WorldWideScience

Sample records for human epidermal membranes

  1. Mechanical Stretch on Human Skin Equivalents Increases the Epidermal Thickness and Develops the Basement Membrane.

    Directory of Open Access Journals (Sweden)

    Eijiro Tokuyama

    Full Text Available All previous reports concerning the effect of stretch on cultured skin cells dealt with experiments on epidermal keratinocytes or dermal fibroblasts alone. The aim of the present study was to develop a system that allows application of stretch stimuli to human skin equivalents (HSEs, prepared by coculturing of these two types of cells. In addition, this study aimed to analyze the effect of a stretch on keratinization of the epidermis and on the basement membrane. HSEs were prepared in a gutter-like structure created with a porous silicone sheet in a silicone chamber. After 5-day stimulation with stretching, HSEs were analyzed histologically and immunohistologically. Stretch-stimulated HSEs had a thicker epidermal layer and expressed significantly greater levels of laminin 5 and collagen IV/VII in the basal layer compared with HSEs not subjected to stretch stimulation. Transmission electron microscopy revealed that the structure of the basement membrane was more developed in HSEs subjected to stretching. Our model may be relevant for extrapolating the effect of a stretch on the skin in a state similar to an in vivo system. This experimental system may be useful for analysis of the effects of stretch stimuli on skin properties and wound healing and is also expected to be applicable to an in vitro model of a hypertrophic scar in the future.

  2. Effects of electrophoresis and electroosmosis during alternating current iontophoresis across human epidermal membrane.

    Science.gov (United States)

    Yan, Guang; Peck, Kendall D; Zhu, Honggang; Higuchi, William I; Li, S Kevin

    2005-03-01

    Previous studies in our laboratory have demonstrated that skin electrical resistance can be controlled by an alternating current (AC) electric field. By maintaining constant skin resistance, AC iontophoresis has been shown to reduce the iontophoretic flux variability of neutral permeants. Recently, it was found that symmetric square-wave AC could enhance iontophoretic transport of both neutral and ionic permeants by means of electrophoresis and/or electroosmosis in a synthetic membrane system, and a model was presented to describe the experimental results. The objective of the present study was to assess the effects of AC voltage and frequency and direct current (DC) offset on the flux of neutral and ionic model permeants with human epidermal membrane (HEM). Experiments were conducted under two different conditions: constant AC voltage iontophoresis and iontophoresis using constant HEM resistance with DC offset voltage. The following are the main findings in these experiments. In the constant AC voltage study, when the permeability data were compared at the same HEM electrical resistance, it was demonstrated that AC even at high frequency (approximately 1 kHz) could enhance the transport of the ionic permeant (tetraethylammonium ion) across HEM, but no enhancement was observed for the neutral permeant (arabinose). For the ionic permeant flux enhancement, the higher the applied AC voltage, the greater the flux enhancement. There was little or no AC frequency dependence of the flux enhancement in the frequency range of 50-1000 Hz. In the constant HEM resistance study of AC with DC offset, approximately linear relationships were observed between flux enhancement and the DC offset voltage for both the neutral and ionic permeants, and these results were found to be consistent with predictions of the modified Nernst-Planck model for conventional constant voltage DC iontophoresis. When the DC offset voltage was increased, the AC component of the flux enhancement for the

  3. /sup 125/I-human epidermal growth factor specific binding to placentas and fetal membranes from varoius pregnancy states

    Energy Technology Data Exchange (ETDEWEB)

    Hofmann, G.E.; Siddiqi, T.A.; Rao, Ch. V.; Carman, F.R.

    1988-01-01

    Specific binding of /sup 125/I-human epidermal growth factor (hEGF) to homogenates of term human placentas and fetal membranes from normal and appropriate for gestational age (N = 20), intrauterine growth retarded (N = 9), twin (N = 11), White class AB diabetic (N = 12), and large for gestational age (N = 13) pregnancies was measured. In all pregnancy states, placentas bound approximately four times more /sup 125/I-hEGF than did fetal membranes (P<0.0001). There was no significant differnce in /sup 125/I-hEGF binding to fetal membranes from the various pregnancy states (P<0.05). /sup 125/I-hEGF specific binding to placentas from intrauterine growth retarded or twin pregnancies was significantly greater compared with placentas from normal and appropriate for gestational age pregnancies (P<0.05). The binding to placentas from pregnancies complicated by White class AB diabetes or large for gestational age infants, on the other hand, was not significantly different from that to placentas from normal and appropriate for gestational age pregnancies. /sup 125/I-hEGF specific binding did not differ between placentas from intrauterine growth retarded or twin pregnancies (P<0.05). Placental and fetal membrane /sup 125/I-hEGF binding did not vary with fetal sex, maternal race, placental weight, or gestational age between 37 to 42 weeks (P<0.05). Placental but not fetal membrane /sup 125/I-hEGF binding increased with increasing infant weight when appropriate for gestational age and large for gestational age infants were included (P<0.05, r = 0.38, N = 32) but not for intrauterine growth retarded, appropriate for gestational age, or large for gestational age infants alone.

  4. Investigation of properties of human epidermal membrane under constant conductance alternating current iontophoresis.

    Science.gov (United States)

    Zhu, Honggang; Peck, Kendall D; Miller, David J; Liddell, Mark R; Yan, Guang; Higuchi, William I; Li, S Kevin

    2003-04-14

    Previous studies in our laboratory have shown that enhanced, constant permeant fluxes across human skin can be achieved by applying an alternating current (AC) to maintain skin electrical conductance at a constant level. Relative to conventional direct current (DC) iontophoresis, for which current is maintained at a constant level, this newly developed constant conductance alternating current (CCAC) method achieves constant fluxes with less inter- and intra-sample variability. The present study focused upon further investigating the permeability properties of human skin during CCAC iontophoresis at a variety of target resistance/conductance values. A three-stage experimental protocol was used with flux measurements determined on 3 consecutive days. Stage I was an AC only protocol (symmetrical AC square-wave signal), stage II was an AC plus DC protocol (AC square-wave with DC offset voltage), and stage III was a repeat of stage I. During this three-stage protocol, the skin electrical resistance was maintained at a constant target value by manually adjusting the applied AC voltage. Radiolabeled mannitol and urea were model permeants in all experiments. Their fluxes were determined and used to characterize the permeability properties of human skin. The results from the present study established that: (i) the CCAC protocol made it possible to reduce HEM electrical resistance to different target levels as low as 0.8 kOmega cm(2) and maintain the specific resistance level throughout the flux experiment, (ii) permeant fluxes are proportional to skin electrical conductance, (iii) under the studied CCAC passive conditions, membrane pore size tends to increase as skin resistance decreases, and (iv) as the membrane breaks down, its pore sizes become larger.

  5. Effects of oxygen-containing terpenes as skin permeation enhancers on the lipoidal pathways of human epidermal membrane.

    Science.gov (United States)

    Chantasart, Doungdaw; Pongjanyakul, Thaned; Higuchi, William I; Li, S Kevin

    2009-10-01

    The present study investigated the effects of oxygen-containing terpenes as skin permeation enhancers on the lipoidal pathways of human epidermal membrane (HEM). The enhancement (E(HEM)) effects of menthol, thymol, carvacrol, menthone, and cineole on the transport of a probe permeant, corticosterone, across HEM were determined. It was found that the enhancer potencies of menthol, thymol, carvacrol, and menthone were essentially the same and higher than that of cineole based on their aqueous concentration in the diffusion cell chamber at E(HEM) = 4. Thymol and carvacrol also had the same E(HEM) = 10 concentration further supporting that they had the same enhancer potency based on the aqueous concentration. The uptake amounts of terpene into the HEM stratum corneum (SC) intercellular lipid under the same conditions indicate that the intrinsic potencies of the studied terpenes are the same based on their concentration in the SC and similar to those of n-alkanol and n-alkylphenyl alcohol. Moreover, they are all better enhancers compared to branched-chain alkanol. The approximately same uptake enhancement of beta-estradiol induced by the studied terpenes and alcohols at E(HEM) conditions into the SC intercellular lipids suggests that the mechanism of enhancement action for the terpenes and those of alcohols are essentially the same.

  6. Effect of permeation enhancer pretreatment on the iontophoresis of luteinizing hormone releasing hormone (LHRH) through human epidermal membrane (HEM).

    Science.gov (United States)

    Smyth, Hugh D C; Becket, Gordon; Mehta, Samir

    2002-05-01

    A 2 x 2 factorial design was performed to determine the effect of a permeation enhancer (oleic acid/propylene glycol), iontophoresis (2 V), and the combination of the two treatments on the permeation enhancement of a model peptide, LHRH (luteinizing hormone releasing hormone), through human epidermal membrane (HEM). In parallel studies, TEAB (tetraethylammonium bromide, a small ionic solute) and sucrose (an electroosmotic flow marker) were also investigated. Structural changes in the HEM were monitored via conductance measurements, differential scanning calorimetry (DSC), and infrared (IR) spectroscopy experiments. LHRH enhancement due to enhancer in combination with iontophoresis (I + E; 29.5 times passive permeability, P), was greater than during iontophoresis alone (I; 14.3) and enhancer treatment alone (E; 3.5). I + E had an additive effect of I and E, indicating the mechanisms of action of the individual enhancement strategies were likely to be located at different sites in the skin. Also, no synergistic enhancement was observed with I + E for either TEAB or sucrose. For TEAB, permeability enhancement due to I (approximately 1400) was much higher than that due to E (14.9), and no additive effect could be detected. For sucrose, E had no effect on either passive or iontophoretic permeability, eliminating the possibility that electroosmosis could explain increases in LHRH permeability. Evidence of synergy between E and I was found, with conductance measurements indicating that I + E synergistically increased the membrane permeability to conducting ions (Na+ and Cl-). It appears these pathways were not available for transport for the solutes used in the current study. DSC and IR investigations showed significant changes in stratum corneum lipid structure following E treatment but not following I. These findings probably arise from the localized action of iontophoresis compared with the bulk action of enhancer. In summary, increased LHRH delivery through HEM in

  7. The Alteration of the Epidermal Basement Membrane Complex of Human Nevus Tissue and Keratinocyte Attachment after High Hydrostatic Pressurization

    Directory of Open Access Journals (Sweden)

    Naoki Morimoto

    2016-01-01

    Full Text Available We previously reported that human nevus tissue was inactivated after high hydrostatic pressure (HHP higher than 200 MPa and that human cultured epidermis (hCE engrafted on the pressurized nevus at 200 MPa but not at 1000 MPa. In this study, we explore the changes to the epidermal basement membrane in detail and elucidate the cause of the difference in hCE engraftment. Nevus specimens of 8 mm in diameter were divided into five groups (control and 100, 200, 500, and 1000 MPa. Immediately after HHP, immunohistochemical staining was performed to detect the presence of laminin-332 and type VII collagen, and the specimens were observed by transmission electron microscopy (TEM. hCE was placed on the pressurized nevus specimens in the 200, 500, and 1000 MPa groups and implanted into the subcutis of nude mice; the specimens were harvested at 14 days after implantation. Then, human keratinocytes were seeded on the pressurized nevus and the attachment was evaluated. The immunohistochemical staining results revealed that the control and 100 MPa, 200 MPa, and 500 MPa groups were positive for type VII collagen and laminin-332 immediately after HHP. TEM showed that, in all of the groups, the lamina densa existed; however, anchoring fibrils were not clearly observed in the 500 or 1000 MPa groups. Although the hCE took in the 200 and 500 MPa groups, keratinocyte attachment was only confirmed in the 200 MPa group. This result indicates that HHP at 200 MPa is preferable for inactivating nevus tissue to allow its reuse for skin reconstruction in the clinical setting.

  8. Mechanistic studies of flux variability of neutral and ionic permeants during constant current dc iontophoresis with human epidermal membrane.

    Science.gov (United States)

    Li, S Kevin; Higuchi, William I; Kochambilli, Rajan P; Zhu, Honggang

    2004-04-01

    Although constant current iontophoresis is supposed to provide constant transdermal transport, significant flux variability and/or time-dependent flux drifts are observed during iontophoresis with human skin in vitro and human studies in vivo. The objectives of the present study were to determine (a) the causes of flux variability in constant current dc transdermal iontophoresis and (b) the relationships of flux variabilities among permeants of different physicochemical properties. Changes in the human epidermal membrane (HEM) effective pore size and/or electroosmosis during constant current dc iontophoresis were examined. Tetraethylammonium ion (TEA), urea, and mannitol were the model permeants. For the neutral permeants, the results in the present study showed a significant increase of fluxes with time in a given experiment and large HEM sample-to-sample variability. Although both effective pore size and pore charge density variations contributed to the time-dependent flux drifts observed in electroosmotic transport, the significant flux drifts observed were found to be primarily a result of the time-dependent increase in effective pore charge density. For the ionic permeant, the observed flux variability was smaller than that of the neutral permeants and was believed to be primarily due to effective pore size alteration in HEM during iontophoresis as suggested in a previous study. The different extents of flux variability observed between neutral and ionic permeants are consistent with the different iontophoretically enhanced transport mechanisms for the neutral and ionic permeants (i.e. electroosmosis and electrophoresis, respectively). The results of the present study also demonstrate that flux variability of two neutral permeants are inter-related, so the flux of one neutral permeant can be predicted if the permeability coefficient of the other neutral permeant is known.

  9. Human epidermal membrane constant conductance iontophoresis: alternating current to obtain reproducible enhanced permeation and reduced lag times of a nonionic polar permeant.

    Science.gov (United States)

    Song, Yang; Li, S Kevin; Peck, Kendall D; Zhu, Honggang; Ghanem, Abdel-Halim; Higuchi, William I

    2002-01-31

    An experimental protocol, using an initial 1 min direct current (DC) applied potential of 4 V followed by alternating current (AC), was established to: (a) increase conductance and permeability and decrease lag time for human epidermal membrane (HEM) relative to unaltered HEM and; (b) maintain constant conductance and permeability during flux studies. The protocol allowed specific permeation parameters of the membrane to be characterized under electrically enhanced, constant flux conditions. The permeability, lag time, and effective membrane thickness were determined using a nonionic polar permeant, urea, while the enhanced conductance was maintained at a constant level with AC. A tortuous pore pathway model was employed to analyze the data. The AC protocol increased membrane permeability, and decreased lag time and effective membrane thickness relative to similar parameters obtained in previous studies from unaltered HEM. Lag times ranged from 32.0 to 105.5 min, and permeability coefficients calculated from steady state fluxes ranged from 1.68 to 6.03x10(-7) cm/s for HEM samples with electrical resistance values during transport of 2.3-8.0 kOmega x cm2. Effective membrane thicknesses were calculated to range from 0.34 to 0.61 cm during AC iontophoresis. Significant additional results were obtained when the protocol was applied for two consecutive runs using the same HEM sample, with time for the HEM sample to recover between runs. During the second run, the applied potential was adjusted to reproduce the conductance obtained on the first run. Under these conditions, the consecutive runs yielded essentially the same lag time, permeability and effective membrane thickness values. These results suggest that constant fluxes can be achieved by keeping HEM electrical conductance constant during AC iontophoresis.

  10. Cell-free synthesis of functional human epidermal growth factor receptor: Investigation of ligand-independent dimerization in Sf21 microsomal membranes using non-canonical amino acids

    Science.gov (United States)

    Quast, Robert B.; Ballion, Biljana; Stech, Marlitt; Sonnabend, Andrei; Varga, Balázs R.; Wüstenhagen, Doreen A.; Kele, Péter; Schiller, Stefan M.; Kubick, Stefan

    2016-01-01

    Cell-free protein synthesis systems represent versatile tools for the synthesis and modification of human membrane proteins. In particular, eukaryotic cell-free systems provide a promising platform for their structural and functional characterization. Here, we present the cell-free synthesis of functional human epidermal growth factor receptor and its vIII deletion mutant in a microsome-containing system derived from cultured Sf21 cells. We provide evidence for embedment of cell-free synthesized receptors into microsomal membranes and asparagine-linked glycosylation. Using the cricket paralysis virus internal ribosome entry site and a repetitive synthesis approach enrichment of receptors inside the microsomal fractions was facilitated thereby providing analytical amounts of functional protein. Receptor tyrosine kinase activation was demonstrated by monitoring receptor phosphorylation. Furthermore, an orthogonal cell-free translation system that provides the site-directed incorporation of p-azido-L-phenylalanine is characterized and applied to investigate receptor dimerization in the absence of a ligand by photo-affinity cross-linking. Finally, incorporated azides are used to generate stable covalently linked receptor dimers by strain-promoted cycloaddition using a novel linker system. PMID:27670253

  11. Epidermal melanin absorption in human skin

    Science.gov (United States)

    Norvang Nilsen, Lill T.; Fiskerstrand, Elisanne J.; Nelson, J. Stuart; Berns, Michael W.; Svaasand, Lars O.

    1996-01-01

    The principle of laser induced selective photothermolysis is to induced thermal damage to specific targets in such a manner that the temperature of the surrounding tissue is maintained below the threshold for thermal damage. The selectivity is obtained by selection of a proper wavelength and pulse duration. The technique is presently being used in the clinic for removal of port-wine stains. The presence of melanin in the epidermal layer can represent a limitation to the selectivity. Melanin absorption drops off significantly with increasing wavelength, but is significant in the entire wavelength region where the blood absorption is high. Treatment of port-wine stain in patients with high skin pigmentation may therefore give overheating of the epidermis, resulting in epidermal necrosis. Melanosomal heating is dependent on the energy and duration of the laser pulse. The heating mechanism for time scales less than typically 1 microsecond(s) corresponds to a transient local heating of the individual melanosomes. For larger time scales, heat diffusion out of the melanosomes become of increased importance, and the temperature distribution will reach a local steady state condition after typically 10 microsecond(s) . For even longer pulse duration, heat diffusing from neighboring melanosomes becomes important, and the temperature rise in a time scale from 100 - 500 microsecond(s) is dominated by this mechanism. The epidermal heating during the typical 450 microsecond(s) pulse used for therapy is thus dependent on the average epidermal melanin content rather than on the absorption coefficient of the individual melanosomes. This study will present in vivo measurements of the epidermal melanin absorption of human skin when exposed to short laser pulses (< 0.1 microsecond(s) ) from a Q-switched ruby laser and with long laser pulses (approximately 500 microsecond(s) ) from a free-running ruby laser or a long pulse length flashlamp pumped dye laser. The epidermal melanin

  12. Topography of human placental receptors for epidermal growth factor.

    Science.gov (United States)

    Rao, C V; Ramani, N; Chegini, N; Stadig, B K; Carman, F R; Woost, P G; Schultz, G S; Cook, C L

    1985-02-10

    These studies were undertaken to determine whether term human placental microvillus plasma membranes, which are exposed to maternal blood, and basolateral plasma membranes, which are in close proximity to fetal blood capillaries, contain receptors for epidermal growth factor (EGF). These two highly purified membranes bound 125I-EGF with similar affinity (apparent dissociation constants, 0.07-0.12 nM, but the total number of available receptors was greater in microvillus (8.2 pmol/mg protein) compared to basolateral (4.9 pmol/mg protein) plasma membranes. Detailed characterization of 125I-EGF binding to these membranes revealed numerous similarities as well as differences. The two membranes contained two major (155 and 140 kDa) and at least three minor (115, 175, and 210 kDa) specific 125I-EGF binding proteins. The 115-kDa protein was only found in basolateral plasma membranes. The 155-kDa protein was predominantly labeled in microvillus, whereas the 140-kDa protein was labeled predominantly in basolateral plasma membranes. The addition of protease inhibitors did not alter the multiple 125I-EGF binding proteins pattern found in these membranes. EGF stimulated phosphorylation of 140- and 155-kDa proteins in both microvillus and basolateral plasma membranes. However, the 155-kDa protein was phosphorylated to a greater extent in microvillus, whereas both 140- and 155-kDa proteins were phosphorylated equally in basolateral plasma membranes. Light and electron microscope autoradiographic studies revealed that 125I-EGF preferentially associated with microvillus plasma membranes. The data demonstrates the presence of EGF receptors in outer cell membranes of syncytiotrophoblasts and suggests that maternal EGF may influence syncytiotrophoblast function by binding to receptors in microvillus plasma membranes, while fetal EGF may also influence syncytiotrophoblast function but via receptors in basolateral plasma membranes.

  13. Epidermal growth factor (urogastrone) in human tissues.

    Science.gov (United States)

    Hirata, Y; Orth, D N

    1979-04-01

    Human epidermal growth factor (hEGF), which stimulates the growth of a variety of tissues, was first isolated from mouse submandibular glands, but is also excreted in large amounts (about 50 micrograms/day) in human urine and is probably identical to human beta-urogastrone (hUG), a potent inhibitor of stimulated gastric acid secretion. However, the primary tissue source of hEGF/hUG is as yet unknown. The hEGF/hUG in homogenates of human salivary glands and a wide variety of other endocrine and nonendocrine tissues was extracted by Amberlite CG-50 cation exchange chromatography and immune affinity chromatography using the immunoglobulin fraction of rabbit anti-hEGF serum covalently bound to agarose. The extracts were subjected to homologous hEGF RIA. Immunoreactive hEGF was found in extracts of adult submandibular gland, thyroid gland, duodenum, jejunum, and kidney, but not in several fetal tissues. The tissue immunoreactive hEGF was similar to standard hEGF in terms of immunoreactivity and elution from Sephadex G-50 Fine resin, but its concentrations were very low (1.3-5.5 ng/g wet tissue). Thus, it is not certain that these tissues represent the only source of the large amounts of hEGF/hUG that appear to be filtered by the kidneys each day.

  14. Nicotinic acid receptor abnormalities in human skin cancer: implications for a role in epidermal differentiation.

    Directory of Open Access Journals (Sweden)

    Yira Bermudez

    Full Text Available BACKGROUND: Chronic UV skin exposure leads to epidermal differentiation defects in humans that can be largely restored by pharmacological doses of nicotinic acid. Nicotinic acid has been identified as a ligand for the human G-protein-coupled receptors GPR109A and GPR109B that signal through G(i-mediated inhibition of adenylyl cyclase. We have examined the expression, cellular distribution, and functionality of GPR109A/B in human skin and skin derived epidermal cells. RESULTS: Nicotinic acid increases epidermal differentiation in photodamaged human skin as judged by the terminal differentiation markers caspase 14 and filaggrin. Both GPR109A and GPR109B genes are transcribed in human skin and in epidermal keratinocytes, but expression in dermal fibroblasts is below limits of detection. Receptor transcripts are greatly over-expressed in squamous cell cancers. Receptor protein in normal skin is prominent from the basal through granular layers of the epidermis, with cellular localization more dispersive in the basal layer but predominantly localized at the plasma membrane in more differentiated epidermal layers. In normal human primary and immortalized keratinocytes, nicotinic acid receptors show plasma membrane localization and functional G(i-mediated signaling. In contrast, in a squamous cell carcinoma derived cell line, receptor protein shows a more diffuse cellular localization and the receptors are nearly non-functional. CONCLUSIONS: The results of these studies justify future genetic and pharmacological intervention studies to define possible specific role(s of nicotinic acid receptors in human skin homeostasis.

  15. Improved epidermal barrier formation in human skin models by chitosan modulated dermal matrices

    Science.gov (United States)

    Mieremet, Arnout; Rietveld, Marion; Absalah, Samira; van Smeden, Jeroen

    2017-01-01

    Full thickness human skin models (FTMs) contain an epidermal and a dermal equivalent. The latter is composed of a collagen dermal matrix which harbours fibroblasts. Current epidermal barrier properties of FTMs do not fully resemble that of native human skin (NHS), which makes these human skin models less suitable for barrier related studies. To further enhance the resemblance of NHS for epidermal morphogenesis and barrier formation, we modulated the collagen dermal matrix with the biocompatible polymer chitosan. Herein, we report that these collagen-chitosan FTMs (CC-FTMs) possess a well-organized epidermis and maintain both the early and late differentiation programs as in FTMs. Distinctively, the epidermal cell activation is reduced in CC-FTMs to levels observed in NHS. Dermal-epidermal interactions are functional in both FTM types, based on the formation of the basement membrane. Evaluation of the barrier structure by the organization of the extracellular lipid matrix of the stratum corneum revealed an elongated repeat distance of the long periodicity phase. The ceramide composition exhibited a higher resemblance of the NHS, based on the carbon chain-length distribution and subclass profile. The inside-out barrier functionality indicated by the transepidermal water loss is significantly improved in the CC-FTMs. The expression of epidermal barrier lipid processing enzymes is marginally affected, although more restricted to a single granular layer. The novel CC-FTM resembles the NHS more closely, which makes them a promising tool for epidermal barrier related studies. PMID:28333992

  16. In vitro human epidermal penetration of 1-bromopropane.

    Science.gov (United States)

    Frasch, H Frederick; Dotson, G Scott; Barbero, Ana M

    2011-01-01

    1-Bromopropane (1-BP; CAS number 106-94-5), also known as n-propyl bromide, is a halogenated short-chain alkane used as an organic solvent with numerous commercial and industrial applications, including garment dry cleaning and vapor degreasing of metals. The purpose of this study was to determine the dermal absorption characteristics and corrosivity of 1-BP. Heat-separated human epidermal membranes were mounted on static diffusion cells. Different exposure scenarios were studied (infinite dose, finite dose, and transient exposure) using neat 1-BP and saturated aqueous solution as donor. Steady-state fluxes for infinite-dose neat 1-BP exposure averaged 625 to 960 μg cm(-2) h(-1). The finite-dose (10 μl/cm(2) = 13.5 mg/cm(2)) unoccluded donor resulted in penetration of <0.2% of the applied dose (22 μg/cm(2)). A 10-min transient exposure to infinite dose resulted in total penetration of 179 μg/cm(2). Steady-state 1-BP fluxes from neat application of a commercial dry cleaning solvent were similar (441 to 722 μg cm(-2) h(-1)). The permeability coefficient of 1-BP in water vehicle was 0.257 ± 0.141 cm/h. The absorption potential of 1-BP following dermal exposure is dependent upon the type and duration of exposure. Donor losses due to evaporation were approximately 500-fold greater than dermal absorption flux; evaporation flux was 420 mg cm(-2) h(-1). 1-BP is cytotoxic but not corrosive, based on results from a cultured reconstructed human epidermal model (EpiDerm Skin Corrosivity Test).

  17. Pattern of hormone receptors and human epidermal growth factor ...

    African Journals Online (AJOL)

    2015-02-05

    Feb 5, 2015 ... Key words: Breast cancer, human epidermal growth factor receptor 2/neu, immunohistochemistry, ... therapy.[6‑8] Of all these prognostic and predictive factors, ... one of the biggest private medical laboratories in Nigeria.

  18. Expression of epidermal growth factor receptors in human brain tumors.

    Science.gov (United States)

    Libermann, T A; Razon, N; Bartal, A D; Yarden, Y; Schlessinger, J; Soreq, H

    1984-02-01

    The expression of receptors for epidermal growth factor (EGF-R) was determined in 29 samples of brain tumors from 22 patients. Primary gliogenous tumors, of various degrees of cancer, five meningiomas, and two neuroblastomas were examined. Tissue samples were frozen in liquid nitrogen immediately after the operation and stored at -70 degrees until use. Cerebral tissue samples from 11 patients who died from diseases not related to the central nervous system served as controls. Immunoprecipitation of functional EGF-R-kinase complexes revealed high levels of EGF-R in all of the brain tumors of nonneuronal origin that were examined. The level of EGF-R varied between tumors from different patients and also between specimens prelevated from different areas of the same tumor. In contrast, the levels of EGF-R from control specimens were invariably low. The biochemical properties of EGF-R in brain tumor specimens were found to be indistinguishable from those of the well-characterized EGF-R from the A-431 cell line, derived from human epidermoid carcinomas. Human brain EGF-R displays a molecular weight of 170,000 by polyacrylamide-sodium dodecyl sulfate gel electrophoresis. It is phosphorylated mainly in tyrosine residues and shows a 2-dimensional phosphopeptide map similar to that obtained with the phosphorylated EGF-R from membranes of A-431 cells. Our observations suggest that induction of EGF-R expression may accompany the malignant transformation of human brain cells of nonneuronal origin.

  19. Human epidermal growth factor and the proliferation of human fibroblasts.

    Science.gov (United States)

    Carpenter, G; Cohen, S

    1976-06-01

    The effect of human epidermal growth factor (hEGF), a 5,400 molecular weight polypeptide isolated from human urine, on the growth of human foreskin fibroblasts (HF cells) was studied by measuring cell numbers and the incorporation of labeled thymidine. The addition of hEGF to HF cells growing in a medium containing 10% calf serum resulted in a 4-fold increase in the final density. The presence of hEGF also promoted the growth of HF cells in media containing either 1% calf serum or 10% gamma globulin-free serum. The addition of hEGF to quiescent confluent monolayers of HF cells, maintained in a medium with 1% calf serum for 48 hours, resulted in a 10- to 20-fold increase in the amount of 3H-thymidine incorporation after 20-24 hours. The stimulation of thymidine incorporation was maximal at an hEGF concentration of 2 ng/ml, was dependent on the presence of serum, and was enhanced by the addition of ascorbic acid. In confluent cultures of HF cells, subject to density dependent inhibition of growth, hEGF was able to stimulate DNA synthesis more effectively than fresh calf serum. Human EGF stimulated DNA synthesis in quiescent cultures, however, regardless of cell density. The addition of rabbit anti-hEGF inhibited all effects of this growth factor on HF cells.

  20. Fatty acid metabolism studies of human epidermal cell cultures.

    Science.gov (United States)

    Marcelo, C L; Dunham, W R

    1993-12-01

    Adult human epidermal keratinocytes grow rapidly in medium that is essential fatty acid (EFA)-deficient. In this medium they exhibit decreased amounts of the fatty acids, 18:2, 20:3, 20:4, and contain increased amounts of monounsaturated fatty acids. [14C]- and [3H]acetate and radiolabeled fatty acids, 16:0, 18:2, and 20:4 were used to study the fatty acid metabolism of these cells. Label from acetate appeared in 14- to 20-carbon fatty acids, both saturated and monounsaturated. No label was seen in the essential fatty acid 18:2, 18:3, and 20:4. Radiolabel from [9, 10-3H]palmitic acid (16:0) was detected in 16:0, 16:1, 18:0, and 18:1. [14C]linoleic acid (18:2) was converted to 18:3, 20:2, 20:3, and 20:4, demonstrating delta 6 and delta 5 desaturase activity in keratinocytes. Label from acetate, 16:0, or 18:2 was found mostly in the cellular phospholipids while only one third of the label from [14C]arachidonic was found in the phospholipids. [14C]acetate and [14C]18:2 time course data were used to construct a model of the metabolism of these reactants, using coupled, first-order differential equations. The data show that EFA-deficient keratinocytes metabolize fatty acids using pathways previously found in liver; they suggest the positioning of 18:2 desaturase and 18:3 elongase near the plasma membrane; they indicate that for the synthesis of nonessential fatty acids the formation of 18:0 from 16:0 is the rate-determining step; and they show that the conversion of 18:2 to 20:3 is rapid. These experiments demonstrate a method to study lipid enzyme kinetics in living cells.

  1. Keratolinin: the soluble substrate of epidermal transglutaminase from human and bovine tissue.

    Science.gov (United States)

    Zettergren, J G; Peterson, L L; Wuepper, K D

    1984-01-01

    Substrates of human and bovine epidermal transglutaminase (glutaminyl-peptide gamma-glutamyltransferase, R-glutaminyl-peptide:amine-gamma-glutamyltransferase, EC 2.3.2.13) were isolated and purified by ion exchange chromatography and preparative zone electrophoresis. These substrates of Mr 36,000, which we propose to call keratolinin, incorporated dansylcadaverine and were precipitated by antibody. Keratolinin is ultimately polymerized on the inner leaflet of the keratinocyte membrane to form the cornified envelope. Each Mr 36,000 substrate was dissociated by chaotropic agents or detergents into noncovalent subunits; the Mr of these subunits was 6,000-6,200 on electrophoresis in 15% acrylamide/1% NaDodSO4/6 M urea gels. Isoelectric focusing of human or bovine keratolinin revealed two moieties separated by 0.3-0.4 pH unit (human, 5.4/5.0; bovine, 6.3/6.0). The two proteins were readily resolved by chromatofocusing and each isoelectric moiety of bovine keratolinin incorporated dansylcadaverine by epidermal transglutaminase and calcium and reacted with identity to antiserum to soluble Mr 36,000 keratolinin. Antiserum to human keratolinin failed to crossreact with its bovine counterpart. Antiserum to involucrin did not crossreact with either keratolinin or epidermis by immunodiffusion. Human and bovine epidermal keratolinins are biochemically similar but immunochemically distinct proteins from the epidermis. Involucrin appears only in significant quantities in cell culture. Images PMID:6141559

  2. 以人羊膜为支架的表皮黑素细胞培养与生物活性鉴定%Culture of human epidermal melanocytes with human amniotic membrane as a scaffold and their biological ability identification

    Institute of Scientific and Technical Information of China (English)

    佘小光; 刘小明; 雷铁池

    2011-01-01

    目的 从吸引疱疱顶微小皮片建立人表皮黑素细胞(MC)原代培养,以人羊膜为支架培养MC,观察羊膜对MC黏附、增殖和树突发育的影响.方法 用负压吸疱法分离疱顶微小皮片,多巴染色后对取自同一个体下腹部和前臂屈侧皮片的MC进行计数.皮片经胰酶消化后自基底面轻刮表皮细胞建立原代MC培养,将培养的第2~4代MC接种至新鲜或冻存羊膜上共孵育不同时间后,倒置显微镜下观察MC形态和树突发育.行石蜡包埋组织切片,HE染色后观察MC对羊膜的黏附.用MTT比色法测定接种在羊膜上的MC存活率.结果 前臂屈侧吸引疱疱顶皮片多巴染色阳性细胞个数为(1543.1±113.3)个/mm2,腹部皮片为(857.4±101.7)个/mm2.在4周内建立MC原代培养至少需要从2个疱顶(面积约25.1 mm2)的前臂皮片获取的表皮细胞.倒置显微镜下观察,与单纯接种细胞培养皿的MC比较,接种至新鲜或冻存羊膜上继续培养4、8、12 d的MC形态多为两极,树突细长延伸.HE染色示MC能黏附并均匀分布在羊膜的基底膜层表面.MTT法测定结果示,羊膜对MC的分裂增殖有抑制,但冻存羊膜与新鲜羊膜对MC增殖抑制差异无统计学意义(P>0.05).结论 人前臂屈侧皮肤富含活性MC,是获取吸引疱疱顶微小皮片建立MC原代培养的较好部位.人羊膜支持MC黏附生长和树突发育,有望成为一种能荷载体外培养扩增MC的人源生物支架.%Objective To establish a primary culture of human melanocytes from tiny skin sheets harvested by using a suction blister method, to carry out a serial subcultivation of the melanocytes with human amniotic membrane (AM) as a scaffold, and to observe the influence of AM on the adhesion, proliferation and dendrite development of melanocytes. Methods Tiny skin sheets were collected from the flexual forearm or lower abdomen of a healthy male volunteer by a suction blister method and melanocytes in the skin sheet were

  3. Structural and biophysical characteristics of human skin in maintaining proper epidermal barrier function

    OpenAIRE

    Boer, Magdalena; Duchnik, Ewa; Maleszka, Romuald; Marchlewicz, Mariola

    2016-01-01

    The complex structure of human skin and its physicochemical properties turn it into an efficient outermost defence line against exogenous factors, and help maintain homeostasis of the human body. This role is played by the epidermal barrier with its major part – stratum corneum. The condition of the epidermal barrier depends on individual and environmental factors. The most important biophysical parameters characterizing the status of this barrier are the skin pH, epidermal hydration, transep...

  4. Specific antibodies and sensitive immunoassays for the human epidermal growth factor receptors (HER2, HER3, and HER4).

    Science.gov (United States)

    Broughton, Marianne Nordlund; Westgaard, Arne; Paus, Elisabeth; Øijordsbakken, Miriam; Henanger, Karoline J; Naume, Bjørn; Bjøro, Trine

    2017-06-01

    The use of trastuzumab in patients with breast cancer that overexpresses human epidermal growth factor receptor 2 has significantly improved treatment outcomes. However, a substantial proportion of this patient group still experiences progression of the disease after receiving the drug. Evaluation of the changes in expression of the human epidermal growth factor receptors could be of interest. Monoclonal antibodies against the extracellular domain of the human growth factor receptors, 2, 3, and 4, have been raised, and specific and sensitive immunoassays have been established. Sera from healthy individuals (Nordic Reference Interval Project and Database) were analyzed in the human epidermal growth factor receptor 2 assay (N = 805) and the human epidermal growth factor receptor 3 and 4 assays (N = 114), and reference limits were calculated. In addition, sera from 208 individual patients with breast cancer were tested in all three assays. Finally, the human epidermal growth factor receptor 2 assay was compared with a chemiluminescent immunoassay for serum human epidermal growth factor receptor 2/neu. Reference values were as follows: human epidermal growth factor receptor 2, human epidermal growth factor receptor 3, human epidermal growth factor receptor 4, human epidermal growth factor receptor 2 and human epidermal growth factor receptor 3 serum levels between the patients with tissue human epidermal growth factor receptor 2-positive and tissue human epidermal growth factor receptor 2-negative ( p = 0.0026, p = 0.000011) tumors, but not in the serum levels of human epidermal growth factor receptor 4 ( p = 0.054). There was good agreement between the in-house human epidermal growth factor receptor 2 assay and the chemiluminescent immunoassay. Our new specific antibodies for all the three human epidermal growth factor receptors may prove valuable in the development of novel anti-human epidermal growth factor receptor targeted therapies with

  5. The membrane fraction of homogenized rat kidney contains an enzyme that releases epidermal growth factor from the kidney membranes

    DEFF Research Database (Denmark)

    Nexø, Ebba; Poulsen, Steen Seier

    1991-01-01

    High levels of epidermal growth factor (EGF) are excreted in the urine and high levels of mRNA for the EGF-precursor have been demonstrated in the kidney. The EGF-precursor is a membrane bound peptide in the kidney, but little is known about the renal processing of the precursor. The present stud....... The EGF releasing enzyme is inhibited by the serine proteinase inhibitor aprotinin and by low temperatures (4 degrees C). The pH optimum of the reaction is pH 7.5-8.0....

  6. Extracorporeal Membrane Oxygenation in a Patient With Refractory Acute Respiratory Distress Syndrome Secondary to Toxic Epidermal Necrolysis.

    Science.gov (United States)

    2014-12-01

    life support (ECLS) in adults with acute respiratory distress syndrome (ARDS) has increased markedly during the past few years after suc- cessful...Extracorporeal Membrane Oxygenation in a Patient With Refractory Acute Respiratory Distress Syndrome Secondary to Toxic Epidermal Necrolysis Christy...COVERED - 4. TITLE AND SUBTITLE Extracorporeal Membrane Oxygenation in a Patient With Refractory Acute Respiratory Distress Syndrome Secondary to

  7. Expression of epidermal growth factor receptors in human endometrial carcinoma

    DEFF Research Database (Denmark)

    Nyholm, H C; Nielsen, Anette Lynge; Ottesen, B

    1993-01-01

    Little data exist on the expression of epidermal growth factor receptors (EGF-Rs) in human endometrial cancer. EGF-R status was studied in 65 patients with endometrial carcinomas and in 26 women with nonmalignant postmenopausal endometria, either inactive/atrophic endometrium or adenomatous...... hyperplasia. EGF-R was identified on frozen tissue sections by means of an indirect immunoperoxidase technique with a monoclonal antibody against the external domain of the EGF-R. Seventy-one percent of the carcinomas expressed positive EGF-R immunoreactivity. In general, staining was most prominent....../inactive endometria and seven of 13 (54%) endometria with adenomatous hyperplasia were EGF-R positive, with an immunostaining pattern rather similar to that of the carcinomas....

  8. Transcriptional responses of human epidermal keratinocytes to Oncostatin-M.

    Science.gov (United States)

    Finelt, Nika; Gazel, Alix; Gorelick, Steven; Blumenberg, Miroslav

    2005-08-21

    Oncostatin-M (OsM) plays an important role in inflammatory and oncogenic processes in skin, including psoriasis and Kaposi sarcoma. However, the molecular responses to OsM in keratinocytes have not been explored in depth. Here we show the results of transcriptional profiling in OsM-treated primary human epidermal keratinocytes, using high-density DNA microarrays. We find that OsM strongly and specifically affects the expression of many genes, in particular those involved with innate immunity, angiogenesis, adhesion, motility, tissue remodeling, cell cycle and transcription. The timing of the responses to OsM comprises two waves, early at 1h, and late at 48 h, with much fewer genes regulated in the intervening time points. Secreted cytokines and growth factors and their receptors, as well as nuclear transcription factors, are primary targets of OsM regulation, and these, in turn, effect the secondary changes.

  9. Transgenic Soybean Production of Bioactive Human Epidermal Growth Factor (EGF.

    Directory of Open Access Journals (Sweden)

    Yonghua He

    Full Text Available Necrotizing enterocolitis (NEC is a devastating condition of premature infants that results from the gut microbiome invading immature intestinal tissues. This results in a life-threatening disease that is frequently treated with the surgical removal of diseased and dead tissues. Epidermal growth factor (EGF, typically found in bodily fluids, such as amniotic fluid, salvia and mother's breast milk, is an intestinotrophic growth factor and may reduce the onset of NEC in premature infants. We have produced human EGF in soybean seeds to levels biologically relevant and demonstrated its comparable activity to commercially available EGF. Transgenic soybean seeds expressing a seed-specific codon optimized gene encoding of the human EGF protein with an added ER signal tag at the N' terminal were produced. Seven independent lines were grown to homozygous and found to accumulate a range of 6.7 +/- 3.1 to 129.0 +/- 36.7 μg EGF/g of dry soybean seed. Proteomic and immunoblot analysis indicates that the inserted EGF is the same as the human EGF protein. Phosphorylation and immunohistochemical assays on the EGF receptor in HeLa cells indicate the EGF protein produced in soybean seed is bioactive and comparable to commercially available human EGF. This work demonstrates the feasibility of using soybean seeds as a biofactory to produce therapeutic agents in a soymilk delivery platform.

  10. Superficial Dermal Fibroblasts Enhance Basement Membrane and Epidermal Barrier Formation in Tissue-Engineered Skin: Implications for Treatment of Skin Basement Membrane Disorders

    OpenAIRE

    2013-01-01

    Basement membrane is a highly specialized structure that binds the dermis and the epidermis of the skin, and is mainly composed of laminins, nidogen, collagen types IV and VII, and the proteoglycans, collagen type XVIII and perlecan, all of which play critical roles in the function and resilience of skin. Both dermal fibroblasts and epidermal keratinocytes contribute to the development of the basement membrane, and in turn the basement membrane and underlying dermis influence the development ...

  11. Receptor-like activity evoked by extracellular ADP in Arabidopsis root epidermal plasma membrane.

    Science.gov (United States)

    Demidchik, Vadim; Shang, Zhonglin; Shin, Ryoung; Colaço, Renato; Laohavisit, Anuphon; Shabala, Sergey; Davies, Julia M

    2011-07-01

    Extracellular purine nucleotides are implicated in the control of plant development and stress responses. While extracellular ATP is known to activate transcriptional pathways via plasma membrane (PM) NADPH oxidase and calcium channel activation, very little is known about signal transduction by extracellular ADP. Here, extracellular ADP was found to activate net Ca(2+) influx in roots of Arabidopsis (Arabidopsis thaliana) and transiently elevate cytosolic free Ca(2+) in root epidermal protoplasts. An inward Ca(2+)-permeable conductance in root epidermal PM was activated within 1 s of ADP application and repeated application evoked a smaller current. Such response speed and densitization are consistent with operation of equivalents to animal ionotropic purine receptors, although to date no equivalent genes for such receptors have been identified in higher plants. In contrast to ATP, extracellular ADP did not evoke accumulation of intracellular reactive oxygen species. While high concentrations of ATP caused net Ca(2+) efflux from roots, equivalent concentrations of ADP caused net influx. Overall the results point to a discrete ADP signaling pathway, reliant on receptor-like activity at the PM.

  12. Receptor-Like Activity Evoked by Extracellular ADP in Arabidopsis Root Epidermal Plasma Membrane1

    Science.gov (United States)

    Demidchik, Vadim; Shang, Zhonglin; Shin, Ryoung; Colaço, Renato; Laohavisit, Anuphon; Shabala, Sergey; Davies, Julia M.

    2011-01-01

    Extracellular purine nucleotides are implicated in the control of plant development and stress responses. While extracellular ATP is known to activate transcriptional pathways via plasma membrane (PM) NADPH oxidase and calcium channel activation, very little is known about signal transduction by extracellular ADP. Here, extracellular ADP was found to activate net Ca2+ influx in roots of Arabidopsis (Arabidopsis thaliana) and transiently elevate cytosolic free Ca2+ in root epidermal protoplasts. An inward Ca2+-permeable conductance in root epidermal PM was activated within 1 s of ADP application and repeated application evoked a smaller current. Such response speed and densitization are consistent with operation of equivalents to animal ionotropic purine receptors, although to date no equivalent genes for such receptors have been identified in higher plants. In contrast to ATP, extracellular ADP did not evoke accumulation of intracellular reactive oxygen species. While high concentrations of ATP caused net Ca2+ efflux from roots, equivalent concentrations of ADP caused net influx. Overall the results point to a discrete ADP signaling pathway, reliant on receptor-like activity at the PM. PMID:21562328

  13. Effects of soap-water wash on human epidermal penetration.

    Science.gov (United States)

    Zhu, Hanjiang; Jung, Eui-Chang; Phuong, Christina; Hui, Xiaoying; Maibach, Howard

    2016-08-01

    Skin decontamination is a primary interventional method used to decrease dermal absorption of hazardous contaminants, including chemical warfare agents, pesticides and industrial pollutants. Soap and water wash, the most common and readily available decontamination system, may enhance percutaneous absorption through the "wash-in effect." To understand better the effect of soap-water wash on percutaneous penetration, and provide insight to improving skin decontamination methods, in vitro human epidermal penetration rates of four C(14) -labeled model chemicals (hydroquinone, clonidine, benzoic acid and paraoxon) were assayed using flow-through diffusion cells. Stratum corneum (SC) absorption rates of these chemicals at various hydration levels (0-295% of the dry SC weights) were determined and compared with the results of the epidermal penetration study to clarify the effect of SC hydration on skin permeability. Results showed accelerated penetration curves of benzoic acid and paraoxon after surface wash at 30 min postdosing. Thirty minutes after washing (60 min postdosing), penetration rates of hydroquinone and benzoic acid decreased due to reduced amounts of chemical on the skin surface and in the SC. At the end of the experiment (90 min postdosing), a soap-water wash resulted in lower hydroquinone penetration, greater paraoxon penetration and similar levels of benzoic acid and clonidine penetration compared to penetration levels in the non-wash groups. The observed wash-in effect agrees with the enhancement effect of SC hydration on the SC chemical absorption rate. These results suggest SC hydration derived from surface wash to be one cause of the wash-in effect. Further, the occurrence of a wash-in effect is dependent on chemical identity and elapsed time between exposure and onset of decontamination. By reducing chemical residue quantity on skin surface and in the SC reservoir, the soap-water wash may decrease the total quantity of chemical absorbed in the

  14. Structural and biophysical characteristics of human skin in maintaining proper epidermal barrier function.

    Science.gov (United States)

    Boer, Magdalena; Duchnik, Ewa; Maleszka, Romuald; Marchlewicz, Mariola

    2016-02-01

    The complex structure of human skin and its physicochemical properties turn it into an efficient outermost defence line against exogenous factors, and help maintain homeostasis of the human body. This role is played by the epidermal barrier with its major part - stratum corneum. The condition of the epidermal barrier depends on individual and environmental factors. The most important biophysical parameters characterizing the status of this barrier are the skin pH, epidermal hydration, transepidermal water loss and sebum excretion. The knowledge of biophysical skin processes may be useful for the implementation of prophylactic actions whose aim is to restore the barrier function.

  15. Structural and biophysical characteristics of human skin in maintaining proper epidermal barrier function

    Directory of Open Access Journals (Sweden)

    Magdalena Boer

    2016-02-01

    Full Text Available The complex structure of human skin and its physicochemical properties turn it into an efficient outermost defence line against exogenous factors, and help maintain homeostasis of the human body. This role is played by the epidermal barrier with its major part – stratum corneum. The condition of the epidermal barrier depends on individual and environmental factors. The most important biophysical parameters characterizing the status of this barrier are the skin pH, epidermal hydration, transepidermal water loss and sebum excretion. The knowledge of biophysical skin processes may be useful for the implementation of prophylactic actions whose aim is to restore the barrier function.

  16. Homologous radioimmunoassay for human epidermal growth factor (urogastrone)

    Energy Technology Data Exchange (ETDEWEB)

    Dailey, G.E.; Kraus, J.W.; Orth, D.N.

    1978-06-01

    Epidermal growth factor (EGF), a polypeptide hormone originally discovered in the mouse submaxillary gland, stimulates growth in a variety of tissues in several species. This hormone has recently been identified in human urine. A homologous RIA for human EGF (RIA-hEGF) has been developed. In general, levels were similar to those recently reported using a heterologous RIA system. Twenty-four-hour urinary excretion of RIA-hEGF by normal adult males and females was 63.0 +- 3.0 and 52.0 +- 3.5 (mean +- SE) ..mu..g/total vol, or 29.7 +- 1.1 and 39.8 +- 1.7 ..mu..g/g creatinine, respectively. Excretion by females taking oral contraceptives was significantly greater (60.1 +- 2.7 ..mu..g/g creatinine; P < 0.01) than that by females who were not. Recent evidence suggests the probable identity of hEGF and ..beta..-urogastrone, a potent inhibitor of gastric acid secretion. Adult males with active peptic ulcer disease appeared to have lower urinary RIA-hEGF excretion (22.9 +- 2.6 ..mu..g/g creatinine) than normal men, but this was not significant (P > 0.05). Several of those with very low values had histories of alcohol abuse. Excretion by patients with Cushing's syndrome was normal. Patients with psoriasis or recovering from major burns excreted both abnormally high and abnormally low levels of RIA-hEGF, with no obvious correlation to their clinical condition. There was no apparent diurnal or postprandial variation in urinary RIA-hEGF excretion by normal subjects. An excellent linear correlation was observed between RIA-hEGF and creatinine concentrations in each urine sample for each subject, suggesting that RIA-hEGF concentration in a random urine sample provides a valid index of 24-h RIA-hEGF excretion.

  17. EphA2 proteomics in human keratinocytes reveals a novel association with afadin and epidermal tight junctions.

    Science.gov (United States)

    Perez White, Bethany E; Ventrella, Rosa; Kaplan, Nihal; Cable, Calvin J; Thomas, Paul M; Getsios, Spiro

    2017-01-01

    EphA2 is a receptor tyrosine kinase that helps to maintain epidermal tissue homeostasis. A proximity-dependent biotin identification (BioID) approach was used to identify proteins in close proximity to EphA2 within primary human keratinocytes and three-dimensional (3D) reconstituted human epidermis (RHE) cultures to map a putative protein interaction network for this membrane receptor that exhibits a polarized distribution in stratified epithelia. Although a subset of known EphA2 interactors were identified in the BioID screen, >97% were uniquely detected in keratinocytes with over 50% of these vicinal proteins only present in 3D human epidermal culture. Afadin (AFDN), a cytoskeletal and junction-associated protein, was present in 2D and 3D keratinocyte cultures, and validated as a so-far-unknown EphA2-interacting protein. Loss of EphA2 protein disrupted the subcellular distribution of afadin and occludin in differentiated keratinocytes, leading to impairment of tight junctions. Collectively, these studies illustrate the use of the BioID approach in order to map receptor interaction networks in 3D human epithelial cultures, and reveal a positive regulatory role for EphA2 in the organization of afadin and epidermal tight junctions. © 2017. Published by The Company of Biologists Ltd.

  18. Growth activity of epidermal cells from different parts of human body

    Institute of Scientific and Technical Information of China (English)

    CHAI Jia-ke; SHENG Zhi-yong; MA Zhong-feng; YANG Hong-ming; LIU Qiang; Liang Li-ming

    2007-01-01

    Background Most epidermal cells used in skin tissue engineering are obtained from the skins of fetuses or prepuces,which can not be widely used in culturing and transplanting autologous epidermis for patients with extensive burn wounds. To solve the problem, in this study, we cultured epidermal cells from different parts of human body in vitro, and detected their growth activity.Methods Normal epidermal cells obtained from the prepuce, scalp, and axilla of male patients, were cultured and passaged. Their growth characteristics including adherent rate and growth activity were compared. Data were analyzed by homogeneity test of variance.Results In primary culture, the growth of epidermal cells from the prepuce was significantly faster than that of the epidermal cells from the scalp and axilla. In the cells obtained from the prepuce, 80% confluence was achieved on day 12, while on day 16 and day 20 in the cells from the scalp and axilla, respectively. However, no significant difference was detected in their growth and proliferation in the second passage.Conclusions Although the growth of epidermal cells obtained from the scalp and axilla is slower than that from the prepuce in primary culture, stable cell line can be established and used in preparation of auto-epidermal grafts for patients with extensive burn wounds. Therefore, the scalp and axillary skin should be considered as important sources of epidermal cells other than the prepuce.

  19. Growth activity of epidermal cells from different parts of human body.

    Science.gov (United States)

    Chai, Jia-ke; Sheng, Zhi-yong; Ma, Zhong-feng; Yang, Hong-ming; Liu, Qiang; Liang, Li-ming

    2007-08-20

    Most epidermal cells used in skin tissue engineering are obtained from the skins of fetuses or prepuces, which can not be widely used in culturing and transplanting autologous epidermis for patients with extensive burn wounds. To solve the problem, in this study, we cultured epidermal cells from different parts of human body in vitro, and detected their growth activity. Normal epidermal cells obtained from the prepuce, scalp, and axilla of male patients, were cultured and passaged. Their growth characteristics including adherent rate and growth activity were compared. Data were analyzed by homogeneity test of variance. In primary culture, the growth of epidermal cells from the prepuce was significantly faster than that of the epidermal cells from the scalp and axilla. In the cells obtained from the prepuce, 80% confluence was achieved on day 12, while on day 16 and day 20 in the cells from the scalp and axilla, respectively. However, no significant difference was detected in their growth and proliferation in the second passage. Although the growth of epidermal cells obtained from the scalp and axilla is slower than that from the prepuce in primary culture, stable cell line can be established and used in preparation of auto-epidermal grafts for patients with extensive burn wounds. Therefore, the scalp and axillary skin should be considered as important sources of epidermal cells other than the prepuce.

  20. Extraction of high-quality epidermal RNA after ammonium thiocyanate-induced dermo-epidermal separation of 4 mm human skin biopsies

    DEFF Research Database (Denmark)

    Clemmensen, Anders; Thomassen, Mads; Clemmensen, Ole;

    2009-01-01

    To obtain a separation of the epidermal and dermal compartments to examine compartment specific biological mechanisms in the skin, we incubated 4 mm human skin punch biopsies in ammonium thiocyanate. We wanted to test (i) the histological quality of the dermo-epidermal separation obtained...... was not always histologically well-defined (i.e. occurred partly intra-epidermally), but also varied between subjects. Consequently, curettage along the dermal surface of the biopsy was added to the procedure. This modified method resulted in an almost perfect separation of the epidermal and dermal compartments...... and almost completely separated from the dermis of 4 mm skin biopsies by 30 min incubation in 3.8% ammonium thiocyanate combined with curettage of the dermal surface, producing high-quality RNA suitable for transcriptional analysis. Our refined method of dermo-epidermal separation will undoubtedly prove...

  1. Evolution of the clonogenic potential of human epidermal stem/progenitor cells with age

    Directory of Open Access Journals (Sweden)

    Zobiri O

    2012-02-01

    Full Text Available Olivia Zobiri, Nathalie Deshayes, Michelle Rathman-JosserandDepartment of Biological Research, L'Oréal Advanced Research, Clichy Cedex, FranceAbstract: A number of clinical observations have indicated that the regenerative potential and overall function of the epidermis is modified with age. The epidermis becomes thinner, repairs itself less efficiently after wounding, and presents modified barrier function recovery. In addition, the dermal papillae flatten out with increasing age, suggesting a modification in the interaction between epidermal and dermal compartments. As the epidermal regenerative capacity is dependent upon stem and progenitor cell function, it is naturally of interest to identify and understand age-related changes in these particular keratinocyte populations. Previous studies have indicated that the number of stem cells does not decrease with age in mouse models but little solid evidence is currently available concerning human skin. The objective of this study was to evaluate the clonogenic potential of keratinocyte populations isolated from the epidermis of over 50 human donors ranging from 18 to 71 years old. The data indicate that the number of epidermal cells presenting high regenerative potential does not dramatically decline with age in human skin. The authors believe that changes in the microenvironment controlling epidermal basal cell activity are more likely to explain the differences in epidermal function observed with increasing age.Keywords: skin, epidermal stem cells, aging, colony-forming efficiency test

  2. RNA interference mediated JAM-A gene silencing promotes human epidermal stem cell proliferation.

    Science.gov (United States)

    Zhou, Tong; Wu, Minjuan; Guo, Xiaocan; Liu, Houqi

    2015-04-01

    The objective of the study was to explore the influence of junctional adhesion molecule A (JAM-A) gene decoration on proliferation and differentiation of human epidermal stem cells (hEpSCs). JAM-A gene and JAM-A interference gene lentivirus eukaryotic expression vectors were established. The recombinant lentivirus was introduced into hEpSCs to observe and detect viral transfection by fluorescence microscopy and Western blot, respectively. After confirmation of successful introduction of the target gene, cell growth curves were mapped out by cytometry to detect cell proliferation in different groups. The expression of hEpSCs labeled molecules was detected by immunofluorescence, and cell safety was detected by teratoma test in all groups. (1) Fluorescence microscopy showed that in the JAM-A over-expression (JAM-A(ov) EpSCs) group, the green fluorescence was mainly distributed in the cell membrane; in the JAM-A interference (JAM-A(kd) EpSCs) group and blank vector (GFP EpSCs) group, all cell bodies were luminous. Western blot showed that JAM-A protein was up-regulated in JAM-A(ov) EpSCs and down-regulated in JAM-A(kd) EpSCs. (2) Growth curves showed that hEpSCs entered the quick-growing phase 4 days after inoculation and reached the platform phase at day 7. JAM-A(ov) EpSCs proliferated more slowly than GFP EpSCs, while JAM-A(kd) EpSCs proliferated significantly faster than GFP EpSCs. (3) Immunofluorescence showed that the expression of transient amplification epidermal marker keratin 14, hEpSCs marker keratin I9 and β-integrin was down-regulated in JAM-A(kd) EpSCs group as compared to that in the GFP EpSCs group, and the expression of epidermal terminal differentiation marker K10 was negative in the JAM-A(kd) EpSCs group. There was no significant difference in the expression of specific molecules between JAM-A(ov) EpSCs and hEpSCs. (4) The result of teratoma test was negative in all groups. The proliferative ability of hEpSCs was increased markedly after down

  3. Human Papilloma Viral DNA Replicates as a Stable Episome in Cultured Epidermal Keratinocytes

    Science.gov (United States)

    Laporta, Robert F.; Taichman, Lorne B.

    1982-06-01

    Human papilloma virus (HPV) is poorly understood because systems for its growth in tissue culture have not been developed. We report here that cultured human epidermal keratinocytes could be infected with HPV from plantar warts and that the viral DNA persisted and replicated as a stable episome. There were 50-200 copies of viral DNA per cell and there was no evidence to indicate integration of viral DNA into the cellular genome. There was also no evidence to suggest that viral DNA underwent productive replication. We conclude that cultured human epidermal keratinocytes may be a model for the study of certain aspects of HPV biology.

  4. Selective peroxidation and externalization of phosphatidylserine in normal human epidermal keratinocytes during oxidative stress induced by cumene hydroperoxide.

    Science.gov (United States)

    Shvedova, Anna A; Tyurina, Julia Y; Kawai, Kazuaki; Tyurin, Vladimir A; Kommineni, Choudari; Castranova, Vincent; Fabisiak, James P; Kagan, Valerian E

    2002-06-01

    Reactive oxygen species not only modulate important signal transduction pathways, but also induce DNA damage and cytotoxicity in keratinocytes. Hydrogen peroxide and organic peroxides are particularly important as these chemicals are widely used in dermally applied cosmetics and pharmaceuticals, and also represent endogenous metabolic intermediates. Lipid peroxidation is of fundamental interest in the cellular response to peroxides, as lipids are extremely sensitive to oxidation and lipid-based signaling systems have been implicated in a number of cellular processes, including apoptosis. Oxidation of specific phospholipid classes was measured in normal human epidermal keratinocytes exposed to cumene hydroperoxide after metabolic incorporation of the fluorescent oxidation-sensitive fatty acid, cis-parinaric acid, using a fluorescence high-performance liquid chromatography assay. In addition, lipid oxidation was correlated with changes in membrane phospholipid asymmetry and other markers of apoptosis. Although cumene hydroperoxide produced significant oxidation of cis-parinaric acid in all phospholipid classes, one phospholipid, phosphatidylserine, appeared to be preferentially oxidized above all other species. Using fluorescamine derivatization and annexin V binding it was observed that specific oxidation of phosphatidylserine was accompanied by phosphatidylserine translocation from the inner to the outer plasma membrane surface where it may serve as a recognition signal for interaction with phagocytic macrophages. These effects occurred much earlier than any detectable changes in other apoptotic markers such as caspase-3 activation, DNA fragmentation, or changes in nuclear morphology. Thus, normal human epidermal keratinocytes undergo profound lipid oxidation with preference for phosphatidylserine followed by phosphatidylserine externalization upon exposure to cumene hydroperoxide. It is therefore likely that normal human epidermal keratinocytes exposed to similar

  5. [Effects of transfection of human epidermal growth factor gene with adenovirus vector on biological characteristics of human epidermal cells].

    Science.gov (United States)

    Yin, Kai; Ma, Li; Shen, Chuan'an; Shang, Yuru; Li, Dawei; Li, Longzhu; Zhao, Dongxu; Cheng, Wenfeng

    2016-05-01

    To investigate the suitable transfection condition of human epidermal cells (hECs) with human epidermal growth factor (EGF) gene by adenovirus vector (Ad-hEGF) and its effects on the biological characteristics of hECs. hECs were isolated from deprecated human fresh prepuce tissue of circumcision by enzyme digestion method and then sub-cultured. hECs of the third passage were used in the following experiments. (1) Cells were divided into non-transfection group and 5, 20, 50, 100, 150, and 200 fold transfection groups according to the random number table (the same grouping method below), with 3 wells in each group. Cells in non-transfection group were not transfected with Ad-hEGF gene, while cells in the latter six groups were transfected with Ad-hEGF gene in multiplicities of infection (MOI) of 5, 20, 50, 100, 150, and 200 respectively. The morphology of the cells was observed with inverted phase contrast microscope, and expression of green fluorescent protein of the cells was observed with inverted fluorescence microscope at transfection hour (TH) 24, 48, and 72. (2) Another three batches of cells were collected, grouped, and treated as above, respectively. Then the transfection rate of Ad-hEGF gene was detected by flow cytometer (n=3), the mass concentration of EGF in culture supernatant of cells was detected by enzyme-linked immunosorbent assay (n=6), and the proliferation activity of cells was detected by cell counting kit 8 (CCK8) and microplate reader (n=6) at TH 24, 48, and 72, respectively. (3) Cells were collected and divided into non-transfection group and transfection group, with 6 wells in each group. Cells in non-transfection group were cultured with culture supernatant of cells without transfection, while cells in transfection group were cultured with culture supernatant of cells which were transfected with Ad-hEGF gene in the optimum MOI (50). CCK8 and microplate reader were used to measure the biological activity of EGF secreted by cells on culture

  6. Mediated exodus of L-dopa from human epidermal Langerhans cells.

    Science.gov (United States)

    Falck, B; Bendsoe, N; Ronquist, G

    2004-03-01

    L-3,4-dihydroxyphenylalanine (L-dopa) is not metabolized within human epidermal Langerhans cells (LC); yet they can take up substantial amounts of this amino acid which subsequently can be released into the extracellular space. We recently reported that human epidermal energy metabolism is predominantly anaerobic and that the influx mechanism is a unidirectional L-dopa/proton counter-transport system and now we describe conditions for the mediated transport of L-dopa out of the LC. It is demonstrated that certain amino acids and one dipeptide can effectively trigger the efflux of L-dopa taken up by the LC.Thus, alpha-methyl-dopa (alpha-m-dopa), D-dopa and the dipeptide, met-ala at the outside of the plasma membrane stimulated the efflux of L-dopa from L-dopa loaded LC. Similar effects were achieved by a variety of other amino acids in the extracellular fluid while some other amino acids were inactive. The time required for 50% D-methionine-induced exodus of L-dopa from L-dopa loaded LC was in the range of 5-7 min and a complete exodus of L-dopa was attained at about 20 min of incubation. This dislocation of L-dopa to the extracellular fluid is interpreted as an expression of trans-stimulation. In the case of alpha-m-dopa, D-dopa and met-ala, which admittedly were not able to penetrate the plasma membrane of LC, the concept of trans-stimulation was given a new purport, since none of them were able to participate in an exchange reaction. Finally, it could be concluded that L-dopa escaped by a route different from the one responsible for L-dopa uptake in LC.Thus, while the influx of L-dopa supports extrusion of protons deriving from anaerobic glycolysis in the LC, L-dopa efflux can provide the cells with useful amino acids in an energy-saving way, altogether a remarkable biological process. From this follows that L-dopa has a biological function of its own, besides being a precursor in the catecholamine and pigment syntheses.

  7. Superficial dermal fibroblasts enhance basement membrane and epidermal barrier formation in tissue-engineered skin: implications for treatment of skin basement membrane disorders.

    Science.gov (United States)

    Varkey, Mathew; Ding, Jie; Tredget, Edward E

    2014-02-01

    Basement membrane is a highly specialized structure that binds the dermis and the epidermis of the skin, and is mainly composed of laminins, nidogen, collagen types IV and VII, and the proteoglycans, collagen type XVIII and perlecan, all of which play critical roles in the function and resilience of skin. Both dermal fibroblasts and epidermal keratinocytes contribute to the development of the basement membrane, and in turn the basement membrane and underlying dermis influence the development and function of the epidermal barrier. Disruption of the basement membrane results in skin fragility, extensive painful blistering, and severe recurring wounds as seen in skin basement membrane disorders such as epidermolysis bullosa, a family of life-threatening congenital skin disorders. Currently, there are no successful strategies for treatment of these disorders; we propose the use of tissue-engineered skin as a promising approach for effective wound coverage and to enhance healing. Fibroblasts and keratinocytes isolated from superficial and deep dermis and epidermis, respectively, of tissue from abdominoplasty patients were independently cocultured on collagen-glycosaminoglycan matrices, and the resulting tissue-engineered skin was assessed for functional differences based on the underlying specific dermal fibroblast subpopulation. Tissue-engineered skin with superficial fibroblasts and keratinocytes formed a continuous epidermis with increased epidermal barrier function and expressed higher levels of epidermal proteins, keratin-5, and E-cadherin, compared to that with deep fibroblasts and keratinocytes, which had an intermittent epidermis. Further, tissue-engineered skin with superficial fibroblasts and keratinocytes formed better basement membrane, and produced more laminin-5, nidogen, collagen type VII, compared to that with deep fibroblasts and keratinocytes. Overall, our results demonstrate that tissue-engineered skin with superficial fibroblasts and keratinocytes

  8. Topical Mineralocorticoid Receptor Blockade Limits Glucocorticoid-Induced Epidermal Atrophy in Human Skin.

    Science.gov (United States)

    Maubec, Eve; Laouénan, Cédric; Deschamps, Lydia; Nguyen, Van Tuan; Scheer-Senyarich, Isabelle; Wackenheim-Jacobs, Anne-Catherine; Steff, Maud; Duhamel, Stéphanie; Tubiana, Sarah; Brahimi, Nesrine; Leclerc-Mercier, Stéphanie; Crickx, Béatrice; Perret, Claudine; Aractingi, Selim; Escoubet, Brigitte; Duval, Xavier; Arnaud, Philippe; Jaisser, Frederic; Mentré, France; Farman, Nicolette

    2015-07-01

    A major deleterious side effect of glucocorticoids is skin atrophy. Glucocorticoids activate the glucocorticoid and the mineralocorticoid (MR) receptor, both present in the epidermis. We hypothesized that glucocorticoid-induced epidermal atrophy may be related to inappropriate occupancy of MR by glucocorticoids. We evaluated whether epidermal atrophy induced by the topical glucocorticoid clobetasol could be limited by coadministration of MR antagonist. In cultured human skin explants, the epidermal atrophy induced by clobetasol was significantly limited by MR antagonism (canrenoate and eplerenone). Blockade of the epithelial sodium channel ENaC by phenamil was also efficient, identifying a role of MR-ENaC cascade in keratinocytes, acting through restoration of clobetasol-induced impairment of keratinocyte proliferation. In the SPIREPI randomized double-blind controlled trial, gels containing clobetasol, the MR antagonist spironolactone, both agents, or placebo were applied on four zones of the forearms of 23 healthy volunteers for 28 days. Primary outcome was histological thickness of the epidermis with clobetasol alone or clobetasol+spironolactone. Spironolactone alone did not affect the epidermal thickness but coapplication of clobetasol and spironolactone significantly limited clobetasol-induced atrophy and was well tolerated. Altogether, these findings identify MR as a factor regulating epidermal homeostasis and suggest that topical MR blockade could limit glucocorticoid-induced epidermal atrophy.

  9. Evolution of the clonogenic potential of human epidermal stem/progenitor cells with age.

    Science.gov (United States)

    Zobiri, Olivia; Deshayes, Nathalie; Rathman-Josserand, Michelle

    2012-01-01

    A number of clinical observations have indicated that the regenerative potential and overall function of the epidermis is modified with age. The epidermis becomes thinner, repairs itself less efficiently after wounding, and presents modified barrier function recovery. In addition, the dermal papillae fatten out with increasing age, suggesting a modification in the interaction between epidermal and dermal compartments. As the epidermal regenerative capacity is dependent upon stem and progenitor cell function, it is naturally of interest to identify and understand age-related changes in these particular keratinocyte populations. Previous studies have indicated that the number of stem cells does not decrease with age in mouse models but little solid evidence is currently available concerning human skin. The objective of this study was to evaluate the clonogenic potential of keratinocyte populations isolated from the epidermis of over 50 human donors ranging from 18 to 71 years old. The data indicate that the number of epidermal cells presenting high regenerative potential does not dramatically decline with age in human skin. The authors believe that changes in the microenvironment controlling epidermal basal cell activity are more likely to explain the differences in epidermal function observed with increasing age.

  10. Toxicity Assessment of Six Titanium Dioxide Nanoparticles in Human Epidermal Keratinocytes

    Science.gov (United States)

    Toxicity Assessment of Six Titanium Dioxide Nanoparticles in Human Epidermal Keratinocytes Nanoparticle uptake in cells may be an important determinant of their potential cytotoxic and inflammatory effects. Six commercial TiO2 NP (A=Alfa Aesar,10nm, A*=Alfa Aesar 32nm, B=P25 27...

  11. Toxicity Assessment of Six Titanium Dioxide Nanoparticles in Human Epidermal Keratinocytes

    Science.gov (United States)

    Toxicity Assessment of Six Titanium Dioxide Nanoparticles in Human Epidermal Keratinocytes Nanoparticle uptake in cells may be an important determinant of their potential cytotoxic and inflammatory effects. Six commercial TiO2 NP (A=Alfa Aesar,10nm, A*=Alfa Aesar 32nm, B=P25 27...

  12. Expression of the epidermal growth factor system in human middle ear cholesteatoma

    DEFF Research Database (Denmark)

    Thorup, Mette Bendixen; Munk, Mathias; Poulsen, Steen Seier

    2014-01-01

    the expression of the epidermal growth factor (EGF) system in human middle ear cholesteatoma. Methods: Forty-seven patients referred for surgery due to cholesteatoma were included in the study. Clinical data were collected. Biopsies of cholesteatoma and skin from the external ear canal were obtained during...

  13. Comparison of rat epidermal keratinocyte organotypic culture (ROC) with intact human skin

    DEFF Research Database (Denmark)

    Pappinen, Sari; Hermansson, Martin; Kuntsche, Judith

    2008-01-01

    The present report is a part of our continuing efforts to explore the utility of the rat epidermal keratinocyte organotypic culture (ROC) as an alternative model to human skin in transdermal drug delivery and skin irritation studies of new chemical entities and formulations. The aim of the presen...

  14. Effects of NaCl and Ca2+on Membrane Potential of Epidermal Cells of Maize Roots

    Institute of Scientific and Technical Information of China (English)

    HUA Jia-min; WANG Xiao-li; ZHAI Fu-qin; YAN Feng; FENG Ke

    2008-01-01

    The effects of salt-stress on plants involve not only the water stress caused by low osmotic pressure,but also the toxicity of excess Na+.A large amount of Na+ entering cells would reduce K+ uptake,which leads to an imbalance of K:Na ratio in cells.One of the reasons for the reduced K+-uptake iS the closure of K+-channel which is controlled by membrane potential.Calcium is usually applied to improve the growth of plants on saline soils and shows positive influence in the integrality of cell membrane.This study applied glass microelectrode technique to monitoring the NaCl-induced changes of membrane potential of root epidermal cells of maize(Zea mays L.,Denghai 11)seedlings at NaCl concentrations of 0,8,20,50,100,200 mmol L-1,respectively.The effect of Ca2+ on the changes of membrane potential caused by NaCl Was also studied.The results showed that:NaCl caused cell membrane depolarization.The depolarization became greater and faster with increasing of NaCl concentration.Moreover,the extent of depolarization was positively correlated with NaCl concentration.The addition of calcium postponed the depolarization,and decreased the degree of depolarization caused by NaCl.High NaCl concentration leads to depolarization of maize root cell membrane,which can partly be counteracted by calcium.

  15. Humanized versus murine anti-human epidermal growth factor receptor monoclonal antibodies for immunoscintigraphic studies

    Energy Technology Data Exchange (ETDEWEB)

    Morales, Alejo A. Morales; Duconge, Jorge; Alvarez-Ruiz, Daniel; Becquer-Viart, Maria de Los Angeles; Nunez-Gandolff, Gilda; Fernandez, Eduardo; Caballero-Torres, Idania; Iznaga-Escobar, Normando

    2000-02-01

    The anti-human epidermal growth factor receptor (EGF-R) humanized antibody h-R3 (IgG{sub 1}), which binds to an extracellular domain of EGF-R, was used to evaluate the biodistribution on nude mice xenografted with A431 epidermoid carcinoma cell line. Results are compared with its murine version ior egf/r3 monoclonal antibody (mAb). Twenty-one athymic female 4NMRI nu/nu mice were injected intravenously with 10 {mu}g/100 {mu}Ci of {sup 99m}Tc-labeled mAbs. The mAb ior C5 that recognizes an antigen expressed preferentially on the surface of malignant and cytoplasm of normal colorectal cells was used as negative control. Immunoreactivity of {sup 99m}Tc-labeled mAbs was measured by enzyme linked immunosorbent assay on A431 cell line and the immunoreactive fractions determined by Lindmo method. Among all organs significant accumulation was found in tumor (6.14{+-}2.50 %ID/g, 5.06{+-}2.61 %ID/g for murine and humanized mAbs, respectively) 4 h after injection. The immunoreactive fractions were found to be 0.88 and 0.81 for murine and humanized mAb, respectively. Thus, we expect better results using the humanized mAb h-R3 for diagnostic immunoscintigraphy.

  16. The Membrane-anchoring Domain of Epidermal Growth Factor Receptor Ligands Dictates Their Ability to Operate in Juxtacrine Mode

    Energy Technology Data Exchange (ETDEWEB)

    Dong, Jianying; Opresko, Lee; Chrisler, William B.; Orr, Galya; Quesenberry, Ryan D.; Lauffenburger, Douglas A.; Wiley, H S.

    2005-06-01

    All ligands of the epidermal growth factor receptor (EGFR) are synthesized as membrane-anchored precursors. Previous work has suggested that some ligands, such as EGF, must be proteolytically released to be active, whereas others, such as heparin binding EGF-like growth factor (HB-EGF) can function while still anchored to the membrane (i.e., juxtacrine signaling). To explore the structural basis for these differences in ligand activity, we engineered a series of membrane-anchored ligands in which the core, receptor-binding domain of EGF was combined with different domains of both EGF and HB-EGF. We found that ligands having the N-terminal extension of EGF could not bind to the EGFR, even when released from the membrane. Ligands lacking an N-terminal extension, but possessing the membrane-anchoring domain of EGF still required proteolytic release for activity, whereas ligands with the membrane anchoring domain of HB-EGF could elicit full biological activity while still membrane anchored. Ligands containing the HB-EGF membrane anchor, but lacking an N-terminal extension, activated EGFR during their transit through the Golgi apparatus . However, cell-mixing experiments and fluorescence resonance energy transfer (FRET) studies showed that juxtacrine signaling typically occurred in trans at the cell surface, at points of cell-cell contact. Our data suggest that the membrane-anchoring domain of ligands selectively controls their ability to participate in juxtacrine signaling and thus, only a subclass of EGFR ligands can act in a juxtacrine mode.

  17. Protein kinase C is differentially regulated by thrombin, insulin, and epidermal growth factor in human mammary tumor cells

    Energy Technology Data Exchange (ETDEWEB)

    Gomez, M.L.; Tellez-Inon, M.T. (Instituto de Ingenieria Genetica y Biologia Molecular, Buenos Aires (Argentina)); Medrano, E.E.; Cafferatta, E.G.A. (Instituto de Investigaciones Bioquimicas Fundacion Campomar, Buenos Aires (Argentina))

    1988-03-01

    The exposure of serum-deprived mammary tumor cells MCF-7 and T-47D to insulin, thrombin, and epidermal growth factor (EGF) resulted in dramatic modifications in the activity and in the translocation capacity of protein kinase C from cytosol to membrane fractions. Insulin induces a 600% activation of the enzyme after 5 h of exposure to the hormone in MCF-7 cells; thrombin either activates (200% in MCF-7) or down-regulates (in T-47D), and EGF exerts only a moderate effect. Thus, the growth factors studied modulate differentially the protein kinase C activity in human mammary tumor cells. The physiological significance of the results obtained are discussed in terms of the growth response elicited by insulin, thrombin, and EGF.

  18. Isolating subpopulations of human epidermal basal cells based on polyclonal serum against trypsin-resistant CSPG4 epitopes

    DEFF Research Database (Denmark)

    Gunnarsson, Anders Patrik Alexander; Christensen, Rikke; Prætorius, Jeppe

    2016-01-01

    unable to study these keratinocytes isolated directly from skin samples by flow cytometry. By choosing epitopes of CSPG4 relatively close to the cell membrane we were able to generate a polyclonal antibody that successfully detects CSPG4 on keratinocytes after trypsinization. Although CSPG4-positive......Chondroitin sulfate proteoglycan 4 (CSPG4) is highly expressed by human epidermal keratinocytes located at the tip of the dermal papilla where keratinocytes show characteristics of stem cells. However, since available antibodies to CSPG4 are directed against trypsin-sensitive epitopes we have been...... that CSPG4-positive basal cell keratinocytes are distinct from CSPG4-negative basal cell keratinocytes. Our study demonstrates that it is possible to generate antibodies against trypsin-resistant epitopes of CSPG4. Our study also documents a marked change in behaviour upon cell culturing and challenges...

  19. Hesperetin induces melanin production in adult human epidermal melanocytes.

    Science.gov (United States)

    Usach, Iris; Taléns-Visconti, Raquel; Magraner-Pardo, Lorena; Peris, José-Esteban

    2015-06-01

    One of the major sources of flavonoids for humans are citrus fruits, hesperidin being the predominant flavonoid. Hesperetin (HSP), the aglycon of hesperidin, has been reported to provide health benefits such as antioxidant, anti-inflammatory and anticarcinogenic effects. However, the effect of HSP on skin pigmentation is not clear. Some authors have found that HSP induces melanogenesis in murine B16-F10 melanoma cells, which, if extrapolated to in vivo conditions, might protect skin against photodamage. Since the effect of HSP on normal melanocytes could be different to that observed on melanoma cells, the described effect of HSP on murine melanoma cells has been compared to the effect obtained using normal human melanocytes. HSP concentrations of 25 and 50 µM induced melanin synthesis and tyrosinase activity in human melanocytes in a concentration-dependent manner. Compared to control melanocytes, 25 µM HSP increased melanin production and tyrosinase activity 1.4-fold (p melanocyte cultures could be reproduced on human skin.

  20. Mitochondrial tolerance to single and repeat exposure to simulated sunlight in human epidermal and dermal skin cells.

    Science.gov (United States)

    Kelly, J; Murphy, J E J

    2016-12-01

    Sunlight represents the primary threat to mitochondrial integrity in skin given the unique nature of the mitochondrial genome and its proximity to the electron transport chain. The accumulation of mitochondrial DNA (mtDNA) mutations is a key factor in many human pathologies and this is linked to key roles of mitochondrial function in terms of energy production and cell regulation. The main objective of this study was to evaluate solar radiation induced changes in mitochondrial integrity, function and dynamics in human skin cells using a Q-Sun solar simulator to deliver a close match to the intensity of summer sunlight. Spontaneously immortalised human skin epidermal keratinocytes (HaCaT) and Human Dermal Fibroblasts (HDFn) were divided into two groups. Group A were irradiated once and Group B twice 7days apart and evaluated using cell survival, viability and mitochondrial membrane potential (MMP) and mass at 1, 4 and 7days post one exposure for Group A and 1, 4, 7 and 14days post second exposure for Group B. Viability and survival of HaCaT and HDFn cells decreased after repeat exposure to Simulated Sunlight Irradiation (SSI) with no recovery. HDFn cells showed no loss in MMP after one or two exposures to SSI compared to HaCaT cells which showed a periodic loss of MMP after one exposure with a repeat exposure causing a dramatic decrease from which cells did not recover. Mitochondrial Mass in exposed HDFn cells was consistent with control after one or two exposures to SSI; however mitochondrial mass was significantly decreased in HaCaT cells. Data presented here suggests that mitochondria in epidermal cells are more sensitive to sunlight damage compared to mitochondria in dermal cells, despite their origin, confirming a skin layer specific sensitivity to sunlight, but not as expected. Copyright © 2016 Elsevier B.V. All rights reserved.

  1. Mechanical response of a living human epidermal keratinocyte sheet as measured in a composite diaphragm inflation experiment.

    Science.gov (United States)

    Selby, John C; Shannon, Mark A

    2007-01-01

    Sheets of normal human epidermal keratinocytes (NHEKs) were reconstituted in vitro on tensed but highly compliant, freestanding polydimethylsiloxane (PDMS) membranes, 5.0 mm in diameter and 10 mum thick. NHEK-PDMS composite diaphragm (CD) specimens were then subjected to cyclical axisymmetric inflation tests to investigate epithelial sheet rheology under conditions of physiologically severe deformations (~50% nominal polar biaxial strains). Because the compliance of the specially formulated PDMS membrane was greater than that of the attached cell layer, the finite load-deformation behavior (mechanical response) of the living NHEK sheet was inferred from differences between the mechanical behavior of the CD specimen and the response of the underlying PDMS membrane measured prior to cell culture. In these composite diaphragm inflation (CDI) experiments, interconnected NHEKs exhibited rheological behaviors that were suggestive of a viscoelastic-plastic stress response. Remarkably, specimens returned to quiescent culture following a sequence of inflation tests recovered at least 80% of their original ability to store elastic strain energy, evidence of biological adaptation and recovery or restitutio ad integrum. Unlike methodologies that assay the morphological or biochemical response of cultured cells to an applied mechanostimulus, CDI experiments can be used to probe the load-bearing functions of desmosomes and adherens junctions within a living epithelial sheet, as well as to assess the rheological behaviors of the intermediate filament and microfilament networks that these cell-cell junctions serve to interconnect.

  2. Model of human epidermis reconstructed in vitro with keratinocytes and melanocytes on dead de-epidermized human dermis

    Directory of Open Access Journals (Sweden)

    Jussara Rehder

    Full Text Available CONTEXT: Recent progress in the field of epithelial culture techniques has allowed the development of culture systems in which the reconstructed epidermis presents characteristics of morphological differentiation similar to those seen in vivo. Human epidermis reconstructed in vitro may be used as the best alternative for the in vitro testing of the toxicology and efficiency of products for topical use, as well as in the treatment of skin burns and chronic skin ulcers. OBJECTIVE: To demonstrate a method for obtaining human epidermis reconstructed in vitro, using keratinocytes and melanocytes cultivated on dead de-epidermized human dermis. TYPE OF STUDY: Experimental/laboratory. SETTING: Skin Cell Culture Laboratory of the Faculdade de Ciências Médicas, Universidade Estadual de Campinas, Campinas, São Paulo, Brazil. PROCEDURE: Human keratinocytes and melanocytes cultured in vitro were grown on a biological matrix (dead de-epidermized human dermis and the system was kept at an air-liquid interface, in a suitable culturing medium, until a stratified human epidermis was formed, maintaining the histological characteristics of the epidermis in vivo. RESULTS: It was histologically demonstrated that it is possible to reproduce a differentiated epidermis through keratinocytes and melanocytes cultured on dead de-epidermized human dermis, thus obtaining a correctly positioned human epidermis reconstructed in vitro with functional keratinocytes and melanocytes that is similar to in vivo epidermis. CONCLUSIONS: It is possible to obtain a completely differentiated human epidermis reconstructed in vitro from keratinocyte and melanocyte cultures on a dead de-epidermized human dermis.

  3. Expression of an Exogenous Growth Hormone Gene by Transplantable Human Epidermal Cells

    Science.gov (United States)

    Morgan, Jeffrey R.; Barrandon, Yann; Green, Howard; Mulligan, Richard C.

    1987-09-01

    Retrovirus-mediated gene transfer was used to introduce a recombinant human growth hormone gene into cultured human keratinocytes. The transduced keratinocytes secreted biologically active growth hormone into the culture medium. When grafted as an epithelial sheet onto athymic mice, these cultured keratinocytes reconstituted an epidermis that was similar in appearance to that resulting from normal cells, but from which human growth hormone could be extracted. Transduced epidermal cells may prove to be a general vehicle for the delivery of gene products by means of grafting.

  4. Membrane contacts between endosomes and ER provide sites for PTP1B-epidermal growth factor receptor interaction.

    Science.gov (United States)

    Eden, Emily R; White, Ian J; Tsapara, Anna; Futter, Clare E

    2010-03-01

    The epidermal growth factor receptor (EGFR) is a critical determinator of cell fate. Signalling from this receptor tyrosine kinase is spatially regulated by progression through the endocytic pathway, governing receptor half-life and accessibility to signalling proteins and phosphatases. Endocytosis of EGFR is required for interaction with the protein tyrosine phosphatase PTP1B (ref. 1), which localizes to the cytoplasmic face of the endoplasmic reticulum (ER), raising the question of how PTP1B comes into contact with endosomal EGFR. We show that EGFR-PTP1B interaction occurs by means of direct membrane contacts between the perimeter membrane of multivesicular bodies (MVBs) and the ER. The population of EGFR interacting with PTP1B is the same population that undergo ESCRT-mediated (endosomal sorting complex required for transport) sorting within MVBs, and PTP1B activity promotes the sequestration of EGFR on to MVB internal vesicles. Membrane contacts between endosomes and the ER form in both the presence and absence of stimulation by EGF. Thus membrane contacts between endosomes and the ER may represent a global mechanism for direct interaction between proteins on these two organelles.

  5. Degenerative and regenerative changes in epidermal organ culture: a morphological study with reference to membrane-coating granules.

    Science.gov (United States)

    Chapman, S J; Vickers, C F

    1988-11-01

    Membrane-coating granules (MCG) are poorly understood lamellate organelles unique to keratinized epithelia. This study provides data on a skin model for future in vitro investigations of MCG. Porcine ear epidermal organ cultures were used under standard cell culture conditions. This system was selected because it is easily established and, following a degenerative period in which MCG are lost, regenerates to form a highly differentiated epidermis. The epidermis appeared healthy during the first 2 d in vitro and contained MCG but lost keratohyalin granules (KHG). Overt degenerative changes were evident in the upper epidermis on Day 3, and MCG were now bloated. By Day 4 only one to three layers of viable undifferentiated cells remained. In the overlying necrotic epidermis MCG were rare, presumably due to the bursting of bloated MCG. Epidermal regeneration began around Day 5 and by Day 7 there were 8 to 13 layers, including a rudimentary parakeratotic stratum corneum (up to 4 layers). The stratum granulosum (two to three layers) now contained immature KHG and poorly lamellate MCG, but only amorphous material extracellularly. By Day 11 there were three to four layers of granular cells as in vivo, and an orthokeratotic stratum corneum (two to four layers). Improved cornification coincided with an increased number of mature KHG and cross-banded MCG, and lamellate MCG contents extracellularly. This model of epidermal regeneration will facilitate studies into the role played by MCG in keratinization because the epithelium initially lacked MCG but later expressed all the major morphologic features of epidermis. Furthermore the mechanisms by which MCG translocation and extrusion are effected may be probed by the inclusion of such agents as antimicrotubular drugs and calcium ionophores.

  6. Inhibition of invasiveness and expression of epidermal growth factor receptor in human colorectal carcinoma cells induced by retinoic acid

    Institute of Scientific and Technical Information of China (English)

    SUNBAODONG; JINDANSONG

    1995-01-01

    Human amniotic basement membrane (HABM) model and agarose drop explant method were used to investigate the effects of retinoic acid(RA) on the invasive ness and adhesiveness to the basement membrane,and the migration of a highly invasive human colorectal cancer cell line CCL229.Results showed that 5×106 MRA markedly reduced the in vitro invasiveness and adhesiveness to the HABM,and the migration of the CCL229 cells.In addition,to elucidate the relation between expression of epidermal growth factor receptor(EGFR) and the invasiveness of the colorectal carcinoma cells,two well-differentiated,but with different invasiveness colorectal cancer cell lines were compared at mRNA level for expression of EGFR by using EGFR cDNA probe labeled with digoxigenin(DIG). Expression of EGFR was shown to be markedly higher in the highly invassive CCL229 cells than that in the low invasive CX-1 cells.Furthermore,expression of EGFR in RA treated CCL229 cells gradually decreased with time,the level being the lowest on day 6 of the RA treatment.

  7. Lysyl Hydroxylase 3 Localizes to Epidermal Basement Membrane and Is Reduced in Patients with Recessive Dystrophic Epidermolysis Bullosa.

    Directory of Open Access Journals (Sweden)

    Stephen A Watt

    Full Text Available Recessive dystrophic epidermolysis bullosa (RDEB is caused by mutations in COL7A1 resulting in reduced or absent type VII collagen, aberrant anchoring fibril formation and subsequent dermal-epidermal fragility. Here, we identify a significant decrease in PLOD3 expression and its encoded protein, the collagen modifying enzyme lysyl hydroxylase 3 (LH3, in RDEB. We show abundant LH3 localising to the basement membrane in normal skin which is severely depleted in RDEB patient skin. We demonstrate expression is in-part regulated by endogenous type VII collagen and that, in agreement with previous studies, even small reductions in LH3 expression lead to significantly less secreted LH3 protein. Exogenous type VII collagen did not alter LH3 expression in cultured RDEB keratinocytes and we show that RDEB patients receiving bone marrow transplantation who demonstrate significant increase in type VII collagen do not show increased levels of LH3 at the basement membrane. Our data report a direct link between LH3 and endogenous type VII collagen expression concluding that reduction of LH3 at the basement membrane in patients with RDEB will likely have significant implications for disease progression and therapeutic intervention.

  8. Isolating subpopulations of human epidermal basal cells based on polyclonal serum against trypsin-resistant CSPG4 epitopes.

    Science.gov (United States)

    Gunnarsson, Anders Patrik; Christensen, Rikke; Praetorius, Jeppe; Jensen, Uffe Birk

    2017-01-15

    Chondroitin sulfate proteoglycan 4 (CSPG4) is highly expressed by human epidermal keratinocytes located at the tip of the dermal papilla where keratinocytes show characteristics of stem cells. However, since available antibodies to CSPG4 are directed against trypsin-sensitive epitopes we have been unable to study these keratinocytes isolated directly from skin samples by flow cytometry. By choosing epitopes of CSPG4 relatively close to the cell membrane we were able to generate a polyclonal antibody that successfully detects CSPG4 on keratinocytes after trypsinization. Although CSPG4-positive basal cells express higher levels of Itgβ1 the colony-forming efficiency is slightly lower than CSPG4-negative basal cells. Sorting the directly isolated keratinocytes based on Itgβ1 did not reveal differences in colony-forming efficiency between keratinocytes expressing high or low levels of Itgβ1. However, after the first passage Itgβ1 could be used to predict colony-forming efficiency whether the culture was established from CSPG4-positive or CSPG4-negative basal cell keratinocytes. Although we were unable to detect differences in the colony-forming assay, global gene expression profiling showed that CSPG4-positive basal cell keratinocytes are distinct from CSPG4-negative basal cell keratinocytes. Our study demonstrates that it is possible to generate antibodies against trypsin-resistant epitopes of CSPG4. Our study also documents a marked change in behaviour upon cell culturing and challenges the way we assess for stemness within the human epidermal basal layer.

  9. Circulating chromatin-anti-chromatin antibody complexes bind with high affinity to dermo-epidermal structures in murine and human lupus nephritis

    DEFF Research Database (Denmark)

    Fismen, S; Hedberg, A; Fenton, K A

    2009-01-01

    Murine and human lupus nephritis are characterized by glomerular deposits of electron-dense structures (EDS). Dominant components of EDS are chromatin fragments and IgG antibodies. Whether glomerular EDS predispose for similar deposits in skin is unknown. We analysed (i) whether dermo-epidermal i...... were present in capillary lumina in glomeruli and skin of all nephritic individuals. Thus, chromatin-IgG complexes accounting for lupus nephritis seem to reach skin through circulation, but other undetermined factors are required for these complexes to deposit within skin membranes....

  10. Human skin basement membrane-associated heparan sulphate proteoglycan: distinctive differences in ultrastructural localization as a function of developmental age

    DEFF Research Database (Denmark)

    Horiguchi, Y; Fine, J D; Couchman, J R

    1991-01-01

    Recent studies have demonstrated that skin basement membrane components are expressed within the dermo-epidermal junction in an orderly sequence during human foetal development. We have investigated the ultrastructural localization of basement membrane-related antigens in human foetal skin...... was identical to that observed in neonatal and adult human skin. These findings demonstrate that active remodelling of the dermo-epidermal junction occurs during at least the first two trimesters, and affects not only basement membrane-associated structures but also specific antigens....... at different developmental ages using two monoclonal antibodies to a well-characterized basement membrane-associated heparan sulphate proteoglycan. A series of foetal skin specimens (range, 54-142 gestational days) were examined using an immunoperoxidase immunoelectron microscopic technique. In specimens...

  11. Simultaneous screening of four epidermal growth factor receptor antagonists from Curcuma longa via cell membrane chromatography online coupled with HPLC-MS.

    Science.gov (United States)

    Sun, Meng; Ma, Wei-na; Guo, Ying; Hu, Zhi-gang; He, Lang-chong

    2013-07-01

    The epidermal growth factor receptors (EGFRs) are significant targets for screening active compounds. In this work, an analytical method was established for rapid screening, separation, and identification of EGFRs antagonists from Curcuma longa. Human embryonic kidney 293 cells with a steadily high expression of EGFRs were used to prepare the cell membrane stationary phase in a cell membrane chromatography model for screening active compounds. Separation and identification of the retention chromatographic peaks was achieved by HPLC-MS. The active sites, docking extents and inhibitory effects of the active compounds were also demonstrated. The screening result found that ar-turmerone, curcumin, demethoxycurcumin, and bisdemethoxycurcumin from Curcuma longa could be active components in a similar manner to gefitinib. Biological trials showed that all of four compounds can inhibit EGFRs protein secretion and cell growth in a dose-dependent manner, and downregulate the phosphorylation of EGFRs. This analytical method demonstrated fast and effective characteristics for screening, separation and identification of the active compounds from a complex system and should be useful for drug discovery with natural medicinal herbs. © 2013 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  12. Regenerative and reparative effects of human chorion-derived stem cell conditioned medium on photo-aged epidermal cells.

    Science.gov (United States)

    Li, Qiankun; Chen, Yan; Ma, Kui; Zhao, Along; Zhang, Cuiping; Fu, Xiaobing

    2016-01-01

    Epidermal cells are an important regenerative source for skin wound healing. Aged epidermal cells have a low ability to renew themselves and repair skin injury. Ultraviolet (UV) radiation, particularly UVB, can cause photo-aging of the skin by suppressing the viability of human epidermal cells. A chorion-derived stem cell conditioned medium (CDSC-CNM) is thought to have regenerative properties. This study aimed to determine the regenerative effects of CDSC-CNM on UVB-induced photo-aged epidermal cells. Epidermal cells were passaged four times and irradiated with quantitative UVB, and non-irradiated cells served as a control group. Cells were then treated with different concentrations of CDSC-CNM. Compared to the non-irradiated group, the proliferation rates and migration rates of UVB-induced photo-aged epidermal cells significantly decreased (p cells significantly improved their viability, and their ROS generation and DNA damage decreased. The secretory factors in CDSC-CNM, including epidermal growth factor (EGF), transforming growth factor-β (TGF-β), interleukin (IL)-6, and IL-8 and the related signaling pathway protein levels, increased compared to the control medium (CM). The potential regenerative and reparative effects of CDSC-CNM indicate that it may be a candidate material for the treatment of prematurely aged skin. The functions of the secretory factors and the mechanisms of CDSC-CNM therapy deserve further attention.

  13. Transcriptional profiling defines the effects of nickel in human epidermal keratinocytes.

    Science.gov (United States)

    Gazel, Alix; Rosdy, Martin; Tornier, Carine; De Fraissinette, Anne De Brugerolle; Blumenberg, Miroslav

    2008-12-01

    Nickel is a ubiquitous and virtually unavoidable environmental pollutant and occupational hazard, but its molecular and cellular effects are not well understood. Human epidermal keratinocytes are the sentinel and the primary target for nickel. We treated with nickel salts skin equivalents containing differentiating epidermal keratinocytes grown on air-liquid interface in standard cell culture conditions. We identified the transcriptional profiles affected by nickel in reconstructed human epidermis (RHE) using DNA microarrays. The Ni-regulated genes were determined at two time points, immediate-early, 30 min after treatment, and late, at 6 h. Using in silico data analysis, we determined that 134 genes are regulated by nickel; of these, 97 are induced and 37 suppressed. Functional categories of regulated genes suggest that Ni inhibits apoptosis, promotes cell cycle and induces synthesis of extracellular matrix proteins and extracellular proteases. Importantly, Ni also regulates a set of secreted signaling proteins, inducing VEGF, amphiregulin, PGF, GDF15, and BST2, while suppressing IL-18, galectin-3, and LITAF. These secreted proteins may be important in Ni-caused allergic reactions. Ni induced inhibitors of the NFkappaB signaling pathway, and suppressed its activators. Correspondingly, NFkappaB binding sites were found to be overrepresented in the Ni-suppressed genes, whereas cFOS/AP1 binding sites were common in the Ni-induced genes. Significant parallels were found between the Ni-regulated genes and the genes regulated by TGFbeta, EGF, glucocorticoids, or Oncostatin-M. The comprehensive identification of Ni-regulated genes in human epidermal equivalents significantly advances our understanding of the molecular effects of nickel in skin.

  14. Development of a PVAl/chitosan composite membrane compatible with the dermo-epidermic system; Desenvolvimento de membrana composta de PVAl e quitosana compativel com o sistema dermo-epidermico

    Energy Technology Data Exchange (ETDEWEB)

    Almeida, Tiago Luiz de

    2009-03-15

    Due to the frequent incidence of people with skin lesions such as burns and ulcers and the lack of available donors, biomaterials with the capacity to mimic skin must be developed. In order to develop these biomaterials, polymers are used in the attempt to achieve characteristics which are closer to the target organ. In this direction, for several years our group has been developing dermo-epidermic substitutes, specifically biodegradable and biocompatible membranes made up of PVAl and chitosan. PVAl, a synthetic polymer, was used to imitate part of the human dermis and chitosan, a polymer of organic origin, was used in this study to stimulate growth and maintenance of the epidermis. Due to the variations of these commercially obtained polymers, the objective of this study was to characterize their physical and chemical properties, comparing them with the membrane previously obtained by our group with the intention of confirming the hypotheses of interferences put forward in this study. The PVAl membranes in the study (PVAl MP) that obtained characteristics most similar to the standard were those irradiated with 13 and 15 kGy; this last was chosen because it was the minimum dose necessary to achieve sterility. These membranes were also those which had the largest percentage of pores between 70 and 100 {mu}m. For chitosan, the principal characteristics studied were the degree of acetylation (DA) and average molecular weight, both results demonstrated different characteristics than commercially indicated. Various membrane preparation protocols were carried out from the chitosan solution (2%). The membrane composed of the solution of chitosan homogenized with glycerol (20%) and dried at room temperature had the best interaction with keratinocytes. To finalize the study, this chitosan solution was poured over a PVAl membrane, lyophilized and impregnated with chitosan (2%) solution and the compound was kept at room temperature until a chitosan film formed on the upper

  15. Expression of the epidermal growth factor system in human endometrium during the menstrual cycle

    DEFF Research Database (Denmark)

    Ejskjaer, Kirsten; Sørensen, B S; Poulsen, Steen Seier;

    2005-01-01

    The epidermal growth factor (EGF) system is ubiquitous in humans and plays fundamental roles in embryogenesis, development, proliferation and differentiation. As the endometrium of fertile women is characterized by proliferation and differentiation, we hypothesize a role for the EGF system...... (HER1) showed highest expression during the proliferative phase, HER2 and HER4 during the early and HER3 during the late secretory phase. Amphiregulin (AR) and transforming growth factor alpha (TGFalpha) expression is highest in proliferative phase. Heparin binding (HB)-EGF and betacellulin (BCL) show...

  16. Down regulation of epidermal growth factor receptors: direct demonstration of receptor degradation in human fibroblasts

    OpenAIRE

    1984-01-01

    The metabolism of the receptor for epidermal growth factor (EGF) has been measured by labeling the receptor in vivo with radioactive amino acid precursors and then determining, by immunoprecipitation with specific anti-EGF receptor antisera, the rate of degradation of the receptor when the cells are placed in a nonradioactive medium. In human fibroblasts the rate of EGF receptor degradation (t1/2 = 10.1 h) was faster than the rate of degradation of total cell protein. When EGF was added to th...

  17. Basement membrane reconstruction in human skin equivalents is regulated by fibroblasts and/or exogenously activated keratinocytes

    NARCIS (Netherlands)

    El Ghalbzouri, A; Jonkman, MF; Dijkman, R; Ponec, M

    2005-01-01

    This study was undertaken to examine the role fibroblasts play in the formation of the basement membrane (BM) in human skin equivalents. For this purpose, keratinocytes were seeded on top of fibroblast-free or fibroblast-populated collagen matrix or de-epidermized dermis and cultured in the absence

  18. Metal: ATP characteristics of insulin- and epidermal growth factor-stimulated phosphorylation in detergent extracts of rat liver plasma membranes.

    Science.gov (United States)

    Uhing, R J; Exton, J H

    1986-09-01

    The metal: ATP characteristics of insulin- and epidermal growth factor-(EGF)-stimulated protein kinase activities were examined in Nonidet P40 extracts of rat liver plasma membranes. The two kinase activities were capable of utilizing either manganese or magnesium, although differences were observed. Insulin-stimulated 32P incorporation into an Mr 95 000 protein exhibited a higher affinity for ATP in the presence of manganese compared to magnesium. At 200 microM ATP, insulin stimulated 32P incorporation into the Mr 95 000 protein 3- to 5-fold after 5 min in the presence of either metal. At 1 mM ATP, insulin-stimulated 32P incorporation was significantly greater in the presence of magnesium. In contrast, EGF-stimulated 32P incorporation into an Mr 170 000 protein exhibited similar ATP dependencies in the presence of magnesium or manganese. Basal phosphorylation of the Mr 170 000 protein was 2- to 3-fold higher in the presence of manganese, however. Since the higher basal phosphorylation persisted after chromatography on wheat germ lectin-Sepharose, it may represent an inherent activity of the receptor kinase. In the presence of magnesium: ATP, low concentrations of manganese enhanced both insulin- and EGF-stimulated phosphorylation of angiotensin II suggesting involvement of a second metal binding site which regulates the kinase activity. The results presented show major differences in the metal: ATP properties of the two major hormonally regulated protein kinase activities observed in detergent-extracted liver membranes.

  19. Asian dust storm particles induce a broad toxicological transcriptional program in human epidermal keratinocytes.

    Science.gov (United States)

    Choi, Hyun; Shin, Dong Wook; Kim, Wonnyon; Doh, Seong-Jae; Lee, Soo Hwan; Noh, Minsoo

    2011-01-15

    Exposure to airborne dust particles originated from seasonal Asian dust storms in Chinese and Mongolian deserts results in increased incidence of a range of diseases including asthma, contact dermatitis and conjunctivitis. The areas affected by Asian dust particles extend from East China to the west coast of North America. In order to study toxicological mechanisms in human skin, we evaluated the effects of dust particles collected during Asian dust storms (Asian dust particles) on gene expression in human epidermal keratinocytes (HEK). In HEK, exposure to Asian dust particles significantly increased gene expressions of cytochrome P450 1A1 (CYP1A1), CYP1A2, and CYP1B1, which is an indication of aryl hydrocarbon receptor (AHR) activation. In addition, Asian dust particles increased gene transcription of the cytokines IL-6, IL-8, and GM-CSF, which have broad pro-inflammatory and immunomodulatory properties. Asian dust particles significantly up-regulated expression of caspase 14 in HEK, suggesting that Asian dust particles directly affect keratinocyte differentiation. We also demonstrated that protein extract of pollen, a material frequently adsorbed onto Asian dust particles, potentially contributes to the increased transcription of IL-6, CYP1A1, CYP1A2, and CYP1B1. Taken together, these studies suggest that Asian dust particles can exert toxicological effects on human skin through the activation of the cellular detoxification system, the production of pro-inflammatory and immunomodulatory cytokines, and changes in the expression of proteins essential in normal epidermal differentiation.

  20. EXPRESSION OF EPIDERMAL GROWTH FACTOR, TRANSFORMING GROWTH FACTOR-a AND THEIR RECEPTOR IN HUMAN PITUITARY TUMORS

    Institute of Scientific and Technical Information of China (English)

    ZHANG; Long

    2001-01-01

    [1]LIU Xu-wen, FU Pei-yu, GAO Zhi-xian. Expression of epidermal growth factor receptors in human glioma [J]. Chin J Neurosurgery 1998; 14:71.[2]Wong AJ, Ruppert JM, Bigner SH, et al. Structural alterations of the epidermal growth factor receptor gene in human gliomas [J]. Proc Natl Acad Sci USA 1992; 89:4309.[3]Webster J, Ham J, Bevan JS. Preliminary characterization of growth factors secreted by human pituitary tumors [J]. J Clin Endocrinol Metab 1991; 72:687.[4]Klibanski A. Nonsecreting pituitary tumors [J]. Endocrinol Metab Clin North Am 1987; 16:793.[5]LeRiche VK, Asa SL, Ezzat S. Epidermal growth factor and its receptor (EGF-R) in human pituitary adenomas: EGF-R correlates with tumor aggressiveness [J]. J Clin Endocrinol Metab 1996; 81:656.

  1. Development of a sensitive enzyme immunoassay for human epidermal growth factor (urogastrone).

    Science.gov (United States)

    Kurobe, M; Tokida, N; Furukawa, S; Ishikawa, E; Hayashi, K

    1986-04-15

    A sensitive two-site enzyme immunoassay (EIA) for human epidermal growth factor (hEGF) was developed, based on the sandwiching of an antigen between anti-hEGF IgG-coated polystyrene beads and anti-hEGF Fab'-linked peroxidase complex (horseradish peroxidase, EC. 1.11.1.7). This method has four advantages: the anti-hEGF Fab'-linked peroxidase complex is more stable than 125I-labelled antibody; the procedure is simple and rapid compared to bioassay; its discriminatory sensitivity is as low as 0.1 pg/assay tube; and serial dilution curves of unextracted human serum and urine samples all paralleled that of standard hEGF. The validity of the measurement of hEGF-like immunoreactivity in human serum and plasma is discussed.

  2. NOVEL NON-CALCEMIC SECOSTEROIDS THAT ARE PRODUCED BY HUMAN EPIDERMAL KERATINOCYTES PROTECT AGAINST SOLAR RADIATION

    Science.gov (United States)

    Slominski, Andrzej T.; Janjetovic, Zorica; Kim, Tae-Kang; Wasilewski, Piotr; Rosas, Sofia; Hanna, Sherie; Sayre, Robert M.; Dowdy, John C.; Li, Wei; Tuckey, Robert C.

    2015-01-01

    CYP11A1 hydroxylates the side chain of vitamin D3 (D3) in a sequential fashion [D3→20S(OH)D3→20,23(OH)2D3→ 17,20,23(OH)3D3], in an alternative to the classical pathway of activation [D3→25(OH)D3→1,25(OH)2D3]. The products/intermediates of the pathway can be further modified by the action of CYP27B1. The CYP11A1-derived products are biologically active with functions determined by the lineage of the target cells. This pathway can operate in epidermal keratinocytes. To further define the role of these novel secosteroids we tested them for protective effects against UVB-induced damage in human epidermal keratinocytes, melanocytes and HaCaT keratinocytes, cultured in vitro. The secosteroids attenuated ROS, H2O2 and NO production by UVB-irradiated keratinocytes and melanocytes, with an efficacy similar to 1,25(OH)2D3, while 25(OH)D3 had lower efficacy. These attenuations were also seen to some extent for the 20(OH)D3 precursor, 20S-hydroxy-7-dehydrocholesterol. These effects were accompanied by upregulation of genes encoding enzymes responsible for defence against oxidative stress. Using immunofluorescent staining we observed that the secosteroids reduced the generation cyclobutane pyrimidine dimers in response to UVB and enhanced expression of p53 phosphorylated at Ser-15, but not at Ser-46. Additional evidence for protection against DNA damage in cells exposed to UVB and treated with secosteroids was provided by the Comet assay where DNA fragmentation was markedly reduced by 20(OH)D3 and 20,23(OH)2D3. In conclusion, novel secosteroids that can be produced by the action of CYP11A1 in epidermal keratinocytes have protective effects against UVB radiation. PMID:25617667

  3. Parotid gland is the main source of human salivary epidermal growth factor

    Energy Technology Data Exchange (ETDEWEB)

    Thesleff, I.; Viinikka, L.; Saxen, L.; Lehtonen, E.; Perheentupa, J.

    1988-01-01

    To clarify the production of human epidermal growth factor (EGF) by different salivary glands, the authors measured its concentration by radioimmunoassay separately in whole saliva, in parotid gland (PG) saliva and in mixed submandibular (SMG) and sublingual gland (SLG) saliva. Also, they studied the presence of EGF in PG and SMG by immunohistochemistry. The mean concentrations of EDG in PG saliva was higher than in whole saliva, which in turn was higher than in mixed SMG + SLG saliva. No sex difference existed in any salivary gland EGF. Immunohistochemistry revealed EGF in the acinar cells of both PG and SMG, buy only in PG there were prominent EDG deposits in luminal spaces. Their data suggest that EDG is produced by both PG and SMG, but that more of it is secreted from the PG. This result is new and challenges the general view that human salivary EDG is mainly from SMG.

  4. Human epidermal keratinocytes death and expression of protein markers of apoptosis after ionizing radiation exposure

    Directory of Open Access Journals (Sweden)

    Sharon Wong

    2013-12-01

    Full Text Available Purpose: Knowledge of the pathophysiology of the irradiated skin is important to understand the tolerance and cosmetic response of the human skin to radiation. There are limited studies on the effect of radiotherapy dosage and fraction size in inducing apoptotic cell death in human skin. The expression of apoptotic biomarkers within a controlled population in different fractionation schemes has also never been studied. This study aims to investigate radiation induced apoptotic cell death in human skin cells after fractionated radiation exposure and the expression of unique biomarkers that reflect cell death or biology using multiplexed immunoassays.Methods: Breast skin biopsies were obtained from a single individual and divided into small pieces. Each piece was irradiated under different radiotherapy treatment fractionation schedules to a total dose of 50Gy. The irradiated skin tissues were analysed using Tunnel, immunohistochemistry and Western blot assays for expression of apoptotic keratinocytes and biomarkers (p53, p21, and PCNA. Haematoxylin and eosin (H&E immunostaining was performed to study the morphological changes in the skin cells. Results: Radiation is mostly absorbed by the epidermal layers and observed to damage the epidermal keratinocytes leading to the activation of apoptotic proteins. Apoptotic proteins (p53, p21 and PCNA were confirmed to be up-regulated in radiation exposed skin cells as compared to normal skin cells with no radiation. There is strong correlation of apoptotic protein expressions with increased radiation dosage and dose fractionation. Statistical analysis with ANOVA revealed a significant increase of PCNA and p21 expression with increased radiation dosage and dose fractionation (p < 0.05. Immunohistochemically, 14 % (range 10.71% to 17.29% of the keratinocytes were positive for PCNA and 22.5% (range 18.28% to 27.2% for p21 after 2Gy of irradiation.  The most widespread, intense and uniform staining for PCNA

  5. Epidermal basement membrane alpha 5(IV) expression in females with Alport syndrome and severity of renal disease.

    Science.gov (United States)

    Massella, Laura; Onetti Muda, Andrea; Faraggiana, Tullio; Bette, Cristiano; Renieri, Alessandra; Rizzoni, Gianfranco

    2003-11-01

    X-linked Alport syndrome is a progressive nephritis caused by mutations of the COL4A5 gene. This gene encodes the collagen alpha 5(IV) chain, which is abnormally distributed in the glomerular basement membrane (GBM) and epidermal basement membrane (EBM). It has been reported a negative correlation between alpha 5(IV) chain distribution in EBM and the degree of proteinuria in heterozygous females with Alport syndrome. In the present study, we evaluated the distribution of the alpha 5(IV) chain in the EBM and the degree of proteinuria in 22 females with X-linked Alport syndrome. The distribution of the cutaneous alpha 5(IV) chain was measured by a confocal laser microscope using an anti-alpha 5(IV) monoclonal antibody. The expression ratio of alpha 5(IV) distribution was quantified dividing the extension of the positive signal and the maximal extension of the specimen. Urinary protein excretion was expressed as urinary protein over urinary creatinine ratio. Proteinuria was present in five of the 22 patients. In two patients with proteinuria, alpha 5(IV)chain was normally distributed; in the remaining three, the expression ratio of alpha 5(IV)chain was 35%, 47%, and 48%. Of the 17 patients without proteinuria, two displayed a complete absence of the alpha 5(IV) chain in EBM, five displayed a normal staining, and the remaining 10 had an expression ratio between 18% and 65%. Our data suggest that there is no correlation between the severity of the glomerular involvement (expressed by proteinuria) and the staining of the alpha 5 chain in the EBM in females with X-linked Alport syndrome.

  6. Use of a collagen-elastin matrix as transport carrier system to transfer proliferating epidermal cells to human dermis in vitro.

    Science.gov (United States)

    Waaijman, Taco; Breetveld, Melanie; Ulrich, Magda; Middelkoop, Esther; Scheper, Rik J; Gibbs, Susan

    2010-01-01

    This in vitro study describes a novel cell culture, transport, and transfer protocol that may be highly suitable for delivering cultured proliferating keratinocytes and melanocytes to large open skin wounds (e.g., burns). We have taken into account previous limitations identified using other keratinocyte transfer techniques, such as regulatory issues, stability of keratinocytes during transport (single cell suspensions undergo terminal differentiation), ease of handling during application, and the degree of epidermal blistering resulting after transplantation (both related to transplanting keratinocyte sheets). Large numbers of proliferating epidermal cells (EC) (keratinocytes and melanocytes) were generated within 10-14 days and seeded onto a three-dimensional matrix composed of elastin and collagen types I, III, and V (Matriderm®), which enabled easy and stable transport of the EC for up to 24 h under ambient conditions. All culture conditions were in accordance with the regulations set by the Dutch Central Committee on Research Involving Human Subjects (CCMO). As an in vitro model system for clinical in vivo transfer, the EC were then transferred from Matriderm onto human acellular dermis during a period of 3 days. After transfer the EC maintained the ability to regenerate into a fully differentiated epidermis containing melanocytes on the human dermis. Proliferating keratinocytes were located in the basal layer and keratin-10 expression was located in differentiating suprabasal layers similar to that found in human epidermis. No blistering was observed (separation of the epidermis from the basement membrane). Keratin-6 expression was strongly upregulated in the regenerating epidermis similar to normal wound healing. In summary, we show that EC-Matriderm contains viable, metabolically active keratinocytes and melanocytes cultured in a manner that permits easy transportation and contains epidermal cells with the potential to form a pigmented reconstructed

  7. Therapeutic targeting of epidermal growth factor receptor in human cancer: successes and limitations%Therapeutic targeting of epidermal growth factor receptor in humancancer: successes and limitations

    Institute of Scientific and Technical Information of China (English)

    Jill Wykosky; Tim Fenton; Frank Furnari; Webster K. Cavenee

    2011-01-01

    Epidermal growth factor receptor (EGFR) is one of the most commonly altered genes in human cancer by way of over-expression, amplification, and mutation. Targeted inhibition of EGFR activity suppresses signal transduction pathways which control tumor cell growth, proliferation, and resistance to apoptosis. Small molecule tyrosine kinase inhibitors and monoclonal antibodies are among the most common EGFR-targeting agents and have been used clinically for treating various malignancies. This review discusses the successes and challenges of targeting EGFR in human cancer. The genetic alterations of EGFR tend to occur more often in some solid tumors than others, as do the mechanisms of resistance to targeted inhibition. The clinical and basic science experiences with these agents thus far have important implications for the future of therapeutic targeting of EGFR.

  8. Reciprocal interactions between Beta1-integrin and epidermal growth factor in three-dimensional basement membrane breast cultures: A different perspective in epithelial biology

    Energy Technology Data Exchange (ETDEWEB)

    Wang, F.; Weaver, V.M.; Petersen, O.W.; Larabell, C.A.; Dedhar, S.; Briand, P.; Lupu, R.; Bissell, M.J.

    1998-09-30

    Anchorage and growth factor independence are cardinal features of the transformed phenotype. Although it is logical that the two pathways must be coregulated in normal tissues to maintain homeostasis, this has not been demonstrated directly. We showed previously that down-modulation of {beta}1-integrin signaling reverted the malignant behavior of a human breast tumor cell line (T4-2) derived from phenotypically normal cells (HMT-3522) and led to growth arrest in a threedimensional (3D) basement membrane assay in which the cells formed tissue-like acini (14). Here, we show that there is a bidirectional cross-modulation of {beta}1-integrin and epidermal growth factor receptor (EGFR) signaling via the mitogenactivated protein kinase (MAPK) pathway. The reciprocal modulation does not occur in monolayer (2D) cultures. Antibodymediated inhibition of either of these receptors in the tumor cells, or inhibition of MAPK kinase, induced a concomitant downregulation of both receptors, followed by growth-arrest and restoration of normal breast tissue morphogenesis. Crossmodulation and tissue morphogenesis were associated with attenuation of EGF-induced transient MAPK activation. To specifically test EGFR and {beta}1-integrin interdependency, EGFR was overexpressed in nonmalignant cells, leading to disruption of morphogenesis and a compensatory up-regulation of {beta}1-integrin expression, again only in 3D. Our results indicate that when breast cells are spatially organized as a result of contact with basement membrane, the signaling pathways become coupled and bidirectional. They further explain why breast cells fail to differentiate in monolayer cultures in which these events are mostly uncoupled. Moreover, in a subset of tumor cells in which these pathways are misregulated but functional, the cells could be 'normalized' by manipulating either pathway.

  9. Immunohistochemical localization of epidermal growth factor in the second-trimester human fetus

    DEFF Research Database (Denmark)

    Poulsen, Steen Seier; Kryger-Baggesen, N; Nexø, Ebba

    1996-01-01

    Epidermal growth factor (EGF) is considered to be important in mammalian neonatal growth and development. In order to clarify its developmental role, we have investigated, by immunohistochemistry, the localization of EGF and the time of its first appearance in various organs from a series of 25...... midtrimester human fetuses with a gestational age ranging from 13 to 22 weeks. The first detectable EGF immunoreactivity occurred in week 15-16 fetuses in the placenta, the skin, the distal tubules of the kidney, the surface epithelium of the stomach, and the tips of the small intestinal villi, as well...... as in a few Paneth cells. Glandular structures, such as the glands of the cardia and the pyloric part of the stomach, Brunner's glands of the duodenum, the pancreas, and the submucous glands of the trachea, showed positive EGF immunoreactivity later (week 17). Thus, apart from the kidney, staining...

  10. An ultrasensitive time-resolved immunofluorometric assay of human epidermal growth factor.

    Science.gov (United States)

    Pesonen, K; Alfthan, H; Stenman, U H; Viinikka, L; Perheentupa, J

    1986-09-01

    We have developed a sandwich-type time-resolved immunofluorometric assay (TR-IFMA) for human epidermal growth factor (hEGF) in body fluids. A two-step solid-phase technique was used. The assay utilizes a polyclonal anti-hEGF attached to the solid phase, and a monoclonal anti-hEGF labeled with Europium (III) as a tracer. The sensitivity of the assay (2.5 pg/ml) is at least 20 times better than what has been achieved by radioimmunoassay (RIA), and the measuring range is much wider: 2.5-5000 pg/ml. The feasibility of TR-IFMA was tested by assaying urine containing large amounts and amniotic fluid containing small amounts (mostly undetectable by RIA) of immunoreactive hEGF. The correlation between urine hEGF concentrations (1-100 ng/ml) measured by RIA and TR-IFMA was good: r = 0.96.

  11. A REVIEW ON EPIDERMAL MANIFESTATION OF PAPPILOMA VIRUS INFECTION IN HUMAN

    Directory of Open Access Journals (Sweden)

    Yashbir Singh

    2015-02-01

    Full Text Available The Human Papilloma Viruses (HPV are non-enveloped, small DNA virus, which are responsible for worldwide problem. HPVS can be associated with different varieties of epidermal manifestations. It belongs to the Papovavirus family. On the basis of oncogenic potential these have been classified as high risk and low risk types of virus. Currently histopathological techniques are widely being used as the diagnostic method for the identification of HPV viral DNA. This article reviews the classification of HPVs and different methods used for the vaccination and diagnosis. The types includes common warts, flat warts, plantar warts, anogenital warts, anal dysplasia and epidermodysplasia verruciformis. Vaccines are available for prevention of HPV infection, and recommended vaccination schedules have been outlined.

  12. Low-fluence CO2 laser irradiation: selective epidermal damage to human skin.

    Science.gov (United States)

    Kamat, B R; Tang, S V; Arndt, K A; Stern, R S; Noe, J M; Rosen, S

    1985-09-01

    The interaction of normal human skin with low-fluence CO2 laser irradiation was studied using a three-phase approach. In phase one, freshly excised skin was observed immediately after impact. In phase two, skin irradiated 2 h prior to excision was studied. In phase three, human volunteers were irradiated and biopsied at time zero, 24 h and 48 h. Seventy-five sites were exposed and 60 biopsies were performed. The earliest histologic changes were observed in the 6-10 J/cm2 fluence (radiant exposure) range and these changes included spindle and vacuolar changes in the basal layer of the epidermis. Papillary dermal coagulation was present to a maximum of 0.03 mm. At fluences of 10-25 J/cm2, superficial dermal necrosis (0.06-0.08 mm) was observed. At fluences above 25 J/cm2, transepidermal necrosis was present with increasing papillary dermal necrosis that was in proportion to the energy density delivered. At 2h, basal vacuolar changes were accompanied by diffuse keratinocytic cell death where contact was maintained between the epidermis and dermis, while where separation occurred limited keratinocytic death was observed. The earliest changes occurred at lower threshold fluences (4-6 J/cm2). After 24 h, these doses resulted in extensive epidermal necrosis with focal acute inflammatory infiltrates. At 48 h, the degree of epidermal "slough" was proportional to the energy density delivered and was maximal with a fluence of 5.7 J/cm2 delivered whereas with a fluence of 3.8 J/cm2 thin slough (0.02 mm) was observed. These findings suggest that low-dose CO2 laser irradiation may provide a new approach to selectively damage the epidermis with minimal dermal damage.

  13. Human amniotic fluid derived cells can competently substitute dermal fibroblasts in a tissue-engineered dermo-epidermal skin analog

    OpenAIRE

    2013-01-01

    PURPOSE: Human amniotic fluid comprises cells with high differentiation capacity, thus representing a potential cell source for skin tissue engineering. In this experimental study, we investigated the ability of human amniotic fluid derived cells to substitute dermal fibroblasts and support epidermis formation and stratification in a humanized animal model. METHODS: Dermo-epidermal skin grafts with either amniocytes or with fibroblasts in the dermis were compared in a rat model. Full-thicknes...

  14. Human brain tumor-associated urinary high molecular weight transforming growth factor: a high molecular weight form of epidermal growth factor.

    Science.gov (United States)

    Stromberg, K; Hudgins, W R; Dorman, L S; Henderson, L E; Sowder, R C; Sherrell, B J; Mount, C D; Orth, D N

    1987-02-15

    Urinary protein obtained from a patient with a highly malignant brain tumor (astrocytoma, grade IV) was adsorbed to trimethylsilyl controlled-pore glass beads and selectively eluted with acetonitrile to yield a high molecular weight (HMW) human transforming growth factor (hTGF). This HMW hTGF promoted clonogenic cell growth in soft agar and competed for membrane receptors with mouse epidermal growth factor. After surgical resection of the tumor, no HMW hTGF was found in urine. HMW hTGF generated a human EGF (hEGF) radioimmunoassay competitive binding curve similar to that of hEGF and parallel to that of a highly purified HMW form of hEGF previously reported to be present in trace concentrations in normal human urine. Both hEGF and HMW hEGF were clonogenic in soft agar, and their clonogenic activity as well as that of HMW hTGF was inhibited by anti-hEGF serum. Both HMW hTGF and HMW hEGF had 20 to 25% of the radioreceptor binding activity of hEGF. HMW hTGF purified from the pooled urine of several patients with malignant astrocytomas and HMW hEGF purified from normal control urine comigrated at Mr 33,000. Thus, HMW hTGF was indistinguishable from HMW hEGF in terms of apparent molecular size, epidermal growth factor receptor binding activity, epidermal growth factor immunoreactivity, and clonogenic activity. Urinary HMW hEGF/hTGF may be of tumor cell origin or may represent a response of normal host tissues to the tumor or its products.

  15. Novel non-calcemic secosteroids that are produced by human epidermal keratinocytes protect against solar radiation.

    Science.gov (United States)

    Slominski, Andrzej T; Janjetovic, Zorica; Kim, Tae-Kang; Wasilewski, Piotr; Rosas, Sofia; Hanna, Sherie; Sayre, Robert M; Dowdy, John C; Li, Wei; Tuckey, Robert C

    2015-04-01

    CYP11A1 hydroxylates the side chain of vitamin D3 (D3) in a sequential fashion [D3→20S(OH)D3→20,23(OH)2D3→17,20,23(OH)3D3], in an alternative to the classical pathway of activation [D3→25(OH)D3→1,25(OH)2D3]. The products/intermediates of the pathway can be further modified by the action of CYP27B1. The CYP11A1-derived products are biologically active with functions determined by the lineage of the target cells. This pathway can operate in epidermal keratinocytes. To further define the role of these novel secosteroids we tested them for protective effects against UVB-induced damage in human epidermal keratinocytes, melanocytes and HaCaT keratinocytes, cultured in vitro. The secosteroids attenuated ROS, H2O2 and NO production by UVB-irradiated keratinocytes and melanocytes, with an efficacy similar to 1,25(OH)2D3, while 25(OH)D3 had lower efficacy. These attenuations were also seen to some extent for the 20(OH)D3 precursor, 20S-hydroxy-7-dehydrocholesterol. These effects were accompanied by upregulation of genes encoding enzymes responsible for defense against oxidative stress. Using immunofluorescent staining we observed that the secosteroids reduced the generation cyclobutane pyrimidine dimers in response to UVB and enhanced expression of p53 phosphorylated at Ser-15, but not at Ser-46. Additional evidence for protection against DNA damage in cells exposed to UVB and treated with secosteroids was provided by the Comet assay where DNA fragmentation was markedly reduced by 20(OH)D3 and 20,23(OH)2D3. In conclusion, novel secosteroids that can be produced by the action of CYP11A1 in epidermal keratinocytes have protective effects against UVB radiation. This article is part of a special issue entitled '17th Vitamin D Workshop'. Copyright © 2015 Elsevier Ltd. All rights reserved.

  16. Upregulation of FOXM1 induces genomic instability in human epidermal keratinocytes

    Directory of Open Access Journals (Sweden)

    Philpott Michael P

    2010-02-01

    Full Text Available Abstract Background The human cell cycle transcription factor FOXM1 is known to play a key role in regulating timely mitotic progression and accurate chromosomal segregation during cell division. Deregulation of FOXM1 has been linked to a majority of human cancers. We previously showed that FOXM1 was upregulated in basal cell carcinoma and recently reported that upregulation of FOXM1 precedes malignancy in a number of solid human cancer types including oral, oesophagus, lung, breast, kidney, bladder and uterus. This indicates that upregulation of FOXM1 may be an early molecular signal required for aberrant cell cycle and cancer initiation. Results The present study investigated the putative early mechanism of UVB and FOXM1 in skin cancer initiation. We have demonstrated that UVB dose-dependently increased FOXM1 protein levels through protein stabilisation and accumulation rather than de novo mRNA expression in human epidermal keratinocytes. FOXM1 upregulation in primary human keratinocytes triggered pro-apoptotic/DNA-damage checkpoint response genes such as p21, p38 MAPK, p53 and PARP, however, without causing significant cell cycle arrest or cell death. Using a high-resolution Affymetrix genome-wide single nucleotide polymorphism (SNP mapping technique, we provided the evidence that FOXM1 upregulation in epidermal keratinocytes is sufficient to induce genomic instability, in the form of loss of heterozygosity (LOH and copy number variations (CNV. FOXM1-induced genomic instability was significantly enhanced and accumulated with increasing cell passage and this instability was increased even further upon exposure to UVB resulting in whole chromosomal gain (7p21.3-7q36.3 and segmental LOH (6q25.1-6q25.3. Conclusion We hypothesise that prolonged and repeated UVB exposure selects for skin cells bearing stable FOXM1 protein causes aberrant cell cycle checkpoint thereby allowing ectopic cell cycle entry and subsequent genomic instability. The aberrant

  17. Ultraviolet B light-induced apoptosis in human keratinocytes enriched with epidermal stem cells and normal keratinocytes

    Institute of Scientific and Technical Information of China (English)

    MEI Xue-ling; LIAN Shi

    2011-01-01

    Background The stem-cell compartment is the primary target for the accumulation of oncogenic mutations.Overexposure to solar ultraviolet radiation is responsible for the development and progression of >90% of skin cancers.Ultraviolet B (UVB) light-induced keratinocyte apoptosis is a strong preventive mechanism against carcinogenesis. The aim of this study was to isolate keratinocytes enriched with putative human epidermal stem cells and to investigate their apoptotic induction by UVB.Methods Keratinocytes enriched with putative human epidermal stem cells were isolated by adherence to collagen Ⅳ and the expressions of β1-integrin and p63 were investigated. Keratinocytes enriched with putative human epidermal stem cells and normal keratinocytes were irradiated with UVB at 0-80 mJ/cm2. The apoptotic response was investigated with phase-contrast microscopy, Hoechst 33342 staining, flow cytometry of annexin V/PI, and procaspase-3 Western blotting.Results Keratinocyte enriched with stem cells expressed high levels of p63 protein and β1-integrin and low level of pan-keratin (C11). In comparison to non-irradiated cells, significant apoptosis of keratinocyte enriched with stem cells was found with 40 and 80 mJ/cm2 UVB. However, significant apoptosis of normal keratinocytes was only found for 80 mJ/cm2 UVB.Conclusions Human epidermal stem cells can undergo apoptosis in response to UVB radiation and are more susceptible than other keratinocytes. The method could be used in vitro studies of human epidermal stem cells.

  18. A Structural Model for the Membrane-Bound Form of the Juxtamembrane Domain of the Epidermal Growth Factor Receptor.

    Energy Technology Data Exchange (ETDEWEB)

    Choowongkomon, Kiattawee; Carlin, Cathleen R.; Sonnichsen, Frank D.

    2005-06-24

    The epidermal growth factor receptor (EGFR) is a member of the receptor tyrosine kinase family involved in the regulation of cellular proliferation and differentiation. Its juxtamembrane domain (JX), the region located between the transmembrane and kinase domains, plays important roles in receptor trafficking. Two sorting signals, a PXXP motif and a 658LL659 motif, are responsible for basolateral sorting in polarized epithelial cells, and a 679LL680 motif targets the ligand-activated receptor for lysosomal degradation. To understand the regulation of these signals, we characterized the structural properties of recombinant JX domain in aqueous solution and in dodecylphosphocholine (DPC) detergent. JX is inherently unstructured in aqueous solution, albeit a nascent helix encompasses the lysosomal sorting signal. In DPC micelles, structures derived from NMR data showed three amphipathic, helical segments. A large, internally inconsistent group of long range nuclear Overhauser effects suggest a close proximity of the helices, and the presence of significant conformational averaging. Models were determined for the average JX conformation using restraints representing the translational restriction due to micelle-surface adsorption, and the helix orientations were determined from residual dipolar couplings. Two equivalent average structural models were obtained that differ only in the relative orientation between first and second helices. In these models, the 658LL659 and 679LL680 motifs are located in the first and second helices and face the micelle surface, whereas the PXXP motif is located in a flexible helix-connecting region. The data suggest that the activity of these signals may be regulated by their membrane association and restricted accessibility in the intact receptor.

  19. Human eccrine sweat gland cells turn into melanin-uptaking keratinocytes in dermo-epidermal skin substitutes.

    Science.gov (United States)

    Böttcher-Haberzeth, Sophie; Biedermann, Thomas; Pontiggia, Luca; Braziulis, Erik; Schiestl, Clemens; Hendriks, Bart; Eichhoff, Ossia M; Widmer, Daniel S; Meuli-Simmen, Claudia; Meuli, Martin; Reichmann, Ernst

    2013-02-01

    Recently, Biedermann et al. (2010) have demonstrated that human eccrine sweat gland cells can develop a multilayered epidermis. The question still remains whether these cells can fulfill exclusive and very specific functional properties of epidermal keratinocytes, such as the incorporation of melanin, a feature absent in sweat gland cells. We added human melanocytes to eccrine sweat gland cells to let them develop into an epidermal analog in vivo. The interaction between melanocytes and sweat gland-derived keratinocytes was investigated. The following results were gained: (1) macroscopically, a pigmentation of the substitutes was seen 2-3 weeks after transplantation; (2) we confirmed the development of a multilayered, stratified epidermis with melanocytes distributed evenly throughout the basal layer; (3) melanocytic dendrites projected to suprabasal layers; and (4) melanin was observed to be integrated into former eccrine sweat gland cells. These skin substitutes were similar or equal to skin substitutes cultured from human epidermal keratinocytes. The only differences observed were a delay in pigmentation and less melanin uptake. These data suggest that eccrine sweat gland cells can form a functional epidermal melanin unit, thereby providing striking evidence that they can assume one of the most characteristic keratinocyte properties.

  20. Th22 cells represent a distinct human T cell subset involved in epidermal immunity and remodeling.

    Science.gov (United States)

    Eyerich, Stefanie; Eyerich, Kilian; Pennino, Davide; Carbone, Teresa; Nasorri, Francesca; Pallotta, Sabatino; Cianfarani, Francesca; Odorisio, Teresa; Traidl-Hoffmann, Claudia; Behrendt, Heidrun; Durham, Stephen R; Schmidt-Weber, Carsten B; Cavani, Andrea

    2009-12-01

    Th subsets are defined according to their production of lineage-indicating cytokines and functions. In this study, we have identified a subset of human Th cells that infiltrates the epidermis in individuals with inflammatory skin disorders and is characterized by the secretion of IL-22 and TNF-alpha, but not IFN-gamma, IL-4, or IL-17. In analogy to the Th17 subset, cells with this cytokine profile have been named the Th22 subset. Th22 clones derived from patients with psoriasis were stable in culture and exhibited a transcriptome profile clearly separate from those of Th1, Th2, and Th17 cells; it included genes encoding proteins involved in tissue remodeling, such as FGFs, and chemokines involved in angiogenesis and fibrosis. Primary human keratinocytes exposed to Th22 supernatants expressed a transcriptome response profile that included genes involved in innate immune pathways and the induction and modulation of adaptive immunity. These proinflammatory Th22 responses were synergistically dependent on IL-22 and TNF-alpha. Furthermore, Th22 supernatants enhanced wound healing in an in vitro injury model, which was exclusively dependent on IL-22. In conclusion, the human Th22 subset may represent a separate T cell subset with a distinct identity with respect to gene expression and function, present within the epidermal layer in inflammatory skin diseases. Future strategies directed against the Th22 subset may be of value in chronic inflammatory skin disorders.

  1. A sensitive two-site enzyme immunoassay for human epidermal growth factor (urogastrone).

    Science.gov (United States)

    Hayashi, K; Nomoto, H; Kurobe, M; Nishimuro, S; Hiratani, H; Furukawa, S

    1985-06-01

    A sensitive enzyme immunoassay (EIA) was developed for human epidermal growth factor (hEGF) or urogastrone, which was isolated from human urine. Our EIA system is based on the sandwiching of an antigen between anti-hEGF IgG coated on a polystyrene tube and anti-hEGF antibody Fab'-linked beta-D-galactosidase (beta-D-galactosidase, EC 3.2.1.23). This method has the advantages that the procedures are simple and rapid and that the antibody Fab'-beta-D-galactosidase complex is more stable than radioisotope-labeled IgG. Purified hEGF is detectable at as low as 100 pg/ml, which is very sensitive compared to the radioimmuno-assays or radioreceptor assays already reported. Using this new EIA system, hEGF levels in human urine were examined. The values for normal males and females were 48.4 and 83.5 ng/mg creatinine, respectively, which shows that females excrete 1.7 times more hEGF than males.

  2. Considerations in the development of a sensitive HPLC assay for human epidermal growth factors in human plasma.

    Science.gov (United States)

    Kagel, J R; Rossi, D T; Nordblom, G D; Dudeck, R C; Barksdale, C M; Kuo, B S; Wright, D S

    1995-09-01

    A sensitive assay was developed for human epidermal growth factors (hEGF) 1-48 (dosed), hEGF 1-53 (endogenous), without interference from potential metabolites hEGFs 1-47 or 1-46. Spiked human plasma samples were injected directly, utilizing on-line immunoaffinity HPLC (anti-hEGF) clean-up. No change in capacity was noted after 81 cycles. After release from the immunoaffinity column, the fragments were further resolved by strong cation-exchange (SCX) via a column switching valve. Method development also required interfacing immunoaffinity, ion-exchange, and detection components. Immunoassays on collected fractions yielded a detection limit of 1 microgram ml-1, although a detection limit of 75 pg ml-1 appears feasible.

  3. Parabens and Human Epidermal Growth Factor Receptor Ligand Cross-Talk in Breast Cancer Cells.

    Science.gov (United States)

    Pan, Shawn; Yuan, Chaoshen; Tagmount, Abderrahmane; Rudel, Ruthann A; Ackerman, Janet M; Yaswen, Paul; Vulpe, Chris D; Leitman, Dale C

    2016-05-01

    Xenoestrogens are synthetic compounds that mimic endogenous estrogens by binding to and activating estrogen receptors. Exposure to estrogens and to some xenoestrogens has been associated with cell proliferation and an increased risk of breast cancer. Despite evidence of estrogenicity, parabens are among the most widely used xenoestrogens in cosmetics and personal-care products and are generally considered safe. However, previous cell-based studies with parabens do not take into account the signaling cross-talk between estrogen receptor α (ERα) and the human epidermal growth factor receptor (HER) family. We investigated the hypothesis that the potency of parabens can be increased with HER ligands, such as heregulin (HRG). The effects of HER ligands on paraben activation of c-Myc expression and cell proliferation were determined by real-time polymerase chain reaction, Western blots, flow cytometry, and chromatin immunoprecipitation assays in ERα- and HER2-positive human BT-474 breast cancer cells. Butylparaben (BP) and HRG produced a synergistic increase in c-Myc mRNA and protein levels in BT-474 cells. Estrogen receptor antagonists blocked the synergistic increase in c-Myc protein levels. The combination of BP and HRG also stimulated proliferation of BT-474 cells compared with the effects of BP alone. HRG decreased the dose required for BP-mediated stimulation of c-Myc mRNA expression and cell proliferation. HRG caused the phosphorylation of serine 167 in ERα. BP and HRG produced a synergistic increase in ERα recruitment to the c-Myc gene. Our results show that HER ligands enhanced the potency of BP to stimulate oncogene expression and breast cancer cell proliferation in vitro via ERα, suggesting that parabens might be active at exposure levels not previously considered toxicologically relevant from studies testing their effects in isolation. Pan S, Yuan C, Tagmount A, Rudel RA, Ackerman JM, Yaswen P, Vulpe CD, Leitman DC. 2016. Parabens and human epidermal

  4. Human epidermal keratinocytes death and expression of protein markers of apoptosis after ionizing radiation exposure

    Directory of Open Access Journals (Sweden)

    Sharon Wong

    2013-12-01

    Full Text Available Purpose: Knowledge of the pathophysiology of the irradiated skin is important to understand the tolerance and cosmetic response of the human skin to radiation. There are limited studies on the effect of radiotherapy dosage and fraction size in inducing apoptotic cell death in human skin. The expression of apoptotic biomarkers within a controlled population in different fractionation schemes has also never been studied. This study aims to investigate radiation induced apoptotic cell death in human skin cells after fractionated radiation exposure and the expression of unique biomarkers that reflect cell death or biology using multiplexed immunoassays. Methods: Breast skin biopsies were obtained from a single individual and divided into small pieces. Each piece was irradiated under different radiotherapy treatment fractionation schedules to a total dose of 50Gy. The irradiated skin tissues were analysed using Tunnel, immunohistochemistry and Western blot assays for expression of apoptotic keratinocytes and biomarkers (p53, p21, and PCNA. Haematoxylin and eosin (H&E immunostaining was performed to study the morphological changes in the skin cells. Results: Radiation is mostly absorbed by the epidermal layers and observed to damage the epidermal keratinocytes leading to the activation of apoptotic proteins. Apoptotic proteins (p53, p21 and PCNA were confirmed to be up-regulated in radiation exposed skin cells as compared to normal skin cells with no radiation. There is strong correlation of apoptotic protein expressions with increased radiation dosage and dose fractionation. Statistical analysis with ANOVA revealed a significant increase of PCNA and p21 expression with increased radiation dosage and dose fractionation (p < 0.05. Immunohistochemically, 14 % (range 10.71% to 17.29% of the keratinocytes were positive for PCNA and 22.5% (range 18.28% to 27.2% for p21 after 2Gy of irradiation. The most widespread, intense and uniform staining for PCNA and

  5. Parabens and Human Epidermal Growth Factor Receptor Ligand Cross-Talk in Breast Cancer Cells

    Science.gov (United States)

    Pan, Shawn; Yuan, Chaoshen; Tagmount, Abderrahmane; Rudel, Ruthann A.; Ackerman, Janet M.; Yaswen, Paul; Vulpe, Chris D.; Leitman, Dale C.

    2015-01-01

    Background: Xenoestrogens are synthetic compounds that mimic endogenous estrogens by binding to and activating estrogen receptors. Exposure to estrogens and to some xenoestrogens has been associated with cell proliferation and an increased risk of breast cancer. Despite evidence of estrogenicity, parabens are among the most widely used xenoestrogens in cosmetics and personal-care products and are generally considered safe. However, previous cell-based studies with parabens do not take into account the signaling cross-talk between estrogen receptor α (ERα) and the human epidermal growth factor receptor (HER) family. Objectives: We investigated the hypothesis that the potency of parabens can be increased with HER ligands, such as heregulin (HRG). Methods: The effects of HER ligands on paraben activation of c-Myc expression and cell proliferation were determined by real-time polymerase chain reaction, Western blots, flow cytometry, and chromatin immunoprecipitation assays in ERα- and HER2-positive human BT-474 breast cancer cells. Results: Butylparaben (BP) and HRG produced a synergistic increase in c-Myc mRNA and protein levels in BT-474 cells. Estrogen receptor antagonists blocked the synergistic increase in c-Myc protein levels. The combination of BP and HRG also stimulated proliferation of BT-474 cells compared with the effects of BP alone. HRG decreased the dose required for BP-mediated stimulation of c-Myc mRNA expression and cell proliferation. HRG caused the phosphorylation of serine 167 in ERα. BP and HRG produced a synergistic increase in ERα recruitment to the c-Myc gene. Conclusion: Our results show that HER ligands enhanced the potency of BP to stimulate oncogene expression and breast cancer cell proliferation in vitro via ERα, suggesting that parabens might be active at exposure levels not previously considered toxicologically relevant from studies testing their effects in isolation. Citation: Pan S, Yuan C, Tagmount A, Rudel RA, Ackerman JM

  6. Protective Effect of Liposome-Encapsulated Glutathione in a Human Epidermal Model Exposed to a Mustard Gas Analog

    Science.gov (United States)

    Paromov, Victor; Kumari, Sudha; Brannon, Marianne; Kanaparthy, Naga S.; Yang, Hongsong; Smith, Milton G.; Stone, William L.

    2011-01-01

    Sulfur mustard or mustard gas (HD) and its monofunctional analog, 2-chloroethyl ethyl sulfide (CEES), or “half-mustard gas,” are alkylating agents that induce DNA damage, oxidative stress, and inflammation. HD/CEES are rapidly absorbed in the skin causing extensive injury. We hypothesize that antioxidant liposomes that deliver both water-soluble and lipid-soluble antioxidants protect skin cells from immediate CEES-induced damage via attenuating oxidative stress. Liposomes containing water-soluble antioxidants and/or lipid-soluble antioxidants were evaluated using in vitro model systems. Initially, we found that liposomes containing encapsulated glutathione (GSH-liposomes) increased cell viability and attenuated production of reactive oxygen species (ROS) in HaCaT cells exposed to CEES. Next, GSH-liposomes were tested in a human epidermal model, EpiDerm. In the EpiDerm, GSH-liposomes administered simultaneously or 1 hour after CEES exposure (2.5 mM) increased cell viability, inhibited CEES-induced loss of ATP and attenuated changes in cellular morphology, but did not reduce caspase-3 activity. These findings paralleled the previously described in vivo protective effect of antioxidant liposomes in the rat lung and established the effectiveness of GSH-liposomes in a human epidermal model. This study provides a rationale for use of antioxidant liposomes against HD toxicity in the skin considering further verification in animal models exposed to HD. PMID:21776256

  7. Protective Effect of Liposome-Encapsulated Glutathione in a Human Epidermal Model Exposed to a Mustard Gas Analog

    Directory of Open Access Journals (Sweden)

    Victor Paromov

    2011-01-01

    Full Text Available Sulfur mustard or mustard gas (HD and its monofunctional analog, 2-chloroethyl ethyl sulfide (CEES, or “half-mustard gas,” are alkylating agents that induce DNA damage, oxidative stress, and inflammation. HD/CEES are rapidly absorbed in the skin causing extensive injury. We hypothesize that antioxidant liposomes that deliver both water-soluble and lipid-soluble antioxidants protect skin cells from immediate CEES-induced damage via attenuating oxidative stress. Liposomes containing water-soluble antioxidants and/or lipid-soluble antioxidants were evaluated using in vitro model systems. Initially, we found that liposomes containing encapsulated glutathione (GSH-liposomes increased cell viability and attenuated production of reactive oxygen species (ROS in HaCaT cells exposed to CEES. Next, GSH-liposomes were tested in a human epidermal model, EpiDerm. In the EpiDerm, GSH-liposomes administered simultaneously or 1 hour after CEES exposure (2.5 mM increased cell viability, inhibited CEES-induced loss of ATP and attenuated changes in cellular morphology, but did not reduce caspase-3 activity. These findings paralleled the previously described in vivo protective effect of antioxidant liposomes in the rat lung and established the effectiveness of GSH-liposomes in a human epidermal model. This study provides a rationale for use of antioxidant liposomes against HD toxicity in the skin considering further verification in animal models exposed to HD.

  8. Further development of the EpiDerm 3D reconstructed human skin micronucleus (RSMN) assay.

    Science.gov (United States)

    Mun, Greg C; Aardema, Marilyn J; Hu, Ting; Barnett, Brenda; Kaluzhny, Yulia; Klausner, Mitchell; Karetsky, Viktor; Dahl, Erica L; Curren, Rodger D

    2009-03-17

    The upcoming ban on testing of cosmetics in animals by the European Union's 7th Amendment to the Cosmetics Directive will require genotoxicity safety assessments of cosmetics ingredients and final formulations to be based primarily on in vitro genotoxicity tests. The current in vitro test battery produces an unacceptably high rate of false positives, and used by itself would effectively prevent the use and development of many ingredients that are actually safe for human use. To address the need for an in vitro test that is more predictive of genotoxicity in vivo, we have developed an in vitro micronucleus assay using a three-dimensional human reconstructed skin model (EpiDerm) that more closely mimics the normal dermal exposure route of chemicals. We have refined this model and assessed its ability to predict genotoxicity of a battery of chemicals that have been previously classified as genotoxins or non-genotoxins based on in vivo rodent skin tests. Our reconstructed skin micronucleus assay correctly identified 7 genotoxins and 5 non-genotoxins, demonstrating its potential to have a higher predictive value than currently available in vitro genotoxicity tests, and its utility as part of a comprehensive in vitro genotoxicity testing strategy.

  9. In vitro analysis of the effect of alkyl-chain length of anionic surfactants on the skin by using a reconstructed human epidermal model.

    Science.gov (United States)

    Yamaguchi, Fumiko; Watanabe, Shin-Ichi; Harada, Fusae; Miyake, Miyuki; Yoshida, Masaki; Okano, Tomomichi

    2014-01-01

    We investigated the effect of the alkyl-chain length of anionic surfactants on the skin using an in vitro model. The evaluated anionic surfactants were sodium alkyl sulfate (AS) and sodium fatty acid methyl ester sulfonate (MES), which had different alkyl-chain lengths (C8-C14). Skin tissue damage and permeability were examined using a reconstructed human epidermal model, LabCyte EPI-MODEL24. Skin tissue damage was examined by measuring cytotoxicity with an MTT assay. Liquid chromatography/tandem mass spectrometry (LC/MS-MS) and liquid chromatography/mass spectrometry (LC/MS) were used to detect surfactants that permeated into the assay medium through an epidermal model. To assess the permeation mechanism and cell damage caused by the surfactants through the epidermis, we evaluated the structural changes of Bovine Serum Albumin (BSA), used as a simple model protein, and the fluidity of 1,2-dipalmitoyl-sn-glycero-3-phosphpcholine (DPPC) liposome, which serves as one of the most abundant phospholipid models of living cell membranes in the epidermis. The effects of the surfactants on the proteins were measured using Circular Dichroism (CD) spectroscopy, while the effects on membrane fluidity were investigated by electron spin resonance (ESR) spectroscopy. ET50 (the 50% median effective time) increased as follows: C10 C12 > C14, for both AS and MES. For both AS and MES, the order parameter, which is the criteria for the microscopic viscosity of lipid bilayers, increased as follows: C10 C12 > C14. It was determined that the difference in skin tissue damage in the LabCyte EPI-MODEL24 with C10 to C14 AS and MES was caused by the difference in permeation and cell membrane fluidity through the lipid bilayer path in the epidermis.

  10. Cell wall accumulation of fluorescent proteins derived from a trans-Golgi cisternal membrane marker and paramural bodies in interdigitated Arabidopsis leaf epidermal cells.

    Science.gov (United States)

    Akita, Kae; Kobayashi, Megumi; Sato, Mayuko; Kutsuna, Natsumaro; Ueda, Takashi; Toyooka, Kiminori; Nagata, Noriko; Hasezawa, Seiichiro; Higaki, Takumi

    2017-01-01

    In most dicotyledonous plants, leaf epidermal pavement cells develop jigsaw puzzle-like shapes during cell expansion. The rapid growth and complicated cell shape of pavement cells is suggested to be achieved by targeted exocytosis that is coordinated with cytoskeletal rearrangement to provide plasma membrane and/or cell wall materials for lobe development during their morphogenesis. Therefore, visualization of membrane trafficking in leaf pavement cells should contribute an understanding of the mechanism of plant cell morphogenesis. To reveal membrane trafficking in pavement cells, we observed monomeric red fluorescent protein-tagged rat sialyl transferases, which are markers of trans-Golgi cisternal membranes, in the leaf epidermis of Arabidopsis thaliana. Quantitative fluorescence imaging techniques and immunoelectron microscopic observations revealed that accumulation of the red fluorescent protein occurred mostly in the curved regions of pavement cell borders and guard cell ends during leaf expansion. Transmission electron microscopy observations revealed that apoplastic vesicular membrane structures called paramural bodies were more frequent beneath the curved cell wall regions of interdigitated pavement cells and guard cell ends in young leaf epidermis. In addition, pharmacological studies showed that perturbations in membrane trafficking resulted in simple cell shapes. These results suggested possible heterogeneity of the curved regions of plasma membranes, implying a relationship with pavement cell morphogenesis.

  11. Chemical allergens stimulate human epidermal keratinocytes to produce lymphangiogenic vascular endothelial growth factor.

    Science.gov (United States)

    Bae, Ok-Nam; Ahn, Seyeon; Jin, Sun Hee; Hong, Soo Hyun; Lee, Jinyoung; Kim, Eun-Sun; Jeong, Tae Cheon; Chun, Young-Jin; Lee, Ai-Young; Noh, Minsoo

    2015-03-01

    Allergic contact dermatitis (ACD) is a cell-mediated immune response that involves skin sensitization in response to contact with various allergens. Angiogenesis and lymphangiogenesis both play roles in the allergic sensitization process. Epidermal keratinocytes can produce vascular endothelial growth factor (VEGF) in response to UV irradiation and during wound healing. However, the effect of haptenic chemical allergens on the VEGF production of human keratinocytes, which is the primary contact site of toxic allergens, has not been thoroughly researched. We systematically investigated whether immune-regulatory cytokines and chemical allergens would lead to the production of VEGF in normal human keratinocytes (NHKs) in culture. VEGF production significantly increased when NHKs were treated with IFNγ, IL-1α, IL-4, IL-6, IL-17A, IL-22 or TNFα. Among the human sensitizers listed in the OECD Test Guideline (TG) 429, we found that CMI/MI, DNCB, 4-phenylenediamine, cobalt chloride, 2-mercaptobenzothiazole, citral, HCA, cinnamic alcohol, imidazolidinyl urea and nickel chloride all significantly upregulated VEGF production in NHKs. In addition, common human haptenic allergens such as avobenzone, formaldehyde and urushiol, also induced the keratinocyte-derived VEGF production. VEGF upregulation by pro-inflammatory stimuli, IFNγ, DNCB or formaldehyde is preceded by the production of IL-8, an acute inflammatory phase cytokine. Lymphangiogenic VEGF-C gene transcription was significantly increased when NHKs were treated with formaldehyde, DNCB or urushiol, while transcription of VEGF-A and VEGF-B did not change. Therefore, the chemical allergen-induced VEGF upregulation is mainly due to the increase in lymphangiogenic VEGF-C transcription in NHKs. These results suggest that keratinocyte-derived VEGF may regulate the lymphangiogenic process during the skin sensitization process of ACD.

  12. Enrichment of putative human epidermal stem cells based on cell size and collagen type IV adhesiveness

    Institute of Scientific and Technical Information of China (English)

    Juxue Li; Enkui Duan; Chenglin Miao; Weixiang Guo; Liwei Jia; Jiaxi Zhou; Baohua Ma; Sha Peng; Shuang Liu; Yujing Cao

    2008-01-01

    The enrichment and identification of human epidermal stem cells (EpSCs) are of paramount importance for both basic research and clinical application. Although several approaches for the enrichment of EpSCs have been established, enriching a pure population of viable EpSCs is still a challenging task. An improved approach is worth developing to enhance the purity and viability of EpSCs. Here we report that cell size combined with collagen type IV adhesiveness can be used in an improved approach to enrich pure and viable human EpSCs. We separated the rapidly adherent keratinocytes into three populations that range in size from 5-7 μm (population A), to 7-9 μm (population B), to >9 μm (population C) in diameter, and found that human putative EpSCs could be further enriched in population A with the smallest size. Among the three populations, population A displayed the highest density of βl-integrin receptor, contained the highest percentage of cells in G0/G1 phase, showed the highest nucleus to cytoplasm ratio, and possessed the highest colony formation efficiency (CFE). When injected into murine blastocysts, these cells participated in multi-tissue formation. More significantly, compared with a previous approach that sorted putative EpSCs according to pl-integrin antibody staining, the viability of the EpSCs enriched by the improved approach was significantly enhanced. Our results provide a putative strategy for the enrichment of human EpSCs, and encourage further study into the role of cell size in stem cell biology.

  13. Secretion of protein and epidermal growth factor (EGF) by transplanted human pancreas.

    Science.gov (United States)

    Konturek, J W; Buesing, M; Hopt, U T; Stachura, J; Becker, H D; Konturek, S J

    1992-08-01

    Epidermal growth factor (EGF) has been localized in human salivary and Brunner's glands and found to stimulate the proliferation of gastrointestinal and pancreatic tissues in animals, but little is known about EGF in human pancreas. This study was designed to determine the distribution and release of EGF in the pancreas and to assess the secretion of EGF and protein by the transplanted human pancreas. The peroxidase antiperoxidase (PAP) immunocytochemical method with anti-hEGF showed that EGF was restricted mainly to the excretory cells lining pancreatic ducts. The EGF immunoreactivity in the pancreatic tissue averaged about 15 +/- 0.5 micrograms/g of tissue wt. The concentration and output of EGF in the pancreatic juice were, respectively, about 3.4 +/- 0.7 ng/mL and 68 + 12 ng/h in basal secretion collected from the whole pancreatic transplant. A significant increase in EGF release from this transplant started about 2 h after its reperfusion and was accompanied by a parallel increase in protein output. Injection of iv secretion (1 U/kg) resulted in a transient rise in EGF output, probably as a result of washout by increased vol flow, whereas HCCK (1 U/kg) caused more prolonged release of EGF accompanied by a marked stimulation of protein secretion. Ingestion of a mixed meal caused an immediate and sustained increment in EGF output, and protein output showed a more protracted increase, reaching its peak in the second postprandial hour. Fractionation of an extract of pancreatic juice on G-5O Sephadex superfine column revealed that EGF immunoreactivity emerged as a major peak in the same position as authentic human EGF (hEGF).(ABSTRACT TRUNCATED AT 250 WORDS)

  14. Bystander killing effect of DS-8201a, a novel anti-human epidermal growth factor receptor 2 antibody-drug conjugate, in tumors with human epidermal growth factor receptor 2 heterogeneity.

    Science.gov (United States)

    Ogitani, Yusuke; Hagihara, Katsunobu; Oitate, Masataka; Naito, Hiroyuki; Agatsuma, Toshinori

    2016-07-01

    Antibody-drug conjugates deliver anticancer agents selectively and efficiently to tumor tissue and have significant antitumor efficacy with a wide therapeutic window. DS-8201a is a human epidermal growth factor receptor 2 (HER2)-targeting antibody-drug conjugate prepared using a novel linker-payload system with a potent topoisomerase I inhibitor, exatecan derivative (DX-8951 derivative, DXd). It was effective against trastuzumab emtansine (T-DM1)-insensitive patient-derived xenograft models with both high and low HER2 expression. In this study, the bystander killing effect of DS-8201a was evaluated and compared with that of T-DM1. We confirmed that the payload of DS-8201a, DXd (1), was highly membrane-permeable whereas that of T-DM1, Lys-SMCC-DM1, had a low level of permeability. Under a coculture condition of HER2-positive KPL-4 cells and negative MDA-MB-468 cells in vitro, DS-8201a killed both cells, whereas T-DM1 and an antibody-drug conjugate with a low permeable payload, anti-HER2-DXd (2), did not. In vivo evaluation was carried out using mice inoculated with a mixture of HER2-positive NCI-N87 cells and HER2-negative MDA-MB-468-Luc cells by using an in vivo imaging system. In vivo, DS-8201a reduced the luciferase signal of the mice, indicating suppression of the MDA-MB-468-Luc population; however, T-DM1 and anti-HER2-DXd (2) did not. Furthermore, it was confirmed that DS-8201a was not effective against MDA-MB-468-Luc tumors inoculated at the opposite side of the NCI-N87 tumor, suggesting that the bystander killing effect of DS-8201a is observed only in cells neighboring HER2-positive cells, indicating low concern in terms of systemic toxicity. These results indicated that DS-8201a has a potent bystander effect due to a highly membrane-permeable payload and is beneficial in treating tumors with HER2 heterogeneity that are unresponsive to T-DM1. © 2016 The Authors. Cancer Science published by John Wiley & Sons Australia, Ltd on behalf of Japanese Cancer

  15. Basis for the gain and subsequent dilution of epidermal pigmentation during human evolution: The barrier and metabolic conservation hypotheses revisited.

