WorldWideScience

Sample records for human epidermal cells

  1. Sensing radiosensitivity of human epidermal stem cells

    International Nuclear Information System (INIS)

    Rachidi, Walid; Harfourche, Ghida; Lemaitre, Gilles; Amiot, Franck; Vaigot, Pierre; Martin, Michele T.

    2007-01-01

    Purpose: Radiosensitivity of stem cells is a matter of debate. For mouse somatic stem cells, both radiosensitive and radioresistant stem cells have been described. By contrast, the response of human stem cells to radiation has been poorly studied. As epidermis is a radiosensitive tissue, we evaluated in the present work the radiosensitivity of cell populations enriched for epithelial stem cells of human epidermis. Methods and materials: The total keratinocyte population was enzymatically isolated from normal human skin. We used flow cytometry and antibodies against cell surface markers to isolate basal cell populations from human foreskin. Cell survival was measured after a dose of 2 Gy with the XTT assay at 72 h after exposure and with a clonogenic assay at 2 weeks. Transcriptome analysis using oligonucleotide microarrays was performed to assess the genomic cell responses to radiation. Results: Cell sorting based on two membrane proteins, α6 integrin and the transferrin receptor CD71, allowed isolation of keratinocyte populations enriched for the two types of cells found in the basal layer of epidermis: stem cells and progenitors. Both the XTT assay and the clonogenic assay showed that the stem cells were radioresistant whereas the progenitors were radiosensitive. We made the hypothesis that upstream DNA damage signalling might be different in the stem cells and used microarray technology to test this hypothesis. The stem cells exhibited a much more reduced gene response to a dose of 2 Gy than the progenitors, as we found that 6% of the spotted genes were regulated in the stem cells and 20% in the progenitors. Using Ingenuity Pathway Analysis software, we found that radiation exposure induced very specific pathways in the stem cells. The most striking responses were the repression of a network of genes involved in apoptosis and the induction of a network of cytokines and growth factors. Conclusion: These results show for the first time that keratinocyte

  2. Radiosensitivity of normal human epidermal cells in culture

    International Nuclear Information System (INIS)

    Dover, R.; Potten, C.S.

    1983-01-01

    Using an in vitro culture system the authors have derived #betta#-radiation survival curves over a dose range 0-8 Gy for the clonogenic cells of normal human epidermis. The culture system used allows the epidermal cells to stratify and form a multi-layered sheet of keratinizing cells. The cultures appear to be a very good model for epidermis in vivo. The survival curves show a population which is apparently more sensitive than murine epidermis in vivo. It remains unclear whether this is an intrinsic difference between the species or is a consequence of the in vitro cultivation of the human cells. (author)

  3. Enrichment of unlabeled human Langerhans cells from epidermal cell suspensions by discontinuous density gradient centrifugation

    NARCIS (Netherlands)

    Teunissen, M. B.; Wormmeester, J.; Kapsenberg, M. L.; Bos, J. D.

    1988-01-01

    In this report we introduce an alternative procedure for enrichment of human epidermal Langerhans cells (LC) from epidermal cell suspensions of normal skin. By means of discontinuous Ficoll-Metrizoate density gradient centrifugation, a fraction containing high numbers of viable, more than 80% pure

  4. Effects of Wnt3a on proliferation and differentiation of human epidermal stem cells

    International Nuclear Information System (INIS)

    Jia Liwei; Zhou Jiaxi; Peng Sha; Li Juxue; Cao Yujing; Duan Enkui

    2008-01-01

    Epidermal stem cells maintain development and homeostasis of mammalian epidermis throughout life. However, the molecular mechanisms involved in the proliferation and differentiation of epidermal stem cells are far from clear. In this study, we investigated the effects of Wnt3a and Wnt/β-catenin signaling on proliferation and differentiation of human fetal epidermal stem cells. We found both Wnt3a and active β-catenin, two key members of the Wnt/β-catenin signaling, were expressed in human fetal epidermis and epidermal stem cells. In addition, Wnt3a protein can promote proliferation and inhibit differentiation of epidermal stem cells in vitro culture. Our results suggest that Wnt/β-catenin signaling plays important roles in human fetal skin development and homeostasis, which also provide new insights on the molecular mechanisms of oncogenesis in human epidermis

  5. Grafting of human epidermal cells, presence and perspectives

    Czech Academy of Sciences Publication Activity Database

    Smetana, Karel; Dvořánková, B.; Labský, Jiří; Vacík, Jiří; Holíková, Z.

    2001-01-01

    Roč. 102, č. 1 (2001), s. 1-6 ISSN 0036-5327 R&D Projects: GA ČR GA203/00/1310; GA AV ČR IBS4050005; GA MZd ND6340; GA MŠk LN00A065; GA AV ČR KSK4055109 Institutional research plan: CEZ:AV0Z4050913 Keywords : cell therapy-keratinocyte-epidermal stem cell * skin defect Subject RIV: CD - Macromolecular Chemistry

  6. Growth of melanocytes in human epidermal cell cultures

    International Nuclear Information System (INIS)

    Staiano-Coico, L.; Hefton, J.M.; Amadeo, C.; Pagan-Charry, I.; Madden, M.R.; Cardon-Cardo, C.

    1990-01-01

    Epidermal cell cultures were grown in keratinocyte-conditioned medium for use as burn wound grafts; the melanocyte composition of the grafts was studied under a variety of conditions. Melanocytes were identified by immunohistochemistry based on a monoclonal antibody (MEL-5) that has previously been shown to react specifically with melanocytes. During the first 7 days of growth in primary culture, the total number of melanocytes in the epidermal cultures decreased to 10% of the number present in normal skin. Beginning on day 2 of culture, bipolar melanocytes were present at a mean cell density of 116 +/- 2/mm2; the keratinocyte to melanocyte ratio was preserved during further primary culture and through three subpassages. Moreover, exposure of cultures to mild UVB irradiation stimulated the melanocytes to proliferate, suggesting that the melanocytes growing in culture maintained their responsiveness to external stimuli. When the sheets of cultured cells were enzymatically detached from the plastic culture flasks before grafting, melanocytes remained in the basal layer of cells as part of the graft applied to the patient

  7. Evolution of the clonogenic potential of human epidermal stem/progenitor cells with age

    Directory of Open Access Journals (Sweden)

    Zobiri O

    2012-02-01

    Full Text Available Olivia Zobiri, Nathalie Deshayes, Michelle Rathman-JosserandDepartment of Biological Research, L'Oréal Advanced Research, Clichy Cedex, FranceAbstract: A number of clinical observations have indicated that the regenerative potential and overall function of the epidermis is modified with age. The epidermis becomes thinner, repairs itself less efficiently after wounding, and presents modified barrier function recovery. In addition, the dermal papillae flatten out with increasing age, suggesting a modification in the interaction between epidermal and dermal compartments. As the epidermal regenerative capacity is dependent upon stem and progenitor cell function, it is naturally of interest to identify and understand age-related changes in these particular keratinocyte populations. Previous studies have indicated that the number of stem cells does not decrease with age in mouse models but little solid evidence is currently available concerning human skin. The objective of this study was to evaluate the clonogenic potential of keratinocyte populations isolated from the epidermis of over 50 human donors ranging from 18 to 71 years old. The data indicate that the number of epidermal cells presenting high regenerative potential does not dramatically decline with age in human skin. The authors believe that changes in the microenvironment controlling epidermal basal cell activity are more likely to explain the differences in epidermal function observed with increasing age.Keywords: skin, epidermal stem cells, aging, colony-forming efficiency test

  8. Human Epidermal Langerhans Cells Maintain Immune Homeostasis in Skin by Activating Skin Resident Regulatory T Cells

    Science.gov (United States)

    Seneschal, Julien; Clark, Rachael A.; Gehad, Ahmed; Baecher-Allan, Clare M.; Kupper, Thomas S.

    2013-01-01

    Recent discoveries indicate that the skin of a normal individual contains 10-20 billion resident memory T cells ( which include various T helper, T cytotoxic, and T regulatory subsets, that are poised to respond to environmental antigens. Using only autologous human tissues, we report that both in vitro and in vivo, resting epidermal Langerhan cells (LC) selectively and specifically induced the activation and proliferation of skin resident regulatory T cells (Treg), a minor subset of skin resident memory T cells. In the presence of foreign pathogen, however, the same LC activated and induced proliferation of effector memory T (Tem) cells and limited Treg cells activation. These underappreciated properties of LC: namely maintenance of tolerance in normal skin, and activation of protective skin resident memory T cells upon infectious challenge, help clarify the role of LC in skin. PMID:22560445

  9. Dermal-epidermal membrane systems by using human keratinocytes and mesenchymal stem cells isolated from dermis

    Energy Technology Data Exchange (ETDEWEB)

    Salerno, Simona, E-mail: s.salerno@itm.cnr.it [Institute on Membrane Technology, National Research Council of Italy, ITM-CNR, c/o University of Calabria, via P. Bucci cubo 17/C, I-87036, Rende (CS) (Italy); Messina, Antonietta [Institute on Membrane Technology, National Research Council of Italy, ITM-CNR, c/o University of Calabria, via P. Bucci cubo 17/C, I-87036, Rende (CS) (Italy); Giordano, Francesca [Department of Pharmacy, Health and Nutritional Sciences, University of Calabria, I-87036 Rende, (CS) (Italy); Bader, Augustinus [Biomedical-Biotechnological Center, BBZ, University of Leipzig, D-04103 Leipzig (Germany); Drioli, Enrico [Institute on Membrane Technology, National Research Council of Italy, ITM-CNR, c/o University of Calabria, via P. Bucci cubo 17/C, I-87036, Rende (CS) (Italy); WCU Energy Engineering Department, Hanyang University, Seoul (Korea, Republic of); De Bartolo, Loredana, E-mail: l.debartolo@itm.cnr.it [Institute on Membrane Technology, National Research Council of Italy, ITM-CNR, c/o University of Calabria, via P. Bucci cubo 17/C, I-87036, Rende (CS) (Italy)

    2017-02-01

    Dermal-epidermal membrane systems were developed by co-culturing human keratinocytes with Skin derived Stem Cells (SSCs), which are Mesenchymal Stem Cells (MSCs) isolated from dermis, on biodegradable membranes of chitosan (CHT), polycaprolactone (PCL) and a polymeric blend of CHT and PCL. The membranes display physico-chemical, morphological, mechanical and biodegradation properties that could satisfy and fulfil specific requirements in skin tissue engineering. CHT membrane exhibits an optimal biodegradation rate for acute wounds; CHT-PCL for the chronic ones. On the other hand, PCL membrane in spite of its very slow biodegradation rate exhibits mechanical properties similar to in vivo dermis, a lower hydrophilic character, and a surface roughness, all properties that make it able to sustain cell adhesion and proliferation for in vitro skin models. Both CHT–PCL and PCL membranes guided epidermal and dermal differentiation of SSCs as pointed out by the expression of cytokeratins and the deposition of the ECM protein fibronectin, respectively. In the dermal-epidermal membrane systems, a more suitable microenvironment for the SSCs differentiation was promoted by the interactions and the mutual interplay with keratinocytes. Being skin tissue-biased stem cells committed to their specific final dermal and/or epidermal cell differentiation, SSCs are more suitable for skin tissue engineering than other adult MSCs with different origin. For this reason, they represent a useful autologous cell source for engineering skin substitutes for both in vivo and in vitro applications.

  10. Low calcium culture condition induces mesenchymal cell-like phenotype in normal human epidermal keratinocytes

    International Nuclear Information System (INIS)

    Takagi, Ryo; Yamato, Masayuki; Murakami, Daisuke; Sugiyama, Hiroaki; Okano, Teruo

    2011-01-01

    Highlights: → Normal human epidermal keratinocytes serially cultured under low calcium concentration were cytokeratin and vimentin double positive cells. → The human keratinocytes expressed some epithelial stem/progenitor cell makers, mesenchymal cell markers, and markers of epithelial-mesenchymal transition. → Mesenchymal cell-like phenotype in the keratinocytes was suppressed under high-calcium condition. -- Abstract: Epithelial-mesenchymal transition (EMT) is an important cellular phenomenon in organ developments, cancer invasions, and wound healing, and many types of transformed cell lines are used for investigating for molecular mechanisms of EMT. However, there are few reports for EMT in normal human epithelial cells, which are non-transformed or non-immortalized cells, in vitro. Therefore, normal human epidermal keratinocytes (NHEK) serially cultured in low-calcium concentration medium (LCM) were used for investigating relations between differentiation and proliferation and mesenchymal-like phenotype in the present study, since long-term cultivation of NHEK is achieved in LCM. Interestingly, NHEK serially cultured in LCM consisted essentially of cytokeratin-vimentin double positive cells (98%), although the NHEK exhibited differentiation under high-calcium culture condition with 3T3 feeder layer. The vimentin expression was suppressed under high-calcium condition. These results may indicate the importance of mesenchymal-like phenotype for serially cultivation of NHEK in vitro.

  11. Autodegradation of 125I-labeled human epidermal cell surface proteins

    International Nuclear Information System (INIS)

    Hashimoto, K.; Singer, K.H.; Lazarus, G.S.

    1982-01-01

    Triton X-100 extracts of cultured human epidermal cells exhibited proteolytic activity as measured by the hydrolysis of [ 3 H]-casein at neutral pH. The majority of endogenous proteolytic activity was inhibited by parahydroxy mercuribenzoate and by mersalyl acid, indicating the enzyme(s) was a thiol class proteinase(s). Crude Triton X-100 extracts were prepared from epidermal cells following labeling of proteins with 125 I. Autodegradation of labeled proteins at 37 degrees C was detected as early as 1 hr and reached a plateau level by 4 hr. Degradation was inhibited by thiol class proteinase inhibitors. Among the detergent-solubilized radiolabeled proteins a polypeptide chain of Mr 155,000 was particularly sensitive to degradation by endogenous thiol proteinase(s)

  12. Effects of epidermal growth factor, transferrin, and insulin on lipofection efficiency in human lung carcinoma cells.

    Science.gov (United States)

    Yanagihara, K; Cheng, H; Cheng, P W

    2000-01-01

    Poor transfection efficiency is the major drawback of lipofection. We showed previously that addition of transferrin (TF) to Lipofectin enhanced the expression of a reporter gene in HeLa cells by 120-fold and achieved close to 100% transfection efficiency. The purpose of this study was to determine whether TF and other ligands could improve the efficiency of lipofection in lung carcinoma cells. Confluent A549, Calu3, and H292 cells were transfected for 18 hours with a plasmid DNA (pCMVlacZ) using Lipofectin plus TF, insulin, or epidermal growth factor as the vector. The transfected cells were assessed for transfection efficiency by beta-galactosidase activity (light units/microg protein) and the percentage of blue cells following 5-bromo-4-chloro-3-indolyl beta-D-galactopyranoside staining. Lipofectin supplemented with epidermal growth factor yielded the largest enhancement of lipofection efficiency (lipofection efficiency in A549 and Calu3 cells but not in H292 cells, whereas TF showed significant lipofection efficiency-enhancing effect in Calu3 and H292 cells but not in A549 cells. The transfection efficiency correlated well with the amounts of DNA delivered to the nucleus as well as the amounts of the receptor. These results indicate that the gene delivery strategy employing ligand-facilitated lipofection can achieve high transfection efficiency in human lung carcinoma cells. In addition, enhancement of the expression of the receptor may be a possible strategy for increasing the efficiency of gene targeting.

  13. Epidermal growth factor increases LRF/Pokemon expression in human prostate cancer cells.

    Science.gov (United States)

    Aggarwal, Himanshu; Aggarwal, Anshu; Agrawal, Devendra K

    2011-10-01

    Leukemia/lymphoma related factor/POK erythroid myeloid ontogenic factor (LRF/Pokemon) is a member of the POK family of proteins that promotes oncogenesis in several forms of cancer. Recently, we found higher LRF expression in human breast and prostate carcinomas compared to the corresponding normal tissues. The aim of this study was to examine the regulation of LRF expression in human prostate cells. Epidermal growth factor (EGF) and its receptors mediate several tumorigenic cascades that regulate cell differentiation, proliferation, migration and survival of prostate cancer cells. There was significantly higher level of LRF expression in the nucleus of LNCaP and PC-3 cells than RWPE-1 cells. A significant increase in LRF expression was observed with increasing doses of EGF in more aggressive and androgen-sensitive prostate cancer cells suggesting that EGF signaling pathway is critical in upregulating the expression of LRF/Pokemon to promote oncogenesis. Copyright © 2011 Elsevier Inc. All rights reserved.

  14. Recycling of epidermal growth factor in a human pancreatic carcinoma cell line

    International Nuclear Information System (INIS)

    Korc, M.; Magun, B.E.

    1985-01-01

    PANC-1 human pancreatic carcinoma cells readily bound and internalized 125 I-labeled epidermal growth factor (EGF). Bound 125 I-labeled EGF was then partially processed to a number of high molecular weight acidic species. Percoll gradient centrifugation of cell homogenates indicated that the majority of 125 I activity localized to several intracellular vesicular compartments. Both intact EGF and its processed species were subsequently released into the incubation medium. A major portion of the released radioactivity was capable of rebinding to the cell. Only a small amount of bound 125 I-labeled EGF was degraded to low molecular weight products, and this degradation was completely blocked by methylamine. These findings suggest that in PANC-1 cells, bound EGF undergoes only limited processing. Both intact EGF and its major processed species bypass the cellular degradative pathways, are slowly released from the cell, and then rebind to the cell

  15. In vivo UVB irradiation induces clustering of Fas (CD95) on human epidermal cells

    DEFF Research Database (Denmark)

    Bang, Bo; Gniadecki, Robert; Larsen, Jørgen K

    2003-01-01

    In vitro studies with human cell lines have demonstrated that the death receptor Fas plays a role in ultraviolet (UV)-induced apoptosis. The purpose of the present study was to investigate the relation between Fas expression and apoptosis as well as clustering of Fas in human epidermis after...... a single dose of UVB irradiation. Normal healthy individuals were irradiated with three minimal erythema doses (MED) of UVB on forearm or buttock skin. Suction blisters from unirradiated and irradiated skin were raised, and Fas, FasL, and apoptosis of epidermal cells quantified by flow cytometry....... Clustering of Fas was from skin biopsied. Soluble FasL in suction blister fluid was quantified by ELISA. Flow cytometric analysis demonstrated increased expression intensity of Fas after irradiation, with 1.6-,2.2- and 2.7-fold increased median expression at 24, 48 and 72 h after irradiation, respectively (n...

  16. Immunohistochemical detection of cytochrome P450 isoenzymes in cultured human epidermal cells.

    Science.gov (United States)

    Van Pelt, F N; Meierink, Y J; Blaauboer, B J; Weterings, P J

    1990-12-01

    We used specific monoclonal antibodies (MAb) to human cytochrome P450 isoenzymes to determine the presence of these proteins in human epidermal cells. Two MAb (P450-5 and P450-8) recognize major forms of hepatic cytochrome P450 involved in biotransformation of xenobiotics. A third MAb, to cytochrome P450-9, is not fully characterized. The proteins were determined by the indirect immunoperoxidase technique after fixation with methanol and acetone. Biopsy materials for cultured keratinocytes, i.e., foreskin and hair follicles, contained the two major forms of cytochrome P450. In cultured keratinocytes derived from hair follicles the proteins were undetectable, whereas the keratinocytes derived from foreskin continued to express the two major forms of hepatic cytochrome P450. Cultured human fibroblasts and a human keratinocyte cell line (SVK14) showed staining similar to that of the foreskin keratinocytes. Cytochrome P450-9 was detectable only in human hepatocytes. The results indicate that, under the culture conditions applied, cultured human foreskin cells and the cell line SVK14 continue to express specific cytochrome P450 isoenzymes in culture, in contrast to hair follicle keratinocytes.

  17. Recurrent exposure to nicotine differentiates human bronchial epithelial cells via epidermal growth factor receptor activation

    International Nuclear Information System (INIS)

    Martinez-Garcia, Eva; Irigoyen, Marta; Anso, Elena; Martinez-Irujo, Juan Jose; Rouzaut, Ana

    2008-01-01

    Cigarette smoking is the major preventable cause of lung cancer in developed countries. Nicotine (3-(1-methyl-2-pyrrolidinyl)-pyridine) is one of the major alkaloids present in tobacco. Besides its addictive properties, its effects have been described in panoply of cell types. In fact, recent studies have shown that nicotine behaves as a tumor promoter in transformed epithelial cells. This research focuses on the effects of acute repetitive nicotine exposure on normal human bronchial epithelial cells (NHBE cells). Here we show that treatment of NHBE cells with recurrent doses of nicotine up to 500 μM triggered cell differentiation towards a neuronal-like phenotype: cells emitted filopodia and expressed neuronal markers such as neuronal cell adhesion molecule, neurofilament-M and the transcription factors neuronal N and Pax-3. We also demonstrate that nicotine treatment induced NF-kB translocation to the nucleus, phosphorylation of the epidermal growth factor receptor (EGFR), and accumulation of heparin binding-EGF in the extracellular medium. Moreover, addition of AG1478, an inhibitor of EGFR tyrosine phosphorylation, or cetuximab, a monoclonal antibody that precludes ligand binding to the same receptor, prevented cell differentiation by nicotine. Lastly, we show that differentiated cells increased their adhesion to the extracellular matrix and their protease activity. Given that several lung pathologies are strongly related to tobacco consumption, these results may help to better understand the damaging consequences of nicotine exposure

  18. Human eccrine sweat gland cells turn into melanin-uptaking keratinocytes in dermo-epidermal skin substitutes.

    Science.gov (United States)

    Böttcher-Haberzeth, Sophie; Biedermann, Thomas; Pontiggia, Luca; Braziulis, Erik; Schiestl, Clemens; Hendriks, Bart; Eichhoff, Ossia M; Widmer, Daniel S; Meuli-Simmen, Claudia; Meuli, Martin; Reichmann, Ernst

    2013-02-01

    Recently, Biedermann et al. (2010) have demonstrated that human eccrine sweat gland cells can develop a multilayered epidermis. The question still remains whether these cells can fulfill exclusive and very specific functional properties of epidermal keratinocytes, such as the incorporation of melanin, a feature absent in sweat gland cells. We added human melanocytes to eccrine sweat gland cells to let them develop into an epidermal analog in vivo. The interaction between melanocytes and sweat gland-derived keratinocytes was investigated. The following results were gained: (1) macroscopically, a pigmentation of the substitutes was seen 2-3 weeks after transplantation; (2) we confirmed the development of a multilayered, stratified epidermis with melanocytes distributed evenly throughout the basal layer; (3) melanocytic dendrites projected to suprabasal layers; and (4) melanin was observed to be integrated into former eccrine sweat gland cells. These skin substitutes were similar or equal to skin substitutes cultured from human epidermal keratinocytes. The only differences observed were a delay in pigmentation and less melanin uptake. These data suggest that eccrine sweat gland cells can form a functional epidermal melanin unit, thereby providing striking evidence that they can assume one of the most characteristic keratinocyte properties.

  19. [Progress in epidermal stem cells].

    Science.gov (United States)

    Wang, Li-Juan; Wang, You-Liang; Yang, Xiao

    2010-03-01

    Mammalian skin epidermis contains different epidermal stem cell pools which contribute to the homeostasis and repair of skin epithelium. Epidermal stem cells possess two essential features common to all stem cells: self-renewal and differentiation. Disturbing the balance between self-renewal and differentiation of epidermal stem cell often causes tumors or other skin diseases. Epidermal stem cell niches provide a special microenvironment that maintains a balance of stem cell quiescence and activity. This review primarily concentrates on the following points of the epidermal stem cells: the existing evidences, the self-renewal and differentiation, the division pattern, the signal pathways regulating self-renewal and differentiation, and the microenvironment (niche) and macroenvironment maintaining the homeostasis of stem cells.

  20. Phosphoproteomic fingerprinting of epidermal growth factor signaling and anticancer drug action in human tumor cells.

    Science.gov (United States)

    Lim, Yoon-Pin; Diong, Lang-Shi; Qi, Robert; Druker, Brian J; Epstein, Richard J

    2003-12-01

    Many proteins regulating cancer cell growth are tyrosine phosphorylated. Using antiphosphotyrosine affinity chromatography, thiourea protein solubilization, two-dimensional PAGE, and mass spectrometry, we report here the characterization of the epidermal growth factor (EGF)-induced phosphoproteome in A431 human epidermoid carcinoma cells. Using this approach, more than 50 distinct tyrosine phosphoproteins are identifiable within five main clusters-cytoskeletal proteins, signaling enzymes, SH2-containing adaptors, chaperones, and focal adhesion proteins. Comparison of the phosphoproteomes induced in vitro by transforming growth factor-alpha and platelet-derived growth factor demonstrates the pathway- and cell-specific nature of the phosphoproteomes induced. Elimination of both basal and ligand-dependent phosphoproteins by cell exposure to the EGF receptor catalytic inhibitor gefitinib (Iressa, ZD1839) suggests either an autocrine growth loop or the presence of a second inhibited kinase in A431 cells. By identifying distinct patterns of phosphorylation involving novel signaling substrates, and by clarifying the mechanism of action of anticancer drugs, these findings illustrate the potential of immunoaffinity-based phosphoproteomics for guiding the discovery of new drug targets and the rational utilization of pathway-specific chemotherapies.

  1. Expression of the epidermal growth factor receptor in human small cell lung cancer cell lines

    DEFF Research Database (Denmark)

    Damstrup, L; Rygaard, K; Spang-Thomsen, M

    1992-01-01

    of EGF receptor mRNA in all 10 cell lines that were found to be EGF receptor-positive and in one cell line that was found to be EGF receptor-negative in the radioreceptor assay and affinity labeling. Our results provide, for the first time, evidence that a large proportion of a broad panel of small cell......Epidermal growth factor (EGF) receptor expression was evaluated in a panel of 21 small cell lung cancer cell lines with radioreceptor assay, affinity labeling, and Northern blotting. We found high-affinity receptors to be expressed in 10 cell lines. Scatchard analysis of the binding data...... demonstrated that the cells bound between 3 and 52 fmol/mg protein with a KD ranging from 0.5 x 10(-10) to 2.7 x 10(-10) M. EGF binding to the receptor was confirmed by affinity-labeling EGF to the EGF receptor. The cross-linked complex had a M(r) of 170,000-180,000. Northern blotting showed the expression...

  2. In vivo UVB irradiation induces clustering of Fas (CD95) on human epidermal cells

    DEFF Research Database (Denmark)

    Bang, Bo; Gniadecki, Robert; Larsen, Jørgen K

    2003-01-01

    a single dose of UVB irradiation. Normal healthy individuals were irradiated with three minimal erythema doses (MED) of UVB on forearm or buttock skin. Suction blisters from unirradiated and irradiated skin were raised, and Fas, FasL, and apoptosis of epidermal cells quantified by flow cytometry...

  3. Bioengineering a human plasma-based epidermal substitute with efficient grafting capacity and high content in clonogenic cells.

    Science.gov (United States)

    Alexaline, Maia M; Trouillas, Marina; Nivet, Muriel; Bourreau, Emilie; Leclerc, Thomas; Duhamel, Patrick; Martin, Michele T; Doucet, Christelle; Fortunel, Nicolas O; Lataillade, Jean-Jacques

    2015-06-01

    Cultured epithelial autografts (CEAs) produced from a small, healthy skin biopsy represent a lifesaving surgical technique in cases of full-thickness skin burn covering >50% of total body surface area. CEAs also present numerous drawbacks, among them the use of animal proteins and cells, the high fragility of keratinocyte sheets, and the immaturity of the dermal-epidermal junction, leading to heavy cosmetic and functional sequelae. To overcome these weaknesses, we developed a human plasma-based epidermal substitute (hPBES) for epidermal coverage in cases of massive burn, as an alternative to traditional CEA, and set up critical quality controls for preclinical and clinical studies. In this study, phenotypical analyses in conjunction with functional assays (clonal analysis, long-term culture, or in vivo graft) showed that our new substitute fulfills the biological requirements for epidermal regeneration. hPBES keratinocytes showed high potential for cell proliferation and subsequent differentiation similar to healthy skin compared with a well-known reference material, as ascertained by a combination of quality controls. This work highlights the importance of integrating relevant multiparameter quality controls into the bioengineering of new skin substitutes before they reach clinical development. This work involves the development of a new bioengineered epidermal substitute with pertinent functional quality controls. The novelty of this work is based on this quality approach. ©AlphaMed Press.

  4. Homeobox A7 increases cell proliferation by up-regulation of epidermal growth factor receptor expression in human granulosa cells

    Directory of Open Access Journals (Sweden)

    Yanase Toshihiko

    2010-06-01

    Full Text Available Abstract Background Homeobox (HOX genes encode transcription factors, which regulate cell proliferation, differentiation, adhesion, and migration. The deregulation of HOX genes is frequently associated with human reproductive system disorders. However, knowledge regarding the role of HOX genes in human granulosa cells is limited. Methods To determine the role of HOXA7 in the regulation and associated mechanisms of cell proliferation in human granulosa cells, HOXA7 and epidermal growth factor receptor (EGFR expressions were examined in primary granulosa cells (hGCs, an immortalized human granulosa cell line, SVOG, and a granulosa tumor cell line, KGN, by real-time PCR and Western blotting. To manipulate the expression of HOXA7, the HOXA7 specific siRNA was used to knockdown HOXA7 in KGN. Conversely, HOXA7 was overexpressed in SVOG by transfection with the pcDNA3.1-HOAX7 vector. Cell proliferation was measured by the MTT assay. Results Our results show that HOXA7 and EGFR were overexpressed in KGN cells compared to hGCs and SVOG cells. Knockdown of HOXA7 in KGN cells significantly decreased cell proliferation and EGFR expression. Overexpression of HOXA7 in SVOG cells significantly promoted cell growth and EGFR expression. Moreover, the EGF-induced KGN proliferation was abrogated, and the activation of downstream signaling was diminished when HOXA7 was knocked down. Overexpression of HOXA7 in SVOG cells had an opposite effect. Conclusions Our present study reveals a novel mechanistic role for HOXA7 in modulating granulosa cell proliferation via the regulation of EGFR. This finding contributes to the knowledge of the pro-proliferation effect of HOXA7 in granulosa cell growth and differentiation.

  5. Cellular processes involved in human epidermal cells exposed to extremely low frequency electric fields.

    Science.gov (United States)

    Collard, J-F; Hinsenkamp, M

    2015-05-01

    We observed on different tissues and organisms a biological response after exposure to pulsed low frequency and low amplitude electric or electromagnetic fields but the precise mechanism of cell response remains unknown. The aim of this publication is to understand, using bioinformatics, the biological relevance of processes involved in the modification of gene expression. The list of genes analyzed was obtained after microarray protocol realized on cultures of human epidermal explants growing on deepidermized human skin exposed to a pulsed low frequency electric field. The directed acyclic graph on a WebGestalt Gene Ontology module shows six categories under the biological process root: "biological regulation", "cellular process", "cell proliferation", "death", "metabolic process" and "response to stimulus". Enriched derived categories are coherent with the type of in vitro culture, the stimulation protocol or with the previous results showing a decrease of cell proliferation and an increase of differentiation. The Kegg module on WebGestalt has highlighted "cell cycle" and "p53 signaling pathway" as significantly involved. The Kegg website brings out interactions between FoxO, MAPK, JNK, p53, p38, PI3K/Akt, Wnt, mTor or NF-KappaB. Some genes expressed by the stimulation are known to have an exclusive function on these pathways. Analyses performed with Pathway Studio linked cell proliferation, cell differentiation, apoptosis, cell cycle, mitosis, cell death etc. with our microarrays results. Medline citation generated by the software and the fold change variation confirms a diminution of the proliferation, activation of the differentiation and a less well-defined role of apoptosis or wound healing. Wnt and DKK functional classes, DKK1, MACF1, ATF3, MME, TXNRD1, and BMP-2 genes proposed in previous publications after a manual analysis are also highlighted with other genes after Pathway Studio automatic procedure. Finally, an analysis conducted on a list of genes

  6. UVA-induced immune suppression in human skin: protective effect of vitamin E in human epidermal cells in vitro

    International Nuclear Information System (INIS)

    Clement-Lacroix, P.; Michel, L.; Moysan, A.; Morliere, P.; Dubertret, L.

    1996-01-01

    UVA (320-400 nm) radiation damage to membranes, proteins, DNA and other cellular targets is predominantly related to oxidative processes. In the present study, we demonstrated that cutaneous UVA-induced immunosuppression can be related, at least in part, to the appearance of these oxidative processes. The UVA-induced oxidative processes in freshly isolated epidermal cells were monitored by measuring the thiobarbituric acid reactive substances (TBARS) as an index of peroxidation. The in vitro immunosuppressive effects of UVA were demonstrated by measuring the allogenic lymphocyte proliferation induced by epidermal cells or purified Langerhans cells in the mixed epidermal cell-lymphocyte reaction (MECLR). In addition, the effects of a potent antioxidant (vitamin E) on these two UVA-induced processes were analysed. (author)

  7. Biochemistry of epidermal stem cells.

    Science.gov (United States)

    Eckert, Richard L; Adhikary, Gautam; Balasubramanian, Sivaprakasam; Rorke, Ellen A; Vemuri, Mohan C; Boucher, Shayne E; Bickenbach, Jackie R; Kerr, Candace

    2013-02-01

    The epidermis is an important protective barrier that is essential for maintenance of life. Maintaining this barrier requires continuous cell proliferation and differentiation. Moreover, these processes must be balanced to produce a normal epidermis. The stem cells of the epidermis reside in specific locations in the basal epidermis, hair follicle and sebaceous glands and these cells are responsible for replenishment of this tissue. A great deal of effort has gone into identifying protein epitopes that mark stem cells, in identifying stem cell niche locations, and in understanding how stem cell populations are related. We discuss these studies as they apply to understanding normal epidermal homeostasis and skin cancer. An assortment of stem cell markers have been identified that permit assignment of stem cells to specific regions of the epidermis, and progress has been made in understanding the role of these cells in normal epidermal homeostasis and in conditions of tissue stress. A key finding is the multiple stem cell populations exist in epidermis that give rise to different structures, and that multiple stem cell types may contribute to repair in damaged epidermis. Understanding epidermal stem cell biology is likely to lead to important therapies for treating skin diseases and cancer, and will also contribute to our understanding of stem cells in other systems. This article is part of a Special Issue entitled Biochemistry of Stem Cells. Copyright © 2012 Elsevier B.V. All rights reserved.

  8. Rho A Regulates Epidermal Growth Factor-Induced Human Osteosarcoma MG63 Cell Migration

    Directory of Open Access Journals (Sweden)

    Jinyang Wang

    2018-05-01

    Full Text Available Osteosarcoma, the most common primary bone tumor, occurs most frequently in children and adolescents and has a 5-year survival rate, which is unsatisfactory. As epidermal growth factor receptor (EGFR positively correlates with TNM (tumor-node-metastasis stage in osteosarcoma, EGFR may play an important role in its progression. The purpose of this study was to explore potential mechanisms underlying this correlation. We found that EGF promotes MG63 cell migration and invasion as well as stress fiber formation via Rho A activation and that these effects can be reversed by inhibiting Rho A expression. In addition, molecules downstream of Rho A, including ROCK1, LIMK2, and Cofilin, are activated by EGF in MG63 cells, leading to actin stress fiber formation and cell migration. Moreover, inhibition of ROCK1, LIMK2, or Cofilin in MG63 cells using known inhibitors or short hairpin RNA (shRNA prevents actin stress fiber formation and cell migration. Thus, we conclude that Rho A/ROCK1/LIMK2/Cofilin signaling mediates actin microfilament formation in MG63 cells upon EGFR activation. This novel pathway provides a promising target for preventing osteosarcoma progression and for treating this cancer.

  9. Protein kinase C is differentially regulated by thrombin, insulin, and epidermal growth factor in human mammary tumor cells

    Energy Technology Data Exchange (ETDEWEB)

    Gomez, M.L.; Tellez-Inon, M.T. (Instituto de Ingenieria Genetica y Biologia Molecular, Buenos Aires (Argentina)); Medrano, E.E.; Cafferatta, E.G.A. (Instituto de Investigaciones Bioquimicas Fundacion Campomar, Buenos Aires (Argentina))

    1988-03-01

    The exposure of serum-deprived mammary tumor cells MCF-7 and T-47D to insulin, thrombin, and epidermal growth factor (EGF) resulted in dramatic modifications in the activity and in the translocation capacity of protein kinase C from cytosol to membrane fractions. Insulin induces a 600% activation of the enzyme after 5 h of exposure to the hormone in MCF-7 cells; thrombin either activates (200% in MCF-7) or down-regulates (in T-47D), and EGF exerts only a moderate effect. Thus, the growth factors studied modulate differentially the protein kinase C activity in human mammary tumor cells. The physiological significance of the results obtained are discussed in terms of the growth response elicited by insulin, thrombin, and EGF.

  10. Pattern of distribution of blood group antigens on human epidermal cells during maturation

    DEFF Research Database (Denmark)

    Dabelsteen, Erik; Buschard, Karsten; Hakomori, Sen-Itiroh

    1984-01-01

    The distribution in human epidermis of A, B, and H blood group antigens and of a precursor carbohydrate chain, N-acetyl-lactosamine, was examined using immunofluorescence staining techniques. The material included tissue from 10 blood group A, 4 blood group B, and 9 blood group O persons. Murine...... on the lower spinous cells whereas H antigen was seen predominantly on upper spinous cells or on the granular cells. Epithelia from blood group A or B persons demonstrated A or B antigens, respectively, but only if the tissue sections were trypsinized before staining. In such cases A or B antigens were found...... monoclonal antibodies were used to identify H antigen (type 2 chain) and N-acetyl-lactosamine. Human antisera were used to identify A and B antigens. In all groups N-acetyl-lactosamine and H antigen were found on the cell membranes of the spinous cell layer. N-acetyl-lactosamine was present mainly...

  11. Polymeric membranes modulate human keratinocyte differentiation in specific epidermal layers.

    Science.gov (United States)

    Salerno, Simona; Morelli, Sabrina; Giordano, Francesca; Gordano, Amalia; Bartolo, Loredana De

    2016-10-01

    In vitro models of human bioengineered skin substitutes are an alternative to animal experimentation for testing the effects and toxicity of drugs, cosmetics and pollutants. For the first time specific and distinct human epidermal strata were engineered by using membranes and keratinocytes. To this purpose, biodegradable membranes of chitosan (CHT), polycaprolactone (PCL) and a polymeric blend of CHT-PCL were prepared by phase-inversion technique and characterized in order to evaluate their morphological, physico-chemical and mechanical properties. The capability of membranes to modulate keratinocyte differentiation inducing specific interactions in epidermal membrane systems was investigated. The overall results demonstrated that the membrane properties strongly influence the cell morpho-functional behaviour of human keratinocytes, modulating their terminal differentiation, with the creation of specific epidermal strata or a fully proliferative epidermal multilayer system. In particular, human keratinocytes adhered on CHT and CHT-PCL membranes, forming the structure of the epidermal top layers, such as the corneum and granulosum strata, characterized by withdrawal or reduction from the cell cycle and cell proliferation. On the PCL membrane, keratinocytes developed an epidermal basal lamina, with high proliferating cells that stratified and migrated over time to form a complete differentiating epidermal multilayer system. Copyright © 2016 Elsevier B.V. All rights reserved.

  12. Epidermal stem cells: location, potential and contribution to cancer.

    Science.gov (United States)

    Ambler, C A; Määttä, A

    2009-01-01

    Epidermal stem cells have been classically characterized as slow-cycling, long-lived cells that reside in discrete niches in the skin. Gene expression studies of niche-resident cells have revealed a number of stem cell markers and regulators, including the Wnt/beta-catenin, Notch, p63, c-Myc and Hedgehog pathways. A new study challenges the traditional developmental paradigm of slow-cycling stem cells and rapid-cycling transit amplifying cells in some epidermal regions, and there is mounting evidence to suggest that multi-lineage epidermal progenitors can be isolated from highly proliferative, non-niche regions. Whether there is a unique microenvironment surrounding these progenitors remains to be determined. Interestingly, cancer stem cells derived from epidermal tumours exist independent of the classic skin stem cell niche, yet also have stem cell properties, including multi-lineage differentiation. This review summarizes recent studies identifying the location and regulators of mouse and human epidermal stem cells and highlights the strategies used to identify cancer stem cells, including expression of normal epidermal stem cell markers, expression of cancer stem cell markers identified in other epidermal tumours and characterization of side-population tumour cells.

  13. Herceptin Enhances the Antitumor Effect of Natural Killer Cells on Breast Cancer Cells Expressing Human Epidermal Growth Factor Receptor-2

    Directory of Open Access Journals (Sweden)

    Xiao Tian

    2017-10-01

    Full Text Available Optimal adoptive cell therapy (ACT should contribute to effective cancer treatment. The unique ability of natural killer (NK cells to kill cancer cells independent of major histocompatibility requirement makes them suitable as ACT tools. Herceptin, an antihuman epidermal growth factor receptor-2 (anti-HER2 monoclonal antibody, is used to treat HER2+ breast cancer. However, it has limited effectiveness and possible severe cardiotoxicity. Given that Herceptin may increase the cytotoxicity of lymphocytes, we explored the possible augmentation of NK cell cytotoxicity against HER2+ breast cancer cells by Herceptin. We demonstrated that Herceptin could interact with CD16 on NK cells to expand the cytotoxic NK (specifically, CD56dim cell population. Additionally, Herceptin increased NK cell migration and cytotoxicity against HER2+ breast cancer cells. In a pilot study, Herceptin-treated NK cells shrunk lung nodular metastasis in a woman with HER2+ breast cancer who could not tolerate the cardiotoxic side effects of Herceptin. Our findings support the therapeutic potential of Herceptin-treated NK cells in patients with HER2+ and Herceptin-intolerant breast cancer.

  14. Effects of recombinant human epidermal growth factor on the proliferation and radiation survival of human fibroblast cell lines in vitro

    International Nuclear Information System (INIS)

    Kim, Hyun Sook; Kang, Ki Mun; Na, Jae Boem; Chai, Gyu Young; Lee, Sang Wook

    2006-01-01

    To explore the effect of recombinant human EGF on the proliferation and survival of human fibroblast cell lines following irradiation. Fibroblast was originated human skin and primary cultured. The trypan blue stain assay and MTT assay were used to study the proliferative effects of EGF on human fibroblast cell lines in vitro. An incubation of fibroblasts with rhEGF for 24 hours immediately after irradiation was counted everyday. Cell cycle distributions were analyzed by FACS analysis. Number of fibroblast was significant more increased rhEGF (1.0 nM, 10 nM, 100 nM, 1,000 nM) treated cell than control after 8 Gy irradiation. Most effective dose of rhEGF was at 160 nM. These survival differences were maintained at 1 week later. Proportion of S phase was significantly increased on rhEGF treated cells. rhEGF cause increased fibroblast proliferation following irradiation. We expect that rhEGF was effective for radiation induced wound healing

  15. Mannosides as crucial part of bioactive supports for cultivation of human epidermal keratinocytes without feeder cells

    Czech Academy of Sciences Publication Activity Database

    Labský, Jiří; Dvořánková, B.; Smetana, Karel; Holíková, Z.; Brož, L.; Gabius, H.J.

    2003-01-01

    Roč. 24, č. 5 (2003), s. 863-872 ISSN 0142-9612 R&D Projects: GA ČR GA203/00/1310; GA MŠk LN00A065; GA MZd ND6340 Institutional research plan: CEZ:AV0Z4050913 Keywords : cell therapy * keratinocyte * mannose Subject RIV: CD - Macromolecular Chemistry Impact factor: 2.903, year: 2003

  16. Specific receptors for epidermal growth factor in human bone tumour cells and its effect on synthesis of prostaglandin E2 by cultured osteosarcoma cell line

    International Nuclear Information System (INIS)

    Hirata, Y.; Uchihashi, M.; Nakashima, H.; Fujita, T.; Matsukura, S.; Matsui, K.

    1984-01-01

    Using tumour cell lines derived from human bone tumours, specific binding sites for epidermal growth factor (EGF), a potent growth stimulator in many tissues, and its effect on synthesis of prostaglandin (PG) E 2 , a potent bone-resorbing factor, by cultured osteosarcoma cell line were studied. Three tumour cell lines, one osteosarcoma (HOSO) and two giant cell tumours of the bone (G-1 and G-2), all possessed specific binding sites for 125 I-labelled EGF: the apparent dissociation constant was approximately 4-10 x 10 -10 M and the maximal binding capacity was 50 000-80 000 sites/cell. EGF had no mitogenic effect in these cell lines. However, these cell lines did not have specific binding sites for 125 I-labelled parathyroid hormone (PTH) or calcitonin. HOSO line produced and secreted PGE 2 into medium, while no significant amount of PGE 2 was demonstrated in G-1 or G-2 line. EGF significantly stimulated PGE 2 production in HOSO line in a dose-dependent manner (0.5-50 ng/ml); its stimulatory effect was completely abolished by indomethacin, an inhibitor of PG biosynthesis. Exogenous PGE 1 significantly stimulated cyclic AMP formation in HOSO line, whereas PGFsub(2α) PTH, calcitonin, or EGF had no effect. None of these calcium-regulating hormones affected cyclic AMP generation in either G-1 of G-2 line. These data indicate that human bone tumour cells have specific EGF receptors unrelated to cell growth, and suggest that EGF may be involved in bone resorption through a PGE 2 -mediated process in human osseous tissues. (author)

  17. Use of a collagen-elastin matrix as transport carrier system to transfer proliferating epidermal cells to human dermis in vitro.

    Science.gov (United States)

    Waaijman, Taco; Breetveld, Melanie; Ulrich, Magda; Middelkoop, Esther; Scheper, Rik J; Gibbs, Susan

    2010-01-01

    This in vitro study describes a novel cell culture, transport, and transfer protocol that may be highly suitable for delivering cultured proliferating keratinocytes and melanocytes to large open skin wounds (e.g., burns). We have taken into account previous limitations identified using other keratinocyte transfer techniques, such as regulatory issues, stability of keratinocytes during transport (single cell suspensions undergo terminal differentiation), ease of handling during application, and the degree of epidermal blistering resulting after transplantation (both related to transplanting keratinocyte sheets). Large numbers of proliferating epidermal cells (EC) (keratinocytes and melanocytes) were generated within 10-14 days and seeded onto a three-dimensional matrix composed of elastin and collagen types I, III, and V (Matriderm®), which enabled easy and stable transport of the EC for up to 24 h under ambient conditions. All culture conditions were in accordance with the regulations set by the Dutch Central Committee on Research Involving Human Subjects (CCMO). As an in vitro model system for clinical in vivo transfer, the EC were then transferred from Matriderm onto human acellular dermis during a period of 3 days. After transfer the EC maintained the ability to regenerate into a fully differentiated epidermis containing melanocytes on the human dermis. Proliferating keratinocytes were located in the basal layer and keratin-10 expression was located in differentiating suprabasal layers similar to that found in human epidermis. No blistering was observed (separation of the epidermis from the basement membrane). Keratin-6 expression was strongly upregulated in the regenerating epidermis similar to normal wound healing. In summary, we show that EC-Matriderm contains viable, metabolically active keratinocytes and melanocytes cultured in a manner that permits easy transportation and contains epidermal cells with the potential to form a pigmented reconstructed

  18. Establishment and characterization of a new cell line, FPS-1, derived from human undifferentiated pleomorphic sarcoma, overexpressing epidermal growth factor receptor and cyclooxygenase-2.

    Science.gov (United States)

    Hakozaki, Michiyuki; Hojo, Hiroshi; Sato, Michiko; Tajino, Takahiro; Yamada, Hitoshi; Kikuchi, Shinichi; Abe, Masafumi

    2006-01-01

    Undifferentiated pleomorphic sarcoma (UPS) is among the most common soft tissue sarcomas in adults. In order to improve its aggressive course or prognosis and establish new therapeutic methods, molecular genetic and biological characterizations of UPS are required. A new human UPS cell line (FPS-1) was established from UPS of the upper arm of a 79-year-old man. The cell line has been maintained for over 14 months with more than 60 passages. FPS-1 cells were characterized using molecular biological methods. FPS-1 cells showed the same morphological and immunophenotypical characteristics as the primary tumor. Cytogenetic and molecular analyses revealed a nonsense mutation in exon 6 of the p53 gene. Epidermal growth factor receptor (EGFR) and cyclooxygenase-2 (COX-2) were expressed in FPS-1 cells. FPS-1 cells might be useful for investigating biological behavior and developing new molecular targeting antitumor drugs for UPS with EGFR or COX-2 expression.

  19. Altered growth, differentiation, and responsiveness to epidermal growth factor of human embryonic mesenchymal cells of palate by persistent rubella virus infection

    International Nuclear Information System (INIS)

    Yoneda, T.; Urade, M.; Sakuda, M.; Miyazaki, T.

    1986-01-01

    We previously demonstrated that human embryonic mesenchymal cells derived from the palate (HEMP cells) retain alkaline phosphatase (ALP) content and capacity for collagen synthesis after long-term culture, and their growth is markedly stimulated by epidermal growth factor (EGF). There was a dramatic decrease in ALP content and capacity to synthesize collagen in HEMP cells (HEMP-RV cells) persistently infected with rubella virus (RV). EGF increased ALP activity and decreased collagen synthesis in HEMP cells, whereas EGF showed no effect on these activities in HEMP-RV cells. Growth of HEMP-RV cells was slightly reduced compared with that of HEMP cells. EGF stimulated growth of HEMP cells and to a lesser extent of HEMP-RV cells. Binding of 125 I-EGF to cell-surface receptors in HEMP-RV cells was, to our surprise, twice as much as that in HEMP cells. However, internalization of bound 125 I-EGF in HEMP-RV cells was profoundly diminished. Thus, persistent RV infection causes not only changes in HEMP cell growth and differentiation but a decrease in or loss of HEMP cell responsiveness to EGF. The effects of persistent RV infection on palatal cell differentiation as well as growth may be responsible for the pathogenesis of congenital rubella. Furthermore, since HEMP cells appear to be closely related to osteoblasts, these results suggest a mechanism for RV-induced osseous abnormalities manifested in congenital rubella patients

  20. GEP100/Arf6 is required for epidermal growth factor-induced ERK/Rac1 signaling and cell migration in human hepatoma HepG2 cells.

    Directory of Open Access Journals (Sweden)

    ZhenZhen Hu

    Full Text Available BACKGROUND: Epidermal growth factor (EGF signaling is implicated in the invasion and metastasis of hepatoma cells. However, the signaling pathways for EGF-induced motility of hepatoma cells remain undefined. METHODOLOGY/PRINCIPAL FINDINGS: We found that EGF dose-dependently stimulated the migration of human hepatoma cells HepG2, with the maximal effect at 10 ng/mL. Additionally, EGF increased Arf6 activity, and ectopic expression of Arf6 T27N, a dominant negative Arf6 mutant, largely abolish EGF-induced cell migration. Blocking GEP100 with GEP100 siRNA or GEP100-△PH, a pleckstrin homology (PH domain deletion mutant of GEP100, blocked EGF-induced Arf6 activity and cell migration. EGF also increased ERK and Rac1 activity. Ectopic expression GEP100 siRNA, GEP100-△PH, or Arf6-T27N suppressed EGF-induced ERK and Rac1 activity. Furthermore, blocking ERK signaling with its inhibitor U0126 remarkably inhibited both EGF-induced Rac1 activation as well as cell migration, and ectopic expression of inactive mutant form of Rac1 (Rac1-T17N also largely abolished EGF-induced cell migration. CONCLUSIONS/SIGNIFICANCE: Taken together, this study highlights the function of the PH domain of GEP100 and its regulated Arf6/ERK/Rac1 signaling cascade in EGF-induced hepatoma cell migration. These findings could provide a rationale for designing new therapy based on inhibition of hepatoma metastasis.

  1. Suppression of the epidermal growth factor receptor inhibits epithelial-mesenchymal transition in human pancreatic cancer PANC-1 cells.

    Science.gov (United States)

    Chang, Zhi-Gang; Wei, Jun-Min; Qin, Chang-Fu; Hao, Kun; Tian, Xiao-Dong; Xie, Kun; Xie, Xue-Hai; Yang, Yin-Mo

    2012-05-01

    Aberrant expression of epidermal growth factor receptor (EGFR) has been detected in pancreatic cancer; however, the mechanisms of EGFR in inducing pancreatic cancer development have not been adequately elucidated. The objective of this study was to determine the role of EGFR in mediating epithelial-mesenchymal transition (EMT) in pancreatic cancer cells. Pancreatic cancer cell line PANC-1 was transfected with small interfering RNA of EGFR by use of a lentiviral expression vector to establish an EGFR-knockdown cell line (si-PANC-1). PANC-1 cells transfected with lentiviral vector expressing negative control sequence were used as negative control (NC-PANC-1). Scratch assay and transwell study were used to analyze cell migration and invasion. Real-time PCR and Western blotting were used to detect the expression of EMT markers E-cadherin, N-cadherin, vimentin, and fibronectin and transcription factors snail, slug, twist1, and sip1 in PANC-1, NC-PANC-1, and si-PANC-1 cells. Immunofluorescent staining with these antibodies and confocal microscopy were used to observe their cellular location and morphologic changes. After RNA interference of EGFR, the migration and invasion ability of si-PANC-1 cells decreased significantly. The expression of epithelial phenotype marker E-cadherin increased and the expression of mesenchymal phenotype markers N-cadherin, vimentin, and fibronectin decreased, indicating reversion of EMT. We also observed intracellular translocation of E-cadherin. Expression of transcription factors snail and slug in si-PANC-1 cells decreased significantly. Suppression of EGFR expression can significantly inhibit EMT of pancreatic cancer PANC-1 cells. The mechanism may be related with the down-regulation of the expression of transcription factors snail and slug.

  2. Epidermal cell death in frogs with chytridiomycosis

    Directory of Open Access Journals (Sweden)

    Laura A. Brannelly

    2017-02-01

    Full Text Available Background Amphibians are declining at an alarming rate, and one of the major causes of decline is the infectious disease chytridiomycosis. Parasitic fungal sporangia occur within epidermal cells causing epidermal disruption, but these changes have not been well characterised. Apoptosis (planned cell death can be a damaging response to the host but may alternatively be a mechanism of pathogen removal for some intracellular infections. Methods In this study we experimentally infected two endangered amphibian species Pseudophryne corroboree and Litoria verreauxii alpina with the causal agent of chytridiomycosis. We quantified cell death in the epidermis through two assays: terminal transferase-mediated dUTP nick end-labelling (TUNEL and caspase 3/7. Results Cell death was positively associated with infection load and morbidity of clinically infected animals. In infected amphibians, TUNEL positive cells were concentrated in epidermal layers, correlating to the localisation of infection within the skin. Caspase activity was stable and low in early infection, where pathogen loads were light but increasing. In animals that recovered from infection, caspase activity gradually returned to normal as the infection cleared. Whereas, in amphibians that did not recover, caspase activity increased dramatically when infection loads peaked. Discussion Increased cell death may be a pathology of the fungal parasite, likely contributing to loss of skin homeostatic functions, but it is also possible that apoptosis suppression may be used initially by the pathogen to help establish infection. Further research should explore the specific mechanisms of cell death and more specifically apoptosis regulation during fungal infection.

