited the opposite trend. This gradual shift in the power spectrum was found across a widespread network of brain regions. The degree to which the subsequent memory effect was modulated by list (serial) position was most pronounced in medial temporal lobe structures. These results suggest that globally increased gamma and decreased delta-theta spectral powers reflect a brain state that predisposes medial temporal lobe structures to enhance the encoding and maintenance of early list items.

  19. cDNA cloning, sequence analysis, and chromosomal localization of the gene for human carnitine palmitoyltransferase

    International Nuclear Information System (INIS)

    Finocchiaro, G.; Taroni, F.; Martin, A.L.; Colombo, I.; Tarelli, G.T.; DiDonato, S.; Rocchi, M.

    1991-01-01

    The authors have cloned and sequenced a cDNA encoding human liver carnitine palmitoyltransferase an inner mitochondrial membrane enzyme that plays a major role in the fatty acid oxidation pathway. Mixed oligonucleotide primers whose sequences were deduced from one tryptic peptide obtained from purified CPTase were used in a polymerase chain reaction, allowing the amplification of a 0.12-kilobase fragment of human genomic DNA encoding such a peptide. A 60-base-pair (bp) oligonucleotide synthesized on the basis of the sequence from this fragment was used for the screening of a cDNA library from human liver and hybridized to a cDNA insert of 2255 bp. This cDNA contains an open reading frame of 1974 bp that encodes a protein of 658 amino acid residues including 25 residues of an NH 2 -terminal leader peptide. The assignment of this open reading frame to human liver CPTase is confirmed by matches to seven different amino acid sequences of tryptic peptides derived from pure human CPTase and by the 82.2% homology with the amino acid sequence of rat CPTase. The NH 2 -terminal region of CPTase contains a leucine-proline motif that is shared by carnitine acetyl- and octanoyltransferases and by choline acetyltransferase. The gene encoding CPTase was assigned to human chromosome 1, region 1q12-1pter, by hybridization of CPTase cDNA with a DNA panel of 19 human-hanster somatic cell hybrids

  20. Genes encoded within 8q24 on the amplicon of a large extrachromosomal element are selectively repressed during the terminal differentiation of HL-60 cells.

    Science.gov (United States)

    Hirano, Tetsuo; Ike, Fumio; Murata, Takehide; Obata, Yuichi; Utiyama, Hiroyasu; Yokoyama, Kazunari K

    2008-04-02

    Human acute myeloblastic leukemia HL-60 cells become resistant to differentiation during long-term cultivation. After 150 passages, double minute chromosomes (dmins) found in early-passaged cells are replaced by large extrachromosomal elements (LEEs). In a DNA library derived from a purified fraction of LEEs, 12.6% (23/183) of clones were assigned to 8q24 and 9.2% (17/183) were assigned to 14q11 in the human genome. Fluorescence in situ hybridization (FISH) revealed a small aberrant chromosome, which had not been found in early-passaged cells, in addition to the purified LEEs. We determined that each LEE consisted of six discontinuous segments in a region that extended for 4.4Mb over the 8q24 locus. Five genes, namely, Myc (a proto-oncogene), NSMCE2 (for a SUMO ligase), CCDC26 (for a retinoic acid-dependent modulator of myeloid differentiation), TRIB1 (for a regulator of MAPK kinase) and LOC389637 (for a protein of unknown function), were encoded by the amplicon. Breaks in the chromosomal DNA within the amplicon were found in the NSMCE2 and CCDC26 genes. The discontinuous structure of the amplicon unit of the LEEs was identical with that of dmins in HL-60 early-passaged cells. The difference between them seemed, predominantly, to be the number (10-15 copies per LEE versus 2 or 3 copies per dmin) of constituent units. Expression of the Myc, NSMCE2, CCDC26 and LOC389637 and TRIB1 genes was constitutive in all lines of HL-60 cells and that of the first four genes was repressed during the terminal differentiation of early-passaged HL-60 cells. We also detected abnormal transcripts of CCDC26. Our results suggest that these genes were selected during the development of amplicons. They might be amplified and, sometimes, truncated to contribute to the maintenance of HL-60 cells in an undifferentiated state.

  1. A maize gene encoding an NADPH binding enzyme highly homologous to isoflavone reductases is activated in response to sulfur starvation.

    Science.gov (United States)

    Petrucco, S; Bolchi, A; Foroni, C; Percudani, R; Rossi, G L; Ottonello, S

    1996-01-01

    we isolated a novel gene that is selectively induced both in roots and shoots in response to sulfur starvation. This gene encodes a cytosolic, monomeric protein of 33 kD that selectively binds NADPH. The predicted polypeptide is highly homologous ( > 70%) to leguminous isoflavone reductases (IFRs), but the maize protein (IRL for isoflavone reductase-like) belongs to a novel family of proteins present in a variety of plants. Anti-IRL antibodies specifically recognize IFR polypeptides, yet the maize protein is unable to use various isoflavonoids as substrates. IRL expression is correlated closely to glutathione availability: it is persistently induced in seedlings whose glutathione content is about fourfold lower than controls, and it is down-regulated rapidly when control levels of glutathione are restored. This glutathione-dependent regulation indicates that maize IRL may play a crucial role in the establishment of a thiol-independent response to oxidative stress under glutathione shortage conditions.

  2. A gene encoding maize caffeoyl-CoA O-methyltransferase confers quantitative resistance to multiple pathogens.

    Science.gov (United States)

    Yang, Qin; He, Yijian; Kabahuma, Mercy; Chaya, Timothy; Kelly, Amy; Borrego, Eli; Bian, Yang; El Kasmi, Farid; Yang, Li; Teixeira, Paulo; Kolkman, Judith; Nelson, Rebecca; Kolomiets, Michael; L Dangl, Jeffery; Wisser, Randall; Caplan, Jeffrey; Li, Xu; Lauter, Nick; Balint-Kurti, Peter

    2017-09-01

    Alleles that confer multiple disease resistance (MDR) are valuable in crop improvement, although the molecular mechanisms underlying their functions remain largely unknown. A quantitative trait locus, qMdr 9.02 , associated with resistance to three important foliar maize diseases-southern leaf blight, gray leaf spot and northern leaf blight-has been identified on maize chromosome 9. Through fine-mapping, association analysis, expression analysis, insertional mutagenesis and transgenic validation, we demonstrate that ZmCCoAOMT2, which encodes a caffeoyl-CoA O-methyltransferase associated with the phenylpropanoid pathway and lignin production, is the gene within qMdr 9.02 conferring quantitative resistance to both southern leaf blight and gray leaf spot. We suggest that resistance might be caused by allelic variation at the level of both gene expression and amino acid sequence, thus resulting in differences in levels of lignin and other metabolites of the phenylpropanoid pathway and regulation of programmed cell death.

  3. The ArcD1 and ArcD2 arginine/ornithine exchangers encoded in the arginine deiminase (ADI) pathway gene cluster of Lactococcus lactis

    NARCIS (Netherlands)

    Noens, Elke E E; Kaczmarek, Michał B; Żygo, Monika; Lolkema, Juke S

    2015-01-01

    The arginine deiminase pathway (ADI) gene cluster in Lactococcus lactis contains two copies of a gene encoding an L-arginine/L-ornithine exchanger, the arcD1 and arcD2 genes. The physiological function of ArcD1 and ArcD2 was studied by deleting the two genes. Deletion of arcD1 resulted in loss of

  4. The implications of alternative splicing in the ENCODE protein complement

    DEFF Research Database (Denmark)

    Tress, Michael L.; Martelli, Pier Luigi; Frankish, Adam

    2007-01-01

    suggested as one explanation for the discrepancy between the number of human genes and functional complexity. Here, we carry out a detailed study of the alternatively spliced gene products annotated in the ENCODE pilot project. We find that alternative splicing in human genes is more frequent than has...

  5. Plasmids encoding PKI(1-31), a specific inhibitor of cAMP-stimulated gene expression, inhibit the basal transcriptional activity of some but not all cAMP-regulated DNA response elements in JEG-3 cells.

    Science.gov (United States)

    Grove, J R; Deutsch, P J; Price, D J; Habener, J F; Avruch, J

    1989-11-25

    Plasmids that encode a bioactive amino-terminal fragment of the heat-stable inhibitor of the cAMP-dependent protein kinase, PKI(1-31), were employed to characterize the role of this protein kinase in the control of transcriptional activity mediated by three DNA regulatory elements in the JEG-3 human placental cell line. The 5'-flanking sequence of the human collagenase gene contains the heptameric sequence, 5'-TGAGTCA-3', previously identified as a "phorbol ester" response element. Reporter genes containing either the intact 1.2-kilobase 5'-flanking sequence from the human collagenase gene or just the 7-base pair (bp) response element, when coupled to an enhancerless promoter, each exhibit both cAMP and phorbol ester-stimulated expression in JEG-3 cells. Cotransfection of either construct with plasmids encoding PKI(1-31) inhibits cAMP-stimulated but not basal- or phorbol ester-stimulated expression. Pretreatment of cells with phorbol ester for 1 or 2 days abrogates completely the response to rechallenge with phorbol ester but does not alter the basal expression of either construct; cAMP-stimulated expression, while modestly inhibited, remains vigorous. The 5'-flanking sequence of the human chorionic gonadotropin-alpha subunit (HCG alpha) gene has two copies of the sequence, 5'-TGACGTCA-3', contained in directly adjacent identical 18-bp segments, previously identified as a cAMP-response element. Reporter genes containing either the intact 1.5 kilobase of 5'-flanking sequence from the HCG alpha gene, or just the 36-bp tandem repeat cAMP response element, when coupled to an enhancerless promoter, both exhibit a vigorous cAMP stimulation of expression but no response to phorbol ester in JEG-3 cells. Cotransfection with plasmids encoding PKI(1-31) inhibits both basal and cAMP-stimulated expression in a parallel fashion. The 5'-flanking sequence of the human enkephalin gene mediates cAMP-stimulated expression of reporter genes in both JEG-3 and CV-1 cells. Plasmids

  6. The Pseudomonas aeruginosa pirA gene encodes a second receptor for ferrienterobactin and synthetic catecholate analogues.

    Science.gov (United States)

    Ghysels, Bart; Ochsner, Urs; Möllman, Ute; Heinisch, Lothar; Vasil, Michael; Cornelis, Pierre; Matthijs, Sandra

    2005-05-15

    Actively secreted iron chelating agents termed siderophores play an important role in the virulence and rhizosphere competence of fluorescent pseudomonads, including Pseudomonas aeruginosa which secretes a high affinity siderophore, pyoverdine, and the low affinity siderophore, pyochelin. Uptake of the iron-siderophore complexes is an active process that requires specific outer membrane located receptors, which are dependent of the inner membrane-associated protein TonB and two other inner membrane proteins, ExbB and ExbC. P. aeruginosa is also capable of using a remarkable variety of heterologous siderophores as sources of iron, apparently by expressing their cognate receptors. Illustrative of this feature are the 32 (of which 28 putative) siderophore receptor genes observed in the P. aeruginosa PAO1 genome. However, except for a few (pyoverdine, pyochelin, enterobactin), the vast majority of P. aeruginosa siderophore receptor genes still remain to be characterized. Ten synthetic iron chelators of catecholate type stimulated growth of a pyoverdine/pyochelin deficient P. aeruginosa PAO1 mutant under condition of severe iron limitation. Null mutants of the 32 putative TonB-dependent siderophore receptor encoding genes engineered in the same genetic background were screened for obvious deficiencies in uptake of the synthetic siderophores, but none showed decreased growth stimulation in the presence of the different siderophores. However, a double knock-out mutant of ferrienterobactin receptor encoding gene pfeA (PA 2688) and pirA (PA0931) failed to be stimulated by 4 of the tested synthetic catecholate siderophores whose chemical structures resemble enterobactin. Ferric-enterobactin also failed to stimulate growth of the double pfeA-pirA mutant although, like its synthetic analogues, it stimulated growth of the corresponding single mutants. Hence, we confirmed that pirA represents a second P. aeruginosa ferric-enterobactin receptor. The example of these two

  7. Screening a yeast promoter library leads to the isolation of the RP29/L32 and SNR17B/RPL37A divergent promoters and the discovery of a gene encoding ribosomal protein L37.

    Science.gov (United States)

    Santangelo, G M; Tornow, J; McLaughlin, C S; Moldave, K

    1991-08-30

    Two promoters (A7 and A23), isolated at random from the Saccharomyces cerevisiae genome by virtue of their capacity to activate transcription, are identical to known intergenic bidirectional promoters. Sequence analysis of the genomic DNA adjacent to the A7 promoter identified a split gene encoding ribosomal (r) protein L37, which is homologous to the tRNA-binding r-proteins, L35a (from human and rat) and L32 (from frogs).

  8. A highly divergent gene cluster in honey bees encodes a novel silk family

    OpenAIRE

    Sutherland, Tara D.; Campbell, Peter M.; Weisman, Sarah; Trueman, Holly E.; Sriskantha, Alagacone; Wanjura, Wolfgang J.; Haritos, Victoria S.

    2006-01-01

    The pupal cocoon of the domesticated silk moth Bombyx mori is the best known and most extensively studied insect silk. It is not widely known that Apis mellifera larvae also produce silk. We have used a combination of genomic and proteomic techniques to identify four honey bee fiber genes (AmelFibroin1–4) and two silk-associated genes (AmelSA1 and 2). The four fiber genes are small, comprise a single exon each, and are clustered on a short genomic region where the open reading frames are GC-r...

  9. The short mRNA isoform of the immunoglobulin superfamily, member 1 gene encodes an intracellular glycoprotein.

    Directory of Open Access Journals (Sweden)

    Ying Wang

    Full Text Available Mutations in the immunoglobulin superfamily, member 1 gene (IGSF1/Igsf1 cause an X-linked form of central hypothyroidism. The canonical form of IGSF1 is a transmembrane glycoprotein with 12 immunoglobulin (Ig loops. The protein is co-translationally cleaved into two sub-domains. The carboxyl-terminal domain (CTD, which contains the last 7 Ig loops, is trafficked to the plasma membrane. Most pathogenic mutations in IGSF1 map to the portion of the gene encoding the CTD. IGSF1/Igsf1 encodes a variety of transcripts. A little studied, but abundant splice variant encodes a truncated form of the protein, predicted to contain the first 2 Ig loops of the full-length IGSF1. The protein (hereafter referred to as IGSF1 isoform 2 or IGSF1-2 is likely retained in most individuals with IGSF1 mutations. Here, we characterized basic biochemical properties of the protein as a foray into understanding its potential function. IGSF1-2, like the IGSF1-CTD, is a glycoprotein. In both mouse and rat, the protein is N-glycosylated at a single asparagine residue in the first Ig loop. Contrary to earlier predictions, neither the murine nor rat IGSF1-2 is secreted from heterologous or homologous cells. In addition, neither protein associates with the plasma membrane. Rather, IGSF1-2 appears to be retained in the endoplasmic reticulum. Whether the protein plays intracellular functions or is trafficked through the secretory pathway under certain physiologic or pathophysiologic conditions has yet to be determined.

  10. Dynein Heavy Chain, Encoded by Two Genes in Agaricomycetes, Is Required for Nuclear Migration in Schizophyllum commune.

    Directory of Open Access Journals (Sweden)

    Melanie Brunsch

    Full Text Available The white-rot fungus Schizophyllum commune (Agaricomycetes was used to study the cell biology of microtubular trafficking during mating interactions, when the two partners exchange nuclei, which are transported along microtubule tracks. For this transport activity, the motor protein dynein is required. In S. commune, the dynein heavy chain is encoded in two parts by two separate genes, dhc1 and dhc2. The N-terminal protein Dhc1 supplies the dimerization domain, while Dhc2 encodes the motor machinery and the microtubule binding domain. This split motor protein is unique to Basidiomycota, where three different sequence patterns suggest independent split events during evolution. To investigate the function of the dynein heavy chain, the gene dhc1 and the motor domain in dhc2 were deleted. Both resulting mutants were viable, but revealed phenotypes in hyphal growth morphology and mating behavior as well as in sexual development. Viability of strain Δdhc2 is due to the higher expression of kinesin-2 and kinesin-14, which was proven via RNA sequencing.

  11. Multiple signalling systems controlling expression of luminescence in Vibrio harveyi: sequence and function of genes encoding a second sensory pathway.

    Science.gov (United States)

    Bassler, B L; Wright, M; Silverman, M R

    1994-07-01

    Density-dependent expression of luminescence in Vibrio harveyi is regulated by the concentration of extracellular signal molecules (autoinducers) in the culture medium. One signal-response system is encoded by the luxL,M,N locus. The luxL and luxM genes are required for the production of an autoinducer (probably beta-hydroxybutyl homoserine lactone), and the luxN gene is required for the response to that autoinducer. Analysis of the phenotypes of LuxL,M and N mutants indicated that an additional signal-response system also controls density sensing. We report here the identification, cloning and analysis of luxP and luxQ, which encode functions required for a second density-sensing system. Mutants with defects in luxP and luxQ are defective in response to a second autoinducer substance. LuxQ, like LuxN, is similar to members of the family of two-component, signal transduction proteins and contains both a histidine protein kinase and a response regulator domain. Analysis of signalling mutant phenotypes indicates that there are at least two separate signal-response pathways which converge to regulate expression of luminescence in V. harveyi.

  12. Ethical issues of perinatal human gene therapy.

    Science.gov (United States)

    Fletcher, J C; Richter, G

    1996-01-01

    This paper examines some key ethical issues raised by trials of human gene therapy in the perinatal period--i.e., in infants, young children, and the human fetus. It describes five resources in ethics for researchers' considerations prior to such trials: (1) the history of ethical debate about gene therapy, (2) a literature on the relevance of major ethical principles for clinical research, (3) a body of widely accepted norms and practices, (4) knowledge of paradigm cases, and (5) researchers' own professional integrity. The paper also examines ethical concerns that must be met prior to any trial: benefits to and safety of subjects, informed assent of children and informed parental permission, informed consent of pregnant women in fetal gene therapy, protection of privacy, and concerns about fairness in the selection of subjects. The paper criticizes the position that cases of fetal gene therapy should be restricted only to those where the pregnant woman has explicitly refused abortion. Additional topics include concerns about genetic enhancement and germ-line gene therapy.

  13. Expression of the rgMT gene, encoding for a rice metallothionein ...

    Indian Academy of Sciences (India)

    the rice rgMT gene in transgenic yeast and Arabidopsis is implicated in improving their tolerance for .... possible by the use of a microscope with UV optics that ... Abiotic stress factors that induced the expression of the ..... Arabidopsis mutant.

  14. Cloning and expression of gene encoding P23 protein from Cryptosporidium parvum

    Directory of Open Access Journals (Sweden)

    Dinh Thi Bich Lan

    2014-12-01

    Full Text Available We cloned the cp23 gene coding P23 (glycoprotein from Cryptosporidium parvum isolated from Thua Thien Hue province, Vietnam. The coding region of cp23 gene from C. parvum is 99% similar with cp23 gene deposited in NCBI (accession number: U34390. SDS-PAGE and Western blot analysis showed that the cp23 gene in E. coli BL21 StarTM (DE3 produced polypeptides with molecular weights of approximately 37, 40 and 49 kDa. These molecules may be non-glycosylated or glycosylated P23 fusion polypeptides. Recombinant P23 protein purified by GST (glutathione S-transferase affinity chromatography can be used as an antigen for C. parvum antibody production as well as to develop diagnostic kit for C. parvum.

  15. Molecular cloning and expression of gene encoding aromatic amino acid decarboxylase in 'Vidal blanc' grape berries.

    Science.gov (United States)

    Pan, Qiu-Hong; Chen, Fang; Zhu, Bao-Qing; Ma, Li-Yan; Li, Li; Li, Jing-Ming

    2012-04-01

    The pleasantly fruity and floral 2-phenylethanol are a dominant aroma compound in post-ripening 'Vidal blanc' grapes. However, to date little has been reported about its synthetic pathway in grapevine. In the present study, a full-length cDNA of VvAADC (encoding aromatic amino acid decarboxylase) was firstly cloned from the berries of 'Vidal blanc', an interspecific hybrid variety of Vitis vinifera × Vitis riparia. This sequence encodes a complete open reading frame of 482 amino acids with a calculated molecular mass of 54 kDa and isoelectric point value (pI) of 5.73. The amino acid sequence deduced shared about 79% identity with that of aromatic L: -amino acid decarboxylases (AADCs) from tomato. Real-time PCR analysis indicated that VvAADC transcript abundance presented a small peak at 110 days after full bloom and then a continuous increase at the berry post-ripening stage, which was consistent with the accumulation of 2-phenylethanol, but did not correspond to the trends of two potential intermediates, phenethylamine and 2-phenylacetaldehyde. Furthermore, phenylalanine still exhibited a continuous increase even in post-ripening period. It is thus suggested that 2-phenylethanol biosynthetic pathway mediated by AADC exists in grape berries, but it has possibly little contribution to a considerable accumulation of 2-phenylethanol in post-ripening 'Vidal blanc' grapes.

  16. The Riemerella anatipestifer AS87_01735 Gene Encodes Nicotinamidase PncA, an Important Virulence Factor.

    Science.gov (United States)

    Wang, Xiaolan; Liu, Beibei; Dou, Yafeng; Fan, Hongjie; Wang, Shaohui; Li, Tao; Ding, Chan; Yu, Shengqing

    2016-10-01

    Riemerella anatipestifer is a major bacterial pathogen that causes septicemic and exudative diseases in domestic ducks. In our previous study, we found that deletion of the AS87_01735 gene significantly decreased the bacterial virulence of R. anatipestifer strain Yb2 (mutant RA625). The AS87_01735 gene was predicted to encode a nicotinamidase (PncA), a key enzyme that catalyzes the conversion of nicotinamide to nicotinic acid, which is an important reaction in the NAD(+) salvage pathway. In this study, the AS87_01735 gene was expressed and identified as the PncA-encoding gene, using an enzymatic assay. Western blot analysis demonstrated that R. anatipestifer PncA was localized to the cytoplasm. The mutant strain RA625 (named Yb2ΔpncA in this study) showed a similar growth rate but decreased NAD(+) quantities in both the exponential and stationary phases in tryptic soy broth culture, compared with the wild-type strain Yb2. In addition, Yb2ΔpncA-infected ducks showed much lower bacterial loads in their blood, and no visible histological changes were observed in the heart, liver, and spleen. Furthermore, Yb2ΔpncA immunization of ducks conferred effective protection against challenge with the virulent wild-type strain Yb2. Our results suggest that the R. anatipestifer AS87_01735 gene encodes PncA, which is an important virulence factor, and that the Yb2ΔpncA mutant can be used as a novel live vaccine candidate. Riemerella anatipestifer is reported worldwide as a cause of septicemic and exudative diseases of domestic ducks. The pncA gene encodes a nicotinamidase (PncA), a key enzyme that catalyzes the conversion of nicotinamide to nicotinic acid, which is an important reaction in the NAD(+) salvage pathway. In this study, we identified and characterized the pncA-homologous gene AS87_01735 in R. anatipestifer strain Yb2. R. anatipestifer PncA is a cytoplasmic protein that possesses similar PncA activity, compared with other organisms. Generation of the pncA mutant Yb

  17. Isolation and expression analysis of FTZ-F1 encoding gene of black rock fish ( Sebastes schlegelii)

    Science.gov (United States)

    Shafi, Muhammad; Wang, Yanan; Zhou, Xiaosu; Ma, Liman; Muhammad, Faiz; Qi, Jie; Zhang, Quanqi

    2013-03-01

    Sex related FTZ-F1 is a transcriptional factor regulating the expression of fushi tarazu (a member of the orphan nuclear receptors) gene. In this study, FTZ-F1 gene ( FTZ-F1) was isolated from the testis of black rockfish ( Sebastes schlegeli) by homology cloning. The full-length cDNA of S. schlegeli FTZ-F1 ( ssFTZ-F1) contained a 232bp 5' UTR, a 1449bp ORF encoding FTZ-F1 (482 amino acid residules in length) with an estimated molecular weight of 5.4kD and a 105bp 3' UTR. Sequence, tissue distribution and phylogenic analysis showed that ssFTZ-F1 belonged to FTZ group, holding highly conserved regions including I, II and III FTZ-F1 boxes and an AF-2 hexamer. Relatively high expression was observed at different larva stages. In juveniles (105 days old), the transcript of ssFTZ-F1 can be detected in all tissues and the abuncance of the gene transcript in testis, ovary, spleen and brain was higher than that in other tissues. In mature fish, the abundance of gene transcript was higher in testis, ovary, spleen and brain than that in liver (trace amount), and the gene was not transcribed in other tissues. The highest abundance of gene transcript was always observed in gonads of both juvenile and mature fish. In addition, the abundance of gene transcript in male tissues were higher than that in female tissue counterparts ( P<0.05).

  18. Characterization and Heterologous Expression of the Genes Encoding Enterocin A Production, Immunity, and Regulation in Enterococcus faecium DPC1146

    Science.gov (United States)

    O’Keeffe, Triona; Hill, Colin; Ross, R. Paul

    1999-01-01

    Enterocin A is a small, heat-stable, antilisterial bacteriocin produced by Enterococcus faecium DPC1146. The sequence of a 10,879-bp chromosomal region containing at least 12 open reading frames (ORFs), 7 of which are predicted to play a role in enterocin biosynthesis, is presented. The genes entA, entI, and entF encode the enterocin A prepeptide, the putative immunity protein, and the induction factor prepeptide, respectively. The deduced proteins EntK and EntR resemble the histidine kinase and response regulator proteins of two-component signal transducing systems of the AgrC-AgrA type. The predicted proteins EntT and EntD are homologous to ABC (ATP-binding cassette) transporters and accessory factors, respectively, of several other bacteriocin systems and to proteins implicated in the signal-sequence-independent export of Escherichia coli hemolysin A. Immediately downstream of the entT and entD genes are two ORFs, the product of one of which, ORF4, is very similar to the product of the yteI gene of Bacillus subtilis and to E. coli protease IV, a signal peptide peptidase known to be involved in outer membrane lipoprotein export. Another potential bacteriocin is encoded in the opposite direction to the other genes in the enterocin cluster. This putative bacteriocin-like peptide is similar to LafX, one of the components of the lactacin F complex. A deletion which included one of two direct repeats upstream of the entA gene abolished enterocin A activity, immunity, and ability to induce bacteriocin production. Transposon insertion upstream of the entF gene also had the same effect, but this mutant could be complemented by exogenously supplied induction factor. The putative EntI peptide was shown to be involved in the immunity to enterocin A. Cloning of a 10.5-kb amplicon comprising all predicted ORFs and regulatory regions resulted in heterologous production of enterocin A and induction factor in Enterococcus faecalis, while a four-gene construct (entAITD) under the

  19. Bioinformatics and phylogenetic analysis of human Tp73 gene ...

    African Journals Online (AJOL)

    The Tp73 gene encoding p73 protein belongs to the Tp53 gene family and it functions in the initiation of cell-cycle arrest or apoptosis and also involves in regulating a series of pathways including breast cancer, neuroblastoma and cholorectal cancer. New discoveries about the control and function of p73 are still in progress ...

  20. Cloning and sequencing of a gene encoding a 21-kilodalton outer membrane protein from Bordetella avium and expression of the gene in Salmonella typhimurium.

    Science.gov (United States)

    Gentry-Weeks, C R; Hultsch, A L; Kelly, S M; Keith, J M; Curtiss, R

    1992-01-01

    Three gene libraries of Bordetella avium 197 DNA were prepared in Escherichia coli LE392 by using the cosmid vectors pCP13 and pYA2329, a derivative of pCP13 specifying spectinomycin resistance. The cosmid libraries were screened with convalescent-phase anti-B. avium turkey sera and polyclonal rabbit antisera against B. avium 197 outer membrane proteins. One E. coli recombinant clone produced a 56-kDa protein which reacted with convalescent-phase serum from a turkey infected with B. avium 197. In addition, five E. coli recombinant clones were identified which produced B. avium outer membrane proteins with molecular masses of 21, 38, 40, 43, and 48 kDa. At least one of these E. coli clones, which encoded the 21-kDa protein, reacted with both convalescent-phase turkey sera and antibody against B. avium 197 outer membrane proteins. The gene for the 21-kDa outer membrane protein was localized by Tn5seq1 mutagenesis, and the nucleotide sequence was determined by dideoxy sequencing. DNA sequence analysis of the 21-kDa protein revealed an open reading frame of 582 bases that resulted in a predicted protein of 194 amino acids. Comparison of the predicted amino acid sequence of the gene encoding the 21-kDa outer membrane protein with protein sequences in the National Biomedical Research Foundation protein sequence data base indicated significant homology to the OmpA proteins of Shigella dysenteriae, Enterobacter aerogenes, E. coli, and Salmonella typhimurium and to Neisseria gonorrhoeae outer membrane protein III, Haemophilus influenzae protein P6, and Pseudomonas aeruginosa porin protein F. The gene (ompA) encoding the B. avium 21-kDa protein hybridized with 4.1-kb DNA fragments from EcoRI-digested, chromosomal DNA of Bordetella pertussis and Bordetella bronchiseptica and with 6.0- and 3.2-kb DNA fragments from EcoRI-digested, chromosomal DNA of B. avium and B. avium-like DNA, respectively. A 6.75-kb DNA fragment encoding the B. avium 21-kDa protein was subcloned into the

  1. Identification of a novel gene family that includes the interferon-inducible human genes 6–16 and ISG12

    Directory of Open Access Journals (Sweden)

    Parker Nadeene

    2004-01-01

    Full Text Available Abstract Background The human 6–16 and ISG12 genes are transcriptionally upregulated in a variety of cell types in response to type I interferon (IFN. The predicted products of these genes are small (12.9 and 11.5 kDa respectively, hydrophobic proteins that share 36% overall amino acid identity. Gene disruption and over-expression studies have so far failed to reveal any biochemical or cellular roles for these proteins. Results We have used in silico analyses to identify a novel family of genes (the ISG12 gene family related to both the human 6–16 and ISG12 genes. Each ISG12 family member codes for a small hydrophobic protein containing a conserved ~80 amino-acid motif (the ISG12 motif. So far we have detected 46 family members in 25 organisms, ranging from unicellular eukaryotes to humans. Humans have four ISG12 genes: the 6–16 gene at chromosome 1p35 and three genes (ISG12(a, ISG12(b and ISG12(c clustered at chromosome 14q32. Mice have three family members (ISG12(a, ISG12(b1 and ISG12(b2 clustered at chromosome 12F1 (syntenic with human chromosome 14q32. There does not appear to be a murine 6–16 gene. On the basis of phylogenetic analyses, genomic organisation and intron-alignments we suggest that this family has arisen through divergent inter- and intra-chromosomal gene duplication events. The transcripts from human and mouse genes are detectable, all but two (human ISG12(b and ISG12(c being upregulated in response to type I IFN in the cell lines tested. Conclusions Members of the eukaryotic ISG12 gene family encode a small hydrophobic protein with at least one copy of a newly defined motif of ~80 amino-acids (the ISG12 motif. In higher eukaryotes, many of the genes have acquired a responsiveness to type I IFN during evolution suggesting that a role in resisting cellular or environmental stress may be a unifying property of all family members. Analysis of gene-function in higher eukaryotes is complicated by the possibility of

  2. Analysis of the CYP51 gene and encoded protein in propiconazole-resistant isolates of Mycosphaerella fijiensis.

    Science.gov (United States)

    Cañas-Gutiérrez, Gloria P; Angarita-Velásquez, Mónica J; Restrepo-Flórez, Juan M; Rodríguez, Paola; Moreno, Claudia X; Arango, Rafael

    2009-08-01

    Mycosphaerella fijiensis Morelet causes black sigatoka, the most important disease in bananas and plantains. Disease control is mainly through the application of systemic fungicides, including sterol demethylation inhibitors (DMIs). Their intensive use has favoured the appearance of resistant strains. However, no studies have been published on the possible resistance mechanisms. In this work, the CYP51 gene was isolated and sequenced in 11 M. fijiensis strains that had shown different degrees of in vitro sensitivity to propiconazole, one of the most widely used DMI fungicides. Six mutations that could be related to the loss in sensitivity to this fungicide were found: Y136F, A313G, Y461D, Y463D, Y463H and Y463N. The mutations were analysed using a homology model of the protein that was constructed from the crystallographic structure of Mycobacterium tuberculosis (Zoff.) Lehmann & Neumann. Additionally, gene expression was determined in 13 M. fijiensis strains through quantitative analysis of products obtained by RT-PCR. Several changes in the sequence of the gene encoding sterol 14alpha-demethylase were found that have been described in other fungi as being correlated with resistance to azole fungicides. No correlation was found between gene expression and propiconazole resistance.

  3. Selective elimination of high constitutive activity or chemokine binding in the human herpesvirus 8 encoded seven transmembrane oncogene ORF74

    DEFF Research Database (Denmark)

    Rosenkilde, M M; Kledal, T N; Holst, Peter Johannes

    2000-01-01

    Open reading frame 74 (ORF74) encoded by human herpesvirus 8 is a highly constitutively active seven transmembrane (7TM) receptor stimulated by angiogenic chemokines, e.g. growth-related oncogene-alpha, and inhibited by angiostatic chemokines e.g. interferon-gamma-inducible protein. Transgenic mice...

  4. Identification and analysis of functional elements in 1% of the human genome by the ENCODE pilot project

    DEFF Research Database (Denmark)

    Birney, Ewan; Stamatoyannopoulos, John A; Dutta, Anindya

    2007-01-01

    We report the generation and analysis of functional data from multiple, diverse experiments performed on a targeted 1% of the human genome as part of the pilot phase of the ENCODE Project. These data have been further integrated and augmented by a number of evolutionary and computational analyses...

  5. Complementation of the amylose-free starch mutant of potato (Solanum tuberosum.) by the gene encoding granule-bound starch synthase

    NARCIS (Netherlands)

    van der Leij, E.R.; Visser, R.G.E.; OOSTERHAVEN, K; VANDERKOP, DAM; Jacobsen, E.; Feenstra, W.

    1991-01-01

    Agrobacterium rhizogenes-mediated introduction of the wild-type allele of the gene encoding granule-bound starch synthase (GBSS) into the amylose-free starch mutant amf of potato leads to restoration of GBSS activity and amylose synthesis, which demonstrates that Amf is the structural gene for GBSS.

  6. Molecular cloning and characterization of two novel genes from hexaploid wheat that encode double PR-1 domains coupled with a receptor-like protein kinase

    Science.gov (United States)

    Hexaploid wheat (Triticum aestivum L.) contains at least 23 TaPr-1 genes encoding the group 1 pathogenesis-related (PR-1) proteins as identified in our previous work. Here we report the cloning and characterization of TaPr-1-rk1 and TaPr-1-rk2, two novel genes closely related to the wheat PR-1 famil...

  7. Cloning and Expression Analysis of MEP Pathway Enzyme-encoding Genes in Osmanthus fragrans

    Directory of Open Access Journals (Sweden)

    Chen Xu

    2016-09-01

    Full Text Available The 2-C-methyl-d-erythritol 4-phosphate (MEP pathway is responsible for the biosynthesis of many crucial secondary metabolites, such as carotenoids, monoterpenes, plastoquinone, and tocopherols. In this study, we isolated and identified 10 MEP pathway genes in the important aromatic plant sweet osmanthus (Osmanthus fragrans. Multiple sequence alignments revealed that 10 MEP pathway genes shared high identities with other reported proteins. The genes showed distinctive expression profiles in various tissues, or at different flower stages and diel time points. The qRT-PCR results demonstrated that these genes were highly expressed in inflorescences, which suggested a tissue-specific transcript pattern. Our results also showed that OfDXS1, OfDXS2, and OfHDR1 had a clear diurnal oscillation pattern. The isolation and expression analysis provides a strong foundation for further research on the MEP pathway involved in gene function and molecular evolution, and improves our understanding of the molecular mechanism underlying this pathway in plants.

  8. The oil palm Shell gene controls oil yield and encodes a homologue of SEEDSTICK

    Science.gov (United States)

    Singh, Rajinder; Leslie Low, Eng-Ti; Ooi, Leslie Cheng-Li; Ong-Abdullah, Meilina; Chin, Ting Ngoot; Nagappan, Jayanthi; Nookiah, Rajanaidu; Amiruddin, Mohd Din; Rosli, Rozana; Abdul Manaf, Mohamad Arif; Chan, Kuang-Lim; Halim, Mohd Amin; Azizi, Norazah; Lakey, Nathan; Smith, Steven W; Budiman, Muhammad A; Hogan, Michael; Bacher, Blaire; Van Brunt, Andrew; Wang, Chunyan; Ordway, Jared M; Sambanthamurthi, Ravigadevi; Martienssen, Robert A

    2014-01-01

    A key event in the domestication and breeding of the oil palm, Elaeis guineensis, was loss of the thick coconut-like shell surrounding the kernel. Modern E. guineensis has three fruit forms, dura (thick-shelled), pisifera (shell-less) and tenera (thin-shelled), a hybrid between dura and pisifera1–4. The pisifera palm is usually female-sterile but the tenera yields far more oil than dura, and is the basis for commercial palm oil production in all of Southeast Asia5. Here, we describe the mapping and identification of the Shell gene responsible for the different fruit forms. Using homozygosity mapping by sequencing we found two independent mutations in the DNA binding domain of a homologue of the MADS-box gene SEEDSTICK (STK) which controls ovule identity and seed development in Arabidopsis. The Shell gene is responsible for the tenera phenotype in both cultivated and wild palms from sub-Saharan Africa, and our findings provide a genetic explanation for the single gene heterosis attributed to Shell, via heterodimerization. This gene mutation explains the single most important economic trait in oil palm, and has implications for the competing interests of global edible oil production, biofuels and rainforest conservation6. PMID:23883930

  9. Meta genome-wide network from functional linkages of genes in human gut microbial ecosystems.

    Science.gov (United States)

    Ji, Yan; Shi, Yixiang; Wang, Chuan; Dai, Jianliang; Li, Yixue

    2013-03-01

    The human gut microbial ecosystem (HGME) exerts an important influence on the human health. In recent researches, meta-genomics provided deep insights into the HGME in terms of gene contents, metabolic processes and genome constitutions of meta-genome. Here we present a novel methodology to investigate the HGME on the basis of a set of functionally coupled genes regardless of their genome origins when considering the co-evolution properties of genes. By analyzing these coupled genes, we showed some basic properties of HGME significantly associated with each other, and further constructed a protein interaction map of human gut meta-genome to discover some functional modules that may relate with essential metabolic processes. Compared with other studies, our method provides a new idea to extract basic function elements from meta-genome systems and investigate complex microbial environment by associating its biological traits with co-evolutionary fingerprints encoded in it.

  10. Expression of the human growth hormone variant gene in cultured fibroblasts and transgenic mice

    International Nuclear Information System (INIS)

    Selden, R.F.; Wagner, T.E.; Blethen, S.; Yun, J.S.; Rowe, M.E.; Goodman, H.M.

    1988-01-01

    The nucleotide sequence of the human growth hormone variant gene, one of the five members of the growth hormone gene family, predicts that it encodes a growth hormone-like protein. As a first step in determining whether this gene is functional in humans, the authors have expressed a mouse methallothionein I/human growth hormone variant fusion gene in mouse L cells and in transgenic mice. The growth hormone variant protein expressed in transiently transfected L cells is distinct from growth hormone itself with respect to reactivity with anti-growth hormone monoclonal antibodies, behavior during column chromatography, and isoelectric point. Transgenic mice expressing the growth hormone variant protein are 1.4- to 1.9-fold larger than nontransgenic controls, suggesting that the protein has growth-promoting properties

  11. Mutations in genes encoding condensin complex proteins cause microcephaly through decatenation failure at mitosis.

    Science.gov (United States)

    Martin, Carol-Anne; Murray, Jennie E; Carroll, Paula; Leitch, Andrea; Mackenzie, Karen J; Halachev, Mihail; Fetit, Ahmed E; Keith, Charlotte; Bicknell, Louise S; Fluteau, Adeline; Gautier, Philippe; Hall, Emma A; Joss, Shelagh; Soares, Gabriela; Silva, João; Bober, Michael B; Duker, Angela; Wise, Carol A; Quigley, Alan J; Phadke, Shubha R; Wood, Andrew J; Vagnarelli, Paola; Jackson, Andrew P

    2016-10-01

    Compaction of chromosomes is essential for accurate segregation of the genome during mitosis. In vertebrates, two condensin complexes ensure timely chromosome condensation, sister chromatid disentanglement, and maintenance of mitotic chromosome structure. Here, we report that biallelic mutations in NCAPD2, NCAPH, or NCAPD3, encoding subunits of these complexes, cause microcephaly. In addition, hypomorphic Ncaph2 mice have significantly reduced brain size, with frequent anaphase chromatin bridge formation observed in apical neural progenitors during neurogenesis. Such DNA bridges also arise in condensin-deficient patient cells, where they are the consequence of failed sister chromatid disentanglement during chromosome compaction. This results in chromosome segregation errors, leading to micronucleus formation and increased aneuploidy in daughter cells. These findings establish "condensinopathies" as microcephalic disorders, with decatenation failure as an additional disease mechanism for microcephaly, implicating mitotic chromosome condensation as a key process ensuring mammalian cerebral cortex size. © 2016 Martin et al.; Published by Cold Spring Harbor Laboratory Press.

  12. Structure and function of the human metallothionein gene family: Final technical report

    International Nuclear Information System (INIS)

    Karin, M.

    1986-01-01

    The full nucleotide sequence of two additional human metallothionein (hMT) genes has been determined. These genes, hMT-I/sub B/ and hMT-I/sub F/, are located within the MT-I gene cluster we have described originally. The hMT-I/sub F/ gene is the first hMT-I gene whose amino acid sequence is in complete agreement with the published sequence of the human MT-I proteins. Therefore it is likely to be an active gene encoding a functional protein. However, since we have just completed the sequence analysis, we have not characterized this gene further yet. The hMT-I/sub B/ gene is closely linked to the hMT-I/sub A/ gene, and two pseudogenes, hMT-I/sub C/ and hMT-I/sub D/ separate the two. From its nucleotide sequence hMT-I/sub B/ seems to be an active gene, encoding a functional protein even though it differs in four positions from the published sequence of human MT-I proteins. This gene is expressed in a human hepatoma cell line, HepG2, and its expression is stimulated by Cd ++ . Using gene fusions to the viral thymidine-kinase gene we find that hMT-I/sub B/, like the hMT-I/sub A/ and hMT-II/sub A/ genes, contains a heavy metal responsive promoterregulatory element within its 5' flanking region. We analyzed the level of hMT-I/sub B/ mRNA in a variety of human cell lines by the S1 nuclease technique, and compared it to the expression of the hMT-II/sub A/ gene. While the hMT-II/sub A/ gene was expressed in all of the cell lines analyzed, the hMT-I/sub B/ gene was expressed in liver and kidney derived cell lines cells. This suggest that the expression of the hMT-I/sub B/ gene is controlled in a tissue specific manner. 13 refs

  13. Expression analysis of the Arabidopsis thaliana AtSpen2 gene, and its relationship with other plant genes encoding Spen proteins

    OpenAIRE

    Solís-Guzmán, María Gloria; Argüello-Astorga, Gerardo; López-Bucio, José; Ruiz-Herrera, León Francisco; López-Meza, Joel; Sánchez-Calderón, Lenin; Carreón-Abud, Yazmín; Martínez-Trujillo, Miguel

    2017-01-01

    Abstract Proteins of the Split ends (Spen) family are characterized by an N-terminal domain, with one or more RNA recognition motifs and a SPOC domain. In Arabidopsis thaliana, the Spen protein FPA is involved in the control of flowering time as a component of an autonomous pathway independent of photoperiod. The A. thaliana genome encodes another gene for a putative Spen protein at the locus At4g12640, herein named AtSpen2. Bioinformatics analysis of the AtSPEN2 SPOC domain revealed low sequ...

  14. Molecular characterization of a phloem-specific gene encoding the filament protein, phloem protein 1 (PP1), from Cucurbita maxima.

    Science.gov (United States)

    Clark, A M; Jacobsen, K R; Bostwick, D E; Dannenhoffer, J M; Skaggs, M I; Thompson, G A

    1997-07-01

    Sieve elements in the phloem of most angiosperms contain proteinaceous filaments and aggregates called P-protein. In the genus Cucurbita, these filaments are composed of two major proteins: PP1, the phloem filament protein, and PP2, the phloem lactin. The gene encoding the phloem filament protein in pumpkin (Cucurbita maxima Duch.) has been isolated and characterized. Nucleotide sequence analysis of the reconstructed gene gPP1 revealed a continuous 2430 bp protein coding sequence, with no introns, encoding an 809 amino acid polypeptide. The deduced polypeptide had characteristics of PP1 and contained a 15 amino acid sequence determined by N-terminal peptide sequence analysis of PP1. The sequence of PP1 was highly repetitive with four 200 amino acid sequence domains containing structural motifs in common with cysteine proteinase inhibitors. Expression of the PP1 gene was detected in roots, hypocotyls, cotyledons, stems, and leaves of pumpkin plants. PP1 and its mRNA accumulated in pumpkin hypocotyls during the period of rapid hypocotyl elongation after which mRNA levels declined, while protein levels remained elevated. PP1 was immunolocalized in slime plugs and P-protein bodies in sieve elements of the phloem. Occasionally, PP1 was detected in companion cells. PP1 mRNA was localized by in situ hybridization in companion cells at early stages of vascular differentiation. The developmental accumulation and localization of PP1 and its mRNA paralleled the phloem lactin, further suggesting an interaction between these phloem-specific proteins.

  15. Mutation of CDH23, encoding a new member of the cadherin gene family, causes Usher syndrome type 1D.

    Science.gov (United States)

    Bolz, H; von Brederlow, B; Ramírez, A; Bryda, E C; Kutsche, K; Nothwang, H G; Seeliger, M; del C-Salcedó Cabrera, M; Vila, M C; Molina, O P; Gal, A; Kubisch, C

    2001-01-01

    Usher syndrome type I (USH1) is an autosomal recessive disorder characterized by congenital sensorineural hearing loss, vestibular dysfunction and visual impairment due to early onset retinitis pigmentosa (RP). So far, six loci (USH1A-USH1F) have been mapped, but only two USH1 genes have been identified: MYO7A for USH1B and the gene encoding harmonin for USH1C. We identified a Cuban pedigree linked to the locus for Usher syndrome type 1D (MIM 601067) within the q2 region of chromosome 10). Affected individuals present with congenital deafness and a highly variable degree of retinal degeneration. Using a positional candidate approach, we identified a new member of the cadherin gene superfamily, CDH23. It encodes a protein of 3,354 amino acids with a single transmembrane domain and 27 cadherin repeats. In the Cuban family, we detected two different mutations: a severe course of the retinal disease was observed in individuals homozygous for what is probably a truncating splice-site mutation (c.4488G-->C), whereas mild RP is present in individuals carrying the homozygous missense mutation R1746Q. A variable expression of the retinal phenotype was seen in patients with a combination of both mutations. In addition, we identified two mutations, Delta M1281 and IVS51+5G-->A, in a German USH1 patient. Our data show that different mutations in CDH23 result in USH1D with a variable retinal phenotype. In an accompanying paper, it is shown that mutations in the mouse ortholog cause disorganization of inner ear stereocilia and deafness in the waltzer mouse.

  16. Time-reversed ultrasonically encoded optical focusing through highly scattering ex vivo human cataractous lenses

    Science.gov (United States)

    Liu, Yan; Shen, Yuecheng; Ruan, Haowen; Brodie, Frank L.; Wong, Terence T. W.; Yang, Changhuei; Wang, Lihong V.

    2018-01-01

    Normal development of the visual system in infants relies on clear images being projected onto the retina, which can be disrupted by lens opacity caused by congenital cataract. This disruption, if uncorrected in early life, results in amblyopia (permanently decreased vision even after removal of the cataract). Doctors are able to prevent amblyopia by removing the cataract during the first several weeks of life, but this surgery risks a host of complications, which can be equally visually disabling. Here, we investigated the feasibility of focusing light noninvasively through highly scattering cataractous lenses to stimulate the retina, thereby preventing amblyopia. This approach would allow the cataractous lens removal surgery to be delayed and hence greatly reduce the risk of complications from early surgery. Employing a wavefront shaping technique named time-reversed ultrasonically encoded optical focusing in reflection mode, we focused 532-nm light through a highly scattering ex vivo adult human cataractous lens. This work demonstrates a potential clinical application of wavefront shaping techniques.

  17. The Cremeomycin Biosynthetic Gene Cluster Encodes a Pathway for Diazo Formation.

    Science.gov (United States)

    Waldman, Abraham J; Pechersky, Yakov; Wang, Peng; Wang, Jennifer X; Balskus, Emily P

    2015-10-12

    Diazo groups are found in a range of natural products that possess potent biological activities. Despite longstanding interest in these metabolites, diazo group biosynthesis is not well understood, in part because of difficulties in identifying specific genes linked to diazo formation. Here we describe the discovery of the gene cluster that produces the o-diazoquinone natural product cremeomycin and its heterologous expression in Streptomyces lividans. We used stable isotope feeding experiments and in vitro characterization of biosynthetic enzymes to decipher the order of events in this pathway and establish that diazo construction involves late-stage N-N bond formation. This work represents the first successful production of a diazo-containing metabolite in a heterologous host, experimentally linking a set of genes with diazo formation. © 2015 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  18. Identifying the Viral Genes Encoding Envelope Glycoproteins for Differentiation of Cyprinid herpesvirus 3 Isolates

    Directory of Open Access Journals (Sweden)

    Se Chang Park

    2013-01-01

    Full Text Available Cyprinid herpes virus 3 (CyHV-3 diseases have been reported around the world and are associated with high mortalities of koi (Cyprinus carpio. Although little work has been conducted on the molecular analysis of this virus, glycoprotein genes identified in the present study seem to be valuable targets for genetic comparison of this virus. Three envelope glycoprotein genes (ORF25, 65 and 116 of the CyHV-3 isolates from the USA, Israel, Japan and Korea were compared, and interestingly, sequence insertions or deletions were observed in these target regions. In addition, polymorphisms were presented in microsatellite zones from two glycoprotein genes (ORF65 and 116. In phylogenetic tree analysis, the Korean isolate was remarkably distinguished from USA, Israel, Japan isolates. These findings may be suitable for many applications including isolates differentiation and phylogeny studies.

  19. Identifying the Viral Genes Encoding Envelope Glycoproteins for Differentiation of Cyprinid herpesvirus 3 Isolates

    Science.gov (United States)

    Han, Jee Eun; Kim, Ji Hyung; Renault, Tristan; Choresca, Casiano; Shin, Sang Phil; Jun, Jin Woo; Park, Se Chang

    2013-01-01

    Cyprinid herpes virus 3 (CyHV-3) diseases have been reported around the world and are associated with high mortalities of koi (Cyprinus carpio). Although little work has been conducted on the molecular analysis of this virus, glycoprotein genes identified in the present study seem to be valuable targets for genetic comparison of this virus. Three envelope glycoprotein genes (ORF25, 65 and 116) of the CyHV-3 isolates from the USA, Israel, Japan and Korea were compared, and interestingly, sequence insertions or deletions were observed in these target regions. In addition, polymorphisms were presented in microsatellite zones from two glycoprotein genes (ORF65 and 116). In phylogenetic tree analysis, the Korean isolate was remarkably distinguished from USA, Israel, Japan isolates. These findings may be suitable for many applications including isolates differentiation and phylogeny studies. PMID:23435236

  20. Population structuring of multi-copy, antigen-encoding genes in Plasmodium falciparum

    Science.gov (United States)

    Artzy-Randrup, Yael; Rorick, Mary M; Day, Karen; Chen, Donald; Dobson, Andrew P; Pascual, Mercedes

    2012-01-01

    The coexistence of multiple independently circulating strains in pathogen populations that undergo sexual recombination is a central question of epidemiology with profound implications for control. An agent-based model is developed that extends earlier ‘strain theory’ by addressing the var gene family of Plasmodium falciparum. The model explicitly considers the extensive diversity of multi-copy genes that undergo antigenic variation via sequential, mutually exclusive expression. It tracks the dynamics of all unique var repertoires in a population of hosts, and shows that even under high levels of sexual recombination, strain competition mediated through cross-immunity structures the parasite population into a subset of coexisting dominant repertoires of var genes whose degree of antigenic overlap depends on transmission intensity. Empirical comparison of patterns of genetic variation at antigenic and neutral sites supports this role for immune selection in structuring parasite diversity. DOI: http://dx.doi.org/10.7554/eLife.00093.001 PMID:23251784

  1. Evolution of the PWWP-domain encoding genes in the plant and animal lineages

    Directory of Open Access Journals (Sweden)

    Alvarez-Venegas Raúl

    2012-06-01

    status throughout evolution. In contrast, our data show that most of the multidomain PWWP combinations in extant multicellular organisms (humans or land plants are present in their unicellular ancestral relatives suggesting they have been transmitted through evolution as conserved linear arrangements (‘cassettes’. Among the most interesting biologically relevant results is the finding that the genes of the two plant Trithorax family subgroups (ATX1/2 and ATX3/4/5 have different phylogenetic origins. The two subgroups occur together in the earliest land plants Physcomitrella patens and Selaginella moellendorffii. Conclusion Gain/loss of a single PWWP domain is observed throughout evolution reflecting dynamic lineage- or species-specific events. In contrast, higher-level protein architectures involving the PWWP domain have survived as stable arrangements driven by evolutionary descent. The association of PWWP domains with the DNA methyltransferases in O. tauri and in the metazoan lineage seems to have occurred independently consistent with convergent evolution. Our results do not support models wherein more complex protein architectures involving the PWWP domain occur with the appearance of more evolutionarily advanced life forms.

  2. Transformation of pickling cucumber with chitinase-encoding genes using Agrobacterium tumefaciens.

    Science.gov (United States)

    Raharjo, S H; Hernandez, M O; Zhang, Y Y; Punja, Z K

    1996-04-01

    Transformation of cucumber cv. Endeavor was attempted using three Agrobacterium tumefaciens strains (a supervirulent leucinopine type, an octopine type and a nopaline type), each harbouring one of three binary vectors which contained an acidic chitinase gene from petunia, and basic chitinase genes from tobacco and bean, respectively, driven by the CaMV 35S promoter. Petiole explants were inoculated with a bacterial suspension (10(8) cells·ml(-1)), cocultivated for 48-96 h and placed on Murashige and Skoog (MS) medium with 5.0 μM each of 2,4-D and BA, 50 mg·l(-1) kanamycin and 500 mg·l(-1) carbenicillin. The frequency of embryogenic callus formation ranged from 0 to 12%, depending on strains/vectors used and length of cocultivation, with the highest being obtained using the leucinopine strain with petunia acidic chitinase gene. The kanamycin-resistant embryogenic calli were used to initiate suspension cultures (in liquid MS medium with 1.0/1.0 μM 2,4-D/BA, 50 mg·l(-1) kanamycin) for multiplication of embryogenic cell aggregates. Upon plating of cell aggregates onto solid MS medium with 1.0/1.0 μM NAA/BA and 50 mg·l(-1) kanamycin, calli continued to grow and later differentiated into plantlets. Transformation by the leucinopine strain and all three vectors was confirmed by PCR amplification of the NPT II gene in transgenic calli and plants, in addition to Southern analysis. Expression of the acidic chitinase gene (from petunia) and both basic chitinase genes (from tobacco and bean) in different transgenic cucumber lines was confirmed by Western analyses.

  3. Direction of movement is encoded in the human primary motor cortex.

    Directory of Open Access Journals (Sweden)

    Carolien M Toxopeus

    Full Text Available The present study investigated how direction of hand movement, which is a well-described parameter in cerebral organization of motor control, is incorporated in the somatotopic representation of the manual effector system in the human primary motor cortex (M1. Using functional magnetic resonance imaging (fMRI and a manual step-tracking task we found that activation patterns related to movement in different directions were spatially disjoint within the representation area of the hand on M1. Foci of activation related to specific movement directions were segregated within the M1 hand area; activation related to direction 0° (right was located most laterally/superficially, whereas directions 180° (left and 270° (down elicited activation more medially within the hand area. Activation related to direction 90° was located between the other directions. Moreover, by investigating differences between activations related to movement along the horizontal (0°+180° and vertical (90°+270° axis, we found that activation related to the horizontal axis was located more anterolaterally/dorsally in M1 than for the vertical axis, supporting that activations related to individual movement directions are direction- and not muscle related. Our results of spatially segregated direction-related activations in M1 are in accordance with findings of recent fMRI studies on neural encoding of direction in human M1. Our results thus provide further evidence for a direct link between direction as an organizational principle in sensorimotor transformation and movement execution coded by effector representations in M1.

  4. CD150 is a member of a family of genes that encode glycoproteins on the surface of hematopoietic cells.

    Science.gov (United States)

    Wang, N; Morra, M; Wu, C; Gullo, C; Howie, D; Coyle, T; Engel, P; Terhorst, C

    2001-07-01

    Human CD150 (SLAM) is a glycoprotein expressed on the surface of T, B, natural killer, and dendritic cells. The extracellular domain of CD150 is the receptor for measles virus and CD150 acts as a co-activator on T and B cells. We characterized the mouse and human CD150 genes, each of which comprises seven exons spanning approximately 32 kb. Mouse CD150 mRNA was detected in T cells and in most thymocyte subsets, except CD4-8- cells. Surprisingly, the CD4-8- thymocytes of CD3gammadeltanull mice, but not of Ragnull or severe combined immunodeficiency mice, expressed CD150. Whereas high levels of CD150 were found in Th1 cells, only small amounts were detectable in Th2 cells. CD150 expression was up-regulated upon in vitro activation of mouse T cells by anti-CD3. The complete mouse CD150 gene is highly homologous to its human orthologue in terms of nucleotide sequences and intron/exon organization. The human genomic sequences indicate that all isoforms detected so far have arisen from alternative splicing events. As judged by fluorescence in situ hybridization, mouse CD150 mapped to Chromosome (Chr) 1, band 1H2.2-2.3, and human CD150 was found on Chr 1q22. Human and mouse CD150 share sequence homologies with six other genes, five of which - CD84, CD229 (Ly-9), CD244 (2B4), CD48, and 19A - are localized in a 250-kb segment in close proximity to the human gene. Their location and their sequence similarities strongly suggest that the CD150 family of cell surface receptors arose via successive duplications of a common ancestral gene.

  5. Extensive changes in the expression of the opioid genes between humans and chimpanzees.

    Science.gov (United States)

    Cruz-Gordillo, Peter; Fedrigo, Olivier; Wray, Gregory A; Babbitt, Courtney C

    2010-01-01

    The various means by which the body perceives, transmits, and resolves the experiences of pain and nociception are mediated by a host of molecules, including neuropeptides within the opioid gene signaling pathway. The peptide ligands and receptors encoded by this group of genes have been linked to behavioral disorders as well as a number of psychiatric affective disorders. Our aim was to explore the recent evolutionary history of these two gene families by taking a comparative genomics approach, specifically through a comparison between humans and chimpanzees. Our analyses indicate differential expression of these genes between the two species, more than expected based on genome-wide comparisons, indicating that differential expression is pervasive among the opioid genes. Of the 8 family members, three genes showed significant expression differences (PENK, PNOC, and OPRL1), with two others marginally significant (OPRM1 and OPRD1). Accelerated substitution rates along human and chimpanzee lineages within the putative regulatory regions of OPRM1, POMC, and PDYN between the human and chimpanzee branches are consistent with positive selection. Collectively, these results suggest that there may have been a selective advantage to modulating the expression of the opioid genes in humans compared with our closest living relatives. Information about the cognitive roles mediated by these genes in humans may help to elucidate the trait consequences of these putatively adaptive expression changes. Copyright © 2010 S. Karger AG, Basel.

  6. Regulation of the alpha-glucuronidase-encoding gene (aguA) from Aspergillus niger

    NARCIS (Netherlands)

    Vries, de R.P.; Vondervoort, van de P.J.I.; Hendriks, L.; Belt, van de M.; Visser, J.

    2002-01-01

    The !-glucuronidase gene aguA from Aspergillus niger was cloned and characterised. Analysis of the promoter region of aguA revealed the presence of four putative binding sites for the major carbon catabolite repressor protein CREA and one putative binding site for the transcriptional activator XLNR.

  7. Human serum amyloid genes--molecular characterization

    International Nuclear Information System (INIS)

    Sack, G.H.; Lease, J.J.

    1986-01-01

    Three clones containing human genes for serum amyloid A protein (SAA) have been isolated and characterized. Each of two clones, GSAA 1 and 2 (of 12.8 and 15.9 kilobases, respectively), contains two exons, accouting for amino acids 12-58 and 58-103 of mature SAA; the extreme 5' termini and 5' untranslated regions have not yet been defined but are anticipated to be close based on studies of murine SAA genes. Initial amino acid sequence comparisons show 78/89 identical residues. At 4 of the 11 discrepant residues, the amino acid specified by the codon is the same as the corresponding residue in murine SAA. Identification of regions containing coding regions has permitted use of selected subclones for blot hybridization studies of larger human SAA chromosomal gene organization. The third clone, GSAA 3 also contains SAA coding information by DNA sequence analysis but has a different organization which has not yet been fully described. We have reported the isolation of clones of human DNA hybridizing with pRS48 - a plasmid containing a complementary DNA (cDNA) clone for murine serum amyloid A (SAA; 1, 2). We now present more detailed data confirming the identity and defining some of the organizational features of these clones

  8. 6-Desaturase-Like Encoding Gene Introduction in Catfish (Clarias gariepinus

    Directory of Open Access Journals (Sweden)

    Anny Hary Ayu

    2017-11-01

    Full Text Available African catfish (Clarias gariepinus is one of the economically valuable aquaculture fish species in Indonesia. This research was aimed to produce F0 transgenic catfish carrying masou salmon Δ6-desaturase-like (OmΔ6FAD gene. The Δ6-desaturase enzyme is involved in highly unsaturated fatty acid biosynthesis. Transgenic catfish was produced by sperm-mediated gene transfer using electroporation method. In this study, as the first step, sperms were electroporated with three different OmΔ6FAD concentration (25, 50, and 100 µg mL-1 to have the highest sperm viability after electroporation (125 V/cm, pulse frequency 5 times, pulse length 30 millisecond, pulse interval 0.1 second. The highest sperm viability and sperm carrying OmΔ6FAD were obtain at 100 µg mL-1. This concentration was then used to produce F0 transgenic catfish in the second step. Sperm motility, sperm viability, fertilization rate, hatching rate, and larval survival at 14 days after hatching were the same as the controls (p>0.05. Genomic DNA was extracted from caudal fin and then used as template to identify transgenic F0 by PCR method using specific primer for OmΔ6FAD gene. The PCR result showed that 53.84% of F0 carried OmΔ6FAD gene. The result of fatty acid analysis showed that EPA and DHA contents of F0 transgenic fish and non-transgenic fish were similar.   Keywords: catfish, Δ6-desaturase-like gene, fatty acids, electroporation

  9. Dissemination of plasmid-encoded AmpC β-lactamases in antimicrobial resistant Salmonella serotypes originating from humans, pigs and the swine environment.

    Science.gov (United States)

    Keelara, Shivaramu; Thakur, Siddhartha

    2014-09-17

    The aim of this study was to characterize and determine the inter-serovar exchange of AmpC β-lactamase conferring plasmids isolated from humans, pigs and the swine environment. Plasmids isolated from a total of 21 antimicrobial resistant (AMR) Salmonella isolates representing human clinical cases (n=6), pigs (n=6) and the swine farm environment (n=9) were characterized by replicon typing and restriction digestion, inter-serovar transferability by conjugation, and presence of AmpC β-lactamase enzyme encoding gene blaCMY-2 by southern hybridization. Based on replicon typing, the majority (17/21, 81%) of the plasmids belonged to the I1-Iγ Inc group and were between 70 and 103kb. The potential for inter-serovar plasmid transfer was further confirmed by the PCR detection of AMR genes on the plasmids isolated from trans-conjugants. Plasmids from Salmonella serovars Anatum, Ouakam, Johannesburg and Typhimurium isolated from the same cohort of pigs and their environment and S. Heidelberg from a single human clinical isolate had identical plasmids based on digestion with multiple restriction enzymes (EcoRI, HindIII and PstI) and southern blotting. We demonstrated likely horizontal inter-serovar exchange of plasmid-encoding AmpC β-lactamases resistance among MDR Salmonella serotypes isolated from pigs, swine farm environment and clinical human cases. This study provides valuable information on the role of the swine farm environment and by extension other livestock farm environments, as a potential reservoir of resistant bacterial strains that potentially transmit resistance determinants to livestock, in this case, swine, humans and possibly other hosts by horizontal exchange of plasmids. Copyright © 2014 Elsevier B.V. All rights reserved.

  10. GATM, the human ortholog of the mouse imprinted Gatm gene, escapes genomic imprinting in placenta

    Directory of Open Access Journals (Sweden)

    Toshinobu Miyamoto

    2005-03-01

    Full Text Available The GATM gene encodes L-arginine:glycine amidinotransferase, which catalyzes the conversion of L-arginine into guanidinoacetate, the rate-limiting step in the synthesis of creatine. Since, deficiencies in creatine synthesis and transport lead to certain forms of mental retardation in human, the human GATM gene appears to be involved in brain development. Recently it has been demonstrated that the mouse Gatm is expressed during development and is imprinted with maternal expression in the placenta and yolk sac, but not in embryonic tissues. We investigated the imprinting status of the human GATM by analyzing its expression in four human placentas. GATM was biallelically expressed, thus suggesting that this gene escapes genomic imprinting in placentas, differently from what has been reported in mouse extra-embryonic tissues.

  11. Two human homeobox genes, c1 and c8: structure analysis and expression in embryonic development

    International Nuclear Information System (INIS)

    Simeone, A.; Mavilio, F.; Acampora, D.

    1987-01-01

    Two human cDNA clones (HHO.c1.95 and HHO.c8.5111) containing a homeobox region have been characterized, and the respective genomic regions have been partially analyzed. Expression of the corresponding genes, termed c1 and c8, was evaluated in different organs and body parts during human embryonic/fetal development. HHO.c1.95 apparently encodes a 217-amino acid protein containing a class I homeodomain that shares 60 out of 61 amino acid residues with the Antennapedia homeodomain of Drosophila melanogaster. HHO.c8.5111 encodes a 153-amino acid protein containing a homeodomains identical to that of the frog AC1 gene. Clones HHO.c1 and HHO.c8 detect by blot-hybridization one and two specific polyadenylylated transcripts, respectively. These are differentially expressed in spinal cord, backbone rudiments, limb buds (or limbs), heart, and skin of human embryos and early fetuses in the 5- to 9-week postfertilization period, thus suggesting that the c1 and c8 genes play a key role in a variety of developmental processes. Together, the results of the embryonic/fetal expression of c1 and c8 and those of two previously analyzed genes (c10 and c13) indicate a coherent pattern of expression of these genes in early human ontogeny

  12. Two human homeobox genes, c1 and c8: structure analysis and expression in embryonic development.

    Science.gov (United States)

    Simeone, A; Mavilio, F; Acampora, D; Giampaolo, A; Faiella, A; Zappavigna, V; D'Esposito, M; Pannese, M; Russo, G; Boncinelli, E

    1987-07-01

    Two human cDNA clones (HHO.c1.95 and HHO.c8.5111) containing a homeobox region have been characterized, and the respective genomic regions have been partially analyzed. Expression of the corresponding genes, termed c1 and c8, was evaluated in different organs and body parts during human embryonic/fetal development. HHO.c1.95 apparently encodes a 217-amino acid protein containing a class I homeodomain that shares 60 out of 61 amino acid residues with the Antennapedia homeodomain of Drosophila melanogaster. HHO.c8.5111 encodes a 153-amino acid protein containing a homeodomain identical to that of the frog AC1 gene. Clones HHO.c1 and HHO.c8 detect by blot-hydridization one and two specific polyadenylylated transcripts, respectively. These are differentially expressed in spinal cord, backbone rudiments, limb buds (or limbs), heart, and skin of human embryos and early fetuses in the 5- to 9-week postfertilization period, thus suggesting that the c1 and c8 genes play a key role in a variety of developmental processes. Together, the results of the embryonic/fetal expression of c1 and c8 and those of two previously analyzed genes (c10 and c13) indicate a coherent pattern of expression of these genes in early human ontogeny.

  13. Differences in virulence genes and genome patterns of mastitis-associated Staphylococcus aureus among goat, cow, and human isolates in Taiwan.

    Science.gov (United States)

    Chu, Chishih; Wei, Yajiun; Chuang, Shih-Te; Yu, Changyou; Changchien, Chih-Hsuan; Su, Yaochi

    2013-03-01

    A total of 117 mastitis-associated Staphylococcus aureus isolates from cow, goat, and human patients were analyzed for differences in antibiotic susceptibility, virulence genes, and genotypes using accessory gene regulator (agr) typing, pulsed-field gel electrophoresis (PFGE) and multilocus sequence typing (MLST). Multidrug-resistant (MDR) S. aureus were commonly found in all sources, though they were predominantly found in human and goat isolates. Almost 70% of the isolates were resistant to ampicillin and penicillin. Host-associated virulence genes were identified as follows: tst, a gene encoding toxic shock syndrome toxin, was found in goat isolates; lukED and lukM, genes encoding leukocidin, found in cow isolates; lukPV, a gene encoding leukocidin, found in human isolates; and eta, a gene encoding for exfoliative toxin, found in both human and cow isolates. All four types of hemolysin, α, β, γ, and δ, were identified in human isolates, three types (α, γ, and δ), were identified in cow isolates, and two types (α and δ) were identified in goat isolates. Agr-typing determined agr1 to be the main subtype in human and cow isolates. PFGE and MLST analysis revealed the presence of diverse genotypes among the three sources. In conclusion, mastitis-associated, genetically diverse strains of MDR S. aureus differed in virulence genes among human, cow, and goat isolates.

  14. Combinational deletion of three membrane protein-encoding genes highly attenuates yersinia pestis while retaining immunogenicity in a mouse model of pneumonic plague.

    Science.gov (United States)

    Tiner, Bethany L; Sha, Jian; Kirtley, Michelle L; Erova, Tatiana E; Popov, Vsevolod L; Baze, Wallace B; van Lier, Christina J; Ponnusamy, Duraisamy; Andersson, Jourdan A; Motin, Vladimir L; Chauhan, Sadhana; Chopra, Ashok K

    2015-04-01

    Previously, we showed that deletion of genes encoding Braun lipoprotein (Lpp) and MsbB attenuated Yersinia pestis CO92 in mouse and rat models of bubonic and pneumonic plague. While Lpp activates Toll-like receptor 2, the MsbB acyltransferase modifies lipopolysaccharide. Here, we deleted the ail gene (encoding the attachment-invasion locus) from wild-type (WT) strain CO92 or its lpp single and Δlpp ΔmsbB double mutants. While the Δail single mutant was minimally attenuated compared to the WT bacterium in a mouse model of pneumonic plague, the Δlpp Δail double mutant and the Δlpp ΔmsbB Δail triple mutant were increasingly attenuated, with the latter being unable to kill mice at a 50% lethal dose (LD50) equivalent to 6,800 LD50s of WT CO92. The mutant-infected animals developed balanced TH1- and TH2-based immune responses based on antibody isotyping. The triple mutant was cleared from mouse organs rapidly, with concurrent decreases in the production of various cytokines and histopathological lesions. When surviving anima