WorldWideScience

Sample records for human epidermal cells

  1. Effects of Wnt3a on proliferation and differentiation of human epidermal stem cells

    International Nuclear Information System (INIS)

    Jia Liwei; Zhou Jiaxi; Peng Sha; Li Juxue; Cao Yujing; Duan Enkui

    2008-01-01

    Epidermal stem cells maintain development and homeostasis of mammalian epidermis throughout life. However, the molecular mechanisms involved in the proliferation and differentiation of epidermal stem cells are far from clear. In this study, we investigated the effects of Wnt3a and Wnt/β-catenin signaling on proliferation and differentiation of human fetal epidermal stem cells. We found both Wnt3a and active β-catenin, two key members of the Wnt/β-catenin signaling, were expressed in human fetal epidermis and epidermal stem cells. In addition, Wnt3a protein can promote proliferation and inhibit differentiation of epidermal stem cells in vitro culture. Our results suggest that Wnt/β-catenin signaling plays important roles in human fetal skin development and homeostasis, which also provide new insights on the molecular mechanisms of oncogenesis in human epidermis

  2. Enrichment of unlabeled human Langerhans cells from epidermal cell suspensions by discontinuous density gradient centrifugation

    NARCIS (Netherlands)

    Teunissen, M. B.; Wormmeester, J.; Kapsenberg, M. L.; Bos, J. D.

    1988-01-01

    In this report we introduce an alternative procedure for enrichment of human epidermal Langerhans cells (LC) from epidermal cell suspensions of normal skin. By means of discontinuous Ficoll-Metrizoate density gradient centrifugation, a fraction containing high numbers of viable, more than 80% pure

  3. Evolution of the clonogenic potential of human epidermal stem/progenitor cells with age

    Directory of Open Access Journals (Sweden)

    Zobiri O

    2012-02-01

    Full Text Available Olivia Zobiri, Nathalie Deshayes, Michelle Rathman-JosserandDepartment of Biological Research, L'Oréal Advanced Research, Clichy Cedex, FranceAbstract: A number of clinical observations have indicated that the regenerative potential and overall function of the epidermis is modified with age. The epidermis becomes thinner, repairs itself less efficiently after wounding, and presents modified barrier function recovery. In addition, the dermal papillae flatten out with increasing age, suggesting a modification in the interaction between epidermal and dermal compartments. As the epidermal regenerative capacity is dependent upon stem and progenitor cell function, it is naturally of interest to identify and understand age-related changes in these particular keratinocyte populations. Previous studies have indicated that the number of stem cells does not decrease with age in mouse models but little solid evidence is currently available concerning human skin. The objective of this study was to evaluate the clonogenic potential of keratinocyte populations isolated from the epidermis of over 50 human donors ranging from 18 to 71 years old. The data indicate that the number of epidermal cells presenting high regenerative potential does not dramatically decline with age in human skin. The authors believe that changes in the microenvironment controlling epidermal basal cell activity are more likely to explain the differences in epidermal function observed with increasing age.Keywords: skin, epidermal stem cells, aging, colony-forming efficiency test

  4. Radiosensitivity of normal human epidermal cells in culture

    International Nuclear Information System (INIS)

    Dover, R.; Potten, C.S.

    1983-01-01

    Using an in vitro culture system the authors have derived #betta#-radiation survival curves over a dose range 0-8 Gy for the clonogenic cells of normal human epidermis. The culture system used allows the epidermal cells to stratify and form a multi-layered sheet of keratinizing cells. The cultures appear to be a very good model for epidermis in vivo. The survival curves show a population which is apparently more sensitive than murine epidermis in vivo. It remains unclear whether this is an intrinsic difference between the species or is a consequence of the in vitro cultivation of the human cells. (author)

  5. Human eccrine sweat gland cells turn into melanin-uptaking keratinocytes in dermo-epidermal skin substitutes.

    Science.gov (United States)

    Böttcher-Haberzeth, Sophie; Biedermann, Thomas; Pontiggia, Luca; Braziulis, Erik; Schiestl, Clemens; Hendriks, Bart; Eichhoff, Ossia M; Widmer, Daniel S; Meuli-Simmen, Claudia; Meuli, Martin; Reichmann, Ernst

    2013-02-01

    Recently, Biedermann et al. (2010) have demonstrated that human eccrine sweat gland cells can develop a multilayered epidermis. The question still remains whether these cells can fulfill exclusive and very specific functional properties of epidermal keratinocytes, such as the incorporation of melanin, a feature absent in sweat gland cells. We added human melanocytes to eccrine sweat gland cells to let them develop into an epidermal analog in vivo. The interaction between melanocytes and sweat gland-derived keratinocytes was investigated. The following results were gained: (1) macroscopically, a pigmentation of the substitutes was seen 2-3 weeks after transplantation; (2) we confirmed the development of a multilayered, stratified epidermis with melanocytes distributed evenly throughout the basal layer; (3) melanocytic dendrites projected to suprabasal layers; and (4) melanin was observed to be integrated into former eccrine sweat gland cells. These skin substitutes were similar or equal to skin substitutes cultured from human epidermal keratinocytes. The only differences observed were a delay in pigmentation and less melanin uptake. These data suggest that eccrine sweat gland cells can form a functional epidermal melanin unit, thereby providing striking evidence that they can assume one of the most characteristic keratinocyte properties.

  6. Autodegradation of 125I-labeled human epidermal cell surface proteins

    International Nuclear Information System (INIS)

    Hashimoto, K.; Singer, K.H.; Lazarus, G.S.

    1982-01-01

    Triton X-100 extracts of cultured human epidermal cells exhibited proteolytic activity as measured by the hydrolysis of [ 3 H]-casein at neutral pH. The majority of endogenous proteolytic activity was inhibited by parahydroxy mercuribenzoate and by mersalyl acid, indicating the enzyme(s) was a thiol class proteinase(s). Crude Triton X-100 extracts were prepared from epidermal cells following labeling of proteins with 125 I. Autodegradation of labeled proteins at 37 degrees C was detected as early as 1 hr and reached a plateau level by 4 hr. Degradation was inhibited by thiol class proteinase inhibitors. Among the detergent-solubilized radiolabeled proteins a polypeptide chain of Mr 155,000 was particularly sensitive to degradation by endogenous thiol proteinase(s)

  7. Polymeric membranes modulate human keratinocyte differentiation in specific epidermal layers.

    Science.gov (United States)

    Salerno, Simona; Morelli, Sabrina; Giordano, Francesca; Gordano, Amalia; Bartolo, Loredana De

    2016-10-01

    In vitro models of human bioengineered skin substitutes are an alternative to animal experimentation for testing the effects and toxicity of drugs, cosmetics and pollutants. For the first time specific and distinct human epidermal strata were engineered by using membranes and keratinocytes. To this purpose, biodegradable membranes of chitosan (CHT), polycaprolactone (PCL) and a polymeric blend of CHT-PCL were prepared by phase-inversion technique and characterized in order to evaluate their morphological, physico-chemical and mechanical properties. The capability of membranes to modulate keratinocyte differentiation inducing specific interactions in epidermal membrane systems was investigated. The overall results demonstrated that the membrane properties strongly influence the cell morpho-functional behaviour of human keratinocytes, modulating their terminal differentiation, with the creation of specific epidermal strata or a fully proliferative epidermal multilayer system. In particular, human keratinocytes adhered on CHT and CHT-PCL membranes, forming the structure of the epidermal top layers, such as the corneum and granulosum strata, characterized by withdrawal or reduction from the cell cycle and cell proliferation. On the PCL membrane, keratinocytes developed an epidermal basal lamina, with high proliferating cells that stratified and migrated over time to form a complete differentiating epidermal multilayer system. Copyright © 2016 Elsevier B.V. All rights reserved.

  8. Low calcium culture condition induces mesenchymal cell-like phenotype in normal human epidermal keratinocytes

    International Nuclear Information System (INIS)

    Takagi, Ryo; Yamato, Masayuki; Murakami, Daisuke; Sugiyama, Hiroaki; Okano, Teruo

    2011-01-01

    Highlights: → Normal human epidermal keratinocytes serially cultured under low calcium concentration were cytokeratin and vimentin double positive cells. → The human keratinocytes expressed some epithelial stem/progenitor cell makers, mesenchymal cell markers, and markers of epithelial-mesenchymal transition. → Mesenchymal cell-like phenotype in the keratinocytes was suppressed under high-calcium condition. -- Abstract: Epithelial-mesenchymal transition (EMT) is an important cellular phenomenon in organ developments, cancer invasions, and wound healing, and many types of transformed cell lines are used for investigating for molecular mechanisms of EMT. However, there are few reports for EMT in normal human epithelial cells, which are non-transformed or non-immortalized cells, in vitro. Therefore, normal human epidermal keratinocytes (NHEK) serially cultured in low-calcium concentration medium (LCM) were used for investigating relations between differentiation and proliferation and mesenchymal-like phenotype in the present study, since long-term cultivation of NHEK is achieved in LCM. Interestingly, NHEK serially cultured in LCM consisted essentially of cytokeratin-vimentin double positive cells (98%), although the NHEK exhibited differentiation under high-calcium culture condition with 3T3 feeder layer. The vimentin expression was suppressed under high-calcium condition. These results may indicate the importance of mesenchymal-like phenotype for serially cultivation of NHEK in vitro.

  9. Epidermal stem cells: location, potential and contribution to cancer.

    Science.gov (United States)

    Ambler, C A; Määttä, A

    2009-01-01

    Epidermal stem cells have been classically characterized as slow-cycling, long-lived cells that reside in discrete niches in the skin. Gene expression studies of niche-resident cells have revealed a number of stem cell markers and regulators, including the Wnt/beta-catenin, Notch, p63, c-Myc and Hedgehog pathways. A new study challenges the traditional developmental paradigm of slow-cycling stem cells and rapid-cycling transit amplifying cells in some epidermal regions, and there is mounting evidence to suggest that multi-lineage epidermal progenitors can be isolated from highly proliferative, non-niche regions. Whether there is a unique microenvironment surrounding these progenitors remains to be determined. Interestingly, cancer stem cells derived from epidermal tumours exist independent of the classic skin stem cell niche, yet also have stem cell properties, including multi-lineage differentiation. This review summarizes recent studies identifying the location and regulators of mouse and human epidermal stem cells and highlights the strategies used to identify cancer stem cells, including expression of normal epidermal stem cell markers, expression of cancer stem cell markers identified in other epidermal tumours and characterization of side-population tumour cells.

  10. The organization of human epidermis: functional epidermal units and phi proportionality.

    Science.gov (United States)

    Hoath, Steven B; Leahy, D G

    2003-12-01

    The concept that mammalian epidermis is structurally organized into functional epidermal units has been proposed on the basis of stratum corneum (SC) architecture, proliferation kinetics, melanocyte:keratinocyte ratios (1:36), and, more recently, Langerhans cell: epidermal cell ratios (1:53). This article examines the concept of functional epidermal units in human skin in which the maintenance of phi (1.618034) proportionality provides a central organizing principle. The following empirical measurements were used: 75,346 nucleated epidermal cells per mm2, 1394 Langerhans cells per mm2, 1999 melanocytes per mm2, 16 (SC) layers, 900-microm2 corneocyte surface area, 17,778 corneocytes per mm2, 14-d (SC) turnover time, and 93,124 per mm2 total epidermal cells. Given these empirical data: (1) the number of corneocytes is a mean proportional between the sum of the Langerhans cell + melanocyte populations and the number of epidermal cells, 3393/17,778-17,778/93,124; (2) the ratio of nucleated epidermal cells over corneocytes is phi proportional, 75,346/17,778 approximately phi3; (3) assuming similar 14-d turnover times for the (SC) and Malpighian epidermis, the number of corneocytes results from subtraction of a cellular fraction equal to approximately 2/phi2 x the number of living cells, 75,436 - (2/phi2 x 75,346) approximately 17,778; and (4) if total epidermal turnover time equals (SC) turnover time x the ratio of living/dead cells, then compartmental turnover times are unequal (14 d for (SC) to 45.3 d for nucleated epidermis approximately 1/2phi) and cellular replacement rates are 52.9 corneocytes/69.3 keratinocytes per mm2 per h approximately 2/phi2. These empirically derived equivalences provide logicomathematical support for the presence of functional epidermal units in human skin. Validation of a phi proportional unit architecture in human epidermis will be important for tissue engineering of skin and the design of instruments for skin measurement.

  11. [Progress in epidermal stem cells].

    Science.gov (United States)

    Wang, Li-Juan; Wang, You-Liang; Yang, Xiao

    2010-03-01

    Mammalian skin epidermis contains different epidermal stem cell pools which contribute to the homeostasis and repair of skin epithelium. Epidermal stem cells possess two essential features common to all stem cells: self-renewal and differentiation. Disturbing the balance between self-renewal and differentiation of epidermal stem cell often causes tumors or other skin diseases. Epidermal stem cell niches provide a special microenvironment that maintains a balance of stem cell quiescence and activity. This review primarily concentrates on the following points of the epidermal stem cells: the existing evidences, the self-renewal and differentiation, the division pattern, the signal pathways regulating self-renewal and differentiation, and the microenvironment (niche) and macroenvironment maintaining the homeostasis of stem cells.

  12. Dermal-epidermal membrane systems by using human keratinocytes and mesenchymal stem cells isolated from dermis

    Energy Technology Data Exchange (ETDEWEB)

    Salerno, Simona, E-mail: s.salerno@itm.cnr.it [Institute on Membrane Technology, National Research Council of Italy, ITM-CNR, c/o University of Calabria, via P. Bucci cubo 17/C, I-87036, Rende (CS) (Italy); Messina, Antonietta [Institute on Membrane Technology, National Research Council of Italy, ITM-CNR, c/o University of Calabria, via P. Bucci cubo 17/C, I-87036, Rende (CS) (Italy); Giordano, Francesca [Department of Pharmacy, Health and Nutritional Sciences, University of Calabria, I-87036 Rende, (CS) (Italy); Bader, Augustinus [Biomedical-Biotechnological Center, BBZ, University of Leipzig, D-04103 Leipzig (Germany); Drioli, Enrico [Institute on Membrane Technology, National Research Council of Italy, ITM-CNR, c/o University of Calabria, via P. Bucci cubo 17/C, I-87036, Rende (CS) (Italy); WCU Energy Engineering Department, Hanyang University, Seoul (Korea, Republic of); De Bartolo, Loredana, E-mail: l.debartolo@itm.cnr.it [Institute on Membrane Technology, National Research Council of Italy, ITM-CNR, c/o University of Calabria, via P. Bucci cubo 17/C, I-87036, Rende (CS) (Italy)

    2017-02-01

    Dermal-epidermal membrane systems were developed by co-culturing human keratinocytes with Skin derived Stem Cells (SSCs), which are Mesenchymal Stem Cells (MSCs) isolated from dermis, on biodegradable membranes of chitosan (CHT), polycaprolactone (PCL) and a polymeric blend of CHT and PCL. The membranes display physico-chemical, morphological, mechanical and biodegradation properties that could satisfy and fulfil specific requirements in skin tissue engineering. CHT membrane exhibits an optimal biodegradation rate for acute wounds; CHT-PCL for the chronic ones. On the other hand, PCL membrane in spite of its very slow biodegradation rate exhibits mechanical properties similar to in vivo dermis, a lower hydrophilic character, and a surface roughness, all properties that make it able to sustain cell adhesion and proliferation for in vitro skin models. Both CHT–PCL and PCL membranes guided epidermal and dermal differentiation of SSCs as pointed out by the expression of cytokeratins and the deposition of the ECM protein fibronectin, respectively. In the dermal-epidermal membrane systems, a more suitable microenvironment for the SSCs differentiation was promoted by the interactions and the mutual interplay with keratinocytes. Being skin tissue-biased stem cells committed to their specific final dermal and/or epidermal cell differentiation, SSCs are more suitable for skin tissue engineering than other adult MSCs with different origin. For this reason, they represent a useful autologous cell source for engineering skin substitutes for both in vivo and in vitro applications.

  13. Growth of melanocytes in human epidermal cell cultures

    International Nuclear Information System (INIS)

    Staiano-Coico, L.; Hefton, J.M.; Amadeo, C.; Pagan-Charry, I.; Madden, M.R.; Cardon-Cardo, C.

    1990-01-01

    Epidermal cell cultures were grown in keratinocyte-conditioned medium for use as burn wound grafts; the melanocyte composition of the grafts was studied under a variety of conditions. Melanocytes were identified by immunohistochemistry based on a monoclonal antibody (MEL-5) that has previously been shown to react specifically with melanocytes. During the first 7 days of growth in primary culture, the total number of melanocytes in the epidermal cultures decreased to 10% of the number present in normal skin. Beginning on day 2 of culture, bipolar melanocytes were present at a mean cell density of 116 +/- 2/mm2; the keratinocyte to melanocyte ratio was preserved during further primary culture and through three subpassages. Moreover, exposure of cultures to mild UVB irradiation stimulated the melanocytes to proliferate, suggesting that the melanocytes growing in culture maintained their responsiveness to external stimuli. When the sheets of cultured cells were enzymatically detached from the plastic culture flasks before grafting, melanocytes remained in the basal layer of cells as part of the graft applied to the patient

  14. Immunohistochemical detection of cytochrome P450 isoenzymes in cultured human epidermal cells.

    Science.gov (United States)

    Van Pelt, F N; Meierink, Y J; Blaauboer, B J; Weterings, P J

    1990-12-01

    We used specific monoclonal antibodies (MAb) to human cytochrome P450 isoenzymes to determine the presence of these proteins in human epidermal cells. Two MAb (P450-5 and P450-8) recognize major forms of hepatic cytochrome P450 involved in biotransformation of xenobiotics. A third MAb, to cytochrome P450-9, is not fully characterized. The proteins were determined by the indirect immunoperoxidase technique after fixation with methanol and acetone. Biopsy materials for cultured keratinocytes, i.e., foreskin and hair follicles, contained the two major forms of cytochrome P450. In cultured keratinocytes derived from hair follicles the proteins were undetectable, whereas the keratinocytes derived from foreskin continued to express the two major forms of hepatic cytochrome P450. Cultured human fibroblasts and a human keratinocyte cell line (SVK14) showed staining similar to that of the foreskin keratinocytes. Cytochrome P450-9 was detectable only in human hepatocytes. The results indicate that, under the culture conditions applied, cultured human foreskin cells and the cell line SVK14 continue to express specific cytochrome P450 isoenzymes in culture, in contrast to hair follicle keratinocytes.

  15. Epidermal growth factor increases LRF/Pokemon expression in human prostate cancer cells.

    Science.gov (United States)

    Aggarwal, Himanshu; Aggarwal, Anshu; Agrawal, Devendra K

    2011-10-01

    Leukemia/lymphoma related factor/POK erythroid myeloid ontogenic factor (LRF/Pokemon) is a member of the POK family of proteins that promotes oncogenesis in several forms of cancer. Recently, we found higher LRF expression in human breast and prostate carcinomas compared to the corresponding normal tissues. The aim of this study was to examine the regulation of LRF expression in human prostate cells. Epidermal growth factor (EGF) and its receptors mediate several tumorigenic cascades that regulate cell differentiation, proliferation, migration and survival of prostate cancer cells. There was significantly higher level of LRF expression in the nucleus of LNCaP and PC-3 cells than RWPE-1 cells. A significant increase in LRF expression was observed with increasing doses of EGF in more aggressive and androgen-sensitive prostate cancer cells suggesting that EGF signaling pathway is critical in upregulating the expression of LRF/Pokemon to promote oncogenesis. Copyright © 2011 Elsevier Inc. All rights reserved.

  16. Human corpus luteum: presence of epidermal growth factor receptors and binding characteristics

    International Nuclear Information System (INIS)

    Ayyagari, R.R.; Khan-Dawood, F.S.

    1987-01-01

    Epidermal growth factor receptors are present in many reproductive tissues but have not been demonstrated in the human corpus luteum. To determine the presence of epidermal growth factor receptors and its binding characteristics, we carried out studies on the plasma cell membrane fraction of seven human corpora lutea (days 16 to 25) of the menstrual cycle. Specific epidermal growth factor receptors were present in human corpus luteum. Insulin, nerve growth factor, and human chorionic gonadotropin did not competitively displace epidermal growth factor binding. The optimal conditions for corpus luteum-epidermal growth factor receptor binding were found to be incubation for 2 hours at 4 degrees C with 500 micrograms plasma membrane protein and 140 femtomol 125 I-epidermal growth factor per incubate. The number (mean +/- SEM) of epidermal growth factor binding sites was 12.34 +/- 2.99 X 10(-19) mol/micrograms protein; the dissociation constant was 2.26 +/- 0.56 X 10(-9) mol/L; the association constant was 0.59 +/- 0.12 X 10(9) L/mol. In two regressing corpora lutea obtained on days 2 and 3 of the menstrual cycle, there was no detectable specific epidermal growth factor receptor binding activity. Similarly no epidermal growth factor receptor binding activity could be detected in ovarian stromal tissue. Our findings demonstrate that specific receptors for epidermal growth factor are present in the human corpus luteum. The physiologic significance of epidermal growth factor receptors in human corpus luteum is unknown, but epidermal growth factor may be involved in intragonadal regulation of luteal function

  17. Grafting of human epidermal cells, presence and perspectives

    Czech Academy of Sciences Publication Activity Database

    Smetana, Karel; Dvořánková, B.; Labský, Jiří; Vacík, Jiří; Holíková, Z.

    2001-01-01

    Roč. 102, č. 1 (2001), s. 1-6 ISSN 0036-5327 R&D Projects: GA ČR GA203/00/1310; GA AV ČR IBS4050005; GA MZd ND6340; GA MŠk LN00A065; GA AV ČR KSK4055109 Institutional research plan: CEZ:AV0Z4050913 Keywords : cell therapy-keratinocyte-epidermal stem cell * skin defect Subject RIV: CD - Macromolecular Chemistry

  18. Oral mucosa: an alternative epidermic cell source to develop autologous dermal-epidermal substitutes from diabetic subjects

    Directory of Open Access Journals (Sweden)

    Daniela GUZMÁN-URIBE

    Full Text Available Abstract Oral mucosa has been highlighted as a suitable source of epidermal cells due to its intrinsic characteristics such as its higher proliferation rate and its obtainability. Diabetic ulcers have a worldwide prevalence that is variable (1%-11%, meanwhile treatment of this has been proven ineffective. Tissue-engineered skin plays an important role in wound care focusing on strategies such autologous dermal-epidermal substitutes. Objective The aim of this study was to obtain autologous dermal-epidermal skin substitutes from oral mucosa from diabetic subjects as a first step towards a possible clinical application for cases of diabetic foot. Material and Methods Oral mucosa was obtained from diabetic and healthy subjects (n=20 per group. Epidermal cells were isolated and cultured using autologous fibrin to develop dermal-epidermal in vitro substitutes by the air-liquid technique with autologous human serum as a supplement media. Substitutes were immunocharacterized with collagen IV and cytokeratin 5-14 as specific markers. A Student´s t- test was performed to assess the differences between both groups. Results It was possible to isolate epidermal cells from the oral mucosa of diabetic and healthy subjects and develop autologous dermal-epidermal skin substitutes using autologous serum as a supplement. Differences in the expression of specific markers were observed and the cytokeratin 5-14 expression was lower in the diabetic substitutes, and the collagen IV expression was higher in the diabetic substitutes when compared with the healthy group, showing a significant difference. Conclusion Cells from oral mucosa could be an alternative and less invasive source for skin substitutes and wound healing. A difference in collagen production of diabetic cells suggests diabetic substitutes could improve diabetic wound healing. More research is needed to determine the crosstalk between components of these skin substitutes and damaged tissues.

  19. Nicotinic acid receptor abnormalities in human skin cancer: implications for a role in epidermal differentiation.

    Directory of Open Access Journals (Sweden)

    Yira Bermudez

    Full Text Available Chronic UV skin exposure leads to epidermal differentiation defects in humans that can be largely restored by pharmacological doses of nicotinic acid. Nicotinic acid has been identified as a ligand for the human G-protein-coupled receptors GPR109A and GPR109B that signal through G(i-mediated inhibition of adenylyl cyclase. We have examined the expression, cellular distribution, and functionality of GPR109A/B in human skin and skin derived epidermal cells.Nicotinic acid increases epidermal differentiation in photodamaged human skin as judged by the terminal differentiation markers caspase 14 and filaggrin. Both GPR109A and GPR109B genes are transcribed in human skin and in epidermal keratinocytes, but expression in dermal fibroblasts is below limits of detection. Receptor transcripts are greatly over-expressed in squamous cell cancers. Receptor protein in normal skin is prominent from the basal through granular layers of the epidermis, with cellular localization more dispersive in the basal layer but predominantly localized at the plasma membrane in more differentiated epidermal layers. In normal human primary and immortalized keratinocytes, nicotinic acid receptors show plasma membrane localization and functional G(i-mediated signaling. In contrast, in a squamous cell carcinoma derived cell line, receptor protein shows a more diffuse cellular localization and the receptors are nearly non-functional.The results of these studies justify future genetic and pharmacological intervention studies to define possible specific role(s of nicotinic acid receptors in human skin homeostasis.

  20. Recycling of epidermal growth factor in a human pancreatic carcinoma cell line

    International Nuclear Information System (INIS)

    Korc, M.; Magun, B.E.

    1985-01-01

    PANC-1 human pancreatic carcinoma cells readily bound and internalized 125 I-labeled epidermal growth factor (EGF). Bound 125 I-labeled EGF was then partially processed to a number of high molecular weight acidic species. Percoll gradient centrifugation of cell homogenates indicated that the majority of 125 I activity localized to several intracellular vesicular compartments. Both intact EGF and its processed species were subsequently released into the incubation medium. A major portion of the released radioactivity was capable of rebinding to the cell. Only a small amount of bound 125 I-labeled EGF was degraded to low molecular weight products, and this degradation was completely blocked by methylamine. These findings suggest that in PANC-1 cells, bound EGF undergoes only limited processing. Both intact EGF and its major processed species bypass the cellular degradative pathways, are slowly released from the cell, and then rebind to the cell

  1. Bioengineering a human plasma-based epidermal substitute with efficient grafting capacity and high content in clonogenic cells.

    Science.gov (United States)

    Alexaline, Maia M; Trouillas, Marina; Nivet, Muriel; Bourreau, Emilie; Leclerc, Thomas; Duhamel, Patrick; Martin, Michele T; Doucet, Christelle; Fortunel, Nicolas O; Lataillade, Jean-Jacques

    2015-06-01

    Cultured epithelial autografts (CEAs) produced from a small, healthy skin biopsy represent a lifesaving surgical technique in cases of full-thickness skin burn covering >50% of total body surface area. CEAs also present numerous drawbacks, among them the use of animal proteins and cells, the high fragility of keratinocyte sheets, and the immaturity of the dermal-epidermal junction, leading to heavy cosmetic and functional sequelae. To overcome these weaknesses, we developed a human plasma-based epidermal substitute (hPBES) for epidermal coverage in cases of massive burn, as an alternative to traditional CEA, and set up critical quality controls for preclinical and clinical studies. In this study, phenotypical analyses in conjunction with functional assays (clonal analysis, long-term culture, or in vivo graft) showed that our new substitute fulfills the biological requirements for epidermal regeneration. hPBES keratinocytes showed high potential for cell proliferation and subsequent differentiation similar to healthy skin compared with a well-known reference material, as ascertained by a combination of quality controls. This work highlights the importance of integrating relevant multiparameter quality controls into the bioengineering of new skin substitutes before they reach clinical development. This work involves the development of a new bioengineered epidermal substitute with pertinent functional quality controls. The novelty of this work is based on this quality approach. ©AlphaMed Press.

  2. Human Epidermal Langerhans Cells Maintain Immune Homeostasis in Skin by Activating Skin Resident Regulatory T Cells

    Science.gov (United States)

    Seneschal, Julien; Clark, Rachael A.; Gehad, Ahmed; Baecher-Allan, Clare M.; Kupper, Thomas S.

    2013-01-01

    Recent discoveries indicate that the skin of a normal individual contains 10-20 billion resident memory T cells ( which include various T helper, T cytotoxic, and T regulatory subsets, that are poised to respond to environmental antigens. Using only autologous human tissues, we report that both in vitro and in vivo, resting epidermal Langerhan cells (LC) selectively and specifically induced the activation and proliferation of skin resident regulatory T cells (Treg), a minor subset of skin resident memory T cells. In the presence of foreign pathogen, however, the same LC activated and induced proliferation of effector memory T (Tem) cells and limited Treg cells activation. These underappreciated properties of LC: namely maintenance of tolerance in normal skin, and activation of protective skin resident memory T cells upon infectious challenge, help clarify the role of LC in skin. PMID:22560445

  3. UVA-induced immune suppression in human skin: protective effect of vitamin E in human epidermal cells in vitro

    International Nuclear Information System (INIS)

    Clement-Lacroix, P.; Michel, L.; Moysan, A.; Morliere, P.; Dubertret, L.

    1996-01-01

    UVA (320-400 nm) radiation damage to membranes, proteins, DNA and other cellular targets is predominantly related to oxidative processes. In the present study, we demonstrated that cutaneous UVA-induced immunosuppression can be related, at least in part, to the appearance of these oxidative processes. The UVA-induced oxidative processes in freshly isolated epidermal cells were monitored by measuring the thiobarbituric acid reactive substances (TBARS) as an index of peroxidation. The in vitro immunosuppressive effects of UVA were demonstrated by measuring the allogenic lymphocyte proliferation induced by epidermal cells or purified Langerhans cells in the mixed epidermal cell-lymphocyte reaction (MECLR). In addition, the effects of a potent antioxidant (vitamin E) on these two UVA-induced processes were analysed. (author)

  4. Epidermal stem cells response to radiative genotoxic stress

    International Nuclear Information System (INIS)

    Marie, Melanie

    2013-01-01

    Human skin is the first organ exposed to various environmental stresses, which requires the development by skin stem cells of specific mechanisms to protect themselves and to ensure tissue homeostasis. As stem cells are responsible for the maintenance of epidermis during individual lifetime, the preservation of genomic integrity in these cells is essential. My PhD aimed at exploring the mechanisms set up by epidermal stem cells in order to protect themselves from two genotoxic stresses, ionizing radiation (Gamma Rays) and ultraviolet radiation (UVB). To begin my PhD, I have taken part of the demonstration of protective mechanisms used by keratinocyte stem cells after ionizing radiation. It has been shown that these cells are able to rapidly repair most types of radiation-induced DNA damage. Furthermore, we demonstrated that this repair is activated by the fibroblast growth factor 2 (FGF2). In order to know if this protective mechanism is also operating in cutaneous carcinoma stem cells, we investigated the response to gamma Rays of carcinoma stem cells isolated from a human carcinoma cell line. As in normal keratinocyte stem cells, we demonstrated that cancer stem cells could rapidly repair radio-induced DNA damage. Furthermore, fibroblast growth factor 2 also mediates this repair, notably thanks to its nuclear isoforms. The second project of my PhD was to study human epidermal stem cells and progenitors responses to UVB radiation. Once cytometry and irradiation conditions were set up, the toxicity of UVB radiation has been evaluate in the primary cell model. We then characterized UVB photons effects on cell viability, proliferation and repair of DNA damage. This study allowed us to bring out that responses of stem cells and their progeny to UVB are different, notably at the level of part of their repair activity of DNA damage. Moreover, progenitors and stem cells transcriptomic responses after UVB irradiation have been study in order to analyze the global

  5. Use of a collagen-elastin matrix as transport carrier system to transfer proliferating epidermal cells to human dermis in vitro.

    Science.gov (United States)

    Waaijman, Taco; Breetveld, Melanie; Ulrich, Magda; Middelkoop, Esther; Scheper, Rik J; Gibbs, Susan

    2010-01-01

    This in vitro study describes a novel cell culture, transport, and transfer protocol that may be highly suitable for delivering cultured proliferating keratinocytes and melanocytes to large open skin wounds (e.g., burns). We have taken into account previous limitations identified using other keratinocyte transfer techniques, such as regulatory issues, stability of keratinocytes during transport (single cell suspensions undergo terminal differentiation), ease of handling during application, and the degree of epidermal blistering resulting after transplantation (both related to transplanting keratinocyte sheets). Large numbers of proliferating epidermal cells (EC) (keratinocytes and melanocytes) were generated within 10-14 days and seeded onto a three-dimensional matrix composed of elastin and collagen types I, III, and V (Matriderm®), which enabled easy and stable transport of the EC for up to 24 h under ambient conditions. All culture conditions were in accordance with the regulations set by the Dutch Central Committee on Research Involving Human Subjects (CCMO). As an in vitro model system for clinical in vivo transfer, the EC were then transferred from Matriderm onto human acellular dermis during a period of 3 days. After transfer the EC maintained the ability to regenerate into a fully differentiated epidermis containing melanocytes on the human dermis. Proliferating keratinocytes were located in the basal layer and keratin-10 expression was located in differentiating suprabasal layers similar to that found in human epidermis. No blistering was observed (separation of the epidermis from the basement membrane). Keratin-6 expression was strongly upregulated in the regenerating epidermis similar to normal wound healing. In summary, we show that EC-Matriderm contains viable, metabolically active keratinocytes and melanocytes cultured in a manner that permits easy transportation and contains epidermal cells with the potential to form a pigmented reconstructed

  6. Biochemistry of epidermal stem cells.

    Science.gov (United States)

    Eckert, Richard L; Adhikary, Gautam; Balasubramanian, Sivaprakasam; Rorke, Ellen A; Vemuri, Mohan C; Boucher, Shayne E; Bickenbach, Jackie R; Kerr, Candace

    2013-02-01

    The epidermis is an important protective barrier that is essential for maintenance of life. Maintaining this barrier requires continuous cell proliferation and differentiation. Moreover, these processes must be balanced to produce a normal epidermis. The stem cells of the epidermis reside in specific locations in the basal epidermis, hair follicle and sebaceous glands and these cells are responsible for replenishment of this tissue. A great deal of effort has gone into identifying protein epitopes that mark stem cells, in identifying stem cell niche locations, and in understanding how stem cell populations are related. We discuss these studies as they apply to understanding normal epidermal homeostasis and skin cancer. An assortment of stem cell markers have been identified that permit assignment of stem cells to specific regions of the epidermis, and progress has been made in understanding the role of these cells in normal epidermal homeostasis and in conditions of tissue stress. A key finding is the multiple stem cell populations exist in epidermis that give rise to different structures, and that multiple stem cell types may contribute to repair in damaged epidermis. Understanding epidermal stem cell biology is likely to lead to important therapies for treating skin diseases and cancer, and will also contribute to our understanding of stem cells in other systems. This article is part of a Special Issue entitled Biochemistry of Stem Cells. Copyright © 2012 Elsevier B.V. All rights reserved.

  7. Effects of epidermal growth factor, transferrin, and insulin on lipofection efficiency in human lung carcinoma cells.

    Science.gov (United States)

    Yanagihara, K; Cheng, H; Cheng, P W

    2000-01-01

    Poor transfection efficiency is the major drawback of lipofection. We showed previously that addition of transferrin (TF) to Lipofectin enhanced the expression of a reporter gene in HeLa cells by 120-fold and achieved close to 100% transfection efficiency. The purpose of this study was to determine whether TF and other ligands could improve the efficiency of lipofection in lung carcinoma cells. Confluent A549, Calu3, and H292 cells were transfected for 18 hours with a plasmid DNA (pCMVlacZ) using Lipofectin plus TF, insulin, or epidermal growth factor as the vector. The transfected cells were assessed for transfection efficiency by beta-galactosidase activity (light units/microg protein) and the percentage of blue cells following 5-bromo-4-chloro-3-indolyl beta-D-galactopyranoside staining. Lipofectin supplemented with epidermal growth factor yielded the largest enhancement of lipofection efficiency (lipofection efficiency in A549 and Calu3 cells but not in H292 cells, whereas TF showed significant lipofection efficiency-enhancing effect in Calu3 and H292 cells but not in A549 cells. The transfection efficiency correlated well with the amounts of DNA delivered to the nucleus as well as the amounts of the receptor. These results indicate that the gene delivery strategy employing ligand-facilitated lipofection can achieve high transfection efficiency in human lung carcinoma cells. In addition, enhancement of the expression of the receptor may be a possible strategy for increasing the efficiency of gene targeting.

  8. In vivo UVB irradiation induces clustering of Fas (CD95) on human epidermal cells

    DEFF Research Database (Denmark)

    Bang, Bo; Gniadecki, Robert; Larsen, Jørgen K

    2003-01-01

    In vitro studies with human cell lines have demonstrated that the death receptor Fas plays a role in ultraviolet (UV)-induced apoptosis. The purpose of the present study was to investigate the relation between Fas expression and apoptosis as well as clustering of Fas in human epidermis after...... a single dose of UVB irradiation. Normal healthy individuals were irradiated with three minimal erythema doses (MED) of UVB on forearm or buttock skin. Suction blisters from unirradiated and irradiated skin were raised, and Fas, FasL, and apoptosis of epidermal cells quantified by flow cytometry....... Clustering of Fas was from skin biopsied. Soluble FasL in suction blister fluid was quantified by ELISA. Flow cytometric analysis demonstrated increased expression intensity of Fas after irradiation, with 1.6-,2.2- and 2.7-fold increased median expression at 24, 48 and 72 h after irradiation, respectively (n...

  9. Dermal Contributions to Human Interfollicular Epidermal Architecture and Self-Renewal

    Directory of Open Access Journals (Sweden)

    Kynan T. Lawlor

    2015-11-01

    Full Text Available The human interfollicular epidermis is renewed throughout life by populations of proliferating basal keratinocytes. Though interfollicular keratinocyte stem cells have been identified, it is not known how self-renewal in this compartment is spatially organized. At the epidermal-dermal junction, keratinocytes sit atop a heterogeneous mix of dermal cells that may regulate keratinocyte self-renewal by influencing local tissue architecture and signalling microenvironments. Focusing on the rete ridges and complementary dermal papillae in human skin, we review the identity and organisation of abundant dermal cells types and present evidence for interactions between the dermal microenvironment and the interfollicular keratinocytes.

  10. Human Papilloma Viral DNA Replicates as a Stable Episome in Cultured Epidermal Keratinocytes

    Science.gov (United States)

    Laporta, Robert F.; Taichman, Lorne B.

    1982-06-01

    Human papilloma virus (HPV) is poorly understood because systems for its growth in tissue culture have not been developed. We report here that cultured human epidermal keratinocytes could be infected with HPV from plantar warts and that the viral DNA persisted and replicated as a stable episome. There were 50-200 copies of viral DNA per cell and there was no evidence to indicate integration of viral DNA into the cellular genome. There was also no evidence to suggest that viral DNA underwent productive replication. We conclude that cultured human epidermal keratinocytes may be a model for the study of certain aspects of HPV biology.

  11. Toxicity Assessment of Six Titanium Dioxide Nanoparticles in Human Epidermal Keratinocytes

    Science.gov (United States)

    Toxicity Assessment of Six Titanium Dioxide Nanoparticles in Human Epidermal Keratinocytes Nanoparticle uptake in cells may be an important determinant of their potential cytotoxic and inflammatory effects. Six commercial TiO2 NP (A=Alfa Aesar,10nm, A*=Alfa Aesar 32nm, B=P25 27...

  12. Role of Pin1 in UVA-induced cell proliferation and malignant transformation in epidermal cells

    International Nuclear Information System (INIS)

    Han, Chang Yeob; Hien, Tran Thi; Lim, Sung Chul; Kang, Keon Wook

    2011-01-01

    Highlights: → Pin1 expression is enhanced by low energy UVA irradiation in both skin tissues of hairless mice and JB6 C141 epidermal cells. → UVA irradiation increases activator protein-1 activity and cyclin D1 in a Pin1-dependent manner. → UVA potentiates EGF-inducible, anchorage-independent growth of epidermal cells, and this is suppressed by Pin1 inhibition or by anti-oxidant. -- Abstract: Ultraviolet A (UVA) radiation (λ = 320-400 nm) is considered a major cause of human skin cancer. Pin1, a peptidyl prolyl isomerase, is overexpressed in most types of cancer tissues and plays an important role in cell proliferation and transformation. Here, we demonstrated that Pin1 expression was enhanced by low energy UVA (300-900 mJ/cm 2 ) irradiation in both skin tissues of hairless mice and JB6 C141 epidermal cells. Exposure of epidermal cells to UVA radiation increased cell proliferation and cyclin D1 expression, and these changes were blocked by Pin1 inhibition. UVA irradiation also increased activator protein-1 (AP-1) minimal reporter activity and nuclear levels of c-Jun, but not c-Fos, in a Pin1-dependent manner. The increases in Pin1 expression and in AP-1 reporter activity in response to UVA were abolished by N-acetylcysteine (NAC) treatment. Finally, we found that pre-exposure of JB6 C141 cells to UVA potentiated EGF-inducible, anchorage-independent growth, and this effect was significantly suppressed by Pin1inhibition or by NAC.

  13. Homeobox A7 increases cell proliferation by up-regulation of epidermal growth factor receptor expression in human granulosa cells

    Directory of Open Access Journals (Sweden)

    Yanase Toshihiko

    2010-06-01

    Full Text Available Abstract Background Homeobox (HOX genes encode transcription factors, which regulate cell proliferation, differentiation, adhesion, and migration. The deregulation of HOX genes is frequently associated with human reproductive system disorders. However, knowledge regarding the role of HOX genes in human granulosa cells is limited. Methods To determine the role of HOXA7 in the regulation and associated mechanisms of cell proliferation in human granulosa cells, HOXA7 and epidermal growth factor receptor (EGFR expressions were examined in primary granulosa cells (hGCs, an immortalized human granulosa cell line, SVOG, and a granulosa tumor cell line, KGN, by real-time PCR and Western blotting. To manipulate the expression of HOXA7, the HOXA7 specific siRNA was used to knockdown HOXA7 in KGN. Conversely, HOXA7 was overexpressed in SVOG by transfection with the pcDNA3.1-HOAX7 vector. Cell proliferation was measured by the MTT assay. Results Our results show that HOXA7 and EGFR were overexpressed in KGN cells compared to hGCs and SVOG cells. Knockdown of HOXA7 in KGN cells significantly decreased cell proliferation and EGFR expression. Overexpression of HOXA7 in SVOG cells significantly promoted cell growth and EGFR expression. Moreover, the EGF-induced KGN proliferation was abrogated, and the activation of downstream signaling was diminished when HOXA7 was knocked down. Overexpression of HOXA7 in SVOG cells had an opposite effect. Conclusions Our present study reveals a novel mechanistic role for HOXA7 in modulating granulosa cell proliferation via the regulation of EGFR. This finding contributes to the knowledge of the pro-proliferation effect of HOXA7 in granulosa cell growth and differentiation.

  14. Niclosamide inhibits epithelial-mesenchymal transition and tumor growth in lapatinib-resistant human epidermal growth factor receptor 2-positive breast cancer.

    Science.gov (United States)

    Liu, Junjun; Chen, Xiaosong; Ward, Toby; Mao, Yan; Bockhorn, Jessica; Liu, Xiaofei; Wang, Gen; Pegram, Mark; Shen, Kunwei

    2016-02-01

    Acquired resistance to lapatinib, a human epidermal growth factor receptor 2 kinase inhibitor, remains a clinical problem for women with human epidermal growth factor receptor 2-positive advanced breast cancer, as metastasis is commonly observed in these patients. Niclosamide, an anti-helminthic agent, has recently been shown to exhibit cytotoxicity to tumor cells with stem-like characteristics. This study was designed to identify the mechanisms underlying lapatinib resistance and to determine whether niclosamide inhibits lapatinib resistance by reversing epithelial-mesenchymal transition. Here, two human epidermal growth factor receptor 2-positive breast cancer cell lines, SKBR3 and BT474, were exposed to increasing concentrations of lapatinib to establish lapatinib-resistant cultures. Lapatinib-resistant SKBR3 and BT474 cells exhibited up-regulation of the phenotypic epithelial-mesenchymal transition markers Snail, vimentin and α-smooth muscle actin, accompanied by activation of nuclear factor-кB and Src and a concomitant increase in stem cell marker expression (CD44(high)/CD24(low)), compared to naive lapatinib-sensitive SKBR3 and BT474 cells, respectively. Interestingly, niclosamide reversed epithelial-mesenchymal transition, induced apoptosis and inhibited cell growth by perturbing aberrant signaling pathway activation in lapatinib-resistant human epidermal growth factor receptor 2-positive cells. The ability of niclosamide to alleviate stem-like phenotype development and invasion was confirmed. Collectively, our results demonstrate that lapatinib resistance correlates with epithelial-mesenchymal transition and that niclosamide inhibits lapatinib-resistant cell viability and epithelial-mesenchymal transition. These findings suggest a role of niclosamide or derivatives optimized for more favorable bioavailability not only in reversing lapatinib resistance but also in reducing metastatic potential during the treatment of human epidermal growth factor receptor

  15. Extracellular Matrix as a Regulator of Epidermal Stem Cell Fate.

    Science.gov (United States)

    Chermnykh, Elina; Kalabusheva, Ekaterina; Vorotelyak, Ekaterina

    2018-03-27

    Epidermal stem cells reside within the specific anatomic location, called niche, which is a microenvironment that interacts with stem cells to regulate their fate. Regulation of many important processes, including maintenance of stem cell quiescence, self-renewal, and homeostasis, as well as the regulation of division and differentiation, are common functions of the stem cell niche. As it was shown in multiple studies, extracellular matrix (ECM) contributes a lot to stem cell niches in various tissues, including that of skin. In epidermis, ECM is represented, primarily, by a highly specialized ECM structure, basement membrane (BM), which separates the epidermal and dermal compartments. Epidermal stem cells contact with BM, but when they lose the contact and migrate to the overlying layers, they undergo terminal differentiation. When considering all of these factors, ECM is of fundamental importance in regulating epidermal stem cells maintenance, proper mobilization, and differentiation. Here, we summarize the remarkable progress that has recently been made in the research of ECM role in regulating epidermal stem cell fate, paying special attention to the hair follicle stem cell niche. We show that the destruction of ECM components impairs epidermal stem cell morphogenesis and homeostasis. A deep understanding of ECM molecular structure as well as the development of in vitro system for stem cell maintaining by ECM proteins may bring us to developing new approaches for regenerative medicine.

  16. Human epidermal growth factor: molecular forms and application of radioimmunoassay and radioreceptor assay

    International Nuclear Information System (INIS)

    Hirata, Y.; Orth, D.N.

    1981-01-01

    Epidermal growth factor (EGF), a 53 amino acid polypeptide, was first isolated by Cohen. EGF's growth-promoting activity is not limited to epidermal cells, but is expressed on a wide variety of tissues derived from a number of different species. Human EGF (hEGF) was isolated and subsequently purified from human urine. Unexpectedly, a close structural relationship was recognized between mEGF and human β-urogastrone. The authors recently developed both an homologous hEGF radioimmunoassay (RIA) and a radioreceptor assay (RRA) using a human placental membrane fraction. Using these assays, the molecular size of hEGF in human body fluids and tissues was evaluated, and partial characterization of a high molecular weight form of hEGF isolated from human urine was carried out. The concentrations of immunoreactive hEGF were also determined in human tissues and plasma after extraction either with cationic exchange chromatography or with immunoaffinity chromatography. (Auth.)

  17. Frozen allogeneic human epidermal cultured sheets for the cure of complicated leg ulcers.

    Science.gov (United States)

    Bolívar-Flores, Y J; Kuri-Harcuch, W

    1999-08-01

    Skin ulcers due to venous stasis or diabetes are common among the elderly and are difficult to treat. Repeated applications of cell-based products have been reported to result in cure or improvement of leg ulcers of small size in a fraction of patients. To examine the effects of frozen human allogeneic epidermal cultures for the treatment of acute and chronic ulcers. We treated a series of 10 consecutive patients with leg ulcers of different etiology and duration with frozen human allogeneic epidermal cultures stored frozen and thawed for 5-10 minutes at room temperature before application. Three patients had ulcers with exposed Achilles or extensor tendon. The ulcers treated were as large as 160 cm2 in area and of up to 20-years' duration. After preliminary preparation of the wounds by debridement to remove necrotic tissue and application of silver sulfadiazine to control infection, thawed cultures were applied biweekly from 2 to 15 times depending on the size and complexity of the ulcer. All ulcers healed, including those with tendon exposure. After the first few applications, granulation tissue formed in the ulcer bed and on exposed tendons, and epidermal healing took place through proliferation and migration of cells from the margins of the wound. The time required for complete healing ranged from 1 to 31 weeks after the first application. The use of frozen human allogeneic epidermal cultures is a safe and effective treatment for venous or diabetic ulcers, even those with tendon exposure. It seems possible that any leg ulcer will be amenable to successful treatment by this method.

  18. Maturational steps of bone marrow-derived dendritic murine epidermal cells. Phenotypic and functional studies on Langerhans cells and Thy-1+ dendritic epidermal cells in the perinatal period.

    Science.gov (United States)

    Elbe, A; Tschachler, E; Steiner, G; Binder, A; Wolff, K; Stingl, G

    1989-10-15

    The adult murine epidermis harbors two separate CD45+ bone marrow (BM)-derived dendritic cell systems, i.e., Ia+, ADPase+, Thy-1-, CD3- Langerhans cells (LC) and Ia-, ADPase-, Thy-1+, CD3+ dendritic epidermal T cells (DETC). To clarify whether the maturation of these cells from their ill-defined precursors is already accomplished before their entry into the epidermis or, alternatively, whether a specific epidermal milieu is required for the expression of their antigenic determinants, we studied the ontogeny of CD45+ epidermal cells (EC). In the fetal life, there exists a considerable number of CD45+, Ia-, ADPase+ dendritic epidermal cells. When cultured, these cells become Ia+ and, in parallel, acquire the potential of stimulating allogeneic T cell proliferation. These results imply that CD45+, Ia-, ADPase+ fetal dendritic epidermal cells are immature LC precursors and suggest that the epidermis plays a decisive role in LC maturation. The day 17 fetal epidermis also contains a small population of CD45+, Thy-1+, ADPase-, CD3- round cells. Over the course of 2 to 3 wk, they are slowly replaced by an ever increasing number of round and, finally, dendritic CD45+, Thy-1+, CD3+ EC. Thus, CD45+, Thy-1+, ADPase-, CD3- fetal EC may either be DETC precursors or, alternatively, may represent a distinctive cell system of unknown maturation potential. According to this latter theory, these cells would be eventually outnumbered by newly immigrating CD45+, Thy-1+, CD3+ T cells--the actual DETC.

  19. Use of etanercept to treat toxic epidermal necrolysis in a human immunodeficiency virus-positive patient

    OpenAIRE

    Yung-Yi Lee; Jui-Hung Ko; Chia-Hung Wei; Wen-Hung Chung

    2013-01-01

    Toxic epidermal necrolysis (TEN) is an uncommon and severe cutaneous adverse drug reaction that causes disseminated necrosis of epidermal cells and mucocutaneous detachment. Here, we report the case of a 32-year-old man with human immunodeficiency virus infection who presented with generalized violaceous macules and blister formation 4 days after the administration of mefenamic acid and amoxicillin for a dental procedure. Additional symptoms included oral ulcers and conjunctivitis. Results of...

  20. Heavy metal-induced cytotoxicity to cultured human epidermal keratinocytes and effects of antioxidants.

    Science.gov (United States)

    Kappus, H; Reinhold, C

    1994-04-01

    Human epidermal keratinocytes which have been cultured were treated with the heavy metal ions of cadmium, mercury, copper and zinc. Cytotoxicity was measured either by protein estimation or by using the neutral red assay. Antioxidants were added in order to find out whether heavy metal-induced cytotoxicity is related to oxidative stress. All metals used showed considerable cytotoxic effects within 24 h in moderate concentrations. None of the antioxidants vitamin E (alpha-tocopherol), pyrogallol, propyl gallate, BHT or ebselen showed any protective or preventive effect. This indicates that oxidative stress may not be involved in the cytotoxicity induced by heavy metals in human epidermal keratinocytes. The cells used are, however, a valuable tool to study mechanisms of cytotoxicity.

  1. Expression and significance of HMGB1, TLR4 and NF-κB p65 in human epidermal tumors

    International Nuclear Information System (INIS)

    Weng, Hui; Deng, Yunhua; Xie, Yuyan; Liu, Hongbo; Gong, Feili

    2013-01-01

    High mobility group protein box 1 (HMGB1) is a DNA binding protein located in nucleus. It is released into extracellular fluid where it acts as a novel proinflammatory cytokine which interacts with Toll like receptor 4 (TLR4) to activate nuclear factor-κB (NF-κB). This sequence of events is involved in tumor growth and progression. However, the effects of HMGB1, TLR4 and NF-κB on epidermal tumors remain unclear. Human epidermal tumor specimens were obtained from 96 patients. Immunohistochemistry was used to detect expression of HMGB1, TLR4 and NF-κB p65 in human epidermal tumor and normal skin specimens. Western blot analysis was used to detect the expression of NF-κB p65 in epithelial cell nuclei in human epidermal tumor and normal tissues. Immunohistochemistry and western blot analysis indicated a progressive but statistically significant increase in p65 expression in epithelial nuclei in benign seborrheic keratosis (SK), precancerous lesions (PCL), low malignancy basal cell carcinoma (BCC) and high malignancy squamous cell carcinoma (SCC) (P <0.01). The level of extracellular HMGB1 in SK was significantly higher than in normal skin (NS) (P <0.01), and was higher than in SCC but without statistical significance. The level of TLR4 on epithelial membranes of SCC cells was significantly higher than in SK, PCL, BCC and NS (P <0.01). There was a significant positive correlation between p65 expression in the epithelial nuclei and TLR4 expression on the epithelial cell membranes (r = 0.3212, P <0.01). These findings indicate that inflammation is intensified in parallel with increasing malignancy. They also indicate that the TLR4 signaling pathway, rather than HMGB1, may be the principal mediator of inflammation in high-grade malignant epidermal tumors. Combined detection of p65 in the epithelial nuclei and TLR4 on the epithelial membranes may assist the accurate diagnosis of malignant epidermal tumors

  2. Ultra-weak photon emission as a non-invasive tool for monitoring of oxidative processes in the epidermal cells of human skin: comparative study on the dorsal and the palm side of the hand.

    Science.gov (United States)

    Rastogi, Anshu; Pospísil, Pavel

    2010-08-01

    All living organisms emit spontaneous ultra-weak photon emission as a result of cellular metabolic processes. Exposure of living organisms to exogenous factors results in oxidative processes and enhancement in ultra-weak photon emission. Here, hydrogen peroxide (H(2)O(2)), as a strongly oxidizing molecule, was used to induce oxidative processes and enhance ultra-weak photon emission in human hand skin. The presented work intends to compare both spontaneous and peroxide-induced ultra-weak photon emission from the epidermal cells on the dorsal and the palm side of the hand. A highly sensitive photomultiplier tube and a charge-coupled device camera were used to detect ultra-weak photon emission from human hand skin. Spontaneous ultra-weak photon emission from the epidermal cells on the dorsal side of the hand was 4 counts/s. Topical application of 500 mM H(2)O(2) to the dorsal side of the hand caused enhancement in ultra-weak photon emission to 40 counts/s. Interestingly, both spontaneous and peroxide-induced ultra-weak photon emission from the epidermal cells on the palm side of the hand were observed to increase twice their values, i.e. 8 and 80 counts/s, respectively. Similarly, the two-dimensional image of ultra-weak photon emission observed after topical application of H(2)O(2) to human skin reveals that photon emission from the palm side exceeds the photon emission from the dorsal side of the hand. The results presented indicate that the ultra-weak photon emission originating from the epidermal cells on the dorsal and the palm side of the hand is related to the histological structure of the human hand skin. Ultra-weak photon emission is shown as a non-destructive technique for monitoring of oxidative processes in the epidermal cells of the human hand skin and as a diagnostic tool for skin diseases.

  3. Phosphoproteomic fingerprinting of epidermal growth factor signaling and anticancer drug action in human tumor cells.

    Science.gov (United States)

    Lim, Yoon-Pin; Diong, Lang-Shi; Qi, Robert; Druker, Brian J; Epstein, Richard J

    2003-12-01

    Many proteins regulating cancer cell growth are tyrosine phosphorylated. Using antiphosphotyrosine affinity chromatography, thiourea protein solubilization, two-dimensional PAGE, and mass spectrometry, we report here the characterization of the epidermal growth factor (EGF)-induced phosphoproteome in A431 human epidermoid carcinoma cells. Using this approach, more than 50 distinct tyrosine phosphoproteins are identifiable within five main clusters-cytoskeletal proteins, signaling enzymes, SH2-containing adaptors, chaperones, and focal adhesion proteins. Comparison of the phosphoproteomes induced in vitro by transforming growth factor-alpha and platelet-derived growth factor demonstrates the pathway- and cell-specific nature of the phosphoproteomes induced. Elimination of both basal and ligand-dependent phosphoproteins by cell exposure to the EGF receptor catalytic inhibitor gefitinib (Iressa, ZD1839) suggests either an autocrine growth loop or the presence of a second inhibited kinase in A431 cells. By identifying distinct patterns of phosphorylation involving novel signaling substrates, and by clarifying the mechanism of action of anticancer drugs, these findings illustrate the potential of immunoaffinity-based phosphoproteomics for guiding the discovery of new drug targets and the rational utilization of pathway-specific chemotherapies.

  4. Upregulation of FOXM1 induces genomic instability in human epidermal keratinocytes

    Directory of Open Access Journals (Sweden)

    Philpott Michael P

    2010-02-01

    Full Text Available Abstract Background The human cell cycle transcription factor FOXM1 is known to play a key role in regulating timely mitotic progression and accurate chromosomal segregation during cell division. Deregulation of FOXM1 has been linked to a majority of human cancers. We previously showed that FOXM1 was upregulated in basal cell carcinoma and recently reported that upregulation of FOXM1 precedes malignancy in a number of solid human cancer types including oral, oesophagus, lung, breast, kidney, bladder and uterus. This indicates that upregulation of FOXM1 may be an early molecular signal required for aberrant cell cycle and cancer initiation. Results The present study investigated the putative early mechanism of UVB and FOXM1 in skin cancer initiation. We have demonstrated that UVB dose-dependently increased FOXM1 protein levels through protein stabilisation and accumulation rather than de novo mRNA expression in human epidermal keratinocytes. FOXM1 upregulation in primary human keratinocytes triggered pro-apoptotic/DNA-damage checkpoint response genes such as p21, p38 MAPK, p53 and PARP, however, without causing significant cell cycle arrest or cell death. Using a high-resolution Affymetrix genome-wide single nucleotide polymorphism (SNP mapping technique, we provided the evidence that FOXM1 upregulation in epidermal keratinocytes is sufficient to induce genomic instability, in the form of loss of heterozygosity (LOH and copy number variations (CNV. FOXM1-induced genomic instability was significantly enhanced and accumulated with increasing cell passage and this instability was increased even further upon exposure to UVB resulting in whole chromosomal gain (7p21.3-7q36.3 and segmental LOH (6q25.1-6q25.3. Conclusion We hypothesise that prolonged and repeated UVB exposure selects for skin cells bearing stable FOXM1 protein causes aberrant cell cycle checkpoint thereby allowing ectopic cell cycle entry and subsequent genomic instability. The aberrant

  5. Protective Effect of Liposome-Encapsulated Glutathione in a Human Epidermal Model Exposed to a Mustard Gas Analog

    Directory of Open Access Journals (Sweden)

    Victor Paromov

    2011-01-01

    Full Text Available Sulfur mustard or mustard gas (HD and its monofunctional analog, 2-chloroethyl ethyl sulfide (CEES, or “half-mustard gas,” are alkylating agents that induce DNA damage, oxidative stress, and inflammation. HD/CEES are rapidly absorbed in the skin causing extensive injury. We hypothesize that antioxidant liposomes that deliver both water-soluble and lipid-soluble antioxidants protect skin cells from immediate CEES-induced damage via attenuating oxidative stress. Liposomes containing water-soluble antioxidants and/or lipid-soluble antioxidants were evaluated using in vitro model systems. Initially, we found that liposomes containing encapsulated glutathione (GSH-liposomes increased cell viability and attenuated production of reactive oxygen species (ROS in HaCaT cells exposed to CEES. Next, GSH-liposomes were tested in a human epidermal model, EpiDerm. In the EpiDerm, GSH-liposomes administered simultaneously or 1 hour after CEES exposure (2.5 mM increased cell viability, inhibited CEES-induced loss of ATP and attenuated changes in cellular morphology, but did not reduce caspase-3 activity. These findings paralleled the previously described in vivo protective effect of antioxidant liposomes in the rat lung and established the effectiveness of GSH-liposomes in a human epidermal model. This study provides a rationale for use of antioxidant liposomes against HD toxicity in the skin considering further verification in animal models exposed to HD.

  6. Sensing radiosensitivity of human epidermal stem cells

    International Nuclear Information System (INIS)

    Rachidi, Walid; Harfourche, Ghida; Lemaitre, Gilles; Amiot, Franck; Vaigot, Pierre; Martin, Michele T.

    2007-01-01

    Purpose: Radiosensitivity of stem cells is a matter of debate. For mouse somatic stem cells, both radiosensitive and radioresistant stem cells have been described. By contrast, the response of human stem cells to radiation has been poorly studied. As epidermis is a radiosensitive tissue, we evaluated in the present work the radiosensitivity of cell populations enriched for epithelial stem cells of human epidermis. Methods and materials: The total keratinocyte population was enzymatically isolated from normal human skin. We used flow cytometry and antibodies against cell surface markers to isolate basal cell populations from human foreskin. Cell survival was measured after a dose of 2 Gy with the XTT assay at 72 h after exposure and with a clonogenic assay at 2 weeks. Transcriptome analysis using oligonucleotide microarrays was performed to assess the genomic cell responses to radiation. Results: Cell sorting based on two membrane proteins, α6 integrin and the transferrin receptor CD71, allowed isolation of keratinocyte populations enriched for the two types of cells found in the basal layer of epidermis: stem cells and progenitors. Both the XTT assay and the clonogenic assay showed that the stem cells were radioresistant whereas the progenitors were radiosensitive. We made the hypothesis that upstream DNA damage signalling might be different in the stem cells and used microarray technology to test this hypothesis. The stem cells exhibited a much more reduced gene response to a dose of 2 Gy than the progenitors, as we found that 6% of the spotted genes were regulated in the stem cells and 20% in the progenitors. Using Ingenuity Pathway Analysis software, we found that radiation exposure induced very specific pathways in the stem cells. The most striking responses were the repression of a network of genes involved in apoptosis and the induction of a network of cytokines and growth factors. Conclusion: These results show for the first time that keratinocyte

  7. BAG-1 enhances cell-cell adhesion, reduces proliferation and induces chaperone-independent suppression of hepatocyte growth factor-induced epidermal keratinocyte migration

    International Nuclear Information System (INIS)

    Hinitt, C.A.M.; Wood, J.; Lee, S.S.; Williams, A.C.; Howarth, J.L.; Glover, C.P.; Uney, J.B.; Hague, A.

    2010-01-01

    Cell motility is important in maintaining tissue homeostasis, facilitating epithelial wound repair and in tumour formation and progression. The aim of this study was to determine whether BAG-1 isoforms regulate epidermal cell migration in in vitro models of wound healing. In the human epidermal cell line HaCaT, endogenous BAG-1 is primarily nuclear and increases with confluence. Both transient and stable p36-Bag-1 overexpression resulted in increased cellular cohesion. Stable transfection of either of the three human BAG-1 isoforms p36-Bag-1 (BAG-1S), p46-Bag-1 (BAG-1M) and p50-Bag-1 (BAG-1L) inhibited growth and wound closure in serum-containing medium. However, in response to hepatocyte growth factor (HGF) in serum-free medium, BAG-1S/M reduced communal motility and colony scattering, but BAG-1L did not. In the presence of HGF, p36-Bag-1 transfectants retained proliferative response to HGF with no change in ERK1/2 activation. However, the cells retained E-cadherin localisation at cell-cell junctions and exhibited pronounced cortical actin. Point mutations in the BAG domain showed that BAG-1 inhibition of motility is independent of its function as a chaperone regulator. These findings are the first to suggest that BAG-1 plays a role in regulating cell-cell adhesion and suggest an important function in epidermal cohesion.

  8. Insulin binding properties of normal and transformed human epidermal cultured keratinocytes

    International Nuclear Information System (INIS)

    Verrando, P.; Ortonne, J.P.

    1985-01-01

    Insulin binding to its receptors was studied in cultured normal and transformed (A431 line) human epidermal keratinocytes. The specific binding was a temperature-dependent, saturable process. Normal keratinocytes possess a mean value of about 80,000 receptors per cell. Fifteen hours exposure of the cells to insulin lowered their receptor number (about 65% loss in available sites); these reappeared when the hormone was removed from the culture medium. In the A431 epidermoid carcinoma cell line, there is a net decrease in insulin binding (84% of the initial bound/free hormone ratio in comparison with normal cells) essentially related to a loss in receptor affinity for insulin. Thus, cultured human keratinocytes which express insulin receptors may be a useful tool in understanding skin pathology related to insulin disorders

  9. Protein kinase C is differentially regulated by thrombin, insulin, and epidermal growth factor in human mammary tumor cells

    Energy Technology Data Exchange (ETDEWEB)

    Gomez, M.L.; Tellez-Inon, M.T. (Instituto de Ingenieria Genetica y Biologia Molecular, Buenos Aires (Argentina)); Medrano, E.E.; Cafferatta, E.G.A. (Instituto de Investigaciones Bioquimicas Fundacion Campomar, Buenos Aires (Argentina))

    1988-03-01

    The exposure of serum-deprived mammary tumor cells MCF-7 and T-47D to insulin, thrombin, and epidermal growth factor (EGF) resulted in dramatic modifications in the activity and in the translocation capacity of protein kinase C from cytosol to membrane fractions. Insulin induces a 600% activation of the enzyme after 5 h of exposure to the hormone in MCF-7 cells; thrombin either activates (200% in MCF-7) or down-regulates (in T-47D), and EGF exerts only a moderate effect. Thus, the growth factors studied modulate differentially the protein kinase C activity in human mammary tumor cells. The physiological significance of the results obtained are discussed in terms of the growth response elicited by insulin, thrombin, and EGF.

  10. In vivo UVB irradiation induces clustering of Fas (CD95) on human epidermal cells

    DEFF Research Database (Denmark)

    Bang, Bo; Gniadecki, Robert; Larsen, Jørgen K

    2003-01-01

    a single dose of UVB irradiation. Normal healthy individuals were irradiated with three minimal erythema doses (MED) of UVB on forearm or buttock skin. Suction blisters from unirradiated and irradiated skin were raised, and Fas, FasL, and apoptosis of epidermal cells quantified by flow cytometry...

  11. Recurrent exposure to nicotine differentiates human bronchial epithelial cells via epidermal growth factor receptor activation

    International Nuclear Information System (INIS)

    Martinez-Garcia, Eva; Irigoyen, Marta; Anso, Elena; Martinez-Irujo, Juan Jose; Rouzaut, Ana

    2008-01-01

    Cigarette smoking is the major preventable cause of lung cancer in developed countries. Nicotine (3-(1-methyl-2-pyrrolidinyl)-pyridine) is one of the major alkaloids present in tobacco. Besides its addictive properties, its effects have been described in panoply of cell types. In fact, recent studies have shown that nicotine behaves as a tumor promoter in transformed epithelial cells. This research focuses on the effects of acute repetitive nicotine exposure on normal human bronchial epithelial cells (NHBE cells). Here we show that treatment of NHBE cells with recurrent doses of nicotine up to 500 μM triggered cell differentiation towards a neuronal-like phenotype: cells emitted filopodia and expressed neuronal markers such as neuronal cell adhesion molecule, neurofilament-M and the transcription factors neuronal N and Pax-3. We also demonstrate that nicotine treatment induced NF-kB translocation to the nucleus, phosphorylation of the epidermal growth factor receptor (EGFR), and accumulation of heparin binding-EGF in the extracellular medium. Moreover, addition of AG1478, an inhibitor of EGFR tyrosine phosphorylation, or cetuximab, a monoclonal antibody that precludes ligand binding to the same receptor, prevented cell differentiation by nicotine. Lastly, we show that differentiated cells increased their adhesion to the extracellular matrix and their protease activity. Given that several lung pathologies are strongly related to tobacco consumption, these results may help to better understand the damaging consequences of nicotine exposure

  12. Epidermal cell death in frogs with chytridiomycosis

    Directory of Open Access Journals (Sweden)

    Laura A. Brannelly

    2017-02-01

    Full Text Available Background Amphibians are declining at an alarming rate, and one of the major causes of decline is the infectious disease chytridiomycosis. Parasitic fungal sporangia occur within epidermal cells causing epidermal disruption, but these changes have not been well characterised. Apoptosis (planned cell death can be a damaging response to the host but may alternatively be a mechanism of pathogen removal for some intracellular infections. Methods In this study we experimentally infected two endangered amphibian species Pseudophryne corroboree and Litoria verreauxii alpina with the causal agent of chytridiomycosis. We quantified cell death in the epidermis through two assays: terminal transferase-mediated dUTP nick end-labelling (TUNEL and caspase 3/7. Results Cell death was positively associated with infection load and morbidity of clinically infected animals. In infected amphibians, TUNEL positive cells were concentrated in epidermal layers, correlating to the localisation of infection within the skin. Caspase activity was stable and low in early infection, where pathogen loads were light but increasing. In animals that recovered from infection, caspase activity gradually returned to normal as the infection cleared. Whereas, in amphibians that did not recover, caspase activity increased dramatically when infection loads peaked. Discussion Increased cell death may be a pathology of the fungal parasite, likely contributing to loss of skin homeostatic functions, but it is also possible that apoptosis suppression may be used initially by the pathogen to help establish infection. Further research should explore the specific mechanisms of cell death and more specifically apoptosis regulation during fungal infection.

  13. Concise Review: Wnt Signaling Pathways in Skin Development and Epidermal Stem Cells.

    Science.gov (United States)

    Veltri, Anthony; Lang, Christopher; Lien, Wen-Hui

    2018-01-01

    Mammalian skin and its appendages constitute the integumentary system forming a barrier between the organism and its environment. During development, skin epidermal cells divide rapidly and stratify into a multilayered epithelium, as well as invaginate downward in the underlying mesenchyme to form hair follicles (HFs). In postnatal skin, the interfollicular epidermal (IFE) cells continuously proliferate and differentiate while HFs undergo cycles of regeneration. Epidermal regeneration is fueled by epidermal stem cells (SCs) located in the basal layer of the IFE and the outer layer of the bulge in the HF. Epidermal development and SC behavior are mainly regulated by various extrinsic cues, among which Wnt-dependent signaling pathways play crucial roles. This review not only summarizes the current knowledge of Wnt signaling pathways in the regulation of skin development and governance of SCs during tissue homeostasis, but also discusses the potential crosstalk of Wnt signaling with other pathways involved in these processes. Stem Cells 2018;36:22-35. © 2017 AlphaMed Press.

  14. Psoriatic T cells reduce epidermal turnover time and affect cell proliferation contributed from differential gene expression.

    Science.gov (United States)

    Li, Junqin; Li, Xinhua; Hou, Ruixia; Liu, Ruifeng; Zhao, Xincheng; Dong, Feng; Wang, Chunfang; Yin, Guohua; Zhang, Kaiming

    2015-09-01

    Psoriasis is mediated primarily by T cells, which reduce epidermal turnover time and affect keratinocyte proliferation. We aimed to identify differentially expressed genes (DEG) in T cells from normal, five pairs of monozygotic twins concordant or discordant for psoriasis, to determine whether these DEG may account for the influence to epidermal turnover time and keratinocyte proliferation. The impact of T cells on keratinocyte proliferation and epidermal turnover time were investigated separately by immunohistochemistry and cultured with (3) H-TdR. mRNA expression patterns were investigated by RNA sequencing and verified by real-time reverse transcription polymerase chain reaction. After co-culture with psoriatic T cells, the expression of Ki-67, c-Myc and p53 increased, while expression of Bcl-2 and epidermal turnover time decreased. There were 14 DEG which were found to participate in the regulation of cell proliferation or differentiation. Psoriatic T cells exhibited the ability to decrease epidermal turnover time and affect keratinocyte proliferation because of the differential expression of PPIL1, HSPH1, SENP3, NUP54, FABP5, PLEKHG3, SLC9A9 and CHCHD4. © 2015 Japanese Dermatological Association.

  15. Expression of the epidermal growth factor receptor in human small cell lung cancer cell lines

    DEFF Research Database (Denmark)

    Damstrup, L; Rygaard, K; Spang-Thomsen, M

    1992-01-01

    of EGF receptor mRNA in all 10 cell lines that were found to be EGF receptor-positive and in one cell line that was found to be EGF receptor-negative in the radioreceptor assay and affinity labeling. Our results provide, for the first time, evidence that a large proportion of a broad panel of small cell......Epidermal growth factor (EGF) receptor expression was evaluated in a panel of 21 small cell lung cancer cell lines with radioreceptor assay, affinity labeling, and Northern blotting. We found high-affinity receptors to be expressed in 10 cell lines. Scatchard analysis of the binding data...... demonstrated that the cells bound between 3 and 52 fmol/mg protein with a KD ranging from 0.5 x 10(-10) to 2.7 x 10(-10) M. EGF binding to the receptor was confirmed by affinity-labeling EGF to the EGF receptor. The cross-linked complex had a M(r) of 170,000-180,000. Northern blotting showed the expression...

  16. Use of etanercept to treat toxic epidermal necrolysis in a human immunodeficiency virus-positive patient

    Directory of Open Access Journals (Sweden)

    Yung-Yi Lee

    2013-06-01

    Full Text Available Toxic epidermal necrolysis (TEN is an uncommon and severe cutaneous adverse drug reaction that causes disseminated necrosis of epidermal cells and mucocutaneous detachment. Here, we report the case of a 32-year-old man with human immunodeficiency virus infection who presented with generalized violaceous macules and blister formation 4 days after the administration of mefenamic acid and amoxicillin for a dental procedure. Additional symptoms included oral ulcers and conjunctivitis. Results of skin biopsy were compatible with Stevens–Johnson syndrome (SJS. SJS progressed to TEN within 2 days. Etanercept treatment showed a dramatic improvement in the symptoms of mucocutaneous lesions. To our knowledge, this is the first report on the treatment of TEN using etanercept in a human immunodeficiency virus-positive patient.

  17. Epidermal stem cells - role in normal, wounded and pathological psoriatic and cancer skin

    DEFF Research Database (Denmark)

    Kamstrup, M.; Faurschou, A.; Gniadecki, R.

    2008-01-01

    In this review we focus on epidermal stem cells in the normal regeneration of the skin as well as in wounded and psoriatic skin. Furthermore, we discuss current data supporting the idea of cancer stem cells in the pathogenesis of skin carcinoma and malignant melanoma. Epidermal stem cells present...... or transit amplifying cells constitute a primary pathogenetic factor in the epidermal hyperproliferation seen in psoriasis. In cutaneous malignancies mounting evidence supports a stem cell origin in skin carcinoma and malignant melanoma and a possible existence of cancer stem cells Udgivelsesdato: 2008/5...

  18. Leptin regulates the pro-inflammatory response in human epidermal keratinocytes.

    Science.gov (United States)

    Lee, Moonyoung; Lee, Eunyoung; Jin, Sun Hee; Ahn, Sungjin; Kim, Sae On; Kim, Jungmin; Choi, Dalwoong; Lim, Kyung-Min; Lee, Seung-Taek; Noh, Minsoo

    2018-05-01

    The role of leptin in cutaneous wound healing process has been suggested in genetically obese mouse studies. However, the molecular and cellular effects of leptin on human epidermal keratinocytes are still unclear. In this study, the whole-genome-scale microarray analysis was performed to elucidate the effect of leptin on epidermal keratinocyte functions. In the leptin-treated normal human keratinocytes (NHKs), we identified the 151 upregulated and 53 downregulated differentially expressed genes (DEGs). The gene ontology (GO) enrichment analysis with the leptin-induced DEGs suggests that leptin regulates NHKs to promote pro-inflammatory responses, extracellular matrix organization, and angiogenesis. Among the DEGs, the protein expression of IL-8, MMP-1, fibronectin, and S100A7, which play roles in which is important in the regulation of cutaneous inflammation, was confirmed in the leptin-treated NHKs. The upregulation of the leptin-induced proteins is mainly regulated by the STAT3 signaling pathway in NHKs. Among the downregulated DEGs, the protein expression of nucleosome assembly-associated centromere protein A (CENPA) and CENPM was confirmed in the leptin-treated NHKs. However, the expression of CENPA and CENPM was not coupled with those of other chromosome passenger complex like Aurora A kinase, INCENP, and survivin. In cell growth kinetics analysis, leptin had no significant effect on the cell growth curves of NHKs in the normal growth factor-enriched condition. Therefore, leptin-dependent downregulation of CENPA and CENPM in NHKs may not be directly associated with mitotic regulation during inflammation.

  19. [Enhanced lymphocyte proliferation in the presence of epidermal cells of HIV-infected patients in vitro].

    Science.gov (United States)

    Kappus, R P; Berger, S; Thomas, C A; Ottmann, O G; Ganser, A; Stille, W; Shah, P M

    1992-07-01

    Clinical observations show that the HIV infection is often associated with affections of the skin. In order to examine the involvement of the epidermal immune system in the HIV infection, we determined accessory cell function of epidermal cells from HIV-1-infected patients. For this we measured the proliferative response of enriched CD(4+)-T-lymphocytes from HIV-infected patients and noninfected controls to stimulation with anti-CD3 and IL-2 in the presence of epidermal cells; the enhancement of the response is dependent on the presence of functionally intact accessory cells. The capacity of epidermal cells to increase the anti-CD3-stimulated T-cell proliferative response was significantly enhanced in HIV patients (CDC III/IVA) as compared with noninfected donors. It is discussed, whether the increased activity of epidermal cells from HIV-infected patients may be responsible for several of the dermal lesions in the course of an HIV infection as due to an enhanced production and release of epidermal cell-derived cytokines.

  20. Gloss, colour and grip: multifunctional epidermal cell shapes in bee- and bird-pollinated flowers.

    Science.gov (United States)

    Papiorek, Sarah; Junker, Robert R; Lunau, Klaus

    2014-01-01

    Flowers bear the function of filters supporting the attraction of pollinators as well as the deterrence of floral antagonists. The effect of epidermal cell shape on the visual display and tactile properties of flowers has been evaluated only recently. In this study we quantitatively measured epidermal cell shape, gloss and spectral reflectance of flowers pollinated by either bees or birds testing three hypotheses: The first two hypotheses imply that bee-pollinated flowers might benefit from rough surfaces on visually-active parts produced by conical epidermal cells, as they may enhance the colour signal of flowers as well as the grip on flowers for bees. In contrast, bird-pollinated flowers might benefit from flat surfaces produced by flat epidermal cells, by avoiding frequent visitation from non-pollinating bees due to a reduced colour signal, as birds do not rely on specific colour parameters while foraging. Moreover, flat petal surfaces in bird-pollinated flowers may hamper grip for bees that do not touch anthers and stigmas while consuming nectar and thus, are considered as nectar thieves. Beside this, the third hypothesis implies that those flower parts which are vulnerable to nectar robbing of bee- as well as bird-pollinated flowers benefit from flat epidermal cells, hampering grip for nectar robbing bees. Our comparative data show in fact that conical epidermal cells are restricted to visually-active parts of bee-pollinated flowers, whereas robbing-sensitive parts of bee-pollinated as well as the entire floral surface of bird-pollinated flowers possess on average flat epidermal cells. However, direct correlations between epidermal cell shape and colour parameters have not been found. Our results together with published experimental studies show that epidermal cell shape as a largely neglected flower trait might act as an important feature in pollinator attraction and avoidance of antagonists, and thus may contribute to the partitioning of flower-visitors.

  1. Gloss, colour and grip: multifunctional epidermal cell shapes in bee- and bird-pollinated flowers.

    Directory of Open Access Journals (Sweden)

    Sarah Papiorek

    Full Text Available Flowers bear the function of filters supporting the attraction of pollinators as well as the deterrence of floral antagonists. The effect of epidermal cell shape on the visual display and tactile properties of flowers has been evaluated only recently. In this study we quantitatively measured epidermal cell shape, gloss and spectral reflectance of flowers pollinated by either bees or birds testing three hypotheses: The first two hypotheses imply that bee-pollinated flowers might benefit from rough surfaces on visually-active parts produced by conical epidermal cells, as they may enhance the colour signal of flowers as well as the grip on flowers for bees. In contrast, bird-pollinated flowers might benefit from flat surfaces produced by flat epidermal cells, by avoiding frequent visitation from non-pollinating bees due to a reduced colour signal, as birds do not rely on specific colour parameters while foraging. Moreover, flat petal surfaces in bird-pollinated flowers may hamper grip for bees that do not touch anthers and stigmas while consuming nectar and thus, are considered as nectar thieves. Beside this, the third hypothesis implies that those flower parts which are vulnerable to nectar robbing of bee- as well as bird-pollinated flowers benefit from flat epidermal cells, hampering grip for nectar robbing bees. Our comparative data show in fact that conical epidermal cells are restricted to visually-active parts of bee-pollinated flowers, whereas robbing-sensitive parts of bee-pollinated as well as the entire floral surface of bird-pollinated flowers possess on average flat epidermal cells. However, direct correlations between epidermal cell shape and colour parameters have not been found. Our results together with published experimental studies show that epidermal cell shape as a largely neglected flower trait might act as an important feature in pollinator attraction and avoidance of antagonists, and thus may contribute to the partitioning of

  2. Hair Follicle and Sebaceous Gland De Novo Regeneration With Cultured Epidermal Stem Cells and Skin-Derived Precursors.

    Science.gov (United States)

    Wang, Xiaoxiao; Wang, Xusheng; Liu, Jianjun; Cai, Ting; Guo, Ling; Wang, Shujuan; Wang, Jinmei; Cao, Yanpei; Ge, Jianfeng; Jiang, Yuyang; Tredget, Edward E; Cao, Mengjun; Wu, Yaojiong

    2016-12-01

    : Stem cell-based organ regeneration is purported to enable the replacement of impaired organs in the foreseeable future. Here, we demonstrated that a combination of cultured epidermal stem cells (Epi-SCs) derived from the epidermis and skin-derived precursors (SKPs) was capable of reconstituting functional hair follicles and sebaceous glands (SG). When Epi-SCs and SKPs were mixed in a hydrogel and implanted into an excisional wound in nude mice, the Epi-SCs formed de novo epidermis along with hair follicles, and SKPs contributed to dermal papilla in the neogenic hair follicles. Notably, a combination of culture-expanded Epi-SCs and SKPs derived from the adult human scalp were sufficient to generate hair follicles and hair. Bone morphogenetic protein 4, but not Wnts, sustained the expression of alkaline phosphatase in SKPs in vitro and the hair follicle-inductive property in vivo when SKPs were engrafted with neonatal epidermal cells into excisional wounds. In addition, Epi-SCs were capable of differentiating into sebocytes and formed de novo SGs, which excreted lipids as do normal SGs. Thus our results indicate that cultured Epi-SCs and SKPs are sufficient to generate de novo hair follicles and SGs, implying great potential to develop novel bioengineered skin substitutes with appendage genesis capacity. In postpartum humans, skin appendages lost in injury are not regenerated, despite the considerable achievement made in skin bioengineering. In this study, transplantation of a combination of culture-expanded epidermal stem cells and skin-derived progenitors from mice and adult humans led to de novo regeneration of functional hair follicles and sebaceous glands. The data provide transferable knowledge for the development of novel bioengineered skin substitutes with epidermal appendage regeneration capacity. ©AlphaMed Press.

  3. H{sup +}/peptide transporter (PEPT2) is expressed in human epidermal keratinocytes and is involved in skin oligopeptide transport

    Energy Technology Data Exchange (ETDEWEB)

    Kudo, Michiko; Katayoshi, Takeshi; Kobayashi-Nakamura, Kumiko [DHC Corporation Laboratories, Division 2, 2-42 Hamada, Mihama-ku, Chiba 261-0025 (Japan); Akagawa, Mitsugu [Department of Biological Chemistry, Division of Applied Life Science, Graduate School of Life and Environmental Sciences, Osaka Prefecture University, 1-1 Gakuen-cho, Naka-ku, Sakai 599-8531 (Japan); Tsuji-Naito, Kentaro, E-mail: knaito@dhc.co.jp [DHC Corporation Laboratories, Division 2, 2-42 Hamada, Mihama-ku, Chiba 261-0025 (Japan)

    2016-07-08

    Peptide transporter 2 (PEPT2) is a member of the proton-coupled oligopeptide transporter family, which mediates the cellular uptake of oligopeptides and peptide-like drugs. Although PEPT2 is expressed in many tissues, its expression in epidermal keratinocytes remains unclear. We investigated PEPT2 expression profile and functional activity in keratinocytes. We confirmed PEPT2 mRNA expression in three keratinocyte lines (normal human epidermal keratinocytes (NHEKs), immortalized keratinocytes, and malignant keratinocytes) by reverse transcription-polymerase chain reaction (RT-PCR) and quantitative real-time RT-PCR. In contrast to PEPT1, PEPT2 expression in the three keratinocytes was similar or higher than that in HepG2 cells, used as PEPT2-positive cells. Immunolocalization analysis using human skin showed epidermal PEPT2 localization. We studied keratinocyte transport function by measuring the oligopeptide content using liquid chromatography/tandem mass spectrometry. Glycylsarcosine uptake in NHEKs was pH-dependent, suggesting that keratinocytes could absorb small peptides in the presence of an inward H{sup +} gradient. We also performed a skin-permeability test of several oligopeptides using skin substitute, suggesting that di- and tripeptides pass actively through the epidermis. In conclusion, PEPT2 is expressed in keratinocytes and involved in skin oligopeptide uptake. -- Highlights: •PEPT2 is expressed in keratinocytes, which are more common than other skin cells. •Immunolocalization analysis using human skin revealed epidermal PEPT2 localization. •Keratinocytes could absorb small peptides in the presence of an inward H{sup +} gradient. •Di- and tripeptide pass actively through the epidermis.

  4. Humanized versus murine anti-human epidermal growth factor receptor monoclonal antibodies for immunoscintigraphic studies

    Energy Technology Data Exchange (ETDEWEB)

    Morales, Alejo A. Morales; Duconge, Jorge; Alvarez-Ruiz, Daniel; Becquer-Viart, Maria de Los Angeles; Nunez-Gandolff, Gilda; Fernandez, Eduardo; Caballero-Torres, Idania; Iznaga-Escobar, Normando

    2000-02-01

    The anti-human epidermal growth factor receptor (EGF-R) humanized antibody h-R3 (IgG{sub 1}), which binds to an extracellular domain of EGF-R, was used to evaluate the biodistribution on nude mice xenografted with A431 epidermoid carcinoma cell line. Results are compared with its murine version ior egf/r3 monoclonal antibody (mAb). Twenty-one athymic female 4NMRI nu/nu mice were injected intravenously with 10 {mu}g/100 {mu}Ci of {sup 99m}Tc-labeled mAbs. The mAb ior C5 that recognizes an antigen expressed preferentially on the surface of malignant and cytoplasm of normal colorectal cells was used as negative control. Immunoreactivity of {sup 99m}Tc-labeled mAbs was measured by enzyme linked immunosorbent assay on A431 cell line and the immunoreactive fractions determined by Lindmo method. Among all organs significant accumulation was found in tumor (6.14{+-}2.50 %ID/g, 5.06{+-}2.61 %ID/g for murine and humanized mAbs, respectively) 4 h after injection. The immunoreactive fractions were found to be 0.88 and 0.81 for murine and humanized mAb, respectively. Thus, we expect better results using the humanized mAb h-R3 for diagnostic immunoscintigraphy.