  3. Cultivation and irradiation of human fibroblasts in a medium enriched with platelet lysate for obtaining feeder layer in epidermal cell culture

    International Nuclear Information System (INIS)

    Yoshito, Daniele

    2011-01-01

    For over 30 years, the use of culture medium, enriched with bovine serum, and murines fibroblasts, with the rate of proliferation controlled by irradiation or by share anticarcinogenic drugs, has been playing successfully its role in assisting in the development of keratinocytes in culture, for clinical purposes. However, currently there is a growing concern about the possibility of transmitting prions and animals viruses to transplanted patients. Taking into account this concern, the present work aims to cultivate human fibroblasts in a medium enriched with human platelets lysate and determine the irradiation dose of these cells, for obtaining feeder layer in epidermal cell culture. For carrying out the proposed objective, platelets lysis has standardized, this lysate was used for human fibroblasts cultivation and the irradiation dose enough to inhibit its duplication was evaluated. Human keratinocytes were cultivated in these feeder layers, in culture medium enriched with the lysate. With these results we conclude that the 10% platelets lysate promoted a better adhesion and proliferation of human fibroblasts and in all dose levels tested (60 to 300 Gy), these had their mitotic activity inactivated by ionizing irradiation, being that the feeder layers obtained with doses from 70 to 150 Gy were those that provided the best development of keratinocytes in medium containing 2.5% of human platelet lysate. Therefore, it was possible to standardize both the cultivation of human fibroblasts as its inactivation for use as feeder layer in culture of keratinocytes, so as to eliminate xenobiotics components. (author)

  4. INHIBITION OF PROTEIN TYROSINE PHOSPHATASE ACTIVITY MEDIATES EPIDERMAL GROWTH FACTOR RECEPTOR SIGNALING IN HUMAN AIRWAY EPITHELIAL CELLS

    Science.gov (United States)

    Epidemiological studies have implicated zinc in the toxicity of ambient particulate matter (PM) inhalation. We previously showed that exposure to metal-laden PM inhibits protein tyrosine phosphatase (PTP) activity in human primary bronchial epithelial cells (HAEC) and leads t...

  5. The epidermal growth factor-like domains of the human EMR2 receptor mediate cell attachment through chondroitin sulfate glycosaminoglycans

    NARCIS (Netherlands)

    Stacey, Martin; Chang, Gin-Wen; Davies, John Q.; Kwakkenbos, Mark J.; Sanderson, Ralph D.; Hamann, Jörg; Gordon, Siamon; Lin, Hsi-Hsien

    2003-01-01

    Using multivalent protein probes, an evolutionarily conserved endogenous ligand for EMR2, a human myeloid cell-restricted EGF-TM7 receptor, was identified on the surface of a number of adherent cell lines. In addition, in situ staining of the ligand has revealed specific in vivo patterns consistent

  6. Human corpus luteum: presence of epidermal growth factor receptors and binding characteristics

    International Nuclear Information System (INIS)

    Ayyagari, R.R.; Khan-Dawood, F.S.

    1987-01-01

    Epidermal growth factor receptors are present in many reproductive tissues but have not been demonstrated in the human corpus luteum. To determine the presence of epidermal growth factor receptors and its binding characteristics, we carried out studies on the plasma cell membrane fraction of seven human corpora lutea (days 16 to 25) of the menstrual cycle. Specific epidermal growth factor receptors were present in human corpus luteum. Insulin, nerve growth factor, and human chorionic gonadotropin did not competitively displace epidermal growth factor binding. The optimal conditions for corpus luteum-epidermal growth factor receptor binding were found to be incubation for 2 hours at 4 degrees C with 500 micrograms plasma membrane protein and 140 femtomol 125 I-epidermal growth factor per incubate. The number (mean +/- SEM) of epidermal growth factor binding sites was 12.34 +/- 2.99 X 10(-19) mol/micrograms protein; the dissociation constant was 2.26 +/- 0.56 X 10(-9) mol/L; the association constant was 0.59 +/- 0.12 X 10(9) L/mol. In two regressing corpora lutea obtained on days 2 and 3 of the menstrual cycle, there was no detectable specific epidermal growth factor receptor binding activity. Similarly no epidermal growth factor receptor binding activity could be detected in ovarian stromal tissue. Our findings demonstrate that specific receptors for epidermal growth factor are present in the human corpus luteum. The physiologic significance of epidermal growth factor receptors in human corpus luteum is unknown, but epidermal growth factor may be involved in intragonadal regulation of luteal function

  7. Epidermal cell-shape regulation and subpopulation kinetics during butyrate-induced terminal maturation of normal and SV40-transformed human keratinocytes: epithelial models of differentiation therapy.

    Science.gov (United States)

    Staiano-Coico, L; Steinberg, M; Higgins, P J

    1990-10-15

    Recent data indicate that malignant human epidermal cells may be appropriate targets for sodium butyrate (NaB)-mediated differentiation therapy. The response of pre- and post-crisis populations of SV40-transformed human keratinocytes (SVKs) to this differentiation-inducing agent was assessed, therefore, within the framework of NaB-directed normal human keratinocyte (NHK) maturation. NaB augmented cornified envelope (CE) production in NHK and pre-crisis SVK cultures; the time-course and efficiency of induced maturation were similar in the 2 cell systems. In NHKs, the percentage of amplifying ("B" substate) cells decreased with time in NaB correlating with increases in both "C" stage keratinocytes and CEs. The latter formed over one or 2 layers of nucleated basal-like cells. Inductions were accompanied by immediate cell cycle blocks (in both the G1 and G2/M phases), reorganization within the actin cytoskeleton, and transient early increases in cellular actin content. Increased NHK and pre-crisis SVK cytoskeletal-associated actin reached a maximum approximately 48 hr after NaB addition and preceded development of CEs. The CE precursors, thus, probably reside in the "B" substate. Post-crisis SVKs, in contrast, were refractive to NaB-induced terminal maturation or cell-cycle perturbation, failed to initiate actin filament rearrangements, and retained a basal cell-like phenotype. Stable transformation of human SVKs in post-crisis phase, therefore, appears to be associated with loss of maturation "competence" within the "B" keratinocyte subpopulation.

  8. Epidermal growth factor receptor signalling in human breast cancer cells operates parallel to estrogen receptor α signalling and results in tamoxifen insensitive proliferation

    International Nuclear Information System (INIS)

    Moerkens, Marja; Zhang, Yinghui; Wester, Lynn; Water, Bob van de; Meerman, John HN

    2014-01-01

    Tamoxifen resistance is a major problem in the treatment of estrogen receptor (ER) α -positive breast cancer patients. Although the mechanisms behind tamoxifen resistance are still not completely understood, clinical data suggests that increased expression of receptor tyrosine kinases is involved. Here, we studied the estrogen and anti-estrogen sensitivity of human breast cancer MCF7 cells that have a moderate, retroviral-mediated, ectopic expression of epidermal growth factor receptor (MCF7-EGFR). Proliferation of MCF7-EGFR and parental cells was induced by 17β-estradiol (E2), epidermal growth factor (EGF) or a combination of these. Inhibition of proliferation under these conditions was investigated with 4-hydroxy-tamoxifen (TAM) or fulvestrant at 10 -12 to 10 -6 M. Cells were lysed at different time points to determine the phosphorylation status of EGFR, MAPK 1/3 , AKT and the expression of ERα. Knockdown of target genes was established using smartpool siRNAs. Transcriptomics analysis was done 6 hr after stimulation with growth factors using Affymetrix HG-U133 PM array plates. While proliferation of parental MCF7 cells could only be induced by E2, proliferation of MCF7-EGFR cells could be induced by either E2 or EGF. Treatment with TAM or fulvestrant did significantly inhibit proliferation of MCF7-EGFR cells stimulated with E2 alone. EGF treatment of E2/TAM treated cells led to a marked cell proliferation thereby overruling the anti-estrogen-mediated inhibition of cell proliferation. Under these conditions, TAM however did still inhibit ERα- mediated transcription. While siRNA-mediated knock-down of EGFR inhibited the EGF- driven proliferation under TAM/E2/EGF condition, knock down of ERα did not. The TAM resistant cell proliferation mediated by the conditional EGFR-signaling may be dependent on the PI3K/Akt pathway but not the MEK/MAPK pathway, since a MEK inhibitor (U0126), did not block the proliferation. Transcriptomic analysis under the various E2/TAM

  9. Concurrent Autophagy Inhibition Overcomes the Resistance of Epidermal Growth Factor Receptor Tyrosine Kinase Inhibitors in Human Bladder Cancer Cells.

    Science.gov (United States)

    Kang, Minyong; Lee, Kyoung-Hwa; Lee, Hye Sun; Jeong, Chang Wook; Kwak, Cheol; Kim, Hyeon Hoe; Ku, Ja Hyeon

    2017-02-04

    Despite the potential therapeutic efficacy of epithelial growth factor receptor (EGFR) inhibitors in the treatment of advanced stage bladder cancer, there currently is no clear evidence to support this hypothesis. In this study, we investigate whether the concurrent treatment of autophagy-blocking agents with EGFR inhibitors exerts synergistic anti-cancer effects in T24 and J82 human bladder cancer cells. Lapatinib and gefitinib were used as EGFR inhibitors, and bafilomycin A1 (BFA1), chloroquine (CQ) and 3-methyladenine (3-MA) were used as the pharmacologic inhibitors of autophagy activities. To assess the proliferative and self-renewal capabilities, the Cell Counting Kit-8 (CCK-8) assay and a clonogenic assay were performed, respectively. To examine apoptotic cell death, flow cytometry using annexin-V/propidium iodide (PI) was used. To measure the autophagy activities, the expression levels of LC3I and II was determined by Western blot analysis. To validate the synergistic effects of autophagy inhibition with EGFR inhibitors, we specifically blocked key autophagy regulatory gene ATG12 by transfection of small interference RNA and examined the phenotypic changes. Of note, lapatinib and gefitinib triggered autophagy activities in T24 and J82 human bladder cancer cells, as indicated by upregulation of LC3II. More importantly, inhibiting autophagy activities with pharmacologic inhibitors (BFA1, CQ or 3-MA) remarkably reduced the cell viabilities and clonal proliferation of T24 and J82 cells, compared to those treated with either of the agents alone. We also obtained similar results of the enhanced anti-cancer effects of EGFR inhibitors by suppressing the expression of ATG12. Notably, the apoptotic assay showed that synergistic anti-cancer effects were induced via the increase of apoptotic cell death. In summary, concomitant inhibition of autophagy activities potentiated the anti-cancer effects of EGFR inhibitors in human bladder cancer cells, indicating a novel

  10. Concurrent Autophagy Inhibition Overcomes the Resistance of Epidermal Growth Factor Receptor Tyrosine Kinase Inhibitors in Human Bladder Cancer Cells

    Directory of Open Access Journals (Sweden)

    Minyong Kang

    2017-02-01

    Full Text Available Despite the potential therapeutic efficacy of epithelial growth factor receptor (EGFR inhibitors in the treatment of advanced stage bladder cancer, there currently is no clear evidence to support this hypothesis. In this study, we investigate whether the concurrent treatment of autophagy-blocking agents with EGFR inhibitors exerts synergistic anti-cancer effects in T24 and J82 human bladder cancer cells. Lapatinib and gefitinib were used as EGFR inhibitors, and bafilomycin A1 (BFA1, chloroquine (CQ and 3-methyladenine (3-MA were used as the pharmacologic inhibitors of autophagy activities. To assess the proliferative and self-renewal capabilities, the Cell Counting Kit-8 (CCK-8 assay and a clonogenic assay were performed, respectively. To examine apoptotic cell death, flow cytometry using annexin-V/propidium iodide (PI was used. To measure the autophagy activities, the expression levels of LC3I and II was determined by Western blot analysis. To validate the synergistic effects of autophagy inhibition with EGFR inhibitors, we specifically blocked key autophagy regulatory gene ATG12 by transfection of small interference RNA and examined the phenotypic changes. Of note, lapatinib and gefitinib triggered autophagy activities in T24 and J82 human bladder cancer cells, as indicated by upregulation of LC3II. More importantly, inhibiting autophagy activities with pharmacologic inhibitors (BFA1, CQ or 3-MA remarkably reduced the cell viabilities and clonal proliferation of T24 and J82 cells, compared to those treated with either of the agents alone. We also obtained similar results of the enhanced anti-cancer effects of EGFR inhibitors by suppressing the expression of ATG12. Notably, the apoptotic assay showed that synergistic anti-cancer effects were induced via the increase of apoptotic cell death. In summary, concomitant inhibition of autophagy activities potentiated the anti-cancer effects of EGFR inhibitors in human bladder cancer cells, indicating

  11. Oral mucosa: an alternative epidermic cell source to develop autologous dermal-epidermal substitutes from diabetic subjects

    Directory of Open Access Journals (Sweden)

    Daniela GUZMÁN-URIBE

    Full Text Available Abstract Oral mucosa has been highlighted as a suitable source of epidermal cells due to its intrinsic characteristics such as its higher proliferation rate and its obtainability. Diabetic ulcers have a worldwide prevalence that is variable (1%-11%, meanwhile treatment of this has been proven ineffective. Tissue-engineered skin plays an important role in wound care focusing on strategies such autologous dermal-epidermal substitutes. Objective The aim of this study was to obtain autologous dermal-epidermal skin substitutes from oral mucosa from diabetic subjects as a first step towards a possible clinical application for cases of diabetic foot. Material and Methods Oral mucosa was obtained from diabetic and healthy subjects (n=20 per group. Epidermal cells were isolated and cultured using autologous fibrin to develop dermal-epidermal in vitro substitutes by the air-liquid technique with autologous human serum as a supplement media. Substitutes were immunocharacterized with collagen IV and cytokeratin 5-14 as specific markers. A Student´s t- test was performed to assess the differences between both groups. Results It was possible to isolate epidermal cells from the oral mucosa of diabetic and healthy subjects and develop autologous dermal-epidermal skin substitutes using autologous serum as a supplement. Differences in the expression of specific markers were observed and the cytokeratin 5-14 expression was lower in the diabetic substitutes, and the collagen IV expression was higher in the diabetic substitutes when compared with the healthy group, showing a significant difference. Conclusion Cells from oral mucosa could be an alternative and less invasive source for skin substitutes and wound healing. A difference in collagen production of diabetic cells suggests diabetic substitutes could improve diabetic wound healing. More research is needed to determine the crosstalk between components of these skin substitutes and damaged tissues.

  12. Ultra-weak photon emission as a non-invasive tool for monitoring of oxidative processes in the epidermal cells of human skin: comparative study on the dorsal and the palm side of the hand.

    Science.gov (United States)

    Rastogi, Anshu; Pospísil, Pavel

    2010-08-01

    All living organisms emit spontaneous ultra-weak photon emission as a result of cellular metabolic processes. Exposure of living organisms to exogenous factors results in oxidative processes and enhancement in ultra-weak photon emission. Here, hydrogen peroxide (H(2)O(2)), as a strongly oxidizing molecule, was used to induce oxidative processes and enhance ultra-weak photon emission in human hand skin. The presented work intends to compare both spontaneous and peroxide-induced ultra-weak photon emission from the epidermal cells on the dorsal and the palm side of the hand. A highly sensitive photomultiplier tube and a charge-coupled device camera were used to detect ultra-weak photon emission from human hand skin. Spontaneous ultra-weak photon emission from the epidermal cells on the dorsal side of the hand was 4 counts/s. Topical application of 500 mM H(2)O(2) to the dorsal side of the hand caused enhancement in ultra-weak photon emission to 40 counts/s. Interestingly, both spontaneous and peroxide-induced ultra-weak photon emission from the epidermal cells on the palm side of the hand were observed to increase twice their values, i.e. 8 and 80 counts/s, respectively. Similarly, the two-dimensional image of ultra-weak photon emission observed after topical application of H(2)O(2) to human skin reveals that photon emission from the palm side exceeds the photon emission from the dorsal side of the hand. The results presented indicate that the ultra-weak photon emission originating from the epidermal cells on the dorsal and the palm side of the hand is related to the histological structure of the human hand skin. Ultra-weak photon emission is shown as a non-destructive technique for monitoring of oxidative processes in the epidermal cells of the human hand skin and as a diagnostic tool for skin diseases.

  13. Punicalagin and (-)-Epigallocatechin-3-Gallate Rescue Cell Viability and Attenuate Inflammatory Responses of Human Epidermal Keratinocytes Exposed to Airborne Particulate Matter PM10.

    Science.gov (United States)

    Seok, Jin Kyung; Lee, Jeong-Won; Kim, Young Mi; Boo, Yong Chool

    2018-01-01

    Airborne particulate matter with a diameter of < 10 µm (PM10) causes oxidative damage, inflammation, and premature skin aging. In this study, we evaluated whether polyphenolic antioxidants attenuate the inflammatory responses of PM10-exposed keratinocytes. Primary human epidermal keratinocytes were exposed in vitro to PM10 in the absence or presence of punicalagin and (-)-epigallocatechin-3-gallate (EGCG), which are the major polyphenolic antioxidants found in pomegranate and green tea, respectively. Assays were performed to determine cell viability, production of reactive oxygen species (ROS), and expression of NADPH oxidases (NOX), proinflammatory cytokines, and matrix metalloproteinase (MMP)-1. PM10 decreased cell viability and increased ROS production in a dose-dependent manner. It also increased the expression levels of NOX-1, NOX-2, tumor necrosis factor-α (TNF-α), interleukin (IL)-1β, IL-6, IL-8, and MMP-1. Punicalagin was not cytotoxic up to 300 μM, and (-)-EGCG was cytotoxic above 30 μM, respectively. Further, punicalagin (3-30 μM) and EGCG (3-10 μM) rescued the viability of PM10-exposed cells. They also attenuated ROS production and the expression of NOX-1, NOX-2, TNF-α, IL-1β, IL-6, IL-8, and MMP-1 stimulated by PM10. This study demonstrates that polyphenolic antioxidants, such as punicalagin and (-)-EGCG, rescue keratinocyte viability and attenuate the inflammatory responses of these cells due to airborne particles. © 2018 S. Karger AG, Basel.

  14. Suppression of the Epidermal Growth Factor-like Domain 7 and Inhibition of Migration and Epithelial-Mesenchymal Transition in Human Pancreatic Cancer PANC-1 Cells.

    Science.gov (United States)

    Wang, Yun-Liang; Dong, Feng-Lin; Yang, Jian; Li, Zhi; Zhi, Qiao-Ming; Zhao, Xin; Yang, Yong; Li, De-Chun; Shen, Xiao-Chun; Zhou, Jin

    2015-01-01

    Epidermal growth factor-like domain multiple 7 (EGFL7), a secreted protein specifically expressed by endothelial cells during embryogenesis, recently was identified as a critical gene in tumor metastasis. Epithelial-mesenchymal transition (EMT) was found to be closely related with tumor progression. Accordingly, it is important to investigate the migration and EMT change after knock-down of EGFL7 gene expression in human pancreatic cancer cells. EGFL7 expression was firstly testified in 4 pancreatic cancer cell lines by real-time polymerase chain reaction (Real-time PCR) and western blot, and the highest expression of EGFL7 was found in PANC-1 cell line. Then, PANC-1 cells transfected with small interference RNA (siRNA) of EGFL7 using plasmid vector were named si-PANC-1, while transfected with negative control plasmid vector were called NC-PANC-1. Transwell assay was used to analyze the migration of PANC-1 cells. Real-time PCR and western blotting were used to detect the expression change of EGFL7 gene, EMT markers like E-Cadherin, N-Cadherin, Vimentin, Fibronectin and transcription factors like snail, slug in PANC-1, NC- PANC-1, and si-PANC-1 cells, respectively. After successful plasmid transfection, EGFL7 gene were dramatically knock-down by RNA interference in si-PANC-1 group. Meanwhile, migration ability decreased significantly, compared with PANC-1 and NC-PANC-1 group. Meanwhile, the expression of epithelial phenotype marker E-Cadherin increased and that of mesenchymal phenotype markers N-Cadherin, Vimentin, Fibronectin dramatically decreased in si-PANC-1 group, indicating a reversion of EMT. Also, transcription factors snail and slug decreased significantly after RNA interference. Current study suggested that highly-expressed EGFL7 promotes migration of PANC-1 cells and acts through transcription factors snail and slug to induce EMT, and further study is needed to confirm this issue.

  15. In vivo production of novel vitamin D2 hydroxy-derivatives by human placentas, epidermal keratinocytes, Caco-2 colon cells and the adrenal gland

    Science.gov (United States)

    Slominski, Andrzej T.; Kim, Tae-Kang; Shehabi, Haleem Z.; Tang, Edith; Benson, Heather A. E.; Semak, Igor; Lin, Zongtao; Yates, Charles R.; Wang, Jin; Li, Wei; Tuckey, Robert C.

    2014-01-01

    We investigated the metabolism of vitamin D2 to hydroxyvitamin D2 metabolites ((OH)D2) by human placentas ex-utero, adrenal glands ex-vivo and cultured human epidermal keratinocytes and colonic Caco-2 cells, and identified 20(OH)D2, 17,20(OH)2D2, 1,20(OH)2D2, 25(OH)D2 and 1,25(OH)2D2 as products. Inhibition of product formation by 22R-hydroxycholesterol indicated involvement of CYP11A1 in 20- and 17-hydroxylation of vitamin D2, while use of ketoconazole indicated involvement of CYP27B1 in 1α-hydroxylation of products. Studies with purified human CYP11A1 confirmed the ability of this enzyme to convert vitamin D2 to 20(OH)D2 and 17,20(OH)2D2. In placentas and Caco-2 cells, production of 20(OH)D2 was higher than 25(OH)D2 while in human keratinocytes the production of 20(OH)D2 and 25(OH)D2 were comparable. HaCaT keratinocytes showed high accumulation of 1,20(OH)2D2 relative to 20(OH)D2 indicating substantial CYP27B1 activity. This is the first in vivo evidence for a novel pathway of vitamin D2 metabolism initiated by CYP11A1 and modified by CYP27B1, with the product profile showing tissue- and cell-type specificity. PMID:24382416

  16. Epidermal stem cells response to radiative genotoxic stress

    International Nuclear Information System (INIS)

    Marie, Melanie

    2013-01-01

    Human skin is the first organ exposed to various environmental stresses, which requires the development by skin stem cells of specific mechanisms to protect themselves and to ensure tissue homeostasis. As stem cells are responsible for the maintenance of epidermis during individual lifetime, the preservation of genomic integrity in these cells is essential. My PhD aimed at exploring the mechanisms set up by epidermal stem cells in order to protect themselves from two genotoxic stresses, ionizing radiation (Gamma Rays) and ultraviolet radiation (UVB). To begin my PhD, I have taken part of the demonstration of protective mechanisms used by keratinocyte stem cells after ionizing radiation. It has been shown that these cells are able to rapidly repair most types of radiation-induced DNA damage. Furthermore, we demonstrated that this repair is activated by the fibroblast growth factor 2 (FGF2). In order to know if this protective mechanism is also operating in cutaneous carcinoma stem cells, we investigated the response to gamma Rays of carcinoma stem cells isolated from a human carcinoma cell line. As in normal keratinocyte stem cells, we demonstrated that cancer stem cells could rapidly repair radio-induced DNA damage. Furthermore, fibroblast growth factor 2 also mediates this repair, notably thanks to its nuclear isoforms. The second project of my PhD was to study human epidermal stem cells and progenitors responses to UVB radiation. Once cytometry and irradiation conditions were set up, the toxicity of UVB radiation has been evaluate in the primary cell model. We then characterized UVB photons effects on cell viability, proliferation and repair of DNA damage. This study allowed us to bring out that responses of stem cells and their progeny to UVB are different, notably at the level of part of their repair activity of DNA damage. Moreover, progenitors and stem cells transcriptomic responses after UVB irradiation have been study in order to analyze the global

  17. Reactive oxygen species-mediated DNA damage and apoptosis in human skin epidermal cells after exposure to nickel nanoparticles.

    Science.gov (United States)

    Alarifi, Saud; Ali, Daoud; Alakhtani, Saad; Al Suhaibani, Entissar S; Al-Qahtani, Ahmed A

    2014-01-01

    Nickel nanoparticles (NiNPs) are increasingly used in various applications due to their unique properties. However, there is little information concerning the toxicity of NiNPs in the human skin cell (A431). The present study was designed to investigate the cytotoxicity, apoptosis, and DNA damage due to NiNPs in A431 cells. A cellular proliferative capacity test showed that NiNPs induce significant cytotoxicity in a dose- and time-dependent manner. NiNPs were also found to induce oxidative stress evidenced by the generation of reactive oxygen species (ROS) and depletion of glutathione (GSH). Further, co-treatment with the antioxidant N-acetylcysteine (NAC) mitigated the ROS generation due to NiNPs, suggesting the potential mechanism of oxidative stress. NiNPs also induced significant elevation of lipid peroxidation, catalase, and superoxide dismutase and caspase-3 activity in A431 cells. In addition, NAC suppressed NiNP-induced caspase-3 activity. DNA fragmentation analysis using the comet assay showed that the NiNPs cause genotoxicity in a dose- and time-dependent manner. Therefore, the study points out the capability of the NiNPs to induce oxidative stress resulting in apoptosis and genotoxicity. This study warrants more careful assessment of NiNPs before their industrial applications.

  18. Suppressors for Human Epidermal Growth Factor Receptor 2/4 (HER2/4): A New Family of Anti-Toxoplasmic Agents in ARPE-19 Cells.

    Science.gov (United States)

    Kim, Yeong Hoon; Bhatt, Lokraj; Ahn, Hye-Jin; Yang, Zhaoshou; Lee, Won-Kyu; Nam, Ho-Woo

    2017-10-01

    The effects of tyrosine kinase inhibitors (TKIs) were evaluated on growth inhibition of intracellular Toxoplasma gondii in host ARPE-19 cells. The number of tachyzoites per parasitophorous vacuolar membrane (PVM) was counted after treatment with TKIs. T. gondii protein expression was assessed by western blot. Immunofluorescence assay was performed using Programmed Cell Death 4 (PDCD4) and T. gondii GRA3 antibodies. The TKIs were divided into 3 groups; non-epidermal growth factor receptor (non-EGFR), anti-human EGFR 2 (anti-HER2), and anti-HER2/4 TKIs, respectively. Group I TKIs (nintedanib, AZD9291, and sunitinib) were unable to inhibit proliferation without destroying host cells. Group II TKIs (lapatinib, gefitinib, erlotinib, and AG1478) inhibited proliferation up to 98% equivalent to control pyrimethamine (5 μM) at 20 μM and higher, without affecting host cells. Group III TKIs (neratinib, dacomitinib, afatinib, and pelitinib) inhibited proliferation up to 98% equivalent to pyrimethamine at 1-5 μM, but host cells were destroyed at 10-20 μM. In Group I, TgHSP90 and SAG1 inhibitions were weak, and GRA3 expression was moderately inhibited. In Group II, TgHSP90 and SAG1 expressions seemed to be slightly enhanced, while GRA3 showed none to mild inhibition; however, AG1478 inhibited all proteins moderately. Protein expression was blocked in Group III, comparable to pyrimethamine. PDCD4 and GRA3 were well localized inside the nuclei in Group I, mildly disrupted in Group II, and were completely disrupted in Group III. This study suggests the possibility of a vital T. gondii TK having potential HER2/4 properties, thus anti-HER2/4 TKIs may inhibit intracellular parasite proliferation with minimal adverse effects on host cells.

  19. Nicotinic acid receptor abnormalities in human skin cancer: implications for a role in epidermal differentiation.

    Directory of Open Access Journals (Sweden)

    Yira Bermudez

    Full Text Available Chronic UV skin exposure leads to epidermal differentiation defects in humans that can be largely restored by pharmacological doses of nicotinic acid. Nicotinic acid has been identified as a ligand for the human G-protein-coupled receptors GPR109A and GPR109B that signal through G(i-mediated inhibition of adenylyl cyclase. We have examined the expression, cellular distribution, and functionality of GPR109A/B in human skin and skin derived epidermal cells.Nicotinic acid increases epidermal differentiation in photodamaged human skin as judged by the terminal differentiation markers caspase 14 and filaggrin. Both GPR109A and GPR109B genes are transcribed in human skin and in epidermal keratinocytes, but expression in dermal fibroblasts is below limits of detection. Receptor transcripts are greatly over-expressed in squamous cell cancers. Receptor protein in normal skin is prominent from the basal through granular layers of the epidermis, with cellular localization more dispersive in the basal layer but predominantly localized at the plasma membrane in more differentiated epidermal layers. In normal human primary and immortalized keratinocytes, nicotinic acid receptors show plasma membrane localization and functional G(i-mediated signaling. In contrast, in a squamous cell carcinoma derived cell line, receptor protein shows a more diffuse cellular localization and the receptors are nearly non-functional.The results of these studies justify future genetic and pharmacological intervention studies to define possible specific role(s of nicotinic acid receptors in human skin homeostasis.

  20. [Effect of low-energy 633 nm red light stimulation on proliferation and reactive oxygen species level of human epidermal cell line HaCaT].

    Science.gov (United States)

    Chen, Z Y; Li, D L; Duan, X D; Peng, D Z

    2016-09-20

    To investigate the changes of proliferative activity and reactive oxygen species level of human epidermal cell line HaCaT after being irradiated with low-energy 633 nm red light. Irradiation distance was determined through preliminary experiment. HaCaT cells were conventionally sub-cultured with RPMI 1640 culture medium containing 10% fetal calf serum, 100 U/mL penicillin, and 100 μg/mL streptomycin. Cells of the third passage were used in the following experiments. (1) Cells were divided into blank control group and 0.082, 0.164, 0.245, 0.491, 1.472, 2.453, 4.910, and 9.810 J/cm(2) irradiation groups according to the random number table, with 3 wells in each group. Cells in blank control group were not irradiated, while cells in the latter 8 irradiation groups were irradiated with 633 nm red light for 10, 20, 30, 60, 180, 300, 600, and 1 200 s in turn. Cells were reirradiated once every 8 hours. After being irradiated for 48 hours (6 times) in irradiation groups, the proliferative activity of cells in 9 groups was determined with cell counting kit 8 and microplate reader (denoted as absorbance value). (2) Another batch of cells were grouped and irradiated as in experiment (1). After being irradiated for once in irradiation groups, cells in 9 groups were conventionally cultured for 60 min with detection reagent of reactive oxygen species. At post culture minute (PCM) 0 (immediately), 30, 60, and 120, reactive oxygen species level of cells was determined with microplate reader (denoted as absorbance value). (3) Another batch of cells were divided into blank control group, 0.082, 0.491, 2.453, and 9.810 J/cm(2) irradiation groups, and positive control group. Cells in blank control group and positive control group were not irradiated (positive control reagent of reactive oxygen species was added to cells in positive control group), and cells in irradiation groups were irradiated as in experiment (1) for once. The expression of reactive oxygen species in cells of each

  1. Inhibition of Epidermal Growth Factor Receptor and PI3K/Akt Signaling Suppresses Cell Proliferation and Survival through Regulation of Stat3 Activation in Human Cutaneous Squamous Cell Carcinoma

    International Nuclear Information System (INIS)

    Bito, T.; Sumita, N.; Ashida, M.; Budiyanto, A.; Ueda, M.; Ichihashi, M.; Nishigori, C.; Tokura, Y.; Bito, T.

    2011-01-01

    Recent studies have emphasized the important role of Stat3 activation in a number of human tumors from the viewpoint of its oncogenic and anti apoptotic activity. In this study, we examined the role and related signaling molecules of Stat3 in the carcinogenesis of human cutaneous squamous cell carcinoma (SCC). In 35 human cutaneous SCC samples, 86% showed overexpression of phosphorylated (p)-Stat3, and most of those simultaneously over expressed p-EGFR or p-Akt. Constitutive activation of EGFR and Stat3 was observed in three SCC cell lines and four of five SCC tissues. AG1478, an inhibitor of the EGFR, down regulated Stat3 activation in HSC-1 human SCC cells. AG1478 inhibited cell proliferation and induced apoptosis of HSC-1 cells but did not inhibit the growth of normal human epidermal keratinocytes that did not show Stat3 activation. Furthermore, a PI3K inhibitor also suppressed Stat3 activation in HSC-1 cells to some degree. Combined treatment with the PI3K inhibitor and AG1478 strongly suppressed Stat3 activity and dramatically induced apoptosis of HSC-1 cells. These data suggest that Stat3 activation through EGFR and/or PI3K/Akt activation plays a critical role in the proliferation and survival of human cutaneous SCC.

  2. Use of etanercept to treat toxic epidermal necrolysis in a human immunodeficiency virus-positive patient

    OpenAIRE

    Yung-Yi Lee; Jui-Hung Ko; Chia-Hung Wei; Wen-Hung Chung

    2013-01-01

    Toxic epidermal necrolysis (TEN) is an uncommon and severe cutaneous adverse drug reaction that causes disseminated necrosis of epidermal cells and mucocutaneous detachment. Here, we report the case of a 32-year-old man with human immunodeficiency virus infection who presented with generalized violaceous macules and blister formation 4 days after the administration of mefenamic acid and amoxicillin for a dental procedure. Additional symptoms included oral ulcers and conjunctivitis. Results of...

  3. Kinetics of growth and differentiation of cultured human epidermal keratinocytes

    International Nuclear Information System (INIS)

    Albers, K.M.

    1985-01-01

    A study was made of the interrelationship between replication and differentiation in cultures of human epidermal keratinocytes. Measures of both parameters were made using newly developed methods to quantify the rate at which keratinocytes replicate and the rate at which they withdraw from the cell cycle. Keratinocyte replication was measured by determining the cell doubling time, labeling index, and cell cycle duration. Cell cycle length was measured using a double label assay that determines the length of time between two successive phases of DNA synthesis. The first DNA synthesis phase was marked by labeling keratinocytes with 14 C-thymidine. At the next round of DNA synthesis, cells were labeled with bromodeoxyuridine, a heavy analog of thymidine. The cell cycle length is given by the time required for the 14 C-labeled DNA to become double labeled. To measure keratinocyte differentiation, the rate at which cells withdraw from the cell cycle was determined. To measure withdrawal, the percentage of cells labeled by a pulse of 14 C-thymidine that failed to undergo a second cycle of DNA synthesis, as measured by bromodeoxyuridine incorporation, was determined. Cells which failed to undergo a second cycle of synthesis were considered to have differentiated and withdrawn from the cell cycle

  4. Molecular subclassification determined by human papillomavirus and epidermal growth factor receptor status is associated with the prognosis of oropharyngeal squamous cell carcinoma.

    Science.gov (United States)

    Nakano, Takafumi; Yamamoto, Hidetaka; Nakashima, Torahiko; Nishijima, Toshimitsu; Satoh, Masanobu; Hatanaka, Yui; Shiratsuchi, Hideki; Yasumatsu, Ryuji; Toh, Satoshi; Komune, Shizuo; Oda, Yoshinao

    2016-04-01

    Human papillomavirus (HPV) infection is an indicator of good response to chemoradiotherapy in oropharyngeal squamous cell carcinoma (OPSCC), and epidermal growth factor receptor (EGFR) is a molecular-therapeutic target in head and neck squamous cell carcinoma. Here we investigated the prevalence and prognostic significance of HPV infection and EGFR alteration in OPSCC. We analyzed the presence of high-risk HPV using in situ hybridization, protein expressions of p16 and EGFR using immunohistochemistry, and the EGFR gene copy number gain using chromogenic in situ hybridization (CISH) in 105 cases of OPSCC. The biopsy specimens before chemoradiotherapy were used for these analyses. HPV infection and p16 protein overexpression were detected in 53.3% and 52.4% of the OPSCCs, and each factor was associated with better overall survival (P = .0026 and P = .0026) and nonkeratinizing histology (P = .0002 and P = .0004), respectively. EGFR gene copy number gain (high polysomy or amplification) was detected in 12.4% of the OPSCCs and was correlated with EGFR protein overexpression (P = .0667) and worse overall survival (P CISH positive) were mutually exclusive. The HPV-negative/EGFR CISH-positive OPSCCs had significantly worse overall survival than did the HPV-positive/EGFR CISH-negative OPSCCs and HPV-negative/EGFR CISH-negative OPSCCs (P CISH-negative OPSCCs had favorable prognosis irrespective of HPV infection. Our results suggest that EGFR gene copy number gain-positive tumors represent an HPV-negative, aggressive subgroup of OPSCCs. The molecular subclassification of OPSCCs based on HPV infection and EGFR status may serve as important information for appropriate therapeutic strategy. Copyright © 2015 Elsevier Inc. All rights reserved.

  5. Epidermal growth factor inhibits glycylsarcosine transport and hPepT1 expression in a human intestinal cell line

    DEFF Research Database (Denmark)

    Nielsen, C U; Amstrup, J; Steffansen, B

    2001-01-01

    (max) decreased from 2.61 +/- 0.4 to 1.06 +/- 0.1 nmol x cm(-2) x min(-1) (n = 3, P PepT1 mRNA (using glucose-6-phosphate dehydrogenase mRNA as control......) in cells treated with EGF. Western blotting indicated a decrease in hPepT1 protein in cell lysates. We conclude that EGF treatment decreases Gly-Sar transport in Caco-2 cells by decreasing the number of peptide transporter molecules in the apical membrane....

  6. Extracellular Matrix as a Regulator of Epidermal Stem Cell Fate.

    Science.gov (United States)

    Chermnykh, Elina; Kalabusheva, Ekaterina; Vorotelyak, Ekaterina

    2018-03-27

    Epidermal stem cells reside within the specific anatomic location, called niche, which is a microenvironment that interacts with stem cells to regulate their fate. Regulation of many important processes, including maintenance of stem cell quiescence, self-renewal, and homeostasis, as well as the regulation of division and differentiation, are common functions of the stem cell niche. As it was shown in multiple studies, extracellular matrix (ECM) contributes a lot to stem cell niches in various tissues, including that of skin. In epidermis, ECM is represented, primarily, by a highly specialized ECM structure, basement membrane (BM), which separates the epidermal and dermal compartments. Epidermal stem cells contact with BM, but when they lose the contact and migrate to the overlying layers, they undergo terminal differentiation. When considering all of these factors, ECM is of fundamental importance in regulating epidermal stem cells maintenance, proper mobilization, and differentiation. Here, we summarize the remarkable progress that has recently been made in the research of ECM role in regulating epidermal stem cell fate, paying special attention to the hair follicle stem cell niche. We show that the destruction of ECM components impairs epidermal stem cell morphogenesis and homeostasis. A deep understanding of ECM molecular structure as well as the development of in vitro system for stem cell maintaining by ECM proteins may bring us to developing new approaches for regenerative medicine.

  7. Inhibition of Epidermal Growth Factor Receptor and Vascular Endothelial Growth Factor Receptor Phosphorylation on Tumor-Associated Endothelial Cells Leads to Treatment of Orthotopic Human Colon Cancer in Nude Mice

    Directory of Open Access Journals (Sweden)

    Takamitsu Sasaki

    2007-12-01

    Full Text Available The purpose of our study was to determine whether the dual inhibition of epidermal growth factor receptor (EGFR and vascular endothelial growth factor receptor (VEGFR signaling pathways in tumor-associated endothelial cells can inhibit the progressive growth of human colon carcinoma in the cecum of nude mice. SW620CE2 human colon cancer cells growing in culture and orthotopically in the cecum of nude mice expressed a high level of transforming growth factor alpha (TGF-α and vascular endothelial growth factor (VEGF but were negative for EGFR, human epidermal growth factor receptor 2 (HER2, VEGFR. Double immunofluorescence staining revealed that tumorassociated endothelial cells expressed EGFR, VEGFR2, phosphorylated EGFR (pEGFR, phosphorylated VEGFR (pVEGFR. Treatment of mice with either 7H-pyrrolo [2,3-d]-pyrimidine lead scaffold (AEE788; an inhibitor of EGFR and VEGFR tyrosine kinase or CPT-11 as single agents significantly inhibited the growth of cecal tumors (P < .01; this decrease was even more pronounced with AEE788 combined with CPT-11 (P < .001. AEE788 alone or combined with CPT-11 also inhibited the expression of pEGFR and pVEGFR on tumor-associated endothelial cells, significantly decreased vascularization and tumor cell proliferation, increased the level of apoptosis in both tumorassociated endothelial cells and tumor cells. These data demonstrate that targeting EGFR and VEGFR signaling on tumor-associated endothelial cells provides a viable approach for the treatment of colon cancer.

  8. Human Papillomavirus and Epidermal Growth Factor Receptor in Oral Cavity and Oropharyngeal Squamous Cell Carcinoma: Correlation With Dynamic Contrast-Enhanced MRI Parameters.

    Science.gov (United States)

    Choi, Yoon Seong; Park, Mina; Kwon, Hyeong Ju; Koh, Yoon Woo; Lee, Seung-Koo; Kim, Jinna

    2016-02-01

    The objective of this study was to investigate differences in dynamic contrast-enhanced MRI (DCE-MRI) parameters on the basis of the status of human papillomavirus (HPV) and epidermal growth factor receptor (EGFR) biomarkers in patients with squamous cell carcinoma (SCC) of the oral cavity and oropharynx by use of histogram analysis. A total of 22 consecutive patients with oral cavity and oropharyngeal SCC underwent DCE-MRI before receiving treatment. DCE parameter maps of the volume transfer constant (K(trans)), the flux rate constant (kep), and the extravascular extracellular volume fraction (ve) were obtained. The histogram parameters were calculated using the entire enhancing tumor volume and were compared between the patient subgroups on the basis of HPV and EGFR biomarker statuses. The cumulative histogram parameters of K(trans) and kep showed lower values in the HPV-negative and EFGR-overexpression group than in the HPV-positive EGFR-negative group. These differences were statistically significant for the mean (p = 0.009), 25th, 50th, and 75th percentile values of K(trans) and for the 25th percentile value of kep when correlated with HPV status in addition to the mean K(trans) value (p = 0.047) and kep value (p = 0.004) when correlated with EGFR status. No statistically significant difference in ve was found on the basis of HPV and EGFR status. DCE-MRI is useful for the assessment of the tumor microenvironment associated with HPV and EGFR biomarkers before treatment of patients with oral cavity and oropharyngeal SCC.

  9. Epidermal growth factor receptor in primary human lung cancer

    International Nuclear Information System (INIS)

    Yu Xueyan; Hu Guoqiang; Tian Keli; Wang Mingyun

    1996-01-01

    Cell membranes were prepared from 12 human lung cancers for the study of the expression of epidermal growth factor receptors (EGFR). EGFR concentration was estimated by ligand binding studies using 125 I-radiolabeled EGF. The dissociation constants of the high affinity sites were identical, 1.48 nmol and 1.1 nmol in cancer and normal lung tissues, the EGFR contents were higher in lung cancer tissues (range: 2.25 to 19.39 pmol·g -1 membrane protein) than that in normal tissues from the same patients (range: 0.72 to 7.43 pmol·g -1 membrane protein). These results suggest that EGF and its receptor may play a role in the regulatory mechanisms in the control of lung cellular growth and tumor promotion

  10. The organization of human epidermis: functional epidermal units and phi proportionality.

    Science.gov (United States)

    Hoath, Steven B; Leahy, D G

    2003-12-01

    The concept that mammalian epidermis is structurally organized into functional epidermal units has been proposed on the basis of stratum corneum (SC) architecture, proliferation kinetics, melanocyte:keratinocyte ratios (1:36), and, more recently, Langerhans cell: epidermal cell ratios (1:53). This article examines the concept of functional epidermal units in human skin in which the maintenance of phi (1.618034) proportionality provides a central organizing principle. The following empirical measurements were used: 75,346 nucleated epidermal cells per mm2, 1394 Langerhans cells per mm2, 1999 melanocytes per mm2, 16 (SC) layers, 900-microm2 corneocyte surface area, 17,778 corneocytes per mm2, 14-d (SC) turnover time, and 93,124 per mm2 total epidermal cells. Given these empirical data: (1) the number of corneocytes is a mean proportional between the sum of the Langerhans cell + melanocyte populations and the number of epidermal cells, 3393/17,778-17,778/93,124; (2) the ratio of nucleated epidermal cells over corneocytes is phi proportional, 75,346/17,778 approximately phi3; (3) assuming similar 14-d turnover times for the (SC) and Malpighian epidermis, the number of corneocytes results from subtraction of a cellular fraction equal to approximately 2/phi2 x the number of living cells, 75,436 - (2/phi2 x 75,346) approximately 17,778; and (4) if total epidermal turnover time equals (SC) turnover time x the ratio of living/dead cells, then compartmental turnover times are unequal (14 d for (SC) to 45.3 d for nucleated epidermis approximately 1/2phi) and cellular replacement rates are 52.9 corneocytes/69.3 keratinocytes per mm2 per h approximately 2/phi2. These empirically derived equivalences provide logicomathematical support for the presence of functional epidermal units in human skin. Validation of a phi proportional unit architecture in human epidermis will be important for tissue engineering of skin and the design of instruments for skin measurement.

  11. Human Papilloma Viral DNA Replicates as a Stable Episome in Cultured Epidermal Keratinocytes

    Science.gov (United States)

    Laporta, Robert F.; Taichman, Lorne B.

    1982-06-01

    Human papilloma virus (HPV) is poorly understood because systems for its growth in tissue culture have not been developed. We report here that cultured human epidermal keratinocytes could be infected with HPV from plantar warts and that the viral DNA persisted and replicated as a stable episome. There were 50-200 copies of viral DNA per cell and there was no evidence to indicate integration of viral DNA into the cellular genome. There was also no evidence to suggest that viral DNA underwent productive replication. We conclude that cultured human epidermal keratinocytes may be a model for the study of certain aspects of HPV biology.

  12. Faster DNA Repair of Ultraviolet-Induced Cyclobutane Pyrimidine Dimers and Lower Sensitivity to Apoptosis in Human Corneal Epithelial Cells than in Epidermal Keratinocytes.

    Directory of Open Access Journals (Sweden)

    Justin D Mallet

    Full Text Available Absorption of UV rays by DNA generates the formation of mutagenic cyclobutane pyrimidine dimers (CPD and pyrimidine (6-4 pyrimidone photoproducts (6-4PP. These damages are the major cause of skin cancer because in turn, they can lead to signature UV mutations. The eye is exposed to UV light, but the cornea is orders of magnitude less prone to UV-induced cancer. In an attempt to shed light on this paradox, we compared cells of the corneal epithelium and the epidermis for UVB-induced DNA damage frequency, repair and cell death sensitivity. We found similar CPD levels but a 4-time faster UVB-induced CPD, but not 6-4PP, repair and lower UV-induced apoptosis sensitivity in corneal epithelial cells than epidermal. We then investigated levels of DDB2, a UV-induced DNA damage recognition protein mostly impacting CPD repair, XPC, essential for the repair of both CPD and 6-4PP and p53 a protein upstream of the genotoxic stress response. We found more DDB2, XPC and p53 in corneal epithelial cells than in epidermal cells. According to our results analyzing the protein stability of DDB2 and XPC, the higher level of DDB2 and XPC in corneal epithelial cells is most likely due to an increased stability of the protein. Taken together, our results show that corneal epithelial cells have a better efficiency to repair UV-induced mutagenic CPD. On the other hand, they are less prone to UV-induced apoptosis, which could be related to the fact that since the repair is more efficient in the HCEC, the need to eliminate highly damaged cells by apoptosis is reduced.

  13. Epidermal growth factor and its receptors in human pancreatic carcinoma

    International Nuclear Information System (INIS)

    Chen, Y.F.; Pan, G.Z.; Hou, X.; Liu, T.H.; Chen, J.; Yanaihara, C.; Yanaihara, N.

    1990-01-01

    The role of epidermal growth factor (EGF) in oncogenesis and progression of malignant tumors is a subject of vast interest. In this study, radioimmunoassay and radioreceptor assay of EGF were established. EGF contents in malignant and benign pancreatic tumors, in normal pancreas tissue, and in culture media of a human pancreatic carcinoma cell line were determined. EGF receptor binding studies were performed. It was shown that EGF contents in pancreatic carcinomas were significantly higher than those in normal pancreas or benign pancreatic tumors. EGF was also detected in the culture medium of a pancreatic carcinoma cell line. The binding of 125I-EGF to the pancreatic carcinoma cells was time and temperature dependent, reversible, competitive, and specific. Scatchard analysis showed that the dissociation constant of EGF receptor was 2.1 X 10(-9) M, number of binding sites was 1.3 X 10(5) cell. These results indicate that there is an over-expression of EGF/EGF receptors in pancreatic carcinomas, and that an autocrine regulatory mechanism may exist in the growth-promoting effect of EGF on tumor cells

  14. Flow cytometry of human primary epidermal and follicular keratinocytes.

    Science.gov (United States)

    Gragnani, Alfredo; Ipolito, Michelle Zampieri; Sobral, Christiane S; Brunialti, Milena Karina Coló; Salomão, Reinaldo; Ferreira, Lydia Masako

    2008-02-19

    The aim of this study was to characterize using flow cytometry cultured human primary keratinocytes isolated from the epidermis and hair follicles by different methods. Human keratinocytes derived from discarded fragments of total skin and scalp hair follicles from patients who underwent plastic surgery in the Plastic Surgery Division at UNIFESP were used. The epidermal keratinocytes were isolated by using 3 different methods: the standard method, upon exposure to trypsin for 30 minutes; the second, by treatment with dispase for 18 hours and with trypsin for 10 minutes; and the third, by treatment with dispase for 18 hours and with trypsin for 30 minutes. Follicular keratinocytes were isolated using the standard method. On comparing the group treated with dispase for 18 hours and with trypsin for 10 minutes with the group treated with dispase for 18 hours and with trypsin for 30 minutes, it was observed that the first group presented the largest number of viable cells, the smallest number of cells in late apoptosis and necrosis with statistical significance, and no difference in apoptosis. When we compared the group treated with dispase for 18 hours and with trypsin for 10 minutes with the group treated with trypsin, the first group presented the largest number of viable cells, the smallest number of cells in apoptosis with statistical significance, and no difference in late apoptosis and necrosis. When we compared the results of the group treated with dispase for 18 hours and with trypsin for 10 minutes with the results for follical isolation, there was a statistical difference in apoptosis and viable cells. The isolation method of treatment with dispase for 18 hours and with trypsin for 10 minutes produced the largest number of viable cells and the smallest number of cells in apoptosis/necrosis.

  15. Toxicity Assessment of Six Titanium Dioxide Nanoparticles in Human Epidermal Keratinocytes

    Science.gov (United States)

    Toxicity Assessment of Six Titanium Dioxide Nanoparticles in Human Epidermal Keratinocytes Nanoparticle uptake in cells may be an important determinant of their potential cytotoxic and inflammatory effects. Six commercial TiO2 NP (A=Alfa Aesar,10nm, A*=Alfa Aesar 32nm, B=P25 27...

  16. Adding a Piece to the Leaf Epidermal Cell Shape Puzzle.

    Science.gov (United States)

    von Wangenheim, Daniel; Wells, Darren M; Bennett, Malcolm J

    2017-11-06

    The jigsaw puzzle-shaped pavement cells in the leaf epidermis collectively function as a load-bearing tissue that controls organ growth. In this issue of Developmental Cell, Majda et al. (2017) shed light on how the jigsaw shape can arise from localized variations in wall stiffness between adjacent epidermal cells. Copyright © 2017 Elsevier Inc. All rights reserved.

  17. Pattern of hormone receptors and human epidermal growth factor ...

    African Journals Online (AJOL)

    Introduction: Breast cancer is the most common cancer among women globally. With immunohistochemistry (IHC), breast cancer is classified into four groups based on IHC profile of estrogen receptor (ER)/progesterone receptor (PR) and human epidermal growth factor receptor 2 (HER2/neu) expression, positive (+) and/or ...

  18. Human epidermal growth factor: molecular forms and application of radioimmunoassay and radioreceptor assay

    International Nuclear Information System (INIS)

    Hirata, Y.; Orth, D.N.

    1981-01-01

    Epidermal growth factor (EGF), a 53 amino acid polypeptide, was first isolated by Cohen. EGF's growth-promoting activity is not limited to epidermal cells, but is expressed on a wide variety of tissues derived from a number of different species. Human EGF (hEGF) was isolated and subsequently purified from human urine. Unexpectedly, a close structural relationship was recognized between mEGF and human β-urogastrone. The authors recently developed both an homologous hEGF radioimmunoassay (RIA) and a radioreceptor assay (RRA) using a human placental membrane fraction. Using these assays, the molecular size of hEGF in human body fluids and tissues was evaluated, and partial characterization of a high molecular weight form of hEGF isolated from human urine was carried out. The concentrations of immunoreactive hEGF were also determined in human tissues and plasma after extraction either with cationic exchange chromatography or with immunoaffinity chromatography. (Auth.)

  19. Near Infrared Optical Visualization of Epidermal Growth Factor Receptors Levels in COLO205 Colorectal Cell Line, Orthotopic Tumor in Mice and Human Biopsies

    Directory of Open Access Journals (Sweden)

    Philip Lazarovici

    2013-07-01

    Full Text Available In this study, we present the applicability of imaging epidermal growth factor (EGF receptor levels in preclinical models of COLO205 carcinoma cells in vitro, mice with orthotopic tumors and ex vivo colorectal tumor biopsies, using EGF-labeled with IRDye800CW (EGF-NIR. The near infrared (NIR bio-imaging of COLO205 cultures indicated specific and selective binding, reflecting EGF receptors levels. In vivo imaging of tumors in mice showed that the highest signal/background ratio between tumor and adjacent tissue was achieved 48 hours post-injection. Dissected colorectal cancer tissues from different patients demonstrated ex vivo specific imaging using the NIR bio-imaging platform of the heterogeneous distributed EGF receptors. Moreover, in the adjacent gastrointestinal tissue of the same patients, which by Western blotting was demonstrated as EGF receptor negative, no labeling with EGF-NIR probe was detected. Present results support the concept of tumor imaging by measuring EGF receptor levels using EGF-NIR probe. This platform is advantageous for EGF receptor bio-imaging of the NCI-60 recommended panel of tumor cell lines including 6–9 colorectal cell lines, since it avoids radioactive probes and is appropriate for use in the clinical setting using NIR technologies in a real-time manner.

  20. Resveratrol modulates MED28 (Magicin/EG-1) expression and inhibits epidermal growth factor (EGF)-induced migration in MDA-MB-231 human breast cancer cells.

    Science.gov (United States)

    Lee, Ming-Fen; Pan, Min-Hsiung; Chiou, Yi-Siou; Cheng, An-Chin; Huang, Han

    2011-11-09

    Resveratrol and pterostilbene exhibit diverse biological activities. MED28, a subunit of the mammalian Mediator complex for transcription, was also identified as magicin, an actin cytoskeleton Grb2-associated protein, and as endothelial-derived gene (EG-1). Several tumors exhibit aberrant MED28 expression, whereas the underlying mechanism is unclear. Triple-negative breast cancers, often expressing epidermal growth factor (EGF) receptor (EGFR), are associated with metastasis and poor survival. The objective of this study is to compare the effect of resveratrol and pterostilbene and to investigate the role of MED28 in EGFR-overexpressing MDA-MB-231 breast cancer cells. Pretreatment of resveratrol, but not pterostlbene, suppressed EGF-mediated migration and expression of MED28 and matrix metalloproteinase (MMP)-9 in MDA-MB-231 cells. Moreover, overexpression of MED28 increased migration, and the addition of EGF further enhanced migration. Our data indicate that resveratrol modulates the effect of MED28 on cellular migration, presumably through the EGFR/phosphatidylinositol 3-kinase (PI3K) signaling pathway, in breast cancer cells.

  1. Role of Pin1 in UVA-induced cell proliferation and malignant transformation in epidermal cells

    International Nuclear Information System (INIS)

    Han, Chang Yeob; Hien, Tran Thi; Lim, Sung Chul; Kang, Keon Wook

    2011-01-01

    Highlights: → Pin1 expression is enhanced by low energy UVA irradiation in both skin tissues of hairless mice and JB6 C141 epidermal cells. → UVA irradiation increases activator protein-1 activity and cyclin D1 in a Pin1-dependent manner. → UVA potentiates EGF-inducible, anchorage-independent growth of epidermal cells, and this is suppressed by Pin1 inhibition or by anti-oxidant. -- Abstract: Ultraviolet A (UVA) radiation (λ = 320-400 nm) is considered a major cause of human skin cancer. Pin1, a peptidyl prolyl isomerase, is overexpressed in most types of cancer tissues and plays an important role in cell proliferation and transformation. Here, we demonstrated that Pin1 expression was enhanced by low energy UVA (300-900 mJ/cm 2 ) irradiation in both skin tissues of hairless mice and JB6 C141 epidermal cells. Exposure of epidermal cells to UVA radiation increased cell proliferation and cyclin D1 expression, and these changes were blocked by Pin1 inhibition. UVA irradiation also increased activator protein-1 (AP-1) minimal reporter activity and nuclear levels of c-Jun, but not c-Fos, in a Pin1-dependent manner. The increases in Pin1 expression and in AP-1 reporter activity in response to UVA were abolished by N-acetylcysteine (NAC) treatment. Finally, we found that pre-exposure of JB6 C141 cells to UVA potentiated EGF-inducible, anchorage-independent growth, and this effect was significantly suppressed by Pin1inhibition or by NAC.

  2. Co-inhibition of epidermal growth factor receptor and insulin-like growth factor receptor 1 enhances radiosensitivity in human breast cancer cells

    International Nuclear Information System (INIS)

    Li, Ping; Veldwijk, Marlon R; Zhang, Qing; Li, Zhao-bin; Xu, Wen-cai; Fu, Shen

    2013-01-01

    Over-expression of epidermal growth factor receptor (EGFR) or insulin-like growth factor-1 receptor (IGF-1R) have been shown to closely correlate with radioresistance of breast cancer cells. This study aimed to investigate the impact of co-inhibition of EGFR and IGF-1R on the radiosensitivity of two breast cancer cells with different profiles of EGFR and IGF-1R expression. The MCF-7 (EGFR +/−, IGF-1R +++) and MDA-MB-468 (EGFR +++, IGF-1R +++) breast cancer cell lines were used. Radiosensitizing effects were determined by colony formation assay. Apoptosis and cell cycle distribution were measured by flow cytometry. Phospho-Akt and phospho-Erk1/2 were quantified by western blot. In vivo studies were conducted using MDA-MB-468 cells xenografted in nu/nu mice. In MDA-MB-468 cells, the inhibition of IGF-1R upregulated the p-EGFR expression. Either EGFR (AG1478) or IGF-1R inhibitor (AG1024) radiosensitized MDA-MB-468 cells. In MCF-7 cells, radiosensitivity was enhanced by AG1024, but not by AG1478. Synergistical radiosensitizing effect was observed by co-inhibition of EGFR and IGF-1R only in MDA-MB-468 cells with a DMF 10% of 1.90. The co-inhibition plus irradiation significantly induced more apoptosis and arrested the cells at G0/G1 phase in MDA-MB-468 cells. Only co-inhibition of EGFR and IGF-1R synergistically diminished the expression of p-Akt and p-Erk1/2 in MDA-MB-468 cells. In vivo studies further verified the radiosensitizing effects by co-inhibition of both pathways in a MDA-MB-468 xenograft model. Our data suggested that co-inhibition of EGFR and IGF-1R synergistically radiosensitized breast cancer cells with both EGFR and IGF-1R high expression. The approach may have an important therapeutic implication in the treatment of breast cancer patients with high expression of EGFR and IGF-1R

  3. Response of human epidermal keratinocytes to UV light

    International Nuclear Information System (INIS)

    Kartasova, A.A.

    1987-01-01

    This thesis presents a study on the response of human epidermal keratinocytes to UV light as well as to other agents like 4-NQO and TPA. The effects of ultraviolet (UV) light on the protein synthesis in cultured keratinocytes are presented in ch. III. The next chapter describes the construction of a cDNA library using mRNA isolated from UV irradiated kernatinocytes. This library was differentially screened with cDNA probes synthesized on mRNA from either UV irradiated or nonirradiated cells. Several groups of cDNA clones corresponding to transcripts whose level in the cytoplasm seem to be affected by exposure to UV light have been isolated and characterized by cross-hybridization, sequencing and Northern blot analysis. More detailed analysis of some of the cDNA clones is presented in the two chapters following ch. IV. The complete cDNA sequence of the proteinase inhibitor cystatin A and the modulation of its expression by UV light and the carcinogen 4-nitroquinoline 1-oxide (4-NQO) in keratinocytes are described in ch. V. Two other groups of cDNA clones have been isolated which do not cross-hybridize with each other on Southern blots. However, the primary structures of the proteins deduced from the nucleotide sequences of these two groups of cDNA clones are very similar. 212 refs.; 33 figs.; 2 tabs

  4. Endothelin B Receptors on Primary Chicken Müller Cells and the Human MIO-M1 Müller Cell Line Activate ERK Signaling via Transactivation of Epidermal Growth Factor Receptors.

    Directory of Open Access Journals (Sweden)

    Mohammad Harun-Or-Rashid

    Full Text Available Injury to the eye or retina triggers Müller cells, the major glia cell of the retina, to dedifferentiate and proliferate. In some species they attain retinal progenitor properties and have the capacity to generate new neurons. The epidermal growth factor receptor (EGFR system and extracellular signal-regulated kinase (ERK signaling are key regulators of these processes in Müller cells. The extracellular signals that modulate and control these processes are not fully understood. In this work we studied whether endothelin receptor signaling can activate EGFR and ERK signaling in Müller cells. Endothelin expression is robustly upregulated at retinal injury and endothelin receptors have been shown to transactivate EGFRs in other cell types. We analyzed the endothelin signaling system in chicken retina and cultured primary chicken Müller cells as well as the human Müller cell line MIO-M1. The Müller cells were stimulated with receptor agonists and treated with specific blockers to key enzymes in the signaling pathway or with siRNAs. We focused on endothelin receptor mediated transactivation of EGFRs by using western blot analysis, quantitative reverse transcriptase PCR and immunocytochemistry. The results showed that chicken Müller cells and the human Müller cell line MIO-M1 express endothelin receptor B. Stimulation by the endothelin receptor B agonist IRL1620 triggered phosphorylation of ERK1/2 and autophosphorylation of (Y1173 EGFR. The effects could be blocked by Src-kinase inhibitors (PP1, PP2, EGFR-inhibitor (AG1478, EGFR-siRNA and by inhibitors to extracellular matrix metalloproteinases (GM6001, consistent with a Src-kinase mediated endothelin receptor response that engage ligand-dependent and ligand-independent EGFR activation. Our data suggest a mechanism for how injury-induced endothelins, produced in the retina, may modulate the Müller cell responses by Src-mediated transactivation of EGFRs. The data give support to a view in

  5. Effects of soap-water wash on human epidermal penetration.

    Science.gov (United States)

    Zhu, Hanjiang; Jung, Eui-Chang; Phuong, Christina; Hui, Xiaoying; Maibach, Howard

    2016-08-01

    Skin decontamination is a primary interventional method used to decrease dermal absorption of hazardous contaminants, including chemical warfare agents, pesticides and industrial pollutants. Soap and water wash, the most common and readily available decontamination system, may enhance percutaneous absorption through the "wash-in effect." To understand better the effect of soap-water wash on percutaneous penetration, and provide insight to improving skin decontamination methods, in vitro human epidermal penetration rates of four C(14) -labeled model chemicals (hydroquinone, clonidine, benzoic acid and paraoxon) were assayed using flow-through diffusion cells. Stratum corneum (SC) absorption rates of these chemicals at various hydration levels (0-295% of the dry SC weights) were determined and compared with the results of the epidermal penetration study to clarify the effect of SC hydration on skin permeability. Results showed accelerated penetration curves of benzoic acid and paraoxon after surface wash at 30 min postdosing. Thirty minutes after washing (60 min postdosing), penetration rates of hydroquinone and benzoic acid decreased due to reduced amounts of chemical on the skin surface and in the SC. At the end of the experiment (90 min postdosing), a soap-water wash resulted in lower hydroquinone penetration, greater paraoxon penetration and similar levels of benzoic acid and clonidine penetration compared to penetration levels in the non-wash groups. The observed wash-in effect agrees with the enhancement effect of SC hydration on the SC chemical absorption rate. These results suggest SC hydration derived from surface wash to be one cause of the wash-in effect. Further, the occurrence of a wash-in effect is dependent on chemical identity and elapsed time between exposure and onset of decontamination. By reducing chemical residue quantity on skin surface and in the SC reservoir, the soap-water wash may decrease the total quantity of chemical absorbed in the

  6. Cultivation and irradiation of human fibroblasts in a medium enriched with platelet lysate for obtaining feeder layer in epidermal cell culture; Cultivo e irradiacao de fibroblastos humanos em meio enriquecido com lisado de plaquetas para obtencao de camada de sustentacao em culturas de celulas da epiderme

    Energy Technology Data Exchange (ETDEWEB)

    Yoshito, Daniele

    2011-07-01

    For over 30 years, the use of culture medium, enriched with bovine serum, and murines fibroblasts, with the rate of proliferation controlled by irradiation or by share anticarcinogenic drugs, has been playing successfully its role in assisting in the development of keratinocytes in culture, for clinical purposes. However, currently there is a growing concern about the possibility of transmitting prions and animals viruses to transplanted patients. Taking into account this concern, the present work aims to cultivate human fibroblasts in a medium enriched with human platelets lysate and determine the irradiation dose of these cells, for obtaining feeder layer in epidermal cell culture. For carrying out the proposed objective, platelets lysis has standardized, this lysate was used for human fibroblasts cultivation and the irradiation dose enough to inhibit its duplication was evaluated. Human keratinocytes were cultivated in these feeder layers, in culture medium enriched with the lysate. With these results we conclude that the 10% platelets lysate promoted a better adhesion and proliferation of human fibroblasts and in all dose levels tested (60 to 300 Gy), these had their mitotic activity inactivated by ionizing irradiation, being that the feeder layers obtained with doses from 70 to 150 Gy were those that provided the best development of keratinocytes in medium containing 2.5% of human platelet lysate. Therefore, it was possible to standardize both the cultivation of human fibroblasts as its inactivation for use as feeder layer in culture of keratinocytes, so as to eliminate xenobiotics components. (author)

  7. Induction of interleukin-6 production by ultraviolet radiation in normal human epidermal keratinocytes and in a human keratinocyte cell line is mediated by DNA damage

    NARCIS (Netherlands)

    Petit-Frère, C.; Clingen, P.H.; Grewe, M.; Krutmann, J.; Roza, L.; Arlett, C.F.; Green, M.H.L.

    1998-01-01

    The sunburn reaction is the most common consequence of human exposure to ultraviolet radiation (UVR), and is mediated at least in part by interleukin- 6 (IL-6). The aim of this study was to determine if DNA is a major chromophore involved in the induction of IL-6 following UV irradiation of a human

  8. Dermal Contributions to Human Interfollicular Epidermal Architecture and Self-Renewal

    Directory of Open Access Journals (Sweden)

    Kynan T. Lawlor

    2015-11-01

    Full Text Available The human interfollicular epidermis is renewed throughout life by populations of proliferating basal keratinocytes. Though interfollicular keratinocyte stem cells have been identified, it is not known how self-renewal in this compartment is spatially organized. At the epidermal-dermal junction, keratinocytes sit atop a heterogeneous mix of dermal cells that may regulate keratinocyte self-renewal by influencing local tissue architecture and signalling microenvironments. Focusing on the rete ridges and complementary dermal papillae in human skin, we review the identity and organisation of abundant dermal cells types and present evidence for interactions between the dermal microenvironment and the interfollicular keratinocytes.

  9. Micromorphology and development of the epicuticular structure on the epidermal cell of ginseng leaves

    Directory of Open Access Journals (Sweden)

    Kyounghwan Lee

    2015-04-01

    Conclusion: The outwardly projected cuticle and epidermal cell wall (i.e., an epicuticular wrinkle acts as a major barrier to block out sunlight in ginseng leaves. The small vesicles in the peripheral region of epidermal cells may suppress the cuticle and parts of epidermal wall, push it upward, and consequently contribute to the formation of the epicuticular structure.

  10. Expression of the Human Epidermal Growth Factor Receptor in a Murine T- Cell Hybridoma: A Transmembrane Protein Tyrosine Kinase Can Synergize with the T-Cell Antigen Receptor

    Science.gov (United States)

    1992-01-01

    cells to 0.9 pM butyrate for 16 h increased limiting dilution as described (32). Flow cytometry confirmed EGFR modal log channel fluorescence for...1991) Cell 65, 281-291 demonstration that phosphatidyl-inositol pathway activation 9. Ullrich, A., Coussens, L., Hayflick , J. S., Dull, T. J., Gray, A

  11. Expression of epidermal growth factor receptors in human endometrial carcinoma

    DEFF Research Database (Denmark)

    Nyholm, H C; Nielsen, Anette Lynge; Ottesen, B

    1993-01-01

    Little data exist on the expression of epidermal growth factor receptors (EGF-Rs) in human endometrial cancer. EGF-R status was studied in 65 patients with endometrial carcinomas and in 26 women with nonmalignant postmenopausal endometria, either inactive/atrophic endometrium or adenomatous...... hyperplasia. EGF-R was identified on frozen tissue sections by means of an indirect immunoperoxidase technique with a monoclonal antibody against the external domain of the EGF-R. Seventy-one percent of the carcinomas expressed positive EGF-R immunoreactivity. In general, staining was most prominent...

  12. Expression and analysis of exogenous proteins in epidermal cells.

    Science.gov (United States)

    Dagnino, Lina; Ho, Ernest; Chang, Wing Y

    2010-01-01

    In this chapter we review protocols for transient transfection of primary keratinocytes. The ability to transfect primary epidermal cells regardless of their differentiation status allows the biochemical and molecular characterization of multiple proteins. We review methods to analyze exogenous protein abundance in transfected keratinocytes by immunoblot and immunoprecipitation. We also present protocols to determine the subcellular distribution of these proteins by indirect immunofluorescence microscopy approaches.

  13. Heterogeneity and plasticity of epidermal stem cells

    DEFF Research Database (Denmark)

    Schepeler, Troels; Page, Mahalia E; Jensen, Kim Bak

    2014-01-01

    The epidermis is an integral part of our largest organ, the skin, and protects us against the hostile environment. It is a highly dynamic tissue that, during normal steady-state conditions, undergoes constant turnover. Multiple stem cell populations residing in autonomously maintained compartments...... facilitate this task. In this Review, we discuss stem cell behaviour during normal tissue homeostasis, regeneration and disease within the pilosebaceous unit, an integral structure of the epidermis that is responsible for hair growth and lubrication of the epithelium. We provide an up-to-date view...... of the pilosebaceous unit, encompassing the heterogeneity and plasticity of multiple discrete stem cell populations that are strongly influenced by external cues to maintain their identity and function....

  14. Use of etanercept to treat toxic epidermal necrolysis in a human immunodeficiency virus-positive patient

    Directory of Open Access Journals (Sweden)

    Yung-Yi Lee

    2013-06-01

    Full Text Available Toxic epidermal necrolysis (TEN is an uncommon and severe cutaneous adverse drug reaction that causes disseminated necrosis of epidermal cells and mucocutaneous detachment. Here, we report the case of a 32-year-old man with human immunodeficiency virus infection who presented with generalized violaceous macules and blister formation 4 days after the administration of mefenamic acid and amoxicillin for a dental procedure. Additional symptoms included oral ulcers and conjunctivitis. Results of skin biopsy were compatible with Stevens–Johnson syndrome (SJS. SJS progressed to TEN within 2 days. Etanercept treatment showed a dramatic improvement in the symptoms of mucocutaneous lesions. To our knowledge, this is the first report on the treatment of TEN using etanercept in a human immunodeficiency virus-positive patient.

  15. Heavy metal-induced cytotoxicity to cultured human epidermal keratinocytes and effects of antioxidants.

    Science.gov (United States)

    Kappus, H; Reinhold, C

    1994-04-01

    Human epidermal keratinocytes which have been cultured were treated with the heavy metal ions of cadmium, mercury, copper and zinc. Cytotoxicity was measured either by protein estimation or by using the neutral red assay. Antioxidants were added in order to find out whether heavy metal-induced cytotoxicity is related to oxidative stress. All metals used showed considerable cytotoxic effects within 24 h in moderate concentrations. None of the antioxidants vitamin E (alpha-tocopherol), pyrogallol, propyl gallate, BHT or ebselen showed any protective or preventive effect. This indicates that oxidative stress may not be involved in the cytotoxicity induced by heavy metals in human epidermal keratinocytes. The cells used are, however, a valuable tool to study mechanisms of cytotoxicity.

  16. Isolation and In Vitro Characterization of Epidermal Stem Cells

    DEFF Research Database (Denmark)

    Moestrup, Kasper S; Andersen, Marianne Stemann; Jensen, Kim Bak

    2017-01-01

    flow cytometry. Using markers that define the spatial origin of epidermal cells, it is possible to interrogate the specific characteristics of subpopulations of cells based on their in vivo credentials. Here, we describe how to isolate, culture, and characterize keratinocytes from murine back and tail......Colony-forming assays represent prospective methods, where cells isolated from enzymatically dissociated tissues or from tissue cultures are assessed for their proliferative capacity in vitro. Complex tissues such as the epithelial component of the skin (the epidermis) are characterized...

  17. Humanized versus murine anti-human epidermal growth factor receptor monoclonal antibodies for immunoscintigraphic studies

    Energy Technology Data Exchange (ETDEWEB)

    Morales, Alejo A. Morales; Duconge, Jorge; Alvarez-Ruiz, Daniel; Becquer-Viart, Maria de Los Angeles; Nunez-Gandolff, Gilda; Fernandez, Eduardo; Caballero-Torres, Idania; Iznaga-Escobar, Normando

    2000-02-01

    The anti-human epidermal growth factor receptor (EGF-R) humanized antibody h-R3 (IgG{sub 1}), which binds to an extracellular domain of EGF-R, was used to evaluate the biodistribution on nude mice xenografted with A431 epidermoid carcinoma cell line. Results are compared with its murine version ior egf/r3 monoclonal antibody (mAb). Twenty-one athymic female 4NMRI nu/nu mice were injected intravenously with 10 {mu}g/100 {mu}Ci of {sup 99m}Tc-labeled mAbs. The mAb ior C5 that recognizes an antigen expressed preferentially on the surface of malignant and cytoplasm of normal colorectal cells was used as negative control. Immunoreactivity of {sup 99m}Tc-labeled mAbs was measured by enzyme linked immunosorbent assay on A431 cell line and the immunoreactive fractions determined by Lindmo method. Among all organs significant accumulation was found in tumor (6.14{+-}2.50 %ID/g, 5.06{+-}2.61 %ID/g for murine and humanized mAbs, respectively) 4 h after injection. The immunoreactive fractions were found to be 0.88 and 0.81 for murine and humanized mAb, respectively. Thus, we expect better results using the humanized mAb h-R3 for diagnostic immunoscintigraphy.

  18. Humanized versus murine anti-human epidermal growth factor receptor monoclonal antibodies for immunoscintigraphic studies

    International Nuclear Information System (INIS)

    Morales, Alejo A. Morales; Duconge, Jorge; Alvarez-Ruiz, Daniel; Becquer-Viart, Maria de Los Angeles; Nunez-Gandolff, Gilda; Fernandez, Eduardo; Caballero-Torres, Idania; Iznaga-Escobar, Normando

    2000-01-01

    The anti-human epidermal growth factor receptor (EGF-R) humanized antibody h-R3 (IgG 1 ), which binds to an extracellular domain of EGF-R, was used to evaluate the biodistribution on nude mice xenografted with A431 epidermoid carcinoma cell line. Results are compared with its murine version ior egf/r3 monoclonal antibody (mAb). Twenty-one athymic female 4NMRI nu/nu mice were injected intravenously with 10 μg/100 μCi of 99m Tc-labeled mAbs. The mAb ior C5 that recognizes an antigen expressed preferentially on the surface of malignant and cytoplasm of normal colorectal cells was used as negative control. Immunoreactivity of 99m Tc-labeled mAbs was measured by enzyme linked immunosorbent assay on A431 cell line and the immunoreactive fractions determined by Lindmo method. Among all organs significant accumulation was found in tumor (6.14±2.50 %ID/g, 5.06±2.61 %ID/g for murine and humanized mAbs, respectively) 4 h after injection. The immunoreactive fractions were found to be 0.88 and 0.81 for murine and humanized mAb, respectively. Thus, we expect better results using the humanized mAb h-R3 for diagnostic immunoscintigraphy

  19. Localized nasal cavity, sinus, and massive bilateral orbital involvement by human T cell leukemia virus 1 adult T cell lymphoma, with epidermal hypertrophy due to mite infestation

    Directory of Open Access Journals (Sweden)

    Kathleen Laveaux

    2010-10-01

    Full Text Available HTLV1 adult T cell lymphoma occurs tends to be widely disseminated and aggressive, with only brief responses to chemotherapy. Aside from cervical adenopathy, involvement of head and neck structures is uncommon and orbital involvement rare. We report a case of nasal cavity HTLV lymphoma with massive bilateral orbital involvement and proptosis, resulting in complete left and partial right eye amaurosis. No other sites of disease were found. Response to chemotherapy was rapid and complete, with almost complete restoration of vision and oculo-motor function; the patient has remained in remission for one year. An associated problem was striking bilateral hypertrophic, hyperkeratotic eyelid and breast lesions due to mite infestation. 

  20. The cell-penetrating peptide domain from human heparin-binding epidermal growth factor-like growth factor (HB-EGF) has anti-inflammatory activity in vitro and in vivo

    International Nuclear Information System (INIS)

    Lee, Jue-Yeon; Seo, Yoo-Na; Park, Hyun-Jung; Park, Yoon-Jeong; Chung, Chong-Pyoung

    2012-01-01

    Highlights: ► HBP sequence identified from HB-EGF has cell penetration activity. ► HBP inhibits the NF-κB dependent inflammatory responses. ► HBP directly blocks phosphorylation and degradation of IκBα. ► HBP inhibits nuclear translocation of NF-κB p65 subunit. -- Abstract: A heparin-binding peptide (HBP) sequence from human heparin-binding epidermal growth factor-like growth factor (HB-EGF) was identified and was shown to exhibit cell penetration activity. This cell penetration induced an anti-inflammatory reaction in lipopolysaccharide (LPS)-treated RAW 264.7 macrophages. HBP penetrated the cell membrane during the 10 min treatment and reduced the LPS-induced production of nitric oxide (NO), inducible nitric oxide synthase (iNOS), and cytokines (TNF-α and IL-6) in a concentration-dependent manner. Additionally, HBP inhibited the LPS-induced upregulation of cytokines, including TNF-α and IL-6, and decreased the interstitial infiltration of polymorphonuclear leukocytes in a lung inflammation model. HBP inhibited NF-κB-dependent inflammatory responses by directly blocking the phosphorylation and degradation of IκBα and by subsequently inhibiting the nuclear translocation of the p65 subunit of NF-κB. Taken together, this novel HBP may be potentially useful candidate for anti-inflammatory treatments and can be combined with other drugs of interest to transport attached molecules into cells.

  1. Maturational steps of bone marrow-derived dendritic murine epidermal cells. Phenotypic and functional studies on Langerhans cells and Thy-1+ dendritic epidermal cells in the perinatal period.

    Science.gov (United States)

    Elbe, A; Tschachler, E; Steiner, G; Binder, A; Wolff, K; Stingl, G

    1989-10-15

    The adult murine epidermis harbors two separate CD45+ bone marrow (BM)-derived dendritic cell systems, i.e., Ia+, ADPase+, Thy-1-, CD3- Langerhans cells (LC) and Ia-, ADPase-, Thy-1+, CD3+ dendritic epidermal T cells (DETC). To clarify whether the maturation of these cells from their ill-defined precursors is already accomplished before their entry into the epidermis or, alternatively, whether a specific epidermal milieu is required for the expression of their antigenic determinants, we studied the ontogeny of CD45+ epidermal cells (EC). In the fetal life, there exists a considerable number of CD45+, Ia-, ADPase+ dendritic epidermal cells. When cultured, these cells become Ia+ and, in parallel, acquire the potential of stimulating allogeneic T cell proliferation. These results imply that CD45+, Ia-, ADPase+ fetal dendritic epidermal cells are immature LC precursors and suggest that the epidermis plays a decisive role in LC maturation. The day 17 fetal epidermis also contains a small population of CD45+, Thy-1+, ADPase-, CD3- round cells. Over the course of 2 to 3 wk, they are slowly replaced by an ever increasing number of round and, finally, dendritic CD45+, Thy-1+, CD3+ EC. Thus, CD45+, Thy-1+, ADPase-, CD3- fetal EC may either be DETC precursors or, alternatively, may represent a distinctive cell system of unknown maturation potential. According to this latter theory, these cells would be eventually outnumbered by newly immigrating CD45+, Thy-1+, CD3+ T cells--the actual DETC.

  2. Frozen allogeneic human epidermal cultured sheets for the cure of complicated leg ulcers.

    Science.gov (United States)

    Bolívar-Flores, Y J; Kuri-Harcuch, W

    1999-08-01

    Skin ulcers due to venous stasis or diabetes are common among the elderly and are difficult to treat. Repeated applications of cell-based products have been reported to result in cure or improvement of leg ulcers of small size in a fraction of patients. To examine the effects of frozen human allogeneic epidermal cultures for the treatment of acute and chronic ulcers. We treated a series of 10 consecutive patients with leg ulcers of different etiology and duration with frozen human allogeneic epidermal cultures stored frozen and thawed for 5-10 minutes at room temperature before application. Three patients had ulcers with exposed Achilles or extensor tendon. The ulcers treated were as large as 160 cm2 in area and of up to 20-years' duration. After preliminary preparation of the wounds by debridement to remove necrotic tissue and application of silver sulfadiazine to control infection, thawed cultures were applied biweekly from 2 to 15 times depending on the size and complexity of the ulcer. All ulcers healed, including those with tendon exposure. After the first few applications, granulation tissue formed in the ulcer bed and on exposed tendons, and epidermal healing took place through proliferation and migration of cells from the margins of the wound. The time required for complete healing ranged from 1 to 31 weeks after the first application. The use of frozen human allogeneic epidermal cultures is a safe and effective treatment for venous or diabetic ulcers, even those with tendon exposure. It seems possible that any leg ulcer will be amenable to successful treatment by this method.

  3. Epidermal Growth Factor Cytoplasmic Domain Affects ErbB Protein Degradation by the Lysosomal and Ubiquitin-Proteasome Pathway in Human Cancer Cells

    Directory of Open Access Journals (Sweden)

    Aleksandra Glogowska

    2012-05-01

    Full Text Available The cytoplasmic domains of EGF-like ligands, including EGF cytoplasmic domain (EGFcyt, have important biological functions. Using specific constructs and peptides of human EGF cytoplasmic domain, we demonstrate that EGFcyt facilitates lysosomal and proteasomal protein degradation, and this coincided with growth inhibition of human thyroid and glioma carcinoma cells. EGFcyt and exon 22–23-encoded peptide (EGF22.23 enhanced procathepsin B (procathB expression and procathB-mediated lysosomal degradation of EGFR/ErbB1 as determined by inhibitors for procathB and the lysosomal ATPase inhibitor BafA1. Presence of mbEGFctF, EGFcyt, EGF22.23, and exon 23-encoded peptides suppressed the expression of the deubiqitinating enzyme ubiquitin C-terminal hydrolase-L1 (UCH-L1. This coincided with hyperubiquitination of total cellular proteins and ErbB1/2 and reduced proteasome activity. Upon small interfering RNA-mediated silencing of endogenously expressed UCH-L1, a similar hyperubiquitinylation phenotype, reduced ErbB1/2 content, and attenuated growth was observed. The exon 23-encoded peptide region of EGFcyt was important for these biologic actions. Structural homology modeling of human EGFcyt showed that this molecular region formed an exposed surface loop. Peptides derived from this EGFcyt loop structure may aid in the design of novel peptide therapeutics aimed at inhibiting growth of cancer cells.

  4. A comprehensive two-dimensional gel protein database of noncultured unfractionated normal human epidermal keratinocytes: towards an integrated approach to the study of cell proliferation, differentiation and skin diseases

    DEFF Research Database (Denmark)

    Celis, J E; Madsen, Peder; Rasmussen, H H

    1991-01-01

    A two-dimensional (2-D) gel database of cellular proteins from noncultured, unfractionated normal human epidermal keratinocytes has been established. A total of 2651 [35S]methionine-labeled cellular proteins (1868 isoelectric focusing, 783 nonequilibrium pH gradient electrophoresis) were resolved...

  5. Insulin binding properties of normal and transformed human epidermal cultured keratinocytes

    International Nuclear Information System (INIS)

    Verrando, P.; Ortonne, J.P.

    1985-01-01

    Insulin binding to its receptors was studied in cultured normal and transformed (A431 line) human epidermal keratinocytes. The specific binding was a temperature-dependent, saturable process. Normal keratinocytes possess a mean value of about 80,000 receptors per cell. Fifteen hours exposure of the cells to insulin lowered their receptor number (about 65% loss in available sites); these reappeared when the hormone was removed from the culture medium. In the A431 epidermoid carcinoma cell line, there is a net decrease in insulin binding (84% of the initial bound/free hormone ratio in comparison with normal cells) essentially related to a loss in receptor affinity for insulin. Thus, cultured human keratinocytes which express insulin receptors may be a useful tool in understanding skin pathology related to insulin disorders

  6. Effect of glucocorticoids and gamma radiation on epidermal Langerhans cells

    International Nuclear Information System (INIS)

    Belsito, D.V.; Baer, R.L.; Thorbecke, G.J.; Gigli, I.

    1984-01-01

    The effect of 750 rads of gamma radiation on the rate of return of epidermal Langerhans cells (LC) following suppressive doses of topical glucorticoids was studied in guinea pigs. Gamma radiation alone had no effect on the LC as assessed by staining for cell membrane ATPase activity and Ia antigen. It did, however, delay the expected return of Ia but not ATPase surface markers on the LC after perturbation with glucocorticoids. The delayed return of surface Ia antigen is possibly related to a radiation-induced defect in the production of a required lymphokine and/or in intracellular Ia transport. Although our data do not rule out a cytolytic effect of steroids on the LC, they do strongly suggest that, at least in part, glucocorticoids act on the LC by altering cell surface characteristics

  7. Homologous radioimmunoassay for human epidermal growth factor (urogastrone)

    International Nuclear Information System (INIS)

    Dailey, G.E.; Kraus, J.W.; Orth, D.N.

    1978-01-01

    Epidermal growth factor (EGF), a polypeptide hormone originally discovered in the mouse submaxillary gland, stimulates growth in a variety of tissues in several species. This hormone has recently been identified in human urine. A homologous RIA for human EGF (RIA-hEGF) has been developed. In general, levels were similar to those recently reported using a heterologous RIA system. Twenty-four-hour urinary excretion of RIA-hEGF by normal adult males and females was 63.0 +- 3.0 and 52.0 +- 3.5 (mean +- SE) μg/total vol, or 29.7 +- 1.1 and 39.8 +- 1.7 μg/g creatinine, respectively. Excretion by females taking oral contraceptives was significantly greater (60.1 +- 2.7 μg/g creatinine; P 0.05). Several of those with very low values had histories of alcohol abuse. Excretion by patients with Cushing's syndrome was normal. Patients with psoriasis or recovering from major burns excreted both abnormally high and abnormally low levels of RIA-hEGF, with no obvious correlation to their clinical condition. There was no apparent diurnal or postprandial variation in urinary RIA-hEGF excretion by normal subjects. An excellent linear correlation was observed between RIA-hEGF and creatinine concentrations in each urine sample for each subject, suggesting that RIA-hEGF concentration in a random urine sample provides a valid index of 24-h RIA-hEGF excretion

  8. Protective Effect of Liposome-Encapsulated Glutathione in a Human Epidermal Model Exposed to a Mustard Gas Analog

    Directory of Open Access Journals (Sweden)

    Victor Paromov

    2011-01-01

    Full Text Available Sulfur mustard or mustard gas (HD and its monofunctional analog, 2-chloroethyl ethyl sulfide (CEES, or “half-mustard gas,” are alkylating agents that induce DNA damage, oxidative stress, and inflammation. HD/CEES are rapidly absorbed in the skin causing extensive injury. We hypothesize that antioxidant liposomes that deliver both water-soluble and lipid-soluble antioxidants protect skin cells from immediate CEES-induced damage via attenuating oxidative stress. Liposomes containing water-soluble antioxidants and/or lipid-soluble antioxidants were evaluated using in vitro model systems. Initially, we found that liposomes containing encapsulated glutathione (GSH-liposomes increased cell viability and attenuated production of reactive oxygen species (ROS in HaCaT cells exposed to CEES. Next, GSH-liposomes were tested in a human epidermal model, EpiDerm. In the EpiDerm, GSH-liposomes administered simultaneously or 1 hour after CEES exposure (2.5 mM increased cell viability, inhibited CEES-induced loss of ATP and attenuated changes in cellular morphology, but did not reduce caspase-3 activity. These findings paralleled the previously described in vivo protective effect of antioxidant liposomes in the rat lung and established the effectiveness of GSH-liposomes in a human epidermal model. This study provides a rationale for use of antioxidant liposomes against HD toxicity in the skin considering further verification in animal models exposed to HD.

  9. Interactions Between Epidermal Keratinocytes, Dendritic Epidermal T-Cells, and Hair Follicle Stem Cells.

    Science.gov (United States)

    Badarinath, Krithika; Dutta, Abhik; Hegde, Akshay; Pincha, Neha; Gund, Rupali; Jamora, Colin

    2018-06-13

    The interplay of immune cells and stem cells in maintaining skin homeostasis and repair is an exciting new frontier in cutaneous biology. With the growing appreciation of the importance of this new crosstalk comes the requirement of methods to interrogate the molecular underpinnings of these leukocyte-stem cell interactions. Here we describe how a combination of FACS, cellular coculture assays, and conditioned media treatments can be utilized to advance our understanding of this emerging area of intercellular communication between immune cells and stem cells.

  10. Psoriatic T cells reduce epidermal turnover time and affect cell proliferation contributed from differential gene expression.

    Science.gov (United States)

    Li, Junqin; Li, Xinhua; Hou, Ruixia; Liu, Ruifeng; Zhao, Xincheng; Dong, Feng; Wang, Chunfang; Yin, Guohua; Zhang, Kaiming

    2015-09-01

    Psoriasis is mediated primarily by T cells, which reduce epidermal turnover time and affect keratinocyte proliferation. We aimed to identify differentially expressed genes (DEG) in T cells from normal, five pairs of monozygotic twins concordant or discordant for psoriasis, to determine whether these DEG may account for the influence to epidermal turnover time and keratinocyte proliferation. The impact of T cells on keratinocyte proliferation and epidermal turnover time were investigated separately by immunohistochemistry and cultured with (3) H-TdR. mRNA expression patterns were investigated by RNA sequencing and verified by real-time reverse transcription polymerase chain reaction. After co-culture with psoriatic T cells, the expression of Ki-67, c-Myc and p53 increased, while expression of Bcl-2 and epidermal turnover time decreased. There were 14 DEG which were found to participate in the regulation of cell proliferation or differentiation. Psoriatic T cells exhibited the ability to decrease epidermal turnover time and affect keratinocyte proliferation because of the differential expression of PPIL1, HSPH1, SENP3, NUP54, FABP5, PLEKHG3, SLC9A9 and CHCHD4. © 2015 Japanese Dermatological Association.

  11. Epidermal stem cells - role in normal, wounded and pathological psoriatic and cancer skin

    DEFF Research Database (Denmark)

    Kamstrup, M.; Faurschou, A.; Gniadecki, R.

    2008-01-01

    In this review we focus on epidermal stem cells in the normal regeneration of the skin as well as in wounded and psoriatic skin. Furthermore, we discuss current data supporting the idea of cancer stem cells in the pathogenesis of skin carcinoma and malignant melanoma. Epidermal stem cells present...... or transit amplifying cells constitute a primary pathogenetic factor in the epidermal hyperproliferation seen in psoriasis. In cutaneous malignancies mounting evidence supports a stem cell origin in skin carcinoma and malignant melanoma and a possible existence of cancer stem cells Udgivelsesdato: 2008/5...

  12. Predicting human epidermal melanin concentrations for different skin tones

    CSIR Research Space (South Africa)

    Smit, Jacoba E

    2011-07-01

    Full Text Available epidermal melanin concentrations for different skin tones JE Smit 1 , AE Karsten 2 , RW Sparrow 1 1 CSIR Biosciences, Pretoria, South Africa 2 CSIR National Laser Centre, Pretoria, South Africa Author e-mail address: KSmit...

  13. Upregulation of FOXM1 induces genomic instability in human epidermal keratinocytes

    Directory of Open Access Journals (Sweden)

    Philpott Michael P

    2010-02-01

    Full Text Available Abstract Background The human cell cycle transcription factor FOXM1 is known to play a key role in regulating timely mitotic progression and accurate chromosomal segregation during cell division. Deregulation of FOXM1 has been linked to a majority of human cancers. We previously showed that FOXM1 was upregulated in basal cell carcinoma and recently reported that upregulation of FOXM1 precedes malignancy in a number of solid human cancer types including oral, oesophagus, lung, breast, kidney, bladder and uterus. This indicates that upregulation of FOXM1 may be an early molecular signal required for aberrant cell cycle and cancer initiation. Results The present study investigated the putative early mechanism of UVB and FOXM1 in skin cancer initiation. We have demonstrated that UVB dose-dependently increased FOXM1 protein levels through protein stabilisation and accumulation rather than de novo mRNA expression in human epidermal keratinocytes. FOXM1 upregulation in primary human keratinocytes triggered pro-apoptotic/DNA-damage checkpoint response genes such as p21, p38 MAPK, p53 and PARP, however, without causing significant cell cycle arrest or cell death. Using a high-resolution Affymetrix genome-wide single nucleotide polymorphism (SNP mapping technique, we provided the evidence that FOXM1 upregulation in epidermal keratinocytes is sufficient to induce genomic instability, in the form of loss of heterozygosity (LOH and copy number variations (CNV. FOXM1-induced genomic instability was significantly enhanced and accumulated with increasing cell passage and this instability was increased even further upon exposure to UVB resulting in whole chromosomal gain (7p21.3-7q36.3 and segmental LOH (6q25.1-6q25.3. Conclusion We hypothesise that prolonged and repeated UVB exposure selects for skin cells bearing stable FOXM1 protein causes aberrant cell cycle checkpoint thereby allowing ectopic cell cycle entry and subsequent genomic instability. The aberrant

  14. Leptin regulates the pro-inflammatory response in human epidermal keratinocytes.

    Science.gov (United States)

    Lee, Moonyoung; Lee, Eunyoung; Jin, Sun Hee; Ahn, Sungjin; Kim, Sae On; Kim, Jungmin; Choi, Dalwoong; Lim, Kyung-Min; Lee, Seung-Taek; Noh, Minsoo

    2018-05-01

    The role of leptin in cutaneous wound healing process has been suggested in genetically obese mouse studies. However, the molecular and cellular effects of leptin on human epidermal keratinocytes are still unclear. In this study, the whole-genome-scale microarray analysis was performed to elucidate the effect of leptin on epidermal keratinocyte functions. In the leptin-treated normal human keratinocytes (NHKs), we identified the 151 upregulated and 53 downregulated differentially expressed genes (DEGs). The gene ontology (GO) enrichment analysis with the leptin-induced DEGs suggests that leptin regulates NHKs to promote pro-inflammatory responses, extracellular matrix organization, and angiogenesis. Among the DEGs, the protein expression of IL-8, MMP-1, fibronectin, and S100A7, which play roles in which is important in the regulation of cutaneous inflammation, was confirmed in the leptin-treated NHKs. The upregulation of the leptin-induced proteins is mainly regulated by the STAT3 signaling pathway in NHKs. Among the downregulated DEGs, the protein expression of nucleosome assembly-associated centromere protein A (CENPA) and CENPM was confirmed in the leptin-treated NHKs. However, the expression of CENPA and CENPM was not coupled with those of other chromosome passenger complex like Aurora A kinase, INCENP, and survivin. In cell growth kinetics analysis, leptin had no significant effect on the cell growth curves of NHKs in the normal growth factor-enriched condition. Therefore, leptin-dependent downregulation of CENPA and CENPM in NHKs may not be directly associated with mitotic regulation during inflammation.

  15. Structural and biophysical characteristics of human skin in maintaining proper epidermal barrier function

    Directory of Open Access Journals (Sweden)

    Magdalena Boer

    2016-02-01

    Full Text Available The complex structure of human skin and its physicochemical properties turn it into an efficient outermost defence line against exogenous factors, and help maintain homeostasis of the human body. This role is played by the epidermal barrier with its major part – stratum corneum. The condition of the epidermal barrier depends on individual and environmental factors. The most important biophysical parameters characterizing the status of this barrier are the skin pH, epidermal hydration, transepidermal water loss and sebum excretion. The knowledge of biophysical skin processes may be useful for the implementation of prophylactic actions whose aim is to restore the barrier function.

  16. Influence of topical human epidermal growth factor on postkeratoplasty re-epithelialisation

    NARCIS (Netherlands)

    M.M. Dellaert; T.A. Casey; S. Wiffen; J. Gordon (Jocelynne); P. Johnson (Jürgen); A.J. Geerards (Annette); W.J. Rijneveld (Wilhelmina); L. Remeijer (Lies); W.H. Beekhuis (Houdijn); P.G.H. Mulder (Paul)

    1997-01-01

    textabstractAIM: To test the efficacy and safety of recombinant human epidermal growth factor (hEGF) on corneal re-epithelialisation following penetrating keratoplasty. METHODS: A prospective, randomised, placebo controlled study was carried out in which patients were

  17. Differences in expression of the cancer stem cell marker aldehyde dehydrogenase 1 among estrogen receptor-positive/human epidermal growth factor receptor type 2-negative breast cancer cases with early, late, and no recurrence.

    Science.gov (United States)

    Miyoshi, Yuichiro; Shien, Tadahiko; Ogiya, Akiko; Ishida, Naoko; Yamazaki, Kieko; Horii, Rie; Horimoto, Yoshiya; Masuda, Norikazu; Yasojima, Hiroyuki; Inao, Touko; Osako, Tomofumi; Takahashi, Masato; Tomioka, Nobumoto; Endo, Yumi; Hosoda, Mitsuchika; Doihara, Hiroyoshi; Miyoshi, Shinichiro; Yamashita, Hiroko

    2016-07-02

    The significance of the expression of aldehyde dehydrogenase 1 (ALDH1), a cancer stem cell marker, for predicting the recurrence of estrogen receptor (ER)-positive/human epidermal growth factor receptor type 2 (HER2)-negative breast cancer is still poorly understood. The value of ALDH1 in predicting the time of recurrence remains unknown. In total, 184 patients with early distant recurrence, 134 patients with late distant recurrence, and 321 control patients without recurrence for more than 10 years after starting initial treatment for ER-positive/HER2-negative breast cancer, registered in 9 institutions, were analyzed. We assessed relationships between ALDH1 and other clinicopathological features, and ALDH1 expression was compared among the three groups. The relationship between ALDH1 expression and overall survival after recurrence was also evaluated in each group. The rates of ALDH1 expression positivity (more than 1 %) in the early, late, and no recurrence groups were 18.4 %, 13.4 %, and 8.4 %, respectively. ALDH1 expression correlated significantly with lymph node metastases (p = 0.048) and the Ki-67 labeling index (p factor independently predicting overall survival after the detection of recurrence (adjusted OR 1.451, 95 % CI 0.985-2.085, p = 0.059). Among patients with ER-positive/HER2-negative breast cancer, ALDH1 expression was more common in those with early recurrence, and this expression was found to be associated with a more aggressive breast cancer phenotype than that in the patients without recurrence. Further study is needed to clarify the prognostic significance of the heterogeneity of cancer stem cells and to confirm their role in resistance to chemotherapy.

  18. Shavenbaby couples patterning to epidermal cell shape control.

    Directory of Open Access Journals (Sweden)

    Hélène Chanut-Delalande

    2006-09-01

    Full Text Available It is well established that developmental programs act during embryogenesis to determine animal morphogenesis. How these developmental cues produce specific cell shape during morphogenesis, however, has remained elusive. We addressed this question by studying the morphological differentiation of the Drosophila epidermis, governed by a well-known circuit of regulators leading to a stereotyped pattern of smooth cells and cells forming actin-rich extensions (trichomes. It was shown that the transcription factor Shavenbaby plays a pivotal role in the formation of trichomes and underlies all examined cases of the evolutionary diversification of their pattern. To gain insight into the mechanisms of morphological differentiation, we sought to identify shavenbaby's downstream targets. We show here that Shavenbaby controls epidermal cell shape, through the transcriptional activation of different classes of cellular effectors, directly contributing to the organization of actin filaments, regulation of the extracellular matrix, and modification of the cuticle. Individual inactivation of shavenbaby's targets produces distinct trichome defects and only their simultaneous inactivation prevent trichome formation. Our data show that shavenbaby governs an evolutionarily conserved developmental module consisting of a set of genes collectively responsible for trichome formation, shedding new light on molecular mechanisms acting during morphogenesis and the way they can influence evolution of animal forms.

  19. Cortactin overexpression results in sustained epidermal growth factor receptor signaling by preventing ligand-induced receptor degradation in human carcinoma cells

    NARCIS (Netherlands)

    van Rossum, AGSH; Gibcus, J; van der Wal, J; Schuuring, E

    2005-01-01

    The chromosome 11q13 region is frequently amplified in human carcinomas and results in an increased expression of various genes including cortactin, and is also associated with an increased invasive potential. Cortactin acts as an important regulator of the actin cytoskeleton. It is therefore very

  20. Epigenetic Regulation of Epidermal Stem Cell Biomarkers and Their Role in Wound Healing

    Directory of Open Access Journals (Sweden)

    Sabita N. Saldanha

    2015-12-01

    Full Text Available As an actively renewable tissue, changes in skin architecture are subjected to the regulation of stem cells that maintain the population of cells responsible for the formation of epidermal layers. Stems cells retain their self-renewal property and express biomarkers that are unique to this population. However, differential regulation of the biomarkers can initiate the pathway of terminal cell differentiation. Although, pockets of non-clarity in stem cell maintenance and differentiation in skin still exist, the influence of epigenetics in epidermal stem cell functions and differentiation in skin homeostasis and wound healing is clearly evident. The focus of this review is to discuss the epigenetic regulation of confirmed and probable epidermal stem cell biomarkers in epidermal stratification of normal skin and in diseased states. The role of epigenetics in wound healing, especially in diseased states of diabetes and cancer, will also be conveyed.

  1. Gloss, colour and grip: multifunctional epidermal cell shapes in bee- and bird-pollinated flowers.

    Science.gov (United States)

    Papiorek, Sarah; Junker, Robert R; Lunau, Klaus

    2014-01-01

    Flowers bear the function of filters supporting the attraction of pollinators as well as the deterrence of floral antagonists. The effect of epidermal cell shape on the visual display and tactile properties of flowers has been evaluated only recently. In this study we quantitatively measured epidermal cell shape, gloss and spectral reflectance of flowers pollinated by either bees or birds testing three hypotheses: The first two hypotheses imply that bee-pollinated flowers might benefit from rough surfaces on visually-active parts produced by conical epidermal cells, as they may enhance the colour signal of flowers as well as the grip on flowers for bees. In contrast, bird-pollinated flowers might benefit from flat surfaces produced by flat epidermal cells, by avoiding frequent visitation from non-pollinating bees due to a reduced colour signal, as birds do not rely on specific colour parameters while foraging. Moreover, flat petal surfaces in bird-pollinated flowers may hamper grip for bees that do not touch anthers and stigmas while consuming nectar and thus, are considered as nectar thieves. Beside this, the third hypothesis implies that those flower parts which are vulnerable to nectar robbing of bee- as well as bird-pollinated flowers benefit from flat epidermal cells, hampering grip for nectar robbing bees. Our comparative data show in fact that conical epidermal cells are restricted to visually-active parts of bee-pollinated flowers, whereas robbing-sensitive parts of bee-pollinated as well as the entire floral surface of bird-pollinated flowers possess on average flat epidermal cells. However, direct correlations between epidermal cell shape and colour parameters have not been found. Our results together with published experimental studies show that epidermal cell shape as a largely neglected flower trait might act as an important feature in pollinator attraction and avoidance of antagonists, and thus may contribute to the partitioning of flower-visitors.

  2. Gloss, colour and grip: multifunctional epidermal cell shapes in bee- and bird-pollinated flowers.

    Directory of Open Access Journals (Sweden)

    Sarah Papiorek

    Full Text Available Flowers bear the function of filters supporting the attraction of pollinators as well as the deterrence of floral antagonists. The effect of epidermal cell shape on the visual display and tactile properties of flowers has been evaluated only recently. In this study we quantitatively measured epidermal cell shape, gloss and spectral reflectance of flowers pollinated by either bees or birds testing three hypotheses: The first two hypotheses imply that bee-pollinated flowers might benefit from rough surfaces on visually-active parts produced by conical epidermal cells, as they may enhance the colour signal of flowers as well as the grip on flowers for bees. In contrast, bird-pollinated flowers might benefit from flat surfaces produced by flat epidermal cells, by avoiding frequent visitation from non-pollinating bees due to a reduced colour signal, as birds do not rely on specific colour parameters while foraging. Moreover, flat petal surfaces in bird-pollinated flowers may hamper grip for bees that do not touch anthers and stigmas while consuming nectar and thus, are considered as nectar thieves. Beside this, the third hypothesis implies that those flower parts which are vulnerable to nectar robbing of bee- as well as bird-pollinated flowers benefit from flat epidermal cells, hampering grip for nectar robbing bees. Our comparative data show in fact that conical epidermal cells are restricted to visually-active parts of bee-pollinated flowers, whereas robbing-sensitive parts of bee-pollinated as well as the entire floral surface of bird-pollinated flowers possess on average flat epidermal cells. However, direct correlations between epidermal cell shape and colour parameters have not been found. Our results together with published experimental studies show that epidermal cell shape as a largely neglected flower trait might act as an important feature in pollinator attraction and avoidance of antagonists, and thus may contribute to the partitioning of

  3. Cultivation of human dermal fibroblasts and epidermal keratinocytes on keratin-coated silica bead substrates.

    Science.gov (United States)

    Tan, Bee Yi; Nguyen, Luong T H; Kim, Hyo-Sop; Kim, Jae-Ho; Ng, Kee Woei

    2017-10-01

    Human hair keratin is promising as a bioactive material platform for various biomedical applications. To explore its versatility further, human hair keratin was coated onto monolayers of silica beads to produce film-like substrates. This combination was hypothesized to provide a synergistic effect in improving the biochemical properties of the resultant composite. Atomic force microscopy analysis showed uniform coatings of keratin on the silica beads with a slight increase in the resulting surface roughness. Keratin-coated silica beads had higher surface energy and relatively lower negative charge than those of bare silica beads. To investigate cell response, human dermal fibroblasts (HDFs), and human epidermal keratinocytes (HEKs) were cultured on the substrates over 4 days. Results showed that keratin coatings significantly enhanced the metabolic activity of HDFs and encouraged cell spreading but did not exert any significant effects on HEKs. HDF expression of collagen I was significantly more intense on the keratin-coated compared to the bare silica substrates. Furthermore, HDF secretion of various cytokines suggested that keratin coatings triggered active cell responses related to wound healing. Collectively, our study demonstrated that human hair keratin-coated silica bead monolayers have the potential to modulate HDF behavior in culture and may be exploited further. © 2017 Wiley Periodicals, Inc. J Biomed Mater Res Part A: 105A: 2789-2798, 2017. © 2017 Wiley Periodicals, Inc.

  4. Hesperetin induces melanin production in adult human epidermal melanocytes.

    Science.gov (United States)

    Usach, Iris; Taléns-Visconti, Raquel; Magraner-Pardo, Lorena; Peris, José-Esteban

    2015-06-01

    One of the major sources of flavonoids for humans are citrus fruits, hesperidin being the predominant flavonoid. Hesperetin (HSP), the aglycon of hesperidin, has been reported to provide health benefits such as antioxidant, anti-inflammatory and anticarcinogenic effects. However, the effect of HSP on skin pigmentation is not clear. Some authors have found that HSP induces melanogenesis in murine B16-F10 melanoma cells, which, if extrapolated to in vivo conditions, might protect skin against photodamage. Since the effect of HSP on normal melanocytes could be different to that observed on melanoma cells, the described effect of HSP on murine melanoma cells has been compared to the effect obtained using normal human melanocytes. HSP concentrations of 25 and 50 µM induced melanin synthesis and tyrosinase activity in human melanocytes in a concentration-dependent manner. Compared to control melanocytes, 25 µM HSP increased melanin production and tyrosinase activity 1.4-fold (p melanin production in human melanocyte cultures could be reproduced on human skin. Copyright © 2015 Elsevier Ltd. All rights reserved.

  5. The peanut lectin-binding glycoproteins of human epidermal keratinocytes

    International Nuclear Information System (INIS)

    Morrison, A.I.; Keeble, S.; Watt, F.M.

    1988-01-01

    The peanut lectin (PNA) is known to bind more strongly to keratinocytes that are undergoing terminal differentiation than to proliferating keratinocytes. In order to investigate the significance of this change in cell-surface carbohydrate authors have identified the PNA-binding glycoproteins of cultured human keratinocytes and antibodies against them. Two heavily glycosylated bands of 110 and 250 kDa were resolved by PAGE of [ 14 C]galactose- or [ 14 C]mannose- and [ 14 C]glucosamine-labeled cell extracts eluted with galactose from PNA affinity columns. The higher molecular weight band was also detected on PNA blots of unlabeled cell extracts transferred to nitrocellulose. Both bands were sensitive to pronase digestion, but only the 250-kDa band was digested with trypsin. A rabbit antiserum that we prepared (anti-PNA-gp) immunoprecipitated both bands from cell extracts. In contrast to PNA, anti-PNA-gp bound equally to proliferating and terminally differentiating cells, indicating that some epitope(s) of the PNA-binding glycoproteins is present on the cell surface prior to terminal differentiation. When keratinocytes grown as a monolayer in low-calcium medium were switched to medium containing 2 mM calcium ions in order to induce desmosome formation and stratification, there was a dramatic redistribution of the PNA-binding glycoproteins, which became concentrated at the boundaries between cells. This may suggest a role for the glycoproteins in cell-cell interactions during stratification

  6. [Enhanced lymphocyte proliferation in the presence of epidermal cells of HIV-infected patients in vitro].

    Science.gov (United States)

    Kappus, R P; Berger, S; Thomas, C A; Ottmann, O G; Ganser, A; Stille, W; Shah, P M

    1992-07-01

    Clinical observations show that the HIV infection is often associated with affections of the skin. In order to examine the involvement of the epidermal immune system in the HIV infection, we determined accessory cell function of epidermal cells from HIV-1-infected patients. For this we measured the proliferative response of enriched CD(4+)-T-lymphocytes from HIV-infected patients and noninfected controls to stimulation with anti-CD3 and IL-2 in the presence of epidermal cells; the enhancement of the response is dependent on the presence of functionally intact accessory cells. The capacity of epidermal cells to increase the anti-CD3-stimulated T-cell proliferative response was significantly enhanced in HIV patients (CDC III/IVA) as compared with noninfected donors. It is discussed, whether the increased activity of epidermal cells from HIV-infected patients may be responsible for several of the dermal lesions in the course of an HIV infection as due to an enhanced production and release of epidermal cell-derived cytokines.

  7. Expression and significance of HMGB1, TLR4 and NF-κB p65 in human epidermal tumors

    International Nuclear Information System (INIS)

    Weng, Hui; Deng, Yunhua; Xie, Yuyan; Liu, Hongbo; Gong, Feili

    2013-01-01

    High mobility group protein box 1 (HMGB1) is a DNA binding protein located in nucleus. It is released into extracellular fluid where it acts as a novel proinflammatory cytokine which interacts with Toll like receptor 4 (TLR4) to activate nuclear factor-κB (NF-κB). This sequence of events is involved in tumor growth and progression. However, the effects of HMGB1, TLR4 and NF-κB on epidermal tumors remain unclear. Human epidermal tumor specimens were obtained from 96 patients. Immunohistochemistry was used to detect expression of HMGB1, TLR4 and NF-κB p65 in human epidermal tumor and normal skin specimens. Western blot analysis was used to detect the expression of NF-κB p65 in epithelial cell nuclei in human epidermal tumor and normal tissues. Immunohistochemistry and western blot analysis indicated a progressive but statistically significant increase in p65 expression in epithelial nuclei in benign seborrheic keratosis (SK), precancerous lesions (PCL), low malignancy basal cell carcinoma (BCC) and high malignancy squamous cell carcinoma (SCC) (P <0.01). The level of extracellular HMGB1 in SK was significantly higher than in normal skin (NS) (P <0.01), and was higher than in SCC but without statistical significance. The level of TLR4 on epithelial membranes of SCC cells was significantly higher than in SK, PCL, BCC and NS (P <0.01). There was a significant positive correlation between p65 expression in the epithelial nuclei and TLR4 expression on the epithelial cell membranes (r = 0.3212, P <0.01). These findings indicate that inflammation is intensified in parallel with increasing malignancy. They also indicate that the TLR4 signaling pathway, rather than HMGB1, may be the principal mediator of inflammation in high-grade malignant epidermal tumors. Combined detection of p65 in the epithelial nuclei and TLR4 on the epithelial membranes may assist the accurate diagnosis of malignant epidermal tumors

  8. Clinical Translation and Validation of a Predictive Biomarker for Patritumab, an Anti-human Epidermal Growth Factor Receptor 3 (HER3) Monoclonal Antibody, in Patients With Advanced Non-small Cell Lung Cancer.

    Science.gov (United States)

    Mendell, Jeanne; Freeman, Daniel J; Feng, Wenqin; Hettmann, Thore; Schneider, Matthias; Blum, Sabine; Ruhe, Jens; Bange, Johannes; Nakamaru, Kenji; Chen, Shuquan; Tsuchihashi, Zenta; von Pawel, Joachim; Copigneaux, Catherine; Beckman, Robert A

    2015-03-01

    During early clinical development, prospective identification of a predictive biomarker and validation of an assay method may not always be feasible. Dichotomizing a continuous biomarker measure to classify responders also leads to challenges. We present a case study of a prospective-retrospective approach for a continuous biomarker identified after patient enrollment but defined prospectively before the unblinding of data. An analysis of the strengths and weaknesses of this approach and the challenges encountered in its practical application are also provided. HERALD (NCT02134015) was a double-blind, phase 2 study in patients with non-small cell lung cancer (NSCLC) randomized to erlotinib with placebo or with high or low doses of patritumab, a monoclonal antibody targeted against human epidermal growth factor receptor 3 (HER3). While the primary objective was to assess safety and progression-free survival (PFS), a secondary objective was to determine a single predictive biomarker hypothesis to identify subjects most likely to benefit from the addition of patritumab. Although not identified as the primary biomarker in the study protocol, on the basis of preclinical results from 2 independent laboratories, expression levels of the HER3 ligand heregulin (HRG) were prospectively declared the predictive biomarker before data unblinding but after subject enrollment. An assay to measure HRG mRNA was developed and validated. Other biomarkers, such as epidermal growth factor receptor (EGFR) mutation status, were also evaluated in an exploratory fashion. The cutoff value for high vs. low HRG mRNA levels was set at the median delta threshold cycle. A maximum likelihood analysis was performed to evaluate the provisional cutoff. The relationship of HRG values to PFS hazard ratios (HRs) was assessed as a measure of internal validation. Additional NSCLC samples were analyzed to characterize HRG mRNA distribution. The subgroup of patients with high HRG mRNA levels ("HRG

  9. Single cell-type comparative metabolomics of epidermal bladder cells from the halophyte Mesembryanthemum crystallinum

    OpenAIRE

    Barkla, Bronwyn J.; Vera-Estrella, Rosario

    2015-01-01

    One of the remarkable adaptive features of the halophyte and facultative CAM plant Mesembryathemum crystallinum are the specialized modified trichomes called epidermal bladder cells (EBC) which cover the leaves, stems, and peduncle of the plant. They are present from an early developmental stage but upon salt stress rapidly expand due to the accumulation of water and sodium. This particular plant feature makes it an attractive system for single cell type studies, with recent proteomics and tr...

  10. H{sup +}/peptide transporter (PEPT2) is expressed in human epidermal keratinocytes and is involved in skin oligopeptide transport

    Energy Technology Data Exchange (ETDEWEB)

    Kudo, Michiko; Katayoshi, Takeshi; Kobayashi-Nakamura, Kumiko [DHC Corporation Laboratories, Division 2, 2-42 Hamada, Mihama-ku, Chiba 261-0025 (Japan); Akagawa, Mitsugu [Department of Biological Chemistry, Division of Applied Life Science, Graduate School of Life and Environmental Sciences, Osaka Prefecture University, 1-1 Gakuen-cho, Naka-ku, Sakai 599-8531 (Japan); Tsuji-Naito, Kentaro, E-mail: knaito@dhc.co.jp [DHC Corporation Laboratories, Division 2, 2-42 Hamada, Mihama-ku, Chiba 261-0025 (Japan)

    2016-07-08

    Peptide transporter 2 (PEPT2) is a member of the proton-coupled oligopeptide transporter family, which mediates the cellular uptake of oligopeptides and peptide-like drugs. Although PEPT2 is expressed in many tissues, its expression in epidermal keratinocytes remains unclear. We investigated PEPT2 expression profile and functional activity in keratinocytes. We confirmed PEPT2 mRNA expression in three keratinocyte lines (normal human epidermal keratinocytes (NHEKs), immortalized keratinocytes, and malignant keratinocytes) by reverse transcription-polymerase chain reaction (RT-PCR) and quantitative real-time RT-PCR. In contrast to PEPT1, PEPT2 expression in the three keratinocytes was similar or higher than that in HepG2 cells, used as PEPT2-positive cells. Immunolocalization analysis using human skin showed epidermal PEPT2 localization. We studied keratinocyte transport function by measuring the oligopeptide content using liquid chromatography/tandem mass spectrometry. Glycylsarcosine uptake in NHEKs was pH-dependent, suggesting that keratinocytes could absorb small peptides in the presence of an inward H{sup +} gradient. We also performed a skin-permeability test of several oligopeptides using skin substitute, suggesting that di- and tripeptides pass actively through the epidermis. In conclusion, PEPT2 is expressed in keratinocytes and involved in skin oligopeptide uptake. -- Highlights: •PEPT2 is expressed in keratinocytes, which are more common than other skin cells. •Immunolocalization analysis using human skin revealed epidermal PEPT2 localization. •Keratinocytes could absorb small peptides in the presence of an inward H{sup +} gradient. •Di- and tripeptide pass actively through the epidermis.

  11. Comparative SAXS and DSC study on stratum corneum structural organization in an epidermal cell culture model (ROC)

    DEFF Research Database (Denmark)

    Kuntsche, Judith; Herre, Angela; Fahr, Alfred

    2013-01-01

    barrier similar to that of human stratum corneum is, however, a prerequisite. In this study, the stratum corneum lipid organization in an epidermal cell culture model based on rat epidermal keratinocytes (REK organotypic culture, ROC) was investigated by small-angle X-ray scattering (SAXS) in dependence......Cell cultured skin equivalents present an alternative for dermatological in vitro evaluations of drugs and excipients as they provide the advantage of availability, lower variability and higher assay robustness compared to native skin. For penetration/permeation studies, an adequate stratum corneum...... and SC lipid organization. Cultivation for 21days resulted in further minor changes in the structural organization of ROC SC. The SAXS patterns of ROC SC had overall large similarities with that of human SC and point to the presence of a long periodicity phase with a repeat distance of about 122Å, e...

  12. Extraction of high-quality epidermal RNA after ammonium thiocyanate-induced dermo-epidermal separation of 4 mm human skin biopsies

    DEFF Research Database (Denmark)

    Clemmensen, Anders; Thomassen, Mads; Clemmensen, Ole

    2009-01-01

    To obtain a separation of the epidermal and dermal compartments to examine compartment specific biological mechanisms in the skin, we incubated 4 mm human skin punch biopsies in ammonium thiocyanate. We wanted to test (i) the histological quality of the dermo-epidermal separation obtained...... by different incubation times; (ii) the amount and quality of extractable epidermal RNA and (iii) its impact on sample RNA expression profiles assessed by large-scale gene expression microarray analysis in both normal and inflamed skin. At 30-min incubation, the split between dermis and epidermis...... and almost completely separated from the dermis of 4 mm skin biopsies by 30 min incubation in 3.8% ammonium thiocyanate combined with curettage of the dermal surface, producing high-quality RNA suitable for transcriptional analysis. Our refined method of dermo-epidermal separation will undoubtedly prove...

  13. Inhibition of epidermal cell proliferation by borderline rays

    Energy Technology Data Exchange (ETDEWEB)

    Born, W [Freiburg Univ.; Daikeler, G

    1976-08-01

    Treatment of guinea pig flanks with very soft x-rays (borderline rays) directly caused a partial block of epidermal DNA synthesis which had been determined by measuring the /sup 3/H-Tdr incorporation. Higher doses and repeated applications would undoubtedly cause lasting damage to the tissue. The enhanced epidermal DNA synthesis which is sometimes observed should not be misinterpreted as a sign of a directly biopositive utilisation of the quantum energy supplied. Rather, it is a secondary repair process following initial phases of depression. A reparative increase in DNA synthesis may also occur as a primary process if the radiation is almost completely absorbed above the germinative layer.

  14. Hair Follicle and Sebaceous Gland De Novo Regeneration With Cultured Epidermal Stem Cells and Skin-Derived Precursors.

    Science.gov (United States)

    Wang, Xiaoxiao; Wang, Xusheng; Liu, Jianjun; Cai, Ting; Guo, Ling; Wang, Shujuan; Wang, Jinmei; Cao, Yanpei; Ge, Jianfeng; Jiang, Yuyang; Tredget, Edward E; Cao, Mengjun; Wu, Yaojiong

    2016-12-01

    : Stem cell-based organ regeneration is purported to enable the replacement of impaired organs in the foreseeable future. Here, we demonstrated that a combination of cultured epidermal stem cells (Epi-SCs) derived from the epidermis and skin-derived precursors (SKPs) was capable of reconstituting functional hair follicles and sebaceous glands (SG). When Epi-SCs and SKPs were mixed in a hydrogel and implanted into an excisional wound in nude mice, the Epi-SCs formed de novo epidermis along with hair follicles, and SKPs contributed to dermal papilla in the neogenic hair follicles. Notably, a combination of culture-expanded Epi-SCs and SKPs derived from the adult human scalp were sufficient to generate hair follicles and hair. Bone morphogenetic protein 4, but not Wnts, sustained the expression of alkaline phosphatase in SKPs in vitro and the hair follicle-inductive property in vivo when SKPs were engrafted with neonatal epidermal cells into excisional wounds. In addition, Epi-SCs were capable of differentiating into sebocytes and formed de novo SGs, which excreted lipids as do normal SGs. Thus our results indicate that cultured Epi-SCs and SKPs are sufficient to generate de novo hair follicles and SGs, implying great potential to develop novel bioengineered skin substitutes with appendage genesis capacity. In postpartum humans, skin appendages lost in injury are not regenerated, despite the considerable achievement made in skin bioengineering. In this study, transplantation of a combination of culture-expanded epidermal stem cells and skin-derived progenitors from mice and adult humans led to de novo regeneration of functional hair follicles and sebaceous glands. The data provide transferable knowledge for the development of novel bioengineered skin substitutes with epidermal appendage regeneration capacity. ©AlphaMed Press.

  15. Signalling in the epidermis: the E2F cell cycle regulatory pathway in epidermal morphogenesis, regeneration and transformation.

    Science.gov (United States)

    Ivanova, Iordanka A; D'Souza, Sudhir J A; Dagnino, Lina

    2005-01-01

    The epidermis is the outermost layer in the skin, and it is the first line of defence against the environment. The epidermis also provides a barrier against loss of fluids and electrolytes, which is crucial for life. Essential in the maintenance of this tissue is its ability to continually self-renew and regenerate after injury. These two characteristics are critically dependent on the ability of the principal epidermal cell type, the keratinocyte, to proliferate and to respond to differentiation cues. Indeed, the epidermis is a multilayered tissue composed of keratinocyte stem cells and their differentiated progeny. Central for the control of cell proliferation is the E2F transcription factor regulatory network. This signaling network also includes cyclins, cdk, cdk inhibitors and the retinoblastoma (pRb) family of proteins. The biological importance of the E2F/pRb pathway is emphasized by the fact that a majority of human tumours exhibit alterations that disrupt the ability of pRb proteins to inhibit E2F, leading to permanent activation of the latter. Further, E2F is essential for normal epidermal regeneration after injury. Other member of the E2F signaling pathway are also involved in epidermal development and pathophysiology. Thus, whereas the pRb family of proteins is essential for epidermal morphogenesis, abnormal regulation of cyclins and E2F proteins results in tumorgenesis in this tissue. In this review, we discuss the role of each member of this important growth regulatory network in epidermal formation, homeostasis and carcinogenesis.

  16. Dynamic changes in nicotinamide pyridine dinucleotide content in normal human epidermal keratinocytes and their effect on retinoic acid biosynthesis

    International Nuclear Information System (INIS)

    Pinkas-Sarafova, Adriana; Markova, N.G.; Simon, M.

    2005-01-01

    The function of many enzymes that regulate metabolism and transcription depends critically on the nicotinamide pyridine dinucleotides. To understand the role of NAD(P)(H) in physiology and pathophysiology, it is imperative to estimate both their amount and ratios in a given cell type. In human epidermis and in cultured epidermal keratinocytes, we found that the total dinucleotide content is in the low millimolar range. The dinucleotide pattern changes during proliferation and maturation of keratinocytes in culture. Differences in the concentrations of NAD(P)(H) of 1.5- to 12-fold were observed. This resulted in alteration of the NAD(P)H/NAD(P) ratio, which could impact the differential regulation of both transcriptional and metabolic processes. In support of this notion, we provide evidence that the two-step oxidation of retinol to retinoic acid, a nuclear hormone critical for epidermal homeostasis, can be regulated by the relative physiological amounts of the pyridine dinucleotides

  17. Niclosamide inhibits epithelial-mesenchymal transition and tumor growth in lapatinib-resistant human epidermal growth factor receptor 2-positive breast cancer.

    Science.gov (United States)

    Liu, Junjun; Chen, Xiaosong; Ward, Toby; Mao, Yan; Bockhorn, Jessica; Liu, Xiaofei; Wang, Gen; Pegram, Mark; Shen, Kunwei

    2016-02-01

    Acquired resistance to lapatinib, a human epidermal growth factor receptor 2 kinase inhibitor, remains a clinical problem for women with human epidermal growth factor receptor 2-positive advanced breast cancer, as metastasis is commonly observed in these patients. Niclosamide, an anti-helminthic agent, has recently been shown to exhibit cytotoxicity to tumor cells with stem-like characteristics. This study was designed to identify the mechanisms underlying lapatinib resistance and to determine whether niclosamide inhibits lapatinib resistance by reversing epithelial-mesenchymal transition. Here, two human epidermal growth factor receptor 2-positive breast cancer cell lines, SKBR3 and BT474, were exposed to increasing concentrations of lapatinib to establish lapatinib-resistant cultures. Lapatinib-resistant SKBR3 and BT474 cells exhibited up-regulation of the phenotypic epithelial-mesenchymal transition markers Snail, vimentin and α-smooth muscle actin, accompanied by activation of nuclear factor-кB and Src and a concomitant increase in stem cell marker expression (CD44(high)/CD24(low)), compared to naive lapatinib-sensitive SKBR3 and BT474 cells, respectively. Interestingly, niclosamide reversed epithelial-mesenchymal transition, induced apoptosis and inhibited cell growth by perturbing aberrant signaling pathway activation in lapatinib-resistant human epidermal growth factor receptor 2-positive cells. The ability of niclosamide to alleviate stem-like phenotype development and invasion was confirmed. Collectively, our results demonstrate that lapatinib resistance correlates with epithelial-mesenchymal transition and that niclosamide inhibits lapatinib-resistant cell viability and epithelial-mesenchymal transition. These findings suggest a role of niclosamide or derivatives optimized for more favorable bioavailability not only in reversing lapatinib resistance but also in reducing metastatic potential during the treatment of human epidermal growth factor receptor

  18. Differences in human skin between the epidermal growth factor receptor distribution detected by EGF binding and monoclonal antibody recognition

    DEFF Research Database (Denmark)

    Green, M R; Couchman, J R

    1985-01-01

    , the eccrine sweat glands, capillary system, and the hair follicle outer root sheath, generally similar in pattern to that previously reported for full-thickness rat skin and human epidermis. The same areas also bound EGF-R1 but in addition the monoclonal antibody recognized a cone of melanin containing......Two methods have been used to examine epidermal growth factor (EGF) receptor distribution in human scalp and foreskin. The first employed [125I]EGF viable explants and autoradiography to determine the EGF binding pattern while the second used a monoclonal antibody to the human EGF receptor to map...... whether EGF-R1 could recognize molecules unrelated to the EGF receptor, the EGF binding and EGF-R1 recognition profiles were compared on cultures of SVK14 cells, a SV40 transformed human keratinocyte cell line. EGF binding and EGF-R1 monoclonal antibody distribution on these cells was found to be similar...

  19. Brief study about the distribution of recombinant human Epidermic Growth Factor (rh-EGF)

    International Nuclear Information System (INIS)

    Rodriguez Garcia, J.C.; De Dios D Espaux, R.; Bello Garciga, J.L.

    1997-01-01

    This report describes results of the study about biodistribution of I-125 recombinant human Epidermic Growth Factor (rhEGF). The radiolabelled product was administrated to Sprague Dawley rats in three different ways: intramuscular, subcutaneous and epidermic; the highest concentration of EGF in blood was found 4 hours after rhEGF administration, with a greater distribution in the plasma with regard to cellular pellet. The slowest plasma clearance corresponded to the intramuscular administration. The highest concentration of radiolabelled rhEGF was found in liver, kidney and intestine. It was found that radiolabelled EGF is excreted mainly throughout urine and faeces although other excretion pathways could exist

  20. Influence of epidermal hydration on the friction of human skin against textiles

    OpenAIRE

    Gerhardt, L.-C; Strässle, V; Lenz, A; Spencer, N.D; Derler, S

    2008-01-01

    Friction and shear forces, as well as moisture between the human skin and textiles are critical factors in the formation of skin injuries such as blisters, abrasions and decubitus. This study investigated how epidermal hydration affects the friction between skin and textiles.

  1. Influence of epidermal hydration on the friction of human skin against textile

    NARCIS (Netherlands)

    Gerhardt, L.C.; Strässle, V.; Lenz, A.; Spencer, N.D.; Derler, S.

    2008-01-01

    Friction and shear forces, as well as moisture between the human skin and textiles are critical factors in the formation of skin injuries such as blisters, abrasions and decubitus. This study investigated how epidermal hydration affects the friction between skin and textiles. The friction between

  2. Pharmacologic induction of epidermal melanin and protection against sunburn in a humanized mouse model.

    Science.gov (United States)

    Amaro-Ortiz, Alexandra; Vanover, Jillian C; Scott, Timothy L; D'Orazio, John A

    2013-09-07

    Fairness of skin, UV sensitivity and skin cancer risk all correlate with the physiologic function of the melanocortin 1 receptor, a Gs-coupled signaling protein found on the surface of melanocytes. Mc1r stimulates adenylyl cyclase and cAMP production which, in turn, up-regulates melanocytic production of melanin in the skin. In order to study the mechanisms by which Mc1r signaling protects the skin against UV injury, this study relies on a mouse model with "humanized skin" based on epidermal expression of stem cell factor (Scf). K14-Scf transgenic mice retain melanocytes in the epidermis and therefore have the ability to deposit melanin in the epidermis. In this animal model, wild type Mc1r status results in robust deposition of black eumelanin pigment and a UV-protected phenotype. In contrast, K14-Scf animals with defective Mc1r signaling ability exhibit a red/blonde pigmentation, very little eumelanin in the skin and a UV-sensitive phenotype. Reasoning that eumelanin deposition might be enhanced by topical agents that mimic Mc1r signaling, we found that direct application of forskolin extract to the skin of Mc1r-defective fair-skinned mice resulted in robust eumelanin induction and UV protection (1). Here we describe the method for preparing and applying a forskolin-containing natural root extract to K14-Scf fair-skinned mice and report a method for measuring UV sensitivity by determining minimal erythematous dose (MED). Using this animal model, it is possible to study how epidermal cAMP induction and melanization of the skin affect physiologic responses to UV exposure.

  3. BAG-1 enhances cell-cell adhesion, reduces proliferation and induces chaperone-independent suppression of hepatocyte growth factor-induced epidermal keratinocyte migration

    International Nuclear Information System (INIS)

    Hinitt, C.A.M.; Wood, J.; Lee, S.S.; Williams, A.C.; Howarth, J.L.; Glover, C.P.; Uney, J.B.; Hague, A.

    2010-01-01

    Cell motility is important in maintaining tissue homeostasis, facilitating epithelial wound repair and in tumour formation and progression. The aim of this study was to determine whether BAG-1 isoforms regulate epidermal cell migration in in vitro models of wound healing. In the human epidermal cell line HaCaT, endogenous BAG-1 is primarily nuclear and increases with confluence. Both transient and stable p36-Bag-1 overexpression resulted in increased cellular cohesion. Stable transfection of either of the three human BAG-1 isoforms p36-Bag-1 (BAG-1S), p46-Bag-1 (BAG-1M) and p50-Bag-1 (BAG-1L) inhibited growth and wound closure in serum-containing medium. However, in response to hepatocyte growth factor (HGF) in serum-free medium, BAG-1S/M reduced communal motility and colony scattering, but BAG-1L did not. In the presence of HGF, p36-Bag-1 transfectants retained proliferative response to HGF with no change in ERK1/2 activation. However, the cells retained E-cadherin localisation at cell-cell junctions and exhibited pronounced cortical actin. Point mutations in the BAG domain showed that BAG-1 inhibition of motility is independent of its function as a chaperone regulator. These findings are the first to suggest that BAG-1 plays a role in regulating cell-cell adhesion and suggest an important function in epidermal cohesion.

  4. High Efficient Expression, Purification, and Functional Characterization of Native Human Epidermal Growth Factor in Escherichia coli

    Directory of Open Access Journals (Sweden)

    Yi Ma

    2016-01-01

    Full Text Available Human epidermal growth factor (hEGF is a small, mitotic growth polypeptide that promotes the proliferation of various cells and is widely applied in clinical practices. However, high efficient expression of native hEGF in Escherichia coli has not been successful, since three disulfide bonds in monomer hEGF made it unable to fold into correct 3D structure using in vivo system. To tackle this problem, we fused Mxe GyrA intein (Mxe at the C-terminal of hEGF followed by small ubiquitin-related modifier (SUMO and 10x His-tag to construct a chimeric protein hEGF-Mxe-SUMO-H10. The fusion protein was highly expressed at the concentration of 281 mg/L and up to 59.5% of the total cellular soluble proteins. The fusion protein was purified by affinity chromatography and 29.4 mg/L of native hEGF can be released by thiol induced N-terminal cleavage without any proteases. The mitotic activity in Balb/c 3T3 cells is proliferated by commercial and recombinant hEGF measured with methylthiazolyldiphenyl-tetrazolium bromide (MTT assay which indicated that recombinant hEGF protein stimulates the cell proliferation similar to commercial protein. This study significantly improved the yield and reduced the cost of hEGF in the recombinant E. coli system and could be a better strategy to produce native hEGF for pharmaceutical development.

  5. High Efficient Expression, Purification, and Functional Characterization of Native Human Epidermal Growth Factor in Escherichia coli.

    Science.gov (United States)

    Ma, Yi; Yu, Jieying; Lin, Jinglian; Wu, Shaomin; Li, Shan; Wang, Jufang

    2016-01-01

    Human epidermal growth factor (hEGF) is a small, mitotic growth polypeptide that promotes the proliferation of various cells and is widely applied in clinical practices. However, high efficient expression of native hEGF in Escherichia coli has not been successful, since three disulfide bonds in monomer hEGF made it unable to fold into correct 3D structure using in vivo system. To tackle this problem, we fused Mxe GyrA intein (Mxe) at the C-terminal of hEGF followed by small ubiquitin-related modifier (SUMO) and 10x His-tag to construct a chimeric protein hEGF-Mxe-SUMO-H 10 . The fusion protein was highly expressed at the concentration of 281 mg/L and up to 59.5% of the total cellular soluble proteins. The fusion protein was purified by affinity chromatography and 29.4 mg/L of native hEGF can be released by thiol induced N-terminal cleavage without any proteases. The mitotic activity in Balb/c 3T3 cells is proliferated by commercial and recombinant hEGF measured with methylthiazolyldiphenyl-tetrazolium bromide (MTT) assay which indicated that recombinant hEGF protein stimulates the cell proliferation similar to commercial protein. This study significantly improved the yield and reduced the cost of hEGF in the recombinant E. coli system and could be a better strategy to produce native hEGF for pharmaceutical development.

  6. Concise Review: Wnt Signaling Pathways in Skin Development and Epidermal Stem Cells.

    Science.gov (United States)

    Veltri, Anthony; Lang, Christopher; Lien, Wen-Hui

    2018-01-01

    Mammalian skin and its appendages constitute the integumentary system forming a barrier between the organism and its environment. During development, skin epidermal cells divide rapidly and stratify into a multilayered epithelium, as well as invaginate downward in the underlying mesenchyme to form hair follicles (HFs). In postnatal skin, the interfollicular epidermal (IFE) cells continuously proliferate and differentiate while HFs undergo cycles of regeneration. Epidermal regeneration is fueled by epidermal stem cells (SCs) located in the basal layer of the IFE and the outer layer of the bulge in the HF. Epidermal development and SC behavior are mainly regulated by various extrinsic cues, among which Wnt-dependent signaling pathways play crucial roles. This review not only summarizes the current knowledge of Wnt signaling pathways in the regulation of skin development and governance of SCs during tissue homeostasis, but also discusses the potential crosstalk of Wnt signaling with other pathways involved in these processes. Stem Cells 2018;36:22-35. © 2017 AlphaMed Press.

  7. Fatal Metastatic Cutaneous Squamous Cell Carcinoma Evolving from a Localized Verrucous Epidermal Nevus

    Directory of Open Access Journals (Sweden)

    Hassan Riad

    2013-10-01

    Full Text Available A malignant transformation is known to occur in many nevi such as a sebaceous nevus or a basal cell nevus, but a verrucous epidermal nevus has only rarely been associated with neoplastic changes. Keratoacanthoma, multifocal papillary apocrine adenoma, multiple malignant eccrine poroma, basal cell carcinoma and cutaneous squamous cell carcinoma (CSCC have all been reported to develop from a verrucous epidermal nevus. CSCC has also been reported to arise from other nevoid lesions like a nevus comedonicus, porokeratosis, a sebaceous nevus, an oral sponge nevus and an ichthyosiform nevus with CHILD syndrome. Here we report a case of progressive poorly differentiated CSCC arising from a localized verrucous epidermal nevus, which caused both spinal cord and brain metastasis.

  8. The Antiaging Properties of Andrographis paniculata by Activation Epidermal Cell Stemness.

    Science.gov (United States)

    You, Jiyoung; Roh, Kyung-Baeg; Li, Zidan; Liu, Guangrong; Tang, Jian; Shin, Seoungwoo; Park, Deokhoon; Jung, Eunsun

    2015-09-22

    Andrographis paniculata (A. paniculata, Chuanxinlian), a medicinal herb with an extremely bitter taste that is native to China and other parts of Southeast Asia, possesses immense therapeutic value; however, its therapeutic properties have rarely been applied in the field of skin care. In this study, we investigated the effect of an A. paniculata extract (APE) on human epidermal stem cells (EpSCs), and confirmed its anti-aging effect through in vitro, ex vivo, and in vivo study. An MTT assay was used to determine cell proliferation. A flow cytometric analysis, with propidium iodide, was used to evaluate the cell cycle. The expression of integrin β1 (CD29), the stem cell marker, was detected with antibodies, using flow cytometry in vitro, and immunohistochemical assays in ex vivo. Type 1 collagen and VEGF (vascular endothelial growth factor) were measured using an enzyme-linked immunosorbent assay (ELISA). During the clinical study, skin hydration, elasticity, wrinkling, sagging, and dermal density were evaluated before treatment and at four and eight weeks after the treatment with the test product (containing the APE) on the face. The proliferation of the EpSCs, treated with the APE, increased significantly. In the cell cycle analysis, the APE increased the G2/M and S stages in a dose-dependent manner. The expression of integrin β1, which is related to epidermal progenitor cell expansion, was up-regulated in the APE-treated EpSCs and skin explants. In addition, the production of VEGF in the EpSCs increased significantly in response to the APE treatment. Consistent with these results, the VEGF and APE-treated EpSCs conditioned medium enhanced the Type 1 collagen production in normal human fibroblasts (NHFs). In the clinical study, the APE improved skin hydration, dermal density, wrinkling, and sagging significantly. Our findings revealed that the APE promotes a proliferation of EpSCs, through the up-regulation of the integrin β1 and VEGF expression. The VEGF

  9. The Antiaging Properties of Andrographis paniculata by Activation Epidermal Cell Stemness

    Directory of Open Access Journals (Sweden)

    Jiyoung You

    2015-09-01

    Full Text Available Andrographis paniculata (A. paniculata, Chuanxinlian, a medicinal herb with an extremely bitter taste that is native to China and other parts of Southeast Asia, possesses immense therapeutic value; however, its therapeutic properties have rarely been applied in the field of skin care. In this study, we investigated the effect of an A. paniculata extract (APE on human epidermal stem cells (EpSCs, and confirmed its anti-aging effect through in vitro, ex vivo, and in vivo study. An MTT assay was used to determine cell proliferation. A flow cytometric analysis, with propidium iodide, was used to evaluate the cell cycle. The expression of integrin β1 (CD29, the stem cell marker, was detected with antibodies, using flow cytometry in vitro, and immunohistochemical assays in ex vivo. Type 1 collagen and VEGF (vascular endothelial growth factor were measured using an enzyme-linked immunosorbent assay (ELISA. During the clinical study, skin hydration, elasticity, wrinkling, sagging, and dermal density were evaluated before treatment and at four and eight weeks after the treatment with the test product (containing the APE on the face. The proliferation of the EpSCs, treated with the APE, increased significantly. In the cell cycle analysis, the APE increased the G2/M and S stages in a dose-dependent manner. The expression of integrin β1, which is related to epidermal progenitor cell expansion, was up-regulated in the APE-treated EpSCs and skin explants. In addition, the production of VEGF in the EpSCs increased significantly in response to the APE treatment. Consistent with these results, the VEGF and APE-treated EpSCs conditioned medium enhanced the Type 1 collagen production in normal human fibroblasts (NHFs. In the clinical study, the APE improved skin hydration, dermal density, wrinkling, and sagging significantly. Our findings revealed that the APE promotes a proliferation of EpSCs, through the up-regulation of the integrin β1 and VEGF expression

  10. Long-wave ultraviolet light induces phospholipase activation in cultured human epidermal keratinocytes

    International Nuclear Information System (INIS)

    Hanson, D.; DeLeo, V.

    1990-01-01

    Long wave ultraviolet radiation (UVA) has been shown to play an important role in the overall response of skin to solar radiation, including sunburn, tanning, premature aging, and non-melanoma skin cancer. UVA induction of inflammation in human skin is thought to be mediated by membrane lipid derived products. In order to investigate the mechanism of this response we examined the effect of UVA on phospholipid metabolism of human epidermal keratinocytes in culture. Keratinocytes were grown in serum free low calcium medium. The cells were prelabeled with [3H] arachidonic acid or [3H] choline and irradiated with UVA (Honle 2002-Hg vapor lamp). Identification and quantitation of specific membrane phospholipid-derived components was achieved using high-performance liquid chromatography, paper chromatography, and radioimmunoassay. UVA resulted in a linear dose dependent release of [3H] arachidonic acid into medium between 1 and 20 joule/cm2. This response was inhibited in an oxygen-reduced environment. The radiolabel released was predominantly free arachidonate and cyclooxygenase metabolites. Cyclooxygenase metabolites prostaglandin E2 and prostacyclin derivative, 6-keto-prostaglandin F1a, were stimulated following UVA irradiation, but the lipoxygenase metabolite, leukotriene B was not detected. Maximal release was measured immediately after irradiation and changed little over 24 h post-irradiation. UVA stimulated an increase of [3H] choline metabolites glycerophosphorylcholine and phosphorylcholine in media extracts suggesting UVA activation of phospholipase C and phospholipase A2 or diacylglyceride lipase

  11. Human Epidermal Growth Factor Receptor 2 Overexpression in Micropapillary and Other Variants of Urothelial Carcinoma.

    Science.gov (United States)

    Behzatoğlu, Kemal; Yörükoğlu, Kutsal; Demir, Hale; Bal, Nebil

    2016-06-21

    Human epidermal growth factor receptor 2 (HER2) protein overexpression or gene amplification has been shown in urothelial bladder cancer. This could be helpful when using targeted anti-HER2 therapy on these tumors. To evaluate HER2 immunohistochemical expression in conventional urothelial carcinoma (UC), in situ UC, and UC variants primarily in micropapillary urothelial carcinoma (MPUC). The study evaluated 60 MPUC cases; 25 invasive, 20 low-grade noninvasive, and 10 high-grade noninvasive UC cases; 8 in situ UC cases; and 69 UC variant cases. The immunohistochemistry staining was scored according to recommendations of the American Society of Clinical Oncology/College of American Pathologists 2013 HER2 test guideline established for breast cancer and only 3+ staining was considered HER2 overexpression. HER2 overexpression was determined by 3+ staining. 34 of 60 MPUC cases (56%) showed HER2 overexpression (3+ staining). We observed 3+ staining HER2 overexpression in nine of 25 conventional invasive UC cases (36%), four of eight in situ UC cases (50%), and three of six lipid cell variant cases (50%). 3+ staining HER2 overexpression was not seen in eight glandular, six small cell, and five sarcomatoid variant cases. HER2 overexpression was negative in the 20 low-grade noninvasive UC cases but positive in two of the 10 high-grade noninvasive UC cases (20%). We observed HER2 overexpression most commonly in MPUC cases. We also found HER2 overexpression in conventional invasive and in situ UC cases. Pure in situ UC and conventional invasive UC, especially MPUC, could be candidate tumors for treatment with anti-HER2 antibody (trastuzumab therapy). Targeted therapy has a limited place in treatment of bladder cancer. In this study, human epidermal growth factor receptor 2 (HER2) overexpression in bladder carcinomas was evaluated in a large number of cases. Anti-HER2 therapy could be used in bladder cancers, as in breast and gastric cancers. Copyright © 2016 European

  12. Chemical allergens stimulate human epidermal keratinocytes to produce lymphangiogenic vascular endothelial growth factor.

    Science.gov (United States)

    Bae, Ok-Nam; Ahn, Seyeon; Jin, Sun Hee; Hong, Soo Hyun; Lee, Jinyoung; Kim, Eun-Sun; Jeong, Tae Cheon; Chun, Young-Jin; Lee, Ai-Young; Noh, Minsoo

    2015-03-01

    Allergic contact dermatitis (ACD) is a cell-mediated immune response that involves skin sensitization in response to contact with various allergens. Angiogenesis and lymphangiogenesis both play roles in the allergic sensitization process. Epidermal keratinocytes can produce vascular endothelial growth factor (VEGF) in response to UV irradiation and during wound healing. However, the effect of haptenic chemical allergens on the VEGF production of human keratinocytes, which is the primary contact site of toxic allergens, has not been thoroughly researched. We systematically investigated whether immune-regulatory cytokines and chemical allergens would lead to the production of VEGF in normal human keratinocytes (NHKs) in culture. VEGF production significantly increased when NHKs were treated with IFNγ, IL-1α, IL-4, IL-6, IL-17A, IL-22 or TNFα. Among the human sensitizers listed in the OECD Test Guideline (TG) 429, we found that CMI/MI, DNCB, 4-phenylenediamine, cobalt chloride, 2-mercaptobenzothiazole, citral, HCA, cinnamic alcohol, imidazolidinyl urea and nickel chloride all significantly upregulated VEGF production in NHKs. In addition, common human haptenic allergens such as avobenzone, formaldehyde and urushiol, also induced the keratinocyte-derived VEGF production. VEGF upregulation by pro-inflammatory stimuli, IFNγ, DNCB or formaldehyde is preceded by the production of IL-8, an acute inflammatory phase cytokine. Lymphangiogenic VEGF-C gene transcription was significantly increased when NHKs were treated with formaldehyde, DNCB or urushiol, while transcription of VEGF-A and VEGF-B did not change. Therefore, the chemical allergen-induced VEGF upregulation is mainly due to the increase in lymphangiogenic VEGF-C transcription in NHKs. These results suggest that keratinocyte-derived VEGF may regulate the lymphangiogenic process during the skin sensitization process of ACD. Copyright © 2015 Elsevier Inc. All rights reserved.

  13. The SKINT1-like gene is inactivated in hominoids but not in all primate species: implications for the origin of dendritic epidermal T cells.

    Directory of Open Access Journals (Sweden)

    Rania Hassan Mohamed

    Full Text Available Dendritic epidermal T cells, which express an invariant Vγ5Vδ1 T-cell receptor and account for 95% of all resident T cells in the mouse epidermis, play a critical role in skin immune surveillance. These γδ T cells are generated by positive selection in the fetal thymus, after which they migrate to the skin. The development of dendritic epidermal T cells is critically dependent on the Skint1 gene expressed specifically in keratinocytes and thymic epithelial cells, suggesting an indispensable role for Skint1 in the selection machinery for specific intraepithelial lymphocytes. Phylogenetically, rodents have functional SKINT1 molecules, but humans and chimpanzees have a SKINT1-like (SKINT1L gene with multiple inactivating mutations. In the present study, we analyzed SKINT1L sequences in representative primate species and found that all hominoid species have a common inactivating mutation, but that Old World monkeys such as olive baboons, green monkeys, cynomolgus macaques and rhesus macaques have apparently functional SKINT1L sequences, indicating that SKINT1L was inactivated in a common ancestor of hominoids. Interestingly, the epidermis of cynomolgus macaques contained a population of dendritic-shaped γδ T cells expressing a semi-invariant Vγ10/Vδ1 T-cell receptor. However, this population of macaque T cells differed from rodent dendritic epidermal T cells in that their Vγ10/Vδ1 T-cell receptors displayed junctional diversity and expression of Vγ10 was not epidermis-specific. Therefore, macaques do not appear to have rodent-type dendritic epidermal T cells despite having apparently functional SKINT1L. Comprehensive bioinformatics analysis indicates that SKINT1L emerged in an ancestor of placental mammals but was inactivated or lost multiple times in mammalian evolution and that Skint1 arose by gene duplication in a rodent lineage, suggesting that authentic dendritic epidermal T cells are presumably unique to rodents.

  14. A Theoretical Model of Jigsaw-Puzzle Pattern Formation by Plant Leaf Epidermal Cells.

    Science.gov (United States)

    Higaki, Takumi; Kutsuna, Natsumaro; Akita, Kae; Takigawa-Imamura, Hisako; Yoshimura, Kenji; Miura, Takashi

    2016-04-01

    Plant leaf epidermal cells exhibit a jigsaw puzzle-like pattern that is generated by interdigitation of the cell wall during leaf development. The contribution of two ROP GTPases, ROP2 and ROP6, to the cytoskeletal dynamics that regulate epidermal cell wall interdigitation has already been examined; however, how interactions between these molecules result in pattern formation remains to be elucidated. Here, we propose a simple interface equation model that incorporates both the cell wall remodeling activity of ROP GTPases and the diffusible signaling molecules by which they are regulated. This model successfully reproduces pattern formation observed in vivo, and explains the counterintuitive experimental results of decreased cellulose production and increased thickness. Our model also reproduces the dynamics of three-way cell wall junctions. Therefore, this model provides a possible mechanism for cell wall interdigitation formation in vivo.

  15. Changes in epidermal growth factor receptor expression during chemotherapy in non-small cell lung cancer

    DEFF Research Database (Denmark)

    Jakobsen, Jan Nyrop; Santoni-Rugiu, Eric; Sørensen, Jens Benn

    2014-01-01

    BACKGROUND: Antibodies targeting epidermal growth factor receptor (EGFR), such as cetuximab, may potentially improve outcome in non-small cell lung cancer (NSCLC) patients with high EGFR expression. The EGFR expression may be heterogeneously distributed within tumors, and small biopsies may thus...

  16. Amplification of epidermal growth factor receptor gene in renal cell carcinoma

    DEFF Research Database (Denmark)

    El-Hariry, Iman; Powles, Thomas; Lau, Mike R

    2010-01-01

    Expression of epidermal growth factor receptor (EGFR) may be of prognostic value in renal cell cancer (RCC). Gene amplification of EGFR was investigated in a cohort of 315 patients with advanced RCC from a previously reported randomised study. Using fluorescent in situ hybridisation, only 2...

  17. Eosinophil peroxidase signals via epidermal growth factor-2 to induce cell proliferation.

    LENUS (Irish Health Repository)

    Walsh, Marie-Therese

    2011-11-01

    Eosinophils exert many of their inflammatory effects in allergic disorders through the degranulation and release of intracellular mediators, including a set of cationic granule proteins that include eosinophil peroxidase. Studies suggest that eosinophils are involved in remodeling. In previous studies, we showed that eosinophil granule proteins activate mitogen-activated protein kinase signaling. In this study, we investigated the receptor mediating eosinophil peroxidase-induced signaling and downstream effects. Human cholinergic neuroblastoma IMR32 and murine melanoma B16.F10 cultures, real-time polymerase chain reaction, immunoprecipitations, and Western blotting were used in the study. We showed that eosinophil peroxidase caused a sustained increase in both the expression of epidermal growth factor-2 (HER2) and its phosphorylation at tyrosine 1248, with the consequent activation of extracellular-regulated kinase 1\\/2. This, in turn, promoted a focal adhesion kinase-dependent egress of the cyclin-dependent kinase inhibitor p27(kip) from the nucleus to the cytoplasm. Eosinophil peroxidase induced a HER2-dependent up-regulation of cell proliferation, indicated by an up-regulation of the nuclear proliferation marker Ki67. This study identifies HER2 as a novel mediator of eosinophil peroxidase signaling. The results show that eosinophil peroxidase, at noncytotoxic levels, can drive cell-cycle progression and proliferation, and contribute to tissue remodeling and cell turnover in airway disease. Because eosinophils are a feature of many cancers, these findings also suggest a role for eosinophils in tumorigenesis.

  18. Murine epidermal Langerhans cells and langerin-expressing dermal dendritic cells are unrelated and exhibit distinct functions

    NARCIS (Netherlands)

    Nagao, Keisuke; Ginhoux, Florent; Leitner, Wolfgang W.; Motegi, Sei-Ichiro; Bennett, Clare L.; Clausen, Björn E.; Merad, Miriam; Udey, Mark C.

    2009-01-01

    A new langerin(+) DC subset has recently been identified in murine dermis (langerin(+) dDC), but the lineage and functional relationships between these cells and langerin(+) epidermal Langerhans cells (LC) are incompletely characterized. Selective expression of the cell adhesion molecule EpCAM by LC

  19. Human epidermal growth factor receptor (HER 2)/neu expression ...

    African Journals Online (AJOL)

    use

    2011-11-23

    Nov 23, 2011 ... expression and gene amplification in colorectal cancer. Wei Deng 1, Wei-Guo .... patients whose clinical data (include diagnosis, age, sex, address, disease history, etc) intact ..... Anal Cell Pathol.10: 149-160. Tapia C, Glatz K, ...

  20. Repair of ultraviolet light damage to the DNA of cultured human epidermal keratinocytes and fibroblasts

    International Nuclear Information System (INIS)

    Taichman, L.B.; Setlow, R.B.

    1979-01-01

    Pure cultures of dermal fibroblasts and epidermal keroatinocytes have been obtained from a single biopsy of newborn foreskin. The cells were labeled, exposed to several doses of uv light, and allowed to repair in the dark for 16 h. The number of pyrimidine dimers before and after repair was assessed by measuring the numbers of sites in the DNA sensitive to a specific uv endonuclease. At all doses used, the extent of repair was similar in the cultured keratinocytes and cultured fibroblasts

  1. Biological interactions of quantum dot nanoparticles in skin and in human epidermal keratinocytes

    International Nuclear Information System (INIS)

    Zhang, Leshuai W.; Yu, William W.; Colvin, Vicki L.; Monteiro-Riviere, Nancy A.

    2008-01-01

    Quantum dots nanoparticles have novel optical properties for biomedical applications and electronics, but little is known about their skin permeability and interaction with cells. QD621 are nail-shaped nanoparticles that contain a cadmium/selenide core with a cadmium sulfide shell coated with polyethylene glycol (PEG) and are soluble in water. QD were topically applied to porcine skin flow-through diffusion cells to assess penetration at 1 μM, 2 μM and 10 μM for 24 h. QD were also studied in human epidermal keratinocytes (HEK) to determine cellular uptake, cytotoxicity and inflammatory potential. Confocal microscopy depicted the penetration of QD621 through the uppermost stratum corneum (SC) layers of the epidermis and fluorescence was found primarily in the SC and near hair follicles. QD were found in the intercellular lipid bilayers of the SC by transmission electron microscopy (TEM). Inductively coupled plasma-optical emission spectroscopy (ICP-OES) analysis for cadmium (Cd) and fluorescence for QD both did not detect Cd nor fluorescence signal in the perfusate at any time point or concentration. In HEK, viability decreased significantly (p < 0.05) from 1.25 nM to 10nM after 24 h and 48 h. There was a significant increase in IL-6 at 1.25 nM to 10 nM, while IL-8 increased from 2.5nM to 10nM after 24 h and 48 h. TEM of HEK treated with 10 nM of QD621 at 24 h depicted QD in cytoplasmic vacuoles and at the periphery of the cell membranes. These results indicate that porcine skin penetration of QD621 is minimal and limited primarily to the outer SC layers, yet if the skin were damaged allowing direct QD exposure to skin or keratinocytes, an inflammatory response could be initiated

  2. Bioengineering of cultured epidermis from adult epidermal stem cells using Mebio gel sutable as autologous graft material

    Directory of Open Access Journals (Sweden)

    Lakshmana K Yerneni

    2007-01-01

    quicker healing proving the importance and usefulness of the method. With this new approach a large number of moderate to severely burned patients could be saved in several burn centers across our country with reduced hospitalization period. However, the cell based therapeutic option in burn-wound healing by the application of in vitro - cultivated sheets of epidermis from autologous epidermal keratinocyte stem cells uses no matrix. This technque is sufficient for burn wounds of 2nd & 3rd mixed degree. The burn wounds predominantly of 3rd?and 4th?mixed degree can not be healed by the thin cultured epidermis, thus requiring a cellular or cellular scaffold that more or less mimic for graft take in deeper burns. With this aim, we are presently attempting to create such a scaffold using Mebiol gel, which could support the cultured epidermis for better transfer to the wound bed. Additionally, the usefulness of Mebiol gel in growing epidermal sheets without the necessity of FBS and/or animal origin feeder cells but using human feeder cells will also be tested.

  3. Human papillomavirus E6/E7 oncogenes promote mouse ear regeneration by increasing the rate of wound re-epithelization and epidermal growth.

    Science.gov (United States)

    Valencia, Concepción; Bonilla-Delgado, José; Oktaba, Katarzyna; Ocádiz-Delgado, Rodolfo; Gariglio, Patricio; Covarrubias, Luis

    2008-12-01

    Mammals have limited regeneration capacity. We report here that, in transgenic mice (Tg(bK6-E6/E7)), the expression of the E6/E7 oncogenes of human papilloma virus type 16 (HPV16) under the control of the bovine keratin 6 promoter markedly improves the mouse's capacity to repair portions of the ear after being wounded. Increased repair capacity correlates with an increased number of epidermal proliferating cells. In concordance with the expected effects of the E6 and E7 oncogenes, levels of p53 decreased and those of p16 in epidermal cells increased. In addition, we observed that wound re-epithelization proceeded faster in transgenic than in wild-type animals. After the initial re-epithelization, epidermal cell migration from the intact surrounding tissue appears to be a major contributor to the growing epidermis, especially in the repairing tissue of transgenic mice. We also found that there is a significantly higher number of putative epidermal stem cells in Tg(bK6-E6/E7) than in wild-type mice. Remarkably, hair follicles and cartilage regenerated within the repaired ear tissue, without evidence of tumor formation. We propose that the ability to regenerate ear portions is limited by the capacity of the epidermis to repair itself and grow.

  4. Single cell-type comparative metabolomics of epidermal bladder cells from the halophyte Mesembryanthemum crystallinum.

    Directory of Open Access Journals (Sweden)

    Bronwyn Jane Barkla

    2015-06-01

    Full Text Available One of the remarkable adaptive features of the halophyte and facultative CAM plant Mesembryathemum crystallinum are the specialized modified trichomes called epidermal bladder cells (EBC which cover the leaves, stems, and peduncle of the plant. They are present from an early developmental stage but upon salt stress rapidly expand due to the accumulation of water and sodium. This particular plant feature makes it an attractive system for single cell type studies, with recent proteomics and transcriptomics studies of the EBC establishing that these cells are metabolically active and have roles other than sodium sequestration. To continue our investigation into the function of these unusual cells we carried out a comprehensive global analysis of the metabolites present in the EBC extract by gas chromatography Time-of-Flight mass spectrometry (GC-TOF and identified 194 known and 722 total molecular features. Statistical analysis of the metabolic changes between control and salt-treated samples was used to identify 352 significantly differing metabolites (268 after correction for FDR. Principal components analysis provided an unbiased evaluation of the data variance structure. Biochemical pathway enrichment analysis suggested significant perturbations in 13 biochemical pathways as defined in KEGG. More than 50% of the metabolites that show significant changes in the EBC, can be classified as compatible solutes and include sugars, sugar alcohols, protein and non-protein amino acids, and organic acids, highlighting the need to maintain osmotic homeostasis to balance the accumulation of Na and Cl ions. Overall, the comparison of metabolic changes in salt treated relative to control samples suggest large alterations in Mesembryanthemum crystallinum epidermal bladder cells.

  5. Single cell-type comparative metabolomics of epidermal bladder cells from the halophyte Mesembryanthemum crystallinum.

    Science.gov (United States)

    Barkla, Bronwyn J; Vera-Estrella, Rosario

    2015-01-01

    One of the remarkable adaptive features of the halophyte Mesembryanthemum crystallinum are the specialized modified trichomes called epidermal bladder cells (EBC) which cover the leaves, stems, and peduncle of the plant. They are present from an early developmental stage but upon salt stress rapidly expand due to the accumulation of water and sodium. This particular plant feature makes it an attractive system for single cell type studies, with recent proteomics and transcriptomics studies of the EBC establishing that these cells are metabolically active and have roles other than sodium sequestration. To continue our investigation into the function of these unusual cells we carried out a comprehensive global analysis of the metabolites present in the EBC extract by gas chromatography Time-of-Flight mass spectrometry (GC-TOF) and identified 194 known and 722 total molecular features. Statistical analysis of the metabolic changes between control and salt-treated samples identified 352 significantly differing metabolites (268 after correction for FDR). Principal components analysis provided an unbiased evaluation of the data variance structure. Biochemical pathway enrichment analysis suggested significant perturbations in 13 biochemical pathways as defined in KEGG. More than 50% of the metabolites that show significant changes in the EBC, can be classified as compatible solutes and include sugars, sugar alcohols, protein and non-protein amino acids, and organic acids, highlighting the need to maintain osmotic homeostasis to balance the accumulation of Na(+) and Cl(-) ions. Overall, the comparison of metabolic changes in salt treated relative to control samples suggests large alterations in M. crystallinum epidermal bladder cells.

  6. Single cell-type comparative metabolomics of epidermal bladder cells from the halophyte Mesembryanthemum crystallinum

    Science.gov (United States)

    Barkla, Bronwyn J.; Vera-Estrella, Rosario

    2015-01-01

    One of the remarkable adaptive features of the halophyte Mesembryanthemum crystallinum are the specialized modified trichomes called epidermal bladder cells (EBC) which cover the leaves, stems, and peduncle of the plant. They are present from an early developmental stage but upon salt stress rapidly expand due to the accumulation of water and sodium. This particular plant feature makes it an attractive system for single cell type studies, with recent proteomics and transcriptomics studies of the EBC establishing that these cells are metabolically active and have roles other than sodium sequestration. To continue our investigation into the function of these unusual cells we carried out a comprehensive global analysis of the metabolites present in the EBC extract by gas chromatography Time-of-Flight mass spectrometry (GC-TOF) and identified 194 known and 722 total molecular features. Statistical analysis of the metabolic changes between control and salt-treated samples identified 352 significantly differing metabolites (268 after correction for FDR). Principal components analysis provided an unbiased evaluation of the data variance structure. Biochemical pathway enrichment analysis suggested significant perturbations in 13 biochemical pathways as defined in KEGG. More than 50% of the metabolites that show significant changes in the EBC, can be classified as compatible solutes and include sugars, sugar alcohols, protein and non-protein amino acids, and organic acids, highlighting the need to maintain osmotic homeostasis to balance the accumulation of Na+ and Cl− ions. Overall, the comparison of metabolic changes in salt treated relative to control samples suggests large alterations in M. crystallinum epidermal bladder cells. PMID:26113856

  7. Protective immunity to UV radiation-induced skin tumours induced by skin grafts and epidermal cells

    International Nuclear Information System (INIS)

    Ronald Sluyter; Kylie S Yuen; Gary M Halliday

    2001-01-01

    There is little evidence that cutaneous dendritic cells (DC), including epidermal Langerhans cells (LC), can induce immunity to UV radiation (UVR)-induced skin tumours. Here, it is shown that cells within skin can induce protective antitumour immunity against a UVR-induced fibrosarcoma. Transplantation of the skin overlying subcutaneous tumours onto naive recipients could induce protective antitumour immunity, probably because the grafting stimulated the tumour Ag-loaded DC to migrate to local lymph nodes. This suggests that cutaneous APC can present tumour Ag to induce protective antitumour immunity. Previously, it has been shown that immunization of mice with MHC class II+ epidermal cells (EC) pulsed with tumour extracts could induce delayed-type hypersensitivity against tumour cells. Here, this same immunization protocol could induce protective immunity against a minimum tumorigenic dose of UVR-induced fibrosarcoma cells, but not higher doses. Epidermal cells obtained from semiallogeneic donors and pulsed with tumour extract could also induce protective immunity. However, presentation of BSA Ag from the culture medium was found to contribute to this result using semiallogeneic EC. The results suggest that LC overlying skin tumours may be able to induce protective immunity to UVR-induced tumours if stimulated to migrate from the skin. Copyright (2001) Australasian Society of Immunology Inc

  8. Genetically induced cell death in bulge stem cells reveals their redundancy for hair and epidermal regeneration.

    Science.gov (United States)

    Driskell, Iwona; Oeztuerk-Winder, Feride; Humphreys, Peter; Frye, Michaela

    2015-03-01

    Adult mammalian epidermis contains multiple stem cell populations in which quiescent and more proliferative stem and progenitor populations coexist. However, the precise interrelation of these populations in homeostasis remains unclear. Here, we blocked the contribution of quiescent keratin 19 (K19)-expressing bulge stem cells to hair follicle formation through genetic ablation of the essential histone methyltransferase Setd8 that is required for the maintenance of adult skin. Deletion of Setd8 eliminated the contribution of bulge cells to hair follicle regeneration through inhibition of cell division and induction of cell death, but the growth and morphology of hair follicles were unaffected. Furthermore, ablation of Setd8 in the hair follicle bulge blocked the contribution of K19-postive stem cells to wounded epidermis, but the wound healing process was unaltered. Our data indicate that quiescent bulge stem cells are dispensable for hair follicle regeneration and epidermal injury in the short term and support the hypothesis that quiescent and cycling stem cell populations are equipotent. © 2014 AlphaMed Press.

  9. Radiolabeled pertuzumab for imaging of human epidermal growth factor receptor 2 expression in ovarian cancer

    Energy Technology Data Exchange (ETDEWEB)

    Jiang, Dawei [Shenzhen University, Guangdong Key Laboratory for Biomedical Measurements and Ultrasound Imaging, School of Biomedical Engineering, Shenzhen (China); University of Wisconsin - Madison, Department of Radiology, Madison, WI (United States); Im, Hyung-Jun [University of Wisconsin - Madison, Department of Radiology, Madison, WI (United States); Seoul National University, Graduate School of Convergence Science and Technology, Seoul (Korea, Republic of); Sun, Haiyan; Cho, Steve Y. [University of Wisconsin - Madison, Department of Radiology, Madison, WI (United States); Valdovinos, Hector F.; England, Christopher G.; Ehlerding, Emily B.; Nickles, Robert J. [University of Wisconsin - Madison, Department of Medical Physics, Madison, WI (United States); Lee, Dong Soo [Seoul National University, Graduate School of Convergence Science and Technology, Seoul (Korea, Republic of); Huang, Peng [Shenzhen University, Guangdong Key Laboratory for Biomedical Measurements and Ultrasound Imaging, School of Biomedical Engineering, Shenzhen (China); Cai, Weibo [University of Wisconsin - Madison, Department of Radiology, Madison, WI (United States); University of Wisconsin - Madison, Department of Medical Physics, Madison, WI (United States); University of Wisconsin Carbone Cancer Center, Madison, WI (United States)

    2017-08-15

    Human epidermal growth factor receptor 2 (HER2) is over-expressed in over 30% of ovarian cancer cases, playing an essential role in tumorigenesis and metastasis. Non-invasive imaging of HER2 is of great interest for physicians as a mean to better detect and monitor the progression of ovarian cancer. In this study, HER2 was assessed as a biomarker for ovarian cancer imaging using {sup 64}Cu-labeled pertuzumab for immunoPET imaging. HER2 expression and binding were examined in three ovarian cancer cell lines (SKOV3, OVCAR3, Caov3) using in vitro techniques, including western blot and saturation binding assays. PET imaging and biodistribution studies in subcutaneous models of ovarian cancer were performed for non-invasive in vivo evaluation of HER2 expression. Additionally, orthotopic models were employed to further validate the imaging capability of {sup 64}Cu-NOTA-pertuzumab. HER2 expression was highest in SKOV3 cells, while OVCAR3 and Caov3 displayed lower HER2 expression. {sup 64}Cu-NOTA-pertuzumab showed high specificity for HER2 (K{sub a} = 3.1 ± 0.6 nM) in SKOV3. In subcutaneous tumors, PET imaging revealed tumor uptake of 41.8 ± 3.8, 10.5 ± 3.9, and 12.1 ± 2.3%ID/g at 48 h post-injection for SKOV3, OVCAR3, and Caov3, respectively (n = 3). In orthotopic models, PET imaging with {sup 64}Cu-NOTA-pertuzumab allowed for rapid and clear delineation of both primary and small peritoneal metastases in HER2-expressing ovarian cancer. {sup 64}Cu-NOTA-pertuzumab is an effective PET tracer for the non-invasive imaging of HER2 expression in vivo, rendering it a potential tracer for treatment monitoring and improved patient stratification. (orig.)

  10. Modulation of Regorafenib effects on HCC cell lines by epidermal growth factor.

    Science.gov (United States)

    D'Alessandro, Rosalba; Refolo, Maria Grazia; Lippolis, Catia; Carella, Nicola; Messa, Caterina; Cavallini, Aldo; Carr, Brian Irving

    2015-06-01

    Blood platelet numbers are correlated to growth and aggressiveness of several tumor types, including hepatocellular carcinoma (HCC). We previously found that platelet lysates (hPLs) also stimulated growth and migration, and antagonized the growth-inhibitory and apoptotic effects of both Sorafenib and Regorafenib, two multikinase inhibitors, on three HCC cell lines. In this study, in vitro function of human epidermal growth factor (EGF) with and without Sorafenib or Regorafenib was investigated. An ELISA kit was used to evaluate the EGF concentrations in hPLs. In vitro function of EGF was assessed with proliferation MTT test. Apoptosis assay, scratch assays, and Transwell assays were performed for apoptosis, invasion, and migration, respectively. MAPK Activation Kit was used to explore MAPK phosphorylation. EGF antagonized the growth inhibition of Regorafenib on three HCC cell lines. Regorafenib-mediated growth inhibition was blocked by 70 % when the cells were pre-treated with EGF. EGF also blocked Regorafenib-induced apoptosis, as well as Regorafenib-induced decreases in cell migration and invasion. The EGF effects were in turn antagonized by concomitant addition to the cultures of EGF receptor antagonist Erlotinib, showing that the EGF receptor was involved in the mechanisms of EGF-mediated blocking of Regorafenib effects. Erlotinib also partially blocked the effects of hPLs in antagonizing Regorafenib-mediated growth inhibition, showing that EGF was an important component of hPL actions. All these results show that EGF antagonized Regorafenib-mediated growth and migration inhibition and apoptosis induction in HCC cells and reinforce the idea that microenvironment can influence cancer drug actions.

  11. Real-time visualization of macromolecule uptake by epidermal Langerhans cells in living animals.

    Science.gov (United States)

    Frugé, Rachel E; Krout, Colleen; Lu, Ran; Matsushima, Hironori; Takashima, Akira

    2012-03-01

    As a skin-resident member of the dendritic cell family, Langerhans cells (LCs) are generally regarded to function as professional antigen-presenting cells. Here we report a simple method to visualize the endocytotic activity of LCs in living animals. BALB/c mice received subcutaneous injection of FITC-conjugated dextran (DX) probes into the ear skin and were then examined under confocal microscopy. Large numbers of FITC(+) epidermal cells became detectable 12-24 hours after injection as background fluorescence signals began to disappear. Most (>90%) of the FITC(+) epidermal cells expressed Langerin, and >95% of Langerin(+) epidermal cells exhibited significant FITC signals. To assess intracellular localization, Alexa Fluor 546-conjugated DX probes were locally injected into IAβ-enhanced green fluorescent protein (EGFP) knock-in mice and Langerin-EGFP-diphtheria toxin receptor mice--three dimensional rotation images showed close association of most of the internalized DX probes with major histocompatibility complex (MHC) class II molecules, but not with Langerin molecules. These observations support the current view that LCs constantly sample surrounding materials, including harmful and innocuous antigens, at the environmental interface. Our data also validate the potential utility of the newly developed imaging approach to monitor LC function in wild-type animals.

  12. Epidermal changes following application of 7,12-dimethylbenz(a)anthracene and 12-O-tetradecanoylphorbol-13-acetate to human skin transplanted to nude mice studied with histological species markers

    International Nuclear Information System (INIS)

    Graem, N.

    1986-01-01

    Effects of the tumor initiator 7,12-dimethylbenz(a)anthracene (DMBA) and of the tumor promoter 12-O-tetradecanoylphorbol-13-acetate (TPA) on epidermis of human fetal and adult skin were studied in the nude mouse/human skin model. Human skin grafts on NC nude mice were exposed to two topical applications of 1 mg of DMBA in 50 microliter of acetone with an interval of 3 days and/or to applications of 10 micrograms of TPA in 50 microliter of acetone twice weekly. In some animals, it was attempted to augment the susceptibility of the grafts to the tumor-initiating effect of DMBA by pretreatment with TPA or ultraviolet light. The mice were sacrificed 8-32 wk after the initial treatment. Tumors did not appear in the central portions of any of the grafts, but epidermal tumors were seen at the graft border in 34.9% of the DMBA-treated animals. To identify human epidermis on the grafts and to determine the species origin of the induced tumors, two independently working histological marker methods were applied. (a) The first is detection of a human Blood Group B-like antigen present in mouse epidermis and in chemically induced murine epidermal tumors. This antigen cannot be demonstrated in human epidermis and in epidermal tumors of human patients. (b) The second is histological staining with the DNA-specific fluorochrome, bisbenzimide, displaying a characteristic pattern of 5-10 intranuclear fluorescent bodies in murine nonneoplastic epidermal cells and in murine epidermal tumor cells. Such a pattern is not seen in human epidermis and in epidermal tumors of human patients. The studies showed that TPA treatment resulted in epidermal hyperplasia in both the human epidermis and the adjacent mouse epidermis and that the induced tumors were derived from murine tissue

  13. Beta1 integrin-mediated adhesion signalling is essential for epidermal progenitor cell expansion.

    Directory of Open Access Journals (Sweden)

    Aleksandra Piwko-Czuchra

    Full Text Available BACKGROUND: There is a major discrepancy between the in vitro and in vivo results regarding the role of beta1 integrins in the maintenance of epidermal stem/progenitor cells. Studies of mice with skin-specific ablation of beta1 integrins suggested that epidermis can form and be maintained in their absence, while in vitro data have shown a fundamental role for these adhesion receptors in stem/progenitor cell expansion and differentiation. METHODOLOGY/PRINCIPAL FINDINGS: To elucidate this discrepancy we generated hypomorphic mice expressing reduced beta1 integrin levels on keratinocytes that developed similar, but less severe defects than mice with beta1-deficient keratinocytes. Surprisingly we found that upon aging these abnormalities attenuated due to a rapid expansion of cells, which escaped or compensated for the down-regulation of beta1 integrin expression. A similar phenomenon was observed in aged mice with a complete, skin-specific ablation of the beta1 integrin gene, where cells that escaped Cre-mediated recombination repopulated the mutant skin in a very short time period. The expansion of beta1 integrin expressing keratinocytes was even further accelerated in situations of increased keratinocyte proliferation such as wound healing. CONCLUSIONS/SIGNIFICANCE: These data demonstrate that expression of beta1 integrins is critically important for the expansion of epidermal progenitor cells to maintain epidermal homeostasis.

  14. Chemical allergens stimulate human epidermal keratinocytes to produce lymphangiogenic vascular endothelial growth factor

    Energy Technology Data Exchange (ETDEWEB)

    Bae, Ok-Nam [College of Pharmacy, Institute of Pharmaceutical Science and Technology, Hanyang University, Ansan 426-791 (Korea, Republic of); Ahn, Seyeon; Jin, Sun Hee; Hong, Soo Hyun; Lee, Jinyoung [College of Pharmacy, Natural Products Research Institute, Seoul National University, Seoul 151-742 (Korea, Republic of); Kim, Eun-Sun [College of Pharmacy, Institute of Pharmaceutical Science and Technology, Hanyang University, Ansan 426-791 (Korea, Republic of); Jeong, Tae Cheon [College of Pharmacy, Yeungnam University, Gyeongsan 712-749 (Korea, Republic of); Chun, Young-Jin [College of Pharmacy, Chung-Ang University, Seoul 156-756 (Korea, Republic of); Lee, Ai-Young, E-mail: leeay@duih.org [Department of Dermatology, Dongguk University Ilsan Hospital, Goyang 410-773 (Korea, Republic of); Noh, Minsoo, E-mail: minsoo@alum.mit.edu [College of Pharmacy, Natural Products Research Institute, Seoul National University, Seoul 151-742 (Korea, Republic of)

    2015-03-01

    Allergic contact dermatitis (ACD) is a cell-mediated immune response that involves skin sensitization in response to contact with various allergens. Angiogenesis and lymphangiogenesis both play roles in the allergic sensitization process. Epidermal keratinocytes can produce vascular endothelial growth factor (VEGF) in response to UV irradiation and during wound healing. However, the effect of haptenic chemical allergens on the VEGF production of human keratinocytes, which is the primary contact site of toxic allergens, has not been thoroughly researched. We systematically investigated whether immune-regulatory cytokines and chemical allergens would lead to the production of VEGF in normal human keratinocytes (NHKs) in culture. VEGF production significantly increased when NHKs were treated with IFNγ, IL-1α, IL-4, IL-6, IL-17A, IL-22 or TNFα. Among the human sensitizers listed in the OECD Test Guideline (TG) 429, we found that CMI/MI, DNCB, 4-phenylenediamine, cobalt chloride, 2-mercaptobenzothiazole, citral, HCA, cinnamic alcohol, imidazolidinyl urea and nickel chloride all significantly upregulated VEGF production in NHKs. In addition, common human haptenic allergens such as avobenzone, formaldehyde and urushiol, also induced the keratinocyte-derived VEGF production. VEGF upregulation by pro-inflammatory stimuli, IFNγ, DNCB or formaldehyde is preceded by the production of IL-8, an acute inflammatory phase cytokine. Lymphangiogenic VEGF-C gene transcription was significantly increased when NHKs were treated with formaldehyde, DNCB or urushiol, while transcription of VEGF-A and VEGF-B did not change. Therefore, the chemical allergen-induced VEGF upregulation is mainly due to the increase in lymphangiogenic VEGF-C transcription in NHKs. These results suggest that keratinocyte-derived VEGF may regulate the lymphangiogenic process during the skin sensitization process of ACD. - Highlights: • Pro-inflammatory cytokines induced VEGF production in normal human

  15. Chemical allergens stimulate human epidermal keratinocytes to produce lymphangiogenic vascular endothelial growth factor

    International Nuclear Information System (INIS)

    Bae, Ok-Nam; Ahn, Seyeon; Jin, Sun Hee; Hong, Soo Hyun; Lee, Jinyoung; Kim, Eun-Sun; Jeong, Tae Cheon; Chun, Young-Jin; Lee, Ai-Young; Noh, Minsoo

    2015-01-01

    Allergic contact dermatitis (ACD) is a cell-mediated immune response that involves skin sensitization in response to contact with various allergens. Angiogenesis and lymphangiogenesis both play roles in the allergic sensitization process. Epidermal keratinocytes can produce vascular endothelial growth factor (VEGF) in response to UV irradiation and during wound healing. However, the effect of haptenic chemical allergens on the VEGF production of human keratinocytes, which is the primary contact site of toxic allergens, has not been thoroughly researched. We systematically investigated whether immune-regulatory cytokines and chemical allergens would lead to the production of VEGF in normal human keratinocytes (NHKs) in culture. VEGF production significantly increased when NHKs were treated with IFNγ, IL-1α, IL-4, IL-6, IL-17A, IL-22 or TNFα. Among the human sensitizers listed in the OECD Test Guideline (TG) 429, we found that CMI/MI, DNCB, 4-phenylenediamine, cobalt chloride, 2-mercaptobenzothiazole, citral, HCA, cinnamic alcohol, imidazolidinyl urea and nickel chloride all significantly upregulated VEGF production in NHKs. In addition, common human haptenic allergens such as avobenzone, formaldehyde and urushiol, also induced the keratinocyte-derived VEGF production. VEGF upregulation by pro-inflammatory stimuli, IFNγ, DNCB or formaldehyde is preceded by the production of IL-8, an acute inflammatory phase cytokine. Lymphangiogenic VEGF-C gene transcription was significantly increased when NHKs were treated with formaldehyde, DNCB or urushiol, while transcription of VEGF-A and VEGF-B did not change. Therefore, the chemical allergen-induced VEGF upregulation is mainly due to the increase in lymphangiogenic VEGF-C transcription in NHKs. These results suggest that keratinocyte-derived VEGF may regulate the lymphangiogenic process during the skin sensitization process of ACD. - Highlights: • Pro-inflammatory cytokines induced VEGF production in normal human

  16. Urea uptake enhances barrier function and antimicrobial defense in humans by regulating epidermal gene expression

    Science.gov (United States)

    Grether-Beck, Susanne; Felsner, Ingo; Brenden, Heidi; Kohne, Zippora; Majora, Marc; Marini, Alessandra; Jaenicke, Thomas; Rodriguez-Martin, Marina; Trullas, Carles; Hupe, Melanie; Elias, Peter M.; Krutmann, Jean

    2012-01-01

    Urea is an endogenous metabolite, known to enhance stratum corneum hydration. Yet, topical urea anecdotally also improves permeability barrier function, and it appears to exhibit antimicrobial activity. Hence, we hypothesized that urea is not merely a passive metabolite, but a small-molecule regulator of epidermal structure and function. In 21 human volunteers, topical urea improved barrier function in parallel with enhanced antimicrobial peptide (LL-37 and β-defensin-2) expression. Urea both stimulates expression of, and is transported into keratinocytes by two urea transporters, UT-A1 and UT-A2, and by aquaporin 3, 7 and 9. Inhibitors of these urea transporters block the downstream biological effects of urea, which include increased mRNA and protein levels for: (i) transglutaminase-1, involucrin, loricrin and filaggrin; (ii) epidermal lipid synthetic enzymes, and (iii) cathelicidin/LL-37 and β-defensin-2. Finally, we explored the potential clinical utility of urea, showing that topical urea applications normalized both barrier function and antimicrobial peptide expression in a murine model of atopic dermatitis (AD). Together, these results show that urea is a small-molecule regulator of epidermal permeability barrier function and antimicrobial peptide expression after transporter uptake, followed by gene regulatory activity in normal epidermis, with potential therapeutic applications in diseased skin. PMID:22418868

  17. Ontogeny and function of murine epidermal Langerhans cells.

    Science.gov (United States)

    Kaplan, Daniel H

    2017-09-19

    Langerhans cells (LCs) are epidermis-resident antigen-presenting cells that share a common ontogeny with macrophages but function as dendritic cells (DCs). Their development, recruitment and retention in the epidermis is orchestrated by interactions with keratinocytes through multiple mechanisms. LC and dermal DC subsets often show functional redundancy, but LCs are required for specific types of adaptive immune responses when antigen is concentrated in the epidermis. This Review will focus on those developmental and functional properties that are unique to LCs.

  18. Epidermal Langerhans' cell induction of immunity against an ultraviolet-induced skin tumour

    International Nuclear Information System (INIS)

    Cavanagh, L.L.; Sluyter, R.; Henderson, K.G.; Barnetson, R.St.C.; Halliday, G.M.

    1996-01-01

    Lanerghans' cells (LC) have been shown experimentally to induce immune response against many antigens; however, their role in the initiation of anti-tumour immunity has received little attention. This study examined the ability of murine epidermal LC to induce immunity to an ultraviolet radiation (UV)-induced skin tumour. Freshly prepared epidermal cells (EC) were cultured for 2 or 20 hr with granulocyte-macrophage colony-stimulating factor (GM-CSF), pulsed with an extract of the UV-13-1 tumour, then used to immunize naive syngeneic mice. Delayed type hypersensitivity (DTH) was elicited 10 days after immunization by injection of UV-13-1 tumour cells into the ear pinna, and measured 24 hr later. EC cultured with GM-CSF for 2 hr induced anti-tumour DTH, as did EC cultured for 20 hr without GM-CSF. Conversely, EC cultured for 2 hr without GM-CSF, or EC cultured for 20 hr with GM-CSF were unable to induce a DTH. Induction of immunity required active presentation of tumour antigens by Ia + EC and was tumour specific. Thus Ia + epidermal cells are capable of inducing anti-tumour immunity to UV-induced skin tumours, but only when they contact antigen in particular states of maturation. (author)

  19. Beta1 integrin-mediated adhesion signalling is essential for epidermal progenitor cell expansion

    DEFF Research Database (Denmark)

    Piwko-Czuchra, Aleksandra; Koegel, Heidi; Meyer, Hannelore

    2009-01-01

    BACKGROUND: There is a major discrepancy between the in vitro and in vivo results regarding the role of beta1 integrins in the maintenance of epidermal stem/progenitor cells. Studies of mice with skin-specific ablation of beta1 integrins suggested that epidermis can form and be maintained in thei...... of increased keratinocyte proliferation such as wound healing. CONCLUSIONS/SIGNIFICANCE: These data demonstrate that expression of beta1 integrins is critically important for the expansion of epidermal progenitor cells to maintain epidermal homeostasis....... that developed similar, but less severe defects than mice with beta1-deficient keratinocytes. Surprisingly we found that upon aging these abnormalities attenuated due to a rapid expansion of cells, which escaped or compensated for the down-regulation of beta1 integrin expression. A similar phenomenon...... was observed in aged mice with a complete, skin-specific ablation of the beta1 integrin gene, where cells that escaped Cre-mediated recombination repopulated the mutant skin in a very short time period. The expansion of beta1 integrin expressing keratinocytes was even further accelerated in situations...

  20. Turnover of pigment granules: cyclic catabolism and anabolism of ommochromes within epidermal cells.

    Science.gov (United States)

    Insausti, T C; Casas, J

    2009-12-01

    Ommochromes are end products of the tryptophan metabolism in arthropods. While the anabolism of ommochromes has been well studied, the catabolism is totally unknown. In order to study it, we used the crab-spider Misumena vatia, which is able to change color reversibly in a few days, from yellow to white and back. Ommochromes is the only pigment class responsible for the body coloration in this animal. The aim of this study was to analyze the fine structure of the epidermal cells in bleaching spiders, in an attempt to correlate morphological changes with the fate of the pigment granules. Central to the process of bleaching is the lysis of the ommochrome granules. In the same cell, intact granules and granules in different degradation stages are found. The degradation begins with granule autolysis. Some components are extruded in the extracellular space and others are recycled via autophagy. Abundant glycogen appears associated to granulolysis. In a later stage of bleaching, ommochrome progranules, typical of white spiders, appear in the distal zone of the same epidermal cell. Catabolism and anabolism of pigment granules thus take place simultaneously in spider epidermal cells. A cyclic pathway of pigment granules formation and degradation, throughout a complete cycle of color change is proposed, together with an explanation for this turnover, involving photoprotection against UV by ommochromes metabolites. The presence of this turnover for melanins is discussed.

  1. Cell fate determination in the Caenorhabditis elegans epidermal lineages

    NARCIS (Netherlands)

    Soete, G.A.J.

    2007-01-01

    The starting point for this work was to use the hypodermal seam of C. elegans as a model system to study cell fate determination. Even though the seam is a relatively simple developmental system, the mechanisms that control cell fate determination in the seam lineages are connected in a highly

  2. Skin Stem Cells: At the Frontier Between the Laboratory and Clinical Practice. Part 1: Epidermal Stem Cells.

    Science.gov (United States)

    Pastushenko, I; Prieto-Torres, L; Gilaberte, Y; Blanpain, C

    2015-11-01

    Stem cells are characterized by their ability to self-renew and differentiate into the different cell lineages of their tissue of origin. The discovery of stem cells in adult tissues, together with the description of specific markers for their isolation, has opened up new lines of investigation, expanding the horizons of biomedical research and raising new hope in the treatment of many diseases. In this article, we review in detail the main characteristics of the stem cells that produce the specialized cells of the skin (epidermal, mesenchymal, and melanocyte stem cells) and their potential implications and applications in diseases affecting the skin. Part I deals with the principal characteristics and potential applications of epidermal stem cells in dermatology. Copyright © 2015 Elsevier España, S.L.U. and AEDV. All rights reserved.

  3. Optimal Therapeutic Strategy for Non-small Cell Lung Cancer with Mutated Epidermal Growth Factor Receptor

    Directory of Open Access Journals (Sweden)

    Zhong SHI

    2015-02-01

    Full Text Available Although epidermal growth factor receptor tyrosine kinase inhibitors (EGFR-TKIs have been widely used in non-small cell lung cancer (NSCLC patients, it is still controversial about how to combine EGFR-TKI with chemotherapy and other targeted drugs. We have made a summary on the current therapeutic models of EGFR-TKI combined with chemotherapy/bevacizumab in this review and aimed to find the optimal therapeutic strategy for NSCLC patients with EGFR mutation.

  4. Outcome of burns treated with autologous cultured proliferating epidermal cells: a prospective randomized multicenter intrapatient comparative trial

    NARCIS (Netherlands)

    Gardien, K.L.M.; Marck, R.E.; Bloemen, M.C.T.; Waaijman, T.; Gibbs, S.; Uhlrich, M.M.W.; Middelkoop, E.

    2016-01-01

    Standard treatment for large burns is transplantation with meshed split skin autografts (SSGs). A disadvantage of this treatment is that healing is accompanied by scar formation. Application of autologous epidermal cells (keratinocytes and melanocytes) may be a suitable therapeutic alternative,

  5. Antitumor activity of ZD6126, a novel vascular-targeting agent, is enhanced when combined with ZD1839, an epidermal growth factor receptor tyrosine kinase inhibitor, and potentiates the effects of radiation in a human non-small cell lung cancer xenograft model.

    Science.gov (United States)

    Raben, David; Bianco, Cataldo; Damiano, Vincenzo; Bianco, Roberto; Melisi, Davide; Mignogna, Chiara; D'Armiento, Francesco Paolo; Cionini, Luca; Bianco, A Raffaele; Tortora, Giampaolo; Ciardiello, Fortunato; Bunn, Paul

    2004-08-01

    Targeting the tumor vasculature may offer an alternative or complementary therapeutic approach to targeting growth factor signaling in lung cancer. The aim of these studies was to evaluate the antitumor effects in vivo of the combination of ZD6126, a tumor-selective vascular-targeting agent; ZD1839 (gefitinib, Iressa), an epidermal growth factor receptor tyrosine kinase inhibitor; and ionizing radiation in the treatment of non-small cell lung cancer xenograft model. Athymic nude mice with established flank A549 human non-small cell lung cancer xenograft model xenografts were treated with fractionated radiation therapy, ZD6126, ZD1839, or combinations of each treatment. ZD6126 (150 mg/kg) was given i.p. the day after each course of radiation. Animals treated with ZD1839 received 100 mg/kg per dose per animal, 5 or 7 days/wk for 2 weeks. Immunohistochemistry was done to evaluate the effects on tumor growth using an anti-Ki67 monoclonal antibody. Effects on tumor-induced vascularization were quantified using an anti-factor VIII-related antigen monoclonal antibody. ZD6126 attenuated the growth of human A549 flank xenografts compared with untreated animals. Marked antitumor effects were observed when animals were treated with a combination of ZD6126 and fractionated radiation therapy with protracted tumor regression. ZD6126 + ZD1839 resulted in a greater tumor growth delay than either agent alone. Similar additive effects were seen with ZD1839 + fractionated radiation. Finally, the addition of ZD6126 to ZD1839 and radiation therapy seemed to further improve tumor growth control, with a significant tumor growth delay compared with animals treated with single agent or with double combinations. Immunohistochemistry showed that ZD1839 induced a marked reduction in A549 tumor cell proliferation. Both ZD1839 and ZD6126 treatment substantially reduced tumor-induced angiogenesis. ZD6126 caused marked vessel destruction through loss of endothelial cells and thrombosis

  6. Immunohistochemical localization of epidermal growth factor in the second-trimester human fetus

    DEFF Research Database (Denmark)

    Poulsen, Steen Seier; Kryger-Baggesen, N; Nexø, Ebba

    1996-01-01

    Epidermal growth factor (EGF) is considered to be important in mammalian neonatal growth and development. In order to clarify its developmental role, we have investigated, by immunohistochemistry, the localization of EGF and the time of its first appearance in various organs from a series of 25...... midtrimester human fetuses with a gestational age ranging from 13 to 22 weeks. The first detectable EGF immunoreactivity occurred in week 15-16 fetuses in the placenta, the skin, the distal tubules of the kidney, the surface epithelium of the stomach, and the tips of the small intestinal villi, as well...

  7. Transient expression of P-type ATPases in tobacco epidermal cells

    DEFF Research Database (Denmark)

    Pedas, Lisbeth Rosager; Palmgren, Michael Broberg; Lopez Marques, Rosa Laura

    2016-01-01

    Transient expression in tobacco cells is a convenient method for several purposes such as analysis of protein-protein interactions and the subcellular localization of plant proteins. A suspension of Agrobacterium tumefaciens cells carrying the plasmid of interest is injected into the intracellula...... for example protein-protein interaction studies. In this chapter, we describe the procedure to transiently express P-type ATPases in tobacco epidermal cells, with focus on subcellular localization of the protein complexes formed by P4-ATPases and their β-subunits....

  8. Effects of epidermal growth factor on neural crest cells in tissue culture

    International Nuclear Information System (INIS)

    Erickson, C.A.; Turley, E.A.

    1987-01-01

    Epidermal growth factor (EGF) stimulates the release of hyaluronic acid (HA) and chondroitin sulfate proteoglycan (CSPG) from quail trunk neural crest cultures in a dose-dependent fashion. It also promotes the expression of cell-associated heparan sulfate proteoglycan (HSPG) as detected by immunofluorescence and immunoprecipitation of the 3 H-labeled proteoglycan. Furthermore, EGF stimulates [ 3 H]thymidine incorporation into total cell DNA. These results raise the possibility that EGF or an analogous growth factor is involved in regulation of neural crest cell morphogenesis

  9. Bone scan and red blood cell scan in a patient with epidermal naevus syndrome

    International Nuclear Information System (INIS)

    Becker, W.; Wolf, F.; Stosiek, N.; Peters, K.P.

    1990-01-01

    A bone scan and red blood cell scan in the rare epidermal naevus syndrome, associated with multiple haemangiomes of the bone and hypophosphataemic osteomalacia in a 20-year-old man are reported. The typical pattern of osteomalacia on the bone scan was associated with lesions of increased bone metabolism in the peripheral bones. The haemangiomas did not pool labelled red blood cells. Thus, the bone scan seems to be suited for diagnosing the complete extent of haemangiomas in bone, but they could not be specifically proven by red blood cell pooling. (orig.)

  10. Model system for plant cell biology: GFP imaging in living onion epidermal cells

    Science.gov (United States)

    Scott, A.; Wyatt, S.; Tsou, P. L.; Robertson, D.; Allen, N. S.

    1999-01-01

    The ability to visualize organelle localization and dynamics is very useful in studying cellular physiological events. Until recently, this has been accomplished using a variety of staining methods. However, staining can give inaccurate information due to nonspecific staining, diffusion of the stain or through toxic effects. The ability to target green fluorescent protein (GFP) to various organelles allows for specific labeling of organelles in vivo. The disadvantages of GFP thus far have been the time and money involved in developing stable transformants or maintaining cell cultures for transient expression. In this paper, we present a rapid transient expression system using onion epidermal peels. We have localized GFP to various cellular compartments (including the cell wall) to illustrate the utility of this method and to visualize dynamics of these compartments. The onion epidermis has large, living, transparent cells in a monolayer, making them ideal for visualizing GFP. This method is easy and inexpensive, and it allows for testing of new GFP fusion proteins in a living tissue to determine deleterious effects and the ability to express before stable transformants are attempted.

  11. Cell type-specific responses to salinity - the epidermal bladder cell transcriptome of Mesembryanthemum crystallinum.

    Science.gov (United States)

    Oh, Dong-Ha; Barkla, Bronwyn J; Vera-Estrella, Rosario; Pantoja, Omar; Lee, Sang-Yeol; Bohnert, Hans J; Dassanayake, Maheshi

    2015-08-01

    Mesembryanthemum crystallinum (ice plant) exhibits extreme tolerance to salt. Epidermal bladder cells (EBCs), developing on the surface of aerial tissues and specialized in sodium sequestration and other protective functions, are critical for the plant's stress adaptation. We present the first transcriptome analysis of EBCs isolated from intact plants, to investigate cell type-specific responses during plant salt adaptation. We developed a de novo assembled, nonredundant EBC reference transcriptome. Using RNAseq, we compared the expression patterns of the EBC-specific transcriptome between control and salt-treated plants. The EBC reference transcriptome consists of 37 341 transcript-contigs, of which 7% showed significantly different expression between salt-treated and control samples. We identified significant changes in ion transport, metabolism related to energy generation and osmolyte accumulation, stress signalling, and organelle functions, as well as a number of lineage-specific genes of unknown function, in response to salt treatment. The salinity-induced EBC transcriptome includes active transcript clusters, refuting the view of EBCs as passive storage compartments in the whole-plant stress response. EBC transcriptomes, differing from those of whole plants or leaf tissue, exemplify the importance of cell type-specific resolution in understanding stress adaptive mechanisms. No claim to original US government works. New Phytologist © 2015 New Phytologist Trust.

  12. Improvement of hydration and epidermal barrier function in human skin by a novel compound isosorbide dicaprylate.

    Science.gov (United States)

    Chaudhuri, R K; Bojanowski, K

    2017-10-01

    The study involved the synthesis of a novel derivative of caprylic acid - isosorbide dicaprylate (IDC) - and the evaluation of its potential in improving water homoeostasis and epidermal barrier function in human skin. The effect of IDC on gene expression was assayed in skin organotypic cultures by DNA microarrays. The results were then confirmed for a few key genes by quantitative PCR, immuno- and cytochemistry. Final validation of skin hydration properties was obtained by four separate clinical studies. Level of hydration was measured by corneometer either by using 2% IDC lotion alone vs placebo or in combination with 2% glycerol lotion vs 2% glycerol only. A direct comparison in skin hydration between 2% IDC and 2% glycerol lotions was also carried out. The epidermal barrier function improvement was assessed by determining changes in transepidermal water loss (TEWL) on the arms before and after treatment with 2% IDC lotion versus placebo. IDC was found to upregulate the expression of AQP3, CD44 and proteins involved in keratinocyte differentiation as well as the formation and function of stratum corneum. A direct comparison between 2% IDC versus 2% glycerol lotions revealed a three-fold advantage of IDC in providing skin hydration. Severely dry skin treated with 2% IDC in combination with 2% glycerol showed 133% improvement, whereas 35% improvement was observed with moderately dry human skin. Topical isosorbide dicaprylate favourably modulates genes involved in the maintenance of skin structure and function, resulting in superior clinical outcomes. By improving skin hydration and epidermal permeability barrier, it offers therapeutic applications in skin ageing. © 2017 Society of Cosmetic Scientists and the Société Française de Cosmétologie.

  13. Stimulation of allogeneic lymphocytes by skin epidermal cells in the rat

    International Nuclear Information System (INIS)

    Tanaka, S.; Sakai, A.

    1979-01-01

    The ability of skin epidermal cells to induce allogeneic lymphocytes into proliferation was examined in mixed skin cell-lymphocyte culture reaction (MSLR). The stimulatng capacity of skin cells was reduced significantly by trypsin digestion, although the damage was repaired by incubation at 37 C for 3 hr. The optimal concentration of mitomycin C for treatment of stimulating cells in the MSLR differed from that in mixed lymphocyte culture reaction (MLR). Irradiation rendered them three to four times more stimulatory than did mitomycin C. Removal of adherent cells from responding cells by passage through a nylon-wool column gave a substantial elevation of the MSLR. The lymphocytes cocultured with skin cells in the primary MSLR incorporated 3 H-thymidine, with the peak at the 6th day of culture. If the lymphocytes primed in the MSLR were restimulated with skin cells from the same stimulating strain, the primed lymphocytes responded promptly and in great magnitude

  14. Sequential cancer mutations in cultured human intestinal stem cells

    NARCIS (Netherlands)

    Drost, Jarno; van Jaarsveld, Richard H.; Ponsioen, Bas; Zimberlin, Cheryl; van Boxtel, Ruben; Buijs, Arjan; Sachs, Norman; Overmeer, René M.; Offerhaus, G. Johan; Begthel, Harry; Korving, Jeroen; van de Wetering, Marc; Schwank, Gerald; Logtenberg, Meike; Cuppen, Edwin; Snippert, Hugo J.; Medema, Jan Paul; Kops, Geert J. P. L.; Clevers, Hans

    2015-01-01

    Crypt stem cells represent the cells of origin for intestinal neoplasia. Both mouse and human intestinal stem cells can be cultured in medium containing the stem-cell-niche factors WNT, R-spondin, epidermal growth factor (EGF) and noggin over long time periods as epithelial organoids that remain

  15. Protein profiling of epidermal bladder cells from the halophyte Mesembryanthemum crystallinum.

    Science.gov (United States)

    Barkla, Bronwyn J; Vera-Estrella, Rosario; Pantoja, Omar

    2012-09-01

    Plant epidermal trichomes are as varied in morphology as they are in function. In the halophyte Mesembryanthemum crystallinum, specialized trichomes called epidermal bladder cells (EBC) line the surface of leaves and stems, and increase dramatically in size and volume upon plant salt-treatment. These cells have been proposed to have roles in plant defense and UV protection, but primarily in sodium sequestration and as water reservoirs. To gain further understanding into the roles of EBC, a cell-type-specific proteomics approach was taken in which precision single-cell sampling of cell sap from individual EBC was combined with shotgun peptide sequencing (LC-MS/MS). Identified proteins showed diverse biological functions and cellular locations, with a high representation of proteins involved in H(+)-transport, carbohydrate metabolism, and photosynthesis. The proteome of EBC provides insight into the roles of these cells in ion and water homeostasis and raises the possibility that they are photosynthetically active and functioning in Crassulacean acid metabolism. © 2012 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  16. A sensitive electrochemiluminescence cytosensor for quantitative evaluation of epidermal growth factor receptor expressed on cell surfaces

    Energy Technology Data Exchange (ETDEWEB)

    Tang, Yanjuan; Zhang, Shaolian; Wen, Qingqing; Huang, Hongxing; Yang, Peihui, E-mail: typh@jnu.edu.cn

    2015-06-30

    Highlights: • EGF-cytosensor was used for evaluating EGFR expression level on cell surfaces. • CdSQDs and EGF were coated on magnetic beads (MBs) for ECL-probe. • Good sensitivity was achieved due to the signal amplification of ECL-probe. - Abstract: A sensitive electrochemiluminescence (ECL) strategy for evaluating the epidermal growth factor receptor (EGFR) expression level on cell surfaces was designed by integrating the specific recognition of EGFR expressed on MCF-7 cell surfaces with an epidermal growth factor (EGF)-funtionalized CdS quantum dots (CdSQDs)-capped magnetic bead (MB) probe. The high sensitivity of ECL probe of EGF-funtionalized CdSQD-capped-MB was used for competitive recognition with EGFR expressed on cell surfaces with recombinant EGFR protein. The changes of ECL intensity depended on both the cell number and the expression level of EGFR receptor on cell surfaces. A wide linear response to cells ranging from 80 to 4 × 10{sup 6} cells mL{sup −1} with a detection limit of 40 cells mL{sup −1} was obtained. The EGF-cytosensor was used to evaluate EGFR expression levels on MCF-7 cells, and the average number of EGFR receptor on single MCF-7 cells was 1.35 × 10{sup 5} with the relative standard deviation of 4.3%. This strategy was further used for in-situ and real-time evaluating EGFR receptor expressed on cell surfaces in response to drugs stimulation at different concentration and incubation time. The proposed method provided potential applications in the detection of receptors on cancer cells and anticancer drugs screening.

  17. Skin mucus of Cyprinus carpio inhibits cyprinid herpesvirus 3 binding to epidermal cells

    Directory of Open Access Journals (Sweden)

    Raj Victor

    2011-08-01

    Full Text Available Abstract Cyprinid herpesvirus 3 (CyHV-3 is the aetiological agent of a mortal and highly contagious disease in common and koi carp. The skin is the major portal of entry of CyHV-3 in carp after immersion in water containing the virus. In the present study, we used in vivo bioluminescence imaging to investigate the effect of skin mucus removal and skin epidermis lesion on CyHV-3 entry. Physical treatments inducing removal of the mucus up to complete erosion of the epidermis were applied on a defined area of carp skin just before inoculation by immersion in infectious water. CyHV-3 entry in carp was drastically enhanced on the area of the skin where the mucus was removed with or without associated epidermal lesion. To investigate whether skin mucus inhibits CyHV-3 binding to epidermal cells, tail fins with an intact mucus layer or without mucus were inoculated ex vivo. While electron microscopy examination revealed numerous viral particles bound on the fins inoculated after mucus removal, no particle could be detected after infection of mucus-covered fins. Finally, anti-CyHV-3 neutralising activity of mucus extract was tested in vitro. Incubation of CyHV-3 with mucus extract reduced its infectivity in a dose dependent manner. The present study demonstrates that skin mucus removal and epidermal lesions enhance CyHV-3 entry in carp. It highlights the role of fish skin mucus as an innate immune protection against viral epidermal entry.

  18. Skin mucus of Cyprinus carpio inhibits cyprinid herpesvirus 3 binding to epidermal cells

    Science.gov (United States)

    2011-01-01

    Cyprinid herpesvirus 3 (CyHV-3) is the aetiological agent of a mortal and highly contagious disease in common and koi carp. The skin is the major portal of entry of CyHV-3 in carp after immersion in water containing the virus. In the present study, we used in vivo bioluminescence imaging to investigate the effect of skin mucus removal and skin epidermis lesion on CyHV-3 entry. Physical treatments inducing removal of the mucus up to complete erosion of the epidermis were applied on a defined area of carp skin just before inoculation by immersion in infectious water. CyHV-3 entry in carp was drastically enhanced on the area of the skin where the mucus was removed with or without associated epidermal lesion. To investigate whether skin mucus inhibits CyHV-3 binding to epidermal cells, tail fins with an intact mucus layer or without mucus were inoculated ex vivo. While electron microscopy examination revealed numerous viral particles bound on the fins inoculated after mucus removal, no particle could be detected after infection of mucus-covered fins. Finally, anti-CyHV-3 neutralising activity of mucus extract was tested in vitro. Incubation of CyHV-3 with mucus extract reduced its infectivity in a dose dependent manner. The present study demonstrates that skin mucus removal and epidermal lesions enhance CyHV-3 entry in carp. It highlights the role of fish skin mucus as an innate immune protection against viral epidermal entry. PMID:21816061

  19. Examination of tetrachlorosalicylanilide (TCSA) photoallergy using in vitro photohapten-modified Langerhans cell-enriched epidermal cells

    International Nuclear Information System (INIS)

    Gerberick, G.F.; Ryan, C.A.; Von Bargen, E.C.; Stuard, S.B.; Ridder, G.M.

    1991-01-01

    Lymphocytes from BALB/c mice photosensitized in vivo to tetrachlorosalicylanilide (TCSA) were investigated to determine whether they could be stimulated to proliferate when cultured with Langerhans cell-enriched cultured epidermal cells (LC-EC) photohapten-modified in vitro with TCSA + UVA radiation. Cultured LC-EC were photohapten-modified in vitro by irradiation in TCSA-containing medium using a 1000-watt solar simulator equipped with filters to deliver primarily UVA radiation (320-400 nm). Lymphocytes from TCSA-photosensitized mice were incubated with LC-EC that had been treated in vitro with 0.1 mM TCSA and 2 J/cm2 UVA radiation (TCSA + UVA). Responder lymphocytes demonstrated a significant increase in their blastogenesis response compared to lymphocytes that were incubated with LC-EC irradiated with UVA prior to treatment with TCSA (UVA/TCSA) or with LC-EC that had received no treatment. Lymphocytes from naive mice or mice photosensitized with musk ambrette (MA) demonstrated a significantly lower response to LC-EC modified with TCSA + UVA, indicating the specificity of the response. Maximum blastogenesis response was achieved when LC-EC were treated with 0.1 mM TCSA and a UVA radiation dose of at least 0.5 J/cm2. Epidermal cells depleted of LC by treatment with anti-Ia antibody plus complement or by an adherence procedure were unable to stimulate this blastogenesis response. Epidermal cells treated in vitro with TCSA + UVA demonstrated enhanced fluorescence compared to control cells. The fluorescence observed was not restricted to any specific epidermal cell type; however, fluorescence microscopy studies revealed that dendritic Ia-positive cells, presumably LC, were also TCSA fluorescent

  20. Expression of the epidermal growth factor system in human endometrium during the menstrual cycle

    DEFF Research Database (Denmark)

    Ejskjaer, Kirsten; Sørensen, B S; Poulsen, Steen Seier

    2005-01-01

    The epidermal growth factor (EGF) system is ubiquitous in humans and plays fundamental roles in embryogenesis, development, proliferation and differentiation. As the endometrium of fertile women is characterized by proliferation and differentiation, we hypothesize a role for the EGF system....... Fourteen premenopausal women had endometrial samples removed on day 6 +/- 1 and day 6 +/- 1 and 12 +/- 1 after ovulation during one menstrual cycle. RNA was extracted and analysed by real-time PCR, and immunohistochemistry was performed to localize the components of the EGF system. Human EGF Receptor 1...... (HER1) showed highest expression during the proliferative phase, HER2 and HER4 during the early and HER3 during the late secretory phase. Amphiregulin (AR) and transforming growth factor alpha (TGFalpha) expression is highest in proliferative phase. Heparin binding (HB)-EGF and betacellulin (BCL) show...

  1. TNP-specific Lyt-2+ cytolytic T cell clones preferentially respond to TNP-conjugated epidermal cells

    International Nuclear Information System (INIS)

    Shimada, S.; Katz, S.I.

    1985-01-01

    A most effective method for the induction of hapten-specific allergic contact sensitivity (CS) is via epicutaneous application of the hapten. Another effective method is by the administration of haptenated epidermal cells (EC) subcutaneously. The latter method induces more intense and longer lasting CS than does the subcutaneous administration of haptenated spleen cells (SC). Thus, there may be something unique about EC which, when haptenated, allows them to generate effector cells more effectively than do SC. The authors therefore, attempted to generate T cell clones that were both hapten- and epidermal-specific. Four days after painting mice with 7% trinitrochlorobenzene, draining lymph node cells were obtained and T cells were purified. These cells were co-cultured with trinitrophenylated (TNP) Langerhans cell-enriched EC. After 4 days, cells were harvested and rested on non-TNP-conjugated EC. The cells were restimulated and rested three times, and were then cloned by limiting dilution with added interleukin 2, which was then continually added. Proliferation of T cells was assessed by [ 3 H]-thymidine incorporation. Cytotoxicity assays utilized TNP-conjugated concanavalin A SC blasts or EC as targets. Clones A-2 and E-4 are Thy-1+, Lyt-2+, and L3T4-, and TNP-specific. In contrast to noncloned TNP-specific T cells, the clones proliferate preferentially in response to TNP-EC rather than TNP-SC. Also in contrast to noncloned T cells, the clones were preferentially cytotoxic for TNP-EC; compared to TNP-SC, there was an eight- to 32-fold increase in killing when TNP-EC were used as targets. Clones A-2 and E-4 therefore exhibit hapten and epidermal specificity

  2. Immunoreactive transforming growth factor alpha and epidermal growth factor in oral squamous cell carcinomas

    DEFF Research Database (Denmark)

    Therkildsen, M H; Poulsen, Steen Seier; Bretlau, P

    1993-01-01

    Forty oral squamous cell carcinomas have been investigated immunohistochemically for the presence of transforming growth factor alpha (TGF-alpha) and epidermal growth factor (EGF). The same cases were recently characterized for the expression of EGF-receptors. TGF-alpha was detected...... previous results confirms the existence of TGF-alpha, EGF, and EGF-receptors in the majority of oral squamous cell carcinomas and their metastases......., the cells above the basal cell layer were positive for both TGF-alpha and EGF. The same staining pattern was observed in oral mucosa obtained from healthy persons. In moderately to well differentiated carcinomas, the immunoreactivity was mainly confined to the cytologically more differentiated cells, thus...

  3. Linking γ-aminobutyric acid A receptor to epidermal growth factor receptor pathways activation in human prostate cancer.

    Science.gov (United States)

    Wu, Weijuan; Yang, Qing; Fung, Kar-Ming; Humphreys, Mitchell R; Brame, Lacy S; Cao, Amy; Fang, Yu-Ting; Shih, Pin-Tsen; Kropp, Bradley P; Lin, Hsueh-Kung

    2014-03-05

    Neuroendocrine (NE) differentiation has been attributed to the progression of castration-resistant prostate cancer (CRPC). Growth factor pathways including the epidermal growth factor receptor (EGFR) signaling have been implicated in the development of NE features and progression to a castration-resistant phenotype. However, upstream molecules that regulate the growth factor pathway remain largely unknown. Using androgen-insensitive bone metastasis PC-3 cells and androgen-sensitive lymph node metastasis LNCaP cells derived from human prostate cancer (PCa) patients, we demonstrated that γ-aminobutyric acid A receptor (GABA(A)R) ligand (GABA) and agonist (isoguvacine) stimulate cell proliferation, enhance EGF family members expression, and activate EGFR and a downstream signaling molecule, Src, in both PC-3 and LNCaP cells. Inclusion of a GABA(A)R antagonist, picrotoxin, or an EGFR tyrosine kinase inhibitor, Gefitinib (ZD1839 or Iressa), blocked isoguvacine and GABA-stimulated cell growth, trans-phospohorylation of EGFR, and tyrosyl phosphorylation of Src in both PCa cell lines. Spatial distributions of GABAAR α₁ and phosphorylated Src (Tyr416) were studied in human prostate tissues by immunohistochemistry. In contrast to extremely low or absence of GABA(A)R α₁-positive immunoreactivity in normal prostate epithelium, elevated GABA(A)R α₁ immunoreactivity was detected in prostate carcinomatous glands. Similarly, immunoreactivity of phospho-Src (Tyr416) was specifically localized and limited to the nucleoli of all invasive prostate carcinoma cells, but negative in normal tissues. Strong GABAAR α₁ immunoreactivity was spatially adjacent to the neoplastic glands where strong phospho-Src (Tyr416)-positive immunoreactivity was demonstrated, but not in adjacent to normal glands. These results suggest that the GABA signaling is linked to the EGFR pathway and may work through autocrine or paracine mechanism to promote CRPC progression. Copyright © 2013 Elsevier

  4. Anti-sense suppression of epidermal growth factor receptor expression alters cellular proliferation, cell-adhesion and tumorigenicity in ovarian cancer cells.

    Science.gov (United States)

    Alper, O; De Santis, M L; Stromberg, K; Hacker, N F; Cho-Chung, Y S; Salomon, D S

    2000-11-15

    Over-expression of epidermal growth factor receptor (EGFR) in ovarian cancer has been well documented. Human NIH:OVCAR-8 ovarian carcinoma cells were transfected with an expression vector containing the anti-sense orientation of truncated human EGFR cDNA. EGFR anti-sense over-expression resulted in decreased EGFR protein and mRNA expression, cell proliferation and tumor formation in nude mice. In accordance with the reduced levels of EGFR in EGFR anti-sense-expressing cells, tyrosine phosphorylation of EGFR was decreased compared to untransfected parental cells treated with EGF. In EGFR anti-sense-transfected cells, expression of erbB-3, but not erbB-2, was increased. In addition, basal and heregulin-beta 1-stimulated tyrosine phosphorylation of erbB-3 was higher in EGFR anti-sense vector-transfected cells. A morphological alteration in EGFR anti-sense gene-expressing cells was correlated with a decrease in the expression of E-cadherin, alpha-catenin and, to a lesser extent, beta-catenin. Changes in the expression of these proteins were associated with a reduction in complex formation among E-cadherin, beta-catenin and alpha-catenin and between beta-catenin and EGFR in EGFR anti-sense-expressing cells compared to sense-transfected control cells. These results demonstrate that EGFR expression in ovarian carcinoma cells regulates expression of cell adhesion proteins that may enhance cell growth and invasiveness. Copyright 2000 Wiley-Liss, Inc.

  5. Phospholipase D2 Enhances Epidermal Growth Factor-Induced Akt Activation in EL4 Lymphoma Cells

    Directory of Open Access Journals (Sweden)

    Manpreet S. Chahal

    2010-07-01

    Full Text Available Phospholipase D2 (PLD2 generates phosphatidic acid through hydrolysis of phosphatidylcholine. PLD2 has been shown to play a role in enhancing tumorigenesis. The epidermal growth factor receptor (EGFR can both activate and interact with PLD2. Murine lymphoma EL4 cells lacking endogenous PLD2 present a unique model to elucidate the role of PLD2 in signal transduction. In the current study, we investigated effects of PLD2 on EGF response. Western blotting and RT-PCR were used to establish that both parental cells and PLD2 transfectants express endogenous EGFR. Levels of EGFR protein are increased in cells expressing active PLD2, as compared to parental cells or cells expressing inactive PLD2. EGF stimulates proliferation of EL4 cells transfected with active PLD2, but not parental cells or cells transfected with inactive PLD2. EGF-mediated proliferation in cells expressing active PLD2 is dependent on the activities of both the EGFR and the PI3K/Akt pathway, as demonstrated by studies using protein kinase inhibitors. EGF-induced invasion through a synthetic extracellular matrix is enhanced in cells expressing active PLD2, as compared to parental cells or cells expressing inactive PLD2. Taken together, the data suggest that PLD2 acts in concert with EGFR to enhance mitogenesis and invasion in lymphoma cells.

  6. Phospholipase D2 Enhances Epidermal Growth Factor-Induced Akt Activation in EL4 Lymphoma Cells.

    Science.gov (United States)

    Chahal, Manpreet S; Brauner, Daniel J; Meier, Kathryn E

    2010-07-02

    Phospholipase D2 (PLD2) generates phosphatidic acid through hydrolysis of phosphatidylcholine. PLD2 has been shown to play a role in enhancing tumorigenesis. The epidermal growth factor receptor (EGFR) can both activate and interact with PLD2. Murine lymphoma EL4 cells lacking endogenous PLD2 present a unique model to elucidate the role of PLD2 in signal transduction. In the current study, we investigated effects of PLD2 on EGF response. Western blotting and RT-PCR were used to establish that both parental cells and PLD2 transfectants express endogenous EGFR. Levels of EGFR protein are increased in cells expressing active PLD2, as compared to parental cells or cells expressing inactive PLD2. EGF stimulates proliferation of EL4 cells transfected with active PLD2, but not parental cells or cells transfected with inactive PLD2. EGF-mediated proliferation in cells expressing active PLD2 is dependent on the activities of both the EGFR and the PI3K/Akt pathway, as demonstrated by studies using protein kinase inhibitors. EGF-induced invasion through a synthetic extracellular matrix is enhanced in cells expressing active PLD2, as compared to parental cells or cells expressing inactive PLD2. Taken together, the data suggest that PLD2 acts in concert with EGFR to enhance mitogenesis and invasion in lymphoma cells.

  7. Yorkie regulates epidermal wound healing in Drosophila larvae independently of cell proliferation and apoptosis.

    Science.gov (United States)

    Tsai, Chang-Ru; Anderson, Aimee E; Burra, Sirisha; Jo, Juyeon; Galko, Michael J

    2017-07-01

    Yorkie (Yki), the transcriptional co-activator of the Hippo signaling pathway, has well-characterized roles in balancing apoptosis and cell division during organ growth control. Yki is also required in diverse tissue regenerative contexts. In most cases this requirement reflects its well-characterized roles in balancing apoptosis and cell division. Whether Yki has repair functions outside of the control of cell proliferation, death, and growth is not clear. Here we show that Yki and Scalloped (Sd) are required for epidermal wound closure in the Drosophila larval epidermis. Using a GFP-tagged Yki transgene we show that Yki transiently translocates to some epidermal nuclei upon wounding. Genetic analysis strongly suggests that Yki interacts with the known wound healing pathway, Jun N-terminal kinase (JNK), but not with Platelet Derived Growth Factor/Vascular-Endothelial Growth Factor receptor (Pvr). Yki likely acts downstream of or parallel to JNK signaling and does not appear to regulate either proliferation or apoptosis in the larval epidermis during wound repair. Analysis of actin structures after wounding suggests that Yki and Sd promote wound closure through actin regulation. In sum, we found that Yki regulates an epithelial tissue repair process independently of its previously documented roles in balancing proliferation and apoptosis. Copyright © 2017 Elsevier Inc. All rights reserved.

  8. Protective effect of Juglans regia L. against ultraviolet B radiation induced inflammatory responses in human epidermal keratinocytes.

    Science.gov (United States)

    Muzaffer, Umar; Paul, V I; Prasad, Nagarajan Rajendra; Karthikeyan, Ramasamy; Agilan, Balupillai

    2018-03-15

    Juglans regia L. has a history of traditional medicinal use for the treatment of various maladies and have been documented with significant antioxidant and antiinflammatory properties. Although all parts of the plant are medicinally important, but male the flower of the plant has not been yet investigated against the photo-damage. The present study, we sought to determine the photoprotective effect of the male flower of J. regia L. against ultraviolet-B radiation-induced inflammatory responses in human skin cells. The profile of pharmacological active compounds present in the male flower of J. regia was analyzed by GC-MS. Then, the antioxidant property of methanolic extract of J. regia (MEJR) was analyzed by in vitro free radical scavenging assays. Further, we analyzed the sun protection factor of this extract by spectrophotometry. Moreover, we investigated the photoprotective effect of MEJR against UVB induced inflammatory signaling in human epidermal cells. Human skin epidermal keratinocytes (HaCaT) were pretreated with the MEJR (80 µg/ml), 30 min prior to UVB-irradiation at a dose of 20 mJ/cm 2 and were investigated for lipid peroxidation, enzymatic antioxidants activity, apoptosis and inflammatory markers expression level. The GC-MS results showed the presence of good amount of pharmacologically active compounds in the MEJR. We observed that the MEJR possess significant free radical scavenging activity and it was comparable with standard antioxidants. Further, the MEJR exhibits 8.8 sun-protection-factor (SPF) value. Pretreatment with MEJR, 30 min prior to UVB-irradiation, prevented ROS generation, lipid peroxidation and restored the activity of antioxidant status in HaCaT cells. Moreover, MEJR pretreatment significantly prevented UVB activated inflammatory markers like TNF-α, IL-1, IL-6, NF-κB, COX-2 in HaCaT. The present findings suggest that MEJR exhibit photoprotective effects and hence it may be useful for the treatment of inflammation related

  9. Topical Human Epidermal Growth Factor in the Treatment of Senile Purpura and the Prevention of Dermatoporosis.

    Science.gov (United States)

    McKnight, Braden; Seidel, Rachel; Moy, Ron

    2015-10-01

    Senile purpura presents itself as a largely unexplored challenge as it has been long thought of as a benign condition without long-term health sequelae. It is becoming increasingly accepted that skin aging not only results in cosmetic disturbances, but as a functional ones. With modern increases in lifespan, skin atrophy associated with solar damage is presenting as a clinically significant inability to mechanically protect patients. This chronic cutaneous insufficiency/fragility syndrome was recently termed dermatoporosis and senile purpura appears to be a visible marker of early stage dysfunction. To examine the effects of topically human epidermal growth factor on the clinical presence of senile purpura and its effect on skin thickness as measured via cutaneous ultrasound. Six subjects applied human epidermal growth factor morning and night for six weeks. Clinical outcomes were evaluated by comparing initial clinical photos to 6-week photos and performing a blinded investigator's global assessment (IGA). Skin thickness was evaluated via cutaneous ultrasound measurement. Ultrasound measurements indicated a mean skin thickening of 195.2 ± 35.7 um (SEM) over 6 weeks. The average number of purpuric lesions decreased from 15 ± 4.6 (SEM) to 2.3 ± 0.7 (SEM) over that same period. Senile purpura presents itself as a cosmetic disturbance posing significant psychological distress and serves as a marker of the severity of skin thinning. In this study, we demonstrate that topical h-EGF diminishes the appearance of senile purpura by thickening skin and may help prevent the development of late stage dermatoporosis.

  10. Establishment of H2Mab-119, an Anti-Human Epidermal Growth Factor Receptor 2 Monoclonal Antibody, Against Pancreatic Cancer.

    Science.gov (United States)

    Yamada, Shinji; Itai, Shunsuke; Nakamura, Takuro; Chang, Yao-Wen; Harada, Hiroyuki; Suzuki, Hiroyoshi; Kaneko, Mika K; Kato, Yukinari

    2017-12-01

    Human epidermal growth factor receptor 2 (HER2) is overexpressed in breast cancer and is associated with poor clinical outcomes. In addition, HER2 expression has been reported in other cancers, such as gastric, colorectal, lung, and pancreatic cancers. An anti-HER2 humanized antibody, trastuzumab, leads to significant survival benefits in patients with HER2-overexpressing breast cancers and gastric cancers. Herein, we established a novel anti-HER2 monoclonal antibody (mAb), H 2 Mab-119 (IgG 1 , kappa), and characterized its efficacy against pancreatic cancers using flow cytometry, Western blot, and immunohistochemical analyses. H 2 Mab-119 reacted with pancreatic cancer cell lines, such as KLM-1, Capan-2, and MIA PaCa-2, but did not react with PANC-1 in flow cytometry analysis. Western blot analysis also revealed a moderate signal for KLM-1 and a weak signal for MIA PaCa-2, although H 2 Mab-119 reacted strongly with LN229/HER2 cells. Finally, immunohistochemical analyses with H 2 Mab-119 revealed sensitive and specific reactions against breast and colon cancers but did not react with pancreatic cancers, indicating that H 2 Mab-119 is useful for detecting HER2 overexpression in pancreatic cancers using flow cytometry and Western blot analyses.

  11. Trichloroethylene-mediated cytotoxicity in human epidermal keratinocytes is mediated by the rapid accumulation of intracellular calcium: Interception by naringenin.

    Science.gov (United States)

    Ali, F; Khan, A Q; Khan, R; Sultana, S

    2016-02-01

    Industrial solvents pose a significant threat to the humankind. The mechanisms of their toxicity still remain in debate. Trichloroethylene (TCE) is a widespread industrial solvent responsible for severe liver dysfunction, cutaneous toxicity in occupationally exposed humans. We utilized an in vitro system of human epidermal keratinocyte (HaCaT) cells in this study to avoid complex cell and extracellular interactions. We report the cytotoxicity of organic solvent TCE in HaCaT and its reversal by a natural flavanone, naringenin (Nar). The cytotoxicity was attributed to the rapid intracellular free calcium (Ca(2+)) release, which might lead to the elevation of protein kinase C along with robust free radical generation, instability due to energy depletion, and sensitization of intracellular stress signal transducer nuclear factor κB. These effects were actually seen to induce significant amount of genomic DNA fragmentation. Furthermore, all these effects of TCE were effectively reversed by the treatment of Nar, a natural flavanone. Our studies identify intracellular Ca as a unique target used by organic solvents in the cytotoxicity and highlight the Ca(2+) ion stabilizer properties of Nar. © The Author(s) 2015.

  12. Limited human epidermal growth factor receptor 2 discordance in metastatic breast cancer patients treated with trastuzumab, a population based study

    NARCIS (Netherlands)

    van Rooijen, J.M.; de Munck, L.; de Graaf, J.C.; Siesling, Sabine; de Vries, Erik G.; Boers, J.E.

    2014-01-01

    Background Accurate assessment of the human epidermal growth factor receptor 2 (HER2) in breast cancer is essential for proper treatment decisions. HER2 positivity confirmation rates in breast cancer trials by central testing pathology laboratories were reported to be approximately 85%. The aim of

  13. Tumor necrosis factor related apoptosis inducing ligand triggers apoptosis in dividing but not in differentiating human epidermal keratinocytes

    NARCIS (Netherlands)

    Jansen, Bastiaan J. H.; van Ruissen, Fred; Cerneus, Stefanie; Cloin, Wendy; Bergers, Mieke; van Erp, Piet E. J.; Schalkwijk, Joost

    2003-01-01

    Using serial analysis of gene expression we have previously identified the expression of several pro-apoptotic and anti-apoptotic genes in cultured human primary epidermal keratinocytes, including tumor necrosis factor related apoptosis inducing ligand (TRAIL). TRAIL is a potent inducer of apoptosis

  14. Limited human epidermal growth factor receptor 2 discordance in metastatic breast cancer patients treated with trastuzumab, a population based study

    NARCIS (Netherlands)

    van Rooijen, J. M.; de Munck, L.; de Graaf, J. C.; Siesling, S.; de Vries, E. G.; Boers, J. E.

    Background: Accurate assessment of the human epidermal growth factor receptor 2 (HER2) in breast cancer is essential for proper treatment decisions. HER2 positivity confirmation rates in breast cancer trials by central testing pathology laboratories were reported to be approximately 85%. The aim of

  15. Basaloid Squamous Cell Carcinoma of the Head and Neck: Subclassification into Basal, Ductal, and Mixed Subtypes Based on Comparison of Clinico-pathologic Features and Expression of p53, Cyclin D1, Epidermal Growth Factor Receptor, p16, and Human Papillomavirus

    Directory of Open Access Journals (Sweden)

    Kyung-Ja Cho

    2017-07-01

    Full Text Available Background Basaloid squamous cell carcinoma (BSCC is a rare variant of squamous cell carcinoma with distinct pathologic characteristics. The histogenesis of BSCC is not fully understood, and the cancer has been suggested to originate from a totipotent primitive cell in the basal cell layer of the surface epithelium or in the proximal duct of secretory glands. Methods Twenty-six cases of head and neck BSCC from Asan Medical Center, Seoul, Korea, reported during a 14-year-period were subclassified into basal, ductal, and mixed subtypes according to the expression of basal (cytokeratin [CK] 5/6, p63 or ductal markers (CK7, CK8/18. The cases were also subject to immunohistochemical study for CK19, p53, cyclin D1, epidermal growth factor receptor (EGFR, and p16 and to in situ hybridization for human papillomavirus (HPV, and the results were clinico-pathologically compared. Results Mixed subtype (12 cases was the most common, and these cases showed hypopharyngeal predilection, older age, and higher expression of CK19, p53, and EGFR than other subtypes. The basal subtype (nine cases showed frequent comedo-necrosis and high expression of cyclin D1. The ductal subtype (five cases showed the lowest expression of p53, cyclin D1, and EGFR. A small number of p16- and/or HPV-positive cases were not restricted to one subtype. BSCC was the cause of death in 19 patients, and the average follow-up period for all patients was 79.5 months. Overall survival among the three subtypes was not significantly different. Conclusions The results of this study suggest a heterogeneous pathogenesis of head and neck BSCC. Each subtype showed variable histology and immunoprofiles, although the clinical implication of heterogeneity was not determined in this study.

  16. Catalase reverses tumorigenicity in a malignant cell line by an epidermal growth factor receptor pathway.

    Science.gov (United States)

    Finch, Joanne S; Tome, Margaret E; Kwei, Kevin A; Bowden, G Tim

    2006-03-01

    We have used a keratinocyte in vivo/in vitro cell model to test the hypothesis that hydrogen peroxide acts as a signaling molecule, contributing to proliferation and tumorigenesis. A cell line, 6M90, that produces squamous cell carcinoma (SCC), has high levels of ROS and low levels of catalase. A new cell line, MTOC2, generated from parental 6M90 cells by introduction of a Tet-responsive catalase transgene, effectively expressed higher peroxisomal catalase. Increased catalase expression diminished constitutive ROS and enhanced viability after treatment with hydrogen peroxide. Protein tyrosine phosphatase activity was higher in the MTOC2 cells with high catalase, consistent with detection of a lower level of phosphorylation at tyrosine 1068 of the epidermal growth factor receptor (EGF-R). Transcription of downstream c-fos, AP-1 transactivation and cell proliferation were higher in the low catalase cells. An EGF-R inhibitor, AG1478, blocks the higher AP-1 transactivation and cell proliferation of the low catalase 6M90 cells. Tumorigenesis in SCID mice was greatly diminished in the high catalase cells. Our data suggest that hydrogen peroxide functions as a signaling molecule that can modulate activity of a protein tyrosine phosphatase/(s) resulting in phosphorylation of tryrosine/(s) on the EGF-R. Therefore, catalase acts as a tumor-suppressor gene in part by decreasing EGF-R signaling.

  17. Effects of recombinant human epidermal growth factor (rhEGF) on experimental radiation-induced oral mucositis in rats

    International Nuclear Information System (INIS)

    Jung, Kwon Il; Kim, Sun Hee; Moon, Soo Young; Kim, Yeon Wha; Hong, Joon Pio; Lee, Sang Wook; Kim, Hyun Sook

    2006-01-01

    Oral mucositis is a common toxicity of radiation or chemotherapy, which is used a treatment for head and neck cancer. We investigated effects of recombinant human epidermal growth factor (rhEGF) on radiation-induced oral mucositis in rat model. Spraque-Dawley rats (7 per group) exposed to a single dose of 25 Gy (day 0) on their head, except for one group, were randomly divided into un-treated, vehicle-treated, and two rhEGF-treated groups. Rats were topically applied with rhEGF (15 or 30 μ g/oral cavity/day) or vehicle to their oral mucosa. Survival rate of rats, weight changes, and food intakes were examined from day 0 to 18 after radiation. Histology study was performed from oral mucosa of rats at day 7 and 18 after radiation. rhEGF-treated groups (15 or 30 μ g/day) showed all survival rate 33%, whereas un-treated and vehicle-treated groups showed all survival rate 0% at the end of experiment. rhEGF-treated groups statistically had less weight loss compared to vehicle-treated group from day 2 to 7 after radiation. Food intake of rats with rhEGF treatment turned to increase at day 14 after radiation. At 7 day after radiation, un-treated and vehicle-treated groups showed severe pseudomembraneous of ulcerative oral mucositis. On the other hand, rhEGF-treated groups had no more than cellular swelling and degeneration of epidermal cells in oral mucosa of rats. These results suggest that rhEGF has significantly positive effects on radiation-induced oral mucositis in rats. rhEGF display a therapeutic potential on a clinical level

  18. Epidermal growth factor-mediated effects on equine vascular smooth muscle cells

    International Nuclear Information System (INIS)

    Grosenbaugh, D.A.; Amoss, M.S.; Hood, D.M.; Morgan, S.J.; Williams, J.D.

    1988-01-01

    Epidermal growth factor (EGF) receptor binding kinetics and EGF-mediated stimulation of DNA synthesis and cellular proliferation were studied in cultured vascular smooth muscle cells (VSMC) from the equine thoracic aorta. Binding studies, using murine 125 I-labeled EGF, indicate the presence of a single class of high-affinity binding sites, with an estimated maximal binding capacity of 5,800 sites/cells. EGF stimulated [ 3 H]thymidine uptake in confluent quiescent monolayers in a dose-dependent fashion, half-maximal stimulation occurring at 7.5 x 10 -11 M. Likewise, EGF-mediated cellular proliferation was dose dependent under reduced serum concentrations. Equine VSMC contain specific receptors for EGF, and EGF can stimulate DNA synthesis and proliferation in these cultured cells, which suggests that EGF may participate in the proliferative changes observed in equine distal digital peripheral vascular disease

  19. Preparation of epidermal growth factor (EGF) conjugated iron oxide nanoparticles and their internalization into colon cancer cells

    International Nuclear Information System (INIS)

    Creixell, Mar; Herrera, Adriana P.; Ayala, Vanessa; Latorre-Esteves, Magda; Perez-Torres, Marianela; Torres-Lugo, Madeline; Rinaldi, Carlos

    2010-01-01

    Epidermal growth factor (EGF) was conjugated with carboxymethyldextran (CMDx) coated iron oxide magnetic nanoparticles using carbodiimide chemistry to obtain magnetic nanoparticles that target the epidermal growth factor receptor (EGFR). Epidermal growth factor modified magnetic nanoparticles were colloidally stable when suspended in biological buffers such as PBS and cell culture media. Both targeted and non-targeted nanoparticles were incubated with CaCo-2 cancer cells, known to overexpress EGFR. Nanoparticle localization within the cell was visualized by confocal laser scanning microscopy and light microscopy using Prussian blue stain. Results showed that targeted magnetic nanoparticles were rapidly accumulated in both flask-shaped small vesicles and large circular endocytic structures. Internalization patterns suggest that both clathrin-dependent and clathrin-independent receptors mediated endocytosis mechanisms are responsible for nanoparticle internalization.

  20. Antitumor efficacy of triple monoclonal antibody inhibition of epidermal growth factor receptor (EGFR) with MM151 in EGFR-dependent and in cetuximab-resistant human colorectal cancer cells

    Science.gov (United States)

    Napolitano, Stefania; Martini, Giulia; Martinelli, Erika; Della Corte, Carminia Maria; Morgillo, Floriana; Belli, Valentina; Cardone, Claudia; Matrone, Nunzia; Ciardiello, Fortunato; Troiani, Teresa

    2017-01-01

    Purpose We investigated the effect of triple monoclonal antibody inhibition of EGFR to overcome acquired resistance to first generation of anti-EGFR inhibitors. Experimental design MM151 is a mixture of three different monoclonal IgG1 antibodies directed toward three different, non-overlapping, epitopes of the EGFR. We performed an in vivo study by using human CRC cell lines (SW48, LIM 1215 and CACO2) which are sensitive to EGFR inhibitors, in order to evaluate the activity of MM151 as compared to standard anti-EGFR mAbs, such as cetuximab, as single agent or in a sequential strategy of combination MM151 with irinotecan (induction therapy) followed by MM151 with a selective MEK1/2 inhibitor (MEKi) (maintenance therapy). Furthermore, the ability of MM151 to overcome acquired resistance to cetuximab has been also evaluated in cetuximab-refractory CRC models. Results MM151 shown stronger antitumor activity as compared to cetuximab. The maintenance treatment with MM151 plus MEKi resulted the most effective therapeutic modality. In fact, this combination caused an almost complete suppression of tumor growth in SW48, LIM 1215 and CACO2 xenografts model at 30 week. Moreover, in this treatment group, mice with no evidence of tumor were more than double as compared to single agent treated mice. Its superior activity has also been demonstrated, in cetuximab-refractory CRC models. Conclusions These results provide experimental evidence that more efficient and complete EGFR blockade may determine better antitumor activity and could contribute to prevent and/or overcome acquired resistance to EGFR inhibitors. PMID:29137301

  1. Embryonic maturation of epidermal Merkel cells is controlled by a redundant transcription factor network.

    Science.gov (United States)

    Perdigoto, Carolina N; Bardot, Evan S; Valdes, Victor J; Santoriello, Francis J; Ezhkova, Elena

    2014-12-01

    Merkel cell-neurite complexes are located in touch-sensitive areas of the mammalian skin and are involved in recognition of the texture and shape of objects. Merkel cells are essential for these tactile discriminations, as they generate action potentials in response to touch stimuli and induce the firing of innervating afferent nerves. It has been shown that Merkel cells originate from epidermal stem cells, but the cellular and molecular mechanisms of their development are largely unknown. In this study, we analyzed Merkel cell differentiation during development and found that it is a temporally regulated maturation process characterized by a sequential activation of Merkel cell-specific genes. We uncovered key transcription factors controlling this process and showed that the transcription factor Atoh1 is required for initial Merkel cell specification. The subsequent maturation steps of Merkel cell differentiation are controlled by cooperative function of the transcription factors Sox2 and Isl1, which physically interact and work to sustain Atoh1 expression. These findings reveal the presence of a robust transcriptional network required to produce functional Merkel cells that are required for tactile discrimination. © 2014. Published by The Company of Biologists Ltd.

  2. Selective Killing Effects of Cold Atmospheric Pressure Plasma with NO Induced Dysfunction of Epidermal Growth Factor Receptor in Oral Squamous Cell Carcinoma.

    Directory of Open Access Journals (Sweden)

    Jung-Hwan Lee

    Full Text Available The aim of this study is to investigate the effects of cold atmospheric pressure plasma (CAP-induced radicals on the epidermal growth factor receptor (EGFR, which is overexpressed by oral squamous cell carcinoma, to determine the underlying mechanism of selective killing. CAP-induced highly reactive radicals were observed in both plasma plume and cell culture media. The selective killing effect was observed in oral squamous cell carcinoma compared with normal human gingival fibroblast. Degradation and dysfunction of EGFRs were observed only in the EGFR-overexpressing oral squamous cell carcinoma and not in the normal cell. Nitric oxide scavenger pretreatment in cell culture media before CAP treatment rescued above degradation and dysfunction of the EGFR as well as the killing effect in oral squamous cell carcinoma. CAP may be a promising cancer treatment method by inducing EGFR dysfunction in EGFR-overexpressing oral squamous cell carcinoma via nitric oxide radicals.

  3. Selective Killing Effects of Cold Atmospheric Pressure Plasma with NO Induced Dysfunction of Epidermal Growth Factor Receptor in Oral Squamous Cell Carcinoma.

    Science.gov (United States)

    Lee, Jung-Hwan; Om, Ji-Yeon; Kim, Yong-Hee; Kim, Kwang-Mahn; Choi, Eun-Ha; Kim, Kyoung-Nam

    2016-01-01

    The aim of this study is to investigate the effects of cold atmospheric pressure plasma (CAP)-induced radicals on the epidermal growth factor receptor (EGFR), which is overexpressed by oral squamous cell carcinoma, to determine the underlying mechanism of selective killing. CAP-induced highly reactive radicals were observed in both plasma plume and cell culture media. The selective killing effect was observed in oral squamous cell carcinoma compared with normal human gingival fibroblast. Degradation and dysfunction of EGFRs were observed only in the EGFR-overexpressing oral squamous cell carcinoma and not in the normal cell. Nitric oxide scavenger pretreatment in cell culture media before CAP treatment rescued above degradation and dysfunction of the EGFR as well as the killing effect in oral squamous cell carcinoma. CAP may be a promising cancer treatment method by inducing EGFR dysfunction in EGFR-overexpressing oral squamous cell carcinoma via nitric oxide radicals.

  4. De novo activating epidermal growth factor mutations (EGFR) in small-cell lung cancer.

    Science.gov (United States)

    Thai, Alesha; Chia, Puey L; Russell, Prudence A; Do, Hongdo; Dobrovic, Alex; Mitchell, Paul; John, Thomas

    2017-09-01

    In Australia, mutations in epidermal growth factor mutations (EGFR) occur in 15% of patients diagnosed with non-small-cell lung cancer and are found with higher frequency in female, non-smokers of Asian ethnicity. Activating mutations in the EGFR gene are rarely described in SCLC. We present two cases of de novo EGFR mutations in patients with SCLC detected in tissue and in plasma cell free DNA, both of whom were of Asian ethnicity and never-smokers. These two cases add to the growing body of evidence suggesting that screening for EGFR mutations in SCLC should be considered in patients with specific clinical features. © 2017 Royal Australasian College of Physicians.

  5. Human epidermal growth factor receptor 2-positive breast cancer: which cytotoxic agent best complements trastuzumab's efficacy in vitro?

    Directory of Open Access Journals (Sweden)

    Hurrell T

    2013-06-01

    Full Text Available Tracey Hurrell, Kim OuthoffDepartment of Pharmacology, University of Pretoria, Pretoria, South AfricaIntroduction: Despite trastuzumab having enhanced selectivity for human epidermal growth factor receptor 2 (HER-2 overexpressing breast cancer cells, treatment is hampered by interindividual variation and tumors with high mitogenic potential. The lack of significant clinical benefit in certain patient cohorts suggests that HER-2 expression is ineffective as a sole prognostic indicator of response to therapy. Therefore, optimizing the clinical role of trastuzumab in drug combinations remains critical for clinical success.Aim: To investigate the effects of trastuzumab in combination with either doxorubicin or geldanamycin on in vitro cell viability, cell cycling, apoptosis and relative HER-2 expression in HER-2-positive (SK-BR-3 and estrogen receptor-positive (MCF-7 breast adenocarcinoma models.Results: HER-2-rich SK-BR-3 cells demonstrated a greater sensitivity to the effects of doxorubicin than MCF-7 cells. Concurrent trastuzumab exposure resulted in a further reduction in cell viability. This decreased cell viability induced by doxorubicin was associated with activation of executioner caspases as well as with alterations in cell-cycle kinetics, primarily promoting S-phase accumulation. Doxorubicin had no effect on surface HER-2 density expression. Geldanamycin reduced cell viability significantly greater in SK-BR-3 than MCF-7 cells, and was associated with G2 cell-cycle accumulation. The addition of trastuzumab did not augment these effects. Geldanamycin promoted substantial reductions in relative surface HER-2 density in SK-BR-3 cells.Conclusion: The in vitro data supported the rationale for using doxorubicin in trastuzumab-based therapies. Therefore, despite the incidence of cardiotoxicity, doxorubicin could retain a fundamental role in treating HER-2-positive breast cancer. While geldanamycin is a potent cytotoxic agent, its concurrent use

  6. Andrographolide regulates epidermal growth factor receptor and transferrin receptor trafficking in epidermoid carcinoma (A-431) cells

    Science.gov (United States)

    Tan, Y; Chiow, KH; Huang, D; Wong, SH

    2010-01-01

    Background and purpose: Andrographolide is the active component of Andrographis paniculata, a plant used in both Indian and Chinese traditional medicine, and it has been demonstrated to induce apoptosis in different cancer cell lines. However, not much is known about how it may affect the key receptors implicated in cancer. Knowledge of how andrographolide affects receptor trafficking will allow us to better understand new mechanisms by which andrographolide may cause death in cancer cells. Experimental approach: We utilized the well-characterized epidermal growth factor receptor (EGFR) and transferrin receptor (TfR) expressed in epidermoid carcinoma (A-431) cells as a model to study the effect of andrographolide on receptor trafficking. Receptor distribution, the total number of receptors and surface receptors were analysed by immunofluorescence, Western blot as well as flow-cytometry respectively. Key results: Andrographolide treatment inhibited cell growth, down-regulated EGFRs on the cell surface and affected the degradation of EGFRs and TfRs. The EGFR was internalized into the cell at an increased rate, and accumulated in a compartment that co-localizes with the lysosomal-associated membrane protein in the late endosomes. Conclusion and implications: This study sheds light on how andrographolide may affect receptor trafficking by inhibiting receptor movement from the late endosomes to lysosomes. The down-regulation of EGFR from the cell surface also indicates a new mechanism by which andrographolide may induce cancer cell death. PMID:20233216

  7. Studies on the relationship between epidermal cell turnover kinetics and permeability of hairless mouse skin

    International Nuclear Information System (INIS)

    Han, S.R.

    1988-01-01

    The primary aim of this study was to develop non-invasive, physical means to quantitatively assess the epidermal turnover kinetics and barrier properties of the skin and relate these to the cutaneous irritation which results from ultraviolet light irradiation and mold thermal burns. After systematically injecting radiolabeled glycine, the appearance of radioactivity at the skin's surface indicated the transit time of radiolabeled cells through the skin. By plotting the data as the cumulative specific activity against time and then fitting them with a third order polynomial equation, it is possible to estimate the turnover time of the stratum corneum. The skin turnover was coordinated with non-invasive transepidermal water loss (TEWL) studies determined with an evaporimeter. In vitro diffusion studies of the permeability of hydrocortisone through UVB irradiated and thermally burned skin were also performed. The studies indicated that irritated skin offers a relatively low diffusional resistance to hydrocortisone. Depending on the severity of the trauma, the increases in hydrocortisone's permeability coefficient through irritated skin ranged from a low of about 2 times normal to a high of about 210 times normal. Trauma-induced changes in hydrocortisone permeability parallel changes in TEWL, proving that the barrier deficient state resulting from rapid epidermal turnover is a general phenomenon

  8. Epidermal wound repair is regulated by the planar cell polarity signaling pathway.

    Science.gov (United States)

    Caddy, Jacinta; Wilanowski, Tomasz; Darido, Charbel; Dworkin, Sebastian; Ting, Stephen B; Zhao, Quan; Rank, Gerhard; Auden, Alana; Srivastava, Seema; Papenfuss, Tony A; Murdoch, Jennifer N; Humbert, Patrick O; Parekh, Vishwas; Boulos, Nidal; Weber, Thomas; Zuo, Jian; Cunningham, John M; Jane, Stephen M

    2010-07-20

    The mammalian PCP pathway regulates diverse developmental processes requiring coordinated cellular movement, including neural tube closure and cochlear stereociliary orientation. Here, we show that epidermal wound repair is regulated by PCP signaling. Mice carrying mutant alleles of PCP genes Vangl2, Celsr1, PTK7, and Scrb1, and the transcription factor Grhl3, interact genetically, exhibiting failed wound healing, neural tube defects, and disordered cochlear polarity. Using phylogenetic analysis, ChIP, and gene expression in Grhl3(-)(/-) mice, we identified RhoGEF19, a homolog of a RhoA activator involved in PCP signaling in Xenopus, as a direct target of GRHL3. Knockdown of Grhl3 or RhoGEF19 in keratinocytes induced defects in actin polymerization, cellular polarity, and wound healing, and re-expression of RhoGEF19 rescued these defects in Grhl3-kd cells. These results define a role for Grhl3 in PCP signaling and broadly implicate this pathway in epidermal repair. (c) 2010 Elsevier Inc. All rights reserved.

  9. Dynein and EFF-1 control dendrite morphology by regulating the localization pattern of SAX-7 in epidermal cells.

    Science.gov (United States)

    Zhu, Ting; Liang, Xing; Wang, Xiang-Ming; Shen, Kang

    2017-12-01

    Our previous work showed that the cell adhesion molecule SAX-7 forms an elaborate pattern in Caenorhabditis elegans epidermal cells, which instructs PVD dendrite branching. However, the molecular mechanism forming the SAX-7 pattern in the epidermis is not fully understood. Here, we report that the dynein light intermediate chain DLI-1 and the fusogen EFF-1 are required in epidermal cells to pattern SAX-7. While previous reports suggest that these two molecules act cell-autonomously in the PVD, our results show that the disorganized PVD dendritic arbors in these mutants are due to the abnormal SAX-7 localization patterns in epidermal cells. Three lines of evidence support this notion. First, the epidermal SAX-7 pattern was severely affected in dli-1 and eff-1 mutants. Second, the abnormal SAX-7 pattern was predictive of the ectopic PVD dendrites. Third, expression of DLI-1 or EFF-1 in the epidermis rescued both the SAX-7 pattern and the disorganized PVD dendrite phenotypes, whereas expression of these molecules in the PVD did not. We also show that DLI-1 functions cell-autonomously in the PVD to promote distal branch formation. These results demonstrate the unexpected roles of DLI-1 and EFF-1 in the epidermis in the control of PVD dendrite morphogenesis. © 2017. Published by The Company of Biologists Ltd.

  10. [Origins and selection of epidermal progenitors and stem cells: a challenge for tissue engineering].

    Science.gov (United States)

    Deshayes, Nathalie; Rathman-Josserand, Michelle

    2008-01-01

    The use of epidermal stem cells and their progeny for tissue engineering and cell therapy represents a source of hope and major interest in view of applications such as replacing the loss of functionality in failing tissues or obtaining physiologic skin equivalents for skin grafting. The use of such cells necessitates the isolation and purification of rare populations of keratinocytes and then increasing their numbers by mass culture. This is not currently possible since part of the specific phenotype of these cells is lost once the cells are placed in culture. Furthermore, few techniques are available to unequivocally detect the presence of skin stem cells and/or their progeny in culture and thus quantify them. Two different sources of stem cells are currently being studied for skin research and clinical applications: skin progenitors either obtained from embryonic stem cells (ESC) or from selection from adult skin tissue. It has been shown that "keratinocyte-like" cells can be derived from ESC; however, the culturing processes must still be optimized to allow for the mass culture of homogeneous populations at a controlled stage of differentiation. The functional characterization of such populations must also be more thoroughly achieved. In order to use stem cells from adult tissues, improvements must be made in order to obtain a satisfactory degree of purification and characterization of this rare population. Distinguishing stem cells from progenitor cells at the molecular level also remains a challenge. Furthermore, stem cell research inevitably requires cultivating these cells outside their physiological environment or niche. It will thus be necessary to better understand the impact of this specific environmental niche on the preservation of the cellular phenotypes of interest.

  11. HaCaT Keratinocytes and Primary Epidermal Keratinocytes Have Different Transcriptional Profiles of Cornified Envelope-Associated Genes to T Helper Cell Cytokines

    Science.gov (United States)

    Seo, Min-Duk; Kang, Tae Jin; Lee, Chang Hoon; Lee, Ai-Young; Noh, Minsoo

    2012-01-01

    HaCaT cells are the immortalized human keratinocytes and have been extensively used to study the epidermal homeostasis and its pathophysiology. T helper cells play a role in various chronic dermatological conditions and they can affect skin barrier homeostasis. To evaluate whether HaCaT cells can be used as a model cell system to study abnormal skin barrier development in various dermatologic diseases, we analyzed the gene expression profile of epidermal differentiation markers of HaCaT cells in response to major T helper (Th) cell cytokines, such as IFNγ, IL-4, IL-17A and IL-22. The gene transcriptional profile of cornified envelope-associated proteins, such as filaggrin, loricrin, involucrin and keratin 10 (KRT10), in HaCaT cells was generally different from that in normal human keratinocytes (NHKs). This suggests that HaCaT cells have a limitation as a model system to study the pathophysiological mechanism associated with the Th cell cytokine-dependent changes in cornified envelope-associated proteins which are essential for normal skin barrier development. In contrast, the gene transcription profile change of human β2-defensin (HBD2) in response to IFNγ, IL-4 or IL-17A in HaCaT cells was consistent with the expression pattern of NHKs. IFNγ also up-regulated transglutaminase 2 (TGM2) gene transcription in both HaCaT cells and NHKs. As an alternative cell culture system for NHKs, HaCaT cells can be used to study molecular mechanisms associated with abnormal HBD2 and TGM2 expression in response to IFNγ, IL-4 or IL-17A. PMID:24116291

  12. DEVELOPMENT OF PRIMARY CELL CULTURE FROM TAIL EPIDERMAL TISSUE OF KOI CARP (Cyprinus carpio koi

    Directory of Open Access Journals (Sweden)

    Lila Gardenia

    2014-06-01

    Full Text Available Primary cell culture from tail epidermal tissue of koi carp (Cyprinus carpio koi was developed. Cells were grown in Leibovits-15 medium supplemented with 20% fetal bovine serum and antibiotics (Penicillin/Streptomycin and Kanamycin. Cell growth was observed in a range of incubation temperature (17oC±2oC, 22oC±2oC, 27oC±2oC, and 32oC±2oC in order to determine the optimum temperature. The cells were able to grow at a range of temperature between 17oC to 32oC with optimal growth at 22oC. Primary cells infected with koi herpes virus produced typical cytopathic effects characterized by severe vacuolation and deformation of nuclei, which is consistent with those of previous reports. Artificial injection experiment by using supernatant koi herpes virus SKBM-1 isolate revealed that it could cause 90% mortality in infected fish within two weeks. PCR test with Sph I-5 specific primers carried out with DNA template from supernatant virus, pellet cell, and gills of infected fish showed positive results in all samples (molecular weight of DNA target 290 bp. The cells were found to be susceptible to koi herpes virus and can be used for virus propagation.

  13. The epidermal cell kinetic response to ultraviolet B irradiation combines regenerative proliferation and carcinogen associated cell cycle delay

    Energy Technology Data Exchange (ETDEWEB)

    Olsen, W.M.; Kirkhus, B. (Oslo Univ. (Norway))

    1989-09-01

    The cell cycle traverse of epidermal basal cells 24 h after in vivo exposure of ultraviolet B (UVB) irradiation was studied by immunochemical staining of incorporated bromodeoxyuridine (BrdU) and bivariate BrdU/DNA flow cytometric analysis. The results were compared with the cell kinetic patterns following topical application of the skin carcinogen methylnitrosourea (MNU) as well as the skin irritant cantharidin. The cell cycle traverse in hairless mouse epidermis 24 h after in vivo exposure to UVB seemed to be a combination of the cell kinetic effects following chemical skin carcinogens and skin irritants. UVB irradiation induced both a delay in transit time through S phase, probably due to DNA damage and subsequent repair, as well as a reduction in the total cell cycle time consistent with rapid regenerative proliferation. (author).

  14. Effects of icotinib, a novel epidermal growth factor receptor tyrosine kinase inhibitor, in EGFR-mutated non-small cell lung cancer.

    Science.gov (United States)

    Yang, Guangdie; Yao, Yinan; Zhou, Jianya; Zhao, Qiong

    2012-06-01

    Epidermal growth factor receptor (EGFR) is one of the most promising targets for non-small cell lung cancer (NSCLC). Our study demonstrated the antitumor effects of icotinib hydrochloride, a highly selective epidermal growth factor receptor tyrosine kinase inhibitor (EGFR TKI), in two EGFR-mutated lung cancer cell lines compared to A549, a cell line without EGFR mutations. We incubated PC-9 and HCC827 human lung cancer cell lines both with (E746-A750) mutations with various concentrations of icotinib and gefitinib for 48 h. Cell proliferation and migration were determined using a real-time cell invasion and migration assay and cytotoxicity assay. Apoptosis was assessed by measuring Annexin V staining using flow cytometry. The antitumor effects of icotinib compared to gefitinib were similar and were most effective in reducing the proliferation of EGFR-mutated cells compared to non-mutated controls. Our results suggest the possibility of icotinib as a new therapeutic agent of EGFR-mutated cancer cells, which has the potential to be used in the first-line treatment of EGFR-mutated NSCLC.

  15. Morphology and dynamics of tumor cell colonies propagating in epidermal growth factor supplemented media

    Science.gov (United States)

    Muzzio, N. E.; Carballido, M.; Pasquale, M. A.; González, P. H.; Azzaroni, O.; Arvia, A. J.

    2018-07-01

    The epidermal growth factor (EGF) plays a key role in physiological and pathological processes. This work reports on the influence of EGF concentration (c EGF) on the modulation of individual cell phenotype and cell colony kinetics with the aim of perturbing the colony front roughness fluctuations. For this purpose, HeLa cell colonies that remain confluent along the whole expansion process with initial quasi-radial geometry and different initial cell populations, as well as colonies with initial quasi-linear geometry and large cell population, are employed. Cell size and morphology as well as its adhesive characteristics depend on c EGF. Quasi-radial colonies (QRC) expansion kinetics in EGF-containing medium exhibits a complex behavior. Namely, at the first stages of growth, the average QRC radius evolution can be described by a t 1/2 diffusion term coupled with exponential growth kinetics up to a critical time, and afterwards a growth regime approaching constant velocity. The extension of each regime depends on c EGF and colony history. In the presence of EGF, the initial expansion of quasi-linear colonies (QLCs) also exhibits morphological changes at both the cell and the colony levels. In these cases, the cell density at the colony border region becomes smaller than in the absence of EGF and consequently, the extension of the effective rim where cell duplication and motility contribute to the colony expansion increases. QLC front displacement velocity increases with c EGF up to a maximum value in the 2–10 ng ml‑1 range. Individual cell velocity is increased by EGF, and an enhancement in both the persistence and the ballistic characteristics of cell trajectories can be distinguished. For an intermediate c EGF, collective cell displacements contribute to the roughening of the colony contours. This global dynamics becomes compatible with the standard Kardar–Parisi–Zhang growth model, although a faster colony roughness saturation in EGF-containing medium

  16. E-cadherin homophilic ligation inhibits cell growth and epidermal growth factor receptor signaling independently of other cell interactions

    DEFF Research Database (Denmark)

    Perrais, Michaël; Chen, Xiao; Perez-Moreno, Mirna

    2007-01-01

    growth inhibitory signals. To address this question, we have selectively formed E-cadherin homophilic bonds at the cell surface of isolated epithelial cells by using functionally active recombinant E-cadherin protein attached to microspheres. We find that E-cadherin ligation alone reduces the frequency...... of cells entering the S phase, demonstrating that E-cadherin ligation directly transduces growth inhibitory signals. E-cadherin binding to beta-catenin is required for cell growth inhibition, but beta-catenin/T-cell factor transcriptional activity is not involved in growth inhibition resulting from...... homophilic binding. Neither E-cadherin binding to p120-catenin nor beta-catenin binding to alpha-catenin, and thereby the actin cytoskeleton, is required for growth inhibition. E-cadherin ligation also inhibits epidermal growth factor (EGF) receptor-mediated growth signaling by a beta...

  17. Characterization of the epidermal growth factor receptor associated with cytoskeletons of A431 cells

    International Nuclear Information System (INIS)

    Roy, L.M.; Gittinger, C.K.; Landreth, G.E.

    1989-01-01

    Epidermal growth factor receptors (EGF-R) have been shown to be associated with the detergent-insoluble cytoskeleton of A431 cells, where they retained both a functional ligand-binding domain and tyrosine kinase activity. In the present study we have characterized the tyrosine kinase and ligand binding activities of this cytoskeletally associated EGF-R. The tyrosine kinase activity of the cytoskeletally associated EGF-R was stimulated by EGF treatment of intact cells as evidenced by increased autophosphorylation and phosphorylation of the exogenous substrate angiotensin II (AII). The kinetic behavior of the EGF-R associated with cytoskeletons of EGF-treated cells was similar to that of purified receptors. The stimulation of the receptor kinase activity required EGF treatment of intact cells prior to Triton extraction. If cytoskeletons were prepared from untreated cells and then incubated with EGF, there was no stimulation of the detergent-insoluble receptor kinase activity, indicating that the immobilized receptor was unable to undergo EGF-stimulated activation. Comparison of peptide maps from soluble and cytoskeletally associated EGF-R revealed qualitatively similar patterns; however, they are distinguished by a prominent 46 kD band in digests of the cytoskeletal EGF-R. Saturable binding of 125I-EGF to A431 cytoskeletons prepared from adherent and suspended cells demonstrated the presence of specific receptors on the cytoskeleton. High-affinity EGF-R were preferentially retained upon detergent extraction of adherent cells, whereas both low- and high-affinity receptors were solubilized from the cytoskeletons of suspended cells. Suspension of cells resulted in the solubilization of an additional 15% of the EGF-R to that solubilized in adherent cells, indicating that EGF-R can reversibly associate with the structural elements of the cell

  18. Amnioserosa cell constriction but not epidermal actin cable tension autonomously drives dorsal closure.

    Science.gov (United States)

    Pasakarnis, Laurynas; Frei, Erich; Caussinus, Emmanuel; Affolter, Markus; Brunner, Damian

    2016-11-01

    Tissue morphogenesis requires coordination of multiple force-producing components. During dorsal closure in fly embryogenesis, an epidermis opening closes. A tensioned epidermal actin/MyosinII cable, which surrounds the opening, produces a force that is thought to combine with another MyosinII force mediating apical constriction of the amnioserosa cells that fill the opening. A model proposing that each force could autonomously drive dorsal closure was recently challenged by a model in which the two forces combine in a ratchet mechanism. Acute force elimination via selective MyosinII depletion in one or the other tissue shows that the amnioserosa tissue autonomously drives dorsal closure while the actin/MyosinII cable cannot. These findings exclude both previous models, although a contribution of the ratchet mechanism at dorsal closure onset remains likely. This shifts the current view of dorsal closure being a combinatorial force-component system to a single tissue-driven closure event.

  19. Development of an affinity-matured humanized anti-epidermal growth factor receptor antibody for cancer immunotherapy.

    Science.gov (United States)

    Nakanishi, Takeshi; Maru, Takamitsu; Tahara, Kazuhiro; Sanada, Hideaki; Umetsu, Mitsuo; Asano, Ryutaro; Kumagai, Izumi

    2013-02-01

    We showed previously that humanization of 528, a murine anti-epidermal growth factor receptor (EGFR) antibody, causes reduced affinity for its target. Here, to improve the affinity of the humanized antibody for use in cancer immunotherapy, we constructed phage display libraries focused on the complementarity-determining regions (CDRs) of the antibody and carried out affinity selection. Two-step selections using libraries constructed in a stepwise manner enabled a 32-fold affinity enhancement of humanized 528 (h528). Thermodynamic analysis of the interactions between the variable domain fragment of h528 (h528Fv) mutants and the soluble extracellular domain of EGFR indicated that the h528Fv mutants obtained from the first selection showed a large increase in negative enthalpy change due to binding, resulting in affinity enhancement. Furthermore, mutants from the second selection showed a decrease in entropy loss, which led to further affinity maturation. These results suggest that a single mutation in the heavy chain variable domain (i.e. Tyr(52) to Trp) enthalpically contributed for overcoming the energetic barrier to the antigen-antibody interaction, which was a major hurdle for the in vitro affinity maturation of h528. We reported previously that the humanized bispecific diabody hEx3 Db, which targets EGFR and CD3, shows strong anti-tumor activity. hEx3 Db mutants, in which the variable domains of h528 were replaced with those of the affinity-enhanced mutants, were prepared and characterized. In a growth inhibition assay of tumor cells, the hEx3 Db mutants showed stronger anti-tumor activity than that of hEx3 Db, suggesting that affinity enhancement of h528Fv enhances the anti-tumor activity of the bispecific diabody.

  20. Radiolabeled cetuximab: dose optimization for epidermal growth factor receptor imaging in a head-and-neck squamous cell carcinoma model

    NARCIS (Netherlands)

    Hoeben, B.A.W.; Molkenboer-Kuenen, J.D.M.; Oyen, W.J.G.; Peeters, W.J.M.; Kaanders, J.H.A.M.; Bussink, J.; Boerman, O.C.

    2011-01-01

    Noninvasive imaging of the epidermal growth factor receptor (EGFR) in head-and-neck squamous cell carcinoma could be of value to select patients for EGFR-targeted therapy. We assessed dose optimization of (111) Indium-DTPA-cetuximab ((111) In-cetuximab) for EGFR imaging in a head-and-neck squamous

  1. Expression of PML tumor suppressor in A 431 cells reduces cellular growth by inhibiting the epidermal growth factor receptor expression

    International Nuclear Information System (INIS)

    Vallian, S.; Chang, K.S.

    2004-01-01

    Our previous studies showed that the promyelocytic leukemia, PML, protein functions as a cellular and growth suppressor. Transient expression of PML was also found to repress the activity of the epidermal growth factor receptor gene promoter. In this study we have examined the effects of PML on A431 cells, which express a high level of + protein. The PML gene was introduced into the cells using the adenovirus-mediated gene transfer system. Western blot analysis on the extracts from the cells expressing PML showed a significant repression in the expression of the epidermal growth factor receptor protein. The cells were examined for growth and DNA synthesis. The data showed a marked reduction in both growth and DNA synthesis rate in the cells expressing PML compared with the control cells. Furthermore, in comparison with the controls, the cells expressing PML were found to be more in G1 phase, fewer in S and about the same number in the G2/M phase. This data clearly demonstrated that the repression of epidermal growth factor receptor expression in A 431 cells by PML was associated with inhibition of cell growth and alteration of the cell cycle distribution, suggesting a novel mechanism for the known growth inhibitory effects of PML

  2. Trafficking through COPII stabilises cell polarity and drives secretion during Drosophila epidermal differentiation.

    Directory of Open Access Journals (Sweden)

    Michaela Norum

    2010-05-01

    Full Text Available The differentiation of an extracellular matrix (ECM at the apical side of epithelial cells implies massive polarised secretion and membrane trafficking. An epithelial cell is hence engaged in coordinating secretion and cell polarity for a correct and efficient ECM formation.We are studying the molecular mechanisms that Drosophila tracheal and epidermal cells deploy to form their specific apical ECM during differentiation. In this work we demonstrate that the two genetically identified factors haunted and ghost are essential for polarity maintenance, membrane topology as well as for secretion of the tracheal luminal matrix and the cuticle. We show that they code for the Drosophila COPII vesicle-coating components Sec23 and Sec24, respectively, that organise vesicle transport from the ER to the Golgi apparatus.Taken together, epithelial differentiation during Drosophila embryogenesis is a concerted action of ECM formation, plasma membrane remodelling and maintenance of cell polarity that all three rely mainly, if not absolutely, on the canonical secretory pathway from the ER over the Golgi apparatus to the plasma membrane. Our results indicate that COPII vesicles constitute a central hub for these processes.

  3. EPIDERMAL GROWTH FACTOR RECEPTOR (EGFR AND HUMAN PAPILLOMAVIRUS (HPV L1 CAPSID PROTEIN IN CERVICAL SQUAMOUS INTRAEPITHELIAL LESIONS

    Directory of Open Access Journals (Sweden)

    Balan Raluca

    2010-09-01

    Full Text Available We analyzed the immunohistochemical pattern of epidermal growth factor receptor (EGFR in cervical squamous intraepithelial lesions (SILs in correlation with L1 HPV capsid protein, in order to determine the relationship between EGFR expression and the infection status of human papillomavirus (HPV. The study included 40 cases, 24 LSIL (low grade SIL (CIN1, cervical intraepithelial neoplasia and 16 HSIL (high grade SIL (6 cases of CIN2 and 10 cases of CIN3. The immunoexpression of L1 HPV protein was assessed on conventional cervico-vaginal smears and EGFR was immunohistochemically evaluated on the corresponding cervical biopsies. The HPV L1 capsid protein was expressed in 45.83% of LSIL and 25% of HSIL. EGFR was overexpressed in 62,4% of HSIL (58,4% CIN2 and 41,6% CIN3 and 37,6% LSIL. The immunoexpression of L1 HPV has clinical application in the progression assessment of the cervical precancerous lesions without a correlation to the grade of the cervical SIL. EGFR is expressed by all proliferating squamous epithelial cells, thus corresponding with the grade of SIL. The evaluation of EGFR status, correlated with L1 HPV protein expression, can provide useful data of progression risk of cervical squamous intraepithelial lesions

  4. Human epidermal growth factor receptor2 expression in unresectable gastric cancers: Relationship with CT characteristics

    Energy Technology Data Exchange (ETDEWEB)

    Lee, Jeong Sub [Dept. of Radiology, Jeju National University Hospital, Jeju (Korea, Republic of); Kim, Se Hyung; Im, Seock Ah; Kim, Min A; Han, Joon Koo [Seoul National University Hospital, Seoul (Korea, Republic of)

    2017-09-15

    To retrospectively analyze the qualitative CT features that correlate with human epidermal growth factor receptor 2 (HER2)-expression in pathologically-proven gastric cancers. A total of 181 patients with pathologically-proven unresectable gastric cancers with HER2-expression (HER2-positive [n = 32] and negative [n = 149]) were included. CT features of primary gastric and metastatic tumors were reviewed. The prevalence of each CT finding was compared in both groups. Thereafter, binary logistic regression determined the most significant differential CT features. Clinical outcomes were compared using Kaplan-Meier method. HER2-postive cancers showed lower clinical T stage (21.9% vs. 8.1%; p = 0.015), hyperattenuation on portal phase (62.5% vs. 30.9%; p = 0.003), and was more frequently metastasized to the liver (62.5% vs. 32.2%; p = 0.001), than HER2-negative cancers. On binary regression analysis, hyperattenuation of the tumor (odds ratio [OR], 4.68; p < 0.001) and hepatic metastasis (OR, 4.43; p = 0.001) were significant independent factors that predict HER2-positive cancers. Median survival of HER2-positive cancers (13.7 months) was significantly longer than HER2-negative cancers (9.6 months) (p = 0.035). HER2-positive gastric cancers show less-advanced T stage, hyperattenuation on the portal phase, and frequently metastasize to the liver, as compared to HER2-negative cancers.

  5. Human epidermal growth factor receptor2 expression in unresectable gastric cancers: Relationship with CT characteristics

    International Nuclear Information System (INIS)

    Lee, Jeong Sub; Kim, Se Hyung; Im, Seock Ah; Kim, Min A; Han, Joon Koo

    2017-01-01

    To retrospectively analyze the qualitative CT features that correlate with human epidermal growth factor receptor 2 (HER2)-expression in pathologically-proven gastric cancers. A total of 181 patients with pathologically-proven unresectable gastric cancers with HER2-expression (HER2-positive [n = 32] and negative [n = 149]) were included. CT features of primary gastric and metastatic tumors were reviewed. The prevalence of each CT finding was compared in both groups. Thereafter, binary logistic regression determined the most significant differential CT features. Clinical outcomes were compared using Kaplan-Meier method. HER2-postive cancers showed lower clinical T stage (21.9% vs. 8.1%; p = 0.015), hyperattenuation on portal phase (62.5% vs. 30.9%; p = 0.003), and was more frequently metastasized to the liver (62.5% vs. 32.2%; p = 0.001), than HER2-negative cancers. On binary regression analysis, hyperattenuation of the tumor (odds ratio [OR], 4.68; p < 0.001) and hepatic metastasis (OR, 4.43; p = 0.001) were significant independent factors that predict HER2-positive cancers. Median survival of HER2-positive cancers (13.7 months) was significantly longer than HER2-negative cancers (9.6 months) (p = 0.035). HER2-positive gastric cancers show less-advanced T stage, hyperattenuation on the portal phase, and frequently metastasize to the liver, as compared to HER2-negative cancers

  6. Brain metastasis in human epidermal growth factor receptor 2-positive breast cancer: from biology to treatment

    Energy Technology Data Exchange (ETDEWEB)

    Koo, Tae Ryool [Dept. of Radiation Oncology, Hallym University Chuncheon Sacred Heart Hospital, Chuncheon (Korea, Republic of); Kim, In Ah [Dept. of Radiation Oncology, Seoul National University Bundang Hospital, Seongnam (Korea, Republic of)

    2016-03-15

    Overexpression of human epidermal growth factor receptor 2 (HER2) is found in about 20% of breast cancer patients. With treatment using trastuzumab, an anti-HER2 monoclonal antibody, systemic control is improved. Nonetheless, the incidence of brain metastasis does not be improved, rather seems to be increased in HER2-positive breast cancer. The mainstay treatment for brain metastases is radiotherapy. According to the number of metastatic lesions and performance status of patients, radiosurgery or whole brain radiotherapy can be performed. The concurrent use of a radiosensitizer further improves intracranial control. Due to its large molecular weight, trastuzumab has a limited ability to cross the blood-brain barrier. However, small tyrosine kinase inhibitors such as lapatinib, has been noted to be a promising agent that can be used as a radiosensitizer to affect HER2-positive breast cancer. This review will outline general management of brain metastases and will focus on preclinical findings regarding the radiosensitizing effect of small molecule HER2 targeting agents.

  7. In vitro transformation of primary cultures of neonatal BALB/c mouse epidermal cells with ultraviolet-B radiation

    International Nuclear Information System (INIS)

    Ananthaswamy, H.N.; Kripke, M.L.

    1981-01-01

    Primary epidermal cultures from neonatal BALB/c mice were used to study the carcinogenic effects of ultraviolet radiation in vitro. These cultures were irradiated once through a Falcon plastic dish cover with an FS40 sunlamp [ultraviolet B, lambda approximately 290 to 400 nm] for various lengths of time and maintained for 8 to 12 weeks without subculturing. During this period, most of the cells in the untreated control showed signs of morphological differentiation and eventually died. The cultures irradiated with ultraviolet B radiation also behaved in the same manner except that, in some dishes, small populations of surviving cells began to proliferate and developed into morphologically distinct foci. Seven long-term cell lines were derived from these ultraviolet-irradiated primary epidermal cell cultures. Six of these cell lines produced tumors when injected s.c. into normal and/or immunosuppressed syngeneic recipients. These tumorigenic cell lines lacked definitive characteristics of differentiated epidermal cells, but the cells possessed intermediate junctions, suggesting that they were of epithelial origin. Some of these in vitro-transformed cell lines appeared to be highly antigenic inasmuch as they grew preferentially in immunosuppressed BALB/c mice as compared to their growth in normal syngeneic recipients

  8. Sphingosine-1-phosphate mediates epidermal growth factor-induced muscle satellite cell activation

    Energy Technology Data Exchange (ETDEWEB)

    Nagata, Yosuke, E-mail: cynagata@mail.ecc.u-tokyo.ac.jp; Ohashi, Kazuya; Wada, Eiji; Yuasa, Yuki; Shiozuka, Masataka; Nonomura, Yoshiaki; Matsuda, Ryoichi

    2014-08-01

    Skeletal muscle can regenerate repeatedly due to the presence of resident stem cells, called satellite cells. Because satellite cells are usually quiescent, they must be activated before participating in muscle regeneration in response to stimuli such as injury, overloading, and stretch. Although satellite cell activation is a crucial step in muscle regeneration, little is known of the molecular mechanisms controlling this process. Recent work showed that the bioactive lipid sphingosine-1-phosphate (S1P) plays crucial roles in the activation, proliferation, and differentiation of muscle satellite cells. We investigated the role of growth factors in S1P-mediated satellite cell activation. We found that epidermal growth factor (EGF) in combination with insulin induced proliferation of quiescent undifferentiated mouse myoblast C2C12 cells, which are also known as reserve cells, in serum-free conditions. Sphingosine kinase activity increased when reserve cells were stimulated with EGF. Treatment of reserve cells with the D-erythro-N,N-dimethylsphingosine, Sphingosine Kinase Inhibitor, or siRNA duplexes specific for sphingosine kinase 1, suppressed EGF-induced C2C12 activation. We also present the evidence showing the S1P receptor S1P2 is involved in EGF-induced reserve cell activation. Moreover, we demonstrated a combination of insulin and EGF promoted activation of satellite cells on single myofibers in a manner dependent on SPHK and S1P2. Taken together, our observations show that EGF-induced satellite cell activation is mediated by S1P and its receptor. - Highlights: • EGF in combination with insulin induces proliferation of quiescent C2C12 cells. • Sphingosine kinase activity increases when reserve cells are stimulated with EGF. • EGF-induced activation of reserve cells is dependent on sphingosine kinase and ERK. • The S1P receptor S1P2 is involved in EGF-induced reserve cell activation. • EGF-induced reserve cell activation is mediated by S1P and its

  9. Sphingosine-1-phosphate mediates epidermal growth factor-induced muscle satellite cell activation

    International Nuclear Information System (INIS)

    Nagata, Yosuke; Ohashi, Kazuya; Wada, Eiji; Yuasa, Yuki; Shiozuka, Masataka; Nonomura, Yoshiaki; Matsuda, Ryoichi

    2014-01-01

    Skeletal muscle can regenerate repeatedly due to the presence of resident stem cells, called satellite cells. Because satellite cells are usually quiescent, they must be activated before participating in muscle regeneration in response to stimuli such as injury, overloading, and stretch. Although satellite cell activation is a crucial step in muscle regeneration, little is known of the molecular mechanisms controlling this process. Recent work showed that the bioactive lipid sphingosine-1-phosphate (S1P) plays crucial roles in the activation, proliferation, and differentiation of muscle satellite cells. We investigated the role of growth factors in S1P-mediated satellite cell activation. We found that epidermal growth factor (EGF) in combination with insulin induced proliferation of quiescent undifferentiated mouse myoblast C2C12 cells, which are also known as reserve cells, in serum-free conditions. Sphingosine kinase activity increased when reserve cells were stimulated with EGF. Treatment of reserve cells with the D-erythro-N,N-dimethylsphingosine, Sphingosine Kinase Inhibitor, or siRNA duplexes specific for sphingosine kinase 1, suppressed EGF-induced C2C12 activation. We also present the evidence showing the S1P receptor S1P2 is involved in EGF-induced reserve cell activation. Moreover, we demonstrated a combination of insulin and EGF promoted activation of satellite cells on single myofibers in a manner dependent on SPHK and S1P2. Taken together, our observations show that EGF-induced satellite cell activation is mediated by S1P and its receptor. - Highlights: • EGF in combination with insulin induces proliferation of quiescent C2C12 cells. • Sphingosine kinase activity increases when reserve cells are stimulated with EGF. • EGF-induced activation of reserve cells is dependent on sphingosine kinase and ERK. • The S1P receptor S1P2 is involved in EGF-induced reserve cell activation. • EGF-induced reserve cell activation is mediated by S1P and its

  10. Making Epidermal Bladder Cells Bigger: Developmental- and Salinity-Induced Endopolyploidy in a Model Halophyte.

    Science.gov (United States)

    Barkla, Bronwyn J; Rhodes, Timothy; Tran, Kieu-Nga T; Wijesinghege, Chathura; Larkin, John C; Dassanayake, Maheshi

    2018-06-01

    Endopolyploidy occurs when DNA replication takes place without subsequent mitotic nuclear division, resulting in cell-specific ploidy levels within tissues. In plants, endopolyploidy plays an important role in sustaining growth and development, but only a few studies have demonstrated a role in abiotic stress response. In this study, we investigated the function of ploidy level and nuclear and cell size in leaf expansion throughout development and tracked cell type-specific ploidy in the halophyte Mesembryanthemum crystallinum In addition to developmental endopolyploidy, we examined the effects of salinity stress on ploidy level. We focused specifically on epidermal bladder cells (EBC), which are modified balloon-like trichomes, due to their large size and role in salt accumulation. Our results demonstrate that ploidy increases as the leaves expand in a similar manner for each leaf type, and ploidy levels up to 512C were recorded for nuclei in EBC of leaves of adult plants. Salt treatment led to a significant increase in ploidy levels in the EBC, and these cells showed spatially related differences in their ploidy and nuclear and cell size depending on the positions on the leaf and stem surface. Transcriptome analysis highlighted salinity-induced changes in genes involved in DNA replication, cell cycle, endoreduplication, and trichome development in EBC. The increase in cell size and ploidy observed in M. crystallinum under salinity stress may contribute to salt tolerance by increasing the storage capacity for sodium sequestration brought about by higher metabolic activity driving rapid cell enlargement in the leaf tissue and EBC. © 2018 American Society of Plant Biologists. All rights reserved.

  11. Effects of epidermal growth factor receptor kinase inhibition on radiation response in canine osteosarcoma cells.

    Science.gov (United States)

    Mantovani, Fernanda B; Morrison, Jodi A; Mutsaers, Anthony J

    2016-05-31

    Radiation therapy is a palliative treatment modality for canine osteosarcoma, with transient improvement in analgesia observed in many cases. However there is room for improvement in outcome for these patients. It is possible that the addition of sensitizing agents may increase tumor response to radiation therapy and prolong quality of life. Epidermal growth factor receptor (EGFR) expression has been documented in canine osteosarcoma and higher EGFR levels have been correlated to a worse prognosis. However, effects of EGFR inhibition on radiation responsiveness in canine osteosarcoma have not been previously characterized. This study examined the effects of the small molecule EGFR inhibitor erlotinib on canine osteosarcoma radiation responses, target and downstream protein expression in vitro. Additionally, to assess the potential impact of treatment on tumor angiogenesis, vascular endothelial growth factor (VEGF) levels in conditioned media were measured. Erlotinib as a single agent reduced clonogenic survival in two canine osteosarcoma cell lines and enhanced the impact of radiation in one out of three cell lines investigated. In cell viability assays, erlotinib enhanced radiation effects and demonstrated single agent effects. Erlotinib did not alter total levels of EGFR, nor inhibit downstream protein kinase B (PKB/Akt) activation. On the contrary, erlotinib treatment increased phosphorylated Akt in these osteosarcoma cell lines. VEGF levels in conditioned media increased after erlotinib treatment as a single agent and in combination with radiation in two out of three cell lines investigated. However, VEGF levels decreased with erlotinib treatment in the third cell line. Erlotinib treatment promoted modest enhancement of radiation effects in canine osteosarcoma cells, and possessed activity as a single agent in some cell lines, indicating a potential role for EGFR inhibition in the treatment of a subset of osteosarcoma patients. The relative radioresistance of

  12. Role of protein kinase C and epidermal growth factor receptor signalling in growth stimulation by neurotensin in colon carcinoma cells

    Directory of Open Access Journals (Sweden)

    Dajani Olav

    2011-10-01

    Full Text Available Abstract Background Neurotensin has been found to promote colon carcinogenesis in rats and mice, and proliferation of human colon carcinoma cell lines, but the mechanisms involved are not clear. We have examined signalling pathways activated by neurotensin in colorectal and pancreatic carcinoma cells. Methods Colon carcinoma cell lines HCT116 and HT29 and pancreatic adenocarcinoma cell line Panc-1 were cultured and stimulated with neurotensin or epidermal growth factor (EGF. DNA synthesis was determined by incorporation of radiolabelled thymidine into DNA. Levels and phosphorylation of proteins in signalling pathways were assessed by Western blotting. Results Neurotensin stimulated the phosphorylation of both extracellular signal-regulated kinase (ERK and Akt in all three cell lines, but apparently did so through different pathways. In Panc-1 cells, neurotensin-induced phosphorylation of ERK, but not Akt, was dependent on protein kinase C (PKC, whereas an inhibitor of the β-isoform of phosphoinositide 3-kinase (PI3K, TGX221, abolished neurotensin-induced Akt phosphorylation in these cells, and there was no evidence of EGF receptor (EGFR transactivation. In HT29 cells, in contrast, the EGFR tyrosine kinase inhibitor gefitinib blocked neurotensin-stimulated phosphorylation of both ERK and Akt, indicating transactivation of EGFR, independently of PKC. In HCT116 cells, neurotensin induced both a PKC-dependent phosphorylation of ERK and a metalloproteinase-mediated transactivation of EGFR that was associated with a gefitinib-sensitive phosphorylation of the downstream adaptor protein Shc. The activation of Akt was also inhibited by gefitinib, but only partly, suggesting a mechanism in addition to EGFR transactivation. Inhibition of PKC blocked neurotensin-induced DNA synthesis in HCT116 cells. Conclusions While acting predominantly through PKC in Panc-1 cells and via EGFR transactivation in HT29 cells, neurotensin used both these pathways in HCT116

  13. Role of protein kinase C and epidermal growth factor receptor signalling in growth stimulation by neurotensin in colon carcinoma cells

    International Nuclear Information System (INIS)

    Müller, Kristin M; Tveteraas, Ingun H; Aasrum, Monica; Ødegård, John; Dawood, Mona; Dajani, Olav; Christoffersen, Thoralf; Sandnes, Dagny L

    2011-01-01

    Neurotensin has been found to promote colon carcinogenesis in rats and mice, and proliferation of human colon carcinoma cell lines, but the mechanisms involved are not clear. We have examined signalling pathways activated by neurotensin in colorectal and pancreatic carcinoma cells. Colon carcinoma cell lines HCT116 and HT29 and pancreatic adenocarcinoma cell line Panc-1 were cultured and stimulated with neurotensin or epidermal growth factor (EGF). DNA synthesis was determined by incorporation of radiolabelled thymidine into DNA. Levels and phosphorylation of proteins in signalling pathways were assessed by Western blotting. Neurotensin stimulated the phosphorylation of both extracellular signal-regulated kinase (ERK) and Akt in all three cell lines, but apparently did so through different pathways. In Panc-1 cells, neurotensin-induced phosphorylation of ERK, but not Akt, was dependent on protein kinase C (PKC), whereas an inhibitor of the β-isoform of phosphoinositide 3-kinase (PI3K), TGX221, abolished neurotensin-induced Akt phosphorylation in these cells, and there was no evidence of EGF receptor (EGFR) transactivation. In HT29 cells, in contrast, the EGFR tyrosine kinase inhibitor gefitinib blocked neurotensin-stimulated phosphorylation of both ERK and Akt, indicating transactivation of EGFR, independently of PKC. In HCT116 cells, neurotensin induced both a PKC-dependent phosphorylation of ERK and a metalloproteinase-mediated transactivation of EGFR that was associated with a gefitinib-sensitive phosphorylation of the downstream adaptor protein Shc. The activation of Akt was also inhibited by gefitinib, but only partly, suggesting a mechanism in addition to EGFR transactivation. Inhibition of PKC blocked neurotensin-induced DNA synthesis in HCT116 cells. While acting predominantly through PKC in Panc-1 cells and via EGFR transactivation in HT29 cells, neurotensin used both these pathways in HCT116 cells. In these cells, neurotensin-induced activation of ERK

  14. The effect of wound dressings on a bio-engineered human dermo-epidermal skin substitute in a rat model

    OpenAIRE

    Hüging, Martina; Biedermann, Thomas; Sobrio, Monia; Meyer, Sarah; Böttcher-Haberzeth, Sophie; Manuel, Edith; Horst, Maya; Hynes, Sally; Reichmann, Ernst; Schiestl, Clemens; Hartmann-Fritsch, Fabienne

    2017-01-01

    Autologous bio-engineered dermo-epidermal skin substitutes are a promising treatment for large skin defects such as burns. For their successful clinical application, the graft dressing must protect and support the keratinocyte layer and, in many cases, possess antimicrobial properties. However, silver in many antimicrobial dressings may inhibit keratinocyte growth and differentiation. The purpose of our study is to evaluate the effect of various wound dressings on the healing of a human hydro...

  15. Modulation of cultured porcine granulosa cell responsiveness to follicle stimulating hormone and epidermal growth factor

    Energy Technology Data Exchange (ETDEWEB)

    Buck, P.A.

    1986-01-01

    Ovarian follicular development is dependent upon the coordinated growth and differentiation of the granulosa cells which line the follicle. Follicle stimulating hormone (FSH) induces granulosa cell differentiation both in vivo and in vitro. Epidermal growth factor (EGF) stimulates granulosa cell proliferation in vitro. The interaction of these two effectors upon selected parameters of growth and differentiation was examined in monolayer cultures of porcine granulose cells. Analysis of the EGF receptor by /sup 125/I-EGF binding revealed that the receptor was of high affinity with an apparent dissociation constant of 4-6 x 10/sup -10/ M. The average number of receptors per cell varied with the state of differentiation both in vivo and in vitro; highly differentiated cells bound two-fold less /sup 125/I-EGF and this effect was at least partially induced by FSH in vitro. EGF receptor function was examined by assessing EGF effects on cell number and /sup 3/H-thymidine incorporation. EGF stimulated thymidine incorporation in both serum-free and serum-supplemented culture, but only in serum-supplemented conditions was cell number increased. EGF receptor function was inversely related to the state of differentiation and was attenuated by FSH. The FSH receptor was examined by /sup 125/I-FSH binding. EGF increased FSH receptor number, and lowered the affinity of the receptor. The function of these receptors was assessed by /sup 125/I-hCG binding and progesterone radioimmunoassay. If EGF was present continuously in the cultures. FSH receptor function was attenuated regardless of FSH receptor number. A preliminary effort to examine the mechanism of this interaction was performed by analyzing hormonally controlled protein synthesis with /sup 35/S-methionine labeling, SDS polyacrylamide gel electrophoresis and fluorography. FSH promoted the expression of a 27,000 dalton protein. This effect was attenuated by EGF.

  16. Amlexanox Blocks the Interaction between S100A4 and Epidermal Growth Factor and Inhibits Cell Proliferation.

    Directory of Open Access Journals (Sweden)

    Ching Chang Cho

    Full Text Available The human S100A4 protein binds calcium, resulting in a change in its conformation to promote the interaction with its target protein. Human epidermal growth factor (EGF is the target protein of S100A4 and a critical ligand of the receptor EGFR. The EGF/EGFR system promotes cell survival, differentiation, and growth by activating several signaling pathways. Amlexanox is an anti-inflammatory and anti-allergic drug that is used to treat recurrent aphthous ulcers. In the present study, we determined that amlexanox interacts with S100A4 using heteronuclear single quantum correlation titration. We elucidated the interactions of S100A4 with EGF and amlexanox using fluorescence and nuclear magnetic resonance spectroscopy. We generated two binary models (for the S100A4-EGF and S100A4-amlexanox complexes and observed that amlexanox and EGF share a similar binding region in mS100A4. We also used a WST-1 assay to investigate the bioactivity of S100A4, EGF, and amlexanox, and found that amlexanox blocks the binding between S100A4 and EGF, and is therefore useful for the development of new anti-proliferation drugs.

  17. Rapid and dynamic subcellular reorganization following mechanical stimulation of Arabidopsis epidermal cells mimics responses to fungal and oomycete attack

    Directory of Open Access Journals (Sweden)

    Takemoto Daigo

    2008-06-01

    Full Text Available Abstract Background Plant cells respond to the presence of potential fungal or oomycete pathogens by mounting a basal defence response that involves aggregation of cytoplasm, reorganization of cytoskeletal, endomembrane and other cell components and development of cell wall appositions beneath the infection site. This response is induced by non-adapted, avirulent and virulent pathogens alike, and in the majority of cases achieves penetration resistance against the microorganism on the plant surface. To explore the nature of signals that trigger this subcellular response and to determine the timing of its induction, we have monitored the reorganization of GFP-tagged actin, microtubules, endoplasmic reticulum (ER and peroxisomes in Arabidopsis plants – after touching the epidermal surface with a microneedle. Results Within 3 to 5 minutes of touching the surface of Arabidopsis cotyledon epidermal cells with fine glass or tungsten needles, actin microfilaments, ER and peroxisomes began to accumulate beneath the point of contact with the needle. Formation of a dense patch of actin was followed by focusing of actin cables on the site of contact. Touching the cell surface induced localized depolymerization of microtubules to form a microtubule-depleted zone surrounding a dense patch of GFP-tubulin beneath the needle tip. The concentration of actin, GFP-tubulin, ER and peroxisomes remained focused on the contact site as the needle moved across the cell surface and quickly dispersed when the needle was removed. Conclusion Our results show that plant cells can detect the gentle pressure of a microneedle on the epidermal cell surface and respond by reorganizing subcellular components in a manner similar to that induced during attack by potential fungal or oomycete pathogens. The results of our study indicate that during plant-pathogen interactions, the basal defence response may be induced by the plant's perception of the physical force exerted by the

  18. The Epidermal Growth Factor Receptor Responsive miR-125a Represses Mesenchymal Morphology in Ovarian Cancer Cells

    Directory of Open Access Journals (Sweden)

    Karen D. Cowden Dahl

    2009-11-01

    Full Text Available The epithelial-to-mesenchymal transition (EMT that occurs during embryonic development is recapitulated during tumor metastasis. Important regulators of this process include growth factors, transcription factors, and adhesion molecules. New evidence suggests that microRNA (miRNA activity contributes to metastatic progression and EMT; however, the mechanisms leading to altered miRNA expression during cancer progression remain poorly understood. Importantly, overexpression of the epidermal growth factor receptor (EGFR in ovarian cancer correlates with poor disease outcome and induces EMT in ovarian cancer cells. We report that EGFR signaling leads to transcriptional repression of the miRNA miR-125a through the ETS family transcription factor PEA3. Overexpression of miR-125a induces conversion of highly invasive ovarian cancer cells from a mesenchymal to an epithelial morphology, suggesting miR-125a is a negative regulator of EMT. We identify AT-rich interactive domain 3B (ARID3B as a target of miR-125a and demonstrate that ARID3B is overexpressed in human ovarian cancer. Repression of miR-125a through growth factor signaling represents a novel mechanism for regulating ovarian cancer invasive behavior.

  19. Autophagy participates in isoliquiritigenin-induced melanin degradation in human epidermal keratinocytes through PI3K/AKT/mTOR signaling.

    Science.gov (United States)

    Yang, Zhibo; Zeng, Biyun; Pan, Yi; Huang, Pan; Wang, Chang

    2018-01-01

    Melanin is the pigment responsible for the color of human skin and hair. Melanin serves as a double-edge sword which can exert both protective and spot-causing effects on skin. Although melanin has an important role in protecting the skin against UV damage, an excessive or uneven melanin production can lead to the formation of freckles and age spots. Isoliquiritigenin (ISL) has been reported to inhibit melanin synthesis; however, its role in melanin degradation remains unclear. In the present study, we evaluated the detailed function of ISL in melanin degradation in human epidermal keratinocytes. Since autophagy has been reported to be related to melanin degradation, we also examined the activation of autophagy by ISL treatment in keratinocytes by measurement of autophagy-related proteins, ATG7, LC3 and p62. Moreover, si-ATG7-induced ATG7 knockdown and autophagy inhibitor 3-MA decreased LC3 II protein levels and increased PMEL17, p62 and melanin levels in HaCaT cells, which could be partially reversed by ISL treatment, indicating that autophagy participated in melanin degradation. The decreased p-AKT and p-mTOR proteins upon ISL treatment indicated the involvement of PI3K/AKT/mTOR signaling in ISL-induced melanin degradation. Taken together, we demonstrated that autophagy participates in ISL-induced melanin degradation in human epidermal keratinocytes through PI3K/AKT/mTOR signaling. Copyright © 2017. Published by Elsevier Masson SAS.

  20. Burn injury suppresses human dermal dendritic cell and Langerhans cell function

    NARCIS (Netherlands)

    van den Berg, Linda M.; de Jong, Marein A. W. P.; Witte, Lot de; Ulrich, Magda M. W.; Geijtenbeek, Teunis B. H.

    2011-01-01

    Human skin contains epidermal Langerhans cells (LCs) and dermal dendritic cells (DCs) that are key players in induction of adaptive immunity upon infection. After major burn injury, suppressed adaptive immunity has been observed in patients. Here we demonstrate that burn injury affects adaptive

  1. Evaluation of dermal-epidermal skin equivalents ('composite-skin') of human keratinocytes in a collagen-glycosaminoglycan matrix(Integra artificial skin).

    Science.gov (United States)

    Kremer, M; Lang, E; Berger, A C

    2000-09-01

    Integra artificial skin (Integra LifeSciences Corp., Plainsboro, NJ, USA) is a dermal template consisting of bovine collagen, chondroitin-6-sulphate and a silastic membrane manufactured as Integra. This product has gained widespread use in the clinical treatment of third degree burn wounds and full thickness skin defects of different aetiologies. The product was designed to significantly reduce the time needed to achieve final wound closure in the treatment of major burn wounds, to optimise the sparse autologous donor skin resources and to improve the durable mechanical quality of the skin substitute. The clinical procedure requires two stages. The first step creates a self neodermis, the second creates a self epidermis on the neodermis. However, it is desirable to cover major burn wounds early in a single step by a skin substitute consisting of a dermal equivalent seeded in vitro with autologous keratinocytes ('composite-skin') out of which a full thickness skin develops in vivo.The goal of this experimental study was to develop a method to integrate human keratinocytes in homogeneous distribution and depth into Integra Artificial Skin. The seeded cell-matrix composites were grafted onto athymic mice in order to evaluate their potential to reconstitute a human epidermis in vivo. We were able to demonstrate that the inoculated human keratinocytes reproducibly displayed a homogeneous pattern of distribution, adherence, proliferation and confluence. The cell-matrix composites grafted in this model exhibited good wound adherence, complete healing, minor wound contraction and had the potential to reconstitute an elastic, functional and durable human skin. Histologically we were able to show that the inoculated human keratinocytes in vivo colonised the matrix in a histomorphologically characteristic epidermal pattern (keratomorula, keratinocyte bubbling) and developed a persisting, stratified, keratinising epidermis which immunohistologically proved to be of human

  2. Epidermal growth factor receptor inhibition by anti-CD147 therapy in cutaneous squamous cell carcinoma.

    Science.gov (United States)

    Frederick, John W; Sweeny, Larissa; Hartman, Yolanda; Zhou, Tong; Rosenthal, Eben L

    2016-02-01

    Advanced cutaneous squamous cell carcinoma (SCC) is an uncommon and aggressive malignancy. As a result, there is limited understanding of its biology and pathogenesis. CD147 and epidermal growth factor receptor (EGFR) have been identified as oncologically important targets, but their relationship remains undefined in cutaneous SCC. Multiple cutaneous SCC cell lines (Colo-16, SRB-1, and SRB-12), were treated in vitro with a range of chimeric anti-CD147 monoclonal antibody (mAb) (0, 50, 100, and 200 µg/mL) or transfected with a small interfering RNA against CD147 (SiCD147). Cell proliferation, migration (scratch wound healing assay), and protein expression was then assessed. In vivo, Colo-16 flank xenografts were treated anti-CD147 mAb (150 µg i.p. triweekly). After treatment with anti-CD147 (200 µg/mL), there was a significant decrease in proliferation for all cell lines relative to controls (p CD147 (200 µg/mL) resulted in decreased cell migration for all cell lines, with an average of 43% reduction in closure compared to controls (p CD147 antibody therapy and siRNA mediated reduction in CD147 expression were both found to decrease protein expression of EGFR, which correlated with a reduction in downstream total and phosphorylated protein kinase B (pAKT). Tumor growth in vivo was reduced for both the anti-CD147 treatment group and the SiCD147 group relative to controls. Inhibition and downregulation of CD147 in cutaneous SCC resulted in suppression of the malignant phenotype in vitro and in vivo, which may be mediated in part by an alteration in EGFR expression. As a result, CD147 may serve as a potential therapeutic target for advanced cutaneous SCC. © 2014 Wiley Periodicals, Inc.

  3. Correlation of human epidermal growth factor receptor protein expression and colorectal cancer.

    Science.gov (United States)

    Yang, Wen-Juan; Shen, Xing-Jie; Ma, Xiao-Xia; Tan, Zhi-Gang; Song, Yan; Guo, Yi-Tong; Yuan, Mei

    2015-07-28

    To investigate the correlation between human epidermal growth factor receptor (HER-2) protein expression and colorectal cancer (CRC) using a case-control study and meta-analysis. Tumor tissue specimens from 162 CRC patients were selected for the case group. Fifty cases were randomly selected, and normal CRC tissue at least 10 cm away from the tumor margins of these cases was used to generate the control group. The expression of the HER-2 protein in the 162 CRC tissue samples and the 50 adjacent normal mucosa tissue samples was detected via immunohistochemistry. The experimental data were analyzed using SPSS 18.0 software, and R software version 3.1.0 was utilized for further verification. The expression of HER-2 protein in the 162 CRC tissue samples was significantly higher than in the normal tissue specimens. The data showed that the expression of HER-2 in CRC was related to the Dukes' stage, the depth of invasion and lymph node metastasis. The HER-2-positive patients had lower 3- and 5-year OS rates than the HER-2-negative patients, but there was no significant difference. However, there was a statistically significant difference in the 3- and 5-year disease-free survival (DFS) rates of HER-2-positive and HER-2-negative patients. The results of the meta-analysis showed that the expression of HER-2 in CRC patients was statistically significantly increased over that of healthy people. The 3-year DFS rate in HER-2-positive patients was markedly lower than that in HER-2-negative patients. Down-regulation of HER-2 expression might be a dependable strategy for CRC therapy.

  4. Assessment of Epidermal Growth Factor Receptor (EGFR expression in human meningioma

    Directory of Open Access Journals (Sweden)

    Perry Arie

    2010-05-01

    Full Text Available Abstract Purpose This study explores whether meningioma expresses epidermal growth factor receptor (EGFR and determines if there is a correlation between the WHO grade of this tumor and the degree of EGFR expression. Methods Following institutional review board approval, 113 meningioma specimens from 89 patients were chosen. Of these, 85 were used for final analysis. After a blinded review, immunohistochemical stains for EGFR were performed. Staining intensity (SI was scored on a scale 0-3 (from no staining to strong staining. Staining percentage of immunoreactive cells (SP was scored 1-5 (from the least to the maximum percent of the specimen staining. Immunohistochemical score (IHS was calculated as the product of SI and SP. Results Eighty-five samples of meningioma were classified in accordance with World Health Organization (WHO criteria: benign 57/85 (67%, atypical 23/85 (27%, and malignant 5/85 (6%. The majority of samples demonstrated a moderate SI for EGFR. IHS for EGFR demonstrated a significant association between SI and histopathologic subtype. Also, there was a correlation between the SP and histopathologic subtype (p = 0.029. A significant association was determined when the benign and the atypical samples were compared to the malignant with respect to the SP (p = 0.009. While there was a range of the IHS for the benign and the atypical histologic subtypes, malignant tumors exhibited the lowest score and were statistically different from the benign and the atypical specimens (p Conclusions To our knowledge, this represents the largest series of meningioma samples analyzed for EGFR expression reported in the literature. EGFR expression is greatest in benign meningiomas and may serve a potential target for therapeutic intervention with selective EGFR inhibitors.

  5. Deregulation of epidermal stem cell niche contributes to pathogenesis of non-healing venous ulcers

    Science.gov (United States)

    Nusbaum, Aron G.; Vukelic, Sasa; Krzyzanowska, Agata; Tomic-Canic, Marjana

    2014-01-01

    The epidermis is maintained by epidermal stem cells (ESC) that reside in distinct niches and contribute to homeostasis and wound closure. Keratinocytes at the non-healing edges of venous ulcers (VUs) are healing-incompetent, hyper-proliferative and non-migratory suggesting deregulation of ESCs. To date genes which regulate ESC niches have been studied in mice only. Utilizing microarray analysis of VU non-healing edges, we identified changes in expression of genes harboring regulation of ESCs and their fate. In a prospective clinical study of ten VUs, we confirmed suppression of the bone morphogenetic protein receptor and GATA binding protein3 as well as inhibitors of DNA-binding proteins 2 and 4. We also found decreased levels of phosphorylated glycogen synthase kinase 3, nuclear presence of ß-catenin and overexpression of its transcriptional target, c-myc indicating activation of the Wnt pathway. Additionally, we found down-regulation of leucine-rich repeats and immunoglobulin-like domains protein 1, a gene important for maintaining ESCs in a quiescent state, and absence of keratin 15, a marker of the basal stem cell compartment suggesting local depletion of ESCs. Our study shows that loss of genes important for regulation of ESCs and their fate along with activation of ß-catenin and c-myc in the VU may contribute to ESC deprivation and a hyper-proliferative, non-migratory, healing incapable wound edge. PMID:24635172

  6. Human epidermal growth factor receptor 2/neu overexpression in urothelial carcinoma of the bladder and its prognostic significance: Is it worth hype?

    Directory of Open Access Journals (Sweden)

    Santosh Kumar

    2015-01-01

    Full Text Available Aims: In urothelial tumors of the urinary bladder, human epidermal growth factor receptor 2 (HER-2/neu expression has been reported over 10 years, but there is no clear correlation between prognosis and recurrence rate. The present study evaluates prognostic implication of HER-2/neu expression. Subjects and Methods: In this study, 100 formalin-fixed paraffin-embedded specimens of primary transitional cell carcinoma of the bladder were processed. HER-2/neu monoclonal antibody immunohistochemistry staining procedure used for the study. Results: A total of 70 (70% patients were positive for overexpression of HER-2/neu. HER-2/neu was positive in patients with 42 (70% superficial tumor, 28 (70% muscle invasive tumor, 41 (75.9% high-grade tumor, 29 (63% low grade tumor, 31 (68.9% recurrent tumor, and 6 (66.6% had positive lymph nodes. Conclusions: Human epidermal growth factor receptor 2/neu over expression was not correlated with the tumor stage, lymphnode metastasis or recurrence of the disease. HER-2/neu overexpression was statistically insignificantly correlated with the differentiation grade (P < 0.161 as compared to previous studies. Future studies on HER-2 expression with chemo-sensitivity and efficacy of HER-2-targeted therapies in urothelial carcinomas is needed.

  7. Single-cell-type quantitative proteomic and ionomic analysis of epidermal bladder cells from the halophyte model plant Mesembryanthemum crystallinum to identify salt-responsive proteins

    OpenAIRE

    Barkla, Bronwyn J.; Vera-Estrella, Rosario; Raymond, Carolyn

    2016-01-01

    Background Epidermal bladder cells (EBC) are large single-celled, specialized, and modified trichomes found on the aerial parts of the halophyte Mesembryanthemum crystallinum. Recent development of a simple but high throughput technique to extract the contents from these cells has provided an opportunity to conduct detailed single-cell-type analyses of their molecular characteristics at high resolution to gain insight into the role of these cells in the salt tolerance of the plant. Results In...

  8. Melanoma cells influence the differentiation pattern of human epidermal keratinocytes

    Czech Academy of Sciences Publication Activity Database

    Kodet, O.; Lacina, L.; Krejčí, E.; Dvořáková, B.; Grim, M.; Štork, J.; Kodetová, D.; Vlček, Čestmír; Šáchová, Jana; Kolář, Michal; Strnad, Hynek; Smetana, K.

    2015-01-01

    Roč. 14, č. 1 (2015), s. 1-1 ISSN 1476-4598 R&D Projects: GA ČR GAP304/12/1333; GA MZd(CZ) NT13488; GA MŠk(CZ) ED1.1.00/02.0109 Grant - others:Charles University in Prague(CZ) PRVOUK 27 – 1; Charles University in Prague(CZ) UNCE 204013 Institutional support: RVO:68378050 Keywords : Melanoma * Cancer microenvironment * Melanocyte Subject RIV: EB - Genetics ; Molecular Biology Impact factor: 5.888, year: 2015

  9. Proton extrusion is an essential signalling component in the HR of epidermal single cells in the barley-powdery mildew interaction

    DEFF Research Database (Denmark)

    Zhou, F.S.; Andersen, C.H.; Burhenne, K.

    2000-01-01

    We propose a model for activation of the epidermal cell hypersensitive response (HR) in the barley/powdery mildew interaction. The model suggests that the plasma membrane proton pump (H+-ATPase) of epidermal cells is activated following penetration by an avirulent powdery mildew fungus...... in the incompatible interaction; (4) race-specific proton extrusion is observed underneath epidermal tissue detached from leaves inoculated 15 h earlier; and (5) treatment of leaves with fusicoccin, an activator of the plasma membrane H+-ATPase, increases the number of HR-cells in the compatible interaction........ This will cause an acidification of the apoplast towards the mesophyll cells, thereby activating generation of H2O2 from the mesophyll, which subsequently triggers the epidermal cell to undergo HR. The model is supported by the following data: (1) the earliest HR-related H2O2 is found in the attachment zones...

  10. Epidermal growth factor treatment of A431 cells alters the binding capacity and electrophoretic mobility of the cytoskeletally associated epidermal growth factor receptor

    International Nuclear Information System (INIS)

    Roy, L.M.; Gittinger, C.K.; Landreth, G.E.

    1991-01-01

    Epidermal growth factor receptor interacts with structural elements of A431 cells and remains associated with the cytoskeleton following extraction with nonionic detergents. Extraction of cells with 0.15% Triton X-100 resulted in detection of only approximately 40% of the EGF binding sites on the cytoskeleton. If the cells were exposed to EGF prior to extraction, approximately twofold higher levels of low-affinity EGF binding sites were detected. The difference in number of EGF binding sites was not a consequence of differences in numbers of EGF receptors associated with the cytoskeleton; equal amounts of 35S-labeled receptor were immunoprecipitated from the cytoskeletons of both control and EGF-treated cells. The effect of EGF pretreatment on binding activity was coincident with a change in the mobility of the receptor from a doublet of Mr approximately 160-180 kDa to a single sharp band at 180 kDa. The alteration in receptor mobility was not a simple consequence of receptor phosphorylation in that the alteration was not reversed by alkaline phosphatase treatment, nor was the shift produced by treatment of the cells with phorbol ester. The two EGF receptor species demonstrated differential susceptibility to V8 proteinase digestion. The EGF-induced 180 kDa species was preferentially digested by the proteinase relative to the 160 kDa species, indicating that EGF binding results in a conformational change in the receptor. The EGF-mediated preservation of binding activity and altered conformation may be related to receptor oligomerization

  11. Triggering Apoptotic Death of Human Epidermal Keratinocytes by Malic Acid: Involvement of Endoplasmic Reticulum Stress- and Mitochondria-Dependent Signaling Pathways

    Directory of Open Access Journals (Sweden)

    Yu-Ping Hsiao

    2015-01-01

    Full Text Available Malic acid (MA has been commonly used in cosmetic products, but the safety reports in skin are sparse. To investigate the biological effects of MA in human skin keratinocytes, we investigated the potential cytotoxicity and apoptotic effects of MA in human keratinocyte cell lines (HaCaT. The data showed that MA induced apoptosis based on the observations of DAPI staining, DNA fragmentation, and sub-G1 phase in HaCaT cells and normal human epidermal keratinocytes (NHEKs. Flow cytometric assays also showed that MA increased the production of mitochondrial superoxide (mito-SOX but decreased the mitochondrial membrane potential. Analysis of bioenergetics function with the XF 24 analyzer Seahorse extracellular flux analyzer demonstrated that oxygen consumption rate (OCR was significantly decreased whereas extracellular acidification rate (ECAR was increased in MA-treated keratinocytes. The occurrence of apoptosis was proved by the increased expressions of FasL, Fas, Bax, Bid, caspases-3, -8, -9, cytochrome c, and the declined expressions of Bcl-2, PARP. MA also induced endoplasmic reticulum stress associated protein expression such as GRP78, GADD153, and ATF6α. We demonstrated that MA had anti-proliferative effect in HaCaT cell through the inhibition of cell cycle progression at G0/G1, and the induction of programmed cell death through endoplasmic reticulum stress- and mitochondria-dependent pathways.

  12. Nuclear receptor NHR-25 is required for cell-shape dynamics during epidermal differentiation in Caenorhabditis elegans

    Czech Academy of Sciences Publication Activity Database

    Šilhánková, Marie; Jindra, Marek; Asahina, Masako

    2005-01-01

    Roč. 118, č. 1 (2005), s. 223-232 ISSN 0021-9533 R&D Projects: GA AV ČR KJB5022303; GA ČR GD524/03/H133 Institutional research plan: CEZ:AV0Z60220518 Keywords : Caenorhabditis elegans * nuclear receptor * epidermal stem cells Subject RIV: EB - Genetics ; Molecular Biology Impact factor: 6.543, year: 2005

  13. Differential regulation of type I interferon and epidermal growth factor pathways by a human Respirovirus virulence factor.

    Directory of Open Access Journals (Sweden)

    Grégory Caignard

    2009-09-01

    Full Text Available A number of paramyxoviruses are responsible for acute respiratory infections in children, elderly and immuno-compromised individuals, resulting in airway inflammation and exacerbation of chronic diseases like asthma. To understand the molecular pathogenesis of these infections, we searched for cellular targets of the virulence protein C of human parainfluenza virus type 3 (hPIV3-C. We found that hPIV3-C interacts directly through its C-terminal domain with STAT1 and GRB2, whereas C proteins from measles or Nipah viruses failed to do so. Binding to STAT1 explains the previously reported capacity of hPIV3-C to block type I interferon signaling, but the interaction with GRB2 was unexpected. This adaptor protein bridges Epidermal Growth Factor (EGF receptor to MAPK/ERK pathway, a signaling cascade recently found to be involved in airway inflammatory response. We report that either hPIV3 infection or transient expression of hPIV3-C both increase cellular response to EGF, as assessed by Elk1 transactivation and phosphorylation levels of ERK1/2, 40S ribosomal subunit protein S6 and translation initiation factor 4E (eIF4E. Furthermore, inhibition of MAPK/ERK pathway with U0126 prevented viral protein expression in infected cells. Altogether, our data provide molecular basis to explain the role of hPIV3-C as a virulence factor and determinant of pathogenesis and demonstrate that Paramyxoviridae have evolved a single virulence factor to block type I interferon signaling and to boost simultaneous cellular response to growth factors.

  14. Epidermal growth factor induces HCCR expression via PI3K/Akt/mTOR signaling in PANC-1 pancreatic cancer cells

    International Nuclear Information System (INIS)

    Xu, Zekuan; Zhang, Guoxin; Zhang, Yi; Jiang, Jiakai; Yang, Yang; Shi, Ruihua; Hao, Bo; Zhang, Zhihong; Huang, Zuhu; Kim, Jin W

    2010-01-01

    Human cervical cancer oncoprotein 1 (HCCR-1), reported as a negative regulator of p53, is over-expressed in a variety of human cancers. However, it is yet unknown whether HCCR-1 plays any role in pancreatic cancer development. The aim of this study was to investigate the effect of epidermal growth factor on the expression of HCCR in pancreatic cancer cells, and to explore if PI3K/Akt/mTOR signaling pathway mediated this expression. A polyclonal antibody against HCCR protein was raised by immunizing Balb/c mice with the purified recombinant protein pMBPc-HCCR. Tissue samples were constructed on a tissue chip, and the expression of HCCR was investigated by immunohistochemistry assay and Western blotting. Pancreatic cell line, PANC-1 cells were stably transfected with plasmids containing sense-HCCR-1 fragment and HCCR siRNA fragment. MTT and transwell assay were used to investigate the proliferation and invasion of stable tansfectants. The specific inhibitor of PI3K and mTOR was used to see if PI3K/mTOR signal transduction was involved in the induction of HCCR gene expression. A Luciferase assay was used to see if Akt can enhance the HCCR promoter activity. HCCR was up-regulated in pancreatic tumor tissues (mean Allred score 4.51 ± 1.549 vs. 2.87 ± 2.193, P < 0.01), especially with high expression in poorly differentiated pancreatic cancer. The growth of cells decreased in HCCR-1 siRNA transfected cells compared with vector transfectants. The number of invasion cells was significantly lower in HCCR-1 siRNA transfected cells (24.4 ± 9.9) than that in vector transfectants (49.1 ± 15.4). Treatment of PANC-1 cells with epidermal growth factor increased HCCR protein level in a dose- and time-dependent manner. However, application of LY294002 and rapamycin caused a dramatic reduction of epidermal growth factor-induced HCCR expression. Over-expression of exogenous constitutively active Akt increased the HCCR promoter activity; in contrast, dominant negative Akt decreased

  15. Targeting the Epidermal Growth Factor Receptor Can Counteract the Inhibition of Natural Killer Cell Function Exerted by Colorectal Tumor-Associated Fibroblasts

    Directory of Open Access Journals (Sweden)

    Delfina Costa

    2018-05-01

    Full Text Available Mesenchymal stromal cells (MSC present in the tumor microenvironment [usually named tumor-associated fibroblasts (TAF] can exert immunosuppressive effects on T and natural killer (NK lymphocytes, favoring tumor immune escape. We have analyzed this mechanism in colorectal carcinoma (CRC and found that co-culture of NK cells with TAF can prevent the IL-2-mediated NKG2D upregulation. This leads to the impairment of NKG2D-mediated recognition of CRC cells, sparing the NK cell activation through DNAM1 or FcγRIIIA (CD16. In situ, TAF express detectable levels of epidermal growth factor receptor (EGFR; thus, the therapeutic anti-EGFR humanized antibody cetuximab can trigger the antibody-dependent cellular cytotoxicity of TAF, through the engagement of FcγRIIIA on NK cells. Importantly, in the tumor, we found a lymphoid infiltrate containing NKp46+CD3− NK cells, enriched in CD16+ cells. This population, sorted and cultured with IL-2, could be triggered via CD16 and via NKG2D. Of note, ex vivo NKp46+CD3− cells were able to kill autologous TAF; in vivo, this might represent a control mechanism to reduce TAF-mediated regulatory effect on NK cell function. Altogether, these findings suggest that MSC from the neoplastic mucosa (TAF of CRC patients can downregulate the immune cell recognition of CRC tumor cells. This immunosuppression can be relieved by the anti-EGFR antibody used in CRC immunotherapy.

  16. Targeting the Epidermal Growth Factor Receptor Can Counteract the Inhibition of Natural Killer Cell Function Exerted by Colorectal Tumor-Associated Fibroblasts

    Science.gov (United States)

    Costa, Delfina; Venè, Roberta; Benelli, Roberto; Romairone, Emanuele; Scabini, Stefano; Catellani, Silvia; Rebesco, Barbara; Mastracci, Luca; Grillo, Federica; Minghelli, Simona; Loiacono, Fabrizio; Zocchi, Maria Raffaella; Poggi, Alessandro

    2018-01-01

    Mesenchymal stromal cells (MSC) present in the tumor microenvironment [usually named tumor-associated fibroblasts (TAF)] can exert immunosuppressive effects on T and natural killer (NK) lymphocytes, favoring tumor immune escape. We have analyzed this mechanism in colorectal carcinoma (CRC) and found that co-culture of NK cells with TAF can prevent the IL-2-mediated NKG2D upregulation. This leads to the impairment of NKG2D-mediated recognition of CRC cells, sparing the NK cell activation through DNAM1 or FcγRIIIA (CD16). In situ, TAF express detectable levels of epidermal growth factor receptor (EGFR); thus, the therapeutic anti-EGFR humanized antibody cetuximab can trigger the antibody-dependent cellular cytotoxicity of TAF, through the engagement of FcγRIIIA on NK cells. Importantly, in the tumor, we found a lymphoid infiltrate containing NKp46+CD3− NK cells, enriched in CD16+ cells. This population, sorted and cultured with IL-2, could be triggered via CD16 and via NKG2D. Of note, ex vivo NKp46+CD3− cells were able to kill autologous TAF; in vivo, this might represent a control mechanism to reduce TAF-mediated regulatory effect on NK cell function. Altogether, these findings suggest that MSC from the neoplastic mucosa (TAF) of CRC patients can downregulate the immune cell recognition of CRC tumor cells. This immunosuppression can be relieved by the anti-EGFR antibody used in CRC immunotherapy. PMID:29910806

  17. Protein profiling of single epidermal cell types from Arabidopsis thaliana using surface-enhanced laser desorption and ionization technology.

    Science.gov (United States)

    Ebert, Berit; Melle, Christian; Lieckfeldt, Elke; Zöller, Daniela; von Eggeling, Ferdinand; Fisahn, Joachim

    2008-08-25

    Here, we describe a novel approach for investigating differential protein expression within three epidermal cell types. In particular, 3000 single pavement, basal, and trichome cells from leaves of Arabidopsis thaliana were harvested by glass micro-capillaries. Subsequently, these single cell samples were joined to form pools of 100 individual cells and analyzed using the ProteinChip technology; SELDI: surface-enhanced laser desorption and ionization. As a result, numerous protein signals that were differentially expressed in the three epidermal cell types could be detected. One of these proteins was characterized by tryptical digestion and subsequent identification via tandem quadrupole-time of flight (Q-TOF) mass spectrometry. Down regulation of this sequenced small subunit precursor of ribulose-1,5 bisphosphate carboxylase(C) oxygenase(O) (RuBisCo) in trichome and basal cells indicates the sink status of these cell types that are located on the surface of A. thaliana source leaves. Based on the obtained protein profiles, we suggest a close functional relationship between basal and trichome cells at the protein level.

  18. Degradation of Epidermal Growth Factor Receptor Mediates Dasatinib-Induced Apoptosis in Head and Neck Squamous Cell Carcinoma Cells

    Directory of Open Access Journals (Sweden)

    Yu-Chin Lin

    2012-06-01

    Full Text Available Epidermal growth factor receptor (EGFR is an important oncoprotein that promotes cell growth and proliferation. Dasatinib, a bcr-abl inhibitor, has been approved clinically for the treatment of chronic myeloid leukemia and demonstrated to be effective against solid tumors in vitro through Src inhibition. Here, we disclose that EGFR degradation mediated dasatinib-induced apoptosis in head and neck squamous cell carcinoma (HNSCC cells. HNSCC cells, including Ca9-22, FaDu, HSC3, SAS, SCC-25, and UMSCC1, were treated with dasatinib, and cell viability, apoptosis, and underlying signal transduction were evaluated. Dasatinib exhibited differential sensitivities against HNSCC cells. Growth inhibition and apoptosis were correlated with its inhibition on Akt, Erk, and Bcl-2, irrespective of Src inhibition. Accordingly, we found that down-regulation of EGFR was a determinant of dasatinib sensitivity. Lysosome inhibitor reversed dasatinib-induced EGFR down-regulation, and c-cbl activity was increased by dasatinib, indicating that dasatinib-induced EGFR down-regulation might be through c-cbl-mediated lysosome degradation. Increased EGFR activation by ligand administration rescued cells from dasatinib-induced apoptosis, whereas inhibition of EGFR enhanced its apoptotic effect. Estrogen receptor α (ERα was demonstrated to play a role in Bcl-2 expression, and dasatinib inhibited ERα at the pretranslational level. ERα was associated with EGFR in dasatinib-treated HNSCC cells. Furthermore, the xenograft model showed that dasatinib inhibited HSC3 tumor growth through in vivo down-regulation of EGFR and ERα. In conclusion, degradation of EGFR is a novel mechanism responsible for dasatinib-induced apoptosis in HNSCC cells.

  19. Targeted delivery of polyamidoamine-paclitaxel conjugate functionalized with anti-human epidermal growth factor receptor 2 trastuzumab

    Directory of Open Access Journals (Sweden)

    Ma P

    2015-03-01

    Full Text Available Pengkai Ma,1 Xuemei Zhang,1 Ling Ni,2 Jinming Li,2 Fengpu Zhang,1 Zheng Wang,1 Shengnan Lian,1 Kaoxiang Sun1 1School of Pharmacy, Yantai University, Yantai, Shandong Province, People’s Republic of China; 2State Key Laboratory of Long-acting and Targeting Drug Delivery System, Yantai, Shandong Province, People’s Republic of China Background: Antibody-dendrimer conjugates have the potential to improve the targeting and release of chemotherapeutic drugs at the tumor site while reducing adverse side effects caused by drug accumulation in healthy tissues. In this study, trastuzumab (TMAB, which binds to human epidermal growth factor receptor 2 (HER2, was used as a targeting agent in a TMAB-polyamidoamine (PAMAM conjugate carrying paclitaxel (PTX specifically to cells overexpressing HER2. Methods: TMAB was covalently linked to a PAMAM dendrimer via bifunctional polyethylene glycol (PEG. PTX was conjugated to PAMAM using succinic anhydride as a cross-linker, yielding TMAB-PEG-PAMAM-PTX. Dynamic light scattering and transmission electron microscopy were used to characterize the conjugates. The cellular uptake and in vivo biodistribution were studied by fluorescence microscopy, flow cytometry, and Carestream In Vivo FX, respectively. Results: Nuclear magnetic resonance spectroscopy demonstrated that PEG, PTX, fluorescein isothiocyanate, and cyanine7 were conjugated to PAMAM. Ultraviolet-visible spectroscopy and sodium dodecyl sulfate polyacrylamide gel electrophoresis demonstrated that TMAB was conjugated to PEG-PAMAM. Dynamic light scattering and transmission electron microscopy measurements revealed that the different conjugates ranged in size between 10 and 35 nm and had a spherical shape. In vitro cellular uptake demonstrated that the TMAB-conjugated PAMAM was taken up by HER2-overexpressing BT474 cells more efficiently than MCF-7 cells that expressed lower levels of HER2. Co-localization experiments indicated that TMAB-conjugated PAMAM was

  20. Incidental Squamous Cell Carcinoma in an Epidermal Inclusion Cyst: A Case Report and Review of the Literature

    Directory of Open Access Journals (Sweden)

    Ethan Frank

    2018-03-01

    Full Text Available Epidermal inclusion cysts are common lesions that rarely develop into squamous cell carcinoma (SCC. Neoplastic change in these cysts can be associated with prominent symptoms such as pain, rapid growth, or ulceration. This study describes the case of a 64-year-old woman with a 4-year history of a largely asymptomatic neck mass, which after routine excision was found to be an epidermal inclusion cyst harboring well-differentiated SCC. The diagnosis was made incidentally after routine cyst bisection and hematoxylin and eosin staining. Given the potential for variable presentation and low cost of hematoxylin and eosin analysis, we recommend a low threshold for a comprehensive pathological search for malignancy in excised cysts when appropriate.

  1. Repeated short climatic change affects the epidermal differentiation program and leads to matrix remodeling in a human organotypic skin model.

    Science.gov (United States)

    Boutrand, Laetitia-Barbollat; Thépot, Amélie; Muther, Charlotte; Boher, Aurélie; Robic, Julie; Guéré, Christelle; Vié, Katell; Damour, Odile; Lamartine, Jérôme

    2017-01-01

    Human skin is subject to frequent changes in ambient temperature and humidity and needs to cope with these environmental modifications. To decipher the molecular response of human skin to repeated climatic change, a versatile model of skin equivalent subject to "hot-wet" (40°C, 80% relative humidity [RH]) or "cold-dry" (10°C, 40% RH) climatic stress repeated daily was used. To obtain an exhaustive view of the molecular mechanisms elicited by climatic change, large-scale gene expression DNA microarray analysis was performed and modulated function was determined by bioinformatic annotation. This analysis revealed several functions, including epidermal differentiation and extracellular matrix, impacted by repeated variations in climatic conditions. Some of these molecular changes were confirmed by histological examination and protein expression. Both treatments (hot-wet and cold-dry) reduced the expression of genes encoding collagens, laminin, and proteoglycans, suggesting a profound remodeling of the extracellular matrix. Strong induction of the entire family of late cornified envelope genes after cold-dry exposure, confirmed at protein level, was also observed. These changes correlated with an increase in epidermal differentiation markers such as corneodesmosin and a thickening of the stratum corneum, indicating possible implementation of defense mechanisms against dehydration. This study for the first time reveals the complex pattern of molecular response allowing adaption of human skin to repeated change in its climatic environment.

  2. Response to Therapy and Outcomes in Oropharyngeal Cancer Are Associated With Biomarkers Including Human Papillomavirus, Epidermal Growth Factor Receptor, Gender, and Smoking

    International Nuclear Information System (INIS)

    Kumar, Bhavna; Cordell, Kitrina G.; Lee, Julia S.; Prince, Mark E.; Tran, Huong H.; Wolf, Gregory T.; Urba, Susan G.; Worden, Francis P.; Chepeha, Douglas B.; Teknos, Theodoros N.; Eisbruch, Avraham; Tsien, Christina I.; Taylor, Jeremy; D'Silva, Nisha J.; Yang, Kun; Kurnit, David M.; Bradford, Carol R.

    2007-01-01

    Induction chemotherapy and concurrent chemoradiation for responders or immediate surgery for non-responders is an effective treatment strategy head and neck squamous cell carcinoma (HNSCC) of the larynx and oropharynx. Biomarkers that predict outcome would be valuable in selecting patients for therapy. In this study, the presence and titer of high risk human papilloma virus (HPV) and expression of epidermal growth factor receptor (EGFR) in pre-treatment biopsies, as well as smoking and gender were examined in oropharynx cancer patients enrolled in an organ sparing trial. HPV16 copy number was positively associated with response to therapy and with overall and disease specific survival, whereas EGFR expression, current or former smoking behavior, and female gender (in this cohort) were associated with poor response and poor survival in multivariate analysis. Smoking cessation and strategies to target EGFR may be useful adjuncts for therapy to improve outcome in the cases with the poorest biomarker profile

  3. Prognostic significance of equivocal human epidermal growth factor receptor 2 results and clinical utility of alternative chromosome 17 genes in patients with invasive breast cancer: A cohort study.

    Science.gov (United States)

    Sneige, Nour; Hess, Kenneth R; Multani, Asha S; Gong, Yun; Ibrahim, Nuhad K

    2017-04-01

    The 2013 testing guidelines for determining the human epidermal growth factor receptor 2 (HER2) status include new cutoff points for the HER2/chromosome enumeration probe 17 (CEP17) ratio and the average HER2 copy number per cell, and they recommend using a reflex test with alternative chromosome 17 probes (Ch17Ps) to resolve equivocal HER2 results. This study sought to determine the clinical utility of alternative Ch17Ps in equivocal cases and the effects of equivocal results and/or a change in the HER2 status on patients' outcomes. The University of Texas MD Anderson Cancer Center database of HER2 dual-probe fluorescence in situ hybridization results from 2000 to 2010 was searched for cases of invasive breast cancer with HER2/CEP17 ratios Cancer 2017;123:1115-1123. © 2016 American Cancer Society. © 2016 American Cancer Society.

  4. The regeneration of epidermal cells of Saintpaulia leaves as a new plant-tissue system for cellular radiation biology

    International Nuclear Information System (INIS)

    Engels, F.M.; Laan, F.M. van der; Leenhouts, H.P.; Chadwick, K.H.

    1980-01-01

    investigation of the nucleus of epidermal cells of the petioles of Saintpaulia leaves by cytofluorimetry revealed that all cells are in a non-cycling pre DNA synthesis phase. Cultivation of dissected leaves results in a synchronous regeneration process of a defined number of cells. Five days after onset of cultivation the cells reach the first mitosis. The nuclear development during the regeneration process is described. Irradiation of the leaves results in a directly visible inhibition of this regenerating capability which is used to quantify cell survival in a tissue. The data show that the radiation response has a similar shape to that of the survival of single cells in culture. This response can be observed before the first mitosis of the cells and its application as a new plant tissue system for cellular radiation research is discussed. (author)

  5. AZD9291 in epidermal growth factor receptor inhibitor-resistant non-small-cell lung cancer.

    Science.gov (United States)

    Stinchcombe, Thomas E

    2016-02-01

    Epidermal growth factor receptor (EGFR) tyrosine kinase inhibitors (TKIs) in advanced EGFR mutant non-small cell lung cancer have an objective response rate (ORR) of approximately 60-70% and a median progression free-survival (PFS) of approximately 10-13 months. Studies of tumor biopsies performed after progression on EGFR TKI revealed that 50-60% of EGFR mutant NSCLC developed an EGFR exon 20 T790M mutation as a mechanism of acquired resistance. AZD9291 is a third generation irreversible EGFR TKI with activity against the activating EGFR mutation, the T790M acquired resistance mutation, and relative sparing of the wild-type EGFR. AZD9291 was investigated in a phase I trial with expansion cohorts in patients with disease progression after EGFR TKI. Patients with and without detectable T790M mutations were enrolled in the trial. The ORR in patients with centrally confirmed and without detectable T790M mutations was 61% (95% CI, 52-70%) and 21% (95% CI, 12-34%), respectively. The PFS observed in patients with centrally confirmed and without detectable T790M mutations was 9.6 months (95% CI, 8.3 to not reached) and 2.8 months (95% CI, 2.1-4.3 months), respectively. At the dose for further investigation, 80 mg daily, the rate of all grade 3-5 drug related adverse events was 11%, and the rates of grade 3 diarrhea and rash were 1% and 0%, respectively. The identification of the T790M resistance mutation and the subsequent development of an agent against the mechanism of resistance provide a template for future drug development for acquired resistance to targeted therapy.

  6. Relationship between the ability of sunscreens containing 2-ethylhexyl-4'-methoxycinnamate to protect against UVR-induced inflammation, depletion of epidermal Langerhans (Ia+) cells and suppression of alloactivating capacity of murine skin in vivo.

    Science.gov (United States)

    Walker, S L; Morris, J; Chu, A C; Young, A R

    1994-01-01

    The UVB sunscreen 2-ethylhexyl-4'-methoxycinnamate was evaluated in hairless albino mouse skin for its ability to inhibit UVR-induced (i) oedema, (ii) epidermal Langerhans cell (Ia+) depletion and (iii) suppression of the alloactivating capacity of epidermal cells (mixed epidermal cell-lymphocyte reaction, MECLR). The sunscreen, prepared at 9% in ethanol or a cosmetic lotion, was applied prior to UVB/UVA irradiation. In some experiments there was a second application halfway through the irradiation. Single applications in both vehicles gave varying degrees of protection from oedema and Langerhans cell depletion but afforded no protection from suppression of MECLR. When the sunscreens were applied twice there was improved protection from oedema and Langerhans cell depletion and complete protection was afforded from suppression of MECLR. There was a clear linear relationship between Langerhans cell numbers and oedema with and without sunscreen application. The relationship between Langerhans cell numbers and MECLR was more complex. These data confirm published discrepancies between protection from oedema (a model for human erythema) and endpoints with immunological significance, but show that 2-ethylhexyl-4'-methoxycinnamate can afford complete immunoprotection, although protection is dependent on the application rate and vehicle.

  7. A nomogram for predicting pathological complete response in patients with human epidermal growth factor receptor 2 negative breast cancer

    International Nuclear Information System (INIS)

    Jin, Xi; Jiang, Yi-Zhou; Chen, Sheng; Yu, Ke-Da; Ma, Ding; Sun, Wei; Shao, Zhi-Min; Di, Gen-Hong

    2016-01-01

    The response to neoadjuvant chemotherapy has been proven to predict long-term clinical benefits for patients. Our research is to construct a nomogram to predict pathological complete response of human epidermal growth factor receptor 2 negative breast cancer patients. We enrolled 815 patients who received neoadjuvant chemotherapy from 2003 to 2015 and divided them into a training set and a validation set. Univariate logistic regression was performed to screen for predictors and construct the nomogram; multivariate logistic regression was performed to identify independent predictors. After performing the univariate logistic regression analysis in the training set, tumor size, hormone receptor status, regimens of neoadjuvant chemotherapy and cycles of neoadjuvant chemotherapy were the final predictors for the construction of the nomogram. The multivariate logistic regression analysis demonstrated that T4 status, hormone receptor status and receiving regimen of paclitaxel and carboplatin were independent predictors of pathological complete response. The area under the receiver operating characteristic curve of the training set and the validation set was 0.779 and 0.701, respectively. We constructed and validated a nomogram to predict pathological complete response in human epidermal growth factor receptor 2 negative breast cancer patients. We also identified tumor size, hormone receptor status and paclitaxel and carboplatin regimen as independent predictors of pathological complete response. The online version of this article (doi:10.1186/s12885-016-2652-z) contains supplementary material, which is available to authorized users

  8. c-Jun/AP-1 pathway-mediated cyclin D1 expression participates in low dose arsenite-induced transformation in mouse epidermal JB6 Cl41 cells

    International Nuclear Information System (INIS)

    Zhang Dongyun; Li Jingxia; Gao Jimin; Huang Chuanshu

    2009-01-01

    Arsenic is a well-documented human carcinogen associated with skin carcinogenesis. Our previous work reveals that arsenite exposure is able to induce cell transformation in mouse epidermal cell JB6 Cl41 through the activation of ERK, rather than JNK pathway. Our current studies further evaluate downstream pathway in low dose arsenite-induced cell transformation in JB6 Cl41 cells. Our results showed that treatment of cells with low dose arsenite induced activation of c-Jun/AP-1 pathway, and ectopic expression of dominant negative mutant of c-Jun (TAM67) blocked arsenite-induced transformation. Furthermore, our data indicated that cyclin D1 was an important downstream molecule involved in c-Jun/AP-1-mediated cell transformation upon low dose arsenite exposure, because inhibition of cyclin D1 expression by its specific siRNA in the JB6 Cl41 cells resulted in impairment of anchorage-independent growth of cells induced by low dose arsenite. Collectively, our results demonstrate that c-Jun/AP-1-mediated cyclin D1 expression is at least one of the key events implicated in cell transformation upon low dose arsenite exposure

  9. Pigment Production Analysis in Human Melanoma Cells.

    Science.gov (United States)

    Hopkin, Amelia Soto; Paterson, Elyse K; Ruiz, Rolando; Ganesan, Anand K

    2016-05-25

    The human epidermal melanocyte is a highly specialized pigmented cell that serves to protect the epidermis from ultraviolet (UV) damage through the production of melanin, or melanogenesis. Misregulation in melanogenesis leading to either hyper- or hypo-pigmentation is found in human diseases such as malasma and vitiligo. Current therapies for these diseases are largely unsuccessful and the need for new therapies is necessary. In order to identify genes and or compounds that can alter melanogenesis, methods are required that can detect changes in pigment production as well as expression of key melanogenesis transcription factors and enzymes. Here we describe methods to detect changes in melanogenesis in a human melanoma cell line, MNT-1, by (1) analyzing pigment production by measuring the absorbance of melanin present by spectrophotometry, (2) analyzing transcript expression of potent regulators of melanogenesis by qunatitative reverse-transcription (RT)PCR and (3) analyzing protein expression of potent regulators of melanogenesis by Western blot (WB).

  10. The Human Cell Atlas.

    Science.gov (United States)

    Regev, Aviv; Teichmann, Sarah A; Lander, Eric S; Amit, Ido; Benoist, Christophe; Birney, Ewan; Bodenmiller, Bernd; Campbell, Peter; Carninci, Piero; Clatworthy, Menna; Clevers, Hans; Deplancke, Bart; Dunham, Ian; Eberwine, James; Eils, Roland; Enard, Wolfgang; Farmer, Andrew; Fugger, Lars; Göttgens, Berthold; Hacohen, Nir; Haniffa, Muzlifah; Hemberg, Martin; Kim, Seung; Klenerman, Paul; Kriegstein, Arnold; Lein, Ed; Linnarsson, Sten; Lundberg, Emma; Lundeberg, Joakim; Majumder, Partha; Marioni, John C; Merad, Miriam; Mhlanga, Musa; Nawijn, Martijn; Netea, Mihai; Nolan, Garry; Pe'er, Dana; Phillipakis, Anthony; Ponting, Chris P; Quake, Stephen; Reik, Wolf; Rozenblatt-Rosen, Orit; Sanes, Joshua; Satija, Rahul; Schumacher, Ton N; Shalek, Alex; Shapiro, Ehud; Sharma, Padmanee; Shin, Jay W; Stegle, Oliver; Stratton, Michael; Stubbington, Michael J T; Theis, Fabian J; Uhlen, Matthias; van Oudenaarden, Alexander; Wagner, Allon; Watt, Fiona; Weissman, Jonathan; Wold, Barbara; Xavier, Ramnik; Yosef, Nir

    2017-12-05

    The recent advent of methods for high-throughput single-cell molecular profiling has catalyzed a growing sense in the scientific community that the time is ripe to complete the 150-year-old effort to identify all cell types in the human body. The Human Cell Atlas Project is an international collaborative effort that aims to define all human cell types in terms of distinctive molecular profiles (such as gene expression profiles) and to connect this information with classical cellular descriptions (such as location and morphology). An open comprehensive reference map of the molecular state of cells in healthy human tissues would propel the systematic study of physiological states, developmental trajectories, regulatory circuitry and interactions of cells, and also provide a framework for understanding cellular dysregulation in human disease. Here we describe the idea, its potential utility, early proofs-of-concept, and some design considerations for the Human Cell Atlas, including a commitment to open data, code, and community.

  11. Topical retinoic acid changes the epidermal cell surface glycosylation pattern towards that of a mucosal epithelium

    DEFF Research Database (Denmark)

    Griffiths, C E; Dabelsteen, Erik; Voorhees, J J

    1996-01-01

    Topical all-trans retinoic acid (RA) produces a number of epidermal changes which are indistinguishable from those observed following treatment with a local irritant, namely sodium lauryl sulphate (SLS). This observation has led to criticism that the efficacy of RA in disorders such as photoageing...

  12. Topical grape seed proanthocyandin extract reduces sunburn cells and mutant p53 positive epidermal cell formation, and prevents depletion of Langerhans cells in an acute sunburn model.

    Science.gov (United States)

    Yuan, Xiao-Ying; Liu, Wei; Hao, Jian-Chun; Gu, Wei-Jie; Zhao, Yan-Shuang

    2012-01-01

    The purpose of this study was to investigate whether grape seed proanthocyanidin extract (GSPE) can provide photoprotection against ultraviolet (UV) irradiation. Study has shown that GSPE is a natural oxidant, and is used in many fields such as ischemia-reperfusion injury, chronic pancreatitis, and even cancer. However, the effect of GSPE on UV irradiation is as yet unknown. Cutaneous areas on the backs of normal volunteers were untreated or treated with GSPE solutions or vehicles 30 min before exposure to two minimal erythema doses (MED) of solar simulated radiation. Cutaneous areas at different sites were examined histologically for the number of sunburn cells, or immunohistochemically for Langerhans cells and mutant p53 epidermal cells. On histological and immunohistochemical examination, skin treated with GSPE before UV radiation showed fewer sunburn cells and mutant p53-positive epidermal cells and more Langerhans cells compared with skin treated with 2-MED UV radiation only (p<0.001, p<0.001, and p<0.01, respectively). GSPE may be a possible preventive agent for photoprotection.

  13. Vitamin D3 targets epidermal and dermal dendritic cells for induction of distinct regulatory T cells

    NARCIS (Netherlands)

    van der Aar, Angelic M. G.; Sibiryak, Darya S.; Bakdash, Ghaith; van Capel, Toni M. M.; van der Kleij, Hanneke P. M.; Opstelten, Dirk-Jan E.; Teunissen, Marcel B. M.; Kapsenberg, Martien L.; de Jong, Esther C.

    2011-01-01

    Background: The vitamin D metabolite 1,25(OH) 2D3 (VitD3) is a potent immunosuppressive drug and, among others, is used for topical treatment of psoriasis. A proposed mechanism of VitD3-mediated suppression is priming of dendritic cells (DCs) to induce regulatory T (Treg) cells. Objective:

  14. Effect and Mechanism of EGFL7 Downregulation in Human Osteosarcoma Cells on the Biological Function of Co-cultured HUVEC

    Directory of Open Access Journals (Sweden)

    Xia Li

    2018-03-01

    Full Text Available Background: Even though epidermal growth factor-like domain 7 is known to be overexpressed in osteosarcoma and is associated with poor clinical outcome, few reports are available regarding its mechanism. Aims: The objective of this study was to explore the effect and mechanism of downregulating epidermal growth factor-like domain 7 expression in a human osteosarcoma cell line on the biological function of co-cultured human umbilical vein endothelial cells. Study Design: Cell study. Methods: In the present study, human osteosarcoma cell lines U2OS, Saos-2, HOS, and MG63, and normal human osteoblasts were cultured in Dulbecco’s Modified Eagle Medium containing 10% fetal bovine serum and 1x antibiotics at 37 °C and 5% CO2 in an incubator. Of the four osteosarcoma cell lines, U2OS expresses the highest level of epidermal growth factor-like domain 7 mRNA as determined using quantitative reverse transcription polymerase chain reaction. With the knockdown of epidermal growth factor-like domain 7 in U2OS and human umbilical vein endothelial cells by lentivirus, the proliferation and apoptosis of U2OS and human umbilical vein endothelial cells were investigated using MTT and flow cytometry assays. After the co-culture of human umbilical vein endothelial cells and epidermal growth factor-like domain 7-knockdown U2OS, the in vitro effects on cell proliferation, apoptosis, adhesion, migration, and the angiogenic ability of human umbilical vein endothelial cells were detected using MTT, flow cytometry, Transwell, and tube formation assays, respectively. The expressions of phosphoinositide 3-kinase, phospho-Akt, total Akt, and vascular endothelial growth factor in human umbilical vein endothelial cells were detected using western blot assay. Results: Lentivirus with epidermal growth factor-like domain 7 shRNA could not significantly affect the proliferation and apoptosis of both U2OS and human umbilical vein endothelial cells, whereas the knockdown of

  15. Matriptase promotes inflammatory cell accumulation and progression of established epidermal tumors

    DEFF Research Database (Denmark)

    Sales, K U; Friis, S; Abusleme, L

    2015-01-01

    Deregulation of matriptase is a consistent feature of human epithelial cancers and correlates with poor disease outcome. We have previously shown that matriptase promotes multi-stage squamous cell carcinogenesis in transgenic mice through dual activation of pro-hepatocyte growth factor-cMet-Akt-m...

  16. Induction of suppression of delayed type hypersensitivity to herpes simplex virus by epidermal cells exposed to UV-irradiated urocanic acid in vivo

    International Nuclear Information System (INIS)

    Ross, J.A.; Howie, S.E.; Norval, M.; Maingay, J.P.

    1987-01-01

    Urocanic acid (UCA), the putative photoreceptor for ultraviolet radiation (UV)-induced suppression, undergoes a UV-dependent trans to cis isomerisation. Epidermal cells from mice painted with UCA, containing a known proportion of the cis-isomer, generate suppression of the delayed type hypersensitivity response to herpes simplex virus type 1 (HSV-1) when transferred to naive syngeneic recipients at the same time and site as infection with HSV-1. One T suppressor cell subset, of phenotype (Thy1+, L3T4+, Ly2-), is induced by the cis-UCA modified epidermal cell transfer. Flow cytometric analysis of the epidermal cells from skin treated with UV or cis-UCA indicates an overall reduction from normal in the number of cells expressing MHC Class II antigens, but no alteration in the number expressing I-J antigens

  17. Size-dependent effects of tungsten carbide-cobalt particles on oxygen radical production and activation of cell signaling pathways in murine epidermal cells

    International Nuclear Information System (INIS)

    Ding, M.; Kisin, E.R.; Zhao, J.; Bowman, L.; Lu, Y.; Jiang, B.; Leonard, S.; Vallyathan, V.; Castranova, V.; Murray, A.R.; Fadeel, B.; Shvedova, A.A.

    2009-01-01

    Hard metal or cemented carbide consists of a mixture of tungsten carbide (WC) (85%) and metallic cobalt (Co) (5-15%). WC-Co is considered to be potentially carcinogenic to humans. However, no comparison of the adverse effects of nano-sized WC-Co particles is available to date. In the present study, we compared the ability of nano- and fine-sized WC-Co particles to form free radicals and propensity to activate the transcription factors, AP-1 and NF-κB, along with stimulation of mitogen-activated protein kinase (MAPK) signaling pathways in a mouse epidermal cell line (JB6 P + ). Our results demonstrated that nano-WC-Co generated a higher level of hydroxyl radicals, induced greater oxidative stress, as evidenced by a decrease of GSH levels, and caused faster JB6 P + cell growth/proliferation than observed after exposure of cells to fine WC-Co. In addition, nano-WC-Co activated AP-1 and NF-κB more efficiently in JB6 +/+ cells as compared to fine WC-Co. Experiments using AP-1-luciferase reporter transgenic mice confirmed the activation of AP-1 by nano-WC-Co. Nano- and fine-sized WC-Co particles also stimulated MAPKs, including ERKs, p38, and JNKs with significantly higher potency of nano-WC-Co. Finally, co-incubation of the JB6 +/+ cells with N-acetyl-cysteine decreased AP-1 activation and phosphorylation of ERKs, p38 kinase, and JNKs, thus suggesting that oxidative stress is involved in WC-Co-induced toxicity and AP-1 activation.

  18. Biodistribution of 99mTc-labeled anti-human epidermal growth factor receptor (EGF-R) humanized monoclonal antibody h-R3 in a xenograft model of human lung adenocarcinoma

    International Nuclear Information System (INIS)

    Morales-Morales, Alejo; Duconge, Jorge; Caballero-Torres, Idania; Nunez-Gandolff, Gilda; Fernandez, Eduardo; Iznaga-Escobar, Normando

    1999-01-01

    The anti-human epidermal growth factor receptor (EGF-R) humanized monoclonal antibody (MAb) h-R3 is an (IgG 1 ), which binds to an extracellular domain of EGF-R. It was used to evaluate the biodistribution on nude mice xenografted with H-125 human lung adenocarcinoma cell line. Results were compared with its murine version of the MAb ior-egf/r3. Twenty-one athymic female 4NMRI nu/nu mice were injected intraperitoneally with 10 μg/100 μCi of 99m Tc-labeled MAbs. Immunoreactivity of 99m Tc-labeled MAbs were measured by enzyme-linked immunosorbent assay (ELISA) on H-125 cell line and the immunoreactive fractions was determined by the Lindmo method. Among all organs, significant accumulation was found in serum (27.05 ± 2.08 %ID/g) and tumor (3.903 ± 0.89 %ID/g) at 4 h after injection. These values decreased to 5.03 ± 0.50 %ID/g and 2.19 ± 0.56 %ID/g for serum and tumor, respectively. The immunoreactive fraction was found to be 0.70, with a correlation coefficient r=0.9984. With the good biodistribution and tumor uptake of the 99m Tc-labeled humanized antibody h-R3, a phase I diagnostic clinical trial of tumor with epithelial origin should be pursued

  19. Biodistribution of {sup 99m}Tc-labeled anti-human epidermal growth factor receptor (EGF-R) humanized monoclonal antibody h-R3 in a xenograft model of human lung adenocarcinoma

    Energy Technology Data Exchange (ETDEWEB)

    Morales-Morales, Alejo; Duconge, Jorge; Caballero-Torres, Idania; Nunez-Gandolff, Gilda; Fernandez, Eduardo; Iznaga-Escobar, Normando E-mail: normando@ict.cim.sld.cu

    1999-04-01

    The anti-human epidermal growth factor receptor (EGF-R) humanized monoclonal antibody (MAb) h-R3 is an (IgG{sub 1}), which binds to an extracellular domain of EGF-R. It was used to evaluate the biodistribution on nude mice xenografted with H-125 human lung adenocarcinoma cell line. Results were compared with its murine version of the MAb ior-egf/r3. Twenty-one athymic female 4NMRI nu/nu mice were injected intraperitoneally with 10 {mu}g/100 {mu}Ci of {sup 99m}Tc-labeled MAbs. Immunoreactivity of {sup 99m}Tc-labeled MAbs were measured by enzyme-linked immunosorbent assay (ELISA) on H-125 cell line and the immunoreactive fractions was determined by the Lindmo method. Among all organs, significant accumulation was found in serum (27.05 {+-} 2.08 %ID/g) and tumor (3.903 {+-} 0.89 %ID/g) at 4 h after injection. These values decreased to 5.03 {+-} 0.50 %ID/g and 2.19 {+-} 0.56 %ID/g for serum and tumor, respectively. The immunoreactive fraction was found to be 0.70, with a correlation coefficient r=0.9984. With the good biodistribution and tumor uptake of the {sup 99m}Tc-labeled humanized antibody h-R3, a phase I diagnostic clinical trial of tumor with epithelial origin should be pursued.

  20. Alterations in epidermal growth factor receptors 1 and 2 in esophageal squamous cell carcinomas

    International Nuclear Information System (INIS)

    Gonzaga, Isabela Martins; Andreollo, Nelson Adami; Simão, Tatiana Almeida de; Pinto, Luis Felipe Ribeiro; Soares-Lima, Sheila Coelho; Santos, Paulo Thiago Souza de; Blanco, Tania Cristina Moita; Reis, Bruno Souza Bianchi de; Quintella, Danielle Carvalho; Oliveira, Ivanir Martins de; Faria, Paulo Antonio Silvestre de; Kruel, Cleber Dario Pinto

    2012-01-01

    Esophageal squamous cell carcinoma (ESCC) shows a 5-year survival rate below 10%, demonstrating the urgency in improving its treatment. Alterations in epidermal growth factor receptors are closely related to malignancy transformation in a number of tumors and recent successful targeted therapies have been directed to these molecules. Therefore, in this study, we analyzed the expression of EGFR and HER2 and evaluated EGFR mutation profile as well as the presence of mutations in hotspots of KRAS and BRAF in ESCC patients. We performed RT-qPCR, immunohistochemistry and Fluorescent in situ hybridization to determine EGFR and HER2 expression in ESCC patients, and direct sequencing and PCR-RFLP for mutations and polymorphism analysis. Our results showed an increased EGFR mRNA expression in tumors compared to surrounding tissue (p <0.05), with 11% of the cases presenting at least a four-fold difference between tumor and paired adjacent mucosa. EGFR protein overexpression was present only in 4% of the cases. The median expression of HER2 mRNA was not different between tumors and adjacent mucosa. Still, 7% of the tumors presented at least a 25-fold higher expression of this gene when compared to its paired counterpart. Immunohistochemical analysis revealed that 21% of the tumors were positive for HER2 (scores 2+ and 3+), although only 3+ tumors presented amplification of this gene. Mutation analysis for EGFR (exons 18-21), KRAS (codons 12 and 13) and BRAF (V600E) showed no mutations in any of the hotspots of these genes in almost 100 patients analyzed. EGFR presented synonymous polymorphisms at codon 836 (C>T) in 2.1% of the patients, and at codon 787 (G>A) in 79.2% of the cases. This last polymorphism was also evaluated in 304 healthy controls, which presented a similar frequency (73.7%) in comparison with ESCC patients. The absence of mutations of EGFR, KRAS and BRAF as well as the overexpression of EGFR and HER2 in less than 10% of the patients suggest that this

  1. The human cell atlas

    DEFF Research Database (Denmark)

    Regev, Aviv; Teichmann, Sarah A.; Lander, Eric S.

    2017-01-01

    The recent advent of methods for high-throughput single-cell molecular profiling has catalyzed a growing sense in the scientific community that the time is ripe to complete the 150-year-old effort to identify all cell types in the human body. The Human Cell Atlas Project is an international...... collaborative effort that aims to define all human cell types in terms of distinctive molecular profiles (such as gene expression profiles) and to connect this information with classical cellular descriptions (such as location and morphology). An open comprehensive reference map of the molecular state of cells...... in healthy human tissues would propel the systematic study of physiological states, developmental trajectories, regulatory circuitry and interactions of cells, and also provide a framework for understanding cellular dysregulation in human disease. Here we describe the idea, its potential utility, early...

  2. Arbuscular Mycorrhizal Fungi Elicit a Novel Intracellular Apparatus in Medicago truncatula Root Epidermal Cells before InfectionW⃞

    Science.gov (United States)

    Genre, Andrea; Chabaud, Mireille; Timmers, Ton; Bonfante, Paola; Barker, David G.

    2005-01-01

    The penetration of arbuscular mycorrhizal (AM) fungi through the outermost root tissues of the host plant is a critical step in root colonization, ultimately leading to the establishment of this ecologically important endosymbiotic association. To evaluate the role played by the host plant during AM infection, we have studied in vivo cellular dynamics within Medicago truncatula root epidermal cells using green fluorescent protein labeling of both the plant cytoskeleton and the endoplasmic reticulum. Targeting roots with Gigaspora hyphae has revealed that, before infection, the epidermal cell assembles a transient intracellular structure with a novel cytoskeletal organization. Real-time monitoring suggests that this structure, designated the prepenetration apparatus (PPA), plays a central role in the elaboration of the apoplastic interface compartment through which the fungus grows when it penetrates the cell lumen. The importance of the PPA is underlined by the fact that M. truncatula dmi (for doesn't make infections) mutants fail to assemble this structure. Furthermore, PPA formation in the epidermis can be correlated with DMI-dependent transcriptional activation of the Medicago early nodulin gene ENOD11. These findings demonstrate how the host plant prepares and organizes AM infection of the root, and both the plant–fungal signaling mechanisms involved and the mechanistic parallels with Rhizobium infection in legume root hairs are discussed. PMID:16284314

  3. Induction of tolerance to topically applied INCB using TNP-conjugated ultraviolet light-irradiated epidermal cells

    International Nuclear Information System (INIS)

    Sauder, D.N.; Tamaki, K.; Moshell, A.N.; Fujiwara, H.; Katz, S.I.

    1981-01-01

    Ultraviolet (uv) radiation has profound effects on the immune system both in vitro and in vivo. Recent studies, utilizing uv irradiation of intact animals, have focused on the suppressive effect of uv irradiation on the generation of allergic contact sensitization (ACS). To explore the mechanism(s) by which uv affects ACS, we used a recently described technique of sensitizing mice with the subcutaneous (s.c.) injection of haptenated epidermal cells. uv-treated or untreated mouse epidermal cells (EC) were conjugated with 1 mM trinitrobenzene sulfonate and injected s.c. into syngeneic recipients. Six days later the ear was challenged with 20 μl of 1% trinitrochlorobenzene (TNCB), and 24 h later ear thickness was measured. Our studies indicate that uv irradiation of EC prior to haptenation not only abrogates their capability of inducing ACS but also induces a state of specific immunologic tolerance. These studies indicate that the s.c. injection of trinitrophenyl conjugated (TNP) uv-irradiated (TNP-uv) EC induces a state of specific immunologic hyporesponsiveness, and passive transfer studies showed that this hyporesponsiveness is in part due to the generation of suppressor T-cells

  4. A Premature Termination of Human Epidermal Growth Factor Receptor Transcription in Escherichia coli

    Directory of Open Access Journals (Sweden)

    Jihene Elloumi-Mseddi

    2014-01-01

    Full Text Available Our success in producing an active epidermal growth factor receptor (EGFR tyrosine kinase in Escherichia coli encouraged us to express the full-length receptor in the same host. Despite its large size, we were successful at producing the full-length EGFR protein fused to glutathione S-transferase (GST that was detected by Western blot analysis. Moreover, we obtained a majoritarian truncated GST-EGFR form detectable by gel electrophoresis and Western blot. This truncated protein was purified and confirmed by MALDI-TOF/TOF analysis to belong to the N-terminal extracellular region of the EGFR fused to GST. Northern blot analysis showed two transcripts suggesting the occurrence of a transcriptional arrest.

  5. Potential involvement of oxygen intermediates and glutathione depletion in UV-induced epidermal cell injury in vitro

    International Nuclear Information System (INIS)

    Hsieh, G.C.; Acosta, D.

    1991-01-01

    Generation of reactive oxygen species (ROS) and depletion of glutathione (GSH) are suggested as the cytotoxic mechanisms for UVB-induced cellular damage. Primary monolayer cultures of epidermal keratinocytes (KCs) prepared from the skin of neonatal rats were irradiated with UVB at levels of 0.25-3.0 J/cm 2 . Cytotoxicity was measured at 3, 6, and 12 hr after UVB radiation. Exposure of KCs to UVB resulted in time- and dose-related toxic responses as determined by plasma membrane integrity, lysosomal function and mitochondrial metabolic activity. Irradiated KCs generated superoxide in a dose-dependent manner when compared to sham-irradiated cells. Superoxide formation, which occurred before and concomitant with cell injury, was decreased by superoxide dismutase (SOD). Cell injury was also significantly prevented by ROS scavengers, SOD and catalase. Pretreatment of cells with endocytosis inhibitors, cytochalasin B and methylamine, suppressed the ability of SOD and catalase to protect keratinocytes from UVB-induced toxicity. Irradiation of cells with UVB caused rapid depletion of GSH to about 30% of unirradiated levels within 15 min. UVB-irradiation led to a rapid transient increase in GSH peroxidase activity, concomitant with a marked decrease in the GSH/GSSG ratio. After 1 hr., while the GSH/GSSG ratio remained low, the GSH peroxidase activity declined below the control levels in UVB-treated epidermal cells. Following extensive GSH depletion in cells preincubated with 0.1 mM buthiomine sulfoximine, KCs became strongly sensitized to the cytotoxic action of UVB. These results indicate that UVB-induced cell injury in cultured KCs may be mediated by ROs and that endogenous GSH may play an important protective role against the cytotoxic action of UVB

  6. Phase III randomized study comparing docetaxel plus trastuzumab with vinorelbine plus trastuzumab as first-line therapy of metastatic or locally advanced human epidermal growth factor receptor 2-positive breast cancer: the HERNATA study

    DEFF Research Database (Denmark)

    Andersson, Michael; Lidbrink, Elisabeth; Bjerre, Karsten

    2011-01-01

    To evaluate docetaxel or vinorelbine, both with trastuzumab, as first-line therapy of human epidermal growth factor receptor 2-positive advanced breast cancer.......To evaluate docetaxel or vinorelbine, both with trastuzumab, as first-line therapy of human epidermal growth factor receptor 2-positive advanced breast cancer....

  7. Androgen and retinoic acid interaction in LNCaP cells, effects on cell proliferation and expression of retinoic acid receptors and epidermal growth factor receptor

    International Nuclear Information System (INIS)

    Li, Ming-tang; Richter, Frank; Chang, Chawnshang; Irwin, Robert J; Huang, Hosea FS

    2002-01-01

    Modulation of the expression of retinoic acid receptors (RAR) α and γ in adult rat prostate by testosterone (T) suggests that RAR signaling events might mediate some of the androgen effects on prostate cells. In this study, we examined the interactions between T and retinoic acid (RA) in cell growth of human prostate carcinoma cells, LNCaP, and their relationship with the expression of RAR and epidermal growth factor receptor (EGF-R). Both T and RA, when administered alone, stimulated 3 H-thymidine incorporation in LNCaP cells in a dose-dependent manner; the effect of each agent was reciprocally attenuated by the other agent. Testosterone treatment of LNCaP cells also resulted in dose dependent, biphasic increases in RAR α and γ mRNAs; increases paralleled that of 3 H-thymidine incorporation and were attenuated by the presence of 100 nM RA. These results suggest a link between RAR signaling and the effect of T on LNCaP cell growth. Gel electrophoretic mobility shift assays revealed the presence of putative androgen responsive element (ARE) in the promoter region of RAR α gene, suggesting that a direct AR-DNA interaction might mediate the effects of T on RAR α gene. Furthermore, treatment of LNCaP cells with 20 nM T resulted in an increase in EGF-R. In contrast, EGF-R was suppressed by 100 nM RA that also suppressed the effect of T. Current results demonstrate interactions between T and RA in the expression of RARs and cell growth in LNCaP cells. The presence of putative ARE in the promoter of the RAR α gene suggests that AR-DNA interaction might mediate the effects of T on RAR α gene. The opposite effects of T and RA on the expression of RAR and EGF-R suggest that signal events of these receptors might be involved in the interaction between T and RA in the control of LNCaP cell growth

  8. Androgen and retinoic acid interaction in LNCaP cells, effects on cell proliferation and expression of retinoic acid receptors and epidermal growth factor receptor

    Directory of Open Access Journals (Sweden)

    Irwin Robert J

    2002-06-01

    Full Text Available Abstract Background Modulation of the expression of retinoic acid receptors (RAR α and γ in adult rat prostate by testosterone (T suggests that RAR signaling events might mediate some of the androgen effects on prostate cells. Method In this study, we examined the interactions between T and retinoic acid (RA in cell growth of human prostate carcinoma cells, LNCaP, and their relationship with the expression of RAR and epidermal growth factor receptor (EGF-R. Results Both T and RA, when administered alone, stimulated 3H-thymidine incorporation in LNCaP cells in a dose-dependent manner; the effect of each agent was reciprocally attenuated by the other agent. Testosterone treatment of LNCaP cells also resulted in dose dependent, biphasic increases in RAR α and γ mRNAs; increases paralleled that of 3H-thymidine incorporation and were attenuated by the presence of 100 nM RA. These results suggest a link between RAR signaling and the effect of T on LNCaP cell growth. Gel electrophoretic mobility shift assays revealed the presence of putative androgen responsive element (ARE in the promoter region of RAR α gene, suggesting that a direct AR-DNA interaction might mediate the effects of T on RAR α gene. Furthermore, treatment of LNCaP cells with 20 nM T resulted in an increase in EGF-R. In contrast, EGF-R was suppressed by 100 nM RA that also suppressed the effect of T. Conclusions Current results demonstrate interactions between T and RA in the expression of RARs and cell growth in LNCaP cells. The presence of putative ARE in the promoter of the RAR α gene suggests that AR-DNA interaction might mediate the effects of T on RAR α gene. The opposite effects of T and RA on the expression of RAR and EGF-R suggest that signal events of these receptors might be involved in the interaction between T and RA in the control of LNCaP cell growth.

  9. Epidermal growth factor receptor antibody plus recombinant human endostatin in treatment of hepatic metastases after remnant gastric cancer resection

    Institute of Scientific and Technical Information of China (English)

    2007-01-01

    We report a 55-year-old male who developed advanced hepatic metastasis and peritoneal carcinomatosis after resection of remnant gastric cancer resection 3 mo ago. The patient only received epidermal growth factor (EGF) receptor antibody (Cetuximab) plus recombinant human endostatin (Endostar).Anti-tumor activity was assessed by 18F-fluorodeoxyglucose (18F-FDG)positron emission tomography/computer tomography (PET/CT) at baseline and then every 4 wk. The case illustrates that 18FDG-PET/CT could make an early prediction of the response to Cetuximab plus Endostar in such clinical situations. 18FDG-PET/CT is a useful molecular imaging modality to evaluate the biological response advanced hepatic metastasis and peritoneal carcinomatosis to Cetuximab plus Endostar in patients after remnant gastric cancer resection.

  10. Direct astatination of a tumour-binding protein, human epidermal growth factor, using nido-carborane as a prosthetic group

    International Nuclear Information System (INIS)

    Sjoestroem, A.; Carlsson, J.; Lundqvist, H.; Koziorowski, J.

    2003-01-01

    A method for direct astatine labeling of proteins has been investigated. Binding sites for astatine were created by coupling of a nido-carborane derivative to a protein, the human epidermal growth factor (hEGF), using two different conjugation methods - by glutaraldehyde cross-linking or by introduction of sulfohydryl groups by Traut's reagent with subsequent linking of ANC-1 with m-maleimidobenzoyl-N-hydroxysulfosuccinimide ester. The conjugates were astatinated using the Chloramine-T method in high yield. The best labeling was obtained by the glutaraldehyde conjugate with an average yield of 68 ± 9%. In vitro stability tests indicated that the glutaraldehyde conjugated label was as stable as hEGF labeled with astatobenzoate. (author)

  11. Harnessing Integrative Omics to Facilitate Molecular Imaging of the Human Epidermal Growth Factor Receptor Family for Precision Medicine.

    Science.gov (United States)

    Pool, Martin; de Boer, H Rudolf; Hooge, Marjolijn N Lub-de; van Vugt, Marcel A T M; de Vries, Elisabeth G E

    2017-01-01

    Cancer is a growing problem worldwide. The cause of death in cancer patients is often due to treatment-resistant metastatic disease. Many molecularly targeted anticancer drugs have been developed against 'oncogenic driver' pathways. However, these treatments are usually only effective in properly selected patients. Resistance to molecularly targeted drugs through selective pressure on acquired mutations or molecular rewiring can hinder their effectiveness. This review summarizes how molecular imaging techniques can potentially facilitate the optimal implementation of targeted agents. Using the human epidermal growth factor receptor (HER) family as a model in (pre)clinical studies, we illustrate how molecular imaging may be employed to characterize whole body target expression as well as monitor drug effectiveness and the emergence of tumor resistance. We further discuss how an integrative omics discovery platform could guide the selection of 'effect sensors' - new molecular imaging targets - which are dynamic markers that indicate treatment effectiveness or resistance.

  12. Thermal analysis of epidermal electronic devices integrated with human skin considering the effects of interfacial thermal resistance

    Science.gov (United States)

    Li, Yuhang; Zhang, Jianpeng; Xing, Yufeng; Song, Jizhou

    2018-05-01

    Epidermal electronic devices (EEDs) have similar mechanical properties as those of human skin such that they can be integrated with human skin for potential applications in monitoring of human vital signs for diagnostic, therapeutic or surgical functions. Thermal management is critical for EEDs in these applications since excessive heating may cause discomfort. Comprehensive analytical studies, finite element analysis and experiments are carried out to study the effects of interfacial thermal resistance between EEDs and human skin on thermal properties of the EED/skin system in this paper. The coupling between the Fourier heat transfer in EEDs and the bio-heat transfer in human skin is accounted in the analytical model based on the transfer matrix method to give accurate predictions on temperatures, which agree well with finite element analysis and experimental measurements. It is shown that the maximum temperature increase of the EED for the case of imperfect bonding between EED and skin is much higher than that of perfect bonding. These results may help the design of EEDs in bi-integrated applications and suggest a valuable route to evaluate the bonding condition between EEDs and biological tissues.

  13. Structure and function of the Juxta membrane domain of the human epidermal growth factor receptor by NMR spectroscopy

    International Nuclear Information System (INIS)

    Choowongkomon, Kiattawee; Carlin, Cathleen; Sonnichsen, Frank D.

    2005-10-01

    The epidermal growth factor receptor (EGFR) is a member of the receptor tyrosine kinase family involved in the regulation of cellular proliferation and differentiation. Its juxta membrane domain (JX), the region located between the transmembrane and kinase domains, plays important roles in receptor trafficking since both basolateral sorting in polarized epithelial cells and lysosomal sorting signals are identified in this region. In order to understand the regulation of these signals, we characterized the structural properties of recombinant JX domain in dodecyl phosphocholine detergent (DPC) by nuclear magnetic resonance (NMR) spectroscopy. In DPC micelles, structures derived from NMR data showed three amphipathic, helical segments. Two equivalent average structural models on the surface of micelles were obtained that differ only in the relative orientation between the first and second helices. Our data suggests that the activity of sorting signals may be regulated by their membrane association and restricted accessibility in the intact receptor

  14. American Society of Clinical Oncology/College of American Pathologists guideline recommendations for human epidermal growth factor receptor 2 testing in breast cancer

    NARCIS (Netherlands)

    Wolff, Antonio C.; Hammond, M. Elizabeth H.; Schwartz, Jared N.; Hagerty, Karen L.; Allred, D. Craig; Cote, Richard J.; Dowsett, Mitchell; Fitzgibbons, Patrick L.; Hanna, Wedad M.; Langer, Amy; McShane, Lisa M.; Paik, Soonmyung; Pegram, Mark D.; Perez, Edith A.; Press, Michael F.; Rhodes, Anthony; Sturgeon, Catharine; Taube, Sheila E.; Tubbs, Raymond; Vance, Gail H.; van de Vijver, Marc; Wheeler, Thomas M.; Hayes, Daniel F.

    2007-01-01

    PURPOSE: To develop a guideline to improve the accuracy of human epidermal growth factor receptor 2 (HER2) testing in invasive breast cancer and its utility as a predictive marker. METHODS: The American Society of Clinical Oncology and the College of American Pathologists convened an expert panel,

  15. Cell-cell adhesion mediated by binding of membrane-anchored transforming growth factor α to epidermal growth factor receptors promotes cell proliferation

    International Nuclear Information System (INIS)

    Anklesaria, P.; Greenberger, J.S.; Teixido, J.; Laiho, M.; Massague, J.; Pierce, J.H.

    1990-01-01

    The precursor for transforming growth factor α, pro-TGF-α, is a cell surface glycoprotein that can establish contact with epidermal growth factor (EGF) receptors on adjacent cells. To examine whether the pro-TGF-α/EGF receptor pair can simultaneously mediate cell adhesion and promote cell proliferation, the authors have expressed pro-TGF-α in a bone marrow stromal cell line labeled with [ 35 S] cysteine. Expression of pro-TGF-α allows these cells to support long-term attachment of an EGF/interleukin-3-dependent hematopoietic progenitor cell line that expresses EGF receptors but is unable to adhere to normal stroma. This interaction is inhibited by soluble EGF receptor ligands. Further, the hematopoietic progenitor cells replicate their DNA while they are attached to the stromal cell layer and become foci of sustained cell proliferation. Thus, pro-TGF-α and the EGF receptor can function as mediators of intercellular adhesion and this interaction may promote a mitogenic response. They propose the term juxtacrine to designate this form of stimulation between adjacent cells

  16. Regulators of floral fragrance production and their target genes in petunia are not exclusively active in the epidermal cells of petals.

    NARCIS (Netherlands)

    Van Moerkercke, A.; Galván-Ampudia, C.S.; Verdonk, J.C.; Haring, M.A.; Schuurink, R.C.

    2012-01-01

    In which cells of the flower volatile biosynthesis takes place is unclear. In rose and snapdragon, some enzymes of the volatile phenylpropanoid/benzenoid pathway have been shown to be present in the epidermal cells of petals. It is therefore generally believed that the production of these compounds

  17. Experimental radioimmunotherapy of a xenografted human glioma using [sup 131]I-labeled monoclonal antibody to epidermal growth factor receptor

    Energy Technology Data Exchange (ETDEWEB)

    Takahashi, Hiroshi; Nakazawa, Shozo [Nippon Medical School, Tokyo (Japan); Herlyn, D

    1993-09-01

    [sup 131]I-labeled F (ab')[sub 2] fragments of murine monoclonal antibodies (MAb) 425 specific to the epidermal growth factor receptor expressed on human gliomas were used in experimental human malignant glioma immunotherapy. Two injections of 150 [mu]Ci [sup 131]I-labeled 425 F(ab')[sub 2] achieved growth inhibition of U-87MG human malignant glioma xenografts in nude mice. This radiolabeled specific MAb F(ab')[sub 2] was significantly superior to radiolabeled fragments of an anti-hepatitis virus control MAb A5C3 in influencing tumor growth. However, similar treatment of established human malignant glioma xenografts did not inhibit progressive tumor growth significantly. No clear tumor inhibition was produced by unlabeled MAb 425F(ab')[sub 2]. These studies suggest that [sup 131]I-labeled MAbs have a significant antitumor effect where unmodified antibody is ineffective. Multiple doses of antibody may achieve an increase in labeled MAb concentration in tumors. (author).

  18. In Vitro Responsiveness of Glioma Cell Lines to Multimodality Treatment With Radiotherapy, Temozolomide, and Epidermal Growth Factor Receptor Inhibition With Cetuximab

    International Nuclear Information System (INIS)

    Combs, Stephanie E.; Schulz-Ertner, Daniela; Roth, Wilfried; Herold-Mende, Christel; Debus, Juergen; Weber, Klaus-Josef

    2007-01-01

    Background: The majority of glioblastoma multiforme (GBM) cells express the epidermal growth factor receptor (EGFR). The present study evaluates the combination of temozolomide (TMZ), EGFR inhibition, and radiotherapy (RT) in GBM cell lines. Methods and Materials: Human GBM cell lines U87, LN229, LN18, NCH 82, and NCH 89 were treated with various combinations of TMZ, RT, and the monoclonal EGFR antibody cetuximab. Responsiveness of glioma cells to the combination treatment was measured by clonogenic survival. Results: Overall, double and triple combinations of RT, TMZ, and cetuximab lead to additive cytotoxic effects (independent toxicity). A notable exception was observed for U87 and LN 18 cell lines, where the combination of TMZ and cetuximab showed substantial antagonism. Interestingly, in these two cell lines, the combination of RT with cetuximab resulted in a substantial increase in cell killing over that expected for independent toxicity. The triple combination with RT, cetuximab, and TMZ was nearly able to overcome the antagonism for the TMZ/cetuximab combination in U87, however only marginally in LN18, GBM cell lines. Conclusion: It appears that EGFR expression is not correlated with cytotoxic effects exerted by cetuximab. Combination treatment with TMZ, cetuximab and radiation resulted in independent toxicity in three out of five cell lines evaluated, the antagonistic effect of the TMZ/cetuximab combination in two cell lines could indicate that TMZ preferentially kills cetuximab-resistant cells, suggesting for some cross-talk between toxicity mechanisms. Expression of EGFR was no surrogate marker for responsiveness to cetuximab, alone or in combination with RT and TMZ

  19. Recycling of epidermal growth factor-receptor complexes in A431 cells: Identification of dual pathways

    International Nuclear Information System (INIS)

    Sorkin, A.; Krolenko, S.; Kudrjavtceva, N.; Lazebnik, J.; Teslenko, L.; Soderquist, A.M.; Nikolsky, N.

    1991-01-01

    The intracellular sorting of EGF-receptor complexes (EGF-RC) has been studied in human epidermoid carcinoma A431 cells. Recycling of EGF was found to occur rapidly after internalization at 37 degrees C. The initial rate of EGF recycling was reduced at 18 degrees C. A significant pool of internalized EGF was incapable of recycling at 18 degrees C but began to recycle when cells were warmed to 37 degrees C. The relative rate of EGF outflow at 37 degrees C from cells exposed to an 18 degrees C temperature block was slower (t1/2 approximately 20 min) than the rate from cells not exposed to a temperature block (t1/2 approximately 5-7 min). These data suggest that there might be both short- and long-time cycles of EGF recycling in A431 cells. Examination of the intracellular EGF-RC dissociation and dynamics of short- and long-time recycling indicated that EGF recycled as EGF-RC. Moreover, EGF receptors that were covalently labeled with a photoactivatable derivative of 125 I-EGF recycled via the long-time pathway at a rate similar to that of 125 I-EGF. Since EGF-RC degradation was also blocked at 18 degrees C, we propose that sorting to the lysosomal and long-time recycling pathway may occur after a highly temperature-sensitive step, presumably in the late endosomes

  20. Filaggrin silencing by shRNA directly impairs the skin barrier function of normal human epidermal keratinocytes and then induces an immune response

    Energy Technology Data Exchange (ETDEWEB)

    Dang, N.N. [Department of Dermatology, Jinan Central Hospital Affiliated to Shandong University, Jinan, Shandong Province (China); College of Life Science, Shandong Normal University, Jinan, Shandong Province (China); Pang, S.G. [Department of Endocrinology, Jinan Central Hospital Affiliated to Shandong University, Jinan, Shandong Province (China); Song, H.Y. [Department of Dermatology, Jinan Central Hospital Affiliated to Shandong University, Jinan, Shandong Province (China); An, L.G. [College of Life Science, Shandong Normal University, Jinan, Shandong Province (China); Ma, X.L. [Central Laboratory, Jinan Central Hospital Affiliated to Shandong University, Jinan, Shandong Province (China)

    2014-11-14

    The objective of this study was to investigate whether a single defect in skin barrier function simulated by filaggrin silencing could induce Th2-predominant inflammation. Filaggrin gene expression was silenced in cultured normal human epidermal keratinocytes (NHEKs) using small hairpin RNA (shRNA, GTTGGCTCAAGCATATTATTT). The efficacy of silencing was confirmed by polymerase chain reaction (PCR) and Western blotting. Filaggrin-silenced cells (LV group), shRNA control cells (NC group), and noninfected cells (Blank group) were evaluated. The expression of cornified cell envelope-related proteins, including cytokeratin (CK)-5, -10, -14, loricrin, involucrin, and transglutaminase (TGM)-1, was detected by Western blotting. Interleukins (IL)-2, IL-4, IL-5, IL-12p70, IL-13, and interferon-gamma (IFN-γ) were detected by enzyme-linked immunosorbent assay (ELISA). After filaggrin was successfully silenced by shRNA, the expressions of CK-5, -10, -14, involucrin, and TGM-1 in NHEKs were significantly downregulated compared to the Blank and NC groups (P<0.05 or P<0.01); only loricrin expression was markedly upregulated (P<0.01). Filaggrin silencing also resulted in significant increases of IL-2, IL-4, IL-5, and IL-13 (P<0.05 or P<0.01), and significant decreases of IL-12p70 and IFN-γ (P<0.01) compared with cells in the Blank and NC groups. Filaggrin silencing impaired normal skin barrier function mainly by targeting the cornified cell envelope. The immune response after filaggrin silencing was characterized by Th2 cells, mainly because of the inhibition of IFN-γ expression. Lack of filaggrin may directly impair skin barrier function and then further induce the immune response.

  1. Epidermal growth factor prevents thallium(I)- and thallium(III)-mediated rat pheochromocytