
Sample records for human foreskin keratinocytes

  1. Immortalization of human foreskin keratinocytes by various human papillomavirus DNAs corresponds to their association with cervical carcinoma

    Energy Technology Data Exchange (ETDEWEB)

    Woodworth, C.D.; Doniger, J.; DiPaolo, J.A.


    Normal human foreskin keratinocytes cotransfected with the neomycin resistance gene and recombinant human papillomavirus (HPV) DNAs (types 16, 18, 31, and 33) that have a high or moderate association with cervical malignancy acquired immortality and contained integrated and transcriptionally active viral genomes. Only transcripts from the intact E6 and E7 genes were detected in at least one cell line, suggesting that one or both of these genes are responsible for immortalization. Recombinant HPV DNAs with low or no oncogenic potential for cervical cancer (HPV1a, -5, -6b, and -11) induced small G418-resistant colonies that senesced as did the nontransfected cells. These colonies contained only episomal virus DNA; therefore, integration of HPV sequences is important for immortalization of keratinocytes. This study suggests that the virus-encoded immortalization function contributes to the pathogenesis of cervical carcinoma.

  2. PCB153 reduces telomerase activity and telomere length in immortalized human skin keratinocytes (HaCaT) but not in human foreskin keratinocytes (NFK)

    Energy Technology Data Exchange (ETDEWEB)

    Senthilkumar, P.K. [Interdisciplinary Graduate Program in Human Toxicology, The University of Iowa, Iowa City, IA (United States); Robertson, L.W. [Interdisciplinary Graduate Program in Human Toxicology, The University of Iowa, Iowa City, IA (United States); Department of Occupational and Environmental Health, The University of Iowa, Iowa City, IA (United States); Ludewig, G., E-mail: [Interdisciplinary Graduate Program in Human Toxicology, The University of Iowa, Iowa City, IA (United States); Department of Occupational and Environmental Health, The University of Iowa, Iowa City, IA (United States)


    Polychlorinated biphenyls (PCBs), ubiquitous environmental pollutants, are characterized by long term-persistence in the environment, bioaccumulation, and biomagnification in the food chain. Exposure to PCBs may cause various diseases, affecting many cellular processes. Deregulation of the telomerase and the telomere complex leads to several biological disorders. We investigated the hypothesis that PCB153 modulates telomerase activity, telomeres and reactive oxygen species resulting in the deregulation of cell growth. Exponentially growing immortal human skin keratinocytes (HaCaT) and normal human foreskin keratinocytes (NFK) were incubated with PCB153 for 48 and 24 days, respectively, and telomerase activity, telomere length, superoxide level, cell growth, and cell cycle distribution were determined. In HaCaT cells exposure to PCB153 significantly reduced telomerase activity, telomere length, cell growth and increased intracellular superoxide levels from day 6 to day 48, suggesting that superoxide may be one of the factors regulating telomerase activity, telomere length and cell growth compared to untreated control cells. Results with NFK cells showed no shortening of telomere length but reduced cell growth and increased superoxide levels in PCB153-treated cells compared to untreated controls. As expected, basal levels of telomerase activity were almost undetectable, which made a quantitative comparison of treated and control groups impossible. The significant down regulation of telomerase activity and reduction of telomere length by PCB153 in HaCaT cells suggest that any cell type with significant telomerase activity, like stem cells, may be at risk of premature telomere shortening with potential adverse health effects for the affected organism. -- Highlights: ► Human immortal (HaCaT) and primary (NFK) keratinocytes were exposed to PCB153. ► PCB153 significantly reduced telomerase activity and telomere length in HaCaT. ► No effect on telomere length and

  3. Transplantation of human neonatal foreskin stromal cells in ex vivo organotypic cultures of embryonic chick femurs

    DEFF Research Database (Denmark)

    Aldahmash, Abdullah; Vishnubalaji, Radhakrishnan


    We have previously reported that human neonatal foreskin stromal cells (hNSSCs) promote angiogenesis in vitro and in chick embryo chorioallantoic membrane (CAM) assay in vivo. To examine the in vivo relevance of this observation, we examined in the present study the differentiation potential of h...

  4. Geraniin supplementation increases human keratinocyte proliferation in serum-free culture

    Directory of Open Access Journals (Sweden)

    Indra Kusuma


    Full Text Available Background Various products used in cellular therapy utilize tissue culture techniques requiring keratinocyte culture. An efficient and clinically acceptable keratinocyte culture system requires supplements with mitogenic activity. Geraniin is a phytochemical with the potential as a supplement for expansion culture of keratinocytes. The objective of the present study was to verify the mitogenic activity of geraniin on human keratinocytes. Methods This was an experimental study using two samples of human foreskin obtained by circumcision of a male child. Epidermal keratinocytes were isolated from the foreskin samples and were divided into paired groups, comprising intervention and control groups. The intervention groups were cultured with geraniin supplementation, whereas the control groups with standard supplements, without the addition of geraniin. Mitochondrial activity of the cells was evaluated by means of the 3-[4,5-dimethylthiazol-2-yl]-2,5-diphenyl-tetrazolium-bromide (MTT proliferation assay. Absorbance values in each of the groups was measured at 450 nm. Data analysis was performed with the paired t-test. Results Geraniin supplementation significantly increased the keratinocyte proliferation rates at dosages of 0.8 to 3.1 µM. An increase of 57% in the proliferation rate was obtained at a dosage of 1.6 µM, while at a dosage of 12.5 µM toxic effects were starting to appear. Geraniin presumably causes increased cellular energy status, resulting in increased proliferation rates. Conclusion The findings in this study provide evidence in support of the utilization of geraniin as a supplement for expansion culture of keratinocytes. Further studies may presumably identify the molecules acting as geraniin receptors and the intracellular mechanisms underlying the increase in proliferation rates.

  5. Decreased Migration of Langerhans Precursor-Like Cells in Response to Human Keratinocytes Expressing HPV-16 E6/E7 is Related to Reduced Macrophage Inflammatory Protein-3Alpha Production (United States)


    keratinocytes and its role in atopic dermatitis . Int Immunol 13:95-103. 47. Pahl, H. L. 1999. Activators and target genes of Rel/NF-kappaB transcription...neonatal foreskins and cultured in EpiLife medium supplemented with human keratinocyte growth supplement (bovine pituitary extract , bovine insulin...were cultured in EpiLife medium supplemented without bovine pituitary extract and hydrocortisone (hereafter called minimal EpiLife) when culture

  6. Topical oestrogen keratinises the human foreskin and may help prevent HIV infection.

    Directory of Open Access Journals (Sweden)

    Andrew J Pask

    Full Text Available With the growing incidence of HIV, there is a desperate need to develop simple, cheap and effective new ways of preventing HIV infection. Male circumcision reduces the risk of infection by about 60%, probably because of the removal of the Langerhans cells which are abundant in the inner foreskin and are the primary route by which HIV enters the penis. Langerhans cells form a vital part of the body's natural defence against HIV and only cause infection when they are exposed to high levels of HIV virions. Rather than removing this natural defence mechanism by circumcision, it may be better to enhance it by thickening the layer of keratin overlying the Langerhans cells, thereby reducing the viral load to which they are exposed. We have investigated the ability of topically administered oestrogen to induce keratinization of the epithelium of the inner foreskin. Histochemically, the whole of the foreskin is richly supplied with oestrogen receptors. The epithelium of the inner foreskin, like the vagina, responds within 24 hours to the topical administration of oestriol by keratinization, and the response persists for at least 5 days after the cessation of the treatment. Oestriol, a cheap, readily available natural oestrogen metabolite, rapidly keratinizes the inner foreskin, the site of HIV entry into the penis. This thickening of the overlying protective layer of keratin should reduce the exposure of the underlying Langerhans cells to HIV virions. This simple treatment could become an adjunct or alternative to surgical circumcision for reducing the incidence of HIV infection in men.

  7. Knockdown of MBP-1 in human foreskin fibroblasts induces p53-p21 dependent senescence.

    Directory of Open Access Journals (Sweden)

    Asish K Ghosh

    Full Text Available MBP-1 acts as a general transcriptional repressor. Overexpression of MBP-1 induces cell death in a number of cancer cells and regresses tumor growth. However, the function of endogenous MBP-1 in normal cell growth regulation remains unknown. To unravel the role of endogenous MBP-1, we knocked down MBP-1 expression in primary human foreskin fibroblasts (HFF by RNA interference. Knockdown of MBP-1 in HFF (HFF-MBPsi-4 resulted in an induction of premature senescence, displayed flattened cell morphology, and increased senescence-associated beta-galactosidase activity. FACS analysis of HFF-MBPsi-4 revealed accumulation of a high number of cells in the G1-phase. A significant upregulation of cyclin D1 and reduction of cyclin A was detected in HFF-MBPsi-4 as compared to control HFF. Senescent fibroblasts exhibited enhanced expression of phosphorylated and acetylated p53, and cyclin-dependent kinase inhibitor, p21. Further analysis suggested that promyolocytic leukemia protein (PML bodies are dramatically increased in HFF-MBPsi-4. Together, these results demonstrated that knockdown of endogenous MBP-1 is involved in cellular senescence of HFF through p53-p21 pathway.

  8. Effects of 2-aminoanthracene and benzo(. cap alpha. )pyrene on interferon production in human foreskin fibroblasts

    Energy Technology Data Exchange (ETDEWEB)

    Chen, Yu-Shiaw; Vaughn, J.M.; Morales, D.


    Human foreskin fibroblast cell cultures (Flow 7000, FS-35) were treated with varying concentrations of 2-aminoanthracene or benzo(..cap alpha..)pyrene for a two-day period prior to interferon (IFN) induction by either poly I . poly C, or 'Vesicular' Stomatitis virus (VSV). IFN in test cell fluids was then assayed and compared to production in untreated cultures. Both cell lines produced similar amounts of beta-interferon in response to poly I . poly C simulus. However, Flow 7000 fibroblasts were extremely sensitive to benzo(..cap alpha..)pyrene, with concentrations as low as 1 treatment inhibiting 93% of IFN-..beta.. productivity. Treatment of FS-35 cells with ten times this concentration was required to inhibit 85% of IFN-..beta.. productivity. Both test chemicals inhibited IFN-..beta.. productivity in FS-35 fibroblasts to the same extent. It was also noted that FS-35 produced alpha-interferon in response to VSV challenge, but this production was vulnerable to treatment with both test chemicals. In all cases, observed levels of IFN inhibition were directly proportional to the concentration of the applied chemical. 1 fig., 4 tabs.

  9. Decorin gene expression and its regulation in human keratinocytes

    Energy Technology Data Exchange (ETDEWEB)

    Velez-DelValle, Cristina; Marsch-Moreno, Meytha; Castro-Munozledo, Federico [Department of Cell Biology, Centro de Investigacion y de Estudios Avanzados del IPN, Apdo. Postal 14-740, Mexico D.F. 07000 (Mexico); Kuri-Harcuch, Walid, E-mail: [Department of Cell Biology, Centro de Investigacion y de Estudios Avanzados del IPN, Apdo. Postal 14-740, Mexico D.F. 07000 (Mexico)


    Highlights: {yields} We showed that cultured human diploid epidermal keratinocytes express and synthesize decorin. {yields} Decorin is found intracytoplasmic in suprabasal cells of cultures and in human epidermis. {yields} Decorin mRNA expression in cHEK is regulated by pro-inflammatory and proliferative cytokines. {yields} Decorin immunostaining of psoriatic lesions showed a lower intensity and altered intracytoplasmic arrangements. -- Abstract: In various cell types, including cancer cells, decorin is involved in regulation of cell attachment, migration and proliferation. In skin, decorin is seen in dermis, but not in keratinocytes. We show that decorin gene (DCN) is expressed in the cultured keratinocytes, and the protein is found in the cytoplasm of differentiating keratinocytes and in suprabasal layers of human epidermis. RT-PCR experiments showed that DCN expression is regulated by pro-inflammatory and proliferative cytokines. Our data suggest that decorin should play a significant role in keratinocyte terminal differentiation, cutaneous homeostasis and dermatological diseases.

  10. Methicillin-resistant Staphylococcus aureus adaptation to human keratinocytes. (United States)

    Soong, Grace; Paulino, Franklin; Wachtel, Sarah; Parker, Dane; Wickersham, Matthew; Zhang, Dongni; Brown, Armand; Lauren, Christine; Dowd, Margaret; West, Emily; Horst, Basil; Planet, Paul; Prince, Alice


    Skin is the most common site of Staphylococcus aureus infection. While most of these infections are self-limited, recurrent infections are common. Keratinocytes and recruited immune cells participate in skin defense against infection. We postulated that S. aureus is able to adapt to the milieu within human keratinocytes to avoid keratinocyte-mediated clearance. From a collection of S. aureus isolated from chronically infected patients with atopic dermatitis, we noted 22% had an agr mutant-like phenotype. Using several models of human skin infection, we demonstrate that toxin-deficient, agr mutants of methicillin-resistant S. aureus (MRSA) USA300 are able to persist within keratinocytes by stimulating autophagy and evading caspase-1 and inflammasome activation. MRSA infection induced keratinocyte autophagy, as evidenced by galectin-8 and LC3 accumulation. Autophagy promoted the degradation of inflammasome components and facilitated staphylococcal survival. The recovery of more than 58% agr or RNAIII mutants (P Soong et al.

  11. Human Keratinocytes Radioprotection with Mentha Longifolia (United States)

    Rizzo, Angela Maria; Berselli, P.; Zava, S.; Negroni, M.; Corsetto, P.; Montorfano, G.; Bertolotti, A.; Ranza, E.; Ottolenghi, A.; Berra, B.

    Antioxidants are suggested to act as radioprotectors, and dietary supplements based on antiox-idants have been proposed for astronauts involved in long-term space missions. Plant extracts with antioxidant properties may be used in dietetic supplements for astronauts; in fact recent nutritional guidelines suggest that "fruits and vegetables may become as important on space-going vessels as limes were on the sea-going vessels of old". Mint presents a large variety of biological properties, such as antiallergenic, antibacterial, anti-inflammatory, antitumor, an-tiviral, gastrointestinal protective, hepatoprotective, chemopreventive activities, most of which are attributable to its antioxidant activity. The aim of the present study is to evaluate the antioxidant properties and protective bio-efficacy of a phenol enriched Mentha longifolia ex-tract on gamma rays stressed human keratinocytes (NCTC2544). We assessed first the in vitro antioxidant activity (ABTS and DPPH), and then evaluated different stress markers in order to investigate various oxidative stress targets: cell viability (MTT); retained proliferating ca-pability (CA); DNA damage (histone H2AX) and protein damage (HSP70 induction). Results indicate that this Mint extract has a higher antioxidant activity respect to fresh extracts, that could be responsible of its really interesting radio-protective effects.

  12. In Vitro Toxicity of Aluminum Nanoparticles in Human Keratinocytes (United States)


    you performed and the hours you dedicated to the girls while I toiled away at homework, projects, and papers. To the girls , without your quiet, and...Germany). HaCaT keratinocytes do not produce tumors when passaged/grown indefinitely. When transplanted onto nude mice, HaCaT keratinocytes...Marie, John Breton, John Lee, Peter Young , and Don E. Griswold. “Interleukin-8 Production Is Regulated by Protein Kinase C in Human

  13. Expression of Transglutaminase in Foreskin of Children with Balanitis Xerotica Obliterans

    Directory of Open Access Journals (Sweden)

    Tiziana Russo


    Full Text Available Balanitis xerotica obliterans (BXO is a chronic inflammatory skin disorder of unclear etiology. The etiology and the exact molecular mechanisms underlying the disease are still unknown. The human transglutaminase (TG family consists of several proteins with catalytic activity essential for biological processes. In the present research we investigated the transcript levels of three TGs in patients operated on for congenital phimosis without or with histologically confirmed BXO; Thirty children with acquired phimosis were enrolled. The removed foreskins were sent both for histological diagnosis and for quantitative real-time PCR to evaluate the transcript levels of keratinocyte (TG1, tissue (TG2, and epidermal (TG3 transglutaminase; We observed a decrease in TG1 and TG3 transcripts by about 70% (p < 0.001 in foreskins from patients with BXO (n = 15 in comparison with patients without BXO (n = 15 and an increase in TG2 mRNA levels by 2.9 folds (p < 0.001; Reduced expression of both TG1 and TG3 was associated with the altered structure of the foreskin in BXO and can be a consequence of damage to keratinocytes. Increased expression of TG2 can be the result of chronic inflammation. TG2 overexpression can play a pivotal role in triggering and maintaining the inflammatory response in BXO patients.

  14. Footprint-free human fetal foreskin derived iPSCs: A tool for modeling hepatogenesis associated gene regulatory networks. (United States)

    Matz, Peggy; Wruck, Wasco; Fauler, Beatrix; Herebian, Diran; Mielke, Thorsten; Adjaye, James


    Induced pluripotent stem cells (iPSCs) are similar to embryonic stem cells and can be generated from somatic cells. We have generated episomal plasmid-based and integration-free iPSCs (E-iPSCs) from human fetal foreskin fibroblast cells (HFF1). We used an E-iPSC-line to model hepatogenesis in vitro. The HLCs were characterized biochemically, i.e. glycogen storage, ICG uptake and release, UREA and bile acid production, as well as CYP3A4 activity. Ultra-structure analysis by electron microscopy revealed the presence of lipid and glycogen storage, tight junctions and bile canaliculi- all typical features of hepatocytes. Furthermore, the transcriptome of undifferentiated E-iPSC, DE, HE and HLCs were compared to that of fetal liver and primary human hepatocytes (PHH). K-means clustering identified 100 clusters which include developmental stage-specific groups of genes, e.g. OCT4 expression at the undifferentiated stage, SOX17 marking the DE stage, DLK and HNF6 the HE stage, HNF4α and Albumin is specific to HLCs, fetal liver and adult liver (PHH) stage. We use E-iPSCs for modeling gene regulatory networks associated with human hepatogenesis and gastrulation in general.

  15. Androgen receptor is overexpressed in boys with severe hypospadias, and ZEB1 regulates androgen receptor expression in human foreskin cells (United States)

    Qiao, Liang; Tasian, Gregory E.; Zhang, Haiyang; Cao, Mei; Ferretti, Max; Cunha, Gerald R.; Baskin, Laurence S.


    INTRODUCTION ZEB1 is overexpressed in patients with severe hypospadias. We examined the interaction between ZeB1 and the androgen receptor (AR) in vitro and the expression of AR in boys with hypospadias. RESULTS ZEB1 and AR colocalize to the nucleus. Estrogen upregulated ZEB1 and AR expression. Chromatin immunoprecipitation (ChIP) demonstrated that ZEB1 binds to an E-box sequence in the AR gene promoter. AR expression is higher in subjects with severe hypospadias than those with mild hypospadias and control subjects (P hypospadias. Environmental estrogenic compounds may increase the risk of hypospadias by facilitating the interaction between ZEB1 and AR. METHODS Hs68 cells, a fibroblast cell line derived from neonatal human foreskin, were exposed to 0, 10, and 100 nmol/l of estrogen, after which the cellular localization of ZEB1 and AR was assessed using immunocytochemistry. To determine if ZEB1 interacted with the AR gene, ChIP was performed using ZEB1 antibody and polymerase chain reaction (PCR) for AR. Second, AR expression was quantified using real-time PcR and western blot in normal subjects (n = 32), and subjects with mild (n = 16) and severe hypospadia (n = 16). PMID:22391641

  16. MiRNA profile associated with replicative senescence, extended cell culture, and ectopic telomerase expression in human foreskin fibroblasts.

    Directory of Open Access Journals (Sweden)

    Laura N Bonifacio

    Full Text Available Senescence is a highly regulated process that limits cellular replication by enforcing a G1 arrest in response to various stimuli. Replicative senescence occurs in response to telomeric DNA erosion, and telomerase expression can offset replicative senescence leading to immortalization of many human cells. Limited data exists regarding changes of microRNA (miRNA expression during senescence in human cells and no reports correlate telomerase expression with regulation of senescence-related miRNAs. We used miRNA microarrays to provide a detailed account of miRNA profiles for early passage and senescent human foreskin (BJ fibroblasts as well as early and late passage immortalized fibroblasts (BJ-hTERT that stably express the human telomerase reverse transcriptase subunit hTERT. Selected miRNAs that were differentially expressed in senescence were assayed for expression in quiescent cells to identify miRNAs that are specifically associated with senescence-associated growth arrest. From this group of senescence-associated miRNAs, we confirmed the ability of miR-143 to induce growth arrest after ectopic expression in young fibroblasts. Remarkably, miR-143 failed to induce growth arrest in BJ-hTERT cells. Importantly, the comparison of late passage immortalized fibroblasts to senescent wild type fibroblasts reveals that miR-146a, a miRNA with a validated role in regulating the senescence associated secretory pathway, is also regulated during extended cell culture independently of senescence. The discovery that miRNA expression is impacted by expression of ectopic hTERT as well as extended passaging in immortalized fibroblasts contributes to a comprehensive understanding of the connections between telomerase expression, senescence and processes of cellular aging.

  17. Measurement of anti-inflammatory effects of glucocorticoids on human keratinocytes in vitro. Comparison of normal human keratinocytes with the keratinocyte cell line HaCaT. (United States)

    Stein, M; Bernd, A; Ramirez-Bosca, A; Kippenberger, S; Holzmann, H


    There are only few objective in vitro methods available for the testing of anti-inflammatory pharmaceutical products. One possibility is in the stimulation of cytokine production in cultivated human keratinocytes by UV light and the subsequent testing of suppressing activities. From the dermatological aspect the interleukins 6 and 8 are especially interesting because they are elevated in psoriatic skin. In the present work three glucocorticoids were tested in cultures of normal human keratinocytes and in the permanent keratinocyte cell line HaCaT. Both cell species produced IL-6 and IL-8 spontaneously, albeit in very small amounts. After UV irradiation the interleukin production increased in a dose dependent manner. The IL-6 and IL-8 induction could be suppressed by each of the glucocorticoids tested. The thymidine incorporation rate of the cells was not affected by the glucocorticoids indicating that the observed suppression of cytokine induction was not the result of a generalised cell damage. The response of both HaCaT keratinocytes and primary human keratinocytes to UV irradiation and glucocorticoid application was similar indicating the possible use of the generally available HaCaT cells for the pharmacological testing of anti-inflammatory activities in vitro.

  18. N-acetyltransferase in human skin and keratinocytes

    NARCIS (Netherlands)

    Vogel, Tanja; Bonifas, Jutta; Wiegman, Marjon; Pas, Hendrikus; Blömeke, Brunhilde; Coenraads, Pieter Jan; Schuttelaar, Marie-Louise

    Background: N-acetyltransferase 1 (NAT1) mediated Nacetylation in human skin and keratinocytes is an important detoxification pathway for aromatic amines including the strong sensitizer para-phenylenediamine (PPD), an important component of oxidative hair dyes. Objectives: Human skin and

  19. Individual variation of the genetic response to bisphenol a in human foreskin fibroblast cells derived from cryptorchidism and hypospadias patients.

    Directory of Open Access Journals (Sweden)

    Xian-Yang Qin

    Full Text Available BACKGROUND/PURPOSE: We hypothesized that polymorphic differences among individuals might cause variations in the effect that environmental endocrine disruptors (EEDs have on male genital malformations (MGMs. In this study, individual variation in the genetic response to low-dose bisphenol A (BPA was investigated in human foreskin fibroblast cells (hFFCs derived from child cryptorchidism (CO and hypospadias (HS patients. METHODOLOGY/PRINCIPAL FINDINGS: hFFCs were collected from control children without MGMs (n=5 and child CO and HS patients (n=8 and 21, respectively. BPA exposure (10 nM was found to inhibit matrix metalloproteinase-11 (MMP11 expression in the HS group (0.74-fold, P=0.0034 but not in the control group (0.93-fold, P=0.84 and CO group (0.94-fold, P=0.70. Significantly lower levels of MMP11 expression were observed in the HS group compared with the control group (0.80-fold, P=0.0088 and CO group (0.79-fold, P=0.039 in response to 10 nM BPA. The effect of single-nucleotide polymorphism rs5000770 (G>A, located within the aryl hydrocarbon receptor nuclear translocator 2 (ARNT2 locus, on individual sensitivity to low-dose BPA was investigated in the HS group. A significant difference in neurotensin receptor 1 (NTSR1 expression in response to 10 nM BPA was observed between AA and AG/GG groups (n=6 and 15, respectively. P=0.031. However, no significant difference in ARNT2 expression was observed (P=0.18. CONCLUSIONS/SIGNIFICANCE: This study advances our understanding of the specificity of low-dose BPA effects on human reproductive health. Our results suggest that genetic variability among individuals affects susceptibility to the effects of EEDs exposure as a potential cause of HS.

  20. SIRT1 Promotes Differentiation of Normal Human Keratinocytes


    Blander, Gil; Bhimavarapu, Anupama; Mammone, Thomas; Maes, Daniel; Elliston, Keith; Reich, Christian; Matsui, Mary Steidl; Guarente, Leonard; Loureiro, Joseph Jorge


    Sir2 regulates lifespan in model organisms, which has stimulated interest in understanding human Sir2 homolog functions. The human Sir2 gene family comprises seven members (SIRT1–SIRT7). SIRT1, the human ortholog of the yeast Sir2 by closest sequence similarity, is a nicotinamide adenine dinucleotide (NAD+)-dependent deacetylase with enzymatic properties indistinguishable from the yeast enzyme. We studied the involvement of SIRT1 in normal human keratinocyte physiology by a transcriptional mi...

  1. Identification of novel low-dose bisphenol a targets in human foreskin fibroblast cells derived from hypospadias patients.

    Directory of Open Access Journals (Sweden)

    Xian-Yang Qin

    Full Text Available The effect of low-dose bisphenol A (BPA exposure on human reproductive health is still controversial. To better understand the molecular basis of the effect of BPA on human reproductive health, a genome-wide screen was performed using human foreskin fibroblast cells (hFFCs derived from child hypospadias (HS patients to identify novel targets of low-dose BPA exposure.Gene expression profiles of hFFCs were measured after exposure to 10 nM BPA, 0.01 nM 17β-estradiol (E2 or 1 nM 2,3,7,8-tetrachlorodibenzo-p-dioxin (TCDD for 24 h. Differentially expressed genes were identified using an unpaired Student's t test with P value cut off at 0.05 and fold change of more than 1.2. These genes were selected for network generation and pathway analysis using Ingenuity Pathways Analysis, Pathway Express and KegArray. Seventy-one genes (42 downregulated and 29 upregulated were identified as significantly differentially expressed in response to BPA, among which 43 genes were found to be affected exclusively by BPA compared with E2 and TCDD. Of particular interest, real-time PCR analysis revealed that the expression of matrix metallopeptidase 11 (MMP11, a well-known effector of development and normal physiology, was found to be inhibited by BPA (0.47-fold and 0.37-fold at 10 nM and 100 nM, respectively. Furthermore, study of hFFCs derived from HS and cryptorchidism (CO patients (n = 23 and 11, respectively indicated that MMP11 expression was significantly lower in the HS group than in the CO group (0.25-fold, P = 0.0027.This present study suggests that an involvement of BPA in the etiology of HS might be associated with the downregulation of MMP11. Further study to elucidate the function of the novel target genes identified in this study during genital tubercle development might increase our knowledge of the effects of low-dose BPA exposure on human reproductive health.

  2. Comparison of human papillomavirus type 16 replication in tonsil and foreskin epithelia. (United States)

    Israr, Mohd; Biryukov, Jennifer; Ryndock, Eric J; Alam, Samina; Meyers, Craig


    Human papillomavirus (HPV) is well recognized as a causative agent for anogenital and oropharyngeal cancers, however, the biology of HPV infection at different mucosal locations, specifically the oral cavity, is not well understood. Importantly, it has yet to be determined if oral tissues are permissive for HPV infection and replication. We investigated for the first time the titers, infectivity, and maturation of HPV16 in oral epithelial versus genital epithelial tissue. We show that infectious HPV16 virions can be produced in oral tissue. This demonstrates, for the first time, that infectious virus could be spread via the oral cavity. HPV16 derived from oral tissue utilize a tissue-spanning redox gradient that facilitates the maturation of virions over time. Maturation is manifested by virion stability and increased susceptibility to neutralization with anti-HPV16 L1 antibodies. However, susceptibility to neutralization by anti-HPV16 L2 specific antibodies decreases during the maturation of HPV16 virions in oral tissue. Copyright © 2016 The Authors. Published by Elsevier Inc. All rights reserved.

  3. ZEB1 is Estrogen Responsive In Vitro in Human Foreskin Cells and is Over Expressed in Penile Skin in Patients With Severe Hypospadias (United States)

    Qiao, Liang; Tasian, Gregory E.; Zhang, Haiyang; Cunha, Gerald R.; Baskin, Laurence


    Purpose We determined the effect of estrogen on ZEB1 in vitro and tested the hypothesis that ZEB1 is over expressed in the penile skin of subjects with hypospadias. Materials and Methods Hs68 cells, a fibroblast cell line derived from human foreskin, were exposed to 0, 1, 10 and 100 nM estrogen, and the expression level of ZEB1 was assessed using reverse transcription real-time polymerase chain reaction, Western blot and immunocytochemical analysis. Next, preputial skin was prospectively collected from case and control subjects at hypospadias repair (37 cases) and circumcision (11). Hypospadias was classified as severe (13 cases) or mild (24) based on the position of the urethral meatus. ZEB1 expression was quantified using reverse transcription real-time polymerase chain reaction, Western blot and immunohistochemical analysis. Results Estrogen increased ZEB1 expression at the mRNA and protein levels in Hs68 cells in a concentration dependent fashion (p hypospadias had significantly higher ZEB1 mRNA levels and protein expression compared to controls or subjects with mild hypospadias (both p hypospadias had increased expression of ZEB1 in the basal layers of the preputial epidermis. Conclusions Estrogen increases ZEB1 expression in a human foreskin fibroblast cell line in vitro. Furthermore, ZEB1 is significantly over expressed in the penile skin of subjects with severe hypospadias. We propose that ZEB1 overexpression may contribute to development of hypospadias and may mediate the effect of estrogen on developing external male genitalia. PMID:21421232

  4. Transcriptional network of p63 in human keratinocytes.

    Directory of Open Access Journals (Sweden)

    Silvia Pozzi

    Full Text Available p63 is a transcription factor required for the development and maintenance of ectodermal tissues in general, and skin keratinocytes in particular. The identification of its target genes is fundamental for understanding the complex network of gene regulation governing the development of epithelia. We report a list of almost 1000 targets derived from ChIP on chip analysis on two platforms; all genes analyzed changed in expression during differentiation of human keratinocytes. Functional annotation highlighted unexpected GO terms enrichments and confirmed that genes involved in transcriptional regulation are the most significant. A detailed analysis of these transcriptional regulators in condition of perturbed p63 levels confirmed the role of p63 in the regulatory network. Rather than a rigid master-slave hierarchical model, our data indicate that p63 connects different hubs involved in the multiple specific functions of the skin.

  5. Similarities in Gene Expression Profiles during In Vitro Aging of Primary Human Embryonic Lung and Foreskin Fibroblasts

    Directory of Open Access Journals (Sweden)

    Shiva Marthandan


    Full Text Available Replicative senescence is of fundamental importance for the process of cellular aging, since it is a property of most of our somatic cells. Here, we elucidated this process by comparing gene expression changes, measured by RNA-seq, in fibroblasts originating from two different tissues, embryonic lung (MRC-5 and foreskin (HFF, at five different time points during their transition into senescence. Although the expression patterns of both fibroblast cell lines can be clearly distinguished, the similar differential expression of an ensemble of genes was found to correlate well with their transition into senescence, with only a minority of genes being cell line specific. Clustering-based approaches further revealed common signatures between the cell lines. Investigation of the mRNA expression levels at various time points during the lifespan of either of the fibroblasts resulted in a number of monotonically up- and downregulated genes which clearly showed a novel strong link to aging and senescence related processes which might be functional. In terms of expression profiles of differentially expressed genes with age, common genes identified here have the potential to rule the transition into senescence of embryonic lung and foreskin fibroblasts irrespective of their different cellular origin.

  6. Polygonum multiflorum Radix extract protects human foreskin melanocytes from oxidative stress in vitro and potentiates hair follicle pigmentation ex vivo. (United States)

    Sextius, P; Betts, R; Benkhalifa, I; Commo, S; Eilstein, J; Massironi, M; Wang, P; Michelet, J-F; Qiu, J; Tan, X; Jeulin, S


    To examine the ability of an extract from traditional Chinese medicine, Polygonum multiflorum Radix, to protect melanocyte viability from oxidative stress, a key mechanism in the initiation and progression of hair greying. To assess the antioxidant capacity of Polygonum multiflorum Radix extract, primary human foreskin melanocytes were treated with a commercially available Polygonum multiflorum Radix extract added to culture medium and exposed to hydrogen peroxide (H 2 O 2 ), using intracellular reactive oxygen species concentrations and glutathione/protein ratios as endpoints. To improve solubility for cosmetic uses, a new Polygonum multiflorum Radix extract was derived. As hair greying is the consequence of melanocyte disappearance in an oxidative stress environment, we checked whether the antioxidant capacity of the new Polygonum multiflorum Radix extract could preserve melanocyte viability in response to H 2 O 2 -induced oxidative stress, and preserve pigmentation within ex vivo human hair follicles. In vitro treatment of primary human foreskin melanocytes with traditional available Polygonum multiflorum Radix extract resulted in decreased intracellular ROS accumulation in response to H 2 O 2 exposure with a concomitant preservation of glutathione-to-protein ratio, consistent with a protective response against H 2 O 2 exposure and demonstrating the promise of this extract for protecting melanocytes against oxidative stress. Melanocytes treated with the improved Polygonum multiflorum Radix extract exhibited attenuated H 2 O 2 -induced cell death, demonstrating a clear cytoprotective effect. Treatment of ex vivo human hair follicles with the improved Polygonum multiflorum Radix extract resulted in a higher level of melanin compared to vehicle-treated controls, demonstrating an ex vivo protective effect on hair pigmentation. Polygonum multiflorum Radix extract protects in vitro primary human foreskin melanocytes from the deleterious effects of H 2 O 2

  7. Potential applications of keratinocytes derived from human embryonic stem cells. (United States)

    Movahednia, Mohammad M; Kidwai, Fahad K; Jokhun, Doorgesh S; Squier, Christopher A; Toh, Wei Seong; Cao, Tong


    Although skin grafting is one of the most advanced cell therapy technique, wide application of skin substitutes is hampered by the difficulty in securing sufficient amount of epidermal substitute. Additionally, in understanding the progression of skin aging and disease, and in screening the cosmetic and pharmaceutical products, there is lack of a satisfactory human skin-specific in vitro model. Recently, human embryonic stem cells (hESCs) have been proposed as an unlimited and reliable cell source to obtain almost all cell types present in the human body. This review focuses on the potential off-the-shelf use of hESC-derived keratinocytes for future clinical applications as well as a powerful in vitro skin model to study skin function and integrity, host-pathogen interactions and disease pathogenesis. Furthermore, we discuss the industrial applications of hESC-derived keratinized multi-layer epithelium which provides a human-like test platform for understanding disease pathogenesis, evaluation of new therapeutic modalities and assessment of the safety and efficacy of skin cosmetics and therapeutics. Overall, we conclude that the hESC-derived keratinocytes have great potential for clinical, research and industrial applications. Copyright © 2015 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  8. Comparison of a frozen human foreskin fibroblast cell assay to an enzyme immunoassay and toxigenic culture for the detection of toxigenic Clostridium difficile. (United States)

    Strachan, Alastair J; Evans, Natalie E; Williams, O Martin; Spencer, Robert C; Greenwood, Rosemary; Probert, Chris J


    This study set out to validate the Hs27 ReadyCell assay (RCCNA) as an alternative CCNA method compared against a commonly used commercial enzyme immunoassay (EIA) method and toxigenic culture (TC) reference standard. A total of 860 samples were identified from those submitted to the Health Protection Agency microbiology laboratories over a 30-week period. RCCNA performed much better than EIA when using TC as a gold standard, with sensitivities of 90.8% versus 78.6% and positive predictive value of 87.3% to 81.9%, respectively. The Hs27 Human Foreskin Fibroblast ReadyCells are an easy-to-use and a sensitive CCNA method for the detection of toxigenic Clostridium difficile directly from stool. A turnaround time of up to 48 h for a negative result and possible need for repeat testing make it an unsuitable method to be used in most clinical laboratory setting. Copyright © 2013 Elsevier Inc. All rights reserved.

  9. Comparison of a frozen human foreskin fibroblast cell assay to an enzyme immunoassay and toxigenic culture for the detection of toxigenic Clostridium difficile☆☆☆★ (United States)

    Strachan, Alastair J.; Evans, Natalie E.; Williams, O. Martin; Spencer, Robert C.; Greenwood, Rosemary; Probert, Chris J.


    This study set out to validate the Hs27 ReadyCell assay (RCCNA) as an alternative CCNA method compared against a commonly used commercial enzyme immunoassay (EIA) method and toxigenic culture (TC) reference standard. A total of 860 samples were identified from those submitted to the Health Protection Agency microbiology laboratories over a 30-week period. RCCNA performed much better than EIA when using TC as a gold standard, with sensitivities of 90.8% versus 78.6% and positive predictive value of 87.3% to 81.9%, respectively. The Hs27 Human Foreskin Fibroblast ReadyCells are an easy-to-use and a sensitive CCNA method for the detection of toxigenic Clostridium difficile directly from stool. A turnaround time of up to 48 h for a negative result and possible need for repeat testing make it an unsuitable method to be used in most clinical laboratory setting. PMID:23107315

  10. Signaling of mechanical stretch in human keratinocytes via MAP kinases. (United States)

    Kippenberger, S; Bernd, A; Loitsch, S; Guschel, M; Müller, J; Bereiter-Hahn, J; Kaufmann, R


    Cells within human skin are permanently exposed to mechanical stretching. Here we present evidence that alterations in cell shape trigger biochemical signaling via MAP kinases in human keratinocytes. In an in vitro attempt we demonstrate a fast but transient activation of extracellular signal-regulated kinases 1/2 in response to cell stretch. This activation is reversed by preincubation with functional blocking antibodies directed towards beta1-integrins. As a second member of MAP kinases, stress-activated protein kinase/c-JUN NH2-terminal kinase was activated in a slower fashion, peaking at 1 h after the initial stimulus. The delay in signal transmission suggests that extracellular signal-regulated kinases 1/2 and stress-activated protein kinase/c-JUN NH2-terminal kinase do not share the same signaling pathway. p38 was not activated by cell stretching. The contribution of cytoskeletal elements in signal perception and transduction was evaluated by selective disruption of either actin filaments, microtubules, or keratin filaments but showed no clear effect on stretch-induced activation of extracellular signal-regulated kinases 1/2 and stress-activated protein kinase/c-JUN NH2-terminal kinase. In conclusion we found evidence of a cell-shape-dependent activation of MAP kinases in human keratinocytes disclosing beta1-integrins as putative mechano-transducers. It is likely that alterations of skin mechanics in vivo underlying pathogenic processes like wound formation and healing trigger physiologic responses via the MAP kinase pathway.

  11. Steroid synthesis by primary human keratinocytes; implications for skin disease

    Energy Technology Data Exchange (ETDEWEB)

    Hannen, Rosalind F., E-mail: [Centre for Cutaneous Research, Institute of Cell and Molecular Science, Barts and The London School of Medicine and Dentistry, Queen Mary University of London, London E1 2AT (United Kingdom); Michael, Anthony E. [Centre for Developmental and Endocrine Signalling, Academic Section of Obstetrics and Gynaecology, Division of Clinical Developmental Sciences, 3rd Floor, Lanesborough Wing, St. George' s, University of London, Cranmer Terrace, Tooting, London SW17 0RE (United Kingdom); Jaulim, Adil [Centre for Cutaneous Research, Institute of Cell and Molecular Science, Barts and The London School of Medicine and Dentistry, Queen Mary University of London, London E1 2AT (United Kingdom); Bhogal, Ranjit [Life Science, Unilever R and D Colworth House, Sharnbrook, Bedfordshire MK44 1LQ (United Kingdom); Burrin, Jacky M. [Centre for Endocrinology, William Harvey Research Institute, Barts and The London School of Medicine and Dentistry, Queen Mary University of London, London EC1M 6BQ (United Kingdom); Philpott, Michael P. [Centre for Cutaneous Research, Institute of Cell and Molecular Science, Barts and The London School of Medicine and Dentistry, Queen Mary University of London, London E1 2AT (United Kingdom)


    Research highlights: {yields} Primary keratinocytes express the steroid enzymes required for cortisol synthesis. {yields} Normal primary human keratinocytes can synthesise cortisol. {yields} Steroidogenic regulators, StAR and MLN64, are expressed in normal epidermis. {yields} StAR expression is down regulated in eczema and psoriatic epidermis. -- Abstract: Cortisol-based therapy is one of the most potent anti-inflammatory treatments available for skin conditions including psoriasis and atopic dermatitis. Previous studies have investigated the steroidogenic capabilities of keratinocytes, though none have demonstrated that these skin cells, which form up to 90% of the epidermis are able to synthesise cortisol. Here we demonstrate that primary human keratinocytes (PHK) express all the elements required for cortisol steroidogenesis and metabolise pregnenolone through each intermediate steroid to cortisol. We show that normal epidermis and cultured PHK express each of the enzymes (CYP11A1, CYP17A1, 3{beta}HSD1, CYP21 and CYP11B1) that are required for cortisol synthesis. These enzymes were shown to be metabolically active for cortisol synthesis since radiometric conversion assays traced the metabolism of [7-{sup 3}H]-pregnenolone through each steroid intermediate to [7-{sup 3}H]-cortisol in cultured PHK. Trilostane (a 3{beta}HSD1 inhibitor) and ketoconazole (a CYP17A1 inhibitor) blocked the metabolism of both pregnenolone and progesterone. Finally, we show that normal skin expresses two cholesterol transporters, steroidogenic acute regulatory protein (StAR), regarded as the rate-determining protein for steroid synthesis, and metastatic lymph node 64 (MLN64) whose function has been linked to cholesterol transport in steroidogenesis. The expression of StAR and MLN64 was aberrant in two skin disorders, psoriasis and atopic dermatitis, that are commonly treated with cortisol, suggesting dysregulation of epidermal steroid synthesis in these patients. Collectively these data

  12. Arsenite suppression of BMP signaling in human keratinocytes

    Energy Technology Data Exchange (ETDEWEB)

    Phillips, Marjorie A.; Qin, Qin [Department of Environmental Toxicology, University of California, Davis, CA 95616-8588 (United States); Hu, Qin; Zhao, Bin [State Key Laboratory of Environmental Chemistry and Ecotoxicology, Research Center for Eco-Environmental Sciences, Chinese Academy of Sciences, Beijing 100085 (China); Rice, Robert H., E-mail: [Department of Environmental Toxicology, University of California, Davis, CA 95616-8588 (United States)


    Arsenic, a human skin carcinogen, suppresses differentiation of cultured keratinocytes. Exploring the mechanism of this suppression revealed that BMP-6 greatly increased levels of mRNA for keratins 1 and 10, two of the earliest differentiation markers expressed, a process prevented by co-treatment with arsenite. BMP also stimulated, and arsenite suppressed, mRNA for FOXN1, an important transcription factor driving early keratinocyte differentiation. Keratin mRNAs increased slowly after BMP-6 addition, suggesting they are indirect transcriptional targets. Inhibition of Notch1 activation blocked BMP induction of keratins 1 and 10, while FOXN1 induction was largely unaffected. Supporting a requirement for Notch1 signaling in keratin induction, BMP increased levels of activated Notch1, which was blocked by arsenite. BMP also greatly decreased active ERK, while co-treatment with arsenite maintained active ERK. Inhibition of ERK signaling mimicked BMP by inducing keratin and FOXN1 mRNAs and by increasing active Notch1, effects blocked by arsenite. Of 6 dual-specificity phosphatases (DUSPs) targeting ERK, two were induced by BMP unless prevented by simultaneous exposure to arsenite and EGF. Knockdown of DUSP2 or DUSP14 using shRNAs greatly reduced FOXN1 and keratins 1 and 10 mRNA levels and their induction by BMP. Knockdown also decreased activated Notch1, keratin 1 and keratin 10 protein levels, both in the presence and absence of BMP. Thus, one of the earliest effects of BMP is induction of DUSPs, which increases FOXN1 transcription factor and activates Notch1, both required for keratin gene expression. Arsenite prevents this cascade by maintaining ERK signaling, at least in part by suppressing DUSP expression. - Highlights: • BMP induces FOXN1 transcription. • BMP induces DUSP2 and DUSP14, suppressing ERK activation. • Arsenite suppresses levels of phosphorylated Smad1/5 and FOXN1 and DUSP mRNA. • These actions rationalize arsenite suppression of keratinocyte

  13. Foreskin Morbidity in Uncircumcised Males

    DEFF Research Database (Denmark)

    Sneppen, Ida; Thorup, Jørgen


    OBJECTIVE: As a consequence of the discussion on whether the health benefits of newborn male circumcision outweigh the risks and the discrepancies in reported figures of complications, we evaluated the incidence and morbidity of foreskin surgery due to medical indications in boys from the Capital...

  14. Efavirenz induces autophagy and aberrant differentiation in normal human keratinocytes (United States)



    Although efavirenz (EFV) is efficacious as an anti-retroviral therapy when combined with other antiretroviral drugs, it may cause adverse clinical effects, including skin and mucosal eruptions, central nervous system complications, hepatotoxicity, renal failure and pulmonary complications. The present study investigated the phenotypic alterations caused by EFV in normal human keratinocytes (NHKs) and determined the cell death pathways leading to the lack of epithelial proliferation and regeneration. Replication kinetics, cellular morphology, and protein and mRNA levels of cell cycle regulatory genes and cell death markers were compared between the EFV-exposed cells and the untreated control. EFV treatment led to cell proliferation arrest and cell death of the NHKs by inducing autophagy mediated by proteasome-dependent degradation of p53. EFV also reduced the levels of mTOR and active ERK signaling in NHKs. Chemical inhibition of p53 degradation with a proteasome inhibitor led to reduced autophagic response of NHKs to EFV. In addition, EFV triggered terminal differentiation of NHKs by inducing the expression of involucrin, filaggrin, loricrin and genes involved in cornified envelope formation. Inhibition of autophagy in the EFV-treated NHKs with 3-methylalanine reduced the levels of involucrin and the extent of cell death. Our data indicate that EFV elicits cytotoxic effects on NHKs in part through induction of autophagy and aberrant differentiation of cells. PMID:23563240

  15. Differential Activation of Human Keratinocytes by Leishmania Species Causing Localized or Disseminated Disease. (United States)

    Scorza, Breanna M; Wacker, Mark A; Messingham, Kelly; Kim, Peter; Klingelhutz, Aloysius; Fairley, Janet; Wilson, Mary E


    All Leishmania species parasites are introduced into mammalian skin through a sand fly bite, but different species cause distinct clinical outcomes. Mouse studies suggest that early responses are critical determinants of subsequent adaptive immunity in leishmaniasis, yet few studies address the role of keratinocytes, the most abundant cell in the epidermis. We hypothesized that Leishmania infection causes keratinocytes to produce immunomodulatory factors that influence the outcome of infection. Incubation of primary or immortalized human keratinocytes with Leishmania infantum or Leishmania major, which cause visceral or cutaneous leishmaniasis, respectively, elicited dramatically different responses. Keratinocytes incubated with L. infantum significantly increased expression of proinflammatory genes for IL-6, IL-8, tumor necrosis factor, and IL-1B, whereas keratinocytes exposed to several L. major isolates did not. Furthermore, keratinocyte-monocyte co-incubation studies across a 4 µM semipermeable membrane suggested that L. infantum-exposed keratinocytes release soluble factors that enhance monocyte control of intracellular L. infantum replication (P Leishmania species that may affect the course of disease. Copyright © 2017 The Authors. Published by Elsevier Inc. All rights reserved.

  16. Taurin-conjugated ursodeoxycholic acid has a reversible inhibitory effect on human keratinocyte growth. (United States)

    Yamaguchi, Y; Itami, S; Nishida, K; Ando, Y; Okamoto, S; Hosokawa, K; Yoshikawa, K


    Tauroursodeoxycholic acid (TUDC) is one of the most hydrophilic taurin conjugated bile acids. TUDC has a suppressive effect on DNA synthesis in primary cultured rat hepatocytes. In this study, we investigated the growth inhibitory effect of TUDC on cultured human keratinocytes. TUDC suppressed the proliferation of keratinocytes in a dose dependent fashion, as measured by both cell counts and 5-bromo-2'-deoxyuridine (BrdU) uptake. Keratinocytes reproliferated and reached almost the same cell number as control after removal of TUDC from the medium. TUDC (1 mM) had no effect on the cell viability, as measured by the dye exclusion test. Epidermal sheets stratified in the presence of TUDC appeared thinner than those stratified without TUDC. These results suggest that TUDC has a reversible growth suppressive effect on human keratinocytes through the mechanism other than cytotoxicity and would be applicable for the treatment of hyperproliferative skin disorders such as psoriasis.

  17. Promoting effect of lactoferrin on barrier function and epithelial differentiation of human keratinocytes. (United States)

    Uchida, Ryo; Aoki, Reiji; Aoki-Yoshida, Ayako; Tajima, Atsushi; Takayama, Yoshiharu


    The purpose of this study was to elucidate the effects of bovine lactoferrin on keratinocyte differentiation and barrier function. Addition of bovine lactoferrin to differentiating HaCaT human keratinocytes led to increased transepithelial electrical resistance (TER), a marker of epithelial barrier function. This elevation was followed by upregulation of two differentiation markers, involucrin and filaggrin. The expression level of sterol regulatory element-binding protein-1 was also enhanced by bovine lactoferrin. The lactoferrin-induced upregulation of involucrin and filaggrin expression were confirmed in normal human epidermal keratinocytes (NHEK). Treatment with SB203580, a p38 mitogen-activated protein kinase (MAPK) α inhibitor, impaired the upregulation of involucrin and filaggrin expression in response to lactoferrin. The elevation of p38 MAPK phosphorylation was further enhanced by lactoferrin in the initial stage of differentiation of HaCaT keratinocytes. The findings suggest that bovine lactoferrin promotes epithelial differentiation by a p38-MAPK-dependent mechanism.

  18. Histamine suppresses epidermal keratinocyte differentiation and impairs skin barrier function in a human skin model


    Gschwandtner, M; Mildner, M.; Mlitz, V; Gruber, F; Eckhart, L; Werfel, T.; Gutzmer, R.; Elias, P M; Tschachler, E.


    Background Defects in keratinocyte differentiation and skin barrier are important features of inflammatory skin diseases like atopic dermatitis. Mast cells and their main mediator histamine are abundant in inflamed skin and thus may contribute to disease pathogenesis. Methods Human primary keratinocytes were cultured under differentiation-promoting conditions in the presence and absence of histamine, histamine receptor agonists and antagonists. The expression of differentiation-associated gen...

  19. Effects of titanium dioxide nanoparticles on human keratinocytes (United States)

    Wright, Clayton; Iyer, Anand Krishnan V.; Wang, Liying; Wu, Nianqiang; Yakisich, Juan S.; Rojanasakul, Yon; Azad, Neelam


    Titanium dioxide (TiO2) is a ubiquitous whitening compound widely used in topical products such as sunscreens, lotions and facial creams. The damaging health effects of TiO2 inhalation has been widely studied in rats, mice and humans showing oxidative stress increase, DNA damage, cell death and inflammatory gene upregulation in lung and throat cells; however, the effects on skin cells from long-term topical use of various products remain largely unknown. In this study, we assessed the effect of specific TiO2 nanoparticles (H2TiO7) on a human keratinocyte cell line (HaCaT). We performed a comparative analysis using three TiO2 particles varying in size (Fine, Ultrafine and H2TiO7) and analyzed their effects on HaCaTs. There is a clear dose-dependent increase in superoxide production, caspase 8 and 9 activity, and apoptosis in HaCaTs after treatment with all three forms of TiO2; however, there is no consistent effect on cell viability and proliferation with either of these TiO2 particles. While there is data suggesting UV exposure can enhance the carcinogenic effects of TiO2, we did not observe any significant effect of UV-C exposure combined with TiO2 treatment on HaCaTs. Furthermore, TiO2-treated cells showed minimal effects on VEGF upregulation and Wnt signaling pathway thereby showing no potential effect on angiogenesis and malignant transformation. Overall, we report here an increase in apoptosis, which may be caspase 8/Fas-dependent, and that the H2TiO7 nanoparticles, despite their smaller particle size, had no significant enhanced effect on HaCaT cells as compared to Fine and Ultrafine forms of TiO2. PMID:27310834

  20. Breast cancer resistance protein identifies clonogenic keratinocytes in human interfollicular epidermis. (United States)

    Ma, Dongrui; Chua, Alvin Wen Choong; Yang, Ennan; Teo, Peiyun; Ting, Yixin; Song, Colin; Lane, Ellen Birgitte; Lee, Seng Teik


    There is a practical need for the identification of robust cell-surface markers that can be used to enrich for living keratinocyte progenitor cells. Breast cancer resistance protein (ABCG2), a member of the ATP binding cassette (ABC) transporter family, is known to be a marker for stem/progenitor cells in many tissues and organs. We investigated the expression of ABCG2 protein in normal human epidermis to evaluate its potential as a cell surface marker for identifying and enriching for clonogenic epidermal keratinocytes outside the pilosebaceous tract. Immunofluorescence and immunoblotting studies of human skin showed that ABCG2 is expressed in a subset of basal layer cells in the epidermis. Flow cytometry analysis showed approximately 2-3% of keratinocytes in non-hair-bearing epidermis expressing ABCG2; this population also expresses p63, β1 and α6 integrins and keratin 14, but not CD34, CD71, C-kit or involucrin. The ABCG2-positive keratinocytes showed significantly higher colony forming efficiency when co-cultured with mouse 3T3 feeder cells, and more extensive long-term proliferation capacity in vitro, than did ABCG2-negative keratinocytes. Upon clonal analysis, most of the freshly isolated ABCG2-positive keratinocytes formed holoclones and were capable of generating a stratified differentiating epidermis in organotypic culture models. These data indicate that in skin, expression of the ABCG2 transporter is a characteristic of interfollicular keratinocyte progentior cells and suggest that ABCG2 may be useful for enriching keratinocyte stem cells in human interfollicular epidermis.

  1. Transcriptional regulation of genes involved in keratinocyte differentiation by human papillomavirus 16 oncoproteins. (United States)

    Gyöngyösi, Eszter; Szalmás, Anita; Ferenczi, Annamária; Póliska, Szilárd; Kónya, József; Veress, György


    The life cycle of human papillomaviruses (HPVs) is strictly linked to the differentiation of their natural host cells. The HPV E6 and E7 oncoproteins can delay the normal differentiation program of keratinocytes; however, the exact mechanisms responsible for this have not yet been identified. The goal of this study was to investigate the effects of HPV16 oncoproteins on the expression of genes involved in keratinocyte differentiation. Primary human keratinocytes transduced by LXSN (control) retroviruses or virus vectors expressing HPV16 E6, E7 or E6/E7 genes were subjected to gene expression profiling. The results of microarray analysis showed that HPV 16 E6 and E7 have the capacity to downregulate the expression of several genes involved in keratinocyte differentiation. Quantitative real-time polymerase chain reaction (qRT-PCR) assays were performed to confirm the microarray data. To investigate the effects of the HPV oncoproteins on the promoters of selected keratinocyte differentiation genes, luciferase reporter assays were performed. Our results suggest that the HPV 16 E6 and/or E7 oncogenes are able to downregulate the expression of several genes involved in keratinocyte differentiation (such as desmocollin 1, keratin 4, S100 calcium-binding protein A8 and small proline-rich protein 1A), at least partially by downregulating their promoter activity. This activity of the HPV oncoproteins may have a role in the productive virus life cycle, and also in virus-induced carcinogenesis.

  2. Notch Cooperates with Survivin to Maintain Stemness and to Stimulate Proliferation in Human Keratinocytes during Ageing

    Directory of Open Access Journals (Sweden)

    Elisabetta Palazzo


    Full Text Available The Notch signaling pathway orchestrates cell fate by either inducing cell differentiation or maintaining cells in an undifferentiated state. This study aims to evaluate Notch expression and function in normal human keratinocytes. Notch1 is expressed in all epidermal layers, though to a different degree of intensity, with a dramatic decrease during ageing. Notch1 intracellular domain (N1ICD levels are decreased during transit from keratinocyte stem cells (KSC to transit amplifying (TA cells, mimicking survivin expression in samples from donors of all ages. Calcium markedly reduces N1ICD levels in keratinocytes. N1ICD overexpression induces the up-regulation of survivin and the down-regulation of keratin 10 and involucrin, while increasing the S phase of the cell cycle. On the other hand, Notch1 inhibition (DAPT dose-dependently decreases survivin, stimulates differentiation, and reduces keratinocyte proliferation in samples from donors of all ages. Silencing Notch downgrades survivin and increases keratin 10. In addition, Notch1 inhibition decreases survivin levels and proliferation both in KSC and TA cells. Finally, while survivin overexpression decreases keratinocyte differentiation and increases N1ICD expression both in KSC and TA cells, silencing survivin results in N1ICD down-regulation and an increase in differentiation markers. These results suggest that the Notch1/survivin crosstalk contributes to the maintenance of stemness in human keratinocytes.

  3. Protective Effects of Triphala on Dermal Fibroblasts and Human Keratinocytes.

    Directory of Open Access Journals (Sweden)

    Sandeep R Varma

    Full Text Available Human skin is body's vital organ constantly exposed to abiotic oxidative stress. This can have deleterious effects on skin such as darkening, skin damage, and aging. Plant-derived products having skin-protective effects are well-known traditionally. Triphala, a formulation of three fruit products, is one of the most important rasayana drugs used in Ayurveda. Several skin care products based on Triphala are available that claim its protective effects on facial skin. However, the skin protective effects of Triphala extract (TE and its mechanistic action on skin cells have not been elucidated in vitro. Gallic acid, ellagic acid, and chebulinic acid were deduced by LC-MS as the major constituents of TE. The identified key compounds were docked with skin-related proteins to predict their binding affinity. The IC50 values for TE on human dermal fibroblasts (HDF and human keratinocytes (HaCaT were 204.90 ± 7.6 and 239.13 ± 4.3 μg/mL respectively. The antioxidant capacity of TE was 481.33 ± 1.5 mM Trolox equivalents in HaCaT cells. Triphala extract inhibited hydrogen peroxide (H2O2 induced RBC haemolysis (IC50 64.95 μg/mL, nitric oxide production by 48.62 ± 2.2%, and showed high reducing power activity. TE also rescued HDF from H2O2-induced damage; inhibited H2O2 induced cellular senescence and protected HDF from DNA damage. TE increased collagen-I, involucrin and filaggrin synthesis by 70.72 ± 2.3%, 67.61 ± 2.1% and 51.91 ± 3.5% in HDF or HaCaT cells respectively. TE also exhibited anti-tyrosinase and melanin inhibition properties in a dose-dependent manner. TE increased the mRNA expression of collagen-I, elastin, superoxide dismutase (SOD-2, aquaporin-3 (AQP-3, filaggrin, involucrin, transglutaminase in HDF or HaCaT cells, and decreased the mRNA levels of tyrosinase in B16F10 cells. Thus, Triphala exhibits protective benefits on skin cells in vitro and can be used as a potential ingredient in skin care formulations.

  4. Remifentanil protects human keratinocytes against hypoxia-reoxygenation injury through activation of autophagy.

    Directory of Open Access Journals (Sweden)

    Jae-Young Kwon

    Full Text Available The proliferation, differentiation, and migration of keratinocytes are essential in the early stages of wound healing. Hypoxia-Reoxygenation (H/R injury to keratinocytes can occur in various stressful environments such as surgery, trauma, and various forms of ulcers. The effects of remifentanil on human keratinocytes under hypoxia-reoxygenation have not been fully studied. Therefore, we investigated the effects of remifentanil on the proliferation, apoptosis, and autophagic activation of human keratinocytes during hypoxic-reoxygenation. Human keratinocytes were cultured under 1% oxygen tension for 24 h. The cells were then treated with various concentrations of remifentanil (0.01, 0.1, 0.5, and 1 ng/mL for 2 h. Thereafter, the cells were reoxygenated for 12 h at 37°C. We measured cell viability via MTT assay. Using quantitative real-time PCR and western blot analysis, we measured the expression levels of proteins associated with apoptosis and autophagy. Quantification of apoptotic cells was performed using flow cytometer analysis and autophagic vacuoles were observed under a fluorescence microscope. Remifentanil treatment brought about an increase in the proliferation of human keratinocytes damaged by hypoxia-reoxygenation and decreased the apoptotic cell death, enhancing autophagic activity. However, the autophagy pathway inhibitor 3-MA inhibited the protective effect of remifentanil in hypoxia-reoxygenation injury. In conclusion, the current study demonstrated that remifentanil treatment stimulated autophagy and reduced apoptotic cell death in a hypoxia-reoxygenation model of human keratinocytes. Our results provide additional insights into the relationship between apoptosis and autophagy.

  5. Locomotion of human skin keratinocytes on polystyrene, fibrin, and collagen substrata and its modification by cell-to-cell contacts. (United States)

    Drukała, J; Bandura, L; Cieślik, K; Korohoda, W


    Epithelial wound repair assures the recovery of the epithelial barrier after wounding. During wound healing epithelial cells migrate to cover the wound surface. The presented experiments were carried out to compare the migration of human keratinocytes from primary and secondary culture on polystyrene, collagen, and fibrin glue used in clinical techniques. The images of migrating keratinocytes were recorded and analyzed using computer-aided methods. The results show that the character of the substrate strongly affects the speed and turning behavior of keratinocytes locomoting over it. The highest motile activity of human skin keratinocytes was found on fibrin glue substratum. It was found that locomotion of freely moving isolated cells was much faster than that of cell sheets. The autologous keratinocytes cultured in vitro were applied with fibrin glue to cover trophic wounds. The transplantation of human autologous keratinocyte suspension in fibrin glue upon long-lasting trophic wounds appeared to induce rapid and permanent wound healing.

  6. Human keratinocytes restrict chikungunya virus replication at a post-fusion step

    Energy Technology Data Exchange (ETDEWEB)

    Bernard, Eric [Centre d' étude d’agents Pathogènes et Biotechnologies pour la Santé, CPBS CNRS- UMR5236/UM1/UM2, Montpellier (France); Hamel, Rodolphe [Laboratoire Maladies Infectieuses et Vecteurs: Ecologie, Génétique, Evolution, Contrôle, UMR 5290 CNRS/IRD/UM1, Montpellier (France); Neyret, Aymeric [Centre d' étude d’agents Pathogènes et Biotechnologies pour la Santé, CPBS CNRS- UMR5236/UM1/UM2, Montpellier (France); Ekchariyawat, Peeraya [Laboratoire Maladies Infectieuses et Vecteurs: Ecologie, Génétique, Evolution, Contrôle, UMR 5290 CNRS/IRD/UM1, Montpellier (France); Molès, Jean-Pierre [INSERM U1058, UM1, CHU Montpellier (France); Simmons, Graham [Blood Systems Research Institute, San Francisco, CA 94118 (United States); Chazal, Nathalie [Centre d' étude d’agents Pathogènes et Biotechnologies pour la Santé, CPBS CNRS- UMR5236/UM1/UM2, Montpellier (France); Desprès, Philippe [Unité Interactions Moléculaires Flavivirus-Hôtes, Institut Pasteur, Paris (France); and others


    Transmission of chikungunya virus (CHIKV) to humans is initiated by puncture of the skin by a blood-feeding Aedes mosquito. Despite the growing knowledge accumulated on CHIKV, the interplay between skin cells and CHIKV following inoculation still remains unclear. In this study we questioned the behavior of human keratinocytes, the predominant cell population in the skin, following viral challenge. We report that CHIKV rapidly elicits an innate immune response in these cells leading to the enhanced transcription of type I/II and type III interferon genes. Concomitantly, we show that despite viral particles internalization into Rab5-positive endosomes and efficient fusion of virus and cell membranes, keratinocytes poorly replicate CHIKV as attested by absence of nonstructural proteins and genomic RNA synthesis. Accordingly, human keratinocytes behave as an antiviral defense against CHIKV infection rather than as a primary targets for initial replication. This picture significantly differs from that reported for Dengue and West Nile mosquito-borne viruses. - Highlights: • Human keratinocytes support endocytosis of CHIKV and fusion of viral membranes. • CHIKV replication is blocked at a post entry step in these cells. • Infection upregulates type-I, –II and –III IFN genes expression. • Keratinocytes behave as immune sentinels against CHIKV.

  7. Autocrine abscisic acid mediates the UV-B-induced inflammatory response in human granulocytes and keratinocytes. (United States)

    Bruzzone, Santina; Basile, Giovanna; Mannino, Elena; Sturla, Laura; Magnone, Mirko; Grozio, Alessia; Salis, Annalisa; Fresia, Chiara; Vigliarolo, Tiziana; Guida, Lucrezia; De Flora, Antonio; Tossi, Vanesa; Cassia, Raul; Lamattina, Lorenzo; Zocchi, Elena


    UV-B is an abiotic environmental stress in both plants and animals. Abscisic acid (ABA) is a phytohormone regulating fundamental physiological functions in plants, including response to abiotic stress. We previously demonstrated that ABA is an endogenous stress hormone also in animal cells. Here, we investigated whether autocrine ABA regulates the response to UV-B of human granulocytes and keratinocytes, the cells involved in UV-triggered skin inflammation. The intracellular ABA concentration increased in UV-B-exposed granulocytes and keratinocytes and ABA was released into the supernatant. The UV-B-induced production of NO and of reactive oxygen species (ROS), phagocytosis, and cell migration were strongly inhibited in granulocytes irradiated in the presence of a monoclonal antibody against ABA. Moreover, presence of the same antibody strongly inhibited release of NO, prostaglandin E2 (PGE(2)), and tumor necrosis factor-α (TNF-α) by UV-B irradiated keratinocytes. Lanthionine synthetase C-like protein 2 (LANCL2) is required for the activation of the ABA signaling pathway in human granulocytes. Silencing of LANCL2 in human keratinocytes by siRNA was accompanied by abrogation of the UV-B-triggered release of PGE(2), TNF-α, and NO and ROS production. These results indicate that UV-B irradiation induces ABA release from human granulocytes and keratinocytes and that autocrine ABA stimulates cell functions involved in skin inflammation. Copyright © 2011 Wiley Periodicals, Inc.

  8. Human Papilloma Viral DNA Replicates as a Stable Episome in Cultured Epidermal Keratinocytes (United States)

    Laporta, Robert F.; Taichman, Lorne B.


    Human papilloma virus (HPV) is poorly understood because systems for its growth in tissue culture have not been developed. We report here that cultured human epidermal keratinocytes could be infected with HPV from plantar warts and that the viral DNA persisted and replicated as a stable episome. There were 50-200 copies of viral DNA per cell and there was no evidence to indicate integration of viral DNA into the cellular genome. There was also no evidence to suggest that viral DNA underwent productive replication. We conclude that cultured human epidermal keratinocytes may be a model for the study of certain aspects of HPV biology.

  9. Curcuma longa Is Able to Induce Apoptotic Cell Death of Pterygium-Derived Human Keratinocytes

    Directory of Open Access Journals (Sweden)

    Silvia Sancilio


    Full Text Available Pterygium is a relatively common eye disease that can display an aggressive clinical behaviour. To evaluate the in vitro effects of Curcuma longa on human pterygium-derived keratinocytes, specimens of pterygium from 20 patients undergoing pterygium surgical excision were collected. Pterygium explants were put into culture and derived keratinocytes were treated with an alcoholic extract of 1.3% Curcuma longa in 0.001% Benzalkonium Chloride for 3, 6, and 24 h. Cultured cells were examined for CAM5.2 (anti-cytokeratin antibody and CD140 (anti-fibroblast transmembrane glycoprotein antibody expression between 3th and 16th passage to assess cell homogeneity. TUNEL technique and Annexin-V/PI staining in flow cytometry were used to detect keratinocyte apoptosis. We showed that Curcuma longa exerts a proapoptotic effect on pterygium-derived keratinocytes already after 3 h treatment. Moreover, after 24 h treatment, Curcuma longa induces a significant increase in TUNEL as well as Annexin-V/PI positive cells in comparison to untreated samples. Our study confirms previous observations highlighting the expression, in pterygium keratinocytes, of nuclear VEGF and gives evidence for the first time to the expression of nuclear and cytoplasmic VEGF-R1. All in all, these findings suggest that Curcuma longa could have some therapeutic potential in the treatment and prevention of human pterygium.

  10. Persea americana Mill. Seed: Fractionation, Characterization, and Effects on Human Keratinocytes and Fibroblasts

    Directory of Open Access Journals (Sweden)

    Maria del R. Ramos-Jerz


    Full Text Available Methanolic avocado (Persea americana Mill., Lauraceae seed extracts were separated by preparative HSCCC. Partition and HSCCC fractions were principally characterized by LC-ESI-MS/MS analysis. Their in vitro influence was investigated on proliferation, differentiation, cell viability, and gene expression on HaCaT and normal human epidermal keratinocytes (NHEK and normal human dermal fibroblasts (NHDF. The methanol-water partition (M from avocado seeds and HSCCC fraction 3 (M.3 were mostly composed of chlorogenic acid and its isomers. Both reduced NHDF but enhanced HaCaT keratinocytes proliferation. HSCCC fraction M.2 composed of quinic acid among chlorogenic acid and its isomers inhibited proliferation and directly induced differentiation of keratinocytes as observed on gene and protein level. Furthermore, M.2 increased NHDF proliferation via upregulation of growth factor receptors. Salidrosides and ABA derivatives present in HSCCC fraction M.6 increased NHDF and keratinocyte proliferation that resulted in differentiation. The residual solvent fraction M.7 contained among low concentrations of ABA derivatives high amounts of proanthocyanidins B1 and B2 as well as an A-type trimer and stimulated proliferation of normal cells and inhibited the proliferation of immortalized HaCaT keratinocytes.

  11. Persea americana Mill. Seed: Fractionation, Characterization, and Effects on Human Keratinocytes and Fibroblasts. (United States)

    Ramos-Jerz, Maria Del R; Villanueva, Socorro; Jerz, Gerold; Winterhalter, Peter; Deters, Alexandra M


    Methanolic avocado (Persea americana Mill., Lauraceae) seed extracts were separated by preparative HSCCC. Partition and HSCCC fractions were principally characterized by LC-ESI-MS/MS analysis. Their in vitro influence was investigated on proliferation, differentiation, cell viability, and gene expression on HaCaT and normal human epidermal keratinocytes (NHEK) and normal human dermal fibroblasts (NHDF). The methanol-water partition (M) from avocado seeds and HSCCC fraction 3 (M.3) were mostly composed of chlorogenic acid and its isomers. Both reduced NHDF but enhanced HaCaT keratinocytes proliferation. HSCCC fraction M.2 composed of quinic acid among chlorogenic acid and its isomers inhibited proliferation and directly induced differentiation of keratinocytes as observed on gene and protein level. Furthermore, M.2 increased NHDF proliferation via upregulation of growth factor receptors. Salidrosides and ABA derivatives present in HSCCC fraction M.6 increased NHDF and keratinocyte proliferation that resulted in differentiation. The residual solvent fraction M.7 contained among low concentrations of ABA derivatives high amounts of proanthocyanidins B1 and B2 as well as an A-type trimer and stimulated proliferation of normal cells and inhibited the proliferation of immortalized HaCaT keratinocytes.

  12. Isorhamnetin Protects Human Keratinocytes against Ultraviolet B-Induced Cell Damage (United States)

    Han, Xia; Piao, Mei Jing; Kim, Ki Cheon; Madduma Hewage, Susara Ruwan Kumara; Yoo, Eun Sook; Koh, Young Sang; Kang, Hee Kyoung; Shin, Jennifer H; Park, Yeunsoo; Yoo, Suk Jae; Chae, Sungwook; Hyun, Jin Won


    Isorhamnetin (3-methylquercetin) is a flavonoid derived from the fruits of certain medicinal plants. This study investigated the photoprotective properties of isorhamnetin against cell damage and apoptosis resulting from excessive ultraviolet (UV) B exposure in human HaCaT keratinocytes. Isorhamnetin eliminated UVB-induced intracellular reactive oxygen species (ROS) and attenuated the oxidative modification of DNA, lipids, and proteins in response to UVB radiation. Moreover, isorhamnetin repressed UVB-facilitated programmed cell death in the keratinocytes, as evidenced by a reduction in apoptotic body formation, and nuclear fragmentation. Additionally, isorhamnetin suppressed the ability of UVB light to trigger mitochondrial dysfunction. Taken together, these results indicate that isorhamnetin has the potential to protect human keratinocytes against UVB-induced cell damage and death. PMID:26157553

  13. Exogenous hydrogen sulfide promotes cell proliferation and differentiation by modulating autophagy in human keratinocytes

    Energy Technology Data Exchange (ETDEWEB)

    Xie, Xin [Department of Dermatology, The Second Affiliated Hospital of Harbin Medical University, Harbin, 150086, Heilongjiang Province (China); Dai, Hui [Department of Cardiology, The First Affiliated Hospital of Harbin Medical University, Harbin, 150001, Heilongjiang Province (China); Zhuang, Binyu [Department of Dermatology, The Second Affiliated Hospital of Harbin Medical University, Harbin, 150086, Heilongjiang Province (China); Chai, Li; Xie, Yanguang [Institute of Dermatology of Heilongjiang Province, Harbin, 150001, Heilongjiang Province (China); Li, Yuzhen, E-mail: [Department of Dermatology, The Second Affiliated Hospital of Harbin Medical University, Harbin, 150086, Heilongjiang Province (China)


    The effects and the underlying mechanisms of hydrogen sulfide (H{sub 2}S) on keratinocyte proliferation and differentiation are still less known. In the current study, we investigated the effects and the underlying mechanisms of exogenous H{sub 2}S on keratinocyte proliferation and differentiation. Human keratinocytes (HaCaT cells) were treated with various concentrations (0.05, 0.25, 0.5 and 1 mM) of sodium hydrosulfide (NaHS, a donor of H{sub 2}S) for 24 h. A CCK-8 assay was used to assess cell viability. Western blot analysis was performed to determine the expression levels of proteins associated with differentiation and autophagy. Transmission electron microscopy was performed to observe autophagic vacuoles, and flow cytometry was applied to evaluate apoptosis. NaHS promoted the viability, induced the differentiation, and enhanced autophagic activity in a dose-dependent manner in HaCaT cells but had no effect on cell apoptosis. Blockage of autophagy by ATG5 siRNA inhibited NaHS-induced cell proliferation and differentiation. The current study demonstrated that autophagy in response to exogenous H{sub 2}S treatment promoted keratinocyte proliferation and differentiation. Our results provide additional insights into the potential role of autophagy in keratinocyte proliferation and differentiation. - Highlights: • Exogenous H{sub 2}S promotes keratinocyte proliferation and differentiation. • The effects of H{sub 2}S on proliferation and differentiation is modulated by autophagy. • Exogenous H{sub 2}S has no effect on keratinocyte apoptosis.

  14. H{sup +}/peptide transporter (PEPT2) is expressed in human epidermal keratinocytes and is involved in skin oligopeptide transport

    Energy Technology Data Exchange (ETDEWEB)

    Kudo, Michiko; Katayoshi, Takeshi; Kobayashi-Nakamura, Kumiko [DHC Corporation Laboratories, Division 2, 2-42 Hamada, Mihama-ku, Chiba 261-0025 (Japan); Akagawa, Mitsugu [Department of Biological Chemistry, Division of Applied Life Science, Graduate School of Life and Environmental Sciences, Osaka Prefecture University, 1-1 Gakuen-cho, Naka-ku, Sakai 599-8531 (Japan); Tsuji-Naito, Kentaro, E-mail: [DHC Corporation Laboratories, Division 2, 2-42 Hamada, Mihama-ku, Chiba 261-0025 (Japan)


    Peptide transporter 2 (PEPT2) is a member of the proton-coupled oligopeptide transporter family, which mediates the cellular uptake of oligopeptides and peptide-like drugs. Although PEPT2 is expressed in many tissues, its expression in epidermal keratinocytes remains unclear. We investigated PEPT2 expression profile and functional activity in keratinocytes. We confirmed PEPT2 mRNA expression in three keratinocyte lines (normal human epidermal keratinocytes (NHEKs), immortalized keratinocytes, and malignant keratinocytes) by reverse transcription-polymerase chain reaction (RT-PCR) and quantitative real-time RT-PCR. In contrast to PEPT1, PEPT2 expression in the three keratinocytes was similar or higher than that in HepG2 cells, used as PEPT2-positive cells. Immunolocalization analysis using human skin showed epidermal PEPT2 localization. We studied keratinocyte transport function by measuring the oligopeptide content using liquid chromatography/tandem mass spectrometry. Glycylsarcosine uptake in NHEKs was pH-dependent, suggesting that keratinocytes could absorb small peptides in the presence of an inward H{sup +} gradient. We also performed a skin-permeability test of several oligopeptides using skin substitute, suggesting that di- and tripeptides pass actively through the epidermis. In conclusion, PEPT2 is expressed in keratinocytes and involved in skin oligopeptide uptake. -- Highlights: •PEPT2 is expressed in keratinocytes, which are more common than other skin cells. •Immunolocalization analysis using human skin revealed epidermal PEPT2 localization. •Keratinocytes could absorb small peptides in the presence of an inward H{sup +} gradient. •Di- and tripeptide pass actively through the epidermis.

  15. Improvement of human keratinocyte migration by a redox active bioelectric dressing.

    Directory of Open Access Journals (Sweden)

    Jaideep Banerjee

    Full Text Available Exogenous application of an electric field can direct cell migration and improve wound healing; however clinical application of the therapy remains elusive due to lack of a suitable device and hence, limitations in understanding the molecular mechanisms. Here we report on a novel FDA approved redox-active Ag/Zn bioelectric dressing (BED which generates electric fields. To develop a mechanistic understanding of how the BED may potentially influence wound re-epithelialization, we direct emphasis on understanding the influence of BED on human keratinocyte cell migration. Mapping of the electrical field generated by BED led to the observation that BED increases keratinocyte migration by three mechanisms: (i generating hydrogen peroxide, known to be a potent driver of redox signaling, (ii phosphorylation of redox-sensitive IGF1R directly implicated in cell migration, and (iii reduction of protein thiols and increase in integrinαv expression, both of which are known to be drivers of cell migration. BED also increased keratinocyte mitochondrial membrane potential consistent with its ability to fuel an energy demanding migration process. Electric fields generated by a Ag/Zn BED can cross-talk with keratinocytes via redox-dependent processes improving keratinocyte migration, a critical event in wound re-epithelialization.

  16. Differential In Vitro Immortalization Capacity of Eleven, Probable High-Risk Human Papillomavirus Types

    NARCIS (Netherlands)

    Schutze, Denise M.; Snijders, Peter J. F.; Bosch, Leontien; Kramer, Duco; Meijer, Chris J. L. M.; Steenbergen, Renske D. M.

    Epidemiological studies identified 12 high-risk HPV (hrHPV) types and 8 probable/possible hrHPV types that display different cancer risks. Functional studies on transforming properties of hrHPV are mainly limited to HPV16 and -18, which induce immortalization of human foreskin keratinocytes (HFKs)

  17. Toxicity Assessment of Six Titanium Dioxide Nanoparticles in Human Epidermal Keratinocytes (United States)

    Toxicity Assessment of Six Titanium Dioxide Nanoparticles in Human Epidermal Keratinocytes Nanoparticle uptake in cells may be an important determinant of their potential cytotoxic and inflammatory effects. Six commercial TiO2 NP (A=Alfa Aesar,10nm, A*=Alfa Aesar 32nm, B=P25 27...

  18. In vitro culture of Keratinocytes from human umbilical cord blood mesenchymal stem cells: the Saigonese culture. (United States)

    Tran, Cong Toai; Huynh, Duy Thao; Gargiulo, Ciro; Nguyen, Phuong Thao; Tran, Thi Thanh Thuy; Huynh, Minh Tuan; Nguyen, Thanh Tung; Filgueira, Luis; Strong, D Micheal


    There have been many attempts to acquire and culture human keratinocytes for clinical purposes including from keratotome slices in media with fetal calf serum (FCS) or pituitary extract (PE), from skin specimens in media with feeder layers, from suction blister epidermal roofs' in serum-free culture and from human umbilical cord blood (hUCB) mesenchymal stem cells (MSCs) in media with skin feeder layers. Conversely this study was designed to investigate whether keratinocytes could be obtained directly from hUCB MSCs in vitro. It is widely established that mesenchymal stem cells from human umbilical cord blood have multipotent capacity and the ability to differentiate into disparate cell lineages hUCB MSCs were directly induced to differentiate into keratinocytes by using a specific medium composed of primary culture medium (PCM) and serum free medium (SFM) in a ratio 1:9 for a period of 7 days and tested by immunostain p63 and K1-K10. Cells thus cultured were positive in both tests, confirming the possibility to directly obtain keratinocytes from MSCs hUCB in vitro.

  19. Cytochrome P450 4A11 expression in human keratinocytes: effects of ultraviolet irradiation. (United States)

    Gonzalez, M C; Marteau, C; Franchi, J; Migliore-Samour, D


    The skin is the major interface between the body and its environment. Directly and continuously exposed to a large variety of foreign agents and stimuli such as ultraviolet radiation (UVR), cutaneous cells are active sites of intense metabolism. The cytochromes P450 (P450) are a group of enzymes that play an important part in the protective role of the skin; they are a family of microsomal membrane-bound mono-oxygenases. These haem-containing proteins catalyse the insertion of an atom of molecular oxygen into the substrate. Although generally present at low levels, a certain number of these enzymes have now been characterized in mammalian skin as constitutive or inducible isoforms. To test the effects of UVR, a source of oxidative stress, on the expression of mRNA coding for several P450 isoforms (CYP), with particular reference to the CYP2E1 and CYP4A11 isoforms, which might play a role in lipid metabolism in human keratinocytes. Human keratinocytes were cultured, irradiated and mRNA expression was analysed by gel electrophoresis after reverse transcriptase polymerase chain reactions. CYP proteins were determined from keratinocyte microsomal fractions by sodium dodecyl sulphate-polyacrylamide gel electrophoresis and immunoperoxidase staining. Thin layer chromatography was used to detect (omega-1)- and (omega)-hydroxylation of lauric acid in the microsomal fractions. mRNAs for CYP2E1, CYP1A1 and CYP3A5 were expressed in all the keratinocyte preparations tested; however, neither CYP3A4 nor CYP3A7 were detected, either in the presence or absence of UVR treatment. CYP19Aro, CYP2C19 and CYP26 were not expressed constitutively, although some induction of CYP19Aro was seen after combined UVB and UVA irradiation. CYP4A11 mRNA was not detected in any keratinocyte preparations either under control conditions or after UVB treatment. Nevertheless, in non-irradiated keratinocyte microsomes, two protein bands were immunoreactive with anti-CYP4A11 enzyme antibodies, one of which

  20. Vitamin D derivatives enhance cytotoxic effects of H2O2 or cisplatin on human keratinocytes. (United States)

    Piotrowska, Anna; Wierzbicka, Justyna; Ślebioda, Tomasz; Woźniak, Michał; Tuckey, Robert C; Slominski, Andrzej T; Żmijewski, Michał A


    Although the skin production of vitamin D is initiated by ultraviolet radiation type B (UVB), the role vitamin D plays in antioxidative or pro-oxidative responses remains to be elucidated. We have used immortalized human HaCaT keratinocytes as a model of proliferating epidermal cells to test the influence of vitamin D on cellular response to H2O2 or the anti-cancer drug, cisplatin. Incubation of keratinocytes with 1,25(OH)2D3 or its low calcemic analogues, 20(OH)D3, 21(OH)pD or calcipotriol, sensitized cells to ROS resulting in more potent inhibition of keratinocyte proliferation by H2O2 in the presence of vitamin D compounds. These results were supported by cell cycle and apoptosis analyses, and measurement of the mitochondrial transmembrane potentials (MMP), however some unique properties of individual secosteroids were observed. Furthermore, in HaCaT keratinocytes treated with H2O2, 1,25(OH)2D3, 21(OH)pD and calcipotriol stimulated the expression of SOD1 and CAT genes, but not SOD2, indicating a possible role of mitochondria in ROS-modulated cell death. 1,25(OH)2D3 also showed a short-term, protective effect on HaCaT keratinocytes, as exemplified by the inhibition of apoptosis and the maintenance of MMP. However, with prolonged incubation with H2O2 or cisplatin, 1,25(OH)2D3 caused an acceleration in the death of the keratinocytes. Therefore, we propose that lead vitamin D derivatives can protect the epidermis against neoplastic transformation secondary to oxidative or UV-induced stress through activation of vitamin D-signaling. Furthermore, our data suggest that treatment with low calcemic vitamin D analogues or the maintenance of optimal level of vitamin D by proper supplementation, can enhance the anticancer efficacy of cisplatin. Copyright © 2016 Elsevier Inc. All rights reserved.

  1. Transforming growth factor-beta isoforms regulate the surface expression of membrane cofactor protein (CD46) and CD59 on human keratinocytes [corrected

    NARCIS (Netherlands)

    Pasch, M. C.; Bos, J. D.; Daha, M. R.; Asghar, S. S.


    We studied the regulation of the expression of complement regulatory proteins, membrane cofactor protein (MCP), decay accelerating factor (DAF) and CD59, on human keratinocytes by supernatant of activated mononuclear cells and by some individual cytokines present therein. Cultured keratinocytes

  2. Formaldehyde solutions in simulated sweat increase human melanoma but not normal human keratinocyte cells proliferation. (United States)

    Rizzi, M; Cravello, B; Tonello, S; Renò, F


    Our skin is in close contact with clothes most of the time thus risking potentially noxious chemicals contact. One of the potentially harmful manufacturing by-products that can be released by textiles when sweating is formaldehyde, used as an anti-crease treatment. As it is known to be carcinogenic to humans and a potent skin sensitizer, the aim of this study was to investigate its effects on both normal human keratinocytes (HaCaT cells) and on a highly invasive malignant melanoma cell line (SK-MEL-28) in order to contribute to the definition of safety cut-off to be applied to the production processes. Formaldehyde concentrations below the commonly accepted limits (10-50μM) were obtained by diluting formaldehyde in simulated sweat (UNI EN ISO 105-E04). The effects on cell proliferation were evaluated by cell counting, while ERK pathway activation was evaluated by western blot. Low concentrations of formaldehyde (10μM) in both acidic and alkaline simulated sweat were able to increase malignant melanoma cell proliferation, while not affecting normal keratinocytes. Melanoma proliferation increase was greater in acidic (pH=5.5) than in alkaline (pH=8) conditions. Moreover, formaldehyde stimulation was able to induce ERK pathway activation. The data obtained suggest the need for an even increasing attention to the potentially harmful effects of textile manufacturing by-products. Copyright © 2016 Elsevier B.V. All rights reserved.

  3. Candida albicans phospholipomannan triggers inflammatory responses of human keratinocytes through Toll-like receptor 2. (United States)

    Li, Min; Chen, Qing; Shen, Yongnian; Liu, Weida


    The Toll-like receptors (TLRs) play an important role in the recognition of Candida albicans components and activation of innate immunity. Phospholipomannan (PLM), a glycolipid, is expressed at the surface of C. albicans cell wall, which acts as a member of the pathogen-associated molecular patterns family. In this study, we sought to clarify whether C. albicans-native PLM could induce an inflammation response in human keratinocytes and to determine the underlying mechanisms. Exposure of cultured human primary keratinocytes to PLM led to the increased gene expression and secretion of proinflammatory cytokines (IL-6) and chemokines (IL-8). PLM hydrolysed with beta-d-mannoside mannohydrolase failed to induce gene expression and secretion of IL-6 and IL-8. PLM up-regulated the mRNA and protein levels of TLR2, whereas the mRNA level of TLR4 was not altered. Keratinocytes challenged with PLM resulted in the activation of NF-kappaB and mitogen-activated protein kinase (MAPKs) including p38. Anti-TLR2 neutralizing antibody, NFkappaB and p38MAPK inhibitors blocked the PLM-induced secretion of IL-6, IL-8 in keratinocytes, but no such effect was observed in pretreatment with anti-TLR4-neutralizing antibody and lipopolysaccharide inhibitor (polymyxin B). These data suggest C. albicans-native PLM may contribute to the inflammatory responses of cutaneous candidiasis in the TLR2-NF-kappaB and p38MAPK signalling pathway dependent manner.

  4. In vitro toxicity of photodynamic antimicrobial chemotherapy on human keratinocytes proliferation. (United States)

    Migliario, Mario; Rizzi, Manuela; Rocchetti, Vincenzo; Cannas, Mario; Renò, Filippo


    This in vitro experimental study has been designed to assess the effects of photodynamic antimicrobial chemotherapy (PACT) on human keratinocytes proliferation. Human keratinocytes (HaCaT) monolayers (∼0.5 cm(2)) have been irradiated with 635 nm red laser light with a fluence of 82.5 or 112.5 J/cm(2) in the absence or presence of toluidine (TB). Cell proliferation, monolayer area coverage, cytokeratin 5 (K5) and filaggrin (Fil) expression, and metalloproteinase (MMP)-2 and MMP-9 activity were measured after 72 h from laser irradiation. HaCaT proliferation was reduced by TB staining. Cell exposure to both low- and high-fluence laser irradiation in both presence and absence of TB staining reduced their proliferation and monolayer area extension. Moreover both laser treatments were able to reduce K5 and Fil expression and MMP-9 production in keratinocytes not treated with TB. These data indicate that PACT could exert toxic effects on normal proliferating keratinocytes present around parodontal pockets. The observed reduced cell proliferation along with a reduced production of enzymes involved in wound healing could alter the clinical outcome of the patients treated with PACT.

  5. Analysis of aquaporin 9 expression in human epidermis and cultured keratinocytes (United States)

    Sugiyama, Yoshinori; Yamazaki, Kohei; Kusaka-Kikushima, Ayumi; Nakahigashi, Kyoko; Hagiwara, Hiromi; Miyachi, Yoshiki


    Aquaporin 9 (AQP9) is a member of the aquaglyceroporin family that transports glycerol, urea and other small solutes as well as water. Compared to the expression and function in epidermal keratinocytes of AQP3, another aquaglyceroporin, our knowledge of epidermal AQP9 remains elusive. In this study, we investigated the expression of AQP9 in the human epidermis and cultured keratinocytes. Immunofluorescence studies revealed that AQP9 expression is highly restricted to the stratum granulosum of the human epidermis, where occludin is also expressed at the tight junctions. Interestingly, the AQP3 staining decreased sharply below the cell layers in which AQP9 is expressed. In cultured normal human epidermal keratinocytes (NHEK), knock-down of AQP9 expression in the differentiated cells induced by RNA interference reduced glycerol uptake, which was not as pronounced as was the case with AQP3 knock-down cells. In contrast, similar reduction of urea uptake was detected in AQP9 and AQP3 knock-down cells. These findings suggested that AQP9 expression in NHEK facilitates at least the transport of glycerol and urea. Finally, we analyzed the effect of retinoic acid (RA), a potent stimulator of keratinocyte proliferation, on AQP3 and AQP9 mRNA expression in differentiated NHEK. Stimulation with RA at 1 μM for 24 h augmented AQP3 expression and down-regulated AQP9 expression. Collectively, these results indicate that AQP9 expression in epidermal keratinocytes is regulated in a different manner from that of AQP3. PMID:25161869

  6. 5-fluorouracil Toxicity Mechanism Determination in Human Keratinocytes: in vitro Study on HaCaT

    Directory of Open Access Journals (Sweden)

    Jan Hartinger


    Full Text Available 5-fluorouracil (5-FU and capecitabine therapy is often accompanied by palmar-plantar erythrodysesthesia (PPE which is manifestation of 5-FU toxicity in keratinocytes. The main mechanisms of 5-FU action are thymidylate synthase (TS inhibition which can be abrogated by thymidine and strengthened by calciumfolinate (CF and incorporation of fluorouridinetriphosphate into RNA which can be abrogated by uridine. For proper PPE treatment 5-FU mechanism of action in keratinocytes needs to be elucidated. We used the 5-FU toxicity modulators uridine, thymidine and CF to discover the mechanism of 5-FU action in human keratinocyte cell line HaCaT. To measure the cellular viability, we used MTT test and RTCA test. CF did not augment 5-FU toxicity and 5-FU toxicity was weakened by uridine. Therefore, the primary mechanism of 5-FU toxicity in keratinocytes is 5-FU incorporation into RNA. The uridine protective effect cannot fully develop in the presence of CF. Thymidine addition to 5-FU and uridine treated cells not only prevents the toxicity-augmenting CF effect but it also prolongs the 5-FU treated cells survival in comparison to uridine only. Therefore, it can be assumed that in the presence of uridine the 5-FU toxicity mechanism is switched from RNA incorporation to TS inhibition. Although particular 5-FU toxicity mechanisms were previously described in various cell types, this is the first time when various combinations of pyrimidine nucleosides and CF were used for 5-FU toxicity mechanism elucidation in human keratinocytes. We suggest that for PPE treatment ointment containing uridine and thymidine should be further clinically tested.

  7. Chemical allergens stimulate human epidermal keratinocytes to produce lymphangiogenic vascular endothelial growth factor

    Energy Technology Data Exchange (ETDEWEB)

    Bae, Ok-Nam [College of Pharmacy, Institute of Pharmaceutical Science and Technology, Hanyang University, Ansan 426-791 (Korea, Republic of); Ahn, Seyeon; Jin, Sun Hee; Hong, Soo Hyun; Lee, Jinyoung [College of Pharmacy, Natural Products Research Institute, Seoul National University, Seoul 151-742 (Korea, Republic of); Kim, Eun-Sun [College of Pharmacy, Institute of Pharmaceutical Science and Technology, Hanyang University, Ansan 426-791 (Korea, Republic of); Jeong, Tae Cheon [College of Pharmacy, Yeungnam University, Gyeongsan 712-749 (Korea, Republic of); Chun, Young-Jin [College of Pharmacy, Chung-Ang University, Seoul 156-756 (Korea, Republic of); Lee, Ai-Young, E-mail: [Department of Dermatology, Dongguk University Ilsan Hospital, Goyang 410-773 (Korea, Republic of); Noh, Minsoo, E-mail: [College of Pharmacy, Natural Products Research Institute, Seoul National University, Seoul 151-742 (Korea, Republic of)


    Allergic contact dermatitis (ACD) is a cell-mediated immune response that involves skin sensitization in response to contact with various allergens. Angiogenesis and lymphangiogenesis both play roles in the allergic sensitization process. Epidermal keratinocytes can produce vascular endothelial growth factor (VEGF) in response to UV irradiation and during wound healing. However, the effect of haptenic chemical allergens on the VEGF production of human keratinocytes, which is the primary contact site of toxic allergens, has not been thoroughly researched. We systematically investigated whether immune-regulatory cytokines and chemical allergens would lead to the production of VEGF in normal human keratinocytes (NHKs) in culture. VEGF production significantly increased when NHKs were treated with IFNγ, IL-1α, IL-4, IL-6, IL-17A, IL-22 or TNFα. Among the human sensitizers listed in the OECD Test Guideline (TG) 429, we found that CMI/MI, DNCB, 4-phenylenediamine, cobalt chloride, 2-mercaptobenzothiazole, citral, HCA, cinnamic alcohol, imidazolidinyl urea and nickel chloride all significantly upregulated VEGF production in NHKs. In addition, common human haptenic allergens such as avobenzone, formaldehyde and urushiol, also induced the keratinocyte-derived VEGF production. VEGF upregulation by pro-inflammatory stimuli, IFNγ, DNCB or formaldehyde is preceded by the production of IL-8, an acute inflammatory phase cytokine. Lymphangiogenic VEGF-C gene transcription was significantly increased when NHKs were treated with formaldehyde, DNCB or urushiol, while transcription of VEGF-A and VEGF-B did not change. Therefore, the chemical allergen-induced VEGF upregulation is mainly due to the increase in lymphangiogenic VEGF-C transcription in NHKs. These results suggest that keratinocyte-derived VEGF may regulate the lymphangiogenic process during the skin sensitization process of ACD. - Highlights: • Pro-inflammatory cytokines induced VEGF production in normal human

  8. TCDD induces dermal accumulation of keratinocyte-derived matrix metalloproteinase-10 in an organotypic model of human skin

    Energy Technology Data Exchange (ETDEWEB)

    De Abrew, K. Nadira [Molecular and Environmental Toxicology Center, University of Wisconsin—Madison, Madison, WI 53706 (United States); Thomas-Virnig, Christina L.; Rasmussen, Cathy A. [Department of Pathology, University of Wisconsin—Madison, Madison, WI 53706 (United States); Bolterstein, Elyse A. [Molecular and Environmental Toxicology Center, University of Wisconsin—Madison, Madison, WI 53706 (United States); Schlosser, Sandy J. [Department of Pathology, University of Wisconsin—Madison, Madison, WI 53706 (United States); Allen-Hoffmann, B. Lynn, E-mail: [Molecular and Environmental Toxicology Center, University of Wisconsin—Madison, Madison, WI 53706 (United States); Department of Pathology, University of Wisconsin—Madison, Madison, WI 53706 (United States)


    The epidermis of skin is the first line of defense against the environment. A three dimensional model of human skin was used to investigate tissue-specific phenotypes induced by the environmental contaminant, 2,3,7,8-tetrachlorodibenzo-p-dioxin (TCDD). Continuous treatment of organotypic cultures of human keratinocytes with TCDD resulted in intracellular spaces between keratinocytes of the basal and immediately suprabasal layers as well as thinning of the basement membrane, in addition to the previously reported hyperkeratinization. These tissue remodeling events were preceded temporally by changes in expression of the extracellular matrix degrading enzyme, matrix metalloproteinase-10 (MMP-10). In organotypic cultures MMP-10 mRNA and protein were highly induced following TCDD treatment. Q-PCR and immunoblot results from TCDD-treated monolayer cultures, as well as indirect immunofluorescence and immunoblot analysis of TCDD-treated organotypic cultures, showed that MMP-10 was specifically contributed by the epidermal keratinocytes but not the dermal fibroblasts. Keratinocyte-derived MMP-10 protein accumulated over time in the dermal compartment of organotypic cultures. TCDD-induced epidermal phenotypes in organotypic cultures were attenuated by the keratinocyte-specific expression of tissue inhibitor of metalloproteinase-1, a known inhibitor of MMP-10. These studies suggest that MMP-10 and possibly other MMP-10-activated MMPs are responsible for the phenotypes exhibited in the basement membrane, the basal keratinocyte layer, and the cornified layer of TCDD-treated organotypic cultures. Our studies reveal a novel mechanism by which the epithelial–stromal microenvironment is altered in a tissue-specific manner thereby inducing structural and functional pathology in the interfollicular epidermis of human skin. - Highlights: • TCDD causes hyperkeratosis and basement membrane changes in a model of human skin. • TCDD induces MMP-10 expression in organotypic cultures

  9. Replacement of murine fibroblasts by human fibroblasts irradiated in obtaining feeder layer for the culture of human keratinocytes

    Energy Technology Data Exchange (ETDEWEB)

    Yoshito, Daniele; Sufi, Bianca S.; Santin, Stefany P.; Mathor, Monica B. [Instituto de Pesquisas Energeticas e Nucleares (IPEN/CNEN-SP), Sao Paulo, SP (Brazil); Altran, Silvana C.; Isaac, Cesar [Universidade Sao Paulo (USP), Sao Paulo, SP (Brazil). Fac. de Medicina. Lab. de Microcirurgia Plastica; Esteves-Pedro, Natalia M. [Universidade Sao Paulo (USP), Sao Paulo, SP (Brazil). Fac. de Ciencias Farmaceuticas. Lab. de Controle Biologico; Herson, Marisa R. [DonorTissue Bank of Victoria (Australia)


    Human autologous epithelia cultivated in vitro, have been used successfully in treating damage to skin integrity. The methodology allowed the cultivation of these epithelia was described by Rheinwald and Green in 1975, this methodology consisted in seeding keratinocytes onto a feeder layer composed of lineage 3T3 murine fibroblasts, the proliferation rate is controlled through the action of ionizing radiation. However, currently there is a growing concern about the possibility of transmitting prions and murine viruses to transplanted patients. Taking into account this concern, in this present work, we replaced the feeder layer originally composed of murine fibroblasts by human fibroblasts. To obtain this new feeder layer was necessary to standardize the enough irradiation dose to inhibit the replication of human fibroblasts and the verification of effectiveness of the development of keratinocytes culture on a feeder layer thus obtained. According to the obtained results we can verify that the human fibroblasts irradiated at various tested doses (60, 70, 100, 200, 250 and 300 Gy) had their mitotic activity inactivated by irradiation, allowing the use of any of these doses to confection of the feeder layer, since these fibroblasts irradiated still showed viable until fourteen days of cultivation. In the test of colony formation efficiency was observed that keratinocytes seeded on irradiated human fibroblasts were able to develop satisfactorily, preserving their clonogenic potential. Therefore it was possible the replacement of murine fibroblasts by human fibroblasts in confection of the feeder layer, in order to eliminate this xenobiotic component of the keratinocytes culture. (author)

  10. Infection of human keratinocytes by Streptococcus dysgalactiae subspecies dysgalactiae isolated from milk of the bovine udder. (United States)

    Roma-Rodrigues, Catarina; Alves-Barroco, Cynthia; Raposo, Luís R; Costa, Mafalda N; Fortunato, Elvira; Baptista, Pedro Viana; Fernandes, Alexandra R; Santos-Sanches, Ilda


    Streptococcus dysgalactiae subsp. dysgalactiae (SDSD) are considered exclusive animal pathogens; however, a putative zoonotic upper limb cellulitis, a prosthetic joint infection and an infective endocarditis were described in humans. To unravel if bovine SDSD isolates are able to infect human cells, the adherence and internalization to human primary keratinocytes of two bovine SDSD strains isolated from milk collected from udder were analyzed. Bacterial adhesion assays and confocal microscopy indicate a high adherence and internalization of SDSD isolates to human cells, suggesting for the first time the ability of bovine isolates to infect human cells. Copyright © 2015 Institut Pasteur. Published by Elsevier Masson SAS. All rights reserved.

  11. Human papillomavirus (HPV upregulates the cellular deubiquitinase UCHL1 to suppress the keratinocyte's innate immune response.

    Directory of Open Access Journals (Sweden)

    Rezaul Karim

    Full Text Available Persistent infection of basal keratinocytes with high-risk human papillomavirus (hrHPV may cause cancer. Keratinocytes are equipped with different pattern recognition receptors (PRRs but hrHPV has developed ways to dampen their signals resulting in minimal inflammation and evasion of host immunity for sustained periods of time. To understand the mechanisms underlying hrHPV's capacity to evade immunity, we studied PRR signaling in non, newly, and persistently hrHPV-infected keratinocytes. We found that active infection with hrHPV hampered the relay of signals downstream of the PRRs to the nucleus, thereby affecting the production of type-I interferon and pro-inflammatory cytokines and chemokines. This suppression was shown to depend on hrHPV-induced expression of the cellular protein ubiquitin carboxyl-terminal hydrolase L1 (UCHL1 in keratinocytes. UCHL1 accomplished this by inhibiting tumor necrosis factor receptor-associated factor 3 (TRAF3 K63 poly-ubiquitination which lead to lower levels of TRAF3 bound to TANK-binding kinase 1 and a reduced phosphorylation of interferon regulatory factor 3. Furthermore, UCHL1 mediated the degradation of the NF-kappa-B essential modulator with as result the suppression of p65 phosphorylation and canonical NF-κB signaling. We conclude that hrHPV exploits the cellular protein UCHL1 to evade host innate immunity by suppressing PRR-induced keratinocyte-mediated production of interferons, cytokines and chemokines, which normally results in the attraction and activation of an adaptive immune response. This identifies UCHL1 as a negative regulator of PRR-induced immune responses and consequently its virus-increased expression as a strategy for hrHPV to persist.

  12. Human papillomavirus type 16 E6 and NFX1-123 mislocalize immune signaling proteins and downregulate immune gene expression in keratinocytes.

    Directory of Open Access Journals (Sweden)

    Justine Levan

    Full Text Available Human papillomavirus (HPV is the most prevalent sexually transmitted infection, affecting an estimated 11% of the world's population. The high-risk HPV types (HR HPV account for approximately 5% of the global burden of cancer and thus cause high morbidity and mortality. Although it is known that persistent infection with HR HPV is the greatest risk factor for developing HPV-associated cancer, and that the HPV early proteins E6 and E7 dysregulate immune detection by its host cells, the mechanisms of immune evasion by HR HPV are not well understood. Previous work in the laboratory identified the endogenous cytoplasmic host protein NFX1-123 as a binding partner of the HR HPV type 16 oncoprotein E6 (16E6. Together NFX1-123 and 16E6 affect cellular growth, differentiation, and immortalization genes and pathways. In a whole genome microarray, human foreskin keratinocytes (HFKs stably expressing 16E6 and overexpressing NFX1-123 showed a diverse set of innate immune genes downregulated two-fold or more when compared to 16E6 cells with endogenous NFX1-123. We demonstrated that 16E6 and NFX1-123 decreased expression of pro-inflammatory cytokines and interferon-stimulated genes (ISGs in 16E6 HFKs at the mRNA and protein level. Knock down of NFX1-123 in 16E6 HFKs resulted in a derepression of innate immune genes, pointing to the requirement of NFX1-123 for immune regulation in the context of 16E6. Studies using immunofluorescent microscopy revealed that 16E6 and NFX1-123 disturbed the normal localization of signaling proteins involved in initiating the immune response. This study identifies NFX1-123 as a critical host protein partner through which 16E6 is able to subvert the immune response and in turn permit a long-lived HR HPV infection.

  13. Human papillomavirus type 16 E6 and NFX1-123 mislocalize immune signaling proteins and downregulate immune gene expression in keratinocytes. (United States)

    Levan, Justine; Vliet-Gregg, Portia A; Robinson, Kristin L; Katzenellenbogen, Rachel A


    Human papillomavirus (HPV) is the most prevalent sexually transmitted infection, affecting an estimated 11% of the world's population. The high-risk HPV types (HR HPV) account for approximately 5% of the global burden of cancer and thus cause high morbidity and mortality. Although it is known that persistent infection with HR HPV is the greatest risk factor for developing HPV-associated cancer, and that the HPV early proteins E6 and E7 dysregulate immune detection by its host cells, the mechanisms of immune evasion by HR HPV are not well understood. Previous work in the laboratory identified the endogenous cytoplasmic host protein NFX1-123 as a binding partner of the HR HPV type 16 oncoprotein E6 (16E6). Together NFX1-123 and 16E6 affect cellular growth, differentiation, and immortalization genes and pathways. In a whole genome microarray, human foreskin keratinocytes (HFKs) stably expressing 16E6 and overexpressing NFX1-123 showed a diverse set of innate immune genes downregulated two-fold or more when compared to 16E6 cells with endogenous NFX1-123. We demonstrated that 16E6 and NFX1-123 decreased expression of pro-inflammatory cytokines and interferon-stimulated genes (ISGs) in 16E6 HFKs at the mRNA and protein level. Knock down of NFX1-123 in 16E6 HFKs resulted in a derepression of innate immune genes, pointing to the requirement of NFX1-123 for immune regulation in the context of 16E6. Studies using immunofluorescent microscopy revealed that 16E6 and NFX1-123 disturbed the normal localization of signaling proteins involved in initiating the immune response. This study identifies NFX1-123 as a critical host protein partner through which 16E6 is able to subvert the immune response and in turn permit a long-lived HR HPV infection.

  14. Effect of 1,24R-dihydroxyvitamin D3 on the growth of human keratinocytes.

    LENUS (Irish Health Repository)

    Matsumoto, K


    The effect of 1,24R-dihydroxyvitamin D3 (1,24R(OH)2D3), a synthetic analogue of a biologically active form of vitamin D3 (1,25-dihydroxyvitamin D3, 1,25(OH)2D3), on the growth of human keratinocytes cultured in serum-free medium was investigated. The growth of cultured normal human keratinocytes was inhibited by 65% by 10(-8)M 1,24R(OH)2D3 and by 90% by 10(-7)M 1,24(OH)2D3. It inhibited cell growth almost completely at 10(-6)M. The DNA synthesis of keratinocytes was also inhibited with 1,24R(OH)2D3 by 27% at 10(-8)M, 59% at 10(-7)M, and 92% at 10(-6)M. The inhibition of cell growth and DNA synthesis were more remarkable by 1,24R(OH)2D3 than by 1,25(OH)2D3. 1,24R(OH)2D3 also inhibited the growth of keratinocytes derived from patients with psoriasis vulgaris; the growth inhibitory effect was again more remarkable with 1,24R(OH)2D3 than with 1,25(OH)2D3. The viability and protein synthesis of keratinocytes were not affected by 1,24R(OH)2D3, suggesting that the growth inhibitory effect is due to its biological activity, not to cytotoxicity. The binding of [3H]-labeled 1,25(OH)2D3 to its receptor in the cytosolic fraction of cultured keratinocytes was competitively substituted by unlabeled 1,24R(OH)2D3 as well as 1,25(OH)2D3, suggesting that 1,24R(OH)2D3 binds to the 1,25(OH)2D3 receptor. It was found that the affinity of 1,24R(OH)2D3 for the receptor was slightly higher than that of 1,25(OH)2D3. These results demonstrate that 1,24R(OH)2D3 functions as a potent growth inhibitor in vitro in human keratinocytes from both normal and psoriatic epidermis, and it possesses a higher affinity for the 1,25(OH)2D3 receptor in cultured human keratinocytes. The difference in affinity of 1,24R(OH)2D3 for the 1,25(OH)2D3 receptor correlates with its greater inhibition of keratinocyte growth than 1,25(OH)2D3. 1,24R(OH)2D3 may be useful in the treatment of psoriasis.

  15. Kanglaite attenuates UVB-induced down-regulation of aquaporin-3 in cultured human skin keratinocytes (United States)



    Ultraviolet (UV) radiation plays an important role in the pathogenesis of skin photoaging. Depending on the wavelength of UV, the epidermis is affected primarily by UVB. One major characteristic of photoaging is the dehydration of the skin. Membrane-inserted water channels (aquaporins) are involved in this process. In this study we demonstrated that UVB radiation induced aquaporin-3 (AQP3) down-regulation in cultured human skin keratinocytes. Kanglaite is a mixture consisting of extractions of Coix Seed, which is an effective anti-neoplastic agent and can inhibit the activities of protein kinase C and NF-κB. We demonstrated that Kanglaite inhibited UVB-induced AQP3 down-regulation of cultured human skin keratinocytes. Our findings provide a potential new agent for anti-photoaging. The related molecular mechanisms remain to be further elucidated. PMID:22211241

  16. Phototoxic effects of Hypericum extract in cultures of human keratinocytes compared with those of psoralen. (United States)

    Bernd, A; Simon, S; Ramirez Bosca, A; Kippenberger, S; Diaz Alperi, J; Miquel, J; Villalba Garcia, J F; Pamies Mira, D; Kaufmann, R


    Extracts of Hypericum perforatum (St. John's wort) are used in the treatment of depression. They contain the plant pigment hypericin and hypericin derivates. These compounds have light-dependent activities. In order to estimate the potential risk of phototoxic skin damage during antidepressive therapy, we investigated the phototoxic activity of hypericin extract using cultures of human keratinocytes and compared it with the effect of the well-known phototoxic agent psoralen. The absorbance spectrum of our Hypericum extract revealed maxima in the whole UV range and in parts of the visible range. We cultivated human keratinocytes in the presence of different Hypericum concentrations and irradiated the cells with 150 mJ/cm2 UVB, 1 J/cm2 UVA or 3 h with a white light of photon flux density 2.6 mumol m-2 s-1. The determination of the bromodeoxyuridine incorporation rate showed a concentration- and light-dependent decrease in DNA synthesis with high hypericin concentrations (> or = 50 micrograms/mL) combined with UVA or visible light radiation. In the case of UVB irradiation a clear phototoxic cell reaction was not detected. We found phototoxic effects even with 10 ng/mL psoralen using UVA with the same study design as in the case of the Hypericum extract. These results confirm the phototoxic activity of Hypericum extract on human keratinocytes. However, the blood levels that are to be expected during antidepressive therapy are presumably too low to induce phototoxic skin reactions.

  17. In Vitro Cytotoxicity and Phototoxicity Assessment of Acylglutamate Surfactants Using a Human Keratinocyte Cell Line

    Directory of Open Access Journals (Sweden)

    Abhay Kyadarkunte


    Full Text Available In the current study, human keratinocyte cell line was used as in vitro cell culture model to elucidate the effects of the fatty acid chain length of acylglutamate (amino acid-based surfactant namely, sodium cocoyl glutamate, sodium lauroyl glutamate, and sodium myristoyl glutamate on their cytotoxicity and the ultraviolet B induced phototoxicity. The endpoint used to assess toxicity was a tetrazolium-based assay whereas, the phototoxic potential of acylglutamate surfactants was predicted using two models namely, the Photo-Irritation Factor and Mean Photo Effect. The results of this study showed that the fatty acid chain length of acylglutamate greatly influences toxic effects on human keratinocyte cells. In addition, all the acylglutamate surfactants tested on human keratinocyte cells demonstrated significantly less cytotoxicity (when irradiated and non-irradiated with ultraviolet B light; p < 0.05 and no phototoxic potential was observed in any of the acylglutamate surfactants, when compared with the positive control chlorpromazine. In conclusion, the in vitro studies confirm the suitability of sodium lauroyl glutamate destined for the synthesis and stabilization of lipid nanoparticles.

  18. Primary cell culture from human oral tissue: gingival keratinocytes,gingival fibroblasts and periodontal ligament fibroblasts

    Directory of Open Access Journals (Sweden)

    Supreya Wanichpakorn


    Full Text Available Primary cell culture of human oral tissue has many applications for oral biology research. There are two techniques in primary culture, which includes the enzymatic and direct explant technique. The objectives of this study were (1 to isolate and investigate the difference in percentage the success in culturing three cell types from human oral tissue: gingival keratinocytes, gingival fibroblasts and periodontal ligament fibroblasts by using the direct explant technique; (2 to compare the effect of sex and age on the success of tissue culturing. Twenty seven tissue samples were obtained from healthy human gingival tissue, 19 female and 8 male patients aged 14-67 years (37.7±17.5. The tissue was cut into 1x1 mm pieces and placed on plastic culture plates containing Dulbecco’s Modified Eagle’s Medium supplemented with 10% fetal calf serum, 100 U/ml penicillin, 100 µg/ml streptomycin and 1% amphotericin B. For the keratinocytes culture, after the epithelial cells started to multiply around the gingival origin and the diameter was 2-5 mm., the fibroblasts were liminated by mechanical removal under inverted microscope to prevent fibroblast overgrowth and the medium was changed to keratinocyte-SFM (Gibco, BRL supplemented with 5 µg/ml gentamycin. The results revealed that gingival fibroblast gave the highest success rate in culture (96.3%, followed by gingival keratinocytes (88.9% and periodontal ligament fibroblasts (81.5%. There was no significant difference in the success rate of cultivation between younger and older individuals, as between sex of the subjects (p>0.05. The risk of failure in culture techniques is mainly caused by microbiological contamination from the tissue samples.

  19. Histamine suppresses epidermal keratinocyte differentiation and impairs skin barrier function in a human skin model (United States)

    Gschwandtner, M; Mildner, M; Mlitz, V; Gruber, F; Eckhart, L; Werfel, T; Gutzmer, R; Elias, P M; Tschachler, E


    Background Defects in keratinocyte differentiation and skin barrier are important features of inflammatory skin diseases like atopic dermatitis. Mast cells and their main mediator histamine are abundant in inflamed skin and thus may contribute to disease pathogenesis. Methods Human primary keratinocytes were cultured under differentiation-promoting conditions in the presence and absence of histamine, histamine receptor agonists and antagonists. The expression of differentiation-associated genes and epidermal junction proteins was quantified by real-time PCR, Western blot, and immunofluorescence labeling. The barrier function of human skin models was tested by the application of biotin as tracer molecule. Results The addition of histamine to human keratinocyte cultures and organotypic skin models reduced the expression of the differentiation-associated proteins keratin 1/10, filaggrin, and loricrin by 80–95%. Moreover, the addition of histamine to skin models resulted in the loss of the granular layer and thinning of the epidermis and stratum corneum by 50%. The histamine receptor H1R agonist, 2-pyridylethylamine, suppressed keratinocyte differentiation to the same extent as did histamine. Correspondingly, cetirizine, an antagonist of H1R, virtually abrogated the effect of histamine. The expression of tight junction proteins zona occludens-1, occludin, claudin-1, and claudin-4, as well as that of desmosomal junction proteins corneodesmosin and desmoglein-1, was down-regulated by histamine. The tracer molecule biotin readily penetrated the tight junction barrier of skin cultures grown in the presence of histamine, while their diffusion was completely blocked in nontreated controls. Conclusions Our findings suggest a new mechanism by which mast cell activation and histamine release contribute to skin barrier defects in inflammatory skin diseases. PMID:23157658

  20. A Sensitive Sensor Cell Line for the Detection of Oxidative Stress Responses in Cultured Human Keratinocytes

    Directory of Open Access Journals (Sweden)

    Ute Hofmann


    Full Text Available In the progress of allergic and irritant contact dermatitis, chemicals that cause the generation of reactive oxygen species trigger a heat shock response in keratinocytes. In this study, an optical sensor cell line based on cultured human keratinocytes (HaCaT cells expressing green fluorescent protein (GFP under the control of the stress-inducible HSP70B’ promoter were constructed. Exposure of HaCaT sensor cells to 25 µM cadmium, a model substance for oxidative stress induction, provoked a 1.7-fold increase in total glutathione and a ~300-fold induction of transcript level of the gene coding for heat shock protein HSP70B’. An extract of Arnica montana flowers resulted in a strong induction of the HSP70B’ gene and a pronounced decrease of total glutathione in keratinocytes. The HSP70B’ promoter-based sensor cells conveniently detected cadmium-induced stress using GFP fluorescence as read-out with a limit of detection of 6 µM cadmium. In addition the sensor cells responded to exposure of cells to A. montana extract with induction of GFP fluorescence. Thus, the HaCaT sensor cells provide a means for the automated detection of the compromised redox status of keratinocytes as an early indicator of the development of human skin disorders and could be applied for the prediction of skin irritation in more complex in vitro 3D human skin models and in the development of micro-total analysis systems (µTAS that may be utilized in dermatology, toxicology, pharmacology and drug screenings.

  1. Permeability barrier properties of oral keratinocyte cultures: a model of intact human oral mucosa. (United States)

    Selvaratnam, L; Cruchley, A T; Navsaria, H; Wertz, P W; Hagi-Pavli, E P; Leigh, I M; Squier, C A; Williams, D M


    The aim of this study was to establish whether an in vitro model of human oral mucosa had similar permeability characteristics to normal oral mucosa. Such a model would have considerable value as an alternative to the use of mucosal biopsies in studies of transmucosal drug delivery. Keratinocytes obtained from buccal mucosa, hard palate and abdominal skin were seeded onto inert collagen membranes (Cellagen Discs) or dead de-epidermised dermis (DDED) and grown either as submerged or air-liquid interface cultures. Subsequently the ultrastructural characteristics, permeability to water and barrier lipid content of the epithelial cultures were assessed and compared with samples of intact mucosa and skin. All the cultures stratified into multilayered epithelia and displayed features of differentiation including tonofilaments, desmosomes and membrane coating granules. The permeability characteristics and barrier lipid content of the oral mucosal cultures resembled those of intact mucosa. By contrast, epidermal keratinocytes failed to produce a permeability barrier comparable with that of skin and had low levels of barrier associated lipids. Cultures of human oral mucosal keratinocytes obtained from healthy adults develop similar permeability properties and barrier lipid composition to their site of origin. This model system may be useful for the evaluation of local and systemic oral mucosal drug delivery.

  2. Peroxiredoxin 2 nuclear levels are regulated by circadian clock synchronization in human keratinocytes. (United States)

    Avitabile, Daniele; Ranieri, Danilo; Nicolussi, Arianna; D'Inzeo, Sonia; Capriotti, Anna Laura; Genovese, Licia; Proietti, Sara; Cucina, Alessandra; Coppa, Anna; Samperi, Roberto; Bizzarri, Mariano; Laganà, Aldo; Torrisi, Maria Rosaria


    Circadian rhythms are highly conserved time tracking systems regulating important biological processes at both systemic and cellular levels. The present study was aimed to identify proteins and biological functions circadian regulated in human keratinocytes. HaCaT keratinocytes were entrained by temperature cycles, and a proteomic study was performed on cell fractions isolated under free running conditions at constant temperature. Bioinformatics analysis revealed that molecular clock entrainment was associated with changes in molecular components regulating cell proliferation, energy metabolism, transcription, translation and redox balance. Nuclear levels of the antioxidant enzyme Peroxiredoxin 2 (PRDX2) were found to oscillate rhythmically over two entire 24h long cycles. Donwregulation of PRDX2 resulted in upregulation of the mitochondrion-specific Peroxiredoxin 3 (PRDX3), all other members of the Peroxiredoxin family remained unaltered. Furthermore, PRDX2 knockdown increased intracellular levels of reactive oxygen species (ROS) and impaired cell cycle progression and proliferation. HaCaT cells transduced with a scramble shRNA were used as control. Our work is the first to show that nuclear levels of PRDX2 display circadian oscillation participating in the regulation of human keratinocytes redox balance. Copyright © 2014 Elsevier Ltd. All rights reserved.

  3. In vitro human keratinocyte migration rates are associated with SNPs in the KRT1 interval.

    Directory of Open Access Journals (Sweden)

    Heng Tao

    Full Text Available Efforts to develop effective therapeutic treatments for promoting fast wound healing after injury to the epidermis are hindered by a lack of understanding of the factors involved. Re-epithelialization is an essential step of wound healing involving the migration of epidermal keratinocytes over the wound site. Here, we examine genetic variants in the keratin-1 (KRT1 locus for association with migration rates of human epidermal keratinocytes (HEK isolated from different individuals. Although the role of intermediate filament genes, including KRT1, in wound activated keratinocytes is well established, this is the first study to examine if genetic variants in humans contribute to differences in the migration rates of these cells. Using an in vitro scratch wound assay we observe quantifiable variation in HEK migration rates in two independent sets of samples; 24 samples in the first set and 17 samples in the second set. We analyze genetic variants in the KRT1 interval and identify SNPs significantly associated with HEK migration rates in both samples sets. Additionally, we show in the first set of samples that the average migration rate of HEK cells homozygous for one common haplotype pattern in the KRT1 interval is significantly faster than that of HEK cells homozygous for a second common haplotype pattern. Our study demonstrates that genetic variants in the KRT1 interval contribute to quantifiable differences in the migration rates of keratinocytes isolated from different individuals. Furthermore we show that in vitro cell assays can successfully be used to deconstruct complex traits into simple biological model systems for genetic association studies.

  4. In vitro human keratinocyte migration rates are associated with SNPs in the KRT1 interval. (United States)

    Tao, Heng; Berno, Anthony J; Cox, David R; Frazer, Kelly A


    Efforts to develop effective therapeutic treatments for promoting fast wound healing after injury to the epidermis are hindered by a lack of understanding of the factors involved. Re-epithelialization is an essential step of wound healing involving the migration of epidermal keratinocytes over the wound site. Here, we examine genetic variants in the keratin-1 (KRT1) locus for association with migration rates of human epidermal keratinocytes (HEK) isolated from different individuals. Although the role of intermediate filament genes, including KRT1, in wound activated keratinocytes is well established, this is the first study to examine if genetic variants in humans contribute to differences in the migration rates of these cells. Using an in vitro scratch wound assay we observe quantifiable variation in HEK migration rates in two independent sets of samples; 24 samples in the first set and 17 samples in the second set. We analyze genetic variants in the KRT1 interval and identify SNPs significantly associated with HEK migration rates in both samples sets. Additionally, we show in the first set of samples that the average migration rate of HEK cells homozygous for one common haplotype pattern in the KRT1 interval is significantly faster than that of HEK cells homozygous for a second common haplotype pattern. Our study demonstrates that genetic variants in the KRT1 interval contribute to quantifiable differences in the migration rates of keratinocytes isolated from different individuals. Furthermore we show that in vitro cell assays can successfully be used to deconstruct complex traits into simple biological model systems for genetic association studies.

  5. In vitro effects of fungi isolated from equine hooves on primary human keratinocytes. (United States)

    Apprich, Veronika; Spergser, Joachim; Rosengarten, Renate; Stanek, Christian


    The effects of two dermatophytes (Microsporum gypseum and Trichophyton mentagrophytes) and four moulds (Scopulariopsis brevicaulis, Alternaria alternata, Geotrichum candidum and Penicillium spp.) on living keratinocyte cultures were examined in vitro using primary human keratinocytes. Rates of apoptosis of infected cells were determined using a colorimetric TUNEL system which detects the characteristic nuclear DNA fragmentation of apoptotic cells. The cytotoxicity of the individual fungi was tested by quantitatively measuring cytosolic enzyme lactate dehydrogenase, released upon cell lysis, in culture supernatants. Additionally, the cell structures within the infected keratinocytes in cultures were examined by scanning electron microscopy. All of the fungi exhibited high cytotoxicity, whereas the development of only the two dermatophytes and the mould Scopulariopsis brevicaulis resulted in distinctly increased apoptosis. Electron microscopy showed that all fungi studied caused similar alterations in the cell structure, with Microsporum gypseum being the most harmful. Increasing loss of cell adhesion as a consequence of a decreasing number of reticulating cell appendices and a reduced cell plasticity were the most evident alterations.

  6. Effects of 25-hydroxyvitamin D3 on cathelicidin production and antibacterial function of human oral keratinocytes. (United States)

    Wang, Qi; Zhang, Wu; Li, Hao; Aprecio, Raydolf; Wu, Wan; Lin, Yiqiao; Li, Yiming


    Vitamin D and its metabolites have been recognized as key determinants in innate immune modulation. In this study, we investigated the regulation of antibacterial functions of oral keratinocyte cells by 25-hydroxyvitamin D3 (25VD3). OKF6/TERT2 cells, an immortalized human oral keratinocyte cell line, were transfected with or without 24-hydroxylase small interfering RNA (siRNA) and incubated with different amounts of 25VD3. These epithelial cells expressed high levels of inactivating 24-hydroxylase (CYP24A1) and relatively low levels of activating 1α-hydroxylase (CYP27B1) in the presence of 25VD3. 25VD3 influenced the expression of vitamin D-driven genes and cathelicidin in a dose-related manner. SiRNA specific to 24-hydroxylase augmented the cathelicidin production and subseqently influenced the antibacterial activity on multispecies of oral pathogens. These observations suggest that 25VD3 is capable of stimulating cathelicidin production and modulating antibacterial function upon CYP24A1 knochdown in oral epithelial cells, and indicate novel mechanisms that 25VD3 may enhance antibacterial ability in oral keratinocytes. Copyright © 2013 Elsevier Inc. All rights reserved.

  7. Honey bee (Apis mellifera) venom induces AIM2 inflammasome activation in human keratinocytes. (United States)

    Dombrowski, Y; Peric, M; Koglin, S; Kaymakanov, N; Schmezer, V; Reinholz, M; Ruzicka, T; Schauber, J


    Following allergen exposure, cytokines and other pro-inflammatory signals play an important role in the immunological cascade leading to allergic sensitization. Inflammasomes sense exogenous and endogenous danger signals and trigger IL-1β and IL-18 activation which in turn shape Th2 responses. Honey bee venom (BV) allergies are very common; however, the local inflammatory cascade leading to the initiation of allergic sensitization is poorly understood. In this study, the local inflammatory cascades in skin after exposure to BV were investigated. The mechanisms of inflammasome activation in human skin and in cultured keratinocytes upon BV exposure were analyzed by ELISA, Western blot, flow cytometry, siRNA techniques, and immunofluorescence. In an ex vivo bee sting model, BV induced IL-1β release suggesting the activation of inflammasomes. Indeed, in cultured keratinocytes, the BV component melittin triggered IL-1β and IL-18 release via the AIM2 inflammasome. AIM2 is a cytosolic DNA receptor, and mitochondrial as well as genomic DNA was detected in the cytosol of melittin-treated keratinocytes as triggers of inflammasome activation. As a mechanism, melittin mediated destruction of mitochondrial membranes leading to the leakage of mitochondrial DNA into the cytosolic compartment. These data suggest that upon BV exposure, keratinocytes are involved in an innate immune response by the activation of the AIM2 inflammasome and subsequent IL-1β and IL-18 release triggered by endogenous DNA. As IL-1β and IL-18 are involved in Th2- and IgE-mediated immune reactions, these results could add to the understanding of the role of the tissue microenvironment to subsequent allergic responses. © 2012 John Wiley & Sons A/S.

  8. Effects of titanium dioxide nanoparticles on human keratinocytes


    Wright, Clayton; Iyer, Anand Krishnan V.; Wang, Liying; Wu, Nianqiang; Yakisich, Juan S.; Rojanasakul, Yon; Azad, Neelam


    Titanium dioxide (TiO2) is a ubiquitous whitening compound widely used in topical products such as sunscreens, lotions and facial creams. The damaging health effects of TiO2 inhalation has been widely studied in rats, mice and humans showing oxidative stress increase, DNA damage, cell death and inflammatory gene upregulation in lung and throat cells; however, the effects on skin cells from long-term topical use of various products remain largely unknown. In this study, we assessed the effect ...

  9. Pseudomonas-derived ceramidase induces production of inflammatory mediators from human keratinocytes via sphingosine-1-phosphate.

    Directory of Open Access Journals (Sweden)

    Ami Oizumi

    Full Text Available Ceramide is important for water retention and permeability barrier functions in the stratum corneum, and plays a key role in the pathogenesis of atopic dermatitis (AD. A Pseudomonas aeruginosa-derived neutral ceramidase (PaCDase isolated from a patient with AD was shown to effectively degrade ceramide in the presence of Staphylococcus aureus-derived lipids or neutral detergents. However, the effect of ceramide metabolites on the functions of differentiating keratinocytes is poorly understood. We found that the ceramide metabolite sphingosine-1-phosphate (S1P stimulated the production of inflammatory mediators such as TNF-α and IL-8 from three-dimensionally cultured human primary keratinocytes (termed "3D keratinocytes", which form a stratum corneum. PaCDase alone did not affect TNF-α gene expression in 3D keratinocytes. In the presence of the detergent Triton X-100, which damages stratum corneum structure, PaCDase, but not heat-inactivated PaCDase or PaCDase-inactive mutant, induced the production of TNF-α, endothelin-1, and IL-8, indicating that this production was dependent on ceramidase activity. Among various ceramide metabolites, sphingosine and S1P enhanced the gene expression of TNF-α, endothelin-1, and IL-8. The PaCDase-enhanced expression of these genes was inhibited by a sphingosine kinase inhibitor and by an S1P receptor antagonist VPC 23019. The TNF-α-binding antibody infliximab suppressed the PaCDase-induced upregulation of IL-8, but not TNF-α, mRNA. PaCDase induced NF-κB p65 phosphorylation. The NF-κB inhibitor curcumin significantly inhibited PaCDase-induced expression of IL-8 and endothelin-1. VPC 23019 and infliximab inhibited PaCDase-induced NF-κB p65 phosphorylation and reduction in the protein level of the NF-κB inhibitor IκBα. Collectively, these findings suggest that (i 3D keratinocytes produce S1P from sphingosine, which is produced through the hydrolysis of ceramide by PaCDase, (ii S1P induces the production

  10. Ecto-nucleoside triphosphate diphosphohydrolase 2 modulates local ATP-induced calcium signaling in human HaCaT keratinocytes.

    Directory of Open Access Journals (Sweden)

    Chia-Lin Ho

    Full Text Available Keratinocytes are the major building blocks of the human epidermis. In many physiological and pathophysiological conditions, keratinocytes release adenosine triphosphate (ATP as an autocrine/paracrine mediator that regulates cell proliferation, differentiation, and migration. ATP receptors have been identified in various epidermal cell types; therefore, extracellular ATP homeostasis likely determines its long-term, trophic effects on skin health. We investigated the possibility that human keratinocytes express surface-located enzymes that modulate ATP concentration, as well as the corresponding receptor activation, in the pericellular microenvironment. We observed that the human keratinocyte cell line HaCaT released ATP and hydrolyzed extracellular ATP. Interestingly, ATP hydrolysis resulted in adenosine diphosphate (ADP accumulation in the extracellular space. Pharmacological inhibition by ARL 67156 or gene silencing of the endogenous ecto-nucleoside triphosphate diphosphohydrolase (NTPDase isoform 2 resulted in a 25% reduction in both ATP hydrolysis and ADP formation. Using intracellular calcium as a reporter, we found that although NTPDase2 hydrolyzed ATP and generated sustainable ADP levels, only ATP contributed to increased intracellular calcium via P2Y2 receptor activation. Furthermore, knocking down NTPDase2 potentiated the nanomolar ATP-induced intracellular calcium increase, suggesting that NTPDase2 globally attenuates nucleotide concentration in the pericellular microenvironment as well as locally shields receptors in the vicinity from being activated by extracellular ATP. Our findings reveal an important role of human keratinocyte NTPDase2 in modulating nucleotide signaling in the extracellular milieu of human epidermis.

  11. UVA and UVB irradiation differentially regulate microRNA expression in human primary keratinocytes.

    Directory of Open Access Journals (Sweden)

    Anne Kraemer

    Full Text Available MicroRNA (miRNA-mediated regulation of the cellular transcriptome is an important epigenetic mechanism for fine-tuning regulatory pathways. These include processes related to skin cancer development, progression and metastasis. However, little is known about the role of microRNA as an intermediary in the carcinogenic processes following exposure to UV-radiation. We now show that UV irradiation of human primary keratinocytes modulates the expression of several cellular miRNAs. A common set of miRNAs was influenced by exposure to both UVA and UVB. However, each wavelength band also activated a distinct subset of miRNAs. Common sets of UVA- and UVB-regulated miRNAs harbor the regulatory elements GLYCA-nTRE, GATA-1-undefined-site-13 or Hox-2.3-undefined-site-2 in their promoters. In silico analysis indicates that the differentially expressed miRNAs responding to UV have potential functions in the cellular pathways of cell growth and proliferation. Interestingly, the expression of miR-23b, which is a differentiation marker of human keratinocytes, is remarkably up-regulated after UVA irradiation. Studying the interaction between miR-23b and its putative skin-relevant targets using a Luciferase reporter assay revealed that RRAS2 (related RAS viral oncogene homolog 2, which is strongly expressed in highly aggressive malignant skin cancer, to be a direct target of miR-23b. This study demonstrates for the first time a differential miRNA response to UVA and UVB in human primary keratinocytes. This suggests that selective regulation of signaling pathways occurs in response to different UV energies. This may shed new light on miRNA-regulated carcinogenic processes involved in UV-induced skin carcinogenesis.

  12. Atopic keratinocytes induce increased neurite outgrowth in a coculture model of porcine dorsal root ganglia neurons and human skin cells. (United States)

    Roggenkamp, Dennis; Falkner, Susanne; Stäb, Franz; Petersen, Marlen; Schmelz, Martin; Neufang, Gitta


    Skin of patients suffering from atopic eczema displays a higher epidermal nerve fiber density, associated with neurogenic inflammation and pruritus. Using an in vitro coculture system, allowing a spatially compartmented culture of somata from porcine dorsal root ganglion neurons and human primary skin cells, we investigated the influence of dermal fibroblasts and keratinocytes on neurite outgrowth. In comparison with dermal fibroblasts, keratinocytes induced more branched and less calcitonin gene-related peptide (CGRP)-immunoreactive nerve fibers. By adding neutralizing antibodies, we showed that nerve growth factor (NGF) and glial cell-line-derived neurotrophic factor (GDNF) are pivotal neurotrophic factors of skin cell-induced neurite outgrowth. Keratinocytes and dermal fibroblasts secreted different ratios of neurotrophic factors, influencing morphology and CGRP immunoreactivity of neurites. To investigate changes of the peripheral nervous system in the pathogenesis of atopic eczema in vitro, we analyzed neurite outgrowth mediated by atopic skin cells. Atopic keratinocytes produced elevated levels of NGF and mediated an increased outgrowth of CGRP-positive sensory fibers. Our results demonstrate the impact of dermal fibroblasts and keratinocytes on skin innervation and emphasize the role of keratinocytes as key players of hyperinnervation in atopic eczema.

  13. Trifloxystrobin-induced mitophagy through mitochondrial damage in human skin keratinocytes. (United States)

    Jang, Yoonjeong; Kim, Ji-Eun; Jeong, Sang-Hee; Paik, Min-Kyoung; Kim, Jun Sung; Cho, Myung-Haing


    Trifloxystrobin is a strobilurin class fungicide, the mode of action of which is to block the mitochondrial electron transport chain and inhibit energy production in fungi. Although adverse effects have been reported by occupational or environmental exposure of fungicides, the pathophysiological mechanism in human cells remains poorly understood. In the present study, we investigated the impact of trifloxystrobin on exposed skin at the cellular organelle level using HaCaT, the human skin keratinocyte cell line. Cells were treated with trifloxystrobin for 48 hr and trifloxystrobin showed detrimental effects on mitochondria evidenced by altered mitochondrial membrane potential and morphology. To identify autophagic degradation of the damaged mitochondria, confocal imaging and Western blotting were performed. Trifloxystrobin induced autophagy-related proteins in HaCaT cells. The mitochondrial reactive oxygen species scavenger mitoTEMPO was applied to further explore the mechanism of trifloxystrobin-mediated mitophagy in human skin cells. PINK1 and Parkin were overexpressed by trifloxystrobin, and mitoTEMPO alleviated the effects on mitophagy induction. Taken together, our findings indicated that mitochondrial damage and mitophagy may play a role in trifloxystrobin-induced toxicity in human keratinocytes and this could be suggested as a mechanism of cutaneous diseases developed by exposure.

  14. Comparison of rat epidermal keratinocyte organotypic culture (ROC) with intact human skin

    DEFF Research Database (Denmark)

    Pappinen, Sari; Hermansson, Martin; Kuntsche, Judith


    The present report is a part of our continuing efforts to explore the utility of the rat epidermal keratinocyte organotypic culture (ROC) as an alternative model to human skin in transdermal drug delivery and skin irritation studies of new chemical entities and formulations. The aim of the present......-hydroxyacid-phytosphingosine ceramides (NP) were absent. Also some alterations in fatty acid profiles of ROC ceramides were noted, e.g., esterified omega-hydroxyacid-sphingosine contained increased levels of oleic acid instead of linoleic acid. The fraction of lipids covalently bound to corneocyte proteins was distinctly lower in ROC...

  15. Human epidermal keratinocytes death and expression of protein markers of apoptosis after ionizing radiation exposure

    Directory of Open Access Journals (Sweden)

    Sharon Wong


    Full Text Available Purpose: Knowledge of the pathophysiology of the irradiated skin is important to understand the tolerance and cosmetic response of the human skin to radiation. There are limited studies on the effect of radiotherapy dosage and fraction size in inducing apoptotic cell death in human skin. The expression of apoptotic biomarkers within a controlled population in different fractionation schemes has also never been studied. This study aims to investigate radiation induced apoptotic cell death in human skin cells after fractionated radiation exposure and the expression of unique biomarkers that reflect cell death or biology using multiplexed immunoassays.Methods: Breast skin biopsies were obtained from a single individual and divided into small pieces. Each piece was irradiated under different radiotherapy treatment fractionation schedules to a total dose of 50Gy. The irradiated skin tissues were analysed using Tunnel, immunohistochemistry and Western blot assays for expression of apoptotic keratinocytes and biomarkers (p53, p21, and PCNA. Haematoxylin and eosin (H&E immunostaining was performed to study the morphological changes in the skin cells. Results: Radiation is mostly absorbed by the epidermal layers and observed to damage the epidermal keratinocytes leading to the activation of apoptotic proteins. Apoptotic proteins (p53, p21 and PCNA were confirmed to be up-regulated in radiation exposed skin cells as compared to normal skin cells with no radiation. There is strong correlation of apoptotic protein expressions with increased radiation dosage and dose fractionation. Statistical analysis with ANOVA revealed a significant increase of PCNA and p21 expression with increased radiation dosage and dose fractionation (p < 0.05. Immunohistochemically, 14 % (range 10.71% to 17.29% of the keratinocytes were positive for PCNA and 22.5% (range 18.28% to 27.2% for p21 after 2Gy of irradiation.  The most widespread, intense and uniform staining for PCNA

  16. The MEK Inhibitors Trametinib and Cobimetinib Induce a Type I Interferon Response in Human Keratinocytes

    Directory of Open Access Journals (Sweden)

    Daniela Lulli


    Full Text Available Mitogen-activated protein kinase kinases (MEK 1 and 2 have crucial roles in tumorigenesis, cell proliferation, and protection from apoptosis, and their inhibition is therefore an attractive therapeutic strategy in cancer. Orally available and highly selective MEK inhibitors have been developed and assessed in numerous clinical trials, either alone or in combination with cytotoxic chemotherapy and/or other targeted agents. Of note, a complex picture of class-specific adverse effects associates with these drugs, frequently including inflammatory skin rash. Here, we investigated the response of normal human keratinocytes to the MEK inhibitors trametinib and cobimetinib, alone and in combination with the v-Raf murine sarcoma viral oncogene homolog B (BRAF inhibitors dabrafenib and vemurafenib, in terms of signal transduction and de novo gene expression. MEK inhibitors triggered enhanced expression of interferon regulatory factor 1 (IRF1 and phosphorylation of signal transducer and activator of transcription 1 (STAT1, and up-regulated the keratinocyte-specific type I interferon κ (IFN-κ, the anti-viral effectors interferon-induced tetratricopeptide repeats (IFIT 1 and 2, and the pro-inflammatory chemokine (C-C motif ligand 2 (CCL2 and the C-X-C motif chemokine 10 (CXCL10, both at the mRNA and protein level. Impairment of IRF1 expression, or abrogation of STAT1 phosphorylation due to IFN-κ gene silencing, suppressed anti-viral and pro-inflammatory gene expression. These data suggest that, similar to what we observed for epidermal growth factor receptor (EGFR blockade, MEK inhibition activates a type I interferon response, which is now recognized as an effective anti-cancer response, in human epidermal keratinocytes.

  17. Human atopic dermatitis skin-derived T cells can induce a reaction in mouse keratinocytes in vivo

    DEFF Research Database (Denmark)

    Martel, Britta C; Blom, Lars; Dyring-Andersen, Beatrice


    injection of the human AD skin-derived T cells resulted in migration of the human T cells from subcutis to the papillary dermis followed by development of erythema and edema in the mouse skin. Furthermore, the human T cells induced a transient proliferative response in the mouse keratinocytes shown......In atopic dermatitis (AD), the inflammatory response between skin infiltrating T cells and keratinocytes is fundamental to the development of chronic lesional eczema. The aim of this study was to investigate whether skin-derived T cells from AD patients could induce an inflammatory response in mice...... through keratinocyte activation and consequently cause development of eczematous lesions. Punch biopsies of lesional skin from AD patients were used to establish skin-derived T cell cultures and which were transferred into NOD.Cg-Prkd(scid) Il2rg(tm1Sug) /JicTac (NOG) mice. We found that subcutaneous...

  18. Optimised retroviral infection of human epidermal keratinocytes: long-term expression of transduced integrin gene following grafting on to SCID mice. (United States)

    Levy, L; Broad, S; Zhu, A J; Carroll, J M; Khazaal, I; Péault, B; Watt, F M


    Previous attempts to achieve long-term gene expression in retrovirally transduced human epidermal keratinocytes in vivo have been largely unsuccessful. This has been variously attributed to a failure to target epidermal stem cells, suboptimal grafting conditions or inactivation of the retroviral vector. In an attempt to overcome these problems we expressed the chick beta 1 integrin subunit in primary human epidermal keratinocytes, which allowed us to monitor retroviral gene expression on a cell-by-cell basis. We describe optimised methods for selecting high-titre amphotropic packaging cells and for infecting keratinocytes in culture. When transduced cells were grafted into mice, graft survival was comparable in nude and SCID mice, but it was essential to combine the keratinocytes with a dermal substrate. Using these methods the majority of keratinocytes expressed the chick beta 1 integrin subunit for at least 16 weeks after grafting. We conclude that epidermal keratinocytes are attractive recipient cells for gene therapy.

  19. Cytotoxicity and terminal differentiation of human oral keratinocyte by indium ions from a silver-palladium-gold-indium dental alloy. (United States)

    Lee, Jung-Hwan; Seo, Sang-Hee; Lee, Sang-Bae; Om, Ji-Yeon; Kim, Kwang-Mahn; Kim, Kyoung-Nam


    Dental alloys containing indium (In) have been used in dental restoration for two decades; however, no study has investigated the biological effects of In ions, which may be released in the oral cavity, on human oral keratinocytes. The objective of the present study was to investigate the biological effects of In ions on human oral keratinocyte after confirming their release from a silver-palladium-gold-indium (Ag-Pd-Au-In) dental alloy. As a corrosion assay, a static immersion tests were performed by detecting the released ions in the corrosion solution from the Ag-Pd-Au-In dental alloy using inductively coupled plasma atomic emission spectroscopy. The cytotoxicity and biological effects of In ions were then studied with In compounds in three human oral keratinocyte cell lines: immortalized human oral keratinocyte (IHOK), HSC-2, and SCC-15. Higher concentrations of In and Cu ions were detected in Ag-Pd-Au-In (P<0.05) than in Ag-Pd-Au, and AgCl deposition occurred on the surface of Ag-Pd-Au-In after a 7-day corrosion test due to its low corrosion resistance. At high concentrations, In ions induced cytotoxicity; however, at low concentrations (∼0.8In(3+)mM), terminal differentiation was observed in human oral keratinocytes. Intracellular ROS was revealed to be a key component of In-induced terminal differentiation. In ions were released from dental alloys containing In, and high concentrations of In ions resulted in cytotoxicity, whereas low concentrations induced the terminal differentiation of human oral keratinocytes via increased intracellular ROS. Therefore, dental alloys containing In must be biologically evaluated for their safe use. Copyright © 2014 Academy of Dental Materials. Published by Elsevier Ltd. All rights reserved.

  20. The Effect of Secretory Factors of Adipose-Derived Stem Cells on Human Keratinocytes

    Directory of Open Access Journals (Sweden)

    Soo-Wan Nam


    Full Text Available The beneficial effects of adipose-derived stem cell conditioned medium (ADSC-CM on skin regeneration have been reported. Although the mechanism of how ADSC-CM promotes skin regeneration is unclear, ADSC-CM contained various growth factors and it is an excellent raw material for skin treatment. ADSC-CM produced in a hypoxia condition of ADSC—in other words, Advanced Adipose-Derived Stem cell Protein Extract (AAPE—has great merits for skin regeneration. In this study, human primary keratinocytes (HKs, which play fundamental roles in skin tissue, was used to examine how AAPE affects HK. HK proliferation was significantly higher in the experimental group (1.22 μg/mL than in the control group. DNA gene chip demonstrated that AAPE in keratinocytes (p < 0.05 notably affected expression of 290 identified transcripts, which were associated with cell proliferation, cycle and migration. More keratinocyte wound healing and migration was shown in the experimental group (1.22 μg/mL. AAPE treatment significantly stimulated stress fiber formation, which was linked to the RhoA-ROCK pathway. We identified 48 protein spots in 2-D gel analysis and selected proteins were divided into 64% collagen components and 30% non-collagen components as shown by the MALDI-TOF analysis. Antibody array results contained growth factor/cytokine such as HGF, FGF-1, G-CSF, GM-CSF, IL-6, VEGF, and TGF-β3 differing from that shown by 2-D analysis. Conclusion: AAPE activates HK proliferation and migration. These results highlight the potential of the topical application of AAPE in the treatment of skin regeneration.

  1. Development of a Full-Thickness Human Skin Equivalent In Vitro Model Derived from TERT-Immortalized Keratinocytes and Fibroblasts

    NARCIS (Netherlands)

    Reijnders, C.M.A.; van Lier, A.; Roffel, S.; Kramer, D.; Scheper, R.J.; Gibbs, S.


    Currently, human skin equivalents (HSEs) used for in vitro assays (e.g., for wound healing) make use of primary human skin cells. Limitations of primary keratinocytes and fibroblasts include availability of donor skin and donor variation. The use of physiologically relevant cell lines could solve

  2. Structural Patterns of Rhamnogalacturonans Modulating Hsp-27 Expression in Cultured Human Keratinocytes

    Directory of Open Access Journals (Sweden)

    Yann Guerardel


    Full Text Available Polysaccharide extracts were obtained from chestnut bran (Castanea sativa, grape marc (Vitis vinifera and apple marc (Malus spp. and fractionated by size exclusion chromatography after endopolygalacturonase degradation. Compositional and linkage analyses by GC and GC-MS showed the characteristic rhamnogalacturonan structure with specific arabinan (apple marc and type II arabinogalactan (chestnut bran, grape marc side chains. Type II arabinogalactan rhamnogalacturonan from chestnut bran significantly stimulated the in vitro differentiation of human keratinocytes, giving evidence of a tight structure-function relationship. This molecule comprises short and ramified 3- and 3,6-β- D-galactan and 5- and 3,5-α-L-arabinan side chains, but also contains significant amounts of t-Xyl and 4-Xyl with a characteristic 2:1 ratio. Enzymatic hydrolysis of this polysaccharide produced fragments of lower molecular weight with unchanged xylose content which conserved the same ability to stimulate human keratinocyte differentiation. It could be then speculated that dimeric xylosyl-xylose and/or longer oligomeric xylose side chains attached to a galacturonan and closely associated to hairy rhamno-galacturonan domains are essential patterns that could determine the biological activity of pectins.

  3. Transcription factors and stress response gene alterations in human keratinocytes following Solar Simulated Ultra Violet Radiation. (United States)

    Marais, Thomas L Des; Kluz, Thomas; Xu, Dazhong; Zhang, Xiaoru; Gesumaria, Lisa; Matsui, Mary S; Costa, Max; Sun, Hong


    Ultraviolet radiation (UVR) from sunlight is the major effector for skin aging and carcinogenesis. However, genes and pathways altered by solar-simulated UVR (ssUVR), a mixture of UVA and UVB, are not well characterized. Here we report global changes in gene expression as well as associated pathways and upstream transcription factors in human keratinocytes exposed to ssUVR. Human HaCaT keratinocytes were exposed to either a single dose or 5 repetitive doses of ssUVR. Comprehensive analyses of gene expression profiles as well as functional annotation were performed at 24 hours post irradiation. Our results revealed that ssUVR modulated genes with diverse cellular functions changed in a dose-dependent manner. Gene expression in cells exposed to a single dose of ssUVR differed significantly from those that underwent repetitive exposures. While single ssUVR caused a significant inhibition in genes involved in cell cycle progression, especially G2/M checkpoint and mitotic regulation, repetitive ssUVR led to extensive changes in genes related to cell signaling and metabolism. We have also identified a panel of ssUVR target genes that exhibited persistent changes in gene expression even at 1 week after irradiation. These results revealed a complex network of transcriptional regulators and pathways that orchestrate the cellular response to ssUVR.

  4. Upregulation of FOXM1 induces genomic instability in human epidermal keratinocytes

    Directory of Open Access Journals (Sweden)

    Philpott Michael P


    Full Text Available Abstract Background The human cell cycle transcription factor FOXM1 is known to play a key role in regulating timely mitotic progression and accurate chromosomal segregation during cell division. Deregulation of FOXM1 has been linked to a majority of human cancers. We previously showed that FOXM1 was upregulated in basal cell carcinoma and recently reported that upregulation of FOXM1 precedes malignancy in a number of solid human cancer types including oral, oesophagus, lung, breast, kidney, bladder and uterus. This indicates that upregulation of FOXM1 may be an early molecular signal required for aberrant cell cycle and cancer initiation. Results The present study investigated the putative early mechanism of UVB and FOXM1 in skin cancer initiation. We have demonstrated that UVB dose-dependently increased FOXM1 protein levels through protein stabilisation and accumulation rather than de novo mRNA expression in human epidermal keratinocytes. FOXM1 upregulation in primary human keratinocytes triggered pro-apoptotic/DNA-damage checkpoint response genes such as p21, p38 MAPK, p53 and PARP, however, without causing significant cell cycle arrest or cell death. Using a high-resolution Affymetrix genome-wide single nucleotide polymorphism (SNP mapping technique, we provided the evidence that FOXM1 upregulation in epidermal keratinocytes is sufficient to induce genomic instability, in the form of loss of heterozygosity (LOH and copy number variations (CNV. FOXM1-induced genomic instability was significantly enhanced and accumulated with increasing cell passage and this instability was increased even further upon exposure to UVB resulting in whole chromosomal gain (7p21.3-7q36.3 and segmental LOH (6q25.1-6q25.3. Conclusion We hypothesise that prolonged and repeated UVB exposure selects for skin cells bearing stable FOXM1 protein causes aberrant cell cycle checkpoint thereby allowing ectopic cell cycle entry and subsequent genomic instability. The aberrant

  5. Solar Simulated Ultraviolet Radiation Induces Global Histone Hypoacetylation in Human Keratinocytes.

    Directory of Open Access Journals (Sweden)

    Xiaoru Zhang

    Full Text Available Ultraviolet radiation (UVR from sunlight is the primary effector of skin DNA damage. Chromatin remodeling and histone post-translational modification (PTM are critical factors in repairing DNA damage and maintaining genomic integrity, however, the dynamic changes of histone marks in response to solar UVR are not well characterized. Here we report global changes in histone PTMs induced by solar simulated UVR (ssUVR. A decrease in lysine acetylation of histones H3 and H4, particularly at positions of H3 lysine 9, lysine 56, H4 lysine 5, and lysine 16, was found in human keratinocytes exposed to ssUVR. These acetylation changes were highly associated with ssUVR in a dose-dependent and time-specific manner. Interestingly, H4K16ac, a mark that is crucial for higher order chromatin structure, exhibited a persistent reduction by ssUVR that was transmitted through multiple cell divisions. In addition, the enzymatic activities of histone acetyltransferases were significantly reduced in irradiated cells, which may account for decreased global acetylation. Moreover, depletion of histone deacetylase SIRT1 in keratinocytes rescued ssUVR-induced H4K16 hypoacetylation. These results indicate that ssUVR affects both HDAC and HAT activities, leading to reduced histone acetylation.

  6. Platelet lysate induces in vitro wound healing of human keratinocytes associated with a strong proinflammatory response. (United States)

    El Backly, Rania; Ulivi, Valentina; Tonachini, Laura; Cancedda, Ranieri; Descalzi, Fiorella; Mastrogiacomo, Maddalena


    Platelet lysates (PL), which are derived from platelets, are cocktails of growth factors and cytokines that can promote tissue regeneration. Until today, most studies have focused on growth factor content of platelets rather than on their potential as a reservoir of mediators and cytokines. Taking advantage of an in vitro scratch assay performed under both normal and inflammatory conditions, in the present work, we report that at physiologic concentrations, PL enhanced wound closure rates of NCTC 2544 human keratinocytes. This effect was clearly detectable 6 h after wounding. Moreover, PL induced a strong cell actin cytoskeletal re-organization that persisted up to 24 h. The accelerated wound closure promoted by PL, in either presence or absence of serum, was associated with a high expression of the inflammatory cytokine interleukin-8. Further, after 24 h PL treatment, confluent keratinocytes also expressed low amounts of interleukin-8 and of the antimicrobial peptide neutrophil gelatinase-associated lipocalin, which dramatically increased under inflammatory conditions. These effects were associated with activation of the inflammatory pathways, p38 mitogen-activated protein kinase, and NF-κB. Our findings support the concept that platelet-derived preparations could accelerate regeneration of difficult-to-heal wounds by triggering an inflammatory cascade and having an antimicrobial role.

  7. Solar Simulated Ultraviolet Radiation Induces Global Histone Hypoacetylation in Human Keratinocytes. (United States)

    Zhang, Xiaoru; Kluz, Thomas; Gesumaria, Lisa; Matsui, Mary S; Costa, Max; Sun, Hong


    Ultraviolet radiation (UVR) from sunlight is the primary effector of skin DNA damage. Chromatin remodeling and histone post-translational modification (PTM) are critical factors in repairing DNA damage and maintaining genomic integrity, however, the dynamic changes of histone marks in response to solar UVR are not well characterized. Here we report global changes in histone PTMs induced by solar simulated UVR (ssUVR). A decrease in lysine acetylation of histones H3 and H4, particularly at positions of H3 lysine 9, lysine 56, H4 lysine 5, and lysine 16, was found in human keratinocytes exposed to ssUVR. These acetylation changes were highly associated with ssUVR in a dose-dependent and time-specific manner. Interestingly, H4K16ac, a mark that is crucial for higher order chromatin structure, exhibited a persistent reduction by ssUVR that was transmitted through multiple cell divisions. In addition, the enzymatic activities of histone acetyltransferases were significantly reduced in irradiated cells, which may account for decreased global acetylation. Moreover, depletion of histone deacetylase SIRT1 in keratinocytes rescued ssUVR-induced H4K16 hypoacetylation. These results indicate that ssUVR affects both HDAC and HAT activities, leading to reduced histone acetylation.

  8. Rhodiola rosea ability to enrich cellular antioxidant defences of cultured human keratinocytes. (United States)

    Calcabrini, Cinzia; De Bellis, Roberta; Mancini, Umberto; Cucchiarini, Luigi; Potenza, Lucia; De Sanctis, Roberta; Patrone, Vania; Scesa, Carla; Dachà, Marina


    Keratinocytes are cells strongly exposed to oxidative stress, but normally good equipped for antioxidant responses. However, it has long been suggested that exogenous antioxidants could play a useful role in minimizing the adverse skin responses associated with such oxidant species. In this work it was paid attention to the extract of Rhodiola rosea L. roots by using the phytocomplex as a whole because of the important activity of its composition and mutual distribution of its components. We have measured the protection afforded by the extract to reduced glutathione levels, glyceraldehyde-3-phosphate dehydrogenase activity, and thiobarbituric acid reactive substances levels in cultured human keratinocytes (NCTC 2544) exposed to different oxidative insults: Fe(II)/ascorbate, Fe(II)/H(2)O(2), and tert-butyl-hydroperoxide. We also have investigated the influence of the R. rosea extract on the production of intracellular reactive oxygen species and on the activity of antioxidant enzymes (catalase, superoxide dismutase, glutathione peroxidase, and glutathione reductase). Furthermore, we have demonstrated that R. rosea extract was able to increase in a time- and dose-dependent manner the activity of the trans plasma membrane oxido reductase activity as an indirect evaluation of the intracellular redox status and this effect was already evident with small concentration of the extract and in a long time. As a result, NCTC 2544 are able to better counteract to several oxidative insults if incubated with R. rosea extract demonstrating a very good antioxidant activity of this phytocomplex.

  9. High Levels of Chemokine C-C Motif Ligand 20 in Human Milk and Its Production by Oral Keratinocytes. (United States)

    Lourenço, Alan G; Komesu, Marilena C; Duarte, Geraldo; Del Ciampo, Luiz A; Mussi-Pinhata, Marisa M; Yamamoto, Aparecida Y


    Chemokine C-C motif ligand 20 (CCL20) is implicated in the formation and function of mucosal lymphoid tissues. Although CCL20 is secreted by many normal human tissues, no studies have evaluated the presence of CCL20 in human milk or its production by oral keratinocytes stimulated by human milk. To evaluate the presence of CCL20 in breast milk and verify CCL20 secretion in vitro by oral keratinocytes stimulated with human and bovine milk, as well as its possible association with breast milk lactoferrin levels. The levels of CCL20 and lactoferrin were measured by enzyme-linked immunosorbent assay in human milk at three different stages of maturation from 74 healthy breastfeeding mothers. In vitro, oral keratinocytes were stimulated with human and bovine milk, and CCL20 was measured in their supernatant. High concentrations of CCL20 were detected in the human breast milk samples obtained during the first week (1,777.07 pg/mL) and second week postpartum (1,523.44 pg/mL), with a significantly low concentration in samples at 3-6 weeks postpartum (238.42 pg/mL; p milk at different weeks postpartum stimulated higher CCL20 secretion by oral keratinocytes compared with bovine milk (p milk lactoferrin concentration. CCl20 is present at high levels in human milk, predominantly in the first and second week postpartum, but at significantly lower levels at 3-6 weeks postpartum. Human milk is capable of stimulating CCL20 secretion by oral keratinocytes, and this induction had no association with breast milk lactoferrin concentration.

  10. Differential effects of selenite and selenate on human melanocytes, keratinocytes, and melanoma cells. (United States)

    Bandura, Laura; Drukala, Justyna; Wolnicka-Glubisz, Agnieszka; Björnstedt, Mikael; Korohoda, Wlodzimierz


    Among the substances that attracted the attention of oncologists in recent years are selenium-containing compounds, both inorganic and organic. Several epidemiological studies have shown an inverse correlation between selenium intake and cancer incidence. In the experiments reported here, we compared the effects of 2 inorganic selenium-containing salts that differed in the level of selenium oxidation, selenite IV and selenate VI. We tested the effects of these 2 compounds on cell survival and growth, cell cycle processing, cell morphology, cytoskeleton, and lipid peroxidation in 3 human skin cell types: normal keratinocytes, melanocytes, and human melanoma cell line HTB140. The different effects of selenite and selenate on the viability, growth, and morphology of normal cells and tumor cells are reported and provide a base for future research and treatment of some neoplastic diseases. The attention is paid to cell apoptosis induced by selenite and not by selenate, and the effects of tested substances on thioredoxin reductase system are postulated.

  11. Nuclear DNA damage-triggered NLRP3 inflammasome activation promotes UVB-induced inflammatory responses in human keratinocytes

    Energy Technology Data Exchange (ETDEWEB)

    Hasegawa, Tatsuya, E-mail:; Nakashima, Masaya; Suzuki, Yoshiharu


    Ultraviolet (UV) radiation in sunlight can result in DNA damage and an inflammatory reaction of the skin commonly known as sunburn, which in turn can lead to cutaneous tissue disorders. However, little has been known about how UV-induced DNA damage mediates the release of inflammatory mediators from keratinocytes. Here, we show that UVB radiation intensity-dependently increases NLRP3 gene expression and IL-1β production in human keratinocytes. Knockdown of NLRP3 with siRNA suppresses UVB-induced production of not only IL-1β, but also other inflammatory mediators, including IL-1α, IL-6, TNF-α, and PGE{sub 2}. In addition, inhibition of DNA damage repair by knockdown of XPA, which is a major component of the nucleotide excision repair system, causes accumulation of cyclobutane pyrimidine dimer (CPD) and activation of NLRP3 inflammasome. In vivo immunofluorescence analysis confirmed that NLRP3 expression is also elevated in UV-irradiated human epidermis. Overall, our findings indicate that UVB-induced DNA damage initiates NLRP3 inflammasome activation, leading to release of various inflammatory mediators from human keratinocytes. - Highlights: • UVB radiation induces NLRP3 inflammasome activation in human keratinocytes. • NLRP3 knockdown suppresses production of UVB-induced inflammatory mediators. • UVB-induced DNA damage triggers NLRP3 inflammasome activation. • NLRP3 expression in human epidermis is elevated in response to UV radiation.

  12. Triterpenoid α-amyrin stimulates proliferation of human keratinocytes but does not protect them against UVB damage

    DEFF Research Database (Denmark)

    Biskup, Edyta; Gołębiowski, Marek; Gniadecki, Robert


    Rhaponticum carthamoides plants ("maral root") are widely used in Siberian folk medicine. The present study reports for the first time the presence of pentacyclic terpenoid, α-amyrin, in methanol extract from leaves of this plant. α-Amyrin induced proliferation of human keratinocytes (HaCaT) by a...

  13. Tumor necrosis factor related apoptosis inducing ligand triggers apoptosis in dividing but not in differentiating human epidermal keratinocytes

    NARCIS (Netherlands)

    Jansen, Bastiaan J. H.; van Ruissen, Fred; Cerneus, Stefanie; Cloin, Wendy; Bergers, Mieke; van Erp, Piet E. J.; Schalkwijk, Joost


    Using serial analysis of gene expression we have previously identified the expression of several pro-apoptotic and anti-apoptotic genes in cultured human primary epidermal keratinocytes, including tumor necrosis factor related apoptosis inducing ligand (TRAIL). TRAIL is a potent inducer of apoptosis

  14. Human allogeneic keratinocytes cultured on acellular xenodermis: the use in healing of burns and other skin defects

    Czech Academy of Sciences Publication Activity Database

    Matoušková, Eva; Brož, L.; Štolbová, V.; Klein, L.; Konigová, R.; Veselý, Pavel


    Roč. 16, č. 4 (2006), s. 63-71 ISSN 0959-2989 R&D Projects: GA AV ČR(CZ) IBS5052312 Institutional research plan: CEZ:AV0Z50520514 Keywords : acellular xenodermis * human keratinocytes * wound grafting Subject RIV: EB - Genetics ; Molecular Biology Impact factor: 0.922, year: 2006

  15. Chromium III histidinate exposure modulates antioxidant gene expression in HaCaT human keratinocytes exposed to oxidative stress (United States)

    While the toxicity of hexavalent chromium is well established, trivalent Cr (Cr(III)) is an essential nutrient involved in insulin and glucose homeostasis. Recently, antioxidant effects of chromium (III) histidinate (Cr(III)His) were reported in HaCaT human keratinocytes exposed to oxidative stress...

  16. Asian dust storm particles induce a broad toxicological transcriptional program in human epidermal keratinocytes. (United States)

    Choi, Hyun; Shin, Dong Wook; Kim, Wonnyon; Doh, Seong-Jae; Lee, Soo Hwan; Noh, Minsoo


    Exposure to airborne dust particles originated from seasonal Asian dust storms in Chinese and Mongolian deserts results in increased incidence of a range of diseases including asthma, contact dermatitis and conjunctivitis. The areas affected by Asian dust particles extend from East China to the west coast of North America. In order to study toxicological mechanisms in human skin, we evaluated the effects of dust particles collected during Asian dust storms (Asian dust particles) on gene expression in human epidermal keratinocytes (HEK). In HEK, exposure to Asian dust particles significantly increased gene expressions of cytochrome P450 1A1 (CYP1A1), CYP1A2, and CYP1B1, which is an indication of aryl hydrocarbon receptor (AHR) activation. In addition, Asian dust particles increased gene transcription of the cytokines IL-6, IL-8, and GM-CSF, which have broad pro-inflammatory and immunomodulatory properties. Asian dust particles significantly up-regulated expression of caspase 14 in HEK, suggesting that Asian dust particles directly affect keratinocyte differentiation. We also demonstrated that protein extract of pollen, a material frequently adsorbed onto Asian dust particles, potentially contributes to the increased transcription of IL-6, CYP1A1, CYP1A2, and CYP1B1. Taken together, these studies suggest that Asian dust particles can exert toxicological effects on human skin through the activation of the cellular detoxification system, the production of pro-inflammatory and immunomodulatory cytokines, and changes in the expression of proteins essential in normal epidermal differentiation. Copyright © 2010 Elsevier Ireland Ltd. All rights reserved.

  17. Hepatocyte and keratinocyte growth factors and their receptors in human lung emphysema

    Directory of Open Access Journals (Sweden)

    Marchal Joëlle


    Full Text Available Abstract Background Hepatocyte and keratinocyte growth factors are key growth factors in the process of alveolar repair. We hypothesized that excessive alveolar destruction observed in lung emphysema involves impaired expression of hepatocyte and keratinocyte growth factors or their respective receptors, c-met and keratinocyte growth factor receptor. The aim of our study was to compare the expression of hepatocyte and keratinocyte growth factors and their receptors in lung samples from 3 groups of patients: emphysema; smokers without emphysema and non-smokers without emphysema. Methods Hepatocyte and keratinocyte growth factor proteins were analysed by immunoassay and western blot; mRNA expression was measured by real time quantitative polymerase chain reaction. Results Hepatocyte and keratinocyte growth factors, c-met and keratinocyte growth factor receptor mRNA levels were similar in emphysema and non-emphysema patients. Hepatocyte growth factor mRNA correlated negatively with FEV1 and the FEV1/FVC ratio both in emphysema patients and in smokers with or without emphysema. Hepatocyte and keratinocyte growth factor protein concentrations were similar in all patients' groups. Conclusion The expression of hepatocyte and keratinocyte growth factors and their receptors is preserved in patients with lung emphysema as compared to patients without emphysema. Hepatocyte growth factor mRNA correlates with the severity of airflow obstruction in smokers.

  18. Arsenic exposure disrupts epigenetic regulation of SIRT1 in human keratinocytes

    Energy Technology Data Exchange (ETDEWEB)

    Herbert, Katharine J. [School of Health Sciences, University of Tasmania, Launceston, TAS 7250 (Australia); Holloway, Adele [Menzies Research Institute Tasmania, University of Tasmania, Hobart, TAS 7000 (Australia); Cook, Anthony L. [School of Health Sciences, University of Tasmania, Launceston, TAS 7250 (Australia); Chin, Suyin P. [Menzies Research Institute Tasmania, University of Tasmania, Hobart, TAS 7000 (Australia); Snow, Elizabeth T., E-mail: [School of Health Sciences, University of Tasmania, Launceston, TAS 7250 (Australia)


    Arsenic is an environmental toxin which increases skin cancer risk for exposed populations worldwide; however the underlying biomolecular mechanism for arsenic-induced carcinogenesis is complex and poorly defined. Recent investigations show that histone deacetylase and DNA methyltransferase activity is impaired, and epigenetic patterns of gene regulation are consistently altered in cancers associated with arsenic exposure. Expression of the histone deacetylase SIRT1 is altered in solid tumours and haematological malignancies; however its role in arsenic-induced pathology is unknown. In this study we investigated the effect of arsenic on epigenetic regulation of SIRT1 and its targeting microRNA, miR-34a in primary human keratinocytes. Acetylation of histone H4 at lysine 16 (H4K16) increased in keratinocytes exposed to 0.5 μM arsenite [As(III)]; and this was associated with chromatin remodelling at the miR-34a promoter. Moreover, although SIRT1 protein initially increased in these As(III)-exposed cells, after 24 days expression was not significantly different from untreated controls. Extended exposure to low-dose As(III) (0.5 μM; > 5 weeks) compromised the pattern of CpG methylation at SIRT1 and miR-34a gene promoters, and this was associated with altered expression for both genes. We have found that arsenic alters epigenetic regulation of SIRT1 expression via structural reorganisation of chromatin at the miR-34a gene promoter in the initial 24 h of exposure; and over time, through shifts in miR-34a and SIRT1 gene methylation. Taken together, this investigation demonstrates that arsenic produces cumulative disruptions to epigenetic regulation of miR-34a expression, and this is associated with impaired coordination of SIRT1 functional activity. - Highlights: • Submicromolar arsenic concentrations disrupt SIRT1 activity and expression in human keratinocytes. • Arsenic-induced chromatin remodelling at the miR-34a gene promoter is associated with hyperacetylation

  19. Cobalt Oxide Nanoparticles: Behavior towards Intact and Impaired Human Skin and Keratinocytes Toxicity

    Directory of Open Access Journals (Sweden)

    Marcella Mauro


    Full Text Available Skin absorption and toxicity on keratinocytes of cobalt oxide nanoparticles (Co3O4NPs have been investigated. Co3O4NPs are commonly used in industrial products and biomedicine. There is evidence that these nanoparticles can cause membrane damage and genotoxicity in vitro, but no data are available on their skin absorption and cytotoxicity on keratinocytes. Two independent 24 h in vitro experiments were performed using Franz diffusion cells, using intact (experiment 1 and needle-abraded human skin (experiment 2. Co3O4NPs at a concentration of 1000 mg/L in physiological solution were used as donor phase. Cobalt content was evaluated by Inductively Coupled–Mass Spectroscopy. Co permeation through the skin was demonstrated after 24 h only when damaged skin protocol was used (57 ± 38 ng·cm−2, while no significant differences were shown between blank cells (0.92 ± 0.03 ng cm−2 and those with intact skin (1.08 ± 0.20 ng·cm−2. To further investigate Co3O4NPs toxicity, human-derived HaCaT keratinocytes were exposed to Co3O4NPs and cytotoxicity evaluated by MTT, Alamarblue® and propidium iodide (PI uptake assays. The results indicate that a long exposure time (i.e., seven days was necessary to induce a concentration-dependent cell viability reduction (EC50 values: 1.3 × 10−4 M, 95% CL = 0.8–1.9 × 10−4 M, MTT essay; 3.7 × 10−5 M, 95% CI = 2.2–6.1 × 10−5 M, AlamarBlue® assay that seems to be associated to necrotic events (EC50 value: 1.3 × 10−4 M, 95% CL = 0.9–1.9 × 10−4 M, PI assay. This study demonstrated that Co3O4NPs can penetrate only damaged skin and is cytotoxic for HaCat cells after long term exposure.

  20. Exposure to Carbon Nanotube Material: Assessment of Nanotube Cytotoxicity Using Human Keratinocyte Cells (United States)

    Shvedova, Anna A.; Castranova, Vincent; Kisin, Elena R.; Schwegler-Berry, Diane; Murray, Ashley R.; Gandelsman, Vadim Z.; Maynard, Andrew; Baron, Paul


    Carbon nanotubes are new members of carbon allotropes similar to fullerenes and graphite. Because of their unique electrical, mechanical, and thermal properties, carbon nanotubes are important for novel applications in the electronics, aerospace, and computer industries. Exposure to graphite and carbon materials has been associated with increased incidence of skin diseases, such as carbon fiber dermatitis, hyperkeratosis, and naevi. We investigated adverse effects of single-wall carbon nanotubes (SWCNT) using a cell culture of immortalized human epidermal keratinocytes (HaCaT). After 18 h of exposure of HaCaT to SWCNT, oxidative stress and cellular toxicity were indicated by formation of free radicals, accumulation of peroxidative products, antioxidant depletion, and loss of cell viability. Exposure to SWCNT also resulted in ultrastructural and morphological changes in cultured skin cells. These data indicate that dermal exposure to unrefined SWCNT may lead to dermal toxicity due to accelerated oxidative stress in the skin of exposed workers.

  1. The role of oncogenic Ras in human skin tumorigenesis depends on the clonogenic potential of the founding keratinocytes. (United States)

    Maurelli, Riccardo; Tinaburri, Lavinia; Gangi, Fabio; Bondanza, Sergio; Severi, Anna Lisa; Scarponi, Claudia; Albanesi, Cristina; Mesiti, Giuseppe; Guerra, Liliana; Capogrossi, Maurizio C; Dellambra, Elena


    The role of Ras in human skin tumorigenesis induction is still ambiguous. Overexpression of oncogenic Ras causes premature senescence in cultured human cells and hyperplasia in transgenic mice. Here, we investigated whether the oncogenic insult outcome might depend on the nature of the founding keratinocyte. We demonstrate that overexpression of the constitutively active Ras-V12 induces senescence in primary human keratinocyte cultures, but that some cells escape senescence and proliferate indefinitely. Ras overexpression in transient-amplifying- or stem-cell-enriched cultures shows that p16 (encoded by CDKN2A) levels are crucial for the final result. Indeed, transient-amplifying keratinocytes expressing high levels of p16 are sensitive to Ras-V12-induced senescence, whereas cells with high proliferative potential, but that do not display p16, are resistant. The subpopulation that sustains the indefinite culture growth exhibits stem cell features. Bypass of senescence correlates with inhibition of the pRb (also known as RB1) pathway and resumption of telomerase reverse transcriptase (TERT) activity. Immortalization is also sustained by activation of the ERK1 and ERK2 (ERK1/2, also known as MAPK3 and MAPK1) and Akt pathways. Moreover, only transduced cultures originating from cultures bearing stem cells induce tumors in nude mice. Our findings demonstrate that the Ras overexpression outcome depends on the clonogenic potential of the recipient keratinocyte and that only the stem cell compartment is competent to initiate tumorigenesis. © 2016. Published by The Company of Biologists Ltd.

  2. Mitochondrial and glycolytic activity of UV-irradiated human keratinocytes and its stimulation by a Saccharomyces cerevisiae autolysate. (United States)

    Schütz, Rolf; Kuratli, Karin; Richard, Nathalie; Stoll, Clarissa; Schwager, Joseph


    Cutaneous aging is correlated with mitochondrial dysfunction and a concomitant decline in energy metabolism that can be accelerated by extrinsic factors such as UV radiation (UVR). In this study we compared cellular bioenergetics of normal and UV-irradiated primary human epidermal keratinocytes. Moreover, we investigated the influence of a Saccharomyces cerevisiae autolysate (SCA) on stressed keratinocytes to regain cellular homeostasis. Cellular metabolism was assessed by extracellular flux analysis which measures oxygen consumption rate (OCR) and extracellular acidification rate (ECAR) as well as by ATP quantification. The expression level of ten mitochondria related genes in normal and UVR-stimulated (60mJ/cm(2) UVB) keratinocytes was quantified by real-time PCR and the impact of SCA addition was determined. Sublethal UV stress increased mitochondrial dysfunction in keratinocytes which resulted in reduced viability, uncoupled oxidative phosphorylation, and down-regulated mitochondrial gene expression. Particularly, gene expression of SHDA, UPC2, BID, and ATP5A1 was reduced about twofold within 4h. Treatment of keratinocytes with SCA shifted cellular metabolism towards a more energetic status by increasing the respiratory rate and glycolysis. SCA also stimulated cellular ATP production after short (4h) and prolonged (22h) incubations and induced the expression of genes related to mitochondrial function towards normal expression levels upon UV irradiation. The decreased respiratory capacity of UV-irradiated keratinocytes was partially compensated by the addition of SCA which enhanced glycolytic activity and thereby increased cellular resistance to environmental stress. Copyright © 2016 Elsevier B.V. All rights reserved.

  3. Preparation and Properties of Soluble Pig Skin Fractions Influencing on Human Keratinocyte Proliferation and Differentiation. (United States)

    Belova, Olga V.; Arion, Vitaly A.; Lopukhin, Yuri M.; Orlova, Valeria F.; Kapitanov, Alexandr B.; Korotkova, Marina N.; Dvorczova, Valentina V.; Rabovskij, Alexandr B.; Beckman, Edit M.; Baranova, Olga A.; Zimina, Irina V.


    Three fractions with different molecular weights were isolated from pig skin. Fraction 1 (F1) and fraction 3 (F3) stimulated human keratinocyte proliferation in primary and regenerating cultures, but didn't affect their differentiation. Fraction 2 (F2) inhibited keratinocyte proliferation and stimulated their differentiation. The content of the proteins, carbohydrates, ribonucleic acids (RNA) and total lipids were determined in the fractions. The content of proteins and total lipids decreased from F1 to F3, but the content of carbohydrates and RNA increased. Physico-chemical properties of the fractions were studied by the methods of isoelectric focusing and vertical electrophoresis in polyacrilamide gel with sodium dodecyl sulphate and 7 M urea. The authors found that F1 contained 2-3 main proteins with molecular weight of 58 kDa and pI from 4.9 to 5.1 and RNA with molecular weight of 44 kDa. F2 was more heterogeneous. It contained a few main proteins with molecular weights from 6.9 to 61 kDa and pI from 4.4 to 8.3 and RNA with approximate molecular weights from 5.0 to 7.5 kDa. F3 contained a few main proteins with molecular weights from 3.5 to 59 kDa and pI from 4.8 to 5.1 and RNA with approximate molecular weights from 4.8 to 7.0 kDa.

  4. Immunomodulatory effects of a set of amygdalin analogues on human keratinocyte cells. (United States)

    Baroni, A; Paoletti, I; Greco, R; Satriano, R A; Ruocco, E; Tufano, M A; Perez, J J


    Peptide T (PT) is an octapeptide shown to resolve psoriatic lesions. Our previous investigations suggest that keratinocytes play an important role in conditioning the therapeutic effects of the PT in psoriasis. However, peptides are not good therapeutic agents, because they exhibit poor absorption, are easily metabolized and are immunogenic. Using computational methods, the natural product amygdalin was identified as peptidomimetic of PT. However, amygdalin exhibits a toxic profile due to its cyanide group. To overcome this deleterious effect, we synthesized analogues lacking the cyanide group. Human keratinocytes were treated with PT or with three different peptidomimetics of PT. To study its effects on the expression of HSP-70, TGF-beta, alpha-v integrin, ICAM-1 and cytokines, we analysed the protein levels by Western blot and ELISA. Our results show that the different peptidomimetics of PT tested exhibit a similar biological behaviour in regard to the overexpression of HSP-70, TGF-beta and alpha-v integrin than the native peptide. TNF-alpha is overexpressed by PT and SVT-03018; between the other two analogs, SVT-03016 do not produce any significant change in regard to the control, while SVT-03017 shows only a moderate increase in regard to control. SVT-03018 provokes a remarkable upregulation of IL-10, stronger than SVT-03016, SVT-03017 and PT. All the other three analogues reduce comparably to the PT, the expression of ICAM-1 and do not increase the release of proinflammatory cytokines. The results highlighted that the three analogues of amygdalin with the cyanide group removed exhibit the same biological effects of PT. Therefore, they can be considered peptidomimetics, suggesting their possible use in the treatment of psoriasis.

  5. Inhibition of Inflammatory and Proliferative Responses of Human Keratinocytes Exposed to the Sesquiterpene Lactones Dehydrocostuslactone and Costunolide (United States)

    Scarponi, Claudia; Butturini, Elena; Sestito, Rosanna; Madonna, Stefania; Cavani, Andrea; Mariotto, Sofia; Albanesi, Cristina


    The imbalance of the intracellular redox state and, in particular, of the glutathione (GSH)/GSH disulfide couple homeostasis, is involved in the pathogenesis of a number of diseases. In many skin diseases, including psoriasis, oxidative stress plays an important role, as demonstrated by the observation that treatments leading to increase of the local levels of oxidant species ameliorate the disease. Recently, dehydrocostuslactone (DCE) and costunolide (CS), two terpenes naturally occurring in many plants, have been found to exert various anti-inflammatory and pro-apoptotic effects on different human cell types. These compounds decrease the level of the intracellular GSH by direct interaction with it, and, therefore, can alter cellular redox state. DCE and CS can trigger S-glutathionylation of various substrates, including the transcription factor STAT3 and JAK1/2 proteins. In the present study, we investigated on the potential role of DCE and CS in regulating inflammatory and proliferative responses of human keratinocytes to cytokines. We demonstrated that DCE and CS decreased intracellular GSH levels in human keratinocytes, as well as inhibited STAT3 and STAT1 phosphorylation and activation triggered by IL-22 or IFN-γ, respectively. Consequently, DCE and CS decreased the IL-22- and IFN-γ-induced expression of inflammatory and regulatory genes in keratinocytes, including CCL2, CXCL10, ICAM-1 and SOCS3. DCE and CS also inhibited proliferation and cell-cycle progression-related gene expression, as well as they promoted cell cycle arrest and apoptosis. In parallel, DCE and CS activated the anti-inflammatory EGFR and ERK1/2 molecules in keratinocytes, and, thus, wound healing in an in vitro injury model. In light of our findings, we can hypothesize that the employment of DCE and CS in psoriasis could efficiently counteract the pro-inflammatory effects of IFN-γ and IL-22 on keratinocytes, revert the apoptosis-resistant phenotype, as well as inhibit hyperproliferation

  6. Inhibition of inflammatory and proliferative responses of human keratinocytes exposed to the sesquiterpene lactones dehydrocostuslactone and costunolide.

    Directory of Open Access Journals (Sweden)

    Claudia Scarponi

    Full Text Available The imbalance of the intracellular redox state and, in particular, of the glutathione (GSH/GSH disulfide couple homeostasis, is involved in the pathogenesis of a number of diseases. In many skin diseases, including psoriasis, oxidative stress plays an important role, as demonstrated by the observation that treatments leading to increase of the local levels of oxidant species ameliorate the disease. Recently, dehydrocostuslactone (DCE and costunolide (CS, two terpenes naturally occurring in many plants, have been found to exert various anti-inflammatory and pro-apoptotic effects on different human cell types. These compounds decrease the level of the intracellular GSH by direct interaction with it, and, therefore, can alter cellular redox state. DCE and CS can trigger S-glutathionylation of various substrates, including the transcription factor STAT3 and JAK1/2 proteins. In the present study, we investigated on the potential role of DCE and CS in regulating inflammatory and proliferative responses of human keratinocytes to cytokines. We demonstrated that DCE and CS decreased intracellular GSH levels in human keratinocytes, as well as inhibited STAT3 and STAT1 phosphorylation and activation triggered by IL-22 or IFN-γ, respectively. Consequently, DCE and CS decreased the IL-22- and IFN-γ-induced expression of inflammatory and regulatory genes in keratinocytes, including CCL2, CXCL10, ICAM-1 and SOCS3. DCE and CS also inhibited proliferation and cell-cycle progression-related gene expression, as well as they promoted cell cycle arrest and apoptosis. In parallel, DCE and CS activated the anti-inflammatory EGFR and ERK1/2 molecules in keratinocytes, and, thus, wound healing in an in vitro injury model. In light of our findings, we can hypothesize that the employment of DCE and CS in psoriasis could efficiently counteract the pro-inflammatory effects of IFN-γ and IL-22 on keratinocytes, revert the apoptosis-resistant phenotype, as well as inhibit

  7. Triggering Apoptotic Death of Human Epidermal Keratinocytes by Malic Acid: Involvement of Endoplasmic Reticulum Stress- and Mitochondria-Dependent Signaling Pathways


    Yu-Ping Hsiao; Wan-Wen Lai; Shi-Bei Wu; Chung-Hung Tsai; Sheau-Chung Tang; Jing-Gung Chung; Jen-Hung Yang


    Malic acid (MA) has been commonly used in cosmetic products, but the safety reports in skin are sparse. To investigate the biological effects of MA in human skin keratinocytes, we investigated the potential cytotoxicity and apoptotic effects of MA in human keratinocyte cell lines (HaCaT). The data showed that MA induced apoptosis based on the observations of DAPI staining, DNA fragmentation, and sub-G1 phase in HaCaT cells and normal human epidermal keratinocytes (NHEKs). Flow cytometric assa...

  8. The Effect of Calcipotriol on the Expression of Human β Defensin-2 and LL-37 in Cultured Human Keratinocytes

    Directory of Open Access Journals (Sweden)

    Beom Joon Kim


    Full Text Available Background. Vitamin D has been reported to regulate innate immunity by controlling the expression of antimicrobial peptides (AMPs. Objective. We investigated the effect of calcipotriol on the expression of AMPs in human cultured keratinocytes. Methods. Keratinocytes were treated with lipopolysaccharide (LPS, TNF-α, Calcipotriol and irradiated with UVB, cultured, and harvested. To assess the expression of human beta defensin-2 and LL-37 in the control group, not exposed to any stimulants, the experimental group was treated with LPS, TNF-α, or UVB, and another group was treated again with calcipotriol; reverse transcriptase-polymerase chain reaction, Western blotting, and immunohistochemical staining were performed. Results. In the experimental group treated with LPS, UVB irradiation, and TNF-α, the expression of β-defensin and LL-37 was increased more than in the control group and then decreased in the experimental group treated with calcipotriol. Conclusions. Calcipotriol suppressed HBD-2 and LL-37, which were stimulated by UVB, LPS, and TNF-α.

  9. Lipophilic prodrugs of amino acids and vitamin E as osmolytes for the compensation of hyperosmotic stress in human keratinocytes. (United States)

    Graf, Rüdiger; Kock, Michael; Bock, Andreas; Schubert-Zsilavecz, Manfred; Steinhilber, Dieter; Kaufmann, Roland; Gassenmeier, Thomas; Beschmann, Heike; Bernd, August; Kippenberger, Stefan


    Skin keratinocytes are subjected to changing osmotic conditions and evolved counteracting mechanisms. Particularly, the expression of osmolyte transporters serves for the maintenance of cell volume in a hypertonic environment. In this study, we show that hyperosmotic stress significantly decreases the proliferation in HaCaT keratinocytes. Supplementation of the culture medium with the amino acids glycine, sarcosine, betaine, taurine and proline restored the proliferation indicating osmoprotective properties of these substances. Amino acids are highly polar molecules and therefore unable to penetrate into deeper epidermal layers after topical application. Thus, we utilized a prodrug concept in which the tested amino acids are coupled to a lipophilic moiety. Ethyl glycinate as a first model compound also showed an osmoprotective effect. In addition, improved penetration of the glycine derivative into deeper epidermal layers could be demonstrated. The prodrug concept was further developed by using the lipid soluble antioxidant alpha-tocopherol as a lipophilic moiety. The derivatives d,l-alpha-tocopheryl-(mono-) glycinate (TMG) and d,l-alpha-tocopheryl-(mono-) prolinate caused an increase in proliferation of HaCaT keratinocytes under salt stress and a decrease in apoptosis induced by hypertonic conditions. Furthermore, the osmoprotective effect of d,l-TMG could be corroborated in normal human keratinocytes. Therefore, it seems feasible that amino acids and their lipophilic derivatives may help to improve the osmotic balance and the hydration of skin. Clinical and cosmetic indications such as atopic eczema, UV exposed skin or aged skin may benefit from this new concept.

  10. Sacha Inchi Oil (Plukenetia volubilis L.), effect on adherence of Staphylococus aureus to human skin explant and keratinocytes in vitro. (United States)

    Gonzalez-Aspajo, German; Belkhelfa, Haouaria; Haddioui-Hbabi, Laïla; Bourdy, Geneviève; Deharo, Eric


    Plukenetia volubilis L. (Euphorbiaceae) is a domesticated vine distributed from the high-altitude Andean rain forest to the lowlands of the Peruvian Amazon. Oil from the cold-pressed seeds, sold under the commercial name of Sacha Inchi Oil (SIO) is actually much in favour because it contains a high percentage of omega 3 and omega 6, and is hence used as a dietary supplement. SIO is also used traditionally for skin care, in order to maintain skin softness, and for the treatment of wounds, insect bites and skin infections, in a tropical context where the skin is frequently damaged. This study was designed in order to verify whether the traditional use of SIO for skin care would have any impact on Staphylococcus aureus growth and skin adherence, as S. aureus is involved in many skin pathologies (impetigo, folliculitis, furuncles and subcutaneous abscesses) being one if the main pathogens that can be found on the skin. Therefore, our objective was to assess SIO bactericidal activity and interference with adherence to human skin explants and the keratinocyte cell line. Cytotoxicity on that cells was also determined. The activity of SIO was compared to coconut oil (CocO), which is widely used for skin care but has different unsaturated fatty acids contents. Laboratory testing with certified oil, determined antibacterial activity against radio labelled S. aureus. Cytotoxic effects were measured with XTT on keratinocyte cells and with neutral red on human skin explants; phenol was used as cytotoxic control. Adherence assays were carried out by mixing H3-labelled S. aureus bacteria with keratinocyte cells and human skin explants, incubated with oils 2h before (to determine the inhibition of adherence, assimilated to a preventive effect) or 2h after the contact of the biological material with S. aureus (to assess the detachment of the bacteria, assimilated to a curative effect). Residual radioactivity measured after washings made it possible to determine the adherence

  11. Calcium and Vitamin D increase mRNA levels for the growth control hIK1 channel in human epidermal keratinocytes but functional channels are not observed

    Directory of Open Access Journals (Sweden)

    Rossie Sandra


    Full Text Available Abstract Background Intermediate-conductance, calcium-activated potassium channels (IKs modulate proliferation and differentiation in mesodermal cells by enhancing calcium influx, and they contribute to the physiology of fluid movement in certain epithelia. Previous reports suggest that IK channels stimulate proliferative growth in a keratinocyte cell line; however, because these channels indirectly promote calcium influx, a critically unique component of the keratinocyte differentiation program, an alternative hypothesis is that they would be anti-proliferative and pro-differentiating. This study addresses these hypotheses. Methods Real-time PCR, patch clamp electrophysiology, and proliferation assays were used to determine if human IK1 (hIK1 expression and function are correlated with either proliferation or differentiation in cultured human skin epidermal keratinocytes, and skin biopsies grown in explant culture. Results hIK1 mRNA expression in human keratinocytes and skin was increased in response to anti-proliferative/pro-differentiating stimuli (elevated calcium and Vitamin D. Correspondingly, the hIK1 agonist 1-EBIO inhibited keratinocyte proliferation suggesting that the channel could be anti-proliferative and pro-differentiating. However, this proliferative inhibition by 1-EBIO was not reversed by a panel of hIK1 blockers, calling into question the mechanism of 1-EBIO action. Subsequent patch clamp electrophysiological analysis failed to detect hIK1 channel currents in keratinocytes, even those expressing substantial hIK1 mRNA in response to calcium and Vitamin D induced differentiation. Identical electrophysiological recording conditions were then used to observe robust IK1 currents in fibroblasts which express IK1 mRNA levels comparable to those of keratinocytes. Thus, the absence of observable hIK1 currents in keratinocytes was not a function of the electrophysiological techniques. Conclusion Human keratinocyte differentiation is

  12. Cytotoxic effects of sodium dodecyl benzene sulfonate on human keratinocytes are not associated with proinflammatory cytokines expression. (United States)

    Mu, Zhanglei; Liu, Xiaojing; Zhao, Yan; Zhang, Jianzhong


    Keratinocytes play a crucial role in the biological function of skin barrier. The relationship between sodium lauryl sulfate (SLS) and keratinocytes has been studied. However, the cytotoxicity and effects of sodium dodecyl benzene sulfonate (SDBS), a common detergent similar to SLS, on keratinocytes are still not known. This study aimed to investigate the effects of SDBS on cytotoxicity and expression of proinflammatory cytokines in cultured human keratinocytes. This study was carried out using the keratinocytes cell line, HaCaT cells. The cytotoxicity of SDBS on HaCaT cells was evaluated with cell counting kit-8 (CCK-8) and phase-contrast microscopy. After exposure to different concentrations of SDBS, the total RNA of the HaCaT cells was extracted for evaluating the relative mRNA expression of IL-1α, IL-6, IL-8, and TNF-α by qPCR. The supernatants of cells were collected for measuring the levels of IL-6 and IL-8 by enzyme-linked immunosorbent assay (ELISA). SDBS at concentrations of 20 µg/ml and over showed direct cytotoxicity and induced morphological changes of the HaCaT cells. The mRNA expressions of IL-1α, IL-6, IL-8, and TNF-a in different concentrations of SDBS at different time were comparable with that of controls. SDBS at concentrations of 5, 10, and 15 µg/ml had no significant effects on IL-6 and IL-8 excretion from HaCaT cells after 24-hour exposure. Moreover, no significant effects on the IL-6 and IL-8 excretion were found after 10 and 15 µg/ml SDBS stimulations for 6, 12, and 24 hours, respectively. SDBS at higher concentrations had cytotoxicity on HaCaT cells but had no effects on the mRNA expression of IL-1α, IL-6, IL-8, and TNF-a, that was different from SLS.

  13. Test system for evaluating the influence of polymer properties on primary human keratinocytes and fibroblasts in mono- and coculture. (United States)

    Trescher, Karoline; Roch, Toralf; Cui, Jing; Kratz, Karl; Lendlein, Andreas; Jung, Friedrich


    Interactions of cells with polymer-based biomaterials are influenced by properties of the substrate. Polymers, which are able to induce cell specific effects, gain increasing importance for biotechnology and regenerative therapies. A test system was developed, which allows studying primary human keratinocytes and fibroblasts in mono- and cocultures to analyze and operate the effect of polymer properties. This system offers to identify polymers for keratinocyte cultivation or wound dressings, since adherence, viability and functionality can be analyzed. Especially the coculture system enables the characterization of potential cell specific effects of polymer-based biomaterials. To establish a coculture test system, it is challenging to find a suitable culture medium, to identify initial seeding densities for comparable cell growth and to develop methods to distinguish and characterize both cell types. Poly(n-butyl acrylate) networks (cPnBAs) as model biomaterials were used to demonstrate the applicability of our newly developed coculture screening system for differential cell growth. The apparent Young's modulus of the cPnBAs differentially regulated fibroblasts and keratinocytes. Particularly, cPnBA73 with an apparent Young's modulus of 930±140 kPa measured in phosphate buffered saline (PBS) solution at ambient temperature seemed to have favoring properties for keratinocyte adhesion, while fibroblast adhesion was not affected. For keratinocytes the concentration of some pro-inflammatory cytokines was lower on cPnBA73 and a decreased deposition of collagen, elastin and fibronectin was observed in the coculture. Copyright © 2013 Elsevier B.V. All rights reserved.

  14. Insights into the impact of silver nanoparticles on human keratinocytes metabolism through NMR metabolomics. (United States)

    Carrola, Joana; Bastos, Verónica; Ferreira de Oliveira, José Miguel P; Oliveira, Helena; Santos, Conceição; Gil, Ana M; Duarte, Iola F


    Due to their antimicrobial properties, silver nanoparticles (AgNPs) are increasingly incorporated into consumer goods and medical products. Their potential toxicity to human cells is however a major concern, and there is a need for improved understanding of their effects on cell metabolism and function. Here, Nuclear Magnetic Resonance (NMR) metabolomics was used to investigate the metabolic profile of human epidermis keratinocytes (HaCaT cell line) exposed for 48 h to 30 nm citrate-stabilized spherical AgNPs (10 and 40 μg/mL). Intracellular aqueous extracts, organic extracts and extracellular culture medium were analysed to provide an integrated view of the cellular metabolic response. The specific metabolite variations, highlighted through multivariate analysis and confirmed by spectral integration, suggested that HaCaT cells exposed to AgNPs displayed upregulated glutathione-based antioxidant protection, increased glutaminolysis, downregulated tricarboxylic acid (TCA) cycle activity, energy depletion and cell membrane modification. Importantly, most metabolic changes were apparent in cells exposed to a concentration of AgNPs which did not affect cell viability at significant levels, thus underlying the sensitivity of NMR metabolomics to detect early biochemical events, even in the absence of a clear cytotoxic response. It can be concluded that NMR metabolomics is an important new tool in the field of in vitro nanotoxicology. Copyright © 2015 Elsevier Inc. All rights reserved.

  15. Binding of transmembrane mucins to galectin-3 limits herpesvirus 1 infection of human corneal keratinocytes. (United States)

    Woodward, A M; Mauris, J; Argüeso, P


    Epithelial cells lining mucosal surfaces impose multiple barriers to viral infection. At the ocular surface, the carbohydrate-binding protein galectin-3 maintains barrier function by cross-linking transmembrane mucins on the apical glycocalyx. Despite these defense mechanisms, many viruses have evolved to exploit fundamental cellular processes on host cells. Here, we use affinity assays to show that herpes simplex virus type 1 (HSV-1), but not HSV-2, binds human galectin-3. Knockdown of galectin-3 in human corneal keratinocytes by small interfering RNA significantly impaired HSV-1 infection, but not expression of nectin-1, indicating that galectin-3 is a herpesvirus entry mediator. Interestingly, exposure of epithelial cell cultures to transmembrane mucin isolates decreased viral infectivity. Moreover, HSV-1 failed to elute the biological counterreceptor MUC16 from galectin-3 affinity columns, suggesting that association of transmembrane mucins to galectin-3 provides protection against viral infection. Together, these results indicate that HSV-1 exploits galectin-3 to enhance virus attachment to host cells and support a protective role for transmembrane mucins under physiological conditions by masking viral entry mediators on the epithelial glycocalyx.

  16. Cellular interactions of a lipid-based nanocarrier model with human keratinocytes: Unravelling transport mechanisms. (United States)

    Silva, Elisabete; Barreiros, Luísa; Segundo, Marcela A; Costa Lima, Sofia A; Reis, Salette


    Knowledge of delivery system transport through epidermal cell monolayer is vital to improve skin permeation and bioavailability. Recently, nanostructured lipid carriers (NLCs) have gained great attention for transdermal delivery due to their biocompatibility, high drug payload, occlusive properties and skin hydration effect. However, the nanocarriers transport related mechanisms in epidermal epithelial cells are not yet understood. In this research, the internalization and transport pathways of the NLCs across the epidermal epithelial cell monolayer (HaCaT cells) were investigated. The 250nm sized witepsol/miglyol NLCs, prepared by hot homogenization had reduced cytotoxicity and no effect on the integrity of cell membrane in human HaCaT keratinocytes. The internalization was time-, concentration- and energy-dependent, and the uptake of NLCs was a vesicle-mediated process by macropinocytosis and clathrin-mediated pathways. 3% of NLCs were found at the apical membrane side of the HaCaT monolayer through exocytosis mechanism. Additionally, the endoplasmic reticulum, Golgi apparatus and microtubules played crucial roles in the transport of NLCs out of HaCaT cells. NLCs were transported intact across the human keratinocytes monolayer, without disturbing the tight junction's structure. From the transcytosis data only approximately 12% of the internalized NLCs were passed from the apical to the basolateral side. The transcytosis of NLCs throughout the HaCaT cell monolayer towards the basolateral membrane side requires the involvement of the endoplasmic reticulum, Golgi apparatus and microtubules. Our findings may contribute to a systematic understanding of NLCs transport across epidermal epithelial cell monolayers and their optimization for clinical transdermal application. Transdermal drug delivery is a challenging and growing area of clinical application. Lipid nanoparticles such as nanostructured lipid carriers (NLCs) have gained wide interest for transdermal drug

  17. Cell kinetic characterization of cultured human keratinocytes from normal and psoriatic individuals. (United States)

    van Ruissen, F; de Jongh, G J; van Erp, P E; Boezeman, J B; Schalkwijk, J


    Psoriasis is a chronic skin disease characterized by epidermal hyperproliferation, disturbed differentiation, and inflammation. It is still a matter of debate whether the pathogenesis of psoriasis is based on immunological mechanisms, on defective growth control mechanisms, or possibly on a combination of both. Several in vivo cell biological differences between psoriatic lesional epidermis and normal epidermis have been reported. However, it is not clear whether these changes are causal or consequential. In case that keratinocytes from psoriatic patients have genetically determined deficiencies or polymorphisms with respect to autocrine growth regulation and the response to inflammatory cytokines, we hypothesize that these differences should be maintained in culture. Here we have started a systematic comparison of first passage keratinocytes cultured from normal skin and uninvolved psoriatic skin to address the question whether there are intrinsic differences in basic cell cycle parameters. In an established, defined culture system using keratinocyte growth medium (KGM) we have determined: (i) cell cycle parameters of exponentially growing keratinocytes, (ii) induction of quiescence by transforming growth factor beta 1 (TGF-beta 1) and (iii) restimulation from the G0-phase of the cell cycle. Bivariate analysis of lodo-deoxyuridine incorporation and relative DNA content was performed by flow cytometry. Within the limitations of this model no gross differences were found between normal and psoriatic keratinocytes with respect to S-phase duration (Ts), total cell cycle duration (Tc), responsiveness to TGF-beta 1 and the kinetics for recruitment from G0. In psoriatic keratinocytes we found a lower amount of cell in S-phase and a shorter duration of G1, compared to normal keratinocytes. The methodology developed here provides us with a model for further studies on differences between normal and psoriatic keratinocytes in their response to immunological and inflammatory

  18. Isolation, identification, and pathological effects of beach sand bacterial extract on human skin keratinocytes in vitro

    Directory of Open Access Journals (Sweden)

    Fazli Subhan


    Full Text Available Background Beaches are recreational spots for people. However, beach sand contains harmful microbes that affect human health, and there are no established methods for either sampling and identifying beach-borne pathogens or managing the quality of beach sand. Method This study was conducted with the aim of improving human safety at beaches and augmenting the quality of the beach experience. Beach sand was used as a resource to isolate bacteria due to its distinctive features and the biodiversity of the beach sand biota. A selected bacterial isolate termed FSRS was identified as Pseudomonas stutzeri using 16S rRNA sequencing and phylogenetic analysis, and the sequence was deposited in the NCBI GenBank database under the accession number MF599548. The isolated P. stutzeri bacterium was cultured in Luria–Bertani growth medium, and a crude extract was prepared using ethyl acetate to examine the potential pathogenic effect of P. stutzeri on human skin. A human skin keratinocyte cell line (HaCaT was used to assess cell adhesion, cell viability, and cell proliferation using a morphological analysis and a WST-1 assay. Result The crude P. stutzeri extract inhibited cell adhesion and decreased cell viability in HaCaT cells. We concluded that the crude extract of P. stutzeri FSRS had a strong pathological effect on human skin cells. Discussion Beach visitors frequently get skin infections, but the exact cause of the infections is yet to be determined. The beach sand bacterium P. stutzeri may, therefore, be responsible for some of the dermatological problems experienced by people visiting the beach.

  19. Exploiting high-throughput screens to optimize Adeno-Associated Viral Vectors for gene transfer into primary human keratinocytes


    Sallach, Jessica


    Chronic non-healing wounds such as diabetic ulcers or burns represent a devastating health problem with significant clinical, physical and social implications. The healing can be frustrating and painful for patients. The difficult healing process requires advanced therapeutic strategies such as the use of primary human keratinocytes (HK) as autologous transplants, which may be considered for clinical use. To improve engraftment or to introduce therapeutic genes into primary HK, efficient and ...

  20. Human Papillomavirus E2 Regulates SRSF3 (SRp20) To Promote Capsid Protein Expression in Infected Differentiated Keratinocytes


    Klymenko, Tetyana; Hernandez-Lopez, H.; MacDonald, A.I; Bodily, J. M.; Graham, S. V.; Beemon, K L


    The human papillomavirus (HPV) life cycle is tightly linked to differentiation of the infected epithelial cell, suggesting a sophisticated interplay between host cell metabolism and virus replication. Previously, we demonstrated in differentiated keratinocytes in vitro and in vivo that HPV type 16 (HPV16) infection caused increased levels of the cellular SR splicing factors (SRSFs) SRSF1 (ASF/SF2), SRSF2 (SC35), and SRSF3 (SRp20). Moreover, the viral E2 transcription and replication factor th...

  1. An ascorbic acid-enriched tomato genotype to fight UVA-induced oxidative stress in normal human keratinocytes. (United States)

    Petruk, Ganna; Raiola, Assunta; Del Giudice, Rita; Barone, Amalia; Frusciante, Luigi; Rigano, Maria Manuela; Monti, Daria Maria


    UVA radiations contribute up to 95% of the total UV exposure and are known to induce cell damage, leading to apoptosis. Since the benefic effects of ascorbic acid on human health are well known, a new tomato genotype (named DHO4), highly rich in ascorbic acid, has been recently obtained. Here, we compared the effects of ascorbic acid and hydrophilic DHO4 extracts in protecting human keratinocytes exposed to UVA stress. Keratinocytes were pre-incubated with ascorbic acid or with extracts from the ascorbic acid enriched tomato genotype and irradiated with UVA light. Then, ROS production, intracellular GSH and lipid peroxidation levels were quantified. Western blots were carried out to evaluate mitogen-activated protein kinases cascade, activation of caspase-3 and inflammation levels. We demonstrated that ROS, GSH and lipid peroxidation levels were not altered in cell exposed to UVA stress when cells were pre-treated with ascorbic acid or with tomato extracts. In addition, no evidence of apoptosis and inflammation were observed in irradiated pre-treated cells. Altogether, we demonstrated the ability of an ascorbic acid enriched tomato genotype to counteract UVA-oxidative stress on human keratinocytes. This protective effect is due to the high concentration of vitamin C that acts as free radical scavenger. This novel tomato genotype may be used as genetic material in breeding schemes to produce improved varieties with higher antioxidant levels. Copyright © 2016 Elsevier B.V. All rights reserved.

  2. Oligonucleotides suppress PKB/Akt and act as superinductors of apoptosis in human keratinocytes. (United States)

    Kippenberger, Stefan; Müller, Jutta; Schultz, Maike; Dorn, Annette; Bock, Andreas; Aygün, Hüseyin; Thaçi, Diamant; Hofmann, Matthias; Kaufmann, Roland; Bernd, August


    DNA oligonucleotides (ODN) applied to an organism are known to modulate the innate and adaptive immune system. Previous studies showed that a CpG-containing ODN (CpG-1-PTO) and interestingly, also a non-CpG-containing ODN (nCpG-5-PTO) suppress inflammatory markers in skin. In the present study it was investigated whether these molecules also influence cell apoptosis. Here we show that CpG-1-PTO, nCpG-5-PTO, and also natural DNA suppress the phosphorylation of PKB/Akt in a cell-type-specific manner. Interestingly, only epithelial cells of the skin (normal human keratinocytes, HaCaT and A-431) show a suppression of PKB/Akt. This suppressive effect depends from ODN lengths, sequence and backbone. Moreover, it was found that TGF alpha-induced levels of PKB/Akt and EGFR were suppressed by the ODN tested. We hypothesize that this suppression might facilitate programmed cell death. By testing this hypothesis we found an increase of apoptosis markers (caspase 3/7, 8, 9, cytosolic cytochrome c, histone associated DNA fragments, apoptotic bodies) when cells were treated with ODN in combination with low doses of staurosporin, a well-known pro-apoptotic stimulus. In summary the present data demonstrate DNA as a modulator of apoptosis which specifically targets skin epithelial cells.

  3. Niacin protects against UVB radiation-induced apoptosis in cultured human skin keratinocytes (United States)



    Niacin and its related derivatives have been shown to have effects on cellular activities. However, the molecular mechanism of its reduced immunosuppressive effects and photoprotective effects remains unclear. In this study, we investigated the molecular mechanism of the photoprotective effect of niacin in ultraviolet (UV)-irradiated human skin keratinocytes (HaCaT cells). We found that niacin effectively suppressed the UV-induced cell death and cell apoptosis of HaCaT cells. Existing data have shown that AKT activation is involved in the cell survival process. Yet, the potential mechanism of niacin in protection against UV-induced skin damage has thus far not fully been eluvidated. We observed that niacin pretreatment enhances UV induced activation of AKT (Ser473 phosphorylation) as well as that of the downstream signal mTOR (S6 and 4E-BP1 phosphorylation). The PI3K/AKT inhibitor, LY294002, and the mTOR inhibitor, rapamycin, largely neutralized the protective effects of niacin, suggesting that AKT and downstream signaling mTOR/S6 activation are necessary for the niacin-induced protective effects against UV-induced cell death and cell apoptosis. Collectively, our data suggest that niacin may be utilized to prevent UV-induced skin damage and provide a novel mechanism of its photoprotective effects against the UV radiation of sunlight by modulating both AKT and downstream mTOR signaling pathways. PMID:22246168

  4. Non-thermal dielectric-barrier discharge plasma damages human keratinocytes by inducing oxidative stress (United States)



    The aim of this study was to identify the mechanisms through which dielectric-barrier discharge plasma damages human keratinocytes (HaCaT cells) through the induction of oxidative stress. For this purpose, the cells were exposed to surface dielectric-barrier discharge plasma in 70% oxygen and 30% argon. We noted that cell viability was decreased following exposure of the cells to plasma in a time-dependent manner, as shown by 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide assay. The levels of intracellular reactive oxygen species (ROS) were determined using 2′,7′-dichlorodihydro-fluorescein diacetate and dihydroethidium was used to monitor superoxide anion production. Plasma induced the generation of ROS, including superoxide anions, hydrogen peroxide and hydroxyl radicals. N-acetyl cysteine, which is an antioxidant, prevented the decrease in cell viability caused by exposure to plasma. ROS generated by exposure to plasma resulted in damage to various cellular components, including lipid membrane peroxidation, DNA breaks and protein carbonylation, which was detected by measuring the levels of 8-isoprostane and diphenyl-1-pyrenylphosphine assay, comet assay and protein carbonyl formation. These results suggest that plasma exerts cytotoxic effects by causing oxidative stress-induced damage to cellular components. PMID:26573561

  5. The effect of melanin on the bystander effect in human keratinocytes

    Energy Technology Data Exchange (ETDEWEB)

    Mosse, I. [Institute of Genetics and Cytology of the National Academy of Sciences, Academicheskaya Str. 27, Minsk (Belarus)]. E-mail:; Marozik, P. [Institute of Genetics and Cytology of the National Academy of Sciences, Academicheskaya Str. 27, Minsk (Belarus); Radiation and Environmental Science Centre, DIT, Dublin 8 (Ireland); Seymour, C. [Department of Medical Physics and Applied Radiation Sciences, McMaster University, Hamilton, Ont. (Canada); Mothersill, C. [Department of Medical Physics and Applied Radiation Sciences, McMaster University, Hamilton, Ont. (Canada)


    The influence of melanin on radiation-induced bystander effects has been studied. Melanin is known to be a natural substance with proved radioprotective properties in different organisms and cell lines. It is non-toxic and is effective against acute and chronic irradiation. The lower the radiation dose, the higher the relative impact of melanin protection. In this study influence of melanin on human keratinocytes (HPV-G cells) has been studied using the colony-forming assay. We have shown that bystander donor medium from 0.5 Gy irradiated cells when transferred to unirradiated cells, caused almost the same effect as direct irradiation. Melanin increased the colony-forming ability of bystander recipient cells when it was added into culture medium before irradiation. The effect of melanin added after irradiation was to produce less protection in both the directly irradiated and bystander medium treated groups. The absorption spectrum of the filtered medium is identical to one of the intact culture medium showing that melanin was not present in filtered medium. Thus, it cannot protect recipient cells but reduces the amount of the bystander effect. It is concluded that melanin added before irradiation effectively decreased the radiation dose. The reduction of the impact of the bystander signal on recipient cells when melanin was added to the donor medium after harvest but before filtration, may mean that the bystander signal has a physical component as melanin can absorb all types of physical energy.

  6. Comparative toxicities of bismuth oxybromide and titanium dioxide exposure on human skin keratinocyte cells. (United States)

    Gao, Xiaoya; Wang, Yawen; Peng, Shiqi; Yue, Bin; Fan, Caimei; Chen, Weiyi; Li, Xiaona


    Nano-sized bismuth oxybromide (BiOBr) particles are being considered for applications within the semiconductor industry. However, little is known about their potential impact on human health. In this study, we comparatively investigated the cytotoxicity of BiOBr and titanium dioxide (TiO2) nanoparticles (NPs) using human skin keratinocyte cell line (HaCaT) as a research model. Results indicate that lamellar-shaped BiOBr (length: 200 nm, width: 150 nm, and an average thickness: around 15 nm) has less toxic effects on cell viability and intracellular organelles than TiO2 (P25) NPs. BiOBr mainly induced late cell apoptosis, while for TiO2, both early apoptosis and late apoptosis were involved. Cell cycle arrest was found in cells on both NPs exposure, and more prominent in TiO2-treated cells. More cellular uptake was achieved after TiO2 exposure, particularly at 10 μg mL(-1), presence of TiO2 resulted in more than 2-fold increase in cellular granularity compared with BiOBr. Furthermore, TiO2 had a high potential to generate intracellular reactive oxygen species (ROS) in cells, where a 2.7-fold increase in TiO2 group and 2.0-fold increase in BiOBr group at the same concentration of 25 μg mL(-1). Higher cellular uptake and ROS stimulation should contribute to the more hazards of TiO2 than BiOBr NPs. This knowledge is a crucial component in the environmental and human hazard assessment of BiOBr and TiO2 NPs. Copyright © 2015 Elsevier Ltd. All rights reserved.

  7. Anti-Inflammatory, Immunomodulatory, and Tissue Repair Activity on Human Keratinocytes by Green Innovative Nanocomposites. (United States)

    Morganti, Pierfrancesco; Fusco, Alessandra; Paoletti, Iole; Perfetto, Brunella; Del Ciotto, Paola; Palombo, Marco; Chianese, Angelo; Baroni, Adone; Donnarumma, Giovanna


    The use of raw materials obtained by waste and processed through innovative industrial methodologies has generated an industry of about a trillion dollars in a short time, and in the near future will provide resources and services for the conservation and sustainable use of natural resources in order to ensure a better and fairer welfare for the human race. The production of nano-fiber chitin non-woven tissue is in accordance with the Organization for Economic Co-operation and Development (OECD) and European Union (EU) bio-economic programs: 100% biodegradable, ecological, and therefore useful in decreasing dependence on fossil fuel resources. The aim of our study is the evaluation of different formulations of a non-woven tissue obtained from electrospinning of a mixture of nanochitin fibrils, lignin, and poly (ethylene) oxide (PEO) on the restoration of damaged tissues. Wound repair is a complex process that involves epithelial and immune cells and includes the induction of metalloproteinases, inflammatory mediators, and angiogenic factors. Our in vitro results have shown that all of the realized chitin nanofibrils-bio-lignin non-woven tissues tested as nontoxic for human keratinocytes (HaCat) cells. Furthermore, the bio-composites that included bio-lignin at 0.1% have been able to modulate the expression of pro-inflammatory cytokines (Tumor Necrosis Factor-α, IL-1α, and IL8), lipopolysaccharide (LPS)-induced, and matrix metalloproteinases (MMPs) and human beta-defensin 2 (HBD-2) expression in HaCat cells, suggesting an anti-inflammatory and immunomodulatory role. Taken together, our results suggest that our chitin nanofibrils-bio-lignin non-woven tissue represents a skin-friendly tool that is able to favor a correct and fast wound repair.

  8. Influence of acidic pH on keratinocyte function and re-epithelialisation of human in vitro wounds. (United States)

    Lönnqvist, Susanna; Emanuelsson, Peter; Kratz, Gunnar


    Chronic wounds are one of the greatest challenges for the healthcare system. Today, a plethora of dressings are used in the treatment of these wounds, each with specific influence on the wound environment. Due to differences in the permeability of the dressings the use will result in differences in the pH balance in the wound bed. However, little is known about how changes in the pH in the wound environment affect the different phases of the healing process. The aim of the present study was to investigate the effects of acidic pH on the regeneration phase by studying keratinocyte function in vitro and re-epithelialisation in an in vitro model of human skin. In vitro assays showed reduced viability and migration rates in human keratinocytes when pH was lowered. Real time PCR revealed differential expression of genes related to wound healing and environmental impairment. Tissue culture showed no re-epithelialisation of wounds subjected to pH 5.0 and moderate re-epithelialisation at pH 6.0, compared to controls at pH 7.4. The results indicate that lowering pH down to pH 5.0 in wounds is counterproductive in aspect of keratinocyte function which is crucial for successful wound healing.

  9. Epigallocatechin-3-gallate attenuates the AIM2-induced secretion of IL-1β in human epidermal keratinocytes. (United States)

    Yun, Mihee; Seo, Gimoon; Lee, Ji-Young; Chae, Gue Tae; Lee, Seong-Beom


    The pro-inflammatory cytokine interleukin-1β (IL-1β) plays a central role in the pathogenesis of psoriasis. Keratinocytes are a major source of IL-1β and express absent in melanoma 2 (AIM2). AIM2 recognizes a double-stranded DNA and initiates the IL-1β-processing of inflammasome. The AIM2 inflammasome is a cytosolic multiprotein complex composed of AIM2, an apoptosis-associated speck-like protein containing a caspase recruitment domain (ASC), and pro-caspase-1. Epigallocatechin-3-Gallate (EGCG), a major polyphenolic component of green tea, has anti-inflammatory properties. In the current study, we investigated the issue of whether or how EGCG suppresses AIM2 inflammasome in human epidermal keratinocytes, neonatal (HEKn). Treatment with EGCG, before or after IFN-γ priming, attenuated poly(dA:dT)-induced IL-1β secretion in HEKn cells. Pre-treatment with EGCG reduced the level of IFN-γ-induced priming signal via the down-regulation of pro-IL-1β and pro-capspase-1 in HEKn cells. Furthermore, treatment with EGCG attenuated poly(dA:dT)-induced ASC oligomerization and caspase-1 activation in IFN-γ-primed HEKn cells. These results suggest that EGCG attenuates AIM2-induced IL-1β secretion by suppressing both IFN-γ-mediated priming and poly(dA:dT)-induced ASC oligomerization of inflammasomes in human epidermal keratinocytes. Copyright © 2015 Elsevier Inc. All rights reserved.

  10. Protective effects of an extract from Citrus bergamia against inflammatory injury in interferon-γ and histamine exposed human keratinocytes. (United States)

    Graziano, Adriana C E; Cardile, Venera; Crascì, Lucia; Caggia, Sivia; Dugo, Paola; Bonina, Francesco; Panico, Annamaria


    The present work evaluated the anti-inflammatory/antioxidant activity of a well characterized extract from Citrus bergamia Risso and Poiteau (CBE), containing neoeriocitrin, naringin, neohesperidin and other flavonoids, on human NCTC 2544 keratinocytes treated with interferon-gamma (IFN-γ) and histamine (H). High performance liquid chromatography (HPLC) coupled with diode array detectors was used to characterize and quantify phenolic compounds in CBE. Anti-inflammatory/antioxidant ability on keratinocytes was determined through evaluation of inter-cellular adhesion molecule-1 (ICAM-1) and inducible nitric oxide synthase (iNOS) expression by Western blot, production of nitric oxide (NO) with Griess reagent and concentration of reactive oxygen species (ROS) by fluorescent quantitative analysis with 2',7'-dichlorfluorescein-diacetate (DCFH-DA). Cell viability was assessed using 3-(4,5-dimethyl-2 thiazoyl)-2,5-diphenyl-2H-tetrazolium bromide (MTT) assay. Antioxidant activity was also measured by oxygen radical absorbance capacity (ORAC) assay. Glycosaminoglycans (GAGs) were quantified using 1.9-dimethyl methylene blue (DMB). CBE exhibited high antioxidant activity confirmed by elevated ORAC values related to high capacity in oxygen radical scavenging. The assays on keratinocytes demonstrated that CBE does not inhibit cell proliferation and is shown to significantly reduce dose-dependently ICAM-1, iNOS, NO, ROS and GAG production in cells exposed to IFN-γ and H. Our study demonstrates that the pools of compounds of an extract from C. bergamia efficiently block the proinflammatory actions induced by IFN-γ and H on human keratinocytes. CBE may be used for topic employment in some inflammatory diseases of the skin and to represent an important opportunity for the essential oil processing industries. Copyright © 2012 Elsevier Inc. All rights reserved.

  11. Regulation of migratory activity of human keratinocytes by topography of multiscale collagen-containing nanofibrous matrices. (United States)

    Fu, Xiaoling; Xu, Meng; Liu, Jie; Qi, Yanmei; Li, Shaohua; Wang, Hongjun


    Nanofibrous matrices hold great promise in skin wound repair partially due to their capability of recapturing the essential attributes of native extracellular matrix (ECM). With regard to limited studies on the effect of nanofibrous matrices on keratinocytes, the present study was aimed to understand how the topographical feature of nanofibrous matrices regulates keratinocyte motility by culturing keratinocytes on polycaprolactone (PCL)/collagen nanofibrous matrices (rough surface with fiber diameters of 331 ± 112 nm) or the matrices coated with a thin layer of collagen gel to form a secondary ultrafine fibrous network (smooth surface with ultrafine fiber diameters of 55 ± 26 nm). It was found that the PCL/collagen nanofibrous matrices alone did not stimulate cell migration, while collagen gel coating could significantly increase cell motility. Further studies demonstrated that the ultrafine fibrous network of collagen gel coating significantly activated integrin β1, Rac1 and Cdc42, facilitated the deposition of laminin-332 (formerly called laminin-5), and promoted the expression of active matrix metalloproteinases (MMPs) (i.e., MMP-2 and 9). Neutralization of integrin β1 activity abrogated the gel coating-induced keratinocyte migration. These findings provide important evidence on the role of topographical features of nanofibrous matrices in regulating the phenotypic alteration of keratinocytes and suggest the possible utility of collagen-containing nanofibrous matrices for skin regeneration especially in re-epithelialization. Copyright © 2013 Elsevier Ltd. All rights reserved.

  12. Hypotonic stress induces E-cadherin expression in cultured human keratinocytes. (United States)

    Kippenberger, Stefan; Loitsch, Stefan; Guschel, Maike; Müller, Jutta; Kaufmann, Roland; Bernd, August


    Human epidermis marks the interface between internal and external environments with the major task being to maintain body hydration. Alternating exposure of skin to a dry or humid environment is likely to cause changes in the epidermal water gradient resulting in osmotic alterations of epidermal keratinocytes. The present in vitro approach studied the effect of hypotonicity on cell-cell contact. It was demonstrated that hypotonic stress applied to human epithelial cells (HaCaT, A-431) induced upregulation of E-cadherin at both, the protein and mRNA level. 5'-deletional mutants of the E-cadherin promoter identified an element ranging from -53 to +31 that conveyed strong transactivation under hypotonic stress. In order to define relevant upstream regulators members of the MAP kinase family, the epidermal growth factor receptor (EGFR) and protein kinase B/Akt (PKB/Akt) were investigated. Hypotonic conditions led to a fast activation of ERK1/2, SAPK/JNK, p38, EGFR and PKB/Akt with distinct activation patterns. Experiments using specific inhibitors showed that p38 contributes to the E-cadherin transactivation under hypotonic conditions. Further upstream, adhesion was found to be a prerequisite for E-cadherin transactivation in this model. In summary, the present study provides evidence that E-cadherin is an osmo-sensitive gene that responds to hypotonic stress. The function of this regulation may be found in morphological changes induced by cell swelling. It is likely that induction of E-cadherin contributes to the stabilization between adjacent cells in order to withstand the physical forces induced by hypotonicity.

  13. Early Gene Expression in Wounded Human Keratinocytes Revealed by DNA Microarray Analysis

    Directory of Open Access Journals (Sweden)

    Pascal Barbry


    Full Text Available Wound healing involves several steps: spreading of the cells, migration and proliferation. We have profiled gene expression during the early events of wound healing in normal human keratinocytes with a home-made DNA microarray containing about 1000 relevant human probes. An original wounding machine was used, that allows the wounding of up to 40% of the surface of a confluent monolayer of cultured cells grown on a Petri dish (compared with 5% with a classical ‘scratch’ method. The two aims of the present study were: (a to validate a limited number of genes by comparing the expression levels obtained with this technique with those found in the literature; (b to combine the use of the wounding machine with DNA microarray analysis for large-scale detection of the molecular events triggered during the early stages of the wound-healing process. The time-courses of RNA expression observed at 0.5, 1.5, 3, 6 and 15 h after wounding for genes such as c-Fos, c-Jun, Egr1, the plasminogen activator PLAU (uPA and the signal transducer and transcription activator STAT3, were consistent with previously published data. This suggests that our methodologies are able to perform quantitative measurement of gene expression. Transcripts encoding two zinc finger proteins, ZFP36 and ZNF161, and the tumour necrosis factor α-induced protein TNFAIP3, were also overexpressed after wounding. The role of the p38 mitogen-activated protein kinase (p38MAPK in wound healing was shown after the inhibition of p38 by SB203580, but our results also suggest the existence of surrogate activating pathways.

  14. The Effects of Antifungal Azoles on Inflammatory Cytokine Production in Human Keratinocytes

    Directory of Open Access Journals (Sweden)

    K Zomorodian


    Full Text Available ABSTRACT: Introduction & Objective: Azoles drugs are being used successfully in treatment of fungal infections. Recently, immunosuppressive effects of some of these agents have been reported. Keratinocytes, as the major cells of the skin, have an important role in innate immunity against pathogenic agents. Considering the scanty of information about the effects of azoles on immune responces, this study was conducted to assess the expression and secretion of inflammatory cytokines in keratinocytes following treatment with azole drugs. Materials & Methods: This is an exprimental study conducted in in molecular biology division in Tehran University of Medical Sciences and Immunodermatology Department in Vienna Medical University. Primery keratinocytes were cultured and treated with different concentrations of fluconazole, itraconazole, ketoconazole and griseofulvin. Secreted IL1, IL6 and TNF-α by keratinocytes in culture supernatant were measured by quantitative enzyme immunoassay technique. Moreover, expression of the genes encoding IL1 and IL8 was evaluated by Real Time-PCR. Results: Treatment of keratinocytes with different concentrations of fluconazole and low concentration of ketoconazole resulted in decrease in IL1 secretion, but Itraconazole and griseofulvin did not show such an effect at the same concentrations. In addition, none of the examined drugs had an effect on secretion level of IL6 and TNF-α. Quantitative analysis of IL1 and IL8 encoding genes revealed that transcription on these genes might be suppressed following treatment with fluconazole or ketoconazole. Conclusion: Fluconazole and ketoconazole might modulate the expression and secretion of IL1 and IL8 and affect the direction of immune responses induced by keratinocytes

  15. Repair of the three main types of bipyrimidine DNA photoproducts in human keratinocytes exposed to UVB and UVA radiations. (United States)

    Courdavault, Sophie; Baudouin, Caroline; Charveron, Marie; Canguilhem, Bruno; Favier, Alain; Cadet, Jean; Douki, Thierry


    Induction of DNA damage by solar UV radiation is a key event in the development of skin cancers. Bipyrimidine photoproducts, including cyclobutane pyrimidine dimers (CPDs), (6-4) photoproducts (64 PPs) and their Dewar valence isomers, have been identified as major UV-induced DNA lesions. In order to identify the predominant and most persistent lesions, we studied the repair of the three types of photolesions in primary cultures of human keratinocytes. Specific and quantitative data were obtained using HPLC associated with tandem mass spectrometry. As shown in other cell types, 64 PPs are removed from UVB-irradiated keratinocytes much more efficiently than CPDs. In contrast, CPDs are still present in high amounts when cells recover their proliferation capacities after cell cycle arrest and elimination of a part of the population by apoptosis. The predominance of CPDs is still maintained when keratinocytes are exposed to a combination of UVB and UVA. Under these conditions, 64 PPs are converted into their Dewar valence isomers that are as efficiently repaired as their (6-4) precursors. Exposure of cells to pure UVA radiation generates thymine cyclobutane dimers that are slightly less efficiently repaired than CPDs produced upon UVB irradiation. Altogether, our results show that CPDs are the most frequent and the less efficiently repaired bipyrimidine photoproducts irrespectively of the applied UV treatment.

  16. Typha latifolia L. fruit polysaccharides induce the differentiation and stimulate the proliferation of human keratinocytes in vitro. (United States)

    Gescher, Kirsten; Deters, Alexandra M


    In Northern America Typha latifolia L. (Typhaceae) fruits are used for more than 4000 years for treatment of skin disorders, burns and as wound dressing to absorb the ichors. The following studies attempted to characterize water-soluble polysaccharides from aqueous Typha latifolia extracts and to investigate the influence of the polymers on cell physiology of human dermal fibroblasts (NHDF) and epidermal keratinocytes (NHEK). Water-soluble raw polysaccharides (RPS) were isolated from Typha latifolia fruits and fractionated by anion exchange chromatography (AEC) and size exclusion chromatography (GPC). Fractions obtained were characterized concerning monosaccharide composition by HPAEC-PAD. The bioactivity of the polysaccharides was investigated on cell viability, proliferation, differentiation and gene expression NHDF of NHEK. RPS was fractionated into 5 heterodisperse fractions (TL1-TL5). The polysaccharides were composed mainly of glucose (more than 50% in RPS and TL4), galactose, xylose, mannose, glucuronic acid, galacturonic acid, arabinose, ribose, fucose, rhamnose, and fructose with differing amounts concerning to RPS and AEC-fractions. Proteins were detected in the RPS (10%) and to a less extend in TL1-TL3 (1-3%). TL1-TL3 significantly increased the proliferation of keratinocytes, whereas TL4 was shown to be a potent inductor of the early differentiation process of keratinocytes. Gene expression analysis supported these results since Smad3 and PKC-α, known to be part of signal pathways leading to cell differentiation, were significantly up regulated. Effects on fibroblasts were not observed, indicating cell specific activity of the polysaccharides. The results clearly indicate a rationale for the traditional use of Typha latifolia fruits extracts for wound healing to the strong stimulatory activity of the polysaccharides on keratinocytes proliferation and early differentiation, major activities necessary for potent wound-healing agents. Copyright © 2011

  17. Ultraviolet B radiation down-regulates ULK1 and ATG7 expression and impairs the autophagy response in human keratinocytes. (United States)

    Chen, Xu; Li, Li; Xu, Song; Bu, Wenbo; Chen, Kun; Li, Min; Gu, Heng


    Autophagy is a self-digestive pathway that helps to maintain cellular homeostasis, and many autophagy-related gene (ATG)s involved the regulation of the autophagy process. Ultraviolet light is a common stressor of skin, but it is unclear how autophagy is regulated after ultraviolet exposure in epidermal keratinocytes. Here, we found that the mRNAs of some key ATG genes such as ULK1, ATG5 and ATG7 exhibited significantly lower levels in the skin tissues of the face and chest with solar ultraviolet exposure, compared with perineal skin. Interestingly, UVB radiation down-regulated the expression of ULK1, ATG3 and ATG7, and it inhibited the autophagy flux via a mechanistic target of rapamycin (MTOR)-independent pathway in human keratinocytes. The inhibition of autophagy in UVB-treated keratinocytes cannot be restored by treatment with the MTOR-dependent autophagy inducer rapamycin. Importantly, UVB treatment perturbs the conversion of microtubule-associated protein 1 light chain 3 (LC3)-I to LC3-II and LC3-II turnover in response to treatment with MTOR inhibitors (Torin 1 and pp242), as well as endoplasmic reticular stress (A23187 and tunicamycin), inositol pathway (L690,330) and autophagy inducers (resveratrol and STF62247). Our study demonstrates that UVB radiation down-regulates several key autophagy-related proteins and impairs the autophagy response in keratinocytes. This study demonstrates a linkage between autophagy and skin disorders associated with ultraviolet exposure. Copyright © 2017 Elsevier B.V. All rights reserved.

  18. Factors affecting ultraviolet-A photon emission from β-irradiated human keratinocyte cells. (United States)

    Le, M; Mothersill, C E; Seymour, C B; Ahmad, S B; Armstrong, A; Rainbow, A J; McNeill, F E


    The luminescence intensity of 340±5 nm photons emitted from HaCaT (human keratinocyte) cells was investigated using a single-photon-counting system during cellular exposure to (90)Y β-particles. Multiple factors were assessed to determine their influence upon the quantity and pattern of photon emission from β-irradiated cells. Exposure of 1 x 10(4) cells/5 mL to 703 μCi resulted in maximum UVA photoemission at 44.8 x 10(3)±2.5 x 10(3) counts per second (cps) from live HaCaT cells (background: 1-5 cps); a 16-fold increase above cell-free controls. Significant biophoton emission was achieved only upon stimulation and was also dependent upon presence of cells. UVA luminescence was measured for (90)Y activities 14 to 703 μCi where a positive relationship between photoemission and (90)Y activity was observed. Irradiation of live HaCaT cells plated at various densities produced a distinct pattern of emission whereby luminescence increased up to a maximum at 1 x 10(4) cells/5 mL and thereafter decreased. However, this result was not observed in the dead cell population. Both live and dead HaCaT cells were irradiated and were found to demonstrate different rates of photon emission at low β activities (⩽400 μCi). Dead cells exhibited greater photon emission rates than live cells which may be attributable to metabolic processes taking place to modulate the photoemissive effect. The results indicate that photon emission from HaCaT cells is perturbed by external stimulation, is dependent upon the activity of radiation delivered, the density of irradiated cells, and cell viability. It is postulated that biophoton emission may be modulated by a biological or metabolic process.

  19. Effect of Storage Temperature on Structure and Function of Cultured Human Oral Keratinocytes.

    Directory of Open Access Journals (Sweden)

    Rakibul Islam

    Full Text Available To assess the effect of storage temperature on the viability, phenotype, metabolism, and morphology of cultured human oral keratinocytes (HOK.Cultured HOK cells were stored in HEPES- and sodium bicarbonate-buffered Minimum Essential Medium (MEM at nine temperatures in approximately 4 °C increments from 4 °C to 37 °C for seven days. Cells were characterized for viability by calcein fluorescence, phenotype retention by immunocytochemistry, metabolic parameters (pH, glucose, lactate, and O2 within the storage medium by blood gas analysis, and morphology by scanning electron microscopy and light microscopy.Relative to the cultured, but non-stored control cells, a high percentage of viable cells were retained only in the 12 °C and 16 °C storage groups (85% ± 13% and 68% ± 10%, respectively. Expression of ABCG2, Bmi1, C/EBPδ, PCNA, cytokeratin 18, and caspase-3 were preserved after storage in the 5 groups between 4 °C and 20 °C, compared to the non-stored control. Glucose, pH and pO2 in the storage medium declined, whereas lactate increased with increasing storage temperature. Morphology was best preserved following storage of the three groups between 12 °C, 16 °C, and 20 °C.We conclude that storage temperatures of 12 °C and 16 °C were optimal for maintenance of cell viability, phenotype, and morphology of cultured HOK. The storage method described in the present study may be applicable for other cell types and tissues; thus its significance may extend beyond HOK and the field of ophthalmology.

  20. Biocompatibility of polymer-infiltrated-ceramic-network (PICN) materials with Human Gingival Keratinocytes (HGKs). (United States)

    Grenade, Charlotte; De Pauw-Gillet, Marie-Claire; Pirard, Catherine; Bertrand, Virginie; Charlier, Corinne; Vanheusden, Alain; Mainjot, Amélie


    Biocompatibility of polymer-infiltrated-ceramic-network (PICN) materials, a new class of CAD-CAM composites, is poorly explored in the literature, in particular, no data are available regarding Human Gingival Keratinocytes (HGK). The first objective of this study was to evaluate the in vitro biocompatibility of PICNs with HGKs in comparison with other materials typically used for implant prostheses. The second objective was to correlate results with PICN monomer release and indirect cytotoxicity. HGK attachment, proliferation and spreading on PICN, grade V titanium (Ti), yttrium zirconia (Zi), lithium disilicate glass-ceramic (eM) and polytetrafluoroethylene (negative control) discs were evaluated using a specific insert-based culture system. For PICN and eM samples, monomer release in the culture medium was quantified by high performance liquid chromatography and indirect cytotoxicity tests were performed. Ti and Zi exhibited the best results regarding HGK viability, number and coverage. eM showed inferior results while PICN showed statistically similar results to eM but also to Ti regarding cell number and to Ti and Zi regarding cell viability. No monomer release from PICN discs was found, nor indirect cytotoxicity, as for eM. The results confirmed the excellent behavior of Ti and Zi with gingival cells. Even if polymer based, PICN materials exhibited intermediate results between Ti-Zi and eM. These promising results could notably be explained by PICN high temperature-high pressure (HT-HP) innovative polymerization mode, as confirmed by the absence of monomer release and indirect cytotoxicity. Copyright © 2017 The Academy of Dental Materials. Published by Elsevier Ltd. All rights reserved.

  1. Knockdown of filaggrin in a three-dimensional reconstructed human epidermis impairs keratinocyte differentiation

    NARCIS (Netherlands)

    Pendaries, Valérie; Malaisse, Jeremy; Pellerin, Laurence; Le Lamer, Marina; Nachat, Rachida; Kezic, Sanja; Schmitt, Anne-Marie; Paul, Carle; Poumay, Yves; Serre, Guy; Simon, Michel


    Atopic dermatitis is a chronic inflammatory skin disorder characterized by defects in the epidermal barrier and keratinocyte differentiation. The expression of filaggrin, a protein thought to have a major role in the function of the epidermis, is downregulated. However, the impact of this deficiency

  2. miR-24 and miR-205 expression is dependent on HPV onco-protein expression in keratinocytes

    Energy Technology Data Exchange (ETDEWEB)

    McKenna, Declan J., E-mail: [Biomedical Sciences Research Institute, University of Ulster, Coleraine, Co. Derry BT52 1SA (United Kingdom); Centre for Cancer Research and Cell Biology, School of Medicine, Dentistry and Biomedical Science, Queen' s University Belfast, Belfast BT9 7BL (United Kingdom); Patel, Daksha, E-mail: [Centre for Cancer Research and Cell Biology, School of Medicine, Dentistry and Biomedical Science, Queen' s University Belfast, Belfast BT9 7BL (United Kingdom); McCance, Dennis J., E-mail: [Centre for Cancer Research and Cell Biology, School of Medicine, Dentistry and Biomedical Science, Queen' s University Belfast, Belfast BT9 7BL (United Kingdom)


    A screen of microRNA (miRNA) expression following differentiation in human foreskin keratinocytes (HFKs) identified changes in several miRNAs, including miR-24 and miR-205. We investigated how expression of Human Papilloma Virus Type-16 (HPV16) onco-proteins E6 and E7 affected expression of miR-24 and miR-205 during proliferation and differentiation of HFKs. We show that the induction of both miR-24 and miR-205 observed during differentiation of HFKs is lost in HFKs expressing E6 and E7. We demonstrate that the effect on miR-205 is due to E7 activity, as miR-205 expression is dependent on pRb expression. Finally, we provide evidence that miR-24 effects in the cell may be due to targeting of cyclin dependent kinase inhibitor p27. In summary, these results indicate that expression of both miR-24 and miR-205 are impacted by E6 and/or E7 expression, which may be one mechanism by which HPV onco-proteins can disrupt the balance between proliferation and differentiation in keratinocytes. - Highlights: • miR-24 and miR-205 are induced during keratinocyte differentiation. • This induction is lost in keratinocytes expressing HPV onco-proteins E6 and E7. • miR-205 is dependent upon pRb expression. • miR-24 targets p27 in cycling keratinocytes.

  3. Nicotinamide attenuates aquaporin 3 overexpression induced by retinoic acid through inhibition of EGFR/ERK in cultured human skin keratinocytes. (United States)

    Song, Xiuzu; Xu, Aie; Pan, Wei; Wallin, Brittany; Kivlin, Rebecca; Lu, Shan; Cao, Cong; Bi, Zhigang; Wan, Yinsheng


    The most common adverse effects that are related to all-trans retinoic acid (atRA) treatment are irritation and dryness of the skin. atRA therapy is reported to impair barrier function as achieved by trans-epidermal water loss (TEWL). Treatment with nicotinamide prior to initiation of atRA therapy provides additional barrier protection and thus reduces susceptibility of retinoic acid. Our previous studies showed that atRA upregulates aquaporin 3 (AQP3) in cultured human skin keratinocytes and fibroblasts. Others have demonstrated that in atopic dermatitis, overexpression of AQP3 is linked to elevated TEWL and that nicotinamide treatment reduces skin TEWL. In this study, we observed that while atRA upregulates AQP3 expression in cultured human skin keratinocytes (HaCaT cells), nicotinamide attenuates the effect of atRA in a concentration-dependent manner. atRA treatment induces EGFR and ERK activation. PD153035, an EGFR inhibitor, and U0126, an ERK inhibitor, inhibit atRA-induced upregulation of AQP3. Nicotinamide also inhibits atRA-induced activation of EGFR/ERK signal transduction and decreases water permeability by downregulating AQP3 expression. Collectively, our results indicate that the effect of atRA on AQP3 expression is at least partly mediated by EGFR/ERK signaling in cultured human skin keratinocytes. Nicotinamide attenuates atRA-induced AQP3 expression through inhibition of EGFR/ERK signal transduction and eventually decreases water permeability and water loss. Our study provides insights into the molecular mechanism through which nicotinamide reverses the side effects of dryness in human skin after treatment with atRA.

  4. Photo-oxidation products of skin surface squalene mediate metabolic and inflammatory responses to solar UV in human keratinocytes.

    Directory of Open Access Journals (Sweden)

    Vladimir Kostyuk

    Full Text Available The study aimed to identify endogenous lipid mediators of metabolic and inflammatory responses of human keratinocytes to solar UV irradiation. Physiologically relevant doses of solar simulated UVA+UVB were applied to human skin surface lipids (SSL or to primary cultures of normal human epidermal keratinocytes (NHEK. The decay of photo-sensitive lipid-soluble components, alpha-tocopherol, squalene (Sq, and cholesterol in SSL was analysed and products of squalene photo-oxidation (SqPx were quantitatively isolated from irradiated SSL. When administered directly to NHEK, low-dose solar UVA+UVB induced time-dependent inflammatory and metabolic responses. To mimic UVA+UVB action, NHEK were exposed to intact or photo-oxidised SSL, Sq or SqPx, 4-hydroxy-2-nonenal (4-HNE, and the product of tryptophan photo-oxidation 6-formylindolo[3,2-b]carbazole (FICZ. FICZ activated exclusively metabolic responses characteristic for UV, i.e. the aryl hydrocarbon receptor (AhR machinery and downstream CYP1A1/CYP1B1 gene expression, while 4-HNE slightly stimulated inflammatory UV markers IL-6, COX-2, and iNOS genes. On contrast, SqPx induced the majority of metabolic and inflammatory responses characteristic for UVA+UVB, acting via AhR, EGFR, and G-protein-coupled arachidonic acid receptor (G2A.Our findings indicate that Sq could be a primary sensor of solar UV irradiation in human SSL, and products of its photo-oxidation mediate/induce metabolic and inflammatory responses of keratinocytes to UVA+UVB, which could be relevant for skin inflammation in the sun-exposed oily skin.

  5. Roles of the PDZ-binding motif of HPV 16 E6 protein in oncogenic transformation of human cervical keratinocytes. (United States)

    Yoshimatsu, Yuki; Nakahara, Tomomi; Tanaka, Katsuyuki; Inagawa, Yuki; Narisawa-Saito, Mako; Yugawa, Takashi; Ohno, Shin-Ichi; Fujita, Masatoshi; Nakagama, Hitoshi; Kiyono, Tohru


    The high-risk human papillomavirus E6 proteins have been shown to interact with and lead to degradation of PDZ-domain-containing proteins through its carboxy-terminal motif. This PDZ-binding motif plays important roles in transformation of cultured cells and carcinogenesis of E6-transgenic mice. However, its biological effects on the natural host cells have not been elucidated. We have examined its roles in an in vitro carcinogenesis model for cervical cancer, in which E6 and E7 together with activated HRAS (HRASG12V ) can induce tumorigenic transformation of normal human cervical keratinocytes. In this model, E6Δ151 mutant, which is defective in binding to PDZ domains, almost lost tumorigenic ability, whereas E6SAT mutant, which is defective in p53 degradation showed activity close to wild-type E6. Interestingly, we found decreased expression of PAR3 in E6-expressing cells independently of E6AP, which has not been previously recognized. Therefore, we knocked down several PDZ-domain containing proteins including PAR3 in human cervical keratinocytes expressing E7, HRASG12V and E6Δ151 to examine whether depletion of these proteins can restore the tumorigenic ability. Single knockdown of SCRIB, MAGI1 or PAR3 significantly but partially restored the tumorigenic ability. The combinatorial knockdown of SCRIB and MAGI1 cooperatively restored the tumorigenic ability, and additional depletion of PAR3 further enhanced the tumorigenic ability surpassing that induced by wild-type E6. These data highlight the importance of the carboxy-terminal motif of the E6 protein and downregulation of PAR3 in tumorigenic transformation of human cervical keratinocytes. © 2017 The Authors. Cancer Science published by John Wiley & Sons Australia, Ltd on behalf of Japanese Cancer Association.

  6. Treatment of phimosis with topical steroids and foreskin anatomy

    Directory of Open Access Journals (Sweden)

    Tatiana C. Marques


    Full Text Available OBJECTIVES: To correlate topical steroidal treatment of stenosed foreskin with the different degrees of glans exposure and the length of time the ointment is applied. MATERIALS AND METHODS: We studied 95 patients with phimosis, divided according to the degree of foreskin retraction. Group A presented no foreskin retraction, group B presented exposure of only the urethral meatus, group C presented exposure of half of the glans, and group D presented exposure of the glans, which was incomplete because of preputial adherences to the coronal sulcus. Patients were submitted to application of 0.05% betamethasone ointment on the distal aspect of the prepuce twice daily for a minimum of 30 days and a maximum of 4 months. RESULTS: Of 95 patients, 10 (10.52% abandoned the treatment and 15 patients in groups C and D were excluded from the study. Among the remaining 70 patients, only 4 patients (5.7% in group A did not obtain adequate glans exposure after treatment. In group A (38 patients, fully retractable foreskins were obtained in 19 patients (50% after 1 month of treatment. In group B (28 patients, fully retractable foreskins were obtained in 18 patients (64.2% after 1 month. CONCLUSIONS: Treatment was successful in 94.2% of patients, irrespective of the type of foreskin anatomy. The improvement may require several months of treatment. Patients with impossibility of urethral meatus exposure present around 10% treatment failure.

  7. Global effects of human papillomavirus type 18 E6/E7 in an organotypic keratinocyte culture system. (United States)

    Garner-Hamrick, Peggy A; Fostel, J M; Chien, Wei-Ming; Banerjee, N Sanjib; Chow, Louise T; Broker, Thomas R; Fisher, Chris


    The effects of human papillomavirus type 18 (HPV-18) E6 and E7 proteins on global patterns of host gene expression in primary human keratinocytes grown in organotypic raft culture system were assessed. Primary human keratinocytes were infected with retroviruses that express the wild-type HPV-18 E6 and E7 genes from the native differentiation-dependent HPV enhancer-promoter. Total RNA was isolated from raft cultures and used to generate probes for querying Affymetrix U95A microarrays, which contain >12,500 human gene sequences. Quadruplicate arrays of each E6/E7-transduced and empty vector-transduced samples were analyzed by 16 pairwise comparisons. Transcripts altered in > or =12 comparisons were selected for further analysis. With this approach, HPV-18 E6/E7 expression significantly altered the expression of 1,381 genes. A large increase in transcripts associated with DNA and RNA metabolism was observed, with major increases noted for transcription factors, splicing factors, and DNA replication elements, among others. Multiple genes associated with protein translation were downregulated. In addition, major alterations were found in transcripts associated with the cell cycle and cell differentiation. Our study provides a systematic description of transcript changes brought about by HPV-18 E6/E7 in a physiologically relevant model and should furnish a solid source of information to guide future studies.

  8. Human keratinocyte caspase-14 expression is altered in human epidermal 3D models by dexamethasone and by natural products used in cosmetics. (United States)

    Kataoka, Saori; Hattori, Kenji; Date, Akira; Tamura, Hiroomi


    Caspase-14 is a cysteinyl-aspartate-specific proteinase that is specifically expressed in epidermal keratinocytes. Dysregulation of caspase-14 expression is implicated in impaired skin barrier formation. To elucidate the regulation of caspase-14 in differentiated keratinocytes, we characterized the expression of caspase-14 in normal human epidermal keratinocytes (NHEKs) and two types of three-dimensional (3D) human epidermis culture models, EPI-200 and EPI-201, via RT-PCR and immunoblot analyses. Caspase-14 expression was absent in subconfluent NHEKs, but was present in confluent NHEKs as well as those induced to differentiate by calcium. Caspase-14 expression levels in the 3D epidermis models were almost equal to that in the Ca(2+)-treated differentiated NHEKs. Despite the presence of caspase-14 expression in these models, caspase-14 activity was found only in the mature 3D skin model, EPI-200. This was confirmed by detection of a 17 kDa cleaved fragment of caspase-14 present only in the EPI-200 model. Since glucocorticoid (GC) receptor is required for skin barrier competence, we investigated whether the GC dexamethasone (Dex) and various natural components of common skin moisturizers affect caspase-14 expression in keratinocytes. Dex decreased caspase-14 expression in undifferentiated, but not differentiated, NHEKs. Conversely, Dex increased caspase-14 expression in both 3D skin models, although it did not alter caspase protease activity. Similar to treatment with Dex, treatment of the premature 3D skin mode, EPI-201 with a Galactomyces ferment filtrate markedly increased expression of caspase-14. Further, these results suggest that the effect of Dex, or lack thereof, on caspase-14 expression is dependent on the stage of keratinocyte differentiation.

  9. Adherence and viability of primary human keratinocytes and primary human dermal fibroblasts on acrylonitrile-based copolymers with different concentrations of positively charged functional groups. (United States)

    Trescher, Karoline; Scharnagl, Nico; Kratz, Karl; Roch, Toralf; Lendlein, Andreas; Jung, Friedrich


    As shown in several studies, various properties of biomaterials such as stiffness, surface roughness, chemical composition or the amount of functional groups at the surface can influence adhesion, viability, proliferation and functionalities of cells. The aim of this work was to explore whether a cell-selective effect could be achieved for acrylonitrile-based copolymers containing different contents of positively charged functional groups, which were introduced by incorporation of methacrylic acid-2-aminoethylester hydrochloride (AEMA) units. The p(AN-co-AEMA) copolymers were synthesized by suspension polymerization in water and processed into disk shaped test specimen via a sintering process to ensure the absence of organic solvents in the copolymers. Copolymers with an AEMA content of 1.4, 1.6, and 4.4 mol-% were investigated according to their cell-selective capacity, which should support the adhesion, viability and proliferation of keratinocytes, while the adherence of fibroblasts should rather be disabled. The test samples were seeded with primary human keratinocytes and primary human dermal fibroblasts in mono- as well as in co-cultures. Tissue culture plate polystyrene (TCP) was used to control the physiologic growth of the cells. Density and viability of attached and non-adherent cells were analyzed by live/dead staining, lactate dehydrogenase (LDH) assay and flow cytometry with DAPI staining. For the assured discrimination of adherent cell types in coculture a keratin/vimentin-staining was performed. On copolymers with 4.4 mol-% AEMA adherent keratinocytes in monoculture and cocultured keratinocytes and fibroblasts showed a higher viability, a lower impairment of cell membranes and higher densities of viable cells compared to both other copolymers. For adherent fibroblasts these parameters did not differ between the copolymers and an increasing ratio of keratinocytes to fibroblasts in cocultures were found with increasing AEMA content. The results showed

  10. In Vitro Growth of Human Keratinocytes and Oral Cancer Cells into Microtissues: An Aerosol-Based Microencapsulation Technique


    Wai Yean Leong; Chin Fhong Soon; Soon Chuan Wong; Kian Sek Tee; Sok Ching Cheong; Siew Hua Gan; Mansour Youseffi


    Cells encapsulation is a micro-technology widely applied in cell and tissue research, tissue transplantation, and regenerative medicine. In this paper, we proposed a growth of microtissue model for the human keratinocytes (HaCaT) cell line and an oral squamous cell carcinoma (OSCC) cell line (ORL-48) based on a simple aerosol microencapsulation technique. At an extrusion rate of 20 ?L/min and air flow rate of 0.3 L/min programmed in the aerosol system, HaCaT and ORL-48 cells in alginate micro...

  11. Triterpenoid α-amyrin stimulates proliferation of human keratinocytes but does not protect them against UVB damage

    DEFF Research Database (Denmark)

    Biskup, Edyta; Gołębiowski, Marek; Gniadecki, Robert


    CaT) by about 18% while other extract components were ineffective. A panel of biochemical and cell-based assays testing the antioxidative and cytoprotective activites of α-amyrin indicated no antioxidative activity of this compound. α-Amyrin did not protect HaCaT cells against the damage caused by UVB radiation.......Rhaponticum carthamoides plants ("maral root") are widely used in Siberian folk medicine. The present study reports for the first time the presence of pentacyclic terpenoid, α-amyrin, in methanol extract from leaves of this plant. α-Amyrin induced proliferation of human keratinocytes (Ha...

  12. Peroxisome Proliferator-Activated Receptor-alpha Is a Functional Target of p63 in Adult Human Keratinocytes

    DEFF Research Database (Denmark)

    Pozzi, Silvia; Boergesen, Michael; Sinha, Satrajit


    healing process, is a target of p63 in human keratinocytes. Silencing of p63 by RNA interference and transient transfections showed that p63 represses PPARalpha through a functional region of promoter B. Chromatin immunoprecipitation analyses indicate that p63 is bound to this region, in the absence...... of expression in the interfollicular epidermis under physiological conditions. Furthermore, we show that PPARalpha is a negative regulator of DeltaNp63alpha levels and that it also binds to a functional region of the DeltaNp63 promoter that lacks PPRE motifs. Therefore, the reciprocal regulation is exerted...

  13. Mechanism of interleukin-1α transcriptional regulation of S100A9 in a human epidermal keratinocyte cell line (United States)

    Bando, Mika; Zou, Xianqiong; Hiroshima, Yuka; Kataoka, Masatoshi; Ross, Karen F; Shinohara, Yasuo; Nagata, Toshihiko; Herzberg, Mark C; Kido, Jun-ichi


    S100A9 is a calcium-binding protein and subunit of antimicrobial calprotectin complex (S100A8/A9). Produced by neutrophils, monocytes/ macrophages and keratinocytes, S100A9 expression increases in response to inflammation. For example, IL-1α produced by epithelial cells acts autonomously on the same cells to induce expression of S100A8/A9 and cellular differentiation. Whereas it is well known that IL-1α and members of the IL-10 family of cytokines upregulate S100A8 and S100A9 in several cell lineages, the pathway and mechanism of IL-1α-dependent transcriptional control of S100A9 in epithelial cells is not established. Modeled using human epidermal keratinocytes (HaCaT cells), IL-1α stimulated phosphorylation of p38 MAPK and induced S100A9 expression, which was blocked by IL-1 receptor antagonist, RNAi suppression of p38, or a p38 MAPK inhibitor. Transcription of S100A9 in HaCaT cells depended on nucleotides -94 to -53 in the upstream promoter region, based upon use of deletion constructs and luciferase reporter activity. Within the responsive promoter region, IL-1α increased the binding activity of CCAAT/enhancer binding protein β (C/EBPβ). Mutated C/EBPβ binding sequences or C/EBPβ-specific siRNA inhibited the S100A9 transcriptional response. Hence, IL-1α is strongly suggested to increase S100A9 expression in a human epidermal keratinocyte cell line by signaling through the IL-1 receptor and p38 MAPK, increasing C/EBPβ-dependent transcriptional activity. PMID:23563247

  14. Nicotinamide enhances repair of ultraviolet radiation-induced DNA damage in human keratinocytes and ex vivo skin. (United States)

    Surjana, Devita; Halliday, Gary M; Damian, Diona L


    Nicotinamide (vitamin B3) protects from ultraviolet (UV) radiation-induced carcinogenesis in mice and from UV-induced immunosuppression in mice and humans. Recent double-blinded randomized controlled Phase 2 studies in heavily sun-damaged individuals have shown that oral nicotinamide significantly reduces premalignant actinic keratoses, and may reduce new non-melanoma skin cancers. Nicotinamide is a precursor of nicotinamide adenine dinucleotide (NAD(+)), an essential coenzyme in adenosine triphosphate (ATP) production. Previously, we showed that nicotinamide prevents UV-induced ATP decline in HaCaT keratinocytes. Energy-dependent DNA repair is a key determinant of cellular survival after exposure to DNA-damaging agents such as UV radiation. Hence, in this study we investigated whether nicotinamide protection from cellular energy loss influences DNA repair. We treated HaCaT keratinocytes with nicotinamide and exposed them to low-dose solar-simulated UV (ssUV). Excision repair was quantified using an assay of unscheduled DNA synthesis. Nicotinamide increased both the proportion of cells undergoing excision repair and the repair rate in each cell. We then investigated ssUV-induced cyclobutane pyrimidine dimers (CPDs) and 8-oxo-7,8-dihydro-2'-deoxyguanosine (8oxoG) formation and repair by comet assay in keratinocytes and with immunohistochemistry in human skin. Nicotinamide reduced CPDs and 8oxoG in both models and the reduction appeared to be due to enhancement of DNA repair. These results show that nicotinamide enhances two different pathways for repair of UV-induced photolesions, supporting nicotinamide's potential as an inexpensive, convenient and non-toxic agent for skin cancer chemoprevention.

  15. The effect of 648 nm diode laser irradiation on second messengers in senescent human keratinocytes (United States)

    Hawkins Evans, D.; Abrahamse, H.


    Background/purpose: Stress induced premature senescence (SIPS) is defined as the long-term effect of subcytotoxic stress on proliferative cell types. Cells in SIPS display differences at the level of protein expression which affect energy metabolism, defense systems, redox potential, cell morphology and transduction pathways. This study aimed to determine the effect of laser irradiation on second messengers in senescent cells and to establish if that effect can be directly linked to changes in cellular function such as cell viability or proliferation. Materials and Methods: Human keratinocyte cell cultures were modified to induce premature senescence using repeated sub-lethal stresses of 200 uM H2O2 or 5% OH every day for four days with two days recovery. SIPS was confirmed by senescence-associated β-galactosidase staining. Control conditions included normal, repeated stress of 500 uM H2O2 to induce apoptosis and 200 uM PBN as an anti-oxidant or free radical scavenger. Cells were irradiated with 1.5 J/cm2 on day 1 and 4 using a 648 nm diode laser (3.3 mW/cm2) and cellular responses were measured 1 h post irradiation. The affect on second messengers was assessed by measuring cAMP, cGMP, nitric oxide and intracellular calcium (Ca2+) while functional changes were assessed using cell morphology, ATP cell viability, LDH membrane integrity and WST-1 cell proliferation. Results: Results indicate an increase in NO and a decrease in cGMP and Ca2+ in 200 uM H2O2 irradiated cells while PBN irradiated cells showed a decrease in cAMP and an increase in ATP viability and cell proliferation. Conclusion: Laser irradiation influences cell signaling which ultimately changes the biological function of senescent cells. If laser therapy can stimulate the biological function of senescent cells it may be beneficial to conditions such as immune senescence, skin ageing, muscle atrophy, premature ageing of arteries in patients with advanced heart disease, neurodegenerative disorders and

  16. UVB-Protective Effects of Isoflavone Extracts from Soybean Cake in Human Keratinocytes

    Directory of Open Access Journals (Sweden)

    Chi-Feng Hung


    Full Text Available It has been shown by chromatography that aglycone, glucoside, acetylglucosideand malonylglucoside isoflavone extracts prepared from soybean cake showed betterantioxidant activities than isoflavone standards. Consequently, the aim of this study was toevaluate the protective effects of these isoflavone extracts against ultraviolet B (UVB-induced keratinocyte damage. Our results demonstrated that these soybean cake isoflavoneextracts could inhibit UVB-induced keratinocyte death. Moreover, they could inhibit UVB-induced intracellular release of hydrogen peroxide (H2O2 Furthermore, these isoflavoneextracts differentially inhibited UVB-induced MAPK phosphorylation. The ERK1/2 andp38 phosphorylation was not inhibited by all tested isoflavone extracts, whereas JNKphosphorylation was inhibited by group I to group III isoflavone extracts. Since theseisoflavone extracts are relative stable and easily obtained than the isoflavone standards, wesuggest that soybean cake may be a useful potential source for developing effective skincare agents in against photoaging.

  17. Amygdalin analogues inhibit IFN-γ signalling and reduce the inflammatory response in human epidermal keratinocytes. (United States)

    Paoletti, Iole; De Gregorio, Vincenza; Baroni, Adone; Tufano, Maria Antonietta; Donnarumma, Giovanna; Perez, Juan Jesus


    Peptide T (PT), an octapeptide fragment located in the V2 region of the HIV-1 gp120-coating protein, appears to be beneficial in the treatment of psoriasis. Our previous investigations suggest that keratinocytes play a key role in conditioning the therapeutic effects of PT in psoriasis. The aim of this study was to explore the effects of PT and the peptidomimetic natural products, Dhurrin and Prunasin, on the expression of the IL-6, IL-8, IL-23, HSP70 and ICAM-1 on IFN-γ and TNF-α-NHEK activated cells. Moreover, we analysed the interference of PT and its analogues through STAT-3 activation. Our results show that the analogues tested exhibit the beneficial biological effects of PT, suggesting the primary role of keratinocytes upon which PT and the peptidomimetics act directly, by reducing proinflammatory responses. Its reduction appears to be important for therapeutic approach in psoriasis pathogenesis.

  18. [Development of an engraftable skin equivalent based on matriderm with human keratinocytes and fibroblasts]. (United States)

    Golinski, P A; Zöller, N; Kippenberger, S; Menke, H; Bereiter-Hahn, J; Bernd, A


    A cell-based wound coverage with keratinocytes and fibroblasts on the basis of a commercially available dermal substitute (Matriderm ((R)), Kollagen/Elastin matrix) was generated, in order to treat wide burn wounds. First the expansion of keratinocytes was optimised and the culturing time was minimised. Raw material was 1-2 cm (2) split skin. Dermis and epidermis were separated by enzymatic treatment with thermolysin. After treatment of both compartments with trypsin and collagenase I, keratinocytes and fibroblasts were isolated and expanded in collagen I coated dishes. After 10 days fibroblasts were seeded on Matriderm ((R)). After cultivation of the fibroblasts-containing matrix for one week keratinocytes were seeded on top. After an additional week of submersed cultivation the matrix was lifted up to the air-liquid interface to initiate epidermal cell differentiation. After 16 days in the air-liquid interphase the matrix was fixed and underwent immunohistochemical and electron microscopic analysis. Histological analysis showed a regularly stratification of the epidermal part. We observed collagen IV, a marker for the basement membrane, between epidermis and dermis. Desmoglein and the differentiation markers involucrine and cytokeratin 10 were found in the suprabasal layers of the epidermis. Electron microscopic analysis showed the basement membrane in the epidermal junction zone as well as cell-cell connections in the form of desmosomes. Late differentiation characteristics, like granular structures and the cornified layer, were found in the stratum granulosum and stratum corneum. Our results demonstrate that a skin equivalent can be generated by using a collagen/elastin matrix, with an expansion rate of 50-100-fold. This skin equivalent may be useful for covering deep wounds.

  19. Adiponectin Suppresses UVB-Induced Premature Senescence and hBD2 Overexpression in Human Keratinocytes.

    Directory of Open Access Journals (Sweden)

    MinJeong Kim

    Full Text Available Recent studies have revealed that adiponectin can suppress cellular inflammatory signaling pathways. This study aimed to elucidate the effect of adiponectin on the unregulated production of hBD2 in UVB-induced premature senescent keratinocytes. We constructed an in vitro model of premature senescent keratinocytes through repeated exposure to low energy UVB. After repeated low energy UVB exposure, there was significant generation of reactive oxygen species (ROS and induction of senescence-associated markers, including senescence associated beta-galactosidase activity and expression of p16INK4a and histone H2AX. In addition, the present clinical study showed higher expression of hBD2 in sun-exposed skin of elderly group, and the overexpression of hBD2 was observed by c-Fos activation in vitro. Adiponectin has the ability to scavenge ROS and consequently inhibit MAPKs and SA-markers in UVB-exposed keratinocytes. An inhibitor study demonstrated that adiponectin downregulated hBD2 mRNA expression through suppression of the AP-1 transcription factor components c-Fos via inactivation of p38 MAPK. Collectively, the dysregulated production of hBD2 by the induction of oxidative stress was attenuated by adiponectin through the suppression of p38 and JNK/SAPK MAPK signaling in UVB-mediated premature senescent inducible conditions. These results suggest the feasibility of adiponectin as an anti-photoaging and anti-inflammatory agent in the skin.

  20. Ski protein levels increase during in vitro progression of HPV16-immortalized human keratinocytes and in cervical cancer. (United States)

    Chen, Yi; Pirisi, Lucia; Creek, Kim E


    We compared the levels of the Ski oncoprotein, an inhibitor of transforming growth factor-beta (TGF-β) signaling, in normal human keratinocytes (HKc), HPV16 immortalized HKc (HKc/HPV16), and differentiation resistant HKc/HPV16 (HKc/DR) in the absence and presence of TGF-β. Steady-state Ski protein levels increased in HKc/HPV16 and even further in HKc/DR, compared to HKc. TGF-β treatment of HKc, HKc/HPV16, and HKc/DR dramatically decreased Ski. TGF-β-induced Ski degradation was delayed in HKc/DR. Ski and phospho-Ski protein levels are cell cycle dependent with maximal Ski expression and localization to centrosomes and mitotic spindles during G2/M. ShRNA knock down of Ski in HKc/DR inhibited cell proliferation. More intense nuclear and cytoplasmic Ski staining and altered Ski localization were found in cervical cancer samples compared to adjacent normal tissue in a cervical cancer tissue array. Overall, these studies demonstrate altered Ski protein levels, degradation and localization in HPV16-transformed human keratinocytes and in cervical cancer. Copyright © 2013 Elsevier Inc. All rights reserved.

  1. Protective Effect of the Ethyl Acetate Fraction of Sargassum muticum against Ultraviolet B–Irradiated Damage in Human Keratinocytes

    Directory of Open Access Journals (Sweden)

    Jin Won Hyun


    Full Text Available The aim of this study was to investigate the cytoprotective properties of the ethyl acetate fraction of Sargassum muticum (SME against ultraviolet B (UVB-induced cell damage in human keratinocytes (HaCaT cells. SME exhibited scavenging activity toward the 1,1-diphenyl-2-picrylhydrazyl radicals and hydrogen peroxide (H2O2 and UVB-induced intracellular reactive oxygen species (ROS. SME also scavenged the hydroxyl radicals generated by the Fenton reaction (FeSO4 + H2O2, which was detected using electron spin resonance spectrometry. In addition, SME decreased the level of lipid peroxidation that was increased by UVB radiation, and restored the level of protein expression and the activities of antioxidant enzymes that were decreased by UVB radiation. Furthermore, SME reduced UVB-induced apoptosis as shown by decreased DNA fragmentation and numbers of apoptotic bodies. These results suggest that SME protects human keratinocytes against UVB-induced oxidative stress by enhancing antioxidant activity in cells, thereby inhibiting apoptosis.

  2. Human papillomavirus types detected in skin warts and cancer differ in their transforming properties but commonly counteract UVB induced protective responses in human keratinocytes

    Energy Technology Data Exchange (ETDEWEB)

    Shterzer, Naama; Heyman, Dariya; Shapiro, Beny; Yaniv, Abraham; Jackman, Anna [Department of Clinical Microbiology and Immunology, Sackler School of Medicine, Tel-Aviv University, Tel-Aviv (Israel); Serour, Francis [Department of Pediatric Surgery, The E. Wolfson Medical Center, Holon (Israel); Chaouat, Malka [Laboratory of Experimental Surgery, Hadassah University Hospital, Ein Karem, Jerusalem (Israel); Gonen, Pinhas [Department of Clinical Microbiology and Immunology, Sackler School of Medicine, Tel-Aviv University, Tel-Aviv (Israel); Tommasino, Massimo [International Agency for Research on Cancer, World Health Organization, Lyon (France); Sherman, Levana [Department of Clinical Microbiology and Immunology, Sackler School of Medicine, Tel-Aviv University, Tel-Aviv (Israel)


    In the present study, E6E7 and E6 proteins of human papillomaviruses (HPVs) associated with skin warts and cancer were compared for their transforming and carcinogenic abilities in primary human keratinocytes (PHKs). We show that E6E7 of cancer associated beta HPV types, notably 49 and 24, were able to extend the life span and enhance the clonogenic efficiency of PHKs when maintained in serum free/low calcium medium. Activities of the beta HPV E6E7 were lower than those of HPV16 E6E7. In contrast, E6 proteins from HPV types detected in skin warts or cancer, notably 10, 49 and 38, attenuated UVB induced protective responses in PHKs including cell death, proliferation arrest and accumulation of the proapoptotic proteins, p53, bax or bak. Together, this investigation revealed functional differences and commonalities between HPVs associated with skin warts and cancer, and allowed the identification of specific properties of beta HPVs supporting their involvement in skin carcinogenesis. - Highlights: • Primary keratinocytes were used to evaluate transforming and carcinogenic abilities of cutaneous HPVs. • E6E7 of cancer associated β HPV types transform primary human keratinocytes. • E6 proteins of cancer and wart associated HPVs inhibit UVB induced cell death. • E6s of cancer and wart associated HPVs attenuate UVB induced proliferation arrest. • E6s of cancer and wart associated HPVs attenuate UVB induced apoptosis signaling.

  3. Alterations of nitric-oxide synthase and xanthine-oxidase activities of human keratinocytes by ultraviolet-B radiation -potential role for peroxynitrite in skin inflammation

    Energy Technology Data Exchange (ETDEWEB)

    Deliconstantinos, G.; Villiotou, V.; Stavrides, J.C. [Athens Univ. (Greece). School of Medicine


    In the present study, we demonstrated that NO synthase (cNOS) and xanthine oxidase (XO) of human keratinocytes can be activated to release NO, superoxide (O-2(-)) and peroxynitrite (ONOO-) following exposure to ultraviolet B (UVB) radiation. We defined that this photo induced response may be involved in the pathogenesis of sunburn erythema and inflammation. Treatment of human keratinocytes with UVB (290-320 nm) radiation (up to 200 mJ/cm(2)) resulted in a dose-dependent increase in NO and ONOO-release that was inhibited by N-monomethyl-L-arginine (L-NMMA). NO and ONOO- release from keratinocytes was accompanied by an increase in intracellular cGMP levels. Treatment of human keratinocyte cytosol with various doses of UVB (up to 100 mJ/cm(2)) resulted in an increase in XO activity that was inhibited by oxypurinol. In in vivo experiments, when experimental animals were subjected to UVB radiation, a protection factor (PF) of 6.5 {+-} 1.8 was calculated when an emulsified cream formulation containing nitro-L-arginine (L-NA) (2%) and L-NMMA (2%) was applied to their skin. The present study indicates that UVB radiation acts as a potent stimulator of cNOS and XO activities in human keratinocytes. NO and ONOO- may exert cytotoxic effects in keratinocytes themselves, as well as in their neighbouring endothelial and smooth muscle cells. This may be a major part of the integrated response leading to erythema production and the inflammation process. (UK).

  4. Angiogenic peptide (AG)-30/5C activates human keratinocytes to produce cytokines/chemokines and to migrate and proliferate via MrgX receptors. (United States)

    Kiatsurayanon, Chanisa; Niyonsaba, François; Chieosilapatham, Panjit; Okumura, Ko; Ikeda, Shigaku; Ogawa, Hideoki


    In addition to their antimicrobial activities, antimicrobial peptides, also known as host defense peptides (HDPs) activate keratinocytes; promote wound healing; and improve the skin barrier. AG-30/5C is a novel angiogenic HDP that activates various functions of fibroblasts and endothelial cells, including cytokine/chemokine production and wound healing. To investigate whether AG-30/5C activates human keratinocytes and to examine the underlying mechanisms. Production of cytokines/chemokines was assessed by ELISA. Expression of Mas-related G-protein coupled receptors X (MrgXs) in keratinocytes was determined by real-time PCR and Western blot. MAPK and NF-κB activation was analysed by Western blot. Cell migration was assessed by chemotaxis microchamber and in vitro wound closure assay, whereas cell proliferation was analysed using an XTT assay. We found that AG-30/5C was more efficient than its parent peptide AG-30 in increasing the production of various cytokines/chemokines and promoting keratinocyte migration and proliferation. Furthermore, MrgX3 and MrgX4 receptors were constitutively expressed in keratinocytes at higher levels than MrgX1 and MrgX2, and were up-regulated upon stimulation with TLR ligands. Because MrgX3 and MrgX4 siRNAs suppressed AG-30/5C-mediated cytokine/chemokine production, keratinocyte migration and proliferation, we propose that AG-30/5C utilizes these MrgXs to stimulate keratinocytes. In addition, AG-30/5C-induced activation of keratinocytes was controlled by MAPK and NF-κB pathways, as evidenced by the inhibitory effects of ERK-, JNK-, p38- and NF-κB-specific inhibitors. Indeed, we confirmed that AG-30/5C enhanced phosphorylation of MAPKs and IκB. Our findings provide novel evidence that AG-30/5C may be a useful therapeutic agent for wound healing by activating human keratinocytes. Copyright © 2016 Japanese Society for Investigative Dermatology. Published by Elsevier Ireland Ltd. All rights reserved.

  5. Suppression of Ultraviolet B Exposure-Mediated Activation of NF-κB in Normal Human Keratinocytes by Resveratrol

    Directory of Open Access Journals (Sweden)

    Vaqar Mustafa Adhami


    Full Text Available Chemoprevention by naturally occurring agents is a newer dimension in the management of neoplasia, including skin cancer. Solar ultraviolet (UV radiation is the major cause of skin cancer. We recently demonstrated that resveratrol (3,5,4'-trihydroxystilbene, a polyphenolic antioxidant found in grapes and red wine, imparts protection from UVB-mediated cutaneous damages in SKH-1 hairless mice. The mechanism of action of resveratrol is not clearly understood. Here, we investigated the involvement of nuclear factor kappa B (NF-κB, which is known to play a critical role in skin biology and the development of skin cancer, as the mechanism of chemoprevention of UV damage by resveratrol. In the normal human epidermal keratinocytes, resveratrol blocked UVB-mediated (40 mJ/cm2 activation of NF-κB in a dose-dependent (5, 10, and 25μM resveratrol for 24 hours as well as time-dependent (5μ/M resveratrol for 12, 24, and 48 hours fashion. Resveratrol treatment of keratinocytes also inhibited UVB-mediated 1 phosphorylation and degradation of IκBα, and 2 activation of IKKα. We suggest that NF-κB pathway plays a critical role in the chemopreventive effects of resveratrol against the adverse effects of UV radiation including photocarcinogenesis.

  6. Realgar-mediated growth inhibition on HaCaT human keratinocytes is associated with induction of apoptosis. (United States)

    Tse, Wai-Pui; Cheng, Christopher H K; Che, Chun-Tao; Zhao, Ming; Fan, Rui-Qiang; Lin, Zhi-Xiu


    Traditional Chinese medicine has long been used to treat a variety of ailments including skin diseases. Our previous study has revealed the ethanolic extract of realgar, a common ingredient used in psoriasis treatment in Chinese medicine, to possess potent anti-proliferative action on cultured HaCaT cells of human keratinocyte origin. In the present study, the mechanisms of action of the observed growth inhibitory action of realgar were investigated. Several bioassay methods were employed to elucidate whether cellular apoptosis is involved in the realgar-induced growth inhibition of the skin cells. Morphologically, nuclear condensation and DNA fragmentation were observed when HaCaT cells were exposed to the realgar extract. DNA fragmentation induced by the treatment of realgar was also evident as detected by gel electrophoresis and the TUNEL method. Cell cycle analysis by propidium iodide (PI) staining demonstrated the appearance of sub-G1 peak and cell cycle arrest at the G1 phase upon realgar treatment. Quantitative analysis by annexin V-PI staining revealed that the realgar-induced apoptotic event was dose-dependent. Furthermore, realgar was able to activate caspase-3 expression when examined by Western blot analysis. Our experimental data unambiguously confirm that induction of cellular apoptosis is mainly responsible for the observed growth inhibition brought about by realgar on the HaCaT keratinocytes, and this finding helps place the traditional use of this mineral for psoriasis treatment on a scientific footing.

  7. Interleukin 22 early affects keratinocyte differentiation, but not proliferation, in a three-dimensional model of normal human skin

    Energy Technology Data Exchange (ETDEWEB)

    Donetti, Elena, E-mail: [Department of Biomedical Sciences for Health, Università degli Studi di Milano, 20133 Milan (Italy); Cornaghi, Laura; Arnaboldi, Francesca; Landoni, Federica [Department of Biomedical Sciences for Health, Università degli Studi di Milano, 20133 Milan (Italy); Romagnoli, Paolo [Department of Experimental and Clinical Medicine, Università degli Studi di Firenze, 50125 Florence (Italy); Mastroianni, Nicolino [Department of Biomedical Sciences for Health, Università degli Studi di Milano, 20133 Milan (Italy); Pescitelli, Leonardo [Department of Surgery and Translational Medicine, Università degli Studi di Firenze, 50125 Florence (Italy); Baruffaldi Preis, Franz W. [I.R.C.C.S. Istituto Ortopedico Galeazzi, 20161 Milan (Italy); Prignano, Francesca [Department of Surgery and Translational Medicine, Università degli Studi di Firenze, 50125 Florence (Italy)


    Interleukin (IL)-22 is a pro-inflammatory cytokine driving the progression of the psoriatic lesion with other cytokines, as Tumor Necrosis Factor (TNF)-alpha and IL-17. Our study was aimed at evaluating the early effect of IL-22 alone or in combination with TNF-alpha and IL-17 by immunofluorescence on i) keratinocyte (KC) proliferation, ii) terminal differentiation biomarkers as keratin (K) 10 and 17 expression, iii) intercellular junctions. Transmission electron microscopy (TEM) analysis was performed. A model of human skin culture reproducing a psoriatic microenvironment was used. Plastic surgery explants were obtained from healthy young women (n=7) after informed consent. Fragments were divided before adding IL-22 or a combination of the three cytokines, and harvested 24 (T24), 48 (T48), and 72 (T72) h later. From T24, in IL-22 samples we detected a progressive decrease in K10 immunostaining in the spinous layer paralleled by K17 induction. By TEM, after IL-22 incubation, keratin aggregates were evident in the perinuclear area. Occludin immunostaining was not homogeneously distributed. Conversely, KC proliferation was not inhibited by IL-22 alone, but only by the combination of cytokines. Our results suggest that IL-22 affects keratinocyte terminal differentiation, whereas, in order to induce a proliferation impairment, a more complex psoriatic-like microenvironment is needed.

  8. The crosstalk between IL-22 signaling and miR-197 in human keratinocytes.

    Directory of Open Access Journals (Sweden)

    Galya Lerman

    Full Text Available The interaction between the immune system and epithelial cells is tightly regulated. Aberrations of this balance may result in inflammatory diseases such as psoriasis, inflammatory bowel disease and rheumatoid arthritis. IL-22 is produced by Th17, Th22 and Th1 cells. Putative targets for IL-22 are cells in the skin, kidney, digestive and respiratory systems. The highest expression of IL-22 receptor is found in the skin. IL-22 plays an important role in the pathogenesis of T cell-mediated inflammatory diseases such as psoriasis, inflammatory bowel disease and rheumatoid arthritis. Recently, we found that miR-197 is down regulated in psoriatic lesions. In the present work we show that miR-197 over expression inhibits keratinocytes proliferation induced by IL-22 and keratinocytes migration. In addition, we found that IL-22 activates miR-197 expression through the binding of phosphorylated STAT3 to sequences in the putative promoter of miR-197. Finally we found that IL-22 receptor subunit IL22RA1 is a direct target of miR-197. Hence, we identified a novel feedback loop controlling IL-22 signaling, in which IL-22 induces miR-197, which in turn, negatively regulates IL-22 receptor and attenuates the biological outcome of such signaling. Regulation of this pathway may be important in inflammatory skin disorders such a psoriasis and in wound healing.

  9. Non-thermal Plasma Activates Human Keratinocytes by Stimulation of Antioxidant and Phase II Pathways (United States)

    Schmidt, Anke; Dietrich, Stephan; Steuer, Anna; Weltmann, Klaus-Dieter; von Woedtke, Thomas; Masur, Kai; Wende, Kristian


    Non-thermal atmospheric pressure plasma provides a novel therapeutic opportunity to control redox-based processes, e.g. wound healing, cancer, and inflammatory diseases. By spatial and time-resolved delivery of reactive oxygen and nitrogen species, it allows stimulation or inhibition of cellular processes in biological systems. Our data show that both gene and protein expression is highly affected by non-thermal plasma. Nuclear factor erythroid-related factor 2 (NRF2) and phase II enzyme pathway components were found to act as key controllers orchestrating the cellular response in keratinocytes. Additionally, glutathione metabolism, which is a marker for NRF2-related signaling events, was affected. Among the most robustly increased genes and proteins, heme oxygenase 1, NADPH-quinone oxidoreductase 1, and growth factors were found. The roles of NRF2 targets, investigated by siRNA silencing, revealed that NRF2 acts as an important switch for sensing oxidative stress events. Moreover, the influence of non-thermal plasma on the NRF2 pathway prepares cells against exogenic noxae and increases their resilience against oxidative species. Via paracrine mechanisms, distant cells benefit from cell-cell communication. The finding that non-thermal plasma triggers hormesis-like processes in keratinocytes facilitates the understanding of plasma-tissue interaction and its clinical application. PMID:25589789

  10. Wound closure with human keratinocytes cultured on a polyurethane dressing overlaid on a cultured human dermal replacement. (United States)

    Rennekampff, H O; Hansbrough, J F; Kiessig, V; Abiezzi, S; Woods, V


    Burn excision followed by immediate wound coverage has become the clinical standard for managing extensive burn injuries in much of the world. When sufficient autograft skin to achieve permanent wound closure is unavailable, cell culture technology has made the use of cultured human keratinocyte (HK) sheets clinically feasible. Whereas previous techniques have focused on development of multilayered, differentiated HK sheets, our attention has been drawn to using HK in a highly proliferative, less differentiated state. Time requirements for preparation of multistratified cultured HK are high, and preparatory steps may destroy important integrin adhesion molecules. We describe the use of HK cultured to single layer confluence on a polyurethane membrane(HD), with serum-free medium. HK-HD grafts were transplanted to full-thickness wounds on athymic mice (n = 31). A second group of mice (DG-HK-HD), n = 28) received a living human dermal replacement containing cultured fibroblasts before placement of HK-HD. Control mice received HD alone (n = 4). Basement membrane proteins on healed wounds and surface integrins on cultured HK were identified by means of immunostaining and direct microscopic visualization. HK cultured just to the confluent state on polyurethane membrane were positive for integrins alpha(5) and alpha(6), major integrins on proliferating HK. Histologic analysis showed epithelialized wounds in all groups after 21 days. Using an anti-human involucrin antibody we demonstrated the presence of HK in 64.5% of the HK-HD group, 61% of the DG-HK-HD group, and 0% in the HD group. Mice that received the living human dermal replacement containing cultured fibroblasts in combination with HK-HD grafts developed a thick, well-vascularized neodermis. Strong laminin and collagen IV staining was observed in wound areas covered with HK. These data show that full-thickness wounds can be closed by application of a single layer of proliferating HK cultured on a biocompatible

  11. Evidence supporting a role for dihydroorotate dehydrogenase, bioenergetics, and p53 in selective teriflunomide-induced apoptosis in transformed versus normal human keratinocytes. (United States)

    Hail, Numsen; Chen, Ping; Kepa, Jadwiga J; Bushman, Lane R


    We have demonstrated previously that the dihydroorotate dehydrogenase (DHODH) inhibitor teriflunomide (TFN) encourages apoptosis in transformed human keratinocytes. Here we sought to determine if this cytotoxic effect could be restricted to transformed keratinocytes relative to their normal human epidermal keratinocyte (NHEK) counterparts, and ascertain a potential mechanistic basis for the selectivity. The NHEK cells proliferated much slower than the premalignant HaCaT and malignant COLO 16 keratinocytes, and exogenous uridine added to the culture medium did not affect this growth. Similarly, DHODH expression and the bioenergetic characteristics of the normal cells were markedly dissimilar from those observed in the transformed cells indicating that de novo pyrimidine synthesis was involved with keratinocyte proliferation. Moreover, a short-term exposure to TFN caused a wild-type p53 response in the NHEK cells illustrating that pyrimidine metabolic stress could regulate this tumor suppressor protein in the normal cells. TFN-induced apoptosis occurred primarily in S phase HaCaT cells. This cell death was sensitive to uridine, an antioxidant, and a caspase inhibitor, and the suppression of Bcl-X(L) and the induction of Mn superoxide dismutase preceded it. These events suggested that mitochondrial/redox stress was involved with the cytotoxic effect of TFN. Conversely, a long-term exposure to TFN caused G(0)/G(1) arrest in the NHEK cells, which supported a cytoprotective role for p53 against TFN-induced apoptosis. Together, these results propose that TFN could be useful in the prevention or therapy of non-melanoma skin cancers and possibly other hyperproliferative keratinocytic diseases.

  12. Rho kinase inhibitor y-27632 prolongs the life span of adult human keratinocytes, enhances skin equivalent development, and facilitates lentiviral transduction.

    NARCIS (Netherlands)

    Bogaard, E.H.J. van den; Rodijk-Olthuis, D.; Jansen, P.A.M.; Vlijmen-Willems, I.M.J.J. van; Erp, P.E.J. van; Joosten, I.; Zeeuwen, P.L.J.M.; Schalkwijk, J.


    The use of tissue-engineered human skin equivalents (HSE) for fundamental research and industrial application requires the expansion of keratinocytes from a limited number of skin biopsies donated by adult healthy volunteers or patients. A pharmacological inhibitor of Rho-associated protein kinases,

  13. The Alteration of the Epidermal Basement Membrane Complex of Human Nevus Tissue and Keratinocyte Attachment after High Hydrostatic Pressurization

    Directory of Open Access Journals (Sweden)

    Naoki Morimoto


    Full Text Available We previously reported that human nevus tissue was inactivated after high hydrostatic pressure (HHP higher than 200 MPa and that human cultured epidermis (hCE engrafted on the pressurized nevus at 200 MPa but not at 1000 MPa. In this study, we explore the changes to the epidermal basement membrane in detail and elucidate the cause of the difference in hCE engraftment. Nevus specimens of 8 mm in diameter were divided into five groups (control and 100, 200, 500, and 1000 MPa. Immediately after HHP, immunohistochemical staining was performed to detect the presence of laminin-332 and type VII collagen, and the specimens were observed by transmission electron microscopy (TEM. hCE was placed on the pressurized nevus specimens in the 200, 500, and 1000 MPa groups and implanted into the subcutis of nude mice; the specimens were harvested at 14 days after implantation. Then, human keratinocytes were seeded on the pressurized nevus and the attachment was evaluated. The immunohistochemical staining results revealed that the control and 100 MPa, 200 MPa, and 500 MPa groups were positive for type VII collagen and laminin-332 immediately after HHP. TEM showed that, in all of the groups, the lamina densa existed; however, anchoring fibrils were not clearly observed in the 500 or 1000 MPa groups. Although the hCE took in the 200 and 500 MPa groups, keratinocyte attachment was only confirmed in the 200 MPa group. This result indicates that HHP at 200 MPa is preferable for inactivating nevus tissue to allow its reuse for skin reconstruction in the clinical setting.

  14. Characterization of a human epidermis model reconstructed from hair follicle keratinocytes and comparison with two commercially models and native skin. (United States)

    Guiraud, B; Hernandez-Pigeon, H; Ceruti, I; Mas, S; Palvadeau, Y; Saint-Martory, C; Castex-Rizzi, N; Duplan, H; Bessou-Touya, S


    Outer root sheath (ORS) cells of human hair follicles are a readily available, non-invasive source of keratinocytes for epidermis reconstruction. The aim of this study was to characterize a model of epidermis reconstructed from ORS cells (ORS-derived model) and to evaluate its reproducibility, in comparison with native human skin and two marketed reconstructed skin models (model A, Episkin(®) and model B, Skinethic(®) ). Cell morphology and tissue architecture of the three models were analysed histologically and proliferation and differentiation marker expression by immunohistochemistry and mRNA quantification. All models displayed the same general epidermal architecture as native epidermis, but with a thicker stratum corneum in models A and B. Compared with native epidermis, Ki67 was correctly localized in epidermal basal cells in all models, as K10 in suprabasal layers. In all skin models, transglutaminase 1 (TGM1) was prematurely expressed in suprabasal layers. However, this expression was only observed from the upper stratum spinosum in the ORS-derived model. In this model, filaggrin and loricrin were correctly located in the stratum granulosum. Filaggrin, involucrin, loricrin and TGM1 mRNAs (markers of keratinocyte terminal differentiation) were transcriptionally expressed in all models. In the ORS-derived model, transcriptional expression level was similar to that of native skin. ORS cell-based reconstructed epidermis is a valid and reproducible model for human epidermis and it may be used to evaluate the effects of active substances and cosmetic formulations. © 2014 Society of Cosmetic Scientists and the Société Française de Cosmétologie.

  15. Structural alterations of foreskin caused by chronic smoking may explain high levels of urethral reconstruction failure using foreskin flaps

    Directory of Open Access Journals (Sweden)

    João P. Rosado


    Full Text Available OBJECTIVES: The aim of the present study was to perform a stereological and biochemical analysis of the foreskin of smoker subjects. MATERIALS AND METHODS: Foreskin samples were obtained from 20 young adults (mean = 27.2 years old submitted to circumcision. Of the patients analyzed, one group (n = 10 had previous history of chronic smoking (a half pack to 3 packs per day for 3 to 13 years (mean = 5.8 ± 3.2. The control group included 10 nonsmoking patients. Masson's trichrome stain was used to quantify the foreskin vascular density. Weigert’s resorcin-fucsin stain was used to assess the elastic system fibers and Picrosirius red stain was applied to study the collagen. Stereological analysis was performed using the Image J software to determine the volumetric densities. For biochemical analysis, the total collagen was determined as µg of hydroxyproline per mg of dry tissue. Means were compared using the unpaired t-test (p < 0.05. RESULTS: Elastic system fibers of smokers was 42.5% higher than in the control group (p = 0.002. In contrast, smooth muscle fibers (p = 0.42 and vascular density (p = 0.16 did not show any significant variation. Qualitative analysis using Picrosirius red stain with polarized light evidenced the presence of type I and III collagen in the foreskin tissue, without significant difference between the groups. Total collagen concentration also did not differ significantly between smokers and non-smokers (73.1µg/mg ± 8.0 vs. 69.2µg/mg ± 5.9, respectively, p = 0.23. CONCLUSIONS: The foreskin tissue of smoking patients had a significant increase of elastic system fibers. Elastic fibers play an important role in this tissue’s turnover and this high concentration in smokers possibly causes high extensibility of the foreskin. The structural alterations in smokers’ foreskins could possibly explain the poor results in smoking patients submitted to foreskin fasciocutaneous flaps in urethral reconstruction surgery.

  16. Triggering apoptotic death of human epidermal keratinocytes by malic Acid: involvement of endoplasmic reticulum stress- and mitochondria-dependent signaling pathways. (United States)

    Hsiao, Yu-Ping; Lai, Wan-Wen; Wu, Shi-Bei; Tsai, Chung-Hung; Tang, Sheau-Chung; Chung, Jing-Gung; Yang, Jen-Hung


    Malic acid (MA) has been commonly used in cosmetic products, but the safety reports in skin are sparse. To investigate the biological effects of MA in human skin keratinocytes, we investigated the potential cytotoxicity and apoptotic effects of MA in human keratinocyte cell lines (HaCaT). The data showed that MA induced apoptosis based on the observations of DAPI staining, DNA fragmentation, and sub-G1 phase in HaCaT cells and normal human epidermal keratinocytes (NHEKs). Flow cytometric assays also showed that MA increased the production of mitochondrial superoxide (mito-SOX) but decreased the mitochondrial membrane potential. Analysis of bioenergetics function with the XF 24 analyzer Seahorse extracellular flux analyzer demonstrated that oxygen consumption rate (OCR) was significantly decreased whereas extracellular acidification rate (ECAR) was increased in MA-treated keratinocytes. The occurrence of apoptosis was proved by the increased expressions of FasL, Fas, Bax, Bid, caspases-3, -8, -9, cytochrome c, and the declined expressions of Bcl-2, PARP. MA also induced endoplasmic reticulum stress associated protein expression such as GRP78, GADD153, and ATF6α. We demonstrated that MA had anti-proliferative effect in HaCaT cell through the inhibition of cell cycle progression at G0/G1, and the induction of programmed cell death through endoplasmic reticulum stress- and mitochondria-dependent pathways.

  17. Triggering Apoptotic Death of Human Epidermal Keratinocytes by Malic Acid: Involvement of Endoplasmic Reticulum Stress- and Mitochondria-Dependent Signaling Pathways

    Directory of Open Access Journals (Sweden)

    Yu-Ping Hsiao


    Full Text Available Malic acid (MA has been commonly used in cosmetic products, but the safety reports in skin are sparse. To investigate the biological effects of MA in human skin keratinocytes, we investigated the potential cytotoxicity and apoptotic effects of MA in human keratinocyte cell lines (HaCaT. The data showed that MA induced apoptosis based on the observations of DAPI staining, DNA fragmentation, and sub-G1 phase in HaCaT cells and normal human epidermal keratinocytes (NHEKs. Flow cytometric assays also showed that MA increased the production of mitochondrial superoxide (mito-SOX but decreased the mitochondrial membrane potential. Analysis of bioenergetics function with the XF 24 analyzer Seahorse extracellular flux analyzer demonstrated that oxygen consumption rate (OCR was significantly decreased whereas extracellular acidification rate (ECAR was increased in MA-treated keratinocytes. The occurrence of apoptosis was proved by the increased expressions of FasL, Fas, Bax, Bid, caspases-3, -8, -9, cytochrome c, and the declined expressions of Bcl-2, PARP. MA also induced endoplasmic reticulum stress associated protein expression such as GRP78, GADD153, and ATF6α. We demonstrated that MA had anti-proliferative effect in HaCaT cell through the inhibition of cell cycle progression at G0/G1, and the induction of programmed cell death through endoplasmic reticulum stress- and mitochondria-dependent pathways.

  18. Human T-Lymphotropic virus (HTLV type I in vivo integration in oral keratinocytes

    Directory of Open Access Journals (Sweden)

    Martha C Domínguez


    Full Text Available Although the infection of HTLV-1 to cell components of the mouth have been previously reported, there was not until this report, a detailed study to show the characteristics of such infection. From 14 Tropical Spastic Paraparesis/ HTLV-1-Associated Myelopathy (HAM/TSP patients and 11 asymptomatic carrier individuals (AC coming from HTLV-1 endemic areas of southwest Pacific of Colombia, infected oral mucosa cells were primary cultured during five days. These cell cultures were immunophenotyped by dual color fluorescence cell assortment using different lymphocyte CD markers and also were immunohistochemically processed using a polyclonal anti-keratin antibody. Five days old primary cultures were characterized as oral keratinocytes, whose phenotype was CD3- /CD4-/CD8-/CD19-/CD14-/CD45-/A575-keratin+. From DNA extracted of primary cultures LTR, pol, env and tax HTLV-1 proviral DNA regions were differentially amplified by PCR showing proviral integration. Using poly A+ RNA obtained of these primary cultures, we amplify by RT-PCR cDNA of tax and pol in 57.14% (8/14 HAM/TSP patients and 27.28% (3/11 AC. Tax and pol poly A+ RNA were expressed only in those sIgA positive subjects. Our results showed that proviral integration and viral gene expression in oral keratinocytes are associated with a HTLV-1 specific local mucosal immune response only in those HTLV-1 infected individuals with detectable levels of sIgA in their oral fluids. Altogether the results gave strong evidence that oral mucosa infection would be parte of the systemic spreading of HTLV-1 infection.

  19. In vitro assessment of IL-4- or IL-13-mediated changes in the structural components of keratinocytes in mice and humans. (United States)

    Omori-Miyake, Miyuki; Yamashita, Masakatsu; Tsunemi, Yuichiro; Kawashima, Makoto; Yagi, Junji


    T helper type 2 (Th2) cytokines, IL-4 and IL-13, attenuate the expression of genes that regulate epidermal cellular structures and the barrier function at the terminal stage of keratinocyte differentiation. However, whether these Th2 cytokines act at earlier stages remains unknown. We investigated the roles of cytokines in expression levels of mRNAs and/or proteins in primary mouse keratinocytes and human keratinocyte HaCaT cells at earlier stages. We showed that IL-4 downregulated the expression levels of Krt1, Krt10, Dsg1, and Dsc1 via IL-4Rα- and signal transducer and activator of transcription factor 6 (STAT6)-dependent mechanisms in differentiating mouse keratinocytes at early stages. As the expression levels of keratin-1 and -10 in the keratinocytes transiently expressing an active form of STAT6 were not downregulated, STAT6 and other IL-4-induced molecules may synergistically regulate this expression. The restoration of the downregulated expression levels of Krt1 and Krt10 induced by IL-4 with the MEK (mitogen-activated protein kinase (MAPK)/extracellular signal-regulated kinase kinase) inhibitor U0126 indicated the involvement of the p44/42 MAPK signaling pathway in the attenuated expression. IL-13 also downregulated the expression of the four genes. Furthermore, IL-4 or IL-13 caused the downregulation of these genes in HaCaT cells and promoted the fragmentation of cell sheets with mechanical stress. Our results showed that IL-4 or IL-13 acted on differentiating keratinocytes in vitro at early stages to attenuate the gene expression.

  20. Incoming human papillomavirus 16 genome is lost in PML protein-deficient HaCaT keratinocytes. (United States)

    Bienkowska-Haba, Malgorzata; Luszczek, Wioleta; Keiffer, Timothy R; Guion, Lucile G M; DiGiuseppe, Stephen; Scott, Rona S; Sapp, Martin


    Human papillomaviruses (HPVs) target promyelocytic leukemia (PML) nuclear bodies (NBs) during infectious entry and PML protein is important for efficient transcription of incoming viral genome. However, the transcriptional down regulation was shown to be promoter-independent in that heterologous promoters delivered by papillomavirus particles were also affected. To further investigate the role of PML protein in HPV entry, we used small hairpin RNA to knockdown PML protein in HaCaT keratinocytes. Confirming previous findings, PML knockdown in HaCaT cells reduced HPV16 transcript levels significantly following infectious entry without impairing binding and trafficking. However, when we quantified steady-state levels of pseudogenomes in interphase cells, we found strongly reduced genome levels compared with parental HaCaT cells. Because nuclear delivery was comparable in both cell lines, we conclude that viral pseudogenome must be removed after successful nuclear delivery. Transcriptome analysis by gene array revealed that PML knockdown in clonal HaCaT cells was associated with a constitutive interferon response. Abrogation of JAK1/2 signaling prevented genome loss, however, did not restore viral transcription. In contrast, knockdown of PML protein in HeLa cells did not affect HPV genome delivery and transcription. HeLa cells are transformed by HPV18 oncogenes E6 and E7, which have been shown to interfere with the JAK/Stat signaling pathway. Our data imply that PML NBs protect incoming HPV genomes. Furthermore, they provide evidence that PML NBs are key regulators of the innate immune response in keratinocytes. Promyelocytic leukemia nuclear bodies (PML NBs) are important for antiviral defense. Many DNA viruses target these subnuclear structures and reorganize them. Reorganization of PML NBs by viral proteins is important for establishment of infection. In contrast, HPVs require the presence of PML protein for efficient transcription of incoming viral genome. Our

  1. Functional interplay between p63 and p53 controls RUNX1 function in the transition from proliferation to differentiation in human keratinocytes. (United States)

    Masse, I; Barbollat-Boutrand, L; Molina, M; Berthier-Vergnes, O; Joly-Tonetti, N; Martin, M T; Caron de Fromentel, C; Kanitakis, J; Lamartine, J


    The interfollicular epidermis is continuously renewed, thanks to a regulated balance between proliferation and differentiation. The ΔNp63 transcription factor has a key role in the control of this process. It has been shown that ΔNp63 directly regulates Runt-related transcription factor 1 (RUNX1) transcription factor expression in mouse keratinocytes. The present study showed for the first time that RUNX1 is expressed in normal human interfollicular epidermis and that its expression is tightly regulated during the transition from proliferation to differentiation. It demonstrated that ΔNp63 directly binds two different RUNX1 regulatory DNA sequences and modulates RUNX1 expression differentially in proliferative or differentiated human keratinocytes. It also showed that the regulation of RUNX1 expression by ΔNp63 is dependent on p53 and that this coregulation relies on differential binding and activation of RUNX1 regulatory sequences by ΔNp63 and p53. We also found that RUNX1 inhibits keratinocyte proliferation and activates directly the expression of KRT1, a critical actor in early keratinocyte differentiation. Finally, we described that RUNX1 expression, similar to ΔNp63 and p53, was strongly expressed and downregulated in basal cell carcinomas and squamous cell carcinomas respectively. Taken together, these data shed light on the importance of tight control of the functional interplay between ΔNp63 and p53 in regulating RUNX1 transcription factor expression for proper regulation of interfollicular epidermal homeostasis.

  2. Interleukin-17 and interferon-gamma synergize in the enhancement of proinflammatory cytokine production by human keratinocytes

    NARCIS (Netherlands)

    Teunissen, M. B.; Koomen, C. W.; de Waal Malefyt, R.; Wierenga, E. A.; Bos, J. D.


    Keratinocytes are influenced by cytokines released by skin-infiltrating T lymphocytes. IL-17 is produced by activated CD4+ T cells and can stimulate epithelial cells. We investigated whether IL-17 could modulate the cytokine production and cell-surface molecule expression of keratinocytes. The

  3. Ligation of the beta4 integrin triggers adhesion behavior of human keratinocytes by an "inside-out" mechanism. (United States)

    Kippenberger, Stefan; Loitsch, Stefan; Müller, Jutta; Guschel, Maike; Kaufmann, Roland; Bernd, August


    Carcinogenesis is considered as a multistep process involving functional changes in the hemidesmosomal organization. In normal skin keratinocytes, expression of the alpha(6)beta(4) integrin is restricted to the proliferative basal layer and mediates stable adhesion to the underlying basement membrane. Observations in carcinoma cells show a functional and spatial dissociation of the alpha(6)beta(4) integrin from the hemidesmosomal complex, which stimulates cell migration and, therefore, may contribute to carcinoma invasion. We now have evaluated the adhesion behavior of epithelial cells at different stages of transformation in response to activation of the beta(4) integrin. It is demonstrated that ligation of the beta(4) integrin augmented adhesion of carcinoma and pre-carcinoma cells to non-modified plastic. In contrast, adhesion behavior of normal human keratinocytes was not influenced by ligation of the beta(4) integrin. In order to explain the mechanism of beta(4)-mediated adhesion, the hypothesis of an "inside-out" activation of integrins was tested. Evidence is given that for cells expressing the alpha(6)beta(4) integrin, ligation of the beta(4) integrin increased beta(1) integrin-mediated adhesion. Furthermore, ligation of the beta(4) integrin led to phosphorylation of PKB/Akt at both phosphorylation sites. Functional blocking of PKB/Akt by dominant-negative overexpression decreased cell adhesion in response to beta(4) integrin ligation. Taken together, the present data establish a link between the ligation of the beta(4) integrin and beta(1) integrin-mediated cell adhesion in carcinoma and pre-carcinoma cells. Hence, these findings provide further insight into the conversion processes during carcinogenesis and show the beta(4) integrin to be a key regulator of cellular adhesion.

  4. GATA3 is a master regulator of the transcriptional response to low-dose ionizing radiation in human keratinocytes

    Energy Technology Data Exchange (ETDEWEB)

    Bonin, F.; Molina, M.; Berthier-Vergnes, O.; Lamartine, J. [Universite de Lyon, Lyon, F-69003 (France); Universite Lyon 1, Lyon, F-69003 (France); CNRS, UMR5534, Centre de Genetique Moleculaire et Cellulaire, Villeurbanne, F-69622 (France); Malet, C.; Ginestet, C. [Centre Leon Berard, Service de Radiotherapie, Lyon F-69008 (France); Martin, M.T. [Laboratoire de Genomique et Radiobiologie de la Keratinopoiese, CEA, IRCM, Evry F-91000 (France)


    Background: The general population is constantly exposed to low levels of radiation through natural, occupational or medical irradiation. Even if the biological effects of low-level radiation have been intensely debated and investigated, the molecular mechanisms underlying the cellular response to low doses remain largely unknown. Results: The present study investigated the role of GATA3 protein in the control of the cellular and molecular response of human keratinocytes exposed to a 1 cGy dose of X-rays. Chromatin immunoprecipitation showed GATA3 to be able to bind the promoter of 4 genes responding to a 1 cGy exposure. To go further into the role of GATA3 after ionizing radiation exposure, we studied the cellular and molecular consequences of radiation in GATA3 knock-down cells. Knockdown was obtained by lentiviral-mediated expression of an shRNA targeting the GATA3 transcript in differentiated keratinocytes. First, radiosensitivity was assessed: the toxicity, in terms of immediate survival (with XTT test), associated with 1 cGy radiation was found to be increased in GATA3 knock-down cells. The impact of GATA3 knock-down on the transcriptome of X-ray irradiated cells was also investigated, using oligonucleotide micro-arrays to assess changes between 3 h and 72 h post-irradiation in normal vs GATA3 knock-down backgrounds; transcriptome response was found to be completely altered in GATA3 knock-down cells, with a strong induction/repression peak 48 h after irradiation. Functional annotation revealed enrichment in genes known to be involved in chaperone activity, TGF{beta} signalling and stress response. Conclusion: Taken together, these data indicate that GATA3 is an important regulator of the cellular and molecular response of epidermal cells to very low doses of radiation. (authors)

  5. Broad-spectrum sunscreens prevent the secretion of proinflammatory cytokines in human keratinocytes exposed to ultraviolet A and phototoxic lomefloxacin

    Energy Technology Data Exchange (ETDEWEB)

    Reinhardt, P.; Cybulski, M. [Lasers and Electro-Optics Div., Consumer and Clinical Radiation Protection Bureau, Product Safety Program, Healthy Environments and Consumer Safety Branch, Health Canada, Ottawa, Ontario (Canada)], E-mail:; Miller, S.M.; Ferrarotto, C.; Wilkins, R. [Radiobiology Div., Consumer and Clinical Radiation Protection Bureau, Product Safety Program, Healthy Environments and Consumer Safety Branch, Health Canada, Ottawa, Ontario (Canada); Deslauriers, Y. [Lasers and Electro-Optics Div., Consumer and Clinical Radiation Protection Bureau, Product Safety Program, Healthy Environments and Consumer Safety Branch, Health Canada, Ottawa, Ontario (Canada)


    The combination of phototoxic drugs and ultraviolet (UV) radiation can trigger the release of proinflammatory cytokines. The present study measured the ability of sunscreens to prevent cytokine secretion in human keratinocytes following cotreatment of these cells with a known photoreactive drug and UVA. Keratinocytes were treated for 1 h with increasing concentrations of lomefloxacin (LOM) or norfloxacin (NOR), exposed to 15 J/cm{sup 2} UVA, and incubated for 24 h. NOR, owing to the absence of a fluorine atom in position 8, was non-phototoxic and used as a negative control. Cell viability and the release of 3 cytokines were assessed, namely interleukin-1{alpha} (IL-1{alpha}), interleukin-6 (IL-6), and tumour necrosis factor-{alpha} (TNF-{alpha}). The measurement of these cytokines may be a useful tool for detecting photoreactive compounds. To measure their ability to prevent cytokine secretion, various sunscreens were inserted between the UVA source and the cells. Treatment with NOR, NOR plus UVA, or LOM had no effect on the cells. LOM plus UVA, however, had an effect on cell viability and on cytokine secretion. IL-1{alpha} levels increased with LOM concentration. The release of TNF-{alpha} and IL-6 followed the same pattern at lower concentrations of LOM but peaked at 15 {mu}mol/L and decreased at higher concentrations. Sunscreens protected the cells from the effects of LOM plus UVA, as cell viability and levels of cytokines remained the same as in the control cells. In conclusion, the application of broad-spectrum sunscreen by individuals exposed to UVA radiation may prevent phototoxic reactions initiated by drugs such as LOM. (author)

  6. SILAC-based quantitative proteomic analysis reveals widespread molecular alterations in human skin keratinocytes upon chronic arsenic exposure. (United States)

    Mir, Sartaj Ahmad; Pinto, Sneha M; Paul, Somnath; Raja, Remya; Nanjappa, Vishalakshi; Syed, Nazia; Advani, Jayshree; Renuse, Santosh; Sahasrabuddhe, Nandini A; Prasad, T S Keshava; Giri, Ashok K; Gowda, Harsha; Chatterjee, Aditi


    Chronic exposure to arsenic is associated with dermatological and nondermatological disorders. Consumption of arsenic-contaminated drinking water results in accumulation of arsenic in liver, spleen, kidneys, lungs, and gastrointestinal tract. Although arsenic is cleared from these sites, a substantial amount of residual arsenic is left in keratin-rich tissues including skin. Epidemiological studies suggest the association of skin cancer upon arsenic exposure, however, the mechanism of arsenic-induced carcinogenesis is not completely understood. We developed a cell line based model to understand the molecular mechanisms involved in arsenic-mediated toxicity and carcinogenicity. Human skin keratinocyte cell line, HaCaT, was chronically exposed to 100 nM sodium arsenite over a period of 6 months. We observed an increase in basal ROS levels in arsenic-exposed cells. SILAC-based quantitative proteomics approach resulted in identification of 2111 proteins of which 42 proteins were found to be overexpressed and 54 downregulated (twofold) upon chronic arsenic exposure. Our analysis revealed arsenic-induced overexpression of aldo-keto reductase family 1 member C2 (AKR1C2), aldo-keto reductase family 1 member C3 (AKR1C3), glutamate-cysteine ligase catalytic subunit (GCLC), and NAD(P)H dehydrogenase [quinone] 1 (NQO1) among others. We observed downregulation of several members of the plakin family including periplakin (PPL), envoplakin (EVPL), and involucrin (IVL) that are essential for terminal differentiation of keratinocytes. MRM and Western blot analysis confirmed differential expression of several candidate proteins. Our study provides insights into molecular alterations upon chronic arsenic exposure on skin. © 2016 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  7. GATA3 is a master regulator of the transcriptional response to low-dose ionizing radiation in human keratinocytes

    Directory of Open Access Journals (Sweden)

    Lamartine Jérôme


    Full Text Available Abstract Background The general population is constantly exposed to low levels of radiation through natural, occupational or medical irradiation. Even if the biological effects of low-level radiation have been intensely debated and investigated, the molecular mechanisms underlying the cellular response to low doses remain largely unknown. Results The present study investigated the role of GATA3 protein in the control of the cellular and molecular response of human keratinocytes exposed to a 1 cGy dose of X-rays. Chromatin immunoprecipitation showed GATA3 to be able to bind the promoter of 4 genes responding to a 1 cGy exposure. To go further into the role of GATA3 after ionizing radiation exposure, we studied the cellular and molecular consequences of radiation in GATA3 knock-down cells. Knock-down was obtained by lentiviral-mediated expression of an shRNA targeting the GATA3 transcript in differentiated keratinocytes. First, radiosensitivity was assessed: the toxicity, in terms of immediate survival (with XTT test, associated with 1 cGy radiation was found to be increased in GATA3 knock-down cells. The impact of GATA3 knock-down on the transcriptome of X-ray irradiated cells was also investigated, using oligonucleotide microarrays to assess changes between 3 h and 72 h post-irradiation in normal vs GATA3 knock-down backgrounds; transcriptome response was found to be completely altered in GATA3 knock-down cells, with a strong induction/repression peak 48 h after irradiation. Functional annotation revealed enrichment in genes known to be involved in chaperone activity, TGFβ signalling and stress response. Conclusion Taken together, these data indicate that GATA3 is an important regulator of the cellular and molecular response of epidermal cells to very low doses of radiation.

  8. Cox2 and β-Catenin/T-cell Factor Signaling Intestinalize Human Esophageal Keratinocytes When Cultured under Organotypic Conditions

    Directory of Open Access Journals (Sweden)

    Jianping Kong


    Full Text Available The incidence of esophageal adenocarcinoma (EAC is rising in the United States. An important risk factor for EAC is the presence of Barrett esophagus (BE. BE is the replacement of normal squamous esophageal epithelium with a specialized columnar epithelium in response to chronic acid and bile reflux. However, the emergence of BE from squamous keratinocytes has not yet been demonstrated. Our research has focused on this. Wnt and cyclooxygenase 2 (Cox2 are two pathways whose activation has been associated with BE and progression to EAC, but their role has not been tested experimentally. To explore their contribution, we engineered a human esophageal keratinocyte cell line to express either a dominant-active Wnt effector CatCLef or a Cox2 complementary DNA. In a two-dimensional culture environment, Cox2 expression increases cell proliferation and migration, but neither transgene induces known BE markers. In contrast, when these cells were placed into three-dimensional organotypic culture conditions, we observed more profound effects. CatCLef-expressing cells were more proliferative, developed a thicker epithelium, and upregulated Notch signaling and several BE markers including NHE2. Cox2 expression also increased cell proliferation and induced a thicker epithelium. More importantly, we observed cysts form within the epithelium, filled with intestinal mucins including Muc5B and Muc17. This suggests that Cox2 expression in a three-dimensional culture environment induces a lineage of mucin-secreting cells and supports an important causal role for Cox2 in BE pathogenesis. We conclude that in vitro modeling of BE pathogenesis can be improved by enhancing Wnt signaling and Cox2 activity and using three-dimensional organotypic culture conditions.

  9. Effect of Annurca apple polyphenols on human HaCaT keratinocytes proliferation. (United States)

    D'Angelo, Stefania; La Porta, Raffaele; Napolitano, Maria; Galletti, Patrizia; Quagliuolo, Lucio; Boccellino, Mariarosaria


    Polyphenols have been demonstrated to have clear antioxidant activities in vitro. However, in complex biological systems, they exhibit additional properties, which are yet poorly understood. The apple is among the most consumed fruits worldwide, and several studies suggest that apple polyphenols could play a role in the prevention of degenerative diseases. The present study aimed at evaluating the Annurca apple polyphenol extract (APE) effects both proliferation and apoptosis on HaCaT cells. The data indicate that apple polyphenolic compounds had significant antiproliferative action on HaCaT cells. The fluorescence-activated cell-sorting analysis showed that APE induced cell apoptosis in a dose-dependent manner. Moreover, apple polyphenols induced apoptosis in epithelial cells by triggering a death receptor-associated extrinsic pathway p53-independent. APE was also capable of inducing morphological changes as evidenced by nuclear condensation. The cellular, morphological, and molecular data unequivocally demonstrated that induction of cellular apoptosis was mainly responsible for the previously observed antiproliferation-induced APE on HaCaT keratinocytes. Our experimental results suggest that apple polyphenols are a promising source from which a natural-based topical agent could be developed for skin diseases treatment.

  10. Impact of Different Spa Waters on Inflammation Parameters in Human Keratinocyte HaCaT Cells. (United States)

    Zöller, Nadja; Valesky, Eva; Hofmann, Matthias; Bereiter-Hahn, Jürgen; Bernd, August; Kaufmann, Roland; Meissner, Markus; Kippenberger, Stefan


    The treatment of different skin conditions with spa waters is a long tradition dating back to at least late Hellenism. Interestingly, independent scientific examinations studying the effect of spa waters are scarce. In the present in vitro study, we compared the effect of culture media supplemented with (a) thermal spa waters (La Roche-Posay, Avène) and (b) two natural mineral drinking waters (Heppinger, Adelholzener) on physiological parameters in HaCaT keratinocytes. The different medium preparations were investigated with regard to cell proliferation and cell damage. Moreover, the impact on inflammation parameters with and without ultraviolet B (UVB) irradiation was examined. Two popular thermal spring waters were found to suppress cell proliferation and cell damage. Moreover, these waters reversed the induction of interleukin-6, as measured using enzyme-linked immunosorbent assay and promoter transactivation, and the formation of reactive oxygen species after UVB stimulation. Of note, the two natural mineral waters, which are distributed as drinking waters, had some effect on the above-mentioned parameters but to a lesser extent. In summary, our results show that spa waters, and particularly those derived from thermal springs, reduce parameters associated with inflammation. It seems likely that trace elements such as selenium and zinc are critical for the observed effects.

  11. FOXM1 allows human keratinocytes to bypass the oncogene-induced differentiation checkpoint in response to gain of MYC or loss of p53. (United States)

    Molinuevo, R; Freije, A; de Pedro, I; Stoll, S W; Elder, J T; Gandarillas, A


    Tumour suppressor p53 or proto-oncogene MYC is frequently altered in squamous carcinomas, but this is insufficient to drive carcinogenesis. We have shown that overactivation of MYC or loss of p53 via DNA damage triggers an anti-oncogenic differentiation-mitosis checkpoint in human epidermal keratinocytes, resulting in impaired cell division and squamous differentiation. Forkhead box M1 (FOXM1) is a transcription factor recently proposed to govern the expression of a set of mitotic genes. Deregulation of FOXM1 occurs in a wide variety of epithelial malignancies. We have ectopically expressed FOXM1 in keratinocytes of the skin after overexpression of MYC or inactivation of endogenous p53. Ectopic FOXM1 rescues the proliferative capacity of MYC- or p53-mutant cells in spite of higher genetic damage and a larger cell size typical of differentiation. As a consequence, differentiation induced by loss of p53 or MYC is converted into increased proliferation and keratinocytes displaying genomic instability are maintained within the proliferative compartment. The results demonstrate that keratinocyte oncogene-induced differentiation is caused by mitosis control and provide new insight into the mechanisms driving malignant progression in squamous cancer.

  12. Keratinocyte transcriptional regulation of the human c-Myc promoter occurs via a novel Lef/Tcf binding element distinct from neoplastic cells. (United States)

    Kolly, Carine; Zakher, Antony; Strauss, Christian; Suter, Maja M; Müller, Eliane J


    The proto-oncogene c-Myc is involved in early neoplastic transformations. Two consensus Lef/Tcf binding elements (TBE) were found to be prerequisite for transcriptional transactivation by the armadillo proteins beta-catenin and plakoglobin (PG) together with Tcf4 in human neoplastic cells. In epidermal keratinocytes, c-Myc was reported to be repressed by Lef-1 and PG. Using reporter gene assays, here we demonstrate that deletion of the two consensus TBE fails to abrogate transcriptional regulation by Lef-1/PG in wildtype and beta-catenin-/- keratinocytes, while it reduces transcription in pre-neoplastic PG-/- keratinocytes. We identified a TBE sequence variant downstream of the major transcriptional initiation site that binds Lef-1 in vitro and in vivo, and its mutation compromised transcriptional regulation by Lef-1/PG. Collectively, this study demonstrates that the two consensus TBE's reported in neoplastic cells are dispensable for c-Myc regulation in normal keratinocytes, which instead use a novel TBE sequence variant. This unprecedented finding may have important implications for armadillo target genes involved in carcinogenesis.

  13. Infection of Keratinocytes with Trichophytum rubrum Induces Epidermal Growth Factor-Dependent RNase 7 and Human Beta-Defensin-3 Expression (United States)

    Rademacher, Franziska; Schröder, Lena; Brasch, Jochen; Harder, Jürgen


    Human keratinocytes are able to express various antimicrobial peptides (AMP) to protect the skin from exaggerated microbial colonization and infection. Recently, in vitro growth-inhibiting activity of the skin-derived AMP psoriasin, RNase 7 and human beta-defensin (hBD)-2 against dermatophytes such as Trichophyton (T.) rubrum have been reported. To evaluate whether keratinocytes are able to respond to T. rubrum infection by an induced expression of AMP we exposed primary keratinocytes to living conidia of T. rubrum. This led to conidia germination and mycelial growth which was paralleled by a strong gene induction of the skin-derived AMP RNase 7 and hBD-3. Gene expression of the AMP psoriasin (S100A7) and hBD-2 were only slightly induced. The T. rubrum-mediated RNase 7 gene induction was accompanied by increased secretion of RNase 7. Parallel treatment of the keratinocytes with T. rubrum and the cytokine combination IL-17A/IFN-γ resulted in synergistic induction of RNase 7 and hBD-3 expression. Since patients receiving therapy by inhibition of the epidermal growth factor receptor (EGFR) more often suffer from dermatophytoses we investigated whether EGFR may be involved in the T. rubrum-mediated RNase 7 and hBD-3 induction. Primary keratinocytes incubated with an EGFR blocking antibody as well as with the EGFR antagonist AG1478 showed a significantly diminished RNase 7 and hBD-3 induction upon exposure of the keratinocytes to T. rubrum indicating that EGFR is involved in the T. rubrum-mediated induction of RNase 7 and hBD-3. The growth of T. rubrum in vitro was inhibited by hBD-3 in a dose-dependent manner suggesting that hBD-3 may contribute to cutaneous innate defense against T. rubrum. Taken together our data indicate that keratinocytes are able to initiate a fast defense response towards T. rubrum by the increased expression of AMP active against T. rubrum. A dysregulation of AMP may contribute to chronic and recurring dermatophytoses. PMID:24747887

  14. Recombinant Human Keratinocyte Growth Factor Induces Akt Mediated Cell Survival Progression in Emphysematous Mice. (United States)

    Prakash Muyal, Jai; Kumar, Dhananjay; Kotnala, Sudhir; Muyal, Vandana; Kumar Tyagi, Amit


    Emphysema has been associated with decreased VEGF and VEGFR-2 expression and the presence of high numbers of apoptotic alveolar cells. Keratinocyte growth factor stimulates VEGF synthesis which in turn confers normal lung structure maintenance via the Akt pathway. In this study the potential role of rHuKGF in the improvement of deregulated Akt mediated cell survival pathway in emphysematous mice was investigated. Three experimental groups, i.e., emphysema, treatment and control groups, were prepared. Lungs of mice were treated on 3 occasions by oropharyngeal instillation of 10mg rHuKGF per kg body weight after induction of emphysema with porcine pancreatic elastase. Subsequently, lung tissues from mice were collected for histopathology and molecular biology studies. Histopathology photomicrographs and destructive index analysis have shown that elastase-induced airspace enlargement and loss of alveoli recovered in the treatment group. rHuKGF stimulates VEGF production which in turn induces the Akt mediated cell survival pathway in emphysematous lungs. mRNA expression of VEGF, VEGFR, PI3K and Akt was significantly increased while Pten, Caspase-9 and Bad was notably decreased in treatment group when compared with emphysema group, being comparable with the control group. Moreover, VEGF protein expression was in accordance with that found for mRNA. Therapeutic rHuKGF supplementation improves the deregulated Akt pathway in emphysema, resulting in alveolar cell survival through activation of the endogenous VEGF-dependent cell survival pathway. Hence rHuKGF may prove to be a potential drug in the treatment of emphysema. Copyright © 2014. Published by Elsevier Espana.

  15. Protective effect of Opuntia ficus-indica L. cladodes against UVA-induced oxidative stress in normal human keratinocytes. (United States)

    Petruk, Ganna; Di Lorenzo, Flaviana; Imbimbo, Paola; Silipo, Alba; Bonina, Andrea; Rizza, Luisa; Piccoli, Renata; Monti, Daria Maria; Lanzetta, Rosa


    Opuntia ficus-indica L. is known for its beneficial effects on human health, but still little is known on cladodes as a potent source of antioxidants. Here, a direct, economic and safe method was set up to obtain water extracts from Opuntia ficus-indica cladodes rich in antioxidant compounds. When human keratinocytes were pre-treated with the extract before being exposed to UVA radiations, a clear protective effect against UVA-induced stress was evidenced, as indicated by the inhibition of stress-induced processes, such as free radicals production, lipid peroxidation and GSH depletion. Moreover, a clear protective effect against apoptosis in pre-treated irradiated cells was evidenced. We found that eucomic and piscidic acids were responsible for the anti-oxidative stress action of cladode extract. In conclusion, a bioactive, safe, low-cost and high value-added extract from Opuntia cladodes was obtained to be used for skin health/protection. Copyright © 2017 Elsevier Ltd. All rights reserved.

  16. Human Papillomavirus E2 Regulates SRSF3 (SRp20) To Promote Capsid Protein Expression in Infected Differentiated Keratinocytes. (United States)

    Klymenko, T; Hernandez-Lopez, H; MacDonald, A I; Bodily, J M; Graham, S V


    The human papillomavirus (HPV) life cycle is tightly linked to differentiation of the infected epithelial cell, suggesting a sophisticated interplay between host cell metabolism and virus replication. Previously, we demonstrated in differentiated keratinocytes in vitro and in vivo that HPV type 16 (HPV16) infection caused increased levels of the cellular SR splicing factors (SRSFs) SRSF1 (ASF/SF2), SRSF2 (SC35), and SRSF3 (SRp20). Moreover, the viral E2 transcription and replication factor that is expressed at high levels in differentiating keratinocytes could bind and control activity of the SRSF1 gene promoter. Here, we show that the E2 proteins of HPV16 and HPV31 control the expression of SRSFs 1, 2, and 3 in a differentiation-dependent manner. E2 has the greatest transactivation effect on expression of SRSF3. Small interfering RNA depletion experiments in two different models of the HPV16 life cycle (W12E and NIKS16) and one model of the HPV31 life cycle (CIN612-9E) revealed that only SRSF3 contributed significantly to regulation of late events in the virus life cycle. Increased levels of SRSF3 are required for L1 mRNA and capsid protein expression. Capsid protein expression was regulated specifically by SRSF3 and appeared independent of other SRSFs. Taken together, these data suggest a significant role of the HPV E2 protein in regulating late events in the HPV life cycle through transcriptional regulation of SRSF3 expression. Human papillomavirus replication is accomplished in concert with differentiation of the infected epithelium. Virus capsid protein expression is confined to the upper epithelial layers so as to avoid immune detection. In this study, we demonstrate that the viral E2 transcription factor activates the promoter of the cellular SRSF3 RNA processing factor. SRSF3 is required for expression of the E4(^)L1 mRNA and so controls expression of the HPV L1 capsid protein. Thus, we reveal a new dimension of virus-host interaction crucial for production

  17. Role of taurine accumulation in keratinocyte hydration. (United States)

    Janeke, Guido; Siefken, Wilfried; Carstensen, Stefanie; Springmann, Gunja; Bleck, Oliver; Steinhart, Hans; Höger, Peter; Wittern, Klaus-Peter; Wenck, Horst; Stäb, Franz; Sauermann, Gerhard; Schreiner, Volker; Doering, Thomas


    Epidermal keratinocytes are exposed to a low water concentration at the stratum corneum-stratum granulosum interface. When epithelial tissues are osmotically perturbed, cellular protection and cell volume regulation is mediated by accumulation of organic osmolytes such as taurine. Previous studies reported the presence of taurine in the epidermis of several animal species. Therefore, we analyzed human skin for the presence of the taurine transporter (TAUT) and studied the accumulation of taurine as one potential mechanism protecting epidermal keratinocytes from dehydration. According to our results, TAUT is expressed as a 69 kDa protein in human epidermis but not in the dermis. For the epidermis a gradient was evident with maximal levels of TAUT in the outermost granular keratinocyte layer and lower levels in the stratum spinosum. No TAUT was found in the basal layer or in the stratum corneum. Keratinocyte accumulation of taurine was induced by experimental induction of skin dryness via application of silica gel to human skin. Cultured human keratinocytes accumulated taurine in a concentration- and osmolarity-dependent manner. TAUT mRNA levels were increased after exposure of human keratinocytes to hyperosmotic culture medium, indicating osmosensitive TAUT mRNA expression as part of the adaptation of keratinocytes to hyperosmotic stress. Keratinocyte uptake of taurine was inhibited by beta-alanine but not by other osmolytes such as betaine, inositol, or sorbitol. Accumulation of taurine protected cultured human keratinocytes from both osmotically induced and ultraviolet-induced apoptosis. Our data indicate that taurine is an important epidermal osmolyte required to maintain keratinocyte hydration in a dry environment.

  18. Conditioned medium from the three-dimensional culture of human umbilical cord perivascular cells accelerate the migration and proliferation of human keratinocyte and fibroblast. (United States)

    Kim, Min Ho; Wu, Wen Hao; Choi, Jee Hyun; Kim, Ji Hyun; Hong, Seok-Ho; Jun, Jin Hyun; Ko, Yong; Lee, Jong Hun


    Previous studies have reported that the conditioned medium (CM) of bone marrow-mesenchymal stem cells (BM-MSCs) stimulate the migration and proliferation of cell types involved in the wound healing process. However, these studies only show MSC-CM effects that were obtained using a two-dimensional (2D) culture. Recently, a three-dimensional (3D) culture has been considered to be a more physiologically appropriate system than the 2D culture. In addition, it has been shown that the procurement of BM-MSC is invasive, and other sources of MSC are thus being explored. Recently, perivascular cells (PVCs) have been considered as an alternative source of cells for dermal wound healing. Therefore, in this study, a PVC-conditioned medium (CM) was collected from a 3D culture (PVC-CM-3D) using highly porous polystyrene-based membranes and compared with PVC-CM from a 2D culture (PVC-CM-2D) to investigate the effects on the migration and proliferation of human keratinocytes and fibroblasts. Moreover, the PVC-CM components from the 2D and 3D cultures were identified using 2D gel electrophoresis. The migrations of the keratinocytes cells and fibroblasts were significantly higher with PVC-CM-3D than with the 2D culture; similarly, the proliferation of keratinocytes was also highly stimulated by PVC-CM-3D. Proteomic analyses of the PVC-CM revealed that type I collagen was highly expressed in the 3D-culture system. Microtubule-actin cross-linked factor 1 (KIAA0465), nebulin-related anchoring protein, and thioredoxin were specifically expressed only in PVC-CM-3D. In addition, more EVs could be isolated from the PVC-CM-3D, and EVs were found to stimulate keratinocyte migration. Taken together, 3D-culture using a polystyrene scaffold is demonstrated to be a better system for providing better physiological conditions; therefore, PVC-CM-3D could be a promising option for skin-wound healing.

  19. Gene expression studies on human keratinocytes transduced with human growth hormone gene for a possible utilization in gene therapy; Estudos da expressao genica mediante utilizacao de queratinocitos humanos normais transduzidos com o gene do hormonio de crscimento humano. Possivel utilizacao em terapia genica

    Energy Technology Data Exchange (ETDEWEB)

    Mathor, Monica Beatriz


    Taking advantage of the recent progress in the DNA-recombinant techniques and of the potentiality of normal human keratinocytes primary culture to reconstitute the epidermis, it was decided to genetically transform these keratinocytes to produce human growth hormone under controllable conditions that would be used in gene therapy at this hormone deficient patients. The first step to achieve this goal was to standardize infection of keratinocytes with retrovirus producer cells containing a construct which included the gene of bacterial b-galactosidase. The best result was obtained cultivating the keratinocytes for 3 days in a 2:1 mixture of retrovirus producer cells and 3T3-J2 fibroblasts irradiated with 60 Gy, and splitting these infected keratinocytes on 3T3-J2 fibroblasts feeder layer. Another preliminary experiment was to infect normal human keratinocytes with interleukin-6 gene (hIL-6) that, in pathologic conditions, could be reproduced by keratinocytes and secreted to the blood stream. Thus, we verify that infected keratinocytes secrete an average amount of 500 ng/10{sup 6} cell/day of cytokin during the in vitro life time, that certify the stable character of the injection. These keratinocytes, when grafted in mice, secrete hIL-6 to the blood stream reaching levels of 40 pg/ml of serum. After these preliminary experiments, we construct a retroviral vector with the human growth hormone gene (h GH) driven by human metallothionein promoter (h PMT), designated DChPMTGH. Normal human keratinocytes were infected with DChPMTGH producer cells, following previously standardized protocol, obtaining infected keratinocytes secreting to the culture media 340 ng h GH/10{sup 6} cell/day without promoter activation. This is the highest level of h GH secreted in human keratinocytes primary culture described in literature. The h GH value increases approximately 10 times after activation with 100 {mu}M Zn{sup +2} for 8-12 hours. (author). 158 refs., 42 figs., 6 tabs.

  20. The comparison of two methods to obtain human oral keratinocytes in primary culture; Comparacao de dois metodos de obtencao celular para cultura primaria de queratinocitos bucais humanos

    Energy Technology Data Exchange (ETDEWEB)

    Klingbeil, Maria Fatima Guarizo


    The therapeutic procedures frequently used in oral treatments for the pathological diseases are surgical, resulting in failures of the mucosal continuity.The possibility to obtain transplantable oral epithelia from an in vitro cell culture opens new utilization perspectives not only to where it comes from, but also as a reconstructive material for other parts of the human body, such as: urethra, epithelia corneo-limbal, cornea, ocular surface. Many researchers still use controversial methods for obtaining cells. It was therefore evaluated and compared the efficiency in both methods: enzymatic and direct explant to obtain oral keratinocytes from human oral mucosa. Fragments of intra oral epithelial tissues from healthy human subjects, undergoing dental surgeries, were donated to the research project. The keratinocytes were cultivated over a feeder-layer from a previously irradiated 3T3 Swiss albino fibroblasts. In this study it was compared the time needed in the cell obtention, the best cell amount between both methods, the life-span, the cell capacity to form an in vitro epithelia and its morphologic structure. The results in the assessment of both methods have shown the possibility to obtain keratinocytes from a small oral fragment, but at the same time we may verify the advantages and peculiar restrictions for each one of both analyzed methods. (author)

  1. Autophagy participates in isoliquiritigenin-induced melanin degradation in human epidermal keratinocytes through PI3K/AKT/mTOR signaling. (United States)

    Yang, Zhibo; Zeng, Biyun; Pan, Yi; Huang, Pan; Wang, Chang


    Melanin is the pigment responsible for the color of human skin and hair. Melanin serves as a double-edge sword which can exert both protective and spot-causing effects on skin. Although melanin has an important role in protecting the skin against UV damage, an excessive or uneven melanin production can lead to the formation of freckles and age spots. Isoliquiritigenin (ISL) has been reported to inhibit melanin synthesis; however, its role in melanin degradation remains unclear. In the present study, we evaluated the detailed function of ISL in melanin degradation in human epidermal keratinocytes. Since autophagy has been reported to be related to melanin degradation, we also examined the activation of autophagy by ISL treatment in keratinocytes by measurement of autophagy-related proteins, ATG7, LC3 and p62. Moreover, si-ATG7-induced ATG7 knockdown and autophagy inhibitor 3-MA decreased LC3 II protein levels and increased PMEL17, p62 and melanin levels in HaCaT cells, which could be partially reversed by ISL treatment, indicating that autophagy participated in melanin degradation. The decreased p-AKT and p-mTOR proteins upon ISL treatment indicated the involvement of PI3K/AKT/mTOR signaling in ISL-induced melanin degradation. Taken together, we demonstrated that autophagy participates in ISL-induced melanin degradation in human epidermal keratinocytes through PI3K/AKT/mTOR signaling. Copyright © 2017. Published by Elsevier Masson SAS.

  2. Calcium spirulan derived from Spirulina platensis inhibits herpes simplex virus 1 attachment to human keratinocytes and protects against herpes labialis. (United States)

    Mader, Julia; Gallo, Antonio; Schommartz, Tim; Handke, Wiebke; Nagel, Claus-Henning; Günther, Patrick; Brune, Wolfram; Reich, Kristian


    Chronic infections with herpes simplex virus (HSV) type 1 are highly prevalent in populations worldwide and cause recurrent oral lesions in up to 40% of infected subjects. We investigated the antiviral activity of a defined Spirulina platensis microalga extract and of purified calcium spirulan (Ca-SP), a sulfated polysaccharide contained therein. The inhibitory effects of HSV-1 were assessed by using a plaque reduction assay and quantitative PCR in a susceptible mammalian epithelial cell line and confirmed in human keratinocytes. Time-of-addition and attachment experiments and fluorescence detection of the HSV-1 tegument protein VP16 were used to analyze the mechanism of HSV-1 inhibition. Effects of Ca-SP on Kaposi sarcoma-associated herpesvirus/human herpes virus 8 replication and uptake of the ORF45 tegument protein were tested in human retinal pigment epithelial cells. In an observational trial the prophylactic effects of topically applied Ca-SP were compared with those of systemic and topical nucleoside analogues in 198 volunteers with recurrent herpes labialis receiving permanent lip makeup. Ca-SP inhibited HSV-1 infection in vitro with a potency at least comparable to that of acyclovir by blocking viral attachment and penetration into host cells. Ca-SP also inhibited entry of Kaposi sarcoma-associated herpesvirus/human herpes virus 8. In the clinical model of herpes exacerbation, the prophylactic effect of a Ca-SP and microalgae extract containing cream was superior to that of acyclovir cream. These data indicate a potential clinical use of Ca-SP containing Spirulina species extract for the prophylactic treatment of herpes labialis and suggest possible activity of Ca-SP against infections caused by other herpesviruses. Copyright © 2015 American Academy of Allergy, Asthma & Immunology. Published by Elsevier Inc. All rights reserved.

  3. Silencing of E7 oncogene restores functional E-cadherin expression in human papillomavirus 16-transformed keratinocytes. (United States)

    Caberg, Jean-Hubert D; Hubert, Pascale M; Begon, Dominique Y; Herfs, Michael F; Roncarati, Patrick J; Boniver, Jacques J; Delvenne, Philippe O


    Human papillomavirus (HPV) infection, particularly type 16, is causally associated with cancer of the uterine cervix. The persistence or progression of cervical lesions suggests that viral antigens are not adequately presented to the immune system. This hypothesis is reinforced by the observation that most squamous intra-epithelial lesions show quantitative and functional alterations of Langerhans cells (LCs). Moreover, E-cadherin-dependent adhesion of LC to keratinocytes (KCs) is defective in cervical HPV16-associated (pre)neoplastic lesions. The possible role of viral oncoprotein E7 in the reduced levels of cell surface E-cadherin was investigated by silencing HPV16 E7 by RNA interference (siRNA). This treatment induced an increased cell surface E-cadherin expression in HPV16-positive KC and a significant adhesion of LC to these squamous cells. The E-cadherin re-expression following HPV16 E7 silencing was associated with increased detection levels of retinoblastoma protein and the activating protein (AP)-2alpha transcription factor. These data suggest that HPV16 E7-induced alterations of LC/KC adhesion may play a role in the defective immune response during cervical carcinogenesis.

  4. Metabolic effects of TiO2 nanoparticles, a common component of sunscreens and cosmetics, on human keratinocytes. (United States)

    Tucci, P; Porta, G; Agostini, M; Dinsdale, D; Iavicoli, I; Cain, K; Finazzi-Agró, A; Melino, G; Willis, A


    The long-term health risks of nanoparticles remain poorly understood, which is a serious concern given their prevalence in the environment from increased industrial and domestic use. The extent to which such compounds contribute to cellular toxicity is unclear, and although it is known that induction of oxidative stress pathways is associated with this process, the proteins and the metabolic pathways involved with nanoparticle-mediated oxidative stress and toxicity are largely unknown. To investigate this problem further, the effect of TiO2 on the HaCaT human keratinocyte cell line was examined. The data show that although TiO2 does not affect cell cycle phase distribution, nor cell death, these nanoparticles have a considerable and rapid effect on mitochondrial function. Metabolic analysis was performed to identify 268 metabolites of the specific pathways involved and 85 biochemical metabolites were found to be significantly altered, many of which are known to be associated with the cellular stress response. Importantly, the uptake of nanoparticles into the cultured cells was restricted to phagosomes, TiO2 nanoparticles did not enter into the nucleus or any other cytoplasmic organelle. No other morphological changes were detected after 24-h exposure consistent with a specific role of mitochondria in this response.

  5. Bmi-1 extends the life span of normal human oral keratinocytes by inhibiting the TGF-{beta} signaling

    Energy Technology Data Exchange (ETDEWEB)

    Kim, Reuben H., E-mail: [UCLA School of Dentistry, Los Angeles, CA 90095 (United States); UCLA Dental Research Institute, Los Angeles, CA 90095 (United States); UCLA Jonsson Comprehensive Cancer Center, Los Angeles, CA 90095 (United States); Lieberman, Mark B.; Lee, Rachel [UCLA School of Dentistry, Los Angeles, CA 90095 (United States); Shin, Ki-Hyuk [UCLA School of Dentistry, Los Angeles, CA 90095 (United States); UCLA Dental Research Institute, Los Angeles, CA 90095 (United States); UCLA Jonsson Comprehensive Cancer Center, Los Angeles, CA 90095 (United States); Mehrazarin, Shebli; Oh, Ju-Eun [UCLA School of Dentistry, Los Angeles, CA 90095 (United States); Park, No-Hee [UCLA School of Dentistry, Los Angeles, CA 90095 (United States); UCLA Dental Research Institute, Los Angeles, CA 90095 (United States); UCLA Jonsson Comprehensive Cancer Center, Los Angeles, CA 90095 (United States); David Geffen School of Medicine at UCLA, Los Angeles, CA 90095 (United States); Kang, Mo K., E-mail: [UCLA School of Dentistry, Los Angeles, CA 90095 (United States); UCLA Dental Research Institute, Los Angeles, CA 90095 (United States); UCLA Jonsson Comprehensive Cancer Center, Los Angeles, CA 90095 (United States)


    We previously demonstrated that Bmi-1 extended the in vitro life span of normal human oral keratinocytes (NHOK). We now report that the prolonged life span of NHOK by Bmi-1 is, in part, due to inhibition of the TGF-{beta} signaling pathway. Serial subculture of NHOK resulted in replicative senescence and terminal differentiation and activation of TGF-{beta} signaling pathway. This was accompanied with enhanced intracellular and secreted TGF-{beta}1 levels, phosphorylation of Smad2/3, and increased expression of p15{sup INK4B} and p57{sup KIP2}. An ectopic expression of Bmi-1 in NHOK (HOK/Bmi-1) decreased the level of intracellular and secreted TGF-{beta}1 induced dephosphorylation of Smad2/3, and diminished the level of p15{sup INK4B} and p57{sup KIP2}. Moreover, Bmi-1 expression led to the inhibition of TGF-{beta}-responsive promoter activity in a dose-specific manner. Knockdown of Bmi-1 in rapidly proliferating HOK/Bmi-1 and cancer cells increased the level of phosphorylated Smad2/3, p15{sup INK4B}, and p57{sup KIP2}. In addition, an exposure of senescent NHOK to TGF-{beta} receptor I kinase inhibitor or anti-TGF-{beta} antibody resulted in enhanced replicative potential of cells. Taken together, these data suggest that Bmi-1 suppresses senescence of cells by inhibiting the TGF-{beta} signaling pathway in NHOK.

  6. In Vitro Growth of Human Keratinocytes and Oral Cancer Cells into Microtissues: An Aerosol-Based Microencapsulation Technique

    Directory of Open Access Journals (Sweden)

    Wai Yean Leong


    Full Text Available Cells encapsulation is a micro-technology widely applied in cell and tissue research, tissue transplantation, and regenerative medicine. In this paper, we proposed a growth of microtissue model for the human keratinocytes (HaCaT cell line and an oral squamous cell carcinoma (OSCC cell line (ORL-48 based on a simple aerosol microencapsulation technique. At an extrusion rate of 20 μL/min and air flow rate of 0.3 L/min programmed in the aerosol system, HaCaT and ORL-48 cells in alginate microcapsules were encapsulated in microcapsules with a diameter ranging from 200 to 300 μm. Both cell lines were successfully grown into microtissues in the microcapsules of alginate within 16 days of culture. The microtissues were characterized by using a live/dead cell viability assay, field emission-scanning electron microscopy (FE-SEM, fluorescence staining, and cell re-plating experiments. The microtissues of both cell types were viable after being extracted from the alginate membrane using alginate lyase. However, the microtissues of HaCaT and ORL-48 demonstrated differences in both nucleus size and morphology. The microtissues with re-associated cells in spheroids are potentially useful as a cell model for pharmacological studies.

  7. In Vitro Growth of Human Keratinocytes and Oral Cancer Cells into Microtissues: An Aerosol-Based Microencapsulation Technique. (United States)

    Leong, Wai Yean; Soon, Chin Fhong; Wong, Soon Chuan; Tee, Kian Sek; Cheong, Sok Ching; Gan, Siew Hua; Youseffi, Mansour


    Cells encapsulation is a micro-technology widely applied in cell and tissue research, tissue transplantation, and regenerative medicine. In this paper, we proposed a growth of microtissue model for the human keratinocytes (HaCaT) cell line and an oral squamous cell carcinoma (OSCC) cell line (ORL-48) based on a simple aerosol microencapsulation technique. At an extrusion rate of 20 μL/min and air flow rate of 0.3 L/min programmed in the aerosol system, HaCaT and ORL-48 cells in alginate microcapsules were encapsulated in microcapsules with a diameter ranging from 200 to 300 μm. Both cell lines were successfully grown into microtissues in the microcapsules of alginate within 16 days of culture. The microtissues were characterized by using a live/dead cell viability assay, field emission-scanning electron microscopy (FE-SEM), fluorescence staining, and cell re-plating experiments. The microtissues of both cell types were viable after being extracted from the alginate membrane using alginate lyase. However, the microtissues of HaCaT and ORL-48 demonstrated differences in both nucleus size and morphology. The microtissues with re-associated cells in spheroids are potentially useful as a cell model for pharmacological studies.

  8. Dissecting the calcium-induced differentiation of human primary keratinocytes stem cells by integrative and structural network analyses.

    Directory of Open Access Journals (Sweden)

    Kiana Toufighi


    Full Text Available The molecular details underlying the time-dependent assembly of protein complexes in cellular networks, such as those that occur during differentiation, are largely unexplored. Focusing on the calcium-induced differentiation of primary human keratinocytes as a model system for a major cellular reorganization process, we look at the expression of genes whose products are involved in manually-annotated protein complexes. Clustering analyses revealed only moderate co-expression of functionally related proteins during differentiation. However, when we looked at protein complexes, we found that the majority (55% are composed of non-dynamic and dynamic gene products ('di-chromatic', 19% are non-dynamic, and 26% only dynamic. Considering three-dimensional protein structures to predict steric interactions, we found that proteins encoded by dynamic genes frequently interact with a common non-dynamic protein in a mutually exclusive fashion. This suggests that during differentiation, complex assemblies may also change through variation in the abundance of proteins that compete for binding to common proteins as found in some cases for paralogous proteins. Considering the example of the TNF-α/NFκB signaling complex, we suggest that the same core complex can guide signals into diverse context-specific outputs by addition of time specific expressed subunits, while keeping other cellular functions constant. Thus, our analysis provides evidence that complex assembly with stable core components and competition could contribute to cell differentiation.

  9. Dissecting the Calcium-Induced Differentiation of Human Primary Keratinocytes Stem Cells by Integrative and Structural Network Analyses (United States)

    Toufighi, Kiana; Yang, Jae-Seong; Luis, Nuno Miguel; Aznar Benitah, Salvador; Lehner, Ben; Serrano, Luis; Kiel, Christina


    The molecular details underlying the time-dependent assembly of protein complexes in cellular networks, such as those that occur during differentiation, are largely unexplored. Focusing on the calcium-induced differentiation of primary human keratinocytes as a model system for a major cellular reorganization process, we look at the expression of genes whose products are involved in manually-annotated protein complexes. Clustering analyses revealed only moderate co-expression of functionally related proteins during differentiation. However, when we looked at protein complexes, we found that the majority (55%) are composed of non-dynamic and dynamic gene products (‘di-chromatic’), 19% are non-dynamic, and 26% only dynamic. Considering three-dimensional protein structures to predict steric interactions, we found that proteins encoded by dynamic genes frequently interact with a common non-dynamic protein in a mutually exclusive fashion. This suggests that during differentiation, complex assemblies may also change through variation in the abundance of proteins that compete for binding to common proteins as found in some cases for paralogous proteins. Considering the example of the TNF-α/NFκB signaling complex, we suggest that the same core complex can guide signals into diverse context-specific outputs by addition of time specific expressed subunits, while keeping other cellular functions constant. Thus, our analysis provides evidence that complex assembly with stable core components and competition could contribute to cell differentiation. PMID:25946651

  10. Loss of viability and induction of apoptosis in human keratinocytes exposed to Staphylococcus aureus biofilms in vitro. (United States)

    Kirker, Kelly R; Secor, Patrick R; James, Garth A; Fleckman, Philip; Olerud, John E; Stewart, Philip S


    Bacteria colonizing chronic wounds are believed to exist as polymicrobial, biofilm communities; however, there are few studies demonstrating the role of biofilms in chronic wound pathogenesis. This study establishes a novel method for studying the effect of biofilms on the cell types involved in wound healing. Cocultures of Staphylococcus aureus biofilms and human keratinocytes (HK) were created by initially growing S. aureus biofilms on tissue culture inserts then transferring the inserts to existing HK cultures. Biofilm-conditioned medium (BCM) was prepared by culturing the insert-supported biofilm in cell culture medium. As a control planktonic-conditioned medium (PCM) was also prepared. Biofilm, BCM, and PCM were used in migration, cell viability, and apoptosis assays. Changes in HK morphology were followed by brightfield and confocal microscopy. After only 3 hours exposure to BCM, but not PCM, HK formed dendrite-like extensions and displayed reduced viability. After 9 hours, there was an increase in apoptosis (pPCM-exposed HK all exhibited reduced scratch closure (p< or =0.0001). The results demonstrated that soluble products of both S. aureus planktonic cells and biofilms inhibit scratch closure. Furthermore, S. aureus biofilms significantly reduced HK viability and significantly increased HK apoptosis compared with planktonic S. aureus.

  11. Sonoporation delivery of monoclonal antibodies against human papillomavirus 16 E6 restores p53 expression in transformed cervical keratinocytes.

    Directory of Open Access Journals (Sweden)

    Melissa Togtema

    Full Text Available High-risk types of human papillomavirus (HPV, such as HPV16, have been found in nearly all cases of cervical cancer. Therapies targeted at blocking the HPV16 E6 protein and its deleterious effects on the tumour suppressor pathways of the cell can reverse the malignant phenotype of affected keratinocytes while sparing uninfected cells. Through a strong interdisciplinary collaboration between engineering and biology, a novel, non-invasive intracellular delivery method for the HPV16 E6 antibody, F127-6G6, was developed. The method employs high intensity focused ultrasound (HIFU in combination with microbubbles, in a process known as sonoporation. In this proof of principle study, it was first demonstrated that sonoporation antibody delivery into the HPV16 positive cervical carcinoma derived cell lines CaSki and SiHa was possible, using chemical transfection as a baseline for comparison. Delivery of the E6 antibody using sonoporation significantly restored p53 expression in these cells, indicating the antibody is able to enter the cells and remains active. This delivery method is targeted, non-cytotoxic, and non-invasive, making it more easily translatable for in vivo experiments than other transfection methods.

  12. UV irradiation-induced zinc dissociation from commercial zinc oxide sunscreen and its action in human epidermal keratinocytes. (United States)

    Martorano, Lisa M; Stork, Christian J; Li, Yang V


    Zinc oxide (ZnO) is an active ingredient in sunscreen owing to its properties of broadly filtering the ultraviolet (UV) light spectrum and it is used to protect against the carcinogenic and photodamaging effects of solar radiation on the skin. This study investigated the dissociation of zinc (Zn(2+) ) from ZnO in commercial sunscreens under ultraviolet type B light (UVB) irradiation and assessed the cytotoxicity of Zn(2+) accumulation in human epidermal keratinocytes (HEK). Using Zn(2+) fluorescent microscopy, we observed a significant increase in Zn(2+) when ZnO sunscreens were irradiated by UVB light. The amount of Zn(2+) increase was dependent on both the irradiation intensity as well as on the ZnO concentration. A reduction in cell viability as a function of ZnO concentration was observed with cytotoxic assays. In a real-time cytotoxicity assay using propidium iodide, the treatment of UVB-irradiated ZnO sunscreen caused a late- or delayed-type cytotoxicity in HEK. The addition of a Zn(2+) chelator provided a protective effect against cellular death in all assays. Furthermore, Zn(2+) was found to induce the production of reactive oxygen species (ROS) in HEK. Our data suggest that UVB irradiation produces an increase in Zn(2+) dissociation in ZnO sunscreen and, consequently, the accumulation of free or labile Zn(2+) from sunscreen causes cytotoxicity and oxidative stress. © 2010 Wiley Periodicals, Inc.

  13. Chitosan-shelled oxygen-loaded nanodroplets abrogate hypoxia dysregulation of human keratinocyte gelatinases and inhibitors: New insights for chronic wound healing

    Energy Technology Data Exchange (ETDEWEB)

    Khadjavi, Amina [Dipartimento di Neuroscienze, Università di Torino, Torino (Italy); Magnetto, Chiara [Istituto Nazionale di Ricerca Metrologica (INRIM), Torino (Italy); Panariti, Alice [Dipartimento di Scienze della Salute, Università di Milano Bicocca, Monza (Italy); Argenziano, Monica [Dipartimento di Scienza e Tecnologia del Farmaco, Università di Torino, Torino (Italy); Gulino, Giulia Rossana [Dipartimento di Oncologia, Università di Torino, Torino (Italy); Rivolta, Ilaria [Dipartimento di Scienze della Salute, Università di Milano Bicocca, Monza (Italy); Cavalli, Roberta [Dipartimento di Scienza e Tecnologia del Farmaco, Università di Torino, Torino (Italy); Giribaldi, Giuliana [Dipartimento di Oncologia, Università di Torino, Torino (Italy); Guiot, Caterina [Dipartimento di Neuroscienze, Università di Torino, Torino (Italy); Prato, Mauro, E-mail: [Dipartimento di Neuroscienze, Università di Torino, Torino (Italy); Dipartimento di Scienze della Sanità Pubblica e Pediatriche, Università di Torino, Torino (Italy)


    Background: : In chronic wounds, efficient epithelial tissue repair is hampered by hypoxia, and balances between the molecules involved in matrix turn-over such as matrix metalloproteinases (MMPs) and tissue inhibitors of metalloproteinases (TIMPs) are seriously impaired. Intriguingly, new oxygenating nanocarriers such as 2H,3H-decafluoropentane-based oxygen-loaded nanodroplets (OLNs) might effectively target chronic wounds. Objective: : To investigate hypoxia and chitosan-shelled OLN effects on MMP/TIMP production by human keratinocytes. Methods: : HaCaT cells were treated for 24 h with 10% v/v OLNs both in normoxia or hypoxia. Cytotoxicity and cell viability were measured through biochemical assays; cellular uptake by confocal microscopy; and MMP and TIMP production by enzyme-linked immunosorbent assay or gelatin zymography. Results: : Normoxic HaCaT cells constitutively released MMP-2, MMP-9, TIMP-1 and TIMP-2. Hypoxia strongly impaired MMP/TIMP balances by reducing MMP-2, MMP-9, and TIMP-2, without affecting TIMP-1 release. After cellular uptake by keratinocytes, nontoxic OLNs abrogated all hypoxia effects on MMP/TIMP secretion, restoring physiological balances. OLN abilities were specifically dependent on time-sustained oxygen diffusion from OLN core. Conclusion: : Chitosan-shelled OLNs effectively counteract hypoxia-dependent dysregulation of MMP/TIMP balances in human keratinocytes. Therefore, topical administration of exogenous oxygen, properly encapsulated in nanodroplet formulations, might be a promising adjuvant approach to promote healing processes in hypoxic wounds. - Highlights: • Hypoxia impairs MMP9/TIMP1 and MMP2/TIMP2 balances in HaCaT human keratinocytes. • Chitosan-shelled oxygen-loaded nanodroplets (OLNs) are internalised by HaCaT cells. • OLNs are not toxic to HaCaT cells. • OLNs effectively counteract hypoxia effects on MMP/TIMP balances in HaCaT cells. • OLNs appear as promising and cost-effective therapeutic tools for hypoxic

  14. B-cell maturation antigen (BCMA) activation exerts specific proinflammatory effects in normal human keratinocytes and is preferentially expressed in inflammatory skin pathologies. (United States)

    Alexaki, Vassilia-Ismini; Pelekanou, Vassiliki; Notas, George; Venihaki, Maria; Kampa, Marilena; Dessirier, Valérie; Sabour-Alaoui, Sanaa; Stathopoulos, Efstathios N; Tsapis, Andreas; Castanas, Elias


    TNFα is known to be expressed in human skin, regulating immune-related responses. Here we report that human normal skin keratinocytes express the members of the TNF superfamily members A proliferation-inducing ligand (APRIL; TNFSF13), B cell-activating factor (BAFF; TNFSF13B), and their receptors, B cell maturation antigen (BCMA; TNFRSF17) and transmembrane activator, calcium-modulator, and cyclophilin ligand interactor (TACI; TNFRSF13B), in a distinct spatial pattern. Our data show a differential expression of these molecules within epidermal layers and skin appendages, whereas the BAFF-specific receptor BAFFR (TNFRSF13C) is absent. Importantly, APRIL and BCMA but not BAFF or TACI are up-regulated in inflammatory skin lesions of psoriasis and squamous cell carcinomas. To explore the functional significance of this system in the skin, we assayed these receptors and ligands in cultured primary keratinocytes and HaCaT cells. We show that both cell types express BAFF, APRIL, BCMA, and TACI. Furthermore, APRIL and/or BAFF trigger nuclear factor-κB activation and IL-6 and granulocyte macrophage colony-stimulating factor (GM-CSF) expression through functional BCMA receptors, an activation inhibited by anti-BCMA short hairpin RNA. However, BAFF and/or APRIL do not induce IL-8 or TNFα production. Our data advance BCMA as an inflammation-related TNFSFR member in keratinocytes, of potential importance in the management of inflammatory skin conditions.

  15. Treponema pallidum flagellins stimulate MMP-9 and MMP-13 expression via TLR5 and MAPK/NF-κB signaling pathways in human epidermal keratinocytes. (United States)

    Jiang, Chuanhao; Xu, Man; Kuang, Xingxing; Xiao, Jinhong; Tan, Manyi; Xie, Yafeng; Xiao, Yongjian; Zhao, Feijun; Wu, Yimou


    Syphilis is a chronic disease caused by Treponema pallidum and the pathogenesis is still unclear. T. pallidum infection induced inflammatory responses are involved in the immunopathological damage in skin and other tissues. Flagellin, the monomeric subunit of bacterial flagella, is a classic pathogen associated molecular patterns (PAMPs) that interacts to TLR5 and induces inflammatory responses. Keratinocytes, as immune sentinels recognize the PAMPs via TLRs, play an important role in skin innate immune response. Matrix metalloproteinases (MMPs) expressed by keratinocytes are involved in skin inflammatory responses and promoting pathogens invasion. In this study, we demonstrate that FlaB1, FlaB2 and FlaB3, the flagellins of T. pallidum, induced MMP-9 and MMP-13 production in human immortalized keratinocytes cell line HaCaT. Silencing of TLR5, but not TLR2 and TLR4 attenuated MMP-9 and MMP-13 expressions induced by T. pallidum flagellins. MMP-9 and MMP-13 expressions were also be abrogated by transfection with a dominant negative (DN) plasmid of MyD88. We also found that treatment of HaCaT cells with FlaB1, FlaB2 and FlaB3 activate the MAPK and NF-κB signaling pathways. Inhibited of ERK, JNK, p38 and NF-κB suppressed MMP-9 expression induced by the FlaB1. MMP-13 expression was found to be suppressed by pretreatment with inhibitors of ERK, JNK and NF-κB, but not p38. These findings demonstrate that T. pallidum flagellins (FlaB1, FlaB2 or FlaB3) can stimulate MMP-9 and MMP-13 expression through TLR5 and MAPK/NF-κB signaling pathways in human epidermal keratinocytes, which could contribute to the pathogenesis of T. pallidum infection. Copyright © 2017. Published by Elsevier Inc.

  16. Effects of JWH015 in cytokine secretion in primary human keratinocytes and fibroblasts and its suitability for topical/transdermal delivery. (United States)

    Bort, Alicia; Alvarado-Vazquez, Perla A; Moracho-Vilrriales, Carolina; Virga, Kristopher G; Gumina, Giuseppe; Romero-Sandoval, Alfonso; Asbill, Scott


    Background JWH015 is a cannabinoid (CB) receptor type 2 agonist that produces immunomodulatory effects. Since skin cells play a key role in inflammatory conditions and tissue repair, we investigated the ability of JWH015 to promote an anti-inflammatory and pro-wound healing phenotype in human primary skin cells. Methods Human primary keratinocytes and fibroblasts were stimulated with lipopolysaccharide. The mRNA expression of cannabinoid receptors was determined using RT-PCR. The effects of JWH015 (0.05, 0.1, 0.5, and 1 µM) in pro- and anti-inflammatory factors were tested in lipopolysaccharide-stimulated cells. A scratch assay, using a co-culture of keratinocytes and fibroblasts, was used to test the effects of JWH015 in wound healing. In addition, the topical and transdermal penetration of JWH015 was studied in Franz diffusion cells using porcine skin and LC-MS. Results The expression of CB1 and CB2 receptors (mRNA) and the production of pro- and anti-inflammatory factors enhanced in keratinocytes and fibroblasts following lipopolysaccharide stimulation. JWH015 reduced the concentration of major pro-inflammatory factors (IL-6 and MCP-1) and increased the concentration of a major anti-inflammatory factor (TGF-β) in lipopolysaccharide-stimulated cells. JWH015 induced a faster scratch gap closure. These JWH015'seffects were mainly modulated through both CB1 and CB2 receptors. Topically administered JWH015 was mostly retained in the skin and displayed a sustained and low level of transdermal permeation. Conclusions Our findings suggest that targeting keratinocytes and fibroblasts with cannabinoid drugs could represent a therapeutic strategy to resolve peripheral inflammation and promote tissue repair.

  17. A comprehensive two-dimensional gel protein database of noncultured unfractionated normal human epidermal keratinocytes: towards an integrated approach to the study of cell proliferation, differentiation and skin diseases

    DEFF Research Database (Denmark)

    Celis, J E; Madsen, Peder; Rasmussen, H H


    A two-dimensional (2-D) gel database of cellular proteins from noncultured, unfractionated normal human epidermal keratinocytes has been established. A total of 2651 [35S]methionine-labeled cellular proteins (1868 isoelectric focusing, 783 nonequilibrium pH gradient electrophoresis) were resolved......, melanocytes, fibroblasts, dermal microvascular endothelial cells, peripheral blood mononuclear cells and sweat duct cells. The keratinocyte 2-D gel protein database will be updated yearly in the November issue of Electrophoresis. Udgivelsesdato: 1991-Nov...

  18. Genotoxicity of citrate-coated silver nanoparticles to human keratinocytes assessed by the comet assay and cytokinesis blocked micronucleus assay. (United States)

    Bastos, V; Duarte, I F; Santos, C; Oliveira, H


    Silver nanoparticles (AgNPs) are widely used in industrial, cosmetic, and biomedical products, and humans are frequently exposed to these products through the skin. It is widely recognized that the characteristics of AgNPs (e.g., size, coating) may influence their cytotoxic effects, but their correlation with DNA damage and mitotic disorders remains poorly explored. In this study, human keratinocytes (HaCaT cell line) were exposed to well-characterized 30 nm AgNPs coated with citrate, and their effects on viability, DNA fragmentation (assessed by the comet assay), and micronuclei (MNi) induction (assessed by the cytokinesis-block micronucleus cytome assays, CBMN) were investigated. The results showed that 10 and 40 μg/mL AgNPs decreased cell proliferation and viability, and induced a significant genetic damage. This was observed by an increase of DNA amount in comet tail, which linearly correlated with dose and time of exposure. Also, cytostaticity (increase of mononucleated cells) and MNi rates increased in treated cells. In contrast, no significant changes were observed in nucleoplasmatic bridges (NPBs) or nuclear buds (NBUDs), although NBUDs tended to increase in all conditions and periods. The cytostatic effects on HaCaT cells were also shown by the decrease of their nuclear division index. Thus, both comet and CBMN assays supported the observation that citrate-AgNPs induced genotoxic effects on HaCaT cells. Considering that AgNPs are present in a vast number of consumer products and also in multiple nanomedicine skin applications and formulations, more research is needed to determine the properties that confer less toxicity of AgNPs to different cell lines.

  19. HPV16 E7 protein and hTERT proteins defective for telomere maintenance cooperate to immortalize human keratinocytes.

    Directory of Open Access Journals (Sweden)

    Jonathan Miller

    Full Text Available Previous studies have shown that wild-type human telomerase reverse transcriptase (hTERT protein can functionally replace the human papillomavirus type 16 (HPV-16 E6 protein, which cooperates with the viral E7 protein in the immortalization of primary keratinocytes. In the current study, we made the surprising finding that catalytically inactive hTERT (hTERT-D868A, elongation-defective hTERT (hTERT-HA, and telomere recruitment-defective hTERT (hTERT N+T also cooperate with E7 in mediating bypass of the senescence blockade and effecting cell immortalization. This suggests that hTERT has activities independent of its telomere maintenance functions that mediate transit across this restriction point. Since hTERT has been shown to have a role in gene activation, we performed microarray studies and discovered that E6, hTERT and mutant hTERT proteins altered the expression of highly overlapping sets of cellular genes. Most important, the E6 and hTERT proteins induced mRNA and protein levels of Bmi1, the core subunit of the Polycomb Group (PcG complex 1. We show further that Bmi1 substitutes for E6 or hTERT in cell immortalization. Finally, tissue array studies demonstrated that expression of Bmi1 increased with the severity of cervical dysplasia, suggesting a potential role in the progression of cervical cancer. Together, these data demonstrate that hTERT has extra-telomeric activities that facilitate cell immortalization and that its induction of Bmi1 is one potential mechanism for mediating this activity.

  20. The IL-8 release from cultured human keratinocytes, mediated by antibodies to bullous pemphigoid autoantigen 180, is inhibited by dapsone (United States)

    Schmidt, E; Reimer, S; Kruse, N; Bröcker, E-B; Zillikens, D


    Bullous pemphigoid (BP) is a subepidermal blistering disease associated with autoantibodies to the hemidesmosomal 180 kD BP autoantigen (BP180). However, the binding of autoantibodies to BP180 alone is not sufficient for blister formation in this disease and the infiltration of neutrophils into the skin is required. Dapsone and nicotinamide inhibit neutrophil chemotaxis and are used effectively in treating BP. IL-8 is a known chemoattractant for neutrophils and has been implicated in the inflammatory process of both human and experimental murine BP. We have recently shown that antibodies to BP180 mediate a dose and time-dependent release of IL-6 and IL-8 from cultured normal human epidermal keratinocytes (NHEK). In the present study, we addressed the question whether dapsone or nicotinamide influence this cytokine release. We demonstrate that dapsone, but not nicotinamide, in its pharmacological range, inhibits the IL-8, but not the IL-6 release from NHEK, induced by anti-BP180 IgG, in a dose-dependent fashion as detected by ELISA. IL-8 mRNA levels, as determined by RT-PCR, were the same in cells treated with BP IgG alone compared to cells treated with BP IgG plus dapsone. This observation suggests that dapsone inhibits the BP IgG-induced IL-8 release from cultured NHEK by mechanisms at the post-transcriptional level. Our findings contribute to the understanding how dapsone leads to a reduced influx of neutrophils into BP lesions and, finally, to the cessation of blister formation in this disease. PMID:11359455

  1. Occludin is involved in adhesion, apoptosis, differentiation and Ca2+-homeostasis of human keratinocytes: implications for tumorigenesis.

    Directory of Open Access Journals (Sweden)

    Susanne Rachow

    Full Text Available Tight junction (TJ proteins are involved in a number of cellular functions, including paracellular barrier formation, cell polarization, differentiation, and proliferation. Altered expression of TJ proteins was reported in various epithelial tumors. Here, we used tissue samples of human cutaneous squamous cell carcinoma (SCC, its precursor tumors, as well as sun-exposed and non-sun-exposed skin as a model system to investigate TJ protein alteration at various stages of tumorigenesis. We identified that a broader localization of zonula occludens protein (ZO-1 and claudin-4 (Cldn-4 as well as downregulation of Cldn-1 in deeper epidermal layers is a frequent event in all the tumor entities as well as in sun-exposed skin, suggesting that these changes result from chronic UV irradiation. In contrast, SCC could be distinguished from the precursor tumors and sun-exposed skin by a frequent complete loss of occludin (Ocln. To elucidate the impact of down-regulation of Ocln, we performed Ocln siRNA experiments in human keratinocytes and uncovered that Ocln downregulation results in decreased epithelial cell-cell adhesion and reduced susceptibility to apoptosis induction by UVB or TNF-related apoptosis-inducing ligand (TRAIL, cellular characteristics for tumorigenesis. Furthermore, an influence on epidermal differentiation was observed, while there was no change of E-cadherin and vimentin, markers for epithelial-mesenchymal transition. Ocln knock-down altered Ca(2+-homeostasis which may contribute to alterations of cell-cell adhesion and differentiation. As downregulation of Ocln is also seen in SCC derived from other tissues, as well as in other carcinomas, we suggest this as a common principle in tumor pathogenesis, which may be used as a target for therapeutic intervention.

  2. Inflammatory responses of a human keratinocyte cell line to 10 nm citrate- and PEG-coated silver nanoparticles

    Energy Technology Data Exchange (ETDEWEB)

    Bastos, V. [University of Aveiro, CESAM & Laboratory of Biotechnology and Cytomics (Portugal); Brown, D.; Johnston, H. [Heriot-Watt University, School of Life Sciences (United Kingdom); Daniel-da-Silva, A. L.; Duarte, I. F. [University of Aveiro, Department of Chemistry, CICECO – Aveiro Institute of Materials (Portugal); Santos, C., E-mail:; Oliveira, H. [University of Aveiro, CESAM & Laboratory of Biotechnology and Cytomics (Portugal)


    Silver nanoparticles (AgNPs) are among the most commonly used engineered NPs and various commercially available products are designed to come in direct contact with the skin (wound dressings, textiles, creams, among others). Currently, there is limited understanding of the influence of coatings on the toxicity of AgNPs and in particular their ability to impact on AgNP’s mediated inflammatory responses. As AgNPs are often stabilized by different coatings, including citrate and polyethyleneglycol (PEG), in this study we investigate the influence of citrate (Cit10) or PEG (PEG10) coatings to 10 nm AgNP on skin, using human HaCaT keratinocytes. AgNPs cytotoxicity and inflammatory response (nuclear factor (NF)-κB induction and cytokine production) of HaCaT were assessed after in vitro exposure to 10 and 40 µg/mL after 4, 24, and 48 h. Results showed that although both types of coated AgNPs decreased cell proliferation and viability, Cit10 AgNPs were more toxic. NF-κB inhibition was observed for the highest concentration (40 µg/mL) of PEG10 AgNPs, and the putative link to early apoptotic pathways observed in these cells is discussed. No production of IL-1β, IL-6, IL-10, and TNFα was stimulated by AgNPs. Furthermore, Cit10 and PEG10 AgNPs decreased the release of MCP-1 by HaCaT cells after 48 h of exposure. As cytokines are vital for the immunologic regulation in the human body, and it is demonstrated that they may interfere with NPs, more research is needed to understand how different AgNPs affect the immune system.

  3. Inhibitors of cysteine cathepsin and calpain do not prevent ultraviolet-B-induced apoptosis in human keratinocytes and HeLa cells

    DEFF Research Database (Denmark)

    Bang, Bo; Baadsgaard, Ole; Skov, Lone


    been demonstrated to play a role in the execution of programmed cell death induced by other stimuli, e.g. TNF-alpha. The purpose of the present study was therefore to investigate whether inhibitors of cysteine cathepsins and calpains could prevent UVB-induced apoptosis in HeLa cells and keratinocytes....... This was done by investigating the effect of the irreversible cysteine protease inhibitor zFA-fmk, the cathepsin B inhibitor CA-074-Me and the calpain inhibitor ALLN on the viability of UVB-irradiated human keratinocytes and HeLa cells. At concentrations of 10 microM and above zVAD-fmk conferred partial dose......-dependent protection against UVB-induced apoptosis in HeLa cells and keratinocytes. Moreover, caspase-3 activity was completely blocked at zVAD-fmk concentrations of 1 microM in HeLa cells. This indicates that caspase-independent mechanisms could be involved in UVB-induced apoptosis. However, the protease inhibitors z...

  4. Large-scale analysis of protein expression changes in human keratinocytes immortalized by human papilloma virus type 16 E6 and E7 oncogenes

    Directory of Open Access Journals (Sweden)

    Arnouk Hilal


    Full Text Available Abstract Background Infection with high-risk type human papilloma viruses (HPVs is associated with cervical carcinomas and with a subset of head and neck squamous cell carcinomas. Viral E6 and E7 oncogenes cooperate to achieve cell immortalization by a mechanism that is not yet fully understood. Here, human keratinocytes were immortalized by long-term expression of HPV type 16 E6 or E7 oncoproteins, or both. Proteomic profiling was used to compare expression levels for 741 discrete protein features. Results Six replicate measurements were performed for each group using two-dimensional difference gel electrophoresis (2D-DIGE. The median within-group coefficient of variation was 19–21%. Significance of between-group differences was tested based on Significance Analysis of Microarray and fold change. Expression of 170 (23% of the protein features changed significantly in immortalized cells compared to primary keratinocytes. Most of these changes were qualitatively similar in cells immortalized by E6, E7, or E6/7 expression, indicating convergence on a common phenotype, but fifteen proteins (~2% were outliers in this regulatory pattern. Ten demonstrated opposite regulation in E6- and E7-expressing cells, including the cell cycle regulator p16INK4a; the carbohydrate binding protein Galectin-7; two differentially migrating forms of the intermediate filament protein Cytokeratin-7; HSPA1A (Hsp70-1; and five unidentified proteins. Five others had a pattern of expression that suggested cooperativity between the co-expressed oncoproteins. Two of these were identified as forms of the small heat shock protein HSPB1 (Hsp27. Conclusion This large-scale analysis provides a framework for understanding the cooperation between E6 and E7 oncoproteins in HPV-driven carcinogenesis.

  5. Oncogenic potential diverge among human papillomavirus type 16 natural variants

    Energy Technology Data Exchange (ETDEWEB)

    Sichero, Laura, E-mail: [Molecular Biology Laboratory, Center of Translational Oncology, Instituto do Cancer do Estado de Sao Paulo-ICESP, Sao Paulo 01246-000 (Brazil); Department of Virology, Ludwig Institute for Cancer Research, Sao Paulo 01323-903 (Brazil); Simao Sobrinho, Joao [Molecular Biology Laboratory, Center of Translational Oncology, Instituto do Cancer do Estado de Sao Paulo-ICESP, Sao Paulo 01246-000 (Brazil); Department of Virology, Ludwig Institute for Cancer Research, Sao Paulo 01323-903 (Brazil); Lina Villa, Luisa [Molecular Biology Laboratory, Center of Translational Oncology, Instituto do Cancer do Estado de Sao Paulo-ICESP, Sao Paulo 01246-000 (Brazil); Department of Virology, Ludwig Institute for Cancer Research, Sao Paulo 01323-903 (Brazil); Department of Radiology, School of Medicine, University of Sao Paulo (Brazil)


    We compared E6/E7 protein properties of three different HPV-16 variants: AA, E-P and E-350G. Primary human foreskin keratinocytes (PHFK) were transduced with HPV-16 E6 and E7 and evaluated for proliferation and ability to grow in soft agar. E-P infected keratinocytes presented the lowest efficiency in colony formation. AA and E-350G keratinocytes attained higher capacity for in vitro transformation. We observed similar degradation of TP53 among HPV-16 variants. Furthermore, we accessed the expression profile in early (p5) and late passage (p30) transduced cells of 84 genes commonly involved in carcinogenesis. Most differences could be attributed to HPV-16 E6/E7 expression. In particular, we detected different expression of ITGA2 and CHEK2 in keratinocytes infected with AA and AA/E-350G late passage cells, respectively, and higher expression of MAP2K1 in E-350G transduced keratinocytes. Our results indicate differences among HPV-16 variants that could explain, at least in part, differences in oncogenic potential attributed to these variants.

  6. Radioprotective effects of Bmi-1 involve epigenetic silencing of oxidase genes and enhanced DNA repair in normal human keratinocytes. (United States)

    Dong, Qinghua; Oh, Ju-Eun; Chen, Wei; Kim, Roy; Kim, Reuben H; Shin, Ki-Hyuk; McBride, William H; Park, No-Hee; Kang, Mo K


    Normal human keratinocytes (NHKs) undergo premature senescence following exposure to ionizing radiation (IR). This study investigates the effect of Bmi-1, a polycomb group protein, on radiation-induced senescence response. When exposed to IR, NHK transduced with Bmi-1 (NHK/Bmi-1) showed reduced senescent phenotype and enhanced proliferation compared with control cells (NHK/B0). To investigate the underlying mechanism, we determined the production of reactive oxygen species (ROS), expression of ROS-generating enzymes, and DNA repair activities in cells. ROS level was increased upon irradiation but notably reduced by Bmi-1 transduction. Irradiation led to strong induction of oxidase genes, e.g., Lpo (lactoperoxidase), p22-phox, p47-phox, and Gp91, in NHK/B0 but their expression was almost completely silenced in NHK/Bmi-1. Induction of oxidase genes upon irradiation was linked with loss of trimethylated histone 3 at lysine 27 (H3K27Me3), but NHK/Bmi-1 expressed a higher level of H3K27Me3 compared with NHK/B0. Bmi-1 transduction suppressed IR-associated induction of jumanji domain containing 3 while enhancing the expression of EZH2, thereby preventing the loss of H3K27Me3 in the irradiated cells. Furthermore, NHK/Bmi-1 demonstrated increased repair of IR-induced DNA damage compared with NHK/B0. These results indicate that Bmi-1 elicits radioprotective effects on NHK by mitigating the genotoxicity of IR through epigenetic mechanisms.

  7. Protective effect of C. sativa leaf extract against UV mediated-DNA damage in a human keratinocyte cell line. (United States)

    Almeida, I F; Pinto, A S; Monteiro, C; Monteiro, H; Belo, L; Fernandes, J; Bento, A R; Duarte, T L; Garrido, J; Bahia, M F; Sousa Lobo, J M; Costa, P C


    Toxic effects of ultraviolet (UV) radiation on skin include protein and lipid oxidation, and DNA damage. The latter is known to play a major role in photocarcinogenesis and photoaging. Many plant extracts and natural compounds are emerging as photoprotective agents. Castanea sativa leaf extract is able to scavenge several reactive species that have been associated to UV-induced oxidative stress. The aim of this work was to analyze the protective effect of C. sativa extract (ECS) at different concentrations (0.001, 0.01, 0.05 and 0.1 μg/mL) against the UV mediated-DNA damage in a human keratinocyte cell line (HaCaT). For this purpose, the cytokinesis-block micronucleus assay was used. Elucidation of the protective mechanism was undertaken regarding UV absorption, influence on (1)O₂ mediated effects or NRF2 activation. ECS presented a concentration-dependent protective effect against UV-mediated DNA damage in HaCaT cells. The maximum protection afforded (66.4%) was achieved with the concentration of 0.1 μg/mL. This effect was found to be related to a direct antioxidant effect (involving (1)O₂) rather than activation of the endogenous antioxidant response coordinated by NRF2. Electrochemical studies showed that the good antioxidant capacity of the ECS can be ascribed to the presence of a pool of different phenolic antioxidants. No genotoxic or phototoxic effects were observed after incubation of HaCaT cells with ECS (up to 0.1 μg/mL). Taken together these results reinforce the putative application of this plant extract in the prevention/minimization of UV deleterious effects on skin. Copyright © 2015 Elsevier B.V. All rights reserved.

  8. Association of a genetic polymorphism (-44 C/G SNP in the human DEFB1 gene with expression and inducibility of multiple β-defensins in gingival keratinocytes

    Directory of Open Access Journals (Sweden)

    Dommisch Henrik


    Full Text Available Abstract Background Human β-defensins (hBDs are antimicrobial peptides with a role in innate immune defense. Our laboratory previously showed that a single nucleotide polymorphism (SNP in the 5' untranslated region of the hBD1 gene (DEFB1, denoted -44 (rs1800972, is correlated with protection from oral Candida. Because this SNP alters the putative mRNA structure, we hypothesized that it alters hBD1 expression. Methods Transfection of reporter constructs and evaluation of antimicrobial activity and mRNA expression levels in keratinocytes from multiple donors were used to evaluate the effect of this SNP on constitutive and induced levels of expression. Results Transfection of CAT reporter constructs containing the 5' untranslated region showed that the -44 G allele yielded a 2-fold increase in CAT protein compared to other common haplotypes suggesting a cis effect on transcription or translation. The constitutive hBD1 mRNA level in human oral keratinocytes was significantly greater in cells from donors with the -44 GG genotype compared to those with the common CC genotype. Surprisingly, the hBD3 mRNA level as well as antimicrobial activity of keratinocyte extracts also correlated with the -44 G allele. Induced levels of hBD1, hBD2, and hBD3 mRNA were evaluated in keratinocytes challenged with Toll-like receptor 2 and 4 ligands, interleukin-1β, TNFα, and interferon-γ (IFNγ. In contrast to constitutive expression levels, IFNγ-induced keratinocyte hBD1 and hBD3 mRNA expression was significantly greater in cells with the common CC genotype, but there was no clear correlation of genotype with hBD2 expression. Conclusion The DEFB1 -44 G allele is associated with an increase in overall constitutive antimicrobial activity and expression of hBD1 and hBD3 in a manner that is consistent with protection from candidiasis, while the more common C allele is associated with IFNγ inducibility of these β-defensins and is likely to be more protective in

  9. Synthesis of complement components C3 and factor B in human keratinocytes is differentially regulated by cytokines

    NARCIS (Netherlands)

    Pasch, M. C.; van den Bosch, N. H.; Daha, M. R.; Bos, J. D.; Asghar, S. S.


    The complement system plays an important part in host defense and inflammation. Locally synthesized complement may perform these functions at tissue and organ level. In skin the keratinocyte is the major cell type, it is known to produce two soluble complement components, C3 and factor B. In this

  10. Keratinocyte-targeted expression of human laminin γ2 rescues skin blistering and early lethality of laminin γ2 deficient mice.

    Directory of Open Access Journals (Sweden)

    Tracy L Adair-Kirk

    Full Text Available Laminin-332 is a heterotrimeric basement membrane component comprised of the α3, ß3, and γ2 laminin chains. Laminin-332 modulates epithelial cell processes, such as adhesion, migration, and differentiation and is prominent in many embryonic and adult tissues. In skin, laminin-332 is secreted by keratinocytes and is a key component of hemidesmosomes connecting the keratinocytes to the underlying dermis. In mice, lack of expression of any of the three Laminin-332 chains result in impaired anchorage and detachment of the epidermis, similar to that seen in human junctional epidermolysis bullosa, and death occurs within a few days after birth. To bypass the early lethality of laminin-332 deficiency caused by the knockout of the mouse laminin γ2 chain, we expressed a dox-controllable human laminin γ2 transgene under a keratinocyte-specific promoter on the laminin γ2 (Lamc2 knockout background. These mice appear similar to their wild-type littermates, do not develop skin blisters, are fertile, and survive >1.5 years. Immunofluorescence analyses of the skin showed that human laminin γ2 colocalized with mouse laminin α3 and ß3 in the basement membrane zone underlying the epidermis. Furthermore, the presence of "humanized" laminin-332 in the epidermal basement membrane zone rescued the alterations in the deposition of hemidesmosomal components, such as plectin, collagen type XVII/BP180, and integrin α6 and ß4 chains, seen in conventional Lamc2 knockout mice, leading to restored formation of hemidesmosomes. These mice will be a valuable tool for studies of organs deficient in laminin-332 and the role of laminin-332 in skin, including wound healing.

  11. In vivo production of novel vitamin D2 hydroxy-derivatives by human placentas, epidermal keratinocytes, Caco-2 colon cells and the adrenal gland (United States)

    Slominski, Andrzej T.; Kim, Tae-Kang; Shehabi, Haleem Z.; Tang, Edith; Benson, Heather A. E.; Semak, Igor; Lin, Zongtao; Yates, Charles R.; Wang, Jin; Li, Wei; Tuckey, Robert C.


    We investigated the metabolism of vitamin D2 to hydroxyvitamin D2 metabolites ((OH)D2) by human placentas ex-utero, adrenal glands ex-vivo and cultured human epidermal keratinocytes and colonic Caco-2 cells, and identified 20(OH)D2, 17,20(OH)2D2, 1,20(OH)2D2, 25(OH)D2 and 1,25(OH)2D2 as products. Inhibition of product formation by 22R-hydroxycholesterol indicated involvement of CYP11A1 in 20- and 17-hydroxylation of vitamin D2, while use of ketoconazole indicated involvement of CYP27B1 in 1α-hydroxylation of products. Studies with purified human CYP11A1 confirmed the ability of this enzyme to convert vitamin D2 to 20(OH)D2 and 17,20(OH)2D2. In placentas and Caco-2 cells, production of 20(OH)D2 was higher than 25(OH)D2 while in human keratinocytes the production of 20(OH)D2 and 25(OH)D2 were comparable. HaCaT keratinocytes showed high accumulation of 1,20(OH)2D2 relative to 20(OH)D2 indicating substantial CYP27B1 activity. This is the first in vivo evidence for a novel pathway of vitamin D2 metabolism initiated by CYP11A1 and modified by CYP27B1, with the product profile showing tissue- and cell-type specificity. PMID:24382416

  12. A foreign body within the foreskin of a 10-year-old boy

    African Journals Online (AJOL)

    inserted in the foreskin of a child. A 10-year-old boy presented with a swollen red penis and a foreign body that he had inserted in the foreskin 3 h earlier. He had made several unsuccessful attempts to remove it. The foreign body was removed under general anesthesia. The variety of objects and place of insertion of foreign.

  13. Steatocystoma simplex in penile foreskin: a case report. (United States)

    de Lima, Mário Maciel; de Lima, Mário Maciel; Granja, Fabiana


    Steatocystoma simplex is an uncommon skin lesion with a histological pattern that is identical to that of steatocystoma multiplex. We are reporting this case of steatocystoma simplex for its uncommon location in the penile foreskin, and its occurrence in a Wapishana man. A 56-year-old man of Wapishana ethnicity presented with complaints of referred penile discomfort and pain during sexual intercourse for 5 years. A physical examination revealed a mobile, compressible subcutaneous non-tender mass of 4 cm diameter located on the left-side of his penile foreskin. There were no signs of inflammation, no grip on the penile shaft, and no urethral discharge or enlargement of lymph nodes. We found no evidence of other cysts on cutaneous examination. We performed classical excision of the lesion under local anesthesia and confirmed the diagnosis of steatocystoma with the pathological report. As there were no complications, we discharged him the same day. Steatocystoma can be considered a differential diagnosis for cystic lesions on and around the penis.

  14. Oxidative stress induced by palytoxin in human keratinocytes is mediated by a H{sup +}-dependent mitochondrial pathway

    Energy Technology Data Exchange (ETDEWEB)

    Pelin, Marco, E-mail: [Department of Life Science, University of Trieste, Via L. Giorgieri 7/9, 34127 Trieste (Italy); Ponti, Cristina, E-mail: [Department of Life Science, University of Trieste, Via L. Giorgieri 7/9, 34127 Trieste (Italy); Sosa, Silvio, E-mail: [Department of Life Science, University of Trieste, Via L. Giorgieri 7/9, 34127 Trieste (Italy); Gibellini, Davide, E-mail: [Department of Haematology and Oncological Sciences, University of Bologna, Via Massarenti 9, 40138 Bologna (Italy); Florio, Chiara, E-mail: [Department of Life Science, University of Trieste, Via L. Giorgieri 7/9, 34127 Trieste (Italy); Tubaro, Aurelia, E-mail: [Department of Life Science, University of Trieste, Via L. Giorgieri 7/9, 34127 Trieste (Italy)


    In the last decades, massive blooms of palytoxin (PLTX)-producing Ostreopsis cf. ovata have been observed along Mediterranean coasts, usually associated to human respiratory and cutaneous problems. At the molecular level, PLTX induces a massive intracellular Na{sup +} influx due to the transformation of Na{sup +}/K{sup +} ATPase in a cationic channel. Recently, we have demonstrated that Na{sup +} overload is the crucial step in mediating overproduction of reactive oxygen species (ROS) and cell death in human HaCaT keratinocytes, tentatively explaining PLTX-induced skin irritant effects. In the present study the molecular mechanisms of ROS production induced by PLTX-mediated Na{sup +} intracellular overload have been investigated. In HaCaT cells, PLTX exposure caused accumulation of superoxide anion, but not of nitric oxide or peroxynitrite/hydroxyl radicals. Even if RT-PCR and western blot analysis revealed an early NOX-2 and iNOS gene and protein over-expressions, their active involvement seemed to be only partial since selective inhibitors did not completely reduce O{sub 2}{sup −} production. A significant role of other enzymes (COX-1, COX-2, XO) was not evidenced. Nigericin, that counteracts Na{sup +}-mediated H{sup +}-imbalance, dissipating ΔpH across mitochondrial inner membrane, and the uncouplers DNP significantly reduced O{sub 2}{sup −} production. These inhibitions were synergistic when co-exposed with complex-I inhibitor rotenone. These results suggest a novel mechanism of O{sub 2}{sup −} production induced by PLTX-mediated ionic imbalance. Indeed, the H{sup +} intracellular overload that follows PLTX-induced intracellular Na{sup +} accumulation, could enhance ΔpH across mitochondrial inner membrane, that seems to be the driving force for O{sub 2}{sup −} production by reversing mitochondrial electron transport. Highlights: ► PLTX induces superoxide (O{sub 2}{sup −}) production by reversing mitochondrial transport chain. ► The mechanism of

  15. Ultraviolet B, melanin and mitochondrial DNA: Photo-damage in human epidermal keratinocytes and melanocytes modulated by alpha-melanocyte-stimulating hormone [version 1; referees: 2 approved

    Directory of Open Access Journals (Sweden)

    Markus Böhm


    Full Text Available Alpha-melanocyte-stimulating hormone (alpha-MSH increases melanogenesis and protects from UV-induced DNA damage. However, its effect on mitochondrial DNA (mtDNA damage is unknown. We have addressed this issue in a pilot study using human epidermal keratinocytes and melanocytes incubated with alpha-MSH and irradiated with UVB. Real-time touchdown PCR was used to quantify total and deleted mtDNA. The deletion detected encompassed the common deletion but was more sensitive to detection. There were 4.4 times more mtDNA copies in keratinocytes than in melanocytes. Irradiation alone did not affect copy numbers. Alpha-MSH slightly increased copy numbers in both cell types in the absence of UVB and caused a similar small decrease in copy number with dose in both cell types. Deleted copies were nearly twice as frequent in keratinocytes as in melanocytes. Alpha-MSH reduced the frequency of deleted copies by half in keratinocytes but not in melanocytes. UVB dose dependently led to an increase in the deleted copy number in alpha-MSH-treated melanocytes. UVB irradiation had little effect on deleted copy number in alpha-MSH-treated keratinocytes. In summary, alpha-MSH enhances mtDNA damage in melanocytes presumably by increased melanogenesis, while α-MSH is protective in keratinocytes, the more so in the absence of irradiation.

  16. Cigarette Smoke Affects ABCAl Expression via Liver X Receptor Nuclear Translocation in Human Keratinocytes

    Directory of Open Access Journals (Sweden)

    Claudia Sticozzi


    Full Text Available Cutaneous tissue is the first barrier against outdoor insults. The outer most layer of the skin, the stratum corneum (SC, is formed by corneocytes embedded in a lipid matrix (cholesterol, ceramide and fatty acids. Therefore, the regulation of lipids and, in particular, of cholesterol homeostasis in the skin is of great importance. ABCA1 is a membrane transporter responsible for cholesterol efflux and plays a key role in maintaining cellular cholesterol levels. Among the many factors that have been associated with skin diseases, the environmental stressor cigarette smoke has been recently studied. In the present study, we demonstrate that ABCA1 expression in human cells (HaCaT was increased (both mRNA and protein levels after CS exposure. This effect was mediated by the inhibition of NFkB (aldehydes adducts formation that allows the translocation of liver X receptor (LXR. These findings suggest that passive smoking may play a role in skin cholesterol levels and thus affect cutaneous tissues functions.

  17. Exposure to heat-inactivated Trichophyton rubrum resulting in a limited immune response of human keratinocytes. (United States)

    Huang, Xiao-Qiang; Yi, Jin-Ling; Yin, Song-Chao; Chen, Rong-Zhang; Li, Mei-Rong; Gong, Zi-Jian; Lai, Wei; Chen, Jian


    Trichophyton rubrum (T. rubrum) represents the most important agent of dermatophytosis in humans. T. rubrum infection causes slight inflammation, and tends to be chronic and recurrent. It is suggested that it may result from the failure of epithelial cells to recognize T. rubrum effectively and initiate effective immune responses. The C-type lectin receptors (CLR) and toll-like receptors (TLR) are the two major pattern recognition receptors (PRRs) that recognize fungal components. Therefore, the purpose of the study was to analyze the expression of those PRRs and the cytokines in HaCaT cells stimulated with heat-inactivated T. rubrum conidia and hyphae, respectively. HaCaT cells were unstimulated or stimulated with heat-inactivated T. rubrum conidia and hyphae (1×10(6) and 1.5×10(5) colony-forming unit (CFU) in 2 ml medium, respectively) for 6, 12 and 24 hours. The mRNA expression of PRRs involved in recognizing fungal pathogen-associated molecular patterns (PAMPs) and signaling molecules were measured by quantitative reverse transcription polymerase chain reaction (RT-PCR). Meanwhile, surface toll-like receptor (TLR) 2, TLR4 and Dectin-1 were analyzed by fluorescence-activated cell sorter (FACS) 24 hours after treatment. The cytokines were detected in cell culture supernatants of HaCaT cells in 12 and 24 hours after treatment. HaCaT cells constitutively expressed mRNA of membrane-bound TLR1, 2, 4 and 6, Dectin1 and DC-SIGN, but not Dectin-2 or Mincle. Heat-killed T. rubrum did not significantly upregulate gene transcriptions of the PRRs of HaCaT cells. Heat-inactivated T. rubrum conidia significantly reduced the surface expression of TLR2 and Dectin-1, and suppressed the secretions of interferon-inducible protein-10 (IP-10) and monocyte chemotactic protein-1 (MCP-1) of HaCaT cells, while heat-killed T. rubrum hyphae significantly induced the secretions of IP-10 and MCP-1. The cell-wall antigens of T. rubrum fail to activate transcriptional expression of PRRs and

  18. Protection against 2-chloroethyl ethyl sulfide (CEES)-induced cytotoxicity in human keratinocytes by an inducer of the glutathione detoxification pathway. (United States)

    Abel, Erika L; Bubel, Jennifer D; Simper, Melissa S; Powell, Leslie; McClellan, S Alex; Andreeff, Michael; MacLeod, Michael C; DiGiovanni, John


    Sulfur mustard (SM or mustard gas) was first used as a chemical warfare agent almost 100years ago. Due to its toxic effects on the eyes, lungs, and skin, and the relative ease with which it may be synthesized, mustard gas remains a potential chemical threat to the present day. SM exposed skin develops fluid filled bullae resulting from potent cytotoxicity of cells lining the basement membrane of the epidermis. Currently, there are no antidotes for SM exposure; therefore, chemopreventive measures for first responders following an SM attack are needed. Glutathione (GSH) is known to have a protective effect against SM toxicity, and detoxification of SM is believed to occur, in part, via GSH conjugation. Therefore, we screened 6 potential chemopreventive agents for ability to induce GSH synthesis and protect cultured human keratinocytes against the SM analog, 2-chloroethyl ethyl sulfide (CEES). Using NCTC2544 human keratinocytes, we found that both sulforaphane and methyl-2-cyano-3,12-dioxooleana-1,9-dien-28-oate (CDDO-Me) stimulated nuclear localization of Nrf2 and induced expression of the GSH synthesis gene, GCLM. Additionally, we found that treatment with CDDO-Me elevated reduced GSH content of NCTC2544 cells and preserved their viability by ~3-fold following exposure to CEES. Our data also suggested that CDDO-Me may act additively with 2,6-dithiopurine (DTP), a nucleophilic scavenging agent, to increase the viability of keratinocytes exposed to CEES. These results suggest that CDDO-Me is a promising chemopreventive agent for SM toxicity in the skin. Copyright © 2011. Published by Elsevier Inc.

  19. Effects of UVB-induced oxidative stress on protein expression and specific protein oxidation in normal human epithelial keratinocytes: a proteomic approach

    Directory of Open Access Journals (Sweden)

    De Marco Federico


    Full Text Available Abstract Background The UVB component of solar ultraviolet irradiation is one of the major risk factors for the development of skin cancer in humans. UVB exposure elicits an increased generation of reactive oxygen species (ROS, which are responsible for oxidative damage to proteins, DNA, RNA and lipids. In order to examine the biological impact of UVB irradiation on skin cells, we used a parallel proteomics approach to analyze the protein expression profile and to identify oxidatively modified proteins in normal human epithelial keratinocytes. Results The expression levels of fifteen proteins - involved in maintaining the cytoskeleton integrity, removal of damaged proteins and heat shock response - were differentially regulated in UVB-exposed cells, indicating that an appropriate response is developed in order to counteract/neutralize the toxic effects of UVB-raised ROS. On the other side, the redox proteomics approach revealed that seven proteins - involved in cellular adhesion, cell-cell interaction and protein folding - were selectively oxidized. Conclusions Despite a wide and well orchestrated cellular response, a relevant oxidation of specific proteins concomitantly occurs in UVB-irradiated human epithelial Keratinocytes. These modified (i.e. likely dysfunctional proteins might result in cell homeostasis impairment and therefore eventually promote cellular degeneration, senescence or carcinogenesis.

  20. A distal region of the human TGM1 promoter is required for expression in transgenic mice and cultured keratinocytes

    Directory of Open Access Journals (Sweden)

    Lu Ying


    Full Text Available Abstract Background TGM1(transglutaminase 1 is an enzyme that crosslinks the cornified envelope of mature keratinocytes. Appropriate expression of the TGM1 gene is crucial for proper keratinocyte function as inactivating mutations lead to the debilitating skin disease, lamellar ichthyosis. TGM1 is also expressed in squamous metaplasia, a consequence in some epithelia of vitamin A deficiency or toxic insult that can lead to neoplasia. An understanding of the regulation of this gene in normal and abnormal differentiation states may contribute to better disease diagnosis and treatment. Methods In vivo requirements for expression of the TGM1 gene were studied by fusing various lengths of promoter DNA to a reporter and injecting the DNA into mouse embryos to generate transgenic animals. Expression of the reporter was ascertained by Western blotting and immunohistochemistry. Further delineation of a transcriptionally important distal region was determined by transfections of progressively shortened or mutated promoter DNA into cultured keratinocytes. Results In vivo analysis of a reporter transgene driven by the TGM1 promoter revealed that 1.6 kilobases, but not 1.1 kilobases, of DNA was sufficient to confer tissue-specific and cell layer-specific expression. This same region was responsible for reporter expression in tissues undergoing squamous metaplasia as a response to vitamin A deprivation. Mutation of a distal promoter AP1 site or proximal promoter CRE site, both identified as important transcriptional elements in transfection assays, did not prevent appropriate expression. Further searching for transcriptional elements using electrophoretic mobility shift (EMSA and transfection assays in cultured keratinocytes identified two Sp1 elements in a transcriptionally active region between -1.6 and -1.4 kilobases. While mutation of either Sp1 site or the AP1 site singly had only a small effect, mutation of all three sites eliminated nearly all the

  1. An Ethanol Extract Derived from Bonnemaisonia hamifera Scavenges Ultraviolet B (UVB Radiation-Induced Reactive Oxygen Species and Attenuates UVB-Induced Cell Damage in Human Keratinocytes

    Directory of Open Access Journals (Sweden)

    Nam Ho Lee


    Full Text Available The present study investigated the photoprotective properties of an ethanol extract derived from the red alga Bonnemaisonia hamifera against ultraviolet B (UVB-induced cell damage in human HaCaT keratinocytes. The Bonnemaisonia hamifera ethanol extract (BHE scavenged the superoxide anion generated by the xanthine/xanthine oxidase system and the hydroxyl radical generated by the Fenton reaction (FeSO4 + H2O2, both of which were detected by using electron spin resonance spectrometry. In addition, BHE exhibited scavenging activity against the 1,1-diphenyl-2-picrylhydrazyl radical and intracellular reactive oxygen species (ROS that were induced by either hydrogen peroxide or UVB radiation. BHE reduced UVB-induced apoptosis, as shown by decreased apoptotic body formation and DNA fragmentation. BHE also attenuated DNA damage and the elevated levels of 8-isoprostane and protein carbonyls resulting from UVB-mediated oxidative stress. Furthermore, BHE absorbed electromagnetic radiation in the UVB range (280–320 nm. These results suggest that BHE protects human HaCaT keratinocytes against UVB-induced oxidative damage by scavenging ROS and absorbing UVB photons, thereby reducing injury to cellular components.

  2. Arsenic Induces p62 Expression to Form a Positive Feedback Loop with Nrf2 in Human Epidermal Keratinocytes: Implications for Preventing Arsenic-Induced Skin Cancer. (United States)

    Shah, Palak; Trinh, Elaine; Qiang, Lei; Xie, Lishi; Hu, Wen-Yang; Prins, Gail S; Pi, Jingbo; He, Yu-Ying


    Exposure to inorganic arsenic in contaminated drinking water poses an environmental public health threat for hundreds of millions of people in the US and around the world. Arsenic is a known carcinogen for skin cancer. However, the mechanism by which arsenic induces skin cancer remains poorly understood. Here, we have shown that arsenic induces p62 expression in an autophagy-independent manner in human HaCaT keratinocytes. In mouse skin, chronic arsenic exposure through drinking water increases p62 protein levels in the epidermis. Nrf2 is required for basal and arsenic-induced p62 up-regulation. p62 knockdown reduces arsenic-induced Nrf2 activity, and induces sustained p21 up-regulation. p62 induction is associated with increased proliferation in mouse epidermis. p62 knockdown had little effect on arsenic-induced apoptosis, while it decreased cell proliferation following arsenic treatment. Our findings indicate that arsenic induces p62 expression to regulate the Nrf2 pathway in human keratinocytes and suggest that targeting p62 may help prevent arsenic-induced skin cancer.

  3. Nicotinamide enhances repair of arsenic and ultraviolet radiation-induced DNA damage in HaCaT keratinocytes and ex vivo human skin.

    Directory of Open Access Journals (Sweden)

    Benjamin C Thompson

    Full Text Available Arsenic-induced skin cancer is a significant global health burden. In areas with arsenic contamination of water sources, such as China, Pakistan, Myanmar, Cambodia and especially Bangladesh and West Bengal, large populations are at risk of arsenic-induced skin cancer. Arsenic acts as a co-carcinogen with ultraviolet (UV radiation and affects DNA damage and repair. Nicotinamide (vitamin B3 reduces premalignant keratoses in sun-damaged skin, likely by prevention of UV-induced cellular energy depletion and enhancement of DNA repair. We investigated whether nicotinamide modifies DNA repair following exposure to UV radiation and sodium arsenite. HaCaT keratinocytes and ex vivo human skin were exposed to 2μM sodium arsenite and low dose (2J/cm2 solar-simulated UV, with and without nicotinamide supplementation. DNA photolesions in the form of 8-oxo-7,8-dihydro-2'-deoxyguanosine and cyclobutane pyrimidine dimers were detected by immunofluorescence. Arsenic exposure significantly increased levels of 8-oxo-7,8-dihydro-2'-deoxyguanosine in irradiated cells. Nicotinamide reduced both types of photolesions in HaCaT keratinocytes and in ex vivo human skin, likely by enhancing DNA repair. These results demonstrate a reduction of two different photolesions over time in two different models in UV and arsenic exposed cells. Nicotinamide is a nontoxic, inexpensive agent with potential for chemoprevention of arsenic induced skin cancer.

  4. Nicotinamide enhances repair of arsenic and ultraviolet radiation-induced DNA damage in HaCaT keratinocytes and ex vivo human skin. (United States)

    Thompson, Benjamin C; Halliday, Gary M; Damian, Diona L


    Arsenic-induced skin cancer is a significant global health burden. In areas with arsenic contamination of water sources, such as China, Pakistan, Myanmar, Cambodia and especially Bangladesh and West Bengal, large populations are at risk of arsenic-induced skin cancer. Arsenic acts as a co-carcinogen with ultraviolet (UV) radiation and affects DNA damage and repair. Nicotinamide (vitamin B3) reduces premalignant keratoses in sun-damaged skin, likely by prevention of UV-induced cellular energy depletion and enhancement of DNA repair. We investigated whether nicotinamide modifies DNA repair following exposure to UV radiation and sodium arsenite. HaCaT keratinocytes and ex vivo human skin were exposed to 2μM sodium arsenite and low dose (2J/cm2) solar-simulated UV, with and without nicotinamide supplementation. DNA photolesions in the form of 8-oxo-7,8-dihydro-2'-deoxyguanosine and cyclobutane pyrimidine dimers were detected by immunofluorescence. Arsenic exposure significantly increased levels of 8-oxo-7,8-dihydro-2'-deoxyguanosine in irradiated cells. Nicotinamide reduced both types of photolesions in HaCaT keratinocytes and in ex vivo human skin, likely by enhancing DNA repair. These results demonstrate a reduction of two different photolesions over time in two different models in UV and arsenic exposed cells. Nicotinamide is a nontoxic, inexpensive agent with potential for chemoprevention of arsenic induced skin cancer.

  5. [The immune response of human keratinocytes to Trichophyton rubrum conidia is partially mediated by toll-like receptor-2, 4, dectin-1 and cytokines]. (United States)

    Li, Ying; Chen, Jian; Wan, Miao-Jian; Lai, Wei; Zheng, Yue; Li, Mei-Rong; Chen, Rong-Zhang; Li, Xiao-Xin


    To investigate the effects of Trichophyton rubrum exposure on the expressions of toll-like receptor-2 (TLR-2), TLR-4 and dendritic cell associated C-type lectin-1 (Dectin-1) and cytokine secretions in human keratinocytes cell line HaCaT. The mRNA of TLR-2,4, and dectin-1 in the HaCaT co-cultured with the conidia of Trichophyton rubrum conidia for 24 h was measured with real-time PCR. The mean fluorescence intensity and the percentage of cells positive for TLR-2, 4, and dectin-1 was detected during the co-culture using flow cytometry. The cytokine secretion profiles in the cell culture supernatant was analyzed using a cytokine antibody array. The TLR-2,4, and dectin-1 mRNA expressions, mean fluorescence intensity and percentage of positive cells for TLR-2,4, and dectin-1 all increased in HaCaT cells in response to Trichophyton rubrum conidia exposure. The results of cytokine antibody array demonstrated obviously increased secretions of IL-8, I-309, IFN-γ, IL-6, and IL-13 in the culture supernatant of HaCaT cells in response to Trichophyton rubrum exposure. The immune responses and immunological recognition of human keratinocytes to Trichophyton rubrum conidia are partially mediated by up-regulating the expressions of TLR-2, TLR-4 and dectin-1 and secretions of multiple cytokines.

  6. Transfection of pseudouridine-modified mRNA encoding CPD-photolyase leads to repair of DNA damage in human keratinocytes: a new approach with future therapeutic potential (United States)

    Boros, Gábor; Miko, Edit; Muramatsu, Hiromi; Weissman, Drew; Emri, Eszter; Rózsa, Dávid; Nagy, Georgina; Juhász, Attila; Juhász, István; van der Horst, Gijsbertus; Horkay, Irén; Remenyik, Éva; Karikó, Katalin; Emri, Gabriella


    UVB irradiation induces harmful photochemical reactions, including formation of cyclobutane pyrimidine dimers (CPDs) in DNA. Accumulation of unrepaired CPD lesions causes inflammation, premature ageing and skin cancer. Photolyases are DNA repair enzymes that can rapidly restore DNA integrity in a light-dependent process called photoreactivation, but these enzymes are absent in humans. Here, we present a novel mRNA-based gene therapy method that directs synthesis of a marsupial, Potorous tridactylus, CPD-photolyase in cultured human keratinocytes. Pseudouridine was incorporated during in vitro transcription to make the mRNA non-immunogenic and highly translatable. Keratinocytes transfected with lipofectamine-complexed mRNA expressed photolyase in the nuclei for at least 2 days. Exposing photolyase mRNA-transfected cells to UVB irradiation resulted in significantly less CPD in those cells that were also treated with photoreactivating light, which is required for photolyase activity. The functional photolyase also diminished other UVB-mediated effects, including induction of IL-6 and inhibition of cell proliferation. These results demonstrate that pseudouridine-containing photolyase mRNA is a powerful tool to repair UVB-induced DNA lesions. The pseudouridine-modified mRNA approach has a strong potential to discern cellular effects of CPD in UV-related cell biological studies. The mRNA-based transient expression of proteins offers a number of opportunities for future application in medicine. PMID:24211294

  7. Trifloxystrobin induces tumor necrosis factor-related apoptosis-inducing ligand (TRAIL)-mediated apoptosis in HaCaT, human keratinocyte cells. (United States)

    Jang, Yoonjeong; Lee, Ah Young; Chang, Seung-Hee; Jeong, Sang-Hee; Park, Kyung-Hun; Paik, Min-Kyoung; Cho, Nam-Joon; Kim, Ji-Eun; Cho, Myung-Haing


    As the outermost layer of the body, the skin plays an important role in exposure to pesticides, which could have negative impacts on human health. Trifloxystrobin is a widely used fungicide of the strobilurin class, however, there is little information regarding the skin contact-associated toxic mechanism. Therefore, the present study was performed in order to identify the skin toxicity mechanism of trifloxystrobin using HaCaT (keratinocyte of human skin) cells. Following 24 or 48 h treatment, cell viability, and subsequent Annexin V-FITC/propidium iodide assay, TUNEL assay and Western blotting were performed to investigate the cell death mechanism of trifloxystrobin. Exposure to trifloxystrobin resulted in diminished viability of HaCaT cells in both a time- and concentration-dependent manner. The cell death was derived through apoptotic pathways in the HaCaT cells. Furthermore, we explored the effect of trifloxystrobin on TRAIL-mediated extrinsic apoptosis using siRNA transfection. Knockdown of death receptor 5 suppressed trifloxystrobin-provoked apoptosis. These results indicate that trifloxystrobin induces TRAIL-mediated apoptosis and has an inhibitory effect in keratinocytes that can interfere with the barrier function and integrity of the skin. This could be proposed as a mechanism of skin toxicity by trifloxystrobin and considered in the management of pesticide exposure.

  8. A novel control of human keratin expression: cannabinoid receptor 1-mediated signaling down-regulates the expression of keratins K6 and K16 in human keratinocytes in vitro and in situ

    Directory of Open Access Journals (Sweden)

    Yuval Ramot


    Full Text Available Cannabinoid receptors (CB are expressed throughout human skin epithelium. CB1 activation inhibits human hair growth and decreases proliferation of epidermal keratinocytes. Since psoriasis is a chronic hyperproliferative, inflammatory skin disease, it is conceivable that the therapeutic modulation of CB signaling, which can inhibit both proliferation and inflammation, could win a place in future psoriasis management. Given that psoriasis is characterized by up-regulation of keratins K6 and K16, we have investigated whether CB1 stimulation modulates their expression in human epidermis. Treatment of organ-cultured human skin with the CB1-specific agonist, arachidonoyl-chloro-ethanolamide (ACEA, decreased K6 and K16 staining intensity in situ. At the gene and protein levels, ACEA also decreased K6 expression of cultured HaCaT keratinocytes, which show some similarities to psoriatic keratinocytes. These effects were partly antagonized by the CB1-specific antagonist, AM251. While CB1-mediated signaling also significantly inhibited human epidermal keratinocyte proliferation in situ, as shown by K6/Ki-67-double immunofluorescence, the inhibitory effect of ACEA on K6 expression in situ was independent of its anti-proliferative effect. Given recent appreciation of the role of K6 as a functionally important protein that regulates epithelial wound healing in mice, it is conceivable that the novel CB1-mediated regulation of keratin 6/16 revealed here also is relevant to wound healing. Taken together, our results suggest that cannabinoids and their receptors constitute a novel, clinically relevant control element of human K6 and K16 expression.

  9. Empirical Modeling of Physiochemical Immune Response of Multilayer Zinc Oxide Nanomaterials under UV Exposure to Melanoma and Foreskin Fibroblasts (United States)

    Fakhar-E-Alam, Muhammad; Akram, M. Waseem; Iqbal, Seemab; Alimgeer, K. S.; Atif, M.; Sultana, K.; Willander, M.; Wang, Zhiming M.


    Carcinogenesis is a complex molecular process starting with genetic and epigenetic alterations, mutation stimulation, and DNA modification, which leads to proteomic adaptation ending with an uncontrolled proliferation mechanism. The current research focused on the empirical modelling of the physiological response of human melanoma cells (FM55P) and human foreskin fibroblasts cells (AG01518) to the multilayer zinc oxide (ZnO) nanomaterials under UV-A exposure. To validate this experimental scheme, multilayer ZnO nanomaterials were grown on a femtotip silver capillary and conjugated with protoporphyrin IX (PpIX). Furthermore, PpIX-conjugated ZnO nanomaterials grown on the probe were inserted into human melanoma (FM55P) and foreskin fibroblasts cells (AG01518) under UV-A light exposure. Interestingly, significant cell necrosis was observed because of a loss in mitochondrial membrane potential just after insertion of the femtotip tool. Intense reactive oxygen species (ROS) fluorescence was observed after exposure to the ZnO NWs conjugated with PpIX femtotip model under UV exposure. Results were verified by applying several experimental techniques, e.g., ROS detection, MTT assay, and fluorescence spectroscopy. The present work reports experimental modelling of cell necrosis in normal human skin as well as a cancerous tissue. These obtained results pave the way for a more rational strategy for biomedical and clinical applications.

  10. RhoB protects human keratinocytes from UVB-induced apoptosis through epidermal growth factor receptor signaling. (United States)

    Canguilhem, Bruno; Pradines, Anne; Baudouin, Caroline; Boby, Céline; Lajoie-Mazenc, Isabelle; Charveron, Marie; Favre, Gilles


    Exposure of the skin to UVB light results in the formation of DNA photolesions that can give rise to cell death, mutations, and the onset of carcinogenic events. Specific proteins are activated by UVB and then trigger signal transduction pathways that lead to cellular responses. An alteration of these signaling molecules is thought to be a fundamental event in tumor promotion by UVB irradiation. RhoB, encoding a small GTPase has been identified as a DNA damage-inducible gene. RhoB is involved in epidermal growth factor (EGF) receptor trafficking, cytoskeletal organization, cell transformation, and survival. We have analyzed the regulation of RhoB and elucidated its role in the cellular response of HaCaT keratinocytes to relevant environmental UVB irradiation. We report here that the activated GTP-bound form of RhoB is increased rapidly within 5 min of exposure to UVB, and then RhoB protein levels increased concomitantly with EGF receptor (EGFR) activation. Inhibition of UVB-induced EGFR activation prevents RhoB protein expression and AKT phosphorylation but not the early activation of RhoB. Blocking UVB-induced RhoB expression with specific small interfering RNAs inhibits AKT and glycogen synthase kinase-3beta phosphorylation through inhibition of EGFR expression. Moreover, down-regulation of RhoB potentiates UVB-induced cell apoptosis. In contrast, RhoB overexpression protects keratinocytes against UVB-induced apoptosis. These results indicated that RhoB is regulated upon UVB exposure by a two-step process consisting of an early EGFR-independent RhoB activation followed by an EGFR-dependent induction of RhoB expression. Moreover, we have demonstrated that RhoB is essential in regulating keratinocyte cell survival after UVB exposure, suggesting its potential role in photocarcinogenesis.

  11. Barium Promotes Anchorage-Independent Growth and Invasion of Human HaCaT Keratinocytes via Activation of c-SRC Kinase (United States)

    Thang, Nguyen Dinh; Yajima, Ichiro; Kumasaka, Mayuko Y.; Ohnuma, Shoko; Yanagishita, Takeshi; Hayashi, Rumiko; Shekhar, Hossain U.; Watanabe, Daisuke; Kato, Masashi


    Explosive increases in skin cancers have been reported in more than 36 million patients with arsenicosis caused by drinking arsenic-polluted well water. This study and previous studies showed high levels of barium as well as arsenic in the well water. However, there have been no reports showing a correlation between barium and cancer. In this study, we examined whether barium (BaCl2) may independently have cancer-related effects on human precancerous keratinocytes (HaCaT). Barium (5–50 µM) biologically promoted anchorage-independent growth and invasion of HaCaT cells in vitro. Barium (5 µM) biochemically enhanced activities of c-SRC, FAK, ERK and MT1-MMP molecules, which regulate anchorage-independent growth and/or invasion. A SRC kinase specific inhibitor, protein phosphatase 2 (PP2), blocked barium-mediated promotion of anchorage-independent growth and invasion with decreased c-SRC kinase activity. Barium (2.5–5 µM) also promoted anchorage-independent growth and invasion of fibroblasts (NIH3T3) and immortalized nontumorigenic melanocytes (melan-a), but not transformed cutaneous squamous cell carcinoma (HSC5 and A431) and malignant melanoma (Mel-ret) cells, with activation of c-SRC kinase. Taken together, our biological and biochemical findings newly suggest that the levels of barium shown in drinking well water independently has the cancer-promoting effects on precancerous keratinocytes, fibroblast and melanocytes in vitro. PMID:22022425

  12. Rhodomyrtus tomentosa Leaf Extract Inhibits Methicillin-Resistant Staphylococcus aureus Adhesion, Invasion, and Intracellular Survival in Human HaCaT Keratinocytes. (United States)

    Srisuwan, Sutthirat; Voravuthikunchai, Supayang Piyawan


    Methicillin-resistant Staphylococcus aureus (MRSA) has an ability to invade nonprofessional phagocytic cells, resulting in persistent infections and most likely host cell death. Series of our studies have claimed pronounced antibacterial efficacy of Rhodomyrtus tomentosa leaf extract. This study was to further investigate potency of the extract in intracellular killing of human HaCaT keratinocytes. Pretreatment of MRSA with the extract resulted in a remarkable reduction in the bacterial adhesion to HaCaT keratinocytes, compared with untreated control (p extract exhibited strong antibacterial activity against intracellular MRSA at nontoxic concentrations (128 mg/L), which may have resulted from the increase in bactericidal activity under phagolysosomal pH. Transmission electron microscopy displayed the effects of the extract on alterations in the bacterial cell morphology with cell lysis. Fluorescence microscopy revealed that the extract decreased MRSA-induced apoptosis in HaCaT cells. In addition, cytotoxicity of HaCaT cells caused by MRSA supernatant was reduced at least 50% by the extract. The potential activities of R. tomentosa extract may be useful in an alternative treatment of MRSA infections in slight acidic compartments, particularly skin infections.

  13. Xenobiotic metabolism capacities of human skin in comparison with a 3D epidermis model and keratinocyte-based cell culture as in vitro alternatives for chemical testing: activating enzymes (Phase I). (United States)

    Götz, Christine; Pfeiffer, Roland; Tigges, Julia; Blatz, Veronika; Jäckh, Christine; Freytag, Eva-Maria; Fabian, Eric; Landsiedel, Robert; Merk, Hans F; Krutmann, Jean; Edwards, Robert J; Pease, Camilla; Goebel, Carsten; Hewitt, Nicola; Fritsche, Ellen


    Skin is important for the absorption and metabolism of exposed chemicals such as cosmetics or pharmaceuticals. The Seventh Amendment to the EU Cosmetics Directive prohibits the use of animals for cosmetic testing for certain endpoints, such as genotoxicity; therefore, there is an urgent need to understand the xenobiotic metabolizing capacities of human skin and to compare these activities with reconstructed 3D skin models developed to replace animal testing. We have measured Phase I enzyme activities of cytochrome P450 (CYP) and cyclooxygenase (COX) in ex vivo human skin, the 3D skin model EpiDerm™ (EPI-200), immortalized keratinocyte-based cell lines and primary normal human epidermal keratinocytes. Our data demonstrate that basal CYP enzyme activities are very low in whole human skin and EPI-200 as well as keratinocytes. In addition, activities in monolayer cells differed from organotypic tissues after induction. COX activity was similar in skin, EPI-200 and NHEK cells, but was significantly lower in immortalized keratinocytes. Hence, the 3D model EPI-200 might represent a more suitable model for dermatotoxicological studies. Altogether, these data help to better understand skin metabolism and expand the knowledge of in vitro alternatives used for dermatotoxicity testing. © 2012 John Wiley & Sons A/S.

  14. Galectin-1 from conditioned medium of three-dimensional culture of adipose-derived stem cells accelerates migration and proliferation of human keratinocytes and fibroblasts. (United States)

    Kim, Min Ho; Wu, Wen Hao; Choi, Jee Hyun; Kim, Jihyun; Jun, Jin Hyun; Ko, Yong; Lee, Jong Hun


    Keratinocytes and fibroblasts cells play important roles in the skin-wound healing process and are the cell types activated by trauma. Activated cells participate in epithelialization, granulation, scar tissue formation, wound remodeling, and angiogenesis via a series of cellular activities including migration and proliferation. Previous studies reported that the conditioned medium (CM) of adipose-derived stem cells (ADSCs) stimulated the migration and proliferation of cell types involved in the skin wound healing process; however, these studies only show ADSC-CM effects that were obtained using 2-dimensional (2D) culture. Recently, 3-dimensional (3D) culture has been considered as a more physiologically appropriate system than 2D culture for ADSC cultures; therefore, ADSC-CM was collected from 3D culture (ADSC-CM-3D) and compared with ADSC-CM from 2D culture (ADSC-CM-2D) to investigate the effects on the migration and proliferation of human keratinocytes (HaCaTs) and fibroblasts. The migrations of the HaCaT cells and fibroblasts were significantly higher with ADSC-CM-3D compared with the 2D culture; similarly, the proliferation of HaCaT cells was also highly stimulated by ADSC-CM-3D. Proteomic analyses of the ADSC-CM revealed that collagens and actins were highly expressed in the 3D-culture system. Chitinase 3-like 1 (CHI3L1), tissue inhibitor of metalloproteinases (TIMP), and galectin-1 were specifically expressed only in ADSC-CM-3D. Especially, through antibody neutralization, galectin-1 in ADSC-CM-3D was found to be an important factor for the migration of human keratinocytes. Therefore, these results suggest that ADSC-CM-3D was more effective in the wound healing than ADSC-CM-2D, and galectin-1 in ADSC-CM-3D was could be a promising option for skin-wound healing. Furthermore, the differential expressions of several ADSC-CM proteins between the 2D- and 3D-culture systems may be used as basic information for the development of efficient wound-healing strategies

  15. Time-dependent bioactivity of preparations from cactus pear (Opuntia ficus indica) and ice plant (Mesembryanthemum crystallinum) on human skin fibroblasts and keratinocytes. (United States)

    Deters, A M; Meyer, U; Stintzing, F C


    Traditionally and nowadays preparations from two xerophytic plants, the ice plant and cactus pear are used in dermatologic and cosmetic preparations. In spite of their daily use, little is known concerning the bioactivity of such extracts on skin cells. The purpose of this study was to investigate the effect of pressed juices from ice plant (McP) and two cactus pear polysaccharides (cold water soluble, NwPS; non swelling pectin, NPec) on the cell physiology of normal human dermal fibroblasts (NHDF) and HaCaT-keratinocytes due to composition, concentration and incubation time. Cactus pear polysaccharides were analyzed by high performance anion exchange chromatography with pulsed amperometric detection after hydrolysis with trifluoroacetic acid. Ice plant pressed juices were filtrated through a 1.2 μm (McPI) and 0.2 μm filter (McPII). Cell proliferation was measured with BrdU incorporation assay. Reduction of tetrazolium salts was applied to determine the metabolic activity (MTT) while necrotic effects were assessed by LDH-release measurements. Cactus pear polysaccharides differed predominantly in their glucose and uronic acid content. The filtration of pressed juices altered the amounts of high molecular weight compounds. The proliferation of NHDF and HaCaTs was significantly stimulated by cactus pear polysaccharides and ice plant pressed juices not until 72 h of incubation. McPI significantly increased the proliferation of NHDF and HaCaTs while significant effect of McPII was only observed in case of HaCaT-keratinocytes. A dependence on concentration was not observed. Metabolic activity was neither influenced by McPI nor by McPII independent of incubation time. The HaCaT proliferation was not significantly influenced by low concentrations of cactus pear polysaccharides however it was inhibited by 100 μg/mL NPec. 100 μg/mL of NwPS and 1 μg/mL NPec stimulated the proliferation of fibroblasts. The metabolic activity of NHDF was not affected neither by NPec nor by

  16. Germacrane sesquiterpenes isolated from the rhizome of Curcuma xanthorrhiza Roxb. inhibit UVB-induced upregulation of MMP-1, -2, and -3 expression in human keratinocytes. (United States)

    Park, Ji-Hae; Mohamed, Mohamed Antar Aziz; Jung, Ye-Jin; Shrestha, Sabina; Lee, Tae Hoon; Lee, Chang-Ho; Han, Daeseok; Kim, Jiyoung; Baek, Nam-In


    Four sesquiterpenes were isolated from the rhizome of Curcuma xanthorrhiza Roxb.: furanodiene (1), germacrone (2), furanodienone (3), and 13-hydroxygermacrone (4). Importantly, this was the first time compounds 1 and 4 were isolated from this plant. The chemical structures of these compounds were determined using 1D- and 2D-nuclear magnetic resonance, infrared spectroscopy, and electron ionization mass spectrometry analyses. Among the isolated compounds, compounds 2 and 4 inhibited UVB-induced upregulation of the mRNA and protein expression levels of MMP-1, MMP-2, and MMP-3 in human keratinocytes (HaCaT). Moreover, this upregulation occurred in a dose-dependent manner over the range of 1-10 μM for each compound.

  17. Effect of Gloriosa superba and Catharanthus roseus Extracts on IFN-γ-Induced Keratin 17 Expression in HaCaT Human Keratinocytes

    Directory of Open Access Journals (Sweden)

    Nattaporn Pattarachotanant


    Full Text Available Gloriosa superba and Catharanthus roseus are useful in traditional medicine for treatment of various skin diseases and cancer. However, their molecular effect on psoriasis has not been investigated. In this study, the effect of ethanol extracts derived from G. superba leaves and C. roseus stems on the expression of psoriatic marker, keratin 17 (K17, was investigated in human keratinocytes using biochemical and molecular experimental approaches. Both extracts could reduce the expression of K17 in a dose-dependent manner through JAK/STAT pathway as demonstrated by an observation of reduced phosphorylation of STAT3 (p-STAT3. The inhibitory activity of G. superba extract was more potent than that of C. roseus. The Pearson's correlation between K17 and cell viability was shown positive. Taken together, the extracts of G. superba and C. roseus may be developed as alternative therapies for psoriasis.

  18. Antimicrobial agent triclosan is a proton ionophore uncoupler of mitochondria in living rat and human mast cells and in primary human keratinocytes. (United States)

    Weatherly, Lisa M; Shim, Juyoung; Hashmi, Hina N; Kennedy, Rachel H; Hess, Samuel T; Gosse, Julie A


    Triclosan (TCS) is an antimicrobial used widely in hospitals and personal care products, at ~10 mm. Human skin efficiently absorbs TCS. Mast cells are ubiquitous key players both in physiological processes and in disease, including asthma, cancer and autism. We previously showed that non-cytotoxic levels of TCS inhibit degranulation, the release of histamine and other mediators, from rat basophilic leukemia mast cells (RBL-2H3), and in this study, we replicate this finding in human mast cells (HMC-1.2). Our investigation into the molecular mechanisms underlying this effect led to the discovery that TCS disrupts adenosine triphosphate (ATP) production in RBL-2H3 cells in glucose-free, galactose-containing media (95% confidence interval EC50 = 7.5-9.7 µm), without causing cytotoxicity. Using these same glucose-free conditions, 15 µm TCS dampens RBL-2H3 degranulation by 40%. The same ATP disruption was found with human HMC-1.2 cells (EC50 4.2-13.7 µm), NIH-3 T3 mouse fibroblasts (EC50 4.8-7.4 µm) and primary human keratinocytes (EC50 3.0-4.1 µm) all with no cytotoxicity. TCS increases oxygen consumption rate in RBL-2H3 cells. Known mitochondrial uncouplers (e.g., carbonyl cyanide 3-chlorophenylhydrazone) previously were found to inhibit mast cell function. TCS-methyl, which has a methyl group in place of the TCS ionizable proton, affects neither degranulation nor ATP production at non-cytotoxic doses. Thus, the effects of TCS on mast cell function are due to its proton ionophore structure. In addition, 5 µm TCS inhibits thapsigargin-stimulated degranulation of RBL-2H3 cells: further evidence that TCS disrupts mast cell signaling. Our data indicate that TCS is a mitochondrial uncoupler, and TCS may affect numerous cell types and functions via this mechanism. Copyright © 2015 John Wiley & Sons, Ltd. Copyright © 2015 John Wiley & Sons, Ltd.

  19. Citric acid induces cell-cycle arrest and apoptosis of human immortalized keratinocyte cell line (HaCaT) via caspase- and mitochondrial-dependent signaling pathways. (United States)

    Ying, Tsung-Ho; Chen, Chia-Wei; Hsiao, Yu-Ping; Hung, Sung-Jen; Chung, Jing-Gung; Yang, Jen-Hung


    Citric acid is an alpha-hydroxyacid (AHA) widely used in cosmetic dermatology and skincare products. However, there is concern regarding its safety for the skin. In this study, we investigated the cytotoxic effects of citric acid on the human keratinocyte cell line HaCaT. HaCaT cells were treated with citric acid at 2.5-12.5 mM for different time periods. Cell-cycle arrest and apoptosis were investigated by 4,6-diamidino-2-phenylindole dihydrochloride (DAPI) staining, flow cytometry, western blot and confocal microscopy. Citric acid not only inhibited proliferation of HaCaT cells in a dose-dependent manner, but also induced apoptosis and cell cycle-arrest at the G2/M phase (before 24 h) and S phase (after 24 h). Citric acid increased the level of Bcl-2-associated X protein (BAX) and reduced the levels of B-cell lymphoma-2 (BCL-2), B-cell lymphoma-extra large (BCL-XL) and activated caspase-9 and caspase-3, which subsequently induced apoptosis via caspase-dependent and caspase-independent pathways. Citric acid also activated death receptors and increased the levels of caspase-8, activated BH3 interacting-domain death agonist (BID) protein, Apoptosis-inducing factor (AIF), and Endonuclease G (EndoG). Therefore, citric acid induces apoptosis through the mitochondrial pathway in the human keratinocyte cell line HaCaT. The study results suggest that citric acid is cytotoxic to HaCaT cells via induction of apoptosis and cell-cycle arrest in vitro.

  20. γ-Tocotrienol prevents 5-FU-induced reactive oxygen species production in human oral keratinocytes through the stabilization of 5-FU-induced activation of Nrf2. (United States)

    Takano, Hideyuki; Momota, Yukihiro; Kani, Kouichi; Aota, Keiko; Yamamura, Yoshiko; Yamanoi, Tomoko; Azuma, Masayuki


    Chemotherapy-induced oral mucositis is a common adverse event in patients with oral squamous cell carcinoma, and is initiated through a variety of mechanisms, including the generation of reactive oxygen species (ROS). In this study, we examined the preventive effect of γ-tocotrienol on the 5-FU-induced ROS production in human oral keratinocytes (RT7). We treated RT7 cells with 5-FU and γ-tocotrienol at concentrations of 10 µg/ml and 10 nM, respectively. When cells were treated with 5-FU alone, significant growth inhibition was observed as compared to untreated cells. This inhibition was, in part, due to the ROS gene-rated by 5-FU treatment, because N-acetyl cysteine (NAC), a ROS scavenger, significantly ameliorated the growth of RT7 cells. γ-tocotrienol showed no cytotoxic effect on the growth of RT7 cells. Simultaneous treatment of cells with these agents resulted in the significant recovery of cell growth, owing to the suppression of ROS generation by γ-tocotrienol. Whereas 5-FU stimulated the expression of NF-E2-related factor 2 (Nrf2) protein in the nucleus up to 12 h after treatment of RT7 cells, γ-tocotrienol had no obvious effect on the expression of nuclear Nrf2 protein. Of note, the combined treatment with both agents stabilized the 5-FU-induced nuclear Nrf2 protein expression until 24 h after treatment. In addition, expression of Nrf2-dependent antioxidant genes, such as heme oxygenase-1 (HO-1) and quinone oxidoreductase-1 (NQO-1), was significantly augmented by treatment of cells with both agents. These findings suggest that γ-tocotrienol could prevent 5-FU-induced ROS generation by stabilizing Nrf2 activation, thereby leading to ROS detoxification and cell survival in human oral keratinocytes.

  1. Recombinant adeno-associated virus type 2-mediated gene transfer into human keratinocytes is influenced by both the ubiquitin/proteasome pathway and epidermal growth factor receptor tyrosine kinase. (United States)

    Braun-Falco, Markus; Eisenried, Angelika; Büning, Hildegard; Ring, Johannes


    Efficient gene delivery into keratinocytes is a prerequisite for successful skin gene therapy. Vectors based on recombinant adeno-associated virus type 2 (rAAV-2) offer several promising features that make them attractive for cutaneous applications. However, highly efficient gene delivery may be hampered by different cellular factors, including lack of viral receptors, impairment of cytoplasmic trafficking or limitations in viral second-strand synthesis. This study was undertaken to find factors that influence rAAV-2-mediated in vitro gene transfer into human keratinocytes and, consequently, ways to optimize gene delivery. Transduction experiments using rAAV-2 vectors expressing green fluorescent protein (GFP) demonstrated that impaired cellular trafficking of vector particles and high levels of autophosphorylation at epidermal growth factor receptor tyrosine kinase (EGF-R TK) have a negative influence on gene transfer into keratinocytes. Treatment of keratinocytes with proteasome inhibitor MG132 resulted in a transient augmentation of GFP expression in up to 37% of cells. Treatment with EGF-R TK inhibitors (quinazoline type) enhanced transgene expression in 10-14.5% of the cells. Gene expression was stable for more than 10 weeks and persisted until proliferative senescence occurred. This stable gene expression allows speculation that keratinocyte stem cells have initially been transduced. These findings might have relevance for the use of rAAV-2 vectors in skin gene therapy: transient enhancement of rAAV-2 transduction with proteasome inhibitors might be useful for genetic promotion of wound healing or skin-directed vaccination. Treatment with quinazolines may increase rAAV-2 transduction of keratinocyte stem cells, which is important for gene therapy approaches to inherited diseases.

  2. The Inflammasome and the Epidermal Growth Factor Receptor (EGFR Are Involved in the Staphylococcus aureus-Mediated Induction of IL-1alpha and IL-1beta in Human Keratinocytes.

    Directory of Open Access Journals (Sweden)

    Maren Simanski

    Full Text Available Staphylococcus (S. aureus is an important pathogen causing various infections including those of the skin. Keratinocytes are able to sense invading S. aureus and to initiate a fast defense reaction by the rapid release of innate defense mediators such as antimicrobial peptides and cytokines. There is increasing evidence that the cytokines IL-1alpha and IL-1beta, which both signal through the IL-1 receptor, play an important role in cutaneous defense against S. aureus. The aim of this study was to gain more insight into the underlying mechanisms leading to the S. aureus-induced IL-1alpha and IL-1beta expression in keratinocytes. Infection of human primary keratinocytes with S. aureus led to the induction of gene expression and protein secretion of IL-1alpha and IL-1beta. Full S. aureus-induced IL-1 protein release required the inflammasome components caspase-1 and ASC (apoptosis-associated speck-like protein containing a CARD whereas gene induction of IL-1alpha and IL-beta by S. aureus was not dependent on caspase-1 and ASC. Since patients receiving anti-cancer therapy by inhibition of the epidermal growth factor receptor (EGFR often suffer from skin infections caused by S. aureus we additionally evaluated whether the EGFR pathway may be involved in the IL-1alpha and IL-1beta induction by S. aureus. Inactivation of the EGFR with a blocking antibody decreased the S. aureus-mediated IL-1alpha and IL-1beta induction in primary keratinocytes. Moreover, the use of siRNA experiments revealed that ADAM17 (A Disintegrin and A Metalloprotease 17, a metalloproteinase known to mediate the shedding and release of EGFR ligands, was required for full induction of IL-1alpha and IL-1beta in keratinocytes infected with S. aureus. A failure of keratinocytes to adequately upregulate IL-1alpha and IL-1beta may promote S. aureus skin infections.

  3. 1,25-dihydroxyvitamin D(3) increases human cystatin A expression by inhibiting the Raf-1/MEK1/ERK signaling pathway of keratinocytes. (United States)

    Takahashi, Hidetoshi; Ibe, Masaki; Honma, Masaru; Ishida-Yamamoto, Akemi; Hashimoto, Yoshio; Iizuka, Hajime


    The active form of vitamin D(3), 1,25-dihydroxyvitamin D(3) (1,25(OH)(2)D3), regulates proliferation and differentiation of keratinocytes. Cystatin A, a cysteine proteinase inhibitor, is a cornified cell envelope constituent and a differentiation marker of keratinocytes. In the present study, we examined the effect of 1,25(OH)(2)D3 on the expression of cystatin A of cultured normal human keratinocytes (NHK). 1,25(OH)(2)D3 suppressed NHK proliferation in a dose-dependent manner with the maximal effect at 1x10(-7) M. It also stimulated cystatin A promoter activity and its expression with similar dose effects. The increased cystatin A was detected by 24 h and the effect was accompanied by the suppression of ERK activity. Cystatin A promoter activity was not affected by cotransfection of vitamin D(3) receptor or retinoid X receptor. Further analyses disclosed that the 12- o-tetradecanoylphorbol-13-acetate (TPA)-responsive element (TRE), T2 (-272 to -278), in cystatin A promoter is critical for the regulation by 1,25(OH)(2)D3. Transfection of the dominant-negative form of ERK adenovirus (Ad-dnERK) increased cystatin A promoter activity and its expression, which was markedly augmented by 1,25(OH)(2)D3 treatment. Transfection of the dominant-active form of Raf-1 (Ad-daRaf-1) or MEK1 (Ad-daMEK1) inhibited 1,25(OH)(2)D3-dependent cystatin A promoter activity and its expression. Consistent with these results, the MEK1 inhibitor, PD98059, further augmented 1,25(OH)(2)D3-induced cystatin A promoter activity and its expression. The present study demonstrated that the 1,25(OH)(2)D3-responsive element in the cystatin A gene is identical to the TRE, T2 (-272 to -278), and that the suppression of Raf-1/MEK1/ERK1,2 signaling pathway increases cystatin A expression of NHK.

  4. The key role of miR-21-regulated SOD2 in the medium-mediated bystander responses in human fibroblasts induced by α-irradiated keratinocytes

    Energy Technology Data Exchange (ETDEWEB)

    Tian, Wenqian; Yin, Xiaoming; Wang, Longxiao; Wang, Jingdong; Zhu, Wei; Cao, Jianping [School of Radiation Medicine and Protection, Medical College of Soochow University/Collaborative Innovation Center of Radiation Medicine of Jiangsu Higher Education Institutions, 199 Renai Road, Suzhou Industrial Park, Suzhou, Jiangsu Province 215123 (China); Yang, Hongying, E-mail: [School of Radiation Medicine and Protection, Medical College of Soochow University/Collaborative Innovation Center of Radiation Medicine of Jiangsu Higher Education Institutions, 199 Renai Road, Suzhou Industrial Park, Suzhou, Jiangsu Province 215123 (China); Institute of Radiotherapy & Oncology, Soochow University (China)


    Highlights: • After co-culture with α-irradiated HaCaT cells, WS1 cells displayed oxidative stress and DNA damage. • Increased miR-21 expression in bystander cells was critical to the occurrence of RIBEs. • SOD2 of bystander cells played an important role in bystander responses. • miR-21 mediated bystander effects through its regulation on SOD2. - Abstract: Radiation-induced bystander effect (RIBE) is well accepted in the radiation research field by now, but the underlying molecular mechanisms for better understanding this phenomenon caused by intercellular communication and intracellular signal transduction are still incomplete. Although our previous study has demonstrated an important role of miR-21 of unirradiated bystander cells in RIBEs, the direct evidence for the hypothesis that RIBE is epigenetically regulated is still limited and how miR-21 mediates RIBEs is unknown. Reactive oxygen species (ROS) have been demonstrated to be involved in RIBEs, however, the roles of anti-oxidative stress system of cells in RIBEs are unclear. Using transwell insert co-culture system, we investigated medium-mediated bystander responses in WS1 human fibroblasts after co-culture with HaCaT keratinocytes traversed by α-particles. Results showed that the ROS levels in unirradiated bystander WS1 cells were significantly elevated after 30 min of co-culture, and 53BP1 foci, a surrogate marker of DNA damage, were obviously induced after 3 h of co-culture. This indicates the occurrence of oxidative stress and DNA damage in bystander WS1 cells after co-culture with irradiated keratinocytes. Furthermore, the expression of miR-21 was increased in bystander WS1 cells, downregulation of miR-21 eliminated the bystander responses, overexpression of miR-21 alone could induce bystander-like oxidative stress and DNA damage in WS1 cells. These data indicate an important mediating role of miR-21 in RIBEs. In addition, MnSOD or SOD2 in WS1 cells was involved in the bystander effects

  5. The key role of miR-21-regulated SOD2 in the medium-mediated bystander responses in human fibroblasts induced by α-irradiated keratinocytes. (United States)

    Tian, Wenqian; Yin, Xiaoming; Wang, Longxiao; Wang, Jingdong; Zhu, Wei; Cao, Jianping; Yang, Hongying


    Radiation-induced bystander effect (RIBE) is well accepted in the radiation research field by now, but the underlying molecular mechanisms for better understanding this phenomenon caused by intercellular communication and intracellular signal transduction are still incomplete. Although our previous study has demonstrated an important role of miR-21 of unirradiated bystander cells in RIBEs, the direct evidence for the hypothesis that RIBE is epigenetically regulated is still limited and how miR-21 mediates RIBEs is unknown. Reactive oxygen species (ROS) have been demonstrated to be involved in RIBEs, however, the roles of anti-oxidative stress system of cells in RIBEs are unclear. Using transwell insert co-culture system, we investigated medium-mediated bystander responses in WS1 human fibroblasts after co-culture with HaCaT keratinocytes traversed by α-particles. Results showed that the ROS levels in unirradiated bystander WS1 cells were significantly elevated after 30min of co-culture, and 53BP1 foci, a surrogate marker of DNA damage, were obviously induced after 3h of co-culture. This indicates the occurrence of oxidative stress and DNA damage in bystander WS1 cells after co-culture with irradiated keratinocytes. Furthermore, the expression of miR-21 was increased in bystander WS1 cells, downregulation of miR-21 eliminated the bystander responses, overexpression of miR-21 alone could induce bystander-like oxidative stress and DNA damage in WS1 cells. These data indicate an important mediating role of miR-21 in RIBEs. In addition, MnSOD or SOD2 in WS1 cells was involved in the bystander effects, overexpression of SOD2 abolished the bystander oxidative stress and DNA damage, indicating that SOD2 was critical to the induction of RIBEs. Moreover, we found that miR-21 regulated SOD2, suggesting that miR-21 might mediate bystander responses through its regulation on SOD2. In conclusion, this study revealed a profound role of miR-21-regulated SOD2 of unirradiated WS1

  6. TiO2 nanoparticles alleviate toxicity by reducing free Zn2+ ion in human primary epidermal keratinocytes exposed to ZnO nanoparticles (United States)

    Kathawala, Mustafa Hussain; Ng, Kee Woei; Loo, Say Chye Joachim


    Nanoparticles have been a subject of intense safety screenings due to their influx in various applications. Although recent studies have reported on the plausible cytotoxicity of nanoparticles, many of these focused only on single-material nanoparticles, while the cytotoxicity of dual-nanoparticle systems (e.g., ZnO with TiO2) has remained unexplored. For example, commercial products like sunscreens and cosmetics contain both nano-sized ZnO and TiO2, but cytotoxicity studies of such systems are meager. In this paper, the cytotoxicity of this dual-nanoparticle system comprising both ZnO and TiO2 was evaluated in vitro on skin-mimicking human primary epidermal keratinocytes (HPEKs). Inductively coupled plasma mass spectrometry, flow cytometry, and confocal microscopy were used to investigate the uptake of nanoparticles and free ions. Results revealed that ZnO nanoparticles were partially soluble (up to 20 μg ml-1 after 1 day) and could induce strong cytotoxicity as compared to the insoluble TiO2 nanoparticles which remained non-toxic until very high concentrations. It was found that TiO2 nanoparticles could play "vigilante" by protecting keratinocytes from acute toxicity of ZnO nanoparticles. This is in agreement with the observation that TiO2 nanoparticles caused an attenuation of free intracellular Zn2+ ions concentration, by adsorbing and immobilizing free Zn2+ ions. This study reveals a unique dual-nanoparticle observation in vitro on HPEKs, and highlights the importance of dual-nanoparticulate toxicity studies, especially in applications where more than one nanoparticle material-type is present.

  7. TiO{sub 2} nanoparticles alleviate toxicity by reducing free Zn{sup 2+} ion in human primary epidermal keratinocytes exposed to ZnO nanoparticles

    Energy Technology Data Exchange (ETDEWEB)

    Kathawala, Mustafa Hussain; Ng, Kee Woei, E-mail:; Loo, Say Chye Joachim, E-mail: [Nanyang Technological University, School of Materials Science and Engineering (Singapore)


    Nanoparticles have been a subject of intense safety screenings due to their influx in various applications. Although recent studies have reported on the plausible cytotoxicity of nanoparticles, many of these focused only on single-material nanoparticles, while the cytotoxicity of dual-nanoparticle systems (e.g., ZnO with TiO{sub 2}) has remained unexplored. For example, commercial products like sunscreens and cosmetics contain both nano-sized ZnO and TiO{sub 2}, but cytotoxicity studies of such systems are meager. In this paper, the cytotoxicity of this dual-nanoparticle system comprising both ZnO and TiO{sub 2} was evaluated in vitro on skin-mimicking human primary epidermal keratinocytes (HPEKs). Inductively coupled plasma mass spectrometry, flow cytometry, and confocal microscopy were used to investigate the uptake of nanoparticles and free ions. Results revealed that ZnO nanoparticles were partially soluble (up to 20 μg ml{sup −1} after 1 day) and could induce strong cytotoxicity as compared to the insoluble TiO{sub 2} nanoparticles which remained non-toxic until very high concentrations. It was found that TiO{sub 2} nanoparticles could play “vigilante” by protecting keratinocytes from acute toxicity of ZnO nanoparticles. This is in agreement with the observation that TiO{sub 2} nanoparticles caused an attenuation of free intracellular Zn{sup 2+} ions concentration, by adsorbing and immobilizing free Zn{sup 2+} ions. This study reveals a unique dual-nanoparticle observation in vitro on HPEKs, and highlights the importance of dual-nanoparticulate toxicity studies, especially in applications where more than one nanoparticle material-type is present.

  8. Effects of Wannachawee Recipe with Antipsoriatic Activity on Suppressing Inflammatory Cytokine Production in HaCaT Human Keratinocytes

    Directory of Open Access Journals (Sweden)

    Mingkwan Na Takuathung


    Full Text Available Psoriasis is a chronic inflammatory and immune-mediated skin disease. The pathogenesis involves T cells activation via the IL-23/Th17 axis. Conventional treatments of psoriasis have adverse events influencing patients’ adherence. Wannachawee Recipe (WCR has been effectively used as Thai folk remedy for psoriasis patients; however, preclinical evidence defining how WCR works is still lacking. This study defined mechanisms for its antiproliferation and anti-inflammatory effects in HaCaT cells. The cytotoxicity and antiproliferation results from SRB and CCK-8 assays showed that WCR inhibited the growth and viability of HaCaT cells in a concentration-dependent manner. The distribution of cell cycle phases determined by flow cytometry showed that WCR did not interrupt cell cycle progression. Interestingly, RT-qPCR revealed that WCR significantly decreased the mRNA expression of IL-1β, IL-6, IL-8, IL-17A, IL-22, IL-23, and TNF-α but induced IL-10 expression in TNF-α- and IFN-γ-induced HaCaT cells. At the protein level determined by ELISA, WCR significantly reduced the secretion of IL-17A, IL-22, and IL-23. The WCR at low concentrations was proved to possess anti-inflammatory effect without cytotoxicity and it did not interfere with cell cycle of keratinocytes. This is the first study to provide convincing evidence that WCR is a potential candidate for development of effective psoriasis therapies.

  9. Expression of TGF-β3 in Isolated Fibroblasts from Foreskin

    Directory of Open Access Journals (Sweden)

    Mahnaz Mahmoudi Rad


    Full Text Available Background: The multifunctional transforming growth factor beta (TGF-β is a glycoprotein that exists in three isoforms. TGF-β3 expression increases in fetal wound healing and reduces fibronectin and collagen I and III deposition, and also improves the architecture of the neodermis which is a combination of blood vessels and connective tissue during wound healing. Fibroblasts are key cells in the wound healing process. TGF-β3 plays a critical role in scar-free wound healing and fibroblast actions in the wound healing process. The aim of this study was to express the TGF-β3 gene (tgf-b3 in human foreskin fibroblasts (HFF’s. Methods: We obtained HFF’s from a newborn and a primary fibroblast culture was prepared. The cells were transfected with TGF-β3-pCMV6-XL5 plasmid DNA by both lipofection and electroporation. Expression of TGF-β3 was measured by enzyme-linked immunosorbent assay (ELISA. Results: The highest TGF-β3 expression (8.3-fold greater than control was obtained by lipofection after 72 hours using 3 μl of transfection reagent. Expression was 1.4-fold greater than control by electroporation. Conclusions: In this study, we successfully increased TGF-β3 expression in primary fibroblast cells. In the future, grafting these transfected fibroblasts onto wounds can help the healing process without scarring.

  10. Combination of low calcium with Y-27632 rock inhibitor increases the proliferative capacity, expansion potential and lifespan of primary human keratinocytes while retaining their capacity to differentiate into stratified epidermis in a 3D skin model.

    Directory of Open Access Journals (Sweden)

    Xanthe L Strudwick

    Full Text Available Human keratinocytes are difficult to isolate and have a limited lifespan. Traditionally, immortalised keratinocyte cell lines are used in vitro due to their ability to bypass senescence and survive indefinitely. However these cells do not fully retain their ability to differentiate in vitro and they are unable to form a normal stratum corneum in organotypic culture. Here we aimed to generate a pool of phenotypically similar keratinocytes from human donors that could be used in monolayer culture, without a fibroblast feeder layer, and in 3D human skin equivalent models. Primary human neonatal epidermal keratinocytes (HEKn were cultured in low calcium, (0.07 mM media, +/-10 μM Y-27632 ROCK inhibitor (HEKn-CaY. mRNA and protein was extracted and expression of differentiation markers Keratin 14 (K14, Keratin 10 (K10 and Involucrin (Inv assessed by qRT-PCR and Western blotting. The differentiation potential of the HEKn-CaY cultures was assessed by increasing calcium levels and removing the Y-27632 for 72 hrs prior to assessment of K14, K10 and Inv. The ability of the HEKn-CaY, to form a stratified epithelium was assessed using a human skin equivalent (HSE model in the absence of Y-27632. Increased proliferative capacity, expansion potential and lifespan of HEKn was observed with the combination of low calcium and 10 μM ROCK inhibitor Y-27632. The removal of Y-27632 and the addition of high calcium to induce differentiation allowed the cells to behave as primary keratinocytes even after extended serial passaging. Prolonged lifespan HEK-CaYs were capable of forming an organised stratified epidermis in 3D HSE cultures, demonstrating their ability to fully stratify and retain their original, primary characteristics. In conclusion, the use of 0.07 mM Calcium and 10 μM Y-27632 in HEKn monocultures provides the opportunity to culture primary human keratinocytes without a cell feeder layer for extended periods of culture whilst retaining their ability to

  11. Keratinocyte specific markers isolated using phage display

    DEFF Research Database (Denmark)

    Jensen, K.B.; Jensen, Ole Nørregaard; Ravn, P.


    Specific molecular markers for various normal and pathogenic cell states and cell types provide knowledge of basic biological systems and have a direct application in targeted therapy. We describe a proteomic method based on the combination of new and improved phage display antibody technologies...... display method was applied to analysis of human skin keratinocytes resulting in the isolation of a panel of antibodies. Fourteen of these antibodies were further characterized, half of which predominantly recognized keratinocytes in a screen of a range of different cell types. Three cognate keratinocyte...... antigens were subsequently identified by mass spectrometry as laminin-5, plectin, and fibronectin. The combination of phage display technology with mass spectrometry methods for protein identification is a general and promising approach for proteomic analysis of cell surface complexity....

  12. Ascorbic acid, ultraviolet C rays, and glucose but not hyperthermia are elicitors of human β-defensin 1 mRNA in normal keratinocytes. (United States)

    Cruz Díaz, Luis Antonio; Flores Miramontes, María Guadalupe; Chávez Hurtado, Paulina; Allen, Kirk; Gonzalez Ávila, Marisela; Prado Montes de Oca, Ernesto


    Hosts' innate defense systems are upregulated by antimicrobial peptide elicitors (APEs). Our aim was to investigate the effects of hyperthermia, ultraviolet A rays (UVA), and ultraviolet C rays (UVC) as well as glucose and ascorbic acid (AA) on the regulation of human β-defensin 1 (DEFB1), cathelicidin (CAMP), and interferon-γ (IFNG) genes in normal human keratinocytes (NHK). The indirect in vitro antimicrobial activity against Staphylococcus aureus and Listeria monocytogenes of these potential APEs was tested. We found that AA is a more potent APE for DEFB1 than glucose in NHK. Glucose but not AA is an APE for CAMP. Mild hypo- (35°C) and hyperthermia (39°C) are not APEs in NHK. AA-dependent DEFB1 upregulation below 20 mM predicts in vitro antimicrobial activity as well as glucose- and AA-dependent CAMP and IFNG upregulation. UVC upregulates CAMP and DEFB1 genes but UVA only upregulates the DEFB1 gene. UVC is a previously unrecognized APE in human cells. Our results suggest that glucose upregulates CAMP in an IFN-γ-independent manner. AA is an elicitor of innate immunity that will challenge the current concept of late activation of adaptive immunity of this vitamin. These results could be useful in designing new potential drugs and devices to combat skin infections.

  13. Influence of different ECM mimetic peptide sequences embedded in a nonfouling environment on the specific adhesion of human-skin keratinocytes and fibroblasts on deformable substrates. (United States)

    Salber, Jochen; Gräter, Stefan; Harwardt, Marc; Hofmann, Matthias; Klee, Doris; Dujic, Jadranka; Jinghuan, Huang; Ding, Jiandong; Kippenberger, Stefan; Bernd, August; Groll, Jürgen; Spatz, Joachim P; Möller, Martin


    Mechanical stress is a decisive factor for the differentiation, proliferation, and general behavior of cells. However, the specific signaling of mechanotransduction is not fully understood. One basic problem is the clear distinction between the different extracellular matrix (ECM) constituents that participate in cellular adhesion and their corresponding signaling pathways. Here, a system is proposed that enables mechanical stimulation of human-skin-derived keratinocytes and human dermal fibroblasts that specifically interact with peptide sequences immobilized on a non-interacting but deformable substrate. The peptide sequences mimic fibronectin, laminin, and collagen type IV, three major components of the ECM. To achieve this, PDMS is activated using ammonia plasma and coated with star-shaped isocyanate-terminated poly(ethylene glycol)-based prepolymers, which results in a functional coating that prevents unspecific cell adhesion. Specific cell adhesion is achieved by functionalization of the layers with the peptide sequences in different combinations. Moreover, a method that enables the decoration of deformable substrates with cell-adhesion peptides in extremely defined nanostructures is presented. The distance and clustering of cell adhesion molecules below 100 nm has been demonstrated to be of utmost importance for cell adhesion. Thus we present a new toolbox that allows for the detailed analysis of the adhesion of human-skin-derived cells on structurally and biochemically decorated deformable substrates.

  14. Ascorbic Acid, Ultraviolet C Rays, and Glucose but not Hyperthermia Are Elicitors of Human β-Defensin 1 mRNA in Normal Keratinocytes

    Directory of Open Access Journals (Sweden)

    Luis Antonio Cruz Díaz


    Full Text Available Hosts’ innate defense systems are upregulated by antimicrobial peptide elicitors (APEs. Our aim was to investigate the effects of hyperthermia, ultraviolet A rays (UVA, and ultraviolet C rays (UVC as well as glucose and ascorbic acid (AA on the regulation of human β-defensin 1 (DEFB1, cathelicidin (CAMP, and interferon-γ (IFNG genes in normal human keratinocytes (NHK. The indirect in vitro antimicrobial activity against Staphylococcus aureus and Listeria monocytogenes of these potential APEs was tested. We found that AA is a more potent APE for DEFB1 than glucose in NHK. Glucose but not AA is an APE for CAMP. Mild hypo- (35°C and hyperthermia (39°C are not APEs in NHK. AA-dependent DEFB1 upregulation below 20 mM predicts in vitro antimicrobial activity as well as glucose- and AA-dependent CAMP and IFNG upregulation. UVC upregulates CAMP and DEFB1 genes but UVA only upregulates the DEFB1 gene. UVC is a previously unrecognized APE in human cells. Our results suggest that glucose upregulates CAMP in an IFN-γ-independent manner. AA is an elicitor of innate immunity that will challenge the current concept of late activation of adaptive immunity of this vitamin. These results could be useful in designing new potential drugs and devices to combat skin infections.

  15. Ascorbic Acid, Ultraviolet C Rays, and Glucose but not Hyperthermia Are Elicitors of Human β-Defensin 1 mRNA in Normal Keratinocytes (United States)

    Cruz Díaz, Luis Antonio; Flores Miramontes, María Guadalupe; Allen, Kirk; Gonzalez Ávila, Marisela; Prado Montes de Oca, Ernesto


    Hosts' innate defense systems are upregulated by antimicrobial peptide elicitors (APEs). Our aim was to investigate the effects of hyperthermia, ultraviolet A rays (UVA), and ultraviolet C rays (UVC) as well as glucose and ascorbic acid (AA) on the regulation of human β-defensin 1 (DEFB1), cathelicidin (CAMP), and interferon-γ (IFNG) genes in normal human keratinocytes (NHK). The indirect in vitro antimicrobial activity against Staphylococcus aureus and Listeria monocytogenes of these potential APEs was tested. We found that AA is a more potent APE for DEFB1 than glucose in NHK. Glucose but not AA is an APE for CAMP. Mild hypo- (35°C) and hyperthermia (39°C) are not APEs in NHK. AA-dependent DEFB1 upregulation below 20 mM predicts in vitro antimicrobial activity as well as glucose- and AA-dependent CAMP and IFNG upregulation. UVC upregulates CAMP and DEFB1 genes but UVA only upregulates the DEFB1 gene. UVC is a previously unrecognized APE in human cells. Our results suggest that glucose upregulates CAMP in an IFN-γ-independent manner. AA is an elicitor of innate immunity that will challenge the current concept of late activation of adaptive immunity of this vitamin. These results could be useful in designing new potential drugs and devices to combat skin infections. PMID:25815330

  16. Noninvasive electromagnetic fields on keratinocyte growth and migration. (United States)

    Huo, Ran; Ma, Qianli; Wu, James J; Chin-Nuke, Kayla; Jing, Yuqi; Chen, Juan; Miyar, Maria E; Davis, Stephen C; Li, Jie


    Although evidence has shown that very small electrical currents produce a beneficial therapeutic result for wounds, noninvasive electromagnetic field (EMF) therapy has consisted mostly of anecdotal clinical reports, with very few well-controlled laboratory mechanistic studies. In this study, we evaluate the effects and potential mechanisms of a noninvasive EMF device on skin wound repair. The effects of noninvasive EMF on keratinocytes and fibroblasts were assessed via proliferation and incisional wound model migration assays. cDNA microarray and RT-PCR were utilized to assess genetic expression changes in keratinocytes after noninvasive EMF treatment. In vitro analyses with human skin keratinocyte cultures demonstrated that noninvasive EMFs have a strong effect on accelerating keratinocyte migration and a relatively weaker effect on promoting keratinocyte proliferation. The positive effects of noninvasive EMFs on cell migration and proliferation seem keratinocyte-specific without such effects seen on dermal fibroblasts. cDNA microarray and RT-PCR performed revealed increased expression of CRK7 and HOXC8 genes in treated keratinocytes. This study suggests that a noninvasive EMF accelerates wound re-epithelialization through a mechanism of promoting keratinocyte migration and proliferation, possibly due to upregulation of CRK7 and HOXC8 genes. Copyright 2010 Elsevier Inc. All rights reserved.

  17. Protein extract of ultraviolet-irradiated human skin keratinocytes promote the expression of mitogen-activated protein kinases, nuclear factor-κB and interferon regulatory factor-3 in Langerhans cells via Toll-like receptor 2 and 4. (United States)

    Wang, Xiao-Yong; Tao, Cheng-Jun; Wu, Qiao-Yun; Yuan, Cheng-Da


    In this study, we investigated whether the protein extract of ultraviolet-irradiated human skin keratinocytes can activate Toll-like receptor 2 and Toll-like receptor 4 of Langerhans cells and induce the downstream gene expression of mitogen-activated protein kinases, nuclear factor-κB and interferon regulatory factor-3. The protein expression of mitogen-activated protein kinases, nuclear factor-κB and interferon regulatory factor-3 in Langerhans cells and the protein expression of HSP60, HSP70 and β-defensin 2 in keratinocytes were examined using Western blot analysis. Langerhans cells were pretreated with or without Toll-like receptor 2 and Toll-like receptor 4 siRNA. We found that the protein extract of ultraviolet-irradiated keratinocytes upregulated the expression of mitogen-activated protein kinases, nuclear factor-κB and interferon regulatory factor-3 in Langerhans cells via Toll-like receptor 2 and Toll-like receptor 4. We also found that ultraviolet radiation upregulated the expression HSP60, HSP70 and β-defensin 2 in keratinocytes. Our previous study demonstrated that ultraviolet radiation upregulated Toll-like receptor 2 and Toll-like receptor 4 expression in Langerhans cells. Ultraviolet radiation also upregulated mitogen-activated protein kinases and nuclear factor-κB/p65 expression via Toll-like receptor 2 and Toll-like receptor 4, and upregulated interferon regulatory factor-3 expression partially via Toll-like receptor 4. So we conclude that ultraviolet radiation can directly or indirectly activate keratinocytes to induce endogenous ligands which stimulate Toll-like receptor 2- or Toll-like receptor 4-dependent signaling cascade in Langerhans cells, sequentially influence innate and adaptive immune responses. © 2013 John Wiley & Sons A/S.

  18. Concomitant granular cell tumor and balanitis xerotica obliterans of the foreskin: A case report and literature review

    Directory of Open Access Journals (Sweden)

    Shaun AC Medlicott, MD, FRCPC


    Full Text Available Balanitis xerotica obliterans is a chronic dermatosis that frequently involves the glans penis and the foreskin. Granular cell tumor is a benign tumor that may rarely involve the penis, but involvement of the foreskin is exceedingly rare. It may result in thickening and ulceration of the overlying epidermis, which can mimic squamous cell carcinoma. An association of these two lesions, one very common and one extremely uncommon, arising concomitantly in the penile foreskin has not been previously documented. A 23-year-old patient with phimosis and a subcutaneous foreskin nodule presented for a medical circumcision. The microscopic examination demonstrated balanitis xerotica obliterans and granular cell tumor, occurring in continuity in the foreskin. To our knowledge, this is the first reported example of these two lesions arising simultaneously in the male genitalia.

  19. Identification of C/EBPα as a novel target of the HPV8 E6 protein regulating miR-203 in human keratinocytes.

    Directory of Open Access Journals (Sweden)

    Anna M Marthaler


    Full Text Available Patients suffering from Epidermodysplasia verruciformis (EV, a rare inherited skin disease, display a particular susceptibility to persistent infection with cutaneous genus beta-human papillomavirus (beta-HPV, such as HPV type 8. They have a high risk to develop non-melanoma skin cancer at sun-exposed sites. In various models evidence is emerging that cutaneous HPV E6 proteins disturb epidermal homeostasis and support carcinogenesis, however, the underlying mechanisms are not fully understood as yet. In this study we demonstrate that microRNA-203 (miR-203, a key regulator of epidermal proliferation and differentiation, is strongly down-regulated in HPV8-positive EV-lesions. We provide evidence that CCAAT/enhancer-binding protein α (C/EBPα, a differentiation-regulating transcription factor and suppressor of UV-induced skin carcinogenesis, directly binds the miR-203 gene within its hairpin region and thereby induces miR-203 transcription. Our data further demonstrate that the HPV8 E6 protein significantly suppresses this novel C/EBPα/mir-203-pathway. As a consequence, the miR-203 target ΔNp63α, a proliferation-inducing transcription factor, is up-regulated, while the differentiation factor involucrin is suppressed. HPV8 E6 specifically down-regulates C/EBPα but not C/EBPβ expression at the transcriptional level. As shown in knock-down experiments, C/EBPα is regulated by the acetyltransferase p300, a well-described target of cutaneous E6 proteins. Notably, p300 bound significantly less to the C/EBPα regulatory region in HPV8 E6 expressing keratinocytes than in control cells as demonstrated by chromatin immunoprecipitation. In situ analysis confirmed congruent suprabasal expression patterns of C/EBPα and miR-203 in non-lesional skin of EV-patients. In HPV8-positive EV-lesions both factors are potently down-regulated in vivo further supporting our in vitro data. In conclusion our study has unraveled a novel p300/C/EBPα/mir-203-dependent

  20. Antioxidant and Anti-Inflammatory Effects of Selected Natural Compounds Contained in a Dietary Supplement on Two Human Immortalized Keratinocyte Lines

    Directory of Open Access Journals (Sweden)

    Elena Fasano


    Full Text Available Several advantages may derive from the use of dietary supplements containing multiple natural antioxidants and/or anti-inflammatory agents. At present, however, there is scarce information on the properties and potential of combined supplements. To fill the gap, the antioxidant and anti-inflammatory activities exerted by a combination of seven natural components (coenzyme Q10, krill oil, lipoic acid, resveratrol, grape seed oil, α-tocopherol, and selenium contained in a dietary supplement used for the prevention of skin disorders were investigated in vitro. Each component was administered, alone or in combination, to human keratinocytes, and the inhibition of Reactive Oxygen Species production and lipid peroxidation as well as the ability to reduce inflammatory cytokine secretion and to modulate Nuclear Factor-κB pathway was evaluated. The combination exhibited high antioxidant activity and in specific conditions the combination’s efficiency was higher than that of the most powerful components administered individually. Moreover, the combination showed remarkable anti-inflammatory properties. It reduced more efficiently than each component the secretion of Monocyte Chemoattractant Protein-1, a crucial cytokine for the development of chronic inflammation in skin, and inhibited Nuclear Factor-κB molecular pathway. Overall, our findings suggest that the combined formulation may have the potential to powerfully inhibit oxidative stress and inflammation at skin level.

  1. Oxidative stress and DNA damage induced by cadmium in the human keratinocyte HaCaT cell line: role of glutathione in the resistance to cadmium. (United States)

    Nzengue, Yves; Steiman, Régine; Garrel, Catherine; Lefèbvre, Emmanuel; Guiraud, Pascale


    Cadmium affects the cellular homeostasis and generates damage via complex mechanisms involving interactions with other metals and oxidative stress induction. In this work we used a human keratinocyte cell line (HaCaT) as a model to study the oxidative damage induced by cadmium to cellular macromolecules, its effect on the antioxidant systems and the role of glutathione in cell protection toward cadmium toxicity. The cells were incubated for 24 and 48 h with cadmium (3, 15, 50 and 100 microM). High doses of cadmium were required to induce a cytotoxicity: 100 microM lead to 30% mortality after 24h and 50% after 48 h. The oxidation of lipids and proteins and the DNA damage, respectively, assessed by thiobarbituric acid reactants determination, thiol group measurement and comet assay, were observed for 50-100 microM cadmium. The cytotoxic effects were strongly correlated to the cellular cadmium content. The glutathione peroxidase and the catalase activities were decreased, while the glutathione reductase activity and the glutathione concentration were increased after cadmium treatment. The superoxide dismutases activities were unchanged. A depletion in glutathione prior to cadmium exposure increased the cytotoxic effects and provoked DNA damage. Our results suggested that the hydroxyl radical could be the major compound involved in the oxidative stress generated by cadmium and that glutathione could play a major role in the protection of HaCaT cells from cytotoxicity but mostly from DNA damage induced by cadmium.

  2. Protective effect of Vaccinium myrtillus extract against UVA- and UVB-induced damage in a human keratinocyte cell line (HaCaT cells). (United States)

    Calò, Rossella; Marabini, Laura


    Recently, the field of skin protection have shown a considerable interest in the use of botanicals. Vaccinium myrtillus contains several polyphenols and anthocyanins with multiple pharmacological properties. The purpose of our study was to examine whether a water-soluble V. myrtillus extract (dry matter 12.4%; total polyphenols 339.3mg/100 g fw; total anthocyanins 297.4 mg/100 g fw) was able to reduce UVA- and UVB-induced damage using a human keratinocyte cell line (HaCaT). HaCaT cells were pretreated for 1h with extract in a serum-free medium and then irradiated with UVA (8-40 J/cm(2)) and UVB (0.008-0.72 J/cm(2)) rays. All experiments were performed 24h after the end of irradiation, except for oxidative stress tests. The extract was able to reduce the UVB-induced cytotoxicity and genotoxicity (studied by comet and micronucleous assays) at lower doses. V. myrtillus extract reduced lipid peroxidation UVB-induced, but had no effect against the ROS UVB-produced. With UVA-induced damage V. myrtillus reduced genotoxicity as well as the unbalance of redox intracellular status. Moreover our extract reduced the UVA-induced apoptosis, but had no effect against the UVB one. V. myrtillus extract showed its free radical scavenging properties reducing oxidative stress and apoptotic markers, especially in UVA-irradiated cells. Copyright © 2014 Elsevier B.V. All rights reserved.

  3. Cytotoxicity and anti-inflammatory effects of zinc ions and eugenol during setting of ZOE in immortalized human oral keratinocytes grown as three-dimensional spheroids. (United States)

    Lee, Jung-Hwan; Lee, Hae-Hyoung; Kim, Kyoung-Nam; Kim, Kwang-Mahn


    The objective of this study is to assess the cytotoxic and anti-inflammatory effects of ZOE cement during setting in two-dimensional (2D) or three-dimensional (3D) cultures of immortalized human oral keratinocytes (IHOKs) with determining the extract components responsible for these effects. Extracts of mixed ZOE at different stages of setting were analyzed by a digital pH meter, ICP-MS, and GC-MS. Serial concentrations of extract and their mixture of ZnCl2, ZnSO4·H2O, and eugenol liquid were added to the 2D and 3D IHOK cultures to determine the half maximal effective concentration in investigating the cause of cytotoxicity by means of WST assay and to investigate mRNA expression levels of inflammatory cytokines by RT-PCR. Zn(2+) and eugenol (4-19 ppm) were detected in the extracts. In the early setting stage, significant cytotoxicity was observed in the 2D and 3D IHOK cultures (Peugenol was not detectable under 100 ppm. Along with the lower levels of inflammatory cytokine gene expressions in the extract, treatment of the 2D IHOKs with Zn(2+) alone and treatment of the 3D IHOKs with Zn(2+) plus eugenol resulted in significantly lower expression levels of IL-1β, IL-6, and IL-8 (Peugenol. Cytotoxic and anti-inflammatory effects differed between the 2D and 3D IHOK cultures. Copyright © 2016. Published by Elsevier Ltd.

  4. Nerve growth factor regulates the expression of vascular endothelial growth factor in human HaCaT keratinocytes via PI3K/mTOR pathway. (United States)

    Zhang, J; Ma, W Y


    Decades of research have provided the data to confirm the hypothesis that there is bidirectional communication between the central nervous system and the immune system in psoriasis pathogenesis, but the contribution of the cutaneous neural system remains underexplored. In this study, we evaluated the molecular mechanisms by which nerve growth factor (NGF) regulates hypoxia-inducible factor-1α (HIF-1α) and vascular endothelial growth factor (VEGF) production. The mRNA and protein levels of VEGF secretion from HaCaT cells by NGF were increased in a concentration-dependent manner. In addition, the NGF- induced increase in VEGF is accompanied by an increase in HIF-1α, but not HIF-2α or HIF-1β. However, this increase is abrogated by pretreatment with a mammalian target of rapamycin (mTOR) inhibitor rapamycin. Pharmacologic inhibitors of the Trk tyrosine kinase, PI-3 kinase, and mTOR pathways prevent NGF-stimulated increases in HIF-1α and VEGF. Mutation of the siRNA-mediated silencing of HIF-1α expression blocks NGF-induced increases in VEGF transcription. Our study indicates that NGF regulates the expression of VEGF through the PI3K/mTOR signaling pathway in human HaCaT keratinocytes.

  5. Protective Effect of Mangifera indica Linn., Cocos nucifera Linn., and Averrhoa carambola Linn. Extracts against Ultraviolet B-Induced Damage in Human Keratinocytes

    Directory of Open Access Journals (Sweden)

    Chalinee Ronpirin


    Full Text Available This study was aimed at investigating the antioxidant activity of Mangifera indica Linn., Cocos nucifera Linn., and Averrhoa carambola Linn. and their biological effect on human keratinocytes affected by the ultraviolet B (UVB, a major cause of cell damage and skin cancer through induction of DNA damage, production of reactive oxygen species (ROS, and apoptosis. The richest antioxidant activity was found in ethanol fraction of M. indica (21.32 ± 0.66 mg QE/g dry weight, while the lowest one was found in aqueous fractions of M. indica and C. nucifera (1.76 ± 2.10 and 1.65 ± 0.38 mg QE/g dry weight, respectively. Ethanol and aqueous fractions of A. carambola (250 µg/mL significantly reduced the number of apoptotic cells. The expression of cleaved caspase 3 in UVB-treated group was significantly greater than that in untreated group. Both fractions of A. carambola (50, 100, and 250 µg/mL significantly decreased the expression of cleaved caspase 3. Regarding the induction of DNA repair, ethanol (100 and 250 µg/mL and aqueous (50, 100 and 250 µg/mL fractions of A. carambola significantly decreased the percentage of cyclobutane pyrimidine dimers (CPD. Taken together, our results suggest that both fractions of A. carambola may be potentially developed for dermal applications.

  6. A foreign body within the foreskin of a 10-year-old boy | Essa ...

    African Journals Online (AJOL)

    Self-inserted foreign bodies in the adult male genitalia are typically the result of autoerotic activity and occasionally require removal by a urologist. In children, the problem is extremely rare and usually accidental. We present a case in which a small action figure was inserted in the foreskin of a child. A 10-year-old boy ...

  7. Interactive effects of 2,3,7,8-tetrachlorodibenzo-p-dioxin and retinoids on proliferation and differentiation in cultured human keratinocytes: quantification of cross-linked envelope formation

    Energy Technology Data Exchange (ETDEWEB)

    Berkers, J.A.M. [Research Inst. of Toxicology, Utrecht Univ. (Netherlands); Hassing, I. [Research Inst. of Toxicology, Utrecht Univ. (Netherlands); Spenkelink, B. [Dept. of Toxicology, Wageningen Agricultural Univ. (Netherlands); Brouwer, A. [Dept. of Toxicology, Wageningen Agricultural Univ. (Netherlands); Blaauboer, B.J. [Research Inst. of Toxicology, Utrecht Univ. (Netherlands)


    Dioxins are potent inducers of chloracne in humans. This skin aberration can be interpreted as an altered differentiation pattern of acinar sebaceous base cells and a change in the rate of terminal differentiation of the keratinocytes. We measured this rate induced by 2,3,7,8-tetrachlorodibenzo-p-dioxin (TCDD) in primary cultures of human keratinocytes. As parameters for differentiation, we quantified the {sup 35}S-methionine incorporation into cross-linked envelopes (revealing the total CLE biomass), as well as the number of microscopically visible CLEs. It was shown that TCDD is a very potent inducer of both CLE biomass and number with a half-maximal effect concentration (EC{sub 50}) of 1.4 nM. CLE biomass was maximally increased 10-fold and the number of cells in culture producing a CLE was increased from 15% in control cultures to maximally 75% of the cells in TCDD-treated cultures. Both effects were Ca{sup 2+}-dependent and increased with elevated cell density, being optimal in post-confluent cultures. Retinoic acid dose-dependently decreased the effect of 10{sup -8} M TCDD, 10{sup -6} M having a nearly complete antagonistic action. This interaction of retinoic acid with TCDD-induced differentiation was non-competitive. Retinol was equally potent as an antagonist of the TCDD-induced elevation of CLE formation as compared with retinoic acid. Retinyl palmitate and etretinate were not very effective as TCDD antagonists. Supplementation of hydrocortisone suppressed the TCDD-induced keratinocyte differentiation. It was concluded that CLE biomass quantification provides a reliable and sensitive parameter for keratinocyte differentiation. In this in vitro system it is shown that TCDD strongly induces a switch from proliferation to terminal differentiation and that this effect can be antagonized effectively by retinoic acid and retinol. (orig.)

  8. Coordination of different ligands to copper(II) and cobalt(III) metal centers enhances Zika virus and dengue virus loads in both arthropod cells and human keratinocytes. (United States)

    Dutta, Shovan; Celestine, Michael J; Khanal, Supreet; Huddleston, Alexis; Simms, Colin; Arca, Jessa Faye; Mitra, Amlan; Heller, Loree; Kraj, Piotr J; Ledizet, Michel; Anderson, John F; Neelakanta, Girish; Holder, Alvin A; Sultana, Hameeda


    Trace elements such as copper and cobalt have been associated with virus-host interactions. However, studies to show the effect of conjugation of copper(II) or cobalt(III) metal centers to thiosemicarbazone ligand(s) derived from either food additives or mosquito repellent such as 2-acetylethiazole or citral, respectively, on Zika virus (ZIKV) or dengue virus (serotype 2; DENV2) infections have not been explored. In this study, we show that four compounds comprising of thiosemicarbazone ligand derived from 2-acetylethiazole viz., (E)-N-ethyl-2-[1-(thiazol-2-yl)ethylidene]hydrazinecarbothioamide (acetylethTSC) (compound 1), a copper(II) complex with acetylethTSC as a ligand (compound 2), a thiosemicarbazone ligand-derived from citral (compound 3) and a cobalt(III) complex with a citral-thiosemicarbazone ligand (compound 4) increased DENV2 and ZIKV replication in both mosquito C6/36 cells and human keratinocytes (HaCaT cells). Treatment of both cell lines with compounds 2 or 4 showed increased dengue viral titers at all three tested doses. Enhanced dengue viral plaque formation was also noted at the tested dose of 100μM, suggesting higher production of infectious viral particles. Treatment with the compounds 2 or 4 enhanced ZIKV and DENV2 RNA levels in HeLa cell line and primary cultures of mouse bone marrow derived dendritic cells. Also, pre- or post treatments with conjugated compounds 2 or 4 showed higher loads of ZIKV or DENV2 envelope (E) protein in HaCaT cells. No changes in loads of E-protein were found in ZIKV-infected C6/36 cells, when compounds were treated after infection. In addition, we tested bis(1,10-phenanthroline)copper(II) chloride ([Cu(phen)2]Cl2, (compound 5) and tris(1,10-phenanthroline)cobalt(III) chloride ([Co(phen)3]Cl3, (compound 6) that also showed enhanced DENV2 loads. Also, we found that copper(II) chloride dehydrate (CuCl2·2H2O) or cobalt(II) chloride hexahydrate (CoCl2·6H2O) alone had no effects as "free" cations. Taken together

  9. Photoprotective Potential of Glycolic Acid by Reducing NLRC4 and AIM2 Inflammasome Complex Proteins in UVB Radiation-Induced Normal Human Epidermal Keratinocytes and Mice. (United States)

    Hung, Sung-Jen; Tang, Sheau-Chung; Liao, Pei-Yun; Ge, Jheng-Siang; Hsiao, Yu-Ping; Yang, Jen-Hung


    Exposure to UVB radiation induces inflammation and free radical-mediated oxidative stress through reactive oxygen species (ROS) that play a crucial role in the induction of skin cancer. Glycolic acid (GA) is frequently used in cosmetics and dermatology. The aim of the study was to analyze the photoprotective mechanisms through which GA retards UVB-induced ROS accumulation and inflammation in normal human epidermal keratinocytes (NHEKs) and mice skin, respectively. NHEK cell line and C57BL/6J mice were treated with GA (0.1 or 5 mM) for 24 h followed by UVB irradiation. ROS accumulation, DNA damage, and expression of inflammasome complexes (NLRP3, NLRC4, ASC, and AIM2) were measured in vitro. Epidermal thickness and inflammasome complex proteins were analyzed in vivo. GA significantly prevented UVB-induced loss of skin cell viability, ROS formation, and DNA damage (single and double strands DNA break). GA suppressed the mRNA expression levels of NLRC4 and AIM2 among the inflammasome complexes. GA also blocked interleukin (IL)-1β by reducing the activity of caspase-1 in the NHEKs. Treatment with GA (2%) inhibited UVB-induced inflammation marker NLRC4 protein levels in mouse dorsal skin. The photoprotective activity of GA was ascribed to the inhibition of ROS formation and DNA damage, as well as a reduction in the activities of inflammasome complexes and IL-1β. We propose that GA has anti-inflammatory and photoprotective effects against UVB irradiation. GA is potentially beneficial to the protection of human skin from UV damage.

  10. N-Acetylglutaminoyl-S-farnesyl-L-cysteine (SIG-1191): an anti-inflammatory molecule that increases the expression of the aquaglyceroporin, aquaporin-3, in human keratinocytes. (United States)

    Fernández, José R; Webb, Corey; Rouzard, Karl; Voronkov, Michael; Huber, Kristen L; Stock, Jeffry B; Stock, Maxwell; Gordon, Joel S; Perez, Eduardo


    Isoprenylcysteine (IPC) small molecules were discovered as signal transduction modulating compounds ~25 years ago. More recently, IPC molecules have demonstrated antioxidant and anti-inflammatory properties in a variety of dermal cells as well as antimicrobial activity, representing a novel class of compounds to ameliorate skin conditions and disease. Here, we demonstrate a new IPC compound, N-acetylglutaminoyl-S-farnesyl-L-cysteine (SIG-1191), which inhibits UVB-induced inflammation blocking pro-inflammatory cytokine interleukin-6 (IL-6) and tumor necrosis factor alpha (TNF-α) production. To investigate further the previously reported hydrating potential of IPC compounds, SIG-1191 was tested for its ability to modulate aquaporin expression. Specifically, aquaporin 3 (AQP3) the most abundant aquaporin found in skin has been reported to play a key role in skin hydration, elasticity and barrier repair. Results show here for the first time that SIG-1191 increases AQP3 expression in both cultured normal human epidermal keratinocytes as well as when applied topically in a three-dimensional (3D) reconstructed human skin equivalent. Additionally, SIG-1191 dose dependently increased AQP3 protein levels, as determined by specific antibody staining, in the epidermis of the 3D skin equivalents. To begin to elucidate which signaling pathways SIG-1191 may be modulating to increase AQP3 levels, we used several pharmacological pathway inhibitors and determined that AQP3 expression is mediated by the Mitogen-activated protein kinase/Extracellular signal-regulated kinase kinase (MEK) pathway. Altogether, these data suggest SIG-1191 represents a new IPC derivative with anti-inflammatory activity that may also promote increased skin hydration based on its ability to increase AQP3 levels.

  11. Suppression of Innate Immune Response by Primary Human Keratinocytes Expressing HPV-16 E6 and E7

    National Research Council Canada - National Science Library

    Guess, Jennifer L


    Human papillomavims (HPV) types infect the skin and mucosal epithelium. Lesions resulting from HPV infection can linger for months or years suggesting that HPV - presence goes unnoticed by the host immune system...

  12. Xenobiotic metabolism capacities of human skin in comparison with a 3D-epidermis model and keratinocyte-based cell culture as in vitro alternatives for chemical testing: phase II enzymes. (United States)

    Götz, Christine; Pfeiffer, Roland; Tigges, Julia; Ruwiedel, Karsten; Hübenthal, Ulrike; Merk, Hans F; Krutmann, Jean; Edwards, Robert J; Abel, Josef; Pease, Camilla; Goebel, Carsten; Hewitt, Nicola; Fritsche, Ellen


    The 7th Amendment to the EU Cosmetics Directive prohibits the use of animals in cosmetic testing for certain endpoints, such as genotoxicity. Therefore, skin in vitro models have to replace chemical testing in vivo. However, the metabolic competence neither of human skin nor of alternative in vitro models has so far been fully characterized, although skin is the first-pass organ for accidentally or purposely (cosmetics and pharmaceuticals) applied chemicals. Thus, there is an urgent need to understand the xenobiotic-metabolizing capacities of human skin and to compare these activities to models developed to replace animal testing. We have measured the activity of the phase II enzymes glutathione S-transferase, UDP-glucuronosyltransferase and N-acetyltransferase in ex vivo human skin, the 3D epidermal model EpiDerm 200 (EPI-200), immortalized keratinocyte-based cell lines (HaCaT and NCTC 2544) and primary normal human epidermal keratinocytes. We show that all three phase II enzymes are present and highly active in skin as compared to phase I. Human skin, therefore, represents a more detoxifying than activating organ. This work systematically compares the activities of three important phase II enzymes in four different in vitro models directly to human skin. We conclude from our studies that 3D epidermal models, like the EPI-200 employed here, are superior over monolayer cultures in mimicking human skin xenobiotic metabolism and thus better suited for dermatotoxicity testing. © 2012 John Wiley & Sons A/S.

  13. Defensive effects of fullerene-C60 dissolved in squalane against the 2,4-nonadienal-induced cell injury in human skin keratinocytes HaCaT and wrinkle formation in 3D-human skin tissue model. (United States)

    Kato, Shinya; Aoshima, Hisae; Saitoh, Yasukazu; Miwa, Nobuhiko


    We dissolved fullerene-C60 in squalane (LipoFullerene; LF-SQ, C60-eq.: 500 ppm) and examined its defensive effects against 2,4-nonadienal (NDA)-induced cell injury in HaCaT keratinocytes and wrinkle formation in three dimensional (3D)-human skin tissue model. NDA is an analog of 4-hydroxynonenal, one of major causes for human body odor indicative of aging and a lipophilic cell injury factor. Cell viability (% of the control) decreased to 31.6% on treatment with NDA (40 microM), but it increased to 66.0-97.5% when LF-SQ of 1-4% (C60-eq.: 5-20 ppm) was administered for 5 hr before NDA addition. The defensive effect by LF-SQ was superior to that of "squalane" alone at the same doses. NDA-induced DNA-fragmentation in HaCaT cells was suppressed by LF-SQ administered for 5 hr before NDA treatment, and LF-SQ protected HaCaT cells against apoptosis-like cell death. LF-SQ did not appreciably defend against hydrogen peroxide, though LF-SQ effectively defended against tert-butylhydroperoxide, a type of the intermediate hydrophilicity-lipophilicity degree out of other reactive oxygen species. The scanning electron microscopy demonstrated that NDA caused wrinkles and abnormal scales on keratinocytes of 3D-human skin tissue model, and structural homogeneity of the interstratum was broken, any of which were, however, markedly suppressed with LF-SQ. Squalane alone exhibited defensive effect against the skin tissue injury to some extent, but which was inferior to LF-SQ. LF-SQ might effectively capture and scavenge lipid radicals generated inside the cell membrane, because squalane acts as a lipophilic carrier of C60. C60 dissolved in squalane can be expected to serve as a cosmeceutical ingredient for anti-wrinkle formation.

  14. Baicalin downregulates Porphyromonas gingivalis lipopolysaccharide-upregulated IL-6 and IL-8 expression in human oral keratinocytes by negative regulation of TLR signaling.

    Directory of Open Access Journals (Sweden)

    Wei Luo

    Full Text Available Periodontal (gum disease is one of the main global oral health burdens and severe periodontal disease (periodontitis is a leading cause of tooth loss in adults globally. It also increases the risk of cardiovascular disease and diabetes mellitus. Porphyromonas gingivalis lipopolysaccharide (LPS is a key virulent attribute that significantly contributes to periodontal pathogenesis. Baicalin is a flavonoid from Scutellaria radix, an herb commonly used in traditional Chinese medicine for treating inflammatory diseases. The present study examined the modulatory effect of baicalin on P. gingivalis LPS-induced expression of IL-6 and IL-8 in human oral keratinocytes (HOKs. Cells were pre-treated with baicalin (0-80 µM for 24 h, and subsequently treated with P. gingivalis LPS at 10 µg/ml with or without baicalin for 3 h. IL-6 and IL-8 transcripts and proteins were detected by real-time polymerase chain reaction and enzyme-linked immunosorbent assay, respectively. The expression of nuclear factor-κB (NF-κB, p38 mitogen-activated protein kinase (MAPK and c-Jun N-terminal kinase (JNK proteins was analyzed by western blot. A panel of genes related to toll-like receptor (TLR signaling was examined by PCR array. We found that baicalin significantly downregulated P. gingivalis LPS-stimulated expression of IL-6 and IL-8, and inhibited P. gingivalis LPS-activated NF-κB, p38 MAPK and JNK. Furthermore, baicalin markedly downregulated P. gingivalis LPS-induced expression of genes associated with TLR signaling. In conclusion, the present study shows that baicalin may significantly downregulate P. gingivalis LPS-upregulated expression of IL-6 and IL-8 in HOKs via negative regulation of TLR signaling.

  15. Manganese superoxide dismutase-mediated inside-out signaling in HaCaT human keratinocytes and SKH-1 mouse skin. (United States)

    Holley, Aaron K; Xu, Yong; Noel, Teresa; Bakthavatchalu, Vasudevan; Batinic-Haberle, Ines; St Clair, Daret K


    Inside-out signaling occurs when changes in organellar activity lead to alterations in cell signaling that culminate at the cell surface. Mitochondria are vital signaling platforms in cells that participate in radiation-induced inside-out signaling. However, the importance of the reactive oxygen species (ROS)-scavenging ability of mitochondria through manganese superoxide dismutase (MnSOD) is not established. Here, we used MnSOD heterozygous knockout and transgenic SKH-1 hairless, albino mice and MnSOD knockdown and overexpressing HaCaT human keratinocytes to study the effects of MnSOD on ultraviolet (UV) radiation-induced inside-out signaling. There is an inverse correlation between MnSOD expression and UV-induced activation of epidermal growth factor receptor (EGFR), as determined by phosphorylation at Tyr1068, both in vitro and in vivo, which correlates with increased ROS production (as measured by dihydroethidium fluorescence). EGFR activation is dependent on Nox4 expression and Src kinase activation, with Src activation upstream of Nox4 in regulation of EGFR activation. Enhanced EGFR activation in MnSOD knockdown cells is abrogated by treatment with the SOD mimetic MnTnBuOE-2-PyP(5+). Our data demonstrate that the ROS-scavenging ability of mitochondria, through the expression of MnSOD, is important for UV-induced inside-out signaling. Decreased MnSOD expression enhances UV-induced activation of different oncogenic signaling pathways through an inside-out signaling-mediated mechanism. Inhibition of inside-out signaling by MnTnBuOE-2-PyP(5+) mimics the effect of endogenous MnSOD, suggesting that pharmacological intervention by SOD mimetics could play an important role in the prevention of aberrant cell signaling, which may contribute to carcinogenesis and may prove valuable for the treatment or prevention of cancer in the future.

  16. Cystathionine metabolic enzymes play a role in the inflammation resolution of human keratinocytes in response to sub-cytotoxic formaldehyde exposure. (United States)

    Lee, Eunyoung; Kim, Hyoung-June; Lee, Moonyoung; Jin, Sun Hee; Hong, Soo Hyun; Ahn, Seyeon; Kim, Sae On; Shin, Dong Wook; Lee, Seung-Taek; Noh, Minsoo


    Low-level formaldehyde exposure is inevitable in industrialized countries. Although daily-life formaldehyde exposure level is practically impossible to induce cell death, most of mechanistic studies related to formaldehyde toxicity have been performed in cytotoxic concentrations enough to trigger cell death mechanism. Currently, toxicological mechanisms underlying the sub-cytotoxic exposure to formaldehyde are not clearly elucidated in skin cells. In this study, the genome-scale transcriptional analysis in normal human keratinocytes (NHKs) was performed to investigate cutaneous biological pathways associated with daily life formaldehyde exposure. We selected the 175 upregulated differentially expressed genes (DEGs) and 116 downregulated DEGs in NHKs treated with 200μM formaldehyde. In the Gene Ontology (GO) enrichment analysis of the 175 upregulated DEGs, the endoplasmic reticulum (ER) unfolded protein response (UPR) was identified as the most significant GO biological process in the formaldeyde-treated NHKs. Interestingly, the sub-cytotoxic formaldehyde affected NHKs to upregulate two enzymes important in the cellular transsulfuration pathway, cystathionine γ-lyase (CTH) and cystathionine-β-synthase (CBS). In the temporal expression analysis, the upregulation of the pro-inflammatory DEGs such as MMP1 and PTGS2 was detected earlier than that of CTH, CBS and other ER UPR genes. The metabolites of CTH and CBS, l-cystathionine and l-cysteine, attenuated the formaldehyde-induced upregulation of pro-inflammatory DEGs, MMP1, PTGS2, and CXCL8, suggesting that CTH and CBS play a role in the negative feedback regulation of formaldehyde-induced pro-inflammatory responses in NHKs. In this regard, the sub-cytotoxic formaldehyde-induced CBS and CTH may regulate inflammation fate decision to resolution by suppressing the early pro-inflammatory response. Copyright © 2016 Elsevier Inc. All rights reserved.

  17. Targeted disruption of core 1 β1,3-galactosyltransferase (C1galt1 induces apical endocytic trafficking in human corneal keratinocytes.

    Directory of Open Access Journals (Sweden)

    Ana Guzman-Aranguez

    Full Text Available BACKGROUND: Exposed mucosal surfaces limit constitutive endocytosis under physiological conditions to prevent uptake of macromolecules and pathogens and, therefore, cellular damage. It is now accepted that cell surface mucins, a group of high molecular weight glycoproteins on the epithelial glycocalyx, defined by their extensive O-glycosylation, play a major role in maintaining barrier function in these surfaces, but the precise mechanisms are unclear. METHODOLOGY/PRINCIPAL FINDINGS: In this work, we utilized a stable tetracycline-inducible RNA interfering system targeting the core 1 ß1,3-galactosyltransferase (C1galt1 or T-synthase, a critical galactosyltransferase required for the synthesis of core 1 O-glycans, to explore the role of mucin-type carbohydrates in apical endocytic trafficking in human corneal keratinocytes. Using cell surface biotinylation and subcellular fractionation, we found increased accumulation of plasma membrane protein in endosomes after C1galt1 depletion. Confocal laser scanning microscopy and fluorometry revealed increased translocation of negatively charged fluorescent nanospheres after C1galt1 knockdown sustained by an active transport process and largely independent of apical intercellular junctions. Internalization of nanospheres could be blocked by dynasore, nocodazole, chlorpromazine, and hyperosmotic sucrose, suggesting a mechanism for clathrin-coated pit budding and vesicular trafficking. This possibility was supported by experiments showing nanosphere colocalization with clathrin heavy chain in the cytoplasm. CONCLUSIONS/SIGNIFICANCE: Together, the data suggest that core 1 O-glycans contribute to maintenance of apical barrier function on exposed mucosal surfaces by preventing clathrin-mediated endocytosis.

  18. Chemical derivatization combined with capillary LC or MALDI-TOF MS for trace determination of lipoic acid in cosmetics and integrated protein expression profiling in human keratinocytes. (United States)

    Tsai, Chia-Ju; Lin, Ying-Chi; Chen, Yen-Ling; Feng, Chia-Hsien


    Lipoic acid (LA) is an essential cofactor in mitochondrial enzymes and an ideal antioxidant in prokaryotic and eukaryotic cells. Capillary liquid chromatography coupled with ultraviolet detection (CapLC-UV) and matrix-assisted laser desorption ionization time-of-flight mass spectrometry (MALDI-TOF MS) are two environmentally friendly methods for determining LA. In this study, a pre-column microwave-assisted derivatization with 4-bromomethyl-6,7-dimethoxycoumarin enhanced the UV absorbance of LA and was monitored at 345 nm by CapLC-UV. Gradient separation was performed using a reversed-phase C18 column with a mobile phase consisting of acetonitrile-0.1% formic acid solution. The ionization of LA was increased, and the LA derivative was detected by MALDI-TOF MS at m/z 683 with an α-cyano-4-hydroxycinnamic acid matrix. The linear response ranged from 0.1 to 40 μM with a correlation coefficient of 0.999. The CapLC-UV and MALDI-TOF MS had detection limits of 5 and 4 fmol, respectively. These methods effectively detected LA in dietary supplements and cosmetics. Cellular proteomes of a human keratinocyte cell line (HaCaT) irradiated with UV radiation were also compared with and without LA treatment. The cellular proteomes were identified by nanoultra performance LC with LTQ Orbitrap system after trypsin digestion. Protein identification was performed by simultaneous peptide sequencing and MASCOT search. The analysis revealed changes in several proteins, including CDC42, TPI1, HNRPA2B1, PRDX1, PTGES3 and MYL6. Copyright © 2014 Elsevier B.V. All rights reserved.

  19. Filaggrin silencing by shRNA directly impairs the skin barrier function of normal human epidermal keratinocytes and then induces an immune response

    Energy Technology Data Exchange (ETDEWEB)

    Dang, N.N. [Department of Dermatology, Jinan Central Hospital Affiliated to Shandong University, Jinan, Shandong Province (China); College of Life Science, Shandong Normal University, Jinan, Shandong Province (China); Pang, S.G. [Department of Endocrinology, Jinan Central Hospital Affiliated to Shandong University, Jinan, Shandong Province (China); Song, H.Y. [Department of Dermatology, Jinan Central Hospital Affiliated to Shandong University, Jinan, Shandong Province (China); An, L.G. [College of Life Science, Shandong Normal University, Jinan, Shandong Province (China); Ma, X.L. [Central Laboratory, Jinan Central Hospital Affiliated to Shandong University, Jinan, Shandong Province (China)


    The objective of this study was to investigate whether a single defect in skin barrier function simulated by filaggrin silencing could induce Th2-predominant inflammation. Filaggrin gene expression was silenced in cultured normal human epidermal keratinocytes (NHEKs) using small hairpin RNA (shRNA, GTTGGCTCAAGCATATTATTT). The efficacy of silencing was confirmed by polymerase chain reaction (PCR) and Western blotting. Filaggrin-silenced cells (LV group), shRNA control cells (NC group), and noninfected cells (Blank group) were evaluated. The expression of cornified cell envelope-related proteins, including cytokeratin (CK)-5, -10, -14, loricrin, involucrin, and transglutaminase (TGM)-1, was detected by Western blotting. Interleukins (IL)-2, IL-4, IL-5, IL-12p70, IL-13, and interferon-gamma (IFN-γ) were detected by enzyme-linked immunosorbent assay (ELISA). After filaggrin was successfully silenced by shRNA, the expressions of CK-5, -10, -14, involucrin, and TGM-1 in NHEKs were significantly downregulated compared to the Blank and NC groups (P<0.05 or P<0.01); only loricrin expression was markedly upregulated (P<0.01). Filaggrin silencing also resulted in significant increases of IL-2, IL-4, IL-5, and IL-13 (P<0.05 or P<0.01), and significant decreases of IL-12p70 and IFN-γ (P<0.01) compared with cells in the Blank and NC groups. Filaggrin silencing impaired normal skin barrier function mainly by targeting the cornified cell envelope. The immune response after filaggrin silencing was characterized by Th2 cells, mainly because of the inhibition of IFN-γ expression. Lack of filaggrin may directly impair skin barrier function and then further induce the immune response.

  20. An in vitro study on the cytotoxicity of bismuth oxychloride nanosheets in human HaCaT keratinocytes. (United States)

    Gao, Xiaoya; Zhang, Xiaochao; Wang, Yawen; Wang, Yunfang; Peng, Shiqi; Fan, Caimei


    As an emerging nanomaterial, bismuth oxychloride (BiOCl) has attracted explosive interests in diverse areas. However, how it interfaces with biological systems, particularly its interaction with human cells and the resulting effects are completely unknown. In this paper, the cytotoxicity of BiOCl nanosheets (NSs) was investigated toward a human skin derived cell line (HaCaT). It was found that BiOCl-NSs had no cytotoxicity at low concentrations (<0.5 µg/mL), whereas higher concentrations (5-100 µg/mL) of BiOCl-NSs could trigger toxic effects on HaCaT cells, with changes in cell morphology and impairment of intracellular structures (mitochondria and cytoskeleton). BiOCl-NSs also led to cell apoptosis and cells cycle arrest in G0/G1 phase. Flow cytometric data showed that BiOCl-NSs were effectively incorporated into HaCaT cells. Transmission electron microscope (TEM) images further revealed that BiOCl-NSs sequestered in the lysosomes, mitochondria, nuclei, and vesicles. Results of DCFH-DA assay and nutritional antioxidant N-acetylcysteine (NAC) experiments suggested that an oxidative stress mechanism was involved in the cytotoxic effects of BiOCl-NSs. Taken together, this work represents the first study on the behavior of BiOCl-NSs on human cells, and constitutes the first and essential step for the risk assessment of BiOCl nanomaterials. Copyright © 2015 Elsevier Ltd. All rights reserved.

  1. 20-Hydroxycholecalciferol, product of vitamin D3 hydroxylation by P450scc, decreases NF-kappaB activity by increasing IkappaB alpha levels in human keratinocytes.

    Directory of Open Access Journals (Sweden)

    Zorica Janjetovic

    Full Text Available The side chain of vitamin D3 is hydroxylated in a sequential manner by cytochrome P450scc (CYP11A1 to form 20-hydroxycholecalciferol, which can induce growth arrest and differentiation of both primary and immortalized epidermal keratinocytes. Since nuclear factor-kappaB (NF-kappaB plays a pivotal role in the regulation of cell proliferation, differentiation and apoptosis, we examined the capability of 20-hydroxycholecalciferol to modulate the activity of NF-kappaB, using 1,25-dihydroxycholecalciferol (calcitriol as a positive control. 20-hydroxycholecalciferol inhibits the activation of NFkappaB DNA binding activity as well as NF-kappaB-driven reporter gene activity in keratinocytes. Also, 20-hydroxycholecalciferol induced significant increases in the mRNA and protein levels of the NF-kappaB inhibitor protein, IkappaB alpha, in a time dependent manner, while no changes in total NF-kappaB-p65 mRNA or protein levels were observed. Another measure of NF-kappaB activity, p65 translocation from the cytoplasm into the nucleus was also inhibited in extracts of 20-hydroxycholecalciferol treated keratinocytes. Increased IkappaB alpha was concomitantly observed in cytosolic extracts of 20-hydroxycholecalciferol treated keratinocytes, as determined by immunoblotting and immunofluorescent staining. In keratinocytes lacking vitamin D receptor (VDR, 20-hydroxycholecalciferol did not affect IkappaB alpha mRNA levels, indicating that it requires VDR for its action on NF-kappaB activity. Comparison of the effects of calcitrol, hormonally active form of vitamin D3, with 20-hydrocholecalciferol show that both agents have a similar potency in inhibiting NF-kappaB. Since NF-kappaB is a major transcription factor for the induction of inflammatory mediators, our findings indicate that 20-hydroxycholecalciferol may be an effective therapeutic agent for inflammatory and hyperproliferative skin diseases.

  2. EGF-receptor tyrosine kinase inhibition induces keratinocyte growth arrest and terminal differentiation. (United States)

    Peus, D; Hamacher, L; Pittelkow, M R


    Epidermal keratinocyte growth and differentiation are regulated by specific families of growth factors and receptors. Peptide growth factors of the epidermal growth factor family stimulate proliferation of clonal density human keratinocytes and suppress markers of terminal differentiation in confluent cultures of human keratinocytes. We present evidence that selected inhibitors of activation of the type I human epidermal growth factor receptor (EGFR or HER-1), namely, neutralizing monoclonal antibody to HER-1/EGFR and the specific tyrosine kinase inhibitor PD 153035, potently inhibit proliferation of human keratinocytes in autonomously replicating subconfluent cultures. Coupled to growth arrest is the suppression of HER-1 tyrosine autophosphorylation in inhibitor-treated human keratinocytes. Proliferation and tyrosine autophosphorylation are initially reversible following removal of the inhibitor and restimulation of cells with epidermal growth factor. Sustained inactivation of HER-1 in autonomously replicating cultures of human keratinocytes induces expression of keratin 1 and keratin 10 genes, early markers of terminal differentiation. Reversal of growth inhibition by epidermal growth factor suppresses keratin 1 and keratin 10 expression. These results demonstrate that human keratinocyte terminal differentiation as well as proliferation are mediated by HER-1. Co-expression of autocrine epidermal growth factor-related ligands as well as HER-1 by human keratinocyte may function as part of the signal transduction network in epidermis to regulate cell number, replication rate, and terminal differentiation.

  3. HPV16-E2 protein modifies self-renewal and differentiation rate in progenitor cells of human immortalized keratinocytes. (United States)

    Domínguez-Catzín, Victoria; Reveles-Espinoza, Alicia-María; Sánchez-Ramos, Janet; Cruz-Cadena, Raúl; Lemus-Hernández, Diana; Garrido, Efraín


    Cervical cancer is the fourth cause of death worldwide by cancer in women and is a disease associated to persistent infection with human papillomavirus (HPV), particularly from two high-risk types HPV16 and 18. The virus initiates its replicative cycle infecting cells located in the basal layer of the epithelium, where a small population of epithelial stem cells is located performing important functions of renewal and maintenance of the tissue. Viral E2 gene is one of the first expressed after infection and plays relevant roles in the replicative cycle of the virus, modifying fundamental processes in the infected cells. Thus, the aim of the present study was to demonstrate the presence of hierarchic subpopulations in HaCaT cell line and evaluate the effect of HPV16-E2 expression, on their biological processes. HaCaT-HPV16-E2 cells were generated by transduction of HaCaT cell line with a lentiviral vector. The α6-integrin-CD71 expression profile was established by immunostaining and flow cytometric analysis. After sorting, cell subpopulations were analyzed in biological assays for self-renewal, clonogenicity and expression of stemness factors (RT-qPCR). We identified in HaCaT cell line three different subpopulations that correspond to early differentiated cells (α6-integrindim), transitory amplifying cells (α6-integrinbri/CD71bri) and progenitor cells (α6-integrinbri/CD71dim). The last subpopulation showed stem cell characteristics, such as self-renewal ability, clonogenicity and expression of the well-known stem cell factors SOX2, OCT4 and NANOG, suggesting they are stem-like cells. Interestingly, the expression of HPV16-E2 in HaCaT cells changed its α6-integrin-CD71 immunophenotype modifying the relative abundance of the cell subpopulations, reducing significantly the percentage of α6-integrinbri/CD71dim cells. Moreover, the expression of the stem cell markers was also modified, increasing the expression of SOX2 and NANOG, but decreasing notably the

  4. Platelet-Released Growth Factors Induce Differentiation of Primary Keratinocytes

    Directory of Open Access Journals (Sweden)

    Andreas Bayer


    Full Text Available Autologous thrombocyte concentrate lysates, for example, platelet-released growth factors, (PRGFs or their clinically related formulations (e.g., Vivostat PRF® came recently into the physicians’ focus as they revealed promising effects in regenerative and reparative medicine such as the support of healing of chronic wounds. To elucidate the underlying mechanisms, we analyzed the influence of PRGF and Vivostat PRF on human keratinocyte differentiation in vitro and on epidermal differentiation status of skin wounds in vivo. Therefore, we investigated the expression of early (keratin 1 and keratin 10 and late (transglutaminase-1 and involucrin differentiation markers. PRGF treatment of primary human keratinocytes decreased keratin 1 and keratin 10 gene expression but induced involucrin and transglutaminase-1 gene expression in an epidermal growth factor receptor- (EGFR- dependent manner. In concordance with these results, microscopic analyses revealed that PRGF-treated human keratinocytes displayed morphological features typical of keratinocytes undergoing terminal differentiation. In vivo treatment of artificial human wounds with Vivostat PRF revealed a significant induction of involucrin and transglutaminase-1 gene expression. Together, our results indicate that PRGF and Vivostat PRF induce terminal differentiation of primary human keratinocytes. This potential mechanism may contribute to the observed beneficial effects in the treatment of hard-to-heal wounds with autologous thrombocyte concentrate lysates in vivo.

  5. TLR4 as a negative regulator of keratinocyte proliferation.

    Directory of Open Access Journals (Sweden)

    Guergana Iotzova-Weiss

    Full Text Available TLR4 is an innate immune receptor with expression in human skin, keratinocytes as well as squamous cell carcinoma (SCC of the skin. In the present study we investigate the role of TLR4 as a negative regulator of keratinocyte proliferation. We present here that the expression of TLR4 increased with the differentiation of cultured keratinocytes in a passage-dependent manner or under calcium-rich conditions. Moreover, the down-regulation of TLR4 by specific knockdown increased the proliferation of HaCaT keratinocytes in vitro. In addition, subcutaneously injected HaCaT keratinocytes with shTLR4 formed growing tumors in nude mice. In contrast, we observed lower proliferation and increased migration in vitro of the SCC13 cell line stably overexpressing TLR4 in comparison to SCC13 TLR4 negative cells. In vivo, SCC13 TLR4-overexpressing tumors showed delayed growth in comparison to TLR4 negative tumors. The overexpression of TLR4 in SCC13 tumor cells was followed by phosphorylation of ERK1/2 and JNK and increased expression of ATF3. In gene expression arrays, the overexpression of TLR4 in tumor cells correlated with gene expression of ATF-3, IL-6, CDH13, CXCL-1 and TFPI. In summary, TLR4 negatively regulates the proliferation of keratinocytes and its overexpression reduces tumor growth of SCC cells.

  6. TLR4 as a negative regulator of keratinocyte proliferation. (United States)

    Iotzova-Weiss, Guergana; Freiberger, Sandra N; Johansen, Pål; Kamarachev, Jivko; Guenova, Emmanuella; Dziunycz, Piotr J; Roux, Guillaume A; Neu, Johannes; Hofbauer, Günther F L


    TLR4 is an innate immune receptor with expression in human skin, keratinocytes as well as squamous cell carcinoma (SCC) of the skin. In the present study we investigate the role of TLR4 as a negative regulator of keratinocyte proliferation. We present here that the expression of TLR4 increased with the differentiation of cultured keratinocytes in a passage-dependent manner or under calcium-rich conditions. Moreover, the down-regulation of TLR4 by specific knockdown increased the proliferation of HaCaT keratinocytes in vitro. In addition, subcutaneously injected HaCaT keratinocytes with shTLR4 formed growing tumors in nude mice. In contrast, we observed lower proliferation and increased migration in vitro of the SCC13 cell line stably overexpressing TLR4 in comparison to SCC13 TLR4 negative cells. In vivo, SCC13 TLR4-overexpressing tumors showed delayed growth in comparison to TLR4 negative tumors. The overexpression of TLR4 in SCC13 tumor cells was followed by phosphorylation of ERK1/2 and JNK and increased expression of ATF3. In gene expression arrays, the overexpression of TLR4 in tumor cells correlated with gene expression of ATF-3, IL-6, CDH13, CXCL-1 and TFPI. In summary, TLR4 negatively regulates the proliferation of keratinocytes and its overexpression reduces tumor growth of SCC cells.

  7. The 0.8% ultraviolet B content of an ultraviolet A sunlamp induces 75% of cyclobutane pyrimidine dimers in human keratinocytes in vitro. (United States)

    Woollons, A; Kipp, C; Young, A R; Petit-Frère, C; Arlett, C F; Green, M H; Clingen, P H


    Tanning lamps, emitting predominantly ultraviolet (UV) A, are used widely throughout the U.K. and other countries, but little is known about the long-term risks associated with their use, especially with respect to skin cancer. We have exposed normal human epidermal keratinocytes to a commercial tanning lamp and used the comet assay in association with DNA repair enzymes T4 endonuclease V and endonuclease III to investigate the relative yields of directly formed cyclobutane pyrimidine dimers (CPDs) and indirectly formed types of oxidative DNA damage. To put the risk of using tanning lamps into perspective, the sunbed used in this study (five Philips Performance 80W-R UVA tubes at a distance of 35 cm) was found to be approximately 0.7 times as potent at inducing CPDs as U.K. natural sunlight around noon on a fine summer day. This compares with a relative risk for CPD induction and erythema of 0.8 and 0.7 times, respectively, calculated from the relevant action spectra of tanning lamps and British noontime sunlight. To determine the relative contribution of UVB and UVA to the induction of CPDs and oxidative DNA damage, we modified the spectral output of the tanning lamps with a series of Schott WG UVB filters. The induction of CPDs was more dependent on the UVB component of the sunbed than oxidative types of damage. Schott WG UVB filters with 50% transmission at 305 nm reduced the yield of T4 endonuclease V sites by 42% while there was only a 17% decrease in the yield of endonuclease III sites. CPD induction was not completely abolished after irradiation through WG335 and WG345 nm filters despite there being no detectable UVB. From these data, it was estimated that, although the tanning lamps emitted only 0.8% of their total output in the UVB range, these wavelengths were responsible for the induction of over 75% of CPDs and 50% of the oxidative damage to DNA.

  8. A Polyphenol-Enriched Fraction of Rose Oil Distillation Wastewater Inhibits Cell Proliferation, Migration and TNF-α-Induced VEGF Secretion in Human Immortalized Keratinocytes. (United States)

    Wedler, Jonas; Rusanov, Krasimir; Atanassov, Ivan; Butterweck, Veronika


    Water steam distillation of rose flowers separates the essential oil from the polyphenol-containing rose oil distillation wastewater. Recently, a strategy was developed to separate rose oil distillation wastewater into a polyphenol depleted water fraction and a polyphenol-enriched fraction [RF20-(SP-207)]. The objective of the present study was to investigate RF20-(SP-207) and fraction F(IV), augmented in quercetin and ellagic acid, for possible antiproliferative effects in immortalized human keratinocytes (HaCaT) since rose petals are known to contain compounds with potential antiproliferative activity.RF20-(SP-207) revealed dose-dependent antiproliferative activity (IC50 of 9.78 µg/mL). In a nontoxic concentration of 10 µg/mL, this effect was stronger than that of the two positive controls LY294002 (10 µM, PI3 K-inhibitor, 30 % inhibition) and NVP-BEZ235 (100 nM, dual PI3 K/mTOR inhibitor, 30 % inhibition) and clearly exceeded the antiproliferative action of quercetin (50 µM, 25 % inhibition) and ellagic acid (1 µM, 15 % inhibition). Time-lapse microscopy detected a significant impairment of cell migration of RF20-(SP-207) and F(IV). At concentrations of 10 µg/mL of both, extract and fraction, cell migration was strongly suppressed (51 % and 28 % gap closure, respectively, compared to 95 % gap closure 24 hours after control treatment). The suppression of cell migration was comparable to the positive controls LY294002, NVP-BEZ235, and quercetin. Furthermore, basal and TNF-α-stimulated VEGF-secretion was significantly reduced by RF20-(SP-207) and F(IV) at 10 µg/mL (44 % vs. untreated control).In conclusion, RF20-(SP-207) showed promising antiproliferative and antimigratory effects and could be developed as a supportive, therapy against hyperproliferation-involved skin diseases. Georg Thieme Verlag KG Stuttgart · New York.

  9. Increased capsaicin receptor TRPV1 in skin nerve fibres and related vanilloid receptors TRPV3 and TRPV4 in keratinocytes in human breast pain

    Directory of Open Access Journals (Sweden)

    Facer Paul


    Full Text Available Abstract Background Breast pain and tenderness affects 70% of women at some time. These symptoms have been attributed to stretching of the nerves with increase in breast size, but tissue mechanisms are poorly understood. Methods Eighteen patients (n = 12 breast reduction and n = 6 breast reconstruction were recruited and assessed for breast pain by clinical questionnaire. Breast skin biopsies from each patient were examined using immunohistological methods with specific antibodies to the capsaicin receptor TRPV1, related vanilloid thermoreceptors TRPV3 and TRPV4, and nerve growth factor (NGF. Results TRPV1-positive intra-epidermal nerve fibres were significantly increased in patients with breast pain and tenderness (TRPV1 fibres / mm epidermis, median [range] – no pain group, n = 8, 0.69 [0–1.27]; pain group, n = 10, 2.15 [0.77–4.38]; p = 0.0009. Nerve Growth Factor, which up-regulates TRPV1 and induces nerve sprouting, was present basal keratinocytes: some breast pain specimens also showed NGF staining in supra-basal keratinocytes. TRPV4-immunoreactive fibres were present in sub-epidermis but not significantly changed in painful breast tissue. Both TRPV3 and TRPV4 were significantly increased in keratinocytes in breast pain tissues; TRPV3, median [range] – no pain group, n = 6, 0.75 [0–2]; pain group, n = 11, 2 123, p = 0.008; TRPV4, median [range] – no pain group, n = 6, [0–1]; pain group, n = 11, 1 [0.5–2], p = 0.014. Conclusion Increased TRPV1 intra-epidermal nerve fibres could represent collateral sprouts, or re-innervation following nerve stretch and damage by polymodal nociceptors. Selective TRPV1-blockers may provide new therapy in breast pain. The role of TRPV3 and TRPV4 changes in keratinocytes deserve further study.

  10. Antioxidant Opuntia ficus-indica Extract Activates AHR-NRF2 Signaling and Upregulates Filaggrin and Loricrin Expression in Human Keratinocytes. (United States)

    Nakahara, Takeshi; Mitoma, Chikage; Hashimoto-Hachiya, Akiko; Takahara, Masakazu; Tsuji, Gaku; Uchi, Hiroshi; Yan, Xianghong; Hachisuka, Junichi; Chiba, Takahito; Esaki, Hitokazu; Kido-Nakahara, Makiko; Furue, Masutaka


    Opuntia ficus-indica (OFI) is a cactus species widely used as an anti-inflammatory, antilipidemic, and hypoglycemic agent. It has been shown that OFI extract (OFIE) inhibits oxidative stress in animal models of diabetes and hepatic disease; however, its antioxidant mechanism remains largely unknown. In this study, we demonstrated that OFIE exhibited potent antioxidant activity through the activation of nuclear factor erythroid 2-related factor 2 (NRF2) and the downstream antioxidant enzyme quinone oxidoreductase 1 (NQO1), which inhibited the generation of reactive oxygen species in keratinocytes challenged with tumor necrosis factor α or benzo[α]pyrene. The antioxidant capacity of OFIE was canceled in NRF2 knockdown keratinocytes. OFIE exerted this NRF2-NQO1 upregulation through activation of the aryl hydrocarbon receptor (AHR). Moreover, the ligation of AHR by OFIE upregulated the expression of epidermal barrier proteins: filaggrin and loricrin. OFIE also prevented TH2 cytokine-mediated downregulation of filaggrin and loricrin expression in an AHR-dependent manner because it was canceled in AHR knockdown keratinocytes. Antioxidant OFIE is a potent activator of AHR-NRF2-NQO1 signaling and may be beneficial in treating barrier-disrupted skin disorders.

  11. Effect of Wnt3a on Keratinocytes Utilizing in Vitro and Bioinformatics Analysis

    Directory of Open Access Journals (Sweden)

    Ju-Suk Nam


    Full Text Available Wingless-type (Wnt signaling proteins participate in various cell developmental processes. A suppressive role of Wnt5a on keratinocyte growth has already been observed. However, the role of other Wnt proteins in proliferation and differentiation of keratinocytes remains unknown. Here, we investigated the effects of the Wnt ligand, Wnt3a, on proliferation and differentiation of keratinocytes. Keratinocytes from normal human skin were cultured and treated with recombinant Wnt3a alone or in combination with the inflammatory cytokine, tumor necrosis factor α (TNFα. Furthermore, using bioinformatics, we analyzed the biochemical parameters, molecular evolution, and protein–protein interaction network for the Wnt family. Application of recombinant Wnt3a showed an anti-proliferative effect on keratinocytes in a dose-dependent manner. After treatment with TNFα, Wnt3a still demonstrated an anti-proliferative effect on human keratinocytes. Exogenous treatment of Wnt3a was unable to alter mRNA expression of differentiation markers of keratinocytes, whereas an altered expression was observed in TNFα-stimulated keratinocytes. In silico phylogenetic, biochemical, and protein–protein interaction analysis showed several close relationships among the family members of the Wnt family. Moreover, a close phylogenetic and biochemical similarity was observed between Wnt3a and Wnt5a. Finally, we proposed a hypothetical mechanism to illustrate how the Wnt3a protein may inhibit the process of proliferation in keratinocytes, which would be useful for future researchers.

  12. The autoimmune regulator (AIRE), which is defective in autoimmune polyendocrinopathy-candidiasis-ectodermal dystrophy patients, is expressed in human epidermal and follicular keratinocytes and associates with the intermediate filament protein cytokeratin 17. (United States)

    Kumar, Vipul; Pedroza, Luis A; Mace, Emily M; Seeholzer, Steven; Cotsarelis, George; Condino-Neto, Antonio; Payne, Aimee S; Orange, Jordan S


    Autoimmune polyendocrinopathy-candidiasis-ectodermal dystrophy (APECED) syndrome, which is caused by mutation of the autoimmune regulator (AIRE) gene, is a highly variable disease characterized by multiple endocrine failure, chronic mucocutaneous candidiasis, and various ectodermal defects. AIRE is a transcriptional regulator classically expressed in medullary thymic epithelial cells, monocytes, macrophages, and dendritic cells. Previous studies have suggested that AIRE can shuttle between the nucleus and cytoplasm of cells, although its cytoplasmic functions are poorly characterized. Through mass spectrometry analysis of proteins co-immunoprecipitating with cytoplasmic AIRE, we identified a novel association of AIRE with the intermediate filament protein cytokeratin 17 (K17) in the THP-1 monocyte cell line. We confirmed AIRE expression in HaCaT epidermal keratinocytes, as well as its interaction with K17. Confocal microscopy of human fetal and adult scalp hair follicles demonstrated a cytoplasmic pattern of AIRE staining that moderately colocalized with K17. The cytoplasmic association of AIRE with the intermediate filament network in human epidermal and follicular keratinocytes may provide a new path to understanding the ectodermal abnormalities associated with the APECED syndrome. Copyright © 2011 American Society for Investigative Pathology. Published by Elsevier Inc. All rights reserved.

  13. Enrichment of oral mucosa and skin keratinocyte progenitor/stem cells. (United States)

    Izumi, Kenji; Marcelo, Cynthia L; Feinberg, Stephen E


    The isolation of human oral mucosa/skin keratinocytes progenitor/stem cells is clinically important to regenerate epithelial tissues for the treatment of oral mucosa/skin defects. Researchers have attempted to isolate a keratinocyte progenitor/stem cell population using cell markers, rapid adherence to collagen type IV, and other methods. In this regard, one of the specific characteristics of keratinocyte progenitor/stem cells is that these cells have a smaller diameter than differentiated cells. This chapter describes methods used in our laboratory to set up primary human oral mucosa and skin keratinocytes in a chemically defined culture system devoid of animal derived products. We utilized the cells in a FDA-approved human clinical trial that involved the intraoral grafting of an ex vivo produced oral mucosa equivalent to increase keratinized tissue around teeth. We also provide two protocols on how to sort keratinocytes using physical criterion, cell size, using a cell sorter and a serial filtration system.

  14. UV induction of cyclobutane thymine dimers in the DNA of cultured melanocytes from foreskin, common melanocytic nevi and dysplastic nevi

    Energy Technology Data Exchange (ETDEWEB)

    Noz, K.C.; Bergman, W.; Schothorst, A.A. (Univ. Hospital Leiden (Netherlands). Dept. of Dermatology); Roza, L. (TNO Medical Biological Lab., Rijswijk (Netherlands)); Darroudi, F. (Rijksuniversiteit Leiden (Netherlands). Lab. voor Stralengenetica en Chemische Mutagenese)


    We compared the induction of cyclobutane thymine dimers after exposure to 302 nm UV in foreskin-derived melanocytes and melanocytes from nevocellular nevi, as well as in melanocytes cultured from dysplastic nevi, precursor lesions of melanoma, derived from four, three and four individuals, respectively. Cyclobutane thymine dimers were quantified in situ by means of an immunofluorescence assay with a specific monoclonal antibody. A method was developed to compare separately performed experiments in a standardized manner. For melanocytes from each source, we demonstrated a linear relationship between UV dose and immunofluorescence. In nevocellular and dysplastic nevi, two subpopulations could be detected, distinguished by their nuclear size. Large nucleated nevocellular nevus cells were most susceptible to the induction of thymine dimers (49% higher induction compared to induction in foreskin melanocytes), while in normal-sized nuclei of these nevus cells the same induction of thymine dimers was found as in nuclei from foreskin melanocytes. In contrast, large nucleated dysplastic nevus melanocytes did not differ from the foreskin melanocytes, while normal-sized nuclei of dysplastic nevus cells showed a lower induction (32% lower induction than in foreskin melanocytes). (Author).

  15. Attenuating properties of Agastache rugosa leaf extract against ultraviolet-B-induced photoaging via up-regulating glutathione and superoxide dismutase in a human keratinocyte cell line. (United States)

    Oh, Yuri; Lim, Hye-Won; Huang, Yu-Hua; Kwon, Hee-Souk; Jin, Chang Duck; Kim, Kyunghoon; Lim, Chang-Jin


    Agastache rugosa Kuntze, known as a Korean mint, is an herbal medicine that has been used for the treatment of diverse kinds of symptoms in traditional medicine. This work was undertaken to assess the protective properties of A. rugosa leaves against UV-B-induced photoaging in HaCaT keratinocytes. They were evaluated via analyzing reactive oxygen species (ROS), promatrix metalloproteinase-2 (proMMP-2) and -9 (proMMP-9), total glutathione (GSH), total superoxide dismutase (SOD), cellular viability, flavonoid content and in vitro radical scavenging activity. Total flavonoid content of ARE, a hot water extract of A. rugosa leaves, was 22.8±7.6mg of naringin equivalent/g ARE. ARE exhibited ABTS(+) radical scavenging activity with an SC50 of 836.9μg/mL. ARE attenuated the UV-B-induced ROS generation. It diminished the UV-B-induced elevation of proMMP-2 and -9 at both activity and protein levels. On the contrary, ARE was able to enhance the UV-B-reduced total GSH and total SOD activity levels. ARE, at the used concentrations, was unable to interfere with the cellular viabilities of HaCaT keratinocytes under UV-B irradiation. Taken together, ARE possesses a protective potential against UV-B-induced photoaging in HaCaT keratinocytes, possibly based upon up-regulating antioxidant components, including total GSH and SOD. These findings reasonably suggest the use of A. rugosa leaves as a photoprotective resource in manufacturing functional cosmetics. Copyright © 2016. Published by Elsevier B.V.

  16. Psidium guajava extract inhibits thymus and activation-regulated chemokine (TARC/CCL17) production in human keratinocytes by inducing heme oxygenase-1 and blocking NF-κB and STAT1 activation. (United States)

    Han, Eun Hee; Hwang, Yong Pil; Choi, Jae Ho; Yang, Ji Hye; Seo, Jong Kwon; Chung, Young Chul; Jeong, Hye Gwang


    Psidium guajava (P. guajava) is a food and medicinal plant with antioxidant, anti-inflammatory, and anti-allergic activities that support its traditional uses. The aim of this study was to determine the effects of P. guajava ethyl acetate extract (PGEA) on atopic dermatitis and to investigate the possible mechanisms by which PGEA inhibits cytokine-induced Th2 chemokine expression in HaCaT human keratinocyte cells. We found that PGEA suppressed the IFN-γ/TNF-α-co-induced production of thymus and activation-regulated chemokine (TARC) protein and mRNA in HaCaT cells. Additionally, PGEA inhibited the TNF-α/IFN-γ-co-induced activation of NF-κB and STAT1 and increased the expression of heme oxygenase-1 (HO-1) protein and mRNA. HO-1 inhibitor enhanced the suppressive effects of PGEA on TNF-α/IFN-γ-co-induced TARC production and gene expression. Collectively, these data demonstrate that PGEA inhibits chemokine expression in keratinocytes by inducing HO-1 expression and it suggests a possible therapeutic application in atopic dermatitis and other inflammatory skin diseases. Copyright © 2011 Elsevier B.V. All rights reserved.

  17. Ultrastructural evaluation of human keratinocyte growth and differentiation on a fibrin substrate Avaliação ultraestrutural do crescimento e da diferenciação de queratinócitos sobre um substrato de fibrina

    Directory of Open Access Journals (Sweden)

    Daniela Yukie Sakai Tanikawa


    Full Text Available PURPOSE: In order to circumvent several difficulties that have been met in the routine use of the in vitro keratinocyte cultures using the standard procedure described by Rheinwald and Green, and obtain a more resilient and the least possible immunogeneic skin substitute for a future clinical application, this work studied a new keratinocyte culture system, which envisages the utilization of a fibrin substrate in association with high densities of human keratinocytes. METHODS: Through light and transmission electron microscopy and immunohistochemical assays, long-term proliferative and differentiative characteristics of keratinocytes cultured onto a fibrin gel under immerse and air-liquid interface culture conditions were evaluated. RESULTS: Despite the absence of a dermal substitute, the results demonstrated that the proposed composite was constituted of a transparent and elastic fibrin film covered by a well-attached, multistratified epithelium with morphological characteristics that resemble human epidermis, including the neoformation, albeit incomplete, of the basement membrane. CONCLUSIONS: Increased mechanical resistance due to the presence of an easy handling substrate, the delivery of nonclonfluent keratinocytes as well as the removal of animal-derived cells from the culture system suggest its potential use for future transplantation purposes.OBJETIVO: Com o intuito de contornar diversas dificuldades encontradas no uso rotineiro de queratinócitos cultivados in vitro pela técnica descrita por Rheinwald e Green, e obter um substituto cutâneo mais resistente e o menos imunogênico possível para futuras aplicações clínicas, este trabalho avaliou um novo sistema de cultura de queratinócitos que prevê a utilização de um substrato de fibrina em associação com queratinócitos humanos em alta densidade. MÉTODOS: Através de microscopia óptica e eletrônica e análise imunohistoquímica, foram avaliadas as caracter

  18. The Asian-American variant of human papillomavirus type 16 exhibits higher activation of MAPK and PI3K/AKT signaling pathways, transformation, migration and invasion of primary human keratinocytes. (United States)

    Hochmann, Jimena; Sobrinho, João S; Villa, Luisa L; Sichero, Laura


    Asian-American (AA) HPV-16 variants are associated with higher risk of cancer. Abnormal activation of intracellular signaling play a critical role in cancer development and progression. Our aim was to elucidate mechanisms underlying the higher oncogenic potential attributed to AA variant. We evaluated activation of MAPK and PI3K/AKT pathways in primary human keratinocytes (PHKs) transduced with E6/E7 of three HPV-16 variants: E-P, AA, E-350G. Phenotypes examined included migration, anchorage independent growth and invasion. AA PHKs presented the highest levels of active proteins involved in all cascades analyzed: MAPK-ERK, MAPK-p38 and PI3K-AKT. AA PHKs were more efficient in promoting anchorage independent growth, and in stimulating cell migration and invasion. MEK1 inhibition decreased migration. The mesenchymal phenotype marker vimentin was increased in AA PHKs. Our results suggest that MEK1, ERK2, AKT2 hyperactivation influence cellular behavior by means of GSK-3b inactivation and EMT induction prompting AA immortalized PHKs to more efficiently surpass carcinogenesis steps. Copyright © 2016 Elsevier Inc. All rights reserved.

  19. Antioxidants protect keratinocytes against M. ulcerans mycolactone cytotoxicity.

    Directory of Open Access Journals (Sweden)

    Alvar Grönberg

    Full Text Available BACKGROUND: Mycobacterium ulcerans is the causative agent of necrotizing skin ulcerations in distinctive geographical areas. M. ulcerans produces a macrolide toxin, mycolactone, which has been identified as an important virulence factor in ulcer formation. Mycolactone is cytotoxic to fibroblasts and adipocytes in vitro and has modulating activity on immune cell functions. The effect of mycolactone on keratinocytes has not been reported previously and the mechanism of mycolactone toxicity is presently unknown. Many other macrolide substances have cytotoxic and immunosuppressive activities and mediate some of their effects via production of reactive oxygen species (ROS. We have studied the effect of mycolactone in vitro on human keratinocytes--key cells in wound healing--and tested the hypothesis that the cytotoxic effect of mycolactone is mediated by ROS. METHODOLOGY/PRINCIPAL FINDINGS: The effect of mycolactone on primary skin keratinocyte growth and cell numbers was investigated in serum free growth medium in the presence of different antioxidants. A concentration and time dependent reduction in keratinocyte cell numbers was observed after exposure to mycolactone. Several different antioxidants inhibited this effect partly. The ROS inhibiting substance deferoxamine, which acts via chelation of Fe(2+, completely prevented mycolactone mediated cytotoxicity. CONCLUSIONS/SIGNIFICANCE: This study demonstrates that mycolactone mediated cytotoxicity can be inhibited by deferoxamine, suggesting a role of iron and ROS in mycolactone induced cytotoxicity of keratinocytes. The data provide a basis for the understanding of Buruli ulcer pathology and the development of improved therapies for this disease.

  20. Metabolic Stress Drives Keratinocyte Defenses against Staphylococcus aureus Infection

    Directory of Open Access Journals (Sweden)

    Matthew Wickersham


    Full Text Available Human skin is commonly colonized and infected by Staphylococcus aureus. Exactly how these organisms are sensed by keratinocytes has not been clearly delineated. Using a combination of metabolic and transcriptomic methodologies, we found that S. aureus infection is sensed as a metabolic stress by the hypoxic keratinocytes. This induces HIF1α signaling, which promotes IL-1β production and stimulates aerobic glycolysis to meet the metabolic requirements of infection. We demonstrate that staphylococci capable of glycolysis, including WT and agr mutants, readily induce HIF1α responses. In contrast, Δpyk glycolytic mutants fail to compete with keratinocytes for their metabolic needs. Suppression of glycolysis using 2-DG blocked keratinocyte production of IL-1β in vitro and significantly exacerbated the S. aureus cutaneous infection in a murine model. Our data suggest that S. aureus impose a metabolic stress on keratinocytes that initiates signaling necessary to promote both glycolysis and the proinflammatory response to infection.

  1. Extremely low frequency electromagnetic fields modulate expression of inducible nitric oxide synthase, endothelial nitric oxide synthase and cyclooxygenase-2 in the human keratinocyte cell line HaCat: potential therapeutic effects in wound healing. (United States)

    Patruno, A; Amerio, P; Pesce, M; Vianale, G; Di Luzio, S; Tulli, A; Franceschelli, S; Grilli, A; Muraro, R; Reale, M


    Extremely low frequency (ELF) electromagnetic fields (EMF) are known to produce a variety of biological effects. Clinical studies are ongoing using EMF in healing of bone fractures and skin wounds. However, little is known about the mechanisms of action of ELF-EMF. Several studies have demonstrated that expression and regulation of nitric oxide synthase (NOS) and cyclooxygenase-2 (COX-2) are vital for wound healing; however, no reports have demonstrated a direct action of ELF-EMF in the modulation of these inflammatory molecules in human keratinocytes. The present study analysed the effect of ELF-EMF on the human keratinocyte cell line HaCaT in order to assess the mechanisms of action of ELF-EMF and to provide further support for their therapeutic use in wound healing. Exposed HaCaT cells were compared with unexposed control cells. At different exposure times, expression of inducible NOS (iNOS), endothelial NOS (eNOS) and COX-2 was evaluated by Western blot analysis. Modulation of iNOS and eNOS was monitored by evaluation of NOS activities, production of nitric oxide (NO) and O(2)(-) and expression of activator protein 1 (AP-1). In addition, catalase activity and prostaglandin (PG) E(2) production were determined. Effects of ELF-EMF on cell growth and viability were monitored. The exposure of HaCaT cells to ELF-EMF increased iNOS and eNOS expression levels. These ELF-EMF-dependent increased expression levels were paralled by increased NOS activities, and increased NO production. In addition, higher levels of AP-1 expression as well as a higher cell proliferation rate were associated with ELF-EMF exposure. In contrast, ELF-EMF decreased COX-2 expression, PGE(2) production, catalase activity and O(2)(-) production. Mediators of inflammation, such as reactive nitrogen and PGE(2), and keratinocyte proliferation are critical for the tissue regenerative processes. The ability of ELF-EMF to upmodulate NOS activities, thus nitrogen intermediates, as well as cell

  2. The mechanism of melanocyte dendrite formation: the impact of differentiating keratinocytes. (United States)

    Kippenberger, S; Bernd, A; Bereiter-Hahn, J; Ramirez-Bosca, A; Kaufmann, R


    In human epidermis one dendritic melanocyte interacts with about 36 keratinocytes and supplies them with melanin. In contrast to the vivo situation melanocytes in culture are far less dendritic. In the present study different culture systems were tested in order to observe the mechanism of melanocyte dendrite formation. In particular, we focused on the role of keratinocytes in this process. Time lapse studies revealed that only differentiated keratinocytes enhance melanocyte dendricity. Differentiated keratinocytes form connected cell sheets, which attach to part of the melanocyte plasma membrane. By contraction and retraction of keratinocyte units, new dendrites were drawn out from the melanocytes. Melanocytes remain passive during this process, which is indicated by the observation that sometimes extended dendrites could not withstand the tension and shear.

  3. Keratinocyte cultures from involved skin in vitiligo patients show an impaired in vitro behaviour. (United States)

    Bondanza, Sergio; Maurelli, Riccardo; Paterna, Patrizia; Migliore, Eleonora; Giacomo, Fabio Di; Primavera, Giovanni; Paionni, Emanuel; Dellambra, Elena; Guerra, Liliana


    Vitiligo depigmentation is considered a consequence of either melanocyte disappearance or loss of functioning melanocytes in the involved areas. However, it has been reported that keratinocytes in involved vitiligo skin are damaged too. Based on this evidence, we evaluated the in vitro behaviour, in life span cultures, of involved and uninvolved vitiligo keratinocytes and their expression of proliferation, differentiation and senescence markers. An additional purpose was to investigate whether vitiligo keratinocytes from depigmented skin are able to sustain survival and growth of normal melanocytes (when added in co-culture experiments), as normal human keratinocytes manage to do. Our results demonstrate that almost all involved vitiligo keratinocytes have a shorter life span in vitro than the uninvolved cells and all of them do not maintain melanocytes in culture in a physiological ratio. Modification of proliferation and senescence marker expression also occurs. Indeed, we detected low initial expression levels of the senescence marker p16 in involved vitiligo keratinocytes, despite their shorter in vitro life span, and increased expression of proliferating cell nuclear antigen and p53. This preliminary analysis of a small number of in vitro cultured vitiligo keratinocytes suggests an impaired senescence process in lesional vitiligo keratinocytes and attempts to regulate it.

  4. The Lipophilic Vitamin C Derivative, 6-O-Palmitoylascorbate Protects Human Keratinocytes and 3D-Human Skin Equivalents Against X-Ray-Induced Oxidative Stress and Apoptosis More Markedly Than L-Ascorbic Acid. (United States)

    Xiao, Li; Miwa, Nobuhiko


    The aim of this study was to investigate preventive effects of the lipophilic vitamin C derivative, 6-O-palmitoylascorbate (PlmtVC) against X-ray radiation-induced harmful events. Free radical scavenging activity tests showed that both fresh and old (being kept at 37°C for 72 h) solutions of PlmtVC showed significantly higher abilities for scavenging both DPPH and peroxyl radical (ROO·) radicals than L-ascorbic acid (L-AA) under the same conditions, suggesting that PlmtVC is an antioxidant more efficient and stable than L-AA. Irradiation with X-ray (15 Gy) increased intracellular ROS production, lipid peroxidation and protein carbonylation, in human keratinocytes HaCaT, all of which were repressed, especially for intracellular ROS more markedly, by PlmtVC than by L-AA. After X-ray (15 Gy)-irradiation, caspase 3/7 activation and TUNEL-detected DNA-strand-breakages characteristic of apoptosis obviously increased in HaCaT cells or 3D-skin tissue equivalents, respectively, both of which were prevented more appreciably by PlmtVC than by L-AA. PlmtVC also noticeably prevented cumene hydroperoxide-induced generation of cellular ROS in epidermis parts of 3D-skin equivalents. Thus, PlmtVC prevents X-ray-induced diverse harmful effects, through its antioxidant activity and the palmitoyl moiety-based lipophilicity, more efficiently than L-AA. J. Cell. Biochem. 118: 318-329, 2017. © 2016 Wiley Periodicals, Inc. © 2016 Wiley Periodicals, Inc.

  5. Modulation of keratinocyte gene expression and differentiation by PPAR-selective ligands and tetradecylthioacetic acid

    DEFF Research Database (Denmark)

    Westergaard, M; Henningsen, J; Svendsen, M L


    Peroxisome proliferator-activated receptors (PPARs) are pleiotropic regulators of growth and differentiation of many cell types. We have performed a comprehensive analysis of the expression of PPARs, transcriptional cofactors, and marker genes during differentiation of normal human keratinocytes ...

  6. DNAX-activating Protein 10 (DAP10) Membrane Adaptor Associates with Receptor for Advanced Glycation End Products (RAGE) and Modulates the RAGE-triggered Signaling Pathway in Human Keratinocytes* (United States)

    Sakaguchi, Masakiyo; Murata, Hitoshi; Aoyama, Yumi; Hibino, Toshihiko; Putranto, Endy Widya; Ruma, I. Made Winarsa; Inoue, Yusuke; Sakaguchi, Yoshihiko; Yamamoto, Ken-ichi; Kinoshita, Rie; Futami, Junichiro; Kataoka, Ken; Iwatsuki, Keiji; Huh, Nam-ho


    The receptor for advanced glycation end products (RAGE) is involved in the pathogenesis of many inflammatory, degenerative, and hyperproliferative diseases, including cancer. Previously, we revealed mechanisms of downstream signaling from ligand-activated RAGE, which recruits TIRAP/MyD88. Here, we showed that DNAX-activating protein 10 (DAP10), a transmembrane adaptor protein, also binds to RAGE. By artificial oligomerization of RAGE alone or RAGE-DAP10, we found that RAGE-DAP10 heterodimer formation resulted in a marked enhancement of Akt activation, whereas homomultimeric interaction of RAGE led to activation of caspase 8. Normal human epidermal keratinocytes exposed to S100A8/A9, a ligand for RAGE, at a nanomolar concentration mimicked the pro-survival response of RAGE-DAP10 interaction, although at a micromolar concentration, the cells mimicked the pro-apoptotic response of RAGE-RAGE. In transformed epithelial cell lines, A431 and HaCaT, in which endogenous DAP10 was overexpressed, and S100A8/A9, even at a micromolar concentration, led to cell growth and survival due to RAGE-DAP10 interaction. Functional blocking of DAP10 in the cell lines abrogated the Akt phosphorylation from S100A8/A9-activated RAGE, eventually leading to an increase in apoptosis. Finally, S100A8/A9, RAGE, and DAP10 were overexpressed in the psoriatic epidermis. Our findings indicate that the functional interaction between RAGE and DAP10 coordinately regulates S100A8/A9-mediated survival and/or apoptotic response of keratinocytes. PMID:25002577

  7. Impact of male circumcision on the HIV epidemic in Papua New Guinea: a country with extensive foreskin cutting practices.

    Directory of Open Access Journals (Sweden)

    Richard T Gray

    Full Text Available The degree to which adult medical male circumcision (MC programs can reduce new HIV infections in a moderate HIV prevalence country like Papua New Guinea (PNG are uncertain especially given the widespread prevalence of longitudinal foreskin cuts among adult males. We estimated the likely impact of a medical MC intervention in PNG using a mathematical model of HIV transmission. The model was age-structured and incorporated separate components for sex, rural/urban, men who have sex with men and female sex workers. Country-specific data of the prevalence of foreskin cuts, sexually transmitted infections, condom usage, and the acceptability of MC were obtained by our group through related studies. If longitudinal foreskin cutting has a protective efficacy of 20% compared to 60% for MC, then providing MC to 20% of uncut males from 2012 would require 376,000 procedures, avert 7,900 HIV infections by 2032, and require 143 MC per averted infection. Targeting uncut urban youths would achieve the most cost effective returns of 54 MC per HIV infection averted. These numbers of MC required to avert an HIV infection change little even with coverage up to 80% of men. The greater the protective efficacy of longitudinal foreskin cuts against HIV acquisition, the less impact MC interventions will have. Dependent on this efficacy, increasing condom use could have a much greater impact with a 10 percentage point increase averting 18,400 infections over this same period. MC programs could be effective in reducing HIV infections in PNG, particularly in high prevalence populations. However the overall impact is highly dependent on the protective efficacy of existing longitudinal foreskin cutting in preventing HIV.

  8. MET signaling in keratinocytes activates EGFR and initiates squamous carcinogenesis. (United States)

    Cataisson, Christophe; Michalowski, Aleksandra M; Shibuya, Kelly; Ryscavage, Andrew; Klosterman, Mary; Wright, Lisa; Dubois, Wendy; Liu, Fan; Zhuang, Anne; Rodrigues, Kameron B; Hoover, Shelley; Dwyer, Jennifer; Simpson, Mark R; Merlino, Glenn; Yuspa, Stuart H


    The receptor tyrosine kinase MET is abundant in many human squamous cell carcinomas (SCCs), but its functional significance in tumorigenesis is not clear. We found that the incidence of carcinogen-induced skin squamous tumors was substantially increased in transgenic MT-HGF (mouse metallothionein-hepatocyte growth factor) mice, which have increased abundance of the MET ligand HGF. Squamous tumors also erupted spontaneously on the skin of MT-HGF mice that were promoted by wounding or the application of 12-O-tetradecanoylphorbol 13-acetate, an activator of protein kinase C. Carcinogen-initiated tumors had Ras mutations, but spontaneous tumors did not. Cultured keratinocytes from MT-HGF mice and oncogenic RAS-transduced keratinocytes shared phenotypic and biochemical features of initiation that were dependent on autocrine activation of epidermal growth factor receptor (EGFR) through increased synthesis and release of EGFR ligands, which was mediated by the kinase SRC, the pseudoproteases iRhom1 and iRhom2, and the metallopeptidase ADAM17. Pharmacological inhibition of EGFR caused the regression of MT-HGF squamous tumors that developed spontaneously in orthografts of MT-HGF keratinocytes combined with dermal fibroblasts and implanted onto syngeneic mice. The global gene expression profile in MET-transformed keratinocytes was highly concordant with that in RAS-transformed keratinocytes, and a core RAS/MET coexpression network was activated in precancerous and cancerous human skin lesions. Tissue arrays revealed that many human skin SCCs have abundant HGF at both the transcript and protein levels. Thus, through the activation of EGFR, MET activation parallels a RAS pathway to contribute to human and mouse cutaneous cancers. Copyright © 2016, American Association for the Advancement of Science.

  9. Scanning Ion Conductance Microscopy of Live Keratinocytes (United States)

    Hegde, V.; Mason, A.; Saliev, T.; Smith, F. J. D.; McLean, W. H. I.; Campbell, P. A.


    Scanning ion conductance microscopy (SICM) is perhaps the least well known technique from the scanning probe microscopy (SPM) family of instruments. As with its more familiar counterpart, atomic force microscopy (AFM), the technique provides high-resolution topographic imaging, with the caveat that target structures must be immersed in a conducting solution so that a controllable ion current may be utilised as the basis for feedback. In operation, this non-contact characteristic of SICM makes it ideal for the study of delicate structures, such as live cells. Moreover, the intrinsic architecture of the instrument, incorporating as it does, a scanned micropipette, lends itself to combination approaches with complementary techniques such as patch-clamp electrophysiology: SICM therefore boasts the capability for both structural and functional imaging. For the present observations, an ICnano S system (Ionscope Ltd., Melbourn, UK) operating in 'hopping mode' was used, with the objective of assessing the instrument's utility for imaging live keratinocytes under physiological buffers. In scans employing cultured HaCaT cells (spontaneously immortalised, human keratinocytes), we compared the qualitative differences of live cells imaged with SICM and AFM, and also with their respective counterparts after chemical fixation in 4% paraformaldehyde. Characteristic surface microvilli were particularly prominent in live cell imaging by SICM. Moreover, time lapse SICM imaging on live cells revealed that changes in the pattern of microvilli could be tracked over time. By comparison, AFM imaging on live cells, even at very low contact forces (monitoring the most delicate living structures with attendant high spatial resolutions.

  10. Rosmarinic acid inhibits poly(I:C)-induced inflammatory reaction of epidermal keratinocytes. (United States)

    Zhou, Ming-Wei; Jiang, Ri-Hua; Kim, Ki-Duck; Lee, Jin-Hyup; Kim, Chang-Deok; Yin, Wei-Tian; Lee, Jeung-Hoon


    Keratinocytes are the predominant cells in the epidermis, exerting their primary role of physical barrier through sophisticated differentiation process. In addition, keratinocytes contribute to the activation of innate immunity, providing the surveillant role against external pathogens. It has been known that chronic skin inflammatory disease such as psoriasis can be provoked by viral pathogens including double-stranded RNA. In this study, we demonstrated that rosmarinic acid (RA) has an inhibitory potential on inflammatory reaction induced by double-stranded RNA mimic poly(I:C) in epidermal keratinocytes. We cultured human epidermal keratinocytes and induced inflammatory reaction by poly(I:C) treatment. The effect of RA on inflammatory reaction of keratinocytes was determined by RT-PCR and Western blot. RA significantly inhibited poly(I:C)-induced expression of inflammatory cytokines including IL-1β, IL-6, IL-8, CCL20, and TNF-α, and downregulated NF-κB signaling pathway in human keratinocytes. In addition, RA significantly inhibited poly(I:C)-induced inflammasome activation, in terms of secretion of active form of IL-1β and caspase-1. Furthermore, RA markedly inhibited poly(I:C)-induced NLRP3 and ASC expression. These results indicate that RA can inhibit poly(I:C)-induced inflammatory reaction of keratinocytes, and suggest that it may be a potential candidate for the treatment of psoriasis. Copyright © 2016 Elsevier Inc. All rights reserved.

  11. mTOR Activation by PI3K/Akt and ERK Signaling in Short ELF-EMF Exposed Human Keratinocytes.

    Directory of Open Access Journals (Sweden)

    Antonia Patruno

    Full Text Available Several reports suggest that ELF-EMF exposures interact with biological processes including promotion of cell proliferation. However, the molecular mechanisms by which ELF-EMF controls cell growth are not completely understood. The present study aimed to investigate the effect of ELF-EMF on keratinocytes proliferation and molecular mechanisms involved. Effect of ELF-EMF (50 Hz, 1 mT on HaCaT cell cycle and cells growth and viability was monitored by FACS analysis and BrdU assay. Gene expression profile by microarray and qRT-PCR validation was performed in HaCaT cells exposed or not to ELF-EMF. mTOR, Akt and MAPKs expressions were evaluated by Western blot analysis. In HaCaT cells, short ELF-EMF exposure modulates distinct patterns of gene expression involved in cell proliferation and in the cell cycle. mTOR activation resulted the main molecular target of ELF-EMF on HaCaT cells. Our data showed the increase of the canonical pathway of mTOR regulation (PI3K/Akt and activation of ERK signaling pathways. Our results indicate that ELF-EMF selectively modulated the expression of multiple genes related to pivotal biological processes and functions that play a key role in physio-pathological mechanisms such as wound healing.

  12. mTOR Activation by PI3K/Akt and ERK Signaling in Short ELF-EMF Exposed Human Keratinocytes (United States)

    Patruno, Antonia; Pesce, Mirko; Grilli, Alfredo; Speranza, Lorenza; Franceschelli, Sara; De Lutiis, Maria Anna; Vianale, Giovina; Costantini, Erica; Amerio, Paolo; Muraro, Raffaella; Felaco, Mario; Reale, Marcella


    Several reports suggest that ELF-EMF exposures interact with biological processes including promotion of cell proliferation. However, the molecular mechanisms by which ELF-EMF controls cell growth are not completely understood. The present study aimed to investigate the effect of ELF-EMF on keratinocytes proliferation and molecular mechanisms involved. Effect of ELF-EMF (50 Hz, 1 mT) on HaCaT cell cycle and cells growth and viability was monitored by FACS analysis and BrdU assay. Gene expression profile by microarray and qRT-PCR validation was performed in HaCaT cells exposed or not to ELF-EMF. mTOR, Akt and MAPKs expressions were evaluated by Western blot analysis. In HaCaT cells, short ELF-EMF exposure modulates distinct patterns of gene expression involved in cell proliferation and in the cell cycle. mTOR activation resulted the main molecular target of ELF-EMF on HaCaT cells. Our data showed the increase of the canonical pathway of mTOR regulation (PI3K/Akt) and activation of ERK signaling pathways. Our results indicate that ELF-EMF selectively modulated the expression of multiple genes related to pivotal biological processes and functions that play a key role in physio-pathological mechanisms such as wound healing. PMID:26431550

  13. mTOR Activation by PI3K/Akt and ERK Signaling in Short ELF-EMF Exposed Human Keratinocytes. (United States)

    Patruno, Antonia; Pesce, Mirko; Grilli, Alfredo; Speranza, Lorenza; Franceschelli, Sara; De Lutiis, Maria Anna; Vianale, Giovina; Costantini, Erica; Amerio, Paolo; Muraro, Raffaella; Felaco, Mario; Reale, Marcella


    Several reports suggest that ELF-EMF exposures interact with biological processes including promotion of cell proliferation. However, the molecular mechanisms by which ELF-EMF controls cell growth are not completely understood. The present study aimed to investigate the effect of ELF-EMF on keratinocytes proliferation and molecular mechanisms involved. Effect of ELF-EMF (50 Hz, 1 mT) on HaCaT cell cycle and cells growth and viability was monitored by FACS analysis and BrdU assay. Gene expression profile by microarray and qRT-PCR validation was performed in HaCaT cells exposed or not to ELF-EMF. mTOR, Akt and MAPKs expressions were evaluated by Western blot analysis. In HaCaT cells, short ELF-EMF exposure modulates distinct patterns of gene expression involved in cell proliferation and in the cell cycle. mTOR activation resulted the main molecular target of ELF-EMF on HaCaT cells. Our data showed the increase of the canonical pathway of mTOR regulation (PI3K/Akt) and activation of ERK signaling pathways. Our results indicate that ELF-EMF selectively modulated the expression of multiple genes related to pivotal biological processes and functions that play a key role in physio-pathological mechanisms such as wound healing.

  14. Human in vitro skin organ culture as a model system for evaluating DNA repair. (United States)

    Liu, Hannah; Tuchinda, Papapit; Fishelevich, Rita; Harberts, Erin; Gaspari, Anthony A


    UV-exposures result in accumulation of genetic lesions that facilitate the development of skin cancer. Numerous pharmacologic agents are currently under development to both inhibit formation of DNA lesions and enhance repair. Drugs must be evaluated in vitro, currently performed in cell culture systems, before being tested on humans. Current systems do not account for the architecture and diverse cellularity of intact human skin. To establish a novel, functionally viable, and reproducible in vitro skin organ culture system for studying the effects of various pharmacologic agents on DNA repair. Human skin was obtained from neonatal foreskins. Intact skin punches derived from foreskins were cultured in vitro prior to exposure to UV-irradiation, and evaluated for DNA-damage using a DNA dot blot. Serial skin biopsies were obtained from patients with actinic keratoses treated with topical imiquimod. Expression of immune-stimulating and DNA repair genes was evaluated in ex vivo and in vitro samples. DNA dot blots revealed active repair of UV induced lesions in our in vitro skin organ culture. The photo-protective effect of sunscreen was detected, while imiquimod treatment did not enhance DNA repair in vitro. The DNA repair molecules XPA and XPF were up-regulated in the skin of imiquimod treated patients with actinic keratoses and imiquimod treated bone marrow-derived cell lines, but not keratinocytes. Our in vitro human skin organ culture model detected repair of UV-induced DNA lesions, and may be easily adapted to investigate various photo-protective drugs intended to prevent or treat skin cancer. Copyright © 2014 Japanese Society for Investigative Dermatology. Published by Elsevier Ireland Ltd. All rights reserved.

  15. Investigation of double strand breaks induced by alpha particle irradiation using C.N.B.G. microbeam in human keratinocytes; Mise en evidence de cassures double brin de l'ADN induites par irradiation de keratinocytes humains en microfaisceau alpha

    Energy Technology Data Exchange (ETDEWEB)

    Pouthier, Th


    To understand the mechanisms of interaction of ionizing radiation with living tissues exposed to low and protracted doses remains a major issue for risk evaluation. The response cannot be found in epidemiological studies because the only available data concern accidental exposures to high doses of radiation. The natural exposure represents the main source of exposure in the daily life, just before the medical sources (radiology, radiotherapy). In addition, this kind of exposure is very difficult to reproduce in vitro by irradiating cell lines. The method per preference is based on random irradiation of cell populations. The mean number of particles having traversed cells is then calculated on the basis of Poisson statistics. In addition to inevitable multiple impacts, the numerous potential intracellular targets (nuclei, cytoplasm), the indirect effects induced by the impact of particles on neighbouring cells or simply the extracellular targets, constitute phenomena that make more complex the interpretation of experimental data. A charged particle microbeam was developed at C.E.N.B.G. to perform the targeted irradiation of individual cells with a targeting precision of a few microns. It is possible to deliver a counted number of alpha particles down to the ultimate dose of one alpha per cell, to target predetermined cells and then to observe the response of the neighbouring cells. This facility has been validated during this work on human keratinocyte cells expressing a recombinant nuclear fluorescent protein (histone H2B-GFP). The combination of ion micro-beams with confocal microscopy and numeric quantitative analysis allowed the measurement of DNA double strand breaks via the phosphorylation of the histone H2A.X in individual cells. The mechanisms of DNA reparation and apoptosis induction were also in the scope of those studies. The experimental results obtained during this thesis validate the methodology we have developed by demonstrating the targeting

  16. Hemin Reduces HMGB1 Release by UVB in an AMPK/HO-1-dependent Pathway in Human Keratinocytes HaCaT Cells. (United States)

    Park, Eun Jung; Kim, Young Min; Chang, Ki Churl


    High mobility group box 1 (HMGB1) plays an important role as a pro-inflammatory cytokine that regulates inflammation in various diseases. We hypothesized that hemin might reduce HMGB1 release through the induction of HO-1 in UVB-induced HaCaTs. The effects of hemin on the release of HMGB1 in UVB exposure were evaluated. The mechanisms were investigated using various signal inhibitors and small interfering RNA techniques. Treatment with hemin inhibited reactive oxygen species (ROS) in UVB-induced HaCaTs in a dose-dependent manner. HMGB1 release by UVB was significantly reduced by hemin, N-acetyl-cysteine and DPI (NADPH oxidase inhibitor). Hemin increased HO-1 induction followed by phosphorylation of AMPK in a time- and dose-dependent manner. Additionally, hemin significantly increased the NAD+/NADH ratio in HaCaTs. The inhibitory effects of UVB-induced HMGB1 release by hemin were significantly reversed not only with pharmacological inhibitors of AMPK (compound c) or HO-1 (ZnPPIX) but also through transfection of small interfering RNAs (siRNAs) for AMPK or HO-1. Interestingly, hemin decreased phosphor-AMPK expression by HO-1 siRNA transfection, but it failed to induce HO-1 in AMPK siRNA-transfected cells, which suggested that HO-1 was involved in AMPK activation by hemin in HaCaT. Moreover, recombinant HMGB1 induced Snail and inhibited E-Cadherin in HaCaTs, whereas hemin reversed those effects through rHMGB1. It is concluded that the increased activity of HO-1/AMPK and scavenging ROS are, at least in part, responsible for the inhibition of UVB-induced HMGB1 release in keratinocyte HaCaTs. Therefore, hemin may be a useful agent for preventing UVB-induced skin cancer. Copyright © 2017 IMSS. Published by Elsevier Inc. All rights reserved.

  17. Lactobacillus rhamnosus GG Lysate Increases Re-Epithelialization of Keratinocyte Scratch Assays by Promoting Migration. (United States)

    Mohammedsaeed, Walaa; Cruickshank, Sheena; McBain, Andrew J; O'Neill, Catherine A


    A limited number of studies have investigated the potential of probiotics to promote wound healing in the digestive tract. The aim of the current investigation was to determine whether probiotic bacteria or their extracts could be beneficial in cutaneous wound healing. A keratinocyte monolayer scratch assay was used to assess re-epithelialization; which comprises keratinocyte proliferation and migration. Primary human keratinocyte monolayers were scratched then exposed to lysates of Lactobacillus (L) rhamnosus GG, L. reuteri, L. plantarum or L. fermentum. Re-epithelialization of treated monolayers was compared to that of untreated controls. Lysates of L. rhamnosus GG and L. reuteri significantly increased the rate of re-epithelialization, with L. rhamnosus GG being the most efficacious. L. reuteri increased keratinocyte proliferation while L. rhamnosus GG lysate significantly increased proliferation and migration. Microarray analysis of L. rhamnosus GG treated scratches showed increased expression of multiple genes including the chemokine CXCL2 and its receptor CXCR2. These are involved in normal wound healing where they stimulate keratinocyte proliferation and/or migration. Increased protein expression of both CXCL2 and CXCR2 were confirmed by ELISA and immunoblotting. These data demonstrate that L. rhamnosus GG lysate accelerates re-epithelialization of keratinocyte scratch assays, potentially via chemokine receptor pairs that induce keratinocyte migration.

  18. No evidence for induction of key components of the Notch signaling pathway (Notch-1, Jagged-1) by treatment with UV-B, 1,25(OH)(2)D(3), and/or epigenetic drugs (TSA, 5-Aza) in human keratinocytes in vitro. (United States)

    Reichrath, Sandra; Reichrath, Jörg


    Notch signaling is of high importance for growth and survival of various cell types. We now analyzed the protein expression of two key components of the Notch signaling pathway (Notch-1, Jagged-1) in spontaneously immortalized (HaCaT) and in malignant (SCL-1) human keratinocytes, using western analysis. We found that Notch-1 and its corresponding ligand Jagged-1 are expressed in both cell lines, with no marked change following UV-B treatment. Moreover, treatment of both cell lines before or after UV-B irradiation with 1,25-dihydroxyvitamin D(3), the biologically active form of vitamin D, and/or epigenetic modulating drugs (TSA; 5-Aza) did not result in a marked modulation of the protein expression of Notch-1 or Jagged-1. Under the experimental conditions of this study, treatment with 1,25(OH)(2)D(3) protected human keratinocytes in part against the antiproliferative effects of UV-B-radiation. In conclusion, our findings do not point at a differential expression of these two key components of Notch signaling in non-malignant as compared to malignant human keratinocytes, indicating that alterations in their expression are not of importance for the photocarcinogenesis of human squamous cell carcinomas. Moreover, our findings do not support the hypothesis that modulation of Notch signaling may be involved in the photoprotective effect of 1,25-dihydroxyvitamin D(3), that we and others reported previously. Additionally, we demonstrate that epigenetic modulating drugs (TSA, 5-Aza) do not markedly modulate the expression Notch-1 or Jagged-1 in UV-B-treated human keratinocytes in vitro.

  19. Dorsal longitudinal foreskin cut is associated with reduced risk of HIV, syphilis and genital herpes in men: a cross-sectional study in Papua New Guinea

    Directory of Open Access Journals (Sweden)

    Andrew J Vallely


    Conclusions: In this large cross-sectional study, men with a dorsal longitudinal foreskin cut were significantly less likely to have HIV, HSV-2 and syphilis compared with uncut men, despite still having a complete (albeit morphologically altered foreskin. The protective effect of the dorsal cut suggests that the mechanism by which male circumcision works is not simply due to the removal of the inner foreskin and its more easily accessible HIV target cells. Exposure of the penile glans and inner foreskin appear to be key mechanisms by which male circumcision confers protection.Further research in this unique setting will help improve our understanding of the fundamental immunohistologic mechanisms by which male circumcision provides protection, and may lead to new biomedical prevention strategies at the mucosal level.

  20. Novel 11β-hydroxysteroid dehydrogenase 1 inhibitors reduce cortisol levels in keratinocytes and improve dermal collagen content in human ex vivo skin after exposure to cortisone and UV.

    Directory of Open Access Journals (Sweden)

    Stéphanie M Boudon

    Full Text Available Activity and selectivity assessment of new bi-aryl amide 11β-hydroxysteroid dehydrogenase 1 (11β-HSD1 inhibitors, prepared in a modular manner via Suzuki cross-coupling, are described. Several compounds inhibiting 11β-HSD1 at nanomolar concentrations were identified. Compounds 2b, 3e, 7b and 12e were shown to selectively inhibit 11β-HSD1 over 11β-HSD2, 17β-HSD1 and 17β-HSD2. These inhibitors also potently inhibited 11β-HSD1 activity in intact HEK-293 cells expressing the recombinant enzyme and in intact primary human keratinocytes expressing endogenous 11β-HSD1. Moreover, compounds 2b, 3e and 12e were tested for their activity in human skin biopsies. They were able to prevent, at least in part, both the cortisone- and the UV-mediated decreases in collagen content. Thus, inhibition of 11β-HSD1 by these compounds can be further investigated to delay or prevent UV-mediated skin damage and skin aging.

  1. HIV-1 efficient entry in inner foreskin is mediated by elevated CCL5/RANTES that recruits T cells and fuels conjugate formation with Langerhans cells.

    Directory of Open Access Journals (Sweden)

    Zhicheng Zhou


    Full Text Available Male circumcision reduces acquisition of HIV-1 by 60%. Hence, the foreskin is an HIV-1 entry portal during sexual transmission. We recently reported that efficient HIV-1 transmission occurs following 1 h of polarized exposure of the inner, but not outer, foreskin to HIV-1-infected cells, but not to cell-free virus. At this early time point, Langerhans cells (LCs and T-cells within the inner foreskin epidermis are the first cells targeted by the virus. To gain in-depth insight into the molecular mechanisms governing inner foreskin HIV-1 entry, foreskin explants were inoculated with HIV-1-infeceted cells for 4 h. The chemokine/cytokine milieu secreted by the foreskin tissue, and resulting modifications in density and spatial distribution of T-cells and LCs, were then investigated. Our studies show that in the inner foreskin, inoculation with HIV-1-infected cells induces increased CCL5/RANTES (1.63-fold and decreased CCL20/MIP-3-alpha (0.62-fold secretion. Elevated CCL5/RANTES mediates recruitment of T-cells from the dermis into the epidermis, which is blocked by a neutralizing CCL5/RANTES Ab. In parallel, HIV-1-infected cells mediate a bi-phasic modification in the spatial distribution of epidermal LCs: attraction to the apical surface at 1 h, followed by migration back towards the basement membrane later on at 4 h, in correlation with reduced CCL20/MIP-3-alpha at this time point. T-cell recruitment fuels the continuous formation of LC-T-cell conjugates, permitting the transfer of HIV-1 captured by LCs. Together, these results reveal that HIV-1 induces a dynamic process of immune cells relocation in the inner foreskin that is associated with specific chemokines secretion, which favors efficient HIV-1 entry at this site.

  2. HIV-1 Efficient Entry in Inner Foreskin Is Mediated by Elevated CCL5/RANTES that Recruits T Cells and Fuels Conjugate Formation with Langerhans Cells (United States)

    Zhou, Zhicheng; Barry de Longchamps, Nicolas; Schmitt, Alain; Zerbib, Marc; Vacher-Lavenu, Marie-Cécile; Bomsel, Morgane; Ganor, Yonatan


    Male circumcision reduces acquisition of HIV-1 by 60%. Hence, the foreskin is an HIV-1 entry portal during sexual transmission. We recently reported that efficient HIV-1 transmission occurs following 1 h of polarized exposure of the inner, but not outer, foreskin to HIV-1-infected cells, but not to cell-free virus. At this early time point, Langerhans cells (LCs) and T-cells within the inner foreskin epidermis are the first cells targeted by the virus. To gain in-depth insight into the molecular mechanisms governing inner foreskin HIV-1 entry, foreskin explants were inoculated with HIV-1-infeceted cells for 4 h. The chemokine/cytokine milieu secreted by the foreskin tissue, and resulting modifications in density and spatial distribution of T-cells and LCs, were then investigated. Our studies show that in the inner foreskin, inoculation with HIV-1-infected cells induces increased CCL5/RANTES (1.63-fold) and decreased CCL20/MIP-3-alpha (0.62-fold) secretion. Elevated CCL5/RANTES mediates recruitment of T-cells from the dermis into the epidermis, which is blocked by a neutralizing CCL5/RANTES Ab. In parallel, HIV-1-infected cells mediate a bi-phasic modification in the spatial distribution of epidermal LCs: attraction to the apical surface at 1 h, followed by migration back towards the basement membrane later on at 4 h, in correlation with reduced CCL20/MIP-3-alpha at this time point. T-cell recruitment fuels the continuous formation of LC-T-cell conjugates, permitting the transfer of HIV-1 captured by LCs. Together, these results reveal that HIV-1 induces a dynamic process of immune cells relocation in the inner foreskin that is associated with specific chemokines secretion, which favors efficient HIV-1 entry at this site. PMID:21738469

  3. Keratinocyte Apoptosis is Decreased in Psoriatic Epidermis

    Directory of Open Access Journals (Sweden)

    Fatma Eskioğlu


    Full Text Available Background and Design: Abnormal differentiation and hyperproliferation of keratinocytes are the hallmarks of psoriasis vulgaris. Although psoriasis vulgaris is generally accepted as a disease of decreased keratinocyte apoptosis, the results are contradictory. The aim of the current study is to investigate whether decreased keratinocyte apoptosis contributes to the formation of a thickened epidermis as increased keratinocyte proliferation. Material and Method: Forty-three untreated psoriasis vulgaris patients and 20 healthy control subjects were included into the study. Biopsy specimens taken from the enrollee were evaluated by immunohistochemical staining for Ki-67 expressions to show the proliferation of keratinocytes and by the terminal deoxynucleotidyl transferase-mediated dUTP-biotin nick-end labeling (TUNEL method to show the apoptotic keratinocytes. Results: Apoptotic index (percentage of the TUNEL positive cells was significantly lower in psoriatic epidermis (0.33±0.64 than in normal epidermis (0.75±0.85; whereas Ki-67 index (percentage of positively staining cells for Ki-67 was significantly higher in psoriatic epidermis (30.86±10.49 than in normal epidermis (11.65±2.98, (p=0.021 and p=0.00; respectively. Conclusion: Decreased keratinocyte apoptosis also contribute to increased epidermal thickness in psoriasis as well as increased keratinocyte proliferation.

  4. FGF7/KGF regulates autophagy in keratinocytes (United States)

    Belleudi, Francesca; Purpura, Valeria; Caputo, Silvia; Torrisi, Maria Rosaria


    Autophagy is a degradative pathway through which cells overcome stressful conditions and rapidly change their phenotype during differentiation. Despite its protective role, when exacerbated, autophagy may lead to cell death. Several growth factors involved in cell survival and in preventing differentiation are able to inhibit autophagy. Here we investigated the autophagic role of FGF7/KGF, an important player in epithelial cell protection and differentiation. Biochemical and quantitative fluorescence approaches showed that FGF7 and its signaling induce autophagy in human keratinocytes and the use of specific inhibitors indicated that this effect is independent of the PI3K-AKT-MTOR pathway. The selective block of autophagosome-to-lysosome fusion clarified that FGF7 induces autophagy stimulating autophagosome formation. However, quantitative fluorescence approaches also indicated that, upon a prolonged autophagic stimulus, FGF7 is able to accelerate autophagosome turnover. Moreover, in differentiating keratinocytes, the use of the autophagic inhibitor 3-MA as well as the depletion of BECN1 and ATG5, 2 essential regulators of the process, counteracted the FGF7-induced increase of the differentiation marker KRT1/K1, suggesting that autophagy is required for the FGF7-mediated early differentiation. These results provide the first evidence of a role of FGF7 in the regulation of sequential steps of the autophagic process and strengthen the hypothesis of a direct interplay between autophagy and differentiation. On the other hand, the ability of FGF7 to accelerate autophagosome turnover, preventing their dangerous accumulation, is consistent with the well-established protective role played by the growth factor in epithelial cells. PMID:24577098

  5. MiR-217 is down-regulated in psoriasis and promotes keratinocyte differentiation via targeting GRHL2

    Energy Technology Data Exchange (ETDEWEB)

    Zhu, Haigang; Hou, Liyue; Liu, Jingjing; Li, Zhiming, E-mail:


    MiR-217 is a well-known tumor suppressor, and its down-regulation has been shown in a wide range of solid and leukaemic cancers. However, the biological role of miR-217 in psoriasis pathogenesis, especially in keratinocyte hyperproliferation and differentiation, is not clearly understood. In this study, we found the expression of miR-217 was markedly down-regulated in psoriasis keratinocytes of psoriatic patients. In addition, overexpression of miR-217 inhibited the proliferation and promoted the differentiation of primary human keratinocytes. On the contrary, inhibition of endogenous miR-217 increased cell proliferation and delayed differentiation. Furthermore, Grainyhead-like 2 (GRHL2) was identified as a direct target of miR-217 by luciferase reporter assay. The expression of miR-217 and GRHL2 was inversely correlated in both transfected keratinocytes and in psoriasis lesional skin. Moreover, knocking down GRHL2 expression by siRNA enhanced keratinocyte differentiation. Taken together, our results demonstrate a role for miR-217 in the regulation of keratinocyte differentiation, partially through the regulation of GRHL2. - Highlights: • miR-217 is down-regulated in psoriasis skin lesions. • miR-217 inhibits the proliferation and promotes differentiation of keratinocytes. • GRHL2 is a novel target of miR-217 in keratinocytes. • GRHL2 is up-regulated and inversely correlated with miR-217 in psoriasis skin lesions.

  6. Tacrolimus Reverses UVB Irradiation-Induced Epidermal Langerhans Cell Reduction by Inhibiting TNF-α Secretion in Keratinocytes via Regulation of NF-κB/p65

    Directory of Open Access Journals (Sweden)

    JiaLi Xu


    Full Text Available Background: Topical calcineurin inhibitors including tacrolimus and pimecrolimus are used in the treatment of many inflammatory skin diseases mainly via blocking T-cell proliferation. Our previous studies found that pimecrolimus 1% cream could reverse high-dose ultraviolet B (UVB irradiation-induced epidermal Langerhans cell (LC reduction via inhibition of LC migration. We conducted this study to investigate the effects of topical tacrolimus 0.03% ointment on high-dose UVB-irradiated human epidermal LCs.Methods: Twenty fresh human foreskin tissues were randomly divided into four groups as follows: Control, Tacrolimus (0.03%, UVB (180 mJ/cm2, and UVB (180 mJ/cm2 + Tacrolimus (0.03%. Four time points were set as follows: 0, 18, 24, and 48 h. We collected culture medium and tissues at each time point. The percentage of CD1a+ cells in the medium was detected by means of flow cytometry. Each tissue was prepared for immunohistochemistry, real-time quantitative PCR, and western blot. HaCaT cells were cultured and divided into four groups: Control, Tacrolimus (1 μg/ml, UVB (30 mJ/cm2, and UVB (30 mJ/cm2 + Tacrolimus (1 μg/ml. The cells were incubated for 24 h and prepared for real-time quantitative PCR and western blot.Results: Topical tacrolimus significantly reversed high-dose UVB irradiation-induced epidermal LC reduction and CD1a+ cell increment in culture medium. Tacrolimus significantly inhibited UVB irradiation-induced tumor necrosis factor-α (TNF-α and nuclear factor kappa B (NF-κB/p65 mRNA and protein expression in HaCaT cells. Tacrolimus also significantly inhibited high-dose UVB irradiation-induced TNF-α expression in cultured tissues. Finally, TNF-α antagonist (recombinant human TNF-α receptor II: IgG Fc fusion protein could significantly reverse UVB irradiation-induced epidermal LC reduction.Conclusion: Topical tacrolimus 0.03% could reverse UVB irradiation-induced epidermal LC reduction by inhibiting TNF-α secretion in

  7. Keratinocytes regulate the function of melanocytes

    Directory of Open Access Journals (Sweden)

    Tomohisa Hirobe


    Full Text Available Mammalian keratinocytes compose the bulk of the epithelium, undergo keratinization, and form the dead superficial layer of the skin. These superficial keratinized cells are continuously replaced by cells derived from mitotic cells in the lowest layer of the epidermis (i.e., the basal layer. Melanocytes locate in the basal layer and do not keratinize; however, they can produce melanin pigments. Melanin is accumulated in small granules called melanosomes. The melanosomes are transported to dendrites from which the melanosomes are transferred to keratinocytes. Epidermal invaginations such as keratinocytes and melanocytes extend to the dermis to form hair follicles. In addition to these two cells, dermal fibroblasts are also required for the formation of hair follicles. The homeostasis of the epidermis and hair follicle is primarily regulated by the cellular interaction between keratinocytes and melanocytes. Keratinocytes stimulate melanocyte functions such as proliferation, differentiation, melanogenesis, and dendritogenesis. Using the techniques of tissue culture, biochemistry, and molecular biology, factors that have been derived from keratinocytes are hormones, growth factors, and cytokines such as α-melanocyte-stimulating hormone, adrenocorticotrophic hormone, basic fibroblast growth factor, nerve growth factor, endothelins, granulocyte-macrophage colony-stimulating factor, stem cell factor, leukemia inhibitory factor, and hepatocyte growth factor. These keratinocyte-derived paracrine factors have a key role in regulating melanocyte function through receptor-mediated signaling pathways, followed by maintaining epidermal and hair follicular homeostasis.

  8. Synthesis and biological activity of M6-P and M6-P analogs on fibroblast and keratinocyte proliferation. (United States)

    Clavel, Caroline; Barragan-Montero, Véronique; Garric, Xavier; Molès, Jean-Pierre; Montero, Jean-Louis


    A new synthetic route to obtain the carboxylate analog of mannose 6-phosphate (M6-P) is presented. The effects of the M6-P, the carboxylate and two other analogs (the phosphonate and the alpha,beta ethylenic carboxylate) on the proliferation of human keratinocytes and dermal fibroblasts as well as on the proliferation of a murine fibroblast cell line, 3T3-J2 are tested. We observed that M6-P is a potent inhibitor of proliferation of both fibroblasts and keratinocytes. Among its analogs, the phosphonate showed a similar effect on human dermal fibroblasts but not on keratinocytes.

  9. Humanized In Vivo Model for Streptococcal Impetigo (United States)

    Scaramuzzino, Dominick A.; McNiff, Jennifer M.; Bessen, Debra E.


    An in vivo model for group A streptococcal (GAS) impetigo was developed, whereby human neonatal foreskin engrafted onto SCID mice was superficially damaged and bacteria were topically applied. Severe infection, indicated by a purulent exudate, could be induced with as few as 1,000 CFU of a virulent strain. Early findings (48 h) showed a loss of stratum corneum and adherence of short chains of gram-positive cocci to the external surface of granular keratinocytes. This was followed by an increasing infiltration of polymorphonuclear leukocytes (neutrophils) of mouse origin, until a thick layer of pus covered an intact epidermis, with massive clumps of cocci accumulated at the outer rim of the pus layer. By 7 days postinoculation, the epidermis was heavily eroded; in some instances, the dermis contained pockets (ulcers) filled with cocci, similar to that observed for ecthyma. Importantly, virulent GAS underwent reproduction, resulting in a net increase in CFU of 20- to 14,000-fold. The majority of emm pattern D strains had a higher gross pathology score than emm pattern A, B, or C (A–C) strains, consistent with epidemiological findings that pattern D strains have a strong tendency to cause impetigo, whereas pattern A–C strains are more likely to cause pharyngitis. PMID:10768985

  10. Activation of two caspase cascades, caspase 8/3/6 and caspase 9/3/6, during photodynamic therapy using a novel photosensitizer, ATX-S10(Na), in normal human keratinocytes. (United States)

    Takahashi, Hidetoshi; Itoh, Yasuhiro; Miyauchi, Yuki; Nakajima, Susumu; Sakata, Isao; Ishida-Yamamoto, Akemi; Iizuka, Hajime


    Photodynamic therapy (PDT) is a potent treatment for skin tumors. Although the therapeutic effect of PDT is supposed to be due to cellular cytotoxicity, the precise mechanism is still unknown. ATX-S10(Na) [13,17-bis(1-carboxypropionyl)carbamoylethyl-8-ethenyl-2-hydroxy-3-hydroxyiminoethylidene-2,7,12,18-tetramethylporphyrin sodium salt], a novel hydrophilic chlorin photosensitizer, shows good accumulation in tumors and is suitable for use in PDT. In this study, we investigated the mechanism of PDT-induced cell death using ATX-S10(Na). . Following ATX-S10(Na) treatment for 12 h, normal human keratinocytes (NHK) were irradiated using a diode laser. PDT-induced cell death and the activity of various caspases were measured. Activation of Fas antigen was also determined by immunoprecipitation analysis. The expression of Bax, cytochrome c, and apoptosis-inducing factor (AIF) was determined by Western blotting. ATX-S10(Na)-PDT had induced apoptosis of NHK by 2 h and the maximal effect was observed at 6 h following irradiation. The effect was suppressed by pretreatment of NHK with inhibitors of caspases 3, 6, 8 and 9. A caspase activity assay revealed the sequential activation of caspases 8, 3 and 6, and caspases 9, 3 and 6, respectively. Immunoprecipitation analysis indicated multimerization of Fas antigen without Fas ligand binding in ATX-S10(Na)-PDT-treated NHK. Western blotting revealed cytosolic release of cytochrome c and AIF accompanied by decreased Bax expression in the cytosol. ATX-S10(Na)-PDT induces apoptosis of NHK, and this was mediated by sequential activation of two caspase cascades, caspases 8, 3 and 6, and caspases 9, 3 and 6. This was accompanied by multimerization of Fas antigen and cytosolic release of cytochrome c and AIF.

  11. Eight Nucleotide Substitutions Inhibit Splicing to HPV-16 3′-Splice Site SA3358 and Reduce the Efficiency by which HPV-16 Increases the Life Span of Primary Human Keratinocytes (United States)

    Li, Xiaoze; Johansson, Cecilia; Cardoso Palacios, Carlos; Mossberg, Anki; Dhanjal, Soniya; Bergvall, Monika; Schwartz, Stefan


    The most commonly used 3′-splice site on the human papillomavirus type 16 (HPV-16) genome named SA3358 is used to produce HPV-16 early mRNAs encoding E4, E5, E6 and E7, and late mRNAs encoding L1 and L2. We have previously shown that SA3358 is suboptimal and is totally dependent on a downstream splicing enhancer containingmultiple potential ASF/SF2 binding sites. Here weshow that only one of the predicted ASF/SF2 sites accounts for the majority of the enhancer activity. We demonstrate that single nucleotide substitutions in this predicted ASF/SF2 site impair enhancer function and that this correlates with less efficient binding to ASF/SF2 in vitro. We provide evidence that HPV-16 mRNAs that arespliced to SA3358 interact with ASF/SF2 in living cells. In addition,mutational inactivation of the ASF/SF2 site weakened the enhancer at SA3358 in episomal forms of the HPV-16 genome, indicating that the enhancer is active in the context of the full HPV-16 genome.This resulted in induction of HPV-16 late gene expression as a result of competition from late splice site SA5639. Furthermore, inactivation of the ASF/SF2 site of the SA3358 splicing enhancer reduced the ability of E6- and E7-encoding HPV-16 plasmids to increase the life span of primary keratinocytes in vitro, demonstrating arequirement for an intact splicing enhancer of SA3358 forefficient production of the E6 and E7 mRNAs. These results link the strength of the HPV-16 SA3358 splicing enhancer to expression of E6 and E7 and to the pathogenic properties of HPV-16. PMID:24039800

  12. Eight nucleotide substitutions inhibit splicing to HPV-16 3'-splice site SA3358 and reduce the efficiency by which HPV-16 increases the life span of primary human keratinocytes.

    Directory of Open Access Journals (Sweden)

    Xiaoze Li

    Full Text Available The most commonly used 3'-splice site on the human papillomavirus type 16 (HPV-16 genome named SA3358 is used to produce HPV-16 early mRNAs encoding E4, E5, E6 and E7, and late mRNAs encoding L1 and L2. We have previously shown that SA3358 is suboptimal and is totally dependent on a downstream splicing enhancer containingmultiple potential ASF/SF2 binding sites. Here weshow that only one of the predicted ASF/SF2 sites accounts for the majority of the enhancer activity. We demonstrate that single nucleotide substitutions in this predicted ASF/SF2 site impair enhancer function and that this correlates with less efficient binding to ASF/SF2 in vitro. We provide evidence that HPV-16 mRNAs that arespliced to SA3358 interact with ASF/SF2 in living cells. In addition,mutational inactivation of the ASF/SF2 site weakened the enhancer at SA3358 in episomal forms of the HPV-16 genome, indicating that the enhancer is active in the context of the full HPV-16 genome.This resulted in induction of HPV-16 late gene expression as a result of competition from late splice site SA5639. Furthermore, inactivation of the ASF/SF2 site of the SA3358 splicing enhancer reduced the ability of E6- and E7-encoding HPV-16 plasmids to increase the life span of primary keratinocytes in vitro, demonstrating arequirement for an intact splicing enhancer of SA3358 forefficient production of the E6 and E7 mRNAs. These results link the strength of the HPV-16 SA3358 splicing enhancer to expression of E6 and E7 and to the pathogenic properties of HPV-16.

  13. Phenylpropanoid glycosides from plant cell cultures induce heme oxygenase 1 gene expression in a human keratinocyte cell line by affecting the balance of NRF2 and BACH1 transcription factors. (United States)

    Sgarbossa, Anna; Dal Bosco, Martina; Pressi, Giovanna; Cuzzocrea, Salvatore; Dal Toso, Roberto; Menegazzi, Marta


    Phenylpropanoids have several highly significant biological properties in both plants and animals. Four phenylpropanoid glycosides (PPGs), verbascoside (VB), forsythoside B (FB), echinacoside (EC) and campneoside I (CP), were purified and tested for their capability to activate NRF2 and induce phase II cytoprotective enzymes in a human keratinocyte cell line (HaCaT). All four substances showed similar strong antioxidant and radical-scavenging activities as determined by diphenylpicrylhydrazyl assay. Furthermore, in HaCaT cells, FB and EC are strong activators of NRF2, the nuclear transcription factor regulating many phase II detoxifying and cytoprotective enzymes, such as heme oxygenase 1 (HMOX1). In HaCaT cells, FB and EC (200 μM) induced nuclear translocation of NRF2 protein after 24 h and reduced nuclear protein levels of BACH1, a repressor of the antioxidant response element. FB and EC greatly HMOX1 mRNA levels by more than 40-fold in 72 h. Cytoplasmic HMOX1 protein levels were also increased at 48 h after treatment. VB was less active compared to FB and EC, and CP was slightly active only at later times of treatment. We suggest that hydroxytyrosol (HYD) could be a potential bioactive metabolite of PPGs since HYD, in equimolar amounts to PGGs, is able to both activate HO-1 transcription and modify Nrf2/Bach1 nuclear protein levels. This is in agreement with the poor activity of CP, which contains a HYD moiety modified by an O-methyl group. In conclusion, FB and EC from plant cell cultures may provide long-lasting skin protection by induction of phase II cytoprotective capabilities. Copyright © 2012 Elsevier Ireland Ltd. All rights reserved.

  14. Novel glycosylated mycosporine-like amino acid, 13-O-(β-galactosyl)-porphyra-334, from the edible cyanobacterium Nostoc sphaericum-protective activity on human keratinocytes from UV light. (United States)

    Ishihara, Kenji; Watanabe, Ryuichi; Uchida, Hajime; Suzuki, Toshiyuki; Yamashita, Michiaki; Takenaka, Hiroyuki; Nazifi, Ehsan; Matsugo, Seiichi; Yamaba, Minami; Sakamoto, Toshio


    A UV-absorbing compound was purified and identified as a novel glycosylated mycosporine-like amino acid (MAA), 13-O-β-galactosyl-porphyra-334 (β-Gal-P334) from the edible cyanobacterium Nostoc sphaericum, known as "ge xian mi" in China and "cushuro" in Peru. Occurrence of the hexosylated derivative of shinorine (hexosyl-shinorine) was also supported by LC-MS/MS analysis. β-Gal-P334 accounted for about 86.5% of total MAA in N. sphaericum, followed by hexosyl-shinorine (13.2%) and porphyra-334 (0.2%). β-Gal-P334 had an absorption maximum at 334nm and molecular absorption coefficient was 46,700 at 334nm. Protection activity of β-Gal-P334 from UVB and UVA+8-methoxypsoralen induced cell damage on human keratinocytes (HaCaT) was assayed in comparison with other MAA (porphyra-334, shinorine, palythine and mycosporine-glycine). The UVB protection activity was highest in mycosporine-glycine, followed by palythine, β-Gal-P334, porphyra-334 and shinorine in order. β-Gal-P334 had highest protection activity from UVA+8-methoxypsoralen induced cell damage followed by porphyra-334, shinorine, mycosporine-glycine and palythine. We also found an antioxidant (radical-scavenging) activity of β-Gal-P334 by colorimetric and ESR methods. From these findings, β-Gal-P334 was suggested to play important roles in stress tolerant mechanisms such as UV and oxidative stress in N. sphaericum as a major MAA. We also consider that the newly identified MAA, β-Gal-P334 has a potential for use as an ingredient of cosmetics and toiletries. Copyright © 2017 Elsevier B.V. All rights reserved.

  15. Fisetin inhibits TNF-α-induced inflammatory action and hydrogen peroxide-induced oxidative damage in human keratinocyte HaCaT cells through PI3K/AKT/Nrf-2-mediated heme oxygenase-1 expression. (United States)

    Seo, Seung-Hee; Jeong, Gil-Saeng


    Oxidative skin damage and skin inflammation play key roles in the pathogenesis of skin-related diseases. Fisetin is a naturally occurring flavonoid abundantly found in several vegetables and fruits. Fisetin has been shown to exert various positive biological effects, such as anti-cancer, anti-proliferative, neuroprotective and anti-oxidative effects. In this study, we investigate the skin protective effects and anti-inflammatory properties of fisetin in hydrogen peroxide- and TNF-α-challenged human keratinocyte HaCaT cells. When HaCaT cells were treated with non-cytotoxic concentrations of fisetin (1-20μM), heme oxygenase (HO)-1 mRNA and protein expression increased in a dose-dependent manner. Furthermore, fisetin dose-dependently increased cell viability and reduced ROS production in hydrogen peroxide-treated HaCaT cells. Fisetin also inhibited the production of NO, PGE2 IL-1β, IL-6, expression of iNOS and COX-2, and activation of NF-κB in HaCaT cells treated with TNF-α. Fisetin induced Nrf2 translocation to the nuclei. HO-1 siRNA transient transfection reversed the effects of fisetin on cytoprotection, ROS reduction, NO, PGE2, IL-1β, IL-6, and TNF-α production, and NF-κB DNA-binding activity. Moreover, fisetin increased Akt phosphorylation and a PI3K pathway inhibitor (LY294002) abolished fisetin-induced cytoprotection and NO inhibition. Taken together, these results provide evidence for a beneficial role of fisetin in skin therapy. Copyright © 2015. Published by Elsevier B.V.

  16. Salivary trefoil factor 3 enhances migration of oral keratinocytes. (United States)

    Storesund, Trond; Hayashi, Katsuhiko; Kolltveit, Kristin M; Bryne, Magne; Schenck, Karl


    Trefoil factor 3 (TFF3) is a member of the mammalian TFF family. Trefoil factors are secreted onto mucosal surfaces of the entire body and exert different effects according to tissue location. Trefoil factors may enhance mucosal healing by modulating motogenic activity, inhibiting apoptosis, and promoting angiogenesis. Trefoil factor 3 is secreted from the submandibular gland and is present in whole saliva. The aim of this study was to assess the migratory and proliferative effects of TFF3 on primary oral human keratinocytes and oral cancer cell lines. The addition of TFF3 increased the migration of both normal oral keratinocytes and the cancer cell line D12, as evaluated by a two-dimensional scratch assay. By contrast, no increase in proliferation or energy metabolism was observed after stimulation with TFF3. Trefoil factor 3-enhanced migration was found to be driven partly by the extracellular signal-related kinase (Erk1/2) pathway, as shown by addition of the mitogen-activated protein kinase (MAPK) inhibitor PD 98059. Previous functional studies on trefoil peptides have all been based on cells from monolayered epithelium like the intestinal mucosa; this is the first report to show that normal and cancerous keratinocytes from stratified epithelium respond to TFF stimuli. Taken together, salivary TFF3 is likely to contribute to oral wound healing.

  17. Formation of keratinocyte multilayers on filters under airlifted or submerged culture conditions in medium containing calcium, ascorbic acid, and keratinocyte growth factor. (United States)

    Seo, Akira; Kitagawa, Norio; Matsuura, Takashi; Sato, Hironobu; Inai, Tetsuichiro


    Three-dimensional (3D) cell culture is a powerful in vitro technique to study the stratification and differentiation of keratinocytes. However, culture conditions, including culture media, supplements, and scaffolds (e.g., collagen gels with or without fibroblasts), can vary considerably. Here, we evaluated the roles of calcium, L-ascorbic acid phosphate magnesium salt n-hydrate (APM), and keratinocyte growth factor (KGF) in a chemically defined medium, EpiLife, in 3D cultures of primary human epidermal keratinocytes directly plated on polycarbonate filter inserts under airlifted or submerged conditions. Eight culture media containing various combinations of these three supplements were examined. Calcium was necessary for the stratification and differentiation of keratinocytes based on the localization of keratins and involucrin. However, the localization patterns of keratins and integrin β4 were partially disrupted and Ki67-positive basal cells almost disappeared 3 weeks after airlift. The addition of KGF, but not APM, prevented these changes. Further addition of APM markedly improved the tissue architecture, including basal cell morphology and the appearance of keratohyalin granules and localized involucrin in the upper suprabasal cells, even after 1 week. Although the submerged culture also formed cornified epithelium-like multilayers, involucrin was localized in the cornified layer, where nuclei were often found. Based on these results, it is most effective to culture keratinocytes at the air-liquid interface in EpiLife medium supplemented with calcium, APM, and KGF to form well-organized and orthokeratinized multilayers as skin analogues.

  18. 3D co-cultures of keratinocytes and melanocytes and cytoprotective effects on keratinocytes against reactive oxygen species by insect virus-derived protein microcrystals

    Energy Technology Data Exchange (ETDEWEB)

    Shimabukuro, Junji; Yamaoka, Ayako; Murata, Ken-ichi [Department of Applied Biology, Kyoto Institute of Technology, Kyoto (Japan); Kotani, Eiji [Department of Applied Biology, Kyoto Institute of Technology, Kyoto (Japan); Insect Biomedical Research Center, Kyoto Institute of Technology, Kyoto (Japan); Hirano, Tomoko [Venture Laboratory, Kyoto Institute of Technology, Kyoto (Japan); Nakajima, Yumiko [Functional Genomics Group, COMB, Tropical Biosphere Research Center, University of the Ryukyus, Okinawa (Japan); Matsumoto, Goichi [Division of Oral Surgery, Yokohama Clinical Education Center of Kanagawa Dental University, Yokohama (Japan); Mori, Hajime, E-mail: [Department of Applied Biology, Kyoto Institute of Technology, Kyoto (Japan); Insect Biomedical Research Center, Kyoto Institute of Technology, Kyoto (Japan)


    Stable protein microcrystals called polyhedra are produced by certain insect viruses. Cytokines, such as fibroblast growth factors (FGFs), can be immobilized within polyhedra. Here, we investigated three-dimensional (3D) co-cultures of keratinocytes and melanocytes on collagen gel containing FGF-2 and FGF-7 polyhedra. Melanocytes were observed to reside at the base of the 3D cell culture and melanin was also typically observed in the lower layer. The 3D cell culture model with FGF-2 and FGF-7 polyhedra was a useful in vitro model of the epidermis due to effective melanogenesis, proliferation and differentiation of keratinocytes. FGF-7 polyhedra showed a potent cytoprotective effect when keratinocytes were treated with menadione, which is a generator of reactive oxygen species. The cytoprotective effect was activated by the inositol triphosphate kinase–Akt pathway leading to upregulation of the antioxidant enzymes superoxide dismutase and peroxiredoxin 6. - Highlights: • 3D cultures using FGF-2 and FGF-7 microcrystals as a human skin model • Cytoprotection of keratinocytes against ROS by FGF-7 microcrystals • Overexpression of SOD and Prdx6 in keratinocytes by FGF-7 microcrystals.

  19. Water-filtered near-infrared influences collagen synthesis of keloid-fibroblasts in contrast to normal foreskin fibroblasts. (United States)

    Zöller, Nadja; König, Anke; Butting, Manuel; Kaufmann, Roland; Bernd, August; Valesky, Eva; Kippenberger, Stefan


    Hypertrophic scar development is associated to impaired wound healing, imbalanced fibroblast proliferation and extracellular matrix synthesis. Stigmatization, physical restrictions and high recurrence rates are only some aspects that illustrate the severe influence impaired wound healing can have on patients' life. The treatment of hypertrophic scars especially keloids is still a challenge. In recent years water-filtered near-infrared irradiation (wIRA) composed of near-infrared (NIR) and a thermal component is applied for an increasing penal of clinical purposes. It is described to beneficially influence e.g. wound healing. But discrimination between the thermal and the NIR dependent components of these effects has not been conclusively elucidated. Aim of our study was therefore to investigate the influence of the light fraction on the thermal impact of wIRA irradiation in dermal cells. We concentrated our analysis on morphological properties and collagen synthesis. Foreskin fibroblasts and the keloid fibroblast cell line KF111 were exposed to temperatures between 37°C and 46°C with or without additional irradiation with 360J/cm(2) NIR. Our results show that viability was not influenced by irradiation. Independent of the analysed fibroblast species temperature dependent occurrence of spheric cells could be observed. These morphological changes were clearly counteracted by additional light exposure. Convective heat reduced collagen type I synthesis in both cell species depending on the applied temperature. Co-treatment with NIR significantly reversed this effect in keloid fibroblast cultures treated at 46°C whereas no difference could be observed in the foreskin fibroblasts. The observed influence on collagen type I synthesis was associated to a temperature dependent TGF-β1 secretion reduction. Co-stimulation of keloid cultures with NIR at 46°C completely abolished the temperature dependent TGF-β1 secretion reduction. In foreskin fibroblast cultures co

  20. Centella asiatica protects against UVB-induced HaCaT keratinocyte damage through microRNA expression changes. (United States)

    An, In-Sook; An, Sungkwan; Choe, Tae-Βoo; Kang, Sang-Μo; Lee, Jae Ho; Park, In-Chul; Jin, Young-Woo; Lee, Su-Jae; Bae, Seunghee


    This study aimed to evaluate the protective effects of Centella asiatica (C. asiatica) against ultraviolet B (UVB) damage in human keratinocytes using microRNA (miRNA) expression profiling analysis. Titrated extract of C. asiatica (TECA) demonstrated low cytotoxicity in normal human HaCaT keratinocytes only at low doses (<5 µg/ml). UVB (50 mJ/cm2) irradiation significantly decreased cell viability, and TECA treatment decreased the UVB toxicity. By using miRNA microarrays, we determined that 72 miRNAs had an altered expression following TECA treatment in UVB-irradiated keratinocytes (46 upregulated and 26 downregulated). Using an miRNA target gene prediction tool and Gene Ontology (GO) analysis, we determined that miRNAs with altered expression were functionally related with the inhibition of apoptosis and cell proliferation. Overall, these results provide meaningful information to facilitate the understanding of TECA-mediated UVB protection in human keratinocytes.

  1. Differential effects of caffeine on hair shaft elongation, matrix and outer root sheath keratinocyte proliferation, and transforming growth factor-β2/insulin-like growth factor-1-mediated regulation of the hair cycle in male and female human hair follicles in vitro. (United States)

    Fischer, T W; Herczeg-Lisztes, E; Funk, W; Zillikens, D; Bíró, T; Paus, R


    Caffeine reportedly counteracts the suppression of hair shaft production by testosterone in organ-cultured male human hair follicles (HFs). We aimed to investigate the impact of caffeine (i) on additional key hair growth parameters, (ii) on major hair growth regulatory factors and (iii) on male vs. female HFs in the presence of testosterone. Microdissected male and female human scalp HFs were treated in serum-free organ culture for 120 h with testosterone alone (0·5 μg mL(-1)) or in combination with caffeine (0·005-0·0005%). The following effects on hair shaft elongation were evaluated by quantitative (immuno)histomorphometry: HF cycling (anagen-catagen transition); hair matrix keratinocyte proliferation; expression of a key catagen inducer, transforming growth factor (TGF)-β2; and expression of the anagen-prolonging insulin-like growth factor (IGF)-1. Caffeine effects were further investigated in human outer root sheath keratinocytes (ORSKs). Caffeine enhanced hair shaft elongation, prolonged anagen duration and stimulated hair matrix keratinocyte proliferation. Female HFs showed higher sensitivity to caffeine than male HFs. Caffeine counteracted testosterone-enhanced TGF-β2 protein expression in male HFs. In female HFs, testosterone failed to induce TGF-β2 expression, while caffeine reduced it. In male and female HFs, caffeine enhanced IGF-1 protein expression. In ORSKs, caffeine stimulated cell proliferation, inhibited apoptosis/necrosis, and upregulated IGF-1 gene expression and protein secretion, while TGF-β2 protein secretion was downregulated. This study reveals new growth-promoting effects of caffeine on human hair follicles in subjects of both sexes at different levels (molecular, cellular and organ). © 2014 British Association of Dermatologists.

  2. Cadmium, lead, and arsenic contamination in paddy soils of a mining area and their exposure effects on human HEPG2 and keratinocyte cell-lines. (United States)

    Xue, Shengguo; Shi, Lizheng; Wu, Chuan; Wu, Hui; Qin, Yanyan; Pan, Weisong; Hartley, William; Cui, Mengqian


    A mining district in south China shows significant metal(loid) contamination in paddy fields. In the soils, average Pb, Cd and As concentrations were 460.1, 11.7 and 35.1mgkg-1 respectively, which were higher than the environmental quality standard for agricultural soils in China (GB15618-1995) and UK Clea Soil Guideline Value. The average contents of Pb, Cd and As in rice were 5.24, 1.1 and 0.7mgkg-1 respectively, which were about 25, 4.5 or 2.5 times greater than the limit values of the maximum safe contaminant concentration standard in food of China (GB 2762-2012), and about 25, 10 or 1 times greater than the limit values of FAO/WHO standard. The elevated contents of Pb, Cd and As detected in soils around the factories, indicated that their spatial distribution was influenced by anthropogenic activity, while greater concentrations of Cd in rice appeared in the northwest region of the factories, indicating that the spatial distribution of heavy metals was also affected by natural factors. As human exposure around mining districts is mainly through oral intake of food and dermal contact, the effects of these metals on the viability and MT protein of HepG2 and KERTr cells were investigated. The cell viability decreased with increasing metal concentrations. Co-exposure to heavy metals (Pb+Cd) increased the metals (Pb or Cd)-mediated MT protein induction in both human HepG2 and KERTr cells. Increased levels of MT protein will lead to greater risk of carcinogenic manifestations, and it is likely that chronic exposure to metals may increase the risk to human health. Nevertheless, when co-exposure to two or more metals occur (such as As+Pb), they may have an antagonistic effect thus reducing the toxic effects of each other. Metal contaminations in paddy soils and rice were influenced by anthropogenic activity; metal co-exposure induced MT protein in human cells. Copyright © 2017 Elsevier Inc. All rights reserved.

  3. Lactobacillus rhamnosus GG inhibits the toxic effects of Staphylococcus aureus on epidermal keratinocytes. (United States)

    Mohammedsaeed, Walaa; McBain, Andrew J; Cruickshank, Sheena M; O'Neill, Catherine A


    Few studies have evaluated the potential benefits of the topical application of probiotic bacteria or material derived from them. We have investigated whether a probiotic bacterium, Lactobacillus rhamnosus GG, can inhibit Staphylococcus aureus infection of human primary keratinocytes in culture. When primary human keratinocytes were exposed to S. aureus, only 25% of the keratinocytes remained viable following 24 h of incubation. However, in the presence of 10(8) CFU/ml of live L. rhamnosus GG, the viability of the infected keratinocytes increased to 57% (P = 0.01). L. rhamnosus GG lysates and spent culture fluid also provided significant protection to keratinocytes, with 65% (P = 0.006) and 57% (P = 0.01) of cells, respectively, being viable following 24 h of incubation. Keratinocyte survival was significantly enhanced regardless of whether the probiotic was applied in the viable form or as cell lysates 2 h before or simultaneously with (P = 0.005) or 12 h after (P = 0.01) S. aureus infection. However, spent culture fluid was protective only if added before or simultaneously with S. aureus. With respect to mechanism, both L. rhamnosus GG lysate and spent culture fluid apparently inhibited adherence of S. aureus to keratinocytes by competitive exclusion, but only viable bacteria or the lysate could displace S. aureus (P = 0.04 and 0.01, respectively). Furthermore, growth of S. aureus was inhibited by either live bacteria or lysate but not spent culture fluid. Together, these data suggest at least two separate activities involved in the protective effects of L. rhamnosus GG against S. aureus, growth inhibition and reduction of bacterial adhesion. Copyright © 2014, American Society for Microbiology. All Rights Reserved.

  4. Comparison of epidermal keratinocytes and dermal fibroblasts as potential target cells for somatic gene therapy of phenylketonuria

    DEFF Research Database (Denmark)

    Christensen, Rikke; Güttler, Flemming; Jensen, Thomas G


    gene therapy. We have previously shown that overexpression of PAH and GTP-CH in primary human keratinocytes leads to high levels of phenylalanine clearance without BH(4) supplementation [Gene Ther. 7 (2000) 1971]. Here, we investigate the capacity of fibroblasts, another cell type from the skin......, to metabolize phenylalanine. After retroviral gene transfer of PAH and GTP-CH both normal and PKU patient fibroblasts were able to metabolize phenylalanine, however, in lower amounts compared to genetically modified keratinocytes. Further comparative analyses between keratinocytes and fibroblasts revealed...

  5. Induction of dental epithelial cell differentiation marker gene expression in non-odontogenic human keratinocytes by transfection with thymosin beta 4

    Directory of Open Access Journals (Sweden)

    Tamotsu Kiyoshima


    Full Text Available Previous studies have shown that the recombination of cells liberated from developing tooth germs develop into teeth. However, it is difficult to use human developing tooth germ as a source of cells because of ethical issues. Previous studies have reported that thymosin beta 4 (Tmsb4x is closely related to the initiation and development of the tooth germ. We herein attempted to establish odontogenic epithelial cells from non-odontogenic HaCaT cells by transfection with TMSB4X. TMSB4X-transfected cells formed nodules that were positive for Alizarin-red S (ALZ and von Kossa staining (calcium phosphate deposits when cultured in calcification-inducing medium. Three selected clones showing larger amounts of calcium deposits than the other clones, expressed PITX2, Cytokeratin 14, and Sonic Hedgehog. The upregulation of odontogenesis-related genes, such as runt-related transcription factor 2 (RUNX2, Amelogenin (AMELX, Ameloblastin (AMBN and Enamelin (ENAM was also detected. These proteins were immunohistochemically observed in nodules positive for the ALZ and von Kossa staining. RUNX2-positive selected TMSB4X-transfected cells implanted into the dorsal subcutaneous tissue of nude mice formed matrix deposits. Immunohistochemically, AMELX, AMBN and ENAM were observed in the matrix deposits. This study demonstrated the possibility of induction of dental epithelial cell differentiation marker gene expression in non-odontogenic HaCaT cells by TMSB4X.

  6. Induction of dental epithelial cell differentiation marker gene expression in non-odontogenic human keratinocytes by transfection with thymosin beta 4. (United States)

    Kiyoshima, Tamotsu; Fujiwara, Hiroaki; Nagata, Kengo; Wada, Hiroko; Ookuma, Yukiko F; Shiotsuka, Maho; Kihara, Makiko; Hasegawa, Kana; Someya, Hirotaka; Sakai, Hidetaka


    Previous studies have shown that the recombination of cells liberated from developing tooth germs develop into teeth. However, it is difficult to use human developing tooth germ as a source of cells because of ethical issues. Previous studies have reported that thymosin beta 4 (Tmsb4x) is closely related to the initiation and development of the tooth germ. We herein attempted to establish odontogenic epithelial cells from non-odontogenic HaCaT cells by transfection with TMSB4X. TMSB4X-transfected cells formed nodules that were positive for Alizarin-red S (ALZ) and von Kossa staining (calcium phosphate deposits) when cultured in calcification-inducing medium. Three selected clones showing larger amounts of calcium deposits than the other clones, expressed PITX2, Cytokeratin 14, and Sonic Hedgehog. The upregulation of odontogenesis-related genes, such as runt-related transcription factor 2 (RUNX2), Amelogenin (AMELX), Ameloblastin (AMBN) and Enamelin (ENAM) was also detected. These proteins were immunohistochemically observed in nodules positive for the ALZ and von Kossa staining. RUNX2-positive selected TMSB4X-transfected cells implanted into the dorsal subcutaneous tissue of nude mice formed matrix deposits. Immunohistochemically, AMELX, AMBN and ENAM were observed in the matrix deposits. This study demonstrated the possibility of induction of dental epithelial cell differentiation marker gene expression in non-odontogenic HaCaT cells by TMSB4X. Copyright © 2013. Published by Elsevier B.V.

  7. Eccrine Sweat Contains IL-1α, IL-1β and IL-31 and Activates Epidermal Keratinocytes as a Danger Signal (United States)

    Dai, Xiuju; Okazaki, Hidenori; Hanakawa, Yasushi; Murakami, Masamoto; Tohyama, Mikiko; Shirakata, Yuji; Sayama, Koji


    Eccrine sweat is secreted onto the skin's surface and is not harmful to normal skin, but can exacerbate eczematous lesions in atopic dermatitis. Although eccrine sweat contains a number of minerals, proteins, and proteolytic enzymes, how it causes skin inflammation is not clear. We hypothesized that it stimulates keratinocytes directly, as a danger signal. Eccrine sweat was collected from the arms of healthy volunteers after exercise, and levels of proinflammatory cytokines in the sweat were quantified by ELISA. We detected the presence of IL-1α, IL-1β, and high levels of IL-31 in sweat samples. To investigate whether sweat activates keratinocytes, normal human keratinocytes were stimulated with concentrated sweat. Western blot analysis demonstrated the activation of NF-κB, ERK, and JNK signaling in sweat-stimulated keratinocytes. Real-time PCR using total RNA and ELISA analysis of supernatants showed the upregulation of IL-8 and IL-1β by sweat. Furthermore, pretreatment with IL-1R antagonist blocked sweat-stimulated cytokine production and signal activation, indicating that bioactive IL-1 is a major factor in the activation of keratinocytes by sweat. Moreover, IL-31 seems to be another sweat stimulator that activates keratinocytes to produce inflammatory cytokine, CCL2. Sweat is secreted onto the skin's surface and does not come into contact with keratinocytes in normal skin. However, in skin with a defective cutaneous barrier, such as atopic dermatitis-affected skin, sweat cytokines can directly act on epidermal keratinocytes, resulting in their activation. In conclusion, eccrine sweat contains proinflammatory cytokines, IL-1 and IL-31, and activates epidermal keratinocytes as a danger signal. PMID:23874436

  8. Eccrine sweat contains IL-1α, IL-1β and IL-31 and activates epidermal keratinocytes as a danger signal.

    Directory of Open Access Journals (Sweden)

    Xiuju Dai

    Full Text Available Eccrine sweat is secreted onto the skin's surface and is not harmful to normal skin, but can exacerbate eczematous lesions in atopic dermatitis. Although eccrine sweat contains a number of minerals, proteins, and proteolytic enzymes, how it causes skin inflammation is not clear. We hypothesized that it stimulates keratinocytes directly, as a danger signal. Eccrine sweat was collected from the arms of healthy volunteers after exercise, and levels of proinflammatory cytokines in the sweat were quantified by ELISA. We detected the presence of IL-1α, IL-1β, and high levels of IL-31 in sweat samples. To investigate whether sweat activates keratinocytes, normal human keratinocytes were stimulated with concentrated sweat. Western blot analysis demonstrated the activation of NF-κB, ERK, and JNK signaling in sweat-stimulated keratinocytes. Real-time PCR using total RNA and ELISA analysis of supernatants showed the upregulation of IL-8 and IL-1β by sweat. Furthermore, pretreatment with IL-1R antagonist blocked sweat-stimulated cytokine production and signal activation, indicating that bioactive IL-1 is a major factor in the activation of keratinocytes by sweat. Moreover, IL-31 seems to be another sweat stimulator that activates keratinocytes to produce inflammatory cytokine, CCL2. Sweat is secreted onto the skin's surface and does not come into contact with keratinocytes in normal skin. However, in skin with a defective cutaneous barrier, such as atopic dermatitis-affected skin, sweat cytokines can directly act on epidermal keratinocytes, resulting in their activation. In conclusion, eccrine sweat contains proinflammatory cytokines, IL-1 and IL-31, and activates epidermal keratinocytes as a danger signal.

  9. The effect of different biologic and biosynthetic wound covers on keratinocyte growth, stratification and differentiation in vitro

    Directory of Open Access Journals (Sweden)

    Eva Matoušková


    Full Text Available The purpose of this study was to compare, by means of in vitro cultivation technique, five marketed brands of wound covers used in the treatment of burns and other skin defects (Biobrane®, Suprathel®, Veloderm®, Xe-Derma®, and Xenoderm® for their ability to stimulate the keratinocyte growth, stratification, and differentiation. In three independent experiments, human keratinocytes were grown on the tested covers in organotypic cultures by the 3T3 feeder layer technique. Vertical paraffin sections of the wound covers with keratinocytes were processed using hematoxylin–eosin staining and immunostaining for involucrin. Keratinocyte populations on the dressings were assessed for (1 number of keratinocyte strata (primary variable, (2 quantitative growth, (3 thickness of the keratinocyte layer, and (4 cell differentiation. The Xe-Derma wound cover provided the best support to keratinocyte proliferation and stratification, with the number of keratinocyte strata significantly (p < 0.05 higher in comparison to all products studied, except Xenoderm. However, in contrast to Xe-Derma, Xenoderm did not significantly differ from the other dressings. The results of this in vitro study show that the brands based on porcine dermal matrix possess the strongest effect on keratinocyte proliferation and stratification. The distinctive position of Xe-Derma may be related to its composition, where natural dermal fibers form a smooth surface, similar to the basement membrane. Furthermore, the results indicate that in vitro evaluation of effects on epithelial growth may accelerate the development of new bio-engineering-based wound covers.

  10. Vaccinia virus induces rapid necrosis in keratinocytes by a STAT3-dependent mechanism.

    Directory of Open Access Journals (Sweden)

    Yong He

    Full Text Available Humans with a dominant negative mutation in STAT3 are susceptible to severe skin infections, suggesting an essential role for STAT3 signaling in defense against cutaneous pathogens.To focus on innate antiviral defenses in keratinocytes, we used a standard model of cutaneous infection of severe combined immunodeficient mice with the current smallpox vaccine, ACAM-2000. In parallel, early events post-infection with the smallpox vaccine ACAM-2000 were investigated in cultured keratinocytes of human and mouse origin.Mice treated topically with a STAT3 inhibitor (Stattic developed larger vaccinia lesions with higher virus titers and died more rapidly than untreated controls. Cultured human and murine keratinocytes infected with ACAM-2000 underwent rapid necrosis, but when treated with Stattic or with inhibitors of RIP1 kinase or caspase-1, they survived longer, produced higher titers of virus, and showed reduced activation of type I interferon responses and inflammatory cytokines release. Treatment with inhibitors of RIP1 kinase and STAT3, but not caspase-1, also reduced the inflammatory response of keratinocytes to TLR ligands. Vaccinia growth properties in Vero cells, which are known to be defective in some antiviral responses, were unaffected by inhibition of RIP1K, caspase-1, or STAT3.Our findings indicate that keratinocytes suppress the replication and spread of vaccinia virus by undergoing rapid programmed cell death, in a process requiring STAT3. These data offer a new framework for understanding susceptibility to skin infection in patients with STAT3 mutations. Interventions which promote prompt necroptosis/pyroptosis of infected keratinocytes may reduce risks associated with vaccination with live vaccinia virus.

  11. Production of superoxide anions by keratinocytes initiates P. acnes-induced inflammation of the skin.

    Directory of Open Access Journals (Sweden)

    Philippe A Grange


    Full Text Available Acne vulgaris is a chronic inflammatory disorder of the sebaceous follicles. Propionibacterium acnes (P. acnes, a gram-positive anareobic bacterium, plays a critical role in the development of these inflammatory lesions. This study aimed at determining whether reactive oxygen species (ROS are produced by keratinocytes upon P. acnes infection, dissecting the mechanism of this production, and investigating how this phenomenon integrates in the general inflammatory response induced by P. acnes. In our hands, ROS, and especially superoxide anions (O2(*-, were rapidly produced by keratinocytes upon stimulation by P. acnes surface proteins. In P. acnes-stimulated keratinocytes, O2(*- was produced by NAD(PH oxidase through activation of the scavenger receptor CD36. O2(*- was dismuted by superoxide dismutase to form hydrogen peroxide which was further detoxified into water by the GSH/GPx system. In addition, P. acnes-induced O2(*- abrogated P. acnes growth and was involved in keratinocyte lysis through the combination of O2(*- with nitric oxide to form peroxynitrites. Finally, retinoic acid derivates, the most efficient anti-acneic drugs, prevent O2(*- production, IL-8 release and keratinocyte apoptosis, suggesting the relevance of this pathway in humans.

  12. Effective inhibition of melanosome transfer to keratinocytes by lectins and niacinamide is reversible. (United States)

    Greatens, Amanda; Hakozaki, Tomohiro; Koshoffer, Amy; Epstein, Howard; Schwemberger, Sandy; Babcock, George; Bissett, Donald; Takiwaki, Hirotsugu; Arase, Seiji; Wickett, R Randall; Boissy, Raymond E


    Skin pigmentation results in part from the transfer of melanized melanosomes synthesized by melanocytes to neighboring keratinocytes. Plasma membrane lectins and their glycoconjugates expressed by these epidermal cells are critical molecules involved in this transfer process. In addition, the derivative of vitamin B(3), niacinamide, can inhibit melanosome transfer and induce skin lightening. We investigated the effects of these molecules on the viability of melanocytes and keratinocytes and on the reversibility of melanosome-transfer inhibition induced by these agents using an in vitro melanocyte-keratinocyte coculture model system. While lectins and neoglycoproteins could induce apoptosis in a dose-dependent manner to melanocytes or keratinocytes in monoculture, similar dosages of the lectins, as opposed to neoglycoproteins, did not induce apoptosis to either cell type when treated in coculture. The dosages of lectins and niacinamide not affecting cell viability produced an inhibitory effect on melanosome transfer, when used either alone or together in cocultures of melanocytes-keratinocytes. Cocultures treated with lectins or niacinamide resumed normal melanosome transfer in 3 days after removal of the inhibitor, while cocultures treated with a combination of lectins and niacinamide demonstrated a lag in this recovery. Subsequently, we assessed the effect of niacinamide on facial hyperpigmented spots using a vehicle-controlled, split-faced design human clinical trial. Topical application of niacinamide resulted in a dose-dependent and reversible reduction in hyperpigmented lesions. These results suggest that lectins and niacinamide at concentrations that do not affect cell viability are reversible inhibitors of melanosome transfer.

  13. GRHL3 binding and enhancers rearrange as epidermal keratinocytes transition between functional states.

    Directory of Open Access Journals (Sweden)

    Rachel Herndon Klein


    Full Text Available Transcription factor binding, chromatin modifications and large scale chromatin re-organization underlie progressive, irreversible cell lineage commitments and differentiation. We know little, however, about chromatin changes as cells enter transient, reversible states such as migration. Here we demonstrate that when human progenitor keratinocytes either differentiate or migrate they form complements of typical enhancers and super-enhancers that are unique for each state. Unique super-enhancers for each cellular state link to gene expression that confers functions associated with the respective cell state. These super-enhancers are also enriched for skin disease sequence variants. GRHL3, a transcription factor that promotes both differentiation and migration, binds preferentially to super-enhancers in differentiating keratinocytes, while during migration, it binds preferentially to promoters along with REST, repressing the expression of migration inhibitors. Key epidermal differentiation transcription factor genes, including GRHL3, are located within super-enhancers, and many of these transcription factors in turn bind to and regulate super-enhancers. Furthermore, GRHL3 represses the formation of a number of progenitor and non-keratinocyte super-enhancers in differentiating keratinocytes. Hence, chromatin relocates GRHL3 binding and enhancers to regulate both the irreversible commitment of progenitor keratinocytes to differentiation and their reversible transition to migration.

  14. Astilbin decreases proliferation and improves differentiation in HaCaT keratinocytes. (United States)

    Zhang, Chunhong; Xu, Qingqing; Tan, Xi; Meng, Liya; Wei, Guo; Liu, Ying; Zhang, Chunmin


    Psoriasis is a common chronic dermatosis characterized by keratinocyte hyperproliferation accompanied by inflammatory reactions. Pathological changes upset the balance between keratinocyte proliferation, differentiation, and death in psoriatic lesions, suggesting that molecules with topical anti-inflammatory, anti-proliferation and anti-angiogenesis abilities may be useful for its treatment. The flavonoid astilbin is the major active component extracted from the rhizome of Smilax glabra, which has been widely used in China to treat inflammatory and autoimmune diseases. Here, we investigate the potential of astilbin as a treatment for psoriasis. We reveal that astilbin inhibits the growth of HaCaT keratinocytes. Detailed study shows that astilbin leads to S phase arrest of the cell cycle by induction of p53 and p21 and activated-AMPK. Additionally, astilbin induced keratinocyte differentiation correlated with suppression of keratin 5 (KRT5) and KRT14 proteins (the markers of epidermal basal layer) and induction KRT1 and KRT10 proteins (occurring in the upper layers). Moreover, astilbin regulates the expression of VEGF in human HaCaT keratinocytes. These results suggest that astilbin may be a promising agent for psoriasis treatment. Copyright © 2017 Elsevier Masson SAS. All rights reserved.

  15. Reorganization of the interchromosomal network during keratinocyte differentiation. (United States)

    Sehgal, Nitasha; Seifert, Brandon; Ding, Hu; Chen, Zihe; Stojkovic, Branislav; Bhattacharya, Sambit; Xu, Jinhui; Berezney, Ronald


    The well-established human epidermal keratinocyte (HEK) differentiation model was investigated to determine possible alterations in chromosome territory (CT) association during differentiation. The seven human chromosomes (1, 4, 11, 12, 16, 17, and 18) selected for this analysis are representative of the chromosome size and gene density range of the overall human genome as well as including a majority of genes involved in epidermal development and differentiation (CT1, 12, and 17). Induction with calcium chloride (Ca(2+)) resulted in morphological changes characteristic of keratinocyte differentiation. Combined multi-fluorescence in situ hybridization (FISH) and computational image analysis on the undifferentiated (0 h) and differentiated (24 h after Ca(2+) treatment) HEK revealed that (a) increases in CT volumes correspond to overall nuclear volume increases, (b) radial positioning is gene density-dependent at 0 h but neither gene density- nor size-dependent at 24 h, (c) the average number of interchromosomal associations for each CT is gene density-dependent and similar at both time points, and (d) there are striking differences in the single and multiple pairwise interchromosomal association profiles. Probabilistic network models of the overall interchromosomal associations demonstrate major reorganization of the network during differentiation. Only ~40 % of the CT pairwise connections in the networks are common to both 0 and 24 h HEK. We propose that there is a probabilistic chromosome positional code which can be significantly altered during cell differentiation in coordination with reprogramming of gene expression.

  16. Dorsal longitudinal foreskin cut is associated with reduced risk of HIV, syphilis and genital herpes in men: a cross-sectional study in Papua New Guinea. (United States)

    Vallely, Andrew J; MacLaren, David; David, Matthew; Toliman, Pamela; Kelly-Hanku, Angela; Toto, Ben; Tommbe, Rachael; Kombati, Zure; Kaima, Petronia; Browne, Kelwyn; Manineng, Clement; Simeon, Lalen; Ryan, Claire; Wand, Handan; Hill, Peter; Law, Greg; Siba, Peter M; McBride, W John H; Kaldor, John M


    Various forms of penile foreskin cutting are practised in Papua New Guinea. In the context of an ecological association observed between HIV infection and the dorsal longitudinal foreskin cut, we undertook an investigation of this relationship at the individual level. We conducted a cross-sectional study among men attending voluntary confidential HIV counselling and testing clinics. Following informed consent, participants had a face-to-face interview and an examination to categorize foreskin status. HIV testing was conducted on site and relevant specimens collected for laboratory-based Herpes simplex type-2 (HSV-2), syphilis, Chlamydia trachomatis (CT), Neisseria gonorrhoeae (NG), and Trichomonas vaginalis (TV) testing. Overall, 1073 men were enrolled: 646 (60.2%) were uncut; 339 (31.6%) had a full dorsal longitudinal cut; 72 (6.7%) a partial dorsal longitudinal cut; and 14 (1.3%) were circumcised. Overall, the prevalence of HIV was 12.3%; HSV-2, 33.6%; active syphilis, 12.1%; CT, 13.4%; NG, 14.1%; and TV 7.6%. Compared with uncut men, men with a full dorsal longitudinal cut were significantly less likely to have HIV (adjusted odds ratio [adjOR] 0.25, 95%CI: 0.12, 0.51); HSV-2 (adjOR 0.60, 95%CI: 0.41, 0.87); or active syphilis (adjOR 0.55, 95%CI: 0.31, 0.96). This apparent protective effect was restricted to men cut prior to sexual debut. There was no difference between cut and uncut men for CT, NG or TV. In this large cross-sectional study, men with a dorsal longitudinal foreskin cut were significantly less likely to have HIV, HSV-2 and syphilis compared with uncut men, despite still having a complete (albeit morphologically altered) foreskin. The protective effect of the dorsal cut suggests that the mechanism by which male circumcision works is not simply due to the removal of the inner foreskin and its more easily accessible HIV target cells. Exposure of the penile glans and inner foreskin appear to be key mechanisms by which male circumcision confers

  17. Oral fibroblasts produce more HGF and KGF than skin fibroblasts in response to co-culture with keratinocytes

    DEFF Research Database (Denmark)

    Grøn, Birgitte; Stoltze, Kaj; Andersson, Anders


    The production of hepatocyte growth factor (HGF) and keratinocyte growth factor (KGF) in subepithelial fibroblasts from buccal mucosa, periodontal ligament, and skin was determined after co-culture with keratinocytes. The purpose was to detect differences between the fibroblast subpopulations...... that could explain regional variation in epithelial growth and wound healing. Normal human fibroblasts were cultured on polystyrene or maintained in collagen matrix and stimulated with keratinocytes cultured on membranes. The amount of HGF and KGF protein in the culture medium was determined every 24 h for 5...... days by ELISA. When cultured on polystyrene, the constitutive level of KGF and HGF in periodontal fibroblasts was higher than the level in buccal and skin fibroblasts. In the presence of keratinocytes, all three types of fibroblasts in general increased their HGF and KGF production 2-3 times. When...

  18. HPV8 Field Cancerization in a Transgenic Mouse Model Is due to Lrig1+ Keratinocyte Stem Cell Expansion. (United States)

    Lanfredini, Simone; Olivero, Carlotta; Borgogna, Cinzia; Calati, Federica; Powell, Kathryn; Davies, Kelli-Jo; De Andrea, Marco; Harries, Sarah; Tang, Hiu Kwan Carolyn; Pfister, Herbert; Gariglio, Marisa; Patel, Girish K


    β-Human papillomaviruses (HPVs) cause near ubiquitous latent skin infection within long-lived hair follicle (HF) keratinocyte stem cells. In patients with epidermodysplasia verruciformis, β-HPV viral replication is associated with skin keratosis and cutaneous squamous cell carcinoma. To determine the role of HF keratinocyte stem cells in β-HPV-induced skin carcinogenesis, we utilized a transgenic mouse model in which the keratin 14 promoter drives expression of the entire HPV8 early region (HPV8tg). HPV8tg mice developed thicker skin in comparison with wild-type littermates consistent with a hyperproliferative epidermis. HF keratinocyte proliferation was evident within the Lrig1+ keratinocyte stem cell population (69 vs. 55%, P cancerization arises from the HF junctional zone and predispose to squamous cell carcinoma. Copyright © 2017 The Authors. Published by Elsevier Inc. All rights reserved.

  19. Examining communication between ultraviolet (UV)-damaged cutaneous nerve cells and epidermal keratinocytes in vitro. (United States)

    Gruber, J V; Holtz, R


    The exposure of the skin to Ultraviolet (UV) radiation is a stressful event and the skin has multiple innate defense mechanisms to counter this threat. For instance, oxidatively damaged nerve cells will express neuroglobin, a hexa-coordinate heme protein, to scavenge free radicals such as nitric oxide (NO). Likewise, keratinocytes will express various anti-oxidant enzymes such as superoxide dismutase (SOD), which will defend the cells against oxidative threats. Nonetheless, cells will still express free radicals during excessive irradiation. A fundamental question that needs to be asked is: what do these cells communicate to one another during such stressful events? This paper will present results of an in vitro study in which dorsal root ganglion were irradiated with UV radiation to elicit oxidative events such as release of NO and calcitonin gene-related peptide (CGRP), a potent neuropeptide. Cell survival was also examined using the standard MTT assay. A plant-based neuroglobin mimic called phytoglobin was used as an NO scavenger to see if control of NO would influence CGRP expression and cell survival. Results of this study demonstrate that control of NO expression in irradiated nerve cells can influence CGRP expression and can also increase cell survival rates. Following this preliminary study, controlled amounts of the nerve cell growth media were added to cultures of normal human keratinocytes and the keratinocytes were allowed to interact with the nerve cell media for 24 h. Following this treatment period, human microarrays were run on the keratinocytes to see what genes were influenced in the keratinocytes as a result of contact with the irradiated nerve cell growth media. It was found that several critical genes expressed by the keratinocytes including NO synthase (NOS1), superoxide dismutase 1 (SOD1), transglutaminase 1 and 3 (TGM1 and TGM3), metallopeptidase inhibitor 1 (TIMP1), and filaggrin (FLG) were clearly influenced by the damaged nerve cells.

  20. MicroRNA-191 triggers keratinocytes senescence by SATB1 and CDK6 downregulation

    Energy Technology Data Exchange (ETDEWEB)

    Lena, A.M.; Mancini, M.; Rivetti di Val Cervo, P. [University of ' Tor Vergata' , Department of Experimental Medicine and Biochemical Sciences, Via Montpellier 1, Rome 00133 (Italy); Istituto Dermopatico dell' Immacolata-Istituto di Ricovero e Cura a Carattere Scientifico (IDI-IRCCS), Laboratory of Biochemistry c/o Department of Experimental Medicine and Biochemical Sciences, University of Rome ' Tor Vergata' , Rome 00133 (Italy); Saintigny, G.; Mahe, C. [CHANEL Parfums Beaute, 135 av. Charles de Gaulle, F 92521, Neuilly/Seine (France); Melino, G., E-mail: [University of ' Tor Vergata' , Department of Experimental Medicine and Biochemical Sciences, Via Montpellier 1, Rome 00133 (Italy); Istituto Dermopatico dell' Immacolata-Istituto di Ricovero e Cura a Carattere Scientifico (IDI-IRCCS), Laboratory of Biochemistry c/o Department of Experimental Medicine and Biochemical Sciences, University of Rome ' Tor Vergata' , Rome 00133 (Italy); Association Cell Death and Differentiation c/o Department of Experimental Medicine and Biochemical Sciences, University of Rome ' Tor Vergata' , Rome 00133 (Italy); and others


    Highlights: Black-Right-Pointing-Pointer miR-191 expression is upregulated in senescencent human epidermal keratinocytes. Black-Right-Pointing-Pointer miR-191 overexpression is sufficient per se to induce senescence in keratinocytes. Black-Right-Pointing-Pointer SATB1 and CDK6 are downregulated in senescence and are direct miR-191 targets. Black-Right-Pointing-Pointer SATB1 and CDK6 silencing by siRNA triggers senescence in HEKn cells. -- Abstract: Keratinocyte replicative senescence has an important role in time-dependent changes of the epidermis, a tissue with high turnover. Senescence encompasses growth arrest during which cells remain metabolically active but acquire a typical enlarged, vacuolar and flattened morphology. It is also accompanied by the expression of endogenous senescence-associated-{beta}-galactosidase and specific gene expression profiles. MicroRNAs levels have been shown to be modulated during keratinocytes senescence, playing key roles in inhibiting proliferation and in the acquisition of senescent markers. Here, we identify miR-191 as an anti-proliferative and replicative senescence-associated miRNA in primary human keratinocytes. Its overexpression is sufficient per se to induce senescence, as evaluated by induction of several senescence-associated markers. We show that SATB1 and CDK6 3 Prime UTRs are two miR-191 direct targets involved in this pathway. Cdk6 and Satb1 protein levels decrease during keratinocytes replicative senescence and their silencing by siRNA is able to induce a G1 block in cell cycle, accompanied by an increase in senescence-associated markers.

  1. Infliximab inhibits DNA repair in ultraviolet B-irradiated premalignant keratinocytes

    DEFF Research Database (Denmark)

    Faurschou, A.; Gniadecki, R.; Wulf, Hans Chr.


    affects the cell cycle and DNA repair in premalignant human keratinocytes after ultraviolet-B (UVB) irradiation. We found that infliximab-treated cells exhibited an enhanced G2/M cell cycle arrest and increased apoptosis after 10-20 mJ/cm(2) UVB. In spite of this, the level of cyclobutane pyrimidine...

  2. Selenoproteins are essential for proper keratinocyte function and skin development.

    Directory of Open Access Journals (Sweden)

    Aniruddha Sengupta


    Full Text Available Dietary selenium is known to protect skin against UV-induced damage and cancer and its topical application improves skin surface parameters in humans, while selenium deficiency compromises protective antioxidant enzymes in skin. Furthermore, skin and hair abnormalities in humans and rodents may be caused by selenium deficiency, which are overcome by dietary selenium supplementation. Most important biological functions of selenium are attributed to selenoproteins, proteins containing selenium in the form of the amino acid, selenocysteine (Sec. Sec insertion into proteins depends on Sec tRNA; thus, knocking out the Sec tRNA gene (Trsp ablates selenoprotein expression. We generated mice with targeted removal of selenoproteins in keratin 14 (K14 expressing cells and their differentiated descendents. The knockout progeny had a runt phenotype, developed skin abnormalities and experienced premature death. Lack of selenoproteins in epidermal cells led to the development of hyperplastic epidermis and aberrant hair follicle morphogenesis, accompanied by progressive alopecia after birth. Further analyses revealed that selenoproteins are essential antioxidants in skin and unveiled their role in keratinocyte growth and viability. This study links severe selenoprotein deficiency to abnormalities in skin and hair and provides genetic evidence for the role of these proteins in keratinocyte function and cutaneous development.

  3. Photoprotection by Punica granatum seed oil nanoemulsion entrapping polyphenol-rich ethyl acetate fraction against UVB-induced DNA damage in human keratinocyte (HaCaT) cell line


    Baccarin, T.; Mitjans Arnal, Montserrat; Ramos López, David; Lemos-Senna,Elenara; Vinardell Martínez-Hidalgo, Ma. Pilar


    There has been an increase in the use of botanicals as skin photoprotective agents. Pomegranate (Punica granatum L.) is well known for its high concentration of polyphenolic compounds and for its antioxidant and anti-inflammatory properties. The aim of this study was to analyse the photoprotection provided by Punica granatum seed oil nanoemulsion entrapping the polyphenol-rich ethyl acetate fraction against UVB-induced DNA damage in the keratinocyte HaCaT cell line. For this purpose, HaCaT ce...

  4. Positive and negative regulation of cell proliferation by E2F-1: influence of protein level and human papillomavirus oncoproteins

    DEFF Research Database (Denmark)

    Melillo, R M; Helin, K; Lowy, D R


    that is defective for immortalization and binding of pRB and pRB-related proteins. By contrast, E2F-1 was unable to complement two other E7 mutants, p2PRO and p31/32ARG/PRO, which are also defective in the immortalization assay, although their proteins display wild-type binding of pRB in vitro. Since the binding...... levels of E2F-1, produced by transfection of the E2F-1 cDNA under the control of a strong promoter, reduced colony formation in normal human foreskin keratinocytes (NHFKs). This inhibition could not be overcome by wild-type human papillomavirus type 16 (HPV16) E6 and E7, two proteins which cooperate...... to immortalize NHFKs, or by a transdominant p53 mutant. High levels of E2F-1 also inhibited growth of primary and established fibroblasts. The growth-inhibitory activity required the DNA binding function of E2F-1 but not its transactivation or pRB binding activities. A positive role for lower levels of E2F-1...

  5. Three-dimensional epithelial tissues generated from human embryonic stem cells. (United States)

    Hewitt, Kyle J; Shamis, Yulia; Carlson, Mark W; Aberdam, Edith; Aberdam, Daniel; Garlick, Jonathan A


    The use of pluripotent human embryonic stem (hES) cells for tissue engineering may provide advantages over traditional sources of progenitor cells because of their ability to give rise to multiple cell types and their unlimited expansion potential. We derived cell populations with properties of ectodermal and mesenchymal cells in two-dimensional culture and incorporated these divergent cell populations into three-dimensional (3D) epithelial tissues. When grown in specific media and substrate conditions, two-dimensional cultures were enriched in cells (EDK1) with mesenchymal morphology and surface markers. Cells with a distinct epithelial morphology (HDE1) that expressed cytokeratin 12 and beta-catenin at cell junctions became the predominant cell type when EDK1 were grown on surfaces enriched in keratinocyte-derived extracellular matrix proteins. When these cells were incorporated into the stromal and epithelial tissue compartments of 3D tissues, they generated multilayer epithelia similar to those generated with foreskin-derived epithelium and fibroblasts. Three-dimensional tissues demonstrated stromal cells with morphologic features of mature fibroblasts, type IV collagen deposition in the basement membrane, and a stratified epithelium that expressed cytokeratin 12. By deriving two distinct cell lineages from a common hES cell source to fabricate complex tissues, it is possible to explore environmental cues that will direct hES-derived cells toward optimal tissue form and function.

  6. Insulin-like growth factor-1-mediated AKT activation postpones the onset of ultraviolet B-induced apoptosis, providing more time for cyclobutane thymine dimer removal in primary human keratinocytes. (United States)

    Decraene, David; Agostinis, Patrizia; Bouillon, Roger; Degreef, Hugo; Garmyn, Marjan


    Insulin-like growth factor-1 (IGF-1) acts as a potent survival factor in numerous cell lines, primarily through activation of the AKT signaling pathway. Although some targets of this pathway have known anti-apoptotic functions, its relationship with the improved survival of cells after exposure to environmental stresses, including UVB, remains largely unclear. We report that in growth factor-deprived keratinocytes, IGF-1 significantly and consistently delayed the onset of UVB-induced apoptosis by >7 h. This delay allowed IGF-1-supplemented keratinocytes to repair significantly more cyclobutane thymine dimers than their growth factor-deprived counterparts. This increase in cyclobutane thymine removal resulted in enhanced survival if the amount of DNA damage was not too high. To increase cell survival after UVB irradiation, IGF-1 supplementation was required only during this initial time period in which extra repair was executed. Finally, we show that IGF-1 mediated this delay in the onset of UVB-induced apoptosis through activation of the AKT signaling pathway. We therefore believe that the AKT signaling pathway increases cell survival after a genotoxic insult such as UVB irradiation not by inhibiting the apoptotic stimulus, but only by postponing the induction of apoptosis, giving the DNA repair mechanism more time to work.

  7. Development of culture techniques of keratinocytes for skin graft production. (United States)

    Masahiro, Kino-oka; Taya, Masahito


    The in vitro cultures of human tissues have attracted a great deal of medical attention as a promising technique for repairing defective tissues in vivo. In the last decade many companies have been established for supplying the regenerated grafts by means of tissue cultures of skin, cartilage, bone and so on. From the viewpoint of biochemical engineering, however, the culture systems for these tissues are not so sophisticated nor so programmed as the submerged culture systems developed for microorganisms. In manufacturing skin grafts, for instance, the raw materials of cells harvested from patients are heterogeneous, and the products of cultured tissues vary in the required size for individual epithelial sheets. Therefore, a reliable and robust process is desired for the production of cultured tissues with high reproducibility and quality. This review focuses on the strategies for developing the culture processes of keratinocytes targeting the epithelial sheet production, including (i) the introduction of culture techniques for keratinocyte cells and survey of skin graft production as it is, (ii) construction of kinetic model of cell growth, (iii) evaluation of cell properties based on image-analyzing techniques, and (iv) design of bioreactor system.

  8. ZNF750 is expressed in differentiated keratinocytes and regulates epidermal late differentiation genes.

    Directory of Open Access Journals (Sweden)

    Idan Cohen

    Full Text Available Disrupted skin barrier due to altered keratinocyte differentiation is common in pathologic conditions such as atopic dermatitis, ichthyosis and psoriasis. However, the molecular cascades governing keratinocyte terminal differentiation are poorly understood. We have previously demonstrated that a dominant mutation in ZNF750 leads to a clinical phenotype reminiscent of psoriasis and seborrheic dermatitis. Here we show that ZNF750 is a nuclear protein bearing a functional C-terminal nuclear localization signal. ZNF750 was specifically expressed in the epidermal suprabasal layers and its expression was augmented during differentiation, both in human skin and in-vitro, peaking in the granular layer. Silencing of ZNF750 in Ca2+-induced HaCaT keratinocytes led to morphologically apparent arrest in the progression of late differentiation, as well as diminished apoptosis and sustained proliferation. ZNF750 knockdown cells presented with markedly reduced expression of epidermal late differentiation markers, including gene subsets of epidermal differentiation complex and skin barrier formation such as FLG, LOR, SPINK5, ALOX12B and DSG1, known to be mutated in various human skin diseases. Furthermore, overexpression of ZNF750 in undifferentiated cells induced terminal differentiation genes. Thus, ZNF750 is a regulator of keratinocyte terminal differentiation and with its downstream targets can serve in future elucidation of therapeutics for common diseases of skin barrier.

  9. Effects of antiinflammatory triterpenes isolated from Leptadenia hastata latex on keratinocyte proliferation. (United States)

    Nikiéma, J B; Vanhaelen-Fastré, R; Vanhaelen, M; Fontaine, J; De Graef, C; Heenen, M


    Several triterpenes isolated from Leptadenia hastata latex were tested for their anti-inflammatory activity. Lupeol (1), its acetate (2) and palmitate (3) esters were found to be the main antiinflammatory constituents in the croton oil-induced ear oedema test. Furthermore, lupeol hemisuccinate (4), synthesized from lupeol, exhibited a higher activity than lupeol in the test. These results prove that the triterpenes play a pivotal role in the topical antiinflammatory effect of this latex. In addition, an in vitro model of human skin keratinocytes (epidermal explants) cultured at an air-liquid interface on a de-epidermized human dermis (DED) was used to investigate the effects of lupeol esters on skin repair in vitro. Compared with the control, compounds 2 and 3 improved keratinocyte proliferation at a concentration of 5 microM in the culture medium; however, they remained less active than compounds 1 and 4. In contrast to compound 1, all the lupeol esters (2-4), and particularly compound 4, induced a good differentiation of keratinocytes with a well-formed stratum corneum without parakeratosis. These results substantiate the topical use of Leptadenia hastata latex in traditional medicine and showed that both antiinflammatory activity and the effect on keratinocyte proliferation of compound 1 could be improved by its hemisuccinylation; on the contrary, esterification by acetylation or palmitoylation decreased these activities. Copyright 2001 John Wiley & Sons, Ltd.

  10. Distinct epidermal keratinocytes respond to extremely low-frequency electromagnetic fields differently.

    Directory of Open Access Journals (Sweden)

    Chao-Ying Huang

    Full Text Available Following an increase in the use of electric appliances that can generate 50 or 60 Hz electromagnetic fields, concerns have intensified regarding the biological effects of extremely low-frequency electromagnetic fields (ELF-EMFs on human health. Previous epidemiological studies have suggested the carcinogenic potential of environmental exposure to ELF-EMFs, specifically at 50 or 60 Hz. However, the biological mechanism facilitating the effects of ELF-EMFs remains unclear. Cellular studies have yielded inconsistent results regarding the biological effects of ELF-EMFs. The inconsistent results might have been due to diverse cell types. In our previous study, we indicated that 1.5 mT, 60 Hz ELF-EMFs will cause G1 arrest through the activation of the ATM-Chk2-p21 pathway in human keratinocyte HaCaT cells. The aim of the current study was to investigate whether ELF-EMFs cause similar effects in a distinct epidermal keratinocyte, primary normal human epidermal keratinocytes (NHEK, by using the same ELF-EMF exposure system and experimental design. We observed that ELF-EMFs exerted no effects on cell growth, cell proliferation, cell cycle distribution, and the activation of ATM signaling pathway in NHEK cells. We demonstrated that the 2 epidermal keratinocytes responded to ELF-EMFs differently. To further validate this finding, we simultaneously exposed the NHEK and HaCaT cells to ELF-EMFs in the same incubator for 168 h and observed the cell growths. The simultaneous exposure of the two cell types results showed that the NHEK and HaCaT cells exhibited distinct responses to ELF-EMFs. Thus, we confirmed that the biological effects of ELF-EMFs in epidermal keratinocytes are cell type specific. Our findings may partially explain the inconsistent results of previous studies when comparing results across various experimental models.

  11. CRM1 and chromosomal passenger complex component survivin are essential to normal mitosis progress and to preserve keratinocytes from mitotic abnormalities. (United States)

    Labarrade, F; Botto, J-M; Domloge, N


    Human epidermis provides the body a barrier against environmental assaults. To assume this function, the epidermis needs the renewal of keratinocytes allowed by constant mitosis, which replace the exfoliating corneocytes. Keratinocyte stem cells (KSCs) located in the basal epidermis are mitotically active, self-renewing and govern the epithelial stratification by producing renewed source of keratinocytes. Protein complex such as the chromosomal passenger complex (CPC) allows the correct development of this process. The CPC is composed of four members: INCENP, survivin, borealin and aurora kinase B, and the disruption of the CPC during cell division induces mitotic spindle defects and improper repartition of chromosomes. The aim of our study was to investigate the implication of CRM1 and survivin in the progress of mitosis in skin keratinocytes. Cultured human keratinocytes and skin biopsies were used in this study. KSCs-enriched population of keratinocytes was isolated from total keratinocytes by differential attachment to a type IV collagen matrix. Survivin and CRM1 expression levels were assessed by immunofluorescence and immunoblotting. Specific siRNAs for each CPC member and for CRM1 were used to determine the relationship between these proteins. Survivin-specific siRNA was used to induce the apparition of mitotic abnormalities in cultured keratinocytes. We demonstrated the ability of our compound 'IV08.009' to modulate the expression level of survivin and CRM1 in keratinocytes and in skin biopsies. We observed that members of the CPC are interdependent: siRNA-induced inhibition of one component caused a decrease in the expression of all other CPC members. Downregulation of survivin or CRM1 induced mitotic abnormalities in keratinocytes. However, decreased number of mitotic abnormalities was observed in keratinocytes after 'IV08.009' application. Basal keratinocytes may divide frequently during skin lifespan, and signs of deterioration could appear such as loss

  12. Saliva induces expression of antimicrobial peptides and promotes intracellular killing of bacteria in keratinocytes by epidermal growth factor receptor transactivation. (United States)

    Mohanty, T; Alberius, P; Schmidtchen, A; Reiss, K; Schröder, J-M; Sørensen, O E


    Wounds in the oral cavity, constantly exposed to both saliva and bacteria, heal quickly without infection. Furthermore, during licking of skin wounds, saliva promotes wound healing and plays a role in keeping the wound free of infection. To investigate whether saliva induces expression of antimicrobial peptides (AMPs) in human epidermal keratinocytes and whether saliva promotes clearance of intracellular bacteria in these cells. Expression of AMPs was investigated in the oral mucosa and ex vivo injured skin by immunohistochemistry. Human beta-defensin-3 expression was investigated in epidermal keratinocytes after saliva stimulation, using real-time polymerase chain reaction and immunofluorescence. We found higher expression of AMPs in the oral mucosa than in the epidermis. Saliva accelerated the injury-induced expression of AMPs in human skin ex vivo and was a potent inducer of the expression of AMPs in epidermal keratinocytes. The expression of AMPs was induced by metalloproteinase-dependent epidermal growth factor receptor (EGFR) transactivation mediated by a salivary lipid. Saliva increased the intracellular clearance of Staphylococcus aureus in keratinocytes through EGFR activation. These findings suggest a previously unreported role of saliva in innate immunity and demonstrate for the first time that saliva induces gene expression in epidermal keratinocytes. © 2016 British Association of Dermatologists.

  13. Death penalty for keratinocytes: apoptosis versus cornification. (United States)

    Lippens, S; Denecker, G; Ovaere, P; Vandenabeele, P; Declercq, W


    Homeostasis implies a balance between cell growth and cell death. This balance is essential for the development and maintenance of multicellular organisms. Homeostasis is controlled by several mechanisms including apoptosis, a process by which cells condemned to death are completely eliminated. However, in some cases, total destruction and removal of dead cells is not desirable, as when they fulfil a specific function such as formation of the skin barrier provided by corneocytes, also known as terminally differentiated keratinocytes. In this case, programmed cell death results in accumulation of functional cell corpses. Previously, this process has been associated with apoptotic cell death. In this overview, we discuss differences and similarities in the molecular regulation of epidermal programmed cell death and apoptosis. We conclude that despite earlier confusion, apoptosis and cornification occur through distinct molecular pathways, and that possibly antiapoptotic mechanisms are implicated in the terminal differentiation of keratinocytes.

  14. Proinflammatory effect of high-mobility group protein B1 on keratinocytes: an autocrine mechanism underlying psoriasis development. (United States)

    Zhang, Weigang; Guo, Sen; Li, Bing; Liu, Lin; Ge, Rui; Cao, Tianyu; Wang, Huina; Gao, Tianwen; Wang, Gang; Li, Chunying


    Psoriasis is an autoimmune skin disease, in which keratinocytes play a crucial pathogenic role. High-mobility group protein B1 (HMGB1) is an inflammatory factor that can be released from keratinocyte nuclei in psoriatic lesions. We aimed to investigate the proinflammatory effect of HMGB1 on keratinocytes and the contribution of HMGB1 to psoriasis development. Normal human keratinocytes were treated with recombinant human HMGB1, and the production of inflammatory factors and the intermediary signalling pathways were examined. Furthermore, the imiquimod-induced psoriasis-like mouse model was used to investigate the role of HMGB1 in psoriasis development in vivo. A total of 11 inflammatory factors were shown to be upregulated by HMGB1 in keratinocytes, among which interleukin (IL)-18 showed the greatest change. We then found that activation of the nuclear factor-κB signalling pathway and inflammasomes accounted for HMGB1-induced IL-18 expression and secretion. Moreover, HMGB1 and downstream IL-18 contributed to the development of psoriasiform dermatitis in the imiquimod-treated mice. In addition, T-helper 17 immune response in the psoriasis-like mouse model could be inhibited by both HMGB1 and IL-18 blockade. Our findings indicate that HMGB1 secreted from keratinocytes can facilitate the production and secretion of inflammatory factors such as IL-18 in keratinocytes in an autocrine way, thus promoting the development of psoriasis. Blocking the proinflammatory function of the HMGB1-IL-18 axis may be useful for psoriasis treatment in the future. Copyright © 2016 Pathological Society of Great Britain and Ireland. Published by John Wiley & Sons, Ltd. Copyright © 2016 Pathological Society of Great Britain and Ireland. Published by John Wiley & Sons, Ltd.

  15. Proteomic Analysis of Low Dose Arsenic and Ionizing Radiation Exposure on Keratinocytes


    Berglund, Susanne R.; Santana, Alison R.; Li, Dan; Rice, Robert H.; Rocke, David M; Goldberg, Zelanna


    Human exposure to arsenic and ionizing radiation occur environmentally at low levels. While the human health effects of arsenic and ionizing radiation have been examined separately, there is little information regarding their combined effects at doses approaching environmental levels. Arsenic toxicity may be affected by concurrent ionizing radiation especially given their known individual carcinogenic actions at higher doses. We found that keratinocytes responded to either low dose arsenic an...

  16. Anomalous features of EMT during keratinocyte transformation.

    Directory of Open Access Journals (Sweden)

    Tamar Geiger

    Full Text Available During the evolution of epithelial cancers, cells often lose their characteristic features and acquire a mesenchymal phenotype, in a process known as epithelial-mesenchymal transition (EMT. In the present study we followed early stages of keratinocyte transformation by HPV16, and observed diverse cellular changes, associated with EMT. We compared primary keratinocytes with early and late passages of HF1 cells, a cell line of HPV16-transformed keratinocytes. We have previously shown that during the progression from the normal cells to early HF1 cells, immortalization is acquired, while in the progression to late HF1, cells become anchorage independent. We show here that during the transition from the normal state to late HF1 cells, there is a progressive reduction in cytokeratin expression, desmosome formation, adherens junctions and focal adhesions, ultimately leading to poorly adhesive phenotype, which is associated with anchorage-independence. Surprisingly, unlike "conventional EMT", these changes are associated with reduced Rac1-dependent cell migration. We monitored reduced Rac1-dependent migration also in the cervical cancer cell line SiHa. Therefore we can conclude that up to the stage of tumor formation migratory activity is eliminated.

  17. Automated identification of epidermal keratinocytes in reflectance confocal microscopy (United States)

    Gareau, Dan


    Keratinocytes in skin epidermis, which have bright cytoplasmic contrast and dark nuclear contrast in reflectance confocal microscopy (RCM), were modeled with a simple error function reflectance profile: erf( ). Forty-two example keratinocytes were identified as a training set which characterized the nuclear size a = 8.6+/-2.8 μm and reflectance gradient b = 3.6+/-2.1 μm at the nuclear/cytoplasmic boundary. These mean a and b parameters were used to create a rotationally symmetric erf( ) mask that approximated the mean keratinocyte image. A computer vision algorithm used an erf( ) mask to scan RCM images, identifying the coordinates of keratinocytes. Applying the mask to the confocal data identified the positions of keratinocytes in the epidermis. This simple model may be used to noninvasively evaluate keratinocyte populations as a quantitative morphometric diagnostic in skin cancer detection and evaluation of dermatological cosmetics.

  18. Transcription of melanogenesis enzymes in melanocytes: dependence upon culture conditions and co-cultivation with keratinocytes. (United States)

    Kippenberger, S; Bernd, A; Bereiter-Hahn, J; Ramirez-Bosca, A; Kaufmann, R; Holzmann, H


    Eumelanogenesis of human skin melanocytes requires at least three enzymes: tyrosinase, TRP 1, and TRP 2. The regulation of these enzymes on transcriptional level was detected in a semiquantitative attempt. The total RNA of melanocytes was reverse-transcripted and followed by a PCR with degenerated primers for all three enzymes. The amplification products were related to each other densitometrically. We examined five different culture conditions: 1) melanocytes in a popular phorbolester containing F-10-medium, 2) melanocytes in a co-culture medium with EGF, 3) melanocytes in a co-culture medium with high calcium, 4) melanocytes co-cultured with keratinocytes in EGF containing co-culture medium, and 5) melanocytes co-cultured with keratinocytes in co-culture medium with high calcium. Melanocytes cultured in phorbolester containing F-10-medium featured transcripts of tyrosinase, TRP 1, and TRP 2 in the ratio 45:45:10. The same results were obtained for melanocytes co-cultured with keratinocytes under the two different culture conditions. In melanocytes cultured alone in co-culture media only TRP 1-transcripts were present. It is likely that under co-culture conditions a keratinocyte-derived factor supports the transcription of all three enzymes. For melanocytes in the phorbolester-containing melanocyte medium a proteinkinase C dependent regulation of transcription seems possible.

  19. Expression of microRNA-184 in keratinocytes represses argonaute 2. (United States)

    Roberts, Julian C; Warren, Richard B; Griffiths, Christopher E M; Ross, Kehinde


    Interleukin-22 (IL-22) is a proinflammatory cytokine that has been associated with the pathogenesis of inflammatory skin disorders. However, the impact of IL-22 on microRNA (miRNA) expression in epidermal keratinocytes is unknown. Here we show that IL-22 induces miR-184 in reconstituted human epidermis (RHE) and in the HaCaT keratinocyte cell line. Exposure to IL-22 increased miR-184 expression 8- and 15-fold in RHE and HaCaT cells, respectively. Oncostatin M, an unrelated proinflammatory cytokine, also raised miR-184 expression in RHE and HaCaT keratinocytes. Pharmacologic and genetic inhibition demonstrated that cytokine-induced expression of miR-184 was mediated by signal transducer and activation of transcription 3 (STAT3). Argonaute 2 (AGO2), a member of the RNA-induced silencing complex (RISC), is a predicted miR-184 target. Using protein, messenger RNA and reporter analyses, we found that miR-184 regulates the expression of AGO2. We conclude that cytokine-induced miR-184 attenuates AGO2 expression in keratinocytes. Copyright © 2013 Wiley Periodicals, Inc.

  20. File list: Oth.Epd.05.AllAg.Keratinocytes [Chip-atlas[Archive

    Lifescience Database Archive (English)

    Full Text Available Oth.Epd.05.AllAg.Keratinocytes mm9 TFs and others Epidermis Keratinocytes SRX352043... ...

  1. File list: Oth.Epd.10.AllAg.Keratinocytes [Chip-atlas[Archive

    Lifescience Database Archive (English)

    Full Text Available Oth.Epd.10.AllAg.Keratinocytes mm9 TFs and others Epidermis Keratinocytes SRX352043... ...

  2. File list: Unc.Epd.50.AllAg.Keratinocytes [Chip-atlas[Archive

    Lifescience Database Archive (English)

    Full Text Available Unc.Epd.50.AllAg.Keratinocytes mm9 Unclassified Epidermis Keratinocytes SRX352044 h...ttp:// ...

  3. File list: ALL.Epd.50.AllAg.Keratinocytes [Chip-atlas[Archive

    Lifescience Database Archive (English)

    Full Text Available ALL.Epd.50.AllAg.Keratinocytes hg19 All antigens Epidermis Keratinocytes SRX079858,...ttp:// ...

  4. File list: Unc.Epd.20.AllAg.Keratinocytes [Chip-atlas[Archive

    Lifescience Database Archive (English)

    Full Text Available Unc.Epd.20.AllAg.Keratinocytes mm9 Unclassified Epidermis Keratinocytes SRX352044 h...ttp:// ...

  5. File list: ALL.Epd.20.AllAg.Keratinocytes [Chip-atlas[Archive

    Lifescience Database Archive (English)

    Full Text Available ALL.Epd.20.AllAg.Keratinocytes hg19 All antigens Epidermis Keratinocytes SRX079858,...ttp:// ...

  6. File list: Unc.Epd.05.AllAg.Keratinocytes [Chip-atlas[Archive

    Lifescience Database Archive (English)

    Full Text Available Unc.Epd.05.AllAg.Keratinocytes mm9 Unclassified Epidermis Keratinocytes SRX352044 h...ttp:// ...

  7. File list: ALL.Epd.10.AllAg.Keratinocytes [Chip-atlas[Archive

    Lifescience Database Archive (English)

    Full Text Available ALL.Epd.10.AllAg.Keratinocytes hg19 All antigens Epidermis Keratinocytes SRX079858,...ttp:// ...

  8. File list: ALL.Epd.05.AllAg.Keratinocytes [Chip-atlas[Archive

    Lifescience Database Archive (English)

    Full Text Available ALL.Epd.05.AllAg.Keratinocytes hg19 All antigens Epidermis Keratinocytes SRX079858,...ttp:// ...

  9. File list: Unc.Epd.10.AllAg.Keratinocytes [Chip-atlas[Archive

    Lifescience Database Archive (English)

    Full Text Available Unc.Epd.10.AllAg.Keratinocytes mm9 Unclassified Epidermis Keratinocytes SRX352044 h...ttp:// ...

  10. File list: Oth.Epd.20.AllAg.Keratinocytes [Chip-atlas[Archive

    Lifescience Database Archive (English)

    Full Text Available Oth.Epd.20.AllAg.Keratinocytes mm9 TFs and others Epidermis Keratinocytes SRX352043... ...

  11. Nrf2 Promotes Keratinocyte Proliferation in Psoriasis through Up-Regulation of Keratin 6, Keratin 16, and Keratin 17. (United States)

    Yang, Luting; Fan, Xueli; Cui, Tingting; Dang, Erle; Wang, Gang


    Psoriasis is a chronic inflammatory skin disease characterized by keratinocyte hyperproliferation of epidermis. Although hyperproliferation-associated keratins K6, K16, and K17 are considered to be the hallmarks of psoriasis, the molecular basis underlying the overexpression of these keratins remains unclear. Nrf2 regulates cell proliferation. Therefore, we investigated whether Nrf2 regulates keratinocyte proliferation via promoting expression of K6, K16, and K17 in psoriasis. We initially found that psoriatic epidermis exhibited elevated expression of Nrf2. Furthermore, Nrf2 promoted expression of K6, K16, and K17 in both HaCaT cells and primary human keratinocytes by binding to the ARE domains located in the promoter of these genes. Additionally, upon stimulation with IL-17 or IL-22, Nrf2 translocated to the nucleus and initiated expression of targeted keratins. In mice of imiquimod-induced psoriasis-like dermatitis, topical application of Nrf2 small interfering RNA alleviated the epidermal hyperplasia with reduced expression of these keratins. More importantly, Nrf2 promoted the proliferation of human keratinocytes through up-regulation of K6, K16, or K17. These data suggested that inflammatory cytokines promoted Nrf2 nuclear translocation in psoriatic epidermis, which led to elevated expression of K6, K16, and K17, thus promoting keratinocyte proliferation and contributing to the pathogenesis of psoriasis. Copyright © 2017 The Authors. Published by Elsevier Inc. All rights reserved.

  12. Differential effects of detergents on keratinocyte gene expression. (United States)

    van Ruissen, F; Le, M; Carroll, J M; van der Valk, P G; Schalkwijk, J


    We have studied the effect of various detergents on keratinocyte gene expression in vitro, using an anionic detergent (sodium dodecyl sulfate), a cationic detergent cetyltrimethylammoniumbromide (CTAB), and two nonionic detergents, Nonidet P-40 and Tween-20. We measured the effect of these detergents on direct cellular toxicity (lactate dehydrogenase release), on the expression of markers for normal differentiation (cytokeratin 1 and involucrin expression), and on disturbed keratinocyte differentiation (SKALP) by northern blot analysis. As reported in other studies, large differences were noted in direct cellular toxicity. In a culture model that mimics normal epidermal differentiation we found that low concentrations of sodium dodecyl sulfate could induce the expression of SKALP, a proteinase inhibitor that is not normally expressed in human epidermis but is found in hyperproliferative skin. Sodium dodecyl sulfate caused upregulation of involucrin and downregulation of cytokeratin 1 expression, which is associated with the hyperproliferative/inflammatory epidermal phenotype found in psoriasis, wound healing, and skin irritation. These changes were not induced after treatment of cultures with CTAB, Triton X-100, and Nonidet-P40. This effect appeared to be specific for the class of anionic detergents because sodium dodecyl benzene sulfonate and sodium laurate also induced SKALP expression. These in vitro findings showed only a partial correlation with the potential of different detergents to induce clinical, biophysical, and cell biologic changes in vivo in human skin. Both sodium dodecyl sulfate and CTAB were found to cause induction and upregulation of SKALP and involucrin at low doses following a 24 h patch test, whereas high concentrations of Triton X-100 did not. Sodium dodecyl sulfate induced higher rates of transepidermal water loss, whereas CTAB treated skin showed more signs of cellular toxicity. We conclude that the action of anionic detergents on

  13. Keratinocyte antiviral response to Poly(dA:dT stimulation and papillomavirus infection in a canine model of X-linked severe combined immunodeficiency.

    Directory of Open Access Journals (Sweden)

    Jennifer A Luff

    Full Text Available X-linked severe combined immunodeficiency (XSCID is caused by a genetic mutation within the common gamma chain (γc, an essential component of the cytokine receptors for interleukin (IL-2, IL-4, IL-7, IL-9, IL-15, and IL-21. XSCID patients are most commonly treated with bone marrow transplants (BMT to restore systemic immune function. However, BMT-XSCID humans and dogs remain at an increased risk for development of cutaneous papillomavirus (PV infections and their associated neoplasms, most typically cutaneous papillomas. Since basal keratinocytes are the target cell for the initial PV infection, we wanted to determine if canine XSCID keratinocytes have a diminished antiviral cytokine response to poly(dA:dT and canine papillomavirus-2 (CPV-2 upon initial infection. We performed quantitative RT-PCR for antiviral cytokines and downstream interferon stimulated genes (ISG on poly(dA:dT stimulated and CPV-2 infected monolayer keratinocyte cultures derived from XSCID and normal control dogs. We found that XSCID keratinocytes responded similarly to poly(dA:dT as normal keratinocytes by upregulating antiviral cytokines and ISGs. CPV-2 infection of both XSCID and normal keratinocytes did not result in upregulation of antiviral cytokines or ISGs at 2, 4, or 6 days post infection. These data suggest that the antiviral response to initial PV infection of basal keratinocytes is similar between XSCID and normal patients, and is not the likely source for the remaining immunodeficiency in XSCID patients.

  14. Cell prolifer