  5. Humanized versus murine anti-human epidermal growth factor receptor monoclonal antibodies for immunoscintigraphic studies

    International Nuclear Information System (INIS)

    Morales, Alejo A. Morales; Duconge, Jorge; Alvarez-Ruiz, Daniel; Becquer-Viart, Maria de Los Angeles; Nunez-Gandolff, Gilda; Fernandez, Eduardo; Caballero-Torres, Idania; Iznaga-Escobar, Normando

    2000-01-01

    The anti-human epidermal growth factor receptor (EGF-R) humanized antibody h-R3 (IgG 1 ), which binds to an extracellular domain of EGF-R, was used to evaluate the biodistribution on nude mice xenografted with A431 epidermoid carcinoma cell line. Results are compared with its murine version ior egf/r3 monoclonal antibody (mAb). Twenty-one athymic female 4NMRI nu/nu mice were injected intravenously with 10 μg/100 μCi of 99m Tc-labeled mAbs. The mAb ior C5 that recognizes an antigen expressed preferentially on the surface of malignant and cytoplasm of normal colorectal cells was used as negative control. Immunoreactivity of 99m Tc-labeled mAbs was measured by enzyme linked immunosorbent assay on A431 cell line and the immunoreactive fractions determined by Lindmo method. Among all organs significant accumulation was found in tumor (6.14±2.50 %ID/g, 5.06±2.61 %ID/g for murine and humanized mAbs, respectively) 4 h after injection. The immunoreactive fractions were found to be 0.88 and 0.81 for murine and humanized mAb, respectively. Thus, we expect better results using the humanized mAb h-R3 for diagnostic immunoscintigraphy

  6. Epigenetic Regulation of Epidermal Stem Cell Biomarkers and Their Role in Wound Healing

    Directory of Open Access Journals (Sweden)

    Sabita N. Saldanha

    2015-12-01

    Full Text Available As an actively renewable tissue, changes in skin architecture are subjected to the regulation of stem cells that maintain the population of cells responsible for the formation of epidermal layers. Stems cells retain their self-renewal property and express biomarkers that are unique to this population. However, differential regulation of the biomarkers can initiate the pathway of terminal cell differentiation. Although, pockets of non-clarity in stem cell maintenance and differentiation in skin still exist, the influence of epigenetics in epidermal stem cell functions and differentiation in skin homeostasis and wound healing is clearly evident. The focus of this review is to discuss the epigenetic regulation of confirmed and probable epidermal stem cell biomarkers in epidermal stratification of normal skin and in diseased states. The role of epigenetics in wound healing, especially in diseased states of diabetes and cancer, will also be conveyed.

  7. Cellular processes involved in human epidermal cells exposed to extremely low frequency electric fields.

    Science.gov (United States)

    Collard, J-F; Hinsenkamp, M

    2015-05-01

    We observed on different tissues and organisms a biological response after exposure to pulsed low frequency and low amplitude electric or electromagnetic fields but the precise mechanism of cell response remains unknown. The aim of this publication is to understand, using bioinformatics, the biological relevance of processes involved in the modification of gene expression. The list of genes analyzed was obtained after microarray protocol realized on cultures of human epidermal explants growing on deepidermized human skin exposed to a pulsed low frequency electric field. The directed acyclic graph on a WebGestalt Gene Ontology module shows six categories under the biological process root: "biological regulation", "cellular process", "cell proliferation", "death", "metabolic process" and "response to stimulus". Enriched derived categories are coherent with the type of in vitro culture, the stimulation protocol or with the previous results showing a decrease of cell proliferation and an increase of differentiation. The Kegg module on WebGestalt has highlighted "cell cycle" and "p53 signaling pathway" as significantly involved. The Kegg website brings out interactions between FoxO, MAPK, JNK, p53, p38, PI3K/Akt, Wnt, mTor or NF-KappaB. Some genes expressed by the stimulation are known to have an exclusive function on these pathways. Analyses performed with Pathway Studio linked cell proliferation, cell differentiation, apoptosis, cell cycle, mitosis, cell death etc. with our microarrays results. Medline citation generated by the software and the fold change variation confirms a diminution of the proliferation, activation of the differentiation and a less well-defined role of apoptosis or wound healing. Wnt and DKK functional classes, DKK1, MACF1, ATF3, MME, TXNRD1, and BMP-2 genes proposed in previous publications after a manual analysis are also highlighted with other genes after Pathway Studio automatic procedure. Finally, an analysis conducted on a list of genes

  8. Epidermal changes following application of 7,12-dimethylbenz(a)anthracene and 12-O-tetradecanoylphorbol-13-acetate to human skin transplanted to nude mice studied with histological species markers

    International Nuclear Information System (INIS)

    Graem, N.

    1986-01-01

    Effects of the tumor initiator 7,12-dimethylbenz(a)anthracene (DMBA) and of the tumor promoter 12-O-tetradecanoylphorbol-13-acetate (TPA) on epidermis of human fetal and adult skin were studied in the nude mouse/human skin model. Human skin grafts on NC nude mice were exposed to two topical applications of 1 mg of DMBA in 50 microliter of acetone with an interval of 3 days and/or to applications of 10 micrograms of TPA in 50 microliter of acetone twice weekly. In some animals, it was attempted to augment the susceptibility of the grafts to the tumor-initiating effect of DMBA by pretreatment with TPA or ultraviolet light. The mice were sacrificed 8-32 wk after the initial treatment. Tumors did not appear in the central portions of any of the grafts, but epidermal tumors were seen at the graft border in 34.9% of the DMBA-treated animals. To identify human epidermis on the grafts and to determine the species origin of the induced tumors, two independently working histological marker methods were applied. (a) The first is detection of a human Blood Group B-like antigen present in mouse epidermis and in chemically induced murine epidermal tumors. This antigen cannot be demonstrated in human epidermis and in epidermal tumors of human patients. (b) The second is histological staining with the DNA-specific fluorochrome, bisbenzimide, displaying a characteristic pattern of 5-10 intranuclear fluorescent bodies in murine nonneoplastic epidermal cells and in murine epidermal tumor cells. Such a pattern is not seen in human epidermis and in epidermal tumors of human patients. The studies showed that TPA treatment resulted in epidermal hyperplasia in both the human epidermis and the adjacent mouse epidermis and that the induced tumors were derived from murine tissue

  9. Micromorphology and development of the epicuticular structure on the epidermal cell of ginseng leaves

    Directory of Open Access Journals (Sweden)

    Kyounghwan Lee

    2015-04-01

    Conclusion: The outwardly projected cuticle and epidermal cell wall (i.e., an epicuticular wrinkle acts as a major barrier to block out sunlight in ginseng leaves. The small vesicles in the peripheral region of epidermal cells may suppress the cuticle and parts of epidermal wall, push it upward, and consequently contribute to the formation of the epicuticular structure.

  10. Comparative SAXS and DSC study on stratum corneum structural organization in an epidermal cell culture model (ROC)

    DEFF Research Database (Denmark)

    Kuntsche, Judith; Herre, Angela; Fahr, Alfred

    2013-01-01

    barrier similar to that of human stratum corneum is, however, a prerequisite. In this study, the stratum corneum lipid organization in an epidermal cell culture model based on rat epidermal keratinocytes (REK organotypic culture, ROC) was investigated by small-angle X-ray scattering (SAXS) in dependence......Cell cultured skin equivalents present an alternative for dermatological in vitro evaluations of drugs and excipients as they provide the advantage of availability, lower variability and higher assay robustness compared to native skin. For penetration/permeation studies, an adequate stratum corneum...... and SC lipid organization. Cultivation for 21days resulted in further minor changes in the structural organization of ROC SC. The SAXS patterns of ROC SC had overall large similarities with that of human SC and point to the presence of a long periodicity phase with a repeat distance of about 122Å, e...

  11. Effect and Mechanism of EGFL7 Downregulation in Human Osteosarcoma Cells on the Biological Function of Co-cultured HUVEC

    Directory of Open Access Journals (Sweden)

    Xia Li

    2018-03-01

    Full Text Available Background: Even though epidermal growth factor-like domain 7 is known to be overexpressed in osteosarcoma and is associated with poor clinical outcome, few reports are available regarding its mechanism. Aims: The objective of this study was to explore the effect and mechanism of downregulating epidermal growth factor-like domain 7 expression in a human osteosarcoma cell line on the biological function of co-cultured human umbilical vein endothelial cells. Study Design: Cell study. Methods: In the present study, human osteosarcoma cell lines U2OS, Saos-2, HOS, and MG63, and normal human osteoblasts were cultured in Dulbecco’s Modified Eagle Medium containing 10% fetal bovine serum and 1x antibiotics at 37 °C and 5% CO2 in an incubator. Of the four osteosarcoma cell lines, U2OS expresses the highest level of epidermal growth factor-like domain 7 mRNA as determined using quantitative reverse transcription polymerase chain reaction. With the knockdown of epidermal growth factor-like domain 7 in U2OS and human umbilical vein endothelial cells by lentivirus, the proliferation and apoptosis of U2OS and human umbilical vein endothelial cells were investigated using MTT and flow cytometry assays. After the co-culture of human umbilical vein endothelial cells and epidermal growth factor-like domain 7-knockdown U2OS, the in vitro effects on cell proliferation, apoptosis, adhesion, migration, and the angiogenic ability of human umbilical vein endothelial cells were detected using MTT, flow cytometry, Transwell, and tube formation assays, respectively. The expressions of phosphoinositide 3-kinase, phospho-Akt, total Akt, and vascular endothelial growth factor in human umbilical vein endothelial cells were detected using western blot assay. Results: Lentivirus with epidermal growth factor-like domain 7 shRNA could not significantly affect the proliferation and apoptosis of both U2OS and human umbilical vein endothelial cells, whereas the knockdown of

  12. Extraction of high-quality epidermal RNA after ammonium thiocyanate-induced dermo-epidermal separation of 4 mm human skin biopsies

    DEFF Research Database (Denmark)

    Clemmensen, Anders; Thomassen, Mads; Clemmensen, Ole

    2009-01-01

    To obtain a separation of the epidermal and dermal compartments to examine compartment specific biological mechanisms in the skin, we incubated 4 mm human skin punch biopsies in ammonium thiocyanate. We wanted to test (i) the histological quality of the dermo-epidermal separation obtained...... by different incubation times; (ii) the amount and quality of extractable epidermal RNA and (iii) its impact on sample RNA expression profiles assessed by large-scale gene expression microarray analysis in both normal and inflamed skin. At 30-min incubation, the split between dermis and epidermis...... and almost completely separated from the dermis of 4 mm skin biopsies by 30 min incubation in 3.8% ammonium thiocyanate combined with curettage of the dermal surface, producing high-quality RNA suitable for transcriptional analysis. Our refined method of dermo-epidermal separation will undoubtedly prove...

  13. Inhibition of Epidermal Growth Factor Receptor and Vascular Endothelial Growth Factor Receptor Phosphorylation on Tumor-Associated Endothelial Cells Leads to Treatment of Orthotopic Human Colon Cancer in Nude Mice

    Directory of Open Access Journals (Sweden)

    Takamitsu Sasaki

    2007-12-01

    Full Text Available The purpose of our study was to determine whether the dual inhibition of epidermal growth factor receptor (EGFR and vascular endothelial growth factor receptor (VEGFR signaling pathways in tumor-associated endothelial cells can inhibit the progressive growth of human colon carcinoma in the cecum of nude mice. SW620CE2 human colon cancer cells growing in culture and orthotopically in the cecum of nude mice expressed a high level of transforming growth factor alpha (TGF-α and vascular endothelial growth factor (VEGF but were negative for EGFR, human epidermal growth factor receptor 2 (HER2, VEGFR. Double immunofluorescence staining revealed that tumorassociated endothelial cells expressed EGFR, VEGFR2, phosphorylated EGFR (pEGFR, phosphorylated VEGFR (pVEGFR. Treatment of mice with either 7H-pyrrolo [2,3-d]-pyrimidine lead scaffold (AEE788; an inhibitor of EGFR and VEGFR tyrosine kinase or CPT-11 as single agents significantly inhibited the growth of cecal tumors (P < .01; this decrease was even more pronounced with AEE788 combined with CPT-11 (P < .001. AEE788 alone or combined with CPT-11 also inhibited the expression of pEGFR and pVEGFR on tumor-associated endothelial cells, significantly decreased vascularization and tumor cell proliferation, increased the level of apoptosis in both tumorassociated endothelial cells and tumor cells. These data demonstrate that targeting EGFR and VEGFR signaling on tumor-associated endothelial cells provides a viable approach for the treatment of colon cancer.

  14. Inhibition of Epidermal Growth Factor Receptor and PI3K/Akt Signaling Suppresses Cell Proliferation and Survival through Regulation of Stat3 Activation in Human Cutaneous Squamous Cell Carcinoma

    International Nuclear Information System (INIS)

    Bito, T.; Sumita, N.; Ashida, M.; Budiyanto, A.; Ueda, M.; Ichihashi, M.; Nishigori, C.; Tokura, Y.; Bito, T.

    2011-01-01

    Recent studies have emphasized the important role of Stat3 activation in a number of human tumors from the viewpoint of its oncogenic and anti apoptotic activity. In this study, we examined the role and related signaling molecules of Stat3 in the carcinogenesis of human cutaneous squamous cell carcinoma (SCC). In 35 human cutaneous SCC samples, 86% showed overexpression of phosphorylated (p)-Stat3, and most of those simultaneously over expressed p-EGFR or p-Akt. Constitutive activation of EGFR and Stat3 was observed in three SCC cell lines and four of five SCC tissues. AG1478, an inhibitor of the EGFR, down regulated Stat3 activation in HSC-1 human SCC cells. AG1478 inhibited cell proliferation and induced apoptosis of HSC-1 cells but did not inhibit the growth of normal human epidermal keratinocytes that did not show Stat3 activation. Furthermore, a PI3K inhibitor also suppressed Stat3 activation in HSC-1 cells to some degree. Combined treatment with the PI3K inhibitor and AG1478 strongly suppressed Stat3 activity and dramatically induced apoptosis of HSC-1 cells. These data suggest that Stat3 activation through EGFR and/or PI3K/Akt activation plays a critical role in the proliferation and survival of human cutaneous SCC.

  15. Structural and biophysical characteristics of human skin in maintaining proper epidermal barrier function

    Directory of Open Access Journals (Sweden)

    Magdalena Boer

    2016-02-01

    Full Text Available The complex structure of human skin and its physicochemical properties turn it into an efficient outermost defence line against exogenous factors, and help maintain homeostasis of the human body. This role is played by the epidermal barrier with its major part – stratum corneum. The condition of the epidermal barrier depends on individual and environmental factors. The most important biophysical parameters characterizing the status of this barrier are the skin pH, epidermal hydration, transepidermal water loss and sebum excretion. The knowledge of biophysical skin processes may be useful for the implementation of prophylactic actions whose aim is to restore the barrier function.

  16. Burn injury suppresses human dermal dendritic cell and Langerhans cell function

    NARCIS (Netherlands)

    van den Berg, Linda M.; de Jong, Marein A. W. P.; Witte, Lot de; Ulrich, Magda M. W.; Geijtenbeek, Teunis B. H.

    2011-01-01

    Human skin contains epidermal Langerhans cells (LCs) and dermal dendritic cells (DCs) that are key players in induction of adaptive immunity upon infection. After major burn injury, suppressed adaptive immunity has been observed in patients. Here we demonstrate that burn injury affects adaptive

  17. Epidermal growth factor receptor in primary human lung cancer

    International Nuclear Information System (INIS)

    Yu Xueyan; Hu Guoqiang; Tian Keli; Wang Mingyun

    1996-01-01

    Cell membranes were prepared from 12 human lung cancers for the study of the expression of epidermal growth factor receptors (EGFR). EGFR concentration was estimated by ligand binding studies using 125 I-radiolabeled EGF. The dissociation constants of the high affinity sites were identical, 1.48 nmol and 1.1 nmol in cancer and normal lung tissues, the EGFR contents were higher in lung cancer tissues (range: 2.25 to 19.39 pmol·g -1 membrane protein) than that in normal tissues from the same patients (range: 0.72 to 7.43 pmol·g -1 membrane protein). These results suggest that EGF and its receptor may play a role in the regulatory mechanisms in the control of lung cellular growth and tumor promotion

  18. Specific receptors for epidermal growth factor in human bone tumour cells and its effect on synthesis of prostaglandin E2 by cultured osteosarcoma cell line

    International Nuclear Information System (INIS)

    Hirata, Y.; Uchihashi, M.; Nakashima, H.; Fujita, T.; Matsukura, S.; Matsui, K.

    1984-01-01

    Using tumour cell lines derived from human bone tumours, specific binding sites for epidermal growth factor (EGF), a potent growth stimulator in many tissues, and its effect on synthesis of prostaglandin (PG) E 2 , a potent bone-resorbing factor, by cultured osteosarcoma cell line were studied. Three tumour cell lines, one osteosarcoma (HOSO) and two giant cell tumours of the bone (G-1 and G-2), all possessed specific binding sites for 125 I-labelled EGF: the apparent dissociation constant was approximately 4-10 x 10 -10 M and the maximal binding capacity was 50 000-80 000 sites/cell. EGF had no mitogenic effect in these cell lines. However, these cell lines did not have specific binding sites for 125 I-labelled parathyroid hormone (PTH) or calcitonin. HOSO line produced and secreted PGE 2 into medium, while no significant amount of PGE 2 was demonstrated in G-1 or G-2 line. EGF significantly stimulated PGE 2 production in HOSO line in a dose-dependent manner (0.5-50 ng/ml); its stimulatory effect was completely abolished by indomethacin, an inhibitor of PG biosynthesis. Exogenous PGE 1 significantly stimulated cyclic AMP formation in HOSO line, whereas PGFsub(2α) PTH, calcitonin, or EGF had no effect. None of these calcium-regulating hormones affected cyclic AMP generation in either G-1 of G-2 line. These data indicate that human bone tumour cells have specific EGF receptors unrelated to cell growth, and suggest that EGF may be involved in bone resorption through a PGE 2 -mediated process in human osseous tissues. (author)

  19. Epidermal growth factor and its receptors in human pancreatic carcinoma

    International Nuclear Information System (INIS)

    Chen, Y.F.; Pan, G.Z.; Hou, X.; Liu, T.H.; Chen, J.; Yanaihara, C.; Yanaihara, N.

    1990-01-01

    The role of epidermal growth factor (EGF) in oncogenesis and progression of malignant tumors is a subject of vast interest. In this study, radioimmunoassay and radioreceptor assay of EGF were established. EGF contents in malignant and benign pancreatic tumors, in normal pancreas tissue, and in culture media of a human pancreatic carcinoma cell line were determined. EGF receptor binding studies were performed. It was shown that EGF contents in pancreatic carcinomas were significantly higher than those in normal pancreas or benign pancreatic tumors. EGF was also detected in the culture medium of a pancreatic carcinoma cell line. The binding of 125I-EGF to the pancreatic carcinoma cells was time and temperature dependent, reversible, competitive, and specific. Scatchard analysis showed that the dissociation constant of EGF receptor was 2.1 X 10(-9) M, number of binding sites was 1.3 X 10(5) cell. These results indicate that there is an over-expression of EGF/EGF receptors in pancreatic carcinomas, and that an autocrine regulatory mechanism may exist in the growth-promoting effect of EGF on tumor cells

  20. Epidermal growth in the bottlenose dolphin, Tursiops truncatus

    International Nuclear Information System (INIS)

    Hicks, B.D.; St Aubin, D.J.; Geraci, J.R.; Brown, W.R.

    1985-01-01

    Epidermal growth in two mature female bottlenose dolphins, Tursiops truncatus, was investigated by following the movement of a cohort of tritiated thymidine-labeled epidermal cells for 59 days. The majority of the cells migrated in a cluster which was estimated to reach the skin surface in 73 days. The authors calculate that the outermost cell layer is sloughed 12 times per day. Turnover time and sloughing rate are estimated to be 1.7 times longer and 8.5 times faster than the respective values for epidermal cell kinetics in humans. This apparent inconsistency of slow transit time and rapid sloughing rate is reconciled by the convoluted structure of the stratum germinativum in the dolphin which results in a ratio of germinatival to superficial cells of 876:1. The stratum germinativum of dolphin epidermis appears to lack morphologically distinct, spatially segregated subpopulations of anchoring and stem cells. Dolphin epidermis has a large capacity for cell population, relatively long turnover time, and rapid sloughing rate. The adaptive advantages of these characteristics are discussed

  1. Epidermal growth in the bottlenose dolphin, Tursiops truncatus

    Energy Technology Data Exchange (ETDEWEB)

    Hicks, B.D.; St. Aubin, D.J.; Geraci, J.R.; Brown, W.R.

    1985-07-01

    Epidermal growth in two mature female bottlenose dolphins, Tursiops truncatus, was investigated by following the movement of a cohort of tritiated thymidine-labeled epidermal cells for 59 days. The majority of the cells migrated in a cluster which was estimated to reach the skin surface in 73 days. The authors calculate that the outermost cell layer is sloughed 12 times per day. Turnover time and sloughing rate are estimated to be 1.7 times longer and 8.5 times faster than the respective values for epidermal cell kinetics in humans. This apparent inconsistency of slow transit time and rapid sloughing rate is reconciled by the convoluted structure of the stratum germinativum in the dolphin which results in a ratio of germinatival to superficial cells of 876:1. The stratum germinativum of dolphin epidermis appears to lack morphologically distinct, spatially segregated subpopulations of anchoring and stem cells. Dolphin epidermis has a large capacity for cell population, relatively long turnover time, and rapid sloughing rate. The adaptive advantages of these characteristics are discussed.

  2. Examination of tetrachlorosalicylanilide (TCSA) photoallergy using in vitro photohapten-modified Langerhans cell-enriched epidermal cells

    International Nuclear Information System (INIS)

    Gerberick, G.F.; Ryan, C.A.; Von Bargen, E.C.; Stuard, S.B.; Ridder, G.M.

    1991-01-01

    Lymphocytes from BALB/c mice photosensitized in vivo to tetrachlorosalicylanilide (TCSA) were investigated to determine whether they could be stimulated to proliferate when cultured with Langerhans cell-enriched cultured epidermal cells (LC-EC) photohapten-modified in vitro with TCSA + UVA radiation. Cultured LC-EC were photohapten-modified in vitro by irradiation in TCSA-containing medium using a 1000-watt solar simulator equipped with filters to deliver primarily UVA radiation (320-400 nm). Lymphocytes from TCSA-photosensitized mice were incubated with LC-EC that had been treated in vitro with 0.1 mM TCSA and 2 J/cm2 UVA radiation (TCSA + UVA). Responder lymphocytes demonstrated a significant increase in their blastogenesis response compared to lymphocytes that were incubated with LC-EC irradiated with UVA prior to treatment with TCSA (UVA/TCSA) or with LC-EC that had received no treatment. Lymphocytes from naive mice or mice photosensitized with musk ambrette (MA) demonstrated a significantly lower response to LC-EC modified with TCSA + UVA, indicating the specificity of the response. Maximum blastogenesis response was achieved when LC-EC were treated with 0.1 mM TCSA and a UVA radiation dose of at least 0.5 J/cm2. Epidermal cells depleted of LC by treatment with anti-Ia antibody plus complement or by an adherence procedure were unable to stimulate this blastogenesis response. Epidermal cells treated in vitro with TCSA + UVA demonstrated enhanced fluorescence compared to control cells. The fluorescence observed was not restricted to any specific epidermal cell type; however, fluorescence microscopy studies revealed that dendritic Ia-positive cells, presumably LC, were also TCSA fluorescent

  3. Kinetics of growth and differentiation of cultured human epidermal keratinocytes

    International Nuclear Information System (INIS)

    Albers, K.M.

    1985-01-01

    A study was made of the interrelationship between replication and differentiation in cultures of human epidermal keratinocytes. Measures of both parameters were made using newly developed methods to quantify the rate at which keratinocytes replicate and the rate at which they withdraw from the cell cycle. Keratinocyte replication was measured by determining the cell doubling time, labeling index, and cell cycle duration. Cell cycle length was measured using a double label assay that determines the length of time between two successive phases of DNA synthesis. The first DNA synthesis phase was marked by labeling keratinocytes with 14 C-thymidine. At the next round of DNA synthesis, cells were labeled with bromodeoxyuridine, a heavy analog of thymidine. The cell cycle length is given by the time required for the 14 C-labeled DNA to become double labeled. To measure keratinocyte differentiation, the rate at which cells withdraw from the cell cycle was determined. To measure withdrawal, the percentage of cells labeled by a pulse of 14 C-thymidine that failed to undergo a second cycle of DNA synthesis, as measured by bromodeoxyuridine incorporation, was determined. Cells which failed to undergo a second cycle of synthesis were considered to have differentiated and withdrawn from the cell cycle

  4. Rho A Regulates Epidermal Growth Factor-Induced Human Osteosarcoma MG63 Cell Migration

    Directory of Open Access Journals (Sweden)

    Jinyang Wang

    2018-05-01

    Full Text Available Osteosarcoma, the most common primary bone tumor, occurs most frequently in children and adolescents and has a 5-year survival rate, which is unsatisfactory. As epidermal growth factor receptor (EGFR positively correlates with TNM (tumor-node-metastasis stage in osteosarcoma, EGFR may play an important role in its progression. The purpose of this study was to explore potential mechanisms underlying this correlation. We found that EGF promotes MG63 cell migration and invasion as well as stress fiber formation via Rho A activation and that these effects can be reversed by inhibiting Rho A expression. In addition, molecules downstream of Rho A, including ROCK1, LIMK2, and Cofilin, are activated by EGF in MG63 cells, leading to actin stress fiber formation and cell migration. Moreover, inhibition of ROCK1, LIMK2, or Cofilin in MG63 cells using known inhibitors or short hairpin RNA (shRNA prevents actin stress fiber formation and cell migration. Thus, we conclude that Rho A/ROCK1/LIMK2/Cofilin signaling mediates actin microfilament formation in MG63 cells upon EGFR activation. This novel pathway provides a promising target for preventing osteosarcoma progression and for treating this cancer.

  5. Signalling in the epidermis: the E2F cell cycle regulatory pathway in epidermal morphogenesis, regeneration and transformation.

    Science.gov (United States)

    Ivanova, Iordanka A; D'Souza, Sudhir J A; Dagnino, Lina

    2005-01-01

    The epidermis is the outermost layer in the skin, and it is the first line of defence against the environment. The epidermis also provides a barrier against loss of fluids and electrolytes, which is crucial for life. Essential in the maintenance of this tissue is its ability to continually self-renew and regenerate after injury. These two characteristics are critically dependent on the ability of the principal epidermal cell type, the keratinocyte, to proliferate and to respond to differentiation cues. Indeed, the epidermis is a multilayered tissue composed of keratinocyte stem cells and their differentiated progeny. Central for the control of cell proliferation is the E2F transcription factor regulatory network. This signaling network also includes cyclins, cdk, cdk inhibitors and the retinoblastoma (pRb) family of proteins. The biological importance of the E2F/pRb pathway is emphasized by the fact that a majority of human tumours exhibit alterations that disrupt the ability of pRb proteins to inhibit E2F, leading to permanent activation of the latter. Further, E2F is essential for normal epidermal regeneration after injury. Other member of the E2F signaling pathway are also involved in epidermal development and pathophysiology. Thus, whereas the pRb family of proteins is essential for epidermal morphogenesis, abnormal regulation of cyclins and E2F proteins results in tumorgenesis in this tissue. In this review, we discuss the role of each member of this important growth regulatory network in epidermal formation, homeostasis and carcinogenesis.

  6. Fatal Metastatic Cutaneous Squamous Cell Carcinoma Evolving from a Localized Verrucous Epidermal Nevus

    Directory of Open Access Journals (Sweden)

    Hassan Riad

    2013-10-01

    Full Text Available A malignant transformation is known to occur in many nevi such as a sebaceous nevus or a basal cell nevus, but a verrucous epidermal nevus has only rarely been associated with neoplastic changes. Keratoacanthoma, multifocal papillary apocrine adenoma, multiple malignant eccrine poroma, basal cell carcinoma and cutaneous squamous cell carcinoma (CSCC have all been reported to develop from a verrucous epidermal nevus. CSCC has also been reported to arise from other nevoid lesions like a nevus comedonicus, porokeratosis, a sebaceous nevus, an oral sponge nevus and an ichthyosiform nevus with CHILD syndrome. Here we report a case of progressive poorly differentiated CSCC arising from a localized verrucous epidermal nevus, which caused both spinal cord and brain metastasis.

  7. Human papillomavirus E6/E7 oncogenes promote mouse ear regeneration by increasing the rate of wound re-epithelization and epidermal growth.

    Science.gov (United States)

    Valencia, Concepción; Bonilla-Delgado, José; Oktaba, Katarzyna; Ocádiz-Delgado, Rodolfo; Gariglio, Patricio; Covarrubias, Luis

    2008-12-01

    Mammals have limited regeneration capacity. We report here that, in transgenic mice (Tg(bK6-E6/E7)), the expression of the E6/E7 oncogenes of human papilloma virus type 16 (HPV16) under the control of the bovine keratin 6 promoter markedly improves the mouse's capacity to repair portions of the ear after being wounded. Increased repair capacity correlates with an increased number of epidermal proliferating cells. In concordance with the expected effects of the E6 and E7 oncogenes, levels of p53 decreased and those of p16 in epidermal cells increased. In addition, we observed that wound re-epithelization proceeded faster in transgenic than in wild-type animals. After the initial re-epithelization, epidermal cell migration from the intact surrounding tissue appears to be a major contributor to the growing epidermis, especially in the repairing tissue of transgenic mice. We also found that there is a significantly higher number of putative epidermal stem cells in Tg(bK6-E6/E7) than in wild-type mice. Remarkably, hair follicles and cartilage regenerated within the repaired ear tissue, without evidence of tumor formation. We propose that the ability to regenerate ear portions is limited by the capacity of the epidermis to repair itself and grow.

  8. Pattern of hormone receptors and human epidermal growth factor ...

    African Journals Online (AJOL)

    Introduction: Breast cancer is the most common cancer among women globally. With immunohistochemistry (IHC), breast cancer is classified into four groups based on IHC profile of estrogen receptor (ER)/progesterone receptor (PR) and human epidermal growth factor receptor 2 (HER2/neu) expression, positive (+) and/or ...

  9. Sequential cancer mutations in cultured human intestinal stem cells

    NARCIS (Netherlands)

    Drost, Jarno; van Jaarsveld, Richard H.; Ponsioen, Bas; Zimberlin, Cheryl; van Boxtel, Ruben; Buijs, Arjan; Sachs, Norman; Overmeer, René M.; Offerhaus, G. Johan; Begthel, Harry; Korving, Jeroen; van de Wetering, Marc; Schwank, Gerald; Logtenberg, Meike; Cuppen, Edwin; Snippert, Hugo J.; Medema, Jan Paul; Kops, Geert J. P. L.; Clevers, Hans

    2015-01-01

    Crypt stem cells represent the cells of origin for intestinal neoplasia. Both mouse and human intestinal stem cells can be cultured in medium containing the stem-cell-niche factors WNT, R-spondin, epidermal growth factor (EGF) and noggin over long time periods as epithelial organoids that remain

  10. Flow cytometry of human primary epidermal and follicular keratinocytes.

    Science.gov (United States)

    Gragnani, Alfredo; Ipolito, Michelle Zampieri; Sobral, Christiane S; Brunialti, Milena Karina Coló; Salomão, Reinaldo; Ferreira, Lydia Masako

    2008-02-19

    The aim of this study was to characterize using flow cytometry cultured human primary keratinocytes isolated from the epidermis and hair follicles by different methods. Human keratinocytes derived from discarded fragments of total skin and scalp hair follicles from patients who underwent plastic surgery in the Plastic Surgery Division at UNIFESP were used. The epidermal keratinocytes were isolated by using 3 different methods: the standard method, upon exposure to trypsin for 30 minutes; the second, by treatment with dispase for 18 hours and with trypsin for 10 minutes; and the third, by treatment with dispase for 18 hours and with trypsin for 30 minutes. Follicular keratinocytes were isolated using the standard method. On comparing the group treated with dispase for 18 hours and with trypsin for 10 minutes with the group treated with dispase for 18 hours and with trypsin for 30 minutes, it was observed that the first group presented the largest number of viable cells, the smallest number of cells in late apoptosis and necrosis with statistical significance, and no difference in apoptosis. When we compared the group treated with dispase for 18 hours and with trypsin for 10 minutes with the group treated with trypsin, the first group presented the largest number of viable cells, the smallest number of cells in apoptosis with statistical significance, and no difference in late apoptosis and necrosis. When we compared the results of the group treated with dispase for 18 hours and with trypsin for 10 minutes with the results for follical isolation, there was a statistical difference in apoptosis and viable cells. The isolation method of treatment with dispase for 18 hours and with trypsin for 10 minutes produced the largest number of viable cells and the smallest number of cells in apoptosis/necrosis.

  11. TNP-specific Lyt-2+ cytolytic T cell clones preferentially respond to TNP-conjugated epidermal cells

    International Nuclear Information System (INIS)

    Shimada, S.; Katz, S.I.

    1985-01-01

    A most effective method for the induction of hapten-specific allergic contact sensitivity (CS) is via epicutaneous application of the hapten. Another effective method is by the administration of haptenated epidermal cells (EC) subcutaneously. The latter method induces more intense and longer lasting CS than does the subcutaneous administration of haptenated spleen cells (SC). Thus, there may be something unique about EC which, when haptenated, allows them to generate effector cells more effectively than do SC. The authors therefore, attempted to generate T cell clones that were both hapten- and epidermal-specific. Four days after painting mice with 7% trinitrochlorobenzene, draining lymph node cells were obtained and T cells were purified. These cells were co-cultured with trinitrophenylated (TNP) Langerhans cell-enriched EC. After 4 days, cells were harvested and rested on non-TNP-conjugated EC. The cells were restimulated and rested three times, and were then cloned by limiting dilution with added interleukin 2, which was then continually added. Proliferation of T cells was assessed by [ 3 H]-thymidine incorporation. Cytotoxicity assays utilized TNP-conjugated concanavalin A SC blasts or EC as targets. Clones A-2 and E-4 are Thy-1+, Lyt-2+, and L3T4-, and TNP-specific. In contrast to noncloned TNP-specific T cells, the clones proliferate preferentially in response to TNP-EC rather than TNP-SC. Also in contrast to noncloned T cells, the clones were preferentially cytotoxic for TNP-EC; compared to TNP-SC, there was an eight- to 32-fold increase in killing when TNP-EC were used as targets. Clones A-2 and E-4 therefore exhibit hapten and epidermal specificity

  12. The Antiaging Properties of Andrographis paniculata by Activation Epidermal Cell Stemness

    Directory of Open Access Journals (Sweden)

    Jiyoung You

    2015-09-01

    Full Text Available Andrographis paniculata (A. paniculata, Chuanxinlian, a medicinal herb with an extremely bitter taste that is native to China and other parts of Southeast Asia, possesses immense therapeutic value; however, its therapeutic properties have rarely been applied in the field of skin care. In this study, we investigated the effect of an A. paniculata extract (APE on human epidermal stem cells (EpSCs, and confirmed its anti-aging effect through in vitro, ex vivo, and in vivo study. An MTT assay was used to determine cell proliferation. A flow cytometric analysis, with propidium iodide, was used to evaluate the cell cycle. The expression of integrin β1 (CD29, the stem cell marker, was detected with antibodies, using flow cytometry in vitro, and immunohistochemical assays in ex vivo. Type 1 collagen and VEGF (vascular endothelial growth factor were measured using an enzyme-linked immunosorbent assay (ELISA. During the clinical study, skin hydration, elasticity, wrinkling, sagging, and dermal density were evaluated before treatment and at four and eight weeks after the treatment with the test product (containing the APE on the face. The proliferation of the EpSCs, treated with the APE, increased significantly. In the cell cycle analysis, the APE increased the G2/M and S stages in a dose-dependent manner. The expression of integrin β1, which is related to epidermal progenitor cell expansion, was up-regulated in the APE-treated EpSCs and skin explants. In addition, the production of VEGF in the EpSCs increased significantly in response to the APE treatment. Consistent with these results, the VEGF and APE-treated EpSCs conditioned medium enhanced the Type 1 collagen production in normal human fibroblasts (NHFs. In the clinical study, the APE improved skin hydration, dermal density, wrinkling, and sagging significantly. Our findings revealed that the APE promotes a proliferation of EpSCs, through the up-regulation of the integrin β1 and VEGF expression

  13. The Antiaging Properties of Andrographis paniculata by Activation Epidermal Cell Stemness.

    Science.gov (United States)

    You, Jiyoung; Roh, Kyung-Baeg; Li, Zidan; Liu, Guangrong; Tang, Jian; Shin, Seoungwoo; Park, Deokhoon; Jung, Eunsun

    2015-09-22

    Andrographis paniculata (A. paniculata, Chuanxinlian), a medicinal herb with an extremely bitter taste that is native to China and other parts of Southeast Asia, possesses immense therapeutic value; however, its therapeutic properties have rarely been applied in the field of skin care. In this study, we investigated the effect of an A. paniculata extract (APE) on human epidermal stem cells (EpSCs), and confirmed its anti-aging effect through in vitro, ex vivo, and in vivo study. An MTT assay was used to determine cell proliferation. A flow cytometric analysis, with propidium iodide, was used to evaluate the cell cycle. The expression of integrin β1 (CD29), the stem cell marker, was detected with antibodies, using flow cytometry in vitro, and immunohistochemical assays in ex vivo. Type 1 collagen and VEGF (vascular endothelial growth factor) were measured using an enzyme-linked immunosorbent assay (ELISA). During the clinical study, skin hydration, elasticity, wrinkling, sagging, and dermal density were evaluated before treatment and at four and eight weeks after the treatment with the test product (containing the APE) on the face. The proliferation of the EpSCs, treated with the APE, increased significantly. In the cell cycle analysis, the APE increased the G2/M and S stages in a dose-dependent manner. The expression of integrin β1, which is related to epidermal progenitor cell expansion, was up-regulated in the APE-treated EpSCs and skin explants. In addition, the production of VEGF in the EpSCs increased significantly in response to the APE treatment. Consistent with these results, the VEGF and APE-treated EpSCs conditioned medium enhanced the Type 1 collagen production in normal human fibroblasts (NHFs). In the clinical study, the APE improved skin hydration, dermal density, wrinkling, and sagging significantly. Our findings revealed that the APE promotes a proliferation of EpSCs, through the up-regulation of the integrin β1 and VEGF expression. The VEGF

  14. Cultivation and irradiation of human fibroblasts in a medium enriched with platelet lysate for obtaining feeder layer in epidermal cell culture

    International Nuclear Information System (INIS)

    Yoshito, Daniele

    2011-01-01

    For over 30 years, the use of culture medium, enriched with bovine serum, and murines fibroblasts, with the rate of proliferation controlled by irradiation or by share anticarcinogenic drugs, has been playing successfully its role in assisting in the development of keratinocytes in culture, for clinical purposes. However, currently there is a growing concern about the possibility of transmitting prions and animals viruses to transplanted patients. Taking into account this concern, the present work aims to cultivate human fibroblasts in a medium enriched with human platelets lysate and determine the irradiation dose of these cells, for obtaining feeder layer in epidermal cell culture. For carrying out the proposed objective, platelets lysis has standardized, this lysate was used for human fibroblasts cultivation and the irradiation dose enough to inhibit its duplication was evaluated. Human keratinocytes were cultivated in these feeder layers, in culture medium enriched with the lysate. With these results we conclude that the 10% platelets lysate promoted a better adhesion and proliferation of human fibroblasts and in all dose levels tested (60 to 300 Gy), these had their mitotic activity inactivated by ionizing irradiation, being that the feeder layers obtained with doses from 70 to 150 Gy were those that provided the best development of keratinocytes in medium containing 2.5% of human platelet lysate. Therefore, it was possible to standardize both the cultivation of human fibroblasts as its inactivation for use as feeder layer in culture of keratinocytes, so as to eliminate xenobiotics components. (author)

  15. Adding a Piece to the Leaf Epidermal Cell Shape Puzzle.

    Science.gov (United States)

    von Wangenheim, Daniel; Wells, Darren M; Bennett, Malcolm J

    2017-11-06

    The jigsaw puzzle-shaped pavement cells in the leaf epidermis collectively function as a load-bearing tissue that controls organ growth. In this issue of Developmental Cell, Majda et al. (2017) shed light on how the jigsaw shape can arise from localized variations in wall stiffness between adjacent epidermal cells. Copyright © 2017 Elsevier Inc. All rights reserved.

  16. Bioengineering of cultured epidermis from adult epidermal stem cells using Mebio gel sutable as autologous graft material

    Directory of Open Access Journals (Sweden)

    Lakshmana K Yerneni

    2007-01-01

    quicker healing proving the importance and usefulness of the method. With this new approach a large number of moderate to severely burned patients could be saved in several burn centers across our country with reduced hospitalization period. However, the cell based therapeutic option in burn-wound healing by the application of in vitro - cultivated sheets of epidermis from autologous epidermal keratinocyte stem cells uses no matrix. This technque is sufficient for burn wounds of 2nd & 3rd mixed degree. The burn wounds predominantly of 3rd?and 4th?mixed degree can not be healed by the thin cultured epidermis, thus requiring a cellular or cellular scaffold that more or less mimic for graft take in deeper burns. With this aim, we are presently attempting to create such a scaffold using Mebiol gel, which could support the cultured epidermis for better transfer to the wound bed. Additionally, the usefulness of Mebiol gel in growing epidermal sheets without the necessity of FBS and/or animal origin feeder cells but using human feeder cells will also be tested.

  17. Skin Stem Cells: At the Frontier Between the Laboratory and Clinical Practice. Part 1: Epidermal Stem Cells.

    Science.gov (United States)

    Pastushenko, I; Prieto-Torres, L; Gilaberte, Y; Blanpain, C

    2015-11-01

    Stem cells are characterized by their ability to self-renew and differentiate into the different cell lineages of their tissue of origin. The discovery of stem cells in adult tissues, together with the description of specific markers for their isolation, has opened up new lines of investigation, expanding the horizons of biomedical research and raising new hope in the treatment of many diseases. In this article, we review in detail the main characteristics of the stem cells that produce the specialized cells of the skin (epidermal, mesenchymal, and melanocyte stem cells) and their potential implications and applications in diseases affecting the skin. Part I deals with the principal characteristics and potential applications of epidermal stem cells in dermatology. Copyright © 2015 Elsevier España, S.L.U. and AEDV. All rights reserved.

  18. Altered growth, differentiation, and responsiveness to epidermal growth factor of human embryonic mesenchymal cells of palate by persistent rubella virus infection

    International Nuclear Information System (INIS)

    Yoneda, T.; Urade, M.; Sakuda, M.; Miyazaki, T.

    1986-01-01

    We previously demonstrated that human embryonic mesenchymal cells derived from the palate (HEMP cells) retain alkaline phosphatase (ALP) content and capacity for collagen synthesis after long-term culture, and their growth is markedly stimulated by epidermal growth factor (EGF). There was a dramatic decrease in ALP content and capacity to synthesize collagen in HEMP cells (HEMP-RV cells) persistently infected with rubella virus (RV). EGF increased ALP activity and decreased collagen synthesis in HEMP cells, whereas EGF showed no effect on these activities in HEMP-RV cells. Growth of HEMP-RV cells was slightly reduced compared with that of HEMP cells. EGF stimulated growth of HEMP cells and to a lesser extent of HEMP-RV cells. Binding of 125 I-EGF to cell-surface receptors in HEMP-RV cells was, to our surprise, twice as much as that in HEMP cells. However, internalization of bound 125 I-EGF in HEMP-RV cells was profoundly diminished. Thus, persistent RV infection causes not only changes in HEMP cell growth and differentiation but a decrease in or loss of HEMP cell responsiveness to EGF. The effects of persistent RV infection on palatal cell differentiation as well as growth may be responsible for the pathogenesis of congenital rubella. Furthermore, since HEMP cells appear to be closely related to osteoblasts, these results suggest a mechanism for RV-induced osseous abnormalities manifested in congenital rubella patients

  19. Establishment and characterization of a new cell line, FPS-1, derived from human undifferentiated pleomorphic sarcoma, overexpressing epidermal growth factor receptor and cyclooxygenase-2.

    Science.gov (United States)

    Hakozaki, Michiyuki; Hojo, Hiroshi; Sato, Michiko; Tajino, Takahiro; Yamada, Hitoshi; Kikuchi, Shinichi; Abe, Masafumi

    2006-01-01

    Undifferentiated pleomorphic sarcoma (UPS) is among the most common soft tissue sarcomas in adults. In order to improve its aggressive course or prognosis and establish new therapeutic methods, molecular genetic and biological characterizations of UPS are required. A new human UPS cell line (FPS-1) was established from UPS of the upper arm of a 79-year-old man. The cell line has been maintained for over 14 months with more than 60 passages. FPS-1 cells were characterized using molecular biological methods. FPS-1 cells showed the same morphological and immunophenotypical characteristics as the primary tumor. Cytogenetic and molecular analyses revealed a nonsense mutation in exon 6 of the p53 gene. Epidermal growth factor receptor (EGFR) and cyclooxygenase-2 (COX-2) were expressed in FPS-1 cells. FPS-1 cells might be useful for investigating biological behavior and developing new molecular targeting antitumor drugs for UPS with EGFR or COX-2 expression.

  20. Beta1 integrin-mediated adhesion signalling is essential for epidermal progenitor cell expansion

    DEFF Research Database (Denmark)

    Piwko-Czuchra, Aleksandra; Koegel, Heidi; Meyer, Hannelore

    2009-01-01

    BACKGROUND: There is a major discrepancy between the in vitro and in vivo results regarding the role of beta1 integrins in the maintenance of epidermal stem/progenitor cells. Studies of mice with skin-specific ablation of beta1 integrins suggested that epidermis can form and be maintained in thei...... of increased keratinocyte proliferation such as wound healing. CONCLUSIONS/SIGNIFICANCE: These data demonstrate that expression of beta1 integrins is critically important for the expansion of epidermal progenitor cells to maintain epidermal homeostasis....... that developed similar, but less severe defects than mice with beta1-deficient keratinocytes. Surprisingly we found that upon aging these abnormalities attenuated due to a rapid expansion of cells, which escaped or compensated for the down-regulation of beta1 integrin expression. A similar phenomenon...... was observed in aged mice with a complete, skin-specific ablation of the beta1 integrin gene, where cells that escaped Cre-mediated recombination repopulated the mutant skin in a very short time period. The expansion of beta1 integrin expressing keratinocytes was even further accelerated in situations...

  1. Influence of topical human epidermal growth factor on postkeratoplasty re-epithelialisation

    NARCIS (Netherlands)

    M.M. Dellaert; T.A. Casey; S. Wiffen; J. Gordon (Jocelynne); P. Johnson (Jürgen); A.J. Geerards (Annette); W.J. Rijneveld (Wilhelmina); L. Remeijer (Lies); W.H. Beekhuis (Houdijn); P.G.H. Mulder (Paul)

    1997-01-01

    textabstractAIM: To test the efficacy and safety of recombinant human epidermal growth factor (hEGF) on corneal re-epithelialisation following penetrating keratoplasty. METHODS: A prospective, randomised, placebo controlled study was carried out in which patients were

  2. Evaluation of dermal-epidermal skin equivalents ('composite-skin') of human keratinocytes in a collagen-glycosaminoglycan matrix(Integra artificial skin).

    Science.gov (United States)

    Kremer, M; Lang, E; Berger, A C

    2000-09-01

    Integra artificial skin (Integra LifeSciences Corp., Plainsboro, NJ, USA) is a dermal template consisting of bovine collagen, chondroitin-6-sulphate and a silastic membrane manufactured as Integra. This product has gained widespread use in the clinical treatment of third degree burn wounds and full thickness skin defects of different aetiologies. The product was designed to significantly reduce the time needed to achieve final wound closure in the treatment of major burn wounds, to optimise the sparse autologous donor skin resources and to improve the durable mechanical quality of the skin substitute. The clinical procedure requires two stages. The first step creates a self neodermis, the second creates a self epidermis on the neodermis. However, it is desirable to cover major burn wounds early in a single step by a skin substitute consisting of a dermal equivalent seeded in vitro with autologous keratinocytes ('composite-skin') out of which a full thickness skin develops in vivo.The goal of this experimental study was to develop a method to integrate human keratinocytes in homogeneous distribution and depth into Integra Artificial Skin. The seeded cell-matrix composites were grafted onto athymic mice in order to evaluate their potential to reconstitute a human epidermis in vivo. We were able to demonstrate that the inoculated human keratinocytes reproducibly displayed a homogeneous pattern of distribution, adherence, proliferation and confluence. The cell-matrix composites grafted in this model exhibited good wound adherence, complete healing, minor wound contraction and had the potential to reconstitute an elastic, functional and durable human skin. Histologically we were able to show that the inoculated human keratinocytes in vivo colonised the matrix in a histomorphologically characteristic epidermal pattern (keratomorula, keratinocyte bubbling) and developed a persisting, stratified, keratinising epidermis which immunohistologically proved to be of human

  3. Epidermal cell-shape regulation and subpopulation kinetics during butyrate-induced terminal maturation of normal and SV40-transformed human keratinocytes: epithelial models of differentiation therapy.

    Science.gov (United States)

    Staiano-Coico, L; Steinberg, M; Higgins, P J

    1990-10-15

    Recent data indicate that malignant human epidermal cells may be appropriate targets for sodium butyrate (NaB)-mediated differentiation therapy. The response of pre- and post-crisis populations of SV40-transformed human keratinocytes (SVKs) to this differentiation-inducing agent was assessed, therefore, within the framework of NaB-directed normal human keratinocyte (NHK) maturation. NaB augmented cornified envelope (CE) production in NHK and pre-crisis SVK cultures; the time-course and efficiency of induced maturation were similar in the 2 cell systems. In NHKs, the percentage of amplifying ("B" substate) cells decreased with time in NaB correlating with increases in both "C" stage keratinocytes and CEs. The latter formed over one or 2 layers of nucleated basal-like cells. Inductions were accompanied by immediate cell cycle blocks (in both the G1 and G2/M phases), reorganization within the actin cytoskeleton, and transient early increases in cellular actin content. Increased NHK and pre-crisis SVK cytoskeletal-associated actin reached a maximum approximately 48 hr after NaB addition and preceded development of CEs. The CE precursors, thus, probably reside in the "B" substate. Post-crisis SVKs, in contrast, were refractive to NaB-induced terminal maturation or cell-cycle perturbation, failed to initiate actin filament rearrangements, and retained a basal cell-like phenotype. Stable transformation of human SVKs in post-crisis phase, therefore, appears to be associated with loss of maturation "competence" within the "B" keratinocyte subpopulation.

  4. Effects of icotinib, a novel epidermal growth factor receptor tyrosine kinase inhibitor, in EGFR-mutated non-small cell lung cancer.

    Science.gov (United States)

    Yang, Guangdie; Yao, Yinan; Zhou, Jianya; Zhao, Qiong

    2012-06-01

    Epidermal growth factor receptor (EGFR) is one of the most promising targets for non-small cell lung cancer (NSCLC). Our study demonstrated the antitumor effects of icotinib hydrochloride, a highly selective epidermal growth factor receptor tyrosine kinase inhibitor (EGFR TKI), in two EGFR-mutated lung cancer cell lines compared to A549, a cell line without EGFR mutations. We incubated PC-9 and HCC827 human lung cancer cell lines both with (E746-A750) mutations with various concentrations of icotinib and gefitinib for 48 h. Cell proliferation and migration were determined using a real-time cell invasion and migration assay and cytotoxicity assay. Apoptosis was assessed by measuring Annexin V staining using flow cytometry. The antitumor effects of icotinib compared to gefitinib were similar and were most effective in reducing the proliferation of EGFR-mutated cells compared to non-mutated controls. Our results suggest the possibility of icotinib as a new therapeutic agent of EGFR-mutated cancer cells, which has the potential to be used in the first-line treatment of EGFR-mutated NSCLC.

  5. Murine epidermal Langerhans cells and langerin-expressing dermal dendritic cells are unrelated and exhibit distinct functions

    NARCIS (Netherlands)

    Nagao, Keisuke; Ginhoux, Florent; Leitner, Wolfgang W.; Motegi, Sei-Ichiro; Bennett, Clare L.; Clausen, Björn E.; Merad, Miriam; Udey, Mark C.

    2009-01-01

    A new langerin(+) DC subset has recently been identified in murine dermis (langerin(+) dDC), but the lineage and functional relationships between these cells and langerin(+) epidermal Langerhans cells (LC) are incompletely characterized. Selective expression of the cell adhesion molecule EpCAM by LC

  6. UVB-induced epidermal hyperproliferation is modified by a single, topical treatment with a mitosis inhibitory epidermal pentapeptide

    International Nuclear Information System (INIS)

    Olsen, W.M.; Elgjo, K.

    1990-01-01

    A single application of a water-miscible cream base containing the recently identified mitosis inhibitory epidermal pentapeptide pyroGlu-Glu-Asp-Ser-GlyOH (EPP) to hairless mouse skin is followed by a long-lasting period of reduced epidermal cell proliferation. To examine if a similar growth inhibition could be achieved in stimulated and rapidly proliferating epidermis, EPP was applied at two different concentrations, 0.005 or 0.02%, to hairless mouse skin immediately after exposure of the left flank to an erythemic dose of ultraviolet B light (UVB). This dose of UVB alone induces a sustained period of rapid epidermal cell proliferation, starting at about 18 h after the irradiation. Epidermal cell proliferation was followed from 18 to 54 h (0.005% cream) or from 18 to 30 h (0.02% cream) after the treatment by estimating the rate of G2-M cell flux (the mitotic rate) by means of Colcemid, and epidermal DNA synthesis by counting labeled cells after pulse-labeling with 3H-thymidine. The unirradiated side of the mice was used as reference. The results showed that topical treatment with a 0.02% EPP cream partially inhibited UVB-induced epidermal hyperproliferation, while the 0.005% EPP cream inhibited as well as stimulated the UVB-induced hyperproliferation. Thus, EPP is effective even in rapidly proliferating epidermal cell populations, but the outcome is obviously dose-dependent in this test system

  7. Herceptin Enhances the Antitumor Effect of Natural Killer Cells on Breast Cancer Cells Expressing Human Epidermal Growth Factor Receptor-2

    Directory of Open Access Journals (Sweden)

    Xiao Tian

    2017-10-01

    Full Text Available Optimal adoptive cell therapy (ACT should contribute to effective cancer treatment. The unique ability of natural killer (NK cells to kill cancer cells independent of major histocompatibility requirement makes them suitable as ACT tools. Herceptin, an antihuman epidermal growth factor receptor-2 (anti-HER2 monoclonal antibody, is used to treat HER2+ breast cancer. However, it has limited effectiveness and possible severe cardiotoxicity. Given that Herceptin may increase the cytotoxicity of lymphocytes, we explored the possible augmentation of NK cell cytotoxicity against HER2+ breast cancer cells by Herceptin. We demonstrated that Herceptin could interact with CD16 on NK cells to expand the cytotoxic NK (specifically, CD56dim cell population. Additionally, Herceptin increased NK cell migration and cytotoxicity against HER2+ breast cancer cells. In a pilot study, Herceptin-treated NK cells shrunk lung nodular metastasis in a woman with HER2+ breast cancer who could not tolerate the cardiotoxic side effects of Herceptin. Our findings support the therapeutic potential of Herceptin-treated NK cells in patients with HER2+ and Herceptin-intolerant breast cancer.

  8. Protein profiling of epidermal bladder cells from the halophyte Mesembryanthemum crystallinum.

    Science.gov (United States)

    Barkla, Bronwyn J; Vera-Estrella, Rosario; Pantoja, Omar

    2012-09-01

    Plant epidermal trichomes are as varied in morphology as they are in function. In the halophyte Mesembryanthemum crystallinum, specialized trichomes called epidermal bladder cells (EBC) line the surface of leaves and stems, and increase dramatically in size and volume upon plant salt-treatment. These cells have been proposed to have roles in plant defense and UV protection, but primarily in sodium sequestration and as water reservoirs. To gain further understanding into the roles of EBC, a cell-type-specific proteomics approach was taken in which precision single-cell sampling of cell sap from individual EBC was combined with shotgun peptide sequencing (LC-MS/MS). Identified proteins showed diverse biological functions and cellular locations, with a high representation of proteins involved in H(+)-transport, carbohydrate metabolism, and photosynthesis. The proteome of EBC provides insight into the roles of these cells in ion and water homeostasis and raises the possibility that they are photosynthetically active and functioning in Crassulacean acid metabolism. © 2012 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  9. Real-time visualization of macromolecule uptake by epidermal Langerhans cells in living animals.

    Science.gov (United States)

    Frugé, Rachel E; Krout, Colleen; Lu, Ran; Matsushima, Hironori; Takashima, Akira

    2012-03-01

    As a skin-resident member of the dendritic cell family, Langerhans cells (LCs) are generally regarded to function as professional antigen-presenting cells. Here we report a simple method to visualize the endocytotic activity of LCs in living animals. BALB/c mice received subcutaneous injection of FITC-conjugated dextran (DX) probes into the ear skin and were then examined under confocal microscopy. Large numbers of FITC(+) epidermal cells became detectable 12-24 hours after injection as background fluorescence signals began to disappear. Most (>90%) of the FITC(+) epidermal cells expressed Langerin, and >95% of Langerin(+) epidermal cells exhibited significant FITC signals. To assess intracellular localization, Alexa Fluor 546-conjugated DX probes were locally injected into IAβ-enhanced green fluorescent protein (EGFP) knock-in mice and Langerin-EGFP-diphtheria toxin receptor mice--three dimensional rotation images showed close association of most of the internalized DX probes with major histocompatibility complex (MHC) class II molecules, but not with Langerin molecules. These observations support the current view that LCs constantly sample surrounding materials, including harmful and innocuous antigens, at the environmental interface. Our data also validate the potential utility of the newly developed imaging approach to monitor LC function in wild-type animals.

  10. Epidermal Langerhans' cell induction of immunity against an ultraviolet-induced skin tumour

    International Nuclear Information System (INIS)

    Cavanagh, L.L.; Sluyter, R.; Henderson, K.G.; Barnetson, R.St.C.; Halliday, G.M.

    1996-01-01

    Lanerghans' cells (LC) have been shown experimentally to induce immune response against many antigens; however, their role in the initiation of anti-tumour immunity has received little attention. This study examined the ability of murine epidermal LC to induce immunity to an ultraviolet radiation (UV)-induced skin tumour. Freshly prepared epidermal cells (EC) were cultured for 2 or 20 hr with granulocyte-macrophage colony-stimulating factor (GM-CSF), pulsed with an extract of the UV-13-1 tumour, then used to immunize naive syngeneic mice. Delayed type hypersensitivity (DTH) was elicited 10 days after immunization by injection of UV-13-1 tumour cells into the ear pinna, and measured 24 hr later. EC cultured with GM-CSF for 2 hr induced anti-tumour DTH, as did EC cultured for 20 hr without GM-CSF. Conversely, EC cultured for 2 hr without GM-CSF, or EC cultured for 20 hr with GM-CSF were unable to induce a DTH. Induction of immunity required active presentation of tumour antigens by Ia + EC and was tumour specific. Thus Ia + epidermal cells are capable of inducing anti-tumour immunity to UV-induced skin tumours, but only when they contact antigen in particular states of maturation. (author)

  11. Isolation and In Vitro Characterization of Epidermal Stem Cells

    DEFF Research Database (Denmark)

    Moestrup, Kasper S; Andersen, Marianne Stemann; Jensen, Kim Bak

    2017-01-01

    flow cytometry. Using markers that define the spatial origin of epidermal cells, it is possible to interrogate the specific characteristics of subpopulations of cells based on their in vivo credentials. Here, we describe how to isolate, culture, and characterize keratinocytes from murine back and tail......Colony-forming assays represent prospective methods, where cells isolated from enzymatically dissociated tissues or from tissue cultures are assessed for their proliferative capacity in vitro. Complex tissues such as the epithelial component of the skin (the epidermis) are characterized...

  12. Cultivation of human dermal fibroblasts and epidermal keratinocytes on keratin-coated silica bead substrates.

    Science.gov (United States)

    Tan, Bee Yi; Nguyen, Luong T H; Kim, Hyo-Sop; Kim, Jae-Ho; Ng, Kee Woei

    2017-10-01

    Human hair keratin is promising as a bioactive material platform for various biomedical applications. To explore its versatility further, human hair keratin was coated onto monolayers of silica beads to produce film-like substrates. This combination was hypothesized to provide a synergistic effect in improving the biochemical properties of the resultant composite. Atomic force microscopy analysis showed uniform coatings of keratin on the silica beads with a slight increase in the resulting surface roughness. Keratin-coated silica beads had higher surface energy and relatively lower negative charge than those of bare silica beads. To investigate cell response, human dermal fibroblasts (HDFs), and human epidermal keratinocytes (HEKs) were cultured on the substrates over 4 days. Results showed that keratin coatings significantly enhanced the metabolic activity of HDFs and encouraged cell spreading but did not exert any significant effects on HEKs. HDF expression of collagen I was significantly more intense on the keratin-coated compared to the bare silica substrates. Furthermore, HDF secretion of various cytokines suggested that keratin coatings triggered active cell responses related to wound healing. Collectively, our study demonstrated that human hair keratin-coated silica bead monolayers have the potential to modulate HDF behavior in culture and may be exploited further. © 2017 Wiley Periodicals, Inc. J Biomed Mater Res Part A: 105A: 2789-2798, 2017. © 2017 Wiley Periodicals, Inc.

  13. A Theoretical Model of Jigsaw-Puzzle Pattern Formation by Plant Leaf Epidermal Cells.

    Science.gov (United States)

    Higaki, Takumi; Kutsuna, Natsumaro; Akita, Kae; Takigawa-Imamura, Hisako; Yoshimura, Kenji; Miura, Takashi

    2016-04-01

    Plant leaf epidermal cells exhibit a jigsaw puzzle-like pattern that is generated by interdigitation of the cell wall during leaf development. The contribution of two ROP GTPases, ROP2 and ROP6, to the cytoskeletal dynamics that regulate epidermal cell wall interdigitation has already been examined; however, how interactions between these molecules result in pattern formation remains to be elucidated. Here, we propose a simple interface equation model that incorporates both the cell wall remodeling activity of ROP GTPases and the diffusible signaling molecules by which they are regulated. This model successfully reproduces pattern formation observed in vivo, and explains the counterintuitive experimental results of decreased cellulose production and increased thickness. Our model also reproduces the dynamics of three-way cell wall junctions. Therefore, this model provides a possible mechanism for cell wall interdigitation formation in vivo.

  14. Differences in human skin between the epidermal growth factor receptor distribution detected by EGF binding and monoclonal antibody recognition

    DEFF Research Database (Denmark)

    Green, M R; Couchman, J R

    1985-01-01

    , the eccrine sweat glands, capillary system, and the hair follicle outer root sheath, generally similar in pattern to that previously reported for full-thickness rat skin and human epidermis. The same areas also bound EGF-R1 but in addition the monoclonal antibody recognized a cone of melanin containing......Two methods have been used to examine epidermal growth factor (EGF) receptor distribution in human scalp and foreskin. The first employed [125I]EGF viable explants and autoradiography to determine the EGF binding pattern while the second used a monoclonal antibody to the human EGF receptor to map...... whether EGF-R1 could recognize molecules unrelated to the EGF receptor, the EGF binding and EGF-R1 recognition profiles were compared on cultures of SVK14 cells, a SV40 transformed human keratinocyte cell line. EGF binding and EGF-R1 monoclonal antibody distribution on these cells was found to be similar...

  15. The SKINT1-like gene is inactivated in hominoids but not in all primate species: implications for the origin of dendritic epidermal T cells.

    Directory of Open Access Journals (Sweden)

    Rania Hassan Mohamed

    Full Text Available Dendritic epidermal T cells, which express an invariant Vγ5Vδ1 T-cell receptor and account for 95% of all resident T cells in the mouse epidermis, play a critical role in skin immune surveillance. These γδ T cells are generated by positive selection in the fetal thymus, after which they migrate to the skin. The development of dendritic epidermal T cells is critically dependent on the Skint1 gene expressed specifically in keratinocytes and thymic epithelial cells, suggesting an indispensable role for Skint1 in the selection machinery for specific intraepithelial lymphocytes. Phylogenetically, rodents have functional SKINT1 molecules, but humans and chimpanzees have a SKINT1-like (SKINT1L gene with multiple inactivating mutations. In the present study, we analyzed SKINT1L sequences in representative primate species and found that all hominoid species have a common inactivating mutation, but that Old World monkeys such as olive baboons, green monkeys, cynomolgus macaques and rhesus macaques have apparently functional SKINT1L sequences, indicating that SKINT1L was inactivated in a common ancestor of hominoids. Interestingly, the epidermis of cynomolgus macaques contained a population of dendritic-shaped γδ T cells expressing a semi-invariant Vγ10/Vδ1 T-cell receptor. However, this population of macaque T cells differed from rodent dendritic epidermal T cells in that their Vγ10/Vδ1 T-cell receptors displayed junctional diversity and expression of Vγ10 was not epidermis-specific. Therefore, macaques do not appear to have rodent-type dendritic epidermal T cells despite having apparently functional SKINT1L. Comprehensive bioinformatics analysis indicates that SKINT1L emerged in an ancestor of placental mammals but was inactivated or lost multiple times in mammalian evolution and that Skint1 arose by gene duplication in a rodent lineage, suggesting that authentic dendritic epidermal T cells are presumably unique to rodents.

  16. In vivo production of novel vitamin D2 hydroxy-derivatives by human placentas, epidermal keratinocytes, Caco-2 colon cells and the adrenal gland

    Science.gov (United States)

    Slominski, Andrzej T.; Kim, Tae-Kang; Shehabi, Haleem Z.; Tang, Edith; Benson, Heather A. E.; Semak, Igor; Lin, Zongtao; Yates, Charles R.; Wang, Jin; Li, Wei; Tuckey, Robert C.

    2014-01-01

    We investigated the metabolism of vitamin D2 to hydroxyvitamin D2 metabolites ((OH)D2) by human placentas ex-utero, adrenal glands ex-vivo and cultured human epidermal keratinocytes and colonic Caco-2 cells, and identified 20(OH)D2, 17,20(OH)2D2, 1,20(OH)2D2, 25(OH)D2 and 1,25(OH)2D2 as products. Inhibition of product formation by 22R-hydroxycholesterol indicated involvement of CYP11A1 in 20- and 17-hydroxylation of vitamin D2, while use of ketoconazole indicated involvement of CYP27B1 in 1α-hydroxylation of products. Studies with purified human CYP11A1 confirmed the ability of this enzyme to convert vitamin D2 to 20(OH)D2 and 17,20(OH)2D2. In placentas and Caco-2 cells, production of 20(OH)D2 was higher than 25(OH)D2 while in human keratinocytes the production of 20(OH)D2 and 25(OH)D2 were comparable. HaCaT keratinocytes showed high accumulation of 1,20(OH)2D2 relative to 20(OH)D2 indicating substantial CYP27B1 activity. This is the first in vivo evidence for a novel pathway of vitamin D2 metabolism initiated by CYP11A1 and modified by CYP27B1, with the product profile showing tissue- and cell-type specificity. PMID:24382416

  17. Endothelial network formed with human dermal microvascular endothelial cells in autologous multicellular skin substitutes.

    Science.gov (United States)

    Ponec, Maria; El Ghalbzouri, Abdoelwaheb; Dijkman, Remco; Kempenaar, Johanna; van der Pluijm, Gabri; Koolwijk, Pieter

    2004-01-01

    A human skin equivalent from a single skin biopsy harboring keratinocytes and melanocytes in the epidermal compartment, and fibroblasts and microvascular dermal endothelial cells in the dermal compartment was developed. The results of the study revealed that the nature of the extracellular matrix of the dermal compartments plays an important role in establishment of endothelial network in vitro. With rat-tail type I collagen matrices only lateral but not vertical expansion of endothelial networks was observed. In contrast, the presence of extracellular matrix of entirely human origin facilitated proper spatial organization of the endothelial network. Namely, when human dermal fibroblasts and microvascular endothelial cells were seeded on the bottom of an inert filter and subsequently epidermal cells were seeded on top of it, fibroblasts produced extracellular matrix throughout which numerous branched tubes were spreading three-dimensionally. Fibroblasts also facilitated the formation of basement membrane at the epidermal/matrix interface. Under all culture conditions, fully differentiated epidermis was formed with numerous melanocytes present in the basal epidermal cell layer. The results of the competitive RT-PCR revealed that both keratinocytes and fibroblasts expressed VEGF-A, -B, -C, aFGF and bFGF mRNA, whereas fibroblasts also expressed VEGF-D mRNA. At protein level, keratinocytes produced 10 times higher amounts of VEGF-A than fibroblasts did. The generation of multicellular skin equivalent from a single human skin biopsy will stimulate further developments for its application in the treatment of full-thickness skin defects. The potential development of biodegradable, biocompatible material suitable for these purposes is a great challenge for future research.

  18. Immunohistochemical localization of epidermal growth factor in rat and man

    DEFF Research Database (Denmark)

    Poulsen, Steen Seier; Nexø, Ebba

    1986-01-01

    Epidermal growth factor (EGF) is a peptide which stimulates cell mitotic activity and differentiation, has a cytoprotective effect on the gastroduodenal mucosa, and inhibits gastric acid secretion. The immunohistochemical localization of EGF in the Brunner's glands and the submandibular glands is...... antisera against human urinary EGF worked in rat as well as man. EGF was found only in cells with an exocrine function.......Epidermal growth factor (EGF) is a peptide which stimulates cell mitotic activity and differentiation, has a cytoprotective effect on the gastroduodenal mucosa, and inhibits gastric acid secretion. The immunohistochemical localization of EGF in the Brunner's glands and the submandibular glands...... is well documented. The localization of EGF in other tissues is still unclarified. In the present study, the immunohistochemical localization of EGF in tissues from rat, man and a 20 week human fetus were investigated. In man and rat, immunoreaction was found in the submandibular glands, the serous glands...

  19. GEP100/Arf6 is required for epidermal growth factor-induced ERK/Rac1 signaling and cell migration in human hepatoma HepG2 cells.

    Directory of Open Access Journals (Sweden)

    ZhenZhen Hu

    Full Text Available BACKGROUND: Epidermal growth factor (EGF signaling is implicated in the invasion and metastasis of hepatoma cells. However, the signaling pathways for EGF-induced motility of hepatoma cells remain undefined. METHODOLOGY/PRINCIPAL FINDINGS: We found that EGF dose-dependently stimulated the migration of human hepatoma cells HepG2, with the maximal effect at 10 ng/mL. Additionally, EGF increased Arf6 activity, and ectopic expression of Arf6 T27N, a dominant negative Arf6 mutant, largely abolish EGF-induced cell migration. Blocking GEP100 with GEP100 siRNA or GEP100-△PH, a pleckstrin homology (PH domain deletion mutant of GEP100, blocked EGF-induced Arf6 activity and cell migration. EGF also increased ERK and Rac1 activity. Ectopic expression GEP100 siRNA, GEP100-△PH, or Arf6-T27N suppressed EGF-induced ERK and Rac1 activity. Furthermore, blocking ERK signaling with its inhibitor U0126 remarkably inhibited both EGF-induced Rac1 activation as well as cell migration, and ectopic expression of inactive mutant form of Rac1 (Rac1-T17N also largely abolished EGF-induced cell migration. CONCLUSIONS/SIGNIFICANCE: Taken together, this study highlights the function of the PH domain of GEP100 and its regulated Arf6/ERK/Rac1 signaling cascade in EGF-induced hepatoma cell migration. These findings could provide a rationale for designing new therapy based on inhibition of hepatoma metastasis.

  20. Beta1 integrin-mediated adhesion signalling is essential for epidermal progenitor cell expansion.

    Directory of Open Access Journals (Sweden)

    Aleksandra Piwko-Czuchra

    Full Text Available BACKGROUND: There is a major discrepancy between the in vitro and in vivo results regarding the role of beta1 integrins in the maintenance of epidermal stem/progenitor cells. Studies of mice with skin-specific ablation of beta1 integrins suggested that epidermis can form and be maintained in their absence, while in vitro data have shown a fundamental role for these adhesion receptors in stem/progenitor cell expansion and differentiation. METHODOLOGY/PRINCIPAL FINDINGS: To elucidate this discrepancy we generated hypomorphic mice expressing reduced beta1 integrin levels on keratinocytes that developed similar, but less severe defects than mice with beta1-deficient keratinocytes. Surprisingly we found that upon aging these abnormalities attenuated due to a rapid expansion of cells, which escaped or compensated for the down-regulation of beta1 integrin expression. A similar phenomenon was observed in aged mice with a complete, skin-specific ablation of the beta1 integrin gene, where cells that escaped Cre-mediated recombination repopulated the mutant skin in a very short time period. The expansion of beta1 integrin expressing keratinocytes was even further accelerated in situations of increased keratinocyte proliferation such as wound healing. CONCLUSIONS/SIGNIFICANCE: These data demonstrate that expression of beta1 integrins is critically important for the expansion of epidermal progenitor cells to maintain epidermal homeostasis.

  1. Transient expression of P-type ATPases in tobacco epidermal cells

    DEFF Research Database (Denmark)

    Pedas, Lisbeth Rosager; Palmgren, Michael Broberg; Lopez Marques, Rosa Laura

    2016-01-01

    Transient expression in tobacco cells is a convenient method for several purposes such as analysis of protein-protein interactions and the subcellular localization of plant proteins. A suspension of Agrobacterium tumefaciens cells carrying the plasmid of interest is injected into the intracellula...... for example protein-protein interaction studies. In this chapter, we describe the procedure to transiently express P-type ATPases in tobacco epidermal cells, with focus on subcellular localization of the protein complexes formed by P4-ATPases and their β-subunits....

  2. Epidermal growth factor and insulin-like growth factor I upregulate the expression of the epidermal growth factor system in rat liver

    DEFF Research Database (Denmark)

    Bor, M V; Sørensen, B S; Vinter-Jensen, L

    2000-01-01

    BACKGROUND/AIM: Both epidermal growth factor and insulin-like growth factor I play a role in connection with the liver. In the present study, the possible interaction of these two growth factor systems was studied by investigating the effect of epidermal growth factor or insulin-like growth factor...... I treatment on the expression of the epidermal growth factor receptor, and its activating ligands, transforming growth factor-alpha and epidermal growth factor. METHODS: Fifty-five male rats received no treatment, human recombinant epidermal growth factor or human recombinant insulin-like growth.......8+/-1.6 fmol/mg protein epidermal growth factor and 144+/-22 fmol/mg protein transforming growth factor-alpha. Both epidermal growth factor and insulin-like growth factor I treatment increased the expression of mRNA for transforming growth factor-alpha and epidermal growth factor receptor, as well...

  3. HaCaT Keratinocytes and Primary Epidermal Keratinocytes Have Different Transcriptional Profiles of Cornified Envelope-Associated Genes to T Helper Cell Cytokines

    Science.gov (United States)

    Seo, Min-Duk; Kang, Tae Jin; Lee, Chang Hoon; Lee, Ai-Young; Noh, Minsoo

    2012-01-01

    HaCaT cells are the immortalized human keratinocytes and have been extensively used to study the epidermal homeostasis and its pathophysiology. T helper cells play a role in various chronic dermatological conditions and they can affect skin barrier homeostasis. To evaluate whether HaCaT cells can be used as a model cell system to study abnormal skin barrier development in various dermatologic diseases, we analyzed the gene expression profile of epidermal differentiation markers of HaCaT cells in response to major T helper (Th) cell cytokines, such as IFNγ, IL-4, IL-17A and IL-22. The gene transcriptional profile of cornified envelope-associated proteins, such as filaggrin, loricrin, involucrin and keratin 10 (KRT10), in HaCaT cells was generally different from that in normal human keratinocytes (NHKs). This suggests that HaCaT cells have a limitation as a model system to study the pathophysiological mechanism associated with the Th cell cytokine-dependent changes in cornified envelope-associated proteins which are essential for normal skin barrier development. In contrast, the gene transcription profile change of human β2-defensin (HBD2) in response to IFNγ, IL-4 or IL-17A in HaCaT cells was consistent with the expression pattern of NHKs. IFNγ also up-regulated transglutaminase 2 (TGM2) gene transcription in both HaCaT cells and NHKs. As an alternative cell culture system for NHKs, HaCaT cells can be used to study molecular mechanisms associated with abnormal HBD2 and TGM2 expression in response to IFNγ, IL-4 or IL-17A. PMID:24116291

  4. Influence of epidermal hydration on the friction of human skin against textiles

    OpenAIRE

    Gerhardt, L.-C; Strässle, V; Lenz, A; Spencer, N.D; Derler, S

    2008-01-01

    Friction and shear forces, as well as moisture between the human skin and textiles are critical factors in the formation of skin injuries such as blisters, abrasions and decubitus. This study investigated how epidermal hydration affects the friction between skin and textiles.

  5. Protective immunity to UV radiation-induced skin tumours induced by skin grafts and epidermal cells

    International Nuclear Information System (INIS)

    Ronald Sluyter; Kylie S Yuen; Gary M Halliday

    2001-01-01

    There is little evidence that cutaneous dendritic cells (DC), including epidermal Langerhans cells (LC), can induce immunity to UV radiation (UVR)-induced skin tumours. Here, it is shown that cells within skin can induce protective antitumour immunity against a UVR-induced fibrosarcoma. Transplantation of the skin overlying subcutaneous tumours onto naive recipients could induce protective antitumour immunity, probably because the grafting stimulated the tumour Ag-loaded DC to migrate to local lymph nodes. This suggests that cutaneous APC can present tumour Ag to induce protective antitumour immunity. Previously, it has been shown that immunization of mice with MHC class II+ epidermal cells (EC) pulsed with tumour extracts could induce delayed-type hypersensitivity against tumour cells. Here, this same immunization protocol could induce protective immunity against a minimum tumorigenic dose of UVR-induced fibrosarcoma cells, but not higher doses. Epidermal cells obtained from semiallogeneic donors and pulsed with tumour extract could also induce protective immunity. However, presentation of BSA Ag from the culture medium was found to contribute to this result using semiallogeneic EC. The results suggest that LC overlying skin tumours may be able to induce protective immunity to UVR-induced tumours if stimulated to migrate from the skin. Copyright (2001) Australasian Society of Immunology Inc

  6. Preparation of epidermal growth factor (EGF) conjugated iron oxide nanoparticles and their internalization into colon cancer cells

    International Nuclear Information System (INIS)

    Creixell, Mar; Herrera, Adriana P.; Ayala, Vanessa; Latorre-Esteves, Magda; Perez-Torres, Marianela; Torres-Lugo, Madeline; Rinaldi, Carlos

    2010-01-01

    Epidermal growth factor (EGF) was conjugated with carboxymethyldextran (CMDx) coated iron oxide magnetic nanoparticles using carbodiimide chemistry to obtain magnetic nanoparticles that target the epidermal growth factor receptor (EGFR). Epidermal growth factor modified magnetic nanoparticles were colloidally stable when suspended in biological buffers such as PBS and cell culture media. Both targeted and non-targeted nanoparticles were incubated with CaCo-2 cancer cells, known to overexpress EGFR. Nanoparticle localization within the cell was visualized by confocal laser scanning microscopy and light microscopy using Prussian blue stain. Results showed that targeted magnetic nanoparticles were rapidly accumulated in both flask-shaped small vesicles and large circular endocytic structures. Internalization patterns suggest that both clathrin-dependent and clathrin-independent receptors mediated endocytosis mechanisms are responsible for nanoparticle internalization.

  7. Influence of epidermal hydration on the friction of human skin against textile

    NARCIS (Netherlands)

    Gerhardt, L.C.; Strässle, V.; Lenz, A.; Spencer, N.D.; Derler, S.

    2008-01-01

    Friction and shear forces, as well as moisture between the human skin and textiles are critical factors in the formation of skin injuries such as blisters, abrasions and decubitus. This study investigated how epidermal hydration affects the friction between skin and textiles. The friction between

  8. Turnover of pigment granules: cyclic catabolism and anabolism of ommochromes within epidermal cells.

    Science.gov (United States)

    Insausti, T C; Casas, J

    2009-12-01

    Ommochromes are end products of the tryptophan metabolism in arthropods. While the anabolism of ommochromes has been well studied, the catabolism is totally unknown. In order to study it, we used the crab-spider Misumena vatia, which is able to change color reversibly in a few days, from yellow to white and back. Ommochromes is the only pigment class responsible for the body coloration in this animal. The aim of this study was to analyze the fine structure of the epidermal cells in bleaching spiders, in an attempt to correlate morphological changes with the fate of the pigment granules. Central to the process of bleaching is the lysis of the ommochrome granules. In the same cell, intact granules and granules in different degradation stages are found. The degradation begins with granule autolysis. Some components are extruded in the extracellular space and others are recycled via autophagy. Abundant glycogen appears associated to granulolysis. In a later stage of bleaching, ommochrome progranules, typical of white spiders, appear in the distal zone of the same epidermal cell. Catabolism and anabolism of pigment granules thus take place simultaneously in spider epidermal cells. A cyclic pathway of pigment granules formation and degradation, throughout a complete cycle of color change is proposed, together with an explanation for this turnover, involving photoprotection against UV by ommochromes metabolites. The presence of this turnover for melanins is discussed.

  9. Proton extrusion is an essential signalling component in the HR of epidermal single cells in the barley-powdery mildew interaction

    DEFF Research Database (Denmark)

    Zhou, F.S.; Andersen, C.H.; Burhenne, K.

    2000-01-01

    We propose a model for activation of the epidermal cell hypersensitive response (HR) in the barley/powdery mildew interaction. The model suggests that the plasma membrane proton pump (H+-ATPase) of epidermal cells is activated following penetration by an avirulent powdery mildew fungus...... in the incompatible interaction; (4) race-specific proton extrusion is observed underneath epidermal tissue detached from leaves inoculated 15 h earlier; and (5) treatment of leaves with fusicoccin, an activator of the plasma membrane H+-ATPase, increases the number of HR-cells in the compatible interaction........ This will cause an acidification of the apoplast towards the mesophyll cells, thereby activating generation of H2O2 from the mesophyll, which subsequently triggers the epidermal cell to undergo HR. The model is supported by the following data: (1) the earliest HR-related H2O2 is found in the attachment zones...

  10. Expression and analysis of exogenous proteins in epidermal cells.

    Science.gov (United States)

    Dagnino, Lina; Ho, Ernest; Chang, Wing Y

    2010-01-01

    In this chapter we review protocols for transient transfection of primary keratinocytes. The ability to transfect primary epidermal cells regardless of their differentiation status allows the biochemical and molecular characterization of multiple proteins. We review methods to analyze exogenous protein abundance in transfected keratinocytes by immunoblot and immunoprecipitation. We also present protocols to determine the subcellular distribution of these proteins by indirect immunofluorescence microscopy approaches.

  11. Amplification of epidermal growth factor receptor gene in renal cell carcinoma

    DEFF Research Database (Denmark)

    El-Hariry, Iman; Powles, Thomas; Lau, Mike R

    2010-01-01

    Expression of epidermal growth factor receptor (EGFR) may be of prognostic value in renal cell cancer (RCC). Gene amplification of EGFR was investigated in a cohort of 315 patients with advanced RCC from a previously reported randomised study. Using fluorescent in situ hybridisation, only 2...

  12. Inter-individual and inter-cell type variation in residual DNA damage after in vivo irradiation of human skin

    International Nuclear Information System (INIS)

    Chua, Melvin Lee Kiang; Somaiah, Navita; Bourne, Sara; Daley, Frances; A'Hern, Roger; Nuta, Otilia; Davies, Sue; Herskind, Carsten; Pearson, Ann; Warrington, Jim; Helyer, Sarah; Owen, Roger; Yarnold, John; Rothkamm, Kai

    2011-01-01

    Purpose: The aim of this study was to compare inter-individual and inter-cell type variation in DNA double-strand break (DSB) repair following in vivo irradiation of human skin. Materials and methods: Duplicate 4 mm core biopsies of irradiated and unirradiated skin were collected from 35 patients 24 h after 4 Gy exposure using 6 MeV electrons. Residual DSB were quantified by scoring 53BP1 foci in dermal fibroblasts, endothelial cells, superficial keratinocytes and basal epidermal cells. Results: Coefficients of inter-individual variation for levels of residual foci 24 h after in vivo irradiation of skin were 39.9% in dermal fibroblasts, 44.3% in endothelial cells, 32.9% in superficial keratinocytes and 46.4% in basal epidermal cells (p < 0.001, ANOVA). In contrast, the coefficient of inter-cell type variation for residual foci levels was only 11.3% in human skin between the different epidermal and dermal cells (p = 0.034, ANOVA). Foci levels between the different skin cell types were correlated (Pearson's R = 0.855-0.955, p < 0.001). Conclusions: Patient-specific factors appear to be more important than cell type-specific factors in determining residual foci levels following in vivo irradiation of human skin.

  13. Epidermal growth factor receptor signalling in human breast cancer cells operates parallel to estrogen receptor α signalling and results in tamoxifen insensitive proliferation

    International Nuclear Information System (INIS)

    Moerkens, Marja; Zhang, Yinghui; Wester, Lynn; Water, Bob van de; Meerman, John HN

    2014-01-01

    Tamoxifen resistance is a major problem in the treatment of estrogen receptor (ER) α -positive breast cancer patients. Although the mechanisms behind tamoxifen resistance are still not completely understood, clinical data suggests that increased expression of receptor tyrosine kinases is involved. Here, we studied the estrogen and anti-estrogen sensitivity of human breast cancer MCF7 cells that have a moderate, retroviral-mediated, ectopic expression of epidermal growth factor receptor (MCF7-EGFR). Proliferation of MCF7-EGFR and parental cells was induced by 17β-estradiol (E2), epidermal growth factor (EGF) or a combination of these. Inhibition of proliferation under these conditions was investigated with 4-hydroxy-tamoxifen (TAM) or fulvestrant at 10 -12 to 10 -6 M. Cells were lysed at different time points to determine the phosphorylation status of EGFR, MAPK 1/3 , AKT and the expression of ERα. Knockdown of target genes was established using smartpool siRNAs. Transcriptomics analysis was done 6 hr after stimulation with growth factors using Affymetrix HG-U133 PM array plates. While proliferation of parental MCF7 cells could only be induced by E2, proliferation of MCF7-EGFR cells could be induced by either E2 or EGF. Treatment with TAM or fulvestrant did significantly inhibit proliferation of MCF7-EGFR cells stimulated with E2 alone. EGF treatment of E2/TAM treated cells led to a marked cell proliferation thereby overruling the anti-estrogen-mediated inhibition of cell proliferation. Under these conditions, TAM however did still inhibit ERα- mediated transcription. While siRNA-mediated knock-down of EGFR inhibited the EGF- driven proliferation under TAM/E2/EGF condition, knock down of ERα did not. The TAM resistant cell proliferation mediated by the conditional EGFR-signaling may be dependent on the PI3K/Akt pathway but not the MEK/MAPK pathway, since a MEK inhibitor (U0126), did not block the proliferation. Transcriptomic analysis under the various E2/TAM

  14. Anti-sense suppression of epidermal growth factor receptor expression alters cellular proliferation, cell-adhesion and tumorigenicity in ovarian cancer cells.

    Science.gov (United States)

    Alper, O; De Santis, M L; Stromberg, K; Hacker, N F; Cho-Chung, Y S; Salomon, D S

    2000-11-15

    Over-expression of epidermal growth factor receptor (EGFR) in ovarian cancer has been well documented. Human NIH:OVCAR-8 ovarian carcinoma cells were transfected with an expression vector containing the anti-sense orientation of truncated human EGFR cDNA. EGFR anti-sense over-expression resulted in decreased EGFR protein and mRNA expression, cell proliferation and tumor formation in nude mice. In accordance with the reduced levels of EGFR in EGFR anti-sense-expressing cells, tyrosine phosphorylation of EGFR was decreased compared to untransfected parental cells treated with EGF. In EGFR anti-sense-transfected cells, expression of erbB-3, but not erbB-2, was increased. In addition, basal and heregulin-beta 1-stimulated tyrosine phosphorylation of erbB-3 was higher in EGFR anti-sense vector-transfected cells. A morphological alteration in EGFR anti-sense gene-expressing cells was correlated with a decrease in the expression of E-cadherin, alpha-catenin and, to a lesser extent, beta-catenin. Changes in the expression of these proteins were associated with a reduction in complex formation among E-cadherin, beta-catenin and alpha-catenin and between beta-catenin and EGFR in EGFR anti-sense-expressing cells compared to sense-transfected control cells. These results demonstrate that EGFR expression in ovarian carcinoma cells regulates expression of cell adhesion proteins that may enhance cell growth and invasiveness. Copyright 2000 Wiley-Liss, Inc.