    Science.gov (United States)

    Elias, Peter M; Williams, Mary L

    2016-10-01

    The evolution of human skin pigmentation must address both the initial evolution of intense epidermal pigmentation in hominins, and its subsequent dilution in modern humans. While many authorities believe that epidermal pigmentation evolved to protect against either ultraviolet B (UV-B) irradiation-induced mutagenesis or folic acid photolysis, we hypothesize that pigmentation augmented the epidermal barriers by shifting the UV-B dose-response curve from toxic to beneficial. Whereas erythemogenic UV-B doses produce apoptosis and cell death, suberythemogenic doses benefit permeability and antimicrobial function. Heavily melanized melanocytes acidify the outer epidermis and emit paracrine signals that augment barrier competence. Modern humans, residing in the cooler, wetter climes of south-central Europe and Asia, initially retained substantial pigmentation. While their outdoor lifestyles still permitted sufficient cutaneous vitamin D3 (VD3) synthesis, their marginal nutritional status, coupled with cold-induced caloric needs, selected for moderate pigment reductions that diverted limited nutritional resources towards more urgent priorities (=metabolic conservation). The further pigment-dilution that evolved as humans reached north-central Europe (i.e., northern France, Germany), likely facilitated cutaneous VD3 synthesis, while also supporting ongoing, nutritional requirements. But at still higher European latitudes where little UV-B breaches the atmosphere (i.e., present-day UK, Scandinavia, Baltic States), pigment dilution alone could not suffice. There, other nonpigment-related mutations evolved to facilitate VD3 production; for example, in the epidermal protein, filaggrin, resulting in reduced levels of its distal metabolite, trans-urocanic acid, a potent UV-B chromophore. Thus, changes in human pigmentation reflect a complex interplay between latitude, climate, diet, lifestyle, and shifting metabolic priorities. © 2016 Wiley Periodicals, Inc.

  16. High Efficient Expression, Purification, and Functional Characterization of Native Human Epidermal Growth Factor in Escherichia coli.

    Science.gov (United States)

    Ma, Yi; Yu, Jieying; Lin, Jinglian; Wu, Shaomin; Li, Shan; Wang, Jufang

    2016-01-01

    Human epidermal growth factor (hEGF) is a small, mitotic growth polypeptide that promotes the proliferation of various cells and is widely applied in clinical practices. However, high efficient expression of native hEGF in Escherichia coli has not been successful, since three disulfide bonds in monomer hEGF made it unable to fold into correct 3D structure using in vivo system. To tackle this problem, we fused Mxe GyrA intein (Mxe) at the C-terminal of hEGF followed by small ubiquitin-related modifier (SUMO) and 10x His-tag to construct a chimeric protein hEGF-Mxe-SUMO-H10. The fusion protein was highly expressed at the concentration of 281 mg/L and up to 59.5% of the total cellular soluble proteins. The fusion protein was purified by affinity chromatography and 29.4 mg/L of native hEGF can be released by thiol induced N-terminal cleavage without any proteases. The mitotic activity in Balb/c 3T3 cells is proliferated by commercial and recombinant hEGF measured with methylthiazolyldiphenyl-tetrazolium bromide (MTT) assay which indicated that recombinant hEGF protein stimulates the cell proliferation similar to commercial protein. This study significantly improved the yield and reduced the cost of hEGF in the recombinant E. coli system and could be a better strategy to produce native hEGF for pharmaceutical development.

  17. Gene Expression Profiling of Human Epidermal Keratinocytes in Simulated Microgravity and Recovery Cultures

    Institute of Scientific and Technical Information of China (English)

    Jade Q. Clement; Shareen M. Lacy; Bobby L. Wilson

    2008-01-01

    Simulated microgravity (SMG) bioreactors and DNA microarray technology are powerful tools to identify "space genes" that play key roles in cellular response to microgravity. We applied these biotechnology tools to investigate SMG and post-SMG recovery effects on human epidermal keratinocytes by exposing cells to SMG for 3,4,9, and 10d using the high aspect ratio vessel bioreactor followed by recovery culturing for 15,50, and 60d in normal gravity. As a result, we identified 162 differentially expressed genes, 32 of which were "center genes" that were most consistently affected in the time course experiments. Eleven of the center genes were from the integrated stress response pathways and were coordinately down regulated. Another seven of the center genes, which are all metallothionein MT-Ⅰ and MT-Ⅱ isoforms, were coordinately up-regulated. In addition, HLA-G, a key gene in cellular immune response suppression, was found to be significantly upregulated during the recovery phase. Overall, more than 80% of the differentially expressed genes from the shorter exposures (≤4d) recovered in 15d; for longer (≥9d) exposures, more than 50d were needed to recover to the impact level of shorter exposures. The data indicated that shorter SMG exposure duration would lead to quicker and more complete recovery from the microgravity effect.

  18. Lapatinib plus trastuzumab in pretreated human epidermal growth factor receptor 2-positive metastatic breast cancer

    Directory of Open Access Journals (Sweden)

    Miguel J Sotelo

    2014-01-01

    Full Text Available Background: Dual human epidermal growth factor receptor 2 (HER2 blockade has been preclinically and clinically assessed in HER2-overexpressing metastatic breast cancer (mBC with encouraging results. Patients and Methods: This is a descriptive retrospective study of trastuzumab plus lapatinib activity in patients with HER2-overexpressing mBC from two centers. The primary endpoints were to assess objective response rate (ORR and toxicity. The secondary endpoints were to assess progression-free survival (PFS and overall survival. Results: A total of 23 HER2-positive mBC patients previously treated with trastuzumab received a trastuzumab plus lapatinib based therapy. Chemotherapy (CT was added to the dual HER2 blockade treatment in 13 patients (56%, whereas hormonotherapy (HT was added in 8 patients (35% and 2 patients (9% received lapatinib plus trastuzumab without any other agent. ORR was 22% (5/23 and 39% (9/23 of patients had stable disease. PFS in the overall population was 4 months. PFS in patients with CT was 5 months, whereas PFS in patients with HT was 2 months. Grade ≥ 3 adverse events were diarrhea (26% and hand-and-foot syndrome (9%. Conclusions: These findings suggest that dual HER2 blockade in combination with CT is feasible in pretreated HER2-positive mBC patients.

  19. Pertuzumab in human epidermal growth-factor receptor 2-positive breast cancer: clinical and economic considerations

    Directory of Open Access Journals (Sweden)

    Lamond NW

    2014-05-01

    Full Text Available Nathan WD Lamond, Tallal YounisDepartment of Medicine, Dalhousie University at the Queen Elizabeth II Health Sciences Centre, Halifax, NS, CanadaAbstract: In the absence of specific therapy, the 15%–20% of breast cancers demonstrating human epidermal growth-factor receptor 2 (HER2 protein overexpression and/or gene amplification are characterized by a more aggressive phenotype and poorer prognosis compared to their HER2-negative counterparts. Trastuzumab (Herceptin, the first anti-HER2-targeted therapy, has been associated with improved survival outcomes in HER2-positive breast cancer. However, many patients with early stage disease continue to relapse, and metastatic disease remains incurable. In order to further improve these outcomes, several novel HER2-targeted agents have recently been developed. Pertuzumab (Perjeta, a monoclonal antibody against the HER2 dimerization domain, has also been associated with improved patient outcomes in clinical trials, and has recently been approved in combination with chemotherapy and trastuzumab for neoadjuvant therapy of early stage, HER2-positive breast cancer and first-line treatment of metastatic disease. This review briefly summarizes pertuzumab's clinical development as well as the published evidence supporting its use, and highlights some of the currently unanswered questions that will influence pertuzumab’s incorporation into clinical practice.Keywords: HER2/neu, clinical trials, drug development, novel therapies, targeted anticancer therapy

  20. Human epidermal growth factor receptor 2 expression in mixed gastric carcinoma.

    Science.gov (United States)

    Wang, Yang-Kun; Chen, Zhong; Yun, Tian; Li, Cong-Yang; Jiang, Bo; Lv, Xue-Xia; Chu, Guang-Hui; Wang, Su-Nan; Yan, Hui; Shi, Lei-Feng

    2015-04-21

    To investigate human epidermal growth factor receptor 2 (HER2) amplification and protein expression in mixed gastric carcinoma. Fluorescence in situ hybridization and immunohistochemistry were used to detect HER2 amplification and protein expression in 277 cases of mixed gastric carcinoma. Protein staining intensity was rate as 1+, 2+, or 3+. Of the 277 cases, 114 (41.2%) expressed HER2 protein. HER2 3+ staining was observed in 28/277 (10.1%) cases, 2+ in 37/277 (13.4%) cases, and 1+ in 49/277 (17.7%) cases. A HER2 amplification rate of 17% was detected, of which 25/28 (89.3%) were observed in the HER2 3+ staining group, 17/37 (45.9%) in 2+, and 5/49 (10.2%) in 1+. Of the 47 patients with HER2 amplification who received chemotherapy plus trastuzumab, 22 demonstrated median progression-free and overall survivals of 9.1 mo and 16.7 mo, respectively, which were significantly better than those achieved with chemotherapy alone (5.6 mo and 12.1 mo, respectively) in 19 previously treated patients (Ps gastric carcinoma displays high heterogeneity. Relatively quantitative parameters are needed for assessing the level of HER2 amplification and protein expression.

  1. Effects of Arsenic on Cell Proliferation and Its Related Gene Expression in Human Epidermal Keratinocyte

    Institute of Scientific and Technical Information of China (English)

    顾军; 毕新岭; 米庆胜; 文军慧

    2002-01-01

    Objective:To study the effects of low concentration of arsenic (As2O3) on DNA synthesisand related transcription factor gene E2F1 expression in keratinocyte. Methods: Human epidermal kerati-nocyte (cell line HaCaT) cultured in vitro was used. After treatment with various concentrations of arse-nic, DNA synthesis and E2F1 expression in HaCaT cells were detected by using 3 H-TdR method and RT-PCR. Results: Arsenic caused a modest increase of keratinocyte DNA synthesis when the concentrationreached the range within 0.5-16 nmol/L, but the amount of incorporated 3 H-TdR decreased and returnedto baseline level when the concentration of arsenic increased to over 16 nmol/L. RT-PCR analysis showedthe level of E2F1 mRNA was elevated in HaCaT cells with the increase of DNA synthesis. Conclusion:Ar-senic of a certain concentration could increase DNA synthesis and enhance E2F1 expression in HaCaT cellline, which might be one of the pathological mechanisms of skin disease related to arsenic.

  2. Molecular Mechanisms and Translational Therapies for Human Epidermal Receptor 2 Positive Breast Cancer

    Directory of Open Access Journals (Sweden)

    Quanxia Lv

    2016-12-01

    Full Text Available Breast cancer is the second leading cause of cancer death among women. Human epidermal receptor 2 (HER2 positive breast cancer (HER2+ BC is the most aggressive subtype of breast cancer, with poor prognosis and a high rate of recurrence. About one third of breast cancer is HER2+ BC with significantly high expression level of HER2 protein compared to other subtypes. Therefore, HER2 is an important biomarker and an ideal target for developing therapeutic strategies for the treatment HER2+ BC. In this review, HER2 structure and physiological and pathological roles in HER2+ BC are discussed. Two diagnostic tests, immunohistochemistry (IHC and fluorescent in situ hybridization (FISH, for evaluating HER2 expression levels are briefly introduced. The current mainstay targeted therapies for HER2+ BC include monoclonal antibodies, small molecule tyrosine kinase inhibitors, antibody–drug conjugates (ADC and other emerging anti-HER2 agents. In clinical practice, combination therapies are commonly adopted in order to achieve synergistic drug response. This review will help to better understand the molecular mechanism of HER2+ BC and further facilitate the development of more effective therapeutic strategies against HER2+ BC.

  3. Differential gene expression profiling of human epidermal growth factor receptor 2-overexpressing mammary tumor

    Institute of Scientific and Technical Information of China (English)

    Yan Wang; Haining Peng; Yingli Zhong; Daiqiang Li; Mi Tang; Xiaofeng Ding; Jian Zhang

    2008-01-01

    Human epidermal growth factor receptor 2 (HER2) is highly expressed in approximately 30% of breast cancer patients,and substantial evidence supports the relationship between HER2 overexpression and poor overall survival. However,the biological function of HER2 signaltransduction pathways is not entirely clear. To investigate gene activation within the pathways, we screened differentially expressed genes in HER2-positive mouse mammary tumor using two-directional suppression subtractive hybridization combined with reverse dot-blotting analysis. Forty genes and expressed sequence tags related to transduction, cell proliferation/growth/apoptosis and secreted/extracellular matrix proteins were differentially expressed in HER2-positive mammary tumor tissue. Among these, 19 were already reported to be differentially expressed in mammary tumor, 11 were first identified to be differentially expressed in mammary tumor in this study but were already reported in other tumors, and 10 correlated with other cancers. These genes can facilitate the understanding of the role of HER2 signaling in breast cancer.

  4. Expression and purification of human epidermal growth factor (hEGF fused with GB1

    Directory of Open Access Journals (Sweden)

    Xueming Zheng

    2016-07-01

    Full Text Available Fusion expression is a promising strategy for the production of bioactive peptides in Escherichia coli. In this study, we constructed a new recombinant expression plasmid containing the coding sequence of 56-residue B1 domain of streptococcal protein G (GB1. For easy purification and cleavage of the recombinant proteins, except GB1, an engineered hexahistidine and tobacco etch virus (TEV protease recognition sites were included in the fusion sequence. Next, we cloned the coding sequence of human epidermal growth factor (hEGF into this new plasmid and produced the recombinant hEGF in E. coli. The bioactive hEGF is a 53-amino acid peptide and is stabilized by three intramolecular disulphide bonds. Compared with glutathione S-transferase, thioredoxin and small ubiquitin-related modifier, GB1 greatly improved the expression and solubility of hEGF. Moreover, the recombinant hEGF bound to the nickel nitrilotriacetic acid resin column, was easily cleaved by TEV protease and the free hEGF was released. The results showed that this new plasmid was appropriate for recombinant production of small bioactive peptides, such as hEGF, which contains a high proportion of hydrophobic residues and intramolecular disulphide linkages.

  5. High Efficient Expression, Purification, and Functional Characterization of Native Human Epidermal Growth Factor in Escherichia coli

    Directory of Open Access Journals (Sweden)

    Yi Ma

    2016-01-01

    Full Text Available Human epidermal growth factor (hEGF is a small, mitotic growth polypeptide that promotes the proliferation of various cells and is widely applied in clinical practices. However, high efficient expression of native hEGF in Escherichia coli has not been successful, since three disulfide bonds in monomer hEGF made it unable to fold into correct 3D structure using in vivo system. To tackle this problem, we fused Mxe GyrA intein (Mxe at the C-terminal of hEGF followed by small ubiquitin-related modifier (SUMO and 10x His-tag to construct a chimeric protein hEGF-Mxe-SUMO-H10. The fusion protein was highly expressed at the concentration of 281 mg/L and up to 59.5% of the total cellular soluble proteins. The fusion protein was purified by affinity chromatography and 29.4 mg/L of native hEGF can be released by thiol induced N-terminal cleavage without any proteases. The mitotic activity in Balb/c 3T3 cells is proliferated by commercial and recombinant hEGF measured with methylthiazolyldiphenyl-tetrazolium bromide (MTT assay which indicated that recombinant hEGF protein stimulates the cell proliferation similar to commercial protein. This study significantly improved the yield and reduced the cost of hEGF in the recombinant E. coli system and could be a better strategy to produce native hEGF for pharmaceutical development.

  6. Brain metastasis in human epidermal growth factor receptor 2-positive breast cancer: from biology to treatment

    Energy Technology Data Exchange (ETDEWEB)

    Koo, Tae Ryool [Dept. of Radiation Oncology, Hallym University Chuncheon Sacred Heart Hospital, Chuncheon (Korea, Republic of); Kim, In Ah [Dept. of Radiation Oncology, Seoul National University Bundang Hospital, Seongnam (Korea, Republic of)

    2016-03-15

    Overexpression of human epidermal growth factor receptor 2 (HER2) is found in about 20% of breast cancer patients. With treatment using trastuzumab, an anti-HER2 monoclonal antibody, systemic control is improved. Nonetheless, the incidence of brain metastasis does not be improved, rather seems to be increased in HER2-positive breast cancer. The mainstay treatment for brain metastases is radiotherapy. According to the number of metastatic lesions and performance status of patients, radiosurgery or whole brain radiotherapy can be performed. The concurrent use of a radiosensitizer further improves intracranial control. Due to its large molecular weight, trastuzumab has a limited ability to cross the blood-brain barrier. However, small tyrosine kinase inhibitors such as lapatinib, has been noted to be a promising agent that can be used as a radiosensitizer to affect HER2-positive breast cancer. This review will outline general management of brain metastases and will focus on preclinical findings regarding the radiosensitizing effect of small molecule HER2 targeting agents.

  7. EGF receptor signaling blocks aryl hydrocarbon receptor-mediated transcription and cell differentiation in human epidermal keratinocytes

    OpenAIRE

    Sutter, Carrie Hayes; Yin, Hong; Li, Yunbo; Mammen, Jennifer S.; Bodreddigari, Sridevi; Stevens, Gaylene; Cole, Judith A; Sutter, Thomas R.

    2009-01-01

    Dioxin is an extremely potent carcinogen. In highly exposed people, the most commonly observed toxicity is chloracne, a pathological response of the skin. Most of the effects of dioxin are attributed to its activation of the aryl hydrocarbon receptor (AHR), a transcription factor that binds to the Ah receptor nuclear translocator (ARNT) to regulate the transcription of numerous genes, including CYP1A1 and CYP1B1. In cultures of normal human epidermal keratinocytes dioxin accelerates cell diff...

  8. Chemical allergens stimulate human epidermal keratinocytes to produce lymphangiogenic vascular endothelial growth factor

    Energy Technology Data Exchange (ETDEWEB)

    Bae, Ok-Nam [College of Pharmacy, Institute of Pharmaceutical Science and Technology, Hanyang University, Ansan 426-791 (Korea, Republic of); Ahn, Seyeon; Jin, Sun Hee; Hong, Soo Hyun; Lee, Jinyoung [College of Pharmacy, Natural Products Research Institute, Seoul National University, Seoul 151-742 (Korea, Republic of); Kim, Eun-Sun [College of Pharmacy, Institute of Pharmaceutical Science and Technology, Hanyang University, Ansan 426-791 (Korea, Republic of); Jeong, Tae Cheon [College of Pharmacy, Yeungnam University, Gyeongsan 712-749 (Korea, Republic of); Chun, Young-Jin [College of Pharmacy, Chung-Ang University, Seoul 156-756 (Korea, Republic of); Lee, Ai-Young, E-mail: leeay@duih.org [Department of Dermatology, Dongguk University Ilsan Hospital, Goyang 410-773 (Korea, Republic of); Noh, Minsoo, E-mail: minsoo@alum.mit.edu [College of Pharmacy, Natural Products Research Institute, Seoul National University, Seoul 151-742 (Korea, Republic of)

    2015-03-01

    Allergic contact dermatitis (ACD) is a cell-mediated immune response that involves skin sensitization in response to contact with various allergens. Angiogenesis and lymphangiogenesis both play roles in the allergic sensitization process. Epidermal keratinocytes can produce vascular endothelial growth factor (VEGF) in response to UV irradiation and during wound healing. However, the effect of haptenic chemical allergens on the VEGF production of human keratinocytes, which is the primary contact site of toxic allergens, has not been thoroughly researched. We systematically investigated whether immune-regulatory cytokines and chemical allergens would lead to the production of VEGF in normal human keratinocytes (NHKs) in culture. VEGF production significantly increased when NHKs were treated with IFNγ, IL-1α, IL-4, IL-6, IL-17A, IL-22 or TNFα. Among the human sensitizers listed in the OECD Test Guideline (TG) 429, we found that CMI/MI, DNCB, 4-phenylenediamine, cobalt chloride, 2-mercaptobenzothiazole, citral, HCA, cinnamic alcohol, imidazolidinyl urea and nickel chloride all significantly upregulated VEGF production in NHKs. In addition, common human haptenic allergens such as avobenzone, formaldehyde and urushiol, also induced the keratinocyte-derived VEGF production. VEGF upregulation by pro-inflammatory stimuli, IFNγ, DNCB or formaldehyde is preceded by the production of IL-8, an acute inflammatory phase cytokine. Lymphangiogenic VEGF-C gene transcription was significantly increased when NHKs were treated with formaldehyde, DNCB or urushiol, while transcription of VEGF-A and VEGF-B did not change. Therefore, the chemical allergen-induced VEGF upregulation is mainly due to the increase in lymphangiogenic VEGF-C transcription in NHKs. These results suggest that keratinocyte-derived VEGF may regulate the lymphangiogenic process during the skin sensitization process of ACD. - Highlights: • Pro-inflammatory cytokines induced VEGF production in normal human

  9. Antibacterial Effect of Human Amnion Membrane

    Directory of Open Access Journals (Sweden)

    Kashani, L. (MD

    2015-01-01

    Full Text Available Background and Objective: Along with antibiotics, the use of biological methods to combat bacteria is notably considered. A natural barrier such as amniotic membrane is one of the ways of dealing with bacterial infections. The aim of this study was to determine the antibacterial effect of human amniotic membrane. Materials and Methods: This descriptive study was performed in Dezyani teaching Hospital of Gorgan University of Medical Sciences, Iran. To evaluate the antibacterial activity against Staphylococcus aureus, Pseudomonas aeruginosa and Escherichia coli bacteria, 20 amniotic membranes were obtained from postpartum mothers and examined by repeated dilution, diffusion and extraction techniques. Data were collected by observation method and described by mean and standard deviation. Results: The antibacterial activity was found in 15% of the samples against Staphylococcus Aureus and Pseudomonas aeruginosa, while no antibacterial activity was found against E. coli. Given the 15% positive responses, "Diffusion" and "repeated dilution" techniques were more effective in investigating the antibacterial effect of amniotic membrane. Conclusion: The results show the probability of antimicrobial effect of amniotic membrane tissue and it seems that this property can be affected by many factors.

  10. H{sup +}/peptide transporter (PEPT2) is expressed in human epidermal keratinocytes and is involved in skin oligopeptide transport

    Energy Technology Data Exchange (ETDEWEB)

    Kudo, Michiko; Katayoshi, Takeshi; Kobayashi-Nakamura, Kumiko [DHC Corporation Laboratories, Division 2, 2-42 Hamada, Mihama-ku, Chiba 261-0025 (Japan); Akagawa, Mitsugu [Department of Biological Chemistry, Division of Applied Life Science, Graduate School of Life and Environmental Sciences, Osaka Prefecture University, 1-1 Gakuen-cho, Naka-ku, Sakai 599-8531 (Japan); Tsuji-Naito, Kentaro, E-mail: knaito@dhc.co.jp [DHC Corporation Laboratories, Division 2, 2-42 Hamada, Mihama-ku, Chiba 261-0025 (Japan)

    2016-07-08

    Peptide transporter 2 (PEPT2) is a member of the proton-coupled oligopeptide transporter family, which mediates the cellular uptake of oligopeptides and peptide-like drugs. Although PEPT2 is expressed in many tissues, its expression in epidermal keratinocytes remains unclear. We investigated PEPT2 expression profile and functional activity in keratinocytes. We confirmed PEPT2 mRNA expression in three keratinocyte lines (normal human epidermal keratinocytes (NHEKs), immortalized keratinocytes, and malignant keratinocytes) by reverse transcription-polymerase chain reaction (RT-PCR) and quantitative real-time RT-PCR. In contrast to PEPT1, PEPT2 expression in the three keratinocytes was similar or higher than that in HepG2 cells, used as PEPT2-positive cells. Immunolocalization analysis using human skin showed epidermal PEPT2 localization. We studied keratinocyte transport function by measuring the oligopeptide content using liquid chromatography/tandem mass spectrometry. Glycylsarcosine uptake in NHEKs was pH-dependent, suggesting that keratinocytes could absorb small peptides in the presence of an inward H{sup +} gradient. We also performed a skin-permeability test of several oligopeptides using skin substitute, suggesting that di- and tripeptides pass actively through the epidermis. In conclusion, PEPT2 is expressed in keratinocytes and involved in skin oligopeptide uptake. -- Highlights: •PEPT2 is expressed in keratinocytes, which are more common than other skin cells. •Immunolocalization analysis using human skin revealed epidermal PEPT2 localization. •Keratinocytes could absorb small peptides in the presence of an inward H{sup +} gradient. •Di- and tripeptide pass actively through the epidermis.

  11. Human epidermal keratinocyte cell response on integrin-specific artificial extracellular matrix proteins.

    Science.gov (United States)

    Tjin, Monica Suryana; Chua, Alvin Wen Choong; Ma, Dong Rui; Lee, Seng Teik; Fong, Eileen

    2014-08-01

    Cell-matrix interactions play critical roles in regulating cellular behavior in wound repair and regeneration of the human skin. In particular, human skin keratinocytes express several key integrins such as alpha5beta1, alpha3beta1, and alpha2beta1 for binding to the extracellular matrix (ECM) present in the basement membrane in uninjured skin. To mimic these key integrin-ECM interactions, artificial ECM (aECM) proteins containing functional domains derived from laminin 5, type IV collagen, fibronectin, and elastin are prepared. Human skin keratinocyte cell responses on the aECM proteins are specific to the cell-binding domain present in each construct. Keratinocyte attachment to the aECM protein substrates is also mediated by specific integrin-material interactions. In addition, the aECM proteins are able to support the proliferation of keratinocyte stem cells, demonstrating their promise for use in skin tissue engineering.

  12. Eps15 is recruited to the plasma membrane upon epidermal growth factor receptor activation and localizes to components of the endocytic pathway during receptor internalization

    DEFF Research Database (Denmark)

    Torrisi, M R; Lotti, L V; Belleudi, F;

    1999-01-01

    Eps15 is a substrate for the tyrosine kinase of the epidermal growth factor receptor (EGFR) and is characterized by the presence of a novel protein:protein interaction domain, the EH domain. Eps15 also stably binds the clathrin adaptor protein complex AP-2. Previous work demonstrated an essential...... role for eps15 in receptor-mediated endocytosis. In this study we show that, upon activation of the EGFR kinase, eps15 undergoes dramatic relocalization consisting of 1) initial relocalization to the plasma membrane and 2) subsequent colocalization with the EGFR in various intracellular compartments...... of the endocytic pathway, with the notable exclusion of coated vesicles. Relocalization of eps15 is independent of its binding to the EGFR or of binding of the receptor to AP-2. Furthermore, eps15 appears to undergo tyrosine phosphorylation both at the plasma membrane and in a nocodazole-sensitive compartment...

  13. H(+)/peptide transporter (PEPT2) is expressed in human epidermal keratinocytes and is involved in skin oligopeptide transport.

    Science.gov (United States)

    Kudo, Michiko; Katayoshi, Takeshi; Kobayashi-Nakamura, Kumiko; Akagawa, Mitsugu; Tsuji-Naito, Kentaro

    2016-07-08

    Peptide transporter 2 (PEPT2) is a member of the proton-coupled oligopeptide transporter family, which mediates the cellular uptake of oligopeptides and peptide-like drugs. Although PEPT2 is expressed in many tissues, its expression in epidermal keratinocytes remains unclear. We investigated PEPT2 expression profile and functional activity in keratinocytes. We confirmed PEPT2 mRNA expression in three keratinocyte lines (normal human epidermal keratinocytes (NHEKs), immortalized keratinocytes, and malignant keratinocytes) by reverse transcription-polymerase chain reaction (RT-PCR) and quantitative real-time RT-PCR. In contrast to PEPT1, PEPT2 expression in the three keratinocytes was similar or higher than that in HepG2 cells, used as PEPT2-positive cells. Immunolocalization analysis using human skin showed epidermal PEPT2 localization. We studied keratinocyte transport function by measuring the oligopeptide content using liquid chromatography/tandem mass spectrometry. Glycylsarcosine uptake in NHEKs was pH-dependent, suggesting that keratinocytes could absorb small peptides in the presence of an inward H(+) gradient. We also performed a skin-permeability test of several oligopeptides using skin substitute, suggesting that di- and tripeptides pass actively through the epidermis. In conclusion, PEPT2 is expressed in keratinocytes and involved in skin oligopeptide uptake. Copyright © 2016 DHC corporation. Published by Elsevier Inc. All rights reserved.

  14. Preparation and in vitro release study of recombinant human epidermal growth factor/chitosan nanoparticle-loaded fibrin-binding amniotic membrane%载表皮生长因子/壳聚糖纳米粒纤维蛋白胶胶联羊膜的制备及体外释药评价

    Institute of Scientific and Technical Information of China (English)

    周文君; 赵敏; 牟彦

    2011-01-01

    背景:纤维蛋白胶胶联羊膜作为一种无需缝合生物移植材料还无法有效地在局部长时间缓释药物,特别是对于一些不稳定的生物活性蛋白药物.目的:构建新型的能有效缓释蛋白药物的载表皮生长因子壳聚糖纳米粒纤维蛋白胶羊膜复合体.方法:制备表皮生长因子/壳聚糖载药纳米粒并考察其表征,然后将载药纳米粒掺入纤维蛋白胶,再将载纳米粒的纤维蛋白胶和羊膜胶联黏合,制备出负载表皮生长因子/壳聚糖纳米粒纤维蛋白胶胶联羊膜,并进行形态学和体外释药观察,检测释放出的表皮生长因子生物活性.结果与结论:表皮生长因子/壳聚糖纳米粒的粒径为(275.7±6.8) nm,Zeta电位为(32.7±0.6) mV,包封率为(67.03±1.22)%,多分散指数为0.23±0.04,形态圆形均一,载纳米粒纤维蛋白胶能够很好地与羊膜胶联黏合,表面呈网状结构,纳米粒充斥其中.载表皮生长因子/壳聚糖纳米粒纤维蛋白胶胶联羊膜体外释药可达14 d,释放的表皮生长因子生物活性可保持7 d以上.说明制备的载重组人表皮生长因子/壳聚糖纳米粒纤维蛋白胶胶联羊膜作为一种无缝合生物移植材料可在局部缓慢释放表皮生长因子.%BACKGROUND: As a sutureless implantable biomaterial, fibrin-binding amniotic membrane can not deliver drugs in a sustainedand efficient way locally, especially for those instable bioactive proteins.OBJECTIVE: To construct a novel sutureless implantable composite biomaterial by combining recombinant human epidermalgrowth factor (rhEGF)-loaded chitosan nanoparticles, fibrin gel and amniotic membrane, which could deliver therapeutic proteins ina sustained way.METHODS: rhEGF-loaded chitosan nanoparticles were prepared and characterized, and then they were incorporated into a fibringel matrix during polymerization. By binding the prepared fibrin gel to a piece of amniotic membrane, a rhEGF/chitosannanoparticle-loaded fibrin

  15. First in human nanotechnology doxorubicin delivery system to target epidermal growth factor receptors in recurrent glioblastoma.

    Science.gov (United States)

    Whittle, James R; Lickliter, Jason D; Gan, Hui K; Scott, Andrew M; Simes, John; Solomon, Benjamin J; MacDiarmid, Jennifer A; Brahmbhatt, Himanshu; Rosenthal, Mark A

    2015-12-01

    There are limited treatment options for patients with recurrent glioblastoma (GBM). The EnGeneIC delivery vehicle (EDV) is a novel nanocellular (minicell) compound which packages theoretically effective concentrations of chemotherapeutic drugs that are designed to target tumors via minicell-surface attached bispecific proteins (EnGeneIC, Lane Cove West, NSW, Australia). Epidermal growth factor receptor (EGFR) is overexpressed in 40-50% of patients with GBM and is a promising target for new therapeutics. (V)EDVDox contains doxorubicin (Dox) within the minicells and targets EGFR through Vectibix (V; Amgen Biologicals, Thousand Oaks, CA, USA). We conducted a first in human Phase I study of (V)EDVDox in adults with recurrent GBM expressing EGFR on immunohistochemistry, following standard therapy including radiation and temozolomide, to establish a safe maximum tolerated dose and determine a recommended Phase II dose (RPTD). (V)EDVDox was administered weekly in an 8week cycle, with dose escalation in successive cohorts of patients using a standard 3+3 design. In total, 14 patients were treated at three dose levels, and the RPTD was identified as 5×10(9)(V)EDVDox. Overall (V)EDVDox was well tolerated, with no dose limiting toxicity and no withdrawals from the study due to adverse events. The most common adverse events were nausea, fever, and chills or rigors, experienced in seven, five and five patients, respectively. Transient uncomplicated hypophosphatemia was seen in seven patients and was not dose-related. Our results demonstrate that (V)EDVDox, up to a dose of 5×10(9)(V)EDVDox weekly, is well tolerated in patients with recurrent GBM.

  16. Human epidermal growth factor receptor 2/neu protein expression in meningiomas: An immunohistochemical study

    Directory of Open Access Journals (Sweden)

    Ramesh Babu Telugu

    2016-01-01

    Full Text Available Background: Meningiomas are common slow-growing primary central nervous system tumors that arise from the meningothelial cells of the arachnoid and spinal cord. Human epidermal growth factor receptor 2 (HER2 or HER2/neu (also known as c-erbB2 is a 185-kD transmembrane glycoprotein with tyrosine kinase activity expressed in meningiomas and various other tumors. It can be used in targeted therapy for HER2/neu positive meningiomas. Aim: To correlate the expression of HER2/neu protein in meningiomas with gender, location, histological subtypes, and grade. Materials and Methods: It was 3½ years prospective (March 2010–October 2011 and retrospective (May 2008–February 2010 study of histopathologically diagnosed intracranial and intraspinal meningiomas. Clinical details of all the cases were noted from the computerized hospital information system. Immunohistochemistry for HER2/neu protein was performed along with scoring. Statistical analysis was done using Chi-square test to look for any association of HER2/neu with gender, location, grade, and various histological subtypes of meningiomas at 5% level of significance. Results: A total of 100 cases of meningiomas were found during the study period. Of which, 80 were Grade I, 18 were Grade II, and 2 were Grade III meningiomas as per the World Health Organization 2007 criteria. The female-male ratio was 1.9:1 and the mean age was 47.8 years. HER2/neu protein was expressed in 75% of Grade I and 72.2% of Grade II and none of Grade III meningiomas. About 72.7% brain invasive meningiomas showed HER2/neu immunopositivity. Conclusion: HER2/neu protein was expressed in 73% of meningiomas. Statistically significant difference of HER2/neu expression was not seen between females and males of Grade I and Grade II/III meningiomas, intracranial and spinal tumors, Grade I and Grade II/III cases, and various histological subtypes of meningiomas.

  17. Heparin Binding Epidermal Growth Factor-Like Growth Factor Heals Chronic Tympanic Membrane Perforations With Advantage Over Fibroblast Growth Factor 2 and Epidermal Growth Factor in an Animal Model.

    Science.gov (United States)

    Santa Maria, Peter Luke; Weierich, Kendall; Kim, Sungwoo; Yang, Yunzhi Peter

    2015-08-01

    That heparin binding epidermal growth factor-like growth factor (HB-EGF) heals chronic tympanic membrane (TM) perforations at higher rates than fibroblast growth factor 2 (FGF2) and epidermal growth factor (EGF) in an animal model. A nonsurgical treatment for chronic TM perforation would benefit those unable to access surgery or those unable to have surgery, as well as reducing the cost of tympanoplasty. Growth factor (GF) treatments have been reported in the literature with variable success with the lack of a suitable animal providing a major obstacle. The GFs were tested in a validated mouse model of chronic TM perforation. A bioabsorbable hydrogel polymer was used to deliver the GF at a steady concentration as it dissolved over 4 weeks. A control (polymer only, n = 18) was compared to polymer loaded with HB-EGF (5 μg/ml, n = 18), FGF2 (100 μg/ml, n = 19), and EGF (250 μg/ml, n = 19). Perforations were inspected at 4 weeks. The healing rates, as defined as 100% perforation closure, were control (5/18, 27.8%), HB-EGF (15/18, 83.3%), FGF2 (6/19, 31.6%), and EGF (3/19, 15.8%). There were no differences between FGF2 (p = 0.80) and EGF (p = 0.31) with control healing rates. HB-EGF (p = 0.000001) showed a significant difference for healing. The HB-EGF healed TMs showed layers similar to a normal TM, whereas the other groups showed a lack of epithelial migration. This study confirms the advantage of HB-EGF over two other commonly used growth factors and is a promising nonsurgical treatment of chronic TM perforations.

  18. The characteristics of human antibody targeting the Epidermal Growth Factor Receptor in vivo for radioimmunotherapy in a small animal model

    Energy Technology Data Exchange (ETDEWEB)

    Kim, Eun Jung; Choi, Tae Hyun; Kim, Byoung Soo; Cheon, Gi Jeong [Korea Institue of Radiological and Medical Sciences, Seoul (Korea, Republic of); Hong, Kwang Won; Chang, Ki Hwan; Shin, Yong Won; Ryoo, Kyung Hwan; Shin, Yong Nam; Kim, Se Ho [Green Cross Corp., Yongin (Korea, Republic of)

    2010-05-15

    The identification of epidermal growth factor receptor (EGFR) as an oncogene has led to the development of anticancer therapeutics directed against EGFR, including Erbitux for colon cancer. Many therapeutic approaches are aimed at the EGFR. Erbitux is example of monoclonal antibody inhibitors. The monoclonal antibodies block the extracellular ligand binding domain. EGFR4-2, IgG human monoclonal antibody, has been developed on the basis of human antibody gene library in Green Cross Corp. Small animal imaging is useful for preclinical evaluation of radiolabeled antibody to see biodistribution and targeting ability at serial time points in same animals

  19. Human epidermal Langerhans cells express the high affinity receptor for immunoglobulin E (Fc epsilon RI)

    OpenAIRE

    1992-01-01

    It has been suggested that epidermal Langerhans cells (LC) bearing immunoglobulin E (IgE) may be involved in the genesis of atopic disease. The identity of the IgE receptor(s) on LC remained unclear, although it represents a crucial point in understanding cellular events linked to the binding of allergens to LC via IgE. In this report, we demonstrate that epidermal LC express the high affinity receptor for the Fc fragment of IgE (Fc epsilon RI) which has, so far, only been described on mast c...

  20. Pattern of distribution of blood group antigens on human epidermal cells during maturation

    DEFF Research Database (Denmark)

    Dabelsteen, Erik; Buschard, Karsten; Hakomori, Sen-Itiroh

    1984-01-01

    The distribution in human epidermis of A, B, and H blood group antigens and of a precursor carbohydrate chain, N-acetyl-lactosamine, was examined using immunofluorescence staining techniques. The material included tissue from 10 blood group A, 4 blood group B, and 9 blood group O persons. Murine...... on the lower spinous cells whereas H antigen was seen predominantly on upper spinous cells or on the granular cells. Epithelia from blood group A or B persons demonstrated A or B antigens, respectively, but only if the tissue sections were trypsinized before staining. In such cases A or B antigens were found...... monoclonal antibodies were used to identify H antigen (type 2 chain) and N-acetyl-lactosamine. Human antisera were used to identify A and B antigens. In all groups N-acetyl-lactosamine and H antigen were found on the cell membranes of the spinous cell layer. N-acetyl-lactosamine was present mainly...

  1. Epidermal growth factor potentiates in vitro metastatic behaviour of human prostate cancer PC-3M cells: involvement of voltage-gated sodium channel

    Directory of Open Access Journals (Sweden)

    Uysal-Onganer Pinar

    2007-11-01

    Full Text Available Abstract Background Although a high level of functional voltage-gated sodium channel (VGSC expression has been found in strongly metastatic human and rat prostate cancer (PCa cells, the mechanism(s responsible for the upregulation is unknown. The concentration of epidermal growth factor (EGF, a modulator of ion channels, in the body is highest in prostatic fluid. Thus, EGF could be involved in the VGSC upregulation in PCa. The effects of EGF on VGSC expression in the highly metastatic human PCa PC-3M cell line, which was shown previously to express both functional VGSCs and EGF receptors, were investigated. A quantitative approach, from gene level to cell behaviour, was used. mRNA levels were determined by real-time PCR. Protein expression was studied by Western blots and immunocytochemistry and digital image analysis. Functional assays involved measurements of transverse migration, endocytic membrane activity and Matrigel invasion. Results Exogenous EGF enhanced the cells' in vitro metastatic behaviours (migration, endocytosis and invasion. Endogenous EGF had a similar involvement. EGF increased VGSC Nav1.7 (predominant isoform in PCa mRNA and protein expressions. Co-application of the highly specific VGSC blocker tetrodotoxin (TTX suppressed the effect of EGF on all three metastatic cell behaviours studied. Conclusion 1 EGF has a major involvement in the upregulation of functional VGSC expression in human PCa PC-3M cells. (2 VGSC activity has a significant intermediary role in potentiating effect of EGF in human PCa.

  2. Effect of glucocorticoid on epidermal growth factor receptor in human salivary gland adenocarcinoma cell line HSG.

    Science.gov (United States)

    Kyakumoto, S; Kurokawa, R; Ota, M

    1990-07-12

    Human salivary gland adenocarcinoma (HSG) cells treated with 10(-6) M triamcinolone acetonide for 48 h exhibited a 1.7- to 2.0-fold increase in [125I]human epidermal growth factor (hEGF) binding capacity as compared with untreated HSG cells. Scatchard analysis of [125I]EGF binding data revealed that the number of binding sites was 83,700 (+/- 29,200) receptors/cell in untreated cells and 160,500 (+/- 35,500) receptors/cell in treated cells. No substantial change in receptor affinity was detected. The dissociation constant of the EGF receptor was 0.78 (+/- 0.26).10(-9) M for untreated cells, whereas it was 0.93 (+/- 0.31).10(-9)M for treated cells. The triamcinolone acetonide-induced increase in [125I]EGF binding capacity was dose-dependent between 10(-9) and 10(-6)M, and maximal binding was observed at 10(-6)M. EGF receptors on HSG cells were affinity-labeled with [125I]EGF by use of the cross-linking reagent disuccinimidyl suberate (DSS). The cross-linked [125I]EGF was 3-4% of the total [125I]EGF bound to HSG cells. The affinity-labeled EGF receptor was detected as a specific 170 kDa band in the autoradiograph after SDS-polyacrylamide gel electrophoresis (SDS-PAGE). Densitometric analysis revealed that triamcinolone acetonide amplified the intensity of this band 2.0-fold over that of the band of untreated cells. EGF receptor synthesis was also measured by immunoprecipitation of [3H]leucine-labeled EGF receptor protein with anti-hEGF receptor monoclonal antibody. Receptor synthesis was increased 1.7- to 1.8-fold when HSG cells were treated with 10(-8)-10(-6)M triamcinolone acetonide for 48 h. When the immunoprecipitated, [35S]methionine-pulse-labeled EGF receptor was analyzed by SDS-PAGE and fluorography, the newly synthesized EGF receptor was detected at the position of 170 kDa; and treatment of HSG cells with triamcinolone acetonide resulted in a 2.0-fold amplification of this 170 kDa band. There was no significant difference in turnover rate of EGF receptor

  3. IgG and IgA with Potential Microbial-Binding Activity Are Expressed by Normal Human Skin Epidermal Cells

    Directory of Open Access Journals (Sweden)

    Dongyang Jiang

    2015-01-01

    Full Text Available The innate immune system of the skin is thought to depend largely on a multi-layered mechanical barrier supplemented by epidermis-derived antimicrobial peptides. To date, there are no reports of antimicrobial antibody secretion by the epidermis. In this study, we report the expression of functional immunoglobulin G (IgG and immunoglobulin A (IgA, previously thought to be only produced by B cells, in normal human epidermal cells and the human keratinocyte line HaCaT. While B cells express a fully diverse Ig, epidermal cell-expressed IgG or IgA showed one or two conservative VHDJH rearrangements in each individual. These unique VDJ rearrangements in epidermal cells were found neither in the B cell-derived Ig VDJ databases published by others nor in our positive controls. IgG and IgA from epidermal cells of the same individual had different VDJ rearrangement patterns. IgG was found primarily in prickle cells, and IgA was mainly detected in basal cells. Both epidermal cell-derived IgG and IgA showed potential antibody activity by binding pathogens like Staphylococcus aureus, the most common pathogenic skin bacteria, but the microbial-binding profile was different. Our data indicates that normal human epidermal cells spontaneously express IgG and IgA, and we speculate that these Igs participate in skin innate immunity.

  4. Expression of T-Lymphocyte Markers in Human Epidermal Growth Factor Receptor 2-Positive Breast Cancer

    Science.gov (United States)

    Lee, Changro; Kim, Joo Heung; Lim, Sung Mook; Park, Hyung Seok; Kim, Seung Il; Park, Byeong-Woo

    2016-01-01

    Purpose The present study aimed to examine the clinical implications of CD4, CD8, and FOXP3 expression on the prognosis of human epidermal growth factor receptor 2 (HER2)-positive breast cancer using a web-based database, and to compare the immunohistochemical expression of T-lymphocyte markers using primary and metastatic HER2-positive tumor tissues before and after HER2-targeted therapy. Methods Using the cBioPortal for Cancer Genomics and Kaplan-Meier plotter, the mRNA expression, association between T-lymphocyte markers, and survival in HER2-positive cancers were investigated according to various cutoff levels. Immunohistochemistry analysis was performed using paired primary and metastatic tissues of 29 HER2-positive tumors treated with systemic chemotherapy and HER2-directed therapy. Results HER2 mRNA was mutually exclusive of T-lymphocyte markers, and a significant correlation between T-cell markers was observed in the cBioPortal for Cancer Genomics. According to analysis of the Kaplan-Meier plotter, the impact of T-lymphocyte marker expression on survival was statistically insignificant in clinical HER2-positive tumors, irrespective of the cutoff levels. However, in the intrinsic HER2-positive subtype, the individual analyses of T-cell markers except for FOXP3 and combined analysis showed significantly favorable survival irrespective of cutoff points. Although the small clinical sample size made it difficult to show the statistical relevance of immunohistochemistry findings, good responses to neoadjuvant treatments might be associated with positive expression of combined T-lymphocyte markers, and approximately half of the samples showed discordance of combined markers between baseline and resistant tumors. Conclusion T-lymphocyte markers could be favorable prognostic factors in HER2-positive breast cancers; however, a consensus on patient section criteria, detection methods, and cutoff value could not be reached. The resistance to HER2-directed therapy might

  5. Expression of Human Epidermal Growth Factor Receptor-2 in Resected Rectal Cancer

    Science.gov (United States)

    Meng, Xiangjiao; Huang, Zhaoqin; Di, Jian; Mu, Dianbin; Wang, Yawei; Zhao, Xianguang; Zhao, Hanxi; Zhu, Wanqi; Li, Xiaolin; Kong, Lingling; Xing, Ligang

    2015-01-01

    Abstract The addition of trastuzumab to chemotherapy was demonstrated to be beneficial for advanced human epidermal growth factor receptor-2 (HER-2) positive gastric cancer. However, the HER-2 status of rectal cancer remains uncertain. This study aimed to determine the HER-2 expression in a large multicenter cohort of rectal cancer patients. The clinical and pathological features of 717 patients were retrospectively reviewed. All the patients were diagnosed with primary rectal adenocarcinoma without distant metastasis and took surgery directly without any preoperative anticancer treatment. HER-2 status was assessed on resected samples. A total of 99 cases with IHC3+ and 16 cases with IHC 2+ plus gene amplification were determined as HER-2 positive. 22.6% of HER-2 positive patients had local recurrence, whereas 16.9% of HER-2 negative patients did (P = 0.146). HER-2 positive tumors were more likely to have distant metastasis (P = 0.007). Univariate analysis revealed that pathological tumor stage, pathological node stage, positive margin, and lymphovascular invasion were significantly correlated with 5-year disease-free survival (DFS) and 5-year overall survival (OS). The patients with >10 dissected lymph nodes showed significantly longer OS (P = 0.045) but not DFS (P = 0.054). HER-2 negative patients had significantly better 5-year DFS (P < 0.001) and 5-year OS (P = 0.013) than those of the HER-2 positive patients. In the subgroup analysis for the early rectal cancer and locally advanced rectal cancer, HER-2 was also a poor predictor for survival. Multivariate analysis revealed that HER-2 was an independent prognostic factor for 5-year DFS (hazard ratio [HR] = 1.919, 95% confidence interval [CI] 1.415–2.605, P < 0.001) and for 5-year OS (HR = 1.549, 95% CI 1.097–2.186, P = 0.013). When the treatment was included in the analysis for locally advanced patients, HER-2 was a prognostic factor for 5-year DFS (P = 0.001) but not for

  6. Triggering apoptotic death of human epidermal keratinocytes by malic Acid: involvement of endoplasmic reticulum stress- and mitochondria-dependent signaling pathways.

    Science.gov (United States)

    Hsiao, Yu-Ping; Lai, Wan-Wen; Wu, Shi-Bei; Tsai, Chung-Hung; Tang, Sheau-Chung; Chung, Jing-Gung; Yang, Jen-Hung

    2015-01-09

    Malic acid (MA) has been commonly used in cosmetic products, but the safety reports in skin are sparse. To investigate the biological effects of MA in human skin keratinocytes, we investigated the potential cytotoxicity and apoptotic effects of MA in human keratinocyte cell lines (HaCaT). The data showed that MA induced apoptosis based on the observations of DAPI staining, DNA fragmentation, and sub-G1 phase in HaCaT cells and normal human epidermal keratinocytes (NHEKs). Flow cytometric assays also showed that MA increased the production of mitochondrial superoxide (mito-SOX) but decreased the mitochondrial membrane potential. Analysis of bioenergetics function with the XF 24 analyzer Seahorse extracellular flux analyzer demonstrated that oxygen consumption rate (OCR) was significantly decreased whereas extracellular acidification rate (ECAR) was increased in MA-treated keratinocytes. The occurrence of apoptosis was proved by the increased expressions of FasL, Fas, Bax, Bid, caspases-3, -8, -9, cytochrome c, and the declined expressions of Bcl-2, PARP. MA also induced endoplasmic reticulum stress associated protein expression such as GRP78, GADD153, and ATF6α. We demonstrated that MA had anti-proliferative effect in HaCaT cell through the inhibition of cell cycle progression at G0/G1, and the induction of programmed cell death through endoplasmic reticulum stress- and mitochondria-dependent pathways.

  7. Triggering Apoptotic Death of Human Epidermal Keratinocytes by Malic Acid: Involvement of Endoplasmic Reticulum Stress- and Mitochondria-Dependent Signaling Pathways

    Directory of Open Access Journals (Sweden)

    Yu-Ping Hsiao

    2015-01-01

    Full Text Available Malic acid (MA has been commonly used in cosmetic products, but the safety reports in skin are sparse. To investigate the biological effects of MA in human skin keratinocytes, we investigated the potential cytotoxicity and apoptotic effects of MA in human keratinocyte cell lines (HaCaT. The data showed that MA induced apoptosis based on the observations of DAPI staining, DNA fragmentation, and sub-G1 phase in HaCaT cells and normal human epidermal keratinocytes (NHEKs. Flow cytometric assays also showed that MA increased the production of mitochondrial superoxide (mito-SOX but decreased the mitochondrial membrane potential. Analysis of bioenergetics function with the XF 24 analyzer Seahorse extracellular flux analyzer demonstrated that oxygen consumption rate (OCR was significantly decreased whereas extracellular acidification rate (ECAR was increased in MA-treated keratinocytes. The occurrence of apoptosis was proved by the increased expressions of FasL, Fas, Bax, Bid, caspases-3, -8, -9, cytochrome c, and the declined expressions of Bcl-2, PARP. MA also induced endoplasmic reticulum stress associated protein expression such as GRP78, GADD153, and ATF6α. We demonstrated that MA had anti-proliferative effect in HaCaT cell through the inhibition of cell cycle progression at G0/G1, and the induction of programmed cell death through endoplasmic reticulum stress- and mitochondria-dependent pathways.

  8. Repeated short climatic change affects the epidermal differentiation program and leads to matrix remodeling in a human organotypic skin model

    Science.gov (United States)

    Boutrand, Laetitia-Barbollat; Thépot, Amélie; Muther, Charlotte; Boher, Aurélie; Robic, Julie; Guéré, Christelle; Vié, Katell; Damour, Odile; Lamartine, Jérôme

    2017-01-01

    Human skin is subject to frequent changes in ambient temperature and humidity and needs to cope with these environmental modifications. To decipher the molecular response of human skin to repeated climatic change, a versatile model of skin equivalent subject to “hot–wet” (40°C, 80% relative humidity [RH]) or “cold–dry” (10°C, 40% RH) climatic stress repeated daily was used. To obtain an exhaustive view of the molecular mechanisms elicited by climatic change, large-scale gene expression DNA microarray analysis was performed and modulated function was determined by bioinformatic annotation. This analysis revealed several functions, including epidermal differentiation and extracellular matrix, impacted by repeated variations in climatic conditions. Some of these molecular changes were confirmed by histological examination and protein expression. Both treatments (hot–wet and cold–dry) reduced the expression of genes encoding collagens, laminin, and proteoglycans, suggesting a profound remodeling of the extracellular matrix. Strong induction of the entire family of late cornified envelope genes after cold–dry exposure, confirmed at protein level, was also observed. These changes correlated with an increase in epidermal differentiation markers such as corneodesmosin and a thickening of the stratum corneum, indicating possible implementation of defense mechanisms against dehydration. This study for the first time reveals the complex pattern of molecular response allowing adaption of human skin to repeated change in its climatic environment.

  9. Shape-induced terminal differentiation of human epidermal stem cells requires p38 and is regulated by histone acetylation.

    Directory of Open Access Journals (Sweden)

    John T Connelly

    Full Text Available Engineered model substrates are powerful tools for examining interactions between stem cells and their microenvironment. Using this approach, we have previously shown that restricted cell adhesion promotes terminal differentiation of human epidermal stem cells via activation of serum response factor (SRF and transcription of AP-1 genes. Here we investigate the roles of p38 MAPK and histone acetylation. Inhibition of p38 activity impaired SRF transcriptional activity and shape-induced terminal differentiation of human keratinocytes. In addition, inhibiting p38 reduced histone H3 acetylation at the promoters of SRF target genes, FOS and JUNB. Although histone acetylation correlated with SRF transcriptional activity and target gene expression, treatment with the histone de-acetylase inhibitor, trichostatin A (TSA blocked terminal differentiation on micro-patterned substrates and in suspension. TSA treatment simultaneously maintained expression of LRIG1, TP63, and ITGB1. Therefore, global histone de-acetylation represses stem cell maintenance genes independent of SRF. Our studies establish a novel role for extrinsic physical cues in the regulation of chromatin remodeling, transcription, and differentiation of human epidermal stem cells.

  10. Activated protein C: A regulator of human skin epidermal keratinocyte function.

    Science.gov (United States)

    McKelvey, Kelly; Jackson, Christopher John; Xue, Meilang

    2014-05-26

    Activated protein C (APC) is a physiological anticoagulant, derived from its precursor protein C (PC). Independent of its anticoagulation, APC possesses strong anti-inflammatory, anti-apoptotic and barrier protective properties which appear to be protective in a number of disorders including chronic wound healing. The epidermis is the outermost skin layer and provides the first line of defence against the external environment. Keratinocytes are the most predominant cells in the epidermis and play a critical role in maintaining epidermal barrier function. PC/APC and its receptor, endothelial protein C receptor (EPCR), once thought to be restricted to the endothelium, are abundantly expressed by skin epidermal keratinocytes. These cells respond to APC by upregulating proliferation, migration and matrix metalloproteinase-2 activity and inhibiting apoptosis/inflammation leading to a wound healing phenotype. APC also increases barrier function of keratinocyte monolayers by promoting the expression of tight junction proteins and re-distributing them to cell-cell contacts. These cytoprotective properties of APC are mediated through EPCR, protease-activated receptors, epidermal growth factor receptor or Tie2. Future preventive and therapeutic uses of APC in skin disorders associated with disruption of barrier function and inflammation look promising. This review will focus on APC's function in skin epidermis/keratinocytes and its therapeutical potential in skin inflammatory conditions.

  11. Activated protein C: A regulator of human skin epidermal keratinocyte function

    Institute of Scientific and Technical Information of China (English)

    Kelly; McKelvey; Christopher; John; Jackson; Meilang; Xue

    2014-01-01

    Activated protein C(APC) is a physiological anticoagulant, derived from its precursor protein C(PC). Independent of its anticoagulation, APC possesses strong anti-inflammatory, anti-apoptotic and barrier protective properties which appear to be protective in a number of disorders including chronic wound healing. The epidermis is the outermost skin layer and provides the first line of defence against the external environment. Keratinocytes are the most predominant cells in the epidermis and play a critical role in maintaining epidermal barrier function. PC/APC and its receptor, endothelial protein C receptor(EPCR), once thought to be restricted to the endothelium, are abundantly expressed by skin epidermal keratinocytes. These cells respond to APC by upregulating proliferation, migration and matrix metalloproteinase-2 activity and inhibiting apoptosis/inflammation leading to a wound healing phenotype. APC also increases barrier function of keratinocyte monolayers by promoting the expression of tight junction proteins and re-distributing them to cell-cell contacts. These cytoprotective properties of APC are mediated through EPCR, protease-activated receptors, epidermal growth factor receptor or Tie2. Future preventive and therapeutic uses of APC in skin disorders associated with disruption of barrier function and inflammation look promising. This review will focus on APC’s function in skin epidermis/keratinocytes and its therapeutical potential in skin inflammatory conditions.

  12. Human epidermal growth factor receptor-2 in oesophageal cancers: An observational study

    Institute of Scientific and Technical Information of China (English)

    Hazem Al-Momani; Rachel Barnes; Ahmed El-Hadi; Rachit Shah; Wyn G Lewis; Paul Edwards

    2012-01-01

    AIM:To determine the incidence of human epidermal growth factor receptor 2 (HER2) over expression in oesophageal cancers.METHODS:A retrospective study,of one hundred consecutive cases of endoscopic histological samples of oesophageal cancers from a single British cancer network were included.Cancer cases were diagnosed between April 2007 and June 2010.HER2 over expression was assessed using immunohistochemistry,those that scored "0" and "+1" were considered "negative"for HER2; those that scored "+3" were considered "Positive".Cases that were scored "+2" on immunohistochemistry further went on to have HER2 gene analysis using the Ventana HER brightfield dual-colour in situ hybridisations (HER B DISH) assay and either came back to be positive or negative for HER2 over expression.Overall survival was measured from date of histological diagnosis until date of death.93% of the cases were followed up till five years or death,and all were followed up till two years.Cases of gastro-oesophageal junctional tumours were excluded.RESULTS:The median age of our sample was 66years (range:38-91 years).Eighty one were male and 19 female.Ninety-one of the cases were adenocarcinoma of the oesophagus and the rest were cases of squamous cell carcinoma.The anatomical distribution of the tumours was; upper oesophagus 2,middle oesophagus 11,and 87 were in the lower oesophagus.Operative resection was completed in 15 cases; seven cases had attempted surgical resections,i.e.,open and close,33 patients received definitive chemo-radiation and 52 had palliative treatment.Twenty-five of the cancers showed evidence of HER2 over expression,all were adenocarcinomas.Of the 25 cases that showed evidence of HER2 over expression,21 (84%) were located in the lower third of the oesophagus.On staging,24 out of the 25 HER2 positive cases were at stage 3or more (13 at stage 3 and 11 at stage 4),For HER2 negative cases 37 were at stage 3 and 32 were staged as stage 4.Seventeen out of twenty five cases

  13. De novo epidermal regeneration using human eccrine sweat gland cells: higher competence of secretory over absorptive cells.

    Science.gov (United States)

    Pontiggia, Luca; Biedermann, Thomas; Böttcher-Haberzeth, Sophie; Oliveira, Carol; Braziulis, Erik; Klar, Agnieszka S; Meuli-Simmen, Claudia; Meuli, Martin; Reichmann, Ernst

    2014-06-01

    In our previous work, we showed that human sweat gland-derived epithelial cells represent an alternative source of keratinocytes to grow a near normal autologous epidermis. The role of subtypes of sweat gland cells in epidermal regeneration and maintenance remained unclear. In this study, we compare the regenerative potential of both secretory and absorptive sweat gland cell subpopulations. We demonstrate the superiority of secretory over absorptive cells in forming a new epidermis on two levels: first, the proliferative and colony-forming efficiencies in vitro are significantly higher for secretory cells (SCs), and second, SCs show a higher frequency of successful epidermis formation as well as an increase in the thickness of the formed epidermis in the in vitro and in vivo functional analyses using a 3D dermo-epidermal skin model. However, the ability of forming functional skin substitutes is not limited to SCs, which supports the hypothesis that multiple subtypes of sweat gland epithelial cells hold regenerative properties, while the existence and exact localization of a keratinocyte stem cell population in the human eccrine sweat gland remain elusive.

  14. [Biomechanical characteristics of human fetal membranes. Preterm fetal membranes are stronger than term fetal membranes].

    Science.gov (United States)

    Rangaswamy, N; Abdelrahim, A; Moore, R M; Uyen, L; Mercer, B M; Mansour, J M; Kumar, D; Sawady, J; Moore, J J

    2011-06-01

    The purpose of this study was to determine the biomechanical characteristics of human fetal membranes (FM) throughout gestation. Biomechanical properties were determined for 115 FM of 23-41 weeks gestation using our previously described methodology. The areas of membrane immediately adjacent to the strongest and weakest tested spots were sampled for histomorphometric analysis. Clinical data on the patients whose FM were examined were also collected. FM less than 28 weeks gestation were associated with higher incidence of abruption and chorioamnionitis. Topographically FM at all gestations had heterogeneous biomechanical characteristics over their surfaces with distinct weak areas. The most premature membranes were the strongest. FM strength represented by rupture force and work to rupture decreased with increasing gestation in both weak and strong regions of FM. This decrease in FM strength was most dramatic at more than 38 weeks gestation. The FM component amnion-chorion sublayers were thinner in the weak areas compared to strong areas. Compared to term FM, preterm FM are stronger but have similar heterogeneous weak and strong areas. Following a gradual increase in FM weakness with increasing gestation, there is a major drop-off at term 38 weeks gestation. The FM weak areas are thinner than the stronger areas. Whether the difference in thickness is enough to account for the strength differences is unknown.

  15. Zinc oxide nanoparticles-induced epigenetic change and G2/M arrest are associated with apoptosis in human epidermal keratinocytes

    Directory of Open Access Journals (Sweden)

    Gao F

    2016-08-01

    Full Text Available Fei Gao, Ningjie Ma, Hong Zhou, Qing Wang, Hao Zhang, Pu Wang, Haoli Hou, Huan Wen, Lijia Li State Key Laboratory of Hybrid Rice, College of Life Sciences, Wuhan University, Wuhan, People’s Republic of China Abstract: As an engineered nanomaterial, zinc oxide nanoparticles (ZnO NPs are used frequently in biological applications and can make contact with human skin. Here, we systematically investigated the effects of ZnO NPs on non-tumorigenic human epidermal keratinocytes, which were used as a test model for this in vitro study, at the epigenetic and molecular levels. Our results showed that ZnO NPs induced cell cycle arrest at the G2/M checkpoint before the viability of human epidermal keratinocytes was reduced, which was associated with the chromatin changes at the epigenetic level, including increased methylation of histone H3K9 and decreased acetylation of histone H4K5 accompanied by chromatin condensation at 24 hours. The mRNA expression of the methyltransferase genes G9a and GLP was also increased upon treatment with ZnO NPs, and the acetyltransferase genes GCN5, P300, and CBP were downregulated. Reactive oxygen species were found to be more abundant after treatment with ZnO NPs for 6 hours, and DNA damage was observed at 24 hours. Transmission electron microscopy and flow cytometry confirmed that ZnO NPs were absorbed into the cell when they were added to the medium. Apoptotic human epidermal keratinocytes were detected, and the expression of the proapoptotic genes Bax, Noxa, and Puma increased significantly, while the expression of the antiapoptotic gene Bcl-xl decreased 24 hours after exposure to ZnO NPs. These findings suggest that the ZnO NPs induced cell cycle arrest at G2/M, which was associated with epigenetic changes and accompanied by p53-Bax mitochondrial pathway-mediated apoptosis. Keywords: ZnO nanoparticle, cell cycle G2/M arrest, histone modification, p53-Bax mitochondrial apoptosis pathway, reactive oxygen species

  16. Interferon alpha2 recombinant and epidermal growth factor modulate proliferation and hypusine synthesis in human epidermoid cancer KB cells.

    Science.gov (United States)

    Caraglia, M; Passeggio, A; Beninati, S; Leardi, A; Nicolini, L; Improta, S; Pinto, A; Bianco, A R; Tagliaferri, P; Abbruzzese, A

    1997-06-15

    We previously found that interferon alpha2 recombinant (IFNalpha) increases the expression of epidermal growth factor receptor (EGF-R) in the human epidermoid cancer KB cell line. Here we report the effects of IFNalpha and epidermal growth factor (EGF) on KB cell cycle kinetics. IFNalpha (1000 i.u./ml) for 48 h decreased the S-phase fraction and diminished the expression of Ki67 and proliferating cell nuclear antigen on KB cells. Incubation of IFNalpha-treated KB cells with 10 nM EGF for 12 h reversed these effects. We then studied several biochemical markers of cell proliferation. Ornithine decarboxylase activity was decreased to about one-tenth by IFNalpha and partly restored by EGF. Hypusine is contained only in eukaryotic initiation factor 5A and its levels are correlated with cell proliferation. IFNalpha decreased hypusine synthesis by 75%; exposure of cells to EGF for 12 h restored hypusine synthesis almost completely. We also studied the effects of IFNalpha on the cytotoxicity of the recombinant toxin TP40, which inhibits elongation factor 2 through EGF-R binding and internalization. IFNalpha greatly enhanced the TP40-induced inhibition of protein synthesis in KB cells. In conclusion, IFNalpha, which affects protein synthesis machinery and increases EGF-R expression, enhances the tumoricidal activity of TP40 and hence could be useful in the setting of anti-cancer therapy.

  17. Dnmt3a and Dnmt3b Associate with Enhancers to Regulate Human Epidermal Stem Cell Homeostasis.

    Science.gov (United States)

    Rinaldi, Lorenzo; Datta, Debayan; Serrat, Judit; Morey, Lluis; Solanas, Guiomar; Avgustinova, Alexandra; Blanco, Enrique; Pons, José Ignacio; Matallanas, David; Von Kriegsheim, Alex; Di Croce, Luciano; Benitah, Salvador Aznar

    2016-10-06

    The genome-wide localization and function of endogenous Dnmt3a and Dnmt3b in adult stem cells are unknown. Here, we show that in human epidermal stem cells, the two proteins bind in a histone H3K36me3-dependent manner to the most active enhancers and are required to produce their associated enhancer RNAs. Both proteins prefer super-enhancers associated to genes that either define the ectodermal lineage or establish the stem cell and differentiated states. However, Dnmt3a and Dnmt3b differ in their mechanisms of enhancer regulation: Dnmt3a associates with p63 to maintain high levels of DNA hydroxymethylation at the center of enhancers in a Tet2-dependent manner, whereas Dnmt3b promotes DNA methylation along the body of the enhancer. Depletion of either protein inactivates their target enhancers and profoundly affects epidermal stem cell function. Altogether, we reveal novel functions for Dnmt3a and Dnmt3b at enhancers that could contribute to their roles in disease and tumorigenesis.

  18. The interaction between epidermal growth factor (EGF) and matrix metalloproteinase induces the development of sweat glands in human fetal skin

    Institute of Scientific and Technical Information of China (English)

    Li Jianfu; Fu Xiaobing; Sheng Zhiyong

    2001-01-01

    Objective:The development of sweat glands is a very complicated biological process involving many factors. In this study, we explore the inter-relationship between epidermal growth factor (EGF),matrix metalloproteinases (MMP-2,MMP-7) and development of sweat glands in human embryos. Furthermore, we hope to elucidate the mechanism(s) underlying the induction of epidermal stem cells into sweat gland cells. Methods:Skin biospies of human embryos obtained from spontaneous abortions at different gestational ages from 11 to 31 weeks were used in this study. The dynamical expression of EGF, MMP-2, MMP-7 and keratin-7 (K7) in developing sweat gland cells or extracellular stroma surrounding the sweat gland cells were examined with S-P immunohistochemical methods.The localization of the cellular sources of MMP-2 and MMP 7 was examined with in situ hybridization. Results:At 14-20 wk of gestation, a gradual increase in EGF immunoreactivity was observed not only in developing sweat gland buds but also in extracellular stroma surrounding the buds,and the expression intensity peaked at 20-22 wk of gesta- tional age. All mRNA-positive buds or cells in developing sweat glands contained corresponding immunoreactive proteins. Positive immunostaining for K7 appeared in early sweat gland buds at 14-16wk of gestation, and from then on, K7 was concentrated in developing sweat gland cords or cells. Conclusions: The morphogenesis of sweat gland in human fetal skin begins at 14-16wk of gestational age, and essentially completes by 24wk. There is a close relationship among EGF,extracellular matrix remodeling and morphogenesis of sweat glands, and EGF is one of the inducers in the development and maturity of sweat gland buds or cells.

  19. Differential regulation of human Eag1 channel expression by serum and epidermal growth factor in lung and breast cancer cells

    Directory of Open Access Journals (Sweden)

    Acuña-Macías I

    2015-10-01

    Full Text Available Isabel Acuña-Macías,1 Eunice Vera,1 Alma Yolanda Vázquez-Sánchez,1 María Eugenia Mendoza-Garrido,2 Javier Camacho1 1Department of Pharmacology, 2Department of Physiology, Biophysics and Neurosciences, Centro de Investigación y de Estudios Avanzados del Instituto Politécnico Nacional, Mexico City, Mexico Abstract: Oncogenic ether à-go-go-1 (Eag1 potassium channels are overexpressed in most primary human solid tumors. Low oxygen and nutrient/growth factor concentrations play critical roles in tumorigenesis. However, the mechanisms by which tumor cells survive and proliferate under growth factor-depleted conditions remain elusive. Here, we investigated whether serum-deprived conditions and epidermal growth factor (EGF regulate Eag1 expression in human lung and breast cancer cells. The human cancer cell lines A549 and MCF-7 (from the lungs and breast, respectively were obtained from the American Type Culture Collection and cultured following the manufacturer’s recommendations. Eag1 gene and protein expression were studied by real-time PCR and immunocytochemistry, respectively. Cell proliferation was evaluated using the 3-(4,5-dimethylthiazol-2-yl-2,5-diphenyltetrazolium bromide assay, and ERK1/2 phosphorylation was investigated by Western blot. Serum-deprived conditions increased Eag1 mRNA and protein expression in both cell lines. This Eag1 upregulation was prevented by EGF and the ERK1/2 inhibitor U0126 in only lung cancer cells; vascular endothelial growth factor did not prevent Eag1 upregulation. Our results suggest that Eag1 may act as a survival and mitogenic factor under low-serum and nutrient conditions and may be a clinical target during the early stages of tumor development. Keywords: lung cancer, serum deprivation, ether à-go-go, potassium channels, EGF, epidermal growth factor, ERK 1/2

  20. Phase III randomized study comparing docetaxel plus trastuzumab with vinorelbine plus trastuzumab as first-line therapy of metastatic or locally advanced human epidermal growth factor receptor 2-positive breast cancer: the HERNATA study

    DEFF Research Database (Denmark)

    Andersson, Michael; Lidbrink, Elisabeth; Bjerre, Karsten;

    2011-01-01

    To evaluate docetaxel or vinorelbine, both with trastuzumab, as first-line therapy of human epidermal growth factor receptor 2-positive advanced breast cancer.......To evaluate docetaxel or vinorelbine, both with trastuzumab, as first-line therapy of human epidermal growth factor receptor 2-positive advanced breast cancer....

  1. Biological skin substitutes to treat toxic epidermal necrolysis in a case with human immunodeficiency virus infection

    Directory of Open Access Journals (Sweden)

    Anokha Oomman

    2014-01-01

    Full Text Available Toxic epidermal necrolysis (TEN is a rare, but life-threatening medical emergency with significant morbidity and mortality. Current treatment standards for TEN patients include stopping all possible drugs associated with the new onset of symptoms, prompt referral and treatment in a specialized center with fluid resuscitation, adequate analgesia and maintenance of nutritional needs. Extensive debridement of the involved epidermis followed by coverage with a skin substitute reduces the mortality from a skin infection and also improves the fluid and electrolyte balance and pain control. This is increasingly considered an important part of the intensive care of these patients. Admitting physicians should be aware of this rare but life-threatening emergency, to allow prompt diagnosis and avoid delays in treatment.

  2. In vivo UVB irradiation induces clustering of Fas (CD95) on human epidermal cells

    DEFF Research Database (Denmark)

    Bang, Bo; Gniadecki, Robert; Larsen, Jørgen K

    2003-01-01

    a single dose of UVB irradiation. Normal healthy individuals were irradiated with three minimal erythema doses (MED) of UVB on forearm or buttock skin. Suction blisters from unirradiated and irradiated skin were raised, and Fas, FasL, and apoptosis of epidermal cells quantified by flow cytometry....... Clustering of Fas was from skin biopsied. Soluble FasL in suction blister fluid was quantified by ELISA. Flow cytometric analysis demonstrated increased expression intensity of Fas after irradiation, with 1.6-,2.2- and 2.7-fold increased median expression at 24, 48 and 72 h after irradiation, respectively (n...... of soluble FasL in suction blister fluid from UVB-irradiated skin did not differ from those in unirradiated skin (n=5). Confocal laser scanning microscopy showed a rapid clustering of Fas within 30 min after irradiation. A simultaneous clustering of the adapter signalling protein FADD suggested that Fas...

  3. A Premature Termination of Human Epidermal Growth Factor Receptor Transcription in Escherichia coli

    Directory of Open Access Journals (Sweden)

    Jihene Elloumi-Mseddi

    2014-01-01

    Full Text Available Our success in producing an active epidermal growth factor receptor (EGFR tyrosine kinase in Escherichia coli encouraged us to express the full-length receptor in the same host. Despite its large size, we were successful at producing the full-length EGFR protein fused to glutathione S-transferase (GST that was detected by Western blot analysis. Moreover, we obtained a majoritarian truncated GST-EGFR form detectable by gel electrophoresis and Western blot. This truncated protein was purified and confirmed by MALDI-TOF/TOF analysis to belong to the N-terminal extracellular region of the EGFR fused to GST. Northern blot analysis showed two transcripts suggesting the occurrence of a transcriptional arrest.

  4. Transcriptional profiling of epidermal differentiation.

    Science.gov (United States)

    Radoja, Nada; Gazel, Alix; Banno, Tomohiro; Yano, Shoichiro; Blumenberg, Miroslav

    2006-10-03

    In epidermal differentiation basal keratinocytes detach from the basement membrane, stop proliferating, and express a new set of structural proteins and enzymes, which results in an impermeable protein/lipid barrier that protects us. To define the transcriptional changes essential for this process, we purified large quantities of basal and suprabasal cells from human epidermis, using the expression of beta4 integrin as the discriminating factor. The expected expression differences in cytoskeletal, cell cycle, and adhesion genes confirmed the effective separation of the cell populations. Using DNA microarray chips, we comprehensively identify the differences in genes expressed in basal and differentiating layers of the epidermis, including the ECM components produced by the basal cells, the proteases in both the basal and suprabasal cells, and the lipid and steroid metabolism enzymes in suprabasal cells responsible for the permeability barrier. We identified the signaling pathways specific for the two populations and found two previously unknown paracrine and one juxtacrine signaling pathway operating between the basal and suprabasal cells. Furthermore, using specific expression signatures, we identified a new set of late differentiation markers and mapped their chromosomal loci, as well as a new set of melanocyte-specific markers. The data represent a quantum jump in understanding the mechanisms of epidermal differentiation.

  5. Human epidermal neural crest stem cells as candidates for cell-based therapies, disease modeling, and drug discovery.

    Science.gov (United States)

    Sieber-Blum, Maya

    2014-09-01

    In this review article I explore the suitability of human epidermal neural crest stem cells (hEPI-NCSC) for translational medicine. hEPI-NCSC are multipotent somatic stem cells that are derived from the embryonic neural crest. hEPI-NCSC are located in the bulge of hair follicles where they persist postnatally and into adulthood. Because of their location in the hairy skin and their migratory behavior, hEPI-NCSC can be easily isolated as a highly pure population of stem cells without the need for purification. Furthermore they can be expanded ex vivo into millions of stem cells, they do not form tumors in vivo, and they can undergo directed differentiation into crest and noncrest-derived cell types of clinical relevance. Taken together, these characteristics make hEPI-NCSC attractive candidates for cell-based therapies, drug discovery, and disease modeling. © 2014 Wiley Periodicals, Inc.

  6. Current status of anti-human epidermal growth factor receptor 2 therapies: predicting and overcoming herceptin resistance.

    Science.gov (United States)

    Chung, Alice; Cui, Xiaojiang; Audeh, William; Giuliano, Armando

    2013-08-01

    Human epidermal growth factor receptor 2-overexpressing (HER2+) breast cancer occurs in 20% to 25% of cases and is associated with poor prognosis. Trastuzumab (Herceptin; Genentech, South San Francisco, CA) is a monoclonal antibody targeting the HER2 extracellular domain that has been shown to significantly reduce relapse rates. However, some patients with HER2+ tumors do not respond to Herceptin, and 60% to 85% of patients with HER2+ metastatic breast cancer acquire resistance within a short time period. In this review, we discuss proposed mechanisms of action of trastuzumab and trastuzumab resistance and various drugs that have been developed to overcome drug resistance. We introduce the basal molecular subtype as a predictor of increased risk in HER2+ breast cancer and a possible alternative cause of drug resistance.

  7. Epidermal growth factor inhibits glycylsarcosine transport and hPepT1 expression in a human intestinal cell line

    DEFF Research Database (Denmark)

    Nielsen, C U; Amstrup, J; Steffansen, B

    2001-01-01

    (max) decreased from 2.61 +/- 0.4 to 1.06 +/- 0.1 nmol x cm(-2) x min(-1) (n = 3, P PepT1 mRNA (using glucose-6-phosphate dehydrogenase mRNA as control......The human intestinal cell line Caco-2 was used as a model system to study the effects of epidermal growth factor (EGF) on peptide transport. EGF decreased apical-to-basolateral fluxes of [(14)C]glycylsarcosine ([(14)C]Gly-Sar) up to 50.2 +/- 3.6% (n = 6) of control values. Kinetic analysis...... of the fluxes showed that maximal flux (V(max)) of transepithelial transport decreased from 3.00 +/- 0.17 nmol x cm(-2) x min(-1) in control cells to 0.50 +/- 0.07 nmol x cm(-2) x min(-1) in cells treated with 5 ng/ml EGF (n = 6, P

  8. Advances in Variations of Estrogen Receptor, Progesterone Receptor and Human Epidermal Growth Factor Receptor-2 Status in Metastatic Breast Cancer

    Institute of Scientific and Technical Information of China (English)

    Yuan Yuan; Zhang Lili

    2013-01-01

    Chemotherapy, endocrine therapy and molecular targeted therapy are vital means in the treatment of metastatic breast cancer (MBC), whose reasonable and standard applications are of great importance to prolong patients’ survival and improve the quality of life. The expressions of estrogen receptor (ER), progesterone receptor (PR) and human epidermal growth factor receptor-2 (HER-2) present signiifcant differences between primary and metastatic breast cancer. However, these differences may affect the selection of MBC patients for therapeutic strategies and judgment on the prognosis. Hence, the relevant researches on variations of hormone receptors and HER-2 in primary and metastatic breast cancer, discordant causes of ER, PR and HER-2 expression in primary and metastatic lesions and clinical value of biopsy to the metastases are reviewed in the study.

  9. Harnessing Integrative Omics to Facilitate Molecular Imaging of the Human Epidermal Growth Factor Receptor Family for Precision Medicine.