  15. In vitro transformation of primary cultures of neonatal BALB/c mouse epidermal cells with ultraviolet-B radiation

    International Nuclear Information System (INIS)

    Ananthaswamy, H.N.; Kripke, M.L.

    1981-01-01

    Primary epidermal cultures from neonatal BALB/c mice were used to study the carcinogenic effects of ultraviolet radiation in vitro. These cultures were irradiated once through a Falcon plastic dish cover with an FS40 sunlamp [ultraviolet B, lambda approximately 290 to 400 nm] for various lengths of time and maintained for 8 to 12 weeks without subculturing. During this period, most of the cells in the untreated control showed signs of morphological differentiation and eventually died. The cultures irradiated with ultraviolet B radiation also behaved in the same manner except that, in some dishes, small populations of surviving cells began to proliferate and developed into morphologically distinct foci. Seven long-term cell lines were derived from these ultraviolet-irradiated primary epidermal cell cultures. Six of these cell lines produced tumors when injected s.c. into normal and/or immunosuppressed syngeneic recipients. These tumorigenic cell lines lacked definitive characteristics of differentiated epidermal cells, but the cells possessed intermediate junctions, suggesting that they were of epithelial origin. Some of these in vitro-transformed cell lines appeared to be highly antigenic inasmuch as they grew preferentially in immunosuppressed BALB/c mice as compared to their growth in normal syngeneic recipients

  16. Epidermal Growth Factor and Intestinal Barrier Function

    Directory of Open Access Journals (Sweden)

    Xiaopeng Tang

    2016-01-01

    Full Text Available Epidermal growth factor (EGF is a 53-amino acid peptide that plays an important role in regulating cell growth, survival, migration, apoptosis, proliferation, and differentiation. In addition, EGF has been established to be an effective intestinal regulator helping to protect intestinal barrier integrity, which was essential for the absorption of nutrients and health in humans and animals. Several researches have demonstrated that EGF via binding to the EGF receptor and subsequent activation of Ras/MAPK, PI3K/AKT, PLC-γ/PKC, and STATS signal pathways regulates intestinal barrier function. In this review, the relationship between epidermal growth factor and intestinal development and intestinal barrier is described, to provide a better understanding of the effects of EGF on intestine development and health.

  17. Immune sensitization against epidermal antigens in polymorphous light eruption

    International Nuclear Information System (INIS)

    Gonzalez-Amaro, R.; Baranda, L.; Salazar-Gonzalez, J.F.; Abud-Mendoza, C.; Moncada, B.

    1991-01-01

    To get further insight into the pathogenesis of polymorphous light eruption, we studied nine patients with polymorphous light eruption and six healthy persons. Two skin biopsy specimens were obtained from each person, one from previously ultraviolet light-irradiated skin and another one from unirradiated skin. An epidermal cell suspension, skin homogenate, or both were prepared from each specimen. Autologous cultures were made with peripheral blood mononuclear cells combined with irradiated or unirradiated skin homogenate and peripheral blood mononuclear cells combined with irradiated or unirradiated epidermal cell suspension. Cell proliferation was assessed by 3H-thymidine incorporation assay. The response of peripheral blood mononuclear cells to unirradiated epidermal cells or unirradiated skin homogenate was similar in both patients and controls. However, peripheral blood mononuclear cells from patients with polymorphous light eruption showed a significantly increased proliferative response to both irradiated epidermal cells and irradiated skin homogenate. Our results indicate that ultraviolet light increases the stimulatory capability of polymorphous light eruption epidermal cells in a unidirectional mixed culture with autologous peripheral blood mononuclear cells. This suggests that an immune sensitization against autologous ultraviolet light-modified skin antigens occurs in polymorphous light eruption

  18. Single cell-type comparative metabolomics of epidermal bladder cells from the halophyte Mesembryanthemum crystallinum

    OpenAIRE

    Barkla, Bronwyn J.; Vera-Estrella, Rosario

    2015-01-01

    One of the remarkable adaptive features of the halophyte and facultative CAM plant Mesembryathemum crystallinum are the specialized modified trichomes called epidermal bladder cells (EBC) which cover the leaves, stems, and peduncle of the plant. They are present from an early developmental stage but upon salt stress rapidly expand due to the accumulation of water and sodium. This particular plant feature makes it an attractive system for single cell type studies, with recent proteomics and tr...

  19. Brief study about the distribution of recombinant human Epidermic Growth Factor (rh-EGF)

    International Nuclear Information System (INIS)

    Rodriguez Garcia, J.C.; De Dios D Espaux, R.; Bello Garciga, J.L.

    1997-01-01

    This report describes results of the study about biodistribution of I-125 recombinant human Epidermic Growth Factor (rhEGF). The radiolabelled product was administrated to Sprague Dawley rats in three different ways: intramuscular, subcutaneous and epidermic; the highest concentration of EGF in blood was found 4 hours after rhEGF administration, with a greater distribution in the plasma with regard to cellular pellet. The slowest plasma clearance corresponded to the intramuscular administration. The highest concentration of radiolabelled rhEGF was found in liver, kidney and intestine. It was found that radiolabelled EGF is excreted mainly throughout urine and faeces although other excretion pathways could exist

  20. Langerhans cell precursors acquire RANK/CD265 in prenatal human skin.

    Science.gov (United States)

    Schöppl, Alice; Botta, Albert; Prior, Marion; Akgün, Johnnie; Schuster, Christopher; Elbe-Bürger, Adelheid

    2015-01-01

    The skin is the first barrier against foreign pathogens and the prenatal formation of a strong network of various innate and adaptive cells is required to protect the newborn from perinatal infections. While many studies about the immune system in healthy and diseased adult human skin exist, our knowledge about the cutaneous prenatal/developing immune system and especially about the phenotype and function of antigen-presenting cells such as epidermal Langerhans cells (LCs) in human skin is still scarce. It has been shown previously that LCs in healthy adult human skin express receptor activator of NF-κB (RANK), an important molecule prolonging their survival. In this study, we investigated at which developmental stage LCs acquire this important molecule. Immunofluorescence double-labeling of cryostat sections revealed that LC precursors in prenatal human skin either do not yet [10-11 weeks of estimated gestational age (EGA)] or only faintly (13-15 weeks EGA) express RANK. LCs express RANK at levels comparable to adult LCs by the end of the second trimester. Comparable with adult skin, dermal antigen-presenting cells at no gestational age express this marker. These findings indicate that epidermal leukocytes gradually acquire RANK during gestation - a phenomenon previously observed also for other markers on LCs in prenatal human skin. Copyright © 2015 The Authors. Published by Elsevier GmbH.. All rights reserved.

  1. Dynein and EFF-1 control dendrite morphology by regulating the localization pattern of SAX-7 in epidermal cells.

    Science.gov (United States)

    Zhu, Ting; Liang, Xing; Wang, Xiang-Ming; Shen, Kang

    2017-12-01

    Our previous work showed that the cell adhesion molecule SAX-7 forms an elaborate pattern in Caenorhabditis elegans epidermal cells, which instructs PVD dendrite branching. However, the molecular mechanism forming the SAX-7 pattern in the epidermis is not fully understood. Here, we report that the dynein light intermediate chain DLI-1 and the fusogen EFF-1 are required in epidermal cells to pattern SAX-7. While previous reports suggest that these two molecules act cell-autonomously in the PVD, our results show that the disorganized PVD dendritic arbors in these mutants are due to the abnormal SAX-7 localization patterns in epidermal cells. Three lines of evidence support this notion. First, the epidermal SAX-7 pattern was severely affected in dli-1 and eff-1 mutants. Second, the abnormal SAX-7 pattern was predictive of the ectopic PVD dendrites. Third, expression of DLI-1 or EFF-1 in the epidermis rescued both the SAX-7 pattern and the disorganized PVD dendrite phenotypes, whereas expression of these molecules in the PVD did not. We also show that DLI-1 functions cell-autonomously in the PVD to promote distal branch formation. These results demonstrate the unexpected roles of DLI-1 and EFF-1 in the epidermis in the control of PVD dendrite morphogenesis. © 2017. Published by The Company of Biologists Ltd.

  2. Effects of soap-water wash on human epidermal penetration.

    Science.gov (United States)

    Zhu, Hanjiang; Jung, Eui-Chang; Phuong, Christina; Hui, Xiaoying; Maibach, Howard

    2016-08-01

    Skin decontamination is a primary interventional method used to decrease dermal absorption of hazardous contaminants, including chemical warfare agents, pesticides and industrial pollutants. Soap and water wash, the most common and readily available decontamination system, may enhance percutaneous absorption through the "wash-in effect." To understand better the effect of soap-water wash on percutaneous penetration, and provide insight to improving skin decontamination methods, in vitro human epidermal penetration rates of four C(14) -labeled model chemicals (hydroquinone, clonidine, benzoic acid and paraoxon) were assayed using flow-through diffusion cells. Stratum corneum (SC) absorption rates of these chemicals at various hydration levels (0-295% of the dry SC weights) were determined and compared with the results of the epidermal penetration study to clarify the effect of SC hydration on skin permeability. Results showed accelerated penetration curves of benzoic acid and paraoxon after surface wash at 30 min postdosing. Thirty minutes after washing (60 min postdosing), penetration rates of hydroquinone and benzoic acid decreased due to reduced amounts of chemical on the skin surface and in the SC. At the end of the experiment (90 min postdosing), a soap-water wash resulted in lower hydroquinone penetration, greater paraoxon penetration and similar levels of benzoic acid and clonidine penetration compared to penetration levels in the non-wash groups. The observed wash-in effect agrees with the enhancement effect of SC hydration on the SC chemical absorption rate. These results suggest SC hydration derived from surface wash to be one cause of the wash-in effect. Further, the occurrence of a wash-in effect is dependent on chemical identity and elapsed time between exposure and onset of decontamination. By reducing chemical residue quantity on skin surface and in the SC reservoir, the soap-water wash may decrease the total quantity of chemical absorbed in the

  3. Biochemistry of epidermal stem cells☆

    Science.gov (United States)

    Eckert, Richard L.; Adhikary, Gautam; Balasubramanian, Sivaprakasam; Rorke, Ellen A.; Vemuri, Mohan C.; Boucher, Shayne E.; Bickenbach, Jackie R.; Kerr, Candace

    2014-01-01

    Background The epidermis is an important protective barrier that is essential for maintenance of life. Maintaining this barrier requires continuous cell proliferation and differentiation. Moreover, these processes must be balanced to produce a normal epidermis. The stem cells of the epidermis reside in specific locations in the basal epidermis, hair follicle and sebaceous glands and these cells are responsible for replenishment of this tissue. Scope of review A great deal of effort has gone into identifying protein epitopes that mark stem cells, in identifying stem cell niche locations, and in understanding how stem cell populations are related. We discuss these studies as they apply to understanding normal epidermal homeostasis and skin cancer. Major conclusions An assortment of stem cell markers have been identified that permit assignment of stem cells to specific regions of the epidermis, and progress has been made in understanding the role of these cells in normal epidermal homeostasis and in conditions of tissue stress. A key finding is the multiple stem cell populations exist in epidermis that give rise to different structures, and that multiple stem cell types may contribute to repair in damaged epidermis. General significance Understanding epidermal stem cell biology is likely to lead to important therapies for treating skin diseases and cancer, and will also contribute to our understanding of stem cells in other systems. This article is part of a Special Issue entitled Biochemistry of Stem Cells. PMID:22820019

  4. Single cell-type comparative metabolomics of epidermal bladder cells from the halophyte Mesembryanthemum crystallinum.

    Science.gov (United States)

    Barkla, Bronwyn J; Vera-Estrella, Rosario

    2015-01-01

    One of the remarkable adaptive features of the halophyte Mesembryanthemum crystallinum are the specialized modified trichomes called epidermal bladder cells (EBC) which cover the leaves, stems, and peduncle of the plant. They are present from an early developmental stage but upon salt stress rapidly expand due to the accumulation of water and sodium. This particular plant feature makes it an attractive system for single cell type studies, with recent proteomics and transcriptomics studies of the EBC establishing that these cells are metabolically active and have roles other than sodium sequestration. To continue our investigation into the function of these unusual cells we carried out a comprehensive global analysis of the metabolites present in the EBC extract by gas chromatography Time-of-Flight mass spectrometry (GC-TOF) and identified 194 known and 722 total molecular features. Statistical analysis of the metabolic changes between control and salt-treated samples identified 352 significantly differing metabolites (268 after correction for FDR). Principal components analysis provided an unbiased evaluation of the data variance structure. Biochemical pathway enrichment analysis suggested significant perturbations in 13 biochemical pathways as defined in KEGG. More than 50% of the metabolites that show significant changes in the EBC, can be classified as compatible solutes and include sugars, sugar alcohols, protein and non-protein amino acids, and organic acids, highlighting the need to maintain osmotic homeostasis to balance the accumulation of Na(+) and Cl(-) ions. Overall, the comparison of metabolic changes in salt treated relative to control samples suggests large alterations in M. crystallinum epidermal bladder cells.

  5. Single cell-type comparative metabolomics of epidermal bladder cells from the halophyte Mesembryanthemum crystallinum

    Science.gov (United States)

    Barkla, Bronwyn J.; Vera-Estrella, Rosario

    2015-01-01

    One of the remarkable adaptive features of the halophyte Mesembryanthemum crystallinum are the specialized modified trichomes called epidermal bladder cells (EBC) which cover the leaves, stems, and peduncle of the plant. They are present from an early developmental stage but upon salt stress rapidly expand due to the accumulation of water and sodium. This particular plant feature makes it an attractive system for single cell type studies, with recent proteomics and transcriptomics studies of the EBC establishing that these cells are metabolically active and have roles other than sodium sequestration. To continue our investigation into the function of these unusual cells we carried out a comprehensive global analysis of the metabolites present in the EBC extract by gas chromatography Time-of-Flight mass spectrometry (GC-TOF) and identified 194 known and 722 total molecular features. Statistical analysis of the metabolic changes between control and salt-treated samples identified 352 significantly differing metabolites (268 after correction for FDR). Principal components analysis provided an unbiased evaluation of the data variance structure. Biochemical pathway enrichment analysis suggested significant perturbations in 13 biochemical pathways as defined in KEGG. More than 50% of the metabolites that show significant changes in the EBC, can be classified as compatible solutes and include sugars, sugar alcohols, protein and non-protein amino acids, and organic acids, highlighting the need to maintain osmotic homeostasis to balance the accumulation of Na+ and Cl− ions. Overall, the comparison of metabolic changes in salt treated relative to control samples suggests large alterations in M. crystallinum epidermal bladder cells. PMID:26113856

  6. Response of human epidermal keratinocytes to UV light

    International Nuclear Information System (INIS)

    Kartasova, A.A.

    1987-01-01

    This thesis presents a study on the response of human epidermal keratinocytes to UV light as well as to other agents like 4-NQO and TPA. The effects of ultraviolet (UV) light on the protein synthesis in cultured keratinocytes are presented in ch. III. The next chapter describes the construction of a cDNA library using mRNA isolated from UV irradiated kernatinocytes. This library was differentially screened with cDNA probes synthesized on mRNA from either UV irradiated or nonirradiated cells. Several groups of cDNA clones corresponding to transcripts whose level in the cytoplasm seem to be affected by exposure to UV light have been isolated and characterized by cross-hybridization, sequencing and Northern blot analysis. More detailed analysis of some of the cDNA clones is presented in the two chapters following ch. IV. The complete cDNA sequence of the proteinase inhibitor cystatin A and the modulation of its expression by UV light and the carcinogen 4-nitroquinoline 1-oxide (4-NQO) in keratinocytes are described in ch. V. Two other groups of cDNA clones have been isolated which do not cross-hybridize with each other on Southern blots. However, the primary structures of the proteins deduced from the nucleotide sequences of these two groups of cDNA clones are very similar. 212 refs.; 33 figs.; 2 tabs

  7. Epidermal growth factor induces HCCR expression via PI3K/Akt/mTOR signaling in PANC-1 pancreatic cancer cells

    International Nuclear Information System (INIS)

    Xu, Zekuan; Zhang, Guoxin; Zhang, Yi; Jiang, Jiakai; Yang, Yang; Shi, Ruihua; Hao, Bo; Zhang, Zhihong; Huang, Zuhu; Kim, Jin W

    2010-01-01

    Human cervical cancer oncoprotein 1 (HCCR-1), reported as a negative regulator of p53, is over-expressed in a variety of human cancers. However, it is yet unknown whether HCCR-1 plays any role in pancreatic cancer development. The aim of this study was to investigate the effect of epidermal growth factor on the expression of HCCR in pancreatic cancer cells, and to explore if PI3K/Akt/mTOR signaling pathway mediated this expression. A polyclonal antibody against HCCR protein was raised by immunizing Balb/c mice with the purified recombinant protein pMBPc-HCCR. Tissue samples were constructed on a tissue chip, and the expression of HCCR was investigated by immunohistochemistry assay and Western blotting. Pancreatic cell line, PANC-1 cells were stably transfected with plasmids containing sense-HCCR-1 fragment and HCCR siRNA fragment. MTT and transwell assay were used to investigate the proliferation and invasion of stable tansfectants. The specific inhibitor of PI3K and mTOR was used to see if PI3K/mTOR signal transduction was involved in the induction of HCCR gene expression. A Luciferase assay was used to see if Akt can enhance the HCCR promoter activity. HCCR was up-regulated in pancreatic tumor tissues (mean Allred score 4.51 ± 1.549 vs. 2.87 ± 2.193, P < 0.01), especially with high expression in poorly differentiated pancreatic cancer. The growth of cells decreased in HCCR-1 siRNA transfected cells compared with vector transfectants. The number of invasion cells was significantly lower in HCCR-1 siRNA transfected cells (24.4 ± 9.9) than that in vector transfectants (49.1 ± 15.4). Treatment of PANC-1 cells with epidermal growth factor increased HCCR protein level in a dose- and time-dependent manner. However, application of LY294002 and rapamycin caused a dramatic reduction of epidermal growth factor-induced HCCR expression. Over-expression of exogenous constitutively active Akt increased the HCCR promoter activity; in contrast, dominant negative Akt decreased

  8. Effects of epidermal growth factor on neural crest cells in tissue culture

    International Nuclear Information System (INIS)

    Erickson, C.A.; Turley, E.A.

    1987-01-01

    Epidermal growth factor (EGF) stimulates the release of hyaluronic acid (HA) and chondroitin sulfate proteoglycan (CSPG) from quail trunk neural crest cultures in a dose-dependent fashion. It also promotes the expression of cell-associated heparan sulfate proteoglycan (HSPG) as detected by immunofluorescence and immunoprecipitation of the 3 H-labeled proteoglycan. Furthermore, EGF stimulates [ 3 H]thymidine incorporation into total cell DNA. These results raise the possibility that EGF or an analogous growth factor is involved in regulation of neural crest cell morphogenesis

  9. Dynamic changes in nicotinamide pyridine dinucleotide content in normal human epidermal keratinocytes and their effect on retinoic acid biosynthesis

    International Nuclear Information System (INIS)

    Pinkas-Sarafova, Adriana; Markova, N.G.; Simon, M.

    2005-01-01

    The function of many enzymes that regulate metabolism and transcription depends critically on the nicotinamide pyridine dinucleotides. To understand the role of NAD(P)(H) in physiology and pathophysiology, it is imperative to estimate both their amount and ratios in a given cell type. In human epidermis and in cultured epidermal keratinocytes, we found that the total dinucleotide content is in the low millimolar range. The dinucleotide pattern changes during proliferation and maturation of keratinocytes in culture. Differences in the concentrations of NAD(P)(H) of 1.5- to 12-fold were observed. This resulted in alteration of the NAD(P)H/NAD(P) ratio, which could impact the differential regulation of both transcriptional and metabolic processes. In support of this notion, we provide evidence that the two-step oxidation of retinol to retinoic acid, a nuclear hormone critical for epidermal homeostasis, can be regulated by the relative physiological amounts of the pyridine dinucleotides

  10. Myosin II activity is required for functional leading-edge cells and closure of epidermal sheets in fish skin ex vivo.

    Science.gov (United States)

    Morita, Toshiyuki; Tsuchiya, Akiko; Sugimoto, Masazumi

    2011-09-01

    Re-epithelialization in skin wound healing is a process in which epidermal sheets grow and close the wound. Although the actin-myosin system is thought to have a pivotal role in re-epithelialization, its role is not clear. In fish skin, re-epithelialization occurs around 500 μm/h and is 50 times faster than in mammalian skin. We had previously reported that leading-edge cells of the epidermal outgrowth have both polarized large lamellipodia and "purse string"-like actin filament cables in the scale-skin culture system of medaka fish, Oryzias latipes (Cell Tissue Res, 2007). The actin purse-string (APS) is a supracellular contractile machinery in which adherens junctions (AJs) link intracellular myosin II-including actin cables between neighboring cells. In this study, we developed a modified "face-to-face" scale-skin culture system as an ex vivo model to study epidermal wound healing, and examined the role of the actin-myosin system in the rapid re-epithelialization using a myosin II ATPase inhibitor, blebbistatin. A low level of blebbistatin suppressed the formation of APS and induced the dissociation of keratocytes from the leading edge without attenuating the growth of the epidermal sheet or the migration rate of solitary keratocytes. AJs in the superficial layer showed no obvious changes elicited by blebbistatin. However, two epidermal sheets without APSs did not make a closure with each other, which was confirmed by inhibiting the connecting AJs between the superficial layers. These results suggest that myosin II activity is required for functional leading-edge cells and for epidermal closure.

  11. Expression of epidermal growth factor receptors in human endometrial carcinoma

    DEFF Research Database (Denmark)

    Nyholm, H C; Nielsen, Anette Lynge; Ottesen, B

    1993-01-01

    Little data exist on the expression of epidermal growth factor receptors (EGF-Rs) in human endometrial cancer. EGF-R status was studied in 65 patients with endometrial carcinomas and in 26 women with nonmalignant postmenopausal endometria, either inactive/atrophic endometrium or adenomatous...... hyperplasia. EGF-R was identified on frozen tissue sections by means of an indirect immunoperoxidase technique with a monoclonal antibody against the external domain of the EGF-R. Seventy-one percent of the carcinomas expressed positive EGF-R immunoreactivity. In general, staining was most prominent...

  12. Endothelin B Receptors on Primary Chicken Müller Cells and the Human MIO-M1 Müller Cell Line Activate ERK Signaling via Transactivation of Epidermal Growth Factor Receptors.

    Directory of Open Access Journals (Sweden)

    Mohammad Harun-Or-Rashid

    Full Text Available Injury to the eye or retina triggers Müller cells, the major glia cell of the retina, to dedifferentiate and proliferate. In some species they attain retinal progenitor properties and have the capacity to generate new neurons. The epidermal growth factor receptor (EGFR system and extracellular signal-regulated kinase (ERK signaling are key regulators of these processes in Müller cells. The extracellular signals that modulate and control these processes are not fully understood. In this work we studied whether endothelin receptor signaling can activate EGFR and ERK signaling in Müller cells. Endothelin expression is robustly upregulated at retinal injury and endothelin receptors have been shown to transactivate EGFRs in other cell types. We analyzed the endothelin signaling system in chicken retina and cultured primary chicken Müller cells as well as the human Müller cell line MIO-M1. The Müller cells were stimulated with receptor agonists and treated with specific blockers to key enzymes in the signaling pathway or with siRNAs. We focused on endothelin receptor mediated transactivation of EGFRs by using western blot analysis, quantitative reverse transcriptase PCR and immunocytochemistry. The results showed that chicken Müller cells and the human Müller cell line MIO-M1 express endothelin receptor B. Stimulation by the endothelin receptor B agonist IRL1620 triggered phosphorylation of ERK1/2 and autophosphorylation of (Y1173 EGFR. The effects could be blocked by Src-kinase inhibitors (PP1, PP2, EGFR-inhibitor (AG1478, EGFR-siRNA and by inhibitors to extracellular matrix metalloproteinases (GM6001, consistent with a Src-kinase mediated endothelin receptor response that engage ligand-dependent and ligand-independent EGFR activation. Our data suggest a mechanism for how injury-induced endothelins, produced in the retina, may modulate the Müller cell responses by Src-mediated transactivation of EGFRs. The data give support to a view in

  13. Single cell-type comparative metabolomics of epidermal bladder cells from the halophyte Mesembryanthemum crystallinum.

    Directory of Open Access Journals (Sweden)

    Bronwyn Jane Barkla

    2015-06-01

    Full Text Available One of the remarkable adaptive features of the halophyte and facultative CAM plant Mesembryathemum crystallinum are the specialized modified trichomes called epidermal bladder cells (EBC which cover the leaves, stems, and peduncle of the plant. They are present from an early developmental stage but upon salt stress rapidly expand due to the accumulation of water and sodium. This particular plant feature makes it an attractive system for single cell type studies, with recent proteomics and transcriptomics studies of the EBC establishing that these cells are metabolically active and have roles other than sodium sequestration. To continue our investigation into the function of these unusual cells we carried out a comprehensive global analysis of the metabolites present in the EBC extract by gas chromatography Time-of-Flight mass spectrometry (GC-TOF and identified 194 known and 722 total molecular features. Statistical analysis of the metabolic changes between control and salt-treated samples was used to identify 352 significantly differing metabolites (268 after correction for FDR. Principal components analysis provided an unbiased evaluation of the data variance structure. Biochemical pathway enrichment analysis suggested significant perturbations in 13 biochemical pathways as defined in KEGG. More than 50% of the metabolites that show significant changes in the EBC, can be classified as compatible solutes and include sugars, sugar alcohols, protein and non-protein amino acids, and organic acids, highlighting the need to maintain osmotic homeostasis to balance the accumulation of Na and Cl ions. Overall, the comparison of metabolic changes in salt treated relative to control samples suggest large alterations in Mesembryanthemum crystallinum epidermal bladder cells.

  14. Epidermal growth factor in the rat prostate

    DEFF Research Database (Denmark)

    Tørring, Niels; Jørgensen, P E; Poulsen, Steen Seier

    1998-01-01

    Epidermal growth factor (EGF) induces proliferation in prostate epithelial and stromal cells in primary culture. This investigation was set up to characterize the time and spatial expression of EGF in the rat prostate.......Epidermal growth factor (EGF) induces proliferation in prostate epithelial and stromal cells in primary culture. This investigation was set up to characterize the time and spatial expression of EGF in the rat prostate....

  15. Heparin-binding epidermal growth factor-like growth factor promotes neuroblastoma differentiation.

    Science.gov (United States)

    Gaviglio, Angela L; Knelson, Erik H; Blobe, Gerard C

    2017-05-01

    High-risk neuroblastoma is characterized by undifferentiated neuroblasts and low schwannian stroma content. The tumor stroma contributes to the suppression of tumor growth by releasing soluble factors that promote neuroblast differentiation. Here we identify heparin-binding epidermal growth factor-like growth factor (HBEGF) as a potent prodifferentiating factor in neuroblastoma. HBEGF mRNA expression is decreased in human neuroblastoma tumors compared with benign tumors, with loss correlating with decreased survival. HBEGF protein is expressed only in stromal compartments of human neuroblastoma specimens, with tissue from high-stage disease containing very little stroma or HBEGF expression. In 3 human neuroblastoma cell lines (SK-N-AS, SK-N-BE2, and SH-SY5Y), soluble HBEGF is sufficient to promote neuroblast differentiation and decrease proliferation. Heparan sulfate proteoglycans and heparin derivatives further enhance HBEGF-induced differentiation by forming a complex with the epidermal growth factor receptor, leading to activation of the ERK1/2 and STAT3 pathways and up-regulation of the inhibitor of DNA binding transcription factor. These data support a role for loss of HBEGF in the neuroblastoma tumor microenvironment in neuroblastoma pathogenesis.-Gaviglio, A. L., Knelson, E. H., Blobe, G. C. Heparin-binding epidermal growth factor-like growth factor promotes neuroblastoma differentiation. © FASEB.

  16. Induction of suppression of delayed type hypersensitivity to herpes simplex virus by epidermal cells exposed to UV-irradiated urocanic acid in vivo

    International Nuclear Information System (INIS)

    Ross, J.A.; Howie, S.E.; Norval, M.; Maingay, J.P.

    1987-01-01

    Urocanic acid (UCA), the putative photoreceptor for ultraviolet radiation (UV)-induced suppression, undergoes a UV-dependent trans to cis isomerisation. Epidermal cells from mice painted with UCA, containing a known proportion of the cis-isomer, generate suppression of the delayed type hypersensitivity response to herpes simplex virus type 1 (HSV-1) when transferred to naive syngeneic recipients at the same time and site as infection with HSV-1. One T suppressor cell subset, of phenotype (Thy1+, L3T4+, Ly2-), is induced by the cis-UCA modified epidermal cell transfer. Flow cytometric analysis of the epidermal cells from skin treated with UV or cis-UCA indicates an overall reduction from normal in the number of cells expressing MHC Class II antigens, but no alteration in the number expressing I-J antigens

  17. Real-time three-dimensional imaging of epidermal splitting and removal by high-definition optical coherence tomography.

    Science.gov (United States)

    Boone, Marc; Draye, Jean Pierre; Verween, Gunther; Pirnay, Jean-Paul; Verbeken, Gilbert; De Vos, Daniel; Rose, Thomas; Jennes, Serge; Jemec, Gregor B E; Del Marmol, Véronique

    2014-10-01

    While real-time 3-D evaluation of human skin constructs is needed, only 2-D non-invasive imaging techniques are available. The aim of this paper is to evaluate the potential of high-definition optical coherence tomography (HD-OCT) for real-time 3-D assessment of the epidermal splitting and decellularization. Human skin samples were incubated with four different agents: Dispase II, NaCl 1 M, sodium dodecyl sulphate (SDS) and Triton X-100. Epidermal splitting, dermo-epidermal junction, acellularity and 3-D architecture of dermal matrices were evaluated by High-definition optical coherence tomography before and after incubation. Real-time 3-D HD-OCT assessment was compared with 2-D en face assessment by reflectance confocal microscopy (RCM). (Immuno) histopathology was used as control. HD-OCT imaging allowed real-time 3-D visualization of the impact of selected agents on epidermal splitting, dermo-epidermal junction, dermal architecture, vascular spaces and cellularity. RCM has a better resolution (1 μm) than HD-OCT (3 μm), permitting differentiation of different collagen fibres, but HD-OCT imaging has deeper penetration (570 μm) than RCM imaging (200 μm). Dispase II and NaCl treatments were found to be equally efficient in the removal of the epidermis from human split-thickness skin allografts. However, a different epidermal splitting level at the dermo-epidermal junction could be observed and confirmed by immunolabelling of collagen type IV and type VII. Epidermal splitting occurred at the level of the lamina densa with dispase II and above the lamina densa (in the lamina lucida) with NaCl. The 3-D architecture of dermal papillae and dermis was more affected by Dispase II on HD-OCT which corresponded with histopathologic (orcein staining) fragmentation of elastic fibres. With SDS treatment, the epidermal removal was incomplete as remnants of the epidermal basal cell layer remained attached to the basement membrane on the dermis. With Triton X-100 treatment

  18. Relationship between the ability of sunscreens containing 2-ethylhexyl-4'-methoxycinnamate to protect against UVR-induced inflammation, depletion of epidermal Langerhans (Ia+) cells and suppression of alloactivating capacity of murine skin in vivo.

    Science.gov (United States)

    Walker, S L; Morris, J; Chu, A C; Young, A R

    1994-01-01

    The UVB sunscreen 2-ethylhexyl-4'-methoxycinnamate was evaluated in hairless albino mouse skin for its ability to inhibit UVR-induced (i) oedema, (ii) epidermal Langerhans cell (Ia+) depletion and (iii) suppression of the alloactivating capacity of epidermal cells (mixed epidermal cell-lymphocyte reaction, MECLR). The sunscreen, prepared at 9% in ethanol or a cosmetic lotion, was applied prior to UVB/UVA irradiation. In some experiments there was a second application halfway through the irradiation. Single applications in both vehicles gave varying degrees of protection from oedema and Langerhans cell depletion but afforded no protection from suppression of MECLR. When the sunscreens were applied twice there was improved protection from oedema and Langerhans cell depletion and complete protection was afforded from suppression of MECLR. There was a clear linear relationship between Langerhans cell numbers and oedema with and without sunscreen application. The relationship between Langerhans cell numbers and MECLR was more complex. These data confirm published discrepancies between protection from oedema (a model for human erythema) and endpoints with immunological significance, but show that 2-ethylhexyl-4'-methoxycinnamate can afford complete immunoprotection, although protection is dependent on the application rate and vehicle.

  19. Genetic analysis of Ras genes in epidermal development and tumorigenesis

    Science.gov (United States)

    Drosten, Matthias; Lechuga, Carmen G; Barbacid, Mariano

    2013-01-01

    Proliferation and differentiation of epidermal keratinocytes are tightly controlled to ensure proper development and homeostasis of the epidermis. The Ras family of small GTPases has emerged as a central node in the coordination of cell proliferation in the epidermis. Recent genetic evidence from mouse models has revealed that the intensity of Ras signaling modulates the proliferative capacity of epidermal keratinocytes. Interfering with Ras signaling either by combined elimination of the 3 Ras genes from the basal layer of the epidermis or by overexpression of dominant-negative Ras isoforms caused epidermal thinning due to hypoproliferation of keratinocytes. In contrast, overexpression of oncogenic Ras mutants in different epidermal cell layers led to hyperproliferative phenotypes including the development of papillomas and squamous cell carcinomas. Here, we discuss the value of loss- and gain-of-function studies in mouse models to assess the role of Ras signaling in the control of epidermal proliferation. PMID:24150175

  20. Induction of Skin-Derived Precursor Cells from Human Induced Pluripotent Stem Cells.

    Science.gov (United States)

    Sugiyama-Nakagiri, Yoriko; Fujimura, Tsutomu; Moriwaki, Shigeru

    2016-01-01

    The generation of full thickness human skin from dissociated cells is an attractive approach not only for treating skin diseases, but also for treating many systemic disorders. However, it is currently not possible to obtain an unlimited number of skin dermal cells. The goal of this study was to develop a procedure to produce skin dermal stem cells from induced pluripotent stem cells (iPSCs). Skin-derived precursor cells (SKPs) were isolated as adult dermal precursors that could differentiate into both neural and mesodermal progenies and could reconstitute the dermis. Thus, we attempted to generate SKPs from iPSCs that could reconstitute the skin dermis. Human iPSCs were initially cultured with recombinant noggin and SB431542, an inhibitor of activin/nodal and TGFβ signaling, to induce neural crest progenitor cells. Those cells were then treated with SKP medium that included CHIR99021, a WNT signal activator. The induction efficacy from neural crest progenitor cells to SKPs was more than 97%. No other modifiers tested were able to induce those cells. Those human iPSC-derived SKPs (hiPSC-SKPs) showed a similar gene expression signature to SKPs isolated from human skin dermis. Human iPSC-SKPs differentiated into neural and mesodermal progenies, including adipocytes, skeletogenic cell types and Schwann cells. Moreover, they could be induced to follicular type keratinization when co-cultured with human epidermal keratinocytes. We here provide a new efficient protocol to create human skin dermal stem cells from hiPSCs that could contribute to the treatment of various skin disorders.

  1. Human Epidermal Growth Factor Receptor 2 Overexpression in Micropapillary and Other Variants of Urothelial Carcinoma.

    Science.gov (United States)

    Behzatoğlu, Kemal; Yörükoğlu, Kutsal; Demir, Hale; Bal, Nebil

    2016-06-21

    Human epidermal growth factor receptor 2 (HER2) protein overexpression or gene amplification has been shown in urothelial bladder cancer. This could be helpful when using targeted anti-HER2 therapy on these tumors. To evaluate HER2 immunohistochemical expression in conventional urothelial carcinoma (UC), in situ UC, and UC variants primarily in micropapillary urothelial carcinoma (MPUC). The study evaluated 60 MPUC cases; 25 invasive, 20 low-grade noninvasive, and 10 high-grade noninvasive UC cases; 8 in situ UC cases; and 69 UC variant cases. The immunohistochemistry staining was scored according to recommendations of the American Society of Clinical Oncology/College of American Pathologists 2013 HER2 test guideline established for breast cancer and only 3+ staining was considered HER2 overexpression. HER2 overexpression was determined by 3+ staining. 34 of 60 MPUC cases (56%) showed HER2 overexpression (3+ staining). We observed 3+ staining HER2 overexpression in nine of 25 conventional invasive UC cases (36%), four of eight in situ UC cases (50%), and three of six lipid cell variant cases (50%). 3+ staining HER2 overexpression was not seen in eight glandular, six small cell, and five sarcomatoid variant cases. HER2 overexpression was negative in the 20 low-grade noninvasive UC cases but positive in two of the 10 high-grade noninvasive UC cases (20%). We observed HER2 overexpression most commonly in MPUC cases. We also found HER2 overexpression in conventional invasive and in situ UC cases. Pure in situ UC and conventional invasive UC, especially MPUC, could be candidate tumors for treatment with anti-HER2 antibody (trastuzumab therapy). Targeted therapy has a limited place in treatment of bladder cancer. In this study, human epidermal growth factor receptor 2 (HER2) overexpression in bladder carcinomas was evaluated in a large number of cases. Anti-HER2 therapy could be used in bladder cancers, as in breast and gastric cancers. Copyright © 2016 European

  2. Protective effect of Juglans regia L. against ultraviolet B radiation induced inflammatory responses in human epidermal keratinocytes.

    Science.gov (United States)

    Muzaffer, Umar; Paul, V I; Prasad, Nagarajan Rajendra; Karthikeyan, Ramasamy; Agilan, Balupillai

    2018-03-15

    Juglans regia L. has a history of traditional medicinal use for the treatment of various maladies and have been documented with significant antioxidant and antiinflammatory properties. Although all parts of the plant are medicinally important, but male the flower of the plant has not been yet investigated against the photo-damage. The present study, we sought to determine the photoprotective effect of the male flower of J. regia L. against ultraviolet-B radiation-induced inflammatory responses in human skin cells. The profile of pharmacological active compounds present in the male flower of J. regia was analyzed by GC-MS. Then, the antioxidant property of methanolic extract of J. regia (MEJR) was analyzed by in vitro free radical scavenging assays. Further, we analyzed the sun protection factor of this extract by spectrophotometry. Moreover, we investigated the photoprotective effect of MEJR against UVB induced inflammatory signaling in human epidermal cells. Human skin epidermal keratinocytes (HaCaT) were pretreated with the MEJR (80 µg/ml), 30 min prior to UVB-irradiation at a dose of 20 mJ/cm 2 and were investigated for lipid peroxidation, enzymatic antioxidants activity, apoptosis and inflammatory markers expression level. The GC-MS results showed the presence of good amount of pharmacologically active compounds in the MEJR. We observed that the MEJR possess significant free radical scavenging activity and it was comparable with standard antioxidants. Further, the MEJR exhibits 8.8 sun-protection-factor (SPF) value. Pretreatment with MEJR, 30 min prior to UVB-irradiation, prevented ROS generation, lipid peroxidation and restored the activity of antioxidant status in HaCaT cells. Moreover, MEJR pretreatment significantly prevented UVB activated inflammatory markers like TNF-α, IL-1, IL-6, NF-κB, COX-2 in HaCaT. The present findings suggest that MEJR exhibit photoprotective effects and hence it may be useful for the treatment of inflammation related

  3. Autophagy participates in isoliquiritigenin-induced melanin degradation in human epidermal keratinocytes through PI3K/AKT/mTOR signaling.

    Science.gov (United States)

    Yang, Zhibo; Zeng, Biyun; Pan, Yi; Huang, Pan; Wang, Chang

    2018-01-01

    Melanin is the pigment responsible for the color of human skin and hair. Melanin serves as a double-edge sword which can exert both protective and spot-causing effects on skin. Although melanin has an important role in protecting the skin against UV damage, an excessive or uneven melanin production can lead to the formation of freckles and age spots. Isoliquiritigenin (ISL) has been reported to inhibit melanin synthesis; however, its role in melanin degradation remains unclear. In the present study, we evaluated the detailed function of ISL in melanin degradation in human epidermal keratinocytes. Since autophagy has been reported to be related to melanin degradation, we also examined the activation of autophagy by ISL treatment in keratinocytes by measurement of autophagy-related proteins, ATG7, LC3 and p62. Moreover, si-ATG7-induced ATG7 knockdown and autophagy inhibitor 3-MA decreased LC3 II protein levels and increased PMEL17, p62 and melanin levels in HaCaT cells, which could be partially reversed by ISL treatment, indicating that autophagy participated in melanin degradation. The decreased p-AKT and p-mTOR proteins upon ISL treatment indicated the involvement of PI3K/AKT/mTOR signaling in ISL-induced melanin degradation. Taken together, we demonstrated that autophagy participates in ISL-induced melanin degradation in human epidermal keratinocytes through PI3K/AKT/mTOR signaling. Copyright © 2017. Published by Elsevier Masson SAS.

  4. Melanin Transfer in Human 3D Skin Equivalents Generated Exclusively from Induced Pluripotent Stem Cells.

    Science.gov (United States)

    Gledhill, Karl; Guo, Zongyou; Umegaki-Arao, Noriko; Higgins, Claire A; Itoh, Munenari; Christiano, Angela M

    2015-01-01

    The current utility of 3D skin equivalents is limited by the fact that existing models fail to recapitulate the cellular complexity of human skin. They often contain few cell types and no appendages, in part because many cells found in the skin are difficult to isolate from intact tissue and cannot be expanded in culture. Induced pluripotent stem cells (iPSCs) present an avenue by which we can overcome this issue due to their ability to be differentiated into multiple cell types in the body and their unlimited growth potential. We previously reported generation of the first human 3D skin equivalents from iPSC-derived fibroblasts and iPSC-derived keratinocytes, demonstrating that iPSCs can provide a foundation for modeling a complex human organ such as skin. Here, we have increased the complexity of this model by including additional iPSC-derived melanocytes. Epidermal melanocytes, which are largely responsible for skin pigmentation, represent the second most numerous cell type found in normal human epidermis and as such represent a logical next addition. We report efficient melanin production from iPSC-derived melanocytes and transfer within an entirely iPSC-derived epidermal-melanin unit and generation of the first functional human 3D skin equivalents made from iPSC-derived fibroblasts, keratinocytes and melanocytes.

  5. Melanin Transfer in Human 3D Skin Equivalents Generated Exclusively from Induced Pluripotent Stem Cells.

    Directory of Open Access Journals (Sweden)

    Karl Gledhill

    Full Text Available The current utility of 3D skin equivalents is limited by the fact that existing models fail to recapitulate the cellular complexity of human skin. They often contain few cell types and no appendages, in part because many cells found in the skin are difficult to isolate from intact tissue and cannot be expanded in culture. Induced pluripotent stem cells (iPSCs present an avenue by which we can overcome this issue due to their ability to be differentiated into multiple cell types in the body and their unlimited growth potential. We previously reported generation of the first human 3D skin equivalents from iPSC-derived fibroblasts and iPSC-derived keratinocytes, demonstrating that iPSCs can provide a foundation for modeling a complex human organ such as skin. Here, we have increased the complexity of this model by including additional iPSC-derived melanocytes. Epidermal melanocytes, which are largely responsible for skin pigmentation, represent the second most numerous cell type found in normal human epidermis and as such represent a logical next addition. We report efficient melanin production from iPSC-derived melanocytes and transfer within an entirely iPSC-derived epidermal-melanin unit and generation of the first functional human 3D skin equivalents made from iPSC-derived fibroblasts, keratinocytes and melanocytes.

  6. Human Adipose Mesenchymal Cells Inhibit Melanocyte Differentiation and the Pigmentation of Human Skin via Increased Expression of TGF-β1.

    Science.gov (United States)

    Klar, Agnes S; Biedermann, Thomas; Michalak, Katarzyna; Michalczyk, Teresa; Meuli-Simmen, Claudia; Scherberich, Arnaud; Meuli, Martin; Reichmann, Ernst

    2017-12-01

    There is accumulating evidence that interactions between epidermal melanocytes and stromal cells play an important role in the regulation of skin pigmentation. In this study we established a pigmented dermo-epidermal skin model, melDESS, of human origin to investigate the effects of distinct stromal cells on melanogenesis. melDESS is a complex, clinically relevant skin equivalent composed of an epidermis containing both melanocytes and keratinocytes. Its dermal compartment consists either of adipose tissue-derived stromal cells, dermal fibroblasts (Fbs), or a mixture of both cell types. These skin substitutes were transplanted for 5 weeks on the backs of immuno-incompetent rats and analyzed. Gene expression and Western blot analyses showed a significantly higher expression of transforming growth factor-β1 by adipose tissue-derived stromal cells compared with dermal Fbs. In addition, we showed that melanocytes responded to the increased levels of transforming growth factor-β1 by down-regulating the expression of key melanogenic enzymes such as tyrosinase. This caused decreased melanin synthesis and, consequently, greatly reduced pigmentation of melDESS. The conclusions are of utmost clinical relevance, namely that adipose tissue-derived stromal cells derived from the hypodermis fail to appropriately interact with epidermal melanocytes, thus preventing the sustainable restoration of the patient's native skin color in bioengineered skin grafts. Copyright © 2017 The Authors. Published by Elsevier Inc. All rights reserved.

  7. Effect of glucocorticoids and gamma radiation on epidermal Langerhans cells

    International Nuclear Information System (INIS)

    Belsito, D.V.; Baer, R.L.; Thorbecke, G.J.; Gigli, I.

    1984-01-01

    The effect of 750 rads of gamma radiation on the rate of return of epidermal Langerhans cells (LC) following suppressive doses of topical glucorticoids was studied in guinea pigs. Gamma radiation alone had no effect on the LC as assessed by staining for cell membrane ATPase activity and Ia antigen. It did, however, delay the expected return of Ia but not ATPase surface markers on the LC after perturbation with glucocorticoids. The delayed return of surface Ia antigen is possibly related to a radiation-induced defect in the production of a required lymphokine and/or in intracellular Ia transport. Although our data do not rule out a cytolytic effect of steroids on the LC, they do strongly suggest that, at least in part, glucocorticoids act on the LC by altering cell surface characteristics

  8. Expression of PML tumor suppressor in A 431 cells reduces cellular growth by inhibiting the epidermal growth factor receptor expression

    International Nuclear Information System (INIS)

    Vallian, S.; Chang, K.S.

    2004-01-01

    Our previous studies showed that the promyelocytic leukemia, PML, protein functions as a cellular and growth suppressor. Transient expression of PML was also found to repress the activity of the epidermal growth factor receptor gene promoter. In this study we have examined the effects of PML on A431 cells, which express a high level of + protein. The PML gene was introduced into the cells using the adenovirus-mediated gene transfer system. Western blot analysis on the extracts from the cells expressing PML showed a significant repression in the expression of the epidermal growth factor receptor protein. The cells were examined for growth and DNA synthesis. The data showed a marked reduction in both growth and DNA synthesis rate in the cells expressing PML compared with the control cells. Furthermore, in comparison with the controls, the cells expressing PML were found to be more in G1 phase, fewer in S and about the same number in the G2/M phase. This data clearly demonstrated that the repression of epidermal growth factor receptor expression in A 431 cells by PML was associated with inhibition of cell growth and alteration of the cell cycle distribution, suggesting a novel mechanism for the known growth inhibitory effects of PML

  9. Faster DNA Repair of Ultraviolet-Induced Cyclobutane Pyrimidine Dimers and Lower Sensitivity to Apoptosis in Human Corneal Epithelial Cells than in Epidermal Keratinocytes.

    Directory of Open Access Journals (Sweden)

    Justin D Mallet

    Full Text Available Absorption of UV rays by DNA generates the formation of mutagenic cyclobutane pyrimidine dimers (CPD and pyrimidine (6-4 pyrimidone photoproducts (6-4PP. These damages are the major cause of skin cancer because in turn, they can lead to signature UV mutations. The eye is exposed to UV light, but the cornea is orders of magnitude less prone to UV-induced cancer. In an attempt to shed light on this paradox, we compared cells of the corneal epithelium and the epidermis for UVB-induced DNA damage frequency, repair and cell death sensitivity. We found similar CPD levels but a 4-time faster UVB-induced CPD, but not 6-4PP, repair and lower UV-induced apoptosis sensitivity in corneal epithelial cells than epidermal. We then investigated levels of DDB2, a UV-induced DNA damage recognition protein mostly impacting CPD repair, XPC, essential for the repair of both CPD and 6-4PP and p53 a protein upstream of the genotoxic stress response. We found more DDB2, XPC and p53 in corneal epithelial cells than in epidermal cells. According to our results analyzing the protein stability of DDB2 and XPC, the higher level of DDB2 and XPC in corneal epithelial cells is most likely due to an increased stability of the protein. Taken together, our results show that corneal epithelial cells have a better efficiency to repair UV-induced mutagenic CPD. On the other hand, they are less prone to UV-induced apoptosis, which could be related to the fact that since the repair is more efficient in the HCEC, the need to eliminate highly damaged cells by apoptosis is reduced.

  10. Novel targeted approaches to treating biliary tract cancer: the dual epidermal growth factor receptor and ErbB-2 tyrosine kinase inhibitor NVP-AEE788 is more efficient than the epidermal growth factor receptor inhibitors gefitinib and erlotinib.

    Science.gov (United States)

    Wiedmann, Marcus; Feisthammel, Jürgen; Blüthner, Thilo; Tannapfel, Andrea; Kamenz, Thomas; Kluge, Annett; Mössner, Joachim; Caca, Karel

    2006-08-01

    Aberrant activation of the epidermal growth factor receptor is frequently observed in neoplasia, notably in tumors of epithelial origin. Attempts to treat such tumors with epidermal growth factor receptor antagonists resulted in remarkable success in recent studies. Little is known, however, about the efficacy of this therapy in biliary tract cancer. Protein expression of epidermal growth factor receptor, ErbB-2, and vascular endothelial growth factor receptor-2 was assessed in seven human biliary tract cancer cell lines by immunoblotting. In addition, histological sections from 19 patients with extrahepatic cholangiocarcinoma were analyzed for epidermal growth factor receptor, ErbB-2 and vascular endothelial growth factor receptor-2 expression by immunohistochemistry. Moreover, we sequenced the cDNA products representing the entire epidermal growth factor receptor coding region of the seven cell lines, and searched for genomic epidermal growth factor receptor amplifications and polysomy by fluorescence in-situ hybridization. Cell growth inhibition by gefitinib erlotinib and NVP-AEE788 was studied in vitro by automated cell counting. In addition, the anti-tumoral effect of erlotinib and NVP-AEE788 was studied in a chimeric mouse model. The anti-tumoral drug mechanism in this model was assessed by MIB-1 antibody staining, terminal deoxynucleotidyl transfer-mediated dUTP nick end-labelling assay, von Willebrand factor staining, and immunoblotting for p-p42/44 (p-Erk1/2, p-MAPK) and p-AKT. Immunoblotting revealed expression of epidermal growth factor receptor, ErbB-2, and vascular endothelial growth factor receptor-2 in all biliary tract cancer cell lines. EGFR was detectable in six of 19 (32%) extrahepatic human cholangiocarcinoma tissue samples, ErbB-2 in 16 of 19 (84%), and vascular endothelial growth factor receptor-2 in nine of 19 (47%). Neither epidermal growth factor receptor mutations nor amplifications or polysomy were found in the seven biliary tract cancer

  11. Foliar Epidermal Studies of Plants in Euphorbiaceae

    Directory of Open Access Journals (Sweden)

    H. A. Thakur

    2014-03-01

    Full Text Available This paper describes foliar epidermal structure in 17 species belonging to 17 genera of the family Euphoprbiaceae. Anomocytic stomata is predominant, rarely they are anisocytic, paracytic on the same foliar surface with different combinations. Leaves are hypostomatic and rarely amphistomatic. The foliar surface is smooth, rarely striated. The foliar epidermal cell walls are straight or undulate. Distribution of stomata, stomatal index, stomatal frequency, stomatal size and other cell wall contours are described in detail.

  12. Pattern of distribution of blood group antigens on human epidermal cells during maturation

    DEFF Research Database (Denmark)

    Dabelsteen, Erik; Buschard, Karsten; Hakomori, Sen-Itiroh

    1984-01-01

    The distribution in human epidermis of A, B, and H blood group antigens and of a precursor carbohydrate chain, N-acetyl-lactosamine, was examined using immunofluorescence staining techniques. The material included tissue from 10 blood group A, 4 blood group B, and 9 blood group O persons. Murine...... on the lower spinous cells whereas H antigen was seen predominantly on upper spinous cells or on the granular cells. Epithelia from blood group A or B persons demonstrated A or B antigens, respectively, but only if the tissue sections were trypsinized before staining. In such cases A or B antigens were found...... monoclonal antibodies were used to identify H antigen (type 2 chain) and N-acetyl-lactosamine. Human antisera were used to identify A and B antigens. In all groups N-acetyl-lactosamine and H antigen were found on the cell membranes of the spinous cell layer. N-acetyl-lactosamine was present mainly...

  13. Punicalagin and (-)-Epigallocatechin-3-Gallate Rescue Cell Viability and Attenuate Inflammatory Responses of Human Epidermal Keratinocytes Exposed to Airborne Particulate Matter PM10.

    Science.gov (United States)

    Seok, Jin Kyung; Lee, Jeong-Won; Kim, Young Mi; Boo, Yong Chool

    2018-01-01

    Airborne particulate matter with a diameter of < 10 µm (PM10) causes oxidative damage, inflammation, and premature skin aging. In this study, we evaluated whether polyphenolic antioxidants attenuate the inflammatory responses of PM10-exposed keratinocytes. Primary human epidermal keratinocytes were exposed in vitro to PM10 in the absence or presence of punicalagin and (-)-epigallocatechin-3-gallate (EGCG), which are the major polyphenolic antioxidants found in pomegranate and green tea, respectively. Assays were performed to determine cell viability, production of reactive oxygen species (ROS), and expression of NADPH oxidases (NOX), proinflammatory cytokines, and matrix metalloproteinase (MMP)-1. PM10 decreased cell viability and increased ROS production in a dose-dependent manner. It also increased the expression levels of NOX-1, NOX-2, tumor necrosis factor-α (TNF-α), interleukin (IL)-1β, IL-6, IL-8, and MMP-1. Punicalagin was not cytotoxic up to 300 μM, and (-)-EGCG was cytotoxic above 30 μM, respectively. Further, punicalagin (3-30 μM) and EGCG (3-10 μM) rescued the viability of PM10-exposed cells. They also attenuated ROS production and the expression of NOX-1, NOX-2, TNF-α, IL-1β, IL-6, IL-8, and MMP-1 stimulated by PM10. This study demonstrates that polyphenolic antioxidants, such as punicalagin and (-)-EGCG, rescue keratinocyte viability and attenuate the inflammatory responses of these cells due to airborne particles. © 2018 S. Karger AG, Basel.

  14. Stimulation of allogeneic lymphocytes by skin epidermal cells in the rat

    International Nuclear Information System (INIS)

    Tanaka, S.; Sakai, A.

    1979-01-01

    The ability of skin epidermal cells to induce allogeneic lymphocytes into proliferation was examined in mixed skin cell-lymphocyte culture reaction (MSLR). The stimulatng capacity of skin cells was reduced significantly by trypsin digestion, although the damage was repaired by incubation at 37 C for 3 hr. The optimal concentration of mitomycin C for treatment of stimulating cells in the MSLR differed from that in mixed lymphocyte culture reaction (MLR). Irradiation rendered them three to four times more stimulatory than did mitomycin C. Removal of adherent cells from responding cells by passage through a nylon-wool column gave a substantial elevation of the MSLR. The lymphocytes cocultured with skin cells in the primary MSLR incorporated 3 H-thymidine, with the peak at the 6th day of culture. If the lymphocytes primed in the MSLR were restimulated with skin cells from the same stimulating strain, the primed lymphocytes responded promptly and in great magnitude

  15. Combined inhibition of EMMPRIN and epidermal growth factor receptor prevents the growth and migration of head and neck squamous cell carcinoma cells.

    Science.gov (United States)

    Suzuki, Shinsuke; Ishikawa, Kazuo

    2014-03-01

    It has been reported that the epidermal growth factor receptor (EGFR) expression is associated with the extracellular matrix metalloproteinase inducer (EMMPRIN) in some solid tumors; however, the relationship of EMMPRIN with EGFR in head and neck cancers is not fully understood. To determine the relationship between EMMPRIN and EGFR in head and neck squamous cell carcinoma (HNSCC), HNSCC cells were stimulated with epidermal growth factor (EGF), a ligand of EGFR. EMMPRIN expression in HNSCC cells was upregulated by EGF. In addition, EGF stimulation induced HNSCC cell invasion and MMP-9 expression. This increase in invasion and MMP-9 expression was abrogated by downmodulation of EMMPRIN. Furthermore, to determine the effects of combined EMMPRIN and EGFR targeting in HNSCC, HNSCC cells were treated with an EMMPRIN function-blocking antibody and the EGFR inhibitor AG1478. This combined treatment resulted in greater inhibition of HNSCC cell proliferation and migration compared with the individual agents alone. These results suggest that EMMPRIN mediates EGFR-induced tumorigenicity and that combined targeting of EMMPRIN and EGFR may be an efficacious treatment approach.

  16. Pigment Production Analysis in Human Melanoma Cells.

    Science.gov (United States)

    Hopkin, Amelia Soto; Paterson, Elyse K; Ruiz, Rolando; Ganesan, Anand K

    2016-05-25

    The human epidermal melanocyte is a highly specialized pigmented cell that serves to protect the epidermis from ultraviolet (UV) damage through the production of melanin, or melanogenesis. Misregulation in melanogenesis leading to either hyper- or hypo-pigmentation is found in human diseases such as malasma and vitiligo. Current therapies for these diseases are largely unsuccessful and the need for new therapies is necessary. In order to identify genes and or compounds that can alter melanogenesis, methods are required that can detect changes in pigment production as well as expression of key melanogenesis transcription factors and enzymes. Here we describe methods to detect changes in melanogenesis in a human melanoma cell line, MNT-1, by (1) analyzing pigment production by measuring the absorbance of melanin present by spectrophotometry, (2) analyzing transcript expression of potent regulators of melanogenesis by qunatitative reverse-transcription (RT)PCR and (3) analyzing protein expression of potent regulators of melanogenesis by Western blot (WB).

  17. Triggering Apoptotic Death of Human Epidermal Keratinocytes by Malic Acid: Involvement of Endoplasmic Reticulum Stress- and Mitochondria-Dependent Signaling Pathways

    Directory of Open Access Journals (Sweden)

    Yu-Ping Hsiao

    2015-01-01

    Full Text Available Malic acid (MA has been commonly used in cosmetic products, but the safety reports in skin are sparse. To investigate the biological effects of MA in human skin keratinocytes, we investigated the potential cytotoxicity and apoptotic effects of MA in human keratinocyte cell lines (HaCaT. The data showed that MA induced apoptosis based on the observations of DAPI staining, DNA fragmentation, and sub-G1 phase in HaCaT cells and normal human epidermal keratinocytes (NHEKs. Flow cytometric assays also showed that MA increased the production of mitochondrial superoxide (mito-SOX but decreased the mitochondrial membrane potential. Analysis of bioenergetics function with the XF 24 analyzer Seahorse extracellular flux analyzer demonstrated that oxygen consumption rate (OCR was significantly decreased whereas extracellular acidification rate (ECAR was increased in MA-treated keratinocytes. The occurrence of apoptosis was proved by the increased expressions of FasL, Fas, Bax, Bid, caspases-3, -8, -9, cytochrome c, and the declined expressions of Bcl-2, PARP. MA also induced endoplasmic reticulum stress associated protein expression such as GRP78, GADD153, and ATF6α. We demonstrated that MA had anti-proliferative effect in HaCaT cell through the inhibition of cell cycle progression at G0/G1, and the induction of programmed cell death through endoplasmic reticulum stress- and mitochondria-dependent pathways.

  18. An Epidermal Biosensor for Carcinoembryonic Antigen

    National Research Council Canada - National Science Library

    Schwartz, Pauline

    2001-01-01

    ...). An epidermal biosensor is a new approach for the early continuous, in vivo detection of the onset of disease by the using genetically modified skin cells to respond to molecules secreted by tumor cells...

  19. Shavenbaby couples patterning to epidermal cell shape control.

    Directory of Open Access Journals (Sweden)

    Hélène Chanut-Delalande

    2006-09-01

    Full Text Available It is well established that developmental programs act during embryogenesis to determine animal morphogenesis. How these developmental cues produce specific cell shape during morphogenesis, however, has remained elusive. We addressed this question by studying the morphological differentiation of the Drosophila epidermis, governed by a well-known circuit of regulators leading to a stereotyped pattern of smooth cells and cells forming actin-rich extensions (trichomes. It was shown that the transcription factor Shavenbaby plays a pivotal role in the formation of trichomes and underlies all examined cases of the evolutionary diversification of their pattern. To gain insight into the mechanisms of morphological differentiation, we sought to identify shavenbaby's downstream targets. We show here that Shavenbaby controls epidermal cell shape, through the transcriptional activation of different classes of cellular effectors, directly contributing to the organization of actin filaments, regulation of the extracellular matrix, and modification of the cuticle. Individual inactivation of shavenbaby's targets produces distinct trichome defects and only their simultaneous inactivation prevent trichome formation. Our data show that shavenbaby governs an evolutionarily conserved developmental module consisting of a set of genes collectively responsible for trichome formation, shedding new light on molecular mechanisms acting during morphogenesis and the way they can influence evolution of animal forms.

  20. Modulation of Regorafenib effects on HCC cell lines by epidermal growth factor.

    Science.gov (United States)

    D'Alessandro, Rosalba; Refolo, Maria Grazia; Lippolis, Catia; Carella, Nicola; Messa, Caterina; Cavallini, Aldo; Carr, Brian Irving

    2015-06-01

    Blood platelet numbers are correlated to growth and aggressiveness of several tumor types, including hepatocellular carcinoma (HCC). We previously found that platelet lysates (hPLs) also stimulated growth and migration, and antagonized the growth-inhibitory and apoptotic effects of both Sorafenib and Regorafenib, two multikinase inhibitors, on three HCC cell lines. In this study, in vitro function of human epidermal growth factor (EGF) with and without Sorafenib or Regorafenib was investigated. An ELISA kit was used to evaluate the EGF concentrations in hPLs. In vitro function of EGF was assessed with proliferation MTT test. Apoptosis assay, scratch assays, and Transwell assays were performed for apoptosis, invasion, and migration, respectively. MAPK Activation Kit was used to explore MAPK phosphorylation. EGF antagonized the growth inhibition of Regorafenib on three HCC cell lines. Regorafenib-mediated growth inhibition was blocked by 70 % when the cells were pre-treated with EGF. EGF also blocked Regorafenib-induced apoptosis, as well as Regorafenib-induced decreases in cell migration and invasion. The EGF effects were in turn antagonized by concomitant addition to the cultures of EGF receptor antagonist Erlotinib, showing that the EGF receptor was involved in the mechanisms of EGF-mediated blocking of Regorafenib effects. Erlotinib also partially blocked the effects of hPLs in antagonizing Regorafenib-mediated growth inhibition, showing that EGF was an important component of hPL actions. All these results show that EGF antagonized Regorafenib-mediated growth and migration inhibition and apoptosis induction in HCC cells and reinforce the idea that microenvironment can influence cancer drug actions.

  1. Changes in epidermal growth factor receptor expression during chemotherapy in non-small cell lung cancer

    DEFF Research Database (Denmark)

    Jakobsen, Jan Nyrop; Santoni-Rugiu, Eric; Sørensen, Jens Benn

    2014-01-01

    BACKGROUND: Antibodies targeting epidermal growth factor receptor (EGFR), such as cetuximab, may potentially improve outcome in non-small cell lung cancer (NSCLC) patients with high EGFR expression. The EGFR expression may be heterogeneously distributed within tumors, and small biopsies may thus...

  2. A comprehensive two-dimensional gel protein database of noncultured unfractionated normal human epidermal keratinocytes: towards an integrated approach to the study of cell proliferation, differentiation and skin diseases

    DEFF Research Database (Denmark)

    Celis, J E; Madsen, Peder; Rasmussen, H H

    1991-01-01

    A two-dimensional (2-D) gel database of cellular proteins from noncultured, unfractionated normal human epidermal keratinocytes has been established. A total of 2651 [35S]methionine-labeled cellular proteins (1868 isoelectric focusing, 783 nonequilibrium pH gradient electrophoresis) were resolved...

  3. Cultivation and irradiation of human fibroblasts in a medium enriched with platelet lysate for obtaining feeder layer in epidermal cell culture; Cultivo e irradiacao de fibroblastos humanos em meio enriquecido com lisado de plaquetas para obtencao de camada de sustentacao em culturas de celulas da epiderme

    Energy Technology Data Exchange (ETDEWEB)

    Yoshito, Daniele

    2011-07-01

    For over 30 years, the use of culture medium, enriched with bovine serum, and murines fibroblasts, with the rate of proliferation controlled by irradiation or by share anticarcinogenic drugs, has been playing successfully its role in assisting in the development of keratinocytes in culture, for clinical purposes. However, currently there is a growing concern about the possibility of transmitting prions and animals viruses to transplanted patients. Taking into account this concern, the present work aims to cultivate human fibroblasts in a medium enriched with human platelets lysate and determine the irradiation dose of these cells, for obtaining feeder layer in epidermal cell culture. For carrying out the proposed objective, platelets lysis has standardized, this lysate was used for human fibroblasts cultivation and the irradiation dose enough to inhibit its duplication was evaluated. Human keratinocytes were cultivated in these feeder layers, in culture medium enriched with the lysate. With these results we conclude that the 10% platelets lysate promoted a better adhesion and proliferation of human fibroblasts and in all dose levels tested (60 to 300 Gy), these had their mitotic activity inactivated by ionizing irradiation, being that the feeder layers obtained with doses from 70 to 150 Gy were those that provided the best development of keratinocytes in medium containing 2.5% of human platelet lysate. Therefore, it was possible to standardize both the cultivation of human fibroblasts as its inactivation for use as feeder layer in culture of keratinocytes, so as to eliminate xenobiotics components. (author)

  4. Rapid and dynamic subcellular reorganization following mechanical stimulation of Arabidopsis epidermal cells mimics responses to fungal and oomycete attack

    Directory of Open Access Journals (Sweden)

    Takemoto Daigo

    2008-06-01

    Full Text Available Abstract Background Plant cells respond to the presence of potential fungal or oomycete pathogens by mounting a basal defence response that involves aggregation of cytoplasm, reorganization of cytoskeletal, endomembrane and other cell components and development of cell wall appositions beneath the infection site. This response is induced by non-adapted, avirulent and virulent pathogens alike, and in the majority of cases achieves penetration resistance against the microorganism on the plant surface. To explore the nature of signals that trigger this subcellular response and to determine the timing of its induction, we have monitored the reorganization of GFP-tagged actin, microtubules, endoplasmic reticulum (ER and peroxisomes in Arabidopsis plants – after touching the epidermal surface with a microneedle. Results Within 3 to 5 minutes of touching the surface of Arabidopsis cotyledon epidermal cells with fine glass or tungsten needles, actin microfilaments, ER and peroxisomes began to accumulate beneath the point of contact with the needle. Formation of a dense patch of actin was followed by focusing of actin cables on the site of contact. Touching the cell surface induced localized depolymerization of microtubules to form a microtubule-depleted zone surrounding a dense patch of GFP-tubulin beneath the needle tip. The concentration of actin, GFP-tubulin, ER and peroxisomes remained focused on the contact site as the needle moved across the cell surface and quickly dispersed when the needle was removed. Conclusion Our results show that plant cells can detect the gentle pressure of a microneedle on the epidermal cell surface and respond by reorganizing subcellular components in a manner similar to that induced during attack by potential fungal or oomycete pathogens. The results of our study indicate that during plant-pathogen interactions, the basal defence response may be induced by the plant's perception of the physical force exerted by the

  5. Biodistribution of 99mTc-labeled anti-human epidermal growth factor receptor (EGF-R) humanized monoclonal antibody h-R3 in a xenograft model of human lung adenocarcinoma

    International Nuclear Information System (INIS)

    Morales-Morales, Alejo; Duconge, Jorge; Caballero-Torres, Idania; Nunez-Gandolff, Gilda; Fernandez, Eduardo; Iznaga-Escobar, Normando

    1999-01-01

    The anti-human epidermal growth factor receptor (EGF-R) humanized monoclonal antibody (MAb) h-R3 is an (IgG 1 ), which binds to an extracellular domain of EGF-R. It was used to evaluate the biodistribution on nude mice xenografted with H-125 human lung adenocarcinoma cell line. Results were compared with its murine version of the MAb ior-egf/r3. Twenty-one athymic female 4NMRI nu/nu mice were injected intraperitoneally with 10 μg/100 μCi of 99m Tc-labeled MAbs. Immunoreactivity of 99m Tc-labeled MAbs were measured by enzyme-linked immunosorbent assay (ELISA) on H-125 cell line and the immunoreactive fractions was determined by the Lindmo method. Among all organs, significant accumulation was found in serum (27.05 ± 2.08 %ID/g) and tumor (3.903 ± 0.89 %ID/g) at 4 h after injection. These values decreased to 5.03 ± 0.50 %ID/g and 2.19 ± 0.56 %ID/g for serum and tumor, respectively. The immunoreactive fraction was found to be 0.70, with a correlation coefficient r=0.9984. With the good biodistribution and tumor uptake of the 99m Tc-labeled humanized antibody h-R3, a phase I diagnostic clinical trial of tumor with epithelial origin should be pursued

  6. Toxic epidermal necrolysis successfully treated with etanercept.

    Science.gov (United States)

    Gubinelli, Emanuela; Canzona, Flora; Tonanzi, Tiziano; Raskovic, Desanka; Didona, Biagio

    2009-03-01

    Toxic epidermal necrolysis (TEN) is a rare and acute severe adverse reaction to drugs, characterised by massive apoptosis and widespread epidermal and mucosal detachment. Although no gold standard therapy exists, human i.v. immunoglobulins have recently been described as an effective treatment for this disease. We report a case of phenobarbital-induced TEN in a 59-year-old white woman where the epidermal detachment stopped 48 h after beginning the etanercept treatment with complete healing after 20 days. To the best of our knowledge, this is only the second reported case of TEN successfully treated with etanercept.

  7. An Epidermal Biosensor for Carcinoembryonic Antigen

    National Research Council Canada - National Science Library

    Schwartz, Pauline

    2003-01-01

    ...) An epidermal biosensor was conceived as a new approach for the early continuous, in vivo detection of the onset of disease by the using genetically modified skin cells to respond to molecules secreted by tumor cells...

  8. The cell-penetrating peptide domain from human heparin-binding epidermal growth factor-like growth factor (HB-EGF) has anti-inflammatory activity in vitro and in vivo

    International Nuclear Information System (INIS)

    Lee, Jue-Yeon; Seo, Yoo-Na; Park, Hyun-Jung; Park, Yoon-Jeong; Chung, Chong-Pyoung

    2012-01-01

    Highlights: ► HBP sequence identified from HB-EGF has cell penetration activity. ► HBP inhibits the NF-κB dependent inflammatory responses. ► HBP directly blocks phosphorylation and degradation of IκBα. ► HBP inhibits nuclear translocation of NF-κB p65 subunit. -- Abstract: A heparin-binding peptide (HBP) sequence from human heparin-binding epidermal growth factor-like growth factor (HB-EGF) was identified and was shown to exhibit cell penetration activity. This cell penetration induced an anti-inflammatory reaction in lipopolysaccharide (LPS)-treated RAW 264.7 macrophages. HBP penetrated the cell membrane during the 10 min treatment and reduced the LPS-induced production of nitric oxide (NO), inducible nitric oxide synthase (iNOS), and cytokines (TNF-α and IL-6) in a concentration-dependent manner. Additionally, HBP inhibited the LPS-induced upregulation of cytokines, including TNF-α and IL-6, and decreased the interstitial infiltration of polymorphonuclear leukocytes in a lung inflammation model. HBP inhibited NF-κB-dependent inflammatory responses by directly blocking the phosphorylation and degradation of IκBα and by subsequently inhibiting the nuclear translocation of the p65 subunit of NF-κB. Taken together, this novel HBP may be potentially useful candidate for anti-inflammatory treatments and can be combined with other drugs of interest to transport attached molecules into cells.

  9. Skin mucus of Cyprinus carpio inhibits cyprinid herpesvirus 3 binding to epidermal cells

    Directory of Open Access Journals (Sweden)

    Raj Victor

    2011-08-01

    Full Text Available Abstract Cyprinid herpesvirus 3 (CyHV-3 is the aetiological agent of a mortal and highly contagious disease in common and koi carp. The skin is the major portal of entry of CyHV-3 in carp after immersion in water containing the virus. In the present study, we used in vivo bioluminescence imaging to investigate the effect of skin mucus removal and skin epidermis lesion on CyHV-3 entry. Physical treatments inducing removal of the mucus up to complete erosion of the epidermis were applied on a defined area of carp skin just before inoculation by immersion in infectious water. CyHV-3 entry in carp was drastically enhanced on the area of the skin where the mucus was removed with or without associated epidermal lesion. To investigate whether skin mucus inhibits CyHV-3 binding to epidermal cells, tail fins with an intact mucus layer or without mucus were inoculated ex vivo. While electron microscopy examination revealed numerous viral particles bound on the fins inoculated after mucus removal, no particle could be detected after infection of mucus-covered fins. Finally, anti-CyHV-3 neutralising activity of mucus extract was tested in vitro. Incubation of CyHV-3 with mucus extract reduced its infectivity in a dose dependent manner. The present study demonstrates that skin mucus removal and epidermal lesions enhance CyHV-3 entry in carp. It highlights the role of fish skin mucus as an innate immune protection against viral epidermal entry.

  10. Skin mucus of Cyprinus carpio inhibits cyprinid herpesvirus 3 binding to epidermal cells

    Science.gov (United States)

    2011-01-01

    Cyprinid herpesvirus 3 (CyHV-3) is the aetiological agent of a mortal and highly contagious disease in common and koi carp. The skin is the major portal of entry of CyHV-3 in carp after immersion in water containing the virus. In the present study, we used in vivo bioluminescence imaging to investigate the effect of skin mucus removal and skin epidermis lesion on CyHV-3 entry. Physical treatments inducing removal of the mucus up to complete erosion of the epidermis were applied on a defined area of carp skin just before inoculation by immersion in infectious water. CyHV-3 entry in carp was drastically enhanced on the area of the skin where the mucus was removed with or without associated epidermal lesion. To investigate whether skin mucus inhibits CyHV-3 binding to epidermal cells, tail fins with an intact mucus layer or without mucus were inoculated ex vivo. While electron microscopy examination revealed numerous viral particles bound on the fins inoculated after mucus removal, no particle could be detected after infection of mucus-covered fins. Finally, anti-CyHV-3 neutralising activity of mucus extract was tested in vitro. Incubation of CyHV-3 with mucus extract reduced its infectivity in a dose dependent manner. The present study demonstrates that skin mucus removal and epidermal lesions enhance CyHV-3 entry in carp. It highlights the role of fish skin mucus as an innate immune protection against viral epidermal entry. PMID:21816061

  11. Epidermal growth factor receptor expression in urinary bladder cancer

    Directory of Open Access Journals (Sweden)

    Dayalu S.L. Naik

    2011-01-01

    Full Text Available Objective : To evaluate the expression pattern of epidermal growth factor receptor (EGFR in urinary bladder cancer and its association with human epidermal growth factor receptor 2 (HER2, epidermal growth factor (EGF, interleukin-6 (IL-6, and high risk human papilloma virus (HPV types 16 and 18. Materials and Methods : Thirty cases of urothelial carcinoma were analyzed. EGFR, HER2, EGF, and IL-6 expressions in the tissue were evaluated by immunohistochemical staining. For HPV, DNA from tissue samples was extracted and detection of HPV was done by PCR technique. Furthermore, evaluation of different intracellular molecules associated with EGFR signaling pathways was performed by the western blot method using lysates from various cells and tissues. Results : In this study, the frequencies of immunopositivity for EGFR, HER2, EGF, and IL-6 were 23%, 60%, 47%, and 80%, respectively. No cases were positive for HPV-18, whereas HPV-16 was detected in 10% cases. Overall, expression of EGFR did not show any statistically significant association with the studied parameters. However, among male patients, a significant association was found only between EGFR and HER2. Conclusions : Overexpression of EGFR and/or HER2, two important members of the same family of growth factor receptors, was observed in a considerable proportion of cases. Precise knowledge in this subject would be helpful to formulate a rational treatment strategy in patients with urinary bladder cancer.

  12. Protein profiling of single epidermal cell types from Arabidopsis thaliana using surface-enhanced laser desorption and ionization technology.

    Science.gov (United States)

    Ebert, Berit; Melle, Christian; Lieckfeldt, Elke; Zöller, Daniela; von Eggeling, Ferdinand; Fisahn, Joachim

    2008-08-25

    Here, we describe a novel approach for investigating differential protein expression within three epidermal cell types. In particular, 3000 single pavement, basal, and trichome cells from leaves of Arabidopsis thaliana were harvested by glass micro-capillaries. Subsequently, these single cell samples were joined to form pools of 100 individual cells and analyzed using the ProteinChip technology; SELDI: surface-enhanced laser desorption and ionization. As a result, numerous protein signals that were differentially expressed in the three epidermal cell types could be detected. One of these proteins was characterized by tryptical digestion and subsequent identification via tandem quadrupole-time of flight (Q-TOF) mass spectrometry. Down regulation of this sequenced small subunit precursor of ribulose-1,5 bisphosphate carboxylase(C) oxygenase(O) (RuBisCo) in trichome and basal cells indicates the sink status of these cell types that are located on the surface of A. thaliana source leaves. Based on the obtained protein profiles, we suggest a close functional relationship between basal and trichome cells at the protein level.

  13. Arctigenin induced gallbladder cancer senescence through modulating epidermal growth factor receptor pathway.

    Science.gov (United States)

    Zhang, Mingdi; Cai, Shizhong; Zuo, Bin; Gong, Wei; Tang, Zhaohui; Zhou, Di; Weng, Mingzhe; Qin, Yiyu; Wang, Shouhua; Liu, Jun; Ma, Fei; Quan, Zhiwei

    2017-05-01

    Gallbladder cancer has poor prognosis and limited therapeutic options. Arctigenin, a representative dibenzylbutyrolactone lignan, occurs in a variety of plants. However, the molecular mechanisms involved in the antitumor effect of arctigenin on gallbladder cancer have not been fully elucidated. The expression levels of epidermal growth factor receptor were examined in 100 matched pairs of gallbladder cancer tissues. A positive correlation between high epidermal growth factor receptor expression levels and poor prognosis was observed in gallbladder cancer tissues. Pharmacological inhibition or inhibition via RNA interference of epidermal growth factor receptor induced cellular senescence in gallbladder cancer cells. The antitumor effect of arctigenin on gallbladder cancer cells was primarily achieved by inducing cellular senescence. In gallbladder cancer cells treated with arctigenin, the expression level of epidermal growth factor receptor significantly decreased. The analysis of the activity of the kinases downstream of epidermal growth factor receptor revealed that the RAF-MEK-ERK signaling pathway was significantly inhibited. Furthermore, the cellular senescence induced by arctigenin could be reverted by pcDNA-epidermal growth factor receptor. Arctigenin also potently inhibited the growth of tumor xenografts, which was accompanied by the downregulation of epidermal growth factor receptor and induction of senescence. This study demonstrates arctigenin could induce cellular senescence in gallbladder cancer through the modulation of epidermal growth factor receptor pathway. These data identify epidermal growth factor receptor as a key regulator in arctigenin-induced gallbladder cancer senescence.

  14. Topical grape seed proanthocyandin extract reduces sunburn cells and mutant p53 positive epidermal cell formation, and prevents depletion of Langerhans cells in an acute sunburn model.

    Science.gov (United States)

    Yuan, Xiao-Ying; Liu, Wei; Hao, Jian-Chun; Gu, Wei-Jie; Zhao, Yan-Shuang

    2012-01-01

    The purpose of this study was to investigate whether grape seed proanthocyanidin extract (GSPE) can provide photoprotection against ultraviolet (UV) irradiation. Study has shown that GSPE is a natural oxidant, and is used in many fields such as ischemia-reperfusion injury, chronic pancreatitis, and even cancer. However, the effect of GSPE on UV irradiation is as yet unknown. Cutaneous areas on the backs of normal volunteers were untreated or treated with GSPE solutions or vehicles 30 min before exposure to two minimal erythema doses (MED) of solar simulated radiation. Cutaneous areas at different sites were examined histologically for the number of sunburn cells, or immunohistochemically for Langerhans cells and mutant p53 epidermal cells. On histological and immunohistochemical examination, skin treated with GSPE before UV radiation showed fewer sunburn cells and mutant p53-positive epidermal cells and more Langerhans cells compared with skin treated with 2-MED UV radiation only (p<0.001, p<0.001, and p<0.01, respectively). GSPE may be a possible preventive agent for photoprotection.

  15. Epidermal wound repair is regulated by the planar cell polarity signaling pathway.

    Science.gov (United States)

    Caddy, Jacinta; Wilanowski, Tomasz; Darido, Charbel; Dworkin, Sebastian; Ting, Stephen B; Zhao, Quan; Rank, Gerhard; Auden, Alana; Srivastava, Seema; Papenfuss, Tony A; Murdoch, Jennifer N; Humbert, Patrick O; Parekh, Vishwas; Boulos, Nidal; Weber, Thomas; Zuo, Jian; Cunningham, John M; Jane, Stephen M

    2010-07-20

    The mammalian PCP pathway regulates diverse developmental processes requiring coordinated cellular movement, including neural tube closure and cochlear stereociliary orientation. Here, we show that epidermal wound repair is regulated by PCP signaling. Mice carrying mutant alleles of PCP genes Vangl2, Celsr1, PTK7, and Scrb1, and the transcription factor Grhl3, interact genetically, exhibiting failed wound healing, neural tube defects, and disordered cochlear polarity. Using phylogenetic analysis, ChIP, and gene expression in Grhl3(-)(/-) mice, we identified RhoGEF19, a homolog of a RhoA activator involved in PCP signaling in Xenopus, as a direct target of GRHL3. Knockdown of Grhl3 or RhoGEF19 in keratinocytes induced defects in actin polymerization, cellular polarity, and wound healing, and re-expression of RhoGEF19 rescued these defects in Grhl3-kd cells. These results define a role for Grhl3 in PCP signaling and broadly implicate this pathway in epidermal repair. (c) 2010 Elsevier Inc. All rights reserved.

  16. Secreted Frizzled related protein-4 (sFRP4) promotes epidermal differentiation and apoptosis

    International Nuclear Information System (INIS)

    Maganga, Richard; Giles, Natalie; Adcroft, Katharine; Unni, Ambili; Keeney, Diane; Wood, Fiona; Fear, Mark; Dharmarajan, Arunasalam

    2008-01-01

    The skin provides vital protection from infection and dehydration. Maintenance of the skin is through a constant program of proliferation, differentiation and apoptosis of epidermal cells, whereby proliferating cells in the basal layer differentiating to form the keratinized, anucleated stratum corneum. The WNT signalling pathway is known to be important in the skin. WNT signalling has been shown to be important both in epidermal development and in the maintenance and cycling of hair follicles and epidermal stem cells. However, the precise role for this pathway in epidermal differentiation remains unknown. We investigated the role of the WNT signalling inhibitor sFRP4 in epidermal differentiation. sFRP4 is expressed in both normal skin and keratinocytes in culture. Expression of sFRP4 mRNA and protein increases with keratinocyte differentiation and apoptosis, whilst exposure of keratinocytes to exogenous sFRP4 promotes apoptosis and expression of the terminal differentiation marker Involucrin. These data suggest sFRP4 promotes epidermal differentiation.

  17. Selective Killing Effects of Cold Atmospheric Pressure Plasma with NO Induced Dysfunction of Epidermal Growth Factor Receptor in Oral Squamous Cell Carcinoma.

    Directory of Open Access Journals (Sweden)

    Jung-Hwan Lee

    Full Text Available The aim of this study is to investigate the effects of cold atmospheric pressure plasma (CAP-induced radicals on the epidermal growth factor receptor (EGFR, which is overexpressed by oral squamous cell carcinoma, to determine the underlying mechanism of selective killing. CAP-induced highly reactive radicals were observed in both plasma plume and cell culture media. The selective killing effect was observed in oral squamous cell carcinoma compared with normal human gingival fibroblast. Degradation and dysfunction of EGFRs were observed only in the EGFR-overexpressing oral squamous cell carcinoma and not in the normal cell. Nitric oxide scavenger pretreatment in cell culture media before CAP treatment rescued above degradation and dysfunction of the EGFR as well as the killing effect in oral squamous cell carcinoma. CAP may be a promising cancer treatment method by inducing EGFR dysfunction in EGFR-overexpressing oral squamous cell carcinoma via nitric oxide radicals.

  18. Selective Killing Effects of Cold Atmospheric Pressure Plasma with NO Induced Dysfunction of Epidermal Growth Factor Receptor in Oral Squamous Cell Carcinoma.

    Science.gov (United States)

    Lee, Jung-Hwan; Om, Ji-Yeon; Kim, Yong-Hee; Kim, Kwang-Mahn; Choi, Eun-Ha; Kim, Kyoung-Nam

    2016-01-01

    The aim of this study is to investigate the effects of cold atmospheric pressure plasma (CAP)-induced radicals on the epidermal growth factor receptor (EGFR), which is overexpressed by oral squamous cell carcinoma, to determine the underlying mechanism of selective killing. CAP-induced highly reactive radicals were observed in both plasma plume and cell culture media. The selective killing effect was observed in oral squamous cell carcinoma compared with normal human gingival fibroblast. Degradation and dysfunction of EGFRs were observed only in the EGFR-overexpressing oral squamous cell carcinoma and not in the normal cell. Nitric oxide scavenger pretreatment in cell culture media before CAP treatment rescued above degradation and dysfunction of the EGFR as well as the killing effect in oral squamous cell carcinoma. CAP may be a promising cancer treatment method by inducing EGFR dysfunction in EGFR-overexpressing oral squamous cell carcinoma via nitric oxide radicals.

  19. Bone scan and red blood cell scan in a patient with epidermal naevus syndrome

    International Nuclear Information System (INIS)

    Becker, W.; Wolf, F.; Stosiek, N.; Peters, K.P.

    1990-01-01

    A bone scan and red blood cell scan in the rare epidermal naevus syndrome, associated with multiple haemangiomes of the bone and hypophosphataemic osteomalacia in a 20-year-old man are reported. The typical pattern of osteomalacia on the bone scan was associated with lesions of increased bone metabolism in the peripheral bones. The haemangiomas did not pool labelled red blood cells. Thus, the bone scan seems to be suited for diagnosing the complete extent of haemangiomas in bone, but they could not be specifically proven by red blood cell pooling. (orig.)

  20. Biodistribution of {sup 99m}Tc-labeled anti-human epidermal growth factor receptor (EGF-R) humanized monoclonal antibody h-R3 in a xenograft model of human lung adenocarcinoma

    Energy Technology Data Exchange (ETDEWEB)

    Morales-Morales, Alejo; Duconge, Jorge; Caballero-Torres, Idania; Nunez-Gandolff, Gilda; Fernandez, Eduardo; Iznaga-Escobar, Normando E-mail: normando@ict.cim.sld.cu

    1999-04-01

    The anti-human epidermal growth factor receptor (EGF-R) humanized monoclonal antibody (MAb) h-R3 is an (IgG{sub 1}), which binds to an extracellular domain of EGF-R. It was used to evaluate the biodistribution on nude mice xenografted with H-125 human lung adenocarcinoma cell line. Results were compared with its murine version of the MAb ior-egf/r3. Twenty-one athymic female 4NMRI nu/nu mice were injected intraperitoneally with 10 {mu}g/100 {mu}Ci of {sup 99m}Tc-labeled MAbs. Immunoreactivity of {sup 99m}Tc-labeled MAbs were measured by enzyme-linked immunosorbent assay (ELISA) on H-125 cell line and the immunoreactive fractions was determined by the Lindmo method. Among all organs, significant accumulation was found in serum (27.05 {+-} 2.08 %ID/g) and tumor (3.903 {+-} 0.89 %ID/g) at 4 h after injection. These values decreased to 5.03 {+-} 0.50 %ID/g and 2.19 {+-} 0.56 %ID/g for serum and tumor, respectively. The immunoreactive fraction was found to be 0.70, with a correlation coefficient r=0.9984. With the good biodistribution and tumor uptake of the {sup 99m}Tc-labeled humanized antibody h-R3, a phase I diagnostic clinical trial of tumor with epithelial origin should be pursued.

  1. Suppression of the epidermal growth factor receptor inhibits epithelial-mesenchymal transition in human pancreatic cancer PANC-1 cells.

    Science.gov (United States)

    Chang, Zhi-Gang; Wei, Jun-Min; Qin, Chang-Fu; Hao, Kun; Tian, Xiao-Dong; Xie, Kun; Xie, Xue-Hai; Yang, Yin-Mo

    2012-05-01

    Aberrant expression of epidermal growth factor receptor (EGFR) has been detected in pancreatic cancer; however, the mechanisms of EGFR in inducing pancreatic cancer development have not been adequately elucidated. The objective of this study was to determine the role of EGFR in mediating epithelial-mesenchymal transition (EMT) in pancreatic cancer cells. Pancreatic cancer cell line PANC-1 was transfected with small interfering RNA of EGFR by use of a lentiviral expression vector to establish an EGFR-knockdown cell line (si-PANC-1). PANC-1 cells transfected with lentiviral vector expressing negative control sequence were used as negative control (NC-PANC-1). Scratch assay and transwell study were used to analyze cell migration and invasion. Real-time PCR and Western blotting were used to detect the expression of EMT markers E-cadherin, N-cadherin, vimentin, and fibronectin and transcription factors snail, slug, twist1, and sip1 in PANC-1, NC-PANC-1, and si-PANC-1 cells. Immunofluorescent staining with these antibodies and confocal microscopy were used to observe their cellular location and morphologic changes. After RNA interference of EGFR, the migration and invasion ability of si-PANC-1 cells decreased significantly. The expression of epithelial phenotype marker E-cadherin increased and the expression of mesenchymal phenotype markers N-cadherin, vimentin, and fibronectin decreased, indicating reversion of EMT. We also observed intracellular translocation of E-cadherin. Expression of transcription factors snail and slug in si-PANC-1 cells decreased significantly. Suppression of EGFR expression can significantly inhibit EMT of pancreatic cancer PANC-1 cells. The mechanism may be related with the down-regulation of the expression of transcription factors snail and slug.

  2. Immunoreactive transforming growth factor alpha and epidermal growth factor in oral squamous cell carcinomas

    DEFF Research Database (Denmark)

    Therkildsen, M H; Poulsen, Steen Seier; Bretlau, P

    1993-01-01

    Forty oral squamous cell carcinomas have been investigated immunohistochemically for the presence of transforming growth factor alpha (TGF-alpha) and epidermal growth factor (EGF). The same cases were recently characterized for the expression of EGF-receptors. TGF-alpha was detected...... previous results confirms the existence of TGF-alpha, EGF, and EGF-receptors in the majority of oral squamous cell carcinomas and their metastases......., the cells above the basal cell layer were positive for both TGF-alpha and EGF. The same staining pattern was observed in oral mucosa obtained from healthy persons. In moderately to well differentiated carcinomas, the immunoreactivity was mainly confined to the cytologically more differentiated cells, thus...

  3. Eosinophil peroxidase signals via epidermal growth factor-2 to induce cell proliferation.

    LENUS (Irish Health Repository)

    Walsh, Marie-Therese

    2011-11-01

    Eosinophils exert many of their inflammatory effects in allergic disorders through the degranulation and release of intracellular mediators, including a set of cationic granule proteins that include eosinophil peroxidase. Studies suggest that eosinophils are involved in remodeling. In previous studies, we showed that eosinophil granule proteins activate mitogen-activated protein kinase signaling. In this study, we investigated the receptor mediating eosinophil peroxidase-induced signaling and downstream effects. Human cholinergic neuroblastoma IMR32 and murine melanoma B16.F10 cultures, real-time polymerase chain reaction, immunoprecipitations, and Western blotting were used in the study. We showed that eosinophil peroxidase caused a sustained increase in both the expression of epidermal growth factor-2 (HER2) and its phosphorylation at tyrosine 1248, with the consequent activation of extracellular-regulated kinase 1\\/2. This, in turn, promoted a focal adhesion kinase-dependent egress of the cyclin-dependent kinase inhibitor p27(kip) from the nucleus to the cytoplasm. Eosinophil peroxidase induced a HER2-dependent up-regulation of cell proliferation, indicated by an up-regulation of the nuclear proliferation marker Ki67. This study identifies HER2 as a novel mediator of eosinophil peroxidase signaling. The results show that eosinophil peroxidase, at noncytotoxic levels, can drive cell-cycle progression and proliferation, and contribute to tissue remodeling and cell turnover in airway disease. Because eosinophils are a feature of many cancers, these findings also suggest a role for eosinophils in tumorigenesis.

  4. Human epidermal growth factor receptor 2/neu overexpression in urothelial carcinoma of the bladder and its prognostic significance: Is it worth hype?

    Directory of Open Access Journals (Sweden)

    Santosh Kumar

    2015-01-01

    Full Text Available Aims: In urothelial tumors of the urinary bladder, human epidermal growth factor receptor 2 (HER-2/neu expression has been reported over 10 years, but there is no clear correlation between prognosis and recurrence rate. The present study evaluates prognostic implication of HER-2/neu expression. Subjects and Methods: In this study, 100 formalin-fixed paraffin-embedded specimens of primary transitional cell carcinoma of the bladder were processed. HER-2/neu monoclonal antibody immunohistochemistry staining procedure used for the study. Results: A total of 70 (70% patients were positive for overexpression of HER-2/neu. HER-2/neu was positive in patients with 42 (70% superficial tumor, 28 (70% muscle invasive tumor, 41 (75.9% high-grade tumor, 29 (63% low grade tumor, 31 (68.9% recurrent tumor, and 6 (66.6% had positive lymph nodes. Conclusions: Human epidermal growth factor receptor 2/neu over expression was not correlated with the tumor stage, lymphnode metastasis or recurrence of the disease. HER-2/neu overexpression was statistically insignificantly correlated with the differentiation grade (P < 0.161 as compared to previous studies. Future studies on HER-2 expression with chemo-sensitivity and efficacy of HER-2-targeted therapies in urothelial carcinomas is needed.

  5. Suppressors for Human Epidermal Growth Factor Receptor 2/4 (HER2/4): A New Family of Anti-Toxoplasmic Agents in ARPE-19 Cells.

    Science.gov (United States)

    Kim, Yeong Hoon; Bhatt, Lokraj; Ahn, Hye-Jin; Yang, Zhaoshou; Lee, Won-Kyu; Nam, Ho-Woo

    2017-10-01

    The effects of tyrosine kinase inhibitors (TKIs) were evaluated on growth inhibition of intracellular Toxoplasma gondii in host ARPE-19 cells. The number of tachyzoites per parasitophorous vacuolar membrane (PVM) was counted after treatment with TKIs. T. gondii protein expression was assessed by western blot. Immunofluorescence assay was performed using Programmed Cell Death 4 (PDCD4) and T. gondii GRA3 antibodies. The TKIs were divided into 3 groups; non-epidermal growth factor receptor (non-EGFR), anti-human EGFR 2 (anti-HER2), and anti-HER2/4 TKIs, respectively. Group I TKIs (nintedanib, AZD9291, and sunitinib) were unable to inhibit proliferation without destroying host cells. Group II TKIs (lapatinib, gefitinib, erlotinib, and AG1478) inhibited proliferation up to 98% equivalent to control pyrimethamine (5 μM) at 20 μM and higher, without affecting host cells. Group III TKIs (neratinib, dacomitinib, afatinib, and pelitinib) inhibited proliferation up to 98% equivalent to pyrimethamine at 1-5 μM, but host cells were destroyed at 10-20 μM. In Group I, TgHSP90 and SAG1 inhibitions were weak, and GRA3 expression was moderately inhibited. In Group II, TgHSP90 and SAG1 expressions seemed to be slightly enhanced, while GRA3 showed none to mild inhibition; however, AG1478 inhibited all proteins moderately. Protein expression was blocked in Group III, comparable to pyrimethamine. PDCD4 and GRA3 were well localized inside the nuclei in Group I, mildly disrupted in Group II, and were completely disrupted in Group III. This study suggests the possibility of a vital T. gondii TK having potential HER2/4 properties, thus anti-HER2/4 TKIs may inhibit intracellular parasite proliferation with minimal adverse effects on host cells.

  6. Effects of recombinant human epidermal growth factor on the proliferation and radiation survival of human fibroblast cell lines in vitro

    International Nuclear Information System (INIS)

    Kim, Hyun Sook; Kang, Ki Mun; Na, Jae Boem; Chai, Gyu Young; Lee, Sang Wook

    2006-01-01

    To explore the effect of recombinant human EGF on the proliferation and survival of human fibroblast cell lines following irradiation. Fibroblast was originated human skin and primary cultured. The trypan blue stain assay and MTT assay were used to study the proliferative effects of EGF on human fibroblast cell lines in vitro. An incubation of fibroblasts with rhEGF for 24 hours immediately after irradiation was counted everyday. Cell cycle distributions were analyzed by FACS analysis. Number of fibroblast was significant more increased rhEGF (1.0 nM, 10 nM, 100 nM, 1,000 nM) treated cell than control after 8 Gy irradiation. Most effective dose of rhEGF was at 160 nM. These survival differences were maintained at 1 week later. Proportion of S phase was significantly increased on rhEGF treated cells. rhEGF cause increased fibroblast proliferation following irradiation. We expect that rhEGF was effective for radiation induced wound healing

  7. Suppression of the Epidermal Growth Factor-like Domain 7 and Inhibition of Migration and Epithelial-Mesenchymal Transition in Human Pancreatic Cancer PANC-1 Cells.

    Science.gov (United States)

    Wang, Yun-Liang; Dong, Feng-Lin; Yang, Jian; Li, Zhi; Zhi, Qiao-Ming; Zhao, Xin; Yang, Yong; Li, De-Chun; Shen, Xiao-Chun; Zhou, Jin

    2015-01-01

    Epidermal growth factor-like domain multiple 7 (EGFL7), a secreted protein specifically expressed by endothelial cells during embryogenesis, recently was identified as a critical gene in tumor metastasis. Epithelial-mesenchymal transition (EMT) was found to be closely related with tumor progression. Accordingly, it is important to investigate the migration and EMT change after knock-down of EGFL7 gene expression in human pancreatic cancer cells. EGFL7 expression was firstly testified in 4 pancreatic cancer cell lines by real-time polymerase chain reaction (Real-time PCR) and western blot, and the highest expression of EGFL7 was found in PANC-1 cell line. Then, PANC-1 cells transfected with small interference RNA (siRNA) of EGFL7 using plasmid vector were named si-PANC-1, while transfected with negative control plasmid vector were called NC-PANC-1. Transwell assay was used to analyze the migration of PANC-1 cells. Real-time PCR and western blotting were used to detect the expression change of EGFL7 gene, EMT markers like E-Cadherin, N-Cadherin, Vimentin, Fibronectin and transcription factors like snail, slug in PANC-1, NC- PANC-1, and si-PANC-1 cells, respectively. After successful plasmid transfection, EGFL7 gene were dramatically knock-down by RNA interference in si-PANC-1 group. Meanwhile, migration ability decreased significantly, compared with PANC-1 and NC-PANC-1 group. Meanwhile, the expression of epithelial phenotype marker E-Cadherin increased and that of mesenchymal phenotype markers N-Cadherin, Vimentin, Fibronectin dramatically decreased in si-PANC-1 group, indicating a reversion of EMT. Also, transcription factors snail and slug decreased significantly after RNA interference. Current study suggested that highly-expressed EGFL7 promotes migration of PANC-1 cells and acts through transcription factors snail and slug to induce EMT, and further study is needed to confirm this issue.

  8. Despite the presence of UVB-induced DNA damage, HLA-DR+ cells from ex vivo UVB-exposed human skin are able to migrate and show no impaired allostimulatory capacity

    NARCIS (Netherlands)

    Kremer, I. B.; Sylva-Steenland, R. M.; Bos, J. D.; Teunissen, M. B.

    1997-01-01

    In this study, we investigated the effect of ultraviolet B radiation on human Langerhans cell function. Normal human skin was irradiated ex vivo with single doses of ultraviolet B. For assessment of T-cell stimulatory function, cells that spontaneously migrated from epidermal sheets were used,

  9. 99m Tc-anti-epidermal growth factor receptor nanobody for tumor imaging.

    Science.gov (United States)

    Piramoon, Majid; Hosseinimehr, Seyed Jalal; Omidfar, Kobra; Noaparast, Zohreh; Abedi, Seyed Mohammad

    2017-04-01

    Nanobodies are important biomolecules for tumor targeting. In this study, we synthesized and labeled anti-epidermal growth factor receptor (EGFR) nanobody OA-cb6 with 99m Tc(CO) 3 + and evaluated its characteristics for targeting the EGFR in the A431 human epidermal carcinoma cell line. Nanobody radiolabeling was achieved with high yield and radiochemical purity, and the radioconjugate was stable. Biodistribution results in nude mice exhibited a favorable tumor-to-muscle ratio at 4-hr postinjection, and tumor location was visualized at 4 hr after injection of radiolabeled nanobody. Our result showed that the OA-cb6- 99m Tc-tricarbonyl radiolabeled nanobody is a promising radiolabeled biomolecule for tumor imaging in cancers with high EGFR overexpression. © 2016 John Wiley & Sons A/S.

  10. Human papilloma virus DNAs immortalize normal human mammary epithelial cells and reduce their growth factor requirements

    International Nuclear Information System (INIS)

    Band, V.; Zajchowski, D.; Kulesa, V.; Sager, R.

    1990-01-01

    Human papilloma virus (HPV) types 16 and 18 are most commonly associated with cervical carcinoma in patients and induce immortalization of human keratinocytes in culture. HPV has not been associated with breast cancer. This report describes the immortalization of normal human mammary epithelial cells (76N) by plasmid pHPV18 or pHPV16, each containing the linearized viral genome. Transfectants were grown continuously for more than 60 passages, whereas 76N cells senesce after 18-20 passages. The transfectants also differ from 76N cells in cloning in a completely defined medium called D2 and growing a minimally supplemented defined medium (D3) containing epidermal growth factor. All transfectant tested contain integrated HPV DNA, express HPV RNA, and produce HPV E7 protein. HPV transfectants do not form tumors in a nude mouse assay. It is concluded that products of the HPV genome induce immortalization of human breast epithelial cells and reduce their growth factor requirements. This result raises the possibility that HPV might be involved in breast cancer. Furthermore, other tissue-specific primary epithelial cells that are presently difficult to grown and investigate may also be immortalized by HPV

  11. Inhibition of epidermal cell proliferation by borderline rays

    Energy Technology Data Exchange (ETDEWEB)

    Born, W [Freiburg Univ.; Daikeler, G

    1976-08-01

    Treatment of guinea pig flanks with very soft x-rays (borderline rays) directly caused a partial block of epidermal DNA synthesis which had been determined by measuring the /sup 3/H-Tdr incorporation. Higher doses and repeated applications would undoubtedly cause lasting damage to the tissue. The enhanced epidermal DNA synthesis which is sometimes observed should not be misinterpreted as a sign of a directly biopositive utilisation of the quantum energy supplied. Rather, it is a secondary repair process following initial phases of depression. A reparative increase in DNA synthesis may also occur as a primary process if the radiation is almost completely absorbed above the germinative layer.

  12. Circulating chromatin-anti-chromatin antibody complexes bind with high affinity to dermo-epidermal structures in murine and human lupus nephritis

    DEFF Research Database (Denmark)

    Fismen, S; Hedberg, A; Fenton, K A

    2009-01-01

    Murine and human lupus nephritis are characterized by glomerular deposits of electron-dense structures (EDS). Dominant components of EDS are chromatin fragments and IgG antibodies. Whether glomerular EDS predispose for similar deposits in skin is unknown. We analysed (i) whether dermo-epidermal i......Murine and human lupus nephritis are characterized by glomerular deposits of electron-dense structures (EDS). Dominant components of EDS are chromatin fragments and IgG antibodies. Whether glomerular EDS predispose for similar deposits in skin is unknown. We analysed (i) whether dermo......-epidermal immune complex deposits have similar molecular composition as glomerular deposits, (ii) whether chromatin fragments bind dermo-epidermal structures, and (iii) whether deposits in nephritic glomeruli predispose for accumulation of similar deposits in skin. Paired skin and kidney biopsies from nephritic...... (NZBxNZW)F1 and MRL-lpr/lpr mice and from five patients with lupus nephritis were analysed by immunofluorescence, immune electron microscopy (IEM) and co-localization TUNEL IEM. Affinity of chromatin fragments for membrane structures was determined by surface plasmon resonance. Results demonstrated (i...

  13. Pharmacologic induction of epidermal melanin and protection against sunburn in a humanized mouse model.

    Science.gov (United States)

    Amaro-Ortiz, Alexandra; Vanover, Jillian C; Scott, Timothy L; D'Orazio, John A

    2013-09-07

    Fairness of skin, UV sensitivity and skin cancer risk all correlate with the physiologic function of the melanocortin 1 receptor, a Gs-coupled signaling protein found on the surface of melanocytes. Mc1r stimulates adenylyl cyclase and cAMP production which, in turn, up-regulates melanocytic production of melanin in the skin. In order to study the mechanisms by which Mc1r signaling protects the skin against UV injury, this study relies on a mouse model with "humanized skin" based on epidermal expression of stem cell factor (Scf). K14-Scf transgenic mice retain melanocytes in the epidermis and therefore have the ability to deposit melanin in the epidermis. In this animal model, wild type Mc1r status results in robust deposition of black eumelanin pigment and a UV-protected phenotype. In contrast, K14-Scf animals with defective Mc1r signaling ability exhibit a red/blonde pigmentation, very little eumelanin in the skin and a UV-sensitive phenotype. Reasoning that eumelanin deposition might be enhanced by topical agents that mimic Mc1r signaling, we found that direct application of forskolin extract to the skin of Mc1r-defective fair-skinned mice resulted in robust eumelanin induction and UV protection (1). Here we describe the method for preparing and applying a forskolin-containing natural root extract to K14-Scf fair-skinned mice and report a method for measuring UV sensitivity by determining minimal erythematous dose (MED). Using this animal model, it is possible to study how epidermal cAMP induction and melanization of the skin affect physiologic responses to UV exposure.

  14. Epidermal growth factor-mediated effects on equine vascular smooth muscle cells

    International Nuclear Information System (INIS)

    Grosenbaugh, D.A.; Amoss, M.S.; Hood, D.M.; Morgan, S.J.; Williams, J.D.

    1988-01-01

    Epidermal growth factor (EGF) receptor binding kinetics and EGF-mediated stimulation of DNA synthesis and cellular proliferation were studied in cultured vascular smooth muscle cells (VSMC) from the equine thoracic aorta. Binding studies, using murine 125 I-labeled EGF, indicate the presence of a single class of high-affinity binding sites, with an estimated maximal binding capacity of 5,800 sites/cells. EGF stimulated [ 3 H]thymidine uptake in confluent quiescent monolayers in a dose-dependent fashion, half-maximal stimulation occurring at 7.5 x 10 -11 M. Likewise, EGF-mediated cellular proliferation was dose dependent under reduced serum concentrations. Equine VSMC contain specific receptors for EGF, and EGF can stimulate DNA synthesis and proliferation in these cultured cells, which suggests that EGF may participate in the proliferative changes observed in equine distal digital peripheral vascular disease

  15. Yorkie regulates epidermal wound healing in Drosophila larvae independently of cell proliferation and apoptosis.

    Science.gov (United States)

    Tsai, Chang-Ru; Anderson, Aimee E; Burra, Sirisha; Jo, Juyeon; Galko, Michael J

    2017-07-01

    Yorkie (Yki), the transcriptional co-activator of the Hippo signaling pathway, has well-characterized roles in balancing apoptosis and cell division during organ growth control. Yki is also required in diverse tissue regenerative contexts. In most cases this requirement reflects its well-characterized roles in balancing apoptosis and cell division. Whether Yki has repair functions outside of the control of cell proliferation, death, and growth is not clear. Here we show that Yki and Scalloped (Sd) are required for epidermal wound closure in the Drosophila larval epidermis. Using a GFP-tagged Yki transgene we show that Yki transiently translocates to some epidermal nuclei upon wounding. Genetic analysis strongly suggests that Yki interacts with the known wound healing pathway, Jun N-terminal kinase (JNK), but not with Platelet Derived Growth Factor/Vascular-Endothelial Growth Factor receptor (Pvr). Yki likely acts downstream of or parallel to JNK signaling and does not appear to regulate either proliferation or apoptosis in the larval epidermis during wound repair. Analysis of actin structures after wounding suggests that Yki and Sd promote wound closure through actin regulation. In sum, we found that Yki regulates an epithelial tissue repair process independently of its previously documented roles in balancing proliferation and apoptosis. Copyright © 2017 Elsevier Inc. All rights reserved.

  16. Long-wave ultraviolet light induces phospholipase activation in cultured human epidermal keratinocytes

    International Nuclear Information System (INIS)

    Hanson, D.; DeLeo, V.

    1990-01-01

    Long wave ultraviolet radiation (UVA) has been shown to play an important role in the overall response of skin to solar radiation, including sunburn, tanning, premature aging, and non-melanoma skin cancer. UVA induction of inflammation in human skin is thought to be mediated by membrane lipid derived products. In order to investigate the mechanism of this response we examined the effect of UVA on phospholipid metabolism of human epidermal keratinocytes in culture. Keratinocytes were grown in serum free low calcium medium. The cells were prelabeled with [3H] arachidonic acid or [3H] choline and irradiated with UVA (Honle 2002-Hg vapor lamp). Identification and quantitation of specific membrane phospholipid-derived components was achieved using high-performance liquid chromatography, paper chromatography, and radioimmunoassay. UVA resulted in a linear dose dependent release of [3H] arachidonic acid into medium between 1 and 20 joule/cm2. This response was inhibited in an oxygen-reduced environment. The radiolabel released was predominantly free arachidonate and cyclooxygenase metabolites. Cyclooxygenase metabolites prostaglandin E2 and prostacyclin derivative, 6-keto-prostaglandin F1a, were stimulated following UVA irradiation, but the lipoxygenase metabolite, leukotriene B was not detected. Maximal release was measured immediately after irradiation and changed little over 24 h post-irradiation. UVA stimulated an increase of [3H] choline metabolites glycerophosphorylcholine and phosphorylcholine in media extracts suggesting UVA activation of phospholipase C and phospholipase A2 or diacylglyceride lipase

  17. Induction of tolerance to topically applied INCB using TNP-conjugated ultraviolet light-irradiated epidermal cells

    International Nuclear Information System (INIS)

    Sauder, D.N.; Tamaki, K.; Moshell, A.N.; Fujiwara, H.; Katz, S.I.

    1981-01-01

    Ultraviolet (uv) radiation has profound effects on the immune system both in vitro and in vivo. Recent studies, utilizing uv irradiation of intact animals, have focused on the suppressive effect of uv irradiation on the generation of allergic contact sensitization (ACS). To explore the mechanism(s) by which uv affects ACS, we used a recently described technique of sensitizing mice with the subcutaneous (s.c.) injection of haptenated epidermal cells. uv-treated or untreated mouse epidermal cells (EC) were conjugated with 1 mM trinitrobenzene sulfonate and injected s.c. into syngeneic recipients. Six days later the ear was challenged with 20 μl of 1% trinitrochlorobenzene (TNCB), and 24 h later ear thickness was measured. Our studies indicate that uv irradiation of EC prior to haptenation not only abrogates their capability of inducing ACS but also induces a state of specific immunologic tolerance. These studies indicate that the s.c. injection of trinitrophenyl conjugated (TNP) uv-irradiated (TNP-uv) EC induces a state of specific immunologic hyporesponsiveness, and passive transfer studies showed that this hyporesponsiveness is in part due to the generation of suppressor T-cells

  18. Epidermal CYP2 family cytochromes P450

    International Nuclear Information System (INIS)

    Du Liping; Hoffman, Susan M.G.; Keeney, Diane S.

    2004-01-01

    Skin is the largest and most accessible drug-metabolizing organ. In mammals, it is the competent barrier that protects against exposure to harmful stimuli in the environment and in the systemic circulation. Skin expresses many cytochromes P450 that have critical roles in exogenous and endogenous substrate metabolism. Here, we review evidence for epidermal expression of genes from the large CYP2 gene family, many of which are expressed preferentially in extrahepatic tissues or specifically in epithelia at the environmental interface. At least 13 CYP2 genes (CYP2A6, 2A7, 2B6, 2C9, 2C18, 2C19, 2D6, 2E1, 2J2, 2R1, 2S1, 2U1, and 2W1) are expressed in skin from at least some human individuals, and the majority of these genes are expressed in epidermis or cultured keratinocytes. Where epidermal expression has been localized in situ by hybridization or immunocytochemistry, CYP2 transcripts and proteins are most often expressed in differentiated keratinocytes comprising the outer (suprabasal) cell layers of the epidermis and skin appendages. The tissue-specific transcriptional regulation of CYP2 genes in the epidermis, and in other epithelia that interface with the environment, suggests important roles for at least some CYP2 gene products in the production and disposition of molecules affecting competency of the epidermal barrier

  19. Keratinocyte-derived IL-24 plays a role in the positive feedback regulation of epidermal inflammation in response to environmental and endogenous toxic stressors

    International Nuclear Information System (INIS)

    Jin, Sun Hee; Choi, Dalwoong; Chun, Young-Jin; Noh, Minsoo

    2014-01-01

    Keratinocytes are the major cellular components of human epidermis and play a key role in the modulating cutaneous inflammation and toxic responses. In human chronic skin diseases, the common skin inflammatory phenotypes like skin barrier disruption and epidermal hyperplasia are manifested in epidermal keratinocytes by interactions with T helper (Th) cells. To find a common gene expression signature of human keratinocytes in chronic skin diseases, we performed a whole genome microarray analysis on normal human epidermal keratinocytes (NHKs) treated with IFNγ, IL-4, IL-17A or IL-22, major cytokines from Th1, Th2, Th17 or Th22 cells, respectively. The microarray results showed that the four genes, IL-24, PDZK1IP1, H19 and filaggrin, had common expression profiles in NHKs exposed to Th cell cytokines. In addition, the acute phase pro-inflammatory cytokines, IL-1β, IL-6 and TNFα, also change the gene transcriptional profile of IL-24, PDZK1IP1, H19, and filaggrin in NHKs as those of Th cytokines. Therefore, the signature gene set, consisting of IL-24, PDZK1IP1, H19, and filaggrin, provides essential insights for understanding the process of cutaneous inflammation and toxic responses. We demonstrate that environmental toxic stressors, such as chemical irritants and ultraviolet irradiation stimulate the production of IL-24 in NHKs. IL-24 stimulates the JAK1-STAT3 and MAPK pathways in NHKs, and promotes the secretion of pro-inflammatory mediators IL-8, PGE2, and MMP-1. These results suggest that keratinocyte-derived IL-24 participates in the positive feedback regulation of epidermal inflammation in response to both endogenous and environmental toxic stressors. - Highlights: • Cutaneous inflammatory gene signature consists of PDZK1IP1, IL-24, H19 and filaggrin. • Pro-inflammatory cytokines increase IL-24 production in human keratinocytes. • Environmental toxic stressors increase IL-24 production in human keratinocytes. • IL-24 stimulates human keratinocytes to

  20. Keratinocyte-derived IL-24 plays a role in the positive feedback regulation of epidermal inflammation in response to environmental and endogenous toxic stressors

    Energy Technology Data Exchange (ETDEWEB)

    Jin, Sun Hee [Natural Products Research Institute, College of Pharmacy, Seoul National University, Seoul 151-742 (Korea, Republic of); Choi, Dalwoong [Department of Public Health Science, Korea University, Seoul 136-701 (Korea, Republic of); Chun, Young-Jin [College of Pharmacy, Chung-Ang University, Seoul 156-756 (Korea, Republic of); Noh, Minsoo, E-mail: minsoo@alum.mit.edu [Natural Products Research Institute, College of Pharmacy, Seoul National University, Seoul 151-742 (Korea, Republic of)

    2014-10-15

    Keratinocytes are the major cellular components of human epidermis and play a key role in the modulating cutaneous inflammation and toxic responses. In human chronic skin diseases, the common skin inflammatory phenotypes like skin barrier disruption and epidermal hyperplasia are manifested in epidermal keratinocytes by interactions with T helper (Th) cells. To find a common gene expression signature of human keratinocytes in chronic skin diseases, we performed a whole genome microarray analysis on normal human epidermal keratinocytes (NHKs) treated with IFNγ, IL-4, IL-17A or IL-22, major cytokines from Th1, Th2, Th17 or Th22 cells, respectively. The microarray results showed that the four genes, IL-24, PDZK1IP1, H19 and filaggrin, had common expression profiles in NHKs exposed to Th cell cytokines. In addition, the acute phase pro-inflammatory cytokines, IL-1β, IL-6 and TNFα, also change the gene transcriptional profile of IL-24, PDZK1IP1, H19, and filaggrin in NHKs as those of Th cytokines. Therefore, the signature gene set, consisting of IL-24, PDZK1IP1, H19, and filaggrin, provides essential insights for understanding the process of cutaneous inflammation and toxic responses. We demonstrate that environmental toxic stressors, such as chemical irritants and ultraviolet irradiation stimulate the production of IL-24 in NHKs. IL-24 stimulates the JAK1-STAT3 and MAPK pathways in NHKs, and promotes the secretion of pro-inflammatory mediators IL-8, PGE2, and MMP-1. These results suggest that keratinocyte-derived IL-24 participates in the positive feedback regulation of epidermal inflammation in response to both endogenous and environmental toxic stressors. - Highlights: • Cutaneous inflammatory gene signature consists of PDZK1IP1, IL-24, H19 and filaggrin. • Pro-inflammatory cytokines increase IL-24 production in human keratinocytes. • Environmental toxic stressors increase IL-24 production in human keratinocytes. • IL-24 stimulates human keratinocytes to

  1. UVB induces IL-12 transcription in human keratinocytes in vivo and in vitro

    International Nuclear Information System (INIS)

    Enk, C.D.; Blauvet, A.; Katz, S.I.; Mahanty, S.

    1996-01-01

    Human epidermal cells produce a wide range of cytokines, including those characteristic of Th2-like responses such as interleukin (IL)-4 and IL-10. As well, keratinocytes have recently been shown to produce Th1-like cytokines such as IL-12. Exposure to UVB has profound effects on the skin and systemic immune system, which is in part mediated by secretion of tumor necrosis factor (TNF)-α by epidermal cells. Because IL-12 induces production of TNF-α by certain cells of the immune system, we sought to determine whether UVB is an inducer of IL-12 gene expression in epidermal cells. Human epidermal cells were exposed to UVB radiation in vivo, isolated by suction blister technique and trypsinization and transcription of the IL-12 p35 and p40 chains was examined by RT-PCR. (Author)

  2. Model system for plant cell biology: GFP imaging in living onion epidermal cells

    Science.gov (United States)

    Scott, A.; Wyatt, S.; Tsou, P. L.; Robertson, D.; Allen, N. S.

    1999-01-01

    The ability to visualize organelle localization and dynamics is very useful in studying cellular physiological events. Until recently, this has been accomplished using a variety of staining methods. However, staining can give inaccurate information due to nonspecific staining, diffusion of the stain or through toxic effects. The ability to target green fluorescent protein (GFP) to various organelles allows for specific labeling of organelles in vivo. The disadvantages of GFP thus far have been the time and money involved in developing stable transformants or maintaining cell cultures for transient expression. In this paper, we present a rapid transient expression system using onion epidermal peels. We have localized GFP to various cellular compartments (including the cell wall) to illustrate the utility of this method and to visualize dynamics of these compartments. The onion epidermis has large, living, transparent cells in a monolayer, making them ideal for visualizing GFP. This method is easy and inexpensive, and it allows for testing of new GFP fusion proteins in a living tissue to determine deleterious effects and the ability to express before stable transformants are attempted.

  3. Urea uptake enhances barrier function and antimicrobial defense in humans by regulating epidermal gene expression

    Science.gov (United States)

    Grether-Beck, Susanne; Felsner, Ingo; Brenden, Heidi; Kohne, Zippora; Majora, Marc; Marini, Alessandra; Jaenicke, Thomas; Rodriguez-Martin, Marina; Trullas, Carles; Hupe, Melanie; Elias, Peter M.; Krutmann, Jean

    2012-01-01

    Urea is an endogenous metabolite, known to enhance stratum corneum hydration. Yet, topical urea anecdotally also improves permeability barrier function, and it appears to exhibit antimicrobial activity. Hence, we hypothesized that urea is not merely a passive metabolite, but a small-molecule regulator of epidermal structure and function. In 21 human volunteers, topical urea improved barrier function in parallel with enhanced antimicrobial peptide (LL-37 and β-defensin-2) expression. Urea both stimulates expression of, and is transported into keratinocytes by two urea transporters, UT-A1 and UT-A2, and by aquaporin 3, 7 and 9. Inhibitors of these urea transporters block the downstream biological effects of urea, which include increased mRNA and protein levels for: (i) transglutaminase-1, involucrin, loricrin and filaggrin; (ii) epidermal lipid synthetic enzymes, and (iii) cathelicidin/LL-37 and β-defensin-2. Finally, we explored the potential clinical utility of urea, showing that topical urea applications normalized both barrier function and antimicrobial peptide expression in a murine model of atopic dermatitis (AD). Together, these results show that urea is a small-molecule regulator of epidermal permeability barrier function and antimicrobial peptide expression after transporter uptake, followed by gene regulatory activity in normal epidermis, with potential therapeutic applications in diseased skin. PMID:22418868

  4. The epidermal cell kinetic response to ultraviolet B irradiation combines regenerative proliferation and carcinogen associated cell cycle delay

    Energy Technology Data Exchange (ETDEWEB)

    Olsen, W.M.; Kirkhus, B. (Oslo Univ. (Norway))

    1989-09-01

    The cell cycle traverse of epidermal basal cells 24 h after in vivo exposure of ultraviolet B (UVB) irradiation was studied by immunochemical staining of incorporated bromodeoxyuridine (BrdU) and bivariate BrdU/DNA flow cytometric analysis. The results were compared with the cell kinetic patterns following topical application of the skin carcinogen methylnitrosourea (MNU) as well as the skin irritant cantharidin. The cell cycle traverse in hairless mouse epidermis 24 h after in vivo exposure to UVB seemed to be a combination of the cell kinetic effects following chemical skin carcinogens and skin irritants. UVB irradiation induced both a delay in transit time through S phase, probably due to DNA damage and subsequent repair, as well as a reduction in the total cell cycle time consistent with rapid regenerative proliferation. (author).

  5. Tumor necrosis factor related apoptosis inducing ligand triggers apoptosis in dividing but not in differentiating human epidermal keratinocytes

    NARCIS (Netherlands)

    Jansen, Bastiaan J. H.; van Ruissen, Fred; Cerneus, Stefanie; Cloin, Wendy; Bergers, Mieke; van Erp, Piet E. J.; Schalkwijk, Joost

    2003-01-01

    Using serial analysis of gene expression we have previously identified the expression of several pro-apoptotic and anti-apoptotic genes in cultured human primary epidermal keratinocytes, including tumor necrosis factor related apoptosis inducing ligand (TRAIL). TRAIL is a potent inducer of apoptosis

  6. Immunohistochemical localization of epidermal growth factor in the second-trimester human fetus

    DEFF Research Database (Denmark)

    Poulsen, Steen Seier; Kryger-Baggesen, N; Nexø, Ebba

    1996-01-01

    Epidermal growth factor (EGF) is considered to be important in mammalian neonatal growth and development. In order to clarify its developmental role, we have investigated, by immunohistochemistry, the localization of EGF and the time of its first appearance in various organs from a series of 25...... midtrimester human fetuses with a gestational age ranging from 13 to 22 weeks. The first detectable EGF immunoreactivity occurred in week 15-16 fetuses in the placenta, the skin, the distal tubules of the kidney, the surface epithelium of the stomach, and the tips of the small intestinal villi, as well...

  7. Regulators of floral fragrance production and their target genes in petunia are not exclusively active in the epidermal cells of petals.

    Science.gov (United States)

    Van Moerkercke, Alex; Galván-Ampudia, Carlos S; Verdonk, Julian C; Haring, Michel A; Schuurink, Robert C

    2012-05-01

    In which cells of the flower volatile biosynthesis takes place is unclear. In rose and snapdragon, some enzymes of the volatile phenylpropanoid/benzenoid pathway have been shown to be present in the epidermal cells of petals. It is therefore generally believed that the production of these compounds occurs in these cells. However, whether the entire pathway is active in these cells and whether it is exclusively active in these cells remains to be proven. Cell-specific transcription factors activating these genes will determine in which cells they are expressed. In petunia, the transcription factor EMISSION OF BENZENOIDS II (EOBII) activates the ODORANT1 (ODO1) promoter and the promoter of the biosynthetic gene isoeugenol synthase (IGS). The regulator ODO1 in turn activates the promoter of the shikimate gene 5-enolpyruvylshikimate-3-phosphate synthase (EPSPS). Here the identification of a new target gene of ODO1, encoding an ABC transporter localized on the plasma membrane, PhABCG1, which is co-expressed with ODO1, is described. PhABCG1 expression is up-regulated in petals overexpressing ODO1 through activation of the PhABCG1 promoter. Interestingly, the ODO1, PhABCG1, and IGS promoters were active in petunia protoplasts originating from both epidermal and mesophyll cell layers of the petal, suggesting that the volatile phenylpropanoid/benzenoid pathway in petunia is active in these different cell types. Since volatile release occurs from epidermal cells, trafficking of (volatile) compounds between cell layers must be involved, but the exact function of PhABCG1 remains to be resolved.

  8. Genetically induced cell death in bulge stem cells reveals their redundancy for hair and epidermal regeneration.

    Science.gov (United States)

    Driskell, Iwona; Oeztuerk-Winder, Feride; Humphreys, Peter; Frye, Michaela

    2015-03-01

    Adult mammalian epidermis contains multiple stem cell populations in which quiescent and more proliferative stem and progenitor populations coexist. However, the precise interrelation of these populations in homeostasis remains unclear. Here, we blocked the contribution of quiescent keratin 19 (K19)-expressing bulge stem cells to hair follicle formation through genetic ablation of the essential histone methyltransferase Setd8 that is required for the maintenance of adult skin. Deletion of Setd8 eliminated the contribution of bulge cells to hair follicle regeneration through inhibition of cell division and induction of cell death, but the growth and morphology of hair follicles were unaffected. Furthermore, ablation of Setd8 in the hair follicle bulge blocked the contribution of K19-postive stem cells to wounded epidermis, but the wound healing process was unaltered. Our data indicate that quiescent bulge stem cells are dispensable for hair follicle regeneration and epidermal injury in the short term and support the hypothesis that quiescent and cycling stem cell populations are equipotent. © 2014 AlphaMed Press.

  9. Trichloroethylene-mediated cytotoxicity in human epidermal keratinocytes is mediated by the rapid accumulation of intracellular calcium: Interception by naringenin.

    Science.gov (United States)

    Ali, F; Khan, A Q; Khan, R; Sultana, S

    2016-02-01

    Industrial solvents pose a significant threat to the humankind. The mechanisms of their toxicity still remain in debate. Trichloroethylene (TCE) is a widespread industrial solvent responsible for severe liver dysfunction, cutaneous toxicity in occupationally exposed humans. We utilized an in vitro system of human epidermal keratinocyte (HaCaT) cells in this study to avoid complex cell and extracellular interactions. We report the cytotoxicity of organic solvent TCE in HaCaT and its reversal by a natural flavanone, naringenin (Nar). The cytotoxicity was attributed to the rapid intracellular free calcium (Ca(2+)) release, which might lead to the elevation of protein kinase C along with robust free radical generation, instability due to energy depletion, and sensitization of intracellular stress signal transducer nuclear factor κB. These effects were actually seen to induce significant amount of genomic DNA fragmentation. Furthermore, all these effects of TCE were effectively reversed by the treatment of Nar, a natural flavanone. Our studies identify intracellular Ca as a unique target used by organic solvents in the cytotoxicity and highlight the Ca(2+) ion stabilizer properties of Nar. © The Author(s) 2015.

  10. Linking γ-aminobutyric acid A receptor to epidermal growth factor receptor pathways activation in human prostate cancer.

    Science.gov (United States)

    Wu, Weijuan; Yang, Qing; Fung, Kar-Ming; Humphreys, Mitchell R; Brame, Lacy S; Cao, Amy; Fang, Yu-Ting; Shih, Pin-Tsen; Kropp, Bradley P; Lin, Hsueh-Kung

    2014-03-05

    Neuroendocrine (NE) differentiation has been attributed to the progression of castration-resistant prostate cancer (CRPC). Growth factor pathways including the epidermal growth factor receptor (EGFR) signaling have been implicated in the development of NE features and progression to a castration-resistant phenotype. However, upstream molecules that regulate the growth factor pathway remain largely unknown. Using androgen-insensitive bone metastasis PC-3 cells and androgen-sensitive lymph node metastasis LNCaP cells derived from human prostate cancer (PCa) patients, we demonstrated that γ-aminobutyric acid A receptor (GABA(A)R) ligand (GABA) and agonist (isoguvacine) stimulate cell proliferation, enhance EGF family members expression, and activate EGFR and a downstream signaling molecule, Src, in both PC-3 and LNCaP cells. Inclusion of a GABA(A)R antagonist, picrotoxin, or an EGFR tyrosine kinase inhibitor, Gefitinib (ZD1839 or Iressa), blocked isoguvacine and GABA-stimulated cell growth, trans-phospohorylation of EGFR, and tyrosyl phosphorylation of Src in both PCa cell lines. Spatial distributions of GABAAR α₁ and phosphorylated Src (Tyr416) were studied in human prostate tissues by immunohistochemistry. In contrast to extremely low or absence of GABA(A)R α₁-positive immunoreactivity in normal prostate epithelium, elevated GABA(A)R α₁ immunoreactivity was detected in prostate carcinomatous glands. Similarly, immunoreactivity of phospho-Src (Tyr416) was specifically localized and limited to the nucleoli of all invasive prostate carcinoma cells, but negative in normal tissues. Strong GABAAR α₁ immunoreactivity was spatially adjacent to the neoplastic glands where strong phospho-Src (Tyr416)-positive immunoreactivity was demonstrated, but not in adjacent to normal glands. These results suggest that the GABA signaling is linked to the EGFR pathway and may work through autocrine or paracine mechanism to promote CRPC progression. Copyright © 2013 Elsevier

  11. Characterization of A Three-Dimensional Organotypic Co-Culture Skin Model for Epidermal Differentiation of Rat Adipose-Derived Stem Cells.

    Science.gov (United States)

    Ghanavati, Zeinab; Orazizadeh, Mahmoud; Bayati, Vahid; Abbaspour, Mohammad Reza; Khorsandi, Layasadat; Mansouri, Esrafil; Neisi, Niloofar

    2016-01-01

    The organotypic co-culture is a well-known technique to examine cellular interactions and their roles in stem cell proliferation and differentiation. This study aims to evaluate the effects of dermal fibroblasts (DFs) on epidermal differentiation of adipose-derived stem cells (ASCs) using a three-dimensional (3D) organotypic co- culture technique. In this experimental research study, rat DFs and ASCs were isolated and cultured separately on electrospun polycaprolactone (PCL) matrices. The PCL matrices seeded by ASCs were superimposed on to the matrices seeded by DFs in order to create a 3D organotypic co-culture. In the control groups, PCL matrices seeded by ASCs were placed on matrices devoid of DFs. After 10 days, we assessed the expressions of keratinocyte-related genes by real-time reverse transcriptase-polymerase chain reaction (RT-PCR) and expression of pan-cytokeratin protein by immunofluorescence in the differentiated keratinocyte-like cells from co- culture and control groups. Keratinocyte-like cell morphologies were also observed by scanning electron microscopy (SEM). The early, intermediate, and terminal differentiation keratinocyte markers-Cytokeratin14, Filaggrin, and Involucrin significantly expressed in the co-culture groups com- pared to the control ones (P<0.05). We observed pan-cytokeratin in keratinocyte-like cells of both groups by immunofluorescence. SEM observation of the co-culture groups showed that the differentiated keratinocyte-like cells developed a polygonal cobblestone shape, considered characteristic of keratinocytes. The 3D organotypic co-culture bilayered construct that consisted of DFs and ASCs was an effective technique for epidermal differentiation of ASCs. This co-culture might be useful for epidermal differentiation of stem cells for future applications in skin regeneration.

  12. Outcome of burns treated with autologous cultured proliferating epidermal cells: a prospective randomized multicenter intrapatient comparative trial

    NARCIS (Netherlands)

    Gardien, K.L.M.; Marck, R.E.; Bloemen, M.C.T.; Waaijman, T.; Gibbs, S.; Uhlrich, M.M.W.; Middelkoop, E.

    2016-01-01

    Standard treatment for large burns is transplantation with meshed split skin autografts (SSGs). A disadvantage of this treatment is that healing is accompanied by scar formation. Application of autologous epidermal cells (keratinocytes and melanocytes) may be a suitable therapeutic alternative,

  13. Single-cell-type quantitative proteomic and ionomic analysis of epidermal bladder cells from the halophyte model plant Mesembryanthemum crystallinum to identify salt-responsive proteins

    OpenAIRE

    Barkla, Bronwyn J.; Vera-Estrella, Rosario; Raymond, Carolyn

    2016-01-01

    Background Epidermal bladder cells (EBC) are large single-celled, specialized, and modified trichomes found on the aerial parts of the halophyte Mesembryanthemum crystallinum. Recent development of a simple but high throughput technique to extract the contents from these cells has provided an opportunity to conduct detailed single-cell-type analyses of their molecular characteristics at high resolution to gain insight into the role of these cells in the salt tolerance of the plant. Results In...

  14. E-cadherin homophilic ligation inhibits cell growth and epidermal growth factor receptor signaling independently of other cell interactions

    DEFF Research Database (Denmark)

    Perrais, Michaël; Chen, Xiao; Perez-Moreno, Mirna

    2007-01-01

    growth inhibitory signals. To address this question, we have selectively formed E-cadherin homophilic bonds at the cell surface of isolated epithelial cells by using functionally active recombinant E-cadherin protein attached to microspheres. We find that E-cadherin ligation alone reduces the frequency...... of cells entering the S phase, demonstrating that E-cadherin ligation directly transduces growth inhibitory signals. E-cadherin binding to beta-catenin is required for cell growth inhibition, but beta-catenin/T-cell factor transcriptional activity is not involved in growth inhibition resulting from...... homophilic binding. Neither E-cadherin binding to p120-catenin nor beta-catenin binding to alpha-catenin, and thereby the actin cytoskeleton, is required for growth inhibition. E-cadherin ligation also inhibits epidermal growth factor (EGF) receptor-mediated growth signaling by a beta...

  15. Keratinocyte-derived IL-24 plays a role in the positive feedback regulation of epidermal inflammation in response to environmental and endogenous toxic stressors.

    Science.gov (United States)

    Jin, Sun Hee; Choi, Dalwoong; Chun, Young-Jin; Noh, Minsoo

    2014-10-15

    Keratinocytes are the major cellular components of human epidermis and play a key role in the modulating cutaneous inflammation and toxic responses. In human chronic skin diseases, the common skin inflammatory phenotypes like skin barrier disruption and epidermal hyperplasia are manifested in epidermal keratinocytes by interactions with T helper (Th) cells. To find a common gene expression signature of human keratinocytes in chronic skin diseases, we performed a whole genome microarray analysis on normal human epidermal keratinocytes (NHKs) treated with IFNγ, IL-4, IL-17A or IL-22, major cytokines from Th1, Th2, Th17 or Th22 cells, respectively. The microarray results showed that the four genes, IL-24, PDZK1IP1, H19 and filaggrin, had common expression profiles in NHKs exposed to Th cell cytokines. In addition, the acute phase pro-inflammatory cytokines, IL-1β, IL-6 and TNFα, also change the gene transcriptional profile of IL-24, PDZK1IP1, H19, and filaggrin in NHKs as those of Th cytokines. Therefore, the signature gene set, consisting of IL-24, PDZK1IP1, H19, and filaggrin, provides essential insights for understanding the process of cutaneous inflammation and toxic responses. We demonstrate that environmental toxic stressors, such as chemical irritants and ultraviolet irradiation stimulate the production of IL-24 in NHKs. IL-24 stimulates the JAK1-STAT3 and MAPK pathways in NHKs, and promotes the secretion of pro-inflammatory mediators IL-8, PGE2, and MMP-1. These results suggest that keratinocyte-derived IL-24 participates in the positive feedback regulation of epidermal inflammation in response to both endogenous and environmental toxic stressors. Copyright © 2014 Elsevier Inc. All rights reserved.

  16. Chromosomal changes in cultured human epithelial cells transformed by low- and high-LET radiation

    Energy Technology Data Exchange (ETDEWEB)

    Yang, Tracy Chui-hsu; Craise, L.M; Prioleau, J.C.; Stampfer, M.R.; Rhim, J.S.

    1990-11-01

    For a better assessment of radiation risk in space, an understanding of the responses of human cells, especially the epithelial cells, to low- and high-LET radiation is essential. In our laboratory, we have successfully developed techniques to study the neoplastic transformation of two human epithelial cell systems by ionizing radiation. These cell systems are human mammary epithelial cells (H184B5) and human epidermal keratinocytes (HEK). Both cell lines are immortal, anchorage dependent for growth, and nontumorigenic in athymic nude nice. Neoplastic transformation was achieved by irradiation cells successively. Our results showed that radiogenic cell transformation is a multistep process and that a single exposure of ionizing radiation can cause only one step of transformation. It requires, therefore, multihits to make human epithelial cells fully tumorigenic. Using a simple karyotyping method, we did chromosome analysis with cells cloned at various stages of transformation. We found no consistent large terminal deletion of chromosomes in radiation-induced transformants. Some changes of total number of chromosomes, however, were observed in the transformed cells. These transformants provide an unique opportunity for further genetic studies at a molecular level. 15 refs., 9 figs., 2 tabs.

  17. Chromosomal changes in cultured human epithelial cells transformed by low- and high-LET radiation

    International Nuclear Information System (INIS)

    Yang, Tracy Chui-hsu; Craise, L.M; Prioleau, J.C.; Stampfer, M.R.; Rhim, J.S.

    1990-11-01

    For a better assessment of radiation risk in space, an understanding of the responses of human cells, especially the epithelial cells, to low- and high-LET radiation is essential. In our laboratory, we have successfully developed techniques to study the neoplastic transformation of two human epithelial cell systems by ionizing radiation. These cell systems are human mammary epithelial cells (H184B5) and human epidermal keratinocytes (HEK). Both cell lines are immortal, anchorage dependent for growth, and nontumorigenic in athymic nude nice. Neoplastic transformation was achieved by irradiation cells successively. Our results showed that radiogenic cell transformation is a multistep process and that a single exposure of ionizing radiation can cause only one step of transformation. It requires, therefore, multihits to make human epithelial cells fully tumorigenic. Using a simple karyotyping method, we did chromosome analysis with cells cloned at various stages of transformation. We found no consistent large terminal deletion of chromosomes in radiation-induced transformants. Some changes of total number of chromosomes, however, were observed in the transformed cells. These transformants provide an unique opportunity for further genetic studies at a molecular level. 15 refs., 9 figs., 2 tabs

  18. Glucocorticoid receptor, but not mineralocorticoid receptor, mediates cortisol regulation of epidermal ionocyte development and ion transport in zebrafish (danio rerio.

    Directory of Open Access Journals (Sweden)

    Shelly Abad Cruz

    Full Text Available Cortisol is the major endogenous glucocorticoid (GC both in human and fish, mediated by corticosteroid receptors. Due to the absence of aldosterone production in teleost fish, cortisol is also traditionally accepted to function as mineralocorticoid (MC; but whether it acts through the glucocorticoid receptor (GR or the mineralocorticoid receptor (MR remains a subject of debate. Here, we used loss-of-function and rescue assays to determine whether cortisol affects zebrafish epidermal ionocyte development and function via the GR and/or the MR. GR knockdown morphants displayed a significant decrease in the major ionocytes, namely Na(+-K(+-ATPase-rich cells (NaRCs and H(+-ATPase-rich cells (HRCs, as well as other cells, including epidermal stem cells (ESCs, keratinocytes, and mucus cells; conversely, cell numbers were unaffected in MR knockdown morphants. In agreement, GR morphants, but not MR morphants, exhibited decreased NaRC-mediated Ca(2+ uptake and HRC-mediated H(+ secretion. Rescue via GR capped mRNA injection or exogenous cortisol incubation normalized the number of epidermal ionocytes in GR morphants. We also provide evidence for GR localization in epidermal cells. At the transcript level, GR mRNA is ubiquitously expressed in gill sections and present in both NaRCs and HRCs, supporting the knockdown and functional assay results in embryo. Altogether, we have provided solid molecular evidence that GR is indeed present on ionocytes, where it mediates the effects of cortisol on ionocyte development and function. Hence, cortisol-GR axis performs the roles of both GC and MC in zebrafish skin and gills.

  19. A sensitive electrochemiluminescence cytosensor for quantitative evaluation of epidermal growth factor receptor expressed on cell surfaces

    Energy Technology Data Exchange (ETDEWEB)

    Tang, Yanjuan; Zhang, Shaolian; Wen, Qingqing; Huang, Hongxing; Yang, Peihui, E-mail: typh@jnu.edu.cn

    2015-06-30

    Highlights: • EGF-cytosensor was used for evaluating EGFR expression level on cell surfaces. • CdSQDs and EGF were coated on magnetic beads (MBs) for ECL-probe. • Good sensitivity was achieved due to the signal amplification of ECL-probe. - Abstract: A sensitive electrochemiluminescence (ECL) strategy for evaluating the epidermal growth factor receptor (EGFR) expression level on cell surfaces was designed by integrating the specific recognition of EGFR expressed on MCF-7 cell surfaces with an epidermal growth factor (EGF)-funtionalized CdS quantum dots (CdSQDs)-capped magnetic bead (MB) probe. The high sensitivity of ECL probe of EGF-funtionalized CdSQD-capped-MB was used for competitive recognition with EGFR expressed on cell surfaces with recombinant EGFR protein. The changes of ECL intensity depended on both the cell number and the expression level of EGFR receptor on cell surfaces. A wide linear response to cells ranging from 80 to 4 × 10{sup 6} cells mL{sup −1} with a detection limit of 40 cells mL{sup −1} was obtained. The EGF-cytosensor was used to evaluate EGFR expression levels on MCF-7 cells, and the average number of EGFR receptor on single MCF-7 cells was 1.35 × 10{sup 5} with the relative standard deviation of 4.3%. This strategy was further used for in-situ and real-time evaluating EGFR receptor expressed on cell surfaces in response to drugs stimulation at different concentration and incubation time. The proposed method provided potential applications in the detection of receptors on cancer cells and anticancer drugs screening.

  20. [Effect of low-energy 633 nm red light stimulation on proliferation and reactive oxygen species level of human epidermal cell line HaCaT].

    Science.gov (United States)

    Chen, Z Y; Li, D L; Duan, X D; Peng, D Z

    2016-09-20

    To investigate the changes of proliferative activity and reactive oxygen species level of human epidermal cell line HaCaT after being irradiated with low-energy 633 nm red light. Irradiation distance was determined through preliminary experiment. HaCaT cells were conventionally sub-cultured with RPMI 1640 culture medium containing 10% fetal calf serum, 100 U/mL penicillin, and 100 μg/mL streptomycin. Cells of the third passage were used in the following experiments. (1) Cells were divided into blank control group and 0.082, 0.164, 0.245, 0.491, 1.472, 2.453, 4.910, and 9.810 J/cm(2) irradiation groups according to the random number table, with 3 wells in each group. Cells in blank control group were not irradiated, while cells in the latter 8 irradiation groups were irradiated with 633 nm red light for 10, 20, 30, 60, 180, 300, 600, and 1 200 s in turn. Cells were reirradiated once every 8 hours. After being irradiated for 48 hours (6 times) in irradiation groups, the proliferative activity of cells in 9 groups was determined with cell counting kit 8 and microplate reader (denoted as absorbance value). (2) Another batch of cells were grouped and irradiated as in experiment (1). After being irradiated for once in irradiation groups, cells in 9 groups were conventionally cultured for 60 min with detection reagent of reactive oxygen species. At post culture minute (PCM) 0 (immediately), 30, 60, and 120, reactive oxygen species level of cells was determined with microplate reader (denoted as absorbance value). (3) Another batch of cells were divided into blank control group, 0.082, 0.491, 2.453, and 9.810 J/cm(2) irradiation groups, and positive control group. Cells in blank control group and positive control group were not irradiated (positive control reagent of reactive oxygen species was added to cells in positive control group), and cells in irradiation groups were irradiated as in experiment (1) for once. The expression of reactive oxygen species in cells of each

  1. Hybrid Enhanced Epidermal SpaceSuit Design Approaches

    Science.gov (United States)

    Jessup, Joseph M.

    A Space suit that does not rely on gas pressurization is a multi-faceted problem that requires major stability controls to be incorporated during design and construction. The concept of Hybrid Epidermal Enhancement space suit integrates evolved human anthropomorphic and physiological adaptations into its functionality, using commercially available bio-medical technologies to address shortcomings of conventional gas pressure suits, and the impracticalities of MCP suits. The prototype HEE Space Suit explored integumentary homeostasis, thermal control and mobility using advanced bio-medical materials technology and construction concepts. The goal was a space suit that functions as an enhanced, multi-functional bio-mimic of the human epidermal layer that works in attunement with the wearer rather than as a separate system. In addressing human physiological requirements for design and construction of the HEE suit, testing regimes were devised and integrated into the prototype which was then subject to a series of detailed tests using both anatomical reproduction methods and human subject.

  2. Epidermal growth factor in alkali-burned corneal epithelial wound healing.

    Science.gov (United States)

    Singh, G; Foster, C S

    1987-06-15

    We conducted a double-masked study to evaluate the effect of epidermal growth factor on epithelial wound healing and recurrent erosions in alkali-burned rabbit corneas. Epithelial wounds 10 mm in diameter healed completely under the influence of topical epidermal growth factor, whereas the control corneas did not resurface in the center. On reversal of treatment, the previously nonhealing epithelial defects healed when treated with topical epidermal growth factor eyedrops. Conversely, the epidermal growth factor-treated and resurfaced corneas developed epithelial defects when treatment was discontinued. Histopathologic examination disclosed hyperplastic epithelium growing over the damaged stroma laden with polymorphonuclear leukocytes when treated with epidermal growth factor eyedrops, but it did not adhere to the underlying tissue. Hydropic changes were seen intracellularly as well as between the epithelial cells and the stroma.

  3. Optical characterization of epidermal cells and their relationship to DNA recovery from touch samples [version 1; referees: 2 approved

    Directory of Open Access Journals (Sweden)

    Cristina E. Stanciu

    2015-11-01

    Full Text Available The goal of this study was to investigate the relative contributions of different cellular and genetic components to biological samples created by touch or contact with a surface – one of the most challenging forms of forensic evidence. Touch samples were generated by having individuals hold an object for five minutes and analyzed for quantity of intact epidermal cells, extracellular DNA, and DNA from pelleted cell material after elution from the collection swab. Comparisons were made between samples where individuals had washed their hands immediately prior to handling and those where hand washing was not controlled. The vast majority (84-100% of DNA detected in these touch samples was extracellular and was uncorrelated to the number of epidermal cells detected. Although little to no extracellular or cell pellet-associated DNA was detected when individuals washed their hands prior to substrate handling, we found that a significant number of epidermal cells (between ~5x103 and ~1x105 could still be recovered from these samples, suggesting that other types of biological information may be present even when no amplifiable nuclear DNA is present. These results help to elucidate the biological context for touch samples and characterize factors that may contribute to patterns of transfer and persistence of genetic material in forensic evidence.

  4. De novo activating epidermal growth factor mutations (EGFR) in small-cell lung cancer.

    Science.gov (United States)

    Thai, Alesha; Chia, Puey L; Russell, Prudence A; Do, Hongdo; Dobrovic, Alex; Mitchell, Paul; John, Thomas

    2017-09-01

    In Australia, mutations in epidermal growth factor mutations (EGFR) occur in 15% of patients diagnosed with non-small-cell lung cancer and are found with higher frequency in female, non-smokers of Asian ethnicity. Activating mutations in the EGFR gene are rarely described in SCLC. We present two cases of de novo EGFR mutations in patients with SCLC detected in tissue and in plasma cell free DNA, both of whom were of Asian ethnicity and never-smokers. These two cases add to the growing body of evidence suggesting that screening for EGFR mutations in SCLC should be considered in patients with specific clinical features. © 2017 Royal Australasian College of Physicians.

  5. Tissue remodeling induced by hypersecreted epidermal growth factor and amphiregulin in the airway after an acute asthma attack.

    Science.gov (United States)

    Enomoto, Yukinori; Orihara, Kanami; Takamasu, Tetsuya; Matsuda, Akio; Gon, Yasuhiro; Saito, Hirohisa; Ra, Chisei; Okayama, Yoshimichi

    2009-11-01

    Epidermal growth factor receptor ligands, such as epidermal growth factor (EGF) and amphiregulin, may play key roles in tissue remodeling in asthma. However, the kinetics of EGF and amphiregulin secretion in the airway after an acute asthma attack and the effect of prolonged airway exposure to these ligands on airway remodeling are unknown. To measure the EGF and amphiregulin concentrations in sputa obtained from patients with asthma under various conditions, and to examine the effects of EGF and amphiregulin on the proliferation or differentiation of airway structural cells. Epidermal growth factor and amphiregulin levels were measured by ELISA in sputum specimens collected from 14 hospitalized children with asthma during an acute asthma attack, 13 stable outpatients with asthma, 8 healthy control children, and 7 children with respiratory tract infections. The effects of EGF and amphiregulin on the proliferation and/or differentiation of normal human bronchial epithelial cells (NHBE), bronchial smooth muscle cells (BSMC), and normal human lung fibroblasts (NHLF) were examined. The sputum levels of EGF were significantly higher for about a week after an acute asthma attack compared with the levels in stable subjects with asthma and control subjects. In contrast, upregulation of amphiregulin in the sputa of patients with asthma was observed only during the acute attack. EGF caused proliferation of NHBE, BSMC, and NHLF, whereas amphiregulin induced proliferation of only NHBE. Prolonged exposure of NHBE to EGF and amphiregulin induced mucous cell metaplasia in an IL-13-independent manner. Acute asthma attacks are associated with hypersecretion of EGF and amphiregulin in the airway. Recurrent acute attacks may aggravate airway remodeling.

  6. Chemical allergens stimulate human epidermal keratinocytes to produce lymphangiogenic vascular endothelial growth factor.

    Science.gov (United States)

    Bae, Ok-Nam; Ahn, Seyeon; Jin, Sun Hee; Hong, Soo Hyun; Lee, Jinyoung; Kim, Eun-Sun; Jeong, Tae Cheon; Chun, Young-Jin; Lee, Ai-Young; Noh, Minsoo

    2015-03-01

    Allergic contact dermatitis (ACD) is a cell-mediated immune response that involves skin sensitization in response to contact with various allergens. Angiogenesis and lymphangiogenesis both play roles in the allergic sensitization process. Epidermal keratinocytes can produce vascular endothelial growth factor (VEGF) in response to UV irradiation and during wound healing. However, the effect of haptenic chemical allergens on the VEGF production of human keratinocytes, which is the primary contact site of toxic allergens, has not been thoroughly researched. We systematically investigated whether immune-regulatory cytokines and chemical allergens would lead to the production of VEGF in normal human keratinocytes (NHKs) in culture. VEGF production significantly increased when NHKs were treated with IFNγ, IL-1α, IL-4, IL-6, IL-17A, IL-22 or TNFα. Among the human sensitizers listed in the OECD Test Guideline (TG) 429, we found that CMI/MI, DNCB, 4-phenylenediamine, cobalt chloride, 2-mercaptobenzothiazole, citral, HCA, cinnamic alcohol, imidazolidinyl urea and nickel chloride all significantly upregulated VEGF production in NHKs. In addition, common human haptenic allergens such as avobenzone, formaldehyde and urushiol, also induced the keratinocyte-derived VEGF production. VEGF upregulation by pro-inflammatory stimuli, IFNγ, DNCB or formaldehyde is preceded by the production of IL-8, an acute inflammatory phase cytokine. Lymphangiogenic VEGF-C gene transcription was significantly increased when NHKs were treated with formaldehyde, DNCB or urushiol, while transcription of VEGF-A and VEGF-B did not change. Therefore, the chemical allergen-induced VEGF upregulation is mainly due to the increase in lymphangiogenic VEGF-C transcription in NHKs. These results suggest that keratinocyte-derived VEGF may regulate the lymphangiogenic process during the skin sensitization process of ACD. Copyright © 2015 Elsevier Inc. All rights reserved.

  7. Improvement of hydration and epidermal barrier function in human skin by a novel compound isosorbide dicaprylate.

    Science.gov (United States)

    Chaudhuri, R K; Bojanowski, K

    2017-10-01

    The study involved the synthesis of a novel derivative of caprylic acid - isosorbide dicaprylate (IDC) - and the evaluation of its potential in improving water homoeostasis and epidermal barrier function in human skin. The effect of IDC on gene expression was assayed in skin organotypic cultures by DNA microarrays. The results were then confirmed for a few key genes by quantitative PCR, immuno- and cytochemistry. Final validation of skin hydration properties was obtained by four separate clinical studies. Level of hydration was measured by corneometer either by using 2% IDC lotion alone vs placebo or in combination with 2% glycerol lotion vs 2% glycerol only. A direct comparison in skin hydration between 2% IDC and 2% glycerol lotions was also carried out. The epidermal barrier function improvement was assessed by determining changes in transepidermal water loss (TEWL) on the arms before and after treatment with 2% IDC lotion versus placebo. IDC was found to upregulate the expression of AQP3, CD44 and proteins involved in keratinocyte differentiation as well as the formation and function of stratum corneum. A direct comparison between 2% IDC versus 2% glycerol lotions revealed a three-fold advantage of IDC in providing skin hydration. Severely dry skin treated with 2% IDC in combination with 2% glycerol showed 133% improvement, whereas 35% improvement was observed with moderately dry human skin. Topical isosorbide dicaprylate favourably modulates genes involved in the maintenance of skin structure and function, resulting in superior clinical outcomes. By improving skin hydration and epidermal permeability barrier, it offers therapeutic applications in skin ageing. © 2017 Society of Cosmetic Scientists and the Société Française de Cosmétologie.

  8. Transcriptional effect of an Aframomum angustifolium seed extract on human cutaneous cells using low-density DNA chips.

    Science.gov (United States)

    Bonnet-Duquennoy, Mathilde; Dumas, Marc; Debacker, Adeline; Lazou, Kristell; Talbourdet, Sylvie; Franchi, Jocelyne; Heusèle, Catherine; André, Patrice; Schnebert, Sylvianne; Bonté, Frédéric; Kurfürst, Robin

    2007-06-01

    Studying photoexposed and photoprotected skin biopsies from young and aged women, it has been found that a specific zone, composed of the basal layers of the epidermis, the dermal epidermal junction, and the superficial dermis, is major target of aging and reactive oxygen species. We showed that this zone is characterized by significant variations at a transcriptional and/or protein levels. Using low-density DNA chip technology, we evaluated the effect of a natural mixture of Aframomum angustifolium seed extract containing labdane diterpenoids on these aging markers. Expression profiles of normal human fibroblasts (NHF) were studied using a customized cDNA macroarray system containing genes covering dermal structure, inflammatory responses, and oxidative stress defense mechanisms. For normal human keratinocyte (NHK) investigations, we chose OLISA technique, a sensitive and quantitative method developed by BioMérieux specifically designed to investigate cell death, proliferation, epidermal structure, differentiation, and oxidative stress defense response. We observed that this extract strongly modified gene expression profiles of treated NHK, but weakly for NHF. This extract regulated antioxidant defenses, dermal-epidermal junction components, and epidermal renewal-related genes. Using low-density DNA chip technology, we identified new potential actions of A. angustifolium seed extract on skin aging.

  9. Homologous radioimmunoassay for human epidermal growth factor (urogastrone)

    International Nuclear Information System (INIS)

    Dailey, G.E.; Kraus, J.W.; Orth, D.N.

    1978-01-01

    Epidermal growth factor (EGF), a polypeptide hormone originally discovered in the mouse submaxillary gland, stimulates growth in a variety of tissues in several species. This hormone has recently been identified in human urine. A homologous RIA for human EGF (RIA-hEGF) has been developed. In general, levels were similar to those recently reported using a heterologous RIA system. Twenty-four-hour urinary excretion of RIA-hEGF by normal adult males and females was 63.0 +- 3.0 and 52.0 +- 3.5 (mean +- SE) μg/total vol, or 29.7 +- 1.1 and 39.8 +- 1.7 μg/g creatinine, respectively. Excretion by females taking oral contraceptives was significantly greater (60.1 +- 2.7 μg/g creatinine; P 0.05). Several of those with very low values had histories of alcohol abuse. Excretion by patients with Cushing's syndrome was normal. Patients with psoriasis or recovering from major burns excreted both abnormally high and abnormally low levels of RIA-hEGF, with no obvious correlation to their clinical condition. There was no apparent diurnal or postprandial variation in urinary RIA-hEGF excretion by normal subjects. An excellent linear correlation was observed between RIA-hEGF and creatinine concentrations in each urine sample for each subject, suggesting that RIA-hEGF concentration in a random urine sample provides a valid index of 24-h RIA-hEGF excretion

  10. Tight junction regulates epidermal calcium ion gradient and differentiation

    International Nuclear Information System (INIS)

    Kurasawa, Masumi; Maeda, Tetsuo; Oba, Ai; Yamamoto, Takuya; Sasaki, Hiroyuki

    2011-01-01

    Research highlights: → We disrupted epidermal tight junction barrier in reconstructed epidermis. → It altered Ca 2+ distribution and consequentially differentiation state as well. → Tight junction should affect epidermal homeostasis by maintaining Ca 2+ gradient. -- Abstract: It is well known that calcium ions (Ca 2+ ) induce keratinocyte differentiation. Ca 2+ distributes to form a vertical gradient that peaks at the stratum granulosum. It is thought that the stratum corneum (SC) forms the Ca 2+ gradient since it is considered the only permeability barrier in the skin. However, the epidermal tight junction (TJ) in the granulosum has recently been suggested to restrict molecular movement to assist the SC as a secondary barrier. The objective of this study was to clarify the contribution of the TJ to Ca 2+ gradient and epidermal differentiation in reconstructed human epidermis. When the epidermal TJ barrier was disrupted by sodium caprate treatment, Ca 2+ flux increased and the gradient changed in ion-capture cytochemistry images. Alterations of ultrastructures and proliferation/differentiation markers revealed that both hyperproliferation and precocious differentiation occurred regionally in the epidermis. These results suggest that the TJ plays a crucial role in maintaining epidermal homeostasis by controlling the Ca 2+ gradient.

  11. Incidental Squamous Cell Carcinoma in an Epidermal Inclusion Cyst: A Case Report and Review of the Literature

    Directory of Open Access Journals (Sweden)

    Ethan Frank

    2018-03-01

    Full Text Available Epidermal inclusion cysts are common lesions that rarely develop into squamous cell carcinoma (SCC. Neoplastic change in these cysts can be associated with prominent symptoms such as pain, rapid growth, or ulceration. This study describes the case of a 64-year-old woman with a 4-year history of a largely asymptomatic neck mass, which after routine excision was found to be an epidermal inclusion cyst harboring well-differentiated SCC. The diagnosis was made incidentally after routine cyst bisection and hematoxylin and eosin staining. Given the potential for variable presentation and low cost of hematoxylin and eosin analysis, we recommend a low threshold for a comprehensive pathological search for malignancy in excised cysts when appropriate.

  12. The control of epidermal stem cells (holoclones) in the treatment of massive full-thickness burns with autologous keratinocytes cultured on fibrin.

    Science.gov (United States)

    Pellegrini, G; Ranno, R; Stracuzzi, G; Bondanza, S; Guerra, L; Zambruno, G; Micali, G; De Luca, M

    1999-09-27

    Cell therapy is an emerging therapeutic strategy aimed at replacing or repairing severely damaged tissues with cultured cells. Epidermal regeneration obtained with autologous cultured keratinocytes (cultured autografts) can be life-saving for patients suffering from massive full-thickness burns. However, the widespread use of cultured autografts has been hampered by poor clinical results that have been consistently reported by different burn units, even when cells were applied on properly prepared wound beds. This might arise from the depletion of epidermal stem cells (holoclones) in culture. Depletion of holoclones can occur because of (i) incorrect culture conditions, (ii) environmental damage of the exposed basal layer of cultured grafts, or (iii) use of new substrates or culture technologies not pretested for holoclone preservation. The aim of this study was to show that, if new keratinocyte culture technologies and/or "delivery systems" are proposed, a careful evaluation of epidermal stem cell preservation is essential for the clinical performance of this life-saving technology. Fibrin was chosen as a potential substrate for keratinocyte cultivation. Stem cells were monitored by clonal analysis using the culture system originally described by Rheinwald and Green as a reference. Massive full-thickness burns were treated with the composite allodermis/cultured autograft technique. We show that: (i) the relative percentage of holoclones, meroclones, and paraclones is maintained when keratinocytes are cultivated on fibrin, proving that fibrin does not induce clonal conversion and consequent loss of epidermal stem cells; (ii) the clonogenic ability, growth rate, and long-term proliferative potential are not affected by the new culture system; (iii) when fibrin-cultured autografts bearing stem cells are applied on massive full-thickness burns, the "take" of keratinocytes is high, reproducible, and permanent; and (iv) fibrin allows a significant reduction of the cost

  13. Predicting human epidermal melanin concentrations for different skin tones

    CSIR Research Space (South Africa)

    Smit, Jacoba E

    2011-07-01

    Full Text Available epidermal melanin concentrations for different skin tones JE Smit 1 , AE Karsten 2 , RW Sparrow 1 1 CSIR Biosciences, Pretoria, South Africa 2 CSIR National Laser Centre, Pretoria, South Africa Author e-mail address: KSmit...

  14. Cell-cell adhesion mediated by binding of membrane-anchored transforming growth factor α to epidermal growth factor receptors promotes cell proliferation

    International Nuclear Information System (INIS)

    Anklesaria, P.; Greenberger, J.S.; Teixido, J.; Laiho, M.; Massague, J.; Pierce, J.H.

    1990-01-01

    The precursor for transforming growth factor α, pro-TGF-α, is a cell surface glycoprotein that can establish contact with epidermal growth factor (EGF) receptors on adjacent cells. To examine whether the pro-TGF-α/EGF receptor pair can simultaneously mediate cell adhesion and promote cell proliferation, the authors have expressed pro-TGF-α in a bone marrow stromal cell line labeled with [ 35 S] cysteine. Expression of pro-TGF-α allows these cells to support long-term attachment of an EGF/interleukin-3-dependent hematopoietic progenitor cell line that expresses EGF receptors but is unable to adhere to normal stroma. This interaction is inhibited by soluble EGF receptor ligands. Further, the hematopoietic progenitor cells replicate their DNA while they are attached to the stromal cell layer and become foci of sustained cell proliferation. Thus, pro-TGF-α and the EGF receptor can function as mediators of intercellular adhesion and this interaction may promote a mitogenic response. They propose the term juxtacrine to designate this form of stimulation between adjacent cells

  15. Establishment of H2Mab-119, an Anti-Human Epidermal Growth Factor Receptor 2 Monoclonal Antibody, Against Pancreatic Cancer.

    Science.gov (United States)

    Yamada, Shinji; Itai, Shunsuke; Nakamura, Takuro; Chang, Yao-Wen; Harada, Hiroyuki; Suzuki, Hiroyoshi; Kaneko, Mika K; Kato, Yukinari

    2017-12-01

    Human epidermal growth factor receptor 2 (HER2) is overexpressed in breast cancer and is associated with poor clinical outcomes. In addition, HER2 expression has been reported in other cancers, such as gastric, colorectal, lung, and pancreatic cancers. An anti-HER2 humanized antibody, trastuzumab, leads to significant survival benefits in patients with HER2-overexpressing breast cancers and gastric cancers. Herein, we established a novel anti-HER2 monoclonal antibody (mAb), H 2 Mab-119 (IgG 1 , kappa), and characterized its efficacy against pancreatic cancers using flow cytometry, Western blot, and immunohistochemical analyses. H 2 Mab-119 reacted with pancreatic cancer cell lines, such as KLM-1, Capan-2, and MIA PaCa-2, but did not react with PANC-1 in flow cytometry analysis. Western blot analysis also revealed a moderate signal for KLM-1 and a weak signal for MIA PaCa-2, although H 2 Mab-119 reacted strongly with LN229/HER2 cells. Finally, immunohistochemical analyses with H 2 Mab-119 revealed sensitive and specific reactions against breast and colon cancers but did not react with pancreatic cancers, indicating that H 2 Mab-119 is useful for detecting HER2 overexpression in pancreatic cancers using flow cytometry and Western blot analyses.

  16. Simple preparation of plant epidermal tissue for laser microdissection and downstream quantitative proteome and carbohydrate analysis

    Directory of Open Access Journals (Sweden)

    Christian eFalter

    2015-03-01

    Full Text Available The outwardly directed cell wall and associated plasma membrane of epidermal cells represent the first layers of plant defense against intruding pathogens. Cell wall modifications and the formation of defense structures at sites of attempted pathogen penetration are decisive for plant defense. A precise isolation of these stress-induced structures would allow a specific analysis of regulatory mechanism and cell wall adaption. However, methods for large-scale epidermal tissue preparation from the model plant Arabidopsis thaliana, which would allow proteome and cell wall analysis of complete, laser-microdissected epidermal defense structures, have not been provided. We developed the adhesive tape – liquid cover glass technique for simple leaf epidermis preparation from A. thaliana, which is also applicable on grass leaves. This method is compatible with subsequent staining techniques to visualize stress-related cell wall structures, which were precisely isolated from the epidermal tissue layer by laser microdissection coupled to laser pressure catapulting. We successfully demonstrated that these specific epidermal tissue samples could be used for quantitative downstream proteome and cell wall analysis. The development of the adhesive tape – liquid cover glass technique for simple leaf epidermis preparation and the compatibility to laser microdissection and downstream quantitative analysis opens new possibilities in the precise examination of stress- and pathogen-related cell wall structures in epidermal cells. Because the developed tissue processing is also applicable on A. thaliana, well-established, model pathosystems that include the interaction with powdery mildews can be studied to determine principal regulatory mechanisms in plant-microbe interaction with their potential outreach into crop breeding.

  17. Combining laser-assisted microdissection (LAM) and RNA-seq allows to perform a comprehensive transcriptomic analysis of epidermal cells of Arabidopsis embryo.

    Science.gov (United States)

    Sakai, Kaori; Taconnat, Ludivine; Borrega, Nero; Yansouni, Jennifer; Brunaud, Véronique; Paysant-Le Roux, Christine; Delannoy, Etienne; Martin Magniette, Marie-Laure; Lepiniec, Loïc; Faure, Jean Denis; Balzergue, Sandrine; Dubreucq, Bertrand

    2018-01-01

    Genome-wide characterization of tissue- or cell-specific gene expression is a recurrent bottleneck in biology. We have developed a sensitive approach based on ultra-low RNA sequencing coupled to laser assisted microdissection for analyzing different tissues of the small Arabidopsis embryo. We first characterized the number of genes detected according to the quantity of tissue yield and total RNA extracted. Our results revealed that as low as 0.02 mm 2 of tissue and 50 pg of total RNA can be used without compromising the number of genes detected. The optimised protocol was used to compare the epidermal versus mesophyll cell transcriptomes of cotyledons at the torpedo-shaped stage of embryo development. The approach was validated by the recovery of well-known epidermal genes such AtML1 or AtPDF2 and genes involved in flavonoid and cuticular waxes pathways. Moreover, the interest and sensitivity of this approach were highlighted by the characterization of several transcription factors preferentially expressed in epidermal cells. This technical advance unlocks some current limitations of transcriptomic analyses and allows to investigate further and efficiently new biological questions for which only a very small amounts of cells need to be isolated. For instance, it paves the way to increasing the spatial accuracy of regulatory networks in developing small embryo of Arabidopsis or other plant tissues.

  18. Nuclear receptor NHR-25 is required for cell-shape dynamics during epidermal differentiation in Caenorhabditis elegans

    Czech Academy of Sciences Publication Activity Database

    Šilhánková, Marie; Jindra, Marek; Asahina, Masako

    2005-01-01

    Roč. 118, č. 1 (2005), s. 223-232 ISSN 0021-9533 R&D Projects: GA AV ČR KJB5022303; GA ČR GD524/03/H133 Institutional research plan: CEZ:AV0Z60220518 Keywords : Caenorhabditis elegans * nuclear receptor * epidermal stem cells Subject RIV: EB - Genetics ; Molecular Biology Impact factor: 6.543, year: 2005

  19. Epidermal growth factor in mammary glands and milk from rats

    DEFF Research Database (Denmark)

    Thulesen, J; Raaberg, Lasse; Nexø, Ebba

    1993-01-01

    Epidermal growth factor (EGF) is one of the major growth-promoting agents in milk. Using immunohistochemistry we localized EGF in the mammary glands of lactating rats to the luminal border of the secretory cells. Following proteolytic pretreatment of the histological sections, the EGF-immunoreact......Epidermal growth factor (EGF) is one of the major growth-promoting agents in milk. Using immunohistochemistry we localized EGF in the mammary glands of lactating rats to the luminal border of the secretory cells. Following proteolytic pretreatment of the histological sections, the EGF...

  20. Phase III randomized study comparing docetaxel plus trastuzumab with vinorelbine plus trastuzumab as first-line therapy of metastatic or locally advanced human epidermal growth factor receptor 2-positive breast cancer: the HERNATA study

    DEFF Research Database (Denmark)

    Andersson, Michael; Lidbrink, Elisabeth; Bjerre, Karsten

    2011-01-01

    To evaluate docetaxel or vinorelbine, both with trastuzumab, as first-line therapy of human epidermal growth factor receptor 2-positive advanced breast cancer.......To evaluate docetaxel or vinorelbine, both with trastuzumab, as first-line therapy of human epidermal growth factor receptor 2-positive advanced breast cancer....

  1. Chemical allergens stimulate human epidermal keratinocytes to produce lymphangiogenic vascular endothelial growth factor

    Energy Technology Data Exchange (ETDEWEB)

    Bae, Ok-Nam [College of Pharmacy, Institute of Pharmaceutical Science and Technology, Hanyang University, Ansan 426-791 (Korea, Republic of); Ahn, Seyeon; Jin, Sun Hee; Hong, Soo Hyun; Lee, Jinyoung [College of Pharmacy, Natural Products Research Institute, Seoul National University, Seoul 151-742 (Korea, Republic of); Kim, Eun-Sun [College of Pharmacy, Institute of Pharmaceutical Science and Technology, Hanyang University, Ansan 426-791 (Korea, Republic of); Jeong, Tae Cheon [College of Pharmacy, Yeungnam University, Gyeongsan 712-749 (Korea, Republic of); Chun, Young-Jin [College of Pharmacy, Chung-Ang University, Seoul 156-756 (Korea, Republic of); Lee, Ai-Young, E-mail: leeay@duih.org [Department of Dermatology, Dongguk University Ilsan Hospital, Goyang 410-773 (Korea, Republic of); Noh, Minsoo, E-mail: minsoo@alum.mit.edu [College of Pharmacy, Natural Products Research Institute, Seoul National University, Seoul 151-742 (Korea, Republic of)

    2015-03-01

    Allergic contact dermatitis (ACD) is a cell-mediated immune response that involves skin sensitization in response to contact with various allergens. Angiogenesis and lymphangiogenesis both play roles in the allergic sensitization process. Epidermal keratinocytes can produce vascular endothelial growth factor (VEGF) in response to UV irradiation and during wound healing. However, the effect of haptenic chemical allergens on the VEGF production of human keratinocytes, which is the primary contact site of toxic allergens, has not been thoroughly researched. We systematically investigated whether immune-regulatory cytokines and chemical allergens would lead to the production of VEGF in normal human keratinocytes (NHKs) in culture. VEGF production significantly increased when NHKs were treated with IFNγ, IL-1α, IL-4, IL-6, IL-17A, IL-22 or TNFα. Among the human sensitizers listed in the OECD Test Guideline (TG) 429, we found that CMI/MI, DNCB, 4-phenylenediamine, cobalt chloride, 2-mercaptobenzothiazole, citral, HCA, cinnamic alcohol, imidazolidinyl urea and nickel chloride all significantly upregulated VEGF production in NHKs. In addition, common human haptenic allergens such as avobenzone, formaldehyde and urushiol, also induced the keratinocyte-derived VEGF production. VEGF upregulation by pro-inflammatory stimuli, IFNγ, DNCB or formaldehyde is preceded by the production of IL-8, an acute inflammatory phase cytokine. Lymphangiogenic VEGF-C gene transcription was significantly increased when NHKs were treated with formaldehyde, DNCB or urushiol, while transcription of VEGF-A and VEGF-B did not change. Therefore, the chemical allergen-induced VEGF upregulation is mainly due to the increase in lymphangiogenic VEGF-C transcription in NHKs. These results suggest that keratinocyte-derived VEGF may regulate the lymphangiogenic process during the skin sensitization process of ACD. - Highlights: • Pro-inflammatory cytokines induced VEGF production in normal human

  2. Chemical allergens stimulate human epidermal keratinocytes to produce lymphangiogenic vascular endothelial growth factor

    International Nuclear Information System (INIS)

    Bae, Ok-Nam; Ahn, Seyeon; Jin, Sun Hee; Hong, Soo Hyun; Lee, Jinyoung; Kim, Eun-Sun; Jeong, Tae Cheon; Chun, Young-Jin; Lee, Ai-Young; Noh, Minsoo

    2015-01-01

    Allergic contact dermatitis (ACD) is a cell-mediated immune response that involves skin sensitization in response to contact with various allergens. Angiogenesis and lymphangiogenesis both play roles in the allergic sensitization process. Epidermal keratinocytes can produce vascular endothelial growth factor (VEGF) in response to UV irradiation and during wound healing. However, the effect of haptenic chemical allergens on the VEGF production of human keratinocytes, which is the primary contact site of toxic allergens, has not been thoroughly researched. We systematically investigated whether immune-regulatory cytokines and chemical allergens would lead to the production of VEGF in normal human keratinocytes (NHKs) in culture. VEGF production significantly increased when NHKs were treated with IFNγ, IL-1α, IL-4, IL-6, IL-17A, IL-22 or TNFα. Among the human sensitizers listed in the OECD Test Guideline (TG) 429, we found that CMI/MI, DNCB, 4-phenylenediamine, cobalt chloride, 2-mercaptobenzothiazole, citral, HCA, cinnamic alcohol, imidazolidinyl urea and nickel chloride all significantly upregulated VEGF production in NHKs. In addition, common human haptenic allergens such as avobenzone, formaldehyde and urushiol, also induced the keratinocyte-derived VEGF production. VEGF upregulation by pro-inflammatory stimuli, IFNγ, DNCB or formaldehyde is preceded by the production of IL-8, an acute inflammatory phase cytokine. Lymphangiogenic VEGF-C gene transcription was significantly increased when NHKs were treated with formaldehyde, DNCB or urushiol, while transcription of VEGF-A and VEGF-B did not change. Therefore, the chemical allergen-induced VEGF upregulation is mainly due to the increase in lymphangiogenic VEGF-C transcription in NHKs. These results suggest that keratinocyte-derived VEGF may regulate the lymphangiogenic process during the skin sensitization process of ACD. - Highlights: • Pro-inflammatory cytokines induced VEGF production in normal human

  3. Potential involvement of oxygen intermediates and glutathione depletion in UV-induced epidermal cell injury in vitro

    International Nuclear Information System (INIS)

    Hsieh, G.C.; Acosta, D.

    1991-01-01

    Generation of reactive oxygen species (ROS) and depletion of glutathione (GSH) are suggested as the cytotoxic mechanisms for UVB-induced cellular damage. Primary monolayer cultures of epidermal keratinocytes (KCs) prepared from the skin of neonatal rats were irradiated with UVB at levels of 0.25-3.0 J/cm 2 . Cytotoxicity was measured at 3, 6, and 12 hr after UVB radiation. Exposure of KCs to UVB resulted in time- and dose-related toxic responses as determined by plasma membrane integrity, lysosomal function and mitochondrial metabolic activity. Irradiated KCs generated superoxide in a dose-dependent manner when compared to sham-irradiated cells. Superoxide formation, which occurred before and concomitant with cell injury, was decreased by superoxide dismutase (SOD). Cell injury was also significantly prevented by ROS scavengers, SOD and catalase. Pretreatment of cells with endocytosis inhibitors, cytochalasin B and methylamine, suppressed the ability of SOD and catalase to protect keratinocytes from UVB-induced toxicity. Irradiation of cells with UVB caused rapid depletion of GSH to about 30% of unirradiated levels within 15 min. UVB-irradiation led to a rapid transient increase in GSH peroxidase activity, concomitant with a marked decrease in the GSH/GSSG ratio. After 1 hr., while the GSH/GSSG ratio remained low, the GSH peroxidase activity declined below the control levels in UVB-treated epidermal cells. Following extensive GSH depletion in cells preincubated with 0.1 mM buthiomine sulfoximine, KCs became strongly sensitized to the cytotoxic action of UVB. These results indicate that UVB-induced cell injury in cultured KCs may be mediated by ROs and that endogenous GSH may play an important protective role against the cytotoxic action of UVB

  4. In vitro dermal and epidermal cellular response to titanium alloy implants fabricated with electron beam melting.

    Science.gov (United States)

    Springer, Jessica Collins; Harrysson, Ola L A; Marcellin-Little, Denis J; Bernacki, Susan H

    2014-10-01

    Transdermal osseointegrated prostheses (TOPs) are emerging as an alternative to socket prostheses. Electron beam melting (EBM) is a promising additive manufacturing technology for manufacture of custom, freeform titanium alloy (Ti6Al4V) implants. Skin ongrowth for infection resistance and mechanical stability are critically important to the success of TOP, which can be influenced by material composition and surface characteristics. We assessed viability and proliferation of normal human epidermal keratinocytes (NHEK) and normal human dermal fibroblasts (NHDF) on several Ti6Al4V surfaces: solid polished commercial, solid polished EBM, solid unpolished EBM and porous unpolished EBM. Cell proliferation was evaluated at days 2 and 7 using alamarBlue(®) and cell viability was analyzed with a fluorescence-based live-dead assay after 1 week. NHDF and NHEK were viable and proliferated on all Ti6Al4V surfaces. NHDF proliferation was highest on commercial and EBM polished surfaces. NHEK was highest on commercial polished surfaces. All EBM Ti6Al4V discs exhibited an acceptable biocompatibility profile compared to solid Ti6Al4V discs from a commercial source for dermal and epidermal cells. EBM may be considered as an option for fabrication of custom transdermal implants. Copyright © 2014 IPEM. Published by Elsevier Ltd. All rights reserved.

  5. Molecular subclassification determined by human papillomavirus and epidermal growth factor receptor status is associated with the prognosis of oropharyngeal squamous cell carcinoma.

    Science.gov (United States)

    Nakano, Takafumi; Yamamoto, Hidetaka; Nakashima, Torahiko; Nishijima, Toshimitsu; Satoh, Masanobu; Hatanaka, Yui; Shiratsuchi, Hideki; Yasumatsu, Ryuji; Toh, Satoshi; Komune, Shizuo; Oda, Yoshinao

    2016-04-01

    Human papillomavirus (HPV) infection is an indicator of good response to chemoradiotherapy in oropharyngeal squamous cell carcinoma (OPSCC), and epidermal growth factor receptor (EGFR) is a molecular-therapeutic target in head and neck squamous cell carcinoma. Here we investigated the prevalence and prognostic significance of HPV infection and EGFR alteration in OPSCC. We analyzed the presence of high-risk HPV using in situ hybridization, protein expressions of p16 and EGFR using immunohistochemistry, and the EGFR gene copy number gain using chromogenic in situ hybridization (CISH) in 105 cases of OPSCC. The biopsy specimens before chemoradiotherapy were used for these analyses. HPV infection and p16 protein overexpression were detected in 53.3% and 52.4% of the OPSCCs, and each factor was associated with better overall survival (P = .0026 and P = .0026) and nonkeratinizing histology (P = .0002 and P = .0004), respectively. EGFR gene copy number gain (high polysomy or amplification) was detected in 12.4% of the OPSCCs and was correlated with EGFR protein overexpression (P = .0667) and worse overall survival (P CISH positive) were mutually exclusive. The HPV-negative/EGFR CISH-positive OPSCCs had significantly worse overall survival than did the HPV-positive/EGFR CISH-negative OPSCCs and HPV-negative/EGFR CISH-negative OPSCCs (P CISH-negative OPSCCs had favorable prognosis irrespective of HPV infection. Our results suggest that EGFR gene copy number gain-positive tumors represent an HPV-negative, aggressive subgroup of OPSCCs. The molecular subclassification of OPSCCs based on HPV infection and EGFR status may serve as important information for appropriate therapeutic strategy. Copyright © 2015 Elsevier Inc. All rights reserved.

  6. Spatiotemporal Expression of p63 in Mouse Epidermal Commitment

    Directory of Open Access Journals (Sweden)

    Qian Zhao

    2015-12-01

    Full Text Available The embryonic surface ectoderm is a simple flat epithelium consisting of cells that express the cytokeratins K8/K18. Before stratification, K5/K14 expression substitutes K8/K18 expression, marking the event called epidermal commitment. Previous studies show that the transcription factor p63 plays an essential role in epidermal commitment. However, detailed expression information of p63 during early epidermal development in mice is still unclear. We systematically studied the expression pattern of p63 in mouse epidermal commitment, together with K8 and K5. We show that p63 expression could be detected as early as E8.5 in mouse embryos preceding epidermal commitment. p63 expression first appears near the newly formed somites and the posterior part of the embryo, further expanding to the whole embryonic surface with particular enrichment in the first branchial arches and the limb buds. ΔNp63 is the major class of isoforms expressed in this period. Relative expression intensity of p63 depends on the embryonic position. In summary, there is a sequential and regular expression pattern of K8, p63 and K5 in mouse epidermal commitment. Our study not only contributes to understanding the early events during epidermal development but also provides a basal tool to study the function of p63 in mammals.

  7. Multistep change in epidermal growth factor receptors during spontaneous neoplastic progression in Chinese hamster embryo fibroblasts

    International Nuclear Information System (INIS)

    Wakshull, E.; Kraemer, P.M.; Wharton, W.

    1985-01-01

    Whole Chinese hamster embryo lineages have been shown to undergo multistep spontaneous neoplastic progression during serial passage in culture. The authors have studied the binding, internalization, and degradation of 125 I-labeled epidermal growth factor at four different stages of transformation. The whole Chinese hamster embryo cells lost cell surface epidermal growth factor receptors gradually during the course of neoplastic progression until only 10% of the receptor number present in the early-passage cells (precrisis) were retained in the late-passage cells (tumorigenic). No differences in internalization rates, chloroquine sensitivity, or ability to degrade hormone between the various passage levels were seen. No evidence for the presence in conditioned medium of transforming growth factors which might mask or down-regulate epidermal growth factor receptor was obtained. These results suggest that a reduction in cell surface epidermal growth factor receptor might be an early event during spontaneous transformation in whole Chinese hamster embryo cells

  8. Generation of Genetically Modified Organotypic Skin Cultures Using Devitalized Human Dermis.

    Science.gov (United States)

    Li, Jingting; Sen, George L

    2015-12-14

    Organotypic cultures allow the reconstitution of a 3D environment critical for cell-cell contact and cell-matrix interactions which mimics the function and physiology of their in vivo tissue counterparts. This is exemplified by organotypic skin cultures which faithfully recapitulates the epidermal differentiation and stratification program. Primary human epidermal keratinocytes are genetically manipulable through retroviruses where genes can be easily overexpressed or knocked down. These genetically modified keratinocytes can then be used to regenerate human epidermis in organotypic skin cultures providing a powerful model to study genetic pathways impacting epidermal growth, differentiation, and disease progression. The protocols presented here describe methods to prepare devitalized human dermis as well as to genetically manipulate primary human keratinocytes in order to generate organotypic skin cultures. Regenerated human skin can be used in downstream applications such as gene expression profiling, immunostaining, and chromatin immunoprecipitations followed by high throughput sequencing. Thus, generation of these genetically modified organotypic skin cultures will allow the determination of genes that are critical for maintaining skin homeostasis.

  9. "Cut-and-paste" manufacture of multiparametric epidermal electronic systems

    Science.gov (United States)

    Lu, Nanshu; Yang, Shixuan; Wang, Pulin

    2016-05-01

    Epidermal electronics is a class of noninvasive and unobstructive skin-mounted, tattoo-like sensors and electronics capable of vital sign monitoring and establishing human-machine interface. The high cost of manpower, materials, vacuum equipment, and photolithographic facilities associated with its manufacture greatly hinders the widespread use of disposable epidermal electronics. Here we report a cost and time effective, completely dry, benchtop "cut-and-paste" method for the freeform and portable manufacture of multiparametric epidermal sensor systems (ESS) within minutes. This versatile method works for all types of thin metal and polymeric sheets and is compatible with any tattoo adhesives or medical tapes. The resulting ESS are multimaterial and multifunctional and have been demonstrated to noninvasively but accurately measure electrophysiological signals, skin temperature, skin hydration, as well as respiratory rate. In addition, planar stretchable coils exploiting double-stranded serpentine design have been successfully applied as wireless, passive epidermal strain sensors.

  10. Europium-labeled epidermal growth factor and neurotensin: novel probes for receptor-binding studies.

    Science.gov (United States)

    Mazor, Ohad; Hillairet de Boisferon, Marc; Lombet, Alain; Gruaz-Guyon, Anne; Gayer, Batya; Skrzydelsky, Delphine; Kohen, Fortune; Forgez, Patricia; Scherz, Avigdor; Rostene, William; Salomon, Yoram

    2002-02-01

    We investigated the possibility of labeling two biologically active peptides, epidermal growth factor (EGF) and neurotensin (NT), with europium (Eu)-diethylenetriaminepentaacetic acid. More specifically, we tested them as probes in studying receptor binding using time-resolved fluorescence of Eu3+. The relatively simple synthesis yields ligands with acceptable binding characteristics similar to isotopically labeled derivatives. The binding affinity (Kd) of labeled Eu-EGF to human A431 epidermal carcinoid cells was 3.6 +/- 1.2 nM, similar to the reported Kd values of EGF, whereas the Kd of Eu-NT to human HT29 colon cancer cells (7.4 +/- 0.5 nM) or to Chinese hamster ovary (CHO) cells transfected with the high-affinity NT receptor (CHO-NT1) were about 10-fold higher than the Kd values of NT. The bioactivity of the Eu-labeled EGF as determined by stimulation of cultured murine D1 hematopoietic cell proliferation was nearly the same as that obtained with native EGF. The maximal stimulation of Ca2+ influx with NT and Eu-NT in CHO-NT1 cells was similar, but the respective K0.5 values were 20 pM and 1 nM, corresponding to differences in the binding affinities previously described. The results of these studies indicate that Eu labeling of peptide hormones and growth factor molecules ranging from 10(3) to 10(5) Da can be conveniently accomplished. Importantly, the Eu-labeled products are stable for approximately 2 years and are completely safe for laboratory use compared to the biohazardous radioligands. Thus, Eu-labeled peptides present an attractive alternative for commonly used radiolabeled ligands in biological studies in general and in receptor assays in particular.

  11. Morphometric analysis of epidermal differentiation in primary roots of Zea mays

    Science.gov (United States)

    Moore, R.; Smith, H. S.

    1990-01-01

    Epidermal differentiation in primary roots of Zea mays was divided into six cell types based on cellular shape and cytoplasmic appearance. These six cell types are: 1) apical protoderm, located at the tip of the root pole and characterized by periclinally flattened cells; 2) cuboidal protoderm, located approximately 230 microns from the root pole and characterized by cuboidal cells; 3) tabular epidermis, located approximately 450 microns from the root pole and characterized by anticlinally flattened cells; 4) cuboidal epidermis, located approximately 900 microns from the root pole and characterized by cuboidal cells having numerous small vacuoles; 5) vacuolate cuboidal epidermis, located approximately 1,500 microns from the root pole and characterized by cuboidal cells containing several large vacuoles; and 6) columnar epidermis, located approximately 2,200 microns from the root pole (i.e., at the beginning of the zone of elongation) and characterized by elongated cells. We also used stereology to quantify the cellular changes associated with epidermal differentiation. The quiescent center and the apical protoderm have significantly different ultrastructures. The relative volume of dictyosomes increases dramatically during the early stages of epidermal differentiation. This increase correlates inversely with the amount of coverage provided by the root cap and mucilage.

  12. T-cell receptor gamma delta bearing cells in normal human skin

    NARCIS (Netherlands)

    Bos, J. D.; Teunissen, M. B.; Cairo, I.; Krieg, S. R.; Kapsenberg, M. L.; Das, P. K.; Borst, J.

    1990-01-01

    T-cell antigen receptors (TCR) are divided into common alpha beta and less common gamma delta types. In the murine skin, TCR gamma delta+ cells have been reported to form the great majority of epidermal T lymphocytes. We have examined the relative contribution of TCR alpha beta+ and TCR gamma delta+

  13. Regulators of floral fragrance production and their target genes in petunia are not exclusively active in the epidermal cells of petals.

    NARCIS (Netherlands)

    Van Moerkercke, A.; Galván-Ampudia, C.S.; Verdonk, J.C.; Haring, M.A.; Schuurink, R.C.

    2012-01-01

    In which cells of the flower volatile biosynthesis takes place is unclear. In rose and snapdragon, some enzymes of the volatile phenylpropanoid/benzenoid pathway have been shown to be present in the epidermal cells of petals. It is therefore generally believed that the production of these compounds

  14. Reliability of using circulating tumor cells for detecting epidermal growth factor receptor mutation status in advanced non-small-cell lung cancer patients: a meta-analysis and systematic review

    Directory of Open Access Journals (Sweden)

    Hu F

    2018-03-01

    Full Text Available Fang Hu,* Xiaowei Mao,* Yujun Zhang, Xiaoxuan Zheng, Ping Gu, Huimin Wang, Xueyan ZhangDepartment of Pulmonary Medicine, Shanghai Chest Hospital, Shanghai Jiao Tong University, Shanghai, People’s Republic of China *These authors contributed equally to this workPurpose: To evaluate the clinical value of circulating tumor cells as a surrogate to detect epidermal growth factor receptor mutation in advanced non-small-cell lung cancer (NSCLC patients.Methods: We searched the electronic databases, and all articles meeting predetermined selection criteria were included in this study. The pooled sensitivity, specificity, positive likelihood ratio, negative likelihood ratio, and diagnostic odds ratio were calculated. The evaluation indexes of the diagnostic performance were the summary receiver operating characteristic curve and area under the summary receiver operating characteristic curve.Results: Eight eligible publications with 255 advanced NSCLC patients were included in this meta-analysis. Taking tumor tissues as reference, the pooled sensitivity, specificity, positive likelihood ratio, negative likelihood ratio, and diagnostic odds ratio of circulating tumor cells for detecting the epidermal growth factor receptor mutation status were found to be 0.82 (95% confidence interval [CI]: 0.50–0.95, 0.95 (95% CI: 0.24–1.00, 16.81 (95% CI: 0.33–848.62, 0.19 (95% CI: 0.06–0.64, and 86.81 (95% CI: 1.22–6,154.15, respectively. The area under the summary receiver operating characteristic curve was 0.92 (95% CI: 0.89–0.94. The subgroup analysis showed that the factors of blood volume, histological type, EGFR-tyrosine kinase inhibitor therapy, and circulating tumor cell and tissue test methods for EGFR accounted for the significant difference of the pooled specificity. No significant difference was found between the pooled sensitivity of the subgroup.Conclusion: Our meta-analysis confirmed that circulating tumor cells are a good surrogate for

  15. Limited human epidermal growth factor receptor 2 discordance in metastatic breast cancer patients treated with trastuzumab, a population based study

    NARCIS (Netherlands)

    van Rooijen, J.M.; de Munck, L.; de Graaf, J.C.; Siesling, Sabine; de Vries, Erik G.; Boers, J.E.

    2014-01-01

    Background Accurate assessment of the human epidermal growth factor receptor 2 (HER2) in breast cancer is essential for proper treatment decisions. HER2 positivity confirmation rates in breast cancer trials by central testing pathology laboratories were reported to be approximately 85%. The aim of

  16. Limited human epidermal growth factor receptor 2 discordance in metastatic breast cancer patients treated with trastuzumab, a population based study

    NARCIS (Netherlands)

    van Rooijen, J. M.; de Munck, L.; de Graaf, J. C.; Siesling, S.; de Vries, E. G.; Boers, J. E.

    Background: Accurate assessment of the human epidermal growth factor receptor 2 (HER2) in breast cancer is essential for proper treatment decisions. HER2 positivity confirmation rates in breast cancer trials by central testing pathology laboratories were reported to be approximately 85%. The aim of

  17. Culture technique of rabbit primary epidermal keratinocytes

    Directory of Open Access Journals (Sweden)

    Marini M

    2012-10-01

    Full Text Available The epidermis is the protective covering outer layer of the mammalian skin. The epidermal cells are stratified squamous epithelia which undergo continuous differentiation of loss and replacement of cells. Ninety per cent of epidermal cells consist of keratinocytes that are found in the basal layer of the stratified epithelium called epidermis. Keratinocytes are responsible for forming tight junctions with the nerves of the skin as well as in the process of wound healing. This article highlights the method of isolation and culture of rabbit primary epidermal keratinocytes in vitro. Approximately 2cm x 2cm oval shaped line was drawn on the dorsum of the rabbit to mark the surgical area. Then, the skin was carefully excised using a surgical blade and the target skin specimens harvested from the rabbits were placed in transport medium comprising of Dulbecco’s Modified Eagle Medium (DMEM and 1% of antibiotic-antimycotic solution. The specimens were transferred into a petri dish containing 70% ethanol and washed for 5 min followed by a wash in 1 x Dulbecco’s Phosphate Buffered Saline (DBPS. Then, the skin specimens were placed in DMEM and minced into small pieces using a scalpel. The minced pieces were placed in a centrifuge tube containing 0.6% Dispase and 1% antibiotic-antimycotic solution overnight at 4°C in a horizontal orientation. The epidermis layer (whitish, semi-transparent was separated from the dermis (pink, opaque, gooey with the aid of curved forceps by fixing the dermis with one pair of forceps while detaching the epidermis with the second pair. The cells were cultured at a density of 4 x 104 cells/cm2 in culture flask at 37°C and 5% CO2. The cell morphology of the keratinocytes was analyzed using inverted microscope.

  18. Biological interactions of quantum dot nanoparticles in skin and in human epidermal keratinocytes

    International Nuclear Information System (INIS)

    Zhang, Leshuai W.; Yu, William W.; Colvin, Vicki L.; Monteiro-Riviere, Nancy A.

    2008-01-01

    Quantum dots nanoparticles have novel optical properties for biomedical applications and electronics, but little is known about their skin permeability and interaction with cells. QD621 are nail-shaped nanoparticles that contain a cadmium/selenide core with a cadmium sulfide shell coated with polyethylene glycol (PEG) and are soluble in water. QD were topically applied to porcine skin flow-through diffusion cells to assess penetration at 1 μM, 2 μM and 10 μM for 24 h. QD were also studied in human epidermal keratinocytes (HEK) to determine cellular uptake, cytotoxicity and inflammatory potential. Confocal microscopy depicted the penetration of QD621 through the uppermost stratum corneum (SC) layers of the epidermis and fluorescence was found primarily in the SC and near hair follicles. QD were found in the intercellular lipid bilayers of the SC by transmission electron microscopy (TEM). Inductively coupled plasma-optical emission spectroscopy (ICP-OES) analysis for cadmium (Cd) and fluorescence for QD both did not detect Cd nor fluorescence signal in the perfusate at any time point or concentration. In HEK, viability decreased significantly (p < 0.05) from 1.25 nM to 10nM after 24 h and 48 h. There was a significant increase in IL-6 at 1.25 nM to 10 nM, while IL-8 increased from 2.5nM to 10nM after 24 h and 48 h. TEM of HEK treated with 10 nM of QD621 at 24 h depicted QD in cytoplasmic vacuoles and at the periphery of the cell membranes. These results indicate that porcine skin penetration of QD621 is minimal and limited primarily to the outer SC layers, yet if the skin were damaged allowing direct QD exposure to skin or keratinocytes, an inflammatory response could be initiated

  19. Assessment of the Developmental Toxicity of Epidermal Growth ...

    African Journals Online (AJOL)

    Purpose: To determine whether epidermal growth factor (EGF) is involved in reproductive developmental toxicity, using the embryonic stem cell test (EST), as well as ascertain how EGF influences embryonic development. Methods: To predict developmental toxicity on the basis of reducing cell viability and inhibition of ...

  20. Repair of ultraviolet light damage to the DNA of cultured human epidermal keratinocytes and fibroblasts

    International Nuclear Information System (INIS)

    Taichman, L.B.; Setlow, R.B.

    1979-01-01

    Pure cultures of dermal fibroblasts and epidermal keroatinocytes have been obtained from a single biopsy of newborn foreskin. The cells were labeled, exposed to several doses of uv light, and allowed to repair in the dark for 16 h. The number of pyrimidine dimers before and after repair was assessed by measuring the numbers of sites in the DNA sensitive to a specific uv endonuclease. At all doses used, the extent of repair was similar in the cultured keratinocytes and cultured fibroblasts

  1. Microneedle fractional radiofrequency increases epidermal hyaluronan and reverses age-related epidermal dysfunction.

    Science.gov (United States)

    Lee, Hee Jung; Seo, Seong Rak; Yoon, Moon Soo; Song, Ji-Ye; Lee, Eun Young; Lee, Sang Eun

    2016-02-01

    Skin aging results in physiological alterations in keratinocyte activities and epidermal function, as well as dermal changes. Yet, the cellular and molecular mechanisms that cause epidermal dysfunction during skin aging are not well understood. Recently, the role of epidermal hyaluronan (HA) as an active regulator of dynamic cellular processes is getting attention and alterations in HA metabolism are thought to be important in age-related epidermal dysfunction. Microneedle fractional radiofrequency (RF) has shown effects for improving cutaneous aging. However, little is known about the effects of fractional RF on the epidermal HA and epidermal function. We investigated the effect of microneedle fractional RF on the expression of epidermal HA in young and aged mice epidermis. We performed fractional RF on the dorsal skin of 30 8-week-old (young) hairless mice and 15 47-week-old (aged) C57BL/6J mice. Skin samples were collected on day 1, 3, and 7. HA content was measured by ELISA. Gene expressions of CD 44, HABP4, and HAS3 were measured using real time RT-PCR. Immunohistochemistry for detection of HA, CD44, PCNA, and filaggrin were performed. HA content and the mRNA levels of HABP4, CD44, and HAS3 were upregulated in the epidermis of both young and aged mice after microneedle fractional RF treatment. The expression was increased from day 1 after treatment and increased expression persisted on day 7. Fractional RF treatment significantly increased PCNA and filaggrin expression only in the aged mice skin. Microneedle fractional RF increased epidermal HA and CD44 expression in both young and aged mice and reversed age-related epidermal dysfunction especially in aged mice, suggesting a new mechanism involved in the skin rejuvenation effect of microneedle fractional RF. © 2015 Wiley Periodicals, Inc.

  2. Optimal Therapeutic Strategy for Non-small Cell Lung Cancer with Mutated Epidermal Growth Factor Receptor

    Directory of Open Access Journals (Sweden)

    Zhong SHI

    2015-02-01

    Full Text Available Although epidermal growth factor receptor tyrosine kinase inhibitors (EGFR-TKIs have been widely used in non-small cell lung cancer (NSCLC patients, it is still controversial about how to combine EGFR-TKI with chemotherapy and other targeted drugs. We have made a summary on the current therapeutic models of EGFR-TKI combined with chemotherapy/bevacizumab in this review and aimed to find the optimal therapeutic strategy for NSCLC patients with EGFR mutation.

  3. High Efficient Expression, Purification, and Functional Characterization of Native Human Epidermal Growth Factor in Escherichia coli

    Directory of Open Access Journals (Sweden)

    Yi Ma

    2016-01-01

    Full Text Available Human epidermal growth factor (hEGF is a small, mitotic growth polypeptide that promotes the proliferation of various cells and is widely applied in clinical practices. However, high efficient expression of native hEGF in Escherichia coli has not been successful, since three disulfide bonds in monomer hEGF made it unable to fold into correct 3D structure using in vivo system. To tackle this problem, we fused Mxe GyrA intein (Mxe at the C-terminal of hEGF followed by small ubiquitin-related modifier (SUMO and 10x His-tag to construct a chimeric protein hEGF-Mxe-SUMO-H10. The fusion protein was highly expressed at the concentration of 281 mg/L and up to 59.5% of the total cellular soluble proteins. The fusion protein was purified by affinity chromatography and 29.4 mg/L of native hEGF can be released by thiol induced N-terminal cleavage without any proteases. The mitotic activity in Balb/c 3T3 cells is proliferated by commercial and recombinant hEGF measured with methylthiazolyldiphenyl-tetrazolium bromide (MTT assay which indicated that recombinant hEGF protein stimulates the cell proliferation similar to commercial protein. This study significantly improved the yield and reduced the cost of hEGF in the recombinant E. coli system and could be a better strategy to produce native hEGF for pharmaceutical development.

  4. High Efficient Expression, Purification, and Functional Characterization of Native Human Epidermal Growth Factor in Escherichia coli.

    Science.gov (United States)

    Ma, Yi; Yu, Jieying; Lin, Jinglian; Wu, Shaomin; Li, Shan; Wang, Jufang

    2016-01-01

    Human epidermal growth factor (hEGF) is a small, mitotic growth polypeptide that promotes the proliferation of various cells and is widely applied in clinical practices. However, high efficient expression of native hEGF in Escherichia coli has not been successful, since three disulfide bonds in monomer hEGF made it unable to fold into correct 3D structure using in vivo system. To tackle this problem, we fused Mxe GyrA intein (Mxe) at the C-terminal of hEGF followed by small ubiquitin-related modifier (SUMO) and 10x His-tag to construct a chimeric protein hEGF-Mxe-SUMO-H 10 . The fusion protein was highly expressed at the concentration of 281 mg/L and up to 59.5% of the total cellular soluble proteins. The fusion protein was purified by affinity chromatography and 29.4 mg/L of native hEGF can be released by thiol induced N-terminal cleavage without any proteases. The mitotic activity in Balb/c 3T3 cells is proliferated by commercial and recombinant hEGF measured with methylthiazolyldiphenyl-tetrazolium bromide (MTT) assay which indicated that recombinant hEGF protein stimulates the cell proliferation similar to commercial protein. This study significantly improved the yield and reduced the cost of hEGF in the recombinant E. coli system and could be a better strategy to produce native hEGF for pharmaceutical development.

  5. Oxygen dependency of epidermal growth factor receptor binding and DNA synthesis of rat hepatocytes

    International Nuclear Information System (INIS)

    Hirose, Tetsuro; Terajima, Hiroaki; Yamauchi, Akira

    1997-01-01

    Background/Aims: Changes in oxygen availability modulate replicative responses in several cell types, but the effects on hepatocyte replication remain unclear. We have studied the effects of transient nonlethal hypoxia on epidermal growth factor receptor binding and epidermal growth factor-induced DNA synthesis of rat hepatocytes. Methods: Lactate dehydrogenase activity in culture supernatant, intracellular adenosine triphosphate content, 125 I-epidermal growth factor specific binding, epidermal growth factor receptor protein expression, and 3 H-thymidine incorporation were compared between hepatocytes cultured in hypoxia and normoxia. Results: Hypoxia up to 3 h caused no significant increase in lactate dehydrogenase activity in the culture supernatant, while intracellular adenosine triphosphate content decreased time-dependently and was restored to normoxic levels by reoxygenation (nonlethal hypoxia). Concomitantly, 125 I-epidermal growth factor specific binding to hepatocytes decreased time-dependently (to 54.1% of normoxia) and was restored to control levels by reoxygenation, although 125 I-insulin specific binding was not affected. The decrease in 125 I-epidermal growth factor specific binding was explained by the decrease in the number or available epidermal growth factor receptors (21.37±3.08 to 12.16±1.42 fmol/10 5 cells), while the dissociation constant of the receptor was not affected. The change in the number of available receptors was not considered to be due to receptor degradation-resynthesis, since immuno-detection of the epidermal growth factor receptor revealed that the receptor protein expression did not change during hypoxia and reoxygenation, and since neither actinomycin D nor cycloheximide affected the recovery of 125 I-epidermal growth factor binding by reoxygenation. Inhibition of epidermal growth factor-induced DNA synthesis after hypoxia (to 75.4% of normoxia by 3 h hypoxia) paralleled the decrease in 125 I-epidermal growth factor binding

  6. Transient gibberellin application promotes Arabidopsis thaliana hypocotyl cell elongation without maintaining transverse orientation of microtubules on the outer tangential wall of epidermal cells

    KAUST Repository

    Sauret-Güeto, Susanna

    2011-11-25

    The phytohormone gibberellin (GA) promotes plant growth by stimulating cellular expansion. Whilst it is known that GA acts by opposing the growth-repressing effects of DELLA proteins, it is not known how these events promote cellular expansion. Here we present a time-lapse analysis of the effects of a single pulse of GA on the growth of Arabidopsis hypocotyls. Our analyses permit kinetic resolution of the transient growth effects of GA on expanding cells. We show that pulsed application of GA to the relatively slowly growing cells of the unexpanded light-grown Arabidopsis hypocotyl results in a transient burst of anisotropic cellular growth. This burst, and the subsequent restoration of initial cellular elongation rates, occurred respectively following the degradation and subsequent reappearance of a GFP-tagged DELLA (GFP-RGA). In addition, we used a GFP-tagged α-tubulin 6 (GFP-TUA6) to visualise the behaviour of microtubules (MTs) on the outer tangential wall (OTW) of epidermal cells. In contrast to some current hypotheses concerning the effect of GA on MTs, we show that the GA-induced boost of hypocotyl cell elongation rate is not dependent upon the maintenance of transverse orientation of the OTW MTs. This confirms that transverse alignment of outer face MTs is not necessary to maintain rapid elongation rates of light-grown hypocotyls. Together with future studies on MT dynamics in other faces of epidermal cells and in cells deeper within the hypocotyl, our observations advance understanding of the mechanisms by which GA promotes plant cell and organ growth. © 2011 Blackwell Publishing Ltd.

  7. Aberrant Wound Healing in an Epidermal Interleukin-4 Transgenic Mouse Model of Atopic Dermatitis

    Science.gov (United States)

    Zhao, Yan; Bao, Lei; Chan, Lawrence S.; DiPietro, Luisa A.; Chen, Lin

    2016-01-01

    Wound healing in a pre-existing Th2-dominated skin milieu was assessed by using an epidermal specific interleukin-4 (IL-4) transgenic (Tg) mouse model, which develops a pruritic inflammatory skin condition resembling human atopic dermatitis. Our results demonstrated that IL-4 Tg mice had delayed wound closure and re-epithelialization even though these mice exhibited higher degrees of epithelial cell proliferation. Wounds in IL-4 Tg mice also showed a marked enhancement in expression of inflammatory cytokines/chemokines, elevated infiltration of inflammatory cells including neutrophils, macrophages, CD3+ lymphocytes, and epidermal dendritic T lymphocytes. In addition, these mice exhibited a significantly higher level of angiogenesis as compared to wild type mice. Furthermore, wounds in IL-4 Tg mice presented with larger amounts of granulation tissue, but had less expression and deposition of collagen. Taken together, an inflamed skin condition induced by IL-4 has a pronounced negative influence on the healing process. Understanding more about the pathogenesis of wound healing in a Th2- dominated environment may help investigators explore new potential therapeutic strategies. PMID:26752054

  8. Effects of recombinant human epidermal growth factor (rhEGF) on experimental radiation-induced oral mucositis in rats

    International Nuclear Information System (INIS)

    Jung, Kwon Il; Kim, Sun Hee; Moon, Soo Young; Kim, Yeon Wha; Hong, Joon Pio; Lee, Sang Wook; Kim, Hyun Sook

    2006-01-01

    Oral mucositis is a common toxicity of radiation or chemotherapy, which is used a treatment for head and neck cancer. We investigated effects of recombinant human epidermal growth factor (rhEGF) on radiation-induced oral mucositis in rat model. Spraque-Dawley rats (7 per group) exposed to a single dose of 25 Gy (day 0) on their head, except for one group, were randomly divided into un-treated, vehicle-treated, and two rhEGF-treated groups. Rats were topically applied with rhEGF (15 or 30 μ g/oral cavity/day) or vehicle to their oral mucosa. Survival rate of rats, weight changes, and food intakes were examined from day 0 to 18 after radiation. Histology study was performed from oral mucosa of rats at day 7 and 18 after radiation. rhEGF-treated groups (15 or 30 μ g/day) showed all survival rate 33%, whereas un-treated and vehicle-treated groups showed all survival rate 0% at the end of experiment. rhEGF-treated groups statistically had less weight loss compared to vehicle-treated group from day 2 to 7 after radiation. Food intake of rats with rhEGF treatment turned to increase at day 14 after radiation. At 7 day after radiation, un-treated and vehicle-treated groups showed severe pseudomembraneous of ulcerative oral mucositis. On the other hand, rhEGF-treated groups had no more than cellular swelling and degeneration of epidermal cells in oral mucosa of rats. These results suggest that rhEGF has significantly positive effects on radiation-induced oral mucositis in rats. rhEGF display a therapeutic potential on a clinical level

  9. The Epidermal Growth Factor Receptor Responsive miR-125a Represses Mesenchymal Morphology in Ovarian Cancer Cells

    Directory of Open Access Journals (Sweden)

    Karen D. Cowden Dahl

    2009-11-01

    Full Text Available The epithelial-to-mesenchymal transition (EMT that occurs during embryonic development is recapitulated during tumor metastasis. Important regulators of this process include growth factors, transcription factors, and adhesion molecules. New evidence suggests that microRNA (miRNA activity contributes to metastatic progression and EMT; however, the mechanisms leading to altered miRNA expression during cancer progression remain poorly understood. Importantly, overexpression of the epidermal growth factor receptor (EGFR in ovarian cancer correlates with poor disease outcome and induces EMT in ovarian cancer cells. We report that EGFR signaling leads to transcriptional repression of the miRNA miR-125a through the ETS family transcription factor PEA3. Overexpression of miR-125a induces conversion of highly invasive ovarian cancer cells from a mesenchymal to an epithelial morphology, suggesting miR-125a is a negative regulator of EMT. We identify AT-rich interactive domain 3B (ARID3B as a target of miR-125a and demonstrate that ARID3B is overexpressed in human ovarian cancer. Repression of miR-125a through growth factor signaling represents a novel mechanism for regulating ovarian cancer invasive behavior.

  10. Antimicrobial peptides and pro-inflammatory cytokines are differentially regulated across epidermal layers following bacterial stimuli.

    Science.gov (United States)

    Percoco, Giuseppe; Merle, Chloé; Jaouen, Thomas; Ramdani, Yasmina; Bénard, Magalie; Hillion, Mélanie; Mijouin, Lily; Lati, Elian; Feuilloley, Marc; Lefeuvre, Luc; Driouich, Azeddine; Follet-Gueye, Marie-Laure

    2013-12-01

    The skin is a natural barrier between the body and the environment and is colonised by a large number of microorganisms. Here, we report a complete analysis of the response of human skin explants to microbial stimuli. Using this ex vivo model, we analysed at both the gene and protein level the response of epidermal cells to Staphylococcus epidermidis (S. epidermidis) and Pseudomonas fluorescens (P. fluorescens), which are present in the cutaneous microbiota. We showed that both bacterial species affect the structure of skin explants without penetrating the living epidermis. We showed by real-time quantitative polymerase chain reaction (qPCR) that S. epidermidis and P. fluorescens increased the levels of transcripts that encode antimicrobial peptides (AMPs), including human β defensin (hBD)2 and hBD3, and the pro-inflammatory cytokines interleukin (IL)-1α and (IL)-1-β, as well as IL-6. In addition, we analysed the effects of bacterial stimuli on the expression profiles of genes related to innate immunity and the inflammatory response across the epidermal layers, using laser capture microdissection (LCM) coupled to qPCR. We showed that AMP transcripts were principally upregulated in suprabasal keratinocytes. Conversely, the expression of pro-inflammatory cytokines was upregulated in the lower epidermis. These findings were confirmed by protein localisation using specific antibodies coupled to optical or electron microscopy. This work underscores the potential value of further studies that use LCM on human skin explants model to study the roles and effects of the epidermal microbiota on human skin physiology. © 2013 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.

  11. Cell type-specific responses to salinity - the epidermal bladder cell transcriptome of Mesembryanthemum crystallinum.

    Science.gov (United States)

    Oh, Dong-Ha; Barkla, Bronwyn J; Vera-Estrella, Rosario; Pantoja, Omar; Lee, Sang-Yeol; Bohnert, Hans J; Dassanayake, Maheshi

    2015-08-01

    Mesembryanthemum crystallinum (ice plant) exhibits extreme tolerance to salt. Epidermal bladder cells (EBCs), developing on the surface of aerial tissues and specialized in sodium sequestration and other protective functions, are critical for the plant's stress adaptation. We present the first transcriptome analysis of EBCs isolated from intact plants, to investigate cell type-specific responses during plant salt adaptation. We developed a de novo assembled, nonredundant EBC reference transcriptome. Using RNAseq, we compared the expression patterns of the EBC-specific transcriptome between control and salt-treated plants. The EBC reference transcriptome consists of 37 341 transcript-contigs, of which 7% showed significantly different expression between salt-treated and control samples. We identified significant changes in ion transport, metabolism related to energy generation and osmolyte accumulation, stress signalling, and organelle functions, as well as a number of lineage-specific genes of unknown function, in response to salt treatment. The salinity-induced EBC transcriptome includes active transcript clusters, refuting the view of EBCs as passive storage compartments in the whole-plant stress response. EBC transcriptomes, differing from those of whole plants or leaf tissue, exemplify the importance of cell type-specific resolution in understanding stress adaptive mechanisms. No claim to original US government works. New Phytologist © 2015 New Phytologist Trust.

  12. EPIDERMAL MORPHOLOGY OF WEST AFRICAN OKRA ...

    African Journals Online (AJOL)

    Administrator

    stem peels were obtained from a slight cut on the tenth internodes. Peels from fruit ... xia l su rfa ce. A b a xia l su rfa ce. Adaxial surface. Abaxial surface. L e n g th. (µ m. ) ..... Variations in epidermal cell shape of both adaxial and abaxial surfaces ...

  13. The biologic role of ganglioside in neuronal differentiation--effects of GM1 ganglioside on human neuroblastoma SH-SY5Y cells.

    OpenAIRE

    Lee, M. C.; Lee, W. S.; Park, C. S.; Juhng, S. W.

    1994-01-01

    Human neuroblastoma SH-SY5Y cell is a cloned cell line which has many attractive features for the study of neuronal proliferation and neurite outgrowth, because it has receptors for insulin, IGF-I and PDGF. Gangliosides are sialic acid containing glycosphingolipids which form an integral part of the plasma membrane of many mammalian cells. They inhibit cell growth mediated by tyrosine kinase receptors and ligand-stimulated tyrosine kinase activity, and autophosphorylation of EGF(epidermal gro...

  14. Internalization and Recycling of the HER2 Receptor on Human Breast Adenocarcinoma Cells Treated with Targeted Phototoxic Protein DARPinminiSOG

    Science.gov (United States)

    Shilova, O. N.; Proshkina, G. M.; Lebedenko, E. N.; Deyev, S. M.

    2015-01-01

    Design and evaluation of new high-affinity protein compounds that can selectively and efficiently destroy human cancer cells are a priority research area in biomedicine. In this study we report on the ability of the recombinant phototoxic protein DARPin-miniSOG to interact with breast adenacarcinoma human cells overexpressing the extracellular domain of human epidermal growth factor receptor 2 (HER2). It was found that the targeted phototoxin DARPin-miniSOG specifically binds to the HER2 with following internalization and slow recycling back to the cell membrane. An insight into the role of DARPin-miniSOG in HER2 internalization could contribute to the treatment of HER2-positive cancer using this phototoxic protein. PMID:26483969

  15. Development of an affinity-matured humanized anti-epidermal growth factor receptor antibody for cancer immunotherapy.

    Science.gov (United States)

    Nakanishi, Takeshi; Maru, Takamitsu; Tahara, Kazuhiro; Sanada, Hideaki; Umetsu, Mitsuo; Asano, Ryutaro; Kumagai, Izumi

    2013-02-01

    We showed previously that humanization of 528, a murine anti-epidermal growth factor receptor (EGFR) antibody, causes reduced affinity for its target. Here, to improve the affinity of the humanized antibody for use in cancer immunotherapy, we constructed phage display libraries focused on the complementarity-determining regions (CDRs) of the antibody and carried out affinity selection. Two-step selections using libraries constructed in a stepwise manner enabled a 32-fold affinity enhancement of humanized 528 (h528). Thermodynamic analysis of the interactions between the variable domain fragment of h528 (h528Fv) mutants and the soluble extracellular domain of EGFR indicated that the h528Fv mutants obtained from the first selection showed a large increase in negative enthalpy change due to binding, resulting in affinity enhancement. Furthermore, mutants from the second selection showed a decrease in entropy loss, which led to further affinity maturation. These results suggest that a single mutation in the heavy chain variable domain (i.e. Tyr(52) to Trp) enthalpically contributed for overcoming the energetic barrier to the antigen-antibody interaction, which was a major hurdle for the in vitro affinity maturation of h528. We reported previously that the humanized bispecific diabody hEx3 Db, which targets EGFR and CD3, shows strong anti-tumor activity. hEx3 Db mutants, in which the variable domains of h528 were replaced with those of the affinity-enhanced mutants, were prepared and characterized. In a growth inhibition assay of tumor cells, the hEx3 Db mutants showed stronger anti-tumor activity than that of hEx3 Db, suggesting that affinity enhancement of h528Fv enhances the anti-tumor activity of the bispecific diabody.

  16. Expression of the epidermal growth factor system in human endometrium during the menstrual cycle

    DEFF Research Database (Denmark)

    Ejskjaer, Kirsten; Sørensen, B S; Poulsen, Steen Seier

    2005-01-01

    The epidermal growth factor (EGF) system is ubiquitous in humans and plays fundamental roles in embryogenesis, development, proliferation and differentiation. As the endometrium of fertile women is characterized by proliferation and differentiation, we hypothesize a role for the EGF system....... Fourteen premenopausal women had endometrial samples removed on day 6 +/- 1 and day 6 +/- 1 and 12 +/- 1 after ovulation during one menstrual cycle. RNA was extracted and analysed by real-time PCR, and immunohistochemistry was performed to localize the components of the EGF system. Human EGF Receptor 1...... (HER1) showed highest expression during the proliferative phase, HER2 and HER4 during the early and HER3 during the late secretory phase. Amphiregulin (AR) and transforming growth factor alpha (TGFalpha) expression is highest in proliferative phase. Heparin binding (HB)-EGF and betacellulin (BCL) show...

  17. Radiolabeled cetuximab: dose optimization for epidermal growth factor receptor imaging in a head-and-neck squamous cell carcinoma model

    NARCIS (Netherlands)

    Hoeben, B.A.W.; Molkenboer-Kuenen, J.D.M.; Oyen, W.J.G.; Peeters, W.J.M.; Kaanders, J.H.A.M.; Bussink, J.; Boerman, O.C.

    2011-01-01

    Noninvasive imaging of the epidermal growth factor receptor (EGFR) in head-and-neck squamous cell carcinoma could be of value to select patients for EGFR-targeted therapy. We assessed dose optimization of (111) Indium-DTPA-cetuximab ((111) In-cetuximab) for EGFR imaging in a head-and-neck squamous

  18. Embryonic maturation of epidermal Merkel cells is controlled by a redundant transcription factor network.

    Science.gov (United States)

    Perdigoto, Carolina N; Bardot, Evan S; Valdes, Victor J; Santoriello, Francis J; Ezhkova, Elena

    2014-12-01

    Merkel cell-neurite complexes are located in touch-sensitive areas of the mammalian skin and are involved in recognition of the texture and shape of objects. Merkel cells are essential for these tactile discriminations, as they generate action potentials in response to touch stimuli and induce the firing of innervating afferent nerves. It has been shown that Merkel cells originate from epidermal stem cells, but the cellular and molecular mechanisms of their development are largely unknown. In this study, we analyzed Merkel cell differentiation during development and found that it is a temporally regulated maturation process characterized by a sequential activation of Merkel cell-specific genes. We uncovered key transcription factors controlling this process and showed that the transcription factor Atoh1 is required for initial Merkel cell specification. The subsequent maturation steps of Merkel cell differentiation are controlled by cooperative function of the transcription factors Sox2 and Isl1, which physically interact and work to sustain Atoh1 expression. These findings reveal the presence of a robust transcriptional network required to produce functional Merkel cells that are required for tactile discrimination. © 2014. Published by The Company of Biologists Ltd.

  19. Size-dependent effects of tungsten carbide-cobalt particles on oxygen radical production and activation of cell signaling pathways in murine epidermal cells

    International Nuclear Information System (INIS)

    Ding, M.; Kisin, E.R.; Zhao, J.; Bowman, L.; Lu, Y.; Jiang, B.; Leonard, S.; Vallyathan, V.; Castranova, V.; Murray, A.R.; Fadeel, B.; Shvedova, A.A.

    2009-01-01

    Hard metal or cemented carbide consists of a mixture of tungsten carbide (WC) (85%) and metallic cobalt (Co) (5-15%). WC-Co is considered to be potentially carcinogenic to humans. However, no comparison of the adverse effects of nano-sized WC-Co particles is available to date. In the present study, we compared the ability of nano- and fine-sized WC-Co particles to form free radicals and propensity to activate the transcription factors, AP-1 and NF-κB, along with stimulation of mitogen-activated protein kinase (MAPK) signaling pathways in a mouse epidermal cell line (JB6 P + ). Our results demonstrated that nano-WC-Co generated a higher level of hydroxyl radicals, induced greater oxidative stress, as evidenced by a decrease of GSH levels, and caused faster JB6 P + cell growth/proliferation than observed after exposure of cells to fine WC-Co. In addition, nano-WC-Co activated AP-1 and NF-κB more efficiently in JB6 +/+ cells as compared to fine WC-Co. Experiments using AP-1-luciferase reporter transgenic mice confirmed the activation of AP-1 by nano-WC-Co. Nano- and fine-sized WC-Co particles also stimulated MAPKs, including ERKs, p38, and JNKs with significantly higher potency of nano-WC-Co. Finally, co-incubation of the JB6 +/+ cells with N-acetyl-cysteine decreased AP-1 activation and phosphorylation of ERKs, p38 kinase, and JNKs, thus suggesting that oxidative stress is involved in WC-Co-induced toxicity and AP-1 activation.

  20. Single-cell-type quantitative proteomic and ionomic analysis of epidermal bladder cells from the halophyte model plant Mesembryanthemum crystallinum to identify salt-responsive proteins.

    Science.gov (United States)

    Barkla, Bronwyn J; Vera-Estrella, Rosario; Raymond, Carolyn

    2016-05-10

    Epidermal bladder cells (EBC) are large single-celled, specialized, and modified trichomes found on the aerial parts of the halophyte Mesembryanthemum crystallinum. Recent development of a simple but high throughput technique to extract the contents from these cells has provided an opportunity to conduct detailed single-cell-type analyses of their molecular characteristics at high resolution to gain insight into the role of these cells in the salt tolerance of the plant. In this study, we carry out large-scale complementary quantitative proteomic studies using both a label (DIGE) and label-free (GeLC-MS) approach to identify salt-responsive proteins in the EBC extract. Additionally we perform an ionomics analysis (ICP-MS) to follow changes in the amounts of 27 different elements. Using these methods, we were able to identify 54 proteins and nine elements that showed statistically significant changes in the EBC from salt-treated plants. GO enrichment analysis identified a large number of transport proteins but also proteins involved in photosynthesis, primary metabolism and Crassulacean acid metabolism (CAM). Validation of results by western blot, confocal microscopy and enzyme analysis helped to strengthen findings and further our understanding into the role of these specialized cells. As expected EBC accumulated large quantities of sodium, however, the most abundant element was chloride suggesting the sequestration of this ion into the EBC vacuole is just as important for salt tolerance. This single-cell type omics approach shows that epidermal bladder cells of M. crystallinum are metabolically active modified trichomes, with primary metabolism supporting cell growth, ion accumulation, compatible solute synthesis and CAM. Data are available via ProteomeXchange with identifier PXD004045.

  1. Simultaneous screening of four epidermal growth factor receptor antagonists from Curcuma longa via cell membrane chromatography online coupled with HPLC-MS.

    Science.gov (United States)

    Sun, Meng; Ma, Wei-na; Guo, Ying; Hu, Zhi-gang; He, Lang-chong

    2013-07-01

    The epidermal growth factor receptors (EGFRs) are significant targets for screening active compounds. In this work, an analytical method was established for rapid screening, separation, and identification of EGFRs antagonists from Curcuma longa. Human embryonic kidney 293 cells with a steadily high expression of EGFRs were used to prepare the cell membrane stationary phase in a cell membrane chromatography model for screening active compounds. Separation and identification of the retention chromatographic peaks was achieved by HPLC-MS. The active sites, docking extents and inhibitory effects of the active compounds were also demonstrated. The screening result found that ar-turmerone, curcumin, demethoxycurcumin, and bisdemethoxycurcumin from Curcuma longa could be active components in a similar manner to gefitinib. Biological trials showed that all of four compounds can inhibit EGFRs protein secretion and cell growth in a dose-dependent manner, and downregulate the phosphorylation of EGFRs. This analytical method demonstrated fast and effective characteristics for screening, separation and identification of the active compounds from a complex system and should be useful for drug discovery with natural medicinal herbs. © 2013 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  2. Co-inhibition of epidermal growth factor receptor and insulin-like growth factor receptor 1 enhances radiosensitivity in human breast cancer cells

    International Nuclear Information System (INIS)

    Li, Ping; Veldwijk, Marlon R; Zhang, Qing; Li, Zhao-bin; Xu, Wen-cai; Fu, Shen

    2013-01-01

    Over-expression of epidermal growth factor receptor (EGFR) or insulin-like growth factor-1 receptor (IGF-1R) have been shown to closely correlate with radioresistance of breast cancer cells. This study aimed to investigate the impact of co-inhibition of EGFR and IGF-1R on the radiosensitivity of two breast cancer cells with different profiles of EGFR and IGF-1R expression. The MCF-7 (EGFR +/−, IGF-1R +++) and MDA-MB-468 (EGFR +++, IGF-1R +++) breast cancer cell lines were used. Radiosensitizing effects were determined by colony formation assay. Apoptosis and cell cycle distribution were measured by flow cytometry. Phospho-Akt and phospho-Erk1/2 were quantified by western blot. In vivo studies were conducted using MDA-MB-468 cells xenografted in nu/nu mice. In MDA-MB-468 cells, the inhibition of IGF-1R upregulated the p-EGFR expression. Either EGFR (AG1478) or IGF-1R inhibitor (AG1024) radiosensitized MDA-MB-468 cells. In MCF-7 cells, radiosensitivity was enhanced by AG1024, but not by AG1478. Synergistical radiosensitizing effect was observed by co-inhibition of EGFR and IGF-1R only in MDA-MB-468 cells with a DMF 10% of 1.90. The co-inhibition plus irradiation significantly induced more apoptosis and arrested the cells at G0/G1 phase in MDA-MB-468 cells. Only co-inhibition of EGFR and IGF-1R synergistically diminished the expression of p-Akt and p-Erk1/2 in MDA-MB-468 cells. In vivo studies further verified the radiosensitizing effects by co-inhibition of both pathways in a MDA-MB-468 xenograft model. Our data suggested that co-inhibition of EGFR and IGF-1R synergistically radiosensitized breast cancer cells with both EGFR and IGF-1R high expression. The approach may have an important therapeutic implication in the treatment of breast cancer patients with high expression of EGFR and IGF-1R

  3. The DP-1 transcription factor is required for keratinocyte growth and epidermal stratification.

    Science.gov (United States)

    Chang, Wing Y; Bryce, Dawn M; D'Souza, Sudhir J A; Dagnino, Lina

    2004-12-03

    The epidermis is a stratified epithelium constantly replenished through the ability of keratinocytes in its basal layer to proliferate and self-renew. The epidermis arises from a single-cell layer ectoderm during embryogenesis. Large proliferative capacity is central to ectodermal cell and basal keratinocyte function. DP-1, a heterodimeric partner of E2F transcription factors, is highly expressed in the ectoderm and all epidermal layers during embryogenesis. To investigate the role of DP-1 in epidermal morphogenesis, we inhibited DP-1 activity through exogenous expression of a dominant-negative mutant (dnDP-1). Expression of the dnDP-1 mutant interferes with binding of E2F/DP-1 heterodimers to DNA and inhibits DNA replication, as well as cyclin A mRNA and protein expression. Chromatin immunoprecipitation analysis demonstrated that the cyclin A promoter is predominantly bound in proliferating keratinocytes by complexes containing E2F-3 and E2F-4. Thus, the mechanisms of decreased expression of cyclin A in the presence of dnDP-1 seem to involve inactivation of DP-1 complexes containing E2F-3 and E2F-4. To assess the consequences on epidermal morphogenesis of inhibiting DP-1 activity, we expressed dnDP-1 in rat epithelial keratinocytes in organotypic culture and observed that DP-1 inhibition negatively affected stratification of these cells. Likewise, expression of dnDP-1 in embryonic ectoderm explants produced extensive disorganization of subsequently formed epidermal basal and suprabasal layers, interfering with normal epidermal formation. We conclude that DP-1 activity is required for normal epidermal morphogenesis and ectoderm-to-epidermis transition.

  4. Arbuscular Mycorrhizal Fungi Elicit a Novel Intracellular Apparatus in Medicago truncatula Root Epidermal Cells before InfectionW⃞

    Science.gov (United States)

    Genre, Andrea; Chabaud, Mireille; Timmers, Ton; Bonfante, Paola; Barker, David G.

    2005-01-01

    The penetration of arbuscular mycorrhizal (AM) fungi through the outermost root tissues of the host plant is a critical step in root colonization, ultimately leading to the establishment of this ecologically important endosymbiotic association. To evaluate the role played by the host plant during AM infection, we have studied in vivo cellular dynamics within Medicago truncatula root epidermal cells using green fluorescent protein labeling of both the plant cytoskeleton and the endoplasmic reticulum. Targeting roots with Gigaspora hyphae has revealed that, before infection, the epidermal cell assembles a transient intracellular structure with a novel cytoskeletal organization. Real-time monitoring suggests that this structure, designated the prepenetration apparatus (PPA), plays a central role in the elaboration of the apoplastic interface compartment through which the fungus grows when it penetrates the cell lumen. The importance of the PPA is underlined by the fact that M. truncatula dmi (for doesn't make infections) mutants fail to assemble this structure. Furthermore, PPA formation in the epidermis can be correlated with DMI-dependent transcriptional activation of the Medicago early nodulin gene ENOD11. These findings demonstrate how the host plant prepares and organizes AM infection of the root, and both the plant–fungal signaling mechanisms involved and the mechanistic parallels with Rhizobium infection in legume root hairs are discussed. PMID:16284314

  5. Genetic Markers and Danger Signals in Stevens-Johnson Syndrome and Toxic Epidermal Necrolysis

    Directory of Open Access Journals (Sweden)

    Wen-Hung Chung

    2010-01-01

    Full Text Available Stevens-Johnson syndrome (SJS and toxic epidermal necrolysis (TEN are life-threatening adverse reactions, which could be induced by a variety of drugs. It was proposed that human leukocyte antigen (HLA-restricted presentation of antigens (drugs or their metabolites to T lymphocytes initiates the immune reactions of SJS/ TEN. However, the genetic susceptibility and the exact pathogenesis were not clear until the recent studies. We first identified that HLA-B*1502 is strongly associated with carbamazepine (CBZ-induced SJS/TEN and HLA-B*5801 with allopurinol-SJS/TEN in Han Chinese. The same associations had been validated across different human populations. For the downstream danger signals, Fas-Fas ligand (FasL and perforin/granzyme B had been advocated as cytotoxic mediators for keratinocyte death in SJS/TEN. However, expression levels of these cytotoxic proteins from the skin lesions were too low to explain the distinct and extensive epidermal necrosis. Our recent study identified that the granulysin, a cytotoxic protein released from cytotoxic T cells or natural killer (NK cells, is a key mediator for disseminated keratinocyte death in SJS/TEN. This article aims to provide an overview of both of the genomic and immunologic perspectives of SJS/TEN. These studies give us a better understanding of the immune mechanisms, biomarkers for disease prevention and early diagnosis, as well as providing the therapeutic targets for the treatments of SJS/TEN.

  6. Hesperetin induces melanin production in adult human epidermal melanocytes.

    Science.gov (United States)

    Usach, Iris; Taléns-Visconti, Raquel; Magraner-Pardo, Lorena; Peris, José-Esteban

    2015-06-01

    One of the major sources of flavonoids for humans are citrus fruits, hesperidin being the predominant flavonoid. Hesperetin (HSP), the aglycon of hesperidin, has been reported to provide health benefits such as antioxidant, anti-inflammatory and anticarcinogenic effects. However, the effect of HSP on skin pigmentation is not clear. Some authors have found that HSP induces melanogenesis in murine B16-F10 melanoma cells, which, if extrapolated to in vivo conditions, might protect skin against photodamage. Since the effect of HSP on normal melanocytes could be different to that observed on melanoma cells, the described effect of HSP on murine melanoma cells has been compared to the effect obtained using normal human melanocytes. HSP concentrations of 25 and 50 µM induced melanin synthesis and tyrosinase activity in human melanocytes in a concentration-dependent manner. Compared to control melanocytes, 25 µM HSP increased melanin production and tyrosinase activity 1.4-fold (p melanin production in human melanocyte cultures could be reproduced on human skin. Copyright © 2015 Elsevier Ltd. All rights reserved.

  7. Trafficking through COPII stabilises cell polarity and drives secretion during Drosophila epidermal differentiation.

    Directory of Open Access Journals (Sweden)

    Michaela Norum

    2010-05-01

    Full Text Available The differentiation of an extracellular matrix (ECM at the apical side of epithelial cells implies massive polarised secretion and membrane trafficking. An epithelial cell is hence engaged in coordinating secretion and cell polarity for a correct and efficient ECM formation.We are studying the molecular mechanisms that Drosophila tracheal and epidermal cells deploy to form their specific apical ECM during differentiation. In this work we demonstrate that the two genetically identified factors haunted and ghost are essential for polarity maintenance, membrane topology as well as for secretion of the tracheal luminal matrix and the cuticle. We show that they code for the Drosophila COPII vesicle-coating components Sec23 and Sec24, respectively, that organise vesicle transport from the ER to the Golgi apparatus.Taken together, epithelial differentiation during Drosophila embryogenesis is a concerted action of ECM formation, plasma membrane remodelling and maintenance of cell polarity that all three rely mainly, if not absolutely, on the canonical secretory pathway from the ER over the Golgi apparatus to the plasma membrane. Our results indicate that COPII vesicles constitute a central hub for these processes.

  8. Resveratrol modulates MED28 (Magicin/EG-1) expression and inhibits epidermal growth factor (EGF)-induced migration in MDA-MB-231 human breast cancer cells.

    Science.gov (United States)

    Lee, Ming-Fen; Pan, Min-Hsiung; Chiou, Yi-Siou; Cheng, An-Chin; Huang, Han

    2011-11-09

    Resveratrol and pterostilbene exhibit diverse biological activities. MED28, a subunit of the mammalian Mediator complex for transcription, was also identified as magicin, an actin cytoskeleton Grb2-associated protein, and as endothelial-derived gene (EG-1). Several tumors exhibit aberrant MED28 expression, whereas the underlying mechanism is unclear. Triple-negative breast cancers, often expressing epidermal growth factor (EGF) receptor (EGFR), are associated with metastasis and poor survival. The objective of this study is to compare the effect of resveratrol and pterostilbene and to investigate the role of MED28 in EGFR-overexpressing MDA-MB-231 breast cancer cells. Pretreatment of resveratrol, but not pterostlbene, suppressed EGF-mediated migration and expression of MED28 and matrix metalloproteinase (MMP)-9 in MDA-MB-231 cells. Moreover, overexpression of MED28 increased migration, and the addition of EGF further enhanced migration. Our data indicate that resveratrol modulates the effect of MED28 on cellular migration, presumably through the EGFR/phosphatidylinositol 3-kinase (PI3K) signaling pathway, in breast cancer cells.

  9. Loss of prostasin (PRSS8) in human bladder transitional cell carcinoma cell lines is associated with epithelial-mesenchymal transition (EMT)

    International Nuclear Information System (INIS)

    Chen, Li-Mei; Verity, Nicole J; Chai, Karl X

    2009-01-01

    The glycosylphosphatidylinositol (GPI)-anchored epithelial extracellular membrane serine protease prostasin (PRSS8) is expressed abundantly in normal epithelia and essential for terminal epithelial differentiation, but down-regulated in human prostate, breast, and gastric cancers and invasive cancer cell lines. Prostasin is involved in the extracellular proteolytic modulation of the epidermal growth factor receptor (EGFR) and is an invasion suppressor. The aim of this study was to evaluate prostasin expression states in the transitional cell carcinomas (TCC) of the human bladder and in human TCC cell lines. Normal human bladder tissues and TCC on a bladder cancer tissue microarray (TMA) were evaluated for prostasin expression by means of immunohistochemistry. A panel of 16 urothelial and TCC cell lines were evaluated for prostasin and E-cadherin expression by western blot and quantitative PCR, and for prostasin gene promoter region CpG methylation by methylation-specific PCR (MSP). Prostasin is expressed in the normal human urothelium and in a normal human urothelial cell line, but is significantly down-regulated in high-grade TCC and lost in 9 (of 15) TCC cell lines. Loss of prostasin expression in the TCC cell lines correlated with loss of or reduced E-cadherin expression, loss of epithelial morphology, and promoter DNA hypermethylation. Prostasin expression could be reactivated by demethylation or inhibition of histone deacetylase. Re-expression of prostasin or a serine protease-inactive variant resulted in transcriptional up-regulation of E-cadherin. Loss of prostasin expression in bladder transitional cell carcinomas is associated with epithelial-mesenchymal transition (EMT), and may have functional implications in tumor invasion and resistance to chemotherapy

  10. Sulfur Mustard (SM) Lesions in Organ-Cultured Human Skin: Markers of Injury and Inflammatory Mediators

    Science.gov (United States)

    1990-04-16

    18. SUB3ECT TERMS (oont’d) epidermal injury organ culture •ranuaear vacuoles C-leucine incorpora’tion by full-thickness human akin explants hi stamine ...mast- cell degranulation prostaglandin E2 lysobomal enzymes: acid phosphatase, B-glucuronidase, 0-galactcsidase, lysozyme and lactic dehydrogenase...that histamline (from local mast cells ), and PA and POgk (probably from mast cells and epidermal cells ) are s3e of the early mediators of the inflmma

  11. ERK-dependent and -independent pathways trigger human neural progenitor cell migration

    International Nuclear Information System (INIS)

    Moors, Michaela; Cline, Jason E.; Abel, Josef; Fritsche, Ellen

    2007-01-01

    Besides differentiation and apoptosis, cell migration is a basic process in brain development in which neural cells migrate several centimeters within the developing brain before reaching their proper positions and forming the right connections. For identifying signaling events that control neural migration and are therefore potential targets of chemicals to disturb normal brain development, we developed a human neurosphere-based migration assay based on normal human neural progenitor (NHNP) cells, in which the distance is measured that cells wander over time. Applying this assay, we investigated the role of the extracellular signal-regulated kinases 1 and 2 (ERK1/2) in the regulation of NHNP cell migration. Exposure to model substances like ethanol or phorbol 12-myristate 13-acetate (PMA) revealed a correlation between ERK1/2 activation and cell migration. The participation of phospho-(P-) ERK1/2 was confirmed by exposure of the cells to the MEK inhibitor PD98059, which directly prohibits ERK1/2 phosphorylation and inhibited cell migration. We identified protein kinase C (PKC) and epidermal growth factor receptor (EGFR) as upstream signaling kinases governing ERK1/2 activation, thereby controlling NHNP cell migration. Additionally, treatments with src kinase inhibitors led to a diminished cell migration without affecting ERK1/2 phosphorylation. Based on these results, we postulate that migration of NHNP cells is controlled via ERK1/2-dependent and -independent pathways

  12. An epidermal equivalent assay for identification and ranking potency of contact sensitizers

    Energy Technology Data Exchange (ETDEWEB)

    Gibbs, Susan, E-mail: S.Gibbs@VUMC.nl [Department of Dermatology, VU University Medical Centre, Dept of Oral Cell Biology, ACTA, Amsterdam (Netherlands); Corsini, Emanuela [Laboratory of Toxicology, DiSFeB, Università degli Studi di Milano (Italy); Spiekstra, Sander W. [Department of Dermatology, VU University Medical Centre, Dept of Oral Cell Biology, ACTA, Amsterdam (Netherlands); Galbiati, Valentina [Laboratory of Toxicology, DiSFeB, Università degli Studi di Milano (Italy); Fuchs, Horst W. [CellSystems GmbH, Troisdorf (Germany); DeGeorge, George; Troese, Matthew [MB Research Labs, Spinnerstown, PA (United States); Hayden, Patrick; Deng, Wei [MatTek Corporation, Ashland, MA (United States); Roggen, Erwin [3Rs Management and Consultancy (Denmark)

    2013-10-15

    The purpose of this study was to explore the possibility of combining the epidermal equivalent (EE) potency assay with the assay which assesses release of interleukin-18 (IL-18) to provide a single test for identification and classification of skin sensitizing chemicals, including chemicals of low water solubility or stability. A protocol was developed using different 3D-epidermal models including in house VUMC model, epiCS® (previously EST1000™), MatTek EpiDerm™ and SkinEthic™ RHE and also the impact of different vehicles (acetone:olive oil 4:1, 1% DMSO, ethanol, water) was investigated. Following topical exposure for 24 h to 17 contact allergens and 13 non-sensitizers a robust increase in IL-18 release was observed only after exposure to contact allergens. A putative prediction model is proposed from data obtained from two laboratories yielding 95% accuracy. Correlating the in vitro EE sensitizer potency data, which assesses the chemical concentration which results in 50% cytotoxicity (EE-EC{sub 50}) with human and animal data showed a superior correlation with human DSA{sub 05} (μg/cm{sup 2}) data (Spearman r = 0.8500; P value (two-tailed) = 0.0061) compared to LLNA data (Spearman r = 0.5968; P value (two-tailed) = 0.0542). DSA{sub 05} = induction dose per skin area that produces a positive response in 5% of the tested population Also a good correlation was observed for release of IL-18 (SI-2) into culture supernatants with human DSA{sub 05} data (Spearman r = 0.8333; P value (two-tailed) = 0.0154). This easily transferable human in vitro assay appears to be very promising, but additional testing of a larger chemical set with the different EE models is required to fully evaluate the utility of this assay and to establish a definitive prediction model. - Highlights: • A potential epidermal equivalent assay to label and classify sensitizers • Il-18 release distinguishes sensitizers from non sensitizers • IL-18 release can rank sensitizer potency

  13. An epidermal equivalent assay for identification and ranking potency of contact sensitizers

    International Nuclear Information System (INIS)

    Gibbs, Susan; Corsini, Emanuela; Spiekstra, Sander W.; Galbiati, Valentina; Fuchs, Horst W.; DeGeorge, George; Troese, Matthew; Hayden, Patrick; Deng, Wei; Roggen, Erwin

    2013-01-01

    The purpose of this study was to explore the possibility of combining the epidermal equivalent (EE) potency assay with the assay which assesses release of interleukin-18 (IL-18) to provide a single test for identification and classification of skin sensitizing chemicals, including chemicals of low water solubility or stability. A protocol was developed using different 3D-epidermal models including in house VUMC model, epiCS® (previously EST1000™), MatTek EpiDerm™ and SkinEthic™ RHE and also the impact of different vehicles (acetone:olive oil 4:1, 1% DMSO, ethanol, water) was investigated. Following topical exposure for 24 h to 17 contact allergens and 13 non-sensitizers a robust increase in IL-18 release was observed only after exposure to contact allergens. A putative prediction model is proposed from data obtained from two laboratories yielding 95% accuracy. Correlating the in vitro EE sensitizer potency data, which assesses the chemical concentration which results in 50% cytotoxicity (EE-EC 50 ) with human and animal data showed a superior correlation with human DSA 05 (μg/cm 2 ) data (Spearman r = 0.8500; P value (two-tailed) = 0.0061) compared to LLNA data (Spearman r = 0.5968; P value (two-tailed) = 0.0542). DSA 05 = induction dose per skin area that produces a positive response in 5% of the tested population Also a good correlation was observed for release of IL-18 (SI-2) into culture supernatants with human DSA 05 data (Spearman r = 0.8333; P value (two-tailed) = 0.0154). This easily transferable human in vitro assay appears to be very promising, but additional testing of a larger chemical set with the different EE models is required to fully evaluate the utility of this assay and to establish a definitive prediction model. - Highlights: • A potential epidermal equivalent assay to label and classify sensitizers • Il-18 release distinguishes sensitizers from non sensitizers • IL-18 release can rank sensitizer potency • EC50 (chemical

  14. Human Papillomavirus and Epidermal Growth Factor Receptor in Oral Cavity and Oropharyngeal Squamous Cell Carcinoma: Correlation With Dynamic Contrast-Enhanced MRI Parameters.

    Science.gov (United States)

    Choi, Yoon Seong; Park, Mina; Kwon, Hyeong Ju; Koh, Yoon Woo; Lee, Seung-Koo; Kim, Jinna

    2016-02-01

    The objective of this study was to investigate differences in dynamic contrast-enhanced MRI (DCE-MRI) parameters on the basis of the status of human papillomavirus (HPV) and epidermal growth factor receptor (EGFR) biomarkers in patients with squamous cell carcinoma (SCC) of the oral cavity and oropharynx by use of histogram analysis. A total of 22 consecutive patients with oral cavity and oropharyngeal SCC underwent DCE-MRI before receiving treatment. DCE parameter maps of the volume transfer constant (K(trans)), the flux rate constant (kep), and the extravascular extracellular volume fraction (ve) were obtained. The histogram parameters were calculated using the entire enhancing tumor volume and were compared between the patient subgroups on the basis of HPV and EGFR biomarker statuses. The cumulative histogram parameters of K(trans) and kep showed lower values in the HPV-negative and EFGR-overexpression group than in the HPV-positive EGFR-negative group. These differences were statistically significant for the mean (p = 0.009), 25th, 50th, and 75th percentile values of K(trans) and for the 25th percentile value of kep when correlated with HPV status in addition to the mean K(trans) value (p = 0.047) and kep value (p = 0.004) when correlated with EGFR status. No statistically significant difference in ve was found on the basis of HPV and EGFR status. DCE-MRI is useful for the assessment of the tumor microenvironment associated with HPV and EGFR biomarkers before treatment of patients with oral cavity and oropharyngeal SCC.

  15. P16INK4a Positive Cells in Human Skin Are Indicative of Local Elastic Fiber Morphology, Facial Wrinkling, and Perceived Age

    DEFF Research Database (Denmark)

    Waaijer, Mariëtte E C; Gunn, David A; Adams, Peter D

    2016-01-01

    Senescent cells are more prevalent in aged human skin compared to young, but evidence that senescent cells are linked to other biomarkers of aging is scarce. We counted cells positive for the tumor suppressor and senescence associated protein p16INK4a in sun-protected upper-inner arm skin biopsies...... wrinkles and a higher perceived age. Participants in the lowest tertile of epidermal p16INK4a counts looked 3 years younger than those in the highest tertile, independently of chronological age and elastic fiber morphology. In conclusion, p16INK4a positive cell numbers in sun-protected human arm skin...

  16. Amlexanox Blocks the Interaction between S100A4 and Epidermal Growth Factor and Inhibits Cell Proliferation.

    Directory of Open Access Journals (Sweden)

    Ching Chang Cho

    Full Text Available The human S100A4 protein binds calcium, resulting in a change in its conformation to promote the interaction with its target protein. Human epidermal growth factor (EGF is the target protein of S100A4 and a critical ligand of the receptor EGFR. The EGF/EGFR system promotes cell survival, differentiation, and growth by activating several signaling pathways. Amlexanox is an anti-inflammatory and anti-allergic drug that is used to treat recurrent aphthous ulcers. In the present study, we determined that amlexanox interacts with S100A4 using heteronuclear single quantum correlation titration. We elucidated the interactions of S100A4 with EGF and amlexanox using fluorescence and nuclear magnetic resonance spectroscopy. We generated two binary models (for the S100A4-EGF and S100A4-amlexanox complexes and observed that amlexanox and EGF share a similar binding region in mS100A4. We also used a WST-1 assay to investigate the bioactivity of S100A4, EGF, and amlexanox, and found that amlexanox blocks the binding between S100A4 and EGF, and is therefore useful for the development of new anti-proliferation drugs.

  17. Xenobiotic metabolism capacities of human skin in comparison with a 3D-epidermis model and keratinocyte-based cell culture as in vitro alternatives for chemical testing: phase II enzymes.

    Science.gov (United States)

    Götz, Christine; Pfeiffer, Roland; Tigges, Julia; Ruwiedel, Karsten; Hübenthal, Ulrike; Merk, Hans F; Krutmann, Jean; Edwards, Robert J; Abel, Josef; Pease, Camilla; Goebel, Carsten; Hewitt, Nicola; Fritsche, Ellen

    2012-05-01

    The 7th Amendment to the EU Cosmetics Directive prohibits the use of animals in cosmetic testing for certain endpoints, such as genotoxicity. Therefore, skin in vitro models have to replace chemical testing in vivo. However, the metabolic competence neither of human skin nor of alternative in vitro models has so far been fully characterized, although skin is the first-pass organ for accidentally or purposely (cosmetics and pharmaceuticals) applied chemicals. Thus, there is an urgent need to understand the xenobiotic-metabolizing capacities of human skin and to compare these activities to models developed to replace animal testing. We have measured the activity of the phase II enzymes glutathione S-transferase, UDP-glucuronosyltransferase and N-acetyltransferase in ex vivo human skin, the 3D epidermal model EpiDerm 200 (EPI-200), immortalized keratinocyte-based cell lines (HaCaT and NCTC 2544) and primary normal human epidermal keratinocytes. We show that all three phase II enzymes are present and highly active in skin as compared to phase I. Human skin, therefore, represents a more detoxifying than activating organ. This work systematically compares the activities of three important phase II enzymes in four different in vitro models directly to human skin. We conclude from our studies that 3D epidermal models, like the EPI-200 employed here, are superior over monolayer cultures in mimicking human skin xenobiotic metabolism and thus better suited for dermatotoxicity testing. © 2012 John Wiley & Sons A/S.

  18. American Society of Clinical Oncology/College of American Pathologists guideline recommendations for human epidermal growth factor receptor 2 testing in breast cancer

    NARCIS (Netherlands)

    Wolff, Antonio C.; Hammond, M. Elizabeth H.; Schwartz, Jared N.; Hagerty, Karen L.; Allred, D. Craig; Cote, Richard J.; Dowsett, Mitchell; Fitzgibbons, Patrick L.; Hanna, Wedad M.; Langer, Amy; McShane, Lisa M.; Paik, Soonmyung; Pegram, Mark D.; Perez, Edith A.; Press, Michael F.; Rhodes, Anthony; Sturgeon, Catharine; Taube, Sheila E.; Tubbs, Raymond; Vance, Gail H.; van de Vijver, Marc; Wheeler, Thomas M.; Hayes, Daniel F.

    2007-01-01

    PURPOSE: To develop a guideline to improve the accuracy of human epidermal growth factor receptor 2 (HER2) testing in invasive breast cancer and its utility as a predictive marker. METHODS: The American Society of Clinical Oncology and the College of American Pathologists convened an expert panel,

  19. The effect of wound dressings on a bio-engineered human dermo-epidermal skin substitute in a rat model

    OpenAIRE

    Hüging, Martina; Biedermann, Thomas; Sobrio, Monia; Meyer, Sarah; Böttcher-Haberzeth, Sophie; Manuel, Edith; Horst, Maya; Hynes, Sally; Reichmann, Ernst; Schiestl, Clemens; Hartmann-Fritsch, Fabienne

    2017-01-01

    Autologous bio-engineered dermo-epidermal skin substitutes are a promising treatment for large skin defects such as burns. For their successful clinical application, the graft dressing must protect and support the keratinocyte layer and, in many cases, possess antimicrobial properties. However, silver in many antimicrobial dressings may inhibit keratinocyte growth and differentiation. The purpose of our study is to evaluate the effect of various wound dressings on the healing of a human hydro...

  20. Modulation of interferon-gamma-induced HLA-DR expression on the human keratinocyte cell line SCC-13 by ultraviolet radiation

    International Nuclear Information System (INIS)

    Khan, I.U.; Boehm, K.D.; Elmets, C.A.

    1993-01-01

    Cell surface expression of major histocompatibility determinants on epidermal keratinocytes is a characteristic feature of a number of inflammatory dermatoses and in all likelihood is caused by diffusion of human leukocyte antigen (HLA)-DR-inducing cytokines from cells present in the dermal mononuclear cell infiltrate. Many of these same disorders respond to ultraviolet (UV) radiation phototherapy. Using the human SCC-13 keratinocyte cell line as a model, UV radiation was found to inhibit interferon-gamma-induced HLA-DR expression. Inhibition correlated closely with decreased steady-state levels of HLA-DR mRNA. These findings provide evidence that the therapeutic effect of UV radiation phototherapy may be mediated by its capacity to down-regulate cytokine-induced keratinocyte HLA-DR expression. (Author)

  1. Leukemia inhibitory factor favours neurogenic differentiation of long-term propagated human midbrain precursor cells

    DEFF Research Database (Denmark)

    Andersen, Rikke K; Widmer, Hans R; Zimmer, Jens

    2009-01-01

    There is a lot of excitement about the potential use of multipotent neural stem cells for the treatment of neurodegenerative diseases. However, the strategy is compromised by the general loss of multipotency and ability to generate neurons after long-term in vitro propagation. In the present study......, human embryonic (5 weeks post-conception) ventral mesencephalic (VM) precursor cells were propagated as neural tissue-spheres (NTS) in epidermal growth factor (EGF; 20 ng/ml) and fibroblast growth factor 2 (FGF2; 20 ng/ml). After more than 325 days, the NTS were transferred to media containing either...... EGF+FGF2, EGF+FGF2+heparin or leukemia inhibitory factor (LIF; 10 ng/ml)+FGF2+heparin. Cultures were subsequently propagated for more than 180 days with NTS analyzed at various time-points. Our data show for the first time that human VM neural precursor cells can be long-term propagated as NTS...

  2. The Effect of Epidermal Structures on Leaf Spectral Signatures of Ice Plants (Aizoaceae

    Directory of Open Access Journals (Sweden)

    René Hans-Jürgen Heim

    2015-12-01

    Full Text Available Epidermal structures (ES of leaves are known to affect the functional properties and spectral responses. Spectral studies focused mostly on the effect of hairs or wax layers only. We studied a wider range of different ES and their impact on spectral properties. Additionally, we identified spectral regions that allow distinguishing different ES. We used a field spectrometer to measure ex situ leaf spectral responses from 350 nm–2500 nm. A spectral library for 25 species of the succulent family Aizoaceae was assembled. Five functional types were defined based on ES: flat epidermal cell surface, convex to papillary epidermal cell surface, bladder cells, hairs and wax cover. We tested the separability of ES using partial least squares discriminant analysis (PLS-DA based on the spectral data. Subsequently, variable importance (VIP was calculated to identify spectral regions relevant for discriminating our functional types (classes. Classification performance was high, with a kappa value of 0.9 indicating well-separable spectral classes. VIP calculations identified six spectral regions of increased importance for the classification. We confirmed and extended previous findings regarding the visible-near-infrared spectral region. Our experiments also confirmed that epidermal leaf traits can be classified due to clearly distinguishable spectral signatures across species and genera within the Aizoaceae.

  3. c-Jun/AP-1 pathway-mediated cyclin D1 expression participates in low dose arsenite-induced transformation in mouse epidermal JB6 Cl41 cells

    International Nuclear Information System (INIS)

    Zhang Dongyun; Li Jingxia; Gao Jimin; Huang Chuanshu

    2009-01-01

    Arsenic is a well-documented human carcinogen associated with skin carcinogenesis. Our previous work reveals that arsenite exposure is able to induce cell transformation in mouse epidermal cell JB6 Cl41 through the activation of ERK, rather than JNK pathway. Our current studies further evaluate downstream pathway in low dose arsenite-induced cell transformation in JB6 Cl41 cells. Our results showed that treatment of cells with low dose arsenite induced activation of c-Jun/AP-1 pathway, and ectopic expression of dominant negative mutant of c-Jun (TAM67) blocked arsenite-induced transformation. Furthermore, our data indicated that cyclin D1 was an important downstream molecule involved in c-Jun/AP-1-mediated cell transformation upon low dose arsenite exposure, because inhibition of cyclin D1 expression by its specific siRNA in the JB6 Cl41 cells resulted in impairment of anchorage-independent growth of cells induced by low dose arsenite. Collectively, our results demonstrate that c-Jun/AP-1-mediated cyclin D1 expression is at least one of the key events implicated in cell transformation upon low dose arsenite exposure

  4. Transcriptional profiling of putative human epithelial stem cells

    Directory of Open Access Journals (Sweden)

    Koçer Salih S

    2008-07-01

    may be enriched for stem cells. This study is the first comprehensive gene expression profile of putative human epithelial stem cells and their progeny that were isolated directly from neonatal foreskin tissue. Our study is important for understanding self renewal and differentiation of epidermal stem cells, and for elucidating signaling pathways involved in those processes. The generated data base may serve those working with other human epithelial tissue progenitors.

  5. Targeting the Epidermal Growth Factor Receptor Can Counteract the Inhibition of Natural Killer Cell Function Exerted by Colorectal Tumor-Associated Fibroblasts

    Directory of Open Access Journals (Sweden)

    Delfina Costa

    2018-05-01

    Full Text Available Mesenchymal stromal cells (MSC present in the tumor microenvironment [usually named tumor-associated fibroblasts (TAF] can exert immunosuppressive effects on T and natural killer (NK lymphocytes, favoring tumor immune escape. We have analyzed this mechanism in colorectal carcinoma (CRC and found that co-culture of NK cells with TAF can prevent the IL-2-mediated NKG2D upregulation. This leads to the impairment of NKG2D-mediated recognition of CRC cells, sparing the NK cell activation through DNAM1 or FcγRIIIA (CD16. In situ, TAF express detectable levels of epidermal growth factor receptor (EGFR; thus, the therapeutic anti-EGFR humanized antibody cetuximab can trigger the antibody-dependent cellular cytotoxicity of TAF, through the engagement of FcγRIIIA on NK cells. Importantly, in the tumor, we found a lymphoid infiltrate containing NKp46+CD3− NK cells, enriched in CD16+ cells. This population, sorted and cultured with IL-2, could be triggered via CD16 and via NKG2D. Of note, ex vivo NKp46+CD3− cells were able to kill autologous TAF; in vivo, this might represent a control mechanism to reduce TAF-mediated regulatory effect on NK cell function. Altogether, these findings suggest that MSC from the neoplastic mucosa (TAF of CRC patients can downregulate the immune cell recognition of CRC tumor cells. This immunosuppression can be relieved by the anti-EGFR antibody used in CRC immunotherapy.

  6. Targeting the Epidermal Growth Factor Receptor Can Counteract the Inhibition of Natural Killer Cell Function Exerted by Colorectal Tumor-Associated Fibroblasts

    Science.gov (United States)

    Costa, Delfina; Venè, Roberta; Benelli, Roberto; Romairone, Emanuele; Scabini, Stefano; Catellani, Silvia; Rebesco, Barbara; Mastracci, Luca; Grillo, Federica; Minghelli, Simona; Loiacono, Fabrizio; Zocchi, Maria Raffaella; Poggi, Alessandro

    2018-01-01

    Mesenchymal stromal cells (MSC) present in the tumor microenvironment [usually named tumor-associated fibroblasts (TAF)] can exert immunosuppressive effects on T and natural killer (NK) lymphocytes, favoring tumor immune escape. We have analyzed this mechanism in colorectal carcinoma (CRC) and found that co-culture of NK cells with TAF can prevent the IL-2-mediated NKG2D upregulation. This leads to the impairment of NKG2D-mediated recognition of CRC cells, sparing the NK cell activation through DNAM1 or FcγRIIIA (CD16). In situ, TAF express detectable levels of epidermal growth factor receptor (EGFR); thus, the therapeutic anti-EGFR humanized antibody cetuximab can trigger the antibody-dependent cellular cytotoxicity of TAF, through the engagement of FcγRIIIA on NK cells. Importantly, in the tumor, we found a lymphoid infiltrate containing NKp46+CD3− NK cells, enriched in CD16+ cells. This population, sorted and cultured with IL-2, could be triggered via CD16 and via NKG2D. Of note, ex vivo NKp46+CD3− cells were able to kill autologous TAF; in vivo, this might represent a control mechanism to reduce TAF-mediated regulatory effect on NK cell function. Altogether, these findings suggest that MSC from the neoplastic mucosa (TAF) of CRC patients can downregulate the immune cell recognition of CRC tumor cells. This immunosuppression can be relieved by the anti-EGFR antibody used in CRC immunotherapy. PMID:29910806

  7. Studies in human skin epithelial cell carcinogenesis

    International Nuclear Information System (INIS)

    Lehman, T.A.

    1987-01-01

    Metabolism and DNA adduct formation of benzo[a]pyrene (BP) by human epidermal keratinocytes pretreated with inhibitors or inducer of cytochrame P450 was studied. To study DNA adduct analysis, cultures were pretreated as described above, and then treated with non-radiolabeled BP. DNA was prepared from these cultures, digested to the nucleotide level, and 32 P-postlabeled for adduct analysis. Cultures pretreated with BHA, 7,8-BF or disulfiralm formed significantly fewer BPDE I-dB adducts than non-pretreated cultures, while cultures pretreated with MeBHA formed more BPDE-I-dG adducts. MeBHA increased BP activation and adduct formation inhuman keratinocyte in cultures by inducing a specific isoenzyme of cytochrome P450 which preferentially increases the oxidative metabolism of BP to 7,8 diol BP and 7,8 diol BP to BPDE I. To approximate an in vivo human system, metabolism of BPDE I by human skin xenografts treated with cell cycles modulators was studied. When treated with BPDE I, specific carcinogen-DNA adducts were formed. Separation and identification of these adducts by the 32 P-postlabeling technique indicated that the 7R- and 7S-BPDE I-dG adducts were the major adducts

  8. Antitumor activity of ZD6126, a novel vascular-targeting agent, is enhanced when combined with ZD1839, an epidermal growth factor receptor tyrosine kinase inhibitor, and potentiates the effects of radiation in a human non-small cell lung cancer xenograft model.

    Science.gov (United States)

    Raben, David; Bianco, Cataldo; Damiano, Vincenzo; Bianco, Roberto; Melisi, Davide; Mignogna, Chiara; D'Armiento, Francesco Paolo; Cionini, Luca; Bianco, A Raffaele; Tortora, Giampaolo; Ciardiello, Fortunato; Bunn, Paul

    2004-08-01

    Targeting the tumor vasculature may offer an alternative or complementary therapeutic approach to targeting growth factor signaling in lung cancer. The aim of these studies was to evaluate the antitumor effects in vivo of the combination of ZD6126, a tumor-selective vascular-targeting agent; ZD1839 (gefitinib, Iressa), an epidermal growth factor receptor tyrosine kinase inhibitor; and ionizing radiation in the treatment of non-small cell lung cancer xenograft model. Athymic nude mice with established flank A549 human non-small cell lung cancer xenograft model xenografts were treated with fractionated radiation therapy, ZD6126, ZD1839, or combinations of each treatment. ZD6126 (150 mg/kg) was given i.p. the day after each course of radiation. Animals treated with ZD1839 received 100 mg/kg per dose per animal, 5 or 7 days/wk for 2 weeks. Immunohistochemistry was done to evaluate the effects on tumor growth using an anti-Ki67 monoclonal antibody. Effects on tumor-induced vascularization were quantified using an anti-factor VIII-related antigen monoclonal antibody. ZD6126 attenuated the growth of human A549 flank xenografts compared with untreated animals. Marked antitumor effects were observed when animals were treated with a combination of ZD6126 and fractionated radiation therapy with protracted tumor regression. ZD6126 + ZD1839 resulted in a greater tumor growth delay than either agent alone. Similar additive effects were seen with ZD1839 + fractionated radiation. Finally, the addition of ZD6126 to ZD1839 and radiation therapy seemed to further improve tumor growth control, with a significant tumor growth delay compared with animals treated with single agent or with double combinations. Immunohistochemistry showed that ZD1839 induced a marked reduction in A549 tumor cell proliferation. Both ZD1839 and ZD6126 treatment substantially reduced tumor-induced angiogenesis. ZD6126 caused marked vessel destruction through loss of endothelial cells and thrombosis

  9. Isolation and characterization of human umbilical cord-derived endothelial colony-forming cells

    Science.gov (United States)

    Zhang, Hao; Tao, Yanling; Ren, Saisai; Liu, Haihui; Zhou, Hui; Hu, Jiangwei; Tang, Yongyong; Zhang, Bin; Chen, Hu

    2017-01-01

    Endothelial colony-forming cells (ECFCs) are a population of endothelial progenitor cells (EPCs) that display robust proliferative potential and vessel-forming capability. Previous studies have demonstrated that a limited number of ECFCs may be obtained from adult bone marrow, peripheral blood and umbilical cord (UC) blood. The present study describes an effective method for isolating ECFCs from human UC. The ECFCs derived from human UC displayed the full properties of EPCs. Analysis of the growth kinetics, cell cycle and colony-forming ability of the isolated human UC-ECFCs indicated that the cells demonstrated properties of stem cells, including relative stability and rapid proliferation in vitro. Gene expression of Fms related tyrosine kinase 1, kinase insert domain receptor, vascular endothelial cadherin, cluster of differentiation (CD)31, CD34, epidermal growth factor homology domains-2, von Willebrand factor and endothelial nitric oxide synthase was assessed by reverse transcription-polymerase chain reaction. The cells were positive for CD34, CD31, CD73, CD105 and vascular endothelial growth factor receptor-2, and negative for CD45, CD90 and human leukocyte antigen-antigen D related protein according to flow cytometry. 1,1′-dioctadecyl-3,3,3′,3′-tetra-methyl-indocarbocyanine perchlorate-labeled acetylated low-density lipoprotein and fluorescein isothiocyanate-Ulex europaeus-l were used to verify the identity of the UC-ECFCs. Matrigel was used to investigate tube formation capability. The results demonstrated that the reported technique is a valuable method for isolating human UC-ECFCs, which have potential for use in vascular regeneration. PMID:29067104

  10. Human epidermal growth factor receptor 2-positive breast cancer: which cytotoxic agent best complements trastuzumab's efficacy in vitro?

    Directory of Open Access Journals (Sweden)

    Hurrell T

    2013-06-01

    Full Text Available Tracey Hurrell, Kim OuthoffDepartment of Pharmacology, University of Pretoria, Pretoria, South AfricaIntroduction: Despite trastuzumab having enhanced selectivity for human epidermal growth factor receptor 2 (HER-2 overexpressing breast cancer cells, treatment is hampered by interindividual variation and tumors with high mitogenic potential. The lack of significant clinical benefit in certain patient cohorts suggests that HER-2 expression is ineffective as a sole prognostic indicator of response to therapy. Therefore, optimizing the clinical role of trastuzumab in drug combinations remains critical for clinical success.Aim: To investigate the effects of trastuzumab in combination with either doxorubicin or geldanamycin on in vitro cell viability, cell cycling, apoptosis and relative HER-2 expression in HER-2-positive (SK-BR-3 and estrogen receptor-positive (MCF-7 breast adenocarcinoma models.Results: HER-2-rich SK-BR-3 cells demonstrated a greater sensitivity to the effects of doxorubicin than MCF-7 cells. Concurrent trastuzumab exposure resulted in a further reduction in cell viability. This decreased cell viability induced by doxorubicin was associated with activation of executioner caspases as well as with alterations in cell-cycle kinetics, primarily promoting S-phase accumulation. Doxorubicin had no effect on surface HER-2 density expression. Geldanamycin reduced cell viability significantly greater in SK-BR-3 than MCF-7 cells, and was associated with G2 cell-cycle accumulation. The addition of trastuzumab did not augment these effects. Geldanamycin promoted substantial reductions in relative surface HER-2 density in SK-BR-3 cells.Conclusion: The in vitro data supported the rationale for using doxorubicin in trastuzumab-based therapies. Therefore, despite the incidence of cardiotoxicity, doxorubicin could retain a fundamental role in treating HER-2-positive breast cancer. While geldanamycin is a potent cytotoxic agent, its concurrent use

  11. Defining the cellular precursors to human breast cancer

    Science.gov (United States)

    Keller, Patricia J.; Arendt, Lisa M.; Skibinski, Adam; Logvinenko, Tanya; Klebba, Ina; Dong, Shumin; Smith, Avi E.; Prat, Aleix; Perou, Charles M.; Gilmore, Hannah; Schnitt, Stuart; Naber, Stephen P.; Garlick, Jonathan A.; Kuperwasser, Charlotte

    2012-01-01

    Human breast cancers are broadly classified based on their gene-expression profiles into luminal- and basal-type tumors. These two major tumor subtypes express markers corresponding to the major differentiation states of epithelial cells in the breast: luminal (EpCAM+) and basal/myoepithelial (CD10+). However, there are also rare types of breast cancers, such as metaplastic carcinomas, where tumor cells exhibit features of alternate cell types that no longer resemble breast epithelium. Until now, it has been difficult to identify the cell type(s) in the human breast that gives rise to these various forms of breast cancer. Here we report that transformation of EpCAM+ epithelial cells results in the formation of common forms of human breast cancer, including estrogen receptor-positive and estrogen receptor-negative tumors with luminal and basal-like characteristics, respectively, whereas transformation of CD10+ cells results in the development of rare metaplastic tumors reminiscent of the claudin-low subtype. We also demonstrate the existence of CD10+ breast cells with metaplastic traits that can give rise to skin and epidermal tissues. Furthermore, we show that the development of metaplastic breast cancer is attributable, in part, to the transformation of these metaplastic breast epithelial cells. These findings identify normal cellular precursors to human breast cancers and reveal the existence of a population of cells with epidermal progenitor activity within adult human breast tissues. PMID:21940501

  12. Inflammatory linear verrucous epidermal naevus: Report of three ...

    African Journals Online (AJOL)

    Background: Epidermal naevi are congenital harmatomas that arise from embryonal ectodermal cells. The inflammatory linear verrucous variant is rare and presents with disturbing symptoms. In blacks the classical erythema is not common but pruritus and discharge are the commonest features. Methods and results: We ...

  13. Impaired degradation followed by enhanced recycling of epidermal growth factor receptor caused by hypo-phosphorylation of tyrosine 1045 in RBE cells

    International Nuclear Information System (INIS)

    Gui, Anping; Kobayashi, Akira; Motoyama, Hiroaki; Kitazawa, Masato; Takeoka, Michiko; Miyagawa, Shinichi

    2012-01-01

    Since cholangiocarcinoma has a poor prognosis, several epidermal growth factor receptor (EGFR)-targeted therapies with antibody or small molecule inhibitor treatment have been proposed. However, their effect remains limited. The present study sought to understand the molecular genetic characteristics of cholangiocarcinoma related to EGFR, with emphasis on its degradation and recycling. We evaluated EGFR expression and colocalization by immunoblotting and immunofluorescence, cell surface EGFR expression by fluorescence-activated cell sorting (FACS), and EGFR ubiquitination and protein binding by immunoprecipitation in the human cholangiocarcinoma RBE and immortalized cholangiocyte MMNK-1 cell lines. Monensin treatment and Rab11a depletion by siRNA were adopted for inhibition of EGFR recycling. Upon stimulation with EGF, ligand-induced EGFR degradation was impaired and the expression of phospho-tyrosine 1068 and phospho-p44/42 MAPK was sustained in RBE cells as compared with MMNK-1 cells. In RBE cells, the process of EGFR sorting for lysosomal degradation was blocked at the early endosome stage, and non-degradated EGFR was recycled to the cell surface. A disrupted association between EGFR and the E3 ubiquitin ligase c-Cbl, as well as hypo-phosphorylation of EGFR at tyrosine 1045 (Tyr1045), were also observed in RBE cells. In RBE cells, up-regulation of EGFR Tyr1045 phosphorylation is a potentially useful molecular alteration in EGFR-targeted therapy. The combination of molecular-targeted therapy determined by the characteristics of individual EGFR phosphorylation events and EGFR recycling inhibition show promise in future treatments of cholangiocarcinoma

  14. Loss of prostasin (PRSS8 in human bladder transitional cell carcinoma cell lines is associated with epithelial-mesenchymal transition (EMT

    Directory of Open Access Journals (Sweden)

    Chai Karl X

    2009-10-01

    Full Text Available Abstract Background The glycosylphosphatidylinositol (GPI-anchored epithelial extracellular membrane serine protease prostasin (PRSS8 is expressed abundantly in normal epithelia and essential for terminal epithelial differentiation, but down-regulated in human prostate, breast, and gastric cancers and invasive cancer cell lines. Prostasin is involved in the extracellular proteolytic modulation of the epidermal growth factor receptor (EGFR and is an invasion suppressor. The aim of this study was to evaluate prostasin expression states in the transitional cell carcinomas (TCC of the human bladder and in human TCC cell lines. Methods Normal human bladder tissues and TCC on a bladder cancer tissue microarray (TMA were evaluated for prostasin expression by means of immunohistochemistry. A panel of 16 urothelial and TCC cell lines were evaluated for prostasin and E-cadherin expression by western blot and quantitative PCR, and for prostasin gene promoter region CpG methylation by methylation-specific PCR (MSP. Results Prostasin is expressed in the normal human urothelium and in a normal human urothelial cell line, but is significantly down-regulated in high-grade TCC and lost in 9 (of 15 TCC cell lines. Loss of prostasin expression in the TCC cell lines correlated with loss of or reduced E-cadherin expression, loss of epithelial morphology, and promoter DNA hypermethylation. Prostasin expression could be reactivated by demethylation or inhibition of histone deacetylase. Re-expression of prostasin or a serine protease-inactive variant resulted in transcriptional up-regulation of E-cadherin. Conclusion Loss of prostasin expression in bladder transitional cell carcinomas is associated with epithelial-mesenchymal transition (EMT, and may have functional implications in tumor invasion and resistance to chemotherapy.

  15. Topical Human Epidermal Growth Factor in the Treatment of Senile Purpura and the Prevention of Dermatoporosis.

    Science.gov (United States)

    McKnight, Braden; Seidel, Rachel; Moy, Ron

    2015-10-01

    Senile purpura presents itself as a largely unexplored challenge as it has been long thought of as a benign condition without long-term health sequelae. It is becoming increasingly accepted that skin aging not only results in cosmetic disturbances, but as a functional ones. With modern increases in lifespan, skin atrophy associated with solar damage is presenting as a clinically significant inability to mechanically protect patients. This chronic cutaneous insufficiency/fragility syndrome was recently termed dermatoporosis and senile purpura appears to be a visible marker of early stage dysfunction. To examine the effects of topically human epidermal growth factor on the clinical presence of senile purpura and its effect on skin thickness as measured via cutaneous ultrasound. Six subjects applied human epidermal growth factor morning and night for six weeks. Clinical outcomes were evaluated by comparing initial clinical photos to 6-week photos and performing a blinded investigator's global assessment (IGA). Skin thickness was evaluated via cutaneous ultrasound measurement. Ultrasound measurements indicated a mean skin thickening of 195.2 ± 35.7 um (SEM) over 6 weeks. The average number of purpuric lesions decreased from 15 ± 4.6 (SEM) to 2.3 ± 0.7 (SEM) over that same period. Senile purpura presents itself as a cosmetic disturbance posing significant psychological distress and serves as a marker of the severity of skin thinning. In this study, we demonstrate that topical h-EGF diminishes the appearance of senile purpura by thickening skin and may help prevent the development of late stage dermatoporosis.

  16. Analysis of Epidermal Growth Factor Receptor Related Gene Expression Changes in a Cellular and Animal Model of Parkinson’s Disease

    Directory of Open Access Journals (Sweden)

    In-Su Kim

    2017-02-01

    Full Text Available We employed transcriptome analysis of epidermal growth factor receptor related gene expression changes in cellular and animal models of Parkinson’s disease (PD. We used a well-known Parkinsonian toxin 1-methyl-4-phenylpyridine (MPP+ to induce neuronal apoptosis in the human neuroblastoma SH-SY5Y cell line. The MPP+-treatment of SH-SY5Y cells was capable of inducing neuro-apoptosis, but it remains unclear what kinds of transcriptional genes are affected by MPP+ toxicity. Therefore the pathways that were significantly perturbed in MPP+ treated human neuroblastoma SH-SY5Y cells were identified based on genome-wide gene expression data at two time points (24 and 48 h. We found that the Epidermal Growth Factor Receptor (EGFR pathway-related genes showed significantly differential expression at all time points. The EGFR pathway has been linked to diverse cellular events such as proliferation, differentiation, and apoptosis. Further, to evaluate the functional significance of the altered EGFR related gene expression observed in MPP+-treated SH-SY5Y cells, the EGFR related GJB2 (Cx26 gene expression was analyzed in an MPP+-intoxicated animal PD model. Our findings identify that the EGFR signaling pathway and its related genes, such as Cx26, might play a significant role in dopaminergic (DAergic neuronal cell death during the process of neuro-apoptosis and therefore can be focused on as potential targets for therapeutic intervention.

  17. Combination effects of epidermal growth factor and glial cell line-derived neurotrophic factor on the in vitro developmental potential of porcine oocytes

    DEFF Research Database (Denmark)

    Valleh, Mehdi Vafaye; Rasmussen, Mikkel Aabech; Hyttel, Poul

    2016-01-01

    of improving this issue, the single and combined effects of epidermal growth factor (EGF) and glial cell line-derived neurotrophic factor (GDNF) on oocyte developmental competence were investigated. Porcine cumulus–oocyte cell complexes (COCs) were matured in serum-free medium supplemented with EGF (0, 10...... with the combination of EGF and GDNF was shown to significantly improve oocyte competence in terms of blastocyst formation, blastocyst cell number and blastocyst hatching rate (P

  18. Silymarin protects epidermal keratinocytes from ultraviolet radiation-induced apoptosis and DNA damage by nucleotide excision repair mechanism.

    Directory of Open Access Journals (Sweden)

    Santosh K Katiyar

    Full Text Available Solar ultraviolet (UV radiation is a well recognized epidemiologic risk factor for melanoma and non-melanoma skin cancers. This observation has been linked to the accumulation of UVB radiation-induced DNA lesions in cells, and that finally lead to the development of skin cancers. Earlier, we have shown that topical treatment of skin with silymarin, a plant flavanoid from milk thistle (Silybum marianum, inhibits photocarcinogenesis in mice; however it is less understood whether chemopreventive effect of silymarin is mediated through the repair of DNA lesions in skin cells and that protect the cells from apoptosis. Here, we show that treatment of normal human epidermal keratinocytes (NHEK with silymarin blocks UVB-induced apoptosis of NHEK in vitro. Silymarin reduces the amount of UVB radiation-induced DNA damage as demonstrated by reduced amounts of cyclobutane pyrimidine dimers (CPDs and as measured by comet assay, and that ultimately may lead to reduced apoptosis of NHEK. The reduction of UV radiation-induced DNA damage by silymarin appears to be related with induction of nucleotide excision repair (NER genes, because UV radiation-induced apoptosis was not blocked by silymarin in NER-deficient human fibroblasts. Cytostaining and dot-blot analysis revealed that silymarin repaired UV-induced CPDs in NER-proficient fibroblasts from a healthy individual but did not repair UV-induced CPD-positive cells in NER-deficient fibroblasts from patients suffering from xeroderma pigmentosum complementation-A disease. Similarly, immunohistochemical analysis revealed that silymarin did not reduce the number of UVB-induced sunburn/apoptotic cells in the skin of NER-deficient mice, but reduced the number of sunburn cells in their wild-type counterparts. Together, these results suggest that silymarin exert the capacity to reduce UV radiation-induced DNA damage and, thus, prevent the harmful effects of UV radiation on the genomic stability of epidermal cells.

  19. Reconstruction of living bilayer human skin equivalent utilizing human fibrin as a scaffold.

    Science.gov (United States)

    Mazlyzam, A L; Aminuddin, B S; Fuzina, N H; Norhayati, M M; Fauziah, O; Isa, M R; Saim, L; Ruszymah, B H I

    2007-05-01

    Our aim of this study was to develop a new methodology for constructing a bilayer human skin equivalent to create a more clinical compliance skin graft composite for the treatment of various skin defects. We utilized human plasma derived fibrin as the scaffold for the development of a living bilayer human skin equivalent: fibrin-fibroblast and fibrin-keratinocyte (B-FF/FK SE). Skin cells from six consented patients were culture-expanded to passage 1. For B-FF/FK SE formation, human fibroblasts were embedded in human fibrin matrix and subsequently another layer of human keratinocytes in human fibrin matrix was stacked on top. The B-FF/FK SE was then transplanted to athymic mice model for 4 weeks to evaluate its regeneration and clinical performance. The in vivo B-FF/FK SE has similar properties as native human skin by histological analysis and expression of basal Keratin 14 gene in the epidermal layer and Collagen type I gene in the dermal layer. Electron microscopy analysis of in vivo B-FF/FK SE showed well-formed and continuous epidermal-dermal junction. We have successfully developed a technique to engineer living bilayer human skin equivalent using human fibrin matrix. The utilization of culture-expanded human skin cells and fibrin matrix from human blood will allow a fully autologous human skin equivalent construction.

  20. Repeated short climatic change affects the epidermal differentiation program and leads to matrix remodeling in a human organotypic skin model.

    Science.gov (United States)

    Boutrand, Laetitia-Barbollat; Thépot, Amélie; Muther, Charlotte; Boher, Aurélie; Robic, Julie; Guéré, Christelle; Vié, Katell; Damour, Odile; Lamartine, Jérôme

    2017-01-01

    Human skin is subject to frequent changes in ambient temperature and humidity and needs to cope with these environmental modifications. To decipher the molecular response of human skin to repeated climatic change, a versatile model of skin equivalent subject to "hot-wet" (40°C, 80% relative humidity [RH]) or "cold-dry" (10°C, 40% RH) climatic stress repeated daily was used. To obtain an exhaustive view of the molecular mechanisms elicited by climatic change, large-scale gene expression DNA microarray analysis was performed and modulated function was determined by bioinformatic annotation. This analysis revealed several functions, including epidermal differentiation and extracellular matrix, impacted by repeated variations in climatic conditions. Some of these molecular changes were confirmed by histological examination and protein expression. Both treatments (hot-wet and cold-dry) reduced the expression of genes encoding collagens, laminin, and proteoglycans, suggesting a profound remodeling of the extracellular matrix. Strong induction of the entire family of late cornified envelope genes after cold-dry exposure, confirmed at protein level, was also observed. These changes correlated with an increase in epidermal differentiation markers such as corneodesmosin and a thickening of the stratum corneum, indicating possible implementation of defense mechanisms against dehydration. This study for the first time reveals the complex pattern of molecular response allowing adaption of human skin to repeated change in its climatic environment.

  1. BLIMP1 Is Required for Postnatal Epidermal Homeostasis but Does Not Define a Sebaceous Gland Progenitor under Steady-State Conditions

    Directory of Open Access Journals (Sweden)

    Kai Kretzschmar

    2014-10-01

    Full Text Available B-lymphocyte-induced nuclear maturation protein 1 (BLIMP1 was previously reported to define a sebaceous gland (SG progenitor population in the epidermis. However, the recent identification of multiple stem cell populations in the hair follicle junctional zone has led us to re-evaluate its function. We show, in agreement with previous studies, that BLIMP1 is expressed by postmitotic, terminally differentiated epidermal cells within the SG, interfollicular epidermis, and hair follicle. Epidermal overexpression of c-Myc results in loss of BLIMP1+ cells, an effect modulated by androgen signaling. Epidermal-specific deletion of Blimp1 causes multiple differentiation defects in the epidermis in addition to SG enlargement. In culture, BLIMP1+ sebocytes have no greater clonogenic potential than BLIMP1− sebocytes. Finally, lineage-tracing experiments reveal that, under steady-state conditions, BLIMP1-expressing cells do not divide. Thus, rather than defining a sebocyte progenitor population, BLIMP1 functions in terminally differentiated cells to maintain homeostasis in multiple epidermal compartments.

  2. Near Infrared Optical Visualization of Epidermal Growth Factor Receptors Levels in COLO205 Colorectal Cell Line, Orthotopic Tumor in Mice and Human Biopsies

    Directory of Open Access Journals (Sweden)

    Philip Lazarovici

    2013-07-01

    Full Text Available In this study, we present the applicability of imaging epidermal growth factor (EGF receptor levels in preclinical models of COLO205 carcinoma cells in vitro, mice with orthotopic tumors and ex vivo colorectal tumor biopsies, using EGF-labeled with IRDye800CW (EGF-NIR. The near infrared (NIR bio-imaging of COLO205 cultures indicated specific and selective binding, reflecting EGF receptors levels. In vivo imaging of tumors in mice showed that the highest signal/background ratio between tumor and adjacent tissue was achieved 48 hours post-injection. Dissected colorectal cancer tissues from different patients demonstrated ex vivo specific imaging using the NIR bio-imaging platform of the heterogeneous distributed EGF receptors. Moreover, in the adjacent gastrointestinal tissue of the same patients, which by Western blotting was demonstrated as EGF receptor negative, no labeling with EGF-NIR probe was detected. Present results support the concept of tumor imaging by measuring EGF receptor levels using EGF-NIR probe. This platform is advantageous for EGF receptor bio-imaging of the NCI-60 recommended panel of tumor cell lines including 6–9 colorectal cell lines, since it avoids radioactive probes and is appropriate for use in the clinical setting using NIR technologies in a real-time manner.

  3. The regeneration of epidermal cells of Saintpaulia leaves as a new plant-tissue system for cellular radiation biology

    International Nuclear Information System (INIS)

    Engels, F.M.; Laan, F.M. van der; Leenhouts, H.P.; Chadwick, K.H.

    1980-01-01

    investigation of the nucleus of epidermal cells of the petioles of Saintpaulia leaves by cytofluorimetry revealed that all cells are in a non-cycling pre DNA synthesis phase. Cultivation of dissected leaves results in a synchronous regeneration process of a defined number of cells. Five days after onset of cultivation the cells reach the first mitosis. The nuclear development during the regeneration process is described. Irradiation of the leaves results in a directly visible inhibition of this regenerating capability which is used to quantify cell survival in a tissue. The data show that the radiation response has a similar shape to that of the survival of single cells in culture. This response can be observed before the first mitosis of the cells and its application as a new plant tissue system for cellular radiation research is discussed. (author)

  4. The effects of Sophora angustifolia and other natural plant extracts on melanogenesis and melanin transfer in human skin cells.

    Science.gov (United States)

    Singh, Suman K; Baker, Richard; Wibawa, Judata I D; Bell, Mike; Tobin, Desmond J

    2013-01-01

    Skin pigmentation is a multistep process of melanin synthesis by melanocytes, its transfer to recipient keratinocytes and its degradation. As dyspigmentation is a prominent marker of skin ageing, novel effective agents that modulate pigmentation safely are being sought for both clinical and cosmetic use. Here, a number of plant extracts were examined for their effect on melanogenesis (by melanin assay and Western blotting) and melanin transfer (by confocal immunomicroscopy of gp100-positive melanin granules in cocultures and by SEM analysis of filopodia), in human melanocytes and in cocultures with phototype-matched normal adult epidermal keratinocytes. Mulberry, Kiwi and Sophora extracts were assessed against isobutylmethylxanthine, hydroquinone, vitamin C and niacinamide. Compared with unstimulated control, all extracts significantly reduced melanogenesis in human melanoma cells and normal adult epidermal melanocytes. These extracts also reduced melanin transfer and reduced filopodia expression on melanocytes, similar to hydroquinone and niacinamide, indicating their effectiveness as multimode pigmentation actives. © 2013 John Wiley & Sons A/S.

  5. Mapping of Carboxypeptidase M in Normal Human Kidney and Renal Cell Carcinoma

    Science.gov (United States)

    Denis, Catherine J.; Van Acker, Nathalie; De Schepper, Stefanie; De Bie, Martine; Andries, Luc; Fransen, Erik; Hendriks, Dirk; Kockx, Mark M.

    2013-01-01

    Although the kidney generally has been regarded as an excellent source of carboxypeptidase M (CPM), little is known about its renal-specific expression level and distribution. This study provides a detailed localization of CPM in healthy and diseased human kidneys. The results indicate a broad distribution of CPM along the renal tubular structures in the healthy kidney. CPM was identified at the parietal epithelium beneath the Bowman’s basement membrane and in glomerular mesangial cells. Capillaries, podocytes, and most interstitial cells were CPM negative. Tumor cells of renal cell carcinoma subtypes lose CPM expression upon dedifferentiation. Tissue microarray analysis demonstrated a correlation between low CPM expression and tumor cell type. CPM staining was intense on phagocytotic tumor-associated macrophages. Immunoreactive CPM was also detected in the tumor-associated vasculature. The absence of CPM in normal renal blood vessels points toward a role for CPM in angiogenesis. Coexistence of CPM and the epidermal growth factor receptor (EGFR) was detected in papillary renal cell carcinoma. However, the different subcellular localization of CPM and EGFR argues against an interaction between these h proteins. The description of the distribution of CPM in human kidney forms the foundation for further study of the (patho)physiological activities of CPM in the kidney. PMID:23172796

  6. Extrapolation of systemic bioavailability assessing skin absorption and epidermal and hepatic metabolism of aromatic amine hair dyes in vitro

    Energy Technology Data Exchange (ETDEWEB)

    Manwaring, John, E-mail: manwaring.jd@pg.com [Procter & Gamble Inc., Mason Business Center, Mason, OH 45040 (United States); Rothe, Helga [Procter & Gamble Service GmbH, Sulzbacher Str. 40, 65823 Schwalbach am Taunus (Germany); Obringer, Cindy; Foltz, David J.; Baker, Timothy R.; Troutman, John A. [Procter & Gamble Inc., Mason Business Center, Mason, OH 45040 (United States); Hewitt, Nicola J. [SWS, Erzhausen (Germany); Goebel, Carsten [Procter & Gamble Service GmbH, Sulzbacher Str. 40, 65823 Schwalbach am Taunus (Germany)

    2015-09-01

    Approaches to assess the role of absorption, metabolism and excretion of cosmetic ingredients that are based on the integration of different in vitro data are important for their safety assessment, specifically as it offers an opportunity to refine that safety assessment. In order to estimate systemic exposure (AUC) to aromatic amine hair dyes following typical product application conditions, skin penetration and epidermal and systemic metabolic conversion of the parent compound was assessed in human skin explants and human keratinocyte (HaCaT) and hepatocyte cultures. To estimate the amount of the aromatic amine that can reach the general circulation unchanged after passage through the skin the following toxicokinetically relevant parameters were applied: a) Michaelis–Menten kinetics to quantify the epidermal metabolism; b) the estimated keratinocyte cell abundance in the viable epidermis; c) the skin penetration rate; d) the calculated Mean Residence Time in the viable epidermis; e) the viable epidermis thickness and f) the skin permeability coefficient. In a next step, in vitro hepatocyte K{sub m} and V{sub max} values and whole liver mass and cell abundance were used to calculate the scaled intrinsic clearance, which was combined with liver blood flow and fraction of compound unbound in the blood to give hepatic clearance. The systemic exposure in the general circulation (AUC) was extrapolated using internal dose and hepatic clearance, and C{sub max} was extrapolated (conservative overestimation) using internal dose and volume of distribution, indicating that appropriate toxicokinetic information can be generated based solely on in vitro data. For the hair dye, p-phenylenediamine, these data were found to be in the same order of magnitude as those published for human volunteers. - Highlights: • An entirely in silico/in vitro approach to predict in vivo exposure to dermally applied hair dyes • Skin penetration and epidermal conversion assessed in human

  7. Extrapolation of systemic bioavailability assessing skin absorption and epidermal and hepatic metabolism of aromatic amine hair dyes in vitro

    International Nuclear Information System (INIS)

    Manwaring, John; Rothe, Helga; Obringer, Cindy; Foltz, David J.; Baker, Timothy R.; Troutman, John A.; Hewitt, Nicola J.; Goebel, Carsten

    2015-01-01

    Approaches to assess the role of absorption, metabolism and excretion of cosmetic ingredients that are based on the integration of different in vitro data are important for their safety assessment, specifically as it offers an opportunity to refine that safety assessment. In order to estimate systemic exposure (AUC) to aromatic amine hair dyes following typical product application conditions, skin penetration and epidermal and systemic metabolic conversion of the parent compound was assessed in human skin explants and human keratinocyte (HaCaT) and hepatocyte cultures. To estimate the amount of the aromatic amine that can reach the general circulation unchanged after passage through the skin the following toxicokinetically relevant parameters were applied: a) Michaelis–Menten kinetics to quantify the epidermal metabolism; b) the estimated keratinocyte cell abundance in the viable epidermis; c) the skin penetration rate; d) the calculated Mean Residence Time in the viable epidermis; e) the viable epidermis thickness and f) the skin permeability coefficient. In a next step, in vitro hepatocyte K m and V max values and whole liver mass and cell abundance were used to calculate the scaled intrinsic clearance, which was combined with liver blood flow and fraction of compound unbound in the blood to give hepatic clearance. The systemic exposure in the general circulation (AUC) was extrapolated using internal dose and hepatic clearance, and C max was extrapolated (conservative overestimation) using internal dose and volume of distribution, indicating that appropriate toxicokinetic information can be generated based solely on in vitro data. For the hair dye, p-phenylenediamine, these data were found to be in the same order of magnitude as those published for human volunteers. - Highlights: • An entirely in silico/in vitro approach to predict in vivo exposure to dermally applied hair dyes • Skin penetration and epidermal conversion assessed in human skin explants and

  8. Expression of intercellular adhesion molecule-1 in UVA-irradiated human skin cells in vitro and in vivo

    International Nuclear Information System (INIS)

    Treina, G.; Scaletta, C.; Frenk, E.; Applegate, L.A.; Fourtanier, A.; Seite, S.

    1996-01-01

    Ultraviolet A (UVA) radiation represents an important oxidative stress to human skin and certain forms of oxidative stress have been shown to modulate intercellular adhesion molecule-1 (ICAM-1) expression. ICAM-1 has been shown to play an important part in many immune reactions and the perturbations of this molecule by ultraviolet radiation could have implications in many inflammatory responses. An enhancement immunohistochemical method with avidin/biotin was used for analysing the early effects of UVA radiation on human cell cultures and human skin (340-400 nm). Both in vitro and in vivo data show that ICAM-1 staining in epidermal keratinocytes, which was expressed constitutively, decreased in a UVA dose-dependent manner. The decrease was most noted at 3-6 h following UVA radiation with some ICAM-1 staining returning by 48 h post-UVA. ICAM-1 positive staining in the dermis was specific for vascular structures and was increased 24 h after UVA radiation. Cultured dermal fibroblasts exhibited ICAM-1 staining which increased slightly within 6-48 h post-UVA radiation. As epidermal ICAM-1 expression is depleted following UVA radiation and dermal expression increases due to an increase in the vascular structures, ICAM-1 provides a valuable marker following UVA radiation in human skin that can be readily measured in situ. (author)

  9. Generation of human cortical neurons from a new immortal fetal neural stem cell line

    International Nuclear Information System (INIS)

    Cacci, E.; Villa, A.; Parmar, M.; Cavallaro, M.; Mandahl, N.; Lindvall, O.; Martinez-Serrano, A.; Kokaia, Z.

    2007-01-01

    Isolation and expansion of neural stem cells (NSCs) of human origin are crucial for successful development of cell therapy approaches in neurodegenerative diseases. Different epigenetic and genetic immortalization strategies have been established for long-term maintenance and expansion of these cells in vitro. Here we report the generation of a new, clonal NSC (hc-NSC) line, derived from human fetal cortical tissue, based on v-myc immortalization. Using immunocytochemistry, we show that these cells retain the characteristics of NSCs after more than 50 passages. Under proliferation conditions, when supplemented with epidermal and basic fibroblast growth factors, the hc-NSCs expressed neural stem/progenitor cell markers like nestin, vimentin and Sox2. When growth factors were withdrawn, proliferation and expression of v-myc and telomerase were dramatically reduced, and the hc-NSCs differentiated into glia and neurons (mostly glutamatergic and GABAergic, as well as tyrosine hydroxylase-positive, presumably dopaminergic neurons). RT-PCR analysis showed that the hc-NSCs retained expression of Pax6, Emx2 and Neurogenin2, which are genes associated with regionalization and cell commitment in cortical precursors during brain development. Our data indicate that this hc-NSC line could be useful for exploring the potential of human NSCs to replace dead or damaged cortical cells in animal models of acute and chronic neurodegenerative diseases. Taking advantage of its clonality and homogeneity, this cell line will also be a valuable experimental tool to study the regulatory role of intrinsic and extrinsic factors in human NSC biology

  10. Analysis of aquaporin 9 expression in human epidermis and cultured keratinocytes

    Directory of Open Access Journals (Sweden)

    Yoshinori Sugiyama

    2014-01-01

    Full Text Available Aquaporin 9 (AQP9 is a member of the aquaglyceroporin family that transports glycerol, urea and other small solutes as well as water. Compared to the expression and function in epidermal keratinocytes of AQP3, another aquaglyceroporin, our knowledge of epidermal AQP9 remains elusive. In this study, we investigated the expression of AQP9 in the human epidermis and cultured keratinocytes. Immunofluorescence studies revealed that AQP9 expression is highly restricted to the stratum granulosum of the human epidermis, where occludin is also expressed at the tight junctions. Interestingly, the AQP3 staining decreased sharply below the cell layers in which AQP9 is expressed. In cultured normal human epidermal keratinocytes (NHEK, knock-down of AQP9 expression in the differentiated cells induced by RNA interference reduced glycerol uptake, which was not as pronounced as was the case with AQP3 knock-down cells. In contrast, similar reduction of urea uptake was detected in AQP9 and AQP3 knock-down cells. These findings suggested that AQP9 expression in NHEK facilitates at least the transport of glycerol and urea. Finally, we analyzed the effect of retinoic acid (RA, a potent stimulator of keratinocyte proliferation, on AQP3 and AQP9 mRNA expression in differentiated NHEK. Stimulation with RA at 1 μM for 24 h augmented AQP3 expression and down-regulated AQP9 expression. Collectively, these results indicate that AQP9 expression in epidermal keratinocytes is regulated in a different manner from that of AQP3.

  11. Epidermal characters of Tamarix L. (Tamaricaceae) from Northwest China and their taxonomic and palaeogeographic implications

    OpenAIRE

    Jian-Wei Zhang; Ashalata D'Rozario; Shi-Min Duan; Xi-Yong Wang; Xiao-Qing Liang; Bo-Rong Pan

    2018-01-01

    The taxonomical position of species of the genus Tamarix (Tamaricaceae) has been criticized because of their gross morphological similarities (such as slender, smooth and reddish–brown branches, grey–green foliage and scale leaves), and their systematic relationships remain unclear. In this paper, the leaf epidermal features of 17 species from China are studied based on the micro-morphological characters of the epidermal cells, stomata, salt glands, papillae and epidermal hairs. According to ...

  12. Three-Dimensional In Vitro Skin and Skin Cancer Models Based on Human Fibroblast-Derived Matrix.

    Science.gov (United States)

    Berning, Manuel; Prätzel-Wunder, Silke; Bickenbach, Jackie R; Boukamp, Petra

    2015-09-01

    Three-dimensional in vitro skin and skin cancer models help to dissect epidermal-dermal and tumor-stroma interactions. In the model presented here, normal human dermal fibroblasts isolated from adult skin self-assembled into dermal equivalents with their specific fibroblast-derived matrix (fdmDE) over 4 weeks. The fdmDE represented a complex human extracellular matrix that was stabilized by its own heterogeneous collagen fiber meshwork, largely resembling a human dermal in vivo architecture. Complemented with normal human epidermal keratinocytes, the skin equivalent (fdmSE) thereof favored the establishment of a well-stratified and differentiated epidermis and importantly allowed epidermal regeneration in vitro for at least 24 weeks. Moreover, the fdmDE could be used to study the features of cutaneous skin cancer. Complementing fdmDE with HaCaT cells in different stages of malignancy or tumor-derived cutaneous squamous cell carcinoma cell lines, the resulting skin cancer equivalents (fdmSCEs) recapitulated the respective degree of tumorigenicity. In addition, the fdmSCE invasion phenotypes correlated with their individual degree of tissue organization, disturbance in basement membrane organization, and presence of matrix metalloproteinases. Together, fdmDE-based models are well suited for long-term regeneration of normal human epidermis and, as they recapitulate tumor-specific growth, differentiation, and invasion profiles of cutaneous skin cancer cells, also provide an excellent human in vitro skin cancer model.

  13. In Vitro Responsiveness of Glioma Cell Lines to Multimodality Treatment With Radiotherapy, Temozolomide, and Epidermal Growth Factor Receptor Inhibition With Cetuximab

    International Nuclear Information System (INIS)

    Combs, Stephanie E.; Schulz-Ertner, Daniela; Roth, Wilfried; Herold-Mende, Christel; Debus, Juergen; Weber, Klaus-Josef

    2007-01-01

    Background: The majority of glioblastoma multiforme (GBM) cells express the epidermal growth factor receptor (EGFR). The present study evaluates the combination of temozolomide (TMZ), EGFR inhibition, and radiotherapy (RT) in GBM cell lines. Methods and Materials: Human GBM cell lines U87, LN229, LN18, NCH 82, and NCH 89 were treated with various combinations of TMZ, RT, and the monoclonal EGFR antibody cetuximab. Responsiveness of glioma cells to the combination treatment was measured by clonogenic survival. Results: Overall, double and triple combinations of RT, TMZ, and cetuximab lead to additive cytotoxic effects (independent toxicity). A notable exception was observed for U87 and LN 18 cell lines, where the combination of TMZ and cetuximab showed substantial antagonism. Interestingly, in these two cell lines, the combination of RT with cetuximab resulted in a substantial increase in cell killing over that expected for independent toxicity. The triple combination with RT, cetuximab, and TMZ was nearly able to overcome the antagonism for the TMZ/cetuximab combination in U87, however only marginally in LN18, GBM cell lines. Conclusion: It appears that EGFR expression is not correlated with cytotoxic effects exerted by cetuximab. Combination treatment with TMZ, cetuximab and radiation resulted in independent toxicity in three out of five cell lines evaluated, the antagonistic effect of the TMZ/cetuximab combination in two cell lines could indicate that TMZ preferentially kills cetuximab-resistant cells, suggesting for some cross-talk between toxicity mechanisms. Expression of EGFR was no surrogate marker for responsiveness to cetuximab, alone or in combination with RT and TMZ

  14. Clinical Studies on conformal radiotherapy combined with epidermal ...

    African Journals Online (AJOL)

    Purpose: To study the effect of conformal radiotherapy combined with epidermal growth factor receptor-tyrosine kinase inhibitor (EGFR-TKI) in the second-line treatment of non-small cell lung cancer (NSCLC). Methods: A total of 316 patients attending Shanghai Pulmonary Hospital affiliated to Tongji University, were divided ...

  15. Cytoskeleton and pericellular matrix organization of pure adult human keratinocytes cultured from suction-blister roof epidermis.

    Science.gov (United States)

    Kariniemi, A L; Lehto, V P; Vartio, T; Virtanen, I

    1982-12-01

    Pure adult human keratinocyte cultures were raised from suction-blister roof epidermis and cultured in MCDB-151 medium. In primary culture the epidermal cells rapidly adhered, spread and began to proliferate on collagen-coated growth substrata but not on uncoated plastic or glass substrata. A fibrillar keratin-specific fluorescence, showing a typical cell-cell arrangement, was seen in all cells in indirect immunofluorescence microscopy, whereas only some cells also showed vimentin-specific staining. A fine fibrillar fibronectin-specific surface staining was seen at the margin of attaching cells and in marginal cells of spreading cell islands, whereas no fluorescence could be seen in epidermal cells, with antibodies against type IV collagen or laminin. Interestingly, the marginal cells also showed intracellular fibronectin. The synthesis of fibronectin in epidermal cell cultures could also be revealed by metabolic labelling experiments with [35S]methionine. In contrast to primary cultures, subcultivated keratinocytes also adhered to uncoated plastic and glass substrata. After subcultivation, keratin and surface fibronectin distribution remained unaltered but after some subcultivations, most of the cells also showed fibrillar vimentin and expressed fibronectin intracellularly. The results show that the suction-blister method provides an easy way to obtain pure epidermal cell cultures without contaminating mesenchymal cells. Our results also suggest a direct role for fibronectin but not for collagen type IV or laminin in adhesion and spreading of epidermal cells in vitro.

  16. Sphingosine-1-phosphate mediates epidermal growth factor-induced muscle satellite cell activation

    Energy Technology Data Exchange (ETDEWEB)

    Nagata, Yosuke, E-mail: cynagata@mail.ecc.u-tokyo.ac.jp; Ohashi, Kazuya; Wada, Eiji; Yuasa, Yuki; Shiozuka, Masataka; Nonomura, Yoshiaki; Matsuda, Ryoichi

    2014-08-01

    Skeletal muscle can regenerate repeatedly due to the presence of resident stem cells, called satellite cells. Because satellite cells are usually quiescent, they must be activated before participating in muscle regeneration in response to stimuli such as injury, overloading, and stretch. Although satellite cell activation is a crucial step in muscle regeneration, little is known of the molecular mechanisms controlling this process. Recent work showed that the bioactive lipid sphingosine-1-phosphate (S1P) plays crucial roles in the activation, proliferation, and differentiation of muscle satellite cells. We investigated the role of growth factors in S1P-mediated satellite cell activation. We found that epidermal growth factor (EGF) in combination with insulin induced proliferation of quiescent undifferentiated mouse myoblast C2C12 cells, which are also known as reserve cells, in serum-free conditions. Sphingosine kinase activity increased when reserve cells were stimulated with EGF. Treatment of reserve cells with the D-erythro-N,N-dimethylsphingosine, Sphingosine Kinase Inhibitor, or siRNA duplexes specific for sphingosine kinase 1, suppressed EGF-induced C2C12 activation. We also present the evidence showing the S1P receptor S1P2 is involved in EGF-induced reserve cell activation. Moreover, we demonstrated a combination of insulin and EGF promoted activation of satellite cells on single myofibers in a manner dependent on SPHK and S1P2. Taken together, our observations show that EGF-induced satellite cell activation is mediated by S1P and its receptor. - Highlights: • EGF in combination with insulin induces proliferation of quiescent C2C12 cells. • Sphingosine kinase activity increases when reserve cells are stimulated with EGF. • EGF-induced activation of reserve cells is dependent on sphingosine kinase and ERK. • The S1P receptor S1P2 is involved in EGF-induced reserve cell activation. • EGF-induced reserve cell activation is mediated by S1P and its

  17. Sphingosine-1-phosphate mediates epidermal growth factor-induced muscle satellite cell activation

    International Nuclear Information System (INIS)

    Nagata, Yosuke; Ohashi, Kazuya; Wada, Eiji; Yuasa, Yuki; Shiozuka, Masataka; Nonomura, Yoshiaki; Matsuda, Ryoichi

    2014-01-01

    Skeletal muscle can regenerate repeatedly due to the presence of resident stem cells, called satellite cells. Because satellite cells are usually quiescent, they must be activated before participating in muscle regeneration in response to stimuli such as injury, overloading, and stretch. Although satellite cell activation is a crucial step in muscle regeneration, little is known of the molecular mechanisms controlling this process. Recent work showed that the bioactive lipid sphingosine-1-phosphate (S1P) plays crucial roles in the activation, proliferation, and differentiation of muscle satellite cells. We investigated the role of growth factors in S1P-mediated satellite cell activation. We found that epidermal growth factor (EGF) in combination with insulin induced proliferation of quiescent undifferentiated mouse myoblast C2C12 cells, which are also known as reserve cells, in serum-free conditions. Sphingosine kinase activity increased when reserve cells were stimulated with EGF. Treatment of reserve cells with the D-erythro-N,N-dimethylsphingosine, Sphingosine Kinase Inhibitor, or siRNA duplexes specific for sphingosine kinase 1, suppressed EGF-induced C2C12 activation. We also present the evidence showing the S1P receptor S1P2 is involved in EGF-induced reserve cell activation. Moreover, we demonstrated a combination of insulin and EGF promoted activation of satellite cells on single myofibers in a manner dependent on SPHK and S1P2. Taken together, our observations show that EGF-induced satellite cell activation is mediated by S1P and its receptor. - Highlights: • EGF in combination with insulin induces proliferation of quiescent C2C12 cells. • Sphingosine kinase activity increases when reserve cells are stimulated with EGF. • EGF-induced activation of reserve cells is dependent on sphingosine kinase and ERK. • The S1P receptor S1P2 is involved in EGF-induced reserve cell activation. • EGF-induced reserve cell activation is mediated by S1P and its

  18. Capacity of Human Dental Follicle Cells to Differentiate into Neural Cells In Vitro

    Directory of Open Access Journals (Sweden)

    Shingo Kanao

    2017-01-01

    Full Text Available The dental follicle is an ectomesenchymal tissue surrounding the developing tooth germ. Human dental follicle cells (hDFCs have the capacity to commit to differentiation into multiple cell types. Here we investigated the capacity of hDFCs to differentiate into neural cells and the efficiency of a two-step strategy involving floating neurosphere-like bodies for neural differentiation. Undifferentiated hDFCs showed a spindle-like morphology and were positive for neural markers such as nestin, β-III-tubulin, and S100β. The cellular morphology of several cells was neuronal-like including branched dendrite-like processes and neurites. Next, hDFCs were used for neurosphere formation in serum-free medium containing basic fibroblast growth factor, epidermal growth factor, and B27 supplement. The number of cells with neuronal-like morphology and that were strongly positive for neural markers increased with sphere formation. Gene expression of neural markers also increased in hDFCs with sphere formation. Next, gene expression of neural markers was examined in hDFCs during neuronal differentiation after sphere formation. Expression of Musashi-1 and Musashi-2, MAP2, GFAP, MBP, and SOX10 was upregulated in hDFCs undergoing neuronal differentiation via neurospheres, whereas expression of nestin and β-III-tubulin was downregulated. In conclusion, hDFCs may be another optimal source of neural/glial cells for cell-based therapies to treat neurological diseases.

  19. Deletion of epidermal Rac1 inhibits HPV-8 induced skin papilloma formation and facilitates HPV-8- and UV-light induced skin carcinogenesis.

    Science.gov (United States)

    Deshmukh, Jayesh; Pofahl, Ruth; Pfister, Herbert; Haase, Ingo

    2016-09-06

    Overexpression and increased activity of the small Rho GTPase Rac1 has been linked to squamous cell carcinoma of the epidermis and mucosa in humans. Targeted deletion of Rac1 or inhibition of Rac1 activity in epidermal keratinocytes reduced papilloma formation in a chemical skin carcinogenesis mouse model. However, a potential role of Rac1 in HPV- and UV-light induced skin carcinogenesis has not been investigated so far, solar UV radiation being an important carcinogen to the skin.To investigate this, we deleted Rac1 or modulated its activity in mice with transgenic expression of Human papilloma virus type-8 (HPV-8) in epidermal keratinocytes. Our data show that inhibition or deletion of Rac1 results in reduced papilloma formation upon UV-irradiation with a single dose, whereas constitutive activation of Rac1 strongly increases papilloma frequency in these mice. Surprisingly, we observed that, upon chronic UV-irradiation, the majority of mice with transgenic expression of HPV-8 and epidermis specific Rac1 deletion developed squamous cell carcinomas. Taken together, our data show that Rac1 exerts a dual role in skin carcinogenesis: its activation is, on one hand, required for HPV-8- and UV-light induced papilloma formation but, on the other, suppresses the development of squamous cell carcinomas.

  20. Cervi cornus Colla (deer antler glue) induce epidermal differentiation in the reconstruction of skin equivalents.

    Science.gov (United States)

    Choi, H-R; Nam, K-M; Kim, D-S; Huh, C-H; Na, J-I; Park, K-C

    2013-06-01

    In the reconstruction of skin equivalents (SEs), keratinocyte differentiation is important because epidermal differentiation is closely related with barrier function. The aim of this study was to investigate the effects of Cervi cornus Colla (CCC) on the stem cell activity and epidermal differentiation in the reconstruction of skin equivalent. Four different models were constructed according to different composition of dermal substitute. Results showed similar morphologic findings when hyaluronic acid (HA) and/or CCC was added. But, immunohistochemical staining showed that p63 was significantly increased by addition of HA and/or CCC. Increased staining of integrin α6 and β1 was variably observed when HA and/or CCC was added to make dermal substitute. These finding showed that addition of HA and/or CCC may affect the stem cell activity in the reconstruction of skin. Furthermore, filaggrin expression was much increased when CCC was added. It showed that epidermal differentiation was significantly improved by addition of CCC. In conclusion, simultaneous presence of HA and CCC contributed to the stem cell activity and epidermal differentiation in the reconstruction of SE. Legislation in the EU prohibits marketing cosmetics and personal care products that contain constituents that have been examined through animal experiments. To avoid these limitations, SEs can be used for testing the safety or the efficacy of cosmetic ingredients. Therefore, our results showed that combined use of HA and CCC can be helpful for the reconstruction of SE with good stem cell activity and epidermal differentiation. © 2013 Society of Cosmetic Scientists and the Société Française de Cosmétologie.

  1. Epidermal Growth Factor Receptor in Pancreatic Cancer

    International Nuclear Information System (INIS)

    Oliveira-Cunha, Melissa; Newman, William G.; Siriwardena, Ajith K.

    2011-01-01

    Pancreatic cancer is the fourth leading cause of cancer related death. The difficulty in detecting pancreatic cancer at an early stage, aggressiveness and the lack of effective therapy all contribute to the high mortality. Epidermal growth factor receptor (EGFR) is a transmembrane glycoprotein, which is expressed in normal human tissues. It is a member of the tyrosine kinase family of growth factors receptors and is encoded by proto-oncogenes. Several studies have demonstrated that EGFR is over-expressed in pancreatic cancer. Over-expression correlates with more advanced disease, poor survival and the presence of metastases. Therefore, inhibition of the EGFR signaling pathway is an attractive therapeutic target. Although several combinations of EGFR inhibitors with chemotherapy demonstrate inhibition of tumor-induced angiogenesis, tumor cell apoptosis and regression in xenograft models, these benefits remain to be confirmed. Multimodality treatment incorporating EGFR-inhibition is emerging as a novel strategy in the treatment of pancreatic cancer

  2. Phospholipase D2 Enhances Epidermal Growth Factor-Induced Akt Activation in EL4 Lymphoma Cells

    Directory of Open Access Journals (Sweden)

    Manpreet S. Chahal

    2010-07-01

    Full Text Available Phospholipase D2 (PLD2 generates phosphatidic acid through hydrolysis of phosphatidylcholine. PLD2 has been shown to play a role in enhancing tumorigenesis. The epidermal growth factor receptor (EGFR can both activate and interact with PLD2. Murine lymphoma EL4 cells lacking endogenous PLD2 present a unique model to elucidate the role of PLD2 in signal transduction. In the current study, we investigated effects of PLD2 on EGF response. Western blotting and RT-PCR were used to establish that both parental cells and PLD2 transfectants express endogenous EGFR. Levels of EGFR protein are increased in cells expressing active PLD2, as compared to parental cells or cells expressing inactive PLD2. EGF stimulates proliferation of EL4 cells transfected with active PLD2, but not parental cells or cells transfected with inactive PLD2. EGF-mediated proliferation in cells expressing active PLD2 is dependent on the activities of both the EGFR and the PI3K/Akt pathway, as demonstrated by studies using protein kinase inhibitors. EGF-induced invasion through a synthetic extracellular matrix is enhanced in cells expressing active PLD2, as compared to parental cells or cells expressing inactive PLD2. Taken together, the data suggest that PLD2 acts in concert with EGFR to enhance mitogenesis and invasion in lymphoma cells.

  3. Phospholipase D2 Enhances Epidermal Growth Factor-Induced Akt Activation in EL4 Lymphoma Cells.

    Science.gov (United States)

    Chahal, Manpreet S; Brauner, Daniel J; Meier, Kathryn E

    2010-07-02

    Phospholipase D2 (PLD2) generates phosphatidic acid through hydrolysis of phosphatidylcholine. PLD2 has been shown to play a role in enhancing tumorigenesis. The epidermal growth factor receptor (EGFR) can both activate and interact with PLD2. Murine lymphoma EL4 cells lacking endogenous PLD2 present a unique model to elucidate the role of PLD2 in signal transduction. In the current study, we investigated effects of PLD2 on EGF response. Western blotting and RT-PCR were used to establish that both parental cells and PLD2 transfectants express endogenous EGFR. Levels of EGFR protein are increased in cells expressing active PLD2, as compared to parental cells or cells expressing inactive PLD2. EGF stimulates proliferation of EL4 cells transfected with active PLD2, but not parental cells or cells transfected with inactive PLD2. EGF-mediated proliferation in cells expressing active PLD2 is dependent on the activities of both the EGFR and the PI3K/Akt pathway, as demonstrated by studies using protein kinase inhibitors. EGF-induced invasion through a synthetic extracellular matrix is enhanced in cells expressing active PLD2, as compared to parental cells or cells expressing inactive PLD2. Taken together, the data suggest that PLD2 acts in concert with EGFR to enhance mitogenesis and invasion in lymphoma cells.

  4. Spatial and Single-Cell Transcriptional Profiling Identifies Functionally Distinct Human Dermal Fibroblast Subpopulations.

    Science.gov (United States)

    Philippeos, Christina; Telerman, Stephanie B; Oulès, Bénédicte; Pisco, Angela O; Shaw, Tanya J; Elgueta, Raul; Lombardi, Giovanna; Driskell, Ryan R; Soldin, Mark; Lynch, Magnus D; Watt, Fiona M

    2018-04-01

    Previous studies have shown that mouse dermis is composed of functionally distinct fibroblast lineages. To explore the extent of fibroblast heterogeneity in human skin, we used a combination of comparative spatial transcriptional profiling of human and mouse dermis and single-cell transcriptional profiling of human dermal fibroblasts. We show that there are at least four distinct fibroblast populations in adult human skin, not all of which are spatially segregated. We define markers permitting their isolation and show that although marker expression is lost in culture, different fibroblast subpopulations retain distinct functionality in terms of Wnt signaling, responsiveness to IFN-γ, and ability to support human epidermal reconstitution when introduced into decellularized dermis. These findings suggest that ex vivo expansion or in vivo ablation of specific fibroblast subpopulations may have therapeutic applications in wound healing and diseases characterized by excessive fibrosis. Copyright © 2018 The Authors. Published by Elsevier Inc. All rights reserved.

  5. Studies on the relationship between epidermal cell turnover kinetics and permeability of hairless mouse skin

    International Nuclear Information System (INIS)

    Han, S.R.

    1988-01-01

    The primary aim of this study was to develop non-invasive, physical means to quantitatively assess the epidermal turnover kinetics and barrier properties of the skin and relate these to the cutaneous irritation which results from ultraviolet light irradiation and mold thermal burns. After systematically injecting radiolabeled glycine, the appearance of radioactivity at the skin's surface indicated the transit time of radiolabeled cells through the skin. By plotting the data as the cumulative specific activity against time and then fitting them with a third order polynomial equation, it is possible to estimate the turnover time of the stratum corneum. The skin turnover was coordinated with non-invasive transepidermal water loss (TEWL) studies determined with an evaporimeter. In vitro diffusion studies of the permeability of hydrocortisone through UVB irradiated and thermally burned skin were also performed. The studies indicated that irritated skin offers a relatively low diffusional resistance to hydrocortisone. Depending on the severity of the trauma, the increases in hydrocortisone's permeability coefficient through irritated skin ranged from a low of about 2 times normal to a high of about 210 times normal. Trauma-induced changes in hydrocortisone permeability parallel changes in TEWL, proving that the barrier deficient state resulting from rapid epidermal turnover is a general phenomenon

  6. UVB radiation generates sunburn pain and affects skin by activating epidermal TRPV4 ion channels and triggering endothelin-1 signaling.

    Science.gov (United States)

    Moore, Carlene; Cevikbas, Ferda; Pasolli, H Amalia; Chen, Yong; Kong, Wei; Kempkes, Cordula; Parekh, Puja; Lee, Suk Hee; Kontchou, Nelly-Ange; Yeh, Iwei; Ye, Iwei; Jokerst, Nan Marie; Fuchs, Elaine; Steinhoff, Martin; Liedtke, Wolfgang B

    2013-08-20

    At our body surface, the epidermis absorbs UV radiation. UV overexposure leads to sunburn with tissue injury and pain. To understand how, we focus on TRPV4, a nonselective cation channel highly expressed in epithelial skin cells and known to function in sensory transduction, a property shared with other transient receptor potential channels. We show that following UVB exposure mice with induced Trpv4 deletions, specifically in keratinocytes, are less sensitive to noxious thermal and mechanical stimuli than control animals. Exploring the mechanism, we find that epidermal TRPV4 orchestrates UVB-evoked skin tissue damage and increased expression of the proalgesic/algogenic mediator endothelin-1. In culture, UVB causes a direct, TRPV4-dependent Ca(2+) response in keratinocytes. In mice, topical treatment with a TRPV4-selective inhibitor decreases UVB-evoked pain behavior, epidermal tissue damage, and endothelin-1 expression. In humans, sunburn enhances epidermal expression of TRPV4 and endothelin-1, underscoring the potential of keratinocyte-derived TRPV4 as a therapeutic target for UVB-induced sunburn, in particular pain.

  7. Epidermal growth factor treatment of A431 cells alters the binding capacity and electrophoretic mobility of the cytoskeletally associated epidermal growth factor receptor

    International Nuclear Information System (INIS)

    Roy, L.M.; Gittinger, C.K.; Landreth, G.E.

    1991-01-01

    Epidermal growth factor receptor interacts with structural elements of A431 cells and remains associated with the cytoskeleton following extraction with nonionic detergents. Extraction of cells with 0.15% Triton X-100 resulted in detection of only approximately 40% of the EGF binding sites on the cytoskeleton. If the cells were exposed to EGF prior to extraction, approximately twofold higher levels of low-affinity EGF binding sites were detected. The difference in number of EGF binding sites was not a consequence of differences in numbers of EGF receptors associated with the cytoskeleton; equal amounts of 35S-labeled receptor were immunoprecipitated from the cytoskeletons of both control and EGF-treated cells. The effect of EGF pretreatment on binding activity was coincident with a change in the mobility of the receptor from a doublet of Mr approximately 160-180 kDa to a single sharp band at 180 kDa. The alteration in receptor mobility was not a simple consequence of receptor phosphorylation in that the alteration was not reversed by alkaline phosphatase treatment, nor was the shift produced by treatment of the cells with phorbol ester. The two EGF receptor species demonstrated differential susceptibility to V8 proteinase digestion. The EGF-induced 180 kDa species was preferentially digested by the proteinase relative to the 160 kDa species, indicating that EGF binding results in a conformational change in the receptor. The EGF-mediated preservation of binding activity and altered conformation may be related to receptor oligomerization

  8. Human neural progenitors express functional lysophospholipid receptors that regulate cell growth and morphology

    Directory of Open Access Journals (Sweden)

    Callihan Phillip

    2008-12-01

    Full Text Available Abstract Background Lysophospholipids regulate the morphology and growth of neurons, neural cell lines, and neural progenitors. A stable human neural progenitor cell line is not currently available in which to study the role of lysophospholipids in human neural development. We recently established a stable, adherent human embryonic stem cell-derived neuroepithelial (hES-NEP cell line which recapitulates morphological and phenotypic features of neural progenitor cells isolated from fetal tissue. The goal of this study was to determine if hES-NEP cells express functional lysophospholipid receptors, and if activation of these receptors mediates cellular responses critical for neural development. Results Our results demonstrate that Lysophosphatidic Acid (LPA and Sphingosine-1-phosphate (S1P receptors are functionally expressed in hES-NEP cells and are coupled to multiple cellular signaling pathways. We have shown that transcript levels for S1P1 receptor increased significantly in the transition from embryonic stem cell to hES-NEP. hES-NEP cells express LPA and S1P receptors coupled to Gi/o G-proteins that inhibit adenylyl cyclase and to Gq-like phospholipase C activity. LPA and S1P also induce p44/42 ERK MAP kinase phosphorylation in these cells and stimulate cell proliferation via Gi/o coupled receptors in an Epidermal Growth Factor Receptor (EGFR- and ERK-dependent pathway. In contrast, LPA and S1P stimulate transient cell rounding and aggregation that is independent of EGFR and ERK, but dependent on the Rho effector p160 ROCK. Conclusion Thus, lysophospholipids regulate neural progenitor growth and morphology through distinct mechanisms. These findings establish human ES cell-derived NEP cells as a model system for studying the role of lysophospholipids in neural progenitors.

  9. Comet assay in reconstructed 3D human epidermal skin models—investigation of intra- and inter-laboratory reproducibility with coded chemicals

    Science.gov (United States)

    Pfuhler, Stefan

    2013-01-01

    Reconstructed 3D human epidermal skin models are being used increasingly for safety testing of chemicals. Based on EpiDerm™ tissues, an assay was developed in which the tissues were topically exposed to test chemicals for 3h followed by cell isolation and assessment of DNA damage using the comet assay. Inter-laboratory reproducibility of the 3D skin comet assay was initially demonstrated using two model genotoxic carcinogens, methyl methane sulfonate (MMS) and 4-nitroquinoline-n-oxide, and the results showed good concordance among three different laboratories and with in vivo data. In Phase 2 of the project, intra- and inter-laboratory reproducibility was investigated with five coded compounds with different genotoxicity liability tested at three different laboratories. For the genotoxic carcinogens MMS and N-ethyl-N-nitrosourea, all laboratories reported a dose-related and statistically significant increase (P 30% cell loss), and the overall response was comparable in all laboratories despite some differences in doses tested. The results of the collaborative study for the coded compounds were generally reproducible among the laboratories involved and intra-laboratory reproducibility was also good. These data indicate that the comet assay in EpiDerm™ skin models is a promising model for the safety assessment of compounds with a dermal route of exposure. PMID:24150594

  10. Epidermal Overexpression of Xenobiotic Receptor PXR Impairs the Epidermal Barrier and Triggers Th2 Immune Response.

    Science.gov (United States)

    Elentner, Andreas; Schmuth, Matthias; Yannoutsos, Nikolaos; Eichmann, Thomas O; Gruber, Robert; Radner, Franz P W; Hermann, Martin; Del Frari, Barbara; Dubrac, Sandrine

    2018-01-01

    The skin is in daily contact with environmental pollutants, but the long-term effects of such exposure remain underinvestigated. Many of these toxins bind and activate the pregnane X receptor (PXR), a ligand-activated transcription factor that regulates genes central to xenobiotic metabolism. The objective of this work was to investigate the effect of constitutive activation of PXR in the basal layer of the skin to mimic repeated skin exposure to noxious molecules. We designed a transgenic mouse model that overexpresses the human PXR gene linked to the herpes simplex VP16 domain under the control of the keratin 14 promoter. We show that transgenic mice display increased transepidermal water loss and elevated skin pH, abnormal stratum corneum lipids, focal epidermal hyperplasia, activated keratinocytes expressing more thymic stromal lymphopoietin, a T helper type 2/T helper type 17 skin immune response, and increased serum IgE. Furthermore, the cutaneous barrier dysfunction precedes development of the T helper type 2/T helper type 17 inflammation in transgenic mice, thereby mirroring the time course of atopic dermatitis development in humans. Moreover, further experiments suggest increased PXR signaling in the skin of patients with atopic dermatitis when compared with healthy skin. Thus, PXR activation by environmental pollutants may compromise epidermal barrier function and favor an immune response resembling atopic dermatitis. Copyright © 2017 The Authors. Published by Elsevier Inc. All rights reserved.

  11. Catalase reverses tumorigenicity in a malignant cell line by an epidermal growth factor receptor pathway.

    Science.gov (United States)

    Finch, Joanne S; Tome, Margaret E; Kwei, Kevin A; Bowden, G Tim

    2006-03-01

    We have used a keratinocyte in vivo/in vitro cell model to test the hypothesis that hydrogen peroxide acts as a signaling molecule, contributing to proliferation and tumorigenesis. A cell line, 6M90, that produces squamous cell carcinoma (SCC), has high levels of ROS and low levels of catalase. A new cell line, MTOC2, generated from parental 6M90 cells by introduction of a Tet-responsive catalase transgene, effectively expressed higher peroxisomal catalase. Increased catalase expression diminished constitutive ROS and enhanced viability after treatment with hydrogen peroxide. Protein tyrosine phosphatase activity was higher in the MTOC2 cells with high catalase, consistent with detection of a lower level of phosphorylation at tyrosine 1068 of the epidermal growth factor receptor (EGF-R). Transcription of downstream c-fos, AP-1 transactivation and cell proliferation were higher in the low catalase cells. An EGF-R inhibitor, AG1478, blocks the higher AP-1 transactivation and cell proliferation of the low catalase 6M90 cells. Tumorigenesis in SCID mice was greatly diminished in the high catalase cells. Our data suggest that hydrogen peroxide functions as a signaling molecule that can modulate activity of a protein tyrosine phosphatase/(s) resulting in phosphorylation of tryrosine/(s) on the EGF-R. Therefore, catalase acts as a tumor-suppressor gene in part by decreasing EGF-R signaling.

  12. A novel three-dimensional cell culture method enhances antiviral drug screening in primary human cells.

    Science.gov (United States)

    Koban, Robert; Neumann, Markus; Daugs, Aila; Bloch, Oliver; Nitsche, Andreas; Langhammer, Stefan; Ellerbrok, Heinz

    2018-02-01

    Gefitinib is a specific inhibitor of the epidermal growth factor receptor (EGFR) and FDA approved for treatment of non-small cell lung cancer. In a previous study we could show the in vitro efficacy of gefitinib for treatment of poxvirus infections in monolayer (2D) cultivated cell lines. Permanent cell lines and 2D cultures, however, are known to be rather unphysiological; therefore it is difficult to predict whether determined effective concentrations or the drug efficacy per se are transferable to the in vivo situation. 3D cell cultures, which meanwhile are widely distributed across all fields of research, are a promising tool for more predictive in vitro investigations of antiviral compounds. In this study the spreading of cowpox virus and the antiviral efficacy of gefitinib were analyzed in primary human keratinocytes (NHEK) grown in a novel 3D extracellular matrix-based cell culture model and compared to the respective monolayer culture. 3D-cultivated NHEK grew in a polarized and thus a more physiological manner with altered morphology and close cell-cell contact. Infected cultures showed a strongly elevated sensitivity towards gefitinib. EGFR phosphorylation, cell proliferation, and virus replication were significantly reduced in 3D cultures at gefitinib concentrations which were at least 100-fold lower than those in monolayer cultures and well below the level of cytotoxicity. Our newly established 3D cell culture model with primary human cells is an easy-to-handle alternative to conventional monolayer cell cultures and previously described more complex 3D cell culture systems. It can easily be adapted to other cell types and a broad spectrum of viruses for antiviral drug screening and many other aspects of virus research under more in vivo-like conditions. In consequence, it may contribute to a more targeted realization of necessary in vivo experiments. Copyright © 2017 Elsevier B.V. All rights reserved.

  13. PANC-1 pancreatic cancer cell growth inhibited by cucurmosin alone and in combination with an epidermal growth factor receptor-targeted drug.

    Science.gov (United States)

    Wang, Congfei; Yang, Aiqin; Zhang, Baoming; Yin, Qiang; Huang, Heguang; Chen, Minghuang; Xie, Jieming

    2014-03-01

    To investigate the inhibition of PANC-1 pancreatic cancer cell growth by cucurmosin (CUS) and its possible mechanism. We observed the inhibition of PANC-1 cell growth by sulforhodamine B and colony-forming experiments in vitro and established nonobese diabetic/severe combined immunodeficiency mouse subcutaneous tumor models in vivo. We used Western blot to analyze protein levels related to apoptosis and epidermal growth factor receptor (EGFR) signaling pathways after drug intervention, whereas the messenger RNA expression of EGFR was analyzed by quantitative real-time polymerase chain reaction. Sulforhodamine B and colony-forming experiments indicated that CUS inhibited PANC-1 cell proliferation in a dose- and time-dependent manner. A stronger inhibitory effect was observed when CUS was combined with gefitinib. The subcutaneous tumor growth was also inhibited. Western blot showed that all the examined proteins decreased, except for 4E-BP1 and the active fragments of caspase 3 and caspase 9 increased. Epidermal growth factor receptor expression did not change significantly in quantitative real-time polymerase chain reaction. Cucurmosin can strongly inhibit the growth of PANC-1 cells in vitro and in vivo. Cucurmosin can down-regulate EGFR protein expression, but not at the messenger RNA level. Cucurmosin can also inhibit the ras/raf and phosphatidylinositol 3-kinase/Akt downstream signaling pathways and enhance the sensitivity of the EGFR-targeted drug gefitinib.

  14. Degradation of Epidermal Growth Factor Receptor Mediates Dasatinib-Induced Apoptosis in Head and Neck Squamous Cell Carcinoma Cells

    Directory of Open Access Journals (Sweden)

    Yu-Chin Lin

    2012-06-01

    Full Text Available Epidermal growth factor receptor (EGFR is an important oncoprotein that promotes cell growth and proliferation. Dasatinib, a bcr-abl inhibitor, has been approved clinically for the treatment of chronic myeloid leukemia and demonstrated to be effective against solid tumors in vitro through Src inhibition. Here, we disclose that EGFR degradation mediated dasatinib-induced apoptosis in head and neck squamous cell carcinoma (HNSCC cells. HNSCC cells, including Ca9-22, FaDu, HSC3, SAS, SCC-25, and UMSCC1, were treated with dasatinib, and cell viability, apoptosis, and underlying signal transduction were evaluated. Dasatinib exhibited differential sensitivities against HNSCC cells. Growth inhibition and apoptosis were correlated with its inhibition on Akt, Erk, and Bcl-2, irrespective of Src inhibition. Accordingly, we found that down-regulation of EGFR was a determinant of dasatinib sensitivity. Lysosome inhibitor reversed dasatinib-induced EGFR down-regulation, and c-cbl activity was increased by dasatinib, indicating that dasatinib-induced EGFR down-regulation might be through c-cbl-mediated lysosome degradation. Increased EGFR activation by ligand administration rescued cells from dasatinib-induced apoptosis, whereas inhibition of EGFR enhanced its apoptotic effect. Estrogen receptor α (ERα was demonstrated to play a role in Bcl-2 expression, and dasatinib inhibited ERα at the pretranslational level. ERα was associated with EGFR in dasatinib-treated HNSCC cells. Furthermore, the xenograft model showed that dasatinib inhibited HSC3 tumor growth through in vivo down-regulation of EGFR and ERα. In conclusion, degradation of EGFR is a novel mechanism responsible for dasatinib-induced apoptosis in HNSCC cells.

  15. Epidermal Inclusion Cysts of The Breast

    Directory of Open Access Journals (Sweden)

    Amir R. Motabar

    2009-02-01

    Full Text Available Epidermal inclusion cysts are uncommon in the breast, but the consequences can besevere when these cysts occur in the breast parenchyma. Here,we report two suchcases. The patient in case 1 was an 37-year-old woman with a 3-cm palpable mass inthe right breast. Mammography revealed a round and smoothly outlined mass, whichindicated a benign tumor, and sonography showed an irregularly shaped and heterogeneoushypoechoic mass, fibroadenoma was suspected on the basis of clinical andimage findings, but excisional biopsy revealed an epidermal inclusion cyst. The patientin case 2 was a 50-year-old woman with a 2.5-cm lesion in the left breast. Mammographyrevealed a round, dense, smoothly outlined mass, and sonography showeda well-defined, central hyperechoic mass. . Breast cancer was suspected on the basisof the sonographic findings and the age of the patient, but the resected specimen revealedan epidermal inclusion cyst. Although epidermal inclusion cysts are benign,occasionally they may play a role in the origin of squamous carcinoma of the breast. .Mammographic and sonographic features of an epidermal cyst may mimic a malignantlesion. Malignant change appears to occur more frequently in epidermal inclusioncysts in the mammary gland, compared to common epidermal inclusion cysts,and this may be associated with origination of mammary epidermal inclusion cystsfrom squamous metaplasia of the mammary duct epithelium.Epidermmoid inclusion cyst of the breast is potentially serious, although such cystsare rare, and differentiation from a malignant or benign breast tumor is required. Excisionis probably the most appropriate treatment, and can eliminate the possible riskof malignant transformation.

  16. Possible role of epidermal keratinocytes in the construction of acupuncture meridians.

    Science.gov (United States)

    Denda, Mitsuhiro; Tsutsumi, Moe

    2014-04-01

    Acupuncture meridians consist of a network of acupuncture points on the skin, stimulation of which is well established to have a variety of physiological effects. We have previously demonstrated that epidermal keratinocytes contain multiple sensory systems for temperature, mechanical stimuli, electric potentials and other stimuli. These sensory systems generate changes in the calcium-ion concentration in the epidermis, so epidermal keratinocytes can generate spatially-localized electro-physiological patterns in the skin. We have previously demonstrated signaling between epidermal keratinocytes and peripheral nerve systems. Therefore, stimuli sensed by epidermal keratinocytes might be transferred to the unmyelinated nerve fibers that are known to exist in the epidermis and, thence, to the spinal cord and brain. We propose that epidermal keratinocytes form an information-gathering network in the skin and that this network plays a key role in whole-body homeostasis in response to the changing environment. We also hypothesize that this network corresponds to the acupuncture meridians. As supporting examples, we present some striking calcium propagation patterns observed in cultured human keratinocytes after adenosine-triphosphate (ATP) stimulation. These results support the ideas that keratinocytes can generate spatially-restricted signaling patterns after environmental stimulation and that the cultures might be in-vitro models of meridians as an information-gathering network in skin. Copyright © 2014. Published by Elsevier B.V.

  17. Anti-Epidermal Growth Factor Receptor Therapy in Head and Neck Squamous Cell Carcinoma: Focus on Potential Molecular Mechanisms of Drug Resistance

    OpenAIRE

    Boeckx, Carolien; Baay, Marc; Wouters, An; Specenier, Pol; Vermorken, Jan B.; Peeters, Marc; Lardon, Filip

    2013-01-01

    Targeted therapy against epidermal growth factor receptor (EGFR) is one of the most promising therapeutics for head and neck squamous cell carcinoma, and EGFR is overexpressed in a wide range of malignancies. An improved understanding of the resistance to EGFR inhibitors may provide new treatment options. This review summarizes some mechanisms and decribes strategies to overcome this resistance.

  18. INHIBITION OF PROTEIN TYROSINE PHOSPHATASE ACTIVITY MEDIATES EPIDERMAL GROWTH FACTOR RECEPTOR SIGNALING IN HUMAN AIRWAY EPITHELIAL CELLS

    Science.gov (United States)

    Epidemiological studies have implicated zinc in the toxicity of ambient particulate matter (PM) inhalation. We previously showed that exposure to metal-laden PM inhibits protein tyrosine phosphatase (PTP) activity in human primary bronchial epithelial cells (HAEC) and leads t...

  19. Adenovirus E4-ORF1 Dysregulates Epidermal Growth Factor and Insulin/Insulin-Like Growth Factor Receptors To Mediate Constitutive Myc Expression

    OpenAIRE

    Kong, Kathleen; Kumar, Manish; Taruishi, Midori; Javier, Ronald T.

    2015-01-01

    The E4-ORF1 protein encoded by human adenovirus stimulates viral replication in human epithelial cells by binding and activating cellular phosphatidylinositol 3-kinase (PI3K) at the plasma membrane and cellular Myc in the nucleus. In this study, we showed that E4-ORF1 hijacks the tyrosine kinase activities of cellular epidermal growth factor receptor (EGFR) and insulin receptor (InsR)/insulin-like growth factor receptor 1 (IGF1R), as well as the lipid kinase activity of PI3K, to mediate const...

  20. Epidermal response of rainbow trout to Ichthyobodo necator

    DEFF Research Database (Denmark)

    Chettri, Jiwan Kumar; Kuhn, Jesper Andreas; Mohammad, Rezkar Jaafar

    2014-01-01

    Infections with the parasitic flagellate Ichthyobodo necator (Henneguy, 1883) cause severe skin and gill disease in rainbow trout Oncorhynchus mykiss (Walbaum, 1792) juveniles. The epidermal disturbances including hyperplasia and mucous cell exhaustion caused by parasitization are known, but no d...

  1. Human spermatogonial stem cells display limited proliferation in vitro under mouse spermatogonial stem cell culture conditions.

    Science.gov (United States)

    Medrano, Jose V; Rombaut, Charlotte; Simon, Carlos; Pellicer, Antonio; Goossens, Ellen

    2016-11-01

    To study the ability of human spermatogonial stem cells (hSSCs) to proliferate in vitro under mouse spermatogonial stem cell (mSSC) culture conditions. Experimental basic science study. Reproductive biology laboratory. Cryopreserved testicular tissue with normal spermatogenesis obtained from three donors subjected to orchiectomy due to a prostate cancer treatment. Testicular cells used to create in vitro cell cultures corresponding to the following groups: [1] unsorted human testicular cells, [2] differentially plated human testicular cells, and [3] cells enriched with major histocompatibility complex class 1 (HLA - )/epithelial cell surface antigen (EPCAM + ) in coculture with inactivated testicular feeders from the same patient. Analyses and characterization including immunocytochemistry and quantitative reverse-transcription polymerase chain reaction for somatic and germ cell markers, testosterone and inhibin B quantification, and TUNEL assay. Putative hSSCs appeared in singlets, doublets, or small groups of up to four cells in vitro only when testicular cells were cultured in StemPro-34 medium supplemented with glial cell line-derived neurotrophic factor (GDNF), leukemia inhibitory factor (LIF), basic fibroblast growth factor (bFGF), and epidermal growth factor (EGF). Fluorescence-activated cell sorting with HLA - /EPCAM + resulted in an enrichment of 27% VASA + /UTF1 + hSSCs, compared to 13% in unsorted controls. Coculture of sorted cells with inactivated testicular feeders gave rise to an average density of 112 hSSCs/cm 2 after 2 weeks in vitro compared with unsorted cells (61 hSSCs/cm 2 ) and differentially plated cells (49 hSSCS/cm 2 ). However, putative hSSCs rarely stained positive for the proliferation marker Ki67, and their presence was reduced to the point of almost disappearing after 4 weeks in vitro. We found that hSSCs show limited proliferation in vitro under mSSC culture conditions. Coculture of HLA - /EPCAM + sorted cells with testicular

  2. Response to Therapy and Outcomes in Oropharyngeal Cancer Are Associated With Biomarkers Including Human Papillomavirus, Epidermal Growth Factor Receptor, Gender, and Smoking

    International Nuclear Information System (INIS)

    Kumar, Bhavna; Cordell, Kitrina G.; Lee, Julia S.; Prince, Mark E.; Tran, Huong H.; Wolf, Gregory T.; Urba, Susan G.; Worden, Francis P.; Chepeha, Douglas B.; Teknos, Theodoros N.; Eisbruch, Avraham; Tsien, Christina I.; Taylor, Jeremy; D'Silva, Nisha J.; Yang, Kun; Kurnit, David M.; Bradford, Carol R.

    2007-01-01

    Induction chemotherapy and concurrent chemoradiation for responders or immediate surgery for non-responders is an effective treatment strategy head and neck squamous cell carcinoma (HNSCC) of the larynx and oropharynx. Biomarkers that predict outcome would be valuable in selecting patients for therapy. In this study, the presence and titer of high risk human papilloma virus (HPV) and expression of epidermal growth factor receptor (EGFR) in pre-treatment biopsies, as well as smoking and gender were examined in oropharynx cancer patients enrolled in an organ sparing trial. HPV16 copy number was positively associated with response to therapy and with overall and disease specific survival, whereas EGFR expression, current or former smoking behavior, and female gender (in this cohort) were associated with poor response and poor survival in multivariate analysis. Smoking cessation and strategies to target EGFR may be useful adjuncts for therapy to improve outcome in the cases with the poorest biomarker profile

  3. Protein structure of fetal antigen 1 (FA1). A novel circulating human epidermal-growth-factor-like protein expressed in neuroendocrine tumors and its relation to the gene products of dlk and pG2

    DEFF Research Database (Denmark)

    Jensen, Charlotte Harken; Krogh, Thomas N; Højrup, Peter

    1994-01-01

    The present paper describes the primary structure, glycosylation and tissue localization of fetal antigen 1 (FA1) isolated from second-trimester human amniotic fluid. FA1 is a single-chained, heterogeneous glycoprotein of 225-262 amino acid residues. FA1 has six well conserved epidermal...... extends with minor corrections to the human adrenal-specific mRNA, pG2 as well. Immunohistochemical analysis demonstrated the presence of FA1 in 10 out of 14 lung tumors containing neuroendocrine elements, and in the placental villi where FA1 was exclusively seen in stromal cells in close contact...... to the vascular structure. In the pancreas, FA1 co-localized with insulin in the insulin secretory granules of the beta cells within the islets of Langerhans. Our findings suggest that FA1 is synthesized as a membrane anchored protein and released into the circulation after enzymic cleavage, and that circulating...

  4. Human melanocytes form a PAX3-expressing melanocyte cluster on Matrigel by the cell migration process.

    Science.gov (United States)

    Choi, Hyunjung; Jin, Sun Hee; Han, Mi Hwa; Lee, Jinyoung; Ahn, Seyeon; Seong, Minjeong; Choi, Hyun; Han, Jiyeon; Cho, Eun-Gyung; Lee, Tae Ryong; Noh, Minsoo

    2014-10-01

    The interactions between human epidermal melanocytes and their cellular microenvironment are important in the regulation of human melanocyte functions or in their malignant transformation into melanoma. Although the basement membrane extracellular matrix (BM-ECM) is one of major melanocyte microenvironments, the effects of BM-ECM on the human melanocyte functions are not fully explained at a molecular level. This study was aimed to characterize the molecular and cellular interactions between normal human melanocytes (NHMs) and BM-ECM. We investigated cell culture models of normal human melanocytes or melanoma cells on three-dimensional (3D) Matrigel to understand the roles of the basement membrane microenvironment in human melanocyte functions. Melanogenesis and melanobast biomarker expression in both primary human melanocytes and melanoma cells on 3D Matrigel were evaluated. We found that NHMs migrated and formed reversible paired box 3 (PAX3) expressing cell clusters on three-dimensional (3D) Matrigel. The melanogenesis was significantly decreased in the PAX3 expressing cell cluster. The expression profile of PAX3, SOX10, and MITF in the melanocyte cluster on 3D Matrigel was similar to that of melanoblasts. Interestingly, PAX3 and SOX10 showed an inverse expression profile in NHMs, whereas the inverse expression pattern of PAX3 and SOX10 was disrupted in melanoma MNT1 and WM266-4 cells. The human melanocyte culture on 3D Matrigel provides an alternative model system to study functions of human melanoblasts. In addition, this system will contribute to the elucidation of PAX3-related tumorigenic mechanisms to understand human melanoma. Copyright © 2014 Japanese Society for Investigative Dermatology. Published by Elsevier Ireland Ltd. All rights reserved.

  5. Human CD3+ T-Cells with the Anti-ERBB2 Chimeric Antigen Receptor Exhibit Efficient Targeting and Induce Apoptosis in ERBB2 Overexpressing Breast Cancer Cells

    Science.gov (United States)

    Munisvaradass, Rusheni; Kumar, Suresh; Govindasamy, Chandramohan; Alnumair, Khalid S.; Mok, Pooi Ling

    2017-01-01

    Breast cancer is a common malignancy among women. The innate and adaptive immune responses failed to be activated owing to immune modulation in the tumour microenvironment. Decades of scientific study links the overexpression of human epidermal growth factor receptor 2 (ERBB2) antigen with aggressive tumours. The Chimeric Antigen Receptor (CAR) coding for specific tumour-associated antigens could initiate intrinsic T-cell signalling, inducing T-cell activation, and cytotoxic activity without the need for major histocompatibility complex recognition. This renders CAR as a potentially universal immunotherapeutic option. Herein, we aimed to establish CAR in CD3+ T-cells, isolated from human peripheral blood mononucleated cells that could subsequently target and induce apoptosis in the ERBB2 overexpressing human breast cancer cell line, SKBR3. Constructed CAR was inserted into a lentiviral plasmid containing a green fluorescent protein tag and produced as lentiviral particles that were used to transduce activated T-cells. Transduced CAR-T cells were then primed with SKBR3 cells to evaluate their functionality. Results showed increased apoptosis in SKBR3 cells co-cultured with CAR-T cells compared to the control (non–transduced T-cells). This study demonstrates that CAR introduction helps overcome the innate limitations of native T-cells leading to cancer cell apoptosis. We recommend future studies should focus on in vivo cytotoxicity of CAR-T cells against ERBB2 expressing tumours. PMID:28885562

  6. Epidermal characters of Tamarix L. (Tamaricaceae from Northwest China and their taxonomic and palaeogeographic implications

    Directory of Open Access Journals (Sweden)

    Jian-Wei Zhang

    2018-04-01

    Full Text Available The taxonomical position of species of the genus Tamarix (Tamaricaceae has been criticized because of their gross morphological similarities (such as slender, smooth and reddish–brown branches, grey–green foliage and scale leaves, and their systematic relationships remain unclear. In this paper, the leaf epidermal features of 17 species from China are studied based on the micro-morphological characters of the epidermal cells, stomata, salt glands, papillae and epidermal hairs. According to the studies, the leaf epidermal features, together with the character of the flower, are taxonomically clearly distinct. The establishment of Tamarix albiflonum is consolidated. Tamarix korolkowi and Tamarix ramosissima have minimal differences in epidermal characters, and the former is suggested to be a junior synonym. Tamarix ramosissima, Tamarix tarimensis, Tamarix arceuthoides and Tamarix hohenackeri are most similar with respect to their leaf epidermis; considering the common morphological features, habit, distribution and especially the hybridization, it is suggested that these four species are closely genetically related and that the variations among them are probably intraspecific. The new taxonomical evidence indicates the occurrence of 13 species and four variants in China. Presently, Tamarix is a typical plant of arid and semi-arid regions, but its Eocene ancestors lived in warm and humid climates in the coastal areas of the ancient Mediterranean Sea. Thus, the papillae or epidermal hairs, which are outgrowths of the outer epidermal cells facilitating the leaf to respond to water stress and commonly seen in the plants growing in arid or semi-arid areas rather than the plants in warm and humid climates, are of relatively recent origin in Tamarix. The primitive species lack papillae or epidermal hairs, while in evolved species these structures are abundant. Based on the ecological adaptations of the epidermal features, the palaeogeographic

  7. Androgen and retinoic acid interaction in LNCaP cells, effects on cell proliferation and expression of retinoic acid receptors and epidermal growth factor receptor

    International Nuclear Information System (INIS)

    Li, Ming-tang; Richter, Frank; Chang, Chawnshang; Irwin, Robert J; Huang, Hosea FS

    2002-01-01

    Modulation of the expression of retinoic acid receptors (RAR) α and γ in adult rat prostate by testosterone (T) suggests that RAR signaling events might mediate some of the androgen effects on prostate cells. In this study, we examined the interactions between T and retinoic acid (RA) in cell growth of human prostate carcinoma cells, LNCaP, and their relationship with the expression of RAR and epidermal growth factor receptor (EGF-R). Both T and RA, when administered alone, stimulated 3 H-thymidine incorporation in LNCaP cells in a dose-dependent manner; the effect of each agent was reciprocally attenuated by the other agent. Testosterone treatment of LNCaP cells also resulted in dose dependent, biphasic increases in RAR α and γ mRNAs; increases paralleled that of 3 H-thymidine incorporation and were attenuated by the presence of 100 nM RA. These results suggest a link between RAR signaling and the effect of T on LNCaP cell growth. Gel electrophoretic mobility shift assays revealed the presence of putative androgen responsive element (ARE) in the promoter region of RAR α gene, suggesting that a direct AR-DNA interaction might mediate the effects of T on RAR α gene. Furthermore, treatment of LNCaP cells with 20 nM T resulted in an increase in EGF-R. In contrast, EGF-R was suppressed by 100 nM RA that also suppressed the effect of T. Current results demonstrate interactions between T and RA in the expression of RARs and cell growth in LNCaP cells. The presence of putative ARE in the promoter of the RAR α gene suggests that AR-DNA interaction might mediate the effects of T on RAR α gene. The opposite effects of T and RA on the expression of RAR and EGF-R suggest that signal events of these receptors might be involved in the interaction between T and RA in the control of LNCaP cell growth

  8. Androgen and retinoic acid interaction in LNCaP cells, effects on cell proliferation and expression of retinoic acid receptors and epidermal growth factor receptor

    Directory of Open Access Journals (Sweden)

    Irwin Robert J

    2002-06-01

    Full Text Available Abstract Background Modulation of the expression of retinoic acid receptors (RAR α and γ in adult rat prostate by testosterone (T suggests that RAR signaling events might mediate some of the androgen effects on prostate cells. Method In this study, we examined the interactions between T and retinoic acid (RA in cell growth of human prostate carcinoma cells, LNCaP, and their relationship with the expression of RAR and epidermal growth factor receptor (EGF-R. Results Both T and RA, when administered alone, stimulated 3H-thymidine incorporation in LNCaP cells in a dose-dependent manner; the effect of each agent was reciprocally attenuated by the other agent. Testosterone treatment of LNCaP cells also resulted in dose dependent, biphasic increases in RAR α and γ mRNAs; increases paralleled that of 3H-thymidine incorporation and were attenuated by the presence of 100 nM RA. These results suggest a link between RAR signaling and the effect of T on LNCaP cell growth. Gel electrophoretic mobility shift assays revealed the presence of putative androgen responsive element (ARE in the promoter region of RAR α gene, suggesting that a direct AR-DNA interaction might mediate the effects of T on RAR α gene. Furthermore, treatment of LNCaP cells with 20 nM T resulted in an increase in EGF-R. In contrast, EGF-R was suppressed by 100 nM RA that also suppressed the effect of T. Conclusions Current results demonstrate interactions between T and RA in the expression of RARs and cell growth in LNCaP cells. The presence of putative ARE in the promoter of the RAR α gene suggests that AR-DNA interaction might mediate the effects of T on RAR α gene. The opposite effects of T and RA on the expression of RAR and EGF-R suggest that signal events of these receptors might be involved in the interaction between T and RA in the control of LNCaP cell growth.

  9. Immunohistochemical localisation of keratin and luminal epithelial antigen in myoepithelial and luminal epithelial cells of human mammary and salivary gland tumours.

    Science.gov (United States)

    Nathrath, W B; Wilson, P D; Trejdosiewicz, L K

    1982-01-01

    Rabbit antisera to human 40-63 000 MW epidermal keratin, one batch with restricted distribution of reactivity from an initial (aK1) and one with "broad spectrum" distribution of reactivity from a late bleeding (aK), and to "luminal epithelial antigen" (aLEA) were applied to formalin fixed paraffin embedded sections of human normal and neoplastic mammary and salivary glands using an indirect immunoperoxidase method. aK1 reacted with myoepithelial cells, aLEA with luminal epithelial cells and aK with both cell types in normal mammary and salivary gland. In breast carcinomas the majority of intraluminal and infiltrating carcinoma cells reacted with aLEA but not with aK1 which reacted only with surrounding myoepithelial cells. aK reacted with both myoepithelial cells and with intraluminal and infiltrating tumour cells. In the salivary gland adenomas the majority of cells reacted with aK, and those cells arranged in a tubular fashion reacted with aLEA.

  10. [Origins and selection of epidermal progenitors and stem cells: a challenge for tissue engineering].

    Science.gov (United States)

    Deshayes, Nathalie; Rathman-Josserand, Michelle

    2008-01-01

    The use of epidermal stem cells and their progeny for tissue engineering and cell therapy represents a source of hope and major interest in view of applications such as replacing the loss of functionality in failing tissues or obtaining physiologic skin equivalents for skin grafting. The use of such cells necessitates the isolation and purification of rare populations of keratinocytes and then increasing their numbers by mass culture. This is not currently possible since part of the specific phenotype of these cells is lost once the cells are placed in culture. Furthermore, few techniques are available to unequivocally detect the presence of skin stem cells and/or their progeny in culture and thus quantify them. Two different sources of stem cells are currently being studied for skin research and clinical applications: skin progenitors either obtained from embryonic stem cells (ESC) or from selection from adult skin tissue. It has been shown that "keratinocyte-like" cells can be derived from ESC; however, the culturing processes must still be optimized to allow for the mass culture of homogeneous populations at a controlled stage of differentiation. The functional characterization of such populations must also be more thoroughly achieved. In order to use stem cells from adult tissues, improvements must be made in order to obtain a satisfactory degree of purification and characterization of this rare population. Distinguishing stem cells from progenitor cells at the molecular level also remains a challenge. Furthermore, stem cell research inevitably requires cultivating these cells outside their physiological environment or niche. It will thus be necessary to better understand the impact of this specific environmental niche on the preservation of the cellular phenotypes of interest.

  11. Transforming growth factor alpha and epidermal growth factor in laryngeal carcinomas demonstrated by immunohistochemistry

    DEFF Research Database (Denmark)

    Christensen, M E; Therkildsen, M H; Poulsen, Steen Seier

    1993-01-01

    the basal cell layer. The present investigation and our previous results confirm the existence of EGF receptors, TGF-alpha and EGF in laryngeal carcinomas. In addition, we conclude that the conditions do exist for growth factors to act through an autocrine system in poorly differentiated tumours and through......Fifteen laryngeal squamous cell carcinomas were investigated for the presence of transforming growth factor alpha (TGF-alpha) and epidermal growth factor (EGF) using immunohistochemical methods. In a recent study the same material was characterized for epidermal growth factor receptors (EGF...... receptors) which were confined predominantly to the undifferentiated cells. The expression of this growth factor system in malignant cells may play a role in carcinogenesis and/or tumour growth. All carcinomas were positive for TGF-alpha and 12 were positive for EGF. In moderately-to-well differentiated...

  12. Thermal analysis of epidermal electronic devices integrated with human skin considering the effects of interfacial thermal resistance

    Science.gov (United States)

    Li, Yuhang; Zhang, Jianpeng; Xing, Yufeng; Song, Jizhou

    2018-05-01

    Epidermal electronic devices (EEDs) have similar mechanical properties as those of human skin such that they can be integrated with human skin for potential applications in monitoring of human vital signs for diagnostic, therapeutic or surgical functions. Thermal management is critical for EEDs in these applications since excessive heating may cause discomfort. Comprehensive analytical studies, finite element analysis and experiments are carried out to study the effects of interfacial thermal resistance between EEDs and human skin on thermal properties of the EED/skin system in this paper. The coupling between the Fourier heat transfer in EEDs and the bio-heat transfer in human skin is accounted in the analytical model based on the transfer matrix method to give accurate predictions on temperatures, which agree well with finite element analysis and experimental measurements. It is shown that the maximum temperature increase of the EED for the case of imperfect bonding between EED and skin is much higher than that of perfect bonding. These results may help the design of EEDs in bi-integrated applications and suggest a valuable route to evaluate the bonding condition between EEDs and biological tissues.

  13. Recombinant epidermal growth factor-like domain-1 from coagulation factor VII functionalized iron oxide nanoparticles for targeted glioma magnetic resonance imaging.

    Science.gov (United States)

    Liu, Heng; Chen, Xiao; Xue, Wei; Chu, Chengchao; Liu, Yu; Tong, Haipeng; Du, Xuesong; Xie, Tian; Liu, Gang; Zhang, Weiguo

    The highly infiltrative and invasive nature of glioma cells often leads to blurred tumor margins, resulting in incomplete tumor resection and tumor recurrence. Accurate detection and precise delineation of glioma help in preoperative delineation, surgical planning and survival prediction. In this study, recombinant epidermal growth factor-like domain-1, derived from human coagulation factor VII, was conjugated to iron oxide nanoparticles (IONPs) for targeted glioma magnetic resonance (MR) imaging. The synthesized EGF1-EGFP-IONPs exhibited excellent targeting ability toward tissue factor (TF)-positive U87MG cells and human umbilical vein endothelial cells in vitro, and demonstrated persistent and efficient MR contrast enhancement up to 12 h for preclinical glioma models with high targeting specificity in vivo. They hold great potential for clinical translation and developing targeted theranostics against brain glioma.

  14. Radiolabeled pertuzumab for imaging of human epidermal growth factor receptor 2 expression in ovarian cancer

    Energy Technology Data Exchange (ETDEWEB)

    Jiang, Dawei [Shenzhen University, Guangdong Key Laboratory for Biomedical Measurements and Ultrasound Imaging, School of Biomedical Engineering, Shenzhen (China); University of Wisconsin - Madison, Department of Radiology, Madison, WI (United States); Im, Hyung-Jun [University of Wisconsin - Madison, Department of Radiology, Madison, WI (United States); Seoul National University, Graduate School of Convergence Science and Technology, Seoul (Korea, Republic of); Sun, Haiyan; Cho, Steve Y. [University of Wisconsin - Madison, Department of Radiology, Madison, WI (United States); Valdovinos, Hector F.; England, Christopher G.; Ehlerding, Emily B.; Nickles, Robert J. [University of Wisconsin - Madison, Department of Medical Physics, Madison, WI (United States); Lee, Dong Soo [Seoul National University, Graduate School of Convergence Science and Technology, Seoul (Korea, Republic of); Huang, Peng [Shenzhen University, Guangdong Key Laboratory for Biomedical Measurements and Ultrasound Imaging, School of Biomedical Engineering, Shenzhen (China); Cai, Weibo [University of Wisconsin - Madison, Department of Radiology, Madison, WI (United States); University of Wisconsin - Madison, Department of Medical Physics, Madison, WI (United States); University of Wisconsin Carbone Cancer Center, Madison, WI (United States)

    2017-08-15

    Human epidermal growth factor receptor 2 (HER2) is over-expressed in over 30% of ovarian cancer cases, playing an essential role in tumorigenesis and metastasis. Non-invasive imaging of HER2 is of great interest for physicians as a mean to better detect and monitor the progression of ovarian cancer. In this study, HER2 was assessed as a biomarker for ovarian cancer imaging using {sup 64}Cu-labeled pertuzumab for immunoPET imaging. HER2 expression and binding were examined in three ovarian cancer cell lines (SKOV3, OVCAR3, Caov3) using in vitro techniques, including western blot and saturation binding assays. PET imaging and biodistribution studies in subcutaneous models of ovarian cancer were performed for non-invasive in vivo evaluation of HER2 expression. Additionally, orthotopic models were employed to further validate the imaging capability of {sup 64}Cu-NOTA-pertuzumab. HER2 expression was highest in SKOV3 cells, while OVCAR3 and Caov3 displayed lower HER2 expression. {sup 64}Cu-NOTA-pertuzumab showed high specificity for HER2 (K{sub a} = 3.1 ± 0.6 nM) in SKOV3. In subcutaneous tumors, PET imaging revealed tumor uptake of 41.8 ± 3.8, 10.5 ± 3.9, and 12.1 ± 2.3%ID/g at 48 h post-injection for SKOV3, OVCAR3, and Caov3, respectively (n = 3). In orthotopic models, PET imaging with {sup 64}Cu-NOTA-pertuzumab allowed for rapid and clear delineation of both primary and small peritoneal metastases in HER2-expressing ovarian cancer. {sup 64}Cu-NOTA-pertuzumab is an effective PET tracer for the non-invasive imaging of HER2 expression in vivo, rendering it a potential tracer for treatment monitoring and improved patient stratification. (orig.)

  15. Carbon isotope ratios of epidermal and mesophyll tissues from leaves of C3 and CAM plants

    International Nuclear Information System (INIS)

    Nishida, K.; Roksandic, Z.; Osmond, B.

    1981-01-01

    The δ 13 C values for epidermal and mesophyll tissues of two C 3 plants, Commelina communis and Tulipa gesneriana, and a CAM plant, Kalanchoē daigremontiana, were measured. The values for the tissues of both C 3 plants were similar. In young leaves of Kalanchoē, the epidermis and the mesophyll showed S 13 C values which were nearly identical, and similar to those found in C 3 plants. However, markedly more negative values for epidermal compared to mesophyll tissue, were obtained in the mature Kalanchoē leaf. This is consistent with the facts that the epidermis in a CAM leaf is formed when leaves engage in C 3 photosynthesis and that subsequent dark CO 2 fixation in guard cells or mesophyll cells makes only a small contribution to total epidermal carbon

  16. Making Epidermal Bladder Cells Bigger: Developmental- and Salinity-Induced Endopolyploidy in a Model Halophyte.

    Science.gov (United States)

    Barkla, Bronwyn J; Rhodes, Timothy; Tran, Kieu-Nga T; Wijesinghege, Chathura; Larkin, John C; Dassanayake, Maheshi

    2018-06-01

    Endopolyploidy occurs when DNA replication takes place without subsequent mitotic nuclear division, resulting in cell-specific ploidy levels within tissues. In plants, endopolyploidy plays an important role in sustaining growth and development, but only a few studies have demonstrated a role in abiotic stress response. In this study, we investigated the function of ploidy level and nuclear and cell size in leaf expansion throughout development and tracked cell type-specific ploidy in the halophyte Mesembryanthemum crystallinum In addition to developmental endopolyploidy, we examined the effects of salinity stress on ploidy level. We focused specifically on epidermal bladder cells (EBC), which are modified balloon-like trichomes, due to their large size and role in salt accumulation. Our results demonstrate that ploidy increases as the leaves expand in a similar manner for each leaf type, and ploidy levels up to 512C were recorded for nuclei in EBC of leaves of adult plants. Salt treatment led to a significant increase in ploidy levels in the EBC, and these cells showed spatially related differences in their ploidy and nuclear and cell size depending on the positions on the leaf and stem surface. Transcriptome analysis highlighted salinity-induced changes in genes involved in DNA replication, cell cycle, endoreduplication, and trichome development in EBC. The increase in cell size and ploidy observed in M. crystallinum under salinity stress may contribute to salt tolerance by increasing the storage capacity for sodium sequestration brought about by higher metabolic activity driving rapid cell enlargement in the leaf tissue and EBC. © 2018 American Society of Plant Biologists. All rights reserved.

  17. A nomogram for predicting pathological complete response in patients with human epidermal growth factor receptor 2 negative breast cancer

    International Nuclear Information System (INIS)

    Jin, Xi; Jiang, Yi-Zhou; Chen, Sheng; Yu, Ke-Da; Ma, Ding; Sun, Wei; Shao, Zhi-Min; Di, Gen-Hong

    2016-01-01

    The response to neoadjuvant chemotherapy has been proven to predict long-term clinical benefits for patients. Our research is to construct a nomogram to predict pathological complete response of human epidermal growth factor receptor 2 negative breast cancer patients. We enrolled 815 patients who received neoadjuvant chemotherapy from 2003 to 2015 and divided them into a training set and a validation set. Univariate logistic regression was performed to screen for predictors and construct the nomogram; multivariate logistic regression was performed to identify independent predictors. After performing the univariate logistic regression analysis in the training set, tumor size, hormone receptor status, regimens of neoadjuvant chemotherapy and cycles of neoadjuvant chemotherapy were the final predictors for the construction of the nomogram. The multivariate logistic regression analysis demonstrated that T4 status, hormone receptor status and receiving regimen of paclitaxel and carboplatin were independent predictors of pathological complete response. The area under the receiver operating characteristic curve of the training set and the validation set was 0.779 and 0.701, respectively. We constructed and validated a nomogram to predict pathological complete response in human epidermal growth factor receptor 2 negative breast cancer patients. We also identified tumor size, hormone receptor status and paclitaxel and carboplatin regimen as independent predictors of pathological complete response. The online version of this article (doi:10.1186/s12885-016-2652-z) contains supplementary material, which is available to authorized users

  18. The epidermal growth factor-like domains of the human EMR2 receptor mediate cell attachment through chondroitin sulfate glycosaminoglycans

    NARCIS (Netherlands)

    Stacey, Martin; Chang, Gin-Wen; Davies, John Q.; Kwakkenbos, Mark J.; Sanderson, Ralph D.; Hamann, Jörg; Gordon, Siamon; Lin, Hsi-Hsien

    2003-01-01

    Using multivalent protein probes, an evolutionarily conserved endogenous ligand for EMR2, a human myeloid cell-restricted EGF-TM7 receptor, was identified on the surface of a number of adherent cell lines. In addition, in situ staining of the ligand has revealed specific in vivo patterns consistent

  19. Duox, Flotillin-2, and Src42A are required to activate or delimit the spread of the transcriptional response to epidermal wounds in Drosophila.

    Directory of Open Access Journals (Sweden)

    Michelle T Juarez

    2011-12-01

    Full Text Available The epidermis is the largest organ of the body for most animals, and the first line of defense against invading pathogens. A breach in the epidermal cell layer triggers a variety of localized responses that in favorable circumstances result in the repair of the wound. Many cellular and genetic responses must be limited to epidermal cells that are close to wounds, but how this is regulated is still poorly understood. The order and hierarchy of epidermal wound signaling factors are also still obscure. The Drosophila embryonic epidermis provides an excellent system to study genes that regulate wound healing processes. We have developed a variety of fluorescent reporters that provide a visible readout of wound-dependent transcriptional activation near epidermal wound sites. A large screen for mutants that alter the activity of these wound reporters has identified seven new genes required to activate or delimit wound-induced transcriptional responses to a narrow zone of cells surrounding wound sites. Among the genes required to delimit the spread of wound responses are Drosophila Flotillin-2 and Src42A, both of which are transcriptionally activated around wound sites. Flotillin-2 and constitutively active Src42A are also sufficient, when overexpressed at high levels, to inhibit wound-induced transcription in epidermal cells. One gene required to activate epidermal wound reporters encodes Dual oxidase, an enzyme that produces hydrogen peroxide. We also find that four biochemical treatments (a serine protease, a Src kinase inhibitor, methyl-ß-cyclodextrin, and hydrogen peroxide are sufficient to globally activate epidermal wound response genes in Drosophila embryos. We explore the epistatic relationships among the factors that induce or delimit the spread of epidermal wound signals. Our results define new genetic functions that interact to instruct only a limited number of cells around puncture wounds to mount a transcriptional response, mediating

  20. DEVELOPMENT OF PRIMARY CELL CULTURE FROM TAIL EPIDERMAL TISSUE OF KOI CARP (Cyprinus carpio koi

    Directory of Open Access Journals (Sweden)

    Lila Gardenia

    2014-06-01

    Full Text Available Primary cell culture from tail epidermal tissue of koi carp (Cyprinus carpio koi was developed. Cells were grown in Leibovits-15 medium supplemented with 20% fetal bovine serum and antibiotics (Penicillin/Streptomycin and Kanamycin. Cell growth was observed in a range of incubation temperature (17oC±2oC, 22oC±2oC, 27oC±2oC, and 32oC±2oC in order to determine the optimum temperature. The cells were able to grow at a range of temperature between 17oC to 32oC with optimal growth at 22oC. Primary cells infected with koi herpes virus produced typical cytopathic effects characterized by severe vacuolation and deformation of nuclei, which is consistent with those of previous reports. Artificial injection experiment by using supernatant koi herpes virus SKBM-1 isolate revealed that it could cause 90% mortality in infected fish within two weeks. PCR test with Sph I-5 specific primers carried out with DNA template from supernatant virus, pellet cell, and gills of infected fish showed positive results in all samples (molecular weight of DNA target 290 bp. The cells were found to be susceptible to koi herpes virus and can be used for virus propagation.

  1. Comparison of a mouse and a novel human scFv-SNAP-auristatin F drug conjugate with potent activity against EGFR-overexpressing human solid tumor cells

    Directory of Open Access Journals (Sweden)

    Woitok M

    2017-07-01

    Full Text Available Mira Woitok,1,2 Diana Klose,1 Stefano Di Fiore,1 Wolfgang Richter,3 Christoph Stein,1 Gerrit Gresch,1 Elena Grieger,1 Stefan Barth,1 Rainer Fischer,1,2 Katharina Kolberg,1,* Judith Niesen1,* 1Fraunhofer Institute for Molecular Biology and Applied Ecology (IME, Aachen, Germany; 2Institute of Molecular Biotechnology (Biology VII, RWTH Aachen University, Aachen, Germany; 3Tube Pharmaceuticals GmbH, Vienna, Austria *These authors contributed equally to this work Abstract: Antibody–drug conjugates (ADCs can deliver toxins to specific targets such as tumor cells. They have shown promise in preclinical/clinical development but feature stoichiometrically undefined chemical linkages, and those based on full-size antibodies achieve only limited tumor penetration. SNAP-tag technology can overcome these challenges by conjugating benzylguanine-modified toxins to single-chain fragment variables (scFvs with 1:1 stoichio­metry while preserving antigen binding. Two (human and mouse scFv-SNAP fusion proteins recognizing the epidermal growth factor receptor (EGFR were expressed in HEK 293T cells. The purified fusion proteins were conjugated to auristatin F (AURIF. Binding activity was confirmed by flow cytometry/immunohistochemistry, and cytotoxic activity was confirmed by cell viability/apoptosis and cell cycle arrest assays, and a novel microtubule dynamics disassembly assay was performed. Both ADCs bound specifically to their target cells in vitro and ex vivo, indicating that the binding activity of the scFv-SNAP fusions was unaffected by conjugation to AURIF. Cytotoxic assays confirmed that the ADCs induced apoptosis and cell cycle arrest at nanomolar concentrations and microtubule disassembly. The SNAP-tag technology provides a platform for the development of novel ADCs with defined conjugation sites and stoichiometry. We achieved the stable and efficient linkage of AURIF to human or murine scFvs using the SNAP-tag technology, offering a strategy to

  2. Commonly Employed African Neonatal Skin Care Products Compromise Epidermal Function in Mice.

    Science.gov (United States)

    Man, Mao-Qiang; Sun, Richard; Man, George; Lee, Dale; Hill, Zelee; Elias, Peter M

    2016-09-01

    Neonatal mortality is much higher in the developing world than in developed countries. Infections are a major cause of neonatal death, particularly in preterm infants, in whom defective epidermal permeability barrier function facilitates transcutaneous pathogen invasion. The objective was to determine whether neonatal skin care products commonly used in Africa benefit or compromise epidermal functions in murine skin. After twice-daily treatment of 6- to 8-week-old hairless mice with each skin care product for 3 days, epidermal permeability barrier function, skin surface pH, stratum corneum hydration, and barrier recovery were measured using a multiprobe adapter system physiology monitor. For products showing some benefits in these initial tests, the epidermal permeability barrier homeostasis was assessed 1 and 5 hours after a single application to acutely disrupted skin. All of the skin care products compromised basal permeability barrier function and barrier repair kinetics. Moreover, after 3 days of treatment, most of the products also reduced stratum corneum hydration while elevating skin surface pH to abnormal levels. Some neonatal skin care products that are widely used in Africa perturb important epidermal functions, including permeability barrier homeostasis in mice. Should these products have similar effects on newborn human skin, they could cause a defective epidermal permeability barrier, which can increase body fluid loss, impair thermoregulation, and contribute to the high rates of neonatal morbidity and mortality seen in Africa. Accordingly, alternative products that enhance permeability barrier function should be identified, particularly for use in preterm infants. © 2016 Wiley Periodicals, Inc.

  3. Cell wall accumulation of fluorescent proteins derived from a trans-Golgi cisternal membrane marker and paramural bodies in interdigitated Arabidopsis leaf epidermal cells.

    Science.gov (United States)

    Akita, Kae; Kobayashi, Megumi; Sato, Mayuko; Kutsuna, Natsumaro; Ueda, Takashi; Toyooka, Kiminori; Nagata, Noriko; Hasezawa, Seiichiro; Higaki, Takumi

    2017-01-01

    In most dicotyledonous plants, leaf epidermal pavement cells develop jigsaw puzzle-like shapes during cell expansion. The rapid growth and complicated cell shape of pavement cells is suggested to be achieved by targeted exocytosis that is coordinated with cytoskeletal rearrangement to provide plasma membrane and/or cell wall materials for lobe development during their morphogenesis. Therefore, visualization of membrane trafficking in leaf pavement cells should contribute an understanding of the mechanism of plant cell morphogenesis. To reveal membrane trafficking in pavement cells, we observed monomeric red fluorescent protein-tagged rat sialyl transferases, which are markers of trans-Golgi cisternal membranes, in the leaf epidermis of Arabidopsis thaliana. Quantitative fluorescence imaging techniques and immunoelectron microscopic observations revealed that accumulation of the red fluorescent protein occurred mostly in the curved regions of pavement cell borders and guard cell ends during leaf expansion. Transmission electron microscopy observations revealed that apoplastic vesicular membrane structures called paramural bodies were more frequent beneath the curved cell wall regions of interdigitated pavement cells and guard cell ends in young leaf epidermis. In addition, pharmacological studies showed that perturbations in membrane trafficking resulted in simple cell shapes. These results suggested possible heterogeneity of the curved regions of plasma membranes, implying a relationship with pavement cell morphogenesis.

  4. Experimental radioimmunotherapy of a xenografted human glioma using [sup 131]I-labeled monoclonal antibody to epidermal growth factor receptor

    Energy Technology Data Exchange (ETDEWEB)

    Takahashi, Hiroshi; Nakazawa, Shozo [Nippon Medical School, Tokyo (Japan); Herlyn, D

    1993-09-01

    [sup 131]I-labeled F (ab')[sub 2] fragments of murine monoclonal antibodies (MAb) 425 specific to the epidermal growth factor receptor expressed on human gliomas were used in experimental human malignant glioma immunotherapy. Two injections of 150 [mu]Ci [sup 131]I-labeled 425 F(ab')[sub 2] achieved growth inhibition of U-87MG human malignant glioma xenografts in nude mice. This radiolabeled specific MAb F(ab')[sub 2] was significantly superior to radiolabeled fragments of an anti-hepatitis virus control MAb A5C3 in influencing tumor growth. However, similar treatment of established human malignant glioma xenografts did not inhibit progressive tumor growth significantly. No clear tumor inhibition was produced by unlabeled MAb 425F(ab')[sub 2]. These studies suggest that [sup 131]I-labeled MAbs have a significant antitumor effect where unmodified antibody is ineffective. Multiple doses of antibody may achieve an increase in labeled MAb concentration in tumors. (author).

  5. Cellular interactions of a lipid-based nanocarrier model with human keratinocytes: Unravelling transport mechanisms.

    Science.gov (United States)

    Silva, Elisabete; Barreiros, Luísa; Segundo, Marcela A; Costa Lima, Sofia A; Reis, Salette

    2017-04-15

    Knowledge of delivery system transport through epidermal cell monolayer is vital to improve skin permeation and bioavailability. Recently, nanostructured lipid carriers (NLCs) have gained great attention for transdermal delivery due to their biocompatibility, high drug payload, occlusive properties and skin hydration effect. However, the nanocarriers transport related mechanisms in epidermal epithelial cells are not yet understood. In this research, the internalization and transport pathways of the NLCs across the epidermal epithelial cell monolayer (HaCaT cells) were investigated. The 250nm sized witepsol/miglyol NLCs, prepared by hot homogenization had reduced cytotoxicity and no effect on the integrity of cell membrane in human HaCaT keratinocytes. The internalization was time-, concentration- and energy-dependent, and the uptake of NLCs was a vesicle-mediated process by macropinocytosis and clathrin-mediated pathways. 3% of NLCs were found at the apical membrane side of the HaCaT monolayer through exocytosis mechanism. Additionally, the endoplasmic reticulum, Golgi apparatus and microtubules played crucial roles in the transport of NLCs out of HaCaT cells. NLCs were transported intact across the human keratinocytes monolayer, without disturbing the tight junction's structure. From the transcytosis data only approximately 12% of the internalized NLCs were passed from the apical to the basolateral side. The transcytosis of NLCs throughout the HaCaT cell monolayer towards the basolateral membrane side requires the involvement of the endoplasmic reticulum, Golgi apparatus and microtubules. Our findings may contribute to a systematic understanding of NLCs transport across epidermal epithelial cell monolayers and their optimization for clinical transdermal application. Transdermal drug delivery is a challenging and growing area of clinical application. Lipid nanoparticles such as nanostructured lipid carriers (NLCs) have gained wide interest for transdermal drug

  6. Concurrent Autophagy Inhibition Overcomes the Resistance of Epidermal Growth Factor Receptor Tyrosine Kinase Inhibitors in Human Bladder Cancer Cells.

    Science.gov (United States)

    Kang, Minyong; Lee, Kyoung-Hwa; Lee, Hye Sun; Jeong, Chang Wook; Kwak, Cheol; Kim, Hyeon Hoe; Ku, Ja Hyeon

    2017-02-04

    Despite the potential therapeutic efficacy of epithelial growth factor receptor (EGFR) inhibitors in the treatment of advanced stage bladder cancer, there currently is no clear evidence to support this hypothesis. In this study, we investigate whether the concurrent treatment of autophagy-blocking agents with EGFR inhibitors exerts synergistic anti-cancer effects in T24 and J82 human bladder cancer cells. Lapatinib and gefitinib were used as EGFR inhibitors, and bafilomycin A1 (BFA1), chloroquine (CQ) and 3-methyladenine (3-MA) were used as the pharmacologic inhibitors of autophagy activities. To assess the proliferative and self-renewal capabilities, the Cell Counting Kit-8 (CCK-8) assay and a clonogenic assay were performed, respectively. To examine apoptotic cell death, flow cytometry using annexin-V/propidium iodide (PI) was used. To measure the autophagy activities, the expression levels of LC3I and II was determined by Western blot analysis. To validate the synergistic effects of autophagy inhibition with EGFR inhibitors, we specifically blocked key autophagy regulatory gene ATG12 by transfection of small interference RNA and examined the phenotypic changes. Of note, lapatinib and gefitinib triggered autophagy activities in T24 and J82 human bladder cancer cells, as indicated by upregulation of LC3II. More importantly, inhibiting autophagy activities with pharmacologic inhibitors (BFA1, CQ or 3-MA) remarkably reduced the cell viabilities and clonal proliferation of T24 and J82 cells, compared to those treated with either of the agents alone. We also obtained similar results of the enhanced anti-cancer effects of EGFR inhibitors by suppressing the expression of ATG12. Notably, the apoptotic assay showed that synergistic anti-cancer effects were induced via the increase of apoptotic cell death. In summary, concomitant inhibition of autophagy activities potentiated the anti-cancer effects of EGFR inhibitors in human bladder cancer cells, indicating a novel

  7. Concurrent Autophagy Inhibition Overcomes the Resistance of Epidermal Growth Factor Receptor Tyrosine Kinase Inhibitors in Human Bladder Cancer Cells

    Directory of Open Access Journals (Sweden)

    Minyong Kang

    2017-02-01

    Full Text Available Despite the potential therapeutic efficacy of epithelial growth factor receptor (EGFR inhibitors in the treatment of advanced stage bladder cancer, there currently is no clear evidence to support this hypothesis. In this study, we investigate whether the concurrent treatment of autophagy-blocking agents with EGFR inhibitors exerts synergistic anti-cancer effects in T24 and J82 human bladder cancer cells. Lapatinib and gefitinib were used as EGFR inhibitors, and bafilomycin A1 (BFA1, chloroquine (CQ and 3-methyladenine (3-MA were used as the pharmacologic inhibitors of autophagy activities. To assess the proliferative and self-renewal capabilities, the Cell Counting Kit-8 (CCK-8 assay and a clonogenic assay were performed, respectively. To examine apoptotic cell death, flow cytometry using annexin-V/propidium iodide (PI was used. To measure the autophagy activities, the expression levels of LC3I and II was determined by Western blot analysis. To validate the synergistic effects of autophagy inhibition with EGFR inhibitors, we specifically blocked key autophagy regulatory gene ATG12 by transfection of small interference RNA and examined the phenotypic changes. Of note, lapatinib and gefitinib triggered autophagy activities in T24 and J82 human bladder cancer cells, as indicated by upregulation of LC3II. More importantly, inhibiting autophagy activities with pharmacologic inhibitors (BFA1, CQ or 3-MA remarkably reduced the cell viabilities and clonal proliferation of T24 and J82 cells, compared to those treated with either of the agents alone. We also obtained similar results of the enhanced anti-cancer effects of EGFR inhibitors by suppressing the expression of ATG12. Notably, the apoptotic assay showed that synergistic anti-cancer effects were induced via the increase of apoptotic cell death. In summary, concomitant inhibition of autophagy activities potentiated the anti-cancer effects of EGFR inhibitors in human bladder cancer cells, indicating

  8. Compartmentalized Epidermal Activation of β-Catenin Differentially Affects Lineage Reprogramming and Underlies Tumor Heterogeneity

    Directory of Open Access Journals (Sweden)

    Kai Kretzschmar

    2016-01-01

    Full Text Available Wnt/β-catenin activation in adult epidermis can induce new hair follicle formation and tumor development. We used lineage tracing to uncover the relative contribution of different stem cell populations. LGR6+ and LRIG1+ stem cells contributed to ectopic hair follicles formed in the sebaceous gland upon β-catenin activation, whereas LGR5+ cells did not. Lgr6, but not Lrig1 or Lgr5, was expressed in a subpopulation of interfollicular epidermal cells that were competent to form new hair follicles. Oncogenic β-catenin expression in LGR5+ cells led to formation of pilomatricomas, while LRIG1+ cells formed trichoadenomas and LGR6+ cells formed dermatofibromas. Tumor formation was always accompanied by a local increase in dermal fibroblast density and transient extracellular matrix remodeling. However, each tumor had a distinct stromal signature in terms of immune cell infiltrate and expression of CD26 and CD44. We conclude that compartmentalization of epidermal stem cells underlies different responses to β-catenin and skin tumor heterogeneity.

  9. Pigmented epidermal cyst with dense collection of melanin: A rare entity - Report of a case with review of the literature.

    Science.gov (United States)

    Jayalakshmy, P S; Subitha, K; Priya, P V; Johnson, Gerald

    2012-05-01

    Epidermal cyst is a very common benign cystic lesion of the skin. It is usual to find ulceration of the lining epithelium, rupture of the cyst wall with chronic inflammation and foreign body giant cell reaction. But, it is very rare to see an epidermal cyst with marked accumulation of melanin pigment. Only a few cases of pigmented epidermal cyst with dense collection of melanin pigment have been published in the literature. Here, we are reporting a case of ruptured epidermal cyst with keratin granuloma formation and showing dense collection of melanin pigment.

  10. Filaggrin silencing by shRNA directly impairs the skin barrier function of normal human epidermal keratinocytes and then induces an immune response

    Energy Technology Data Exchange (ETDEWEB)

    Dang, N.N. [Department of Dermatology, Jinan Central Hospital Affiliated to Shandong University, Jinan, Shandong Province (China); College of Life Science, Shandong Normal University, Jinan, Shandong Province (China); Pang, S.G. [Department of Endocrinology, Jinan Central Hospital Affiliated to Shandong University, Jinan, Shandong Province (China); Song, H.Y. [Department of Dermatology, Jinan Central Hospital Affiliated to Shandong University, Jinan, Shandong Province (China); An, L.G. [College of Life Science, Shandong Normal University, Jinan, Shandong Province (China); Ma, X.L. [Central Laboratory, Jinan Central Hospital Affiliated to Shandong University, Jinan, Shandong Province (China)

    2014-11-14

    The objective of this study was to investigate whether a single defect in skin barrier function simulated by filaggrin silencing could induce Th2-predominant inflammation. Filaggrin gene expression was silenced in cultured normal human epidermal keratinocytes (NHEKs) using small hairpin RNA (shRNA, GTTGGCTCAAGCATATTATTT). The efficacy of silencing was confirmed by polymerase chain reaction (PCR) and Western blotting. Filaggrin-silenced cells (LV group), shRNA control cells (NC group), and noninfected cells (Blank group) were evaluated. The expression of cornified cell envelope-related proteins, including cytokeratin (CK)-5, -10, -14, loricrin, involucrin, and transglutaminase (TGM)-1, was detected by Western blotting. Interleukins (IL)-2, IL-4, IL-5, IL-12p70, IL-13, and interferon-gamma (IFN-γ) were detected by enzyme-linked immunosorbent assay (ELISA). After filaggrin was successfully silenced by shRNA, the expressions of CK-5, -10, -14, involucrin, and TGM-1 in NHEKs were significantly downregulated compared to the Blank and NC groups (P<0.05 or P<0.01); only loricrin expression was markedly upregulated (P<0.01). Filaggrin silencing also resulted in significant increases of IL-2, IL-4, IL-5, and IL-13 (P<0.05 or P<0.01), and significant decreases of IL-12p70 and IFN-γ (P<0.01) compared with cells in the Blank and NC groups. Filaggrin silencing impaired normal skin barrier function mainly by targeting the cornified cell envelope. The immune response after filaggrin silencing was characterized by Th2 cells, mainly because of the inhibition of IFN-γ expression. Lack of filaggrin may directly impair skin barrier function and then further induce the immune response.

  11. Growth-inhibitory effect of TGF-B on human fetal adrenal cells in primary monolayer culture.

    Science.gov (United States)

    Riopel, L; Branchaud, C L; Goodyer, C G; Adkar, V; Lefebvre, Y

    1989-08-01

    We examined the effects of transforming-growth factor-B (TGF-B) on growth ([3H]-thymidine uptake) and function (dehydroepiandrosterone sulfate [DHAS] and cortisol production) of human fetal zone adrenal cells. Results indicate that TGF-B significantly inhibits, in a dose-related manner, both basal and epidermal growth factor (EGF)-stimulated cell growth: IC50 = 0.1-0.25 ng/ml. EGF is ineffective in overcoming the inhibitory effect of TGF-B, suggesting a noncompetitive antagonism between the two factors. Also, the inhibitory effect of TGF-B is additive to that of adrenocorticotropic hormone (ACTH). On the other hand, TGF-B (1 ng/ml) does not significantly change basal or ACTH-stimulated DHAS or cortisol secretion. We conclude that, unlike its effect on other steroid-producing cells, TGF-B inhibits growth of fetal zone cells and does not appear to have a significant inhibitory effect on steroidogenesis.

  12. Human periapical cyst-mesenchymal stem cells differentiate into neuronal cells.

    Science.gov (United States)

    Marrelli, M; Paduano, F; Tatullo, M

    2015-06-01

    It was recently reported that human periapical cysts (hPCys), a commonly occurring odontogenic cystic lesion of inflammatory origin, contain mesenchymal stem cells (MSCs) with the capacity for self-renewal and multilineage differentiation. In this study, periapical inflammatory cysts were compared with dental pulp to determine whether this tissue may be an alternative accessible tissue source of MSCs that retain the potential for neurogenic differentiation. Flow cytometry and immunofluorescence analysis indicated that hPCy-MSCs and dental pulp stem cells spontaneously expressed the neuron-specific protein β-III tubulin and the neural stem-/astrocyte-specific protein glial fibrillary acidic protein (GFAP) in their basal state before differentiation occurs. Furthermore, undifferentiated hPCy-MSCs showed a higher expression of transcripts for neuronal markers (β-III tubulin, NF-M, MAP2) and neural-related transcription factors (MSX-1, Foxa2, En-1) as compared with dental pulp stem cells. After exposure to neurogenic differentiation conditions (neural media containing epidermal growth factor [EGF], basic fibroblast growth factor [bFGF], and retinoic acid), the hPCy-MSCs showed enhanced expression of β-III tubulin and GFAP proteins, as well as increased expression of neurofilaments medium, neurofilaments heavy, and neuron-specific enolase at the transcript level. In addition, neurally differentiated hPCy-MSCs showed upregulated expression of the neural transcription factors Pitx3, Foxa2, Nurr1, and the dopamine-related genes tyrosine hydroxylase and dopamine transporter. The present study demonstrated for the first time that hPCy-MSCs have a predisposition toward the neural phenotype that is increased when exposed to neural differentiation cues, based on upregulation of a comprehensive set of proteins and genes that define neuronal cells. In conclusion, these results provide evidence that hPCy-MSCs might be another optimal source of neural/glial cells for cell

  13. EPIDERMAL GROWTH FACTOR RECEPTOR (EGFR AND HUMAN PAPILLOMAVIRUS (HPV L1 CAPSID PROTEIN IN CERVICAL SQUAMOUS INTRAEPITHELIAL LESIONS

    Directory of Open Access Journals (Sweden)

    Balan Raluca

    2010-09-01

    Full Text Available We analyzed the immunohistochemical pattern of epidermal growth factor receptor (EGFR in cervical squamous intraepithelial lesions (SILs in correlation with L1 HPV capsid protein, in order to determine the relationship between EGFR expression and the infection status of human papillomavirus (HPV. The study included 40 cases, 24 LSIL (low grade SIL (CIN1, cervical intraepithelial neoplasia and 16 HSIL (high grade SIL (6 cases of CIN2 and 10 cases of CIN3. The immunoexpression of L1 HPV protein was assessed on conventional cervico-vaginal smears and EGFR was immunohistochemically evaluated on the corresponding cervical biopsies. The HPV L1 capsid protein was expressed in 45.83% of LSIL and 25% of HSIL. EGFR was overexpressed in 62,4% of HSIL (58,4% CIN2 and 41,6% CIN3 and 37,6% LSIL. The immunoexpression of L1 HPV has clinical application in the progression assessment of the cervical precancerous lesions without a correlation to the grade of the cervical SIL. EGFR is expressed by all proliferating squamous epithelial cells, thus corresponding with the grade of SIL. The evaluation of EGFR status, correlated with L1 HPV protein expression, can provide useful data of progression risk of cervical squamous intraepithelial lesions

  14. Dermal matrix proteins initiate re-epithelialization but are not sufficient for coordinated epidermal outgrowth in a new fish skin culture model.

    Science.gov (United States)

    Matsumoto, Reiko; Sugimoto, Masazumi

    2007-02-01

    We have established a new culture system to study re-epithelialization during fish epidermal wound healing. In this culture system, fetal bovine serum (FBS) stimulates the epidermal outgrowth of multi-cellular layers from scale skin mounted on a coverslip, even when cell proliferation is blocked. The rate of outgrowth is about 0.4 mm/h, and at 3 h after incubation, the area occupied by the epidermal sheet is nine times larger than the area of the original scale skin. Cells at the bottom of the outgrowth show a migratory phenotype with lamellipodia, and "purse string"-like actin bundles have been found over the leading-edge cells with polarized lamellipodia. In the superficial cells, re-development of adherens junctions and microridges has been detected, together with the appearance and translocation of phosphorylated p38 MAPK into nuclear areas. Thus, this culture system provides an excellent model to study the mechanisms of epidermal outgrowth accompanied by migration and re-differentiation. We have also examined the role of extracellular matrix proteins in the outgrowth. Type I collagen or fibronectin stimulates moderate outgrowth in the absence of FBS, but development of microridges and the distribution of phosphorylated p38 MAPK are attenuated in the superficial cells. In addition, the leading-edge cells do not have apparent "purse string"-like actin bundles. The outgrowth stimulated by FBS is inhibited by laminin. These results suggest that dermal substrates such as type I collagen and fibronectin are able to initiate epidermal outgrowth but require other factors to enhance such outgrowth, together with coordinated alterations in cellular phenotype.

  15. Forkhead Box C1 Regulates Human Primary Keratinocyte Terminal Differentiation.

    Directory of Open Access Journals (Sweden)

    Lianghua Bin

    Full Text Available The epidermis serves as a critical protective barrier between the internal and external environment of the human body. Its remarkable barrier function is established through the keratinocyte (KC terminal differentiation program. The transcription factors specifically regulating terminal differentiation remain largely unknown. Using a RNA-sequencing (RNA-seq profiling approach, we found that forkhead box c 1 (FOXC1 was significantly up-regulated in human normal primary KC during the course of differentiation. This observation was validated in human normal primary KC from several different donors and human skin biopsies. Silencing FOXC1 in human normal primary KC undergoing differentiation led to significant down-regulation of late terminal differentiation genes markers including epidermal differentiation complex genes, keratinization genes, sphingolipid/ceramide metabolic process genes and epidermal specific cell-cell adhesion genes. We further demonstrated that FOXC1 works down-stream of ZNF750 and KLF4, and upstream of GRHL3. Thus, this study defines FOXC1 as a regulator specific for KC terminal differentiation and establishes its potential position in the genetic regulatory network.

  16. Urinary transforming growth factors in neoplasia: separation of 125I-labeled transforming growth factor-alpha from epidermal growth factor in human urine

    International Nuclear Information System (INIS)

    Stromberg, K.; Hudgins, W.R.

    1986-01-01

    Purified human epidermal growth factor (hEGF) from urine promotes anchorage-independent cell growth in soft agar medium. This growth is enhanced by transforming growth factor-beta (TGF-beta), and is specifically inhibited by hEGF antiserum. Transforming growth factors of the alpha type (TGF-alpha), potentially present in normal human urine or urine from tumor-bearing patients, also promote anchorage-independent cell growth and compete with EGF for membrane receptor binding. Consequently, TGF-alpha cannot be distinguished from urinary hEGF by these two functional assays. Therefore, a technique for separation of TGF-alpha and related peptides from urinary EGF based on biochemical characteristics would be useful. Radioiodination of characterized growth factors [mouse EGF (mEGF), hEGF, and rat TGF-alpha (rTGF-alpha)], which were then separately added to human urine, was used to evaluate a resolution scheme that separates TGF-alpha from the high level of background hEGF present in human urine. Methyl bonded microparticulate silica efficiently adsorbed the 125 I-labeled mEGF, 125 I-labeled hEGF, and 125 I-labeled rTGF-alpha that were added to 24-h human urine samples. Fractional elution with acetonitrile (MeCN) of the adsorbed silica released approximately 70 to 80% of the 125 I-labeled mEGF and 125 I-labeled hEGF between 25 and 30% MeCN, and over 80% of the 125 I-labeled rTGF-alpha between 15 and 25% MeCN, with retention after dialysis of less than 0.2 and 1.7% of the original urinary protein, respectively. A single-step enrichment of about 400-fold for mEGF and hEGF, and 50-fold for rTGF-alpha were achieved rapidly. 125 I-labeled mEGF and 125 I-labeled hEGF eluted later than would be predicted on the basis of their reported molecular weight of approximately 6000, whereas 125 I-labeled rTGF-alpha eluted from Bio-Gel P-10 at an approximate molecular weight of 8000 to 9000

  17. Th17 cell-mediated immune responses promote mast cell proliferation by triggering stem cell factor in keratinocytes

    International Nuclear Information System (INIS)

    Cho, Kyung-Ah; Park, Minhwa; Kim, Yu-Hee; Woo, So-Youn

    2017-01-01

    Although mast cells are traditionally thought to function as effector cells in allergic responses, they have increasingly been recognized as important regulators of various immune responses. Mast cells mature locally; thus, tissue-specific influences are important for promoting mast cell accumulation and survival in the skin and the gastrointestinal tract. In this study, we determined the effects of keratinocytes on mast cell accumulation during Th17-mediated skin inflammation. We observed increases in dermal mast cells in imiquimod-induced psoriatic dermatitis in mice accompanied by the expression of epidermal stem cell factor (SCF), a critical mast cell growth factor. Similar to mouse epidermal keratinocytes, SCF was highly expressed in the human HaCaT keratinocyte cell line following stimulation with IL−17. Further, keratinocytes promoted mast cell proliferation following stimulation with IL−17 in vitro. However, the effects of keratinocytes on mast cells were significantly diminished in the presence of anti−CD117 (stem cell factor receptor) blocking antibodies. Taken together, our results revealed that the Th17-mediated inflammatory environment promotes mast cell accumulation through keratinocyte-derived SCF. - Highlights: • Psoriasis-like skin inflammation increase dermal mast cells. • Keratinocyte produce stem cell factor in psoriasis-like skin inflammation. • Keratinocyte promote mast cell proliferation by stem cell factor dependent manner

  18. Ultrathin epidermal strain sensor based on an elastomer nanosheet with an inkjet-printed conductive polymer

    Science.gov (United States)

    Tetsu, Yuma; Yamagishi, Kento; Kato, Akira; Matsumoto, Yuya; Tsukune, Mariko; Kobayashi, Yo; Fujie, Masakatsu G.; Takeoka, Shinji; Fujie, Toshinori

    2017-08-01

    To minimize the interference that skin-contact strain sensors cause natural skin deformation, physical conformability to the epidermal structure is critical. Here, we developed an ultrathin strain sensor made from poly(3,4-ethylenedioxythiophene):poly(styrene sulfonate) (PEDOT:PSS) inkjet-printed on a polystyrene-polybutadiene-polystyrene (SBS) nanosheet. The sensor, whose total thickness and gauge factor were ˜1 µm and 0.73 ± 0.10, respectively, deeply conformed to the epidermal structure and successfully detected the small skin strain (˜2%) while interfering minimally with the natural deformation of the skin. Such an epidermal strain sensor will open a new avenue for precisely detecting the motion of human skin and artificial soft-robotic skin.

  19. Differentiation of human endometrial stem cells into urothelial cells on a three-dimensional nanofibrous silk-collagen scaffold: an autologous cell resource for reconstruction of the urinary bladder wall.

    Science.gov (United States)

    Shoae-Hassani, Alireza; Mortazavi-Tabatabaei, Seyed Abdolreza; Sharif, Shiva; Seifalian, Alexander Marcus; Azimi, Alireza; Samadikuchaksaraei, Ali; Verdi, Javad

    2015-11-01

    Reconstruction of the bladder wall via in vitro differentiated stem cells on an appropriate scaffold could be used in such conditions as cancer and neurogenic urinary bladder. This study aimed to examine the potential of human endometrial stem cells (EnSCs) to form urinary bladder epithelial cells (urothelium) on nanofibrous silk-collagen scaffolds, for construction of the urinary bladder wall. After passage 4, EnSCs were induced by keratinocyte growth factor (KGF) and epidermal growth factor (EGF) and seeded on electrospun collagen-V, silk and silk-collagen nanofibres. Later we tested urothelium-specific genes and proteins (uroplakin-Ia, uroplakin-Ib, uroplakin-II, uroplakin-III and cytokeratin 20) by immunocytochemistry, RT-PCR and western blot analyses. Scanning electron microscopy (SEM) and histology were used to detect cell-matrix interactions. DMEM/F12 supplemented by KGF and EGF induced EnSCs to express urothelial cell-specific genes and proteins. Either collagen, silk or silk-collagen scaffolds promoted cell proliferation. The nanofibrous silk-collagen scaffolds provided a three-dimensional (3D) structure to maximize cell-matrix penetration and increase differentiation of the EnSCs. Human EnSCs seeded on 3D nanofibrous silk-collagen scaffolds and differentiated to urothelial cells provide a suitable source for potential use in bladder wall reconstruction in women. Copyright © 2013 John Wiley & Sons, Ltd.

  20. Development of EMab-51, a Sensitive and Specific Anti-Epidermal Growth Factor Receptor Monoclonal Antibody in Flow Cytometry, Western Blot, and Immunohistochemistry.

    Science.gov (United States)

    Itai, Shunsuke; Kaneko, Mika K; Fujii, Yuki; Yamada, Shinji; Nakamura, Takuro; Yanaka, Miyuki; Saidoh, Noriko; Handa, Saori; Chang, Yao-Wen; Suzuki, Hiroyoshi; Harada, Hiroyuki; Kato, Yukinari

    2017-10-01

    The epidermal growth factor receptor (EGFR) is a member of the human epidermal growth factor receptor (HER) family of receptor tyrosine kinases and is involved in cell growth and differentiation. EGFR homodimers or heterodimers with other HER members, such as HER2 and HER3, activate downstream signaling cascades in many cancers. In this study, we developed novel anti-EGFR monoclonal antibodies (mAbs) and characterized their efficacy in flow cytometry, Western blot, and immunohistochemical analyses. First, we expressed the full-length or ectodomain of EGFR in LN229 glioblastoma cells and then immunized mice with LN229/EGFR or ectodomain of EGFR, and performed the first screening using enzyme-linked immunosorbent assays. Subsequently, we selected mAbs according to their efficacy in flow cytometry (second screening), Western blot (third screening), and immunohistochemical (fourth screening) analyses. Among 100 mAbs, only one clone EMab-51 (IgG 1 , kappa) reacted with EGFR in Western blot analysis. Finally, immunohistochemical analyses with EMab-51 showed sensitive and specific reactions against oral cancer cells, warranting the use of EMab-51 to detect EGFR in pathological analyses of EGFR-expressing cancers.

  1. Exposure to Carbon Nanotube Material: Assessment of Nanotube Cytotoxicity Using Human Keratinocyte Cells

    Science.gov (United States)

    Shvedova, Anna A.; Castranova, Vincent; Kisin, Elena R.; Schwegler-Berry, Diane; Murray, Ashley R.; Gandelsman, Vadim Z.; Maynard, Andrew; Baron, Paul

    2003-01-01

    Carbon nanotubes are new members of carbon allotropes similar to fullerenes and graphite. Because of their unique electrical, mechanical, and thermal properties, carbon nanotubes are important for novel applications in the electronics, aerospace, and computer industries. Exposure to graphite and carbon materials has been associated with increased incidence of skin diseases, such as carbon fiber dermatitis, hyperkeratosis, and naevi. We investigated adverse effects of single-wall carbon nanotubes (SWCNT) using a cell culture of immortalized human epidermal keratinocytes (HaCaT). After 18 h of exposure of HaCaT to SWCNT, oxidative stress and cellular toxicity were indicated by formation of free radicals, accumulation of peroxidative products, antioxidant depletion, and loss of cell viability. Exposure to SWCNT also resulted in ultrastructural and morphological changes in cultured skin cells. These data indicate that dermal exposure to unrefined SWCNT may lead to dermal toxicity due to accelerated oxidative stress in the skin of exposed workers.

  2. Amnioserosa cell constriction but not epidermal actin cable tension autonomously drives dorsal closure.

    Science.gov (United States)

    Pasakarnis, Laurynas; Frei, Erich; Caussinus, Emmanuel; Affolter, Markus; Brunner, Damian

    2016-11-01

    Tissue morphogenesis requires coordination of multiple force-producing components. During dorsal closure in fly embryogenesis, an epidermis opening closes. A tensioned epidermal actin/MyosinII cable, which surrounds the opening, produces a force that is thought to combine with another MyosinII force mediating apical constriction of the amnioserosa cells that fill the opening. A model proposing that each force could autonomously drive dorsal closure was recently challenged by a model in which the two forces combine in a ratchet mechanism. Acute force elimination via selective MyosinII depletion in one or the other tissue shows that the amnioserosa tissue autonomously drives dorsal closure while the actin/MyosinII cable cannot. These findings exclude both previous models, although a contribution of the ratchet mechanism at dorsal closure onset remains likely. This shifts the current view of dorsal closure being a combinatorial force-component system to a single tissue-driven closure event.

  3. X irradiation of human epidermis in vitro. 2

    International Nuclear Information System (INIS)

    Wollina, U.; Fueller, J.; Burger, B.; Hipler, C.; Jena Univ.

    1989-01-01

    On the example of the reduction of epidermal adhesion of FITC wheat germ agglutinine (WGA) the direct membrane effect of a single X irradiation (44 kV and 220 kV) was analyzed in vitro. Human normal skin and psoriasis centres were compared. Normal skin showed no alteration of microscopically visible FITC-WGA adhesion on epidermal cells over the whole dose range. Foci of psoriasis responded to doses of ≥ 5 Gy (44 and 220 kV) with a drastic reduction of epidermal lectin binding to lower and medium cell layers. Maximum efficacy was with 5 Gy (44 kV) or 10 Gy (220 kV). A dose elevation up to 20 Gy did not result in an increase of efficacy. Topographically the radiosensitive FITC-WGA adhesion could chiefly be seen in the dermal ridges. The findings support the impression of an increased radiosensitivity of the lesional psoriatic epidermis compared with normal skin. This is connected with an abnormal differentiation of keratinocytes in psoriasis. (author)

  4. Quantitative studies of the fate of epidermal Langerhans cells after X-irradiation of guinea-pig and mouse footpad skin

    Energy Technology Data Exchange (ETDEWEB)

    Cole, S.; Fairweather, J.M.; Townsend, K.M.S.

    1987-01-01

    Langerhans cell numbers, morphology and distribution were observed in cross sections of footpad epidermis from 1 to 28 days after exposure of the hind feed of CBA/H mice or albino guinea-pigs to a single absorbed dose of 20 Gy of X-rays. In mice, the number of Langerhans cells reactive with anti-macrophage F4/80 monoclonal antibody steadily declined by approximately 85% within 10 days after irradiation. Remaining Langerhans cells were exceptionally dendritic. Very few Birbeck granule-containing cells were found in murine popliteal lymph nodes before or after irradiation but damaged cells were present in superficial strata of irradiated epidermis. The morphology and number of epidermal F4/80-positive cells approached normal by 15 days after irradiation. In guinea-pigs, gradual suprabasal movement and loss of rounded, ATPase-positive Langerhans cells from the epidermis were detectable from 5 to 20 days after irradiation but the magnitude of the cell loss and redistribution was partially obscured by the simultaneous appearance of clusters of replacement Langerhans cells in the basal layer and by keratinocyte hyperplasia.

  5. Characterization of the epidermal growth factor receptor associated with cytoskeletons of A431 cells

    International Nuclear Information System (INIS)

    Roy, L.M.; Gittinger, C.K.; Landreth, G.E.

    1989-01-01

    Epidermal growth factor receptors (EGF-R) have been shown to be associated with the detergent-insoluble cytoskeleton of A431 cells, where they retained both a functional ligand-binding domain and tyrosine kinase activity. In the present study we have characterized the tyrosine kinase and ligand binding activities of this cytoskeletally associated EGF-R. The tyrosine kinase activity of the cytoskeletally associated EGF-R was stimulated by EGF treatment of intact cells as evidenced by increased autophosphorylation and phosphorylation of the exogenous substrate angiotensin II (AII). The kinetic behavior of the EGF-R associated with cytoskeletons of EGF-treated cells was similar to that of purified receptors. The stimulation of the receptor kinase activity required EGF treatment of intact cells prior to Triton extraction. If cytoskeletons were prepared from untreated cells and then incubated with EGF, there was no stimulation of the detergent-insoluble receptor kinase activity, indicating that the immobilized receptor was unable to undergo EGF-stimulated activation. Comparison of peptide maps from soluble and cytoskeletally associated EGF-R revealed qualitatively similar patterns; however, they are distinguished by a prominent 46 kD band in digests of the cytoskeletal EGF-R. Saturable binding of 125I-EGF to A431 cytoskeletons prepared from adherent and suspended cells demonstrated the presence of specific receptors on the cytoskeleton. High-affinity EGF-R were preferentially retained upon detergent extraction of adherent cells, whereas both low- and high-affinity receptors were solubilized from the cytoskeletons of suspended cells. Suspension of cells resulted in the solubilization of an additional 15% of the EGF-R to that solubilized in adherent cells, indicating that EGF-R can reversibly associate with the structural elements of the cell

  6. Responses of epidermal cell turgor pressure and photosynthetic activity of leaves of the atmospheric epiphyte Tillandsia usneoides (Bromeliaceae) after exposure to high humidity.

    Science.gov (United States)

    Martin, Craig E; Rux, Guido; Herppich, Werner B

    2013-01-01

    It has been well-established that many epiphytic bromeliads of the atmospheric-type morphology, i.e., with leaf surfaces completely covered by large, overlapping, multicellular trichomes, are capable of absorbing water vapor from the atmosphere when air humidity increases. It is much less clear, however, whether this absorption of water vapor can hydrate the living cells of the leaves and, as a consequence, enhance physiological processes in such cells. The goal of this research was to determine if the absorption of atmospheric water vapor by the atmospheric epiphyte Tillandsia usneoides results in an increase in turgor pressure in leaf epidermal cells that subtend the large trichomes, and, by using chlorophyll fluorescence techniques, to determine if the absorption of atmospheric water vapor by leaves of this epiphyte results in increased photosynthetic activity. Results of measurements on living cells of attached leaves of this epiphytic bromeliad, using a pressure probe and of whole-shoot fluorescence imaging analyses clearly illustrated that the turgor pressure of leaf epidermal cells did not increase, and the photosynthetic activity of leaves did not increase, following exposure of the leaves to high humidity air. These results experimentally demonstrate, for the first time, that the absorption of water vapor following increases in atmospheric humidity in atmospheric epiphytic bromeliads is mostly likely a physical phenomenon resulting from hydration of non-living leaf structures, e.g., trichomes, and has no physiological significance for the plant's living tissues. Copyright © 2012 Elsevier GmbH. All rights reserved.

  7. Automated measurement of epidermal thickness from optical coherence tomography images using line region growing

    Science.gov (United States)

    Delacruz, Jomer; Weissman, Jesse; Gossage, Kirk

    2010-02-01

    Optical Coherence Tomography (OCT) is a non-invasive imaging modality that acquires cross sectional images of tissue in-vivo. It accelerates skin diagnosis by eliminating invasive biopsy and laborious histology in the process. Dermatologists have widely used it for looking at morphology of skin diseases such as psoriasis, dermatitis, basal cell carcinoma etc. Skin scientists have also successfully used it for looking at differences in epidermal thickness and its underlying structure with respect to age, body sites, ethnicity, gender, and other related factors. Similar to other in-vivo imaging systems, OCT images suffer from a high degree of speckle and noise content, which hinders examination of tissue structures. Most of the previous work in OCT segmentation of skin was done manually. This compromised the quality of the results by limiting the analyses to a few frames per area. In this paper, we discuss a region growing method for automatic identification of the upper and lower boundaries of the epidermis in living human skin tissue. This image analysis method utilizes images obtained from a frequency-domain OCT. This system is high-resolution and high-speed, and thus capable of capturing volumetric images of the skin in short time. The three-dimensional (3D) data provides additional information that is used in the segmentation process to help compensate for the inherent noise in the images. This method not only provides a better estimation of the epidermal thickness, but also generates a 3D surface map of the epidermal-dermal junction, from which underlying topography can be visualized and further quantified.

  8. The Langerhans cell

    International Nuclear Information System (INIS)

    Wolff, K.; Stingl, G.

    1983-01-01

    Langerhans cells are the bone-marrow-derived immune cells of the epidermis; they express Ia antigens and receptors for the Fc portion of IgG and complement components and are required for epidermal-cell-induced antigen-specific, syngeneic and allogeneic T-cell activitation and the generation of epidermal-cell-induced cytotoxic T cells. Their presence within the epidermis and functional integrity determine whether topical application of haptens leads to specific sensitization or unresponsiveness, and in skin grafts of only I region disparate donors, they represent the cells responsible for the critical allosensitizing signal. UV radiation abrogates most of Langerhans cell functions in vitro; under certain conditions in vivo, it prevents contact sensitization favoring the development of specific unresponsiveness. UV radiation abrogates antigen-presenting capacities of epidermal cells by interfering both with the processing of antigen by Langerhans cells and the production of the epidermal-cell-derived thymocyte activating factor required for optimal T-cell responses

  9. Characterization of Fetal Keratinocytes, Showing Enhanced Stem Cell-Like Properties: A Potential Source of Cells for Skin Reconstruction

    Directory of Open Access Journals (Sweden)

    Kenneth K.B. Tan

    2014-08-01

    Full Text Available Epidermal stem cells have been in clinical application as a source of culture-generated grafts. Although applications for such cells are increasing due to aging populations and the greater incidence of diabetes, current keratinocyte grafting technology is limited by immunological barriers and the time needed for culture amplification. We studied the feasibility of using human fetal skin cells for allogeneic transplantation and showed that fetal keratinocytes have faster expansion times, longer telomeres, lower immunogenicity indicators, and greater clonogenicity with more stem cell indicators than adult keratinocytes. The fetal cells did not induce proliferation of T cells in coculture and were able to suppress the proliferation of stimulated T cells. Nevertheless, fetal keratinocytes could stratify normally in vitro. Experimental transplantation of fetal keratinocytes in vivo seeded on an engineered plasma scaffold yielded a well-stratified epidermal architecture and showed stable skin regeneration. These results support the possibility of using fetal skin cells for cell-based therapeutic grafting.

  10. Intranasal epidermal growth factor treatment rescues neonatal brain injury

    Science.gov (United States)

    Scafidi, Joseph; Hammond, Timothy R.; Scafidi, Susanna; Ritter, Jonathan; Jablonska, Beata; Roncal, Maria; Szigeti-Buck, Klara; Coman, Daniel; Huang, Yuegao; McCarter, Robert J.; Hyder, Fahmeed; Horvath, Tamas L.; Gallo, Vittorio

    2014-02-01

    There are no clinically relevant treatments available that improve function in the growing population of very preterm infants (less than 32 weeks' gestation) with neonatal brain injury. Diffuse white matter injury (DWMI) is a common finding in these children and results in chronic neurodevelopmental impairments. As shown recently, failure in oligodendrocyte progenitor cell maturation contributes to DWMI. We demonstrated previously that the epidermal growth factor receptor (EGFR) has an important role in oligodendrocyte development. Here we examine whether enhanced EGFR signalling stimulates the endogenous response of EGFR-expressing progenitor cells during a critical period after brain injury, and promotes cellular and behavioural recovery in the developing brain. Using an established mouse model of very preterm brain injury, we demonstrate that selective overexpression of human EGFR in oligodendrocyte lineage cells or the administration of intranasal heparin-binding EGF immediately after injury decreases oligodendroglia death, enhances generation of new oligodendrocytes from progenitor cells and promotes functional recovery. Furthermore, these interventions diminish ultrastructural abnormalities and alleviate behavioural deficits on white-matter-specific paradigms. Inhibition of EGFR signalling with a molecularly targeted agent used for cancer therapy demonstrates that EGFR activation is an important contributor to oligodendrocyte regeneration and functional recovery after DWMI. Thus, our study provides direct evidence that targeting EGFR in oligodendrocyte progenitor cells at a specific time after injury is clinically feasible and potentially applicable to the treatment of premature children with white matter injury.

  11. Excision of pyrimidine dimers from epidermal DNA and nonsemiconservative epidermal DNA synthesis following ultraviolet irradiation of mouse skin

    International Nuclear Information System (INIS)

    Bowden, G.T.; Trosko, J.E.; Shapas, B.G.; Boutwell, R.K.

    1975-01-01

    Pyrimidine dimer production and excision in epidermal DNA were studied at five different dose levels of ultraviolet light in the skin of intact mice. Dimer production increased with dose up to 50,400 ergs/sq mm. Approximately 30 percent of the thymine-containing dimers were excised by 24 hr after irradiation at three lower dose levels of ultraviolet light. Nonsemiconservative DNA replication in ultraviolet-irradiated mouse skin was shown to continue for at least 18 hr. The rate of nonsemiconservative replication decreased with time, but did so slowly. The initial rates of nonsemiconservative replication increased with ultraviolet light dose levels up to about 4200 ergs/sq mm, after which the initial rates were decreased. Semiconservative epidermal DNA synthesis was shown to be inhibited by hydroxyurea, but hydroxyurea had no effect on ultraviolet light-induced nonsemiconservative DNA replication. The observed pyrimidine dimer excision and nonsemiconservative DNA replication suggest that in the intact mouse the cells of the epidermis are capable of DNA excision repair after ultraviolet irradiation of mouse skin

  12. Construction of multifunctional proteins for tissue engineering: epidermal growth factor with collagen binding and cell adhesive activities.

    Science.gov (United States)

    Hannachi Imen, Elloumi; Nakamura, Makiko; Mie, Masayasu; Kobatake, Eiry

    2009-01-01

    The development of different techniques based on natural and polymeric scaffolds are useful for the design of different biomimetic materials. These approaches, however, require supplementary steps for the chemical or physical modification of the biomaterial. To avoid such steps, in the present study, we constructed a new multifunctional protein that can be easily immobilized onto hydrophobic surfaces, and at the same time helps enhance specific cell adhesion and proliferation onto collagen substrates. A collagen binding domain was fused to a previously constructed protein, which had an epidermal growth factor fused to a hydrophobic peptide that allows for cell adhesion. The new fusion protein, designated fnCBD-ERE-EGF is produced in Escherichia coli, and its abilities to bind to collagen and promote cell proliferation were investigated. fnCBD-ERE-EGF was shown to keep both collagen binding and cell growth-promoting activities comparable to those of the corresponding unfused proteins. The results obtained in this study also suggest the use of a fnCBD-ERE-EGF as an alternative for the design of multifunctional ECM-bound growth factor based materials.

  13. Stimulation of prostaglandin E2 production by phorbol esters and epidermal growth factor in porcine thyroid cells

    International Nuclear Information System (INIS)

    Kasai, K.; Hiraiwa, M.; Emoto, T.; Akimoto, K.; Takaoka, T.; Shimoda, S.I.

    1987-01-01

    Effects of phorbol esters and epidermal growth factor (EGF) on prostaglandin E 2 production by cultured porcine thyroid cells were examined. Both phorbol 12-myristate 13-acetate (PMA) and EGF stimulated prostaglandin E 2 production by the cells in dose related fashion. PMA stimulated prostaglandin E 2 production over fifty-fold with the dose of 10 -7 M compared with control. EGF (10 -7 M) also stimulated it about ten-fold. The ED 50 values of PMA and EGF were respectively around 1 x 10 -9 M and 5 x 10 -10 M. Thyroid stimulating hormone (TSH), however, did not stimulate prostaglandin E 2 production from 1 to 24-h incubation. The release of radioactivity from [ 3 H]-arachidonic acid prelabeled cells was also stimulated by PMA and EGF, but not by TSH. These results indicate that both PMA and EGF are potent stimulators of prostaglandin E 2 production, associated with the activity to stimulate arachidonic acid release in porcine thyroid cells. 36 references, 2 figures, 1 table

  14. EGF–FGF2 stimulates the proliferation and improves the neuronal commitment of mouse epidermal neural crest stem cells (EPI-NCSCs)

    International Nuclear Information System (INIS)

    Bressan, Raul Bardini; Melo, Fernanda Rosene; Almeida, Patricia Alves; Bittencourt, Denise Avani; Visoni, Silvia; Jeremias, Talita Silva; Costa, Ana Paula; Leal, Rodrigo Bainy; Trentin, Andrea Gonçalves

    2014-01-01

    Epidermal neural crest stem cells (EPI-NCSCs), which reside in the bulge of hair follicles, are attractive candidates for several applications in cell therapy, drug screening and tissue engineering. As suggested remnants of the embryonic neural crest (NC) in an adult location, EPI-NCSCs are able to generate a wide variety of cell types and are readily accessible by a minimally invasive procedure. Since the combination of epidermal growth factor (EGF) and fibroblast growth factor type 2 (FGF 2 ) is mitogenic and promotes the neuronal commitment of various stem cell populations, we examined its effects in the proliferation and neuronal potential of mouse EPI-NCSCs. By using a recognized culture protocol of bulge whiskers follicles, we were able to isolate a population of EPI-NCSCs, characterized by the migratory potential, cell morphology and expression of phenotypic markers of NC cells. EPI-NCSCs expressed neuronal, glial and smooth muscle markers and exhibited the NC-like fibroblastic morphology. The treatment with the combination EGF and FGF 2 , however, increased their proliferation rate and promoted the acquisition of a neuronal-like morphology accompanied by reorganization of neural cytoskeletal proteins βIII-tubulin and nestin, as well as upregulation of the pan neuronal marker βIII-tubulin and down regulation of the undifferentiated NC, glial and smooth muscle cell markers. Moreover, the treatment enhanced the response of EPI-NCSCs to neurogenic stimulation, as evidenced by induction of GAP43, and increased expression of Mash-1 in neuron-like cell, both neuronal-specific proteins. Together, the results suggest that the combination of EGF–FGF2 stimulates the proliferation and improves the neuronal potential of EPI-NCSCs similarly to embryonic NC cells, ES cells and neural progenitor/stem cells of the central nervous system and highlights the advantage of using EGF–FGF 2 in neuronal differentiation protocols. - Highlights: • EPI-NCSCs express

  15. Comparative SEM and LM foliar epidermal and palyno-morphological studies of Amaranthaceae and its taxonomic implications.

    Science.gov (United States)

    Hussain, Amara Noor; Zafar, Muhammad; Ahmad, Mushtaq; Khan, Raees; Yaseen, Ghulam; Khan, Muhammad Saleem; Nazir, Abdul; Khan, Amir Muhammad; Shaheen, Shabnum

    2018-05-01

    Palynological features as well as comparative foliar epidermal using light and scanning electron microscope (SEM) of 17 species (10genera) of Amaranthaceae have been studied for its taxonomic significance. Different foliar and palynological micro-morphological characters were examined to explain their value in resolving the difficulty in identification. All species were amphistomatic but stomata on abaxial surface were more abundant. Taxonomically significant epidermal character including stomata type, trichomes (unicellular, multicellular, and capitate) and epidermal cells shapes (polygonal and irregular) were also observed. Pollens of this family are Polypantoporate, pores large, spheroidal, mesoporous region is sparsely to scabrate, densely psilate, and spinulose. All these characters can be active at species level for identification purpose. This study indicates that at different taxonomic levels, LM and SEM pollen and epidermal morphology is explanatory and significant to identify species and genera. © 2018 Wiley Periodicals, Inc.

  16. [Effects of icotinib hydrochloride on the proliferation and apoptosis of human lung cancer cell lines].

    Science.gov (United States)

    Ma, Li; Han, Xiao-hong; Wang, Shuai; Wang, Jian-fei; Shi, Yuan-kai

    2012-09-25

    To explore the effects of icotinib on the proliferation and apoptosis of various lung cancer cell lines. Human lung cancer cell lines HCC827, H1650, H1975, A549 and human epidermal cancer cell line A431 were treated in vitro with icotinib or gefitinib at a concentration gradient of 0 - 40 µmol/L. Their proliferation effects were analyzed by the thiazolyl blue (MTT) assay and the apoptotic effects detected by flow cytometer. The downstream signaling proteins were detected by Western blot. The median inhibitory concentrations (IC(50)) of icotinib for A431 and HCC827 cell lines were (0.04 ± 0.02) and (0.15 ± 0.06) µmol/L respectively. No significant differences existed between the inhibitions of gefitinib and icotinib on A431, HCC827, H1650, H1975 and A549 cell lines (all P > 0.05). Compared with H1650, H1975 and A549 cell lines, icotinib significantly inhibited A431 (P = 0.009, 0.005 and 0.000) and HCC827 (P = 0.001, 0.001 and 0.000) cell lines. And it lowered the expressions of p-AKT, p-ERK and survivin protein expression through the inhibited activity of p-EGFR protein. Icotinib can arrest the proliferation of lung adenocarcinoma cells with EGFR mutation or over-expression by inhibiting the signal pathways of AKT-ERK and survivin.

  17. Real-time three-dimensional imaging of epidermal splitting and removal by high-definition optical coherence tomography

    DEFF Research Database (Denmark)

    Boone, Marc; Draye, Jean Pierre; Verween, Gunther

    2014-01-01

    While real-time 3-D evaluation of human skin constructs is needed, only 2-D non-invasive imaging techniques are available. The aim of this paper is to evaluate the potential of high-definition optical coherence tomography (HD-OCT) for real-time 3-D assessment of the epidermal splitting and decell......While real-time 3-D evaluation of human skin constructs is needed, only 2-D non-invasive imaging techniques are available. The aim of this paper is to evaluate the potential of high-definition optical coherence tomography (HD-OCT) for real-time 3-D assessment of the epidermal splitting...... before and after incubation. Real-time 3-D HD-OCT assessment was compared with 2-D en face assessment by reflectance confocal microscopy (RCM). (Immuno) histopathology was used as control. HD-OCT imaging allowed real-time 3-D visualization of the impact of selected agents on epidermal splitting, dermo......-epidermal junction, dermal architecture, vascular spaces and cellularity. RCM has a better resolution (1 μm) than HD-OCT (3 μm), permitting differentiation of different collagen fibres, but HD-OCT imaging has deeper penetration (570 μm) than RCM imaging (200 μm). Dispase II and NaCl treatments were found...

  18. BDNF/TrkB signaling protects HT-29 human colon cancer cells from EGFR inhibition

    International Nuclear Information System (INIS)

    Brunetto de Farias, Caroline; Heinen, Tiago Elias; Pereira dos Santos, Rafael; Abujamra, Ana Lucia; Schwartsmann, Gilberto

    2012-01-01

    Highlights: ► BDNF protected HT-29 colorectal cancer cells from the antitumor effect of cetuximab. ► TrkB inhibition potentiated the antitumor effect of cetuximab. ► BDNF/TrkB signaling might be involved in resistance to anti-EGFR therapy. -- Abstract: The clinical success of targeted treatment of colorectal cancer (CRC) is often limited by resistance to anti-epidermal growth factor receptor (EGFR) therapy. The neurotrophin brain-derived neurotrophic factor (BDNF) and its receptor TrkB have recently emerged as anticancer targets, and we have previously shown increased BDNF levels in CRC tumor samples. Here we report the findings from in vitro experiments suggesting that BDNF/TrkB signaling can protect CRC cells from the antitumor effects of EGFR blockade. The anti-EGFR monoclonal antibody cetuximab reduced both cell proliferation and the mRNA expression of BDNF and TrkB in human HT-29 CRC cells. The inhibitory effect of cetuximab on cell proliferation and survival was counteracted by the addition of human recombinant BDNF. Finally, the Trk inhibitor K252a synergistically enhanced the effect of cetuximab on cell proliferation, and this effect was blocked by BDNF. These results provide the first evidence that increased BDNF/TrkB signaling might play a role in resistance to EGFR blockade. Moreover, it is possible that targeting TrkB could potentiate the anticancer effects of anti-EGFR therapy.

  19. Abnormalities of lymphocyte function and phenotypic pattern in a case of toxic epidermal necrolysis

    DEFF Research Database (Denmark)

    Hagdrup, H; Tønnesen, E; Clemmensen, O

    1992-01-01

    We examined the blood lymphocyte function and phenotypic pattern in a patient with toxic epidermal necrolysis after taking salazopyrin. We studied cell surface markers, natural killer cell activity and mitogen-induced lymphocyte transformation. Our results point to temporary immunosuppression...... as evidenced by lymphopenia with a large "null cell" population, reduced natural killer cell activity, and impaired lymphocyte response to mitogens....

  20. Irradiation of protoporphyric mice induces down-regulation of epidermal eicosanoid metabolism

    International Nuclear Information System (INIS)

    He, D.; Lim, H.W.

    1991-01-01

    This study investigated the effect of radiation on clinical and histologic changes, and on cutaneous eicosanoid metabolism, in Skh:HR-1 hairless albino mice rendered protoporphyric by the administration of collidine. At 0.1-18 h after exposure to 12 kJ/m2 of 396-406 nm irradiation, thicknesses of back skin and ears were measured, and histologic changes were evaluated by using hematoxylin and eosin (H-E) and Giemsa's stains. Activities of eicosanoid-metabolizing enzymes in epidermal and dermal homogenates were assessed by incubating the tissue homogenates with 3H-AA, followed by quantitation of the eicosanoids generated by radio-TLC. In irradiated protoporphyric mice, an increase of back-skin thickness was noted at 0.1 h, reaching a peak at 18 h, whereas maximal increase in ear thickness was observed at 12 h. Histologic changes included dermal edema, increased mast cell degranulation, and mononuclear cells in the dermis. In these irradiated protoporphyric animals, generations of 6 keto-PGF1a, PGF2a, PGE2, PGD2, and HETE by epidermal eicosanoid-metabolizing enzymes were markedly suppressed at all the timepoints studied. Dermal eicosanoid-metabolizing enzymes of irradiated protoporphyric mice generated increased amounts of PGE2 and HETE at 18 h, probably reflecting the presence of dermal cellular infiltrates. The suppression of the activities of epidermal eicosanoid-metabolizing enzymes was prevented by intraperitoneal injection of WR-2721, a sulfhydryl group generator, prior to irradiation, suggesting that the suppression was secondary to photo-oxidative damage of the enzymes during the in vivo phototoxic response. These results suggest that the effect of protoporphyrin and radiation on cutaneous eicosanoid metabolism in this animal model in vivo is that of a down regulation of the activities of epidermal eicosanoid-metabolizing enzymes

  1. Upregulated epidermal growth factor receptor expression following near-infrared irradiation simulating solar radiation in a three-dimensional reconstructed human corneal epithelial tissue culture model.

    Science.gov (United States)

    Tanaka, Yohei; Nakayama, Jun

    2016-01-01

    Humans are increasingly exposed to near-infrared (NIR) radiation from both natural (eg, solar) and artificial (eg, electrical appliances) sources. Although the biological effects of sun and ultraviolet (UV) exposure have been extensively investigated, the biological effect of NIR radiation is still unclear. We previously reported that NIR as well as UV induces photoaging and standard UV-blocking materials, such as sunglasses, do not sufficiently block NIR. The objective of this study was to investigate changes in gene expression in three-dimensional reconstructed corneal epithelial tissue culture exposed to broad-spectrum NIR irradiation to simulate solar NIR radiation that reaches human tissues. DNA microarray and quantitative real-time polymerase chain reaction analysis were used to assess gene expression levels in a three-dimensional reconstructed corneal epithelial model composed of normal human corneal epithelial cells exposed to water-filtered broad-spectrum NIR irradiation with a contact cooling (20°C). The water-filter allowed 1,000-1,800 nm wavelengths and excluded 1,400-1,500 nm wavelengths. A DNA microarray with >62,000 different probes showed 25 and 150 genes that were up- or downregulated by at least fourfold and twofold, respectively, after NIR irradiation. In particular, epidermal growth factor receptor (EGFR) was upregulated by 19.4-fold relative to control cells. Quantitative real-time polymerase chain reaction analysis revealed that two variants of EGFR in human corneal epithelial tissue were also significantly upregulated after five rounds of 10 J/cm(2) irradiation (Psolar energy reaching the Earth is in the NIR region, which cannot be adequately blocked by eyewear and thus can induce eye damage with intensive or long-term exposure, protection from both UV and NIR radiation may prevent changes in gene expression and in turn eye damage.

  2. 3',5'-Cyclic diguanylic acid (c-di-GMP) inhibits basal and growth factor-stimulated human colon cancer cell proliferation

    International Nuclear Information System (INIS)

    Karaolis, David K.R.; Cheng, Kunrong; Lipsky, Michael; Elnabawi, Ahmed; Catalano, Jennifer; Hyodo, Mamoru; Hayakawa, Yoshihiro; Raufman, Jean-Pierre

    2005-01-01

    The novel cyclic dinucleotide, 3',5'-cyclic diguanylic acid, cGpGp (c-di-GMP), is a naturally occurring small molecule that regulates important signaling mechanisms in prokaryotes. Recently, we showed that c-di-GMP has 'drug-like' properties and that c-di-GMP treatment might be a useful antimicrobial approach to attenuate the virulence and pathogenesis of Staphylococcus aureus and prevent or treat infection. In the present communication, we report that c-di-GMP (≤50 μM) has striking properties regarding inhibition of cancer cell proliferation in vitro. c-di-GMP inhibits both basal and growth factor (acetylcholine and epidermal growth factor)-induced cell proliferation of human colon cancer (H508) cells. Toxicity studies revealed that exposure of normal rat kidney cells and human neuroblastoma cells to c-di-GMP at biologically relevant doses showed no lethal cytotoxicity. Cyclic dinucleotides, such as c-di-GMP, represent an attractive and novel 'drug-platform technology' that can be used not only to develop new antimicrobial agents, but also to develop novel therapeutic agents to prevent or treat cancer

  3. Stevens–Johnson syndrome/toxic epidermal necrolysis caused by cefadroxil in a cat

    Directory of Open Access Journals (Sweden)

    Roberta Sartori

    2016-06-01

    Full Text Available Case summary A 5-year-old, spayed female, indoor-only domestic shorthair cat was referred with an acute history of multifocal cutaneous and mucocutaneous erosive-ulcerative lesions and skin detachment. The lesions occurred on the seventh day of therapy with cefadroxil. Erosive-ulcerative and occasionally crusted lesions were apparent on the medial and lateral canthus of both eyes, ventral neck, abdomen, perivulvar region, periungual skin and medial aspect of the front and hindlimbs. Diffuse and severe exfoliation was present on the dorsum and tail base and in both external ear canals. The cat was also dehydrated, tachycardic and febrile. Histopathological examination revealed extensive epidermal ulceration, interface dermatitis with vacuolar degeneration, apoptosis at multiple epidermal levels and basal, suprabasal and spinous dermoepidermal detachment. The histopathological diagnosis was consistent with Stevens–Johnson syndrome/toxic epidermal necrolysis (SJS/TEN. The recently reported Algorithm of Drug Causality in Epidermal Necrolysis (ALDEN, currently used in human medicine, was applied and a score of +6 was calculated; this supported the view that SJS/TEN in this cat was very likely to be associated with cefadroxil administration. Relevance and novel information This clinical communication reports cefadroxil as a very probable cause of SJS/TEN in a cat; the ALDEN was applied in this case and supported diagnosis.

  4. EGFR inhibitor C225 increases the radiosensitivity of human lung squamous cancer cells

    Directory of Open Access Journals (Sweden)

    Yang Ruijie

    2010-10-01

    Full Text Available Abstract Background The purpose of the present study is to investigate the direct biological effects of the epidermal growth factor receptor (EGFR inhibitor C225 on the radiosensitivity of human lung squamous cancer cell-H520. H520 cells were treated with different dosage of 60Co γ ray irradiation (1.953 Gy/min in the presence or absence of C225. The cellular proliferation, colony forming capacity, apoptosis, the cell cycle distribution as well as caspase-3 were analyzed in vitro. Results We found that C225 treatment significantly increased radiosensitivity of H-520 cells to irradiation, and led to cell cycle arrest in G1 phase, whereas 60Co γ ray irradiation mainly caused G2 phase arrest. H-520 cells thus displayed both the G1 and G2 phase arrest upon treatment with C225 in combination with 60Co γ ray irradiation. Moreover, C225 treatment significantly increased the apoptosis percentage of H-520 cells (13.91% ± 1.88% compared with the control group (5.75% ± 0.64%, P Conclusion In this regard, C225 treatment may make H-520 cells more sensitive to irradiation through the enhancement of caspase-3 mediated tumor cell apoptosis and cell cycle arrest.

  5. Fractional sunburn threshold UVR doses generate equivalent vitamin D and DNA damage in skin types I-VI, but with epidermal DNA damage gradient correlated to skin darkness.

    Science.gov (United States)

    Shih, Barbara B; Farrar, Mark D; Cooke, Marcus S; Osman, Joanne; Langton, Abigail K; Kift, Richard; Webb, Ann R; Berry, Jacqueline L; Watson, Rachel E B; Vail, Andy; de Gruijl, Frank R; Rhodes, Lesley E

    2018-05-03

    Public health guidance recommends limiting sun-exposure to sub-sunburn levels, but it's unknown whether these can gain vitamin D (for musculoskeletal health) whilst avoiding epidermal DNA damage (initiates skin cancer). Well-characterised healthy humans of all skin types (I-VI; lightest to darkest skin) were exposed to a low dose-series of solar simulated UVR of 20-80% their individual sunburn threshold dose (minimal erythemal dose, MED). Significant UVR dose-responses were seen for serum 25(OH)D and whole epidermal CPD, with as little as 0.2 MED concurrently producing 25(OH)D and CPD. Notably, fractional MEDs generated equivalent levels of whole epidermal CPD and 25(OH)D across all skin types. Crucially, we demonstrated an epidermal gradient of CPD formation strongly correlated with skin darkness (r=0.74; Pskin types, ranging from darkest skin, where high CPD levels occurred superficially with none in the germinative basal layer, through to lightest skin where CPD were induced evenly across the epidermal depth. Darker skin people can be encouraged to utilise sub-sunburn UVR-exposure to enhance their vitamin D. In lighter skin people, basal cell damage occurs concurrent with vitamin D synthesis at exquisitely low UVR levels, providing an explanation for their high skin cancer incidence; greater caution is required. Copyright © 2018 The Authors. Published by Elsevier Inc. All rights reserved.

  6. Flipped script for gefitinib: A reapproved tyrosine kinase inhibitor for first-line treatment of epidermal growth factor receptor mutation positive metastatic nonsmall cell lung cancer.

    Science.gov (United States)

    Bogdanowicz, Brian S; Hoch, Matthew A; Hartranft, Megan E

    2017-04-01

    Purpose The approval history, pharmacology, pharmacokinetics, clinical trials, efficacy, dosing recommendations, drug interactions, safety, place in therapy, and economic considerations of gefitinib are reviewed. Summary Lung cancer is one of the most commonly diagnosed cancers and is the leading cause of cancer death. Platinum-based chemotherapy and tyrosine kinase inhibitors, such as erlotinib and afatinib, are recommended therapies for nonsmall cell lung cancer. The European Medicines Association based their approval of gefitinib on the randomized, multicenter Iressa Pan-Asia Study (IPASS, NCT00322452) and a single-arm study showing effectiveness in Caucasians (IFUM, NCT01203917). Both studies were recently referenced by the United States Food & Drug Administration to reapprove gefitinib for the first-line treatment of advanced nonsmall cell lung cancer with epidermal growth factor receptor exon 19 deletions or exon 21 substitution. Diarrhea, acneiform rash, and interstitial lung disease are known side effects of gefitinib. Conclusion Use of gefitinib for the first-line therapy of metastatic nonsmall cell lung cancer with epidermal growth factor receptor exon 19 deletions (residues 747-750) or exon 21 substitution mutation (L858R) is well-documented and supported.

  7. Epidermal growth factor receptor: an independent predictor of survival in astrocytic tumors given definitive irradiation

    International Nuclear Information System (INIS)

    An Zhu; Shaeffer, James; Leslie, Susan; Kolm, Paul; El-Mahdi, Anas M.

    1996-01-01

    Purpose: To determine whether the expression of epidermal growth factor receptor (EGFR) protein was predictive of patient survival independently of other prognostic factors in astrocytic tumors. Methods and Materials: Epidermal growth factor receptor protein expression was investigated immunohistochemically in formalin-fixed, paraffin-embedded surgical specimens of 55 glioblastoma multiforme, 14 anaplastic astrocytoma, and 2 astrocytomas given definitive irradiation. We evaluated the relationship of EGFR protein expression and tumor grade, histologic features, age at diagnosis, sex, patient survival, and recurrence-free survival. Results: The percentage of tumor cells which were EGFR positive related to reduced survival by Cox regression analysis in both univariate (p = 0.0424) and multivariate analysis (p = 0.0016). Epidermal growth factor receptor positivity was the only 1 of 11 clinical and histological variables associated with decreased recurrence-free survival by either univariate (p = 0.0353) or multivariate (p = 0.0182) analysis. Epidermal growth factor receptor protein expression was not related to patient age, sex, or histologic features. Conclusion: Epidermal growth factor receptor positivity was a significant and independent prognostic indicator for overall survival and recurrence-free survival for irradiated patients with astrocytic gliomas

  8. A transcription factor active on the epidermal growth factor receptor gene

    International Nuclear Information System (INIS)

    Kageyama, R.; Merlino, G.T.; Pastan, I.

    1988-01-01

    The authors have developed an in vitro transcription system for the epidermal growth factor receptor (EGFR) oncogene by using nuclear extracts of A431 human epidermoid carcinoma cells, which overproduce EGFR. They found that a nuclear factor, termed EGFR-specific transcription factor (ETF), specifically stimulated EGFR transcription by 5- to 10-fold. In this report, ETF, purified by using sequence-specific oligonucleotide affinity chromatography, is shown by renaturing material eluted from a NaDodSO 4 /polyacrylamide gel to be a protein with a molecular mass of 120 kDa. ETF binds to the promoter region, as measured by DNase I footprinting and gel-mobility-shift assays, and specifically stimulates the transcription of the EGFR gene in a reconstituted in vitro transcription system. These results suggest that ETF could play a role in the overexpression of the cellular oncogene EGFR

  9. In situ behavior of human Langerhans cells in skin organ culture

    NARCIS (Netherlands)

    Rambukkana, A.; Bos, J. D.; Irik, D.; Menko, W. J.; Kapsenberg, M. L.; Das, P. K.

    1995-01-01

    Epidermal Langerhans cells (ELC) play a critical role in the initiation of cutaneous immune responses. ELC are characterized by the expression of major histocompatibility complex (MHC) class II Ag and a number of adhesion/costimulatory molecules. Evidence suggests that cytokines induced within the

  10. Epidermal protection with cryogen spray cooling during high fluence pulsed dye laser irradiation: an ex vivo study.

    Science.gov (United States)

    Tunnell, J W; Nelson, J S; Torres, J H; Anvari, B

    2000-01-01

    Higher laser fluences than currently used in therapy (5-10 J/cm(2)) are expected to result in more effective treatment of port wine stain (PWS) birthmarks. However, higher incident fluences increase the risk of epidermal damage caused by absorption of light by melanin. Cryogen spray cooling offers an effective method to reduce epidermal injury during laser irradiation. The objective of this study was to determine whether high laser incident fluences (15-30 J/cm(2)) could be used while still protecting the epidermis in ex vivo human skin samples. Non-PWS skin from a human cadaver was irradiated with a Candela ScleroPlus Laser (lambda = 585 nm; pulse duration = 1.5 msec) by using various incident fluences (8-30 J/cm(2)) without and with cryogen spray cooling (refrigerant R-134a; spurt durations: 40-250 msec). Assessment of epidermal damage was based on histologic analysis. Relatively short spurt durations (40-100 msec) protected the epidermis for laser incident fluences comparable to current therapeutic levels (8-10 J/cm(2)). However, longer spurt durations (100-250 msec) increased the fluence threshold for epidermal damage by a factor of three (up to 30 J/cm(2)) in these ex vivo samples. Results of this ex vivo study show that epidermal protection from high laser incident fluences can be achieved by increasing the cryogen spurt duration immediately before pulsed laser exposure. Copyright 2000 Wiley-Liss, Inc.

  11. Extrapolation of systemic bioavailability assessing skin absorption and epidermal and hepatic metabolism of aromatic amine hair dyes in vitro.

    Science.gov (United States)

    Manwaring, John; Rothe, Helga; Obringer, Cindy; Foltz, David J; Baker, Timothy R; Troutman, John A; Hewitt, Nicola J; Goebel, Carsten

    2015-09-01

    Approaches to assess the role of absorption, metabolism and excretion of cosmetic ingredients that are based on the integration of different in vitro data are important for their safety assessment, specifically as it offers an opportunity to refine that safety assessment. In order to estimate systemic exposure (AUC) to aromatic amine hair dyes following typical product application conditions, skin penetration and epidermal and systemic metabolic conversion of the parent compound was assessed in human skin explants and human keratinocyte (HaCaT) and hepatocyte cultures. To estimate the amount of the aromatic amine that can reach the general circulation unchanged after passage through the skin the following toxicokinetically relevant parameters were applied: a) Michaelis-Menten kinetics to quantify the epidermal metabolism; b) the estimated keratinocyte cell abundance in the viable epidermis; c) the skin penetration rate; d) the calculated Mean Residence Time in the viable epidermis; e) the viable epidermis thickness and f) the skin permeability coefficient. In a next step, in vitro hepatocyte Km and Vmax values and whole liver mass and cell abundance were used to calculate the scaled intrinsic clearance, which was combined with liver blood flow and fraction of compound unbound in the blood to give hepatic clearance. The systemic exposure in the general circulation (AUC) was extrapolated using internal dose and hepatic clearance, and Cmax was extrapolated (conservative overestimation) using internal dose and volume of distribution, indicating that appropriate toxicokinetic information can be generated based solely on in vitro data. For the hair dye, p-phenylenediamine, these data were found to be in the same order of magnitude as those published for human volunteers. Copyright © 2015. Published by Elsevier Inc.

  12. Induction of proliferation of basal epidermal keratinocytes by cold atmospheric-pressure plasma.

    Science.gov (United States)

    Hasse, S; Duong Tran, T; Hahn, O; Kindler, S; Metelmann, H-R; von Woedtke, T; Masur, K

    2016-03-01

    Over the past few decades, new cold plasma sources have been developed that have the great advantage of operating at atmospheric pressure and at temperatures tolerable by biological material. New applications for these have emerged, especially in the field of dermatology. Recently it was demonstrated that cold atmospheric-pressure plasma positively influences healing of chronic wounds. The potential of cold plasma lies in its capacity to reduce bacterial load in the wound while at the same time stimulating skin cells and therefore promoting wound closure. In recent years, there have been great advances in the understanding of the molecular mechanisms triggered by cold plasma involving signalling pathways and gene regulation in cell culture. To investigate cold plasma-induced effects in ex vivo treated human skin biopsies. Human skin tissue was exposed to cold plasma for different lengths of time, and analysed by immunofluorescence with respect to DNA damage, apoptosis, proliferation and differentiation markers. After cold plasma treatment, the epidermal integrity and keratin expression pattern remained unchanged. As expected, the results revealed an increase in apoptotic cells after 3 and 5 min of treatment. Strikingly, an induction of proliferating basal keratinocytes was detected after cold plasma exposure for 1 and 3 min. As these are the cells that regenerate the epidermis, this could indeed be beneficial for wound closure. We investigated the effect of cold plasma on human skin by detecting molecules for growth and apoptosis, and found that both processes are dependent on treatment time. Therefore, this approach offers promising results for further applications of cold plasma in clinical dermatology. © 2015 British Association of Dermatologists.

  13. Inhibition of cyclobutane pyrimidine dimer formation in epidermal p53 gene of UV-irradiated mice by alpha-tocopherol

    International Nuclear Information System (INIS)

    Chen, W.; Barthelman, M.; Martinez, J.; Alberts, D.; Gensler, H.L.

    1997-01-01

    Mutations or alterations in the p53 gene have been observed in 50-100% of ultraviolet light (UV)-induced squamous cell carcinoma in humans and animals. Most of the mutations occurred at dipyrimidine sequences, suggesting that pyrimidine dimers in the p53 gene play a role in the pathogenesis of cutaneous squamous cell carcinoma. We previously showed that topical alpha-tocopherol prevents UV-induced skin carcinogenesis in the mouse. In the present study we asked whether topical alpha-tocopherol reduces the level of UV-induced cyclobutane pyrimidine dimers in the murine epidermal p53 gene. Mice received six dorsal applications of 25 mg each of alpha-tocopherol, on alternate days, before exposure to 500 J/m2 of UV-B irradiation. Mice were killed at selected times after irradiation. The level of dimers in the epidermal p53 gene was measured using the T4 endonuclease V assay with quantitative Southern hybridization. Topical alpha-tocopherol caused a 55% reduction in the formation of cyclobutane pyrimidine dimers in the epidermal p53 gene. The rate of reduction of pyrimidine dimers between 1 and 10 hours after irradiation was similar in UV-irradiated mice, regardless of alpha-tocopherol treatment. Therefore, the lower level of cyclobutane pyrimidine dimers in UV-irradiated mice treated with alpha-tocopherol than in control UV-irradiated mice resulted from the prevention of formation of the dimers, and not from enhanced repair of these lesions. Our results indicate that alpha-tocopherol acts as an effective sunscreen in vivo, preventing the formation of premutagenic DNA lesions in a gene known to be important in skin carcinogenesis

  14. Active Stat3 is required for survival of human squamous cell carcinoma cells in serum-free conditions

    Directory of Open Access Journals (Sweden)

    DiGiovanni John

    2006-04-01

    Full Text Available Abstract Background Squamous cell carcinoma (SCC of the skin is the most aggressive form of non-melanoma skin cancer (NMSC, and is the single most commonly diagnosed cancer in the U.S., with over one million new cases reported each year. Recent studies have revealed an oncogenic role of activated signal transducer and activator of transcription 3 (Stat3 in many human tumors, especially in those of epithelial origin, including skin SCC. Stat3 is a mediator of numerous growth factor and cytokine signaling pathways, all of which activate it through phosphorylation of tyrosine 705. Results To further address the role of Stat3 in skin SCC tumorigenesis, we have analyzed a panel of human skin-derived cell lines ranging from normal human epidermal keratinocytes (NHEK, to non-tumorigenic transformed skin cells (HaCaT, to highly tumorigenic cells (SRB1-m7 and SRB12-p9 and observed a positive correlation between Stat3 phosphorylation and SCC malignancy. We next determined the role of Stat3 activity in cell proliferation and viability under serum-free culture conditions. This was accomplished by suppressing Stat3 activity in the SRB12-p9 cells through stable expression of a dominant negative acting form of Stat3β, which contains a tyrosine 705 to phenylalanine mutation (S3DN. The S3DN cells behaved similar to parental SRB12-p9 cells when cultured in optimal growth conditions, in the presence of 10% fetal calf serum. However, unlike the SRB12-p9 cells, S3DN cells underwent apoptotic cell death when cultured in serum-free medium (SFM. This was evidenced by multiple criteria, including accumulation of sub-G1 particles, induced PARP cleavage, and acquisition of the characteristic morphological changes associated with apoptosis. Conclusion This study provides direct evidence for a role for Stat3 in maintaining cell survival in the conditions of exogenous growth factor deprivation produced by culture in SFM. We also propose that delivery of the S3DN gene or

  15. Altered [125I]epidermal growth factor binding and receptor distribution in psoriasis

    International Nuclear Information System (INIS)

    Nanney, L.B.; Stoscheck, C.M.; Magid, M.; King, L.E. Jr.

    1986-01-01

    Stimulation of growth and differentiation of human epidermis by epidermal growth factor (EGF) is mediated by its binding to specific receptors. Whether EGF receptors primarily mediate cell division or differentiation in hyperproliferative disease such as psoriasis vulgaris is unclear. To study the pathogenesis of psoriasis, 4-mm2 punch biopsy specimens of normal, uninvolved, and involved psoriatic skin were assayed for EGF receptors by autoradiographic, immunohistochemical, and biochemical methods. Using autoradiographic and immunohistochemical methods, basal keratinocytes were found to contain the greatest number of EGF binding sites and immunoreactive receptors as compared to the upper layers of the epidermis in both normal epidermis and psoriatic skin. No EGF receptor differences between normal and psoriatic epidermis were observed in this layer. In the upper layers of the epidermis, a 2-fold increase in EGF binding capacity was observed in psoriatic skin as compared with normal thin or thick skin. Biochemical methods indicated that [ 125 I]EGF binding was increased in psoriatic epidermis as compared with similar thickness normal epidermis when measured on a protein basis. Epidermal growth factor was shown to increase phosphorylation of the EGF receptor in skin. EGF receptors retained in the nonmitotic stratum spinosum and parakeratotic stratum corneum may reflect the incomplete, abnormal differentiation that occurs in active psoriatic lesions. Alternatively, retained EGF receptors may play a direct role in inhibiting cellular differentiation in the suprabasal layers

  16. An ultra-sensitive biophysical risk assessment of light effect on skin cells.

    Science.gov (United States)

    Bennet, Devasier; Viswanath, Buddolla; Kim, Sanghyo; An, Jeong Ho

    2017-07-18

    The aim of this study was to analyze photo-dynamic and photo-pathology changes of different color light radiations on human adult skin cells. We used a real-time biophysical and biomechanics monitoring system for light-induced cellular changes in an in vitro model to find mechanisms of the initial and continuous degenerative process. Cells were exposed to intermittent, mild and intense (1-180 min) light with On/Off cycles, using blue, green, red and white light. Cellular ultra-structural changes, damages, and ECM impair function were evaluated by up/down-regulation of biophysical, biomechanical and biochemical properties. All cells exposed to different color light radiation showed significant changes in a time-dependent manner. Particularly, cell growth, stiffness, roughness, cytoskeletal integrity and ECM proteins of the human dermal fibroblasts-adult (HDF-a) cells showed highest alteration, followed by human epidermal keratinocytes-adult (HEK-a) cells and human epidermal melanocytes-adult (HEM-a) cells. Such changes might impede the normal cellular functions. Overall, the obtained results identify a new insight that may contribute to premature aging, and causes it to look aged in younger people. Moreover, these results advance our understanding of the different color light-induced degenerative process and help the development of new therapeutic strategies.

  17. A review of toxic epidermal necrolysis management in Japan

    Directory of Open Access Journals (Sweden)

    Yuri Kinoshita

    2017-01-01

    Full Text Available Toxic epidermal necrolysis (TEN is a severe adverse drug reaction characterized by necrosis of the epidermis. Its incidence is approximately 1 per million a year and average mortality rate is high at 25–50%. TEN has a flu-like prodrome, followed by atypical, targetoid erythematous or purpuric macules on the skin. These macules coalesce to form flaccid blisters that slough off as areas of epidermal necrosis. Drugs such as allopurinol, sulfonamides, and carbamazepine are the most common causes. The human leukocyte antigen (HLA-B*15:02 in Asians being administered carbamazepine and the HLA-B*58:01 antigen in patients of all ethnicities being administered allopurinol are known to be high-risk factors. Rapid diagnosis, discontinuation of the causative drug, and supportive treatment are essential for better prognosis and improvement of sequelae. Till now, systemic corticosteroids and intravenous immunoglobulins have been used as the most common active interventions; however, no gold standard has been established. In Japan, physicians follow a unique diagnostic criteria and treatment guideline to improve the diagnosis rate and streamline treatments. This may be a contributing factor for the lower mortality rate (14.3%. The efficacy of systemic corticosteroids, immunoglobulins, and plasmapheresis may have been beneficial as well. In Japan, TEN is defined as an epidermal detachment of over 10% of the body surface area (BSA, while the globally accepted definition established by Bastuji-Garin describes it as an epidermal detachment of over 30% of the BSA. In Japanese individuals, HLA-A*02:06, HLA-A*02:07, HLA-A*31:01 and HLA-B*51:01 may be linked to higher risks of TEN.

  18. Differential gene expression in human granulosa cells from recombinant FSH versus human menopausal gonadotropin ovarian stimulation protocols

    Directory of Open Access Journals (Sweden)

    Bietz Mandi G

    2010-03-01

    Full Text Available Abstract Background The study was designed to test the hypothesis that granulosa cell (GC gene expression response differs between recombinant FSH and human menopausal gonadotropin (hMG stimulation regimens. Methods Females Results After exclusions, 1736 genes exhibited differential expression between groups. Over 400 were categorized as signal transduction genes, ~180 as transcriptional regulators, and ~175 as enzymes/metabolic genes. Expression of selected genes was confirmed by RT-PCR. Differentially expressed genes included A kinase anchor protein 11 (AKAP11, bone morphogenetic protein receptor II (BMPR2, epidermal growth factor (EGF, insulin-like growth factor binding protein (IGFBP-4, IGFBP-5, and hypoxia-inducible factor (HIF-1 alpha. Conclusions Results suggest that major differences exist in the mechanism by which pure FSH alone versus FSH/LH regulate gene expression in preovulatory GC that could impact oocyte maturity and developmental competence.

  19. Resveratrol and Estradiol Exert Disparate Effects on Cell Migration, Cell Surface Actin Structures, and Focal Adhesion Assembly in MDA-MB-231 Human Breast Cancer Cells

    Directory of Open Access Journals (Sweden)

    Nicolas G. Azios

    2005-02-01

    Full Text Available Resveratrol, a grape polyphenol, is thought to be a cancer preventive, yet its effects on metastatic breast cancer are relatively unknown. Since cancer cell invasion is dependent on cell migration, the chemotactic response of MDA-MB-231 metastatic human breast cancer cells to resveratrol, estradiol (E2, or epidermal growth factor (EGF was investigated. Resveratrol decreased while E2 and EGF increased directed cell migration. Resveratrol may inhibit cell migration by altering the cytoskeleton. Resveratrol induced a rapid global array of filopodia and decreased focal adhesions and focal adhesion kinase (FAK activity. E2 or EGF treatment did not affect filopodia extension but increased lamellipodia and associated focal adhesions that are integral for cell migration. Combined resveratrol and E2 treatment resulted in a filopodia and focal adhesion response similar to resveratrol alone. Combined resveratrol and EGF resulted in a lamellipodia and focal adhesion response similar to EGF alone. E2 and to a lesser extent resveratrol increased EGFR activity. The cytoskeletal changes and EGFR activity in response to E2 were blocked by EGFR1 inhibitor indicating that E2 may increase cell migration via crosstalk with EGFR signaling. These data suggest a promotional role for E2 in breast cancer cell migration but an antiestrogenic, preventative role for resveratrol.

  20. Herbal medicines that benefit epidermal permeability barrier function

    Directory of Open Access Journals (Sweden)

    Lizhi Hu

    2015-06-01

    Full Text Available Epidermal permeability barrier function plays a critical role in regulating cutaneous functions. Hence, researchers have been searching for effective and affordable regimens to enhance epidermal permeability barrier function. In addition to topical stratum corneum lipids, peroxisome proliferator-activated receptor, and liver X receptor ligands, herbal medicines have been proven to benefit epidermal permeability barrier function in both normal and diseased skin, including atopic dermatitis, glucocorticoid-induced skin damage, and UVB-damaged skin. The potential mechanisms by which herbal medicines improve the permeability barrier include stimulation of epidermal differentiation, lipid production, antimicrobial peptide expression, and antioxidation. Therefore, utilization of herbal medicines could be a valuable alternative approach to enhance epidermal permeability barrier function in order to prevent and/or treat skin disorders associated with permeability barrier abnormalities.

  1. Andrographolide regulates epidermal growth factor receptor and transferrin receptor trafficking in epidermoid carcinoma (A-431) cells

    Science.gov (United States)

    Tan, Y; Chiow, KH; Huang, D; Wong, SH

    2010-01-01

    Background and purpose: Andrographolide is the active component of Andrographis paniculata, a plant used in both Indian and Chinese traditional medicine, and it has been demonstrated to induce apoptosis in different cancer cell lines. However, not much is known about how it may affect the key receptors implicated in cancer. Knowledge of how andrographolide affects receptor trafficking will allow us to better understand new mechanisms by which andrographolide may cause death in cancer cells. Experimental approach: We utilized the well-characterized epidermal growth factor receptor (EGFR) and transferrin receptor (TfR) expressed in epidermoid carcinoma (A-431) cells as a model to study the effect of andrographolide on receptor trafficking. Receptor distribution, the total number of receptors and surface receptors were analysed by immunofluorescence, Western blot as well as flow-cytometry respectively. Key results: Andrographolide treatment inhibited cell growth, down-regulated EGFRs on the cell surface and affected the degradation of EGFRs and TfRs. The EGFR was internalized into the cell at an increased rate, and accumulated in a compartment that co-localizes with the lysosomal-associated membrane protein in the late endosomes. Conclusion and implications: This study sheds light on how andrographolide may affect receptor trafficking by inhibiting receptor movement from the late endosomes to lysosomes. The down-regulation of EGFR from the cell surface also indicates a new mechanism by which andrographolide may induce cancer cell death. PMID:20233216

  2. Model-Based Analysis of Arabidopsis Leaf Epidermal Cells Reveals Distinct Division and Expansion Patterns for Pavement and Guard Cells1[W][OA

    Science.gov (United States)

    Asl, Leila Kheibarshekan; Dhondt, Stijn; Boudolf, Véronique; Beemster, Gerrit T.S.; Beeckman, Tom; Inzé, Dirk; Govaerts, Willy; De Veylder, Lieven

    2011-01-01

    To efficiently capture sunlight for photosynthesis, leaves typically develop into a flat and thin structure. This development is driven by cell division and expansion, but the individual contribution of these processes is currently unknown, mainly because of the experimental difficulties to disentangle them in a developing organ, due to their tight interconnection. To circumvent this problem, we built a mathematic model that describes the possible division patterns and expansion rates for individual epidermal cells. This model was used to fit experimental data on cell numbers and sizes obtained over time intervals of 1 d throughout the development of the first leaf pair of Arabidopsis (Arabidopsis thaliana). The parameters were obtained by a derivative-free optimization method that minimizes the differences between the predicted and experimentally observed cell size distributions. The model allowed us to calculate probabilities for a cell to divide into guard or pavement cells, the maximum size at which it can divide, and its average cell division and expansion rates at each point during the leaf developmental process. Surprisingly, average cell cycle duration remained constant throughout leaf development, whereas no evidence for a maximum cell size threshold for cell division of pavement cells was found. Furthermore, the model predicted that neighboring cells of different sizes within the epidermis expand at distinctly different relative rates, which could be verified by direct observations. We conclude that cell division seems to occur independently from the status of cell expansion, whereas the cell cycle might act as a timer rather than as a size-regulated machinery. PMID:21693673

  3. Effects of a new bifunctional psoralen, 4,4',5'-trimethylazapsoralen and ultraviolet-A radiation on murine dendritic epidermal cells.

    Science.gov (United States)

    Aubin, F; Alcalay, J; Dall'Acqua, F; Kripke, M L

    1990-06-01

    Although some psoralens are therapeutically active in the treatment of cutaneous hyperproliferative diseases when combined with UVA (320-400 nm) radiation, the toxic effects of these compounds have led physicians to seek new photochemotherapeutic agents. One such agent is 4,4',5'-trimethylazapsoralen (TMAP), a new bifunctional psoralen compound. We investigated the effects of repetitive treatments with TMAP plus UVA radiation on the number of dendritic immune cells in murine epidermis and on the induction of phototoxicity. Mice treated 3 times per week for 4 weeks with 129 microgram TMAP plus 10 kJ/m2 UVA radiation exhibited no gross or microscopic evidence of phototoxicity. During this treatment, the numbers of ATPase+, Ia+, and Thy-l+ dendritic epidermal cells were greatly reduced, and by the end of the treatment period, few dendritic immune cells could be detected. We conclude that morphological alterations of cutaneous immune cells can occur in the absence of overt phototoxicity, and that TMAP plus low-dose UVA radiation decreases the numbers of detectable Langerhans cells and Thy-1+ cells in murine skin.

  4. Pharmacokinetics, biodistribution and dosimetry of 99mTc-labeled anti-human epidermal growth factor receptor humanized monoclonal antibody R3 in rats

    International Nuclear Information System (INIS)

    Escobar, Normando Iznaga; Morales, Alejo Morales; Duconge, Jorge; Torres, Idania Caballero; Fernandez, Eduardo; Gomez, Jose A.

    1998-01-01

    The pharmacokinetics, biodistribution and dosimetry of 99m Tc-labeled anti-human epidermal growth factor receptor (anti-hEGF-r) humanized monoclonal antibody (MAb) R3 was investigated following intravenous injection in normal Wistar rats. Serum disappearance curves were best fit by a two-compartment model having a mean distribution half-life (t (1(2α)) ) of 0.250 h and a mean elimination (t (1(2β)) ) of 13.89 h. Among the various organs, a little accumulation of the radiolabeled antibody was found only in kidneys. Biodistribution and dosimetry studies in humans were performed by extrapolation of the animal data to humans. Absorbed dose to normal organs and the remainder of the whole body were estimated using the medical internal radiation dose formula, and dose contributions from radioactivity in transit through the gastrointestinal tract were estimated using a compartment model. Extrapolated values of radiation absorbed dose to normal organs in rads per millicurie administered were whole body, 0.0085; lower large intestine wall, 0.0898; small intestine, 0.0530; upper large intestine wall, 0.0731; and kidneys, 0.0455. The effective dose equivalent predicted was 0.0162 rem/mCi and the effective dose was found to be 0.015 rem/mCi. On the basis of the pharmacokinetics, biodistribution and internal radiation dosimetry information obtained in this study, a diagnostic phase I clinical trial with 99m Tc-labeled humanized MAb R3 conjugate in patients should be supported

  5. Epidermal growth factor prevents thallium(I)- and thallium(III)-mediated rat pheochromocytoma (PC12) cell apoptosis.

    Science.gov (United States)

    Pino, María Teresa Luján; Marotte, Clarisa; Verstraeten, Sandra Viviana

    2017-03-01

    We have reported recently that the proliferation of PC12 cells exposed to micromolar concentrations of Tl(I) or Tl(III) has different outcomes, depending on the absence (EGF - cells) or the presence (EGF + cells) of epidermal growth factor (EGF) added to the media. In the current work, we investigated whether EGF supplementation could also modulate the extent of Tl(I)- or Tl(III)-induced cell apoptosis. Tl(I) and Tl(III) (25-100 μM) decreased cell viability in EGF - but not in EGF + cells. In EGF - cells, Tl(I) decreased mitochondrial potential, enhanced H 2 O 2 generation, and activated mitochondrial-dependent apoptosis. In addition, Tl(III) increased nitric oxide production and caused a misbalance between the anti- and pro-apoptotic members of Bcl-2 family. Tl(I) increased ERK1/2, JNK, p38, and p53 phosphorylation in EGF - cells. In these cells, Tl(III) did not affect ERK1/2 and JNK phosphorylation but increased p53 phosphorylation that was related to the promotion of cell senescence. In addition, this cation significantly activated p38 in both EGF - and EGF + cells. The specific inhibition of ERK1/2, JNK, p38, or p53 abolished Tl(I)-mediated EGF - cell apoptosis. Only when p38 activity was inhibited, Tl(III)-mediated apoptosis was prevented in EGF - and EGF + cells. Together, current results indicate that EGF partially prevents the noxious effects of Tl by preventing the sustained activation of MAPKs signaling cascade that lead cells to apoptosis and point to p38 as a key mediator of Tl(III)-induced PC12 cell apoptosis.

  6. Direct astatination of a tumour-binding protein, human epidermal growth factor, using nido-carborane as a prosthetic group

    International Nuclear Information System (INIS)

    Sjoestroem, A.; Carlsson, J.; Lundqvist, H.; Koziorowski, J.

    2003-01-01

    A method for direct astatine labeling of proteins has been investigated. Binding sites for astatine were created by coupling of a nido-carborane derivative to a protein, the human epidermal growth factor (hEGF), using two different conjugation methods - by glutaraldehyde cross-linking or by introduction of sulfohydryl groups by Traut's reagent with subsequent linking of ANC-1 with m-maleimidobenzoyl-N-hydroxysulfosuccinimide ester. The conjugates were astatinated using the Chloramine-T method in high yield. The best labeling was obtained by the glutaraldehyde conjugate with an average yield of 68 ± 9%. In vitro stability tests indicated that the glutaraldehyde conjugated label was as stable as hEGF labeled with astatobenzoate. (author)

  7. Morphology and dynamics of tumor cell colonies propagating in epidermal growth factor supplemented media

    Science.gov (United States)

    Muzzio, N. E.; Carballido, M.; Pasquale, M. A.; González, P. H.; Azzaroni, O.; Arvia, A. J.

    2018-07-01

    The epidermal growth factor (EGF) plays a key role in physiological and pathological processes. This work reports on the influence of EGF concentration (c EGF) on the modulation of individual cell phenotype and cell colony kinetics with the aim of perturbing the colony front roughness fluctuations. For this purpose, HeLa cell colonies that remain confluent along the whole expansion process with initial quasi-radial geometry and different initial cell populations, as well as colonies with initial quasi-linear geometry and large cell population, are employed. Cell size and morphology as well as its adhesive characteristics depend on c EGF. Quasi-radial colonies (QRC) expansion kinetics in EGF-containing medium exhibits a complex behavior. Namely, at the first stages of growth, the average QRC radius evolution can be described by a t 1/2 diffusion term coupled with exponential growth kinetics up to a critical time, and afterwards a growth regime approaching constant velocity. The extension of each regime depends on c EGF and colony history. In the presence of EGF, the initial expansion of quasi-linear colonies (QLCs) also exhibits morphological changes at both the cell and the colony levels. In these cases, the cell density at the colony border region becomes smaller than in the absence of EGF and consequently, the extension of the effective rim where cell duplication and motility contribute to the colony expansion increases. QLC front displacement velocity increases with c EGF up to a maximum value in the 2–10 ng ml‑1 range. Individual cell velocity is increased by EGF, and an enhancement in both the persistence and the ballistic characteristics of cell trajectories can be distinguished. For an intermediate c EGF, collective cell displacements contribute to the roughening of the colony contours. This global dynamics becomes compatible with the standard Kardar–Parisi–Zhang growth model, although a faster colony roughness saturation in EGF-containing medium

  8. Human keratinocytes are a source for tumor necrosis factor alpha: Evidence for synthesis and release upon stimulation with endotoxin or ultraviolet light

    International Nuclear Information System (INIS)

    Koeck, A.S.; Schwarz, T.; Kirnbauer, R.; Urbanski, A.; Perry, P.; Ansel, J.C.; Luger, T.A.

    1990-01-01

    Tumor necrosis factor alpha (TNF-alpha), in addition to being cytotoxic for certain tumor cells, has turned out as a multifunctional cytokine that is involved in the regulation of immunity and inflammation. Since human keratinocytes have been demonstrated to be a potent source of various cytokines, it was investigated whether epidermal cells synthesize and release TNF-alpha. Supernatants derived from normal human keratinocytes (HNK) and human epidermoid carcinoma cell lines (KB, A431) were tested both in a TNF-alpha-specific ELISA and a bioassay. In supernatants of untreated epidermal cells, no or minimal TNF-alpha activity was found, while after stimulation with lipopolysaccharide (LPS) or ultraviolet (UV) light, significant amounts were detected. Western blot analysis using an antibody directed against human TNF-alpha revealed a molecular mass of 17 kD for keratinocyte-derived TNF-alpha. These biological and biochemical data were also confirmed by Northern blot analysis revealing mRNA specific for TNF-alpha in LPS- or ultraviolet B (UVB)-treated HNK and KB cells. In addition, increased TNF-alpha levels were detected in the serum obtained from human volunteers 12 and 24 h after a single total body UVB exposure, which caused a severe sunburn reaction. These findings indicate that keratinocytes upon stimulation are able to synthesize and release TNF-alpha, which may gain access to the circulation. Thus, TNF-alpha in concert with other epidermal cell-derived cytokines may mediate local and systemic inflammatory reactions during host defense against injurious events caused by microbial agents or UV irradiation

  9. Role of protein kinase C and epidermal growth factor receptor signalling in growth stimulation by neurotensin in colon carcinoma cells

    Directory of Open Access Journals (Sweden)

    Dajani Olav

    2011-10-01

    Full Text Available Abstract Background Neurotensin has been found to promote colon carcinogenesis in rats and mice, and proliferation of human colon carcinoma cell lines, but the mechanisms involved are not clear. We have examined signalling pathways activated by neurotensin in colorectal and pancreatic carcinoma cells. Methods Colon carcinoma cell lines HCT116 and HT29 and pancreatic adenocarcinoma cell line Panc-1 were cultured and stimulated with neurotensin or epidermal growth factor (EGF. DNA synthesis was determined by incorporation of radiolabelled thymidine into DNA. Levels and phosphorylation of proteins in signalling pathways were assessed by Western blotting. Results Neurotensin stimulated the phosphorylation of both extracellular signal-regulated kinase (ERK and Akt in all three cell lines, but apparently did so through different pathways. In Panc-1 cells, neurotensin-induced phosphorylation of ERK, but not Akt, was dependent on protein kinase C (PKC, whereas an inhibitor of the β-isoform of phosphoinositide 3-kinase (PI3K, TGX221, abolished neurotensin-induced Akt phosphorylation in these cells, and there was no evidence of EGF receptor (EGFR transactivation. In HT29 cells, in contrast, the EGFR tyrosine kinase inhibitor gefitinib blocked neurotensin-stimulated phosphorylation of both ERK and Akt, indicating transactivation of EGFR, independently of PKC. In HCT116 cells, neurotensin induced both a PKC-dependent phosphorylation of ERK and a metalloproteinase-mediated transactivation of EGFR that was associated with a gefitinib-sensitive phosphorylation of the downstream adaptor protein Shc. The activation of Akt was also inhibited by gefitinib, but only partly, suggesting a mechanism in addition to EGFR transactivation. Inhibition of PKC blocked neurotensin-induced DNA synthesis in HCT116 cells. Conclusions While acting predominantly through PKC in Panc-1 cells and via EGFR transactivation in HT29 cells, neurotensin used both these pathways in HCT116

  10. Role of protein kinase C and epidermal growth factor receptor signalling in growth stimulation by neurotensin in colon carcinoma cells

    International Nuclear Information System (INIS)

    Müller, Kristin M; Tveteraas, Ingun H; Aasrum, Monica; Ødegård, John; Dawood, Mona; Dajani, Olav; Christoffersen, Thoralf; Sandnes, Dagny L

    2011-01-01

    Neurotensin has been found to promote colon carcinogenesis in rats and mice, and proliferation of human colon carcinoma cell lines, but the mechanisms involved are not clear. We have examined signalling pathways activated by neurotensin in colorectal and pancreatic carcinoma cells. Colon carcinoma cell lines HCT116 and HT29 and pancreatic adenocarcinoma cell line Panc-1 were cultured and stimulated with neurotensin or epidermal growth factor (EGF). DNA synthesis was determined by incorporation of radiolabelled thymidine into DNA. Levels and phosphorylation of proteins in signalling pathways were assessed by Western blotting. Neurotensin stimulated the phosphorylation of both extracellular signal-regulated kinase (ERK) and Akt in all three cell lines, but apparently did so through different pathways. In Panc-1 cells, neurotensin-induced phosphorylation of ERK, but not Akt, was dependent on protein kinase C (PKC), whereas an inhibitor of the β-isoform of phosphoinositide 3-kinase (PI3K), TGX221, abolished neurotensin-induced Akt phosphorylation in these cells, and there was no evidence of EGF receptor (EGFR) transactivation. In HT29 cells, in contrast, the EGFR tyrosine kinase inhibitor gefitinib blocked neurotensin-stimulated phosphorylation of both ERK and Akt, indicating transactivation of EGFR, independently of PKC. In HCT116 cells, neurotensin induced both a PKC-dependent phosphorylation of ERK and a metalloproteinase-mediated transactivation of EGFR that was associated with a gefitinib-sensitive phosphorylation of the downstream adaptor protein Shc. The activation of Akt was also inhibited by gefitinib, but only partly, suggesting a mechanism in addition to EGFR transactivation. Inhibition of PKC blocked neurotensin-induced DNA synthesis in HCT116 cells. While acting predominantly through PKC in Panc-1 cells and via EGFR transactivation in HT29 cells, neurotensin used both these pathways in HCT116 cells. In these cells, neurotensin-induced activation of ERK

  11. Inhibitors of the epidermal growth factor receptor in apple juice extract.

    Science.gov (United States)

    Kern, Melanie; Tjaden, Zeina; Ngiewih, Yufanyi; Puppel, Nicole; Will, Frank; Dietrich, Helmut; Pahlke, Gudrun; Marko, Doris

    2005-04-01

    The polyphenol-rich extract of a consumer-relevant apple juice blend was found to potently inhibit the growth of the human colon cancer cell line HT29 in vitro. The epidermal growth factor receptor (EGFR) and its subsequent signaling cascade play an important role in the regulation of cell proliferation in HT29 cells. The protein tyrosine kinase activity of an EGFR preparation was effectively inhibited by the polyphenol-rich apple juice extract. Treatment of intact cells with this extract resulted in the suppression of the subsequent mitogen-activated protein kinase cascade. Amongst the so far identified apple juice constituents, the proanthocyanidins B1 and B2 as well as quercetin-3-glc (isoquercitrin) and quercetin-3-gal (hyperoside) were found to possess substantial EGFR-inhibitory properties. However, as to be expected from the final concentration of these potential EGFR inhibitors in the original polyphenol-rich extract, a synthetic mixture of the apple juice constituents identified and available so far, including both proanthocyanidins and the quercetin glycosides, showed only marginal inhibitory effects on the EGFR. These results permit the assumption that yet unknown constituents contribute substantially to the potent EGFR-inhibitory properties of polyphenol-rich apple juice extract. In summary, the polyphenol composition of apple juice possesses promising growth-inhibitory properties, affecting proliferation-associated signaling cascades in colon tumor cells.

  12. EGF–FGF{sub 2} stimulates the proliferation and improves the neuronal commitment of mouse epidermal neural crest stem cells (EPI-NCSCs)

    Energy Technology Data Exchange (ETDEWEB)

    Bressan, Raul Bardini; Melo, Fernanda Rosene; Almeida, Patricia Alves; Bittencourt, Denise Avani; Visoni, Silvia; Jeremias, Talita Silva [Departamento de Biologia Celular, Embriologia e Genética, Centro de Ciências Biológicas, Universidade Federal de Santa Catarina, Campus Universitário – Trindade, 88040-900 Florianópolis SC (Brazil); Costa, Ana Paula; Leal, Rodrigo Bainy [Departamento de Bioquímica, Centro de Ciências Biológicas, Universidade Federal de Santa Catarina, Campus Universitário – Trindade, 88040-900 Florianópolis SC (Brazil); Trentin, Andrea Gonçalves, E-mail: andrea.trentin@ufsc.br [Departamento de Biologia Celular, Embriologia e Genética, Centro de Ciências Biológicas, Universidade Federal de Santa Catarina, Campus Universitário – Trindade, 88040-900 Florianópolis SC (Brazil)

    2014-09-10

    Epidermal neural crest stem cells (EPI-NCSCs), which reside in the bulge of hair follicles, are attractive candidates for several applications in cell therapy, drug screening and tissue engineering. As suggested remnants of the embryonic neural crest (NC) in an adult location, EPI-NCSCs are able to generate a wide variety of cell types and are readily accessible by a minimally invasive procedure. Since the combination of epidermal growth factor (EGF) and fibroblast growth factor type 2 (FGF{sub 2}) is mitogenic and promotes the neuronal commitment of various stem cell populations, we examined its effects in the proliferation and neuronal potential of mouse EPI-NCSCs. By using a recognized culture protocol of bulge whiskers follicles, we were able to isolate a population of EPI-NCSCs, characterized by the migratory potential, cell morphology and expression of phenotypic markers of NC cells. EPI-NCSCs expressed neuronal, glial and smooth muscle markers and exhibited the NC-like fibroblastic morphology. The treatment with the combination EGF and FGF{sub 2}, however, increased their proliferation rate and promoted the acquisition of a neuronal-like morphology accompanied by reorganization of neural cytoskeletal proteins βIII-tubulin and nestin, as well as upregulation of the pan neuronal marker βIII-tubulin and down regulation of the undifferentiated NC, glial and smooth muscle cell markers. Moreover, the treatment enhanced the response of EPI-NCSCs to neurogenic stimulation, as evidenced by induction of GAP43, and increased expression of Mash-1 in neuron-like cell, both neuronal-specific proteins. Together, the results suggest that the combination of EGF–FGF2 stimulates the proliferation and improves the neuronal potential of EPI-NCSCs similarly to embryonic NC cells, ES cells and neural progenitor/stem cells of the central nervous system and highlights the advantage of using EGF–FGF{sub 2} in neuronal differentiation protocols. - Highlights: • EPI

  13. FRMD4A upregulation in human squamous cell carcinoma promotes tumor growth and metastasis and is associated with poor prognosis.

    Science.gov (United States)

    Goldie, Stephen J; Mulder, Klaas W; Tan, David Wei-Min; Lyons, Scott K; Sims, Andrew H; Watt, Fiona M

    2012-07-01

    New therapeutic strategies are needed to improve treatment of head and neck squamous cell carcinoma (HNSCC), an aggressive tumor with poor survival rates. FRMD4A is a human epidermal stem cell marker implicated previously in epithelial polarity that is upregulated in SCC cells. Here, we report that FRMD4A upregulation occurs in primary human HNSCCs where high expression levels correlate with increased risks of relapse. FRMD4A silencing decreased growth and metastasis of human SCC xenografts in skin and tongue, reduced SCC proliferation and intercellular adhesion, and stimulated caspase-3 activity and expression of terminal differentiation markers. Notably, FRMD4A attenuation caused nuclear accumulation of YAP, suggesting a potential role for FRMD4A in Hippo signaling. Treatment with the HSP90 inhibitor 17-DMAG or ligation of CD44 with hyaluronan caused nuclear depletion of FRMD4A, nuclear accumulation of YAP and reduced SCC growth and metastasis. Together, our findings suggest FRMD4A as a novel candidate therapeutic target in HNSCC based on the key role in metastatic growth we have identified. ©2012 AACR.

  14. The tryptophan-derived endogenous arylhydrocarbon receptor ligand 6-formylindolo[3,2-b]carbazole (FICZ) is a nanomolar UVA-photosensitizer in epidermal keratinocytes

    Science.gov (United States)

    Williams, Joshua D.; Cabello, Christopher M.; Qiao, Shuxi; Wondrak, Georg T.

    2014-01-01

    Endogenous UVA-chromophores may act as sensitizers of oxidative stress underlying cutaneous photoaging and photocarcinogenesis, but the molecular identity of non-DNA key chromophores displaying UVA-driven photodyamic activity in human skin remains largely undefined. Here we report that 6-formylindolo[3,2-b]carbazole (FICZ), a tryptophan photoproduct and endogenous high affinity aryl hydrocarbon receptor (AhR) agonist, acts as a nanomolar photosensitizer potentiating UVA-induced oxidative stress irrespective of AhR ligand activity. In human HaCaT and primary epidermal keratinocytes, photodynamic induction of apoptosis was elicited by the combined action of solar simulated UVA and FICZ, whereas exposure to the isolated action of UVA or FICZ did not impair viability. In a human epidermal tissue reconstruct, FICZ/UVA-cotreatment caused pronounced phototoxicity inducing keratinocyte cell death, and FICZ photodynamic activity was also substantiated in a murine skin exposure model. Array analysis revealed pronounced potentiation of cellular heat shock, ER stress, and oxidative stress response gene expression observed only upon FICZ/UVA-cotreatment. FICZ photosensitization caused intracellular oxidative stress, and comet analysis revealed introduction of formamidopyrimidine-DNA glycosylase (FPG)-sensitive oxidative DNA lesions suppressible by antioxidant cotreatment. Taken together, our data demonstrate that the endogenous AhR ligand FICZ displays nanomolar photodynamic activity representing a molecular mechanism of UVA-induced photooxidative stress potentially operative in human skin. PMID:25431849

  15. Synergistic Induction of Cyclooxygenase-2 by Transforming Growth Factor-β1 and Epidermal Growth Factor Inhibits Apoptosis in Epithelial Cells

    Directory of Open Access Journals (Sweden)

    Debabrata Saha

    1999-12-01

    Full Text Available Increased expression of cyclooxygenase-2 (COX-2 expression has been observed in several human tumor types and in selected animal and cell culture models of carcinogenesis, including lung cancer. Increased expression of COX-2 and production of prostaglandins appear to provide a survival advantage to transformed cells through the inhibition of apoptosis, increased attachment to extracellular matrix, increased invasiveness, the stimulation of angiogenesis. In the present studies, we found that transforming growth factor β1 (TGF-β1 and epidermal growth factor (EGF synergistically induced the expression of COX-2 and prostaglandin E2 (PGE2 production in mink lung epithelial (Mvi Lu cells. EGF, but not PDGF or IGF-1, was able to inhibit TGF-β1-induced apoptosis in Mvi Lu cells and this effect was blocked by NS-398, a selective inhibitor of COX-2 activity, suggesting a possible role for COX-2 in the anti-apoptosic effect of EGF receptor ligands. The combination of TGF-β1 and EGF also significantly induced COX-2 expression in rat intestinal epithelial (RIE-1 cells and completely prevented sodium butyrate (NaBu-induced apoptosis. The synergistic induction of COX-2 by TGF-β1 and EGF was not observed in R1B-L17 cells, a line derived from Mvi Lu cells that lacks the TGF-β type-I receptor. AG1478, a selective inhibitor of EGF receptor tyrosine kinase activity, completely suppressed the induction of COX-2 expression by either EGF or TGF-β1+EGF. Also, PD98059, a specific inhibitor of MEK/ERK pathway, SB203580, a specific inhibitor of p38 MAPK activity, significantly inhibited the induction of COX-2 in response to combined EGF and TGF-β1. These results suggest an important collaborative interaction of TGF-β1 and EGF signaling in the induction of COX-2 and prostaglandin production in Mv1Lu cells.

  16. Essential contribution of tumor-derived perlecan to epidermal tumor growth and angiogenesis

    DEFF Research Database (Denmark)

    Jiang, Xinnong; Multhaupt, Hinke; Chan, En

    2004-01-01

    As a major heparan sulfate proteoglycan (PG) in basement membranes, perlecan has been linked to tumor invasion, metastasis, and angiogenesis. Here we produced epidermal tumors in immunocompromised rats by injection of mouse RT101 tumor cells. Tumor sections stained with species-specific perlecan...... factor. In vivo, antisense perlecan-transfected cells generated no tumors, whereas untransfected and vector-transfected cells formed tumors with obvious neovascularization, suggesting that tumor perlecan rather than host perlecan controls tumor growth and angiogenesis....

  17. The peanut lectin-binding glycoproteins of human epidermal keratinocytes

    International Nuclear Information System (INIS)

    Morrison, A.I.; Keeble, S.; Watt, F.M.

    1988-01-01

    The peanut lectin (PNA) is known to bind more strongly to keratinocytes that are undergoing terminal differentiation than to proliferating keratinocytes. In order to investigate the significance of this change in cell-surface carbohydrate authors have identified the PNA-binding glycoproteins of cultured human keratinocytes and antibodies against them. Two heavily glycosylated bands of 110 and 250 kDa were resolved by PAGE of [ 14 C]galactose- or [ 14 C]mannose- and [ 14 C]glucosamine-labeled cell extracts eluted with galactose from PNA affinity columns. The higher molecular weight band was also detected on PNA blots of unlabeled cell extracts transferred to nitrocellulose. Both bands were sensitive to pronase digestion, but only the 250-kDa band was digested with trypsin. A rabbit antiserum that we prepared (anti-PNA-gp) immunoprecipitated both bands from cell extracts. In contrast to PNA, anti-PNA-gp bound equally to proliferating and terminally differentiating cells, indicating that some epitope(s) of the PNA-binding glycoproteins is present on the cell surface prior to terminal differentiation. When keratinocytes grown as a monolayer in low-calcium medium were switched to medium containing 2 mM calcium ions in order to induce desmosome formation and stratification, there was a dramatic redistribution of the PNA-binding glycoproteins, which became concentrated at the boundaries between cells. This may suggest a role for the glycoproteins in cell-cell interactions during stratification

  18. Efficient Generation of NKX6-1+ Pancreatic Progenitors from Multiple Human Pluripotent Stem Cell Lines

    Directory of Open Access Journals (Sweden)

    M. Cristina Nostro

    2015-04-01

    Full Text Available Human pluripotent stem cells (hPSCs represent a renewable source of pancreatic beta cells for both basic research and therapeutic applications. Given this outstanding potential, significant efforts have been made to identify the signaling pathways that regulate pancreatic development in hPSC differentiation cultures. In this study, we demonstrate that the combination of epidermal growth factor (EGF and nicotinamide signaling induces the generation of NKX6-1+ progenitors from all hPSC lines tested. Furthermore, we show that the size of the NKX6-1+ population is regulated by the duration of treatment with retinoic acid, fibroblast growth factor 10 (FGF10, and inhibitors of bone morphogenetic protein (BMP and hedgehog signaling pathways. When transplanted into NOD scid gamma (NSG recipients, these progenitors differentiate to give rise to exocrine and endocrine cells, including monohormonal insulin+ cells. Together, these findings provide an efficient and reproducible strategy for generating highly enriched populations of hPSC-derived beta cell progenitors for studies aimed at further characterizing their developmental potential in vivo and deciphering the pathways that regulate their maturation in vitro.

  19. Immunoautoradiographic analysis of epidermal growth factor receptors: a sensitive method for the in situ identification of receptor proteins and for studying receptor specificity

    International Nuclear Information System (INIS)

    Fernandez-Pol, J.A.

    1982-01-01

    The use of an immunoautoradiographic system for the detection and analysis of epidermal growth factor (EGF) receptors in human epidermoid carcinoma A-431 cells is reported. By utilizing this technique, the interaction between EGF and its membrane receptor in A-431 cells can be rapidly visualized. The procedure is simple, rapid, and very sensitive, and it provides conclusive evidence that the 150K dalton protein is the receptor fo EGF in A-431 cells. In summary, the immunoautoradiographic procedure brings to the analysis of hormone rceptor proteins the power that the radioimmunoassay technique has brought to the analysis of hormones. Thus, this assay system is potentially applicable in a wide spectrum in many fields of nuclear medicine and biology

  20. BDNF/TrkB signaling protects HT-29 human colon cancer cells from EGFR inhibition

    Energy Technology Data Exchange (ETDEWEB)

    Brunetto de Farias, Caroline [Cancer Research Laboratory, University Hospital Research Center (CPE-HCPA), Federal University of Rio Grande do Sul, 90035-003 Porto Alegre, RS (Brazil); Children' s Cancer Institute, 90420-140 Porto Alegre, RS (Brazil); Laboratory of Neuropharmacology and Neural Tumor Biology, Department of Pharmacology, Institute for Basic Health Sciences, Federal University of Rio Grande do Sul, 90050-170 Porto Alegre, RS (Brazil); National Institute for Translational Medicine (INCT-TM), 90035-003 Porto Alegre, RS (Brazil); Heinen, Tiago Elias; Pereira dos Santos, Rafael [Cancer Research Laboratory, University Hospital Research Center (CPE-HCPA), Federal University of Rio Grande do Sul, 90035-003 Porto Alegre, RS (Brazil); Laboratory of Neuropharmacology and Neural Tumor Biology, Department of Pharmacology, Institute for Basic Health Sciences, Federal University of Rio Grande do Sul, 90050-170 Porto Alegre, RS (Brazil); National Institute for Translational Medicine (INCT-TM), 90035-003 Porto Alegre, RS (Brazil); Abujamra, Ana Lucia [Cancer Research Laboratory, University Hospital Research Center (CPE-HCPA), Federal University of Rio Grande do Sul, 90035-003 Porto Alegre, RS (Brazil); Children' s Cancer Institute, 90420-140 Porto Alegre, RS (Brazil); National Institute for Translational Medicine (INCT-TM), 90035-003 Porto Alegre, RS (Brazil); Schwartsmann, Gilberto [Cancer Research Laboratory, University Hospital Research Center (CPE-HCPA), Federal University of Rio Grande do Sul, 90035-003 Porto Alegre, RS (Brazil); National Institute for Translational Medicine (INCT-TM), 90035-003 Porto Alegre, RS (Brazil); Department of Internal Medicine, School of Medicine, Federal University of Rio Grande do Sul, 90035-003 Porto Alegre, RS (Brazil); and others

    2012-08-24

    Highlights: Black-Right-Pointing-Pointer BDNF protected HT-29 colorectal cancer cells from the antitumor effect of cetuximab. Black-Right-Pointing-Pointer TrkB inhibition potentiated the antitumor effect of cetuximab. Black-Right-Pointing-Pointer BDNF/TrkB signaling might be involved in resistance to anti-EGFR therapy. -- Abstract: The clinical success of targeted treatment of colorectal cancer (CRC) is often limited by resistance to anti-epidermal growth factor receptor (EGFR) therapy. The neurotrophin brain-derived neurotrophic factor (BDNF) and its receptor TrkB have recently emerged as anticancer targets, and we have previously shown increased BDNF levels in CRC tumor samples. Here we report the findings from in vitro experiments suggesting that BDNF/TrkB signaling can protect CRC cells from the antitumor effects of EGFR blockade. The anti-EGFR monoclonal antibody cetuximab reduced both cell proliferation and the mRNA expression of BDNF and TrkB in human HT-29 CRC cells. The inhibitory effect of cetuximab on cell proliferation and survival was counteracted by the addition of human recombinant BDNF. Finally, the Trk inhibitor K252a synergistically enhanced the effect of cetuximab on cell proliferation, and this effect was blocked by BDNF. These results provide the first evidence that increased BDNF/TrkB signaling might play a role in resistance to EGFR blockade. Moreover, it is possible that targeting TrkB could potentiate the anticancer effects of anti-EGFR therapy.

  1. Release of infectious cells from epidermal ulcers in Ichthyophonus sp.-infected Pacific herring (Clupea pallasii): evidence for multiple mechanisms of transmission.

    Science.gov (United States)

    Kocan, Richard M; Gregg, Jacob L; Hershberger, Paul K

    2010-04-01

    A common clinical sign of ichthyophoniasis in herring and trout is "sandpaper" skin, a roughening of the epidermis characterized by the appearance of small papules, followed by ulceration and sloughing of the epithelium; early investigators hypothesized that these ulcers might be a means of transmitting the parasite, Ichthyophonus sp., without the necessity of ingesting an infected host. We examined the cells associated with the epidermal lesions and confirmed that they were viable Ichthyophonus sp. cells that were readily released from the skin into the mucous layer and ultimately into the aquatic environment. The released cells were infectious when injected into the body cavity of specific-pathogen-free herring. Our hypothesis is that different mechanisms of transmission occur in carnivorous and planktivorous hosts: Planktonic feeders become infected by ingestion of ulcer-derived cells, while carnivores become infected by ingestion of whole infected fish.

  2. Extraordinarily Stretchable All-Carbon Collaborative Nanoarchitectures for Epidermal Sensors

    KAUST Repository

    Cai, Yichen

    2017-06-16

    Multifunctional microelectronic components featuring large stretchability, high sensitivity, high signal-to-noise ratio (SNR), and broad sensing range have attracted a huge surge of interest with the fast developing epidermal electronic systems. Here, the epidermal sensors based on all-carbon collaborative percolation network are demonstrated, which consist 3D graphene foam and carbon nanotubes (CNTs) obtained by two-step chemical vapor deposition processes. The nanoscaled CNT networks largely enhance the stretchability and SNR of the 3D microarchitectural graphene foams, endowing the strain sensor with a gauge factor as high as 35, a wide reliable sensing range up to 85%, and excellent cyclic stability (>5000 cycles). The flexible and reversible strain sensor can be easily mounted on human skin as a wearable electronic device for real-time and high accuracy detecting of electrophysiological stimuli and even for acoustic vibration recognition. The rationally designed all-carbon nanoarchitectures are scalable, low cost, and promising in practical applications requiring extraordinary stretchability and ultrahigh SNRs.

  3. Extraordinarily Stretchable All-Carbon Collaborative Nanoarchitectures for Epidermal Sensors

    KAUST Repository

    Cai, Yichen; Shen, Jie; Dai, Ziyang; Zang, Xiaoxian; Dong, Qiuchun; Guan, Guofeng; Li, Lain-Jong; Huang, Wei; Dong, Xiaochen

    2017-01-01

    Multifunctional microelectronic components featuring large stretchability, high sensitivity, high signal-to-noise ratio (SNR), and broad sensing range have attracted a huge surge of interest with the fast developing epidermal electronic systems. Here, the epidermal sensors based on all-carbon collaborative percolation network are demonstrated, which consist 3D graphene foam and carbon nanotubes (CNTs) obtained by two-step chemical vapor deposition processes. The nanoscaled CNT networks largely enhance the stretchability and SNR of the 3D microarchitectural graphene foams, endowing the strain sensor with a gauge factor as high as 35, a wide reliable sensing range up to 85%, and excellent cyclic stability (>5000 cycles). The flexible and reversible strain sensor can be easily mounted on human skin as a wearable electronic device for real-time and high accuracy detecting of electrophysiological stimuli and even for acoustic vibration recognition. The rationally designed all-carbon nanoarchitectures are scalable, low cost, and promising in practical applications requiring extraordinary stretchability and ultrahigh SNRs.

  4. Attenuation of hind-limb ischemia in mice with endothelial-like cells derived from different sources of human stem cells.

    Directory of Open Access Journals (Sweden)

    Wing-Hon Lai

    Full Text Available Functional endothelial-like cells (EC have been successfully derived from different cell sources and potentially used for treatment of cardiovascular diseases; however, their relative therapeutic efficacy remains unclear. We differentiated functional EC from human bone marrow mononuclear cells (BM-EC, human embryonic stem cells (hESC-EC and human induced pluripotent stem cells (hiPSC-EC, and compared their in-vitro tube formation, migration and cytokine expression profiles, and in-vivo capacity to attenuate hind-limb ischemia in mice. Successful differentiation of BM-EC was only achieved in 1/6 patient with severe coronary artery disease. Nevertheless, BM-EC, hESC-EC and hiPSC-EC exhibited typical cobblestone morphology, had the ability of uptaking DiI-labeled acetylated low-density-lipoprotein, and binding of Ulex europaeus lectin. In-vitro functional assay demonstrated that hiPSC-EC and hESC-EC had similar capacity for tube formation and migration as human umbilical cord endothelial cells (HUVEC and BM-EC (P>0.05. While increased expression of major angiogenic factors including epidermal growth factor, hepatocyte growth factor, vascular endothelial growth factor, placental growth factor and stromal derived factor-1 were observed in all EC cultures during hypoxia compared with normoxia (P<0.05, the magnitudes of cytokine up-regulation upon hypoxic were more dramatic in hiPSC-EC and hESC-EC (P<0.05. Compared with medium, transplanting BM-EC (n = 6, HUVEC (n = 6, hESC-EC (n = 8 or hiPSC-EC (n = 8 significantly attenuated severe hind-limb ischemia in mice via enhancement of neovascularization. In conclusion, functional EC can be generated from hECS and hiPSC with similar therapeutic efficacy for attenuation of severe hind-limb ischemia. Differentiation of functional BM-EC was more difficult to achieve in patients with cardiovascular diseases, and hESC-EC or iPSC-EC are readily available as "off-the-shelf" format for the treatment

  5. Attenuation of Hind-Limb Ischemia in Mice with Endothelial-Like Cells Derived from Different Sources of Human Stem Cells

    Science.gov (United States)

    Chan, Yau-Chi; Ng, Joyce H. L.; Au, Ka-Wing; Wong, Lai-Yung; Siu, Chung-Wah; Tse, Hung-Fat

    2013-01-01

    Functional endothelial-like cells (EC) have been successfully derived from different cell sources and potentially used for treatment of cardiovascular diseases; however, their relative therapeutic efficacy remains unclear. We differentiated functional EC from human bone marrow mononuclear cells (BM-EC), human embryonic stem cells (hESC-EC) and human induced pluripotent stem cells (hiPSC-EC), and compared their in-vitro tube formation, migration and cytokine expression profiles, and in-vivo capacity to attenuate hind-limb ischemia in mice. Successful differentiation of BM-EC was only achieved in 1/6 patient with severe coronary artery disease. Nevertheless, BM-EC, hESC-EC and hiPSC-EC exhibited typical cobblestone morphology, had the ability of uptaking DiI-labeled acetylated low-density-lipoprotein, and binding of Ulex europaeus lectin. In-vitro functional assay demonstrated that hiPSC-EC and hESC-EC had similar capacity for tube formation and migration as human umbilical cord endothelial cells (HUVEC) and BM-EC (P>0.05). While increased expression of major angiogenic factors including epidermal growth factor, hepatocyte growth factor, vascular endothelial growth factor, placental growth factor and stromal derived factor-1 were observed in all EC cultures during hypoxia compared with normoxia (P<0.05), the magnitudes of cytokine up-regulation upon hypoxic were more dramatic in hiPSC-EC and hESC-EC (P<0.05). Compared with medium, transplanting BM-EC (n = 6), HUVEC (n = 6), hESC-EC (n = 8) or hiPSC-EC (n = 8) significantly attenuated severe hind-limb ischemia in mice via enhancement of neovascularization. In conclusion, functional EC can be generated from hECS and hiPSC with similar therapeutic efficacy for attenuation of severe hind-limb ischemia. Differentiation of functional BM-EC was more difficult to achieve in patients with cardiovascular diseases, and hESC-EC or iPSC-EC are readily available as “off-the-shelf” format for the treatment of

  6. Purification and ex vivo expansion of postnatal human marrow mesodermal progenitor cells.

    Science.gov (United States)

    Reyes, M; Lund, T; Lenvik, T; Aguiar, D; Koodie, L; Verfaillie, C M

    2001-11-01

    It is here reported that mesenchymal stem cells known to give rise to limb-bud mesoderm can, at the single-cell level, also differentiate into cells of visceral mesoderm and can be expanded extensively by means of clinically applicable methods. These cells were named mesodermal progenitor cells (MPCs). MPCs were selected by depleting bone marrow mononuclear cells from more than 30 healthy human donors of CD45(+)/glycophorin-A (GlyA)(+) cells. Cells were cultured on fibronectin with epidermal growth factor and platelet-derived growth factor BB and 2% or less fetal calf serum. It was found that 1/5 x 10(3) CD45(-)GlyA(-) cells, or 1/10(6) bone marrow mononuclear cells, gave rise to clusters of small adherent cells. Cell-doubling time was 48 to 72 hours, and cells have been expanded in culture for more than 60 cell doublings. MPCs are CD34(-), CD44(low), CD45(-), CD117 (cKit)(-), class I-HLA(-), and HLA-DR(-). MPCs differentiated into cells of limb-bud mesoderm (osteoblasts, chondrocytes, adipocytes, stroma cells, and skeletal myoblasts) as well as visceral mesoderm (endothelial cells). Retroviral marking was used to definitively prove that single MPCs can differentiate into cells of limb bud and visceral mesoderm. Thus, MPCs that proliferate without obvious senescence under clinically applicable conditions and differentiate at the single-cell level not only into mesenchymal cells but also cells of visceral mesoderm may be an ideal source of stem cells for treatment of genetic or degenerative disorders affecting cells of mesodermal origin.

  7. Interactions Between Epidermal Keratinocytes, Dendritic Epidermal T-Cells, and Hair Follicle Stem Cells.

    Science.gov (United States)

    Badarinath, Krithika; Dutta, Abhik; Hegde, Akshay; Pincha, Neha; Gund, Rupali; Jamora, Colin

    2018-06-13

    The interplay of immune cells and stem cells in maintaining skin homeostasis and repair is an exciting new frontier in cutaneous biology. With the growing appreciation of the importance of this new crosstalk comes the requirement of methods to interrogate the molecular underpinnings of these leukocyte-stem cell interactions. Here we describe how a combination of FACS, cellular coculture assays, and conditioned media treatments can be utilized to advance our understanding of this emerging area of intercellular communication between immune cells and stem cells.

  8. Scaffolding proteins in the development and maintenance of the epidermal permeability barrier.

    Science.gov (United States)

    Crawford, Melissa; Dagnino, Lina

    2017-10-02

    The skin of mammals and other terrestrial vertebrates protects the organism against the external environment, preventing heat, water and electrolyte loss, as well as entry of chemicals and pathogens. Impairments in the epidermal permeability barrier function are associated with the genesis and/or progression of a variety of pathological conditions, including genetic inflammatory diseases, microbial and viral infections, and photodamage induced by UV radiation. In mammals, the outside-in epidermal permeability barrier is provided by the joint action of the outermost cornified layer, together with assembled tight junctions in granular keratinocytes found in the layers underneath. Tight junctions serve as both outside-in and inside-out barriers, and impede paracellular movements of ions, water, macromolecules and microorganisms. At the molecular level, tight junctions consist of integral membrane proteins that form an extracellular seal between adjacent cells, and associate with cytoplasmic scaffold proteins that serve as links with the actin cytoskeleton. In this review, we address the roles that scaffold proteins play specifically in the establishment and maintenance of the epidermal permeability barrier, and how various pathologies alter or impair their functions.

  9. Toxic epidermal necrolysis and Stevens-Johnson syndrome

    Directory of Open Access Journals (Sweden)

    French Lars E

    2010-12-01

    Full Text Available Abstract Toxic epidermal necrolysis (TEN and Stevens Johnson Syndrome (SJS are severe adverse cutaneous drug reactions that predominantly involve the skin and mucous membranes. Both are rare, with TEN and SJS affecting approximately 1or 2/1,000,000 annually, and are considered medical emergencies as they are potentially fatal. They are characterized by mucocutaneous tenderness and typically hemorrhagic erosions, erythema and more or less severe epidermal detachment presenting as blisters and areas of denuded skin. Currently, TEN and SJS are considered to be two ends of a spectrum of severe epidermolytic adverse cutaneous drug reactions, differing only by their extent of skin detachment. Drugs are assumed or identified as the main cause of SJS/TEN in most cases, but Mycoplasma pneumoniae and Herpes simplex virus infections are well documented causes alongside rare cases in which the aetiology remains unknown. Several drugs are at "high" risk of inducing TEN/SJS including: Allopurinol, Trimethoprim-sulfamethoxazole and other sulfonamide-antibiotics, aminopenicillins, cephalosporins, quinolones, carbamazepine, phenytoin, phenobarbital and NSAID's of the oxicam-type. Genetic susceptibility to SJS and TEN is likely as exemplified by the strong association observed in Han Chinese between a genetic marker, the human leukocyte antigen HLA-B*1502, and SJS induced by carbamazepine. Diagnosis relies mainly on clinical signs together with the histological analysis of a skin biopsy showing typical full-thickness epidermal necrolysis due to extensive keratinocyte apoptosis. Differential diagnosis includes linear IgA dermatosis and paraneoplastic pemphigus, pemphigus vulgaris and bullous pemphigoid, acute generalized exanthematous pustulosis (AGEP, disseminated fixed bullous drug eruption and staphyloccocal scalded skin syndrome (SSSS. Due to the high risk of mortality, management of patients with SJS/TEN requires rapid diagnosis, evaluation of the prognosis

  10. Osteo-/odontogenic differentiation of induced mesenchymal stem cells generated through epithelial-mesenchyme transition of cultured human keratinocytes.

    Science.gov (United States)

    Yi, Jin-Kyu; Mehrazarin, Shebli; Oh, Ju-Eun; Bhalla, Anu; Oo, Jenessa; Chen, Wei; Lee, Min; Kim, Reuben H; Shin, Ki-Hyuk; Park, No-Hee; Kang, Mo K

    2014-11-01

    Revascularization of necrotic pulp has been successful in the resolution of periradicular inflammation; yet, several case studies suggest the need for cell-based therapies using mesenchymal stem cells (MSCs) as an alternative for de novo pulp regeneration. Because the availability of MSCs may be limited, especially in an aged population, the current study reports an alternative approach in generating MSCs from epidermal keratinocytes through a process called epithelial-mesenchymal transition (EMT). We induced EMT in primary normal human epidermal keratinocytes (NHEKs) by transient transfection of small interfering RNA targeting the p63 gene. The resulting cells were assayed for their mesenchymal marker expression, proliferation capacities as a monolayer and in a 3-dimensional collagen scaffold, and differentiation capacities. Transient transfection of p63 small-interfering RNA successfully abolished the expression of endogenous p63 in NHEKs and induced the expression of mesenchymal markers (eg, vimentin and fibronectin), whereas epithelial markers (eg, E-cadherin and involucrin) were lost. The NHEKs exhibiting the EMT phenotype acquired extended replicative potential and an increased telomere length compared with the control cells. Similar to the established MSCs, the NHEKs with p63 knockdown showed attachment onto the 3-dimensional collagen scaffold and underwent progressive proliferation and differentiation. Upon differentiation, these EMT cells expressed alkaline phosphatase activity, osteocalcin, and osteonectin and readily formed mineralized nodules detected by alizarin S red staining, showing osteo-/odontogenic differentiation. The induction of EMT in primary NHEKs by means of transient p63 knockdown allows the generation of induced MSCs from autologous sources. These cells may be used for tissues engineering purposes, including that of dental pulp. Copyright © 2014 American Association of Endodontists. Published by Elsevier Inc. All rights reserved.

  11. Skin-resident stem cells and wound healing.

    Science.gov (United States)

    Iwata, Yohei; Akamatsu, Hirohiko; Hasebe, Yuichi; Hasegawa, Seiji; Sugiura, Kazumitsu

    2017-01-01

    CD271 is common stem cell marker for the epidermis and dermis. We assessed a kinetic movement of epidermal and dermal CD271 + cells in the wound healing process to elucidate the possible involvement with chronic skin ulcers. Epidermal CD271 + cells were proliferated and migrated from 3 days after wounding. Purified epidermal CD271 + cells expressed higher TGFβ2 and VEGFα transcripts than CD271 - cells. Delayed wound healing was observed in the aged mice compared with young mice. During the wound healing process, the peak of dermal CD271 + cell accumulation was delayed in aged mice compared with young mice. The expression levels of collagen-1, -3, -5, F4-80, EGF, FGF2, TGFβ1, and IL-1α were significantly increased in young mice compared with aged mice. Furthermore, purified dermal CD271 + cells expressed higher FGF2, EGF, PDGFB, and TGFβ1 gene transcripts than CD271 - cells. These results suggested that epidermal and dermal CD271 + cells were closely associated with wound healing process by producing various growth factors. Epidermal and dermal CD271 + cells in chronic skin ulcer patients were significantly reduced compared with healthy controls. Thus, both epidermal and dermal stem cells can play an important role in wound healing process.

  12. Mast cells are dispensable in a genetic mouse model of chronic dermatitis.

    Science.gov (United States)

    Sulcova, Jitka; Meyer, Michael; Guiducci, Eva; Feyerabend, Thorsten B; Rodewald, Hans-Reimer; Werner, Sabine

    2015-06-01

    Chronic inflammatory skin diseases, such as atopic dermatitis, affect a large percentage of the population, but the role of different immune cells in the pathogenesis of these disorders is largely unknown. Recently, we found that mice lacking fibroblast growth factor receptor 1 (Fgfr1) and Fgfr2 (K5-R1/R2 mice) in the epidermis have a severe impairment in the epidermal barrier, which leads to the development of a chronic inflammatory skin disease that shares many features with human atopic dermatitis. Using Fgfr1-/Fgfr2-deficient mice, we analyzed the consequences of the loss of mast cells. Mast cells accumulated and degranulated in the skin of young Fgfr1-/Fgfr2-deficient mice, most likely as a consequence of increased expression of the mast cell chemokine Ccl2. The increase in mast cells occurred before the development of histological abnormalities, indicating a functional role of these cells in the inflammatory skin phenotype. To test this hypothesis, we mated the Fgfr1-/Fgfr2-deficient mice with mast cell-deficient CreMaster mice. Surprisingly, loss of mast cells did not or only mildly affect keratinocyte proliferation, epidermal thickness, epidermal barrier function, accumulation and activation of different immune cells, or expression of different proinflammatory cytokines in the skin. These results reveal that mast cells are dispensable for the development of chronic inflammation in response to a defect in the epidermal barrier. Copyright © 2015 American Society for Investigative Pathology. Published by Elsevier Inc. All rights reserved.

  13. Inhibition of STAT-3 results in radiosensitization of human squamous cell carcinoma

    International Nuclear Information System (INIS)

    Bonner, James A.; Trummell, Hoa Q.; Willey, Christopher D.; Plants, Brian A.; Raisch, Kevin P.

    2009-01-01

    Background: Signal transducer and activator of transcription-3 (STAT-3) is a downstream component of the Epidermal Growth Factor Receptor (EGFr) signaling process that may facilitate the resistance of tumor cells to conventional cancer treatments. Studies were performed to determine if inhibition of this downstream protein produces radiosensitization. Methods/Results: A431 cells (human squamous cell carcinoma cells with EGFr overexpression) were found to be sensitized to radiation after treatment with STAT-3 small interfering RNA (siRNA). Therefore, a short hairpin RNA (shRNA) against STAT-3 was designed and cloned into a pBABE vector system modified for shRNA expression. Following transfection, clone 2.1 was selected for further study as it showed a dramatic reduction of STAT-3 protein (and mRNA) when compared to A431 parental cells or a negative control shRNA cell line (transfected with STAT-3 shRNA with 2 base pairs mutated). A431 2.1 showed doubling times of 25-31 h as compared to 18-24 h for the parental cell line. The A431 shRNA knockdown STAT-3 cells A431 were more sensitive to radiation than A431 parental or negative STAT-3 control cells. Conclusion: A431 cells stably transfected with shRNA against STAT-3 resulted in enhanced radiosensitivity. Further work will be necessary to determine whether the inhibition of STAT-3 phosphorylation is a necessary step for the radiosensitization that is induced by the inhibition of EGFr.

  14. Membrane microdomain-associated uroplakin IIIa contributes to Src-dependent mechanisms of anti-apoptotic proliferation in human bladder carcinoma cells

    Directory of Open Access Journals (Sweden)

    Shigeru Kihira

    2012-08-01

    Our previous study demonstrated that tyrosine phosphorylation of p145met/β-subunit of hepatocyte growth factor receptor by epidermal growth factor receptor and Src contributes to the anti-apoptotic growth of human bladder carcinoma cell 5637 under serum-starved conditions. Here, we show that some other cell lines of human bladder carcinoma, but not other types of human cancer cells, also exhibit Src-dependent, anti-apoptotic proliferation under serum-starved conditions, and that low-density, detergent-insoluble membrane microdomains (MD serve as a structural platform for signaling events involving p145met, EGFR, and Src. As an MD-associated molecule that may contribute to bladder carcinoma-specific cellular function, we identified uroplakin IIIa (UPIIIa, an urothelium-specific protein. Results obtained so far revealed: 1 UPIIIa undergoes partial proteolysis in serum-starved cells; 2 a specific antibody to the extracellular domain of UPIIIa inhibits the proteolysis of UPIIIa and the activation of Src, and promotes apoptosis in serum-starved cells; and 3 knockdown of UPIIIa by short interfering RNA also promotes apoptosis in serum-starved cells. GM6001, a potent inhibitor of matrix metalloproteinase (MMP, inhibits the proteolysis of UPIIIa and promotes apoptosis in serum-starved cells. Furthermore, serum starvation promotes expression and secretion of the heparin-binding EGF-like growth factor in a manner that depends on the functions of MMP, Src, and UPIIIa. These results highlight a hitherto unknown signaling network involving a subset of MD-associated molecules in the anti-apoptotic mechanisms of human bladder carcinoma cells.

  15. Effect of in vitro and in vivo UV irradiation on the production of ETAF activity by human and murine keratinocytes

    International Nuclear Information System (INIS)

    Ansel, J.C.; Luger, T.A.; Green, I.

    1983-01-01

    Cultured epidermal cells and keratinocytes produce a potent hormone-like factor called epidermal cell-derived thymocyte-activating factor (ETAF). ETAF appears to be similar if not identical to a monocyte-derived lymphokine, known as interleukin 1 (IL-1). These two cytokines are able to amplify a diverse number of proliferative and inflammatory processes. Several recent investigations have suggested that UV-induced immunosuppression may be due in part to the inhibition of IL-1/ETAF production by monocytes and keratinocytes, respectively. We therefore decided to directly study the effects of various doses of in vitro and in vivo UV radiation (UVR) on the production of ETAF by normal murine epidermal cells and a murine (Pam 212) and a human (SCC) keratinocyte cell line. Our results surprisingly demonstrated an increase in both the extracellular and the intracellular ETAF activity of the murine epidermal, Pam 212, and SCC after sublethal amounts of in vitro UVR. Likewise, increased ETAF activity of murine epidermal cells was detected after sublethal doses of in vivo UVR. The UV-induced ETAF activity was cycloheximide-sensitive, suggesting that de novo synthesis of ETAF rather than cell membrane leakage was responsible for the increased ETAF activity. The fact that UV irradiation can increase ETAF activity by keratinocytes could have important local and systemic consequences for the host and may provide an efficient, contaminant-free method for generating ETAF activity for further biochemical and immunologic studies

  16. Modulation of cultured porcine granulosa cell responsiveness to follicle stimulating hormone and epidermal growth factor

    Energy Technology Data Exchange (ETDEWEB)

    Buck, P.A.

    1986-01-01

    Ovarian follicular development is dependent upon the coordinated growth and differentiation of the granulosa cells which line the follicle. Follicle stimulating hormone (FSH) induces granulosa cell differentiation both in vivo and in vitro. Epidermal growth factor (EGF) stimulates granulosa cell proliferation in vitro. The interaction of these two effectors upon selected parameters of growth and differentiation was examined in monolayer cultures of porcine granulose cells. Analysis of the EGF receptor by /sup 125/I-EGF binding revealed that the receptor was of high affinity with an apparent dissociation constant of 4-6 x 10/sup -10/ M. The average number of receptors per cell varied with the state of differentiation both in vivo and in vitro; highly differentiated cells bound two-fold less /sup 125/I-EGF and this effect was at least partially induced by FSH in vitro. EGF receptor function was examined by assessing EGF effects on cell number and /sup 3/H-thymidine incorporation. EGF stimulated thymidine incorporation in both serum-free and serum-supplemented culture, but only in serum-supplemented conditions was cell number increased. EGF receptor function was inversely related to the state of differentiation and was attenuated by FSH. The FSH receptor was examined by /sup 125/I-FSH binding. EGF increased FSH receptor number, and lowered the affinity of the receptor. The function of these receptors was assessed by /sup 125/I-hCG binding and progesterone radioimmunoassay. If EGF was present continuously in the cultures. FSH receptor function was attenuated regardless of FSH receptor number. A preliminary effort to examine the mechanism of this interaction was performed by analyzing hormonally controlled protein synthesis with /sup 35/S-methionine labeling, SDS polyacrylamide gel electrophoresis and fluorography. FSH promoted the expression of a 27,000 dalton protein. This effect was attenuated by EGF.

  17. Extract from the Zooxanthellate Jellyfish Cotylorhiza tuberculata Modulates Gap Junction Intercellular Communication in Human Cell Cultures

    Directory of Open Access Journals (Sweden)

    Stefano Piraino

    2013-05-01

    Full Text Available On a global scale, jellyfish populations in coastal marine ecosystems exhibit increasing trends of abundance. High-density outbreaks may directly or indirectly affect human economical and recreational activities, as well as public health. As the interest in biology of marine jellyfish grows, a number of jellyfish metabolites with healthy potential, such as anticancer or antioxidant activities, is increasingly reported. In this study, the Mediterranean “fried egg jellyfish” Cotylorhiza tuberculata (Macri, 1778 has been targeted in the search forputative valuable bioactive compounds. A medusa extract was obtained, fractionated, characterized by HPLC, GC-MS and SDS-PAGE and assayed for its biological activity on breast cancer cells (MCF-7 and human epidermal keratinocytes (HEKa. The composition of the jellyfish extract included photosynthetic pigments, valuable ω-3 and ω-6 fatty acids, and polypeptides derived either from jellyfish tissues and their algal symbionts. Extract fractions showed antioxidant activity and the ability to affect cell viability and intercellular communication mediated by gap junctions (GJIC differentially in MCF-7and HEKa cells. A significantly higher cytotoxicity and GJIC enhancement in MCF-7 compared to HEKa cells was recorded. A putative action mechanism for the anticancer bioactivity through the modulation of GJIC has been hypothesized and its nutraceutical and pharmaceutical potential was discussed.

  18. Epidermal growth factor receptor tyrosine kinase (EGFR-TK) mutation testing in adults with locally advanced or metastatic non-small cell lung cancer: A systematic review and cost-effectiveness analysis

    NARCIS (Netherlands)

    M. Westwood (Marie); M.A. Joore (Manuela); P. Whiting (Penny); T. van Asselt (Thea); B.L.T. Ramaekers (Bram); N. Armstrong (Nigel); K. Misso (Kate); J.L. Severens (Hans); J. Kleijnen (Jos)

    2014-01-01

    markdownabstract__Abstract__ Background: Non-small cell lung cancer (NSCLC) is the most common form of lung cancer. Some epidermal growth factor receptor tyrosine kinase (EGFR-TK) mutations make tumours responsive to treatment with EGFR-TK inhibitors (EGFR-TKIs) but less responsive to treatment

  19. ErbB2 resembles an autoinhibited invertebrate epidermal growth factor receptor

    Energy Technology Data Exchange (ETDEWEB)

    Alvarado, Diego; Klein, Daryl E.; Lemmon, Mark A.; (UPENN-MED)

    2009-09-25

    The orphan receptor tyrosine kinase ErbB2 (also known as HER2 or Neu) transforms cells when overexpressed, and it is an important therapeutic target in human cancer. Structural studies have suggested that the oncogenic (and ligand-independent) signalling properties of ErbB2 result from the absence of a key intramolecular 'tether' in the extracellular region that autoinhibits other human ErbB receptors, including the epidermal growth factor (EGF) receptor. Although ErbB2 is unique among the four human ErbB receptors, here we show that it is the closest structural relative of the single EGF receptor family member in Drosophila melanogaster (dEGFR). Genetic and biochemical data show that dEGFR is tightly regulated by growth factor ligands, yet a crystal structure shows that it, too, lacks the intramolecular tether seen in human EGFR, ErbB3 and ErbB4. Instead, a distinct set of autoinhibitory interdomain interactions hold unliganded dEGFR in an inactive state. All of these interactions are maintained (and even extended) in ErbB2, arguing against the suggestion that ErbB2 lacks autoinhibition. We therefore suggest that normal and pathogenic ErbB2 signalling may be regulated by ligands in the same way as dEGFR. Our findings have important implications for ErbB2 regulation in human cancer, and for developing therapeutic approaches that target novel aspects of this orphan receptor.

  20. Microtubule heterogeneity of Ornithogalum umbellatum ovary epidermal cells: non-stable cortical microtubules and stable lipotubuloid microtubules.

    Science.gov (United States)

    Kwiatkowska, Maria; Stępiński, Dariusz; Polit, Justyna T; Popłońska, Katarzyna; Wojtczak, Agnieszka

    2011-01-01

    Lipotubuloids, structures containing lipid bodies and microtubules, are described in ovary epidermal cells of Ornithogalum umbellatum. Microtubules of lipotubuloids can be fixed in electron microscope fixative containing only buffered OsO(4) or in glutaraldehyde with OsO(4) post-fixation, or in a mixture of OsO(4) and glutaraldehyde. None of these substances fixes cortical microtubules of ovary epidermis of this plant which is characterized by dynamic longitudinal growth. However, cortical microtubules can be fixed with cold methanol according immunocytological methods with the use of β-tubulin antibodies and fluorescein. The existence of cortical microtubules has also been evidenced by EM observations solely after the use of taxol, microtubule stabilizer, and fixation in a glutaraldehyde/OsO(4) mixture. These microtubules mostly lie transversely, sometimes obliquely, and rarely parallel to the cell axis. Staining, using Ruthenium Red and silver hexamine, has revealed that lipotubuloid microtubules surface is covered with polysaccharides. The presumption has been made that the presence of a polysaccharide layer enhances the stability of lipotubuloid microtubules.