    Science.gov (United States)

    Pool, Martin; de Boer, H Rudolf; Hooge, Marjolijn N Lub-de; van Vugt, Marcel A T M; de Vries, Elisabeth G E

    2017-01-01

    Cancer is a growing problem worldwide. The cause of death in cancer patients is often due to treatment-resistant metastatic disease. Many molecularly targeted anticancer drugs have been developed against 'oncogenic driver' pathways. However, these treatments are usually only effective in properly selected patients. Resistance to molecularly targeted drugs through selective pressure on acquired mutations or molecular rewiring can hinder their effectiveness. This review summarizes how molecular imaging techniques can potentially facilitate the optimal implementation of targeted agents. Using the human epidermal growth factor receptor (HER) family as a model in (pre)clinical studies, we illustrate how molecular imaging may be employed to characterize whole body target expression as well as monitor drug effectiveness and the emergence of tumor resistance. We further discuss how an integrative omics discovery platform could guide the selection of 'effect sensors' - new molecular imaging targets - which are dynamic markers that indicate treatment effectiveness or resistance.

  10. Real-time three-dimensional imaging of epidermal splitting and removal by high-definition optical coherence tomography

    DEFF Research Database (Denmark)

    Boone, Marc; Draye, Jean Pierre; Verween, Gunther;

    2014-01-01

    , the epidermal removal was incomplete as remnants of the epidermal basal cell layer remained attached to the basement membrane on the dermis. With Triton X-100 treatment, the epidermis was not removed. In conclusion, HD-OCT imaging permits real-time 3-D visualization of the impact of selected agents on human...... to be equally efficient in the removal of the epidermis from human split-thickness skin allografts. However, a different epidermal splitting level at the dermo-epidermal junction could be observed and confirmed by immunolabelling of collagen type IV and type VII. Epidermal splitting occurred at the level...... of the lamina densa with dispase II and above the lamina densa (in the lamina lucida) with NaCl. The 3-D architecture of dermal papillae and dermis was more affected by Dispase II on HD-OCT which corresponded with histopathologic (orcein staining) fragmentation of elastic fibres. With SDS treatment...

  11. Imaging of human epidermal growth factor receptor type 2 expression with 18F-labeled affibody molecule ZHER2:2395 in a mouse model for ovarian cancer.

    NARCIS (Netherlands)

    Heskamp, S.; Laverman, P.; Rosik, D.; Boschetti, F.; Graaf, W.T.A. van der; Oyen, W.J.G.; Laarhoven, H.W.M. van; Tolmachev, V.; Boerman, O.C.

    2012-01-01

    Affibody molecules are small (7 kDa) proteins with subnanomolar targeting affinity. Previous SPECT studies in xenografts have shown that the Affibody molecule (111)In-DOTA-Z(HER2)(:2395) can discriminate between high and low human epidermal growth factor receptor type 2 (HER2)-expressing tumors,

  12. MATRIX METALLOPROTEINS (MMP)-MEDIATED PHOSPHORYLATION OF THE EPIDERMAL GROWTH FACTOR RECEPTOR (EGFR) IN HUMAN AIRWAY EPITHELIAL CELLS (HAEC) EXPOSED TO ZINC (ZN)

    Science.gov (United States)

    Matrix Metalloproteinase (MMP)-Mediated Phosphorylation of The Epidermal Growth Factor Receptor (EGFR) in Human Airway Epithelial Cells (HAEC) Exposed to Zinc (Zn)Weidong Wu, James M. Samet, Robert Silbajoris, Lisa A. Dailey, Lee M. Graves, and Philip A. BrombergCenter fo...

  13. Comparison of in vivo immune responses following transplantation of vascularized and non-vascularized human dermo-epidermal skin substitutes.

    Science.gov (United States)

    Klar, Agnes S; Biedermann, Thomas; Simmen-Meuli, Claudia; Reichmann, Ernst; Meuli, Martin

    2017-03-01

    Autologous bio-engineered dermo-epidermal skin substitutes (DESS) represent an alternative therapeutic option for a definitive treatment of skin defects in human patients. Largely, the interaction of host immune cells with transplanted DESS is considered to be essential for the granulation tissue formation, graft take, and its functionality. The aim of this study was to compare the spatiotemporal distribution and density of host-derived monocytes/macrophages and granulocytes in vascularized (vascDESS) versus non-vascularized DESS (non-vascDESS) in a rat model. Keratinocytes and the stromal vascular fraction (SVF) were derived from human skin or human adipose tissue, respectively. Human SVF containing both endothelial and mesenchymal/stromal progenitors was used to develop a vascularized collagen type I-based dermal component in vitro. The donor-matched, monolayer-expanded adipose stromal cells lacking endothelial cells were used as a negative control. Subsequently, human keratinocytes were seeded on top of hydrogels to build dermo-epidermal skin grafts. After transplantation onto full-thickness skin wounds on the back of immuno-incompetent rats, grafts were excised and analyzed after 1 and 3 weeks. The expression of distinct inflammatory cell markers specific for host-derived monocytes/macrophages (CD11b, CD68) or granulocytes (HIS48) was analyzed by immunofluorescence microscopy. All skin grafts were infiltrated by host-derived monocytes/macrophages (CD11b(+), CD68(+)) and granulocytes (HIS48(+)) between 1-3 week post-transplantation. When compared to non-vascDESS, the vascDESS showed an increased granulocyte infiltration at all time points analyzed with the majority of cells scattered throughout the whole dermal part. Whereas a moderate number of rat monocytes/macrophages (CD11b(+), CD68(+)) were found in vascDESS at 1 week, only a few cells were detected in non-vascDESS. We observed a time-dependent decrease of monocytes/macrophages in all transplants at 3

  14. Role of iron in inactivation of epidermal growth factor receptor after asbestos treatment of human lung and pleural target cells.

    Science.gov (United States)

    Baldys, Aleksander; Aust, Ann E

    2005-05-01

    Although the mechanism by which asbestos causes cancer remains unknown, iron associated with asbestos is thought to play a role in the pathogenic effects of fibers. Here, we examined the effects of asbestos on the epidermal growth factor receptor (EGFR) in human lung epithelial (A549) cells, human pleural mesothelial (MET5A) cells, and normal human small airway epithelial (SAEC) cells. Treatment of A549, MET5A, and SAEC cells with asbestos caused a significant reduction of EGFR tyrosine phosphorylation. This was both time- (15 min to 24 h) and concentration-dependent (1.5, 3, and 6 mug/cm(2)) in A549 cells. Also, treatment with 6 mug/cm(2) crocidolite for 24 h diminished the phosphorylation levels of human EGFR 2 (HER2). Exposure of A549 cells to 6 mug/cm(2) crocidolite for 3-24 h resulted in no detectable Y1045 phosphorylation and no apparent degradation of the EGFR. Inhibition of fiber endocytosis resulted in a considerable inhibition of EGFR dephosphorylation. Removal of iron from asbestos by desferrioxamine B or phytic acid inhibited asbestos-induced decreases in EGFR phosphorylation. The effects of crocidolite, amosite, and chrysotile on the EGFR phosphorylation state appeared to be directly related to the amount of iron mobilized from these fibers. These results strongly suggest that iron plays an important role in asbestos-induced inactivation of EGFR.

  15. Membrane-bound estrogen receptor-α expression and epidermal growth factor receptor mutation are associated with a poor prognosis in lung adenocarcinoma patients

    Directory of Open Access Journals (Sweden)

    Shimizu Katsuhiko

    2012-07-01

    Full Text Available Abstract Background The purpose of this study is to clarify the correlations between the expression of membrane-bound estrogen receptor-α (mERα and epidermal growth factor receptor (EGFR mutation and clinicopathological factors, especially in relation to the prognosis, in patients with lung adenocarcinoma. Methods We conducted a retrospective review of the data of 51 lung adenocarcinoma patients with tumors measuring less than 3 cm in diameter. Immunohistochemical staining for mERα expression and detection of the EGFR mutation status were performed. Results Among the 51 patients, the tumors in 15 showed both mERα expression and EGFR mutation. ("double positive" Significant associations between "double positive" and vascular invasion, vascular endothelial growth factor expression, and Ki-67 expression were observed. A multivariate analysis revealed that only "double positive" was an independent risk factor influencing the recurrence-free survival. Conclusions Presence of mERα expression together with EGFR mutation was found to be an independent prognostic factor for survival in patients with lung adenocarcinoma, suggesting cross-talk between mERα and EGFR mutation.

  16. Expression of the epidermal growth factor receptor in human small cell lung cancer cell lines

    DEFF Research Database (Denmark)

    Damstrup, L; Rygaard, K; Spang-Thomsen, M;

    1992-01-01

    Epidermal growth factor (EGF) receptor expression was evaluated in a panel of 21 small cell lung cancer cell lines with radioreceptor assay, affinity labeling, and Northern blotting. We found high-affinity receptors to be expressed in 10 cell lines. Scatchard analysis of the binding data...... demonstrated that the cells bound between 3 and 52 fmol/mg protein with a KD ranging from 0.5 x 10(-10) to 2.7 x 10(-10) M. EGF binding to the receptor was confirmed by affinity-labeling EGF to the EGF receptor. The cross-linked complex had a M(r) of 170,000-180,000. Northern blotting showed the expression...... of EGF receptor mRNA in all 10 cell lines that were found to be EGF receptor-positive and in one cell line that was found to be EGF receptor-negative in the radioreceptor assay and affinity labeling. Our results provide, for the first time, evidence that a large proportion of a broad panel of small cell...

  17. Leiden reconstructed human epidermal model as a tool for the evaluation of the skin corrosion and irritation potential according to the ECVAM guidelines.

    Science.gov (United States)

    El Ghalbzouri, A; Siamari, R; Willemze, R; Ponec, M

    2008-08-01

    In the ECVAM validation studies two common skin protocols have been developed, the skin corrosion and skin irritation protocol. Both protocols include next to general and functional conditions that the skin model must meet, also the correct prediction of the activity of certain reference chemicals. For the skin corrosion protocol, the OECD TG 431 defined 12 reference chemicals that should be correctly predicted by the epidermal skin model. For skin irritation 20 test substances should meet the defined criteria. In this study we aimed to subject our Leiden human epidermal (LHE) model to both common protocols according to the ECVAM guidelines. The LHE model generated in this study has been fully characterized and shows very high similarities with the native skin. After minor technical changes in both protocols, corrosion classifications were obtained in concordance with those reported for the validated human skin models EpiSkin and EpiDerm. The results obtained with the common skin irritation protocol were very similar to that of earlier studies with the SkinEthic, EpiSkin and EpiDerm models. This means that the protocols and prediction models developed during the validation studies with a specific skin model can be used with other similar skin models. This study demonstrates that reconstructed human skin equivalents have been proven to be efficient and reliable alternatives to animal testing.

  18. Identification of bone morphogenetic protein 7 (BMP7) as an instructive factor for human epidermal Langerhans cell differentiation

    Science.gov (United States)

    Yasmin, Nighat; Bauer, Thomas; Modak, Madhura; Wagner, Karin; Schuster, Christopher; Köffel, Rene; Seyerl, Maria; Stöckl, Johannes; Elbe-Bürger, Adelheid; Graf, Daniel

    2013-01-01

    Human Langerhans cell (LC) precursors populate the epidermis early during prenatal development and thereafter undergo massive proliferation. The prototypic antiproliferative cytokine TGF-β1 is required for LC differentiation from human CD34+ hematopoietic progenitor cells and blood monocytes in vitro. Similarly, TGF-β1 deficiency results in LC loss in vivo. However, immunohistology studies revealed that human LC niches in early prenatal epidermis and adult basal (germinal) keratinocyte layers lack detectable TGF-β1. Here we demonstrated that these LC niches express high levels of bone morphogenetic protein 7 (BMP7) and that Bmp7-deficient mice exhibit substantially diminished LC numbers, with the remaining cells appearing less dendritic. BMP7 induces LC differentiation and proliferation by activating the BMP type-I receptor ALK3 in the absence of canonical TGF-β1–ALK5 signaling. Conversely, TGF-β1–induced in vitro LC differentiation is mediated via ALK3; however, co-induction of ALK5 diminished TGF-β1–driven LC generation. Therefore, selective ALK3 signaling by BMP7 promotes high LC yields. Within epidermis, BMP7 shows an inverse expression pattern relative to TGF-β1, the latter induced in suprabasal layers and up-regulated in outer layers. We observed that TGF-β1 inhibits microbial activation of BMP7-generated LCs. Therefore, TGF-β1 in suprabasal/outer epidermal layers might inhibit LC activation, resulting in LC network maintenance. PMID:24190429

  19. Identification of bone morphogenetic protein 7 (BMP7) as an instructive factor for human epidermal Langerhans cell differentiation.

    Science.gov (United States)

    Yasmin, Nighat; Bauer, Thomas; Modak, Madhura; Wagner, Karin; Schuster, Christopher; Köffel, Rene; Seyerl, Maria; Stöckl, Johannes; Elbe-Bürger, Adelheid; Graf, Daniel; Strobl, Herbert

    2013-11-18

    Human Langerhans cell (LC) precursors populate the epidermis early during prenatal development and thereafter undergo massive proliferation. The prototypic antiproliferative cytokine TGF-β1 is required for LC differentiation from human CD34(+) hematopoietic progenitor cells and blood monocytes in vitro. Similarly, TGF-β1 deficiency results in LC loss in vivo. However, immunohistology studies revealed that human LC niches in early prenatal epidermis and adult basal (germinal) keratinocyte layers lack detectable TGF-β1. Here we demonstrated that these LC niches express high levels of bone morphogenetic protein 7 (BMP7) and that Bmp7-deficient mice exhibit substantially diminished LC numbers, with the remaining cells appearing less dendritic. BMP7 induces LC differentiation and proliferation by activating the BMP type-I receptor ALK3 in the absence of canonical TGF-β1-ALK5 signaling. Conversely, TGF-β1-induced in vitro LC differentiation is mediated via ALK3; however, co-induction of ALK5 diminished TGF-β1-driven LC generation. Therefore, selective ALK3 signaling by BMP7 promotes high LC yields. Within epidermis, BMP7 shows an inverse expression pattern relative to TGF-β1, the latter induced in suprabasal layers and up-regulated in outer layers. We observed that TGF-β1 inhibits microbial activation of BMP7-generated LCs. Therefore, TGF-β1 in suprabasal/outer epidermal layers might inhibit LC activation, resulting in LC network maintenance.

  20. Repeated short climatic change affects the epidermal differentiation program and leads to matrix remodeling in a human organotypic skin model

    Directory of Open Access Journals (Sweden)

    Boutrand LB

    2017-02-01

    Full Text Available Laetitia-Barbollat Boutrand,1 Amélie Thépot,2 Charlotte Muther,3 Aurélie Boher,2 Julie Robic,4 Christelle Guéré,4 Katell Vié,4 Odile Damour,5 Jérôme Lamartine1,3 1Departement de Biologie, Université Claude Bernard Lyon I, 2LabSkinCreations, 3CNRS UMR5305, Laboratoire de Biologie Tissulaire et d’Ingénierie Thérapeutique (LBTI, Lyon, 4Laboratoires Clarins, Cergy-Pontoise, 5Banque de Tissus et Cellules, Hospices Civiles de Lyon, Lyon, France Abstract: Human skin is subject to frequent changes in ambient temperature and humidity and needs to cope with these environmental modifications. To decipher the molecular response of human skin to repeated climatic change, a versatile model of skin equivalent subject to “hot–wet” (40°C, 80% relative humidity [RH] or “cold–dry” (10°C, 40% RH climatic stress repeated daily was used. To obtain an exhaustive view of the molecular mechanisms elicited by climatic change, large-scale gene expression DNA microarray analysis was performed and modulated function was determined by bioinformatic annotation. This analysis revealed several functions, including epidermal differentiation and extracellular matrix, impacted by repeated variations in climatic conditions. Some of these molecular changes were confirmed by histological examination and protein expression. Both treatments (hot–wet and cold–dry reduced the expression of genes encoding collagens, laminin, and proteoglycans, suggesting a profound remodeling of the extracellular matrix. Strong induction of the entire family of late cornified envelope genes after cold–dry exposure, confirmed at protein level, was also observed. These changes correlated with an increase in epidermal differentiation markers such as corneodesmosin and a thickening of the stratum corneum, indicating possible implementation of defense mechanisms against dehydration. This study for the first time reveals the complex pattern of molecular response allowing

  1. Behavioral and neural responses of toads to salt solutions correlate with basolateral membrane potential of epidermal cells of the skin.

    Science.gov (United States)

    Hillyard, Stanley D; Baula, Victor; Tuttle, Wendy; Willumsen, Niels J; Larsen, Erik H

    2007-10-01

    Dehydrated toads initiated water absorption response (WR) behavior and absorbed water from dilute NaCl solutions. With 200-250 mM NaCl, WR behavior and water absorption were both suppressed. With 200-250 mM Na-gluconate, WR initiation was significantly greater than with NaCl but water loss was greater. Neural recordings from spinal nerve #6 showed a greater integrated response to 250 mM NaCl than to 250 mM Na-gluconate, whereas a larger rinse response was seen with Na-gluconate. Studies with isolated epithelium showed a large increase in conductance (G(t)) when 250 mM NaCl replaced NaCl Ringer's as the apical bathing solution that was accompanied by depolarization of the transepithelial potential (V(t)) and basolateral membrane potential (V(b)). Depolarization of V(b) corresponded with the neural response to 250 mM NaCl. When 250 mM Na-gluconate replaced Ringer's as the apical solution G(t) remained low, V(b) transiently hyperpolarized to values near the equilibrium potential for K(+) and corresponded with the reduced neural response. These results support the hypothesis that chemosensory function of the skin is analogous to that of mammalian taste cells but utilizes paracellular ion transport to a greater degree.

  2. Skin Basement Membrane: The Foundation of Epidermal Integrity—BM Functions and Diverse Roles of Bridging Molecules Nidogen and Perlecan

    Directory of Open Access Journals (Sweden)

    Dirk Breitkreutz

    2013-01-01

    Full Text Available The epidermis functions in skin as first defense line or barrier against environmental impacts, resting on extracellular matrix (ECM of the dermis underneath. Both compartments are connected by the basement membrane (BM, composed of a set of distinct glycoproteins and proteoglycans. Herein we are reviewing molecular aspects of BM structure, composition, and function regarding not only (i the dermoepidermal interface but also (ii the resident microvasculature, primarily focusing on the per se nonscaffold forming components perlecan and nidogen-1 and nidogen-2. Depletion or functional deficiencies of any BM component are lethal at some stage of development or around birth, though BM defects vary between organs and tissues. Lethality problems were overcome by developmental stage- and skin-specific gene targeting or by cell grafting and organotypic (3D cocultures of normal or defective cells, which allows recapitulating BM formation de novo. Thus, evidence is accumulating that BM assembly and turnover rely on mechanical properties and composition of the adjacent ECM and the dynamics of molecular assembly, including further “minor” local components, nidogens largely functioning as catalysts or molecular adaptors and perlecan as bridging stabilizer. Collectively, orchestration of BM assembly, remodeling, and the role of individual players herein are determined by the developmental, tissue-specific, or functional context.

  3. New Whitening Constituents from Taiwan-Native Pyracantha koidzumii: Structures and Tyrosinase Inhibitory Analysis in Human Epidermal Melanocytes

    Directory of Open Access Journals (Sweden)

    Rong-Dih Lin

    2015-12-01

    Full Text Available Nontoxic natural products useful in skin care cosmetics are of considerable interest. Tyrosinase is a rate-limiting enzyme for which its inhibitor is useful in developing whitening cosmetics. Pyracantha koidzumii (Hayata Rehder is an endemic species in Taiwan that exhibits tyrosinase-inhibitory activity. To find new active natural compounds from P. koidzumii, we performed bioguided isolation and studied the related activity in human epidermal melanocytes. In total, 13 compounds were identified from P. koidzumii in the present study, including two new compounds, 3,6-dihydroxy-2,4-dimethoxy-dibenzofuran (9 and 3,4-dihydroxy-5-methoxybiphenyl-2ʹ-O-β-d-glucopyranoside (13, as well as 11 known compounds. The new compound 13 exhibited maximum potency in inhibiting cellular tyrosinase activity, the protein expression of cellular tyrosinase and tyrosinase-related protein-2, as well as the mRNA expression of Paired box 3 and microphthalmia-associated transcription factor in a concentration-dependent manner. In the enzyme kinetic assay, the new compound 13 acted as an uncompetitive mixed-type inhibitor against the substrate l-3,4-dihydroxyphenylalanine and had a Km value against this substrate of 0.262 mM, as calculated using the Lineweaver–Burk plots. Taken together, our findings show compound 13 exhibits tyrosinase inhibition in human melanocytes and compound 13 may be a potential candidate for use in cosmetics.

  4. The role of epidermal growth factor-like module containing mucin-like hormone receptor 2 in human cancers

    Directory of Open Access Journals (Sweden)

    Michael Safaee

    2014-04-01

    Full Text Available G-protein coupled receptors (GPCRs are among the most diverse and ubiquitous proteins in all of biology. The epidermal growth factorseven span transmembrane (EGF-TM7 subfamily of adhesion GPCRs is a small subset whose members are mainly expressed on the surface of leukocytes. The EGF domains on the N-terminus add significant size to these receptors and they are considered to be among the largest members of the TM7 family. Although not all of their ligands or downstream targets have been identified, there is evidence implicating the EGF-TM7 family diverse processes such as cell adhesion, migration, inflammation, and autoimmune disease. Recent studies have identified expression of EGF-TM7 family members on human neoplasms including those of the thyroid, stomach, colon, and brain. Their presence on these tissues is not surprising given the ubiquity of GPCRs, but because their functional significance and pathways are not completely understood, they are of tremendous clinical and scientific interest. Current evidence suggests that expression of certain EGF-TM7 receptors is correlated with tumor grade, confers a more invasive phenotype, and increases the likelihood of metastatic disease. In this review, we will discuss the structure, function, and regulation of these receptors. We also describe the expression of these receptors in human cancers and explore their potential mechanistic significance.

  5. Trichloroethylene-mediated cytotoxicity in human epidermal keratinocytes is mediated by the rapid accumulation of intracellular calcium: Interception by naringenin.

    Science.gov (United States)

    Ali, F; Khan, A Q; Khan, R; Sultana, S

    2016-02-01

    Industrial solvents pose a significant threat to the humankind. The mechanisms of their toxicity still remain in debate. Trichloroethylene (TCE) is a widespread industrial solvent responsible for severe liver dysfunction, cutaneous toxicity in occupationally exposed humans. We utilized an in vitro system of human epidermal keratinocyte (HaCaT) cells in this study to avoid complex cell and extracellular interactions. We report the cytotoxicity of organic solvent TCE in HaCaT and its reversal by a natural flavanone, naringenin (Nar). The cytotoxicity was attributed to the rapid intracellular free calcium (Ca(2+)) release, which might lead to the elevation of protein kinase C along with robust free radical generation, instability due to energy depletion, and sensitization of intracellular stress signal transducer nuclear factor κB. These effects were actually seen to induce significant amount of genomic DNA fragmentation. Furthermore, all these effects of TCE were effectively reversed by the treatment of Nar, a natural flavanone. Our studies identify intracellular Ca as a unique target used by organic solvents in the cytotoxicity and highlight the Ca(2+) ion stabilizer properties of Nar.

  6. In vivo UVB irradiation induces clustering of Fas (CD95) on human epidermal cells

    DEFF Research Database (Denmark)

    Bang, Bo; Gniadecki, Robert; Larsen, Jørgen K

    2003-01-01

    In vitro studies with human cell lines have demonstrated that the death receptor Fas plays a role in ultraviolet (UV)-induced apoptosis. The purpose of the present study was to investigate the relation between Fas expression and apoptosis as well as clustering of Fas in human epidermis after...... clustering has a functional significance. Our results ar in accordance with previous findings from in vitro studies, and suggest that Fas is activated in vivo in human epidermis after UVB exposure....

  7. Simvastatin-induced Toxic Epidermal Necrolysis

    Institute of Scientific and Technical Information of China (English)

    Emmanouil Petrou; Vasiliki Karali; Emmanouil Papadakis

    2014-01-01

    Toxic epidermal necrolysis comprises a severe immune-complex mediated hypersensitivity reaction that typically involves the skin and mucous membranes.Herein, we describe a68-year -old man who presented with the condition after simvastatin administration.

  8. Simvastatin-induced Toxic Epidermal Necrolysis

    Directory of Open Access Journals (Sweden)

    Emmanouil Petrou

    2014-01-01

    Full Text Available Toxic epidermal necrolysis comprises a severe immune-complex mediated hypersensitivity reaction that typically involves the skin and mucous membranes. Herein, we describe a 68-year -old man who presented with the condition after simvastatin administration.

  9. Inhibition of iodine-125-labeled human follitropin binding to testicular receptor by epidermal growth factor and synthetic peptides

    Energy Technology Data Exchange (ETDEWEB)

    Sluss, P.M.; Krystek, S.R. Jr.; Andersen, T.T.; Melson, B.E.; Huston, J.S.; Ridge, R.; Reichert, L.E. Jr.

    1986-05-06

    Two tetrapeptide sequence homologies between mouse epidermal growth factor precursor (mEGFP) and human follitropin (FSH) were revealed by a computer program that identifies identical residues among polypeptide sequences. The two tetrapeptides, Lys-Thr-Cys-Thr (KTCT) and Thr-Arg-Asp-Leu (TRDL), are present in the hormone-specific beta subunit of FSH from all species studied. These tetrapeptides are not present in the alpha subunit, which is common to all pituitary glycoprotein hormones. Both tetrapeptides are also found in mEGFP, and one tetrapeptide, TRDL, is located within the 53-residue form of mEGF purified from mouse submaxillary glands. Computer-generated hydropathy profiles predicted that both tetrapeptides are located in hydrophilic portions of the FSH beta subunit and that TRDL is in a hydrophilic portion of commercially available mEGF. Therefore, the tetrapeptides might be accessible to receptor binding sites for FSH. We report that mEGF inhibits binding of /sup 125/I-labeled human FSH to receptors in testis by 50% (I50) at a concentration of 1.8 X 10(-5) M. No binding inhibition was observed by GnRH or arginine-vasopressin at 10(-4) M, neither of which contain the tetrapeptide sequences. FSH beta subunit, which contains both tetrapeptides, also inhibited binding (I50 = 9 X 10(-8) M) of /sup 125/I-labeled human FSH to testis receptor. Thus, it appears that FSH beta subunit and mEGF are capable of inhibiting binding of FSH to testicular FSH receptors, presumably through interactions that include the homologous tetrapeptides. This presumption was supported by the observation that the synthetic tetrapeptides (KTCT or TRDL) were also active in inhibiting binding of /sup 125/I-labeled human FSH to testis receptor.

  10. High-level expression and purification of soluble bioactive recombinant human heparin-binding epidermal growth factor in Escherichia coli.

    Science.gov (United States)

    Khalili, Mostafa; Soleyman, Mohammad Reza; Baazm, Maryam; Beyer, Cordian

    2015-07-01

    Heparin-binding epidermal growth factor (HB-EGF) is a member of highly conserved superfamily of proteins that has potential mitogenic activity and stimulates differentiation and migration of various cell types. Since HB-EGF has three intra-molecular disulfide bonds, a high expression pattern of active HB-EGF in an E. coli expression system was not successfully established. The aim of this study was to increase production of soluble bioactive recombinant human HB-EGF in E. coli by modifying growth conditions and codon optimization. The open reading frame codons of human HB-EGF were optimized to achieve high level expression in E. coli. The optimized codon was amplified, cloned into plasmid pET-32a, and transformed into E. coli BL21 for further expression. The cultivation parameters (temperature and inducer) were optimized to produce a high yield of soluble HB-EGF. The fusion protein was purified by Nickel-nitrilotriacetic acid (Ni-NTA) affinity chromatography. Amethylthiazole tetrazolium assay was used to evaluate the bioactivity of the produced recombinant protein. After codon optimization, the codon adaptation index (CAI) was increased from 0.255 in native gene to 0.829 using the optimized sequence. By lowering the temperature to 22°C and the inducer to 0.4 μM, we obtained 35% soluble expression of recombinant and biologically active human HB-EGF. Our data demonstrate that codon optimization increases the yield of HB-EGF in an E. coli expression system. Furthermore, the chosen modifications in cell culturing increase the solubility of recombinant human HB-EGF.

  11. Blockade of Ets-1 attenuates epidermal growth factor-dependent collagen loss in human carotid plaque smooth muscle cells.

    Science.gov (United States)

    Rao, Velidi H; Rai, Vikrant; Stoupa, Samantha; Agrawal, Devendra K

    2015-09-15

    Although degradation of extracellular matrix by matrix metalloproteinases (MMPs) is thought to be involved in symptomatic (S) carotid plaques in atherosclerosis, the mechanisms of MMP expression are poorly understood. Here, we demonstrate that collagen loss in vascular smooth vessel cells (VSMCs) isolated from S plaques was induced by epidermal growth factor (EGF) through the activation of p38-MAPK and JNK-MAPK pathways. Inhibitors of p38-MAPK and JNK-MAPK signaling pathways downregulated the expression of MMP-1 and MMP-9. In addition, we examined whether v-ets erythroblastosis virus E26 oncogene homologue 1 (Ets-1), an important regulator of different genes, is involved in destabilizing S plaques in patients with carotid stenosis. We demonstrate that EGF induces Ets-1 expression and decreases interstitial and basement membrane collagen in vascular smooth muscle cells (VSMCs) from patients with carotid stenosis. Increased expression of MMP-1 and -9 and decreased collagen mRNA transcripts were also found in Ets-1-overexpressed VSMCs. Transfection with both dominant-negative form of Ets-1 and small interfering RNA blocked EGF-induced MMP-1 and -9 expressions and increased the mRNA transcripts for collagen I (α1) and collagen III (α1) in S compared with asymptomatic (AS) carotid plaques. Inhibitors of p38-MAPK (SB202190) and JNK-MAPK (SP600125) signaling pathways decreased the expression of Ets-1, MMP-1, and MMP-9 and increased collagen type I and III expression in EGF-treated VSMCs. This study provides a mechanistic insight into the role of Ets-1 in the plaque destabilization in patients with carotid stenosis involving p38-MAPK and JNK signaling pathways. Copyright © 2015 the American Physiological Society.

  12. Induction of cyclooxygenase-2 expression by prostaglandin E2 stimulation of the prostanoid EP4 receptor via coupling to Gαi and transactivation of the epidermal growth factor receptor in HCA-7 human colon cancer cells.

    Science.gov (United States)

    Yoshida, Kenji; Fujino, Hiromichi; Otake, Sho; Seira, Naofumi; Regan, John W; Murayama, Toshihiko

    2013-10-15

    Increased expressions of cyclooxygenase-2 (COX-2) and its downstream metabolite, prostaglandin E2 (PGE2), are well documented events in the development of colorectal cancer. Interestingly, PGE2 itself can induce the expression of COX-2 thereby creating the potential for positive feedback. Although evidence for such a positive feedback has been previously described, the specific E-type prostanoid (EP) receptor subtype that mediates this response, as well as the relevant signaling pathways, remain unclear. We now report that the PGE2 stimulated induction of COX-2 expression in human colon cancer HCA-7 cells is mediated by activation of the prostanoid EP4 receptor subtype and is followed by coupling of the receptor to Gαi and the activation of phosphatidylinositol 3-kinase. Subsequent activation of metalloproteinases releases membrane bound heparin-binding epidermal growth factor-like growth factor resulting in the transactivation of epidermal growth factor receptors and the activation of the extracellular signal-regulated kinases and induction of COX-2 expression. This induction of COX-2 expression by PGE2 stimulation of the prostanoid EP4 receptor may underlie the upregulation of COX-2 during colorectal cancer and appears to be an early event in the process of tumorigenesis. © 2013 Elsevier B.V. All rights reserved.

  13. Human papillomavirus E6/E7 oncogenes promote mouse ear regeneration by increasing the rate of wound re-epithelization and epidermal growth.

    Science.gov (United States)

    Valencia, Concepción; Bonilla-Delgado, José; Oktaba, Katarzyna; Ocádiz-Delgado, Rodolfo; Gariglio, Patricio; Covarrubias, Luis

    2008-12-01

    Mammals have limited regeneration capacity. We report here that, in transgenic mice (Tg(bK6-E6/E7)), the expression of the E6/E7 oncogenes of human papilloma virus type 16 (HPV16) under the control of the bovine keratin 6 promoter markedly improves the mouse's capacity to repair portions of the ear after being wounded. Increased repair capacity correlates with an increased number of epidermal proliferating cells. In concordance with the expected effects of the E6 and E7 oncogenes, levels of p53 decreased and those of p16 in epidermal cells increased. In addition, we observed that wound re-epithelization proceeded faster in transgenic than in wild-type animals. After the initial re-epithelization, epidermal cell migration from the intact surrounding tissue appears to be a major contributor to the growing epidermis, especially in the repairing tissue of transgenic mice. We also found that there is a significantly higher number of putative epidermal stem cells in Tg(bK6-E6/E7) than in wild-type mice. Remarkably, hair follicles and cartilage regenerated within the repaired ear tissue, without evidence of tumor formation. We propose that the ability to regenerate ear portions is limited by the capacity of the epidermis to repair itself and grow.

  14. Membrane transport of anandamide through resealed human red blood cell membranes

    DEFF Research Database (Denmark)

    Bojesen, I.N.; Hansen, Harald S.

    2005-01-01

    The use of resealed red blood cell membranes (ghosts) allows the study of the transport of a compound in a nonmetabolizing system with a biological membrane. Transmembrane movements of anandamide (N-arachidonoylethanolamine, arachidonoylethanolamide) have been studied by exchange efflux experiments...... at 0°C and pH 7.3 with albumin-free and albumin-filled human red blood cell ghosts. The efflux kinetics is biexponential and is analyzed in terms of compartment models. The distribution of anandamide on the membrane inner to outer leaflet pools is determined to be 0.275 ± 0.023, and the rate constant...... of unidirectional flux from inside to outside is 0.361 ± 0.023 s. The rate constant of unidirectional flux from the membrane to BSA in the medium ([BSA]) increases with the square root of [BSA] in accordance with the theory of an unstirred layer around ghosts. Anandamide passed through the red blood cell membrane...

  15. Repair effect of diabetic ulcers with recombinant human epidermal growth factor loaded by sustained-release microspheres

    Institute of Scientific and Technical Information of China (English)

    2008-01-01

    In this study the w/o/w extraction–evaporation technique was adopted to prepare poly(lactic-co-glycolic acid) (PLGA) microspheres loading recombinant human epidermal growth factor (rhEGF). The micro-spheres were characterized for morphology by transmission electron microscopy (TEM) and particle size distribution. The release performances, the proliferation effects and therapeutic effects of rhEGF-loaded PLGA microspheres were all studied. The results showed that these spherical micro-spheres had a narrow size distribution and a high drug encapsulation efficiency (85.6%). RhEGF-loaded microspheres enhanced the growth rate of fibroblasts and wound healing more efficiently than pure rhEGF. The number of the proliferating cell nuclear antigen (PCNA) in the epidermis layer with the mi-crosphere treatment was significantly larger than those of the control groups. Overall locally sustained delivery of rhEGF from biodegradable PLGA microspheres may serve as a novel therapeutic strategy for diabetic ulcer repair.

  16. Structural model for the interaction of a designed Ankyrin Repeat Protein with the human epidermal growth factor receptor 2.

    Directory of Open Access Journals (Sweden)

    V Chandana Epa

    Full Text Available Designed Ankyrin Repeat Proteins are a class of novel binding proteins that can be selected and evolved to bind to targets with high affinity and specificity. We are interested in the DARPin H10-2-G3, which has been evolved to bind with very high affinity to the human epidermal growth factor receptor 2 (HER2. HER2 is found to be over-expressed in 30% of breast cancers, and is the target for the FDA-approved therapeutic monoclonal antibodies trastuzumab and pertuzumab and small molecule tyrosine kinase inhibitors. Here, we use computational macromolecular docking, coupled with several interface metrics such as shape complementarity, interaction energy, and electrostatic complementarity, to model the structure of the complex between the DARPin H10-2-G3 and HER2. We analyzed the interface between the two proteins and then validated the structural model by showing that selected HER2 point mutations at the putative interface with H10-2-G3 reduce the affinity of binding up to 100-fold without affecting the binding of trastuzumab. Comparisons made with a subsequently solved X-ray crystal structure of the complex yielded a backbone atom root mean square deviation of 0.84-1.14 Ångstroms. The study presented here demonstrates the capability of the computational techniques of structural bioinformatics in generating useful structural models of protein-protein interactions.

  17. Association of human epidermal growth factor receptor 2 status with ipsilateral breast tumor recurrence and resistance to endocrine therapy

    Science.gov (United States)

    ISHITOBI, MAKOTO; SHIBA, MIZUHO; NAKAYAMA, TAKAHIRO; KOYAMA, HIROKI; TAMAKI, YASUHIRO

    2015-01-01

    The effect of prior endocrine therapy on tumor biology and clinical outcomes of locoregional recurrence remains unclear. A total of 76 patients, who underwent salvage breast surgery for estrogen receptor-positive ipsilateral breast tumor recurrence (IBTR) following breast-conserving surgery for primary breast cancer, were retrospectively reviewed to investigate the association of human epidermal growth factor receptor 2 (HER2) status with the characteristics of IBTR and clinical outcomes following resection of IBTR. There was a tendency for more patients with HER2-positive IBTR to show resistance to endocrine therapy (71.4%) compared with those with HER2-negative IBTR (37.3%) (P=0.085). Patients with HER2-positive IBTR exhibited a higher rate of recurrence (62.5%) compared with those with HER2-negative IBTR (25.0%) (P=0.027). These results suggested that HER2-positive IBTR may be associated with resistance to endocrine therapy and a poorer clinical outcome. PMID:26171193

  18. EPIDERMAL GROWTH FACTOR RECEPTOR (EGFR AND HUMAN PAPILLOMAVIRUS (HPV L1 CAPSID PROTEIN IN CERVICAL SQUAMOUS INTRAEPITHELIAL LESIONS

    Directory of Open Access Journals (Sweden)

    Balan Raluca

    2010-09-01

    Full Text Available We analyzed the immunohistochemical pattern of epidermal growth factor receptor (EGFR in cervical squamous intraepithelial lesions (SILs in correlation with L1 HPV capsid protein, in order to determine the relationship between EGFR expression and the infection status of human papillomavirus (HPV. The study included 40 cases, 24 LSIL (low grade SIL (CIN1, cervical intraepithelial neoplasia and 16 HSIL (high grade SIL (6 cases of CIN2 and 10 cases of CIN3. The immunoexpression of L1 HPV protein was assessed on conventional cervico-vaginal smears and EGFR was immunohistochemically evaluated on the corresponding cervical biopsies. The HPV L1 capsid protein was expressed in 45.83% of LSIL and 25% of HSIL. EGFR was overexpressed in 62,4% of HSIL (58,4% CIN2 and 41,6% CIN3 and 37,6% LSIL. The immunoexpression of L1 HPV has clinical application in the progression assessment of the cervical precancerous lesions without a correlation to the grade of the cervical SIL. EGFR is expressed by all proliferating squamous epithelial cells, thus corresponding with the grade of SIL. The evaluation of EGFR status, correlated with L1 HPV protein expression, can provide useful data of progression risk of cervical squamous intraepithelial lesions

  19. Development of a new in vitro skin sensitization assay (Epidermal Sensitization Assay; EpiSensA) using reconstructed human epidermis.

    Science.gov (United States)

    Saito, Kazutoshi; Nukada, Yuko; Takenouchi, Osamu; Miyazawa, Masaaki; Sakaguchi, Hitoshi; Nishiyama, Naohiro

    2013-12-01

    Recent changes in regulatory requirements and social views on animal testing have accelerated the development of reliable alternative tests for predicting skin sensitizing potential of chemicals. In this study, we aimed to develop a new in vitro skin sensitization assay using reconstructed human epidermis, RhE model, which is expected to have broader applicability domain rather than existing in vitro assays. Microarray analysis revealed that the expression of five genes (ATF3, DNAJB4, GCLM, HSPA6 and HSPH1) related to cellular stress response were significantly up-regulated in RhE model after 6h treatment with representative skin sensitizers, 1-fluoro-2,4-dinitrobenzene and oxazolone, but not a non-sensitizer, benzalkonium chloride. The predictive performance of five genes was examined with eight skin sensitizers (e.g., cinnamic aldehyde), four non-sensitizers (e.g., sodium lauryl sulfate) and four pre-/pro-haptens (e.g., p-phenylenediamine, isoeugenol). When the positive criteria were set to obtain the highest accuracy with the animal testing (LLNA), ATF3, DNAJB4 and GCLM exhibited a high predictive accuracy (100%, 93.8% and 87.5%, respectively). All tested pre-/pro-haptens were correctly predicted by both ATF3 and DNAJB4. These results suggested that the RhE-based assay, termed epidermal sensitization assay (EpiSensA), could be an useful skin sensitization assay with a broad applicability domain including pre-/pro-haptens. Copyright © 2013 Elsevier Ltd. All rights reserved.

  20. Expression and Prognostic Significance of Human Epidermal Growth Factor Receptors 1 and 3 in Gastric and Esophageal Adenocarcinoma.

    Directory of Open Access Journals (Sweden)

    Charlotta Hedner

    Full Text Available Gastric and esophageal adenocarcinomas are major global cancer burdens. These cancer forms are characterized by a poor prognosis and a modest response to chemo- radio- and targeted treatment. Hence there is an obvious need for further enhanced diagnostic and treatment strategies. The aim of this study was to examine the expression and prognostic impact of human epidermal growth factor receptor 1 (HER1/EGFR and 3 (HER3, as well as the occurrence of EGFR and KRAS mutations in gastric and esophageal adenocarcinoma.Immunohistochemical expression of EGFR and HER3 was analysed in all primary tumours and a subset of lymph node metastases in a consecutive cohort of 174 patients with adenocarcinoma of the stomach, cardia and esophagus. The anti-HER3 antibody used was validated by siRNA-mediated knockdown, immunohistochemistry and quantitative real-time PCR. EGFR and KRAS mutation status was analysed by pyrosequencing tecchnology.High EGFR expression was an independent risk factor for shorter overall survival (OS, whereas high HER3 expression was associated with a borderline significant trend towards a longer OS. KRAS mutations were present in only 4% of the tumours and had no prognostic impact. All tumours were EGFR wild-type. These findings contribute to the ongoing efforts to decide on the potential clinical value of different HERs and druggable mutations in gastric and esophageal adenocarcinomas, and attention is drawn to the need for more standardised investigational methods.

  1. Repair effect of diabetic ulcers with recombinant human epidermal growth factor loaded by sustained-release microspheres

    Institute of Scientific and Technical Information of China (English)

    DONG XiaoQing; XU Jun; WANG WeiCai; Luo Hao; LIANG XiaoFei; Zhang Lei; Wang HanJie; Wang PengHua; CHANG Jin

    2008-01-01

    In this study the w/o/w extraction-evaporation technique was adopted to prepare poly(lactic-co-glycolic acid) (PLGA) microspheres loading recombinant human epidermal growth factor (rhEGF). The micro-spheres were characterized for morphology by transmission electron microscopy (TEM) and particle size distribution. The release performances, the proliferation effects and therapeutic effects of rhEGF-Ioaded PLGA microspheres were all studied. The results showed that these spherical micro-spheres had a narrow size distribution and a high drug encapsulation efficiency (85.6%). RhEGF-ioaded microspheres enhanced the growth rate of fibroblasts and wound healing more efficiently than pure rhEGF. The number of the proliferating cell nuclear antigen (PCNA) in the epidermis layer with the mi-crosphere treatment was significantly larger than those of the control groups. Overall locally sustained delivery of rhEGF from biodegradable PLGA microspheres may serve as a novel therapeutic strategy for diabetic ulcer repair.

  2. Mammographic features of calcifications in DCIS: correlation with oestrogen receptor and human epidermal growth factor receptor 2 status

    Energy Technology Data Exchange (ETDEWEB)

    Bae, Min Sun; Moon, Woo Kyung; Chang, Jung Min; Cho, Nariya [Seoul National University College of Medicine, Department of Radiology, Seoul (Korea, Republic of); Park, So Yeon; Won, Jae-Kyung; Jeon, Yoon-Kyung; Park, In Ae [Seoul National University College of Medicine, Department of Pathology, Seoul (Korea, Republic of); Moon, Hyeong-Gon; Han, Wonshik [Seoul National University College of Medicine, Department of Surgery, Seoul (Korea, Republic of)

    2013-08-15

    This study investigated the correlation of oestrogen receptor (ER) and human epidermal growth factor receptor 2 (HER2) status with the probability of malignancy (POM) of mammographic calcifications in ductal carcinoma in situ (DCIS). A total of 101 women (age range, 27-83 years) with pure DCIS that presented as mammographic calcifications were included. Three radiologists independently reviewed mammograms according to the BI-RADS lexicon and provided 100-point POM scores and a BI-RADS category. ER, HER2 and breast cancer subtypes were determined using immunohistochemistry (IHC) and fluorescence in situ hybridisation. Pairwise correlations between POM and IHC biomarker scores were calculated, and mammographic features were compared between breast cancer subtypes. HER2 level positively correlated with the POM score (P < 0.0001) and BI-RADS category (P < 0.0001), and ER level inversely correlated with the POM score (P < 0.013) and BI-RADS category (P < 0.010). Fine linear branching (P = 0.004) and segmental (P = 0.014) calcifications were significantly associated with HER2-positive cancers, and clustered calcifications were more frequently observed in ER-positive cancers (P = 0.014). HER2 status in DCIS correlated positively with the POM of mammographic calcifications, as determined by radiologists on the basis of the BI-RADS lexicon. (orig.)

  3. Collagen hydrogels strengthened by biodegradable meshes are a basis for dermo-epidermal skin grafts intended to reconstitute human skin in a one-step surgical intervention.

    Science.gov (United States)

    Hartmann-Fritsch, Fabienne; Biedermann, Thomas; Braziulis, Erik; Luginbühl, Joachim; Pontiggia, Luca; Böttcher-Haberzeth, Sophie; van Kuppevelt, Toin H; Faraj, Kaeuis A; Schiestl, Clemens; Meuli, Martin; Reichmann, Ernst

    2016-01-01

    Extensive full-thickness skin loss, associated with deep burns or other traumata, represents a major clinical problem that is far from being solved. A promising approach to treat large skin defects is the use of tissue-engineered full-thickness skin analogues with nearly normal anatomy and function. In addition to excellent biological properties, such skin substitutes should exhibit optimal structural and mechanical features. This study aimed to test novel dermo-epidermal skin substitutes based on collagen type I hydrogels, physically strengthened by two types of polymeric net-like meshes. One mesh has already been used in clinical trials for treating inguinal hernia; the second one is new but consists of a FDA-approved polymer. Both meshes were integrated into collagen type I hydrogels and dermo-epidermal skin substitutes were generated. Skin substitutes were transplanted onto immuno-incompetent rats and analyzed after distinct time periods. The skin substitutes homogeneously developed into a well-stratified epidermis over the entire surface of the grafts. The epidermis deposited a continuous basement membrane and dermo-epidermal junction, displayed a well-defined basal cell layer, about 10 suprabasal strata and a stratum corneum. Additionally, the dermal component of the grafts was well vascularized. Copyright © 2012 John Wiley & Sons, Ltd.

  4. Development of Human Membrane Transporters: Drug Disposition and Pharmacogenetics.

    Science.gov (United States)

    Mooij, Miriam G; Nies, Anne T; Knibbe, Catherijne A J; Schaeffeler, Elke; Tibboel, Dick; Schwab, Matthias; de Wildt, Saskia N

    2016-05-01

    Membrane transporters play an essential role in the transport of endogenous and exogenous compounds, and consequently they mediate the uptake, distribution, and excretion of many drugs. The clinical relevance of transporters in drug disposition and their effect in adults have been shown in drug-drug interaction and pharmacogenomic studies. Little is known, however, about the ontogeny of human membrane transporters and their roles in pediatric pharmacotherapy. As they are involved in the transport of endogenous substrates, growth and development may be important determinants of their expression and activity. This review presents an overview of our current knowledge on human membrane transporters in pediatric drug disposition and effect. Existing pharmacokinetic and pharmacogenetic data on membrane substrate drugs frequently used in children are presented and related, where possible, to existing ex vivo data, providing a basis for developmental patterns for individual human membrane transporters. As data for individual transporters are currently still scarce, there is a striking information gap regarding the role of human membrane transporters in drug therapy in children.

  5. Materials and optimized designs for human-machine interfaces via epidermal electronics.

    Science.gov (United States)

    Jeong, Jae-Woong; Yeo, Woon-Hong; Akhtar, Aadeel; Norton, James J S; Kwack, Young-Jin; Li, Shuo; Jung, Sung-Young; Su, Yewang; Lee, Woosik; Xia, Jing; Cheng, Huanyu; Huang, Yonggang; Choi, Woon-Seop; Bretl, Timothy; Rogers, John A

    2013-12-17

    Thin, soft, and elastic electronics with physical properties well matched to the epidermis can be conformally and robustly integrated with the skin. Materials and optimized designs for such devices are presented for surface electromyography (sEMG). The findings enable sEMG from wide ranging areas of the body. The measurements have quality sufficient for advanced forms of human-machine interface.

  6. Immunohistochemical localization of epidermal growth factor in the second-trimester human fetus

    DEFF Research Database (Denmark)

    Poulsen, Steen Seier; Kryger-Baggesen, N; Nexø, Ebba

    1996-01-01

    midtrimester human fetuses with a gestational age ranging from 13 to 22 weeks. The first detectable EGF immunoreactivity occurred in week 15-16 fetuses in the placenta, the skin, the distal tubules of the kidney, the surface epithelium of the stomach, and the tips of the small intestinal villi, as well...

  7. Proteomic Analysis of Arsenic-Induced Oxidative Stress in Human Epidermal Keratinocytes

    Science.gov (United States)

    Chronic exposure to inorganic arsenic (IAs) has been associated with the development of several human cancers, including those found in the skin, lung, urinary bladder, liver, prostate and kidney. The precise mechanisms by which arsenic causes cancer are unknown. Defining the mod...

  8. Gene Expression of Normal Human Epidermal Keratinocytes Modulated by Trivalent Arsenicals

    Science.gov (United States)

    Chronic exposure to inorganic arsenic (iAs) is associated with the development of benign and malignant human skin lesions including nonmelanoma skin cancers. The precise arsenical form(s) responsible for this carcinogenic effect are unknown, although trivalent inorganic arsenic (...

  9. Altered growth, differentiation, and responsiveness to epidermal growth factor of human embryonic mesenchymal cells of palate by persistent rubella virus infection.

    OpenAIRE

    Yoneda, T.; Urade, M; Sakuda, M.; Miyazaki, T

    1986-01-01

    We previously demonstrated that human embryonic mesenchymal cells derived from the palate (HEMP cells) retain alkaline phosphatase (ALP) content and capacity for collagen synthesis after long-term culture, and their growth is markedly stimulated by epidermal growth factor (EGF). There was a dramatic decrease in ALP content and capacity to synthesize collagen in HEMP cells (HEMP-RV cells) persistently infected with rubella virus (RV). EGF increased ALP activity and decreased collagen synthesis...

  10. Optimization of chitosan film as a substitute for animal and human epidermal sheets for in vitro permeation of polar and non polar drugs.

    Science.gov (United States)

    Rana, Vikas; Babita, Kumar; Goyal, Dinesh; Gorea, Rakesh; Tiwary, Ashok

    2004-12-01

    The present investigation is aimed at preparing chitosan films capable of simulating the flux of modal drugs, 5-fluorouracil (5-FU) and indomethacin (INDO), across rat, rabbit and human cadaver epidermal sheets. Application of statistical design revealed that the concentration of chitosan, crosslinking time and concentration of crosslinking agent significantly influenced the in vitro flux of 5-FU and INDO across chitosan films. Multiple linear regression revealed a linear influence of all these active variables on 5-FU and INDO flux. It was deduced from atomic absorption spectroscopic analyses, DSC and IR spectroscopic data that 5% (m/V) sodium tripolyphosphate (NaTPP) produced optimum crosslinking of chitosan films. The in vitro permeation of both 5-FU and INDO across optimized film formulations was found to be comparable to that obtained across rat, rabbit and human epidermal sheets. These results indicate that optimized chitosan films have a potential to be developed as a substitute for animal and human cadaver epidermal sheets for preliminary in vitro permeation studies.

  11. Human Amnion Membrane: Potential Applications in Oral and Periodontal Field.

    Science.gov (United States)

    Mohan, Ranjana; Bajaj, Aashima; Gundappa, Mohan

    2017-01-01

    Human amniotic membrane (HAM) is derived from the fetal membranes which consist of the inner amniotic membrane made of single layer of amnion cells fixed to collagen-rich mesenchyme attached to chorion. HAM has low immunogenicity, anti-inflammatory properties and their cells can be isolated without the sacrifice of human embryos. Amniotic membrane has biological properties which are important for the experimental and clinical applications in managing patients of various medical specialties. Abundant, natural and wonderful biomembrane not only protects the foetus but also has various clinical applications in the field of dermatology, ophthalmology, ENT surgery, orthopedics and dental surgery. As it is discarded post-partum it may be useful for regenerative medicine and cell therapy to treat damaged or diseased tissues.

  12. Human Amnion Membrane: Potential Applications in Oral and Periodontal Field

    Science.gov (United States)

    Mohan, Ranjana; Bajaj, Aashima; Gundappa, Mohan

    2017-01-01

    Human amniotic membrane (HAM) is derived from the fetal membranes which consist of the inner amniotic membrane made of single layer of amnion cells fixed to collagen-rich mesenchyme attached to chorion. HAM has low immunogenicity, anti-inflammatory properties and their cells can be isolated without the sacrifice of human embryos. Amniotic membrane has biological properties which are important for the experimental and clinical applications in managing patients of various medical specialties. Abundant, natural and wonderful biomembrane not only protects the foetus but also has various clinical applications in the field of dermatology, ophthalmology, ENT surgery, orthopedics and dental surgery. As it is discarded post-partum it may be useful for regenerative medicine and cell therapy to treat damaged or diseased tissues. PMID:28316944

  13. Relationship Between Quantitative Estrogen and Progesterone Receptor Expression and Human Epidermal Growth Factor Receptor 2 (HER-2) Status With Recurrence in the Arimidex, Tamoxifen, Alone or in Combination Trial

    National Research Council Canada - National Science Library

    Mitch Dowsett; Craig Allred; Jill Knox; Emma Quinn; Janine Salter; Chris Wale; Jack Cuzick; Joan Houghton; Norman Williams; Elizabeth Mallon; Hugh Bishop; Ian Ellis; Denis Larsimont; Hironobu Sasano; Pauline Carder; Antonio Llombart Cussac; Fiona Knox; Valerie Speirs; John Forbes; Aman Buzdar

    2008-01-01

    ...) expression and human epidermal growth factor 2 (HER-2) status with time to recurrence (TTR) in postmenopausal women with hormone receptor-positive primary breast cancer treated with anastrozole or tamoxifen as adjuvant therapy...

  14. Identification of human leukemia antigen A*0201-restricted epitopes derived from epidermal growth factor pathway substrate number 8.

    Science.gov (United States)

    Tang, Baishan; Zhou, Weijun; Du, Jingwen; He, Yanjie; Li, Yuhua

    2015-08-01

    T-cell-mediated immunotherapy of hematological malignancies requires selection of targeted tumor-associated antigens and T-cell epitopes contained in these tumor proteins. Epidermal growth factor receptor pathway substrate 8 (EPS8), whose function is pivotal for tumor proliferation, progression and metastasis, has been found to be overexpressed in most human tumor types, while its expression in normal tissue is low. The aim of the present study was to identify human leukemia antigen (HLA)-A*0201-restricted epitopes of EPS8 by using a reverse immunology approach. To achieve this, computer algorithms were used to predict HLA-A*0201 molecular binding, proteasome cleavage patterns as well as translocation of transporters associated with antigen processing. Candidate peptides were experimentally validated by T2 binding affinity assay and brefeldin-A decay assay. The functional avidity of peptide-specific cytotoxic T lymphocytes (CTLs) induced from peripheral blood mononuclear cells of healthy volunteers were evaluated by using an enzyme-linked immunosorbent spot assay and a cytotoxicity assay. Four peptides, designated as P455, P92, P276 and P360, had high affinity and stability of binding towards the HLA-A*0201 molecule, and specific CTLs induced by them significantly responded to the corresponding peptides and secreted IFN-γ. At the same time, the CTLs were able to specifically lyse EPS8-expressing cell lines in an HLA-A*0201-restricted manner. The present study demonstrated that P455, P92, P276 and P360 were CTL epitopes of EPS8, and were able to be used for epitope-defined adoptive T-cell transfer and multi-epitope-based vaccine design.

  15. Epidemiologic Study of Human Epidermal Growth Factor Receptor 2 Expression in Advanced/Metastatic Gastric Cancer: an Assessment of Human Epidermal Growth Factor Receptor 2 Status in Tumor Tissue Samples of Gastric and Gastro-Esophageal Junction Cancer

    Science.gov (United States)

    Seo, Kyung Won; Jeon, Taeyong; Kim, Sewon; Kim, Sung Soo; Kim, Kwanghee; Suh, Byoung-Jo; Hwang, Sunhwi; Choi, SeongHee; Ryu, Seungwan; Min, Jae Seok; Lee, Young-Joon; Jee, Ye Seob; Chae, Hyeondong

    2017-01-01

    Purpose The Trastuzumab for gastric cancer (GC) trial identified human epidermal growth factor receptor 2 (HER2) as a predictor of successful treatment with trastuzumab (HER2 receptor targeting agent) among patients with advanced/metastatic GC. To date, the prevalence of HER2 overexpression in the Korean population is unknown. The present study aimed to assess the incidence of HER2 positivity among GC and gastroesophageal (GE) junction cancer samples and the relationship between HER2 overexpression and clinicopathological characteristics in Korean patients. Materials and Methods Tumor samples collected from 1,695 patients with histologically proven GC or GE junction enrolled at 14 different hospitals in Korea were examined. After gathering clinicopathological data of all patients, HER2 status was assessed by immunohistochemistry (IHC) at each hospital, and IHC 2+ cases were subjected to silver-enhanced in situ hybridization at 3 central laboratories. Results A total of 182 specimens tested positive for HER2, whereas 1,505 tested negative. Therefore, the overall HER2-positive rate in this study was 10.8% (95% confidence interval=9.3%–12.3%). The HER2-positive rate was higher among intestinal-type cases (17.6%) than among other types, and was higher among patients older than 70 years and 50 years of age, compared to other age groups. Conclusions Our evaluation of the HER2 positivity rate (10.8%) among Korean patients with GC and GE junction indicated the necessity of epidemiological data when conducting studies related to HER2 expression in GC and GE junction.

  16. Human keratinocyte caspase-14 expression is altered in human epidermal 3D models by dexamethasone and by natural products used in cosmetics.

    Science.gov (United States)

    Kataoka, Saori; Hattori, Kenji; Date, Akira; Tamura, Hiroomi

    2013-10-01

    Caspase-14 is a cysteinyl-aspartate-specific proteinase that is specifically expressed in epidermal keratinocytes. Dysregulation of caspase-14 expression is implicated in impaired skin barrier formation. To elucidate the regulation of caspase-14 in differentiated keratinocytes, we characterized the expression of caspase-14 in normal human epidermal keratinocytes (NHEKs) and two types of three-dimensional (3D) human epidermis culture models, EPI-200 and EPI-201, via RT-PCR and immunoblot analyses. Caspase-14 expression was absent in subconfluent NHEKs, but was present in confluent NHEKs as well as those induced to differentiate by calcium. Caspase-14 expression levels in the 3D epidermis models were almost equal to that in the Ca(2+)-treated differentiated NHEKs. Despite the presence of caspase-14 expression in these models, caspase-14 activity was found only in the mature 3D skin model, EPI-200. This was confirmed by detection of a 17 kDa cleaved fragment of caspase-14 present only in the EPI-200 model. Since glucocorticoid (GC) receptor is required for skin barrier competence, we investigated whether the GC dexamethasone (Dex) and various natural components of common skin moisturizers affect caspase-14 expression in keratinocytes. Dex decreased caspase-14 expression in undifferentiated, but not differentiated, NHEKs. Conversely, Dex increased caspase-14 expression in both 3D skin models, although it did not alter caspase protease activity. Similar to treatment with Dex, treatment of the premature 3D skin mode, EPI-201 with a Galactomyces ferment filtrate markedly increased expression of caspase-14. Further, these results suggest that the effect of Dex, or lack thereof, on caspase-14 expression is dependent on the stage of keratinocyte differentiation.

  17. HUMAN AMNIOTIC MEMBRANE GRAFTING: A BOON IN OCULAR CHEMICAL INJURIES

    Directory of Open Access Journals (Sweden)

    Shashikala

    2013-03-01

    Full Text Available INTRODUCTION: Amniotic membrane is the innermost layer of the f etal membranes. It has a stromal matrix, a collagen layer, and an overlying basement membrane with a single layer of epithelium. (1 Amniotic membrane has unique properties including an ti-adhesive effects, bacterio-static properties, wound protection, pain redu ction, and epithelialisation effects. Another characteristic of amniotic membrane is the lack of imunogenicity. (2 Amniotic membranes have been used as a dressing to promote he aling of chronic ulcers of the leg and as a biological dressing for burned skin and skin woun ds. (3, 4 It has also been used in surgical reconstruction of artificial vagina, for repairing o mphaloceles, and to prevent tissue adhesion in surgeries of the abdomen, head, or pelvis. (5, 6 Amniotic membrane has been successfully used in ocular conditions like persistent epithelial defects (7, pterygium, (8 Symblepharon (9 and for ocular surface reconstruction. (10, 11 The purpose of this study was to evaluate the use of cryo- preserved Human amniotic membrane graft( HAMT, with or without limbal autograft transplantation (LAT in patients with previous and fr esh chemical eye injuries respectively. Institutional ethical committee approval was obtained .

  18. Epidermal mechano-acoustic sensing electronics for cardiovascular diagnostics and human-machine interfaces

    Science.gov (United States)

    Liu, Yuhao; Norton, James J. S.; Qazi, Raza; Zou, Zhanan; Ammann, Kaitlyn R.; Liu, Hank; Yan, Lingqing; Tran, Phat L.; Jang, Kyung-In; Lee, Jung Woo; Zhang, Douglas; Kilian, Kristopher A.; Jung, Sung Hee; Bretl, Timothy; Xiao, Jianliang; Slepian, Marvin J.; Huang, Yonggang; Jeong, Jae-Woong; Rogers, John A.

    2016-01-01

    Physiological mechano-acoustic signals, often with frequencies and intensities that are beyond those associated with the audible range, provide information of great clinical utility. Stethoscopes and digital accelerometers in conventional packages can capture some relevant data, but neither is suitable for use in a continuous, wearable mode, and both have shortcomings associated with mechanical transduction of signals through the skin. We report a soft, conformal class of device configured specifically for mechano-acoustic recording from the skin, capable of being used on nearly any part of the body, in forms that maximize detectable signals and allow for multimodal operation, such as electrophysiological recording. Experimental and computational studies highlight the key roles of low effective modulus and low areal mass density for effective operation in this type of measurement mode on the skin. Demonstrations involving seismocardiography and heart murmur detection in a series of cardiac patients illustrate utility in advanced clinical diagnostics. Monitoring of pump thrombosis in ventricular assist devices provides an example in characterization of mechanical implants. Speech recognition and human-machine interfaces represent additional demonstrated applications. These and other possibilities suggest broad-ranging uses for soft, skin-integrated digital technologies that can capture human body acoustics. PMID:28138529

  19. The human skin/chick chorioallantoic membrane model accurately predicts the potency of cosmetic allergens.

    Science.gov (United States)

    Slodownik, Dan; Grinberg, Igor; Spira, Ram M; Skornik, Yehuda; Goldstein, Ronald S

    2009-04-01

    The current standard method for predicting contact allergenicity is the murine local lymph node assay (LLNA). Public objection to the use of animals in testing of cosmetics makes the development of a system that does not use sentient animals highly desirable. The chorioallantoic membrane (CAM) of the chick egg has been extensively used for the growth of normal and transformed mammalian tissues. The CAM is not innervated, and embryos are sacrificed before the development of pain perception. The aim of this study was to determine whether the sensitization phase of contact dermatitis to known cosmetic allergens can be quantified using CAM-engrafted human skin and how these results compare with published EC3 data obtained with the LLNA. We studied six common molecules used in allergen testing and quantified migration of epidermal Langerhans cells (LC) as a measure of their allergic potency. All agents with known allergic potential induced statistically significant migration of LC. The data obtained correlated well with published data for these allergens generated using the LLNA test. The human-skin CAM model therefore has great potential as an inexpensive, non-radioactive, in vivo alternative to the LLNA, which does not require the use of sentient animals. In addition, this system has the advantage of testing the allergic response of human, rather than animal skin.

  20. Melatonin and its metabolites ameliorate ultraviolet B-induced damage in human epidermal keratinocytes.

    Science.gov (United States)

    Janjetovic, Zorica; Nahmias, Zachary P; Hanna, Sherie; Jarrett, Stuart G; Kim, Tae-Kang; Reiter, Russel J; Slominski, Adrzej T

    2014-08-01

    We investigated the protective effects of melatonin and its metabolites: 6-hydroxymelatonin (6-OHM), N1-acetyl-N2-formyl-5-methoxykynuramine (AFMK), N-acetylserotonin (NAS), and 5-methoxytryptamine (5-MT) in human keratinocytes against a range of doses (25, 50, and 75 mJ/cm2) of ultraviolet B (UVB) radiation. There was significant reduction in the generation of reactive oxygen species (50-60%) when UVB-exposed keratinocytes were treated with melatonin or its derivatives. Similarly, melatonin and its metabolites reduced the nitrite and hydrogen peroxide levels that were induced by UVB as early as 30 min after the exposure. Moreover, melatonin and its metabolites enhanced levels of reduced glutathione in keratinocytes within 1 hr after UVB exposure in comparison with control cells. Using proliferation assay, we observed a dose-dependent increase in viability of UVB-irradiated keratinocytes that were treated with melatonin or its derivatives after 48 hr. Using the dot-blot technique and immunofluorescent staining we also observed that melatonin and its metabolites enhanced the DNA repair capacity of UVB-induced pyrimidine photoproducts (6-4)or cyclobutane pyrimidine dimers generation in human keratinocytes. Additional evidence for induction of DNA repair in cells exposed to UVB and treated with the indole compounds was shown using the Comet assay. Finally, melatonin and its metabolites further enhanced expression of p53 phosphorylated at Ser-15 but not at Ser-46 or its nonphosphorylated form. In conclusion, melatonin, its precursor NAS, and its metabolites 6-OHM, AFMK, 5-MT, which are endogenously produced in keratinocytes, protect these cells against UVB-induced oxidative stress and DNA damage. © 2014 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.

  1. PAI-1 transcriptional regulation during the G0 --> G1 transition in human epidermal keratinocytes.

    Science.gov (United States)

    Qi, Li; Allen, Rosalie R; Lu, Qi; Higgins, Craig E; Garone, Rosemarie; Staiano-Coico, Lisa; Higgins, Paul J

    2006-10-01

    Plasminogen activator inhibitor type-1 (PAI-1) is the major negative regulator of the plasmin-dependent pericellular proteolytic cascade. PAI-1 gene expression is normally growth state regulated but frequently elevated in chronic fibroproliferative and neoplastic diseases affecting both stromal restructuring and cellular migratory activities. Kinetic modeling of cell cycle transit in synchronized human keratinocytes (HaCaT cells) indicated that PAI-1 transcription occurred early after serum stimulation of quiescent (G0) cells and prior to entry into a cycling G1 condition. PAI-1 repression (in G0) was associated with upstream stimulatory factor-1 (USF-1) occupancy of two consensus E box motifs (5'-CACGTG-3') at the PE1 and PE2 domains in the PF1 region (nucleotides -794 to -532) of the PAI-1 promoter. Chromatin immunoprecipitation (ChIP) analysis established that the PE1 and PE2 site E boxes were occupied by USF-1 in quiescent cells and by USF-2 in serum-activated, PAI-1-expressing keratinocytes. This reciprocal and growth state-dependent residence of USF family members (USF-1 vs. USF-2) at PE1/PE2 region chromatin characterized the G0 --> G1 transition period and the transcriptional status of the PAI-1 gene. A consensus E box motif was required for USF/E box interactions, as a CG --> AT substitution at the two central nucleotides inhibited formation of USF/probe complexes. The 5' flanking sites (AAT or AGAC) in the PE2 segment were not necessary for USF binding. USF recognition of the PE1/PE2 region E box sites required phosphorylation with several potential involved residues, including T153, maping to the USF-specific region (USR). A T153A substitution in USF-1 did not repress serum-induced PAI-1 expression whereas the T153D mutant was an effective suppressor. As anticipated from the ChIP results, transfection of wild-type USF-2 failed to inhibit PAI-1 induction. Collectively, these data suggest that USF family members are important regulators of PAI-1 gene

  2. Normal human epidermal keratinocytes treated with 7-dehydrocholesterol express increased levels of heat shock protein.

    Science.gov (United States)

    Mammone, Thomas; Muizzuddin, Neelam; Goyarts, Earl; Gan, David; Giacomoni, Paolo; Marenus, Ken; Maes, Daniel

    2004-01-01

    Human skin, and its isolated cells, respond to insults with a variety of repair and protective mechanisms. One such mechanism is the production of heat shock proteins (HSPs). Heat shock proteins help the other cellular proteins fold correctly into their active three-dimensional structures. Therefore, they can enhance the survival of cells under harsh, denaturing conditions. In order to develop a means of promoting the heat shock response to prepare the skin to withstand insult, we are investigating materials that appear to protect the skin biologically. One such material is vitamin D3 and its precursors. We have observed that keratinocytes treated with 7-dehydrocholesterol (7-DHC), a precursor of vitamin D3, have increased levels of protein and mRNA for heat shock proteins. In addition, we observed that topically applied 7-DHC increases the minimal dose of UVB required to induce erythema. These data suggest that 7-DHC can induce heat shock proteins in skin keratinocytes and that they will be more resistant to UVB insult.

  3. Differential regulation of type I interferon and epidermal growth factor pathways by a human Respirovirus virulence factor.

    Directory of Open Access Journals (Sweden)

    Grégory Caignard

    2009-09-01

    Full Text Available A number of paramyxoviruses are responsible for acute respiratory infections in children, elderly and immuno-compromised individuals, resulting in airway inflammation and exacerbation of chronic diseases like asthma. To understand the molecular pathogenesis of these infections, we searched for cellular targets of the virulence protein C of human parainfluenza virus type 3 (hPIV3-C. We found that hPIV3-C interacts directly through its C-terminal domain with STAT1 and GRB2, whereas C proteins from measles or Nipah viruses failed to do so. Binding to STAT1 explains the previously reported capacity of hPIV3-C to block type I interferon signaling, but the interaction with GRB2 was unexpected. This adaptor protein bridges Epidermal Growth Factor (EGF receptor to MAPK/ERK pathway, a signaling cascade recently found to be involved in airway inflammatory response. We report that either hPIV3 infection or transient expression of hPIV3-C both increase cellular response to EGF, as assessed by Elk1 transactivation and phosphorylation levels of ERK1/2, 40S ribosomal subunit protein S6 and translation initiation factor 4E (eIF4E. Furthermore, inhibition of MAPK/ERK pathway with U0126 prevented viral protein expression in infected cells. Altogether, our data provide molecular basis to explain the role of hPIV3-C as a virulence factor and determinant of pathogenesis and demonstrate that Paramyxoviridae have evolved a single virulence factor to block type I interferon signaling and to boost simultaneous cellular response to growth factors.

  4. Prediction of recurrence risk in early breast cancer using human epidermal growth factor 2 and cyclin A2

    Institute of Scientific and Technical Information of China (English)

    LI Hui-ping; XIAO Yu; WANG You-fan; L(U) You-yong; SUN Yan; JI Jia-fu; HOU Kuan-yong; LEI Yu-tao; ZHAO Hong-mei; WANG Jing; ZHENG Jie; LIU Jian-ying; WANG Mo-pei

    2010-01-01

    Background Human epidermal growth factor 2 (HER2) is one of the most important prediction factors, but only 25%-30% of breast cancer patients HER2 are positive. It is unknown whether there are other molecular markers that could be used to predict prognosis and recurrence in HER2 negative patients.This study investigated correlations of cyclin A2 and HER2 levels with clinical outcomes in 281 patients with invasive breast cancer in order to identify whether cyclin A2 can serve as a prognostic factor in HER2 negative patients.Methods Immunohistochemical staining was used to detect cyclin A2 and HER2 expression in 281 patients. Cyclin A2. and HER2 gene amplifications were analyzed using gene analysis and RT-PCR in 12 patients. Risk and survival estimates were analyzed using Log-rank, Kaplan-Meier, and Cox regression analysis; cyclin A2 and HER2 consistency with survival were analyzed using Kappa analysis.Results Patients with higher cyclin A2 and HER2 expressions had significantly shorter disease-free survival periods (P=0.047 and P=0.05, respectively). Kappa analysis performed that cyclin A2 and HER2 showed a low Kappa index (kappa=0.37), allowing us to conclude that cyclin A2 and HER2 detect different pathologies. Gene analysis and RT-PCR showed that cyclin A2 was upregulated in patients with early relapse; the average increase was 3.69-2.74 fold.Conclusions Cyclin A2 and HER2 are associated with proliferation and high recurrence, particularly when combined. Cyclin A2 is easily detected by nuclear staining and might be a useful biomarker for recurrence risk in HER2 negative patients.

  5. Association between cadmium and breast cancer risk according to estrogen receptor and human epidermal growth factor receptor 2: epidemiological evidence.

    Science.gov (United States)

    Strumylaite, Loreta; Kregzdyte, Rima; Bogusevicius, Algirdas; Poskiene, Lina; Baranauskiene, Dale; Pranys, Darius

    2014-05-01

    The study aimed to examine the association between cadmium (Cd) and the risk of breast cancer according to estrogen receptor (ER) and human epidermal growth factor receptor 2 (HER2). A hospital-based case-control study was carried out in 585 cases and 1,170 controls. Information on possible risk factors was collected via a structured questionnaire. Urinary Cd was determined by atomic absorption spectrometry. The ER and HER2 levels in tumor tissue were analyzed by immunohistochemistry. Logistic regression was used to calculate odds ratios (ORs) and 95 % confidence intervals (CIs) for breast cancer by creatinine-adjusted urinary Cd. Women with greater creatinine-adjusted urine Cd (3rd quartile: 0.241-0.399 μg/g and 4th quartile: ≥ 0.4 μg/g) experienced 1.6 times higher risk of breast cancer compared with those having Cd concentration lower than 0.147 μg/g (1st quartile) [OR = 1.6, (95 % CI 1.19, 2.17) and OR = 1.62 (95 % CI 1.19, 2.21), respectively, P trend = 0.001] after adjustment for age and other confounders. Both ER+ and HER2- cases from the highest quartile of urine Cd exhibited approximately twice the breast cancer risk of those in the lowest quartile [OR = 1.9, (95 % CI 1.31, 2.74) and OR = 1.87, (95 % CI 1.33, 2.62), respectively, P trend cadmium as a risk factor for breast cancer, especially for both ER+ and HER2- cancer patients.

  6. Downregulation of Epidermal Growth Factor Receptor Expression Contributes to α-TEA's Proapoptotic Effects in Human Ovarian Cancer Cell Lines

    Directory of Open Access Journals (Sweden)

    Ming-Chieh Shun

    2010-01-01

    Full Text Available RRR-α-tocopherol derivative α-TEA (RRR-α-tocopherol ether-linked acetic acid analog has been shown to be a potent antitumor agent both in vivo and in vitro. In this study, we investigated the effects of α-TEA on the expression of epidermal growth factor receptor (EGFR family members, ErbB1, 2 and 3, and the role of ErbB 2 and 3 in α-TEA-induced apoptosis and suppression of Akt, FLIP and survivin in the cisplatin-sensitive (A2780S and -resistant (A2780/CP70R human ovarian cancer cell lines. Data show that α-TEA's ability to induced apoptosis was associated with reduced expression of ErbB1 (cisplatin-resistant cells, 2 and 3 (both cell types and reduced levels of the phosphorylated (active form of Akt; as well as, reduced levels of FLIP and survivin proteins in both cell types. Ectopic overexpression and siRNA knockdown studies showed that ErbB2, ErbB3, Akt, FLIP and survivin are involved in α-TEA-induce apoptosis and that α-TEA downregulates FLIP and survivin via suppression of pAkt, which is mediated by ErbB2 and ErB3. Thus, α-TEA is a potent pro-apoptotic agent for both cisplatin-sensitive and -resistant ovarian cancer cell lines in cell culture and it produces cell death, at least in part, by downregulation of members of the EGFR family.

  7. Pertuzumab for the treatment of patients with human epidermal growth factor receptor 2-positive breast cancer in Japan.

    Science.gov (United States)

    Osako, Tomofumi; Nishimura, Reiki; Nishiyama, Yasuyuki; Fujisue, Mamiko

    2015-11-01

    Pertuzumab, a novel anti-human epidermal growth factor receptor 2 (HER2) agent, is effective for metastatic HER2-positive breast cancer when used in combination with taxane and trastuzumab. The aim of the present study was to describe the use of pertuzumab in Japan. A phase I clinical trial of pertuzumab for HER2-positive metastatic breast cancer was first conducted in the United States in 2001 (study ID no. TOC2297g) and for HER2-positive solid cancers in Japan in 2004 (study ID no. JO17076). However, Japanese patients were not enrolled in a global phase II trial for metastatic breast cancer (study ID no. BO17929) and no phase II trial of pertuzumab for Japanese patients has yet been conducted. A phase III trial on pertuzumab for metastatic breast cancer (CLEOPATRA study), which included 53 Japanese patients, revealed that pertuzumab significantly prolonged progression-free and overall survival. However, the superiority of the pertuzumab group was not verified in the subgroup analysis of Japanese patients, which was not a preplanned analysis. Therefore, a postmarketing clinical trial for Japanese patients with HER2-positive metastatic breast cancer (COMACHI study) was initiated in November, 2013, to investigate the clinical effectiveness of pertuzumab in Japanese patients. As of December, 2014, global trials on pertuzumab in the metastatic and adjuvant settings are currently ongoing. These trials included Japanese patients with HER2-positive breast cancer. Pertuzumab was approved in Japan in August, 2013 due to the positive findings of the CLEOPATRA study. Unlike the United States and Europe, the Japanes Pharmaceutical and Medical Devices Agency approved the administration of pertuzumab as second- or later-line treatment for HER2-positive metastatic breast cancer, as well as first-line treatment. Furthermore, pertuzumab may be used in combination with other chemotherapeutic agents, with the exception of docetaxel. The approval of the expanded use of pertuzumab is

  8. MicroRNA-181b negatively regulates the proliferation of human epidermal keratinocytes in psoriasis through targeting TLR4.

    Science.gov (United States)

    Feng, Cheng; Bai, Ming; Yu, Nan-Ze; Wang, Xiao-Jun; Liu, Zeng

    2017-02-01

    Our study aims to explore the role of microRNA-181b (miR-181b) and TLR in the regulation of cell proliferation of human epidermal keratinocytes (HEKs) in psoriasis. Twenty-eight patients diagnosed with psoriasis vulgaris were selected as a case group with their lesional and non-lesional skin tissues collected. A control group consisted of 20 patients who underwent plastic surgery with their healthy skin tissues collected. Real-time quantitative fluorescence polymerase chain reaction (RT-qPCR), in situ hybridization and immunohistochemistry were used to detect the expressions of miR-181b and TLR4 in HEKs of healthy skin, psoriatic lesional skin and non-lesional skin respectively. The 3' untranslated region (3'UTR) of TLR4 combined with miR-181b was verified by a dual-luciferase reporter assay. Western blotting and bromodeoxyuridine were applied for corresponding detection of TLR4 expression and cell mitosis. The expression of miR-181b in HEKs of psoriatic lesional skin was less than healthy skin and psoriatic non-lesional skin. In psoriatic lesional and non-lesional skin, TLR4-positive cell rates and the number of positive cells per square millimetre were higher than healthy skin. The dual-luciferase reporter assay verified that miR-181b targets TLR4. HEKs transfected with miR-181b mimics had decreased expression of TLR4, along with the decrease of mitotic indexes and Brdu labelling indexes. However, HEKs transfected with miR-181b inhibitors showed increased TLR4 expression, mitotic indexes and Brdu labelling indexes. HEKs transfected with both miR-181b inhibitors and siTLR4 had decreased mitotic indexes and Brdu labelling indexes. These results indicate that miR-181b can negatively regulate the proliferation of HEKs in psoriasis by targeting TLR4.

  9. Fundamental analysis of recombinant human epidermal growth factor in solution with biophysical methods.

    Science.gov (United States)

    Kim, Nam Ah; Lim, Dae Gon; Lim, Jun Yeul; Kim, Ki Hyun; Jeong, Seong Hoon

    2015-02-01

    Correlation of thermodynamic and secondary structural stability of proteins at various buffer pHs was investigated using differential scanning calorimetry (DSC), dynamic light scattering (DLS) and attenuated total reflection Fourier-transform infrared spectroscopy (ATR FT-IR). Recombinant human epithelial growth factor (rhEGF) was selected as a model protein at various pHs and in different buffers, including phosphate, histidine, citrate, HEPES and Tris. Particle size and zeta potential of rhEGF at each selected pH of buffer were observed by DLS. Four factors were used to characterize the biophysical stability of rhEGF in solution: temperature at maximum heat flux (Tm), intermolecular β-sheet contents, zeta size and zeta potential. It was possible to predict the apparent isoelectric point (pI) of rhEGF as 4.43 by plotting pH against zeta potential. When the pH of the rhEGF solution increased or decreased from pI, the absolute zeta potential increased indicating a reduced possibility of protein aggregation, since Tm increased and β-sheet contents decreased. The contents of induced intermolecular β-sheet in Tris and HEPES buffers were the lowest. Thermodynamic stability of rhEGF markedly increased when pH is higher than 6.2 in histidine buffer where Tm of first transition was all above 70 °C. Moreover, rhEGF in Tris buffer was more thermodynamically stable than in HEPES with higher zeta potential. Tris buffer at pH 7.2 was concluded to be the most favorable.

  10. Identification of calcium-binding proteins associated with the human sperm plasma membrane

    National Research Council Canada - National Science Library

    Naaby-Hansen, Soren; Diekman, Alan; Shetty, Jagathpala; Flickinger, Charles J; Westbrook, Anne; Herr, John C

    2010-01-01

    The precise composition of the human sperm plasma membrane, the molecular interactions that define domain specific functions, and the regulation of membrane associated proteins during the capacitation...

  11. The erythrocyte membrane in human muscular dystrophy

    NARCIS (Netherlands)

    W. Ruitenbeek (Willem)

    1979-01-01

    textabstractMore than 250 different forms of human neuromuscular diseases are known. They differ in age of onset, severity of weakness, rate of progression, type of inheritance, groups of muscles affected, frequency of incidence. Sometimes the clinical symptoms are not restricted to nervous and/or m

  12. Beyond membrane channelopathies: alternative mechanisms underlying complex human disease

    Institute of Scientific and Technical Information of China (English)

    Konstantinos Dean BOUDOULAS; Peter J MOHLER

    2011-01-01

    Over the past fifteen years, our understanding of the molecular mechanisms underlying human disease has flourished in large part due to the discovery of gene mutations linked with membrane ion channels and transporters. In fact, ion channel defects ("channelopathies" - the focus of this review series) have been associated with a spectrum of serious human disease phenotypes including cystic fibrosis, cardiac arrhythmia, diabetes, skeletal muscle defects, and neurological disorders. However, we now know that human disease, particularly excitable cell disease, may be caused by defects in non-ion channel polypeptides including in cellular components residing well beneath the plasma membrane. For example, over the past few years, a new class of potentially fatal cardiac arrhythmias has been linked with cytoplasmic proteins that include sub-membrane adapters such as ankyrin-B (ANK2),ankyrin-G (ANK3), and alpha-1 syntrophin, membrane coat proteins including caveolin-3 (CAV3), signaling platforms including yotiao (AKAPg), and cardiac enzymes (GPD1L). The focus of this review is to detail the exciting role of lamins, yet another class of gene products that have provided elegant new insight into human disease.

  13. Membrane properties in small cutaneous nerve fibers in humans

    DEFF Research Database (Denmark)

    Hennings, Kristian; Frahm, Ken Steffen; Petrini, Laura;

    2016-01-01

    than large fibers (rmANOVA, Bonferroni, P=0.006). CONCLUSION: This study is a reliable method to investigate the membrane properties of small cutaneous nerve fibers in humans and may be used in clinical settings as a diagnostic or profiling tool. This article is protected by copyright. All rights...

  14. Matriptase and prostasin are expressed in human skin in an inverse trend over the course of differentiation and are targeted to different regions of the plasma membrane

    Directory of Open Access Journals (Sweden)

    Chih-Hsin Lai

    2016-10-01

    Full Text Available Matriptase and prostasin, acting as a tightly coupled proteolytic cascade, were reported to be required for epidermal barrier formation in mouse skin. Here we show that, in human skin, matriptase and prostasin are expressed with an inverse pattern over the course of differentiation. Matriptase was detected primarily in epidermal basal keratinocytes and the basaloid cells in the outer root sheath of hair follicles and the sebaceous gland, where prostasin was not detected. In contrast, prostasin was detected primarily in differentiated cells in the epidermal granular layer, the inner root sheath of hair follicles, and the sebaceous gland, where matriptase expression is negligible. While co-expressed in the middle stage of differentiation, prostasin was detected as polarized patches, and matriptase at intercellular junctions. Targeting to different subcellular localizations is also observed in HaCaT human keratinocytes, in which matriptase was detected primarily at intercellular junctions, and prostasin primarily on membrane protrusion. Furthermore, upon induction of zymogen activation, free active prostasin remains cell-associated and free active matriptase is rapidly shed into the extracellular milieu. Our data suggest that matriptase and prostasin likely function as independent entities in human skin rather than as a tightly coupled proteolytic cascade as observed in mouse skin.

  15. Matriptase and prostasin are expressed in human skin in an inverse trend over the course of differentiation and are targeted to different regions of the plasma membrane

    Science.gov (United States)

    Lai, Chih-Hsin; Chang, Shun-Cheng; Chen, Yen-Ju; Wang, Yi-Jie J.; Lai, Ying-Jun J.; Chang, Hsiang-Hua D.; Berens, Eric B.; Johnson, Michael D.; Wang, Jehng-Kang; Lin, Chen-Yong

    2016-01-01

    ABSTRACT Matriptase and prostasin, acting as a tightly coupled proteolytic cascade, were reported to be required for epidermal barrier formation in mouse skin. Here we show that, in human skin, matriptase and prostasin are expressed with an inverse pattern over the course of differentiation. Matriptase was detected primarily in epidermal basal keratinocytes and the basaloid cells in the outer root sheath of hair follicles and the sebaceous gland, where prostasin was not detected. In contrast, prostasin was detected primarily in differentiated cells in the epidermal granular layer, the inner root sheath of hair follicles, and the sebaceous gland, where matriptase expression is negligible. While co-expressed in the middle stage of differentiation, prostasin was detected as polarized patches, and matriptase at intercellular junctions. Targeting to different subcellular localizations is also observed in HaCaT human keratinocytes, in which matriptase was detected primarily at intercellular junctions, and prostasin primarily on membrane protrusion. Furthermore, upon induction of zymogen activation, free active prostasin remains cell-associated and free active matriptase is rapidly shed into the extracellular milieu. Our data suggest that matriptase and prostasin likely function as independent entities in human skin rather than as a tightly coupled proteolytic cascade as observed in mouse skin. PMID:27543057

  16. Pharmacokinetics, biodistribution and dosimetry of 99mTc-labeled anti-human epidermal growth factor receptor humanized monoclonal antibody R3 in rats.

    Science.gov (United States)

    Iznaga Escobar, N; Morales, A M; Ducongé, J; Torres, I C; Fernández, E; Gómez, J A

    1998-01-01

    The pharmacokinetics, biodistribution and dosimetry of 99mTc-labeled anti-human epidermal growth factor receptor (anti-hEGF-r) humanized monoclonal antibody (MAb) R3 was investigated following intravenous injection in normal Wistar rats. Serum disappearance curves were best fit by a two-compartment model having a mean distribution half-life (t 1/2alpha) of 0.250 h and a mean elimination (t 1/2beta) of 13.89 h. Among the various organs, a little accumulation of the radiolabeled antibody was found only in kidneys. Biodistribution and dosimetry studies in humans were performed by extrapolation of the animal data to humans. Absorbed dose to normal organs and the remainder of the whole body were estimated using the medical internal radiation dose formula, and dose contributions from radioactivity in transit through the gastrointestinal tract were estimated using a compartment model. Extrapolated values of radiation absorbed dose to normal organs in rads per millicurie administered were whole body, 0.0085; lower large intestine wall, 0.0898; small intestine, 0.0530; upper large intestine wall, 0.0731; and kidneys, 0.0455. The effective dose equivalent predicted was 0.0162 rem/mCi and the effective dose was found to be 0.015 rem/mCi. On the basis of the pharmacokinetics, biodistribution and internal radiation dosimetry information obtained in this study, a diagnostic phase I clinical trial with 99mTc-labeled humanized MAb R3 conjugate in patients should be supported.

  17. Pertuzumab for the treatment of patients with human epidermal growth factor receptor 2-positive breast cancer in Japan

    Science.gov (United States)

    OSAKO, TOMOFUMI; NISHIMURA, REIKI; NISHIYAMA, YASUYUKI; FUJISUE, MAMIKO

    2015-01-01

    Pertuzumab, a novel anti-human epidermal growth factor receptor 2 (HER2) agent, is effective for metastatic HER2-positive breast cancer when used in combination with taxane and trastuzumab. The aim of the present study was to describe the use of pertuzumab in Japan. A phase I clinical trial of pertuzumab for HER2-positive metastatic breast cancer was first conducted in the United States in 2001 (study ID no. TOC2297g) and for HER2-positive solid cancers in Japan in 2004 (study ID no. JO17076). However, Japanese patients were not enrolled in a global phase II trial for metastatic breast cancer (study ID no. BO17929) and no phase II trial of pertuzumab for Japanese patients has yet been conducted. A phase III trial on pertuzumab for metastatic breast cancer (CLEOPATRA study), which included 53 Japanese patients, revealed that pertuzumab significantly prolonged progression-free and overall survival. However, the superiority of the pertuzumab group was not verified in the subgroup analysis of Japanese patients, which was not a preplanned analysis. Therefore, a postmarketing clinical trial for Japanese patients with HER2-positive metastatic breast cancer (COMACHI study) was initiated in November, 2013, to investigate the clinical effectiveness of pertuzumab in Japanese patients. As of December, 2014, global trials on pertuzumab in the metastatic and adjuvant settings are currently ongoing. These trials included Japanese patients with HER2-positive breast cancer. Pertuzumab was approved in Japan in August, 2013 due to the positive findings of the CLEOPATRA study. Unlike the United States and Europe, the Japanes Pharmaceutical and Medical Devices Agency approved the administration of pertuzumab as second- or later-line treatment for HER2-positive metastatic breast cancer, as well as first-line treatment. Furthermore, pertuzumab may be used in combination with other chemotherapeutic agents, with the exception of docetaxel. The approval of the expanded use of pertuzumab is

  18. Human epidermal growth factor receptor 2-positive breast cancer: which cytotoxic agent best complements trastuzumab's efficacy in vitro?

    Directory of Open Access Journals (Sweden)

    Hurrell T

    2013-06-01

    Full Text Available Tracey Hurrell, Kim OuthoffDepartment of Pharmacology, University of Pretoria, Pretoria, South AfricaIntroduction: Despite trastuzumab having enhanced selectivity for human epidermal growth factor receptor 2 (HER-2 overexpressing breast cancer cells, treatment is hampered by interindividual variation and tumors with high mitogenic potential. The lack of significant clinical benefit in certain patient cohorts suggests that HER-2 expression is ineffective as a sole prognostic indicator of response to therapy. Therefore, optimizing the clinical role of trastuzumab in drug combinations remains critical for clinical success.Aim: To investigate the effects of trastuzumab in combination with either doxorubicin or geldanamycin on in vitro cell viability, cell cycling, apoptosis and relative HER-2 expression in HER-2-positive (SK-BR-3 and estrogen receptor-positive (MCF-7 breast adenocarcinoma models.Results: HER-2-rich SK-BR-3 cells demonstrated a greater sensitivity to the effects of doxorubicin than MCF-7 cells. Concurrent trastuzumab exposure resulted in a further reduction in cell viability. This decreased cell viability induced by doxorubicin was associated with activation of executioner caspases as well as with alterations in cell-cycle kinetics, primarily promoting S-phase accumulation. Doxorubicin had no effect on surface HER-2 density expression. Geldanamycin reduced cell viability significantly greater in SK-BR-3 than MCF-7 cells, and was associated with G2 cell-cycle accumulation. The addition of trastuzumab did not augment these effects. Geldanamycin promoted substantial reductions in relative surface HER-2 density in SK-BR-3 cells.Conclusion: The in vitro data supported the rationale for using doxorubicin in trastuzumab-based therapies. Therefore, despite the incidence of cardiotoxicity, doxorubicin could retain a fundamental role in treating HER-2-positive breast cancer. While geldanamycin is a potent cytotoxic agent, its concurrent use

  19. Human epidermal growth factor receptor-2 overexpression and amplification in metastatic and recurrent high grade or type 2 endometrial carcinomas

    Directory of Open Access Journals (Sweden)

    Kato R

    2013-08-01

    Full Text Available Rina Kato,1 Kiyoshi Hasegawa,1 Risa Ishii,1 Akiko Owaki,1 Yutaka Torii,1 Shuko Oe,1 Hiroshi Hirasawa,2 Yoichi Kobayashi,3 Yasuhiro Udagawa1 1Department of Obstetrics and Gynecology, Fujita Health University School of Medicine, Toyoake, Japan; 2Department of Pathology, Fujita Health University School of Medicine, Toyoake, Japan; 3Department of Obstetrics and Gynecology, Kyorin University School of Medicine, Mitaka, Japan Introduction: Human epidermal growth factor receptor (HER-2 overexpression or gene amplification is more common in high-grade or type 2 endometrial carcinomas. We assessed the discordance of HER-2 expression between primary and metastatic or recurrent endometrial carcinomas. Materials and methods: Thirty-six primary, along with 14 metastatic and five recurrent tumors (matched to primaries, pathologically confirmed as high-grade or type 2 endometrial carcinomas, were submitted for immunohistochemistry (IHC for HER-2. Fluorescence in situ hybridization was performed when the tumors showed HER-2 overexpression (≥2+ IHC score. The results of the IHC and fluorescence in situ hybridization assays were compared between the primary and metastatic or recurrent tumors. The relationships between HER-2 expression and clinicopathological factors or prognosis were investigated. Results: HER-2 overexpression and HER-2 amplification (a ratio of HER-2 copies to chromosome 17 [CEP17] copies ≥2.2 were detected in 33.3% (twelve of 36 patients and 5.6% (two of 36 patients of primary tumors, respectively. HER-2 overexpression was not associated with clinicopathological factors or prognosis. In 19 tumor specimens obtained from metastatic or recurrent tumors, HER-2 overexpression and HER-2 amplification were detected in 57.9% (eleven patients and 15.8% (three patients, respectively. HER-2 overexpression tended to predict a worse prognosis. Conclusion: HER-2 expression in metastatic or recurrent tumors was more frequent than in matched primary high

  20. Epidermal Vascular Endothelial Growth Factor Production Is Required for Permeability Barrier Homeostasis, Dermal Angiogenesis, and the Development of Epidermal Hyperplasia

    Science.gov (United States)

    Elias, Peter M.; Arbiser, Jack; Brown, Barbara E.; Rossiter, Heidemarie; Man, Mao-Qiang; Cerimele, Francesca; Crumrine, Debra; Gunathilake, Roshan; Choi, Eung Ho; Uchida, Yoshikazu; Tschachler, Erwin; Feingold, Kenneth R.

    2008-01-01

    Primary abnormalities in permeability barrier function appear to underlie atopic dermatitis and epidermal trauma; a concomitant barrier dysfunction could also drive other inflammatory dermatoses, including psoriasis. Central to this outside-inside view of disease pathogenesis is the epidermal generation of cytokines/growth factors, which in turn signal downstream epidermal repair mechanisms. Yet, this cascade, if sustained, signals downstream epidermal hyperplasia and inflammation. We found here that acute barrier disruption rapidly stimulates mRNA and protein expression of epidermal vascular endothelial growth factor-A (VEGF-A) in normal hairless mice, a specific response to permeability barrier requirements because up-regulation is blocked by application of a vapor-impermeable membrane. Moreover, epidermal vegf−/− mice display abnormal permeability barrier homeostasis, attributable to decreased VEGF signaling of epidermal lamellar body production; a paucity of dermal capillaries with reduced vascular permeability; and neither angiogenesis nor epidermal hyperplasia in response to repeated tape stripping (a model of psoriasiform hyperplasia). These results support a central role for epidermal VEGF in the maintenance of epidermal permeability barrier homeostasis and a link between epidermal VEGF production and both dermal angiogenesis and the development of epidermal hyperplasia. Because psoriasis is commonly induced by external trauma [isomorphic (Koebner) phenomenon] and is associated with a prominent permeability barrier abnormality, excess VEGF production, prominent angiogenesis, and epidermal hyperplasia, these results could provide a potential outside-inside mechanistic basis for the development of psoriasis. PMID:18688025

  1. The epidermal growth factor-like domain of the human cartilage large aggregating proteoglycan, aggrecan: increased serum concentration in rheumatoid arthritis

    DEFF Research Database (Denmark)

    Møller, H J; Ingemann-Hansen, T; Poulsen, J H

    1994-01-01

    The large aggregating proteoglycan from human cartilage, aggrecan, has recently been shown to possess an immunologically detectable domain with close homology to epidermal growth factor (EGF), that is variably expressed by alternative mRNA splicing. Using a competitive ELISA we detected this domain...... in sera from both patients with RA and normal controls. The EGF-like domain could only be detected after digestion of sera with chondroitinase ABC, which demonstrates its proteoglycan origin. The concentration of the aggrecan EGF-like domain was considerably elevated in sera from patients with RA...

  2. Pathogen receptor discovery with a microfluidic human membrane protein array

    Science.gov (United States)

    Glick, Yair; Ben-Ari, Ya’ara; Drayman, Nir; Pellach, Michal; Neveu, Gregory; Boonyaratanakornkit, Jim; Avrahami, Dorit; Einav, Shirit; Oppenheim, Ariella

    2016-01-01

    The discovery of how a pathogen invades a cell requires one to determine which host cell receptors are exploited. This determination is a challenging problem because the receptor is invariably a membrane protein, which represents an Achilles heel in proteomics. We have developed a universal platform for high-throughput expression and interaction studies of membrane proteins by creating a microfluidic-based comprehensive human membrane protein array (MPA). The MPA is, to our knowledge, the first of its kind and offers a powerful alternative to conventional proteomics by enabling the simultaneous study of 2,100 membrane proteins. We characterized direct interactions of a whole nonenveloped virus (simian virus 40), as well as those of the hepatitis delta enveloped virus large form antigen, with candidate host receptors expressed on the MPA. Selected newly discovered membrane protein–pathogen interactions were validated by conventional methods, demonstrating that the MPA is an important tool for cellular receptor discovery and for understanding pathogen tropism. PMID:27044079

  3. A sensitive enzyme immunoassay for human epidermal growth factor. Determination of hEGF in human serum and urine and pharmacokinetics in mouse.

    Science.gov (United States)

    Hayashi, T; Hashimoto, K; Sakamoto, S

    1989-07-01

    A sensitive enzyme immunoassay for human epidermal growth factor (hEGF) is described. The anti-hEGF antibody was prepared by immunizing rabbits with hEGF, which was synthesized by Escherichia coli using the genetic engineering technique. The present assay system was based on the sandwiching of an antigen between anti-hEGF F(ab')2 precoated on a 96-well polystyrene plate and beta-D-galactosidase-labeled anti-hEGF Fab'. The range of measurable hEGF by this assay was 0.1-100 pg/well. Recoveries of hEGF added to serum and urine ranged between 94 and 108%. The intra- and inter-assay coefficients of variation were less than 6 and 8%, respectively. The results obtained by this assay method correlated well with those obtained by the radioimmunoassay method. By using this assay, the time course of serum hEGF levels in mice after the various administrations were also examined.

  4. Detergent-resistant membranes in human erythrocytes and their connection to the membrane-skeleton

    Indian Academy of Sciences (India)

    Annarita Ciana; Cesare Balduini; Giampaolo Minetti

    2005-06-01

    In cell membranes, local inhomogeneity in the lateral distribution of lipids and proteins is thought to exist in vivo in the form of lipid ‘rafts’, microdomains enriched in cholesterol and sphingolipids, and in specific classes of proteins, that appear to play specialized roles for signal transduction, cell-cell recognition, parasite or virus infection, and vesicular trafficking. These structures are operationally defined as membranes resistant to solubilization by nonionic detergents at 4°C (detergent-resistant membranes, DRMs). This definition appears to be necessary and sufficient, although additional manoeuvres, not always described with sufficient detail, may be needed to ensure isolation of DRMs, like mechanical homogenization, and changes in the pH and/or ionic strength of the solubilization medium. We show here for the human erythrocyte that the different conditions adopted may lead to the isolation of qualitatively and quantitatively different DRM fractions, thus contributing to the complexity of the notion itself of lipid raft. A significant portion of erythrocyte DRMs enriched in reported lipid raft markers, such as flotillin-1, flotillin-2 and GM1, is anchored to the spectrin membrane-skeleton via electrostatic interactions that can be disrupted by the simultaneous increase in pH and ionic strength of the solubilization medium.

  5. Detergent-resistant membranes in human erythrocytes and their connection to the membrane-skeleton

    Indian Academy of Sciences (India)

    Annarita Ciana; Cesare Balduini; Giampaolo Minetti

    2005-09-01

    In cell membranes, local inhomogeneity in the lateral distribution of lipids and proteins is thought to exist in vivo in the form of lipid ‘rafts’, microdomains enriched in cholesterol and sphingolipids, and in specific classes of proteins, that appear to play specialized roles for signal transduction, cell-cell recognition, parasite or virus infection, and vesicular trafficking. These structures are operationally defined as membranes resistant to solubilization by nonionic detergents at 4°C (detergent-resistant membranes, DRMs). This definition appears to be necessary and sufficient, although additional manoeuvres, not always described with sufficient detail, may be needed to ensure isolation of DRMs, like mechanical homogenization, and changes in the pH and/or ionic strength of the solubilization medium. We show here for the human erythrocyte that the different conditions adopted may lead to the isolation of qualitatively and quantitatively different DRM fractions, thus contributing to the complexity of the notion itself of lipid raft. A significant portion of erythrocyte DRMs enriched in reported lipid raft markers, such as flotillin-1, flotillin-2 and GM1, is anchored to the spectrin membrane-skeleton via electrostatic interactions that can be disrupted by the simultaneous increase in pH and ionic strength of the solubilization medium.

  6. Evaluation of cultured human dermal- and dermo-epidermal substitutes focusing on extracellular matrix components: Comparison of protein and RNA analysis.

    Science.gov (United States)

    Oostendorp, Corien; Meyer, Sarah; Sobrio, Monia; van Arendonk, Joyce; Reichmann, Ernst; Daamen, Willeke F; van Kuppevelt, Toin H

    2017-05-01

    Treatment of full-thickness skin defects with split-thickness skin grafts is generally associated with contraction and scar formation and cellular skin substitutes have been developed to improve skin regeneration. The evaluation of cultured skin substitutes is generally based on qualitative parameters focusing on histology. In this study we focused on quantitative evaluation to provide a template for comparison of human bio-engineered skin substitutes between clinical and/or research centers, and to supplement histological data. We focused on extracellular matrix proteins since these components play an important role in skin regeneration. As a model we analyzed the human dermal substitute denovoDerm and the dermo-epidermal skin substitute denovoSkin. The quantification of the extracellular matrix proteins type III collagen and laminin 5 in tissue homogenates using western blotting analysis and ELISA was not successful. The same was true for assaying lysyl oxidase, an enzyme involved in crosslinking of matrix molecules. As an alternative, gene expression levels were measured using qPCR. Various RNA isolation procedures were probed. The gene expression profile for specific dermal and epidermal genes could be measured reliably and reproducibly. Differences caused by changes in the cell culture conditions could easily be detected. The number of cells in the skin substitutes was measured using the PicoGreen dsDNA assay, which was found highly quantitative and reproducible. The (dis) advantages of assays used for quantitative evaluation of skin substitutes are discussed.

  7. Effects of radiation on the permeability of human basement membranes

    Science.gov (United States)

    Fan, B.-T.; Achour, S.; Simmonet, F.; Guerin, D.

    1999-02-01

    The influence of radiation on the permeability properties of human basement membrane was investigated by measuring the diffusion rate of several organic compounds (glycine, proline, glucose, urea and insulin) through human anterior lens capsules. The basement membranes borne an γ-irradiation treatment change significantly their permeability vis-a-vis studied organic substances. This modification in physico-chemical properties is probably due to the radiation, which alters or degrades the complex structure (or architecture) of basement membranes. Moreover the change in permeability is dependent upon the diffusing compounds. An increase in diffusion has been observed for glucose, glycine and urea. However for insulin and proline, a decrease in diffusion rate was observed. L'influence de radiation sur la perméabilité de la membrane basale a été étudiée par la mesure de la vitesse de diffusion de plusieurs composés organiques d'intérêt biologique (glycine, proline, glucose, urée et insuline) à travers la lame basale antérieure du cristallin de l'oil humain. Les membranes basales qui sont traitées avec l'irradiation γ changent significativement leur perméabilité vis-à-vis des substances organiques. Ce changement de propriétés physico-chimiques est probablement dû à l'altération ou la dégradation de la structure (ou de l'architecture) de la membrane basale entraînée par l'irradiation. De plus, la modification de la perméabilité de la membrane basale est dépendante des composés diffusants. Une augmentation de la vitesse de diffusion a été observée pour le glucose, le glycine et l'urée. Par contre, dans les cas de l'insuline et de la proline, on a observé une diminution de la vitesse de diffusion.

  8. Integral membrane pyrophosphatases: a novel drug target for human pathogens?

    Directory of Open Access Journals (Sweden)

    Henri Xhaard

    2016-03-01

    Full Text Available Membrane-integral pyrophosphatases (mPPases are found in several human pathogens, including Plasmodium species, the protozoan parasites that cause malaria. These enzymes hydrolyze pyrophosphate and couple this to the pumping of ions (H+ and/or Na+ across a membrane to generate an electrochemical gradient. mPPases play an important role in stress tolerance in plants, protozoan parasites, and bacteria. The solved structures of mPPases from Vigna radiata and Thermotoga maritima open the possibility of using structure-based drug design to generate novel molecules or repurpose known molecules against this enzyme. Here, we review the current state of knowledge regarding mPPases, focusing on their structure, the proposed mechanism of action, and their role in human pathogens. We also summarize different methodologies in structure-based drug design and propose an example region on the mPPase structure that can be exploited by these structure-based methods for drug targeting. Since mPPases are not found in animals and humans, this enzyme is a promising potential drug target against livestock and human pathogens.

  9. Photoacoustic measurement of epidermal melanin

    Science.gov (United States)

    Viator, John A.; Svaasand, Lars O.; Aguilar, Guillermo; Choi, Bernard; Nelson, J. Stuart

    2003-06-01

    Most dermatologic laser procedures must consider epidermal melanin, as it is a broadband optical absorber which affects subsurface fluence, effectively limiting the amount of light reaching the dermis and targeted chromophores. An accurate method for quantifying epidermal melanin content would aid clinicians in determining proper light dosage for therapeutic laser procedures. While epidermal melanin content has been quantified non-invasively using optical methods, there is currently no way to determine the melanin distribution in the epidermis. We have developed a photoacoustic probe that uses a Q-switched, frequency doubled Nd:YAG laser operating at 532nm to generate acoustic pulses in skin in vivo. The probe contained a piezoelectric element that detected photoacoustic waves which were then analyzed for epidermal melanin content, using a photoacoustic melanin index (PAMI). We tested 15 human subjects with skin types I--VI using the photoacoustic probe. We also present photoacoustic data for a human subject with vitiligo. Photoacoustic measurement showed melanin in the vitiligo subject was almost completely absent.

  10. NASA-approved rotary bioreactor enhances proliferation of human epidermal stem cells and supports formation of 3D epidermis-like structure.

    Directory of Open Access Journals (Sweden)

    Xiao-hua Lei

    Full Text Available The skin is susceptible to different injuries and diseases. One major obstacle in skin tissue engineering is how to develop functional three-dimensional (3D substitute for damaged skin. Previous studies have proved a 3D dynamic simulated microgravity (SMG culture system as a "stimulatory" environment for the proliferation and differentiation of stem cells. Here, we employed the NASA-approved rotary bioreactor to investigate the proliferation and differentiation of human epidermal stem cells (hEpSCs. hEpSCs were isolated from children foreskins and enriched by collecting epidermal stem cell colonies. Cytodex-3 micro-carriers and hEpSCs were co-cultured in the rotary bioreactor and 6-well dish for 15 days. The result showed that hEpSCs cultured in rotary bioreactor exhibited enhanced proliferation and viability surpassing those cultured in static conditions. Additionally, immunostaining analysis confirmed higher percentage of ki67 positive cells in rotary bioreactor compared with the static culture. In contrast, comparing with static culture, cells in the rotary bioreactor displayed a low expression of involucrin at day 10. Histological analysis revealed that cells cultured in rotary bioreactor aggregated on the micro-carriers and formed multilayer 3D epidermis structures. In conclusion, our research suggests that NASA-approved rotary bioreactor can support the proliferation of hEpSCs and provide a strategy to form multilayer epidermis structure.

  11. 3D pharmacophore-based virtual screening, docking and density functional theory approach towards the discovery of novel human epidermal growth factor receptor-2 (HER2) inhibitors.

    Science.gov (United States)

    Gogoi, Dhrubajyoti; Baruah, Vishwa Jyoti; Chaliha, Amrita Kashyap; Kakoti, Bibhuti Bhushan; Sarma, Diganta; Buragohain, Alak Kumar

    2016-12-21

    Human epidermal growth factor receptor 2 (HER2) is one of the four members of the epidermal growth factor receptor (EGFR) family and is expressed to facilitate cellular proliferation across various tissue types. Therapies targeting HER2, which is a transmembrane glycoprotein with tyrosine kinase activity, offer promising prospects especially in breast and gastric/gastroesophageal cancer patients. Persistence of both primary and acquired resistance to various routine drugs/antibodies is a disappointing outcome in the treatment of many HER2 positive cancer patients and is a challenge that requires formulation of new and improved strategies to overcome the same. Identification of novel HER2 inhibitors with improved therapeutics index was performed with a highly correlating (r=0.975) ligand-based pharmacophore model (Hypo1) in this study. Hypo1 was generated from a training set of 22 compounds with HER2 inhibitory activity and this well-validated hypothesis was subsequently used as a 3D query to screen compounds in a total of four databases of which two were natural product databases. Further, these compounds were analyzed for compliance with Veber's drug-likeness rule and optimum ADMET parameters. The selected compounds were then subjected to molecular docking and Density Functional Theory (DFT) analysis to discern their molecular interactions at the active site of HER2. The findings thus presented would be an important starting point towards the development of novel HER2 inhibitors using well-validated computational techniques.

  12. Synergistic anti-proliferative and pro-apoptotic activity of combined therapy with bortezomib, a proteasome inhibitor, with anti-epidermal growth factor receptor (EGFR) drugs in human cancer cells.

    Science.gov (United States)

    Cascone, Tina; Morelli, Maria Pia; Morgillo, Floriana; Kim, Woo-Young; Rodolico, Gabriella; Pepe, Stefano; Tortora, Giampaolo; Berrino, Liberato; Lee, Ho-Young; Heymach, John V; Ciardiello, Fortunato

    2008-09-01

    The proteasome plays a pivotal role in the turnover of regulatory transduction proteins induced by activated cell membrane growth factor receptors. The epidermal growth factor receptor (EGFR) pathway is crucial in the development and progression of human epithelial cancers. Proteasome inhibition may sensitize human cancer cell lines to EGFR inhibitors. We investigated the growth inhibitory and pro-apoptotic effects of the proteasome inhibitor bortezomib in combination with anti-EGFR drugs, such as gefitinib, vandetanib, and cetuximab in EGFR-expressing human cancer cell lines. Bortezomib determined dose-dependent growth inhibition in a nine cancer cell line panel (IC(50) values, range 6-42 nM). A significant synergistic growth inhibitory effect was observed with the combination of bortezomib and each EGFR inhibitor in all cell lines (combination index, CI, range 0.10-0.55), which was accompanied by a significant induction in apoptosis by the combined treatment with bortezomib, cetuximab and vandetanib. In HCT-116 colon cancer and A549 lung adenocarcinoma cells, bortezomib plus EGFR inhibitor treatment induced a more effective inhibition of EGFR-activated down-stream signals, including a marked suppression in activated, phosphorylated Akt (P-Akt). In contrast, overexpression of a constitutively active P-Akt protected A549 cells by cell growth inhibition and apoptosis following treatment with bortezomib and EGFR inhibitors. The combined treatment with bortezomib and EGFR inhibitors has a synergistic growth inhibitory and pro-apoptotic activity in different human cancer cells which possess a functional EGFR-dependent autocrine growth pathway through to a more efficient and sustained inhibition of Akt.

  13. Epidermal growth factor-like domain 7 promotes migration and invasion of human trophoblast cells through activation of MAPK, PI3K and NOTCH signaling pathways.

    Science.gov (United States)

    Massimiani, M; Vecchione, L; Piccirilli, D; Spitalieri, P; Amati, F; Salvi, S; Ferrazzani, S; Stuhlmann, H; Campagnolo, L

    2015-05-01

    Epidermal growth factor-like domain 7 (Egfl7) is a gene that encodes a partially secreted protein and whose expression is largely restricted to the endothelia. We recently reported that EGFL7 is also expressed by trophoblast cells in mouse and human placentas. Here, we investigated the molecular pathways that are regulated by EGFL7 in trophoblast cells. Stable EGFL7 overexpression in a Jeg3 human choriocarcinoma cell line resulted in significantly increased cell migration and invasiveness, while cell proliferation was unaffected. Analysis of mitogen-activated protein kinase (MAPK) and phosphatidylinositol 3-kinase (PI3K) pathways showed that EGFL7 promotes Jeg3 cell motility by activating both pathways. We show that EGFL7 activates the epidermal growth factor receptor (EGFR) in Jeg3 cells, resulting in downstream activation of extracellular regulated kinases (ERKs). In addition, we provide evidence that EGFL7-triggered migration of Jeg3 cells involves activation of NOTCH signaling. EGFL7 and NOTCH1 are co-expressed in Jeg3 cells, and blocking of NOTCH activation abrogates enhanced migration of Jeg3 cells overexpressing EGFL7. We also demonstrate that signaling through EGFR and NOTCH converged to mediate EGFL7 effects. Reduction of endogenous EGFL7 expression in Jeg3 cells significantly decreased cell migration. We further confirmed that EGFL7 stimulates cell migration by using primary human first trimester trophoblast (PTB) cells overexpressing EGFL7. In conclusion, our data suggest that in trophoblast cells, EGFL7 regulates cell migration and invasion by activating multiple signaling pathways. Our results provide a possible explanation for the correlation between reduced expression of EGFL7 and inadequate trophoblast invasion observed in placentopathies.

  14. Relationship between cyclooxygenase-2 and human epidermal growth factor receptor 2 in vascular endothelial growth factor C up-regulation and lymphangiogenesis in human breast cancer.

    Science.gov (United States)

    Bhattacharjee, Rabindra N; Timoshenko, Alexander V; Cai, Jing; Lala, Peeyush K

    2010-09-01

    Both cyclooxygenase (COX)-2 and human epidermal growth factor receptor (HER)-2 promote breast cancer progression; however, the relationship between the two molecules remains unclear. We utilized human breast cancer tissues and cell lines to examine whether COX-2 and HER-2 played independent or interdependent roles in vascular endothelial growth factor (VEGF)-C up-regulation and lymphangiogenesis. A paired correlation of immunodetectable levels of COX-2, VEGF-C, and HER-2 proteins and lymphovascular density (LVD; D2-40-immunolabeled) in 55 breast cancer specimens revealed a positive correlation between COX-2 and HER-2 irrespective of clinicopathological status. However COX-2 alone positively correlated with LVD. In 10 independent specimens, mRNA levels showed a positive correlation between HER-2 and COX-2 or VEGF-C but not LYVE-1 (lymphovascular endothelial marker). These findings implicate COX-2, but not HER-2, in breast cancer-associated lymphangiogenesis. Manipulation of the COX-2 or HER-2 genes in breast cancer cell lines varying widely in COX-2 and HER-2 expression revealed a direct role of COX-2 and an indirect COX-2 dependent role of HER-2 in VEGF-C up-regulation: (i) high VEGF-C expression in high COX-2/low HER-2 expressing MDA-MB-231 cells was reduced by siRNA-mediated down-regulation of COX-2, but not HER-2; (ii) integration of HER-2 in these cells simultaneously up-regulated COX-2 protein as well as VEGF-C secretion; and (iii) low VEGF-C secretion by high HER-2/low COX-2 expressing SK-BR-3 cells was stimulated by COX-2 overexpression. These findings of the primary role of COX-2 and the COX-2-dependent role of HER-2, if any, in VEGF-C up-regulation and lymphangiogenesis suggest that COX-2 inhibitors may abrogate lymphatic metastasis in breast cancer irrespective of HER-2 status. © 2010 Japanese Cancer Association.

  15. Alterations in the human epidermal growth factor receptor 2-phosphatidylinositol 3-kinase-v-Akt pathway in gastric cancer

    Institute of Scientific and Technical Information of China (English)

    Yasutaka Sukawa; Hiroyuki Yamamoto; Katsuhiko Nosho; Hiroaki Kunimoto; Hiromu Suzuki; Yasushi Adachi; Mayumi Nakazawa

    2012-01-01

    AIM:To investigate human epidermal growth factor receptor 2 (HER2)-phosphatidylinositol 3-kinase (PI3K)-v-Akt murine thymoma viral oncogene homolog signaling pathway.METHODS:We analyzed 231 formalin-fixed,paraffinembedded gastric cancer tissue specimens from Japanese patients who had undergone surgical treatment.The patients' age,sex,tumor location,depth of invasion,pathological type,lymph node metastasis,and pathological stage were determined by a review of the medical records.Expression of HER2 was analyzed by immunohistochemistry (IHC) using the HercepTestTM kit.Standard criteria for HER2 positivity (0,1+,2+,and 3+) were used.Tumors that scored 3+ were considered HER2-positive.Expression of phospho Akt (pAkt)was also analyzed by IHC.Tumors were considered pAkt-positive when the percentage of positive tumor cells was 10% or more.PI3K,catalytic,alpha polypeptide (PIK3CA) mutations in exons 1,9 and 20 were analyzed by pyrosequencing.Epstein-Barr virus (EBV)infection was analyzed by in situ hybridization targeting EBV-encoded small RNA (EBER) with an EBER-RNA probe.Microsatellite instability (MSI) was analyzed by polymerase chain reaction using the mononucleotide markers BAT25 and BAT26.RESULTS:HER2 expression levels of 0,1+,2+ and 3+ were found in 167 (72%),32 (14%),12 (5%) and 20 (8.7%) samples,respectively.HER2 overexpression (IHC 3+) significantly correlated with intestinal histological type (15/20 vs 98/205,P =0.05).PIK3CA mutations were present in 20 cases (8.7%) and significantly correlated with MSI (10/20 vs 9/211,P < 0.01).The mutation frequency was high (21%) in T4 cancers and very low (6%) in T2 cancers.Mutations in exons 1,9 and 20 were detected in 5 (2%),9 (4%) and 7(3%) cases,respectively.Two new types of PIK3CA mutation,R88Q and R108H,were found in exon1.All PIK3CA mutations were heterozygous missense singlebase substitutions,the most common being H1047R (6/20,30%) in exon20.Eighteen cancers (8%) were EBV-positive and this

  16. Expression, purification, and characterization of recombinant human and murine milk fat globule-epidermal growth factor-factor 8.

    Science.gov (United States)

    Castellanos, Erick R; Ciferri, Claudio; Phung, Wilson; Sandoval, Wendy; Matsumoto, Marissa L

    2016-08-01

    Milk fat globule-epidermal growth factor-factor 8 (MFG-E8), as its name suggests, is a major glycoprotein component of milk fat globules secreted by the mammary epithelium. Although its role in milk fat production is unclear, MFG-E8 has been shown to act as a bridge linking apoptotic cells to phagocytes for removal of these dying cells. MFG-E8 is capable of bridging these two very different cell types via interactions through both its epidermal growth factor (EGF)-like domain(s) and its lectin-type C domains. The EGF-like domain interacts with αVβ3 and αVβ5 integrins on the surface of phagocytes, whereas the C domains bind phosphatidylserine found on the surface of apoptotic cells. In an attempt to purify full-length, recombinant MFG-E8 expressed in either insect cells or CHO cells, we find that it is highly aggregated. Systematic truncation of the domain architecture of MFG-E8 indicates that the C domains are mainly responsible for the aggregation propensity. Addition of Triton X-100 to the conditioned cell culture media allowed partial recovery of non-aggregated, full-length MFG-E8. A more comprehensive detergent screen identified CHAPS as a stabilizer of MFG-E8 and allowed purification of a significant portion of non-aggregated, full-length protein. The CHAPS-stabilized recombinant MFG-E8 retained its natural ability to bind both αVβ3 and αVβ5 integrins and phosphatidylserine suggesting that it is properly folded and active. Herein we describe an efficient purification method for production of non-aggregated, full-length MFG-E8.

  17. Epidermal electronic systems for sensing and therapy

    Science.gov (United States)

    Lu, Nanshu; Ameri, Shideh K.; Ha, Taewoo; Nicolini, Luke; Stier, Andrew; Wang, Pulin

    2017-04-01

    Epidermal electronic system is a class of hair thin, skin soft, stretchable sensors and electronics capable of continuous and long-term physiological sensing and clinical therapy when applied on human skin. The high cost of manpower, materials, and photolithographic facilities associated with its manufacture limit the availability of disposable epidermal electronics. We have invented a cost and time effective, completely dry, benchtop "cut-and-paste" method for the green, freeform and portable manufacture of epidermal electronics within minutes. We have applied the "cut-and-paste" method to manufacture epidermal electrodes, hydration and temperature sensors, conformable power-efficient heaters, as well as cuffless continuous blood pressure monitors out of metal thin films, two-dimensional (2D) materials, and piezoelectric polymer sheets. For demonstration purpose, we will discuss three examples of "cut-and-pasted" epidermal electronic systems in this paper. The first will be submicron thick, transparent epidermal graphene electrodes that can be directly transferred to human skin like a temporary transfer tattoo and can measure electrocardiogram (ECG) with signal-to-noise ratio and motion artifacts on par with conventional gel electrodes. The second will be a chest patch which houses both electrodes and pressure sensors for the synchronous measurements of ECG and seismocardiogram (SCG) such that beat-to-beat blood pressure can be inferred from the time interval between the R peak of the ECG and the AC peak of the SCG. The last example will be a highly conformable, low power consumption epidermal heater for thermal therapy.

  18. Verrucous epidermal nevus

    OpenAIRE

    Kim, Randie; Marmon, Shoshana; Kaplan, Jennifer; Kamino, Hideko; Pomeranz, Miriam Keltz

    2013-01-01

    A 64-year-old man presented with a three-year history of an enlarging, pruritic, linear, verrucous plaque on his left lower extremity. Histopathologic examination was consistent with a verrucous epidermal nevus, which is a benign epidermal hamartoma, most commonly observed in the pediatric population. Verrucous epidermal nevi are often refractory to treatment and have high rates of recurrences, causing them to be therapeutic challenges. We review the treatment modalities reported to be effect...

  19. Expression of a chemically synthesized gene for human epidermal growth factor under the control of cauliflower mosaic virus 35S promoter in transgenic tobacco.

    Science.gov (United States)

    Higo, K; Saito, Y; Higo, H

    1993-09-01

    Nicotiana tabacum was transformed with a chemically synthesized gene encoding the human epidermal growth factor (hEGF) under control of the CaMV-35S promoter. The hEGF gene sequence was present at one to several copies in the primary transformant plants (R0), and a transcript with the expected length was produced. Slot blot analysis of total RNAs of the progeny (R1) seedlings, originating from self-pollination of the R0 plants, showed that the level of mRNA expression was generally, but not always, heritable. The highest hEGF peptide content per unit of total soluble protein in young (upper) R1 leaves so far examined by an immunological method was about 0.001%. These results suggest that either the hEGF peptide was less stable than the average leaf protein, or the hEGF mRNAs were not efficiently translated.

  20. [Effects of lentivirus-mediated epidermal growth factor-like domain 7 silencing on proliferation and invasion of human laryngeal carcinoma Hep-2 cells].

    Science.gov (United States)

    Li, Jingjia; Ye, Jin; Zhuang, Shimin; Wang, Tao; Wang, Zhiyuan; Chang, Lihong; Zhang, Gehua

    2014-08-01

    To explore the effects of epidermal growth factor-like domain 7 (EGFL7) gene silencing on the proliferation and invasion ablity of laryngeal carcinoma cells. A lentiviral vector expressing EGFL7 shRNA was constructed and transfected into human laryngeal carcinoma Hep-2 cells. The expressions of EGFL7 mRNA and protein were detected by Real-time PCR and Western blot, respectively. Cell proliferation was evaluated by CCK-8 assay, cell cycle and apoptosis were tested by flow cytometry, and cell invasion was detected by transwell invasion assay. The relative expression level s of EGFL7 mRNA and protein in EGFL7-SuRNA group were svgnificantly lower than control group (P Hep-2 cells. The proliferation of Hep-2 cells was significantly inhibited after transfection (P Hep-2 cells can be inhibited by siRNA mediated EGFL7 gene silencing.

  1. The bi-functional organization of human basement membranes.

    Science.gov (United States)

    Halfter, Willi; Monnier, Christophe; Müller, David; Oertle, Philipp; Uechi, Guy; Balasubramani, Manimalha; Safi, Farhad; Lim, Roderick; Loparic, Marko; Henrich, Paul Bernhard

    2013-01-01

    The current basement membrane (BM) model proposes a single-layered extracellular matrix (ECM) sheet that is predominantly composed of laminins, collagen IVs and proteoglycans. The present data show that BM proteins and their domains are asymmetrically organized providing human BMs with side-specific properties: A) isolated human BMs roll up in a side-specific pattern, with the epithelial side facing outward and the stromal side inward. The rolling is independent of the curvature of the tissue from which the BMs were isolated. B) The epithelial side of BMs is twice as stiff as the stromal side, and C) epithelial cells adhere to the epithelial side of BMs only. Side-selective cell adhesion was also confirmed for BMs from mice and from chick embryos. We propose that the bi-functional organization of BMs is an inherent property of BMs and helps build the basic tissue architecture of metazoans with alternating epithelial and connective tissue layers.

  2. The bi-functional organization of human basement membranes.

    Directory of Open Access Journals (Sweden)

    Willi Halfter

    Full Text Available The current basement membrane (BM model proposes a single-layered extracellular matrix (ECM sheet that is predominantly composed of laminins, collagen IVs and proteoglycans. The present data show that BM proteins and their domains are asymmetrically organized providing human BMs with side-specific properties: A isolated human BMs roll up in a side-specific pattern, with the epithelial side facing outward and the stromal side inward. The rolling is independent of the curvature of the tissue from which the BMs were isolated. B The epithelial side of BMs is twice as stiff as the stromal side, and C epithelial cells adhere to the epithelial side of BMs only. Side-selective cell adhesion was also confirmed for BMs from mice and from chick embryos. We propose that the bi-functional organization of BMs is an inherent property of BMs and helps build the basic tissue architecture of metazoans with alternating epithelial and connective tissue layers.

  3. Antitumor effect of afatinib, as a human epidermal growth factor receptor 2-targeted therapy, in lung cancers harboring HER2 oncogene alterations.

    Science.gov (United States)

    Suzawa, Ken; Toyooka, Shinichi; Sakaguchi, Masakiyo; Morita, Mizuki; Yamamoto, Hiromasa; Tomida, Shuta; Ohtsuka, Tomoaki; Watanabe, Mototsugu; Hashida, Shinsuke; Maki, Yuho; Soh, Junichi; Asano, Hiroaki; Tsukuda, Kazunori; Miyoshi, Shinichiro

    2016-01-01

    Human epidermal growth factor receptor 2 (HER2) is a member of the HER family of proteins containing four receptor tyrosine kinases. It plays an important role in the pathogenesis of certain human cancers. In non-small-cell lung cancer (NSCLC), HER2 amplification or mutations have been reported. However, little is known about the benefit of HER2-targeted therapy for NSCLCs harboring HER2 alterations. In this study, we investigated the antitumor effect of afatinib, an irreversible epidermal growth factor receptor (EGFR)-HER2 dual inhibitor, in lung cancers harboring HER2 oncogene alterations, including novel HER2 mutations in the transmembrane domain, which we recently identified. Normal bronchial epithelial cells, BEAS-2B, ectopically overexpressing wild-type HER2 or mutants (A775insYVMA, G776VC, G776LC, P780insGSP, V659E, and G660D) showed constitutive autophosphorylation of HER2 and activation of downstream signaling. They were sensitive to afatinib, but insensitive to gefitinib. Furthermore, we examined the antitumor activity of afatinib and gefitinib in several NSCLC cell lines, and investigated the association between their genetic alterations and sensitivity to afatinib treatment. In HER2-altered NSCLC cells (H2170, Calu-3, and H1781), afatinib downregulated the phosphorylation of HER2 and EGFR as well as their downstream signaling, and induced an antiproliferative effect through G1 arrest and apoptotic cell death. In contrast, HER2- or EGFR-non-dependent NSCLC cells were insensitive to afatinib. In addition, these effects were confirmed in vivo by using a xenograft mouse model of HER2-altered lung cancer cells. Our results suggest that afatinib is a therapeutic option as a HER2-targeted therapy for NSCLC harboring HER2 amplification or mutations.

  4. Photoprotective Potential of Glycolic Acid by Reducing NLRC4 and AIM2 Inflammasome Complex Proteins in UVB Radiation-Induced Normal Human Epidermal Keratinocytes and Mice.

    Science.gov (United States)

    Hung, Sung-Jen; Tang, Sheau-Chung; Liao, Pei-Yun; Ge, Jheng-Siang; Hsiao, Yu-Ping; Yang, Jen-Hung

    2017-02-01

    Exposure to UVB radiation induces inflammation and free radical-mediated oxidative stress through reactive oxygen species (ROS) that play a crucial role in the induction of skin cancer. Glycolic acid (GA) is frequently used in cosmetics and dermatology. The aim of the study was to analyze the photoprotective mechanisms through which GA retards UVB-induced ROS accumulation and inflammation in normal human epidermal keratinocytes (NHEKs) and mice skin, respectively. NHEK cell line and C57BL/6J mice were treated with GA (0.1 or 5 mM) for 24 h followed by UVB irradiation. ROS accumulation, DNA damage, and expression of inflammasome complexes (NLRP3, NLRC4, ASC, and AIM2) were measured in vitro. Epidermal thickness and inflammasome complex proteins were analyzed in vivo. GA significantly prevented UVB-induced loss of skin cell viability, ROS formation, and DNA damage (single and double strands DNA break). GA suppressed the mRNA expression levels of NLRC4 and AIM2 among the inflammasome complexes. GA also blocked interleukin (IL)-1β by reducing the activity of caspase-1 in the NHEKs. Treatment with GA (2%) inhibited UVB-induced inflammation marker NLRC4 protein levels in mouse dorsal skin. The photoprotective activity of GA was ascribed to the inhibition of ROS formation and DNA damage, as well as a reduction in the activities of inflammasome complexes and IL-1β. We propose that GA has anti-inflammatory and photoprotective effects against UVB irradiation. GA is potentially beneficial to the protection of human skin from UV damage.

  5. Identification of Goodpasture antigens in human alveolar basement membrane.

    Science.gov (United States)

    Yoshioka, K; Iseki, T; Okada, M; Morimoto, Y; Eryu, N; Maki, S

    1988-01-01

    Goodpasture (GP) antigens, protein components reactive with human autoantibodies against glomerular basement membrane (GBM), were identified in human alveolar basement membrane (ABM) using an enzyme-linked immunoassay (ELISA), Western blotting and immunoprecipitation. All six anti-GBM antisera studied, three obtained from patients with glomerulonephritis and pulmonary haemorrhages (i.e. GP syndrome), and three from patients with glomerulonephritis alone, distinctively reacted with collagenase-digested (CD) ABM. Very cationic 22-28 kD and 40-48 kD components were detected by blot analysis combined with two-dimensional gel electrophoresis. These proteins showed some similarities to GP antigens in human GBM with respect to the monomer-dimer composition and charge distribution. Inhibition ELISA revealed that the binding of anti-GBM antisera to CDGBM decreased when they were pre-incubated with CDABM, suggesting that the anti-GBM antisera recognized the same epitope(s) on the GBM and ABM. Heterogeneity of the GP antigens in human ABM was demonstrated by blotting; monomeric antigens were absent or at low levels in the CDABM of three out of 10 normal individuals. In immunoprecipitation, anti-GBM antisera from patients with and without pulmonary haemorrhage showed different reactivities with CDABM. The former antisera precipitated both monomeric and dimeric components, but the latter did not. The observations of variation in monomer-dimer composition of ABM, and the different binding of anti-GBM antisera to it may explain why only some patients with anti-GBM nephritis have lung involvement. Images Fig. 3 Fig. 4 Fig. 5 Fig. 6 PMID:2466590

  6. Cytotoxicity of HBD3 for dendritic cells, normal human epidermal keratinocytes, hTERT keratinocytes, and primary oral gingival epithelial keratinocytes in cell culture conditions.

    Science.gov (United States)

    Leelakanok, Nattawut; Fischer, Carol L; Bates, Amber M; Guthmiller, Janet M; Johnson, Georgia K; Salem, Aliasger K; Brogden, Kim A; Brogden, Nicole K

    2015-12-03

    Human β-defensin 3 (HBD3) is a prominent host defense peptide. In our recent work, we observed that HBD3 modulates pro-inflammatory agonist-induced chemokine and cytokine responses in human myeloid dendritic cells (DCs), often at 20.0 μM concentrations. Since HBD3 can be cytotoxic in some circumstances, it is necessary to assess its cytotoxicity for DCs, normal human epidermal keratinocytes (NHEKs), human telomerase reverse transcriptase (hTERT) keratinocytes, and primary oral gingival epithelial (GE) keratinocytes in different cell culture conditions. Cells, in serum free media with resazurin and in complete media with 10% fetal bovine serum and resazurin, were incubated with 5, 10, 20, and 40 μM HBD3. Cytotoxicity was determined by measuring metabolic conversion of resazurin to resorufin. The lethal dose 50 (LD50, mean μM±Std Err) values were determined from the median fluorescent intensities of test concentrations compared to live and killed cell controls. The LD50 value range of HBD3 was 18.2-35.9 μM in serum-free media for DCs, NHEKs, hTERT keratinocytes, and GE keratinocytes, and >40.0 μM in complete media. Thus, HBD3 was cytotoxic at higher concentrations, which must be considered in future studies of HBD3-modulated chemokine and cytokine responses in vitro. Copyright © 2015 Elsevier Ireland Ltd. All rights reserved.

  7. Genetics Home Reference: epidermal nevus

    Science.gov (United States)

    ... thicker and darker and develop a wart-like (verrucous) appearance. Often, keratinocytic epidermal nevi follow a pattern ... are also known as linear epidermal nevi or verrucous epidermal nevi, based on characteristics of their appearance. ...

  8. Isolation and characterization of human membrane carboxypeptidase (HMCP)

    Energy Technology Data Exchange (ETDEWEB)

    Skidgel, R.A.; Davis, R.M.

    1986-03-05

    The authors detected a membrane-bound carboxypeptidase in human placenta and other tissues which cleaves C-terminal Lys or Arg of peptides such as Lys/sup 6/-Met/sup 5/-enkephalin. The enzyme was solubilized from placental microvilli with 0.8% CHAPS and purified 427-fold by ion-exchange chromatography, Sepharose-arginine affinity chromatography, chromatofocusing and gel filtration on HPLC. HMCP had a mol. wt. of 67,000 in SDS-PAGE and 65,300 in gel filtration and a pH optimum of 7.0. HMCP cleaved Bz-Gly-argininic acid the fastest (90 ..mu..mol/min/mg) followed by Bz-Ala-Lys (41), Bz-Phe-Lys (26), Bz-Gly-Arg (1.7) and Bz-Gly-Lys (1.6). Activity was stimulated by CoCl/sub 2/ and inhibited by cadmium acet., o-phenanthroline and 2-mercaptomethyl-3-guanidinoethylthiopropanoic acid but not by phenylmethylsulfonyl fluoride, aprotinin or p-chloromercuriphenylsulfonate. The enzyme was stable for 1 hr at room temp. at pH 4.25, but lost 31% activity at pH 4.0. HMCP did not react with antiserum to human plasma carboxypeptidase N in Western blotting. This study shows that human placental microvilli contain a membrane carboxypeptidase, that differs from other carboxypeptidases, and cleaves C-terminal basic amino acids from peptides. This enzyme could be involved in regulating the level of peptide hormones in the placenta and other tissues.

  9. Blister fluid T lymphocytes during toxic epidermal necrolysis are functional cytotoxic cells which express human natural killer (NK) inhibitory receptors

    Science.gov (United States)

    Le Cleach, L; Delaire, S; Boumsell, L; Bagot, M; Bourgault-Villada, I; Bensussan, A; Roujeau, J C

    2000-01-01

    Toxic epidermal necrolysis (TEN) is a rare life-threatening adverse drug reaction characterized by a massive destruction of the epidermis. Immunohistological studies of skin biopsies of TEN showed infiltrates of predominantly CD8+ T lymphocytes even though other authors reported a prominent involvement of cells of the monocyte-macrophage lineage. The aim of this study was to characterize phenotypically and functionally the cells present in the cutaneous blister fluid of four patients with TEN. We first determined that lymphocytes were predominant in blister fluid obtained early, while monocytes/macrophages later became the most important population. We then showed that this lymphocyte population, mainly CD3+CD8+, corresponded to a peculiar cell subset as they expressed cutaneous leucocyte antigen, killer inhibitory receptors KIR/KAR and failed to express CD28 molecule. Functionally, we determined that blister T lymphocytes had a cytotoxic T lymphocyte (CTL)- and NK-like cytotoxicity. The role of this cytotoxic lymphocyte population present at the site of lesions during TEN remains to be understood. PMID:10606987

  10. Optimizing in vitro culture conditions leads to a significantly shorter production time of human dermo-epidermal skin substitutes.

    Science.gov (United States)

    Pontiggia, Luca; Klar, Agnieszka; Böttcher-Haberzeth, Sophie; Biedermann, Thomas; Meuli, Martin; Reichmann, Ernst

    2013-03-01

    Autologous dermo-epidermal skin substitutes (DESS) generated in vitro represent a promising therapeutic means to treat full-thickness skin defects in clinical practice. A serious drawback with regard to acute patients is the relatively long production time of 3-4 weeks. With this experimental study we aimed to decrease the production time of DESS without compromising their quality. Two in vitro steps of DESS construction were varied: the pre-cultivation time of fibroblasts in hydrogels (1, 3, and 6 days), and the culture time of keratinocytes (3, 6, and 12 days) before transplantation of DESS on nude rats. Additionally, the impact of the air-liquid interface culture during 3 days before transplantation was investigated. 3 weeks after transplantation, the macroscopic appearance was evaluated and histological sections were produced to analyze structure and thickness of epidermis and dermis, the stratification of the epidermis, and the presence of a basal lamina. Optimal DESS formation was obtained with a fibroblast pre-cultivation time of 6 days. The minimal culture time of keratinocytes on hydrogels was also 6 days. The air-liquid interface culture did not improve graft quality. By optimizing our in vitro culture conditions, it was possible to very substantially reduce the production time for DESS from 21 to 12 days. However, pre-cultivation of fibroblasts in the dermal equivalent and proliferation of keratinocytes before transplantation remain crucial for an equilibrated maturation of the epidermis and cannot be completely skipped.

  11. Internalization and down-regulation of the human epidermal growth factor receptor are regulated by the carboxyl-terminal tyrosines

    DEFF Research Database (Denmark)

    Helin, K; Beguinot, L

    1991-01-01

    with receptors in which 1, 2, or all 3 tyrosines were changed to phenylalanines. The triple point mutant EGF-R, expressed in NIH-3T3, exhibited low autophosphorylation in vivo, low biological and reduced kinase activities. Single and double point mutants were down-regulated, as well as wild type EGF-R......The C terminus of the epidermal growth factor receptor (EGF-R) contains three tyrosines (Y1068, Y1148, and Y1173) which correspond to the major autophosphorylation sites. To investigate the role of the tyrosines in internalization and down-regulation of the EGF-R, mutational analysis was performed...... in response to EGF showing a half-life of about 1 h. Degradation of the triple point mutant, however, was impaired and resulted in a half-life of 4 h in the presence of EGF. EGF-dependent down-regulation of surface receptors was decreased in the triple point mutant EGF-R as was internalization and degradation...

  12. Lipid-protein interactions in plasma membranes of fiber cells isolated from the human eye lens.

    Science.gov (United States)

    Raguz, Marija; Mainali, Laxman; O'Brien, William J; Subczynski, Witold K

    2014-03-01

    The protein content in human lens membranes is extremely high, increases with age, and is higher in the nucleus as compared with the cortex, which should strongly affect the organization and properties of the lipid bilayer portion of intact membranes. To assess these effects, the intact cortical and nuclear fiber cell plasma membranes isolated from human lenses from 41- to 60-year-old donors were studied using electron paramagnetic resonance spin-labeling methods. Results were compared with those obtained for lens lipid membranes prepared from total lipid extracts from human eyes of the same age group [Mainali, L., Raguz, M., O'Brien, W. J., and Subczynski, W. K. (2013) Biochim. Biophys. Acta]. Differences were considered to be mainly due to the effect of membrane proteins. The lipid-bilayer portions of intact membranes were significantly less fluid than lipid bilayers of lens lipid membranes, prepared without proteins. The intact membranes were found to contain three distinct lipid environments termed the bulk lipid domain, boundary lipid domain, and trapped lipid domain. However, the cholesterol bilayer domain, which was detected in cortical and nuclear lens lipid membranes, was not detected in intact membranes. The relative amounts of bulk and trapped lipids were evaluated. The amount of lipids in domains uniquely formed due to the presence of membrane proteins was greater in nuclear membranes than in cortical membranes. Thus, it is evident that the rigidity of nuclear membranes is greater than that of cortical membranes. Also the permeability coefficients for oxygen measured in domains of nuclear membranes were significantly lower than appropriate coefficients measured in cortical membranes. Relationships between the organization of lipids into lipid domains in fiber cells plasma membranes and the organization of membrane proteins are discussed.

  13. The Molecular Structure of Human Red Blood Cell Membranes from Highly Oriented, Solid Supported Multi-Lamellar Membranes

    Science.gov (United States)

    Himbert, Sebastian; Alsop, Richard J.; Rose, Markus; Hertz, Laura; Dhaliwal, Alexander; Moran-Mirabal, Jose M.; Verschoor, Chris P.; Bowdish, Dawn M. E.; Kaestner, Lars; Wagner, Christian; Rheinstädter, Maikel C.

    2017-01-01

    We prepared highly oriented, multi-lamellar stacks of human red blood cell (RBC) membranes applied on silicon wafers. RBC ghosts were prepared by hemolysis and applied onto functionalized silicon chips and annealed into multi-lamellar RBC membranes. High resolution X-ray diffraction was used to determine the molecular structure of the stacked membranes. We present direct experimental evidence that these RBC membranes consist of nanometer sized domains of integral coiled-coil peptides, as well as liquid ordered (lo) and liquid disordered (ld) lipids. Lamellar spacings, membrane and hydration water layer thicknesses, areas per lipid tail and domain sizes were determined. The common drug aspirin was added to the RBC membranes and found to interact with RBC membranes and preferably partition in the head group region of the lo domain leading to a fluidification of the membranes, i.e., a thinning of the bilayers and an increase in lipid tail spacing. Our results further support current models of RBC membranes as patchy structures and provide unprecedented structural details of the molecular organization in the different domains.

  14. In situ changes in the relative abundance of human epidermal cytokine messenger RNA levels following exposure to the poison ivy/oak contact allergen urushiol.

    Science.gov (United States)

    Boehm, K D; Yun, J K; Strohl, K P; Trefzer, U; Häffner, A; Elmets, C A

    1996-06-01

    Abstract: Epidermal keratinocytes in culture have been shown to produce many cytokines, and their proteins have been identified in skin tissue samples. It has therefore been assumed that these cytokines are transcribed in vivo by the epidermis in response to contact allergens. In this report, in situ hybridization was used to detect the messenger RNAs for interleukin-1 alpha (IL-1 alpha), interleukin-1 beta (IL-1 beta) and tumour necrosis factor-alpha (TNF-alpha) in samples of human skin prior to and at various times after application of urushiol, the immunogenic component of poison ivy/oak. In sensitive subjects, IL-1 alpha and TNF-alpha mRNAs showed a progressive increase in transcript levels that paralleled the clinical and histological features of the inflammatory process. The time-course of the IL-1 beta response differed from that of IL-1 alpha and TNF-alpha, in that there was an early (by 6 h after urushiol administration) elevation in IL-1 beta mRNA that occurred before there was evidence of inflammation and had returned to background levels by 72 h when the reaction had reached its peak. In contrast to urushiol-sensitive subjects, urushiol-anergic individuals did not exhibit an increase in IL-1 alpha, IL-1 beta or TNF-alpha mRNA levels. The data provide evidence for an in vivo role for epidermal IL-1 alpha, IL-1 beta and TNF-alpha transcription in the regulation of IL-1 beta and TNF-alpha polypeptide levels in the epidermis in response to this common contact allergen.

  15. Comparison of rat epidermal keratinocyte organotypic culture (ROC) with intact human skin: lipid composition and thermal phase behavior of the stratum corneum.

    Science.gov (United States)

    Pappinen, Sari; Hermansson, Martin; Kuntsche, Judith; Somerharju, Pentti; Wertz, Philip; Urtti, Arto; Suhonen, Marjukka

    2008-04-01

    The present report is a part of our continuing efforts to explore the utility of the rat epidermal keratinocyte organotypic culture (ROC) as an alternative model to human skin in transdermal drug delivery and skin irritation studies of new chemical entities and formulations. The aim of the present study was to compare the stratum corneum lipid content of ROC with the corresponding material from human skin. The lipid composition was determined by thin-layer chromatography (TLC) and mass-spectrometry, and the thermal phase transitions of stratum corneum were studied by differential scanning calorimetry (DSC). All major lipid classes of the stratum corneum were present in ROC in a similar ratio as found in human stratum corneum. Compared to human skin, the level of non-hydroxyacid-sphingosine ceramide (NS) was increased in ROC, while alpha-hydroxyacid-phytosphingosine ceramide (AP) and non-hydroxyacid-phytosphingosine ceramides (NP) were absent. Also some alterations in fatty acid profiles of ROC ceramides were noted, e.g., esterified omega-hydroxyacid-sphingosine contained increased levels of oleic acid instead of linoleic acid. The fraction of lipids covalently bound to corneocyte proteins was distinctly lower in ROC compared to human skin, in agreement with the results from DSC. ROC underwent a lipid lamellar order to disorder transition (T2) at a slightly lower temperature (68 degrees C) than human skin (74 degrees C). These differences in stratum corneum lipid composition and the thermal phase transitions may explain the minor differences previously observed in drug permeation between ROC and human skin.

  16. Production of monoclonal antibodies to human glomerular basement membrane.

    Directory of Open Access Journals (Sweden)

    Mino,Yasuaki

    1984-10-01

    Full Text Available Using the technique of somatic cell fusion, we produced monoclonal antibodies to collagenase-digested human glomerular basement membrane (GBM. Fourteen monoclonal antibodies which reacted with normal human kidney in indirect immunofluorescence (IIF studies were produced. An analysis of the binding patterns indicated that the antigens recognized could be divided into six broad groups. Monoclonal antibody B3-H10 (Group 1 reacted with only GBM in a fine granular pattern. A5-B12 and B5-C2 (Group 2 reacted with GBM and peritubular capillary in a linear pattern. B2-A12 (Group 3 reacted with only epithelial cells. Al-C9 and A4-E2 (Group 4 showed a mesangial pattern in glomerulus and a lineal pattern in tubular basement membrane (TBM, Bowman's capsule and peritubular capillary. A1-E1, A1-E11, A2-E6, A3-B6, A4-F8 and B5-H2 (Group 5 recognized determinants common to GBM, TBM, Bowman's capsule and/or peritubular capillary. A3-F1 and B5-E10 (Group 6 reacted with TBM and Bowman's capsule. The staining pattern of B3-H10 (Group 1 was characteristic because it was not linear, but finely granular along the GBM. The staining pattern of B2-A12 (Group 3 was also characteristic because only epithelial cells were stained, and processes of epithelial cells were observed as fine fibrils. To the best of our knowledge, these two types of monoclonal antibodies have not been reported previously.

  17. Human amniotic fluid derived cells can competently substitute dermal fibroblasts in a tissue-engineered dermo-epidermal skin analog

    NARCIS (Netherlands)

    Hartmann-Fritsch, Fabienne; Hosper, Nynke; Luginbuehl, Joachim; Biedermann, Thomas; Reichmann, Ernst; Meuli, Martin

    Human amniotic fluid comprises cells with high differentiation capacity, thus representing a potential cell source for skin tissue engineering. In this experimental study, we investigated the ability of human amniotic fluid derived cells to substitute dermal fibroblasts and support epidermis

  18. Characterization of human and mouse peroxiredoxin IV: evidence for inhibition by Prx-IV of epidermal growth factor- and p53-induced reactive oxygen species.

    Science.gov (United States)

    Wong, C M; Chun, A C; Kok, K H; Zhou, Y; Fung, P C; Kung, H F; Jeang, K T; Jin, D Y

    2000-01-01

    The aim of this study was to identify and characterize human and mouse Prx-IV. We identified mouse peroxiredoxin IV (Prx-IV) by virtue of sequence homology to its human ortholog previously called AOE372. Mouse Prx-IV conserves an amino-terminal presequence coding for signal peptide. The amino acid sequences of mature mouse and human Prx-IV share 97.5% identity. Phylogenetic analysis demonstrates that Prx-IV is more closely related to Prx-I/-II/-III than to Prx-V/-VI. Previously, we mapped the mouse Prx-IV gene to chromosome X by analyzing two sets of multiloci genetic crosses. Here we performed further comparative analysis of mouse and human Prx-IV genomic loci. Consistent with the mouse results, human Prx-IV gene localized to chromosome Xp22.135-136, in close proximity to SAT and DXS7178. A bacterial artificial chromosome (BAC) clone containing the complete human Prx-IV locus was identified. The size of 7 exons and the sequences of the splice junctions were confirmed by PCR analysis. We conclude that mouse Prx-IV is abundantly expressed in many tissues. However, we could not detect Prx-IV in the conditioned media of NIH-3T3 and Jurkat cells. Mouse Prx-IV was specifically found in the nucleus-excluded region of cultured mouse cells. Intracellularly, overexpression of mouse Prx-IV prevented the production of reactive oxygen species induced by epidermal growth factor or p53. Taken together, mouse Prx-IV is likely a cytoplasmic or organellar peroxiredoxin involved in intracellular redox signaling.

  19. MMP-1 and MMP-9 regulate epidermal growth factor-dependent collagen loss in human carotid plaque smooth muscle cells.

    Science.gov (United States)

    Rao, Velidi H; Kansal, Vikash; Stoupa, Samantha; Agrawal, Devendra K

    2014-02-01

    Mechanisms underlying the rupture of atherosclerotic plaque, a crucial factor in the development of myocardial infarction and stroke, are not well defined. Here, we examined the role of epidermal growth factor (EGF)-mediated matrix metalloproteinases (MMP) on the stability of interstitial collagens in vascular smooth muscle cells (VSMCs) isolated from carotid endarterectomy tissues of symptomatic and asymptomatic patients with carotid stenosis. VSMCs isolated from the carotid plaques of both asymptomatic and symptomatic patients were treated with EGF. The MMP-9 activity was quantified by gelatin zymography and the analysis of mRNA transcripts and protein for MMP-9, MMP-1, EGFR and collagen types I, Col I(α1) and collagen type III, Col III(α1) were analyzed by qPCR and immunofluorescence, respectively. The effect of EGF treatment to increase MMP-9 activity and mRNA transcripts for MMP-9, MMP-1, and EGFR and to decrease mRNA transcripts for Col I(α1) and Col III(α1) was threefold to fourfold greater in VSMCs isolated from the carotid plaques of symptomatic than asymptomatic patients. Inhibitors of EGFR (AG1478) and a small molecule inhibitor of MMP-9 decreased the MMP9 expression and upregulated Col I(α1) and Col III(α1) in EGF-treated VSMCs of both groups. Additionally, the magnitude in decreased MMP-9 mRNA and increased Col I(α1) and Col III(α1) due to knockdown of MMP-9 gene with siRNA in EGF-treated VSMCs was significantly greater in the symptomatic group than the asymptomatic group. Thus, a selective blockade of both EGFR and MMP-9 may be a novel strategy and a promising target for stabilizing vulnerable plaques in patients with carotid stenosis.

  20. Metabolic remodeling of the human red blood cell membrane measured by quantitative phase microscopy

    Science.gov (United States)

    Park, YongKeun; Best, Catherine; Auth, Thorsten; Gov, Nir S.; Safran, Samuel; Popescu, Gabriel

    2011-02-01

    We have quantitatively and systemically measured the morphologies and dynamics of fluctuations in human RBC membranes using a full-field laser interferometry technique that accurately measures dynamic membrane fluctuations. We present conclusive evidence that the presence of adenosine 5'-triphosphate (ATP) facilitates nonequilibrium dynamic fluctuations in the RBC membrane and that these fluctuations are highly correlated with specific regions in the biconcave shape of RBCs. Spatial analysis reveals that these nonequilibrium membrane fluctuations are enhanced at the scale of the spectrin mesh size. Our results indicate the presence of dynamic remodeling in the RBC membrane cortex powered by ATP, which results in nonequilibrium membrane fluctuations.

  1. Membraner

    DEFF Research Database (Denmark)

    Bach, Finn

    2009-01-01

    Notatet giver en kort introduktion til den statiske virkemåde af membraner og membrankonstruktioner......Notatet giver en kort introduktion til den statiske virkemåde af membraner og membrankonstruktioner...

  2. Epidermal vascular endothelial growth factor production is required for permeability barrier homeostasis, dermal angiogenesis, and the development of epidermal hyperplasia: implications for the pathogenesis of psoriasis.

    Science.gov (United States)

    Elias, Peter M; Arbiser, Jack; Brown, Barbara E; Rossiter, Heidemarie; Man, Mao-Qiang; Cerimele, Francesca; Crumrine, Debra; Gunathilake, Roshan; Choi, Eung Ho; Uchida, Yoshikazu; Tschachler, Erwin; Feingold, Kenneth R

    2008-09-01

    Primary abnormalities in permeability barrier function appear to underlie atopic dermatitis and epidermal trauma; a concomitant barrier dysfunction could also drive other inflammatory dermatoses, including psoriasis. Central to this outside-inside view of disease pathogenesis is the epidermal generation of cytokines/growth factors, which in turn signal downstream epidermal repair mechanisms. Yet, this cascade, if sustained, signals downstream epidermal hyperplasia and inflammation. We found here that acute barrier disruption rapidly stimulates mRNA and protein expression of epidermal vascular endothelial growth factor-A (VEGF-A) in normal hairless mice, a specific response to permeability barrier requirements because up-regulation is blocked by application of a vapor-impermeable membrane. Moreover, epidermal vegf(-/-) mice display abnormal permeability barrier homeostasis, attributable to decreased VEGF signaling of epidermal lamellar body production; a paucity of dermal capillaries with reduced vascular permeability; and neither angiogenesis nor epidermal hyperplasia in response to repeated tape stripping (a model of psoriasiform hyperplasia). These results support a central role for epidermal VEGF in the maintenance of epidermal permeability barrier homeostasis and a link between epidermal VEGF production and both dermal angiogenesis and the development of epidermal hyperplasia. Because psoriasis is commonly induced by external trauma [isomorphic (Koebner) phenomenon] and is associated with a prominent permeability barrier abnormality, excess VEGF production, prominent angiogenesis, and epidermal hyperplasia, these results could provide a potential outside-inside mechanistic basis for the development of psoriasis.

  3. Red wine activates plasma membrane redox system in human erythrocytes.

    Science.gov (United States)

    Tedesco, Idolo; Moccia, Stefania; Volpe, Silvestro; Alfieri, Giovanna; Strollo, Daniela; Bilotto, Stefania; Spagnuolo, Carmela; Di Renzo, Massimo; Aquino, Rita P; Russo, Gian Luigi

    2016-01-01

    In the present study, we report that polyphenols present in red wine obtained by a controlled microvinification process are able to protect human erythrocytes from oxidative stress and to activate Plasma Membrane Redox System (PMRS). Human plasma obtained from healthy subjects was incubated in the presence of whole red wine at a concentration corresponding to 9.13-73 μg/ml gallic acid equivalents to verify the capacity to protect against hypochlorous acid (HOCl)-induced plasma oxidation and to minimize chloramine formation. Red wine reduced hemolysis and chloramine formation induced by HOCl of 40 and 35%, respectively. PMRS present on human erythrocytes transfers electrons from intracellular molecules to extracellular electron acceptors. We demonstrated that whole red wine activated PMRS activity in human erythrocytes isolated from donors in a dose-dependent manner with a maximum at about 70-100 μg/ml gallic acid equivalents. We also showed that red wine increased glutathione (GSH) levels and erythrocytic antioxidant capacity, measured by 2,2-diphenyl-1-picrylhydrazyl (DPPH) quenching assay. Furthermore, we reported that GSH played a crucial role in regulating PMRS activity in erythrocytes. In fact, the effect of iodoacetamide, an alkylating agent that induces depletion of intracellular GSH, was completely counteracted by red wine. Bioactive compounds present in red wine, such as gallic acid, resveratrol, catechin, and quercetin were unable to activate PMRS when tested at the concentrations normally present in aged red wines. On the contrary, the increase of PMRS activity was associated with the anthocyanin fraction, suggesting the capacity of this class of compounds to positively modulate PMRS enzymatic activity.

  4. Carbamzepine-induced toxic epidermal necrolysis

    Directory of Open Access Journals (Sweden)

    Nithyananda K Chowta

    2011-01-01

    Full Text Available Toxic epidermal necrolysis (TEN, also known as Lyell′s syndrome, is a widespread life-threatening mucocutaneous disease where there is extensive detachment of the skin and mucous membrane. Many factors involved in the etiology of TEN including adverse drug reactions. Here we are reporting a case of toxic epidermal necrolysis in an adult male patient after receiving carbamazepine in a 38 year old male. On the18th day of carbamazepine, patient developed blisters which first appeared on the trunk, chest and arms. The erythematous rash was covering almost all over the body with epidermal detachment of 70% body surface area. There was loss of eye lashes, congestion of conjunctiva with mucopurulent discharge and exposure keratitis. The clinical impression was TEN induced by carbamazepine. Carbamazepine was stopped immediately. He was treated with high dose intravenous betamethasone and systemic and topical antibiotics. After one month, the progression of the skin lesions halted and he was discharged.

  5. Antitumor activity of a combination of trastuzumab (Herceptin) and oral fluoropyrimidine S-1 on human epidermal growth factor receptor 2-overexpressing pancreatic cancer.

    Science.gov (United States)

    Saeki, Hiroyuki; Yanoma, Shunsuke; Takemiya, Shouji; Sugimasa, Yukio; Akaike, Makoto; Yukawa, Norio; Rino, Yasushi; Imada, Toshio

    2007-08-01

    The cytotoxic effect of trastuzumab in combination with oral fluoropyrimidine S-1 on human epidermal growth factor receptor 2 (HER2)-overexpressing human pancreatic cancer cell line TRG in vitro and in vivo was investigated. HER2 expression in TRG was analyzed by RT-PCR and flow cytometry. For in vitro experiments, 5-fluorouracil (5-FU) was used instead of S-1. In vivo studies were conducted with TRG xenografts in athymic mice. Trastuzumab (10 mg/kg) was administered intraperitoneally once a week for 4 weeks. S-1 (10 mg/kg) was administered orally 5 days a week for 4 weeks. The results showed that TRG cells were positive for HER2 mRNA and overexpressed HER2 protein. Either trastuzumab or 5-FU concentration-dependently inhibited the growth of TRG cells. The combination of trastuzumab and 5-FU resulted in a significant inhibition of growth of TRG cells compared to either agent alone (P<0.001). Incubation of TRG cells with peripheral blood mononuclear cells after treatment with trastuzumab enhanced the antiproliferative effect of trastuzumab, which could be the result of antibody-dependent cellular cytotoxicity. The combination of trastuzumab and S-1 resulted in a significant reduction in xenograft volume compared to each agent alone (P<0.0001). In conclusion, this study showed that combination therapy with trastuzumab and S-1 may be effective for HER2-overexpressing pancreatic cancer patients.

  6. Eicosopentaneoic Acid and Other Free Fatty Acid Receptor Agonists Inhibit Lysophosphatidic Acid- and Epidermal Growth Factor-Induced Proliferation of Human Breast Cancer Cells

    Directory of Open Access Journals (Sweden)

    Mandi M. Hopkins

    2016-01-01

    Full Text Available Many key actions of ω-3 (n-3 fatty acids have recently been shown to be mediated by two G protein-coupled receptors (GPCRs in the free fatty acid receptor (FFAR family, FFA1 (GPR40 and FFA4 (GPR120. n-3 Fatty acids inhibit proliferation of human breast cancer cells in culture and in animals. In the current study, the roles of FFA1 and FFA4 were investigated. In addition, the role of cross-talk between GPCRs activated by lysophosphatidic acid (LPA, and the tyrosine kinase receptor activated by epidermal growth factor (EGF, was examined. In MCF-7 and MDA-MB-231 human breast cancer cell lines, both LPA and EGF stimulated proliferation, Erk activation, Akt activation, and CCN1 induction. LPA antagonists blocked effects of LPA and EGF on proliferation in MCF-7 and MDA-MB-231, and on cell migration in MCF-7. The n-3 fatty acid eicosopentaneoic acid inhibited LPA- and EGF-induced proliferation in both cell lines. Two synthetic FFAR agonists, GW9508 and TUG-891, likewise inhibited LPA- and EGF-induced proliferation. The data suggest a major role for FFA1, which was expressed by both cell lines. The results indicate that n-3 fatty acids inhibit breast cancer cell proliferation via FFARs, and suggest a mechanism involving negative cross-talk between FFARS, LPA receptors, and EGF receptor.

  7. Rapid Visualization of Human Tumor Xenografts through Optical Imaging with a Near-Infrared Fluorescent Anti–Epidermal Growth Factor Receptor Nanobody

    Directory of Open Access Journals (Sweden)

    Sabrina Oliveira

    2012-01-01

    Full Text Available Given that overexpression of the epidermal growth factor receptor (EGFR is found in many types of human epithelial cancers, noninvasive molecular imaging of this receptor is of great interest. A number of studies have employed monoclonal antibodies as probes; however, their characteristic long half-life in the bloodstream has encouraged the development of smaller probes. In this study, an anti-EGFR nanobody-based probe was developed and tested in comparison with cetuximab for application in optical molecular imaging. To this aim, the anti-EGFR nanobody 7D12 and cetuximab were conjugated to the near-infrared fluorophore IRDye800CW. 7D12-IR allowed the visualization of tumors as early as 30 minutes postinjection, whereas with cetuximab-IR, no signal above background was observed at the tumor site. Quantification of the IR-conjugated proteins in the tumors revealed ≈ 17% of injected dose per gram 2 hours after injection of 7D12-IR, which was significantly higher than the tumor uptake obtained 24 hours after injection of cetuximab-IR. This difference is associated with the superior penetration and distribution of 7D12-IR within the tumor. These results demonstrate that this anti-EGFR nanobody conjugated to the NIR fluorophore has excellent properties for rapid preclinical optical imaging, which holds promise for its future use as a complementary diagnostic tool in humans.

  8. Lysophosphatidic acid transactivates both c-Met and epidermal growth factor receptor, and induces cyclooxygenase-2 expression in human colon cancer LoVo cells

    Institute of Scientific and Technical Information of China (English)

    Dai Shida; Joji Kitayama; Hironori Yamaguchi; Hiroharu Yamashita; Ken Mori; Toshiaki Watanabe; Hirokazu Nagawa

    2005-01-01

    AIM: To examine whether lysophosphatidic acid (LPA)induces phosphorylation of c-Met and epidermal growth factor receptor (EGFR), both of which have been proposed as prognostic markers of colorectal cancer, and whether LPA induces cyclooxygenase-2 (COX-2) expression in human colon cancer cells.METHODS: Using a human colon cancer cell line, LoVo cells, we performed immunoprecipitation analysis,followed by Western blot analysis. We also examined whether LPA induced COX-2 expression, by Western blot analysis.RESULTS: Immunoprecipitation analysis revealed that 10 μmol/L LPA induced tyrosine phosphorylation of c-Met and EGFR in LoVo cells within a few minutes. We found that c-Met tyrosine phosphorylation induced by LPA was not attenuated by pertussis toxin or a matrix metalloproteinase inhibitor, in marked contrast to the results for EGFR. In addition, 0.2-40 μmol/L LPA induced COX-2 expression in a dose-dependent manner.CONCLUSION: Our results suggest that LPA acts upstream of various receptor tyrosine kinases (RTKs) and COX-2,and thus may act as a potent stimulator of colorectal cancer.

  9. Validation and substantiation of 25 kGy as sterilization dose for lyophilized human amnion membrane.

    Science.gov (United States)

    Djefal, A; Tahtat, D; Khodja, A Nacer; Bouzid, S Saad; Remane, N

    2007-01-01

    The validation and substantiation of sterilization dose for lyophilized human amnion membrane by gamma irradiation delivered by Co60 source were investigated. The validation experiments were conducted according to ISO 13409 method B. A total of 120 human amnion membranes were collected. Of these, 10 membranes were used for estimation of bioburden and 20 membranes were used for the individual sterility test at verification dose. The average bioburden per product unit with sample item portion (SIP = 1) for lyophilized human amnion membrane was 572 cfu. The verification dose experiments were done at dose of 8.1 kGy and the results of sterility tests showed that human amnion membrane got one positive. Consequently, the sterilization dose of 25 kGy was confirmed and substantiated.

  10. Kinetic aspects of human placental alkaline phosphatase enzyme membrane.

    Science.gov (United States)

    Roig, M G; Serrano, M A; Bello, J F; Cachaza, J M; Kennedy, J F

    1991-01-01

    The crosslinking of alkaline phosphatase of human placenta with human serum albumin has been optimized. During the physico-chemical characterization of this immobilized biocatalyst, special attention was paid to attributes such as the irreversibility of the enzyme support bonding, the stability of the catalytic activity, and the effects of pH and temperature on this activity. Regarding stability, patterns of denaturation are proposed, to account for inactivation curves over time and under storage/operation conditions. These patterns, in some cases, indicate the existence of different populations of immobilized enzyme molecules, with a different degree of sensitivity to denaturation. The activity vs pH profiles are clearly modified by the immobilization process. This is because the pH of the free homogeneous solution, measurable with a pH-meter, differs from the real pH of the immediate microenvironment of the immobilized enzyme molecules due to the effects of proton accumulation in the microenvironment (in the reaction catalysed by alkaline phosphatase, protons are produced), to limitations to the free diffusion of H+ and to the possible partition effects of H+ due to polar interactions with residues or molecules of the enzyme membrane. In the experimental working conditions, the apparent optimum temperatures are centered at 40 degrees C, inactivation (thermal denaturation) occurring above this temperature. In the temperature range 10-40 degrees C, the kinetic control over the overall activity of the immobilized enzyme was observed, causing the Arrhenius profiles to be linear.

  11. Human amniotic fluid derived cells can competently substitute dermal fibroblasts in a tissue-engineered dermo-epidermal skin analog

    NARCIS (Netherlands)

    Hartmann-Fritsch, Fabienne; Hosper, Nynke; Luginbuehl, Joachim; Biedermann, Thomas; Reichmann, Ernst; Meuli, Martin

    2013-01-01

    Human amniotic fluid comprises cells with high differentiation capacity, thus representing a potential cell source for skin tissue engineering. In this experimental study, we investigated the ability of human amniotic fluid derived cells to substitute dermal fibroblasts and support epidermis formati

  12. Requirements for F-BAR proteins TOCA-1 and TOCA-2 in actin dynamics and membrane trafficking during Caenorhabditis elegans oocyte growth and embryonic epidermal morphogenesis.

    Directory of Open Access Journals (Sweden)

    Chiara Giuliani

    2009-10-01

    Full Text Available The TOCA family of F-BAR-containing proteins bind to and remodel lipid bilayers via their conserved F-BAR domains, and regulate actin dynamics via their N-Wasp binding SH3 domains. Thus, these proteins are predicted to play a pivotal role in coordinating membrane traffic with actin dynamics during cell migration and tissue morphogenesis. By combining genetic analysis in Caenorhabditis elegans with cellular biochemical experiments in mammalian cells, we showed that: i loss of CeTOCA proteins reduced the efficiency of Clathrin-mediated endocytosis (CME in oocytes. Genetic interference with CeTOCAs interacting proteins WSP-1 and WVE-1, and other components of the WVE-1 complex, produced a similar effect. Oocyte endocytosis defects correlated well with reduced egg production in these mutants. ii CeTOCA proteins localize to cell-cell junctions and are required for proper embryonic morphogenesis, to position hypodermal cells and to organize junctional actin and the junction-associated protein AJM-1. iii Double mutant analysis indicated that the toca genes act in the same pathway as the nematode homologue of N-WASP/WASP, wsp-1. Furthermore, mammalian TOCA-1 and C. elegans CeTOCAs physically associated with N-WASP and WSP-1 directly, or WAVE2 indirectly via ABI-1. Thus, we propose that TOCA proteins control tissues morphogenesis by coordinating Clathrin-dependent membrane trafficking with WAVE and N-WASP-dependent actin-dynamics.

  13. In vivo production of novel vitamin D2 hydroxy-derivatives by human placentas, epidermal keratinocytes, Caco-2 colon cells and the adrenal gland

    Science.gov (United States)

    Slominski, Andrzej T.; Kim, Tae-Kang; Shehabi, Haleem Z.; Tang, Edith; Benson, Heather A. E.; Semak, Igor; Lin, Zongtao; Yates, Charles R.; Wang, Jin; Li, Wei; Tuckey, Robert C.

    2014-01-01

    We investigated the metabolism of vitamin D2 to hydroxyvitamin D2 metabolites ((OH)D2) by human placentas ex-utero, adrenal glands ex-vivo and cultured human epidermal keratinocytes and colonic Caco-2 cells, and identified 20(OH)D2, 17,20(OH)2D2, 1,20(OH)2D2, 25(OH)D2 and 1,25(OH)2D2 as products. Inhibition of product formation by 22R-hydroxycholesterol indicated involvement of CYP11A1 in 20- and 17-hydroxylation of vitamin D2, while use of ketoconazole indicated involvement of CYP27B1 in 1α-hydroxylation of products. Studies with purified human CYP11A1 confirmed the ability of this enzyme to convert vitamin D2 to 20(OH)D2 and 17,20(OH)2D2. In placentas and Caco-2 cells, production of 20(OH)D2 was higher than 25(OH)D2 while in human keratinocytes the production of 20(OH)D2 and 25(OH)D2 were comparable. HaCaT keratinocytes showed high accumulation of 1,20(OH)2D2 relative to 20(OH)D2 indicating substantial CYP27B1 activity. This is the first in vivo evidence for a novel pathway of vitamin D2 metabolism initiated by CYP11A1 and modified by CYP27B1, with the product profile showing tissue- and cell-type specificity. PMID:24382416

  14. Toksisk epidermal nekrolyse

    DEFF Research Database (Denmark)

    Bygum, Anette; Andersen, Klaus Ejner

    2006-01-01

    Toxic epidermal necrolysis (TEN) is a rare, mostly drug-induced life-threatening mucocutaneous reaction with generalised symptoms and internal organ involvement. Current treatment strategy focuses on supportive intensive care with close collaboration among many specialties. Specific therapies...

  15. Immunology of membranous nephropathy: from animal models to humans.

    Science.gov (United States)

    Sinico, R A; Mezzina, N; Trezzi, B; Ghiggeri, G M; Radice, A

    2016-02-01

    Membranous nephropathy (MN), the leading cause of nephrotic syndrome in adults, is characterized by the deposition of subepithelial immune deposits that consist mainly of immunoglobulin (Ig)G and complement. Most of the cases are primary or idiopathic (iMN), while only approximately 25% of the cases are secondary to some known disease such as systemic lupus erythematosus, hepatitis B, drugs and malignancies. Most of our knowledge on the pathogenesis of iMN has relied upon old experimental models (i.e. Heymann nephritis) that have shown that immune deposits are formed in situ by the reaction of autoantibodies against the respective podocyte antigen. Recent findings indicate that podocyte proteins also act as an autoantigen in human iMN. The M-type phospholipase A2 receptor (PLA2R) has been identified as the main target antigen, as it can be found in approximately 70% of iMN patients but only rarely in other glomerulonephritides. Podocytes damage in the experimental model of Heymann nephritis is complement-mediated. In humans, the presence of complement within the subepithelial deposits is well established, but IgG4, which does not activate complement by classical or alternative pathways, represents the predominant subclass of IgG anti-PLA2R. Some evidence suggests that IgG4 anti-PLA2R autoantibodies can bind mannan-binding lectin (MBL) and activate the lectin complement pathway. A genetic background for iMN has been demonstrated by genome-wide association studies that have shown highly significant associations of the PLA2R1 and the human leucocyte antigen (HLA)-DQA1 loci with iMN. In addition to their diagnostic value, anti-PLA2R antibodies may be useful to monitor disease activity and predict response to treatment.

  16. Pericapillary basement membrane thickening in human skeletal muscles.

    Science.gov (United States)

    Baum, Oliver; Bigler, Marius

    2016-09-01

    The basement membrane (BM) surrounding capillaries in skeletal muscles varies physiologically in thickness according to age, physical fitness, and anatomical site in humans. Furthermore, the pericapillary BM thickness (CBMT) increases pathophysiologically during several common disease states, including peripheral arterial disease and diabetes mellitus. This review on CBM thickening in human skeletal muscles is two pronged. First, it addresses the advantages/disadvantages of grid- and tablet-based measuring and morphometric techniques that are implemented to assess the CBMT on transmission electron micrographs. Second, it deals with the biology of CBM thickening in skeletal muscles, particularly its possible causes, molecular mechanisms, and functional impact. CBM thickening is triggered by several physical factors, including diabetes-associated glycation, hydrostatic pressure, and inflammation. Increased biosynthesis of type IV collagen expression or repetitive cycles in pericyte or endothelial cell degeneration/proliferation appear to be most critical for CBM accumulation. A thickened CBM obviously poses a greater barrier for diffusion, lowers the microvascular elasticity, and impedes transcytosis of inflammatory cells. Our own morphometric data reveal the CBM enlargement to be not accompanied by the pericyte coverage. Owing to an overlap or redundancy in the capillary supply, CBM thickening in skeletal muscles might not be such a devastating occurrence as in organs with endarterial circulation (e.g., kidney and retina). CBM growth in skeletal muscles can be reversed by training or administration of antidiabetic drugs. In conclusion, CBM thickening in skeletal muscles is a microvascular remodeling process by which metabolic, hemodynamic, and inflammatory forces are integrated together and which could play a hitherto underestimated role in etiology/progression of human diseases.

  17. The balance between 4-hydroxynonenal and intrinsic glutathione/glutathione S-transferase A4 system may be critical for the epidermal growth factor receptor phosphorylation of human esophageal squamous cell carcinomas.

    Science.gov (United States)

    Uno, Kaname; Kato, Katsuaki; Kusaka, Gen; Asano, Naoki; Iijima, Katsunori; Shimosegawa, Tooru

    2011-10-01

    Oxidative stress might participate in the carcinogenesis of human esophageal squamous cell carcinomas (hESCC). 4-Hydroxynonenal (HNE) is a major product of membrane lipid peroxidation with short life. It might act as an important mediator through the generation of adducts and activate epidermal growth factor receptor (EGFR) signaling. It is mainly trapped with glutathione (GSH) and catalyzed by glutathione S-transferases (GSTs). This study aimed to elucidate the possible participation of HNE, GSH/GST system, and EGFR signaling in hESCC development. Immunohistochemistry of HNE adducts, EGFR, and phosphorylated EGFR (pEGFR) was performed with hESCC specimens. The effect of HNE on the phosphorylation of EGFR and its downstream PhospholipaseCγ1 (PLCγ1) was investigated with KYSE30 cell-line. Pretreatment with GSH inducer N-acetylcysteine (NAC) or GSH inhibitor Buthionine sulfoximine (BSO) and mandatory transfection of hGSTA4 gene in KYSE30 were conducted to investigate the relationship between HNE and GSH/GST system. Immunoreactants of HNE adducts, EGFR, and pEGFR were increased in hESCC compared to non-cancerous epithelium with positive correlations. The treatment of HNE ligand-independently induced the phosphorylation of EGFR and PLCγ1 accompanying the diminishment of intracellular GSH level. NAC increased GSH contents but BSO decreased in dose-dependent manners. Reflecting changes in GSH, HNE-induced EGFR phosphorylation was suppressed by NAC, whereas it was promoted by BSO. Mandatory expression of hGSTA4 suppressed HNE-induced events. We first demonstrated that the ligand-independent activation of EGFR by the balance between the stimulation of HNE and the prevention of intrinsic GSH/GST system might participate in the development of hESCC.

  18. The cell-penetrating peptide domain from human heparin-binding epidermal growth factor-like growth factor (HB-EGF) has anti-inflammatory activity in vitro and in vivo

    Energy Technology Data Exchange (ETDEWEB)

    Lee, Jue-Yeon; Seo, Yoo-Na; Park, Hyun-Jung [Research Center, Nano Intelligent Biomedical Engineering Corporation (NIBEC), Seoul (Korea, Republic of); Park, Yoon-Jeong, E-mail: parkyj@snu.ac.kr [Research Center, Nano Intelligent Biomedical Engineering Corporation (NIBEC), Seoul (Korea, Republic of); Department of Dental Regenerative Biotechnology, Dental Research Institute and School of Dentistry, Seoul National University, Seoul (Korea, Republic of); Chung, Chong-Pyoung, E-mail: ccpperio@snu.ac.kr [Research Center, Nano Intelligent Biomedical Engineering Corporation (NIBEC), Seoul (Korea, Republic of); Department of Periodontology, College of Dentistry, Seoul National University, Seoul (Korea, Republic of)

    2012-03-23

    Highlights: Black-Right-Pointing-Pointer HBP sequence identified from HB-EGF has cell penetration activity. Black-Right-Pointing-Pointer HBP inhibits the NF-{kappa}B dependent inflammatory responses. Black-Right-Pointing-Pointer HBP directly blocks phosphorylation and degradation of I{kappa}B{alpha}. Black-Right-Pointing-Pointer HBP inhibits nuclear translocation of NF-{kappa}B p65 subunit. -- Abstract: A heparin-binding peptide (HBP) sequence from human heparin-binding epidermal growth factor-like growth factor (HB-EGF) was identified and was shown to exhibit cell penetration activity. This cell penetration induced an anti-inflammatory reaction in lipopolysaccharide (LPS)-treated RAW 264.7 macrophages. HBP penetrated the cell membrane during the 10 min treatment and reduced the LPS-induced production of nitric oxide (NO), inducible nitric oxide synthase (iNOS), and cytokines (TNF-{alpha} and IL-6) in a concentration-dependent manner. Additionally, HBP inhibited the LPS-induced upregulation of cytokines, including TNF-{alpha} and IL-6, and decreased the interstitial infiltration of polymorphonuclear leukocytes in a lung inflammation model. HBP inhibited NF-{kappa}B-dependent inflammatory responses by directly blocking the phosphorylation and degradation of I{kappa}B{alpha} and by subsequently inhibiting the nuclear translocation of the p65 subunit of NF-{kappa}B. Taken together, this novel HBP may be potentially useful candidate for anti-inflammatory treatments and can be combined with other drugs of interest to transport attached molecules into cells.

  19. Co-expression of epidermal growth factor-receptor and c-erb B-2 proto-oncogene product in human salivary-gland adenocarcinoma cell line HSG and the implications for HSG cell autocrine growth.

    Science.gov (United States)

    Kyakumoto, S; Kurokawa, R; Hoshino, M; Ota, M

    1994-07-01

    The autonomous proliferation of HSG cells is mediated by an autocrine growth factor, a 46K epidermal growth factor (EGF)-like molecule. The receptor for this molecule was investigated. Immunoprecipitation and immunoblotting revealed the expression of two possible receptor molecules, EGF-R and p185erbB-2, in HSG cells. Northern blotting also revealed the co-expression of 5.6-kb EGF-R mRNA and 4.6-kb c-erb B-2 mRNA. When the purified EGF-like molecule was added to the cultures, EGF-R but not p185erbB-2 was autophosphorylated. These results suggest that, although both EGF-R and p185erbB-2 are co-expressed in HSG cells, the EGF-R is the genuine receptor for the EGF-like molecule. However, there is a possibility that p185erB-2 is involved in the signal transduction system. This possibility was examined by using specific antibodies to human EGF-R (hEGF-R), p185erbB-2, and EGF to inhibit the functions of these molecules. Addition of these three antibodies to the cultures inhibited the growth of HSG cells. The antibodies to EGF-R and p185erbB-2 also caused morphological changes such as disturbances of the plasma membrane, and some cell death. Surprisingly, the effect of the anti-p185erbB-2 antibody on growth inhibition and morphology was stronger than that of the anti-hEGF-R antibody. Thus, p185erB-2 expressed in HSG cells has an important function in the signal transduction of HSG cell growth.

  20. Use of a serum-free epidermal culture model to show deleterious effects of epidermal growth factor on morphogenesis and differentiation.

    Science.gov (United States)

    Chen, C S; Lavker, R M; Rodeck, U; Risse, B; Jensen, P J

    1995-01-01

    The presence of serum has limited the utility of many culture models for the study of cytokine effects because its complexity and variability can confound the interpretation of data. In the present study, a serum-free skin co-culture model was used to investigate the effect of exogenous epidermal growth factor (EGF) on epidermal proliferation and differentiation. Human keratinocytes cultured on collagen rafts at the air-liquid interface produced a well-differentiated epithelium that resembled normal epidermis. Keratin filaments, membrane-coating granules, and keratohyalin granules were all observed. Epidermal differentiation markers keratin K1/K10, involucrin, and transglutaminase were localized in most of the suprabasal layers, whereas profilaggrin/filaggrin was confined to the granular layers and stratum corneum. In the continual presence of 10-20 ng/mL EGF, the epidermis was less organized, thinner, and less proliferative. EGF also depressed several indicators of differentiation: The number of keratohyalin granules and membrane-coating granules was greatly decreased; antigen expression of profilaggrin/filaggrin appeared diminished by immunocytochemical staining; frequent nuclear retention was noted in the relatively thickened stratum corneum-like layers. As detected by immunohistochemical staining, the expression of EGF receptor in the epidermis was reduced by exogenous EGF. These data illustrate that EGF cannot be considered a simple mitogen. Our findings also underscore the importance of using sophisticated culture models to assess complex cytokine effects that may be dependent on the architecture of a differentiating epidermis.

  1. The Membrane-anchored Serine Protease Prostasin (CAP1/PRSS8) Supports Epidermal Development and Postnatal Homeostasis Independent of Its Enzymatic Activity

    DEFF Research Database (Denmark)

    Peters, Diane E; Szabo, Roman; Friis, Stine

    2014-01-01

    The membrane-anchored serine protease prostasin (CAP1/PRSS8) is part of a cell surface proteolytic cascade that is essential for epithelial barrier formation and homeostasis. Here, we report the surprising finding that prostasin executes these functions independent of its own enzymatic activity....... Prostasin null (Prss8(-/-)) mice lack barrier formation and display fatal postnatal dehydration. In sharp contrast, mice homozygous for a point mutation in the Prss8 gene, which causes the substitution of the active site serine within the catalytic histidine-aspartate-serine triad with alanine and renders...... prostasin catalytically inactive (Prss8(Cat-/Cat-) mice), develop barrier function and are healthy when followed for up to 20 weeks. This striking difference could not be explained by genetic modifiers or by maternal effects, as these divergent phenotypes were displayed by Prss8(-/-) and Prss8(Cat...

  2. Repair of an oroantral communication by a human amniotic membrane: a novel technique.

    Science.gov (United States)

    Lakshmi, Subha; Bharani, Siva; Ambardar, Kalhan

    2015-08-01

    The amniotic membrane is the innermost layer of fetal membrane and is attached to the chorion in the placenta. This membrane has been used for nearly a century in varied fields such as ophthalmology, reconstructive surgery, and burn treatment. In this case report, we used a human amniotic membrane to repair an iatrogenic oroantral communication that occurred during the extraction of the patient's right upper second molar. A splint was given after the perforation was covered with human amniotic membrane and healing was clinically evaluated at various intervals. The outcome of the study revealed that the human amniotic membrane was an efficient graft material for repairing the defect caused by an iatrogenic oroantral communication following tooth extraction.

  3. Ultrananocrystalline Diamond-Coated Microporous Silicon Nitride Membranes for Medical Implant Applications

    Science.gov (United States)

    Skoog, Shelby A.; Sumant, Anirudha V.; Monteiro-Riviere, Nancy A.; Narayan, Roger J.

    2012-04-01

    Ultrananocrystalline diamond (UNCD) exhibits excellent biological and mechanical properties, which make it an appropriate choice for promoting epidermal cell migration on the surfaces of percutaneous implants. We deposited a ~150 nm thick UNCD film on a microporous silicon nitride membrane using microwave plasma chemical vapor deposition. Scanning electron microscopy and Raman spectroscopy were used to examine the pore structure and chemical bonding of this material, respectively. Growth of human epidermal keratinocytes on UNCD-coated microporous silicon nitride membranes and uncoated microporous silicon nitride membranes was compared using the 3-(4,5-dimethylthiazol-2-yl)2,5-diphenyltetrazolium bromide (MTT) assay. The results show that the UNCD coating did not significantly alter the viability of human epidermal keratinocytes, indicating potential use of this material for improving skin sealing around percutaneous implants.

  4. Effects of radiation on the permeability of human basement membranes; Effets des radiations sur la permeabilite de membranes basales humaines

    Energy Technology Data Exchange (ETDEWEB)

    Fan, B.T. [Paris-7 Univ., ITODYS, UPRES-A 7086 CNRS, 75 (France); Achour, S. [Paris-7 Univ., 75 (France). Unite de Recheche Chimie et Pharmacologie; Simmonet, F. [CEA Saclay, 91 - Gif-sur-Yvette (France). INSTN, Institut National des Sciences et Techniques Nucleaires; Guerin, D. [Clinique d`Aulnay, 93 - Aulnay-sous-Bois (France)

    1999-02-01

    The influence of radiation on the permeability properties of human basement membrane was investigated by measuring the diffusion rate of several organic compounds (glycine, proline, glucose, urea and insulin) through human anterior lens capsules. The basement membranes borne an {gamma}-irradiation treatment change significantly their permeability vis-a-vis studied organic substances. This modification in physico-chemical properties is probably due to the radiation, which alters or degrades the complex structure (or architecture) of basement membranes. Moreover the change in permeability is dependent upon the diffusing compounds. An increase in diffusion has been observed for glucose, glycine and urea. However for insulin and proline, a decrease in diffusion rate was observed. (authors) 21 refs.

  5. Novel epidermal growth factor receptor pathway mediates release of human β-defensin 3 from Helicobacter pylori-infected gastric epithelial cells.

    Science.gov (United States)

    Muhammad, Jibran S; Zaidi, Syed F; Zhou, Yue; Sakurai, Hiroaki; Sugiyama, Toshiro

    2016-04-01

    Persistent Helicobacter pylori (H. pylori) infection in hostile gastric mucosa can result in gastric diseases. Helicobacter pylori induces to express antimicrobial peptides from gastric epithelial cells, especially human β-defensin 3 (hBD3), as an innate immune response, and this expression of hBD3 is mediated by epidermal growth factor receptor (EGFR) activation. In this study, we found that phosphorylation of a serine residue of EGFR via transforming growth factor β-activated kinase-1 (TAK1), and subsequent p38α activation is essential for H. pylori-induced hBD3 release from gastric epithelial cells. We showed that this pathway was dependent on H. pylori type IV secretion system and was independent of H. pylori-derived CagA or peptidoglycan. H. pylori infection induced phosphorylation of serine residue of EGFR, and this phosphorylation was followed by internalization of EGFR; consequently, hBD3 was released at an early phase of the infection. In the presence of TAK1 or p38α inhibitors, synthesis of hBD3 was completely inhibited. Similar results were observed in EGFR-, TAK1- or p38α-knockdown cells. However, NOD1 knockdown in gastric epithelial cells did not inhibit hBD3 induction. Our study has firstly demonstrated that this novel EGFR activating pathway functioned to induce hBD3 at an early phase of H. pylori infection.

  6. Treatment challenges for community oncologists treating postmenopausal women with endocrine-resistant, hormone receptor-positive, human epidermal growth factor receptor 2-negative advanced breast cancer

    Directory of Open Access Journals (Sweden)

    Gradishar WJ

    2016-07-01

    Full Text Available William J Gradishar Division of Hematology/Oncology, Department of Medicine, Northwestern University Feinberg School of Medicine, Chicago, IL, USA Abstract: Community-based oncologists are faced with challenges and opportunities when delivering quality patient care, including high patient volumes and diminished resources; however, there may be the potential to deliver increased patient education and subsequently improve outcomes. This review discusses the treatment of postmenopausal women with endocrine-resistant, hormone receptor-positive, human epidermal growth factor receptor 2-negative advanced breast cancer in order to illustrate considerations in the provision of pertinent quality education in the treatment of these patients and the management of therapy-related adverse events. An overview of endocrine-resistant breast cancer and subsequent treatment challenges is also provided. Approved treatment options for endocrine-resistant breast cancer include hormonal therapies and mammalian target of rapamycin inhibitors. Compounds under clinical investigation are also discussed. Keywords: community oncologists, hormone receptor-positive advanced breast cancer, endocrine resistance

  7. Additive effect of heat on the UVB-induced tyrosinase activation and melanogenesis via ERK/p38/MITF pathway in human epidermal melanocytes.

    Science.gov (United States)

    Gu, Wei-Jie; Ma, Hui-Jun; Zhao, Guang; Yuan, Xiao-Ying; Zhang, Ping; Liu, Wen; Ma, Li-Juan; Lei, Xiao-Bing

    2014-08-01

    Heat is known as an environmental factor that causes significant skin pigmentation, but its effects on melanogenesis have been poorly studied. It has been shown that mitogen-activated protein kinase (MAPK) is involved in ultraviolet B (UVB) and stress-induced melanogenesis in melanocytes. In this study, we investigated the effects of heat and UVB, on melanocyte melanogenesis, differentiation, and MAPK phosphorylation. The results showed that heat (1 h at 40 °C for 5 days) increased cell dendrites, enlarged cell bodies, and induced extracellular signal-regulated kinases (ERK)/p38/MITF activation but did not influence melanogenesis of human epidermal melanocytes from skin phototype III. UVB irradiation (20 mJ/cm(2) for 5 days) induced melanogenesis and c-jun N-terminal kinases (JNK)/p38/MITF/tyrosinase activation in melanocytes from skin phototype III. UVB combined with heat resulted in much more significant tyrosinase activation and melanogenesis as compared with UVB alone in melanocytes from skin phototype III. Furthermore, heat treatment and UVB irradiation induced JNK, ERK, and p38 activation but not melanogenic and morphological changes in melanocytes from skin phototype I. These findings suggested that heat promoted melanocyte differentiation, probably via heat-induced ERK/p38/MITF/activation. Furthermore, heat had an additive effect on the UVB-induced tyrosinase activation and melanogenesis. These results provide a new clue for dermatologists for the treatment of hypopigmented skin disease with heat combined with UVB irradiation.

  8. Obesity increases the incidence of distant metastases in oestrogen receptor-negative human epidermal growth factor receptor 2-positive breast cancer patients.

    Science.gov (United States)

    Mazzarella, Luca; Disalvatore, Davide; Bagnardi, Vincenzo; Rotmensz, Nicole; Galbiati, Donata; Caputo, Sara; Curigliano, Giuseppe; Pelicci, Pier Giuseppe

    2013-11-01

    Obesity is a major negative determinant of breast cancer outcome. However, there are contrasting data on the differential impact of obesity on specific breast cancer subtypes. In particular, very little is known on human epidermal growth factor receptor 2-positive (HER2+) tumours. We assessed the prognostic role of increased body mass index (BMI) on a consecutive series of non-metastatic HER2+ patients treated at our institution before the introduction of adjuvant Trastuzumab. We separately analysed oestrogen receptor-positive (ER+) and -negative (ER-) HER2+ cases. In ER-/HER2+ tumours we observed a significantly worse overall survival (Hazard ratio (HR) 1.79, p-value 0.041) and cumulative incidence of distant metastases (HR 2.03, p-value 0.019) in obese (BMI>30) versus normal/underweight (BMIobese patients, masking the overall effect on disease-free survival. Outcome in ER+ tumours, instead, was not significantly different between BMI groups. Obesity significantly correlates with worse overall survival and cumulative incidence of distant metastases in ER-/HER2 positive breast cancer. Differences in the biology of breast tumours may determine individual susceptibility to obesity. The biology of the underlying tumour should be taken into account in the design of dietary intervention trials in breast cancer. Copyright © 2013 Elsevier Ltd. All rights reserved.

  9. New insights in the structure and biology of the high affinity receptor for IgE (Fc epsilon RI) on human epidermal Langerhans cells.

    Science.gov (United States)

    Bieber, T; Kraft, S; Jürgens, M; Strobel, I; Haberstok, J; Tomov, H; Regele, D; de la Salle, H; Wollenberg, A; Hanau, D

    1996-10-01

    The recent structural and functional analysis of the high affinity receptor for IgE (Fc epsilon RI) expressed on human epidermal Langerhans cells (LC) revealed new aspects of the biology of this structure. In contrast to basophils and mast cells where this receptor seems to be expressed constitutively at a constant level, the expression of Fc epsilon RI on LC varies on the donor and the inflammatory environment of the cells and lacks the classical beta-chain. This also implies functional differences most probably related to the expression level. Although the signalling pathway seems to be similar to that of basophils or mast cells, LC from individuals with atopic dermatitis are fully activated by receptor ligation while LC from normal individuals fail to exhibit calcium mobilization under the same conditions. Finally, LC from normal and atopic individuals use Fc epsilon RI to maximize antigen uptake via specific IgE and subsequent presentation to T cells. Thus, Fc epsilon RI expressed on LC differs in terms of structure and function from that expressed on effector cells of anaphylaxis.

  10. Combined effects of lapatinib and bortezomib in human epidermal receptor 2 (HER2)-overexpressing breast cancer cells and activity of bortezomib against lapatinib-resistant breast cancer cells.

    Science.gov (United States)

    Ma, Chuandong; Niu, Xiuqing; Luo, Jianmin; Shao, Zhimin; Shen, Kunwei

    2010-10-01

    Lapatinib and bortezomib are highly active against breast cancer cells. Breast cancer patients who initially respond to lapatinib may eventually manifest acquired resistance to this treatment. Thus, the identification of novel agents that may prevent or delay the development of acquired resistance to lapatinib is critical. In the current study, we show that the combination of lapatinib and bortezomib results in a synergistic growth inhibition in human epidermal receptor 2 (HER2)-overexpressing breast cancer cells and that the combination enhances apoptosis of SK-BR-3 cells. Importantly, we found that the combination of lapatinib plus bortezomib more effectively blocked activation of the HER2 pathway in SK-BR-3 cells, compared with monotherapy. In addition, we established a model of acquired resistance to lapatinib by chronically challenging SK-BR-3 breast cancer cells with increasing concentrations of lapatinib. Here, we showed that bortezomib notably induced apoptosis of lapatinib-resistant SK-BR-3 pools and further inhibited HER2 signaling in the resistant cells. Taken together, the current data indicate a synergistic interaction between lapatinib and bortezomib in HER2-overexpressing breast cancer cells and provide the rationale for the clinical evaluation of these two noncross-resistant targeted therapies. The combination of lapatinib and bortezomib may be a potentially novel approach to prevent or delay the onset of acquired resistance to lapatinib in HER2-overxpressing/estrogen receptor (ER)-negative breast cancers.

  11. Chemosensitization role of fulvestrant in combination with chemotherapy in postmenopausal hormone receptor positive and human epidermal growth factor negative metastatic breast cancer.

    Science.gov (United States)

    Luo, Qing-Qing; Adhikari, Vishnu Prasad; Zhao, Chun-Xia; Wu, He; Dai, Wei; Li, Xin; Wu, Yu-Tuan; Wu, Kai-Nan; Kong, Ling-Quan

    2016-12-01

    In metastatic breast cancer (MBC), hormone receptor positive (HR+), human epidermal growth factor negative (HER2-) subtype accounts for the majority. With various new modalities available to prolong life span in this group of patients, the effect is distant from optimum. Prevalent strategy of treating postmenopausal HR+ HER2- MBC is application of chemotherapy (CT) after progression of disease on endocrine therapy (ET) of several lines. Generally, ET targets HR+ ingredients and CT works better with HR- tumor cells. HR+ MBC, though hormone-sensitive, has HR- portion which reacts poorly to ET. Thus, sequential use of ET and CT neglects its insensitive part and gives rise to drug resistance, while alleviation of tumor burden is the top priority in metastatic setting. Chemohormonal therapy (i.e. concomitant use of ET and chemotherapy) complements for the shortcoming of current therapy strategy targeting both HR+ and HR- ingredients theoretically. Fulvestrant, a pure estrogen receptor antagonist and down-regulator, could be a promising agent using concurrently with CT based on chemosensitizing character shown in preclinical and pilot clinical studies. It is hypothesized in this article that chemohormonal therapy with concurrent fulvestrant and CT would be a promising strategy in postmenopausal HR+ HER2- MBC patients. Proof of this hypothesis would help control evolvement of tumor burden and acquirement of drug resistance over a short period of time. Copyright © 2016 Elsevier Ltd. All rights reserved.

  12. Metastatic human epidermal growth factor 2 (HER2/neu) amplified breast cancer with acute fulminant hepatitis responding to trastuzumab, pertuzumab and carboplatin.

    Science.gov (United States)

    Macias, Mariela N; Shin, Daniel Sanghoon; Ledezma, Blanca; Sadeghi, Saeed

    2014-06-04

    A 30-year-old woman presented to an outside hospital with pain in the right upper abdomen. Imaging revealed over 100 liver lesions, the largest measuring 74 mm×71 mm, and multiple lytic bone lesions. An outpatient liver biopsy showed a poorly differentiated adenocarcinoma favouring a breast primary. The tumour was oestrogen and progesterone receptor negative, but human epidermal growth factor 2 (HER2/neu) amplified. In her second clinic visit she had decompensated liver failure manifested by new-onset ascites and jaundice. Initially, the chemotherapy plan was for docetaxel, pertuzumab and trastuzumab, but given her severe liver dysfunction we used a combination of carboplatin, pertuzumab and trastuzumab as an inpatient. She was hospitalised for 14 days and eventually discharged with a marked improvement of her symptoms and liver tests. She subsequently completed five outpatient chemotherapy cycles. We showed that carboplatin is a possible alternative to docetaxel when severe liver dysfunction precludes docetaxel's use in combination with pertuzumab and trastuzumab.

  13. An inhibitor of the epidermal growth factor receptor function does not affect the ability of human papillomavirus 11 to form warts in the xenografted immunodeficient mouse model.

    Science.gov (United States)

    Parkinson, Tanya; Howett, Mary K; Welsh, Patricia A; Patrick, Susan D; Neely, Elizabeth B; Flanagan, Neil; Pollack, Vincent A; Pustilnik, Leslie R; Moyer, Jim; Perros, Manos

    2007-04-01

    Epidermal growth factor receptor (EGFr) has been shown to be induced and activated in cells infected with HPV, suggesting that it may play a physiological role in viral replication or in the formation or maintenance of warts. To investigate this possibility, human foreskin tissue was infected with HPV11 and transplanted onto the renal capsule and the dermis of immunodeficient mice. The animals were treated orally or topically with the potent EGFr inhibitor CP-545130, with treatment starting either immediately following graft attachment, or following a 70 day period to allow development of warts. The rate of appearance of warts, wart size and number were monitored. In addition, we measured intra-lesional HPV replication levels and examined the morphology of the graft tissues. Analysis of the results showed no significant difference between placebo and compound-treated groups, despite high levels of compound present in the graft tissue. We conclude that EGFr kinase activity is not required for the development and maintenance of HPV-11-induced warts in this model.

  14. Patterns of resource utilization and cost for postmenopausal women with hormone-receptor-positive, human epidermal growth factor receptor-2-negative advanced breast cancer in Europe.

    Science.gov (United States)

    Jerusalem, Guy; Neven, Patrick; Marinsek, Nina; Zhang, Jie; Degun, Ravi; Benelli, Giancarlo; Saletan, Stephen; Ricci, Jean-François; Andre, Fabrice

    2015-10-24

    Healthcare resource utilization in breast cancer varies by disease characteristics and treatment choices. However, lack of clarity in guidelines can result in varied interpretation and heterogeneous treatment management and costs. In Europe, the extent of this variability is unclear. Therefore, evaluation of chemotherapy use and costs versus hormone therapy across Europe is needed. This retrospective chart review (N = 355) examined primarily direct costs for chemotherapy versus hormone therapy in postmenopausal women with hormone-receptor-positive (HR+), human epidermal growth factor receptor-2-negative (HER2-) advanced breast cancer across 5 European countries (France, Germany, The Netherlands, Belgium, and Sweden). Total direct costs across the first 3 treatment lines were approximately €10,000 to €14,000 lower for an additional line of hormone therapy-based treatment versus switching to chemotherapy-based treatment. Direct cost difference between chemotherapy-based and hormone therapy-based regimens was approximately €1900 to €2500 per month. Chemotherapy-based regimens were associated with increased resource utilization (managing side effects; concomitant targeted therapy use; and increased frequencies of hospitalizations, provider visits, and monitoring tests). The proportion of patients taking sick leave doubled after switching from hormone therapy to chemotherapy. These results suggest chemotherapy is associated with increased direct costs and potentially with increased indirect costs (lower productivity of working patients) versus hormone therapy in HR+, HER2- advanced breast cancer.

  15. Dactylone inhibits epidermal growth factor-induced transformation and phenotype expression of human cancer cells and induces G1-S arrest and apoptosis.

    Science.gov (United States)

    Fedorov, Sergey N; Shubina, Larisa K; Bode, Ann M; Stonik, Valentin A; Dong, Zigang

    2007-06-15

    The marine natural chamigrane-type sesquiterpenoid, dactylone, is closely related to secondary metabolites of some edible species of red algae. In the present study, the effect of dactylone was tested on the mouse skin epidermal JB6 P+ Cl41 cell line and its stable transfectants as well as on several human tumor cell lines, including lung (H460), colon (HCT-116), and skin melanomas (SK-MEL-5 and SK-MEL-28). This natural product was effective at nontoxic doses as a cancer-preventive agent, which exerted its actions, at least in part, through the inhibition of cyclin D3 and Cdk4 expression and retinoblastoma tumor suppressor protein (Rb) phosphorylation. The inhibition of these cell cycle components was followed by cell cycle arrest at the G1-S transition with subsequent p53-independent apoptosis. Therefore, these data showed that application of dactylone and related compounds may lead to decreased malignant cell transformation and/or decreased tumor cell proliferation.

  16. Epidermal Growth Factor Receptor Kinase Inhibitors Synergize with TCDD to Induce CYP1A1/1A2 in Human Breast Epithelial MCF10A Cells.

    Science.gov (United States)

    Joiakim, Aby; Mathieu, Patricia A; Shelp, Catherine; Boerner, Julie; Reiners, John J

    2016-05-01

    CYP1A1 and CYP1A2 are transcriptionally activated in the human normal breast epithelial cell line MCF10A following exposure to 2,3,7,8-tetrachlorodibenzo-p-dioxin (TCDD). Shifting MCF10A cultures to medium deficient in serum and epidermal growth factor (EGF) caused rapid reductions in the activated (i.e., phosphorylated) forms of extracellular regulated kinases (ERKs) and the epidermal growth factor receptor (EGFR). Shifting to serum/EGF-deficient medium also enhanced TCDD-mediated induction of cytochrome P450 (CYP)1A1 Treatment of cells cultured in complete medium with the EGFR inhibitors gefitinib (Iressa), AG1478, and CI-1033 resulted in concentration-dependent reductions of active EGFR and ERKs, and increased CYP1A1 mRNA content ∼3- to 18-fold above basal level. EGFR inhibitors synergized with TCDD and resulted in transient CYP1A1 and CYP1A2 mRNA accumulations ∼8-fold greater (maximum at 5 hours) than that achieved with only TCDD. AG1478, gefitinib, and TCDD individually induced small increases (∼1.2- to 2.5-fold) in CYP1A1 protein content but did not cause additive or synergistic accumulations of CYP1A1 protein when used in combination. The mitogen-activated protein kinase kinase inhibitor PD184352 inhibited ERK and EGFR activation in a concentration-dependent fashion without causing CYP1A1 mRNA accumulation. However, cotreatment with PD184352 potentiated TCDD-mediated CYP1A1 induction. TCDD-mediated induction of CYP1A1 in MCF7-TET on-EGFR cells, a MCF7 variant in which EGFR expression can be controlled, was not affected by the activity status of EGFR or ERKs. Hence, EGFR signaling mutes both basal and ligand-induced expression of two aryl hydrocarbon receptor-responsive P450s in MCF10A cultures. However, these effects are cell context-dependent. Furthermore, CYP1A1 mRNA and protein abundance are not closely coupled in MCF10A cultures.

  17. Circulating-free DNA Mutation Associated with Response of Targeted Therapy in Human Epidermal Growth Factor Receptor 2-positive Metastatic Breast Cancer

    Science.gov (United States)

    Ye, Qing; Qi, Fan; Bian, Li; Zhang, Shao-Hua; Wang, Tao; Jiang, Ze-Fei

    2017-01-01

    Background: The addition of anti-human epidermal growth factor receptor 2 (HER2)-targeted drugs, such as trastuzumab, lapatinib, and trastuzumab emtansine (T-DM1), to chemotherapy significantly improved prognosis of HER2-positive breast cancer patients. However, it was confused that metastatic patients vary in the response of targeted drug. Therefore, methods of accurately predicting drug response were really needed. To overcome the spatial and temporal limitations of biopsies, we aimed to develop a more sensitive and less invasive method of detecting mutations associated with anti-HER2 therapeutic response through circulating-free DNA (cfDNA). Methods: From March 6, 2014 to December 10, 2014, 24 plasma samples from 20 patients with HER2-positive metastatic breast cancer who received systemic therapy were eligible. We used a panel for detection of hot-spot mutations from 50 oncogenes and tumor suppressor genes, and then used targeted next-generation sequencing (NGS) to identify somatic mutation of these samples in those 50 genes. Samples taken before their first trastuzumab administration and subsequently proven with clinical benefit were grouped into sensitive group. The others were collected after disease progression of the trastuzumab-based therapy and were grouped into the resistant group. Results: A total of 486 single-nucleotide variants from 46 genes were detected. Of these 46 genes, phosphatidylinositol 4,5-bisphosphate 3-kinase catalytic subunit alpha (PIK3CA), proto-oncogene c-Kit (KIT), and tumor protein p53 (TP53) were the most common mutated genes. Seven genes, including epidermal growth factor receptor (EGFR), G protein subunit alpha S (GNAS), HRas proto-oncogene (HRAS), mutL homolog 1 (MLH1), cadherin 1 (CDH1), neuroblastoma RAS viral oncogene homolog (NRAS), and NOTCH1, that only occurred mutations in the resistant group were associated with the resistance of targeted therapy. In addition, we detected a HER2 S855I mutation in two patients who had

  18. Calcium and Vitamin D increase mRNA levels for the growth control hIK1 channel in human epidermal keratinocytes but functional channels are not observed

    Directory of Open Access Journals (Sweden)

    Rossie Sandra

    2004-06-01

    Full Text Available Abstract Background Intermediate-conductance, calcium-activated potassium channels (IKs modulate proliferation and differentiation in mesodermal cells by enhancing calcium influx, and they contribute to the physiology of fluid movement in certain epithelia. Previous reports suggest that IK channels stimulate proliferative growth in a keratinocyte cell line; however, because these channels indirectly promote calcium influx, a critically unique component of the keratinocyte differentiation program, an alternative hypothesis is that they would be anti-proliferative and pro-differentiating. This study addresses these hypotheses. Methods Real-time PCR, patch clamp electrophysiology, and proliferation assays were used to determine if human IK1 (hIK1 expression and function are correlated with either proliferation or differentiation in cultured human skin epidermal keratinocytes, and skin biopsies grown in explant culture. Results hIK1 mRNA expression in human keratinocytes and skin was increased in response to anti-proliferative/pro-differentiating stimuli (elevated calcium and Vitamin D. Correspondingly, the hIK1 agonist 1-EBIO inhibited keratinocyte proliferation suggesting that the channel could be anti-proliferative and pro-differentiating. However, this proliferative inhibition by 1-EBIO was not reversed by a panel of hIK1 blockers, calling into question the mechanism of 1-EBIO action. Subsequent patch clamp electrophysiological analysis failed to detect hIK1 channel currents in keratinocytes, even those expressing substantial hIK1 mRNA in response to calcium and Vitamin D induced differentiation. Identical electrophysiological recording conditions were then used to observe robust IK1 currents in fibroblasts which express IK1 mRNA levels comparable to those of keratinocytes. Thus, the absence of observable hIK1 currents in keratinocytes was not a function of the electrophysiological techniques. Conclusion Human keratinocyte differentiation is

  19. An Apical-Membrane Chloride Channel in Human Tracheal Epithelium

    Science.gov (United States)

    Welsh, Michael J.

    1986-06-01

    The mechanism of chloride transport by airway epithelia has been of substantial interest because airway and sweat gland-duct epithelia are chloride-impermeable in cystic fibrosis. The decreased chloride permeability prevents normal secretion by the airway epithelium, thereby interfering with mucociliary clearance and contributing to the morbidity and mortality of the disease. Because chloride secretion depends on and is regulated by chloride conductance in the apical cell membrane, the patch-clamp technique was used to directly examine single-channel currents in primary cultures of human tracheal epithelium. The cells contained an anion-selective channel that was not strongly voltage-gated or regulated by calcium in cell-free patches. The channel was also blocked by analogs of carboxylic acid that decrease apical chloride conductance in intact epithelia. When attached to the cell, the channel was activated by isoproterenol, although the channel was also observed to open spontaneously. However, in some cases, the channel was only observed after the patch was excised from the cell. These results suggest that this channel is responsible for the apical chloride conductance in airway epithelia.

  20. Sustained complete remission of human epidermal growth factor receptor 2-positive metastatic breast cancer in the liver during long-term trastuzumab (Herceptin maintenance therapy in a woman: a case report

    Directory of Open Access Journals (Sweden)

    Tsavaris Nicolas

    2010-12-01

    Full Text Available Abstract Introduction This case report and short review discusses how long trastuzumab should be continued in metastatic breast cancer, the safety issues in case of pregnancy and the risk of relapse with trastuzumab cessation. Case presentation We present the case of a 34-year-old Caucasian woman with human epidermal growth factor receptor 2-positive metastatic breast cancer in the liver who achieved prolonged complete remission within six months of receiving trastuzumab (Herceptin in combination with vinorelbine and gemcitabine. The patient remains in complete remission seven years later and continues to receive trastuzumab as maintenance therapy. Conclusion Trastuzumab-based therapies have greatly improved the survival rates of patients with human epidermal growth factor receptor 2- positive metastatic breast cancer. Despite such improvements, the safety of trastuzumab administration during pregnancy is yet to be defined.

  1. Albuterol Improves Alveolar-Capillary Membrane Conductance in Healthy Humans

    Science.gov (United States)

    Taylor, Natalie E.; Baker, Sarah E.; Olson, Thomas P.; Lalande, Sophie; Johnson, Bruce D.; Snyder, Eric M.

    2016-01-01

    BACKGROUND Beta-2 adrenergic receptors (β2ARs) are located throughout the body including airway and alveolar cells. The β2ARs regulate lung fluid clearance through a variety of mechanisms including ion transport on alveolar cells and relaxation of the pulmonary lymphatics. We examined the effect of an inhaled β2-agonist (albuterol) on alveolar-capillary membrane conductance (DM) and pulmonary capillary blood volume (VC) in healthy humans. METHODS We assessed the diffusing capacity of the lungs for carbon monoxide (DLCO) and nitric oxide (DLNO) at baseline, 30 minutes, and 60 minutes following nebulized albuterol (2.5 mg, diluted in 3 mL normal saline) in 45 healthy subjects. Seventeen subjects repeated these measures following nebulized normal saline (age = 27 ± 9 years, height = 165 ± 21 cm, weight = 68 ± 12 kg, BMI = 26 ± 9 kg/m2). Cardiac output (Q), heart rate, systemic vascular resistance (SVR), blood pressure, oxygen saturation, forced expiratory volume at one-second (FEV1), and forced expiratory flow at 50% of forced vital capacity (FEF50) were assessed at baseline, 30 minutes, and 60 minutes following the administration of albuterol or saline. RESULTS Albuterol resulted in a decrease in SVR, and an increase in Q, FEV1, and FEF50 compared to saline controls. Albuterol also resulted in a decrease in VC at 60 minutes post albuterol. Both albuterol and normal saline resulted in no change in DLCO or DM when assessed alone, but a significant increase was observed in DM when accounting for changes in VC. CONCLUSION These data suggest that nebulized albuterol improves pulmonary function in healthy humans, while nebulization of both albuterol and saline results in an increase in DM/VC. PMID:27773996

  2. 1)Jarid2 regulates mouse epidermal stem cell activation and differentiation ; 2)Tumor heterogeneity and metastasis-initiation in human squamous cell carcinoma

    OpenAIRE

    Mejetta, Stefania

    2013-01-01

    Jarid2 is required for the genomic recruitment of the polycomb repressive complex-2 (PRC2) in embryonic stem cells. However, its specific role during late development and adult tissues remains largely uncharacterized. In this first part of my thesis, we show that deletion of Jarid2 in mouse epidermis reduces the proliferation and potentiates the differentiation of postnatal epidermal progenitors, without affecting epidermal development. In neonatal epidermis, Jarid2 deficien...

  3. Differences in human skin between the epidermal growth factor receptor distribution detected by EGF binding and monoclonal antibody recognition

    DEFF Research Database (Denmark)

    Green, M R; Couchman, J R

    1985-01-01

    , the eccrine sweat glands, capillary system, and the hair follicle outer root sheath, generally similar in pattern to that previously reported for full-thickness rat skin and human epidermis. The same areas also bound EGF-R1 but in addition the monoclonal antibody recognized a cone of melanin containing...

  4. Cystatin M/E knockdown by lentiviral delivery of shRNA impairs epidermal morphogenesis of human skin equivalents

    NARCIS (Netherlands)

    Jansen, P.A.M.; Bogaard, E.H. van den; Kersten, F.F.J.; Oostendorp, C.; Vlijmen-Willems, I.M. van; Oji, V.; Traupe, H.; Hennies, H.C.; Schalkwijk, J.; Zeeuwen, P.L.J.M.

    2012-01-01

    The protease inhibitor cystatin M/E (CST6) regulates a biochemical pathway involved in stratum corneum homeostasis, and its deficiency in mice causes ichthyosis and neonatal lethality. Cystatin M/E deficiency has not been described in humans so far, and we did not detect disease-causing mutations in

  5. Gemcitabine Plus Docetaxel Versus Docetaxel in Patients With Predominantly Human Epidermal Growth Factor Receptor 2-Negative Locally Advanced or Metastatic Breast Cancer: A Randomized, Phase III Study by the Danish Breast Cancer Cooperative Group

    DEFF Research Database (Denmark)

    Nielsen, Dorte L; Bjerre, Karsten D; Jakobsen, Erik H;

    2011-01-01

    PURPOSE The objective of this phase III study was to compare the efficacy of gemcitabine plus docetaxel (GD) versus docetaxel in patients with advanced breast cancer. PATIENTS AND METHODS Predominantly human epidermal growth factor receptor 2 (HER2) -negative patients were randomly assigned to ge...... GD compared with docetaxel demonstrated increased TTP in metastatic breast cancer. However, RR and OS were similar. Thus, the addition of gemcitabine failed to demonstrate any clinically meaningful benefit when combined with docetaxel....

  6. An Absence of Nuclear Lamins in Keratinocytes Leads to Ichthyosis, Defective Epidermal Barrier Function, and Intrusion of Nuclear Membranes and Endoplasmic Reticulum into the Nuclear Chromatin

    Science.gov (United States)

    Jung, Hea-Jin; Tatar, Angelica; Tu, Yiping; Nobumori, Chika; Yang, Shao H.; Goulbourne, Chris N.; Herrmann, Harald

    2014-01-01

    B-type lamins (lamins B1 and B2) have been considered to be essential for many crucial functions in the cell nucleus (e.g., DNA replication and mitotic spindle formation). However, this view has been challenged by the observation that an absence of both B-type lamins in keratinocytes had no effect on cell proliferation or the development of skin and hair. The latter findings raised the possibility that the functions of B-type lamins are subserved by lamins A and C. To explore that idea, we created mice lacking all nuclear lamins in keratinocytes. Those mice developed ichthyosis and a skin barrier defect, which led to death from dehydration within a few days after birth. Microscopy of nuclear-lamin-deficient skin revealed hyperkeratosis and a disordered stratum corneum with an accumulation of neutral lipid droplets; however, BrdU incorporation into keratinocytes was normal. Skin grafting experiments confirmed the stratum corneum abnormalities and normal BrdU uptake. Interestingly, the absence of nuclear lamins in keratinocytes resulted in an interspersion of nuclear/endoplasmic reticulum membranes with the chromatin. Thus, a key function of the nuclear lamina is to serve as a “fence” and prevent the incursion of cytoplasmic organelles into the nuclear chromatin. PMID:25312645

  7. AUTOIMMUNE EPIDERMAL BLISTERING DISEASES

    Directory of Open Access Journals (Sweden)

    Ana Maria Abreu Velez

    2013-11-01

    Full Text Available Autoimmune bullous skin diseases (ABDs are uncommon, potentially fatal diseases of skin and mucous membranes which are associated with deposits of autoantibodies and complement against distinct molecules of the epidermis and dermal/epidermal basement membrane zone (BMZ. These autoantibodies lead to a loss in skin molecular integrity, which manifests clinically as formation of blisters or erosions. In pemphigus vulgaris, loss of adhesion occurs within the epidermis. The pioneering work of Ernst H. Beutner, Ph.D. and Robert E. Jordon, M.D. confirmed the autoimmune nature of these diseases. Walter F. Lever, M.D. contributed significantly to our understanding of the histopathologic features of these diseases. Walter Lever, M.D. and Ken Hashimoto, M.D. contributed electron microscopic studies of these diseases, especially in pemphigus vulgaris and bullous pemphigoid. In bullous pemphigoid (BP, linear IgA bullous dermatosis, epidermolysis bullosa acquisita (EBA and dermatitis herpetiformis (DH, loss of adhesion takes place within or underneath the BMZ. Classic EBA demonstrates extensive skin fragility; DH is commonly associated with gluten-sensitive enteropathy, and manifests clinically with pruritic papulovesicles on the extensor surfaces of the extremities and the lumbosacral area. The clinical spectrum of bullous pemphigoid includes tense blisters, urticarial plaques, and prurigo-like eczematous lesions. Pemphigoid gestationis mostly occurs during the last trimester of pregnancy, and mucous membrane pemphigoid primarily involves the oral mucosa and conjunctivae and leads to scarring. Linear IgA bullous dermatosis manifests with tense blisters in a „cluster of jewels”-like pattern in childhood (chronic bullous disease of childhood and is more clinically heterogeneous in adulthood. Many of the autoantigens in these disorders are known and have been well characterized. ABDs may be influenced by both genetic and exogenous factors. The diagnoses of

  8. Filaggrin and the great epidermal barrier grief.

    Science.gov (United States)

    McGrath, John A

    2008-05-01

    One of the principal functions of human skin is to form an effective mechanical barrier against the external environment. This involves the maturation and death of epidermal keratinocytes as well as the assembly of a complex network of differentially and spatially expressed proteins, glycoproteins and lipids into the keratinocyte cell membrane and surrounding extracellular space. In 2006, the key role of the granular cell layer protein filaggrin (filament-aggregating protein) in maintaining the skin barrier was determined with the identification of loss-of-function mutations in the profilaggrin gene (FLG). These mutations have been shown to be the cause of ichthyosis vulgaris and a major risk factor for the development of atopic dermatitis, asthma associated with atopic dermatitis as well as systemic allergies. Mutations in the FLG gene are extremely common, occurring in approximately 9% of individuals from European populations. The remarkable discovery of these widespread mutations is expected to have a major impact on the classification and management of many patients with ichthyosis and atopic disease. It is also hoped that the genetic discovery of FLG mutations will lead to the future development of more specific, non-immunosuppressive treatments capable of restoring effective skin barrier function and alleviating or preventing disease in susceptible individuals.

  9. A variety of human monoclonal antibodies against epidermal growth factor receptor isolated from a phage antibody library.

    Science.gov (United States)

    Kurosawa, Gene; Kondo, Mariko; Kurosawa, Yoshikazu

    2016-11-04

    When the technology for constructing human antibody (Ab) libraries using a phage-display system was developed, many researchers in Ab-related fields anticipated that it would be widely applied to the development of pharmaceutical drugs against various diseases, including cancers. However, successful examples of such applications are very limited. Moreover, researchers who utilize phage-display technology now show divergent ways of thinking about phage Ab libraries. For example, there is debate about what should be the source of VH and VL genes for the construction of libraries to cover the whole repertoire of Abs present in the human body. In the immune system, the introduction of mutations into V genes followed by selection based on binding activity, termed Ab maturation, is required for the production of Abs exhibiting high affinity to the antigen (Ag). Therefore, introduction of mutations and selection are required for isolation of Abs with high affinity after isolation of clones from phage Ab libraries. We constructed a large human Ab library termed AIMS, developed a screening method termed ICOS, and succeeded in isolating many human monoclonal Abs (mAbs) that specifically and strongly bind to various tumor-associated Ags. Eight anti-EGFR mAbs were included, which we characterized. These mAbs showed various different activities against EGFR-expressing cancer cells. In this paper, we describe these data and discuss the possibility and necessity that the mAbs isolated from the AIMS library might be developed as therapeutic drugs against cancers without introduction of mutations. Copyright © 2016 The Authors. Published by Elsevier Inc. All rights reserved.

  10. Development of a Bioengineered Skin-Humanized Mouse Model for Psoriasis : Dissecting Epidermal-Lymphocyte Interacting Pathways

    OpenAIRE

    Guerrero-Aspizua, Sara; García, Marta; Murillas, Rodolfo; Retamosa, Luisa; Illera, Nuria; Duarte, Blanca; Holguín, Almudena; Puig, Susana; Hernández, Maria Isabel; Meana, Alvaro; Jorcano, Jose Luis; Larcher, Fernando; Carretero, Marta; del Río, Marcela

    2010-01-01

    Over the past few years, whole skin xenotransplantation models that mimic different aspects of psoriasis have become available. However, these models are strongly constrained by the lack of skin donor availability and homogeneity. We present in this study a bioengineering-based skin-humanized mouse model for psoriasis, either in an autologous version using samples derived from psoriatic patients or, more importantly, in an allogeneic context, starting from skin biopsies and blood samples from...

  11. Pattern of hormone receptors and human epidermal growth factor receptor 2 status in sub-Saharan breast cancer cases: Private practice experience.

    Science.gov (United States)

    Nwafor, C C; Keshinro, S O

    2015-01-01

    Breast cancer is the most common cancer among women globally. With immunohistochemistry (IHC), breast cancer is classified into four groups based on IHC profile of estrogen receptor (ER)/progesterone receptor (PR) and human epidermal growth factor receptor 2 (HER2/neu) expression, positive (+) and/or negative (-). The IHC classification correlates well with intrinsic gene expression microarray categorization. ER-positive tumors may benefit from being treated with selective ER modulators and aromatase inhibitors, whereas patients with HER2/neu positive tumors have been shown to experience a significant survival advantage when treated with humanized monoclonal antibodies against HER2/neu. To determine ER/PR, HER2/neu expression and their association with histological prognostic markers in female breast carcinomas seen in a private diagnostic laboratory based in Lagos. Immunohistochemistry reports of breast cancer patients, which were diagnosed by histopathology section of a private diagnostic laboratory based in Lagos, Nigeria from August 2009 to August 2014. About 18.7% of breast cancers had IHC (ER, PR and HER2) done on them and were all females. The mean age of all subjects was 49.5 years (standard deviation, 13.2; range, 29-78 years). Most (95.8%) of the breast cancers were of invasive ductal carcinoma type, with 77.4% of them been >5 cm. IHC pattern was as follows: ER/PR+, HER2-=19 (39.6%), ER/PR-, HER2- (triple negative [TN])=14 (29.2%), ER/PR+, HER2+=9 (18.8%), ER/PR-, HER2+=6 (12.5%), corresponding to Lumina A, TN/basal-like, Lumina B and HER2 over expressed respectively. Triple negative breast cancers are common in our environment and affect young females most and could be contributory to the poorer prognosis of breast cancer in our environment.

  12. [Study on the regular pattern of the distribution of skin epidermal stem cells in the different parts of a healthy human body].

    Science.gov (United States)

    Chen, Xiao-dong; Li, Tian-zeng; Qi, Shao-hai; Xie, Ju-lin; Xu, Ying-bin; Pan, Shu; Yuan, Ji-Shan; Zhang, Tao; Liang, Hui-zhen

    2006-02-01

    To investigate the regular pattern of the distribution of skin epidermal stem cells (ESCs) in the different parts of a healthy human body, and to evaluate the feasibility of the identification of ESCs by P63 and CD29 with single and double labeling. Full-thickness skin samples from 21 parts (including scalp, dorsum of foot, sole of foot, pubic region, and scrotum) of 5 healthy persons were harvested for the study. Immunohistochemistry method with biotin-streptavidin-horseradish peroxidase (SP) was employed with P63 and CD29 as the first antibody to carry out single and double labeling. The staining results were subjected to image analysis. The distribution of the ESCs in the skin from the above parts was observed and expressed as positive unit (PU) value. It was found by P63 single labeling and P63 and CD29 double labeling that the PU value in the dorsum of foot was the lowest while that in the scalp was the highest among all the parts of a healthy body. It was also found by CD29 single labeling that the PU value in the dorsum of foot was the lowest [(11.9 +/- 1.5)%] while highest in the scalp [(29.1 +/- 5.0)%]. The PU value in the hairy region of a human body was evidently higher than that in the non-hairy region (P 0.05). There are more ESCs in the skin from the scalp, mons pubis and scrotum than other parts of the body. Single P63 or CD29 labeling exhibits higher sensitivity but lower specificity in the identification of ESCs. While the double labeling method exhibits higher specificity but lower sensitivity. Above all, it seems that the double labeling may be a simple and effective method for the identification of ESCs.

  13. Comparative study of the effects of recombinant human epidermal growth factor and basic fibroblast growth factor on corneal epithelial wound healing and neovascularization in vivo and in vitro.

    Science.gov (United States)

    Yan, Limeng; Wu, Wei; Wang, Zhichong; Li, Chaoyang; Lu, Xiaohe; Duan, Hucheng; Zhou, Jin; Wang, Xiaoran; Wan, Pengxia; Song, Yiyue; Tang, Jing; Han, Yu

    2013-01-01

    This study was undertaken to investigate the effects of recombinant human epidermal growth factor (rhEGF) and basic fibroblast growth factor (bFGF) on corneal wound healing and neovascularization (CNV). The positive effects of 10 ng/ml rhEGF and bFGF on the proliferation of corneal epithelial cells (SD-HCEC1s), rabbit keratocyte cells (RKCs) and human umbilical vein endothelial cells (HUVECs) as well as the effects on the migration capacity on HUVECs were observed. An animal central corneal wound and CNV model was established in rabbits. One eye of each group was chosen randomly for topical administration of rhEGF, bFGF or normal saline, and variability in the area of corneal epithelial wound healing and CNV was observed. The optimal concentration of rhEGF and bFGF for the proliferation of corneal epithelial cells was 10 ng/ml. The promotive effect of 10 ng/ml rhEGF on the proliferation of RKCs and HUVECs was less than that of 10 ng/ml bFGF. In the animal experiment, the healing rate of the corneal epithelium in the rhEGF group was better than in the other groups on day 1. On day 3, the healing rates of the 3 groups were nearly equal. The CNV area in the rhEGF group was less than that of the bFGF group. rhEGF and bFGF both had promotive effects on corneal epithelial wound healing, but rhEGF had a weaker promotive effect on CNV than bFGF. With long-term application of growth factor drugs, rhEGF is suggested for lessening the growth of CNV. Copyright © 2012 S. Karger AG, Basel.

  14. Pigmentation and dermal conservative effects of the astonishing algae Sargassum polycystum and Padina tenuis on guinea pigs, human epidermal melanocytes (HEM) and Chang cells.

    Science.gov (United States)

    Quah, Chin Chew; Kim, Kah Hwi; Lau, Mei Siu; Kim, Wee Ric; Cheah, Swee Hung; Gundamaraju, Rohit

    2014-01-01

    The preference for a fairer skin-tone has become a common trend among both men and women around the world. In this study, seaweeds Sargassum polycystum and Padina tenuis were investigated for their in vitro and in vivo potentials in working as skin whitening agents. Seaweed has been used as a revolutionary skin repairing agent in both traditional and modern preparations. The high antioxidant content is one of the prime reasons for its potent action. It has been employed in traditional Chinese and Japanese medicine. For centuries, most medical practitioners in the Asian cultures have known seaweed as an organic source of vitamins, minerals, fatty acids like omega-3 and omega-6 and antioxidants. The present objective of the study was to evaluate the potent dermal protective effect of the two seaweeds Sargassum polycystum and Padina tenuis on human cell lines and guinea pigs. Seaweeds were extracted with ethanol and further fractionated with hexane, ethyl acetate and water. The extracts were tested for mushroom tyrosinase inhibitory activity, cytotoxicity in human epidermal melanocyte (HEM), and Chang cells. Extracts with potent melanocytotoxicity were formulated into cosmetic cream and tested on guinea pigs in dermal irritation tests and de-pigmentation assessments. Both Sargassum polycystum and Padina tenuis seaweeds showed significant inhibitory effect on mushroom tyrosinase in the concentration tested. SPEt showed most potent cytotoxicity on HEM (IC50 of 36µg/ml), followed by SPHF (65µg/ml), and PTHF (78.5µg/ml). SPHF and SPEt reduced melanin content in skin of guinea pigs when assessed histologically. SPEt, SPHF and PTHF were able to inhibit HEM proliferation in vitro, with SPHF being most potent and did not cause any dermal irritation in guinea pigs. The results obtained indicate that SPHF is a promising pharmacological or cosmetic agent.

  15. Epidermal nevus syndromes.

    Science.gov (United States)

    Asch, Sarah; Sugarman, Jeffrey L

    2015-01-01

    The term epidermal nevus syndrome (ENS) has been used to describe the association of epidermal hamartomas and extracutaneous abnormalities. Although many continue to use the term "ENS," it is now understood that this is not one disease, but rather a heterogeneous group with distinct genetic profiles defined by a common cutaneous phenotype: the presence of epidermal and adnexal hamartomas that are associated with other organ system involvement. One commonality is that epidermal nevi often follow the lines of Blaschko and it appears the more widespread the cutaneous manifestations, the greater the risk for extracutaneous manifestations. The majority of the extracutaneous manifestations involve the brain, eye, and skeletal systems. The CNS involvement is wide ranging and involves both clinical manifestations such as intellectual disability and seizures, as well as structural anomalies. Several subsets of ENS with characteristic features have been delineated including the nevus sebaceus syndrome, Proteus syndrome, CHILD syndrome, Becker's nevus syndrome, nevus comedonicus syndrome, and phakomatosis pigmentokeratotica. Advances in molecular biology have revealed that the manifestations of ENS are due to genomic mosaicism. It is likely that the varied clinical manifestations of ENS are due in great part to the functional effects of specific genetic defects. Optimal management of the patient with ENS involves an interdisciplinary approach given the potential for multisystem involvement. Of note, epidermal nevi have been associated with both benign and malignant neoplasms, and thus ongoing clinical follow-up is required.

  16. Epidermal nevus syndrome.

    Science.gov (United States)

    Laura, Flores-Sarnat

    2013-01-01

    Epidermal nevus syndrome (ENS) is an inclusive term for a heterogeneous group of congenital disorders characterized by the presence of epidermal nevi associated with systemic involvement. These disorders, as are all primary neurocutaneous syndromes, are neurocristopathies. The epidermal nevi that follow the lines of Blaschko and most systemic anomalies in skeletal, ocular, cardiovascular, endocrine, and orodental tissues, as well as lipomas, are due to defective neural crest. The most important and frequent anomaly in the brain in all forms of epidermal nevus syndromes (ENSs) is hemimegalencephaly (HME). This malformation often is not recognized, despite being the principal cause of neurological manifestations in ENSs. They consist mainly of epilepsy and developmental delay or intellectual disability. The onset of epilepsy in ENS usually is in early infancy, often as infantile spasms. Several syndromic forms have been delineated. I propose the term "Heide's syndrome" for those distinctive cases with the typical triad of hemifacial epidermal nevus, ipsilateral facial lipoma, and hemimegalencephaly. Most ENSs are sporadic. The mechanism is thought to be genetic mosaicism with a lethal autosomal dominant gene. Specific genetic mutations (PTEN, FGFR3, PIK3CA, and AKT1) have been documented in some patients. The large number of contributors for over more than a century and a half to the description of these disorders precludes the use of new author eponyms.

  17. Upregulated epidermal growth factor receptor expression following near-infrared irradiation simulating solar radiation in a three-dimensional reconstructed human corneal epithelial tissue culture model

    Directory of Open Access Journals (Sweden)

    Tanaka Y

    2016-08-01

    Full Text Available Yohei Tanaka,1,2 Jun Nakayama2 1Department of Plastic Surgery, Clinica Tanaka Plastic, Reconstructive Surgery and Anti-aging Center, 2Department of Molecular Pathology, Shinshu University Graduate School of Medicine, Matsumoto, Nagano, Japan Background and objective: Humans are increasingly exposed to near-infrared (NIR radiation from both natural (eg, solar and artificial (eg, electrical appliances sources. Although the biological effects of sun and ultraviolet (UV exposure have been extensively investigated, the biological effect of NIR radiation is still unclear. We previously reported that NIR as well as UV induces photoaging and standard UV-blocking materials, such as sunglasses, do not sufficiently block NIR. The objective of this study was to investigate changes in gene expression in three-dimensional reconstructed corneal epithelial tissue culture exposed to broad-spectrum NIR irradiation to simulate solar NIR radiation that reaches human tissues.Materials and methods: DNA microarray and quantitative real-time polymerase chain reaction analysis were used to assess gene expression levels in a three-dimensional reconstructed corneal epithelial model composed of normal human corneal epithelial cells exposed to water-filtered broad-spectrum NIR irradiation with a contact cooling (20°C. The water-filter allowed 1,000–1,800 nm wavelengths and excluded 1,400–1,500 nm wavelengths.Results: A DNA microarray with >62,000 different probes showed 25 and 150 genes that were up- or downregulated by at least fourfold and twofold, respectively, after NIR irradiation. In particular, epidermal growth factor receptor (EGFR was upregulated by 19.4-fold relative to control cells. Quantitative real-time polymerase chain reaction analysis revealed that two variants of EGFR in human corneal epithelial tissue were also significantly upregulated after five rounds of 10 J/cm2 irradiation (P<0.05.Conclusion: We found that NIR irradiation induced the

  18. Concurrent Autophagy Inhibition Overcomes the Resistance of Epidermal Growth Factor Receptor Tyrosine Kinase Inhibitors in Human Bladder Cancer Cells

    Directory of Open Access Journals (Sweden)

    Minyong Kang

    2017-02-01

    Full Text Available Despite the potential therapeutic efficacy of epithelial growth factor receptor (EGFR inhibitors in the treatment of advanced stage bladder cancer, there currently is no clear evidence to support this hypothesis. In this study, we investigate whether the concurrent treatment of autophagy-blocking agents with EGFR inhibitors exerts synergistic anti-cancer effects in T24 and J82 human bladder cancer cells. Lapatinib and gefitinib were used as EGFR inhibitors, and bafilomycin A1 (BFA1, chloroquine (CQ and 3-methyladenine (3-MA were used as the pharmacologic inhibitors of autophagy activities. To assess the proliferative and self-renewal capabilities, the Cell Counting Kit-8 (CCK-8 assay and a clonogenic assay were performed, respectively. To examine apoptotic cell death, flow cytometry using annexin-V/propidium iodide (PI was used. To measure the autophagy activities, the expression levels of LC3I and II was determined by Western blot analysis. To validate the synergistic effects of autophagy inhibition with EGFR inhibitors, we specifically blocked key autophagy regulatory gene ATG12 by transfection of small interference RNA and examined the phenotypic changes. Of note, lapatinib and gefitinib triggered autophagy activities in T24 and J82 human bladder cancer cells, as indicated by upregulation of LC3II. More importantly, inhibiting autophagy activities with pharmacologic inhibitors (BFA1, CQ or 3-MA remarkably reduced the cell viabilities and clonal proliferation of T24 and J82 cells, compared to those treated with either of the agents alone. We also obtained similar results of the enhanced anti-cancer effects of EGFR inhibitors by suppressing the expression of ATG12. Notably, the apoptotic assay showed that synergistic anti-cancer effects were induced via the increase of apoptotic cell death. In summary, concomitant inhibition of autophagy activities potentiated the anti-cancer effects of EGFR inhibitors in human bladder cancer cells, indicating

  19. Affinity Maturation of an Epidermal Growth Factor Receptor Targeting Human Monoclonal Antibody ER414 by CDR Mutation

    OpenAIRE

    2012-01-01

    It is well established that blocking the interaction of EGFR with growth factors leads to the arrest of tumor growth, resulting in tumor cell death. ER414 is a human monoclonal antibody (mAb) derived by guided selection of the mouse mAb A13. The ER414 exhibited a ~17-fold lower affinity and, as a result, lower efficacy of inhibition of the EGF-mediated tyrosine phosphorylation of EGFR when compared with mAb A13 and cetuximab. We performed a stepwise in vitro affinity maturation to improve the...

  20. EXPRESSION OF EPIDERMAL GROWTH FACTOR, TRANSFORMING GROWTH FACTOR-a AND THEIR RECEPTOR IN HUMAN PITUITARY TUMORS

    Institute of Scientific and Technical Information of China (English)

    2001-01-01

    Objective: To explore the role of growth factor autocrine stimulation in the pathogenesis of human pituitary tumors. Methods: The expression of EGF, TGF-a and EGFR were studied by immunohisto-chemical method on paraffin-embedded sections of 30 cases pituitary tumor. Results: EGFR and its ligands EGF, TGF-a expressed in majority of pituitary tumors. The expression of EGFR and its ligands varied with cells' intensity, density and type. Conclusion: The EGF autocrine stimulating exerted in the pituitary tumor development process, that tyrosine kinases inhibitors may be useful for pituitary tumors treatment.

  1. Autologous nerve anastomosis versus human amniotic membrane anastomosis A rheological comparison following simulated sciatic nerve injury

    Institute of Scientific and Technical Information of China (English)

    Guangyao Liu; Qiao Zhang; Yan Jin; Zhongli Gao

    2011-01-01

    The sciatic nerve is biological viscoelastic solid, with stress relaxation and creep characteristics. In this study, a comparative analysis of the stress relaxation and creep characteristics of the sciatic nerve was conducted after simulating sciatic nerve injury and anastomosing with autologous nerve or human amniotic membrane. The results demonstrate that, at the 7 200-second time point, both stress reduction and strain increase in the human amniotic membrane anastomosis group were significantly greater than in the autologous nerve anastomosis group. Our findings indicate that human amniotic membrane anastomosis for sciatic nerve injury has excellent rheological characteristics and is conducive to regeneration of the injured nerve.

  2. Mechanistic effects of long-term ultraviolet B irradiation induce epidermal and dermal changes in human skin xenografts.

    Science.gov (United States)

    Hachiya, Akira; Sriwiriyanont, Penkanok; Fujimura, Tsutomu; Ohuchi, Atsushi; Kitahara, Takashi; Takema, Yoshinori; Kitzmiller, William J; Visscher, Marty O; Tsuboi, Ryoji; Boissy, Raymond E

    2009-02-01

    UVB irradiation has been reported to induce photoaging and suppress systemic immune function that could lead to photocarcinogenesis. However, because of the paucity of an UVB-induced photodamaged skin model, precise and temporal mechanism(s) underlying the deleterious effects of long-term UVB exposure on human skin have yet to be delineated. In this study, we established a model using human skin xenografted onto severe combined immunodeficient mice, which were subsequently challenged by repeated UVB irradiation for 6 weeks. Three-dimensional optical image analysis of skin replicas and noninvasive biophysical measurements illustrated a significant increase in skin surface roughness, similar to premature photoaging, and a significant loss of skin elasticity after long-term UVB exposure. Resembling authentically aged skin, UVB-exposed samples exhibited significant increases in epithelial keratins (K6, K16, K17), elastins, and matrix metalloproteinases (MMP-1, MMP-9, MMP-12) as well as degradation of collagens (I, IV, VII). The UVB-induced deterioration of fibrous keratin intermediate filaments was also observed in the stratum corneum. Additionally, similarities in gene expression patterns between our model and chronologically aged skin substantiated the plausible relationship between photodamage and chronological age. Furthermore, severe skin photodamage was observed when neutralizing antibodies against TIMP-1, an endogenous inhibitor of MMPs, were administered during the UVB exposure regimen. Taken together, these findings suggest that our skin xenograft model recapitulates premature photoaged skin and provides a comprehensive tool with which to assess the deleterious effects of UVB irradiation.

  3. Relationship of p53 Mutations to Epidermal Cell Proliferation and Apoptosis in Human UV-Induced Skin Carcinogenesis

    Directory of Open Access Journals (Sweden)

    Janine G. Einspahr

    1999-11-01

    Full Text Available Human skin is continually subjected to UV-irradiation with the p53 gene playing a pivotal role in repair of UV-induced DNA damage and apoptosis. Consequently, p53 alterations are early events in human UV-induced skin carcinogenesis. We studied 13 squamous cell carcinomas (SCC, 16 actinic keratoses (AK, 13 samples adjacent to an AK (chronically sun-damaged, and 14 normal-appearing skin samples for p53 mutation, p53 immunostaining (IHC, apoptosis (in situ TUNEL and morphology, and proliferation (PCNA. The frequency of p53 mutation increased from 14% in normal skin, to 38.5% in sun-damaged skin, 63% in AK, and 54% in SCC. p53 IHC increased similarly. Apoptosis (TUNEL increased from 0.06 ± 0.02%, to 0.1 ± 0.2, 0.3 ± 0.3, and 0.4 ± 0.3 in normal skin, sun-damaged skin, AK, and SCC, respectively. Apoptosis was strongly correlated with proliferation (i.e., TUNEL and PCNA, r = 0.7, P < 0.0001, and proliferation was significantly increased in the progression from normal skin to SCC. Bax was significantly increased in SCC compared to AK. These data imply that apoptosis in samples with a high frequency of p53 mutation may not necessarily be p53-dependent. We suggest that there is a mechanism for apoptosis in response to increased cellular proliferation that is p53-independent.

  4. Ginsenosides Rb1 and Rg1 Stimulate Melanogenesis in Human Epidermal Melanocytes via PKA/CREB/MITF Signaling

    Directory of Open Access Journals (Sweden)

    Mao Lin

    2014-01-01

    Full Text Available Reduced or defective melanin skin pigmentation may cause many hypopigmentation disorders and increase the risk of damage to the skin triggered by UV irradiation. Ginsenosides Rb1 and Rg1 have many molecular targets including the cAMP-response element-binding protein (CREB, which is involved in melanogenesis. This study aimed to investigate the effects of ginsenosides Rb1 and Rg1 on melanogenesis in human melanocytes and their related mechanisms. The effects of Rb1 and Rg1 on cell viability, tyrosinase activity, cellular melanin content and protein levels of tyrosinase, microphthalmia-associated transcription factor (MITF, and activation of CREB in melanocytes were assessed. Results showed that Rb1 or Rg1 significantly increased cellular melanin content and tyrosinase activity in a dose-dependent manner. By contrast, the cell viability of melanocytes remained unchanged. After exposure to Rb1 or Rg1, the protein levels of tyrosinase, MITF, and phosphorylated CREB were significantly increased. Furthermore, pretreatment with the selective PKA inhibitor H-89 significantly blocked the Rb1- or Rg1-induced increase of melanin content. These findings indicated that Rb1 and Rg1 increased melanogenesis and tyrosinase activity in human melanocytes, which was associated with activation of PKA/CREB/MITF signaling. The effects and mechanisms of Rb1 or Rg1 on skin pigmentation deserve further study.

  5. Clinical Experience: Using Dehydrated Human Amnion/Chorion Membrane Allografts for Acute and Reconstructive Burn Care.

    Science.gov (United States)

    Reilly, Debra Ann; Hickey, Sean; Glat, Paul; Lineaweaver, William C; Goverman, Jeremy

    2017-02-01

    Amniotic membrane is immunologically privileged and is a reservoir of growth factors and cytokines known to modulate inflammation and enhance the healing process, while also possessing antimicrobial, antifibrosis, and antiscarring properties. These properties establish a strong argument for using amniotic membrane derived products as a treatment for burns. The purpose of this article is to describe the use of commercially available dehydrated human amnion/chorion membrane allografts in patients with partial-thickness and full-thickness burns.

  6. Removal of Endotoxin from Human Serum Albumin Solutions by Hydrophobic and Cationic Charged Membrane

    Institute of Scientific and Technical Information of China (English)

    2000-01-01

    A novel matrix of macropore cellulose membrane was prepared by chemical graft, and immobilized the cationic charged groups as affinity ligands. The prepared membrane can be used for the removal of endotoxin from human serum albumin (HSA) solutions. With a cartridge of 20 sheets affinity membrane of 47 mm diameter, the endotoxin level in HSA solution can be reduced to 0.027 eu/mL. Recovery of HSA was over 95%.

  7. Cell membrane softening in human breast and cervical cancer cells

    Science.gov (United States)

    Händel, Chris; Schmidt, B. U. Sebastian; Schiller, Jürgen; Dietrich, Undine; Möhn, Till; Kießling, Tobias R.; Pawlizak, Steve; Fritsch, Anatol W.; Horn, Lars-Christian; Briest, Susanne; Höckel, Michael; Zink, Mareike; Käs, Josef A.

    2015-08-01

    Biomechanical properties are key to many cellular functions such as cell division and cell motility and thus are crucial in the development and understanding of several diseases, for instance cancer. The mechanics of the cellular cytoskeleton have been extensively characterized in cells and artificial systems. The rigidity of the plasma membrane, with the exception of red blood cells, is unknown and membrane rigidity measurements only exist for vesicles composed of a few synthetic lipids. In this study, thermal fluctuations of giant plasma membrane vesicles (GPMVs) directly derived from the plasma membranes of primary breast and cervical cells, as well as breast cell lines, are analyzed. Cell blebs or GPMVs were studied via thermal membrane fluctuations and mass spectrometry. It will be shown that cancer cell membranes are significantly softer than their non-malignant counterparts. This can be attributed to a loss of fluid raft forming lipids in malignant cells. These results indicate that the reduction of membrane rigidity promotes aggressive blebbing motion in invasive cancer cells.

  8. Expression of functional neurotransmitter receptors in Xenopus oocytes after injection of human brain membranes

    Science.gov (United States)

    Miledi, Ricardo; Eusebi, Fabrizio; Martínez-Torres, Ataúlfo; Palma, Eleonora; Trettel, Flavia

    2002-01-01

    The Xenopus oocyte is a very powerful tool for studies of the structure and function of membrane proteins, e.g., messenger RNA extracted from the brain and injected into oocytes leads to the synthesis and membrane incorporation of many types of functional receptors and ion channels, and membrane vesicles from Torpedo electroplaques injected into oocytes fuse with the oocyte membrane and cause the appearance of functional Torpedo acetylcholine receptors and Cl− channels. This approach was developed further to transplant already assembled neurotransmitter receptors from human brain cells to the plasma membrane of Xenopus oocytes. Membranes isolated from the temporal neocortex of a patient, operated for intractable epilepsy, were injected into oocytes and, within a few hours, the oocyte membrane acquired functional neurotransmitter receptors to γ-aminobutyric acid, α-amino-3-hydroxy-5-methyl-4-isoxazolepropionic acid, kainate, and glycine. These receptors were also expressed in the plasma membrane of oocytes injected with mRNA extracted from the temporal neocortex of the same patient. All of this makes the Xenopus oocyte a more useful model than it already is for studies of the structure and function of many human membrane proteins and opens the way to novel pathophysiological investigations of some human brain disorders. PMID:12237406

  9. Human antibody fragments specific for the epidermal growth factor receptor selected from large non-immunised phage display libraries.

    Science.gov (United States)

    Souriau, Christelle; Rothacker, Julie; Hoogenboom, Hennie R; Nice, Edouard

    2004-09-01

    Antibodies to EGFR have been shown to display anti-tumour effects mediated in part by inhibition of cellular proliferation and angiogenesis, and by enhancement of apoptosis. Humanised antibodies are preferred for clinical use to reduce complications with HAMA and HAHA responses frequently seen with murine and chimaeric antibodies. We have used depletion and subtractive selection strategies on cells expressing the EGFR to sample two large antibody fragment phage display libraries for the presence of human antibodies which are specific for the EGFR. Four Fab fragments and six scFv fragments were identified, with affinities of up to 2.2nM as determined by BIAcore analysis using global fitting of the binding curves to obtain the individual rate constants (ka and kd). This overall approach offers a generic screening method for the identification of growth factor specific antibodies and antibody fragments from large expression libraries and has potential for the rapid development of new therapeutic and diagnostic reagents.

  10. NBP, a zebrafish homolog of human Kank3, is a novel Numb interactor essential for epidermal integrity and neurulation.

    Science.gov (United States)

    Boggetti, Barbara; Jasik, Jan; Takamiya, Masanari; Strähle, Uwe; Reugels, Alexander M; Campos-Ortega, José A

    2012-05-01

    Numb is an adaptor protein implicated in diverse basic cellular processes. Using the yeast-two hybrid system we isolated a novel Numb interactor in zebrafish called NBP which is an ortholog of human renal tumor suppressor Kank. NBP interacts with the PTB domain of Numb through a region well conserved among vertebrate Kanks containing the NGGY sequence. Similar NBP and Numb morphant phenotype such as impaired convergence and extension movements during gastrulation, neurulation and epidermis defects and enhanced phenotypic aberrations in double morphants suggest that the genes interact genetically. We demonstrate that the expression of NBP undergoes quantitative and qualitative changes during embryogenesis and that the protein accumulates at the cell periphery to sites of cell-cell contact during gastrulation and later in development it concentrates at the basal poles of differentiated cells. These findings imply a possible role of NBP in establishing and maintaining cell adhesion and tissue integrity.

  11. Decellularized human Schneiderian membrane: electron microscopic study as a bioscaffold and preliminary cell seeding.

    Science.gov (United States)

    Rahpeyma, Amin; Khajehahmadi, Saeedeh; Khalife, Hussein H

    2014-12-01

    Perforation of maxillary sinus mucous membrane is one of the most prevalent complications during open sinus lift surgery. Moreover, such complication can usually be managed by an absorbable membrane. As far as absorbable membranes are concerned, decellularized maxillary sinus mucous membrane, which is an extracellular matrix, can be used as a biologic scaffold and an insulating membrane in sinus lifting surgery. The decellularization process of the maxillary sinus membrane was performed by means of physical and chemical procedures (liquid nitrogen and sodium dodecyl sulfate). Then this membrane was used as a bioscaffold for culturing with adult mesenchymal stem cells, which were derived from adipose tissue. Histologic evaluation of the decellularized scaffold revealed that cells of the Schneiderian membrane were compatibly removed via SDS 1%. Moreover, the scan with electron microscope (S6N - Leo vp1450, Germany) of the scaffold indicated that the collagen fibers of the decellularized maxillary sinus membrane were intact. Furthermore, the culture studies carried out showed that this scaffold supported cell seeding. The decellularized human maxillary Schneiderian membrane has a 3D structure similar to that of the extracellular matrix of human normal tissues. As a matter of fact, it can be used as a bioscaffold to support cell seeding. Copyright © 2014 Elsevier GmbH. All rights reserved.

  12. Inhibition of chemomigration of a human prostatic carcinoma cell (TSU-pr1) line by inhibition of epidermal growth factor receptor function.

    Science.gov (United States)

    Zolfaghari, A; Djakiew, D

    1996-04-01

    Chemoattractants expressed at bony sites and pelvic lymph nodes are thought to promote the preferential metastasis of human prostate tumor cells to these organs. Epidermal growth factor (EGF) is a potent chemoattractant for several human metastatic prostate tumor cell lines, including the TSU-pr1 cell line, and EGF has been localized to the stroma of both bony sites and pelvic lymph nodes in humans. Hence, we investigated whether the TSU-pr1 cell line expresses a functional EGF receptor (EGFR), which when antagonized reduces EGF-mediated chemomigration of this cell line. In this context, the EGFR immunoprecipitated from cell lysates of TSU-pr1 cells comigrated with the EGFR from A431 cells at a molecular weight of 170 kD. Addition of human EGF (hEGF) to the TSU-pr1 cells for 5 min stimulated the dose-dependent biphasic phosphorylation of the EGFR, with maximal stimulation of EGFR phosphorylation occurring at 2 ng/ml hEGF. In addition, treatment of hEGF-stimulated (2 ng/ml) TSU-pr1 cells with 0.5 microgram/ml anti-hEGF monoclonal antibody or 100 nM staurosporine inhibited EGFR phosphorylation. Conversely, as negative controls, treatment of hEGF-stimulated (2 ng/ml) TSU-pr1 cells with K252a or dimethyl sulfoxide (DMSO) vehicle did not inhibit EGFR phosphorylation. TSU-pr1 cells were stimulated to migration in 4 hr across Boyden chambers in response to 10 ng/ml hEGF. Treatment of the TSU-pr1 cells with anti-hEGFR monoclonal antibody inhibited in a dose-dependent manner the chemomigration of the TSU-pr1 cells across Boyden chambers. Similarly, treatment of the TSU-pr1 cells with staurosporine inhibited in a dose-dependent manner the chemomigration of the TSU-pr1 cells across Boyden chambers. These results demonstrate that antagonists of hEGF-mediated hEGFR phosphorylation also antagonize chemomigration of the TSU-pr1 cells across Boyden chambers, suggesting that antagonists of the EGFR in prostate cancer may be useful in the treatment of metastatic disease.

  13. Primary Adult Human Retinal Pigment Epithelial Cell Cultures on Human Amniotic Membranes

    Directory of Open Access Journals (Sweden)

    Singhal Shweta

    2005-01-01

    Full Text Available Purpose: Retinal pigment epithelial (RPE cells grow well on surfaces that provide an extracellular matrix. Our aim was to establish primary adult human RPE cell cultures that retain their epithelial morphology in vitro using human amniotic membrane (hAM as substrate. Materials and Methods: Human cadaver eyeballs (16 were obtained from the eye bank after corneal trephination. RPE cells were harvested by a mechanical dissection of the inner choroid surface (10, group 1 or by b enzymatic digestion using 0.25% Trypsin/0.02% EDTA (6, group 2. The cells were explanted onto de-epithelialized hAM, nourished using DMEM/HAMS F-12 media and monitored for growth under the phase contrast microscope. Cell cultures were characterised by whole mount studies and paraffin sections. Growth data in the two groups were compared using the students′ ′t′ test. Results: Eleven samples (68.75% showed positive cultures with small, hexagonal cells arising from around the explant which formed a confluent and progressively pigmented monolayer. Whole mounts showed closely placed polygonal cells with heavily pigmented cytoplasm and indistinct nuclei. The histologic sections showed monolayers of cuboidal epithelium with variable pigmentation within the cytoplasm. Growth was seen by day 6-23 (average 11.5 days in the mechanical group, significantly earlier ( P Conclusions: Primary adult human RPE cell cultures retain epithelial morphology in vitro when cultured on human amniotic membranes . Mechanical dissection of the inner choroid surface appears to be an effective method of isolating RPE cells and yields earlier growth in cultures as compared to isolation by enzymatic digestion

  14. Factors affecting disease-free survival in patients with human epidermal growth factor receptor 2-positive breast cancer who receive adjuvant trastuzumab

    Science.gov (United States)

    GÜNDÜZ, SEYDA; GÖKSU, SEMA SEZGIN; ARSLAN, DENIZ; TATLI, ALI MURAT; UYSAL, MÜKREMIN; GÜNDÜZ, UMUT RIZA; SEVINÇ, MERT MAHSUNI; COŞKUN, HASAN SENOL; BOZCUK, HAKAN; MUTLU, HASAN; SAVAS, BURHAN

    2015-01-01

    Breast cancer is the most frequently diagnosed cancer in women worldwide and the second cause of cancer-related mortality. A total of 20–30% of patients with early-stage breast cancer develop recurrence within the first 5 years following diagnosis. Trastuzumab significantly improves overall survival and disease-free survival (DFS) in women with human epidermal growth factor receptor 2 (HER2)-positive early and locally advanced breast cancer. This study aimed to determine the factors that affect DFS following adjuvant transtuzumab therapy. A total of 62 patients treated with trastuzumab for early and locally advanced breast cancer were included in our study. Data, including pathology, treatment and treatment outcome, rate of recurrence and laboratory tests, were retrospectively collected. There was no significant association between DFS and age, menopausal status, disease stage and hormone receptor status. The median follow-up was 48.4 months. The median DFS of patients treated with adjuvant trastuzumab was 64.1 months. In addition, the median DFS was 44.3 vs. 66.8 months in patients with platelet-lymphocyte ratio (PLR) ≤200 vs. >200, respectively (log-rank test; P=0.001), and 70 vs. 45 months in patients with eosinophil count ≤70 vs. >70×103/mm3 (log-rank test; P=0.001). Our data revealed the prognostic relevance of a decrease in the peripheral blood eosinophil count and PLR value following trastuzumab therapy in breast cancer. PLR and eosinophil count measurements are cost-effective, readily available worldwide, non-invasive and safe. Combined with other markers, such as patient age, tumor stage and tumor histology, may be effectively used for patients with breast cancer. PMID:26623060

  15. Short trains of intra-epidermal electrical stimulation to elicit reliable behavioral and electrophysiological responses to the selective activation of nociceptors in humans.

    Science.gov (United States)

    Mouraux, André; Marot, Emilie; Legrain, Valéry

    2014-02-21

    Currently, the study of nociception in humans relies mainly on thermal stimulation of heat-sensitive nociceptive afferents. To circumvent some limitations of thermal stimulation, it was proposed that intra-epidermal electrical stimulation (IES) could be used as an alternative method to activate nociceptors selectively. The selectivity of IES relies on the fact that it can generate a very focal electrical current and, thereby, activate nociceptive free nerve endings located in the epidermis without concomitantly activating non-nociceptive mechanoreceptors located more deeply in the dermis. However, an important limitation of IES is that it is selective for nociceptors only when very low current intensities are used. At these intensities, the stimulus generates a very weak percept, and the signal-to-noise ratio of the elicited evoked potentials (EPs) is very low. To circumvent this limitation, it was proposed that the strength of the nociceptive afferent volley could be increased through temporal summation, using short trains of repeated IES. Here, we characterized the intensity of perception and EPs elicited by trains of 2, 3 and 4 IES delivered using a 5-ms inter-stimulus interval. We found that both the intensity of perception and the magnitude of EPs significantly increased with the number of pulses. In contrast, the latency of the elicited EPs was not affected by the number of pulses, indicating that temporal summation did not affect the type of activated fibers and, therefore, that trains of IES can be used to increase the reliability of stimulus-evoked responses while still preserving its selectivity for nociceptors.

  16. Detection of Alpha-Toxin and Other Virulence Factors in Biofilms of Staphylococcus aureus on Polystyrene and a Human Epidermal Model

    Science.gov (United States)

    Lemmens-den Toom, N. A.; Willemse, J.; Koning, R. A.; Demmers, J. A. A.; Dekkers, D. H. W.; Rijkers, E.; El Ghalbzouri, A.; Nibbering, P. H.; van Wamel, W.

    2016-01-01

    Background & Aim The ability of Staphylococcus aureus to successfully colonize (a)biotic surfaces may be explained by biofilm formation and the actions of virulence factors. The aim of the present study was to establish the presence of 52 proteins, including virulence factors such as alpha-toxin, during biofilm formation of five different (methicillin resistant) S. aureus strains on Leiden human epidermal models (LEMs) and polystyrene surfaces (PS) using a competitive Luminex-based assay. Results All five S. aureus strains formed biofilms on PS, whereas only three out of five strains formed biofilms on LEMs. Out of the 52 tested proteins, six functionally diverse proteins (ClfB, glucosaminidase, IsdA, IsaA, SACOL0688 and nuclease) were detected in biofilms of all strains on both PS and LEMs. At the same time, four toxins (alpha-toxin, gamma-hemolysin B and leukocidins D and E), two immune modulators (formyl peptide receptor-like inhibitory protein and Staphylococcal superantigen-like protein 1), and two other proteins (lipase and LytM) were detectable in biofilms by all five S. aureus strains on LEMs, but not on PS. In contrast, fibronectin-binding protein B (FnbpB) was detectable in biofilms by all S. aureus biofilms on PS, but not on LEMs. These data were largely confirmed by the results from proteomic and transcriptomic analyses and in case of alpha-toxin additionally by GFP-reporter technology. Conclusion Functionally diverse virulence factors of (methicillin-resistant) S. aureus are present during biofilm formation on LEMs and PS. These results could aid in identifying novel targets for future treatment strategies against biofilm-associated infections. PMID:26741798

  17. Detection of Alpha-Toxin and Other Virulence Factors in Biofilms of Staphylococcus aureus on Polystyrene and a Human Epidermal Model.

    Directory of Open Access Journals (Sweden)

    P M den Reijer

    Full Text Available The ability of Staphylococcus aureus to successfully colonize (abiotic surfaces may be explained by biofilm formation and the actions of virulence factors. The aim of the present study was to establish the presence of 52 proteins, including virulence factors such as alpha-toxin, during biofilm formation of five different (methicillin resistant S. aureus strains on Leiden human epidermal models (LEMs and polystyrene surfaces (PS using a competitive Luminex-based assay.All five S. aureus strains formed biofilms on PS, whereas only three out of five strains formed biofilms on LEMs. Out of the 52 tested proteins, six functionally diverse proteins (ClfB, glucosaminidase, IsdA, IsaA, SACOL0688 and nuclease were detected in biofilms of all strains on both PS and LEMs. At the same time, four toxins (alpha-toxin, gamma-hemolysin B and leukocidins D and E, two immune modulators (formyl peptide receptor-like inhibitory protein and Staphylococcal superantigen-like protein 1, and two other proteins (lipase and LytM were detectable in biofilms by all five S. aureus strains on LEMs, but not on PS. In contrast, fibronectin-binding protein B (FnbpB was detectable in biofilms by all S. aureus biofilms on PS, but not on LEMs. These data were largely confirmed by the results from proteomic and transcriptomic analyses and in case of alpha-toxin additionally by GFP-reporter technology.Functionally diverse virulence factors of (methicillin-resistant S. aureus are present during biofilm formation on LEMs and PS. These results could aid in identifying novel targets for future treatment strategies against biofilm-associated infections.

  18. Cyclooxygenase-2 and human epidermal growth factor receptor type 2 (HER-2 expression simultaneously in invasive and in situ breast ductal carcinoma

    Directory of Open Access Journals (Sweden)

    Adrienne Pratti Lucarelli

    Full Text Available CONTEXT AND OBJECTIVE: Cyclooxygenase-2 (COX-2 and human epidermal growth factor receptor type 2 (HER-2 are associated with tumorigenesis. Studies have shown that HER-2 can regulate COX-2 expression. The aim of this study was to evaluate the correlation between COX-2 and HER-2 expression in normal breast epithelium and in ductal carcinoma in situ (DCIS and invasive ductal carcinoma (IDC present in the same breast. DESIGN AND SETTING: Cross-sectional study at the Mastology Unit of the Department of Gynecology and Obstetrics, Santa Casa de Misericórdia de São Paulo Hospital. METHODS: COX-2 and HER-2 were detected using immunohistochemistry on 100 tissue fragments. HER-2 > +2 was subjected to fluorescence in situ hybridization (FISH. RESULTS: COX-2 expression was detected in 87%, 85% and 75% of IDC, DCIS and normal epithelium, respectively. HER-2 expression was detected in 34% of IDC and 34% of DCIS. COX-2 in DCIS correlated with HER-2 in IDC (P = 0.049 and DCIS (P = 0.049. COX-2 in normal epithelium correlated with HER-2 in IDC (P = 0.046 and DCIS (P = 0.046. COX-2 in IDC was not associated with HER-2 (P = 0.235. Comparison between COX-2 and HER-2 in DCIS showed that there was a statistically significant difference with regard to nuclear grades II and III and presence of comedonecrosis (P < 0.001. In IDC, there was significant expression with nuclear grades II and III and histological grade II (P < 0.001. CONCLUSIONS: Our findings provide evidence that HER-2 and COX-2 regulate each other

  19. Human epidermal growth factor receptor type 2 protein expression in Chinese metastatic prostate cancer patients correlates with cancer specific survival and increases after exposure to hormonal therapy

    Institute of Scientific and Technical Information of China (English)

    Bo Dai; Yun-Yi Kong; Ding-Wei Ye; Chun-Guang Ma; Xiao-Yan Zhou; Xu-Dong Yao

    2008-01-01

    Aim: To investigate human epidermal growth factor receptor type 2 (HER2) protein expression and gene amplification in Chinese metastatic prostate cancer patients and their potential value as prognostic factors. Methods: Immuno-histochemistry (IHC) was performed to investigate HER2 protein expression in prostate biopsy specimens from 104 Chinese metastatic prostate cancer patients. After 3-11 months of hormonal therapy, 12 patients underwent transure- thral resection of the prostate (TURP). HER2 protein expression of TURP specimens was compared with that of the original biopsy specimens. Of these, 10 biopsy and 4 TURP specimens with HER2 IHC staining scores ≥ 2+ were investigated for HER2 gene amplification status by fluorescent in situ hybridization (FISH). Results: Of the 104 prostate biopsy specimens, HER2 protein expression was 0, 1+, 2+ and 3+ in 49 (47.1%), 45 (43.3%), 8 (7.7%) and 2 (1.9%) cases, respectively. There was a significant association between HER2 expression and Gleason score (P = 0.026). HER2 protein expression of prostate cancer tissues increased in 33.3% of patients after hormonal therapy. None of the 14 specimens with HER2 IHC scores > 2+ showed HER2 gene amplification. Patients with HER2 scores ≥ 2+ had a significantly higher chance of dying from prostate cancer than those with HER2 scores of 0 (P = 0.004) and 1+ (P = 0.034). Multivariate Cox regression analysis showed that HER2 protein expression intensity was an independent predictor of cancer-related death (P = 0.039). Conclusion: An HER2 IHC score ≥ 2+ should be defined as HER2 protein overexpression in prostate cancer. Overexpression of HER2 protein in cancer tissue might suggest an increased risk of dying from prostate cancer. HER2 protein expression increases in some individual patients after hormonal therapy.

  20. Human Epidermal Growth Factor Receptor-3 mRNA Expression as a Prognostic Marker for Invasive Duct Carcinoma not Otherwise Specified

    Science.gov (United States)

    Hammoda, Ghada Ezat; El-Hefnawy, Sally Mohammed; Abdallah, Rania Abdallah

    2017-01-01

    Introduction Breast cancer is the most common cancer in women and the Erythroblastosis Oncogene B(ErbB) receptor family holds crucial role in its pathogenesis. Human Epidermal Growth Factor Receptor 3 (HER-3) gene over expression in breast tissue has been associated with aggressive clinical behaviour and bad prognosis. Aim To evaluate HER-3 mRNA expression level as a prognostic marker for breast cancer and to correlate its level with other established prognostic parameters. Materials and Methods This study was carried out on specimens of 100 cases that were divided into 40 patients presented with fibroadenoma and 60 patients presented with Invasive Ductal Carcinoma (IDC) not otherwise specified and underwent modified radical mastectomy. All specimens were investigated for HER-2/neu, ER and PR expression by Immunohistochemistry (IHC) and quantitative assay of HER-3 mRNA expression using real time PCR technique. Results There was a significant high HER3 mRNA level in carcinoma cases compared to fibroadenoma. In malignant cases, HER3 mRNA level was significantly associated with advanced T stage, advanced N stage, number of positive lymph nodes, large tumour size and cases associated with an adjacent in situ component. Moreover, HER-3 mRNA level was of highest values in Her-2/neu positive group followed by triple negative cases with the lowest level in luminal group (p<0.05). Conclusion HER-3 gene is upregulated in IDC especially those carrying poor prognostic features. HER-3 mRNA level may identify a subset of patients with a poor prognosis, and who could undergo further evaluation for the efficacy of HER3 targeted anticancer therapy. PMID:28384967

  1. Filaggrin silencing by shRNA directly impairs the skin barrier function of normal human epidermal keratinocytes and then induces an immune response

    Energy Technology Data Exchange (ETDEWEB)

    Dang, N.N. [Department of Dermatology, Jinan Central Hospital Affiliated to Shandong University, Jinan, Shandong Province (China); College of Life Science, Shandong Normal University, Jinan, Shandong Province (China); Pang, S.G. [Department of Endocrinology, Jinan Central Hospital Affiliated to Shandong University, Jinan, Shandong Province (China); Song, H.Y. [Department of Dermatology, Jinan Central Hospital Affiliated to Shandong University, Jinan, Shandong Province (China); An, L.G. [College of Life Science, Shandong Normal University, Jinan, Shandong Province (China); Ma, X.L. [Central Laboratory, Jinan Central Hospital Affiliated to Shandong University, Jinan, Shandong Province (China)

    2014-11-14

    The objective of this study was to investigate whether a single defect in skin barrier function simulated by filaggrin silencing could induce Th2-predominant inflammation. Filaggrin gene expression was silenced in cultured normal human epidermal keratinocytes (NHEKs) using small hairpin RNA (shRNA, GTTGGCTCAAGCATATTATTT). The efficacy of silencing was confirmed by polymerase chain reaction (PCR) and Western blotting. Filaggrin-silenced cells (LV group), shRNA control cells (NC group), and noninfected cells (Blank group) were evaluated. The expression of cornified cell envelope-related proteins, including cytokeratin (CK)-5, -10, -14, loricrin, involucrin, and transglutaminase (TGM)-1, was detected by Western blotting. Interleukins (IL)-2, IL-4, IL-5, IL-12p70, IL-13, and interferon-gamma (IFN-γ) were detected by enzyme-linked immunosorbent assay (ELISA). After filaggrin was successfully silenced by shRNA, the expressions of CK-5, -10, -14, involucrin, and TGM-1 in NHEKs were significantly downregulated compared to the Blank and NC groups (P<0.05 or P<0.01); only loricrin expression was markedly upregulated (P<0.01). Filaggrin silencing also resulted in significant increases of IL-2, IL-4, IL-5, and IL-13 (P<0.05 or P<0.01), and significant decreases of IL-12p70 and IFN-γ (P<0.01) compared with cells in the Blank and NC groups. Filaggrin silencing impaired normal skin barrier function mainly by targeting the cornified cell envelope. The immune response after filaggrin silencing was characterized by Th2 cells, mainly because of the inhibition of IFN-γ expression. Lack of filaggrin may directly impair skin barrier function and then further induce the immune response.

  2. Soluble Human Epidermal Growth Factor Receptor 2 (sHER2 as a Potential Risk Assessment, Screening, and Diagnostic Biomarker of Lung Adenocarcinoma

    Directory of Open Access Journals (Sweden)

    Andre T. Baron

    2013-01-01

    Full Text Available Lung cancer is the leading cause of cancer-related death in the United States. Here, we evaluated the potential clinical utility of soluble human epidermal growth factor receptor 2 (sHER2 for the risk assessment, screening, and diagnosis of non-small cell lung cancer (NSCLC using an unmatched case-control study design. Serum sHER2 concentrations were measured by immunoassay in 244 primary NSCLC cases and 218 healthy controls. Wilcoxon rank-sum tests, logistic regression models, and receiver operating characteristic plots were used to assess whether sHER2 is associated with lung cancer. Median serum sHER2 concentrations are higher in patients with adenocarcinoma than squamous cell carcinoma regardless of gender, and sHER2 is a weak, independent biomarker of adenocarcinoma, but not of squamous cell carcinoma, adjusted for age and gender. The age-adjusted relative risk (odds of adenocarcinoma is 3.95 (95% CI: 1.22, 12.81 and 7.93 (95% CI: 2.26, 27.82 greater for women and men with high sHER2 concentrations (≥6.60 ng/mL vs. low sHER2 concentrations (≤1.85 ng/mL, respectively. When adjusted for each other, sHER2, age, and gender discern healthy controls from patients with primary adenocarcinomas of the lung with 85.9% accuracy. We conclude that even though serum sHER2 is not a strong, stand-alone discriminatory biomarker of adenocarcinoma, sHER2 may be a useful, independent covariate in multivariate risk assessment, screening, and diagnostic models of lung cancer.

  3. Clinicopathologic features and treatment outcomes of patients with human epidermal growth factor receptor 2-positive adenocarcinoma of the esophagus and gastroesophageal junction.

    Science.gov (United States)

    Phillips, B E; Tubbs, R R; Rice, T W; Rybicki, L A; Plesec, T; Rodriguez, C P; Videtic, G M; Saxton, J P; Ives, D I; Adelstein, D J

    2013-04-01

    Human epidermal growth factor receptor 2 (HER2) is overexpressed in 21% of gastric and 33% of gastroesophageal junction (GEJ) adenocarcinomas. Trastuzumab has been approved for metastatic HER2-positive gastric/GEJ cancer in combination with chemotherapy. This retrospective analysis was undertaken to better define the clinicopathologic features, treatment outcomes, and prognosis in patients with HER2-positive adenocarcinoma of the esophagus/GEJ. Pathologic specimens from 156 patients with adenocarcinoma of the esophagus/GEJ treated on clinical trials with chemoradiation and surgery were tested for HER2. Seventy-six patients also received 2 years of gefitinib. Baseline characteristics and treatment outcomes of the HER2-positive and negative patients were compared both in aggregate and separately for each of the two trials. Of 156 patients, 135 had sufficient pathologic material available for HER2 assessment. HER2 positivity was found in 23%; 28% with GEJ primaries and 15% with esophageal primaries (P= 0.10). There was no statistical difference in clinicopathologic features between HER2-positive and negative patients except HER2-negative tumors were more likely to be poorly differentiated (P < 0.001). Locoregional recurrence, distant metastatic recurrence, any recurrence, and overall survival were also statistically similar between the HER2-positive and the HER2-negative groups, in both the entire cohort and in the gefitinib-treated subset. Except for tumor differentiation, HER2-positive and negative patients with adenocarcinoma of the esophagus and GEJ do not differ in clinicopathologic characteristics and treatment outcomes. Given the demonstrated benefit of trastuzumab in HER2-positive gastric cancer and the similar incidence of HER2 overexpression in esophageal/GEJ adenocarcinoma, further evaluation of HER2-directed therapy in this disease seems indicated.

  4. GEP100/Arf6 is required for epidermal growth factor-induced ERK/Rac1 signaling and cell migration in human hepatoma HepG2 cells.

    Directory of Open Access Journals (Sweden)

    ZhenZhen Hu

    Full Text Available BACKGROUND: Epidermal growth factor (EGF signaling is implicated in the invasion and metastasis of hepatoma cells. However, the signaling pathways for EGF-induced motility of hepatoma cells remain undefined. METHODOLOGY/PRINCIPAL FINDINGS: We found that EGF dose-dependently stimulated the migration of human hepatoma cells HepG2, with the maximal effect at 10 ng/mL. Additionally, EGF increased Arf6 activity, and ectopic expression of Arf6 T27N, a dominant negative Arf6 mutant, largely abolish EGF-induced cell migration. Blocking GEP100 with GEP100 siRNA or GEP100-△PH, a pleckstrin homology (PH domain deletion mutant of GEP100, blocked EGF-induced Arf6 activity and cell migration. EGF also increased ERK and Rac1 activity. Ectopic expression GEP100 siRNA, GEP100-△PH, or Arf6-T27N suppressed EGF-induced ERK and Rac1 activity. Furthermore, blocking ERK signaling with its inhibitor U0126 remarkably inhibited both EGF-induced Rac1 activation as well as cell migration, and ectopic expression of inactive mutant form of Rac1 (Rac1-T17N also largely abolished EGF-induced cell migration. CONCLUSIONS/SIGNIFICANCE: Taken together, this study highlights the function of the PH domain of GEP100 and its regulated Arf6/ERK/Rac1 signaling cascade in EGF-induced hepatoma cell migration. These findings could provide a rationale for designing new therapy based on inhibition of hepatoma metastasis.

  5. Evaluation of human epidermal growth factor receptor 2 (HER2) single nucleotide polymorphisms (SNPs) in normal and breast tumor tissues and their link with breast cancer prognostic factors.

    Science.gov (United States)

    Furrer, Daniela; Lemieux, Julie; Côté, Marc-André; Provencher, Louise; Laflamme, Christian; Barabé, Frédéric; Jacob, Simon; Michaud, Annick; Diorio, Caroline

    2016-12-01

    Amplification of the human epidermal growth factor receptor 2 (HER2) gene is associated with worse prognosis and decreased overall survival in breast cancer patients. The HER2 gene contains several polymorphisms; two of the best-characterized HER2 polymorphisms are Ile655Val and Ala1170Pro. The aim of this study was to evaluate the association between these two HER2 polymorphisms in normal breast and breast cancer tissues and known breast cancer prognostic factors in a retrospective cohort study of 73 women with non-metastatic HER2-positive breast cancer. HER2 polymorphisms were assessed in breast cancer tissue and normal breast tissue using TaqMan assay. Ala1170Pro polymorphism in normal breast tissue was associated with age at diagnosis (p = 0.007), tumor size (p = 0.004) and lymphovascular invasion (p = 0.06). Similar significant associations in cancer tissues were observed. No association between the Ile655Val polymorphism and prognostic factors were observed. However, we found significant differences in the distribution of Ile655Val (p = 0.03) and Ala1170Pro (p = 0.01) genotypes between normal breast and breast tumor tissues. This study demonstrates that only the Ala1170Pro polymorphism is associated with prognostic factors in HER2-positive breast cancer patients. Moreover, our results suggest that both HER2 polymorphisms could play a significant role in carcinogenesis in non-metastatic HER2-positive breast cancer women.

  6. TiO{sub 2} nanoparticles alleviate toxicity by reducing free Zn{sup 2+} ion in human primary epidermal keratinocytes exposed to ZnO nanoparticles

    Energy Technology Data Exchange (ETDEWEB)

    Kathawala, Mustafa Hussain; Ng, Kee Woei, E-mail: kwng@ntu.edu.sg; Loo, Say Chye Joachim, E-mail: joachimloo@ntu.edu.sg [Nanyang Technological University, School of Materials Science and Engineering (Singapore)

    2015-06-15

    Nanoparticles have been a subject of intense safety screenings due to their influx in various applications. Although recent studies have reported on the plausible cytotoxicity of nanoparticles, many of these focused only on single-material nanoparticles, while the cytotoxicity of dual-nanoparticle systems (e.g., ZnO with TiO{sub 2}) has remained unexplored. For example, commercial products like sunscreens and cosmetics contain both nano-sized ZnO and TiO{sub 2}, but cytotoxicity studies of such systems are meager. In this paper, the cytotoxicity of this dual-nanoparticle system comprising both ZnO and TiO{sub 2} was evaluated in vitro on skin-mimicking human primary epidermal keratinocytes (HPEKs). Inductively coupled plasma mass spectrometry, flow cytometry, and confocal microscopy were used to investigate the uptake of nanoparticles and free ions. Results revealed that ZnO nanoparticles were partially soluble (up to 20 μg ml{sup −1} after 1 day) and could induce strong cytotoxicity as compared to the insoluble TiO{sub 2} nanoparticles which remained non-toxic until very high concentrations. It was found that TiO{sub 2} nanoparticles could play “vigilante” by protecting keratinocytes from acute toxicity of ZnO nanoparticles. This is in agreement with the observation that TiO{sub 2} nanoparticles caused an attenuation of free intracellular Zn{sup 2+} ions concentration, by adsorbing and immobilizing free Zn{sup 2+} ions. This study reveals a unique dual-nanoparticle observation in vitro on HPEKs, and highlights the importance of dual-nanoparticulate toxicity studies, especially in applications where more than one nanoparticle material-type is present.

  7. Translocation of annexin Ⅰ from cellular membrane to the nuclear membrane in human esophageal squamous cell carcinoma

    Institute of Scientific and Technical Information of China (English)

    Yu Liu; Xiao-Hang Zhao; Hui-Xin Wang; Ning Lu; You-Sheng Mao; Fang Liu; Ying Wang; Hai-Rong Zhang; Kun Wang; Min Wu

    2003-01-01

    AIM: To investigate the alteration of the annexin I subcellular localization in esophageal squamous cell carcinoma (ESCC)and the correlation between the translocation and the tumorigenesis of ESCC.METHODS: The protein localization of annexin I was detected in both human ESCC tissues and cell line via the indirect immunofiuorescence strategy.RESULTS: In the normal esophageal epithelia the annexin I was mainly located on the plasma membrane and formed a consecutive typical trammels net. Annexin I protein also expressed dispersively in cytoplasm and the nuclei without specific localization on the nuclear membrane. In esophageal cancer annexin I decreased very sharply with scattered disappearance on the cellular membrane, however it translocated and highly expressed on the nuclear membrane,which was never found in normal esophageal epithelia. In cultured esophageal cancer cell line annexin I protein was also focused on the nuclear membrane, which was consistent with the result from esophageal cancer tissues.CONCLUSION: This observation suggests that the translocation of annexin I protein in ESCC may correlate with the tumorigenesis of the esophageal cancer.

  8. Assessment of the skin irritation potential of chemicals by using the SkinEthic reconstructed human epidermal model and the common skin irritation protocol evaluated in the ECVAM skin irritation validation study.

    Science.gov (United States)

    Kandárová, Helena; Liebsch, Manfred; Schmidt, Elisabeth; Genschow, Elke; Traue, Dieter; Spielmann, Horst; Meyer, Kirstin; Steinhoff, Claudia; Tornier, Carine; De Wever, Bart; Rosdy, Martin

    2006-08-01

    Currently, two reconstructed human skin models, EpiDerm and EPISKIN are being evaluated in an ECVAM skin irritation validation study. A common skin irritation protocol has been developed, differing only in minor technical details for the two models. A small-scale study, applying this common skin irritation protocol to the SkinEthic reconstructed human epidermis (RHE), was performed at ZEBET at the BfR, Berlin, Germany, to consider whether this protocol could be successfully transferred to another epidermal model. Twenty substances from Phase III of the ECVAM prevalidation study on skin irritation were tested with the SkinEthic RHE. After minor, model-specific adaptations for the SkinEthic RHE, almost identical results to those obtained with the EpiDerm and EPISKIN models were achieved. The overall accuracy of the method was more than 80%, indicating a reliable prediction of the skin irritation potential of the tested chemicals when compared to in vivo rabbit data. As a next step, inter laboratory reproducibility was assessed in a study conducted between ZEBET and the Department of Experimental Toxicology, Schering AG, Berlin, Germany. Six coded substances were tested in both laboratories, with three different batches of the SkinEthic model. The assay results showed good reproducibility and correct predictions of the skin irritation potential for all six test chemicals. The results obtained with the SkinEthic RHE and the common protocol were reproducible in both phases, and the overall outcome is very similar to that of earlier studies with the EPISKIN and EpiDerm models. Therefore, the SkinEthic skin irritation assay test protocol can now be evaluated in a formal "catch-up" validation study.

  9. The Acinar Cage: Basement Membranes Determine Molecule Exchange and Mechanical Stability of Human Breast Cell Acini.

    Directory of Open Access Journals (Sweden)

    Aljona Gaiko-Shcherbak

    Full Text Available The biophysical properties of the basement membrane that surrounds human breast glands are poorly understood, but are thought to be decisive for normal organ function and malignancy. Here, we characterize the breast gland basement membrane with a focus on molecule permeation and mechanical stability, both crucial for organ function. We used well-established and nature-mimicking MCF10A acini as 3D cell model for human breast glands, with ether low- or highly-developed basement membrane scaffolds. Semi-quantitative dextran tracer (3 to 40 kDa experiments allowed us to investigate the basement membrane scaffold as a molecule diffusion barrier in human breast acini in vitro. We demonstrated that molecule permeation correlated positively with macromolecule size and intriguingly also with basement membrane development state, revealing a pore size of at least 9 nm. Notably, an intact collagen IV mesh proved to be essential for this permeation function. Furthermore, we performed ultra-sensitive atomic force microscopy to quantify the response of native breast acini and of decellularized basement membrane shells against mechanical indentation. We found a clear correlation between increasing acinar force resistance and basement membrane formation stage. Most important native acini with highly-developed basement membranes as well as cell-free basement membrane shells could both withstand physiologically relevant loads (≤ 20 nN without loss of structural integrity. In contrast, low-developed basement membranes were significantly softer and more fragile. In conclusion, our study emphasizes the key role of the basement membrane as conductor of acinar molecule influx and mechanical stability of human breast glands, which are fundamental for normal organ function.

  10. Scanning electron microscopic assessment on surface morphology of preserved human amniotic membrane after gamma sterilisation.

    Science.gov (United States)

    Ab Hamid, Suzina Sheikh; Zahari, Nor Kamalia; Yusof, Norimah; Hassan, Asnah

    2014-03-01

    Human amniotic membrane that has been processed and sterilised by gamma irradiation is widely used as a biological dressing in surgical applications. The morphological structure of human amniotic membrane was studied under scanning electron microscopy (SEM) to assess effects of gamma radiation on human amniotic membrane following different preservation methods. The amniotic membrane was preserved by either air drying or submerged in glycerol before gamma irradiated at 15, 25 and 35 kGy. Fresh human amniotic membrane, neither preserved nor irradiated was used as the control. The surface morphology of glycerol preserved amnion was found comparable to the fresh amniotic membrane. The cells of the glycerol preserved was beautifully arranged, homogonous in size and tended to round up. The cell structure in the air dried preserved amnion seemed to be flattened and dehydrated. The effects of dehydration on intercellular channels and the microvilli on the cell surface were clearly seen at higher magnifications (10,000×). SEM revealed that the changes of the cell morphology of the glycerol preserved amnion were visible at 35 kGy while the air dried already changed at 25 kGy. Glycerol preservation method is recommended for human amniotic membrane as the cell morphological structure is maintained and radiation doses lower than 25 kGy for sterilization did not affect the appearance of the preserved amnion.

  11. Affinity Maturation of an Epidermal Growth Factor Receptor Targeting Human Monoclonal Antibody ER414 by CDR Mutation.

    Science.gov (United States)

    Chang, Ki-Hwan; Kim, Min-Soo; Hong, Gwang-Won; Seo, Mi-Sun; Shin, Yong-Nam; Kim, Se-Ho

    2012-08-01

    It is well established that blocking the interaction of EGFR with growth factors leads to the arrest of tumor growth, resulting in tumor cell death. ER414 is a human monoclonal antibody (mAb) derived by guided selection of the mouse mAb A13. The ER414 exhibited a ~17-fold lower affinity and, as a result, lower efficacy of inhibition of the EGF-mediated tyrosine phosphorylation of EGFR when compared with mAb A13 and cetuximab. We performed a stepwise in vitro affinity maturation to improve the affinity of ER414. We obtained a 3D model of ER414 to identify the amino acids in the CDRs that needed to be mutated. Clones were selected from the phage library with randomized amino acids in the CDRs and substitution of amino acids in the HCDR3 and LCDR1 of ER414 led to improved affinity. A clone, H3-14, with a ~20-fold increased affinity, was selected from the HCDR3 randomized library. Then three clones, ER2, ER78 and ER79, were selected from the LCDR1 randomized library based on the H3-14 but did not show further increased affinities compared to that of H3-14. Of the three, ER2 was chosen for further characterization due to its better expression than others. We successfully performed affinity maturation of ER414 and obtained antibodies with a similar affinity as cetuximab. And antibody from an affinity maturation inhibits the EGF-mediated tyrosine phosphorylation of EGFR in a manner similar to cetuximab.

  12. Manufacture and scanning electron microscopic observation of human dermis collagen membrane

    Institute of Scientific and Technical Information of China (English)

    1999-01-01

    @@ Introduction Collagen is a kind of biomacromolecule and can be used as cover material for burn wounds. In this article,we report the scanning electron microscopic observation of human dermis collagen membrane prepared by three methods.

  13. A novel role of RASSF9 in maintaining epidermal homeostasis.

    Directory of Open Access Journals (Sweden)

    Chiou-Mei Lee

    Full Text Available The physiological role of RASSF9, a member of the Ras-association domain family (RASSF, is currently unclear. Here, we report a mouse line in which an Epstein-Barr virus Latent Membrane Protein 1 (LMP1 transgene insertion has created a 7.2-kb chromosomal deletion, which abolished RASSF9 gene expression. The RASSF9-null mice exhibited interesting phenotypes that resembled human ageing, including growth retardation, short lifespan, less subcutaneous adipose layer and alopecia. In the wild-type mice, RASSF9 is predominantly expressed in the epidermal keratinocytes of skin, as determined by quantitative reverse-transcription PCR, immunofluorescence and in situ hybridization. In contrast, RASSF9-/- mice presented a dramatic change in epithelial organization of skin with increased proliferation and aberrant differentiation as detected by bromodeoxyuridine incorporation assays and immunofluorescence analyses. Furthermore, characteristic functions of RASSF9-/- versus wild type (WT mouse primary keratinocytes showed significant proliferation linked to a reduction of p21Cip1 expression under growth or early differentiation conditions. Additionally, in RASSF9-/- keratinocytes there was a drastic down-modulation of terminal differentiation markers, which could be rescued by infection with a recombinant adenovirus, Adv/HA-RASSF9. Our results indicate a novel and significant role of RASSF9 in epidermal homeostasis.

  14. [Beyond immunopathogenesis. Insulin resistance and "epidermal dysfunction"].

    Science.gov (United States)

    Boehncke, W-H; Boehncke, S; Buerger, C

    2012-03-01

    Insulin is a central player in the regulation of metabolic as well as non-metabolic cells: inefficient signal transduction (insulin resistance) not only represents the cornerstone in the pathogenesis of type 2 diabetes mellitus, but also drives atherosclerosis through inducing endothelial dysfunction. Last but not least epidermal homeostasis depends on insulin. We summarize the effects of insulin on proliferation and differentiation of human keratinocytes as well as the relevance of cytokine-induced insulin resistance for alterations in epidermal homeostasis characteristic for psoriasis. Kinases involved in both insulin- as well as cytokine-receptor signaling represent potential targets for innovative therapeutics. Such small molecules would primarily normalize "epidermal dysfunction", thus complementing the immunomodulatory strategies of today's biologics.

  15. A comprehensive two-dimensional gel protein database of noncultured unfractionated normal human epidermal keratinocytes: towards an integrated approach to the study of cell proliferation, differentiation and skin diseases

    DEFF Research Database (Denmark)

    Celis, J E; Madsen, Peder; Rasmussen, H H

    1991-01-01

    proteins in alphabetical order), "basal cell markers", "differentiation markers", "proteins highly up-regulated in psoriatic skin", "microsequenced proteins" and "human autoantigens". For reference, we have also included 2-D gel (isoelectric focusing) patterns of cultured normal and psoriatic keratinocytes......A two-dimensional (2-D) gel database of cellular proteins from noncultured, unfractionated normal human epidermal keratinocytes has been established. A total of 2651 [35S]methionine-labeled cellular proteins (1868 isoelectric focusing, 783 nonequilibrium pH gradient electrophoresis) were resolved...

  16. Penile Epidermal Inclusion Cyst

    Directory of Open Access Journals (Sweden)

    M. El-Shazly

    2012-01-01

    Full Text Available We report a case of epidermal inclusion cyst in a 32-year-old male. This was a complication of circumcision that was neglected over years to form stones and urethrocutaneous fistula. Complete excision of the cyst and repair of the fistula were performed successfully. Histopathological examination confirmed our diagnosis.

  17. Effects of phenylpropanolamine (PPA) on in vitro human erythrocyte membranes and molecular models

    Energy Technology Data Exchange (ETDEWEB)

    Suwalsky, Mario, E-mail: msuwalsk@udec.cl [Faculty of Chemical Sciences, University of Concepcion, Concepcion (Chile); Zambrano, Pablo; Mennickent, Sigrid [Faculty of Pharmacy, University of Concepcion, Concepcion (Chile); Villena, Fernando [Faculty of Biological Sciences, University of Concepcion, Concepcion (Chile); Sotomayor, Carlos P.; Aguilar, Luis F. [Instituto de Quimica, Pontificia Universidad Catolica de Valparaiso, Valparaiso (Chile); Bolognin, Silvia [CNR-Institute for Biomedical Technologies, University of Padova, Padova (Italy)

    2011-03-18

    Research highlights: {yields} PPA is a common ingredient in cough-cold medication and appetite suppressants. {yields} Reports on its effects on human erythrocytes are very scarce. {yields} We found that PPA induced in vitro morphological changes to human erythrocytes. {yields} PPA interacted with isolated unsealed human erythrocyte membranes. {yields} PPA interacted with class of lipid present in the erythrocyte membrane outer monolayer. -- Abstract: Norephedrine, also called phenylpropanolamine (PPA), is a synthetic form of the ephedrine alkaloid. After reports of the occurrence of intracranial hemorrhage and other adverse effects, including several deaths, PPA is no longer sold in USA and Canada. Despite the extensive information about PPA toxicity, reports on its effects on cell membranes are scarce. With the aim to better understand the molecular mechanisms of the interaction of PPA with cell membranes, ranges of concentrations were incubated with intact human erythrocytes, isolated unsealed human erythrocyte membranes (IUM), and molecular models of cell membranes. The latter consisted in bilayers built-up of dimyristoylphosphatidylcholine (DMPC) and dimyristoylphosphatidylethanolamine (DMPE), phospholipid classes present in the outer and inner monolayers of most plasmatic cell membranes, respectively. The capacity of PPA to perturb the bilayer structures of DMPC and DMPE was assessed by X-ray diffraction, DMPC large unilamellar vesicles (LUV) and IUM were studied by fluorescence spectroscopy, and intact human erythrocytes were observed by scanning electron microscopy (SEM). This study presents evidence that PPA affects human red cell membranes as follows: (a) in SEM studies on human erythrocytes it was observed that 0.5 mM PPA induced shape changes; (b) in IUM PPA induced a sharp decrease in the fluorescence anisotropy in the lipid bilayer acyl chains in a concentration range lower than 100 {mu}M; (c) X-ray diffraction studies showed that PPA in the 0.1-0.5 m

  18. Human Amnion Membrane Serves as a Substratum for Growing Axons in vitro and in vivo

    Science.gov (United States)

    Davis, George E.; Blaker, Scott N.; Engvall, Eva; Varon, Silvio; Manthorpe, Marston; Gage, Fred H.

    1987-05-01

    The epithelial cell layer of human amnion membrane can be removed while the basement membrane and stromal surfaces remain morphologically intact. Such a preparation has been used as a substratum for the in vitro culture of dissociated neurons. Embryonic motor neurons from chick ciliary ganglion attached to both surfaces but grew extensive neurites only on the basement membrane. On cross sections of rolled amnion membranes, regenerating axons of cultured neurons were guided along pathways of basement membrane that were immunoreactive with an antibody to laminin. In addition, when rolled amnion membranes were implanted into a lesion cavity between the rat septum and hippocampus, cholinergic neurons extended axons through the longitudinally oriented implant into the hippocampus. Thus, this amnion preparation can serve as a bridge to promote axonal regeneration in vivo in damaged adult brain.

  19. Effects of lanthanide ions on hydrolysis of phosphatidylin- ositol in human erythrocyte membranes

    Institute of Scientific and Technical Information of China (English)

    2001-01-01

    The effects of lanthanides on the hydrolysis of phosphatidylinositol in human erythrocyte membranes were studied. 3H-inositol labeling chromatography and HPLC were used to determine inositol 1, 4, 5-triphosphate and diacylglycerol separately, the hydrolytic products of phos-phatidylinositol due to the reaction of lanthanide ions with human erythrocyte membranes. The unhydrolyzed phospha-tidylinositol in membranes was also determined. The results indicate that the hydrolysis of phosphatidylinositol can be promoted by lanthanides (La3+, Ce3+, Y3+, Tb3+) and the ef-fects of La3+ and Ce3+ are stronger than those of Y3+ and Tb3+.

  20. Comparison of human mesenchymal stromal cells from four neonatal tissues: Amniotic membrane, chorionic membrane, placental decidua and umbilical cord.

    Science.gov (United States)

    Araújo, Anelise Bergmann; Salton, Gabrielle Dias; Furlan, Juliana Monteiro; Schneider, Natália; Angeli, Melissa Helena; Laureano, Álvaro Macedo; Silla, Lúcia; Passos, Eduardo Pandolfi; Paz, Ana Helena

    2017-05-01

    Mesenchymal stromal cells (MSCs) are being investigated as a potential alternative for cellular therapy. This study was designed to compare the biological characteristics of MSCs isolated from amniotic membrane (A-MSCs), chorionic membrane (C-MSCs), placental decidua (D-MSCs) and umbilical cord (UC-MSCs) to ascertain whether any one of these sources is superior to the others for cellular therapy purposes. MSCs were isolated from amniotic membrane, chorionic membrane, umbilical cord and placental decidua. Immunophenotype, differentiation ability, cell size, cell complexity, polarity index and growth kinetics of MSCs isolated from these four sources were analyzed. MSCs were successfully isolated from all four sources. Surface marker profile and differentiation ability were consistent with human MSCs. C-MSCs in suspension were the smallest cells, whereas UC-MSCs presented the greatest length and least width. A-MSCs had the lowest polarity index and UC-MSCs, as more elongated cells, the highest. C-MSCs, D-MSCs and UC-MSCs exhibited similar growth capacity until passage 8 (P8); C-MSCs presented better lifespan, whereas insignificant proliferation was observed in A-MSCs. Neonatal and maternal tissues can serve as sources of multipotent stem cells. Some characteristics of MSCs obtained from four neonatal tissues were compared and differences were observed. Amniotic membrane was the least useful source of MSCs, whereas chorionic membrane and umbilical cord were considered good options for future use in cell therapy because of the known advantages of immature cells. Copyright © 2017 International Society for Cellular Therapy. Published by Elsevier Inc. All rights reserved.

  1. A practical guide for the identification of membrane and plasma membrane proteins in human embryonic stem cells and human embryonal carcinoma cells.

    NARCIS (Netherlands)

    Dormeyer, W.; van Hoof, D.; Mummery, C.L.; Krijgsveld, J.; Heck, A.

    2008-01-01

    The identification of (plasma) membrane proteins in cells can provide valuable insights into the regulation of their biological processes. Pluripotent cells such as human embryonic stem cells and embryonal carcinoma cells are capable of unlimited self-renewal and share many of the biological

  2. Molecular mechanism underlying the synergistic interaction between trifluorothymidine and the epidermal growth factor receptor inhibitor erlotinib in human colorectal cancer cell lines

    NARCIS (Netherlands)

    Bijnsdorp, Irene V.; Kruyt, Frank A. E.; Fukushima, Masakazu; Smid, Kees; Gokoel, Shanti; Peters, Godefridus J.

    2010-01-01

    The pyrimidine trifluorothymidine (TFT) inhibits thymidylate synthase (TS) and can be incorporated into the DNA. TFT, as part of TAS-102, is clinically evaluated in phase II studies as an oral chemotherapeutic agent. Erlotinib is a tyrosine kinase inhibitor of the epidermal growth factor receptor (E

  3. Epidermal growth factor-receptor interaction in rat pheochromocytoma (PC12) and human epidermoid A431 cells: Biochemical and ultrastructural studies

    NARCIS (Netherlands)

    Laat, S.W. de; Boonstra, J.; Mummery, C.L.; Defize, L.; Leunissen, J.; Verkleij, A.J.

    1984-01-01

    Pheochromocytoma cells (clone PC12) have specific plasmamembrane receptors for both epidermal growth factor (EGF) and nerve growth factor (NGF). These growth factors have however, opposite biological effects in PC12 cells; EGF acts mitogenically, while NGF induces differentiation and causes arrest o

  4. Influence of preparative procedures on the membrane viscoelasticity of human red cell ghosts.

    Science.gov (United States)

    Nash, G B; Tran-Son-Tay, R; Meiselman, H J

    1986-02-13

    The effects of systematic variations in the preparative procedures on the membrane viscoelastic properties of resealed human red blood cell ghosts have been investigated. Ghosts, prepared by hypotonic lysis at 0 degrees C and resealing at 37 degrees C, were subjected to: measurement of the time constant for extensional recovery (tc); measurement of the membrane shear elastic modulus (mu) via three separate techniques; determination of the membrane viscosity (eta m) via a cone-plate Rheoscope. Membrane viscosity was also determined as eta m = mu X tc. Compared to intact cells, ghosts had shorter tc, regardless of their residual hemoglobin concentration (up to 21.6 g/dl). However, prolonged exposure to hypotonic media did increase their recovery time toward the intact cell value. The shear elastic modulus, as judged by micropipette aspiration of membrane tongues (mu p), was similar for all ghosts and intact cells. This result, taken with the tc data, indicates that ghosts have reduced membrane viscosity. Rheoscopic analysis also showed that eta m was reduced for ghosts, with the degree of reduction (approx. 50%) agreeing well with that estimated by the product mu p X tc. However, flow channel and pipette elongation estimates indicated that the ghost membrane elastic modulus was somewhat elevated compared to intact cells. We conclude that: ghosts have reduced membrane viscosity; ghosts have membrane rigidities close to intact cells, except possibly when the membrane is subjected to very large strains; the reduction in eta m is not directly related to the loss of hemoglobin; prolonged exposure of ghosts to low-ionic strength media increases the membrane viscosity toward its initial cellular level. These data indicate that the mechanical characteristics of ghost membranes can be varied by changing the methods of preparation and thus have potential application to further studies of the structural determinants of red cell membrane viscoelasticity.

  5. Biocompatibility of three bioabsorbable membranes assessed in FGH fibroblasts and human osteoblast like cells culture.

    Science.gov (United States)

    Soares, Michelle Pereira Costa Mundim; Soares, Paulo Vinícius; Pereira, Analice Giovani; Moura, Camilla Christian Gomes; Soares, Priscila Barbosa Ferreira; Naves, Lucas Zago; de Magalhães, Denildo

    2014-08-06

    Specific physical and chemical features of the membranes may influence the healing of periodontal tissues after guided tissue regeneration (GTR). The aim of the present investigation was to analyze the biological effects of three bioabsorbable membranes. The hypothesis is that all tested membranes present similar biological effects. Human osteoblast like-cells (SaOs-2) and gingival fibroblasts FGH (BCRJ -RJ) were cultured in DMEM medium. The viability of the cells cultured on the membranes was assesses using 3-(4,5-Dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide (MTT). Quantitative determination of activated human Transforming Growth Factor beta 1 (TGF-β1) on the supernatants of the cell culture was observed. Samples were examined using scanning electron microscope (SEM). SaOs2, in 24 hours, PLA group showed higher values when compared to other groups (P statistical significance values when compared two times. In 4 h and 24 h, for the fibroblasts group, significantly difference was found to PLA membrane, when compared with the other groups (p statistically significant difference (p analysis of culture supernatants of fibroblasts, in 24 hours, only PLA group presented significant difference (p = 0,008). The biomaterials analyzed did not show cytotoxicity, since no membrane presented lower results than the control group. PLA membrane presented the best performance due to its higher cell viability and absorbance levels of proliferation. Both collagen membranes showed similar results either when compared to each other or to the control group.

  6. Cultivation and irradiation of human fibroblasts in a medium enriched with platelet lysate for obtaining feeder layer in epidermal cell culture; Cultivo e irradiacao de fibroblastos humanos em meio enriquecido com lisado de plaquetas para obtencao de camada de sustentacao em culturas de celulas da epiderme

    Energy Technology Data Exchange (ETDEWEB)

    Yoshito, Daniele

    2011-07-01

    For over 30 years, the use of culture medium, enriched with bovine serum, and murines fibroblasts, with the rate of proliferation controlled by irradiation or by share anticarcinogenic drugs, has been playing successfully its role in assisting in the development of keratinocytes in culture, for clinical purposes. However, currently there is a growing concern about the possibility of transmitting prions and animals viruses to transplanted patients. Taking into account this concern, the present work aims to cultivate human fibroblasts in a medium enriched with human platelets lysate and determine the irradiation dose of these cells, for obtaining feeder layer in epidermal cell culture. For carrying out the proposed objective, platelets lysis has standardized, this lysate was used for human fibroblasts cultivation and the irradiation dose enough to inhibit its duplication was evaluated. Human keratinocytes were cultivated in these feeder layers, in culture medium enriched with the lysate. With these results we conclude that the 10% platelets lysate promoted a better adhesion and proliferation of human fibroblasts and in all dose levels tested (60 to 300 Gy), these had their mitotic activity inactivated by ionizing irradiation, being that the feeder layers obtained with doses from 70 to 150 Gy were those that provided the best development of keratinocytes in medium containing 2.5% of human platelet lysate. Therefore, it was possible to standardize both the cultivation of human fibroblasts as its inactivation for use as feeder layer in culture of keratinocytes, so as to eliminate xenobiotics components. (author)

  7. Induction of interleukin-6 production by ultraviolet radiation in normal human epidermal keratinocytes and in a human keratinocyte cell line is mediated by DNA damage

    NARCIS (Netherlands)

    Petit-Frère, C.; Clingen, P.H.; Grewe, M.; Krutmann, J.; Roza, L.; Arlett, C.F.; Green, M.H.L.

    1998-01-01

    The sunburn reaction is the most common consequence of human exposure to ultraviolet radiation (UVR), and is mediated at least in part by interleukin- 6 (IL-6). The aim of this study was to determine if DNA is a major chromophore involved in the induction of IL-6 following UV irradiation of a human

  8. Tumor-infiltrating lymphocytes and response to neoadjuvant chemotherapy with or without carboplatin in human epidermal growth factor receptor 2-positive and triple-negative primary breast cancers.

    Science.gov (United States)

    Denkert, Carsten; von Minckwitz, Gunter; Brase, Jan C; Sinn, Bruno V; Gade, Stephan; Kronenwett, Ralf; Pfitzner, Berit M; Salat, Christoph; Loi, Sherene; Schmitt, Wolfgang D; Schem, Christian; Fisch, Karin; Darb-Esfahani, Silvia; Mehta, Keyur; Sotiriou, Christos; Wienert, Stephan; Klare, Peter; André, Fabrice; Klauschen, Frederick; Blohmer, Jens-Uwe; Krappmann, Kristin; Schmidt, Marcus; Tesch, Hans; Kümmel, Sherko; Sinn, Peter; Jackisch, Christian; Dietel, Manfred; Reimer, Toralf; Untch, Michael; Loibl, Sibylle

    2015-03-20

    Modulation of immunologic interactions in cancer tissue is a promising therapeutic strategy. To investigate the immunogenicity of human epidermal growth factor receptor 2 (HER2) -positive and triple-negative (TN) breast cancers (BCs), we evaluated tumor-infiltrating lymphocytes (TILs) and immunologically relevant genes in the neoadjuvant GeparSixto trial. GeparSixto investigated the effect of adding carboplatin (Cb) to an anthracycline-plus-taxane combination (PM) on pathologic complete response (pCR). A total of 580 tumors were evaluated before random assignment for stromal TILs and lymphocyte-predominant BC (LPBC). mRNA expression of immune-activating (CXCL9, CCL5, CD8A, CD80, CXCL13, IGKC, CD21) as well as immunosuppressive factors (IDO1, PD-1, PD-L1, CTLA4, FOXP3) was measured in 481 tumors. Increased levels of stromal TILs predicted pCR in univariable (P < .001) and multivariable analyses (P < .001). pCR rate was 59.9% in LPBC and 33.8% for non-LPBC (P < .001). pCR rates ≥ 75% were observed in patients with LPBC tumors treated with PMCb, with a significant test for interaction with therapy in the complete (P = .002) and HER2-positive (P = .006), but not the TNBC, cohorts. Hierarchic clustering of mRNA markers revealed three immune subtypes with different pCR rates (P < .001). All 12 immune mRNA markers were predictive for increased pCR. The highest odds ratios (ORs) were observed for PD-L1 (OR, 1.57; 95% CI, 1.34 to 1.86; P < .001) and CCL5 (OR, 1.41; 95% CI, 1.23 to 1.62; P < .001). Immunologic factors were highly significant predictors of therapy response in the GeparSixto trial, particularly in patients treated with Cb. After further standardization, they could be included in histopathologic assessment of BC. © 2014 by American Society of Clinical Oncology.

  9. Relationship between body mass index and the expression of hormone receptors or human epidermal growth factor receptor 2 with respect to breast cancer survival.

    Science.gov (United States)

    Jeon, Ye Won; Kang, Su Hwan; Park, Min Ho; Lim, Woosung; Cho, Se Heun; Suh, Young Jin

    2015-11-06

    The association between body mass index (BMI) at the time of breast cancer diagnosis and the prognosis of breast cancer patients remains controversial. Furthermore, the association between BMI and prognosis with respect to different breast cancer subtypes is not clearly defined. We analyzed data from 41,021 invasive breast cancer patients between January 1988 and February 2008 from the Korean Breast Cancer Registry (KBCR) database. Overall survival (OS) and breast cancer-specific survival (BCSS) were analyzed using the Kaplan-Meier method and Cox's proportional hazard regression model among all patients and specific breast cancer subtypes with respect to BMI categories. A U-shaped association between BMI and mortality was observed in the total cohort. Underweight and obese individuals exhibited worse OS (hazard ratio, 1.23 [95 % confidence interval {CI}, 1.05 to 1.44] and 1.29 [1.13 to 1.48], respectively) and BCSS (1.26 [1.03 to 1.54] and 1.21 [1.02 to 1.43], respectively) than normal-weight individuals. In the estrogen receptor (ER) and/or progesterone receptor (PR)+/human epidermal growth factor receptor 2 (HER2) - subgroup, obese individuals exhibited worse OS (1.48 [1.18 to 1.85]) and BCSS (1.31 [1.13 to 1.52]) than normal-weight individuals. Conversely, in the ER and PR-/HER2+ subgroup, underweight individuals exhibited worse OS (1.68 [1.12 to 2.47]) and BCSS (1.79 [1.11 to 2.90]) than normal-weight individuals. We observed a U-shaped relationship between BMI at diagnosis and poor OS and BCSS among all breast cancer patients. However, obesity in the ER and/or PR+/HER2- subgroup and underweight in the ER and PR-/HER2+ subgroup were poor prognostic factors. Therefore, BMI at diagnosis and breast cancer subtype should be considered simultaneously in various treatment decision processes and surveillance schedules.

  10. Basement membrane abnormalities in human eyes with diabetic retinopathy

    DEFF Research Database (Denmark)

    Ljubimov, A V; Burgeson, R E; Butkowski, R J

    1996-01-01

    discontinuously for laminin-1, entactin/nidogen, and alpha3-alpha4 Type IV collagen, in contrast to non-DR corneas. Major BM alterations were found in DR retinas compared to normals and non-DR diabetics. The inner limiting membrane (retinal BM) of DR eyes had accumulations of fibronectin (including cellular......) and Types I, III, IV (alpha1-alpha2), and V collagen. The BM zone of new retinal blood vessels in neovascularized areas accumulated tenascin and Type XII collagen, whereas normal, diabetic, and adjacent DR retinas showed only weak and irregular staining. In preretinal membranes, perlecan, bamacan, and Types...... VI, VIII, XII, and XIV collagen were newly identified. Diabetic BM thickening appears to involve qualitative alterations of specific BM markers at an advanced disease stage, with the appearance of DR....

  11. Quantitative mapping of intracellular cations in the human amniotic membrane

    Science.gov (United States)

    Moretto, Ph.; Llabador, Y.; Simonoff, M.; Razafindrabe, L.; Bara, M.; Guiet-Bara, A.

    1993-05-01

    The effect of magnesium and taurine on the permeability of cell membranes to monovalent cations has been investigated using the Bordeaux nuclear microprobe. PIXE and RBS techniques have been used to provide quantitative measurements and ion distributions in the isolated amniotic membrane. This physiological model for cellular exchanges allowed us to reveal the distribution of most elements involved in cellular pathways and the modifications under different experimental conditions of incubation in physiological fluids. The PIXE microanalysis provided an original viewpoint on these mechanisms. Following this first study, the amnion compact lamina was found to play a role which was not, up to now, taken into account in the interpretation of electrophysiological experimentations. The release of some ionic species, such as K +, from the epithelial cells, during immersion in isotonic fluids, could have been hitherto underestimated.

  12. Toxic epidermal necrolysis and Stevens-Johnson syndrome

    Directory of Open Access Journals (Sweden)

    French Lars E

    2010-12-01

    Full Text Available Abstract Toxic epidermal necrolysis (TEN and Stevens Johnson Syndrome (SJS are severe adverse cutaneous drug reactions that predominantly involve the skin and mucous membranes. Both are rare, with TEN and SJS affecting approximately 1or 2/1,000,000 annually, and are considered medical emergencies as they are potentially fatal. They are characterized by mucocutaneous tenderness and typically hemorrhagic erosions, erythema and more or less severe epidermal detachment presenting as blisters and areas of denuded skin. Currently, TEN and SJS are considered to be two ends of a spectrum of severe epidermolytic adverse cutaneous drug reactions, differing only by their extent of skin detachment. Drugs are assumed or identified as the main cause of SJS/TEN in most cases, but Mycoplasma pneumoniae and Herpes simplex virus infections are well documented causes alongside rare cases in which the aetiology remains unknown. Several drugs are at "high" risk of inducing TEN/SJS including: Allopurinol, Trimethoprim-sulfamethoxazole and other sulfonamide-antibiotics, aminopenicillins, cephalosporins, quinolones, carbamazepine, phenytoin, phenobarbital and NSAID's of the oxicam-type. Genetic susceptibility to SJS and TEN is likely as exemplified by the strong association observed in Han Chinese between a genetic marker, the human leukocyte antigen HLA-B*1502, and SJS induced by carbamazepine. Diagnosis relies mainly on clinical signs together with the histological analysis of a skin biopsy showing typical full-thickness epidermal necrolysis due to extensive keratinocyte apoptosis. Differential diagnosis includes linear IgA dermatosis and paraneoplastic pemphigus, pemphigus vulgaris and bullous pemphigoid, acute generalized exanthematous pustulosis (AGEP, disseminated fixed bullous drug eruption and staphyloccocal scalded skin syndrome (SSSS. Due to the high risk of mortality, management of patients with SJS/TEN requires rapid diagnosis, evaluation of the prognosis

  13. Chromatographic design for the purification of recombinant human membrane COMT

    OpenAIRE

    Santos, Fátima Raquel Milhano dos

    2012-01-01

    Several studies suggest that membrane form of catechol-O-methyltransferase OMT (MB-COMT) is the main responsible for O-methylation at physiologically low concentrations of catecholamines. Despite this, until now no studies have been allowed the total isolation of MB-COMT. Then, a sustainable chromatographic step should be developed in order to obtain significant quantities of active and pure enzyme for posterior application on biochemical, kinetic and structural studies. For the first time, w...

  14. BINDING OF GONADOTROPHIN-RELEASING HORMONE WITH ITS RECEPTORS ON HUMAN PLACENTAL MEMBRANES

    Institute of Scientific and Technical Information of China (English)

    QIUXiu-Di; WANGHan-Zheng; GONGYue-Ting

    1989-01-01

    Theeffects of gonadotrophin--relensing hormone (GnRH) onthe bindingof125I-labelled GnRH agonist to human placental membranes were studied. The GnRH binding sites of human plaoenta had a high specificity but low affinity. The natural GnRH had a slightly

  15. Effects of the local anesthetic benzocaine on the human erythrocyte membrane and molecular models.

    Science.gov (United States)

    Suwalsky, Mario; Schneider, Carlos; Villena, Fernando; Norris, Beryl; Cárdenas, Hernán; Cuevas, Francisco; Sotomayor, Carlos P

    2004-04-01

    The interaction of the local anesthetic benzocaine with the human erythrocyte membrane and molecular models is described. The latter consisted of isolated unsealed human erythrocyte membranes (IUM), large unilamellar vesicles (LUV) of dimyristoylphospatidylcholine (DMPC), and phospholipid multilayers of DMPC and dimyristoylphospatidyletanolamine (DMPE), representatives of phospholipid classes located in the outer and inner monolayers of the human erythrocyte membrane, respectively. Optical and scanning electron microscopy of human erythrocytes revealed that benzocaine induced the formation of echinocytes. Experiments performed on IUM and DMPC LUV by fluorescence spectroscopy showed that benzocaine interacted with the phospholipid bilayer polar groups and hydrophobic acyl chains. X-ray diffraction analysis of DMPC confirmed these results and showed that benzocaine had no effects on DMPE. The effect on sodium transport was also studied using the isolated toad skin. Electrophysiological measurements indicated a significant decrease in the potential difference (PD) and in the short-circuit current (Isc) after the application of benzocaine, reflecting inhibition of active ion transport.

  16. Proteomic Analysis of Outer Membrane Proteins from Salmonella Enteritidis Strains with Different Sensitivity to Human Serum

    Science.gov (United States)

    Dudek, Bartłomiej; Krzyżewska, Eva; Kapczyńska, Katarzyna; Rybka, Jacek; Pawlak, Aleksandra; Korzekwa, Kamila; Klausa, Elżbieta; Bugla-Płoskońska, Gabriela

    2016-01-01

    Differential analysis of outer membrane composition of S. Enteritidis strains, resistant to 50% normal human serum (NHS) was performed in order to find factors influencing the resistance to higher concentrations of NHS. Ten S. Enteritidis clinical strains, resistant to 50% NHS, all producing very long lipopolysaccharide, were subjected to the challenge of 75% NHS. Five extreme strains: two resistant and three sensitive to 75% NHS, were chosen for the further analysis of outer membrane proteins composition. Substantial differences were found in the levels of particular outer membrane proteins between resistant and sensitive strains, i.e. outer membrane protease E (PgtE) was present mainly in resistant strains, while sensitive strains possessed a high level of flagellar hook-associated protein 2 (FliD) and significantly higher levels of outer membrane protein A (OmpA). PMID:27695090

  17. Training-induced changes in membrane transport proteins of human skeletal muscle

    DEFF Research Database (Denmark)

    Juel, C.

    2006-01-01

    for 6-8 weeks substantially increases the density of membrane proteins, whereas years of training (as performed by athletes) have no further effect. Studies suggest that training-induced changes at the protein level are important functionally. The underlying factors responsible for these changes......Training improves human physical performance by inducing structural and cardiovascular changes, metabolic changes, and changes in the density of membrane transport proteins. This review focuses on the training-induced changes in proteins involved in sarcolemmal membrane transport. It is concluded...... that the same type of training affects many transport proteins, suggesting that all transport proteins increase with training, and that both sprint and endurance training in humans increase the density of most membrane transport proteins. There seems to be an upper limit for these changes: intense training...

  18. Influences of infrared irradiation on human epidermal melanocytes%红外线照射对人表皮黑素细胞影响的研究

    Institute of Scientific and Technical Information of China (English)

    张悦; 赵广; 孟如松; 宋文婷; 邵丽芳; 牛建荣

    2012-01-01

    目的 探讨红外线(infrared,JR)照射促进体外培养的正常人表皮黑素细胞的酪氨酸酶活性及黑素含量的作用,寻找IR照射的最佳剂量.方法 将体外培养的正常人表皮黑素细胞分别给予不同的红外线剂量:0 J/cm2(对照组)、20 J/cm2、60 J/cm2、80 J/cm2、100 J/cm2、140 J/cm2、240 J/cm2、320 J/cm2,采用四甲基偶氮唑蓝(MTT)法选择最佳剂量并以此作为照射条件,连续3d,检测黑素细胞的酪氨酸酶活性、酪氨酸酶活性增长率、黑素含量、红外线照射对黑素细胞影响率以及细胞周期.结果 红外线照射的最佳剂量为80 J/cm2,此照射下的酪氨酸酶活性0.3601±0.0301,高于对照组0.3114±0.0341 (P< 0.05),酪氨酸酶活性增长率为15.64%.照射组的黑素细胞含量为0.2748±0.0243,高于对照组0.2325±0.0254(P<0.05),红外线照射对黑素细胞黑素含量影响率18.19%.细胞周期检测结果显示,G1细胞比例明显低于对照组(P<0.01),G2期和S期细胞比例较对照组增加(P<0.05).结论 80 J/cm2是IR照射的理想剂量,可以增加黑素细胞的黑素含量,提高酪氨酸酶活性,促进黑素细胞分化增殖.%Objective To observe the increasing effect of infrared irradiation on tyrosinase activity and melanin content in cultured normal human epidermal melanocytes in vitro and to explore the optimal dose of infrared irradiation.Methods Epidermal melanocytes were isolated from normal human foreskin tissue,and subjected to primary culture.Methyl thiazolyl tetrazolium (MTT) assay was performed to evaluate the effect of different doses(0,20,60,80,100,140,240,320 J/cm2)of infrared light on the proliferation of melanocytes and to select the optimal irradiation dose.Then,melanocytes were irradiated with infrared light at the optimal dose for 3 consecutive days followed by the determination of tyrosinase activity,melanin content,and cell cycle via dopa oxidation assay,NaOH solubilization method and flow cytometry

  19. Effect of Supracervical Apposition and Spontaneous Labour on Apoptosis and Matrix Metalloproteinases in Human Fetal Membranes

    Directory of Open Access Journals (Sweden)

    Mahalia Chai

    2013-01-01

    Full Text Available Background. Apoptosis and matrix metalloproteinase (MMP-9 are capable of hydrolysing components of the extracellular matrix and weakening the fetal membranes which leads to eventual rupture, a key process of human parturition. The aim of this study was to determine the effect of supracervical apposition and spontaneous labour on apoptosis and MMP-9 in human fetal membranes at term. Methods. Fetal membranes were obtained from term non-labouring supracervical site (SCS and compared to (i a paired distal site (DS or (ii site of rupture (SOR after spontaneous labour onset. Results. The expression of the proapoptotic markers Bax, Smac, Fas, FasL, caspase-3, and PARP, was significantly higher in the non-labouring SCS chorion compared to paired DS. Bax, Smac, FasL, caspase-3, and PARP staining was higher in the non-labouring SCS fetal membranes than that in the post-labour SOR. MMP-9 expression and activity were higher in the post-labour SOR fetal membranes compared to non-labouring SCS fetal membranes. Conclusion. Components of the apoptotic signalling pathways and MMP-9 may play a role in rupture and labour. Non-labouring SCS fetal membranes display altered morphology and altered apoptotic biochemical characteristics in preparation for labour, while the laboured SOR displays unique MMP characteristics.

  20. The expression pattern of two novel cytokines (IL-24 and IL-29) in human fetal membranes.

    Science.gov (United States)

    Nace, Judith; Fortunato, Stephen J; Maul, Holger; Menon, Ramkumar

    2010-11-01

    interleukin (IL)-24 and -29 are novel cytokines, produced by immune cells in response to microbial antigens. The functions of these cytokines in the reproductive system are unknown. We examined the expression pattern of IL-24 and IL-29 in human fetal membranes from preterm and term births and in in vitro in response to microbial antigens. fetal membranes collected from cesarean sections at term (normal, not in labor) were placed in culture for 48 h. These membranes were then stimulated with bacterial lipopolysaccharide (LPS) or viral antigen poly-inosinic and cytidylic acid (polyIC) for an additional 24 h. Amniotic fluids (AF) and fetal membranes were also collected from preterm and term deliveries. IL-24 and IL-29 expressions were studied by RT-PCR. ELISA documented culture media and AF cytokine concentrations. IL-24 and IL-29 expressions were seen in cultured fetal membranes regardless of stimulation. Expressions were also found in preterm and term labor membranes, but not in non-labor tissues at term. IL-24 concentrations were higher after LPS stimulation whereas IL-29 concentrations were higher after polyIC-stimulation. AF analysis did not detect either of the cytokines either preterm or term. this is the first study to report IL-24 and IL-29 expressions in human fetal membranes. Higher concentrations of these cytokines in response to distinct infectious stimuli suggest different pathways for fetal immune response during infection.

  1. Solution Poisson-Boltzmann equation: Application in the Human Neuron Membrane

    CERN Document Server

    Soares, M A G; Cortez, C M

    2008-01-01

    With already demonstrated in previous work the equations that describe the space dependence of the electric potential are determined by the solution of the equation of Poisson-Boltzmann. In this work we consider these solutions for the membrane of the human neuron, using a model simplified for this structure considering the distribution of electrolytes in each side of the membrane, as well as the effect of glycocalyx and the lipidic bilayer. It was assumed that on both sides of the membrane the charges are homogeneously distributed and that the potential depends only on coordinate z.

  2. TNF-α and Th2 cytokines induce atopic dermatitis-like features on epidermal differentiation proteins and stratum corneum lipids in human skin equivalents.

    Science.gov (United States)

    Danso, Mogbekeloluwa O; van Drongelen, Vincent; Mulder, Aat; van Esch, Jeltje; Scott, Hannah; van Smeden, Jeroen; El Ghalbzouri, Abdoelwaheb; Bouwstra, Joke A

    2014-07-01

    Atopic dermatitis (AD) is a chronic inflammatory skin disease in which the skin barrier function is disrupted. In this inflammatory AD environment, cytokines are upregulated, but the cytokine effect on the AD skin barrier is not fully understood. We aimed to investigate the influence of Th2 (IL-4, IL-13, IL-31) and pro-inflammatory (tumor necrosis factor alpha (TNF-α)) cytokines on epidermal morphogenesis, proliferation, differentiation, and stratum corneum lipid properties. For this purpose, we used the Leiden epidermal model (LEM) in which the medium was supplemented with these cytokines. Our results show that IL-4, IL-13, IL-31, and TNF-α induce spongiosis, augment TSLP secretion by keratinocytes, and alter early and terminal differentiation-protein expression in LEMs. TNF-α alone or in combination with Th2 cytokines decreases the level of long chain free fatty acids (FFAs) and ester linked ω-hydroxy (EO) ceramides, consequently affecting the lipid organization. IL-31 increases long chain FFAs in LEMs but decreases relative abundance of EO ceramides. These findings clearly show that supplementation with TNF-α and Th2 cytokines influence epidermal morphogenesis and barrier function. As a result, these LEMs show similar characteristics as found in AD skin and can be used as an excellent tool for screening formulations and drugs for the treatment of AD.

  3. Placental membrane aging and HMGB1 signaling associated with human parturition

    Science.gov (United States)

    Menon, Ramkumar; Behnia, Faranak; Polettini, Jossimara; Saade, George R; Campisi, Judith; Velarde, Michael

    2016-01-01

    Aging is associated with the onset of several diseases in various organ systems; however, different tissues may age differently, rendering some of them dysfunctional sooner than others. Placental membranes (fetal amniochorionic membranes) protect the fetus throughout pregnancy, but their longevity is limited to the duration of pregnancy. The age-associated dysfunction of these membranes is postulated to trigger parturition. Here, we investigated whether cellular senescence—the loss of cell division potential as a consequence of stress—is involved in placental membrane function at term. We show telomere reduction, p38 MAPK activation, increase in p21 expression, loss of lamin B1 loss, increase in SA-β-galactosidase, and senescence-associated secretory phenotype (SASP) gene expression in placental membranes after labor and delivery (term labor [TL]) compared to membranes prior to labor at term (term, not-in-labor [TNIL]). Exposing TNIL placental membranes to cigarette smoke extract, an oxidative stress inducer, also induced markers of cellular senescence similar to those in TL placental membranes. Bioinformatics analysis of differentially expressed SASP genes revealed HMGB1 signaling among the top pathways involved in labor. Further, we show that recombinant HMGB1 upregulates the expression of genes associated with parturition in myometrial cells. These data suggest that the natural physiologic aging of placental tissues is associated with cellular senescence and human parturition. PMID:26851389

  4. Placental membrane aging and HMGB1 signaling associated with human parturition.

    Science.gov (United States)

    Menon, Ramkumar; Behnia, Faranak; Polettini, Jossimara; Saade, George R; Campisi, Judith; Velarde, Michael

    2016-02-01

    Aging is associated with the onset of several diseases in various organ systems; however, different tissues may age differently, rendering some of them dysfunctional sooner than others. Placental membranes (fetal amniochorionic membranes) protect the fetus throughout pregnancy, but their longevity is limited to the duration of pregnancy. The age-associated dysfunction of these membranes is postulated to trigger parturition. Here, we investigated whether cellular senescence-the loss of cell division potential as a consequence of stress-is involved in placental membrane function at term. We show telomere reduction, p38 MAPK activation, increase in p21 expression, loss of lamin B1 loss, increase in SA-β-galactosidase , and senescence-associated secretory phenotype (SASP) gene expression in placental membranes after labor and delivery (term labor [TL]) compared to membranes prior to labor at term (term, not-in-labor [TNIL]). Exposing TNIL placental membranes to cigarette smoke extract, an oxidative stress inducer, also induced markers of cellular senescence similar to those in TL placental membranes. Bioinformatics analysis of differentially expressed SASP genes revealed HMGB1 signaling among the top pathways involved in labor. Further, we show that recombinant HMGB1 upregulates the expression of genes associated with parturition in myometrial cells. These data suggest that the natural physiologic aging of placental tissues is associated with cellular senescence and human parturition.

  5. Epidermal Langerhans cells rapidly capture and present antigens from C-type lectin-targeting antibodies deposited in the dermis.

    Science.gov (United States)

    Flacher, Vincent; Tripp, Christoph H; Stoitzner, Patrizia; Haid, Bernhard; Ebner, Susanne; Del Frari, Barbara; Koch, Franz; Park, Chae Gyu; Steinman, Ralph M; Idoyaga, Juliana; Romani, Nikolaus

    2010-03-01

    Antigen-presenting cells can capture antigens that are deposited in the skin, including vaccines given subcutaneously. These include different dendritic cells (DCs) such as epidermal Langerhans cells (LCs), dermal DCs, and dermal langerin+ DCs. To evaluate access of dermal antigens to skin DCs, we used mAb to two C-type lectin endocytic receptors, DEC-205/CD205 and langerin/CD207. When applied to murine and human skin explant cultures, these mAbs were efficiently taken up by epidermal LCs. In addition, anti-DEC-205 targeted langerin+ CD103+ and langerin- CD103- mouse dermal DCs. Unexpectedly, intradermal injection of either mAb, but not isotype control, resulted in strong and rapid labeling of LCs in situ, implying that large molecules can diffuse through the basement membrane into the epidermis. Epidermal LCs targeted in vivo by ovalbumin-coupled anti-DEC-205 potently presented antigen to CD4+ and CD8+ T cells in vitro. However, to our surprise, LCs targeted through langerin were unable to trigger T-cell proliferation. Thus, epidermal LCs have a major function in uptake of lectin-binding antibodies under standard vaccination conditions.

  6. Fractionation of human liver mitochondria: enzymic and morphological characterization of the inner and outer membranes as compared to rat liver mitochondria.

    Science.gov (United States)

    Benga, G; Hodarnau, A; Tilinca, R; Porutiu, D; Dancea, S; Pop, V; Wrigglesworth, J

    1979-02-01

    The fractionation of human liver mitochondria into inner membrane, outer membrane and matrix material is reported. Compared with rat, human liver mitochondria are more fragile. Fractionation can be achieved in only 2 steps, a digitonin treatment for removal of the outer membrane and centrifugation of the inner membrane plus matrix particles through a linear sucrose gradient resulting in purified inner membranes and matrix.

  7. Human T Cell Crosstalk Is Induced by Tumor Membrane Transfer

    Science.gov (United States)

    Uzana, Ronny; Eisenberg, Galit; Merims, Sharon; Frankenburg, Shoshana; Pato, Aviad; Yefenof, Eitan; Engelstein, Roni; Peretz, Tamar

    2015-01-01

    Trogocytosis is a contact-dependent unidirectional transfer of membrane fragments between immune effector cells and their targets, initially detected in T cells following interaction with professional antigen presenting cells (APC). Previously, we have demonstrated that trogocytosis also takes place between melanoma-specific cytotoxic T lymphocytes (CTLs) and their cognate tumors. In the present study, we took this finding a step further, focusing on the ability of melanoma membrane-imprinted CD8+ T cells to act as APCs (CD8+T-APCs). We demonstrate that, following trogocytosis, CD8+T-APCs directly present a variety of melanoma derived peptides to fraternal T cells with the same TCR specificity or to T cells with different TCRs. The resulting T cell-T cell immune synapse leads to (1) Activation of effector CTLs, as determined by proliferation, cytokine secretion and degranulation; (2) Fratricide (killing) of CD8+T-APCs by the activated CTLs. Thus, trogocytosis enables cross-reactivity among CD8+ T cells with interchanging roles of effectors and APCs. This dual function of tumor-reactive CTLs may hint at their ability to amplify or restrict reactivity against the tumor and participate in modulation of the anti-cancer immune response. PMID:25671577

  8. Human T cell crosstalk is induced by tumor membrane transfer.

    Directory of Open Access Journals (Sweden)

    Ronny Uzana

    Full Text Available Trogocytosis is a contact-dependent unidirectional transfer of membrane fragments between immune effector cells and their targets, initially detected in T cells following interaction with professional antigen presenting cells (APC. Previously, we have demonstrated that trogocytosis also takes place between melanoma-specific cytotoxic T lymphocytes (CTLs and their cognate tumors. In the present study, we took this finding a step further, focusing on the ability of melanoma membrane-imprinted CD8+ T cells to act as APCs (CD8+ T-APCs. We demonstrate that, following trogocytosis, CD8+ T-APCs directly present a variety of melanoma derived peptides to fraternal T cells with the same TCR specificity or to T cells with different TCRs. The resulting T cell-T cell immune synapse leads to (1 Activation of effector CTLs, as determined by proliferation, cytokine secretion and degranulation; (2 Fratricide (killing of CD8+ T-APCs by the activated CTLs. Thus, trogocytosis enables cross-reactivity among CD8+ T cells with interchanging roles of effectors and APCs. This dual function of tumor-reactive CTLs may hint at their ability to amplify or restrict reactivity against the tumor and participate in modulation of the anti-cancer immune response.

  9. COMPARISON OF IN VITRO AND IN VIVO RESPONSES TO ARSENIC: GENE EXPRESSION PROFILING IN NORMAL HUMAN EPIDERMAL KERATINOCYTES AND HYPERKERATOSES FROM ARSENIC-EXPOSED HUMANS

    Science.gov (United States)

    Chronic exposure to arsenic is positively associated with skin, urinary bladder, lung, liver and kidney cancer development in humans. Elucidating the mode of action of arsenic carcinogenesis is a complicated issue as target cells are exposed to different toxic species of arsenic....

  10. Deorphanizing the human transmembrane genome: A landscape of uncharacterized membrane proteins.

    Science.gov (United States)

    Babcock, Joseph J; Li, Min

    2014-01-01

    The sequencing of the human genome has fueled the last decade of work to functionally characterize genome content. An important subset of genes encodes membrane proteins, which are the targets of many drugs. They reside in lipid bilayers, restricting their endogenous activity to a relatively specialized biochemical environment. Without a reference phenotype, the application of systematic screens to profile candidate membrane proteins is not immediately possible. Bioinformatics has begun to show its effectiveness in focusing the functional characterization of orphan proteins of a particular functional class, such as channels or receptors. Here we discuss integration of experimental and bioinformatics approaches for characterizing the orphan membrane proteome. By analyzing the human genome, a landscape reference for the human transmembrane genome is provided.

  11. Irradiated Human Dermal Fibroblasts Are as Efficient as Mouse Fibroblasts as a Feeder Layer to Improve Human Epidermal Cell Culture Lifespan

    Directory of Open Access Journals (Sweden)

    Lucie Germain

    2013-02-01

    Full Text Available A fibroblast feeder layer is currently the best option for large scale expansion of autologous skin keratinocytes that are to be used for the treatment of severely burned patients. In a clinical context, using a human rather than a mouse feeder layer is desirable to reduce the risk of introducing animal antigens and unknown viruses. This study was designed to evaluate if irradiated human fibroblasts can be used in keratinocyte cultures without affecting their morphological and physiological properties. Keratinocytes were grown either with or without a feeder layer in serum-containing medium. Our results showed that keratinocytes grown either on an irradiated human feeder layer or irradiated 3T3 cells (i3T3 can be cultured for a comparable number of passages. The average epithelial cell size and morphology were also similar. On the other hand, keratinocytes grown without a feeder layer showed heavily bloated cells at early passages and stop proliferating after only a few passages. On the molecular aspect, the expression level of the transcription factor Sp1, a useful marker of keratinocytes lifespan, was maintained and stabilized for a high number of passages in keratinocytes grown with feeder layers whereas Sp1 expression dropped quickly without a feeder layer. Furthermore, gene profiling on microarrays identified potential target genes whose expression is differentially regulated in the absence or presence of an i3T3 feeder layer and which may contribute at preserving the growth characteristics of these cells. Irradiated human dermal fibroblasts therefore provide a good human feeder layer for an effective expansion of keratinocytes in vitro that are to be used for clinical purposes.

  12. Proteomic analysis of membrane microdomains derived from both failing and non-failing human hearts.

    Science.gov (United States)

    Banfi, Cristina; Brioschi, Maura; Wait, Robin; Begum, Shajna; Gianazza, Elisabetta; Fratto, Pasquale; Polvani, Gianluca; Vitali, Ettore; Parolari, Alessandro; Mussoni, Luciana; Tremoli, Elena

    2006-03-01

    Eukaryotic cells plasma membranes are organized into microdomains of specialized function such as lipid rafts and caveolae, with a specific lipid composition highly enriched in cholesterol and glycosphingolipids. In addition to their role in regulating signal transduction, multiple functions have been proposed, such as anchorage of receptors, trafficking of cholesterol, and regulation of permeability. However, an extensive understanding of their protein composition in human heart, both in failing and non-failing conditions, is not yet available. Membrane microdomains were isolated from left ventricular tissue of both failing (n = 15) and non-failing (n = 15) human hearts. Protein composition and differential protein expression was explored by comparing series of 2-D maps and subsequent identification by LC-MS/MS analysis. Data indicated that heart membrane microdomains are enriched in chaperones, cytoskeletal-associated proteins, enzymes and protein involved in signal transduction pathway. In addition, differential protein expression profile revealed that 30 proteins were specifically up- or down-regulated in human heart failure membrane microdomains. This study resulted in the identification of human heart membrane microdomain protein composition, which was not previously available. Moreover, it allowed the identification of multiple proteins whose expression is altered in heart failure, thus opening new perspectives to determine which role they may play in this disease.

  13. Hypertrophic scarring is associated with epidermal abnormalities : An immunohistochemical study

    NARCIS (Netherlands)

    Adriessen, MP; Niessen, FB; Van de Kerkhof, PC; Schalkwijk, J

    1998-01-01

    The role of epidermal keratinocytes in the early phases of normal unimpaired wound healing has been studied extensively. However, little is known about the cell biological processes in the epidermis and the basal membrane zone during the later phases of dermal matrix formation and remodelling of the

  14. Hypertrophic scarring is associated with epidermal abnormalities : An immunohistochemical study

    NARCIS (Netherlands)

    Adriessen, MP; Niessen, FB; Van de Kerkhof, PC; Schalkwijk, J

    1998-01-01

    The role of epidermal keratinocytes in the early phases of normal unimpaired wound healing has been studied extensively. However, little is known about the cell biological processes in the epidermis and the basal membrane zone during the later phases of dermal matrix formation and remodelling of the

  15. Kinetic Evaluation of Cell Membrane Hydrolysis during Apoptosis by Human Isoforms of Secretory Phospholipase A2*

    Science.gov (United States)

    Olson, Erin D.; Nelson, Jennifer; Griffith, Katalyn; Nguyen, Thaothanh; Streeter, Michael; Wilson-Ashworth, Heather A.; Gelb, Michael H.; Judd, Allan M.; Bell, John D.

    2010-01-01

    Some isoforms of secretory phospholipase A2 (sPLA2) distinguish between healthy and damaged or apoptotic cells. This distinction reflects differences in membrane physical properties. Because various sPLA2 isoforms respond differently to properties of artificial membranes such as surface charge, they should also behave differently as these properties evolve during a dynamic physiological process such as apoptosis. To test this idea, S49 lymphoma cell death was induced by glucocorticoid (6–48 h) or calcium ionophore. Rates of membrane hydrolysis catalyzed by various concentrations of snake venom and human groups IIa, V, and X sPLA2 were compared after each treatment condition. The data were analyzed using a model that evaluates the adsorption of enzyme to the membrane surface and subsequent binding of substrate to the active site. Results were compared temporally to changes in membrane biophysics and composition. Under control conditions, membrane hydrolysis was confined to the few unhealthy cells present in each sample. Increased hydrolysis during apoptosis and necrosis appeared to reflect substrate access to adsorbed enzyme for the snake venom and group X isoforms corresponding to weakened lipid-lipid interactions in the membrane. In contrast, apoptosis promoted initial adsorption of human groups V and IIa concurrent with phosphatidylserine exposure on the membrane surface. However, this observation was inadequate to explain the behavior of the groups V and IIa enzymes toward necrotic cells where hydrolysis was reduced or absent. Thus, a combination of changes in cell membrane properties during apoptosis and necrosis capacitates the cell for hydrolysis differently by each isoform. PMID:20139082

  16. The autoimmune regulator (AIRE), which is defective in autoimmune polyendocrinopathy-candidiasis-ectodermal dystrophy patients, is expressed in human epidermal and follicular keratinocytes and associates with the intermediate filament protein cytokeratin 17.

    Science.gov (United States)

    Kumar, Vipul; Pedroza, Luis A; Mace, Emily M; Seeholzer, Steven; Cotsarelis, George; Condino-Neto, Antonio; Payne, Aimee S; Orange, Jordan S

    2011-03-01

    Autoimmune polyendocrinopathy-candidiasis-ectodermal dystrophy (APECED) syndrome, which is caused by mutation of the autoimmune regulator (AIRE) gene, is a highly variable disease characterized by multiple endocrine failure, chronic mucocutaneous candidiasis, and various ectodermal defects. AIRE is a transcriptional regulator classically expressed in medullary thymic epithelial cells, monocytes, macrophages, and dendritic cells. Previous studies have suggested that AIRE can shuttle between the nucleus and cytoplasm of cells, although its cytoplasmic functions are poorly characterized. Through mass spectrometry analysis of proteins co-immunoprecipitating with cytoplasmic AIRE, we identified a novel association of AIRE with the intermediate filament protein cytokeratin 17 (K17) in the THP-1 monocyte cell line. We confirmed AIRE expression in HaCaT epidermal keratinocytes, as well as its interaction with K17. Confocal microscopy of human fetal and adult scalp hair follicles demonstrated a cytoplasmic pattern of AIRE staining that moderately colocalized with K17. The cytoplasmic association of AIRE with the intermediate filament network in human epidermal and follicular keratinocytes may provide a new path to understanding the ectodermal abnormalities associated with the APECED syndrome. Copyright © 2011 American Society for Investigative Pathology. Published by Elsevier Inc. All rights reserved.

  17. Molecular recognition based iron removal from human plasma with imprinted membranes.

    Science.gov (United States)

    Yavuz, H; Andaç, M; Uzun, L; Say, R; Denizli, A

    2006-09-01

    The aim of this study is to prepare ion-imprinted poly(2-hydroxyethyl methacrylate) (HEMA) based membranes which can be used for the selective removal of Fe3+ ions from Fe3+-overdosed human plasma. N-methacryloyl-(L)-glutamic acid (MAGA) was chosen as the ion-complexing monomer. In the first step, Fe3+ was complexed with MAGA and then, the Fe3+-imprinted poly(HEMA-MAGA) membranes were prepared by UV-initiated photo-polymerization of HEMA and MAGA-Fe3+ complex in the presence of an initiator (benzoyl peroxide). After that, the template (i.e., Fe3+ ions) was removed by using 0.1 M EDTA solution at room temperature. The specific surface area of the Fe3+-imprinted poly(HEMA-MAGA) membranes was found to be 49.2 m2/g and the swelling ratio was 92%. According to the elemental analysis results, the polymeric membranes contained 145.7 micromol MAGA/g polymer. The maximum adsorption capacity was 164.2 micromol Fe3+/g membrane. The relative selectivity coefficients of ion-imprinted membranes for Fe3+/Zn2+ and Fe3+/Cr3+ were 12.6 and 62.5 times greater than the non-imprinted matrix, respectively. The Fe3+-imprinted poly(HEMA-MAGA) membranes could be used many times without decreasing their Fe3+ adsorption capacities significantly.

  18. Upregulated expression of La ribonucleoprotein domain family member 6 and collagen type I gene following water-filtered broad-spectrum near-infrared irradiation in a 3-dimensional human epidermal tissue culture model as revealed by microarray analysis.

    Science.gov (United States)

    Tanaka, Yohei; Nakayama, Jun

    2017-02-27

    Water-filtered broad-spectrum near-infrared irradiation can induce various biological effects, as our previous clinical, histological, and biochemical investigations have shown. However, few studies that examined the changes thus induced in gene expression. The aim was to investigate the changes in gene expression in a 3-dimensional reconstructed epidermal tissue culture exposed to water-filtered broad-spectrum near-infrared irradiation. DNA microarray and quantitative real-time polymerase chain reaction (PCR) analysis was used to assess gene expression levels in a 3-dimensional reconstructed epidermal model composed of normal human epidermal cells exposed to water-filtered broad-spectrum near-infrared irradiation. The water filter allowed 1000-1800 nm wavelengths and excluded 1400-1500 nm wavelengths, and cells were exposed to 5 or 10 rounds of near-infrared irradiation at 10 J/cm(2) . A DNA microarray with over 50 000 different probes showed 18 genes that were upregulated or downregulated by at least twofold after irradiation. Quantitative real-time PCR revealed that, relative to control cells, the gene encoding La ribonucleoprotein domain family member 6 (LARP6), which regulates collagen expression, was significantly and dose-dependently upregulated (P < 0.05) by water-filtered broad-spectrum near-infrared exposure. Gene encoding transcripts of collagen type I were significantly upregulated compared with controls (P < 0.05). This study demonstrates the ability of water-filtered broad-spectrum near-infrared irradiation to stimulate the production of type I collagen. © 2017 The Australasian College of Dermatologists.

  19. Interaction of mesoporous silica nanoparticles with human red blood cell membranes: size and surface effects.

    Science.gov (United States)

    Zhao, Yannan; Sun, Xiaoxing; Zhang, Guannan; Trewyn, Brian G; Slowing, Igor I; Lin, Victor S-Y

    2011-02-22

    The interactions of mesoporous silica nanoparticles (MSNs) of different particle sizes and surface properties with human red blood cell (RBC) membranes were investigated by membrane filtration, flow cytometry, and various microscopic techniques. Small MCM-41-type MSNs (∼100 nm) were found to adsorb to the surface of RBCs without disturbing the membrane or morphology. In contrast, adsorption of large SBA-15-type MSNs (∼600 nm) to RBCs induced a strong local membrane deformation leading to spiculation of RBCs, internalization of the particles, and eventual hemolysis. In addition, the relationship between the degree of MSN surface functionalization and the degree of its interaction with RBC, as well as the effect of RBC-MSN interaction on cellular deformability, were investigated. The results presented here provide a better understanding of the mechanisms of RBC-MSN interaction and the hemolytic activity of MSNs and will assist in the rational design of hemocompatible MSNs for intravenous drug delivery and in vivo imaging.

  20. Binding of (/sup 3/H)imipramine to human platelet membranes with compensation for saturable binding to filters and its implication for binding studies with brain membranes

    Energy Technology Data Exchange (ETDEWEB)

    Phillips, O.M.; Wood, K.M.; Williams, D.C.

    1984-08-01

    Apparent specific binding of (/sup 3/H)imipramine to human platelet membranes at high concentrations of imipramine showed deviation from that expected of a single binding site, a result consistent with a low-affinity binding site. The deviation was due to displaceable, saturable binding to the glass fibre filters used in the assays. Imipramine, chloripramine, desipramine, and fluoxetine inhibited binding to filters whereas 5-hydroxytryptamine and ethanol were ineffective. Experimental conditions were developed that eliminated filter binding, allowing assay of high- and low-affinity binding to membranes. Failure to correct for filter binding may lead to overestimation of binding parameters, Bmax and KD for high-affinity binding to membranes, and may also be misinterpreted as indicating a low-affinity binding component in both platelet and brain membranes. Low-affinity binding (KD less than 2 microM) of imipramine to human platelet membranes was demonstrated and its significance discussed.

  1. Progesterone Inhibits Human Myometrial Contractions by Action on Membrane Receptors

    Directory of Open Access Journals (Sweden)

    Remzi Gokdeniz

    2013-02-01

    Full Text Available Background: The mechanisms for myometrial inhibition are still being investigated Aim: To examine mechanisms of progesterone (P4 inhibition of uterine contractility. Methods: Prospective study Tertiary care center at St. Joseph’s Hospital and at Maricopa Hospital, Phoenix, AZ and research center in Arizona, USA. During 2010-2011, 24 women given birth by cesarean section. Uterine tissues from women (n=24 at term were suspended in organ chambers and exposed to various agents. Contractility was registered and compared before and after addition of agents. Tissues were treated with P4 alone, a progestin (R5020 with low affinity to the progesterone membrane receptor (mPR, or a non-sex steroid (cholesterol. Other tissues were pretreated with inhibitors of adenylate cyclase (SQ 22536, phosphodiesterase (rolipram, nitric oxide (NO synthases (L-NAME or a nuclear P4 receptor antagonist (mifepristone, MIF, followed by P4. Data were analyzed by ANOVA. Results: P4 (P0.05 inhibitory effects. P4 inhibition is not blocked by MIF, SQ, ODQ, rolipram or L-NAME (P>0.05. Conclusions: P4 rapidly inhibits myometrial contractility by nongenomic mechanisms through action on mPR but not via cAMP, cGMP, or NO [Cukurova Med J 2013; 38(1.000: 92-102

  2. The synthesis and characterization of cellular membrane affinity chromatography columns for the study of human multidrug resistant proteins MRP1, MRP2 and human breast cancer resistant protein BCRP using membranes obtained from Spodoptera frugiperda (Sf9) insect cells

    OpenAIRE

    Bhatia, Prateek A.; Moaddel, Ruin; Wainer, Irving W.

    2010-01-01

    CMAC (cellular membrane affinity chromatography columns) have been developed for the study of the human multidrug transporters MRP1, MRP2 and the breast cancer resistance protein (BCRP). The columns were constructed using the immobilized artificial membrane (IAM) stationary phase and cellular membrane fragments obtained from Spodopetra frugiperda (Sf9) cells that had been stably transfected with human Mrp1, Mrp2 or Bcrp c-DNA, using a baculovirus expression system. The resulting CMAC(Sf9MRP1)...

  3. Human membrane transporter database: a Web-accessible relational database for drug transport studies and pharmacogenomics.

    Science.gov (United States)

    Yan, Q; Sadée, W

    2000-01-01

    The human genome contains numerous genes that encode membrane transporters and related proteins. For drug discovery, development, and targeting, one needs to know which transporters play a role in drug disposition and effects. Moreover, genetic polymorphisms in human membrane transporters may contribute to interindividual differences in the response to drugs. Pharmacogenetics, and, on a genome-wide basis, pharmacogenomics, address the effect of genetic variants on an individual's response to drugs and xenobiotics. However, our knowledge of the relevant transporters is limited at present. To facilitate the study of drug transporters on a broad scale, including the use of microarray technology, we have constructed a human membrane transporter database (HMTD). Even though it is still largely incomplete, the database contains information on more than 250 human membrane transporters, such as sequence, gene family, structure, function, substrate, tissue distribution, and genetic disorders associated with transporter polymorphisms. Readers are invited to submit additional data. Implemented as a relational database, HMTD supports complex biological queries. Accessible through a Web browser user interface via Common Gateway Interface (CGI) and Java Database Connection (JDBC), HMTD also provides useful links and references, allowing interactive searching and downloading of data. Taking advantage of the features of an electronic journal, this paper serves as an interactive tutorial for using the database, which we expect to develop into a research tool.

  4. Parallel artificial liquid membrane extraction of acidic drugs from human plasma

    DEFF Research Database (Denmark)

    Roldan-Pijuan, Mercedes; Pedersen-Bjergaard, Stig; Gjelstad, Astrid

    2015-01-01

    The new sample preparation concept “Parallel artificial liquid membrane extraction (PALME)” was evaluated for extraction of the acidic drugs ketoprofen, fenoprofen, diclofenac, flurbiprofen, ibuprofen, and gemfibrozil from human plasma samples. Plasma samples (250 μL) were loaded into individual...

  5. ADENOSINE-TRIPHOSPHATE DEPENDENT TAUROCHOLATE TRANSPORT IN HUMAN LIVER PLASMA-MEMBRANES

    NARCIS (Netherlands)

    WOLTERS, H; KUIPERS, F; SLOOFF, MJH; VONK, RJ

    1992-01-01

    Transport systems involved in uptake and biliary secretion of bile salts have been extensively studied in rat liver; however, little is known about these systems in the human liver. In this study, we investigated taurocholate (TC) transport in canalicular and basolateral plasma membrane vesicles iso

  6. Proteome profiling of human neutrophil granule subsets, secretory vesicles, and cell membrane

    DEFF Research Database (Denmark)

    Rørvig, Sara; Østergaard, Ole; Heegaard, Niels Henrik Helweg;

    2013-01-01

    granules, SVs, and plasma membrane has been performed before. Here, we performed subcellular fractionation on freshly isolated human neutrophils by nitrogen cavitation and density centrifugation on a four-layer Percoll gradient. Granule subsets were pooled and subjected to SDS-PAGE, and gel pieces were in...

  7. Multifractal characterization of morphology of human red blood cells membrane skeleton.

    Science.gov (United States)

    Ţălu, Ş; Stach, S; Kaczmarska, M; Fornal, M; Grodzicki, T; Pohorecki, W; Burda, K

    2016-04-01

    The purpose of this paper is to show applicability of multifractal analysis in investigations of the morphological changes of ultra-structures of red blood cells (RBCs) membrane skeleton measured using atomic force microscopy (AFM). Human RBCs obtained from healthy and hypertensive donors as well as healthy erythrocytes irradiated with neutrons (45 μGy) were studied. The membrane skeleton of the cells was imaged using AFM in a contact mode. Morphological characterization of the three-dimensional RBC surfaces was realized by a multifractal method. The nanometre scale study of human RBCs surface morphology revealed a multifractal geometry. The generalized dimensions Dq and the singularity spectrum f(α) provided quantitative values that characterize the local scale properties of their membrane skeleton organization. Surface characterization was made using areal ISO 25178-2: 2012 topography parameters in combination with AFM topography measurement. The surface structure of human RBCs is complex with hierarchical substructures resulting from the organization of the erythrocyte membrane skeleton. The analysed AFM images confirm a multifractal nature of the surface that could be useful in histology to quantify human RBC architectural changes associated with different disease states. In case of very precise measurements when the red cell surface is not wrinkled even very fine differences can be uncovered as was shown for the erythrocytes treated with a very low dose of ionizing radiation.

  8. Ultrastructural observations and preparation of cultured human epidermal melanocytes' samples%体外培养人表皮黑素细胞样本制备及超微结构观察

    Institute of Scientific and Technical Information of China (English)

    徐丹丹; 陈玮莹; 李伟秋; 方斌; 黄清霞; 梁伟全; 梁彦; 钟耀棠; 王腾彬; 周远军

    2012-01-01

    Purpose To investigate the preparation methods of TEM samples for cultured human epidermal melanocytes and to observe the ultrastructures of the cells. Methods Melanocytes were isolated from children s foreskins and cultured in M254 medium that was supplemented with human melanocyte growth supplement. Purified melanocytes were harvested from culture flask and TEM sample was prepared by conventional method, or cultured on PET film and allowed to attach and then TEM sample was prepared, respectively. Results Transmission electron microscopy showed that the ultrastructure of melanocytes and dendrites in transverse section were observed in samples prepared with conventional method. The intact ultrastructure of melanocytes and their dendrites could be observed in longitudinal section while PET film was applied as cellular support. Conclusions The PET film is an excellent cellular supporting material for the cultivation of human epidermal melanocytes. The ultrastructures of human epidermal melanocytes could be observed in samples prepared in different ways. But the sample that using PET film as cellular support is much beneficial for the ultrastructural observation of metabolism and transferring of melanosome in melanocytes.%目的 探讨体外培养正常人表皮黑素细胞(melanocytes,MC)透射电镜制样方法及超微结构观察的作用.方法 采用M254 MC培养基及添加剂HMGS培养和纯化人表皮MC;分别采用常规制样方法和以PET聚酯薄膜为培养细胞的支持物制备透射电镜样本.结果 人表皮MC透射电镜观察发现,常规制样标本可观察人表皮MC及其树状突起横切面的超微结构.PET聚酯薄膜作为培养MC支持物的样本可观察人表皮MC和树状突起的完整超微结构及树状突起的纵切面超微结构.结论 PET聚酯薄膜可作为人表皮MC体外培养良好的支持材料.应用不同样本制备方法可以观察MC的超微结构,使用PET聚酯薄膜作为细胞支持物制备的标本

  9. Identification of Goodpasture target antigens in basement membranes of human glomeruli, lung, and placenta.

    Science.gov (United States)

    Weber, M; Köhler, H; Manns, M; Baum, H P; Meyer zum Büschenfelde, K H

    1987-01-01

    Collagenase-digests of human glomerular (GBM), alveolar (ABM), and placenta basement membranes (PBM) were separated by gel filtration columns and the pools rich in Goodpasture antigens (GP) were identified by an antibody inhibition-ELISA. Sodium dodecyl sulphate-polyacrylamide gel electrophoresis (SDS-PAGE) followed by immunoblotting on nitrocellulose membranes was performed with each basement membrane preparation. Sera from patients with florid GP-syndrome and antibodies to glomerular basement membrane (anti-GBM antibodies) were incubated with nitrocellulose strips of GBM, ABM, and PBM. Immunoperoxidase staining revealed reactivity with target antigens of 24, 26, 44, and 50 kD in the GBM and of 44 and 50 kD in the ABM and PBM, respectively. No corresponding reactivity was observed using convalescent GP-sera, sera from patients with other immunological diseases or sera from healthy blood donors. The antigens were sensitive to reduction. We conclude, that antigens of similar molecular-weights can be identified by anti-GBM positive sera in human glomerular, alveolar and placenta basement membranes. Images Fig. 1 Fig. 2 Fig. 3 Fig. 4 PMID:3608225

  10. Effect of pH and temperature on the binding of bilirubin to human erythrocyte membranes

    Indian Academy of Sciences (India)

    H Rashid; Mohammad K Ali; S Tayyab

    2000-06-01

    Effect of pH and temperature on the binding of bilirubin to human erythrocyte membranes was studied by incubating the membranes at different pH and temperatures and determining the bound bilirubin. At all pH values, the amount of membrane-bound bilirubin increased with the increase in bilirubin-to-albumin molar ratios (B/As), being highest at lower pH values in all cases. Further, linear increase in bound bilirubin with the increase in bilirubin concentration in the incubate was observed at a constant B/A and at all pH values. However, the slope value increased with the decrease in pH suggesting more bilirubin binding to membranes at lower pH values. Increase in bilirubin binding at lower pH can be explained on the basis of increased free bilirubin concentration as well as more conversion of bilirubin dianion to monoanion. Temperature dependence of bilirubin binding to membranes was observed within the temperature range of 7°–60°C, showing minimum binding at 27°C and 37°C which increased on either side. Increase in bilirubin binding at temperatures lower than 20°C and higher than 40°C can be ascribed to the change in membrane topography as well as bilirubin-albumin interaction.

  11. Structural characterization of membrane-bound human immunodeficiency virus-1 Gag matrix with neutron reflectometry

    Science.gov (United States)

    Eells, Rebecca; Barros, Marilia; Scott, Kerry M.; Karageorgos, Ioannis; Heinrich, Frank; Lösche, Mathias

    2017-01-01

    The structural characterization of peripheral membrane proteins represents a tremendous challenge in structural biology due to their transient interaction with the membrane and the potential multitude of protein conformations during this interaction. Neutron reflectometry is uniquely suited to address this problem because of its ability to structurally characterize biological model systems nondestructively and under biomimetic conditions that retain full protein functionality. Being sensitive to only the membrane-bound fraction of a water-soluble peripheral protein, neutron reflectometry obtains a low-resolution average structure of the protein-membrane complex that is further refined using integrative modeling strategies. Here, the authors review the current technological state of biological neutron reflectometry exemplified by a detailed report on the structure determination of the myristoylated human immunodeficiency virus-1 (HIV-1) Gag matrix associated with phosphoserine-containing model membranes. The authors found that the HIV-1 Gag matrix is able to adopt different configurations at the membrane in a pH-dependent manner and that the myristate group orients the protein in a way that is conducive to PIP2-binding. PMID:28511544

  12. A kinetic model for the effects of vanadate on human erythrocyte membrane

    Institute of Scientific and Technical Information of China (English)

    张天蓝; 王夔

    1999-01-01

    The effects of vanadate on human erythrocyte membrane have been investigated with stopped-flow and equilibrium fluorescence quenching techniques. The equilibrium study showed a half-quenching concentration (K1/2) of 0.27 mmol·L-1. The stopped-flow experiment exhibited a fast rise (t1、2f~1s) and a slow drop (t1/2s 1~2 min) in fluorescence. Based on the results and that from the across membrane transport of vanadate, a kinetic model is proposed which suggests that the membrane proteins experience a series of conformational changes before and during the quenching of the intrinsic fluorescence. These changes are induced mainly by three kinds of interactions: (i) the long-distance, non-specific interaction between the vanadate and the erythrocyte membrane surface, (ⅱ) the charge interaction between the vanadate and parts of the membrane proteins, and(ⅲ) the binding of the vanadate to some membrane proteins.

  13. Membrane androgen binding sites are preferentially expressed in human prostate carcinoma cells

    Directory of Open Access Journals (Sweden)

    Delakas Dimitrios

    2003-01-01

    Full Text Available Abstract Background Prostate cancer is one of the most frequent malignancies in males. Nevertheless, to this moment, there is no specific routine diagnostic marker to be used in clinical practice. Recently, the identification of a membrane testosterone binding site involved in the remodeling of actin cytoskeleton structures and PSA secretion, on LNCaP human prostate cancer cells has been reported. We have investigated whether this membrane testosterone binding component could be of value for the identification of prostate cancer. Methods Using a non-internalizable testosterone-BSA-FITC analog, proven to bind on membrane sites only in LNCaP cells, we have investigated the expression of membrane testosterone binding sites in a series of prostate carcinomas (n = 14, morphologically normal epithelia, taken from areas of the surgical specimens far from the location of the carcinomas (n = 8 and benign prostate hyperplasia epithelia (n = 10. Isolated epithelial cells were studied by flow cytometry, and touching preparations, after 10-min incubation. In addition, routine histological slides were assayed by confocal laser microscopy. Results We show that membrane testosterone binding sites are preferentially expressed in prostate carcinoma cells, while BPH and non-malignant epithelial cells show a low or absent binding. Conclusions Our results indicate that membrane testosterone receptors might be of use for the rapid routine identification of prostate cancer, representing a new diagnostic marker of the disease.

  14. Epidermal Growth Factor and Intestinal Barrier Function

    Directory of Open Access Journals (Sweden)

    Xiaopeng Tang

    2016-01-01

    Full Text Available Epidermal growth factor (EGF is a 53-amino acid peptide that plays an important role in regulating cell growth, survival, migration, apoptosis, proliferation, and differentiation. In addition, EGF has been established to be an effective intestinal regulator helping to protect intestinal barrier integrity, which was essential for the absorption of nutrients and health in humans and animals. Several researches have demonstrated that EGF via binding to the EGF receptor and subsequent activation of Ras/MAPK, PI3K/AKT, PLC-γ/PKC, and STATS signal pathways regulates intestinal barrier function. In this review, the relationship between epidermal growth factor and intestinal development and intestinal barrier is described, to provide a better understanding of the effects of EGF on intestine development and health.

  15. Melatonin enhances mitochondrial ATP synthesis, reduces reactive oxygen species formation, and mediates translocation of the nuclear erythroid 2-related factor 2 resulting in activation of phase-2 antioxidant enzymes (γ-GCS, HO-1, NQO1) in ultraviolet radiation-treated normal human epidermal keratinocytes (NHEK).

    Science.gov (United States)

    Kleszczyński, Konrad; Zillikens, Detlef; Fischer, Tobias W

    2016-09-01

    Melatonin is an ubiquitous molecule with a variety of functions including potent antioxidative properties. Due to its lipophilic character, it easily crosses cellular and intracellular membranes and reaches all subcellular organelles. Because of its ability to scavenge free radicals, melatonin protects against oxidative stress, for example, induced by ultraviolet radiation (UVR). Here, we investigated, in a dose-dependent (0, 10, 25, and 50 mJ/cm(2) ) and time-dependent (0, 4, 24, 48 hr post-UVR) manner, whether melatonin prevents the UVR-mediated alterations in ATP synthesis and the generation of reactive oxygen species (ROS) in normal human epidermal keratinocytes (NHEK). Additionally, we evaluated the molecular mechanism of action of melatonin with regard to activation of phase-2 antioxidative enzymes via nuclear erythroid 2-related factor (Nrf2). We found that (i) melatonin counteracted UVR-induced alterations in the ATP synthesis and reduced free radical formation; (ii) melatonin induced the translocation of Nrf2 transcription factor from the cytosol into the nucleus resulting in, (iii) melatonin enhanced gene expression of phase-2 antioxidative enzymes including γ-glutamylcysteine synthetase (γ-GCS), heme oxygenase-1 (HO-1), and NADPH: quinone dehydrogenase-1 (NQO1) representing an elevated antioxidative response of keratinocytes. These results suggest that melatonin not only directly scavenges ROS, but also significantly induces the activation of phase-2 antioxidative enzymes via the Nrf2 pathway uncovering a new action mechanism that supports the ability of keratinocytes to protect themselves from UVR-mediated oxidative stress.

  16. Development of synovial membrane in the temporomandibular joint of the human fetus

    Directory of Open Access Journals (Sweden)

    L.O. Carvalho de Moraes

    2015-11-01

    Full Text Available The development of the synovial membrane was analyzed in serial sections of 21 temporomandibular joints of human fetuses at 9 to 13 weeks of gestation. Sections of two fetuses at 12 weeks of development were used to perform immunohistochemical expression of the markers CD68 and Hsp27 on the synovial lining. Macrophage-like type A and fibroblast-like type B cells, which express CD68 and Hsp27, respectively, were observed at the twelfth week of development. Our results suggest that the development of the synovial membrane is related to the vascularization of the joint and the formation of the articular cavities.

  17. Development of synovial membrane in the temporomandibular joint of the human fetus.

    Science.gov (United States)

    Carvalho de Moraes, L O; Tedesco, R C; Arraez-Aybar, L A; Klein, O; Mérida-Velasco, J R; Alonso, L G

    2015-11-26

    The development of the synovial membrane was analyzed in serial sections of 21 temporomandibular joints of human fetuses at 9 to 13 weeks of gestation. Sections of two fetuses at 12 weeks of development were used to perform immunohistochemical expression of the markers CD68 and Hsp27 on the synovial lining. Macrophage-like type A and fibroblast-like type B cells, which express CD68 and Hsp27, respectively, were observed at the twelfth week of development. Our results suggest that the development of the synovial membrane is related to the vascularization of the joint and the formation of the articular cavities.

  18. EXPRESSION OF EPIDERMAL GROWTH FACTOR RECEPTOR IN DIFFERENT SALIVARY ADENOID CYSTIC CARCINOMA CELL LINES

    Institute of Scientific and Technical Information of China (English)

    MA Jie; ZONG Zhi-hong; WANG Zhao-yuan

    2005-01-01

    Objective: To investigate the expression of epidermal growth factor receptor, a receptor tyrosine protein kinase, in the subcellular fractions of human salivary adenoid cystic carcinoma cell lines SACC-83 and SACC-LM. Methods: Low metastatic and high metastatic cells of the adenoid cystic carcinoma, SACC-83 and SACC-LM, were cultured. Their subcellular fractions were extracted. The expression of epidermal growth factor receptor was detected with Western blot method, and the results of protein expression were quantitatively analyzed by FluorChem V2.0 software. Results: The results of Western blot analysis indicated that, EGFR expression on the membrane of SACC-83 cells was significantly higher than that of SACC-LM cells, but its expression in cytoplasm was significantly less in the former than the later (P<0.01). In SACC-83 cell line, EGFR was over-expressed in membrane (P<0.01), but in SACC-LM cell line, EGFR was over-expressed in cytoplasm (P<0.01). Conclusion: The results suggest that the obtaining of metastasis ability is related to the high expression of EGFR protein in cytoplasm, so the molecular targeting therapy to EGFR may be an ideal treatment for the invasion and metastasis of salivary adenoid cystic carcinoma.

  19. Effect of the Human Amniotic Membrane on Liver Regeneration in Rats

    Science.gov (United States)

    Sipahi, Mesut; Şahin, Sevinç; Arslan, Ergin; Börekci, Hasan; Metin, Bayram; Cantürk, Nuh Zafer

    2015-01-01

    Introduction. Operations are performed for broader liver surgery indications for a better understanding of hepatic anatomy/physiology and developments in operation technology. Surgery can cure some patients with liver metastasis of some tumors. Nevertheless, postoperative liver failure is the most feared complication causing mortality in patients who have undergone excision of a large liver mass. The human amniotic membrane has regenerative effects. Thus, we investigated the effects of the human amniotic membrane on regeneration of the resected liver. Methods. Twenty female Wistar albino rats were divided into control and experimental groups and underwent a 70% hepatectomy. The human amniotic membrane was placed over the residual liver in the experimental group. Relative liver weight, histopathological features, and biochemical parameters were assessed on postoperative day 3. Results. Total protein and albumin levels were significantly lower in the experimental group than in the control group. No difference in relative liver weight was observed between the groups. Hepatocyte mitotic count was significantly higher in the experimental group than in the control group. Hepatic steatosis was detected in the experimental group. Conclusion. Applying the amniotic membrane to residual liver adversely affected liver regeneration. However, mesenchymal stem cell research has the potential to accelerate liver regeneration investigations. PMID:26457000

  20. Deoxygenation Affects Composition of Membrane-Bound Proteins in Human Erythrocytes

    Directory of Open Access Journals (Sweden)

    Oksana G. Luneva

    2016-06-01

    Full Text Available Background/Aims: ATP release from erythrocyte plays a key role in hypoxia-induced elevation of blood flow in systematic circulation. We have previously shown that hemolysis contributes to erythrocyte ATP release triggered by several stimuli, including hypoxia, but the molecular mechanisms of hypoxia-increased membrane fragility remain unknown. Methods: In this study, we compared the action of hypoxia on hemolysis, ATP release and the composition of membrane-bound proteins in human erythrocytes. Results: Twenty minutes incubation of human erythrocytes in the oxygen-free environment increased the content of extracellular hemoglobin by ∼1.5 fold. Paired measurements of hemoglobin and ATP content in the same samples, showed a positive correlation between hemolysis and ATP release. Comparative analysis of SDS-PAGE electrophoresis of erythrocyte ghosts obtained under control and deoxygenated conditions revealed a ∼2-fold elevation of the content of membrane-bound protein with Mr of ∼60 kDa. Conclusion: Deoxygenation of human erythrocytes affects composition of membrane-bound proteins. Additional experiments should be performed to identify the molecular origin of 60 kDa protein and its role in the attenuation of erythrocyte integrity and ATP release in hypoxic conditions.

  1. Effect of the Human Amniotic Membrane on Liver Regeneration in Rats

    Directory of Open Access Journals (Sweden)

    Mesut Sipahi

    2015-01-01

    Full Text Available Introduction. Operations are performed for broader liver surgery indications for a better understanding of hepatic anatomy/physiology and developments in operation technology. Surgery can cure some patients with liver metastasis of some tumors. Nevertheless, postoperative liver failure is the most feared complication causing mortality in patients who have undergone excision of a large liver mass. The human amniotic membrane has regenerative effects. Thus, we investigated the effects of the human amniotic membrane on regeneration of the resected liver. Methods. Twenty female Wistar albino rats were divided into control and experimental groups and underwent a 70% hepatectomy. The human amniotic membrane was placed over the residual liver in the experimental group. Relative liver weight, histopathological features, and biochemical parameters were assessed on postoperative day 3. Results. Total protein and albumin levels were significantly lower in the experimental group than in the control group. No difference in relative liver weight was observed between the groups. Hepatocyte mitotic count was significantly higher in the experimental group than in the control group. Hepatic steatosis was detected in the experimental group. Conclusion. Applying the amniotic membrane to residual liver adversely affected liver regeneration. However, mesenchymal stem cell research has the potential to accelerate liver regeneration investigations.

  2. Human Metapneumovirus Is Capable of Entering Cells by Fusion with Endosomal Membranes.

    Directory of Open Access Journals (Sweden)

    Reagan G Cox

    2015-12-01

    Full Text Available Human metapneumovirus (HMPV, a member of the Paramyxoviridae family, is a leading cause of lower respiratory illness. Although receptor binding is thought to initiate fusion at the plasma membrane for paramyxoviruses, the entry mechanism for HMPV is largely uncharacterized. Here we sought to determine whether HMPV initiates fusion at the plasma membrane or following internalization. To study the HMPV entry process in human bronchial epithelial (BEAS-2B cells, we used fluorescence microscopy, an R18-dequenching fusion assay, and developed a quantitative, fluorescence microscopy assay to follow virus binding, internalization, membrane fusion, and visualize the cellular site of HMPV fusion. We found that HMPV particles are internalized into human bronchial epithelial cells before fusing with endosomes. Using chemical inhibitors and RNA interference, we determined that HMPV particles are internalized via clathrin-mediated endocytosis in a dynamin-dependent manner. HMPV fusion and productive infection are promoted by RGD-binding integrin engagement, internalization, actin polymerization, and dynamin. Further, HMPV fusion is pH-independent, although infection with rare strains is modestly inhibited by RNA interference or chemical inhibition of endosomal acidification. Thus, HMPV can enter via endocytosis, but the viral fusion machinery is not triggered by low pH. Together, our results indicate that HMPV is capable of entering host cells by multiple pathways, including membrane fusion from endosomal compartments.

  3. Amino acid composition analysis of human secondary transport proteins and implications for reliable membrane topology prediction.

    Science.gov (United States)

    Saidijam, Massoud; Azizpour, Sonia; Patching, Simon G

    2016-07-08

    Secondary transporters in humans are a large group of proteins that transport a wide range of ions, metals, organic and inorganic solutes involved in energy transduction, control of membrane potential and osmotic balance, metabolic processes and in the absorption or efflux of drugs and xenobiotics. They are also emerging as important targets for development of new drugs and as target sites for drug delivery to specific organs or tissues. We have performed amino acid composition (AAC) and phylogenetic analyses and membrane topology predictions for 336 human secondary transport proteins and used the results to confirm protein classification and to look for trends and correlations with structural domains and specific substrates and/or function. Some proteins showed statistically high contents of individual amino acids or of groups of amino acids with similar physicochemical properties. One recurring trend was a correlation between high contents of charged and/or polar residues with misleading results in predictions of membrane topology, which was especially prevalent in Mitochondrial Carrier family proteins. We demonstrate how charged or polar residues located in the middle of transmembrane helices can interfere with their identification by membrane topology tools resulting in missed helices in the prediction. Comparison of AAC in the human proteins with that in 235 secondary transport proteins from Escherichia coli revealed similar overall trends along with differences in average contents for some individual amino acids and groups of similar amino acids that are presumed to result from a greater number of functions and complexity in the higher organism.

  4. Unique membrane properties and enhanced signal processing in human neocortical neurons

    Science.gov (United States)

    Eyal, Guy; Verhoog, Matthijs B; Testa-Silva, Guilherme; Deitcher, Yair; Lodder, Johannes C; Benavides-Piccione, Ruth; Morales, Juan; DeFelipe, Javier; de Kock, Christiaan PJ; Mansvelder, Huibert D; Segev, Idan

    2016-01-01

    The advanced cognitive capabilities of the human brain are often attributed to our recently evolved neocortex. However, it is not known whether the basic building blocks of the human neocortex, the pyramidal neurons, possess unique biophysical properties that might impact on cortical computations. Here we show that layer 2/3 pyramidal neurons from human temporal cortex (HL2/3 PCs) have a specific membrane capacitance (Cm) of ~0.5 µF/cm2, half of the commonly accepted 'universal' value (~1 µF/cm2) for biological membranes. This finding was predicted by fitting in vitro voltage transients to theoretical transients then validated by direct measurement of Cm in nucleated patch experiments. Models of 3D reconstructed HL2/3 PCs demonstrated that such low Cm value significantly enhances both synaptic charge-transfer from dendrites to soma and spike propagation along the axon. This is the first demonstration that human cortical neurons have distinctive membrane properties, suggesting important implications for signal processing in human neocortex. DOI: http://dx.doi.org/10.7554/eLife.16553.001 PMID:27710767

  5. Transport of 3-bromopyruvate across the human erythrocyte membrane.

    Science.gov (United States)

    Sadowska-Bartosz, Izabela; Soszyński, Mirosław; Ułaszewski, Stanisław; Ko, Young; Bartosz, Grzegorz

    2014-06-01

    3-Bromopyruvic acid (3-BP) is a promising anticancer compound because it is a strong inhibitor of glycolytic enzymes, especially glyceraldehyde 3-phosphate dehydrogenase. The Warburg effect means that malignant cells are much more dependent on glycolysis than normal cells. Potential complications of anticancer therapy with 3-BP are side effects due to its interaction with normal cells, especially erythrocytes. Transport into cells is critical for 3-BP to have intracellular effects. The aim of our study was the kinetic characterization of 3-BP transport into human erythrocytes. 3-BP uptake by erythrocytes was linear within the first 3 min and pH-dependent. The transport rate decreased with increasing pH in the range of 6.0-8.0. The Km and Vm values for 3-BP transport were 0.89 mM and 0.94 mmol/(l cells x min), respectively. The transport was inhibited competitively by pyruvate and significantly inhibited by DIDS, SITS, and 1-cyano-4-hydroxycinnamic acid. Flavonoids also inhibited 3-BP transport: the most potent inhibition was found for luteolin and quercetin.

  6. Targeting epidermal Langerhans cells by epidermal powder immunization

    Institute of Scientific and Technical Information of China (English)

    2002-01-01

    Immune reactions to foreign or self-antigens lead to protective immunity and, sometimes, immune disorders such as allergies and autoimmune diseases. Antigen presenting cells (APC) including epidermal Langerhans cells (LCs) play an important role in the course and outcome of the immune reactions. Epidermal powder immunization (EPI) is a technology that offers a tool to manipulate the LCs and the potential to harness the immune reactions towards prevention and treatment of infectious diseases and immune disorders.

  7. Targeting of a Transporter to the Outer Apicoplast Membrane in the Human Malaria Parasite Plasmodium falciparum

    Science.gov (United States)

    Goodman, Christopher D.; McFadden, Geoffrey I.

    2016-01-01

    Apicoplasts are vestigial plastids in apicomplexan parasites like Plasmodium, the causative agent of malaria. Apicomplexan parasites are dependant on their apicoplasts for synthesis of various molecules that they are unable to scavenge in sufficient quantity from their host, which makes apicoplasts attractive drug targets. Proteins known as plastid phosphate translocators (pPTs) are embedded in the outer apicoplast membrane and are responsible for the import of carbon, energy and reducing power to drive anabolic synthesis in the organelle. We investigated how a pPT is targeted into the outer apicoplast membrane of the human malaria parasite P. falciparum. We showed that a transmembrane domain is likely to act as a recessed signal anchor to direct the protein into the endomembrane system, and that a tyrosine in the cytosolic N-terminus of the protein is essential for targeting, but one or more, as yet unidentified, factors are also essential to direct the protein into the outer apicoplast membrane. PMID:27442138

  8. Targeting of a Transporter to the Outer Apicoplast Membrane in the Human Malaria Parasite Plasmodium falciparum.

    Directory of Open Access Journals (Sweden)

    Liting Lim

    Full Text Available Apicoplasts are vestigial plastids in apicomplexan parasites like Plasmodium, the causative agent of malaria. Apicomplexan parasites are dependant on their apicoplasts for synthesis of various molecules that they are unable to scavenge in sufficient quantity from their host, which makes apicoplasts attractive drug targets. Proteins known as plastid phosphate translocators (pPTs are embedded in the outer apicoplast membrane and are responsible for the import of carbon, energy and reducing power to drive anabolic synthesis in the organelle. We investigated how a pPT is targeted into the outer apicoplast membrane of the human malaria parasite P. falciparum. We showed that a transmembrane domain is likely to act as a recessed signal anchor to direct the protein into the endomembrane system, and that a tyrosine in the cytosolic N-terminus of the protein is essential for targeting, but one or more, as yet unidentified, factors are also essential to direct the protein into the outer apicoplast membrane.

  9. The insecticide DDT decreases membrane potential and cell input resistance of cultured human liver cells.

    Science.gov (United States)

    Schefczik, K; Buff, K

    1984-10-03

    The resting membrane potential, Em, and the cell input resistance, Rinp, of cultured human Chang liver cells were measured using the single electrode 'double-pulse' current clamp technique, following exposure of the cells to the insecticide DDT (20 microM). In control (unexposed) cells, the mean Em was -24 mV, and the mean Rinp was 30 M omega. Neither parameter was significantly impaired after 1 h of cell exposure to DDT. But after 7 and 48 h, the Em was depolarized by 15 and 25 mV, respectively, in parallel with a decrease of the cell input resistance. The strongly time-delayed effect of DDT on Chang liver cell membranes may indicate a mode of interaction different from excitable membranes.

  10. Angiogenic Potential of Human Neonatal Foreskin Stromal Cells in the Chick Embryo Chorioallantoic Membrane Model

    Directory of Open Access Journals (Sweden)

    Radhakrishnan Vishnubalaji

    2015-01-01

    Full Text Available Several studies have demonstrated the multipotentiality of human neonatal foreskin stromal cells (hNSSCs as being able to differentiate into adipocytes and osteoblasts and potentially other cell types. Recently, we demonstrated that hNSSCs play a role during in vitro angiogenesis and appear to possess a capacity to differentiate into endothelial-like cells; however, their angiogenic potential within an ex vivo environment remains unclear. Current study shows hNSSCs to display significant migration potential in the undifferentiated state and high responsiveness in the in vitro wound healing scratch assay. When hNSSCs were seeded onto the top of the CAM, human von Willebrand factor (hVWF, CD31, smooth muscle actin (SMA, and factor XIIIa positive cells were observed in the chick endothelium. CAMs transplanted with endothelial-differentiated hNSSCs displayed a higher number of blood vessels containing hNSSCs compared to CAMs transplanted with undifferentiated hNSSCs. Interestingly, undifferentiated hNSSCs showed a propensity to differentiate towards ectoderm with indication of epidermal formation with cells positive for CD1a, CK5/6, CK19, FXIIIa, and S-100 cells, which warrant further investigation. Our findings imply a potential angiogenic role for hNSSCs ex vivo in the differentiated and undifferentiated state, with potential contribution to blood vessel formation and potential application in tissue regeneration and vascularization.

  11. Construction of Plant Expression Vector for Recombinant Human Epidermal Growth Factor (hEGF)%重组人表皮生长因子(hEGF)植物表达载体的构建

    Institute of Scientific and Technical Information of China (English)

    武玉永; 刘东东; 信凯; 姚庆收

    2013-01-01

    [Objective] This study aimed to construct plant expression vector for recombinant human epidermal growth factor (hEGF) and further to provide a basis for the expression of hEGF in peanut hairy root system.[Method] According to the hEGF sequence in GenBank,hEGF was synthesized artificially; subsequently,hEGF gene was ligated with green fluorescent protein (GFP) gene,and their ligation product was then amplified with primers flanked with corresponding endonuclease cleavage sites,followed by double digestion by Sal I and EcoR I of the amplified products; next,pRI 101 AN DNA was extracted and digested by both Sal I and EcoR I;susequently,the digestion products of hEGF and GFP ligation fragment by Sal I and EcoR I and the digestion products of pRI 101 AN plasmid DNA by Sal I and EcoR I were ligated,and their ligation product was transformed into Escherichia coil XL10-Gold,followed by extraction of DNA from the recombinants exhibiting green fluorescence,which was then identified by enzymatic digestion and PCR,and the verified recombinant plasmid DNA was named pBZG101.[Result] Human epidermal growth factor gene (hEGF) and green fluorescent protein gene (GFP) were successfully ligated,and their ligation fragment was successfully ligated to pRI 101 AN DNA,finally with the acquirement of the plant expression vector for recombinant human epidermal growth factor-(pBZG101).[Conclusion] The plant expression vector for recombinant human epidermal growth factor-(pBZG101)-was successfully constructed in this study.%[目的]构建重组人表皮生长因子的植物用表达载体,为应用花生毛状根表达系统表达人表皮生长因子(hEGF)奠定基础.[方法]在GenBank中找到hEGF基因序列,并人工合成;将含hEGF基因与绿色荧光蛋白(GFP)的基因连接,用加相应接头的引物扩增得到这2个基因的片段,然后用Sal I和EcoR I的进行双酶切并回收;提取质粒pRI 101 AN DNA,并用Sal I和EcoR I对其进行双酶切并回

  12. Production of Human Epidermal Growth Factor in Fed-batch Culture of Acetate-tolerant Escherichia coli%补料分批培养耐乙酸大肠杆菌生产人表皮生长因子

    Institute of Scientific and Technical Information of China (English)

    韩云; 李志敏; 杜鹏; 甘人宝; 叶勤

    2007-01-01

    An acetate-tolerant mutant of Escherichia coli DH5α, DA19, was used for secretory production of human epidermal growth factor (hEGF) whose expression was under the control of phoA promoter. The recombinant cells were cultured in a chemically defined medium, and glucose was added at different specific provision rates during the growth and expression phases. It was found that pH had a significant effect on the extracellular hEGF production. The extracellular hEGF concentration was 75.5mg·L-1, 5.2-fold of the level reached at pH 7.0, even though more acetate was produced. Nitrogen source was limited in the later growth phase. Supplementation of ammonium promoted the consumption of phosphate and reduced the time to exhaust phosphate, but the extracellular hEGF production was similar to that without supplementation of ammonium.

  13. Inhibition of Sendai virus fusion with phospholipid vesicles and human erythrocyte membranes by hydrophobic peptides

    Energy Technology Data Exchange (ETDEWEB)

    Kelsey, D.R.; Flanagan, T.D.; Young, J.E.; Yeagle, P.L. (State Univ. of New York, Buffalo (USA))

    1991-06-01

    Hydrophobic di- and tripeptides which are capable of inhibiting enveloped virus infection of cells are also capable of inhibiting at least three different types of membrane fusion events. Large unilamellar vesicles (LUV) of N-methyl dioleoylphosphatidylethanolamine (N-methyl DOPE), containing encapsulated 1-aminonaphthalene-3,6,8-trisulfonic acid (ANTS) and/or p-xylene bis(pyridinium bromide) (DPX), were formed by extrusion. Vesicle fusion and leakage were then monitored with the ANTS/DPX fluorescence assay. Sendai virus fusion with lipid vesicles and Sendai virus fusion with human erythrocyte membranes were measured by following the relief of fluorescence quenching of virus labeled with octadecylrhodamine B chloride (R18). This study found that the effectiveness of the peptides carbobenzoxy-L-Phe-L-Phe (Z-L-Phe-L-Phe), Z-L-Phe, Z-D-Phe, and Z-Gly-L-Phe-L-Phe in inhibiting N-methyl DOPE LUV fusion or fusion of virus with N-methyl DOPE LUV also paralleled their reported ability to block viral infectivity. Furthermore, Z-D-Phe-L-PheGly and Z-Gly-L-Phe inhibited Sendai virus fusion with human erythrocyte membranes with the same relative potency with which they inhibited vesicle-vesicle and virus-vesicle fusion. The evidence suggests a mechanism by which these peptides exert their inhibition of plaque formation by enveloped viruses. This class of inhibitors apparently acts by inhibiting fusion of the viral envelope with the target cell membrane, thereby preventing viral infection. The physical pathway by which these peptides inhibit membrane fusion was investigated. {sup 31}P nuclear magnetic resonance (NMR) of proposed intermediates in the pathway for membrane fusion in LUV revealed that the potent fusion inhibitor Z-D-Phe-L-PheGly selectively altered the structure (or dynamics) of the hypothesized fusion intermediates and that the poor inhibitor Z-Gly-L-Phe did not.

  14. The use of cis-parinaric acid to determine lipid peroxidation in human erythrocyte membranes. Comparison of normal and sickle erythrocyte membranes.

    Science.gov (United States)

    Van den Berg, J J; Kuypers, F A; Qju, J H; Chiu, D; Lubin, B; Roelofsen, B; Op den Kamp, J A

    1988-09-15

    The recently developed parinaric acid assay is shown to offer possibilities for studying peroxidation processes in biological membrane systems. Taking the human erythrocyte membrane as a model, several initiating systems were investigated, as well as the effect of residual hemoglobin in ghost membrane preparations. The effectivity of a radical generating system appeared to be strongly dependent upon whether radicals are generated at the membrane level or in the water phase. Thus, cumene hydroperoxide at concentrations of 1.0-1.5 mM was found to be a very efficient initiator of peroxidation in combination with submicromolar levels of hemin-Fe3+ as membrane-bound cofactor. In combination with cumene hydroperoxide, membrane-bound hemoglobin appeared to be about 6-times more effective in promoting peroxidation than hemoglobin in the water phase. Results comparing the behaviour of normal and sickle erythrocyte ghost suspensions in the peroxidation assay suggest that the increased oxidative stress on sickle erythrocyte membranes could be due to enhanced membrane binding of sickle hemoglobin, but also partly to a characteristically higher capability of sickle hemoglobin to promote peroxidation. The order of peroxidation-promoting capabilities that could be derived from the experiments was hemin greater than sickle hemoglobin greater than normal hemoglobin.

  15. Virus rejection with two model human enteric viruses in membrane bioreactor system

    Institute of Scientific and Technical Information of China (English)

    2007-01-01

    A membrane bioreactor (MBR) with gravity drain was tested for virus rejection with two coliphages, T4 and f2, which were used as surrogates for human enteric viruses. Virus rejection was investigated by PVDF and PP membrane modules, with the pore sizes of 0.22 and 0.1 μm, respectively. In tap water system, 2.1 lg rejection of coliphage T4 could be achieved by PVDF membrane compared with complete rejection by PP membrane, while for coliphage f2 with smaller diameter, 0.3―0.5 lg rejection of the influent virus was removed by the two membranes. In domestic wastewater system, cake layer and gel layer on the membrane surface changed the cut-off size of the membrane so that there was no significant difference between PP and PVDF for each coliphage. The removal ratios of coliphage T4 and f2 in the MBR were more than 5.5 and 3.0 lg, respectively. Compared with 5.5 lg removal for virus T4 in the MBR system, only 2.1 lg (96.8%―99.9%) removal rate was observed in the conventional activated sludge system with the influent virus concentration fluctuating from 1830 to 57000 PFU/mL. Only 0.8%―22% virus removal was the effect of adsorption to activated sludge, which showed a decreasing tendency with the retention time, while 75%―98% was the effect of virus inactivation by microbial activity. It indicated that the major mechanism of virus removal was not the transfer of viruses from the water phase to the sludge phase but inactivation in the biological treatment process.

  16. Virus rejection with two model human enteric viruses in membrane bioreactor system

    Institute of Scientific and Technical Information of China (English)

    ZHENG Xiang; LIU JunXin

    2007-01-01

    A membrane bioreactor (MBR) with gravity drain was tested for virus rejection with two coliphages, T4 and f2, which were used as surrogates for human enteric viruses. Virus rejection was investigated by PVDF and PP membrane modules, with the pore sizes of 0.22 and 0.1 μm, respectively. In tap water system, 2.1 lg rejection of coliphage T4 could be achieved by PVDF membrane compared with complete rejection by PP membrane, while for coliphage f2 with smaller diameter, 0.3-0.5 lg rejection of the influent virus was removed by the two membranes. In domestic wastewater system, cake layer and gel layer on the membrane surface changed the cut-off size of the membrane so that there was no significant difference between PP and PVDF for each coliphage. The removal ratios of coliphage T4 and f2 in the MBR were more than 5.5 and 3.0 lg, respectively. Compared with 5.5 lg removal for virus T4 in the MBR system, only 2.1 lg (96.8%-99.9%) removal rate was observed in the conventional activated sludge system with the influent virus concentration fluctuating from 1830 to 57000 PFU/mL. Only 0.8 %-22 % virus removal was the effect of adsorption to activated sludge, which showed a decreasing tendency with the retention time, while 75%-98% was the effect of virus inactivation by microbial activity. It indicated that the major mechanism of virus removal was not the transfer of viruses from the water phase to the sludge phase but inactivation in the biological treatment process.

  17. The effect of aspartame metabolites on human erythrocyte membrane acetylcholinesterase activity.

    Science.gov (United States)

    Tsakiris, Stylianos; Giannoulia-Karantana, Aglaia; Simintzi, Irene; Schulpis, Kleopatra H

    2006-01-01

    Studies have implicated aspartame (ASP) with neurological problems. The aim of this study was to evaluate acetylcholinesterase (AChE) activity in human erythrocyte membranes after incubation with the sum of ASP metabolites, phenylalanine (Phe), methanol (met) and aspartic acid (aspt), or with each one separately. Erythrocyte membranes were obtained from 12 healthy individuals and were incubated with ASP hydrolysis products for 1 h at 37 degrees C. AChE was measured spectrophotometrically. Incubation of membranes with ASP metabolites corresponding with 34 mg/kg, 150 mg/kg or 200 mg/kg of ASP consumption resulted in an enzyme activity reduction by -33%, -41%, and -57%, respectively. Met concentrations 0.14 mM, 0.60 mM, and 0.80 mM decreased the enzyme activity by -20%, -32% or -40%, respectively. Aspt concentrations 2.80 mM, 7.60 mM or 10.0 mM inhibited membrane AChE activity by -20%, -35%, and -47%, respectively. Phe concentrations 0.14 mM, 0.35 mM or 0.50mM reduced the enzyme activity by -11%, -33%, and -35%, respectively. Aspt or Phe concentrations 0.82 mM or 0.07 mM, respectively, did not alter the membrane AChE activity. It is concluded that low concentrations of ASP metabolites had no effect on the membrane enzyme activity, whereas high or toxic concentrations partially or remarkably decreased the membrane AChE activity, respectively. Additionally, neurological symptoms, including learning and memory processes, may be related to the high or toxic concentrations of the sweetener metabolites.

  18. Membrane microdomain-associated uroplakin IIIa contributes to Src-dependent mechanisms of anti-apoptotic proliferation in human bladder carcinoma cells

    Directory of Open Access Journals (Sweden)

    Shigeru Kihira

    2012-08-01

    Our previous study demonstrated that tyrosine phosphorylation of p145met/β-subunit of hepatocyte growth factor receptor by epidermal growth factor receptor and Src contributes to the anti-apoptotic growth of human bladder carcinoma cell 5637 under serum-starved conditions. Here, we show that some other cell lines of human bladder carcinoma, but not other types of human cancer cells, also exhibit Src-dependent, anti-apoptotic proliferation under serum-starved conditions, and that low-density, detergent-insoluble membrane microdomains (MD serve as a structural platform for signaling events involving p145met, EGFR, and Src. As an MD-associated molecule that may contribute to bladder carcinoma-specific cellular function, we identified uroplakin IIIa (UPIIIa, an urothelium-specific protein. Results obtained so far revealed: 1 UPIIIa undergoes partial proteolysis in serum-starved cells; 2 a specific antibody to the extracellular domain of UPIIIa inhibits the proteolysis of UPIIIa and the activation of Src, and promotes apoptosis in serum-starved cells; and 3 knockdown of UPIIIa by short interfering RNA also promotes apoptosis in serum-starved cells. GM6001, a potent inhibitor of matrix metalloproteinase (MMP, inhibits the proteolysis of UPIIIa and promotes apoptosis in serum-starved cells. Furthermore, serum starvation promotes expression and secretion of the heparin-binding EGF-like growth factor in a manner that depends on the functions of MMP, Src, and UPIIIa. These results highlight a hitherto unknown signaling network involving a subset of MD-associated molecules in the anti-apoptotic mechanisms of human bladder carcinoma cells.

  19. Cross-reactivity of anti-H pylori antibodies with membrane antigens of human erythrocytes

    Institute of Scientific and Technical Information of China (English)

    Feng-Hua Guo; Fan-Ling Meng; Jian-Zhong Zhang; Xiao-Mei Yan; Chun-Xiang Fan; Fei Zhao; Yuan Hu; Di Xiao; Xun Zeng; Mao-Jun Zhang; Li-Hua He

    2007-01-01

    AIM: To investigate whether anti-H pylori antibodies have cross-reaction with antigens of erythrocyte membrane.METHODS: Blood samples were collected from 14 volunteers (8 positive and 6 negative for H pylori detected by 13C-urea breath test) of the general population. Erythrocyte membrane proteins of the subjects were examined by Western blot using antiH pylori serum. The proteins related to the positive bands were identified by mass spectrum analysis.RESULTS: Anti-H pylori antibodies had cross-reaction with the proteins of about 50 kDa of erythrocyte membranes in all samples independent of H pylori infection. One protein in the positive band was identified as Chain S, the crystal structure of the cytoplasmic domain of human erythrocyte Band-3 protein.CONCLUSION: Anti-H pylori antibodies cross-react with some antigens of human erythrocyte membrane, which may provide a clue for the relationship between H pylori infection and vascular disorders.

  20. Comparison of Characteristics of Human Amniotic Membrane and Human Adipose Tissue Derived Mesenchymal Stem Cells

    Science.gov (United States)

    Dizaji Asl, Khadijeh; Shafaei, Hajar; Soleimani Rad, Jafar; Nozad, Hojjat Ollah

    2017-01-01

    BACKGROUND Mesenchymal stem cells (MSCs) are ideal candidates for treatment of diseases. Amniotic membranes are an inexpensive source of MSCs (AM-MSC) without any donor site morbidity in cell therapy. Adipose tissue derived stem cells (ASCs) are also suitable cells for cell therapy. There is discrepancy in CD271 expression among MSCs from different sources. In this study, the characteristics of AM-MSC and ASCs and CD271 expression were compared. METHODS Adult adipose tissue samples were obtained from patients undergoing elective surgical procedure, and samples of amniotic membrane were collected immediately after caesarean operation. After isolation and expansion of MSCs, the proliferation rate and viability of cells were evaluated through calculating DT and MTT assay. Expression of routine mesenchymal specific surface antigens of MSCs and CD271 was evaluated by flow cytometry for both types of cells. RESULTS The growth rate and viability of the MSCs from the amniotic membrane was significantly higher compared with the ASCs. The low expression of CD14 and CD45 indicated that AM-MSC and ASCs are non hematopoietic cells, and both cell types expressed high percentages of CD44, CD105. The results revealed that AM-MSC and ASCs expressed no CD271 on their surfaces. CONCLUSION This study showed that amniotic membrane is a suitable cell source for cell therapy, and CD271 is a negative marker for MSCs identification from amniotic membrane and adipose tissue.

  1. Toxic epidermal necrolysis.

    Science.gov (United States)

    Castelain, Florence; Humbert, Philippe

    2012-11-01

    Toxic epidermal necrolysis (TEN) is a severe mucocutaneous drug-induced syndrome that causes massive keratinocyte apoptosis and therefore hydro-electrolytic disorders and systemic infection. TEN approximately affects one to two cases per million per year. Mortality rate may reach thirty percent of cases. Thus, TEN constitutes a therapeutic emergency at diagnosis. Typically, clinical examination shows a mucocutaneous detachment involving more than thirty percent of body area. Definitive diagnosis is made on cutaneous biopsy with histological exam that shows the blister of necrotic keratinocytes. Main differential diagnosis are acute staphylococcus epidermis, acute generalized exanthematous pustulosis, linear IgA bullous dermatosis, paraneoplastic pemphigus, bullous fixed pigmented erythema, acute lupus erythematosus. In the early days, SCORTEN gives a good estimation and is now widely used as prognostic score. Drugs are generally considered as the main etiology of TEN but in some cases bacterial or viral infections could be involved. Physiopathology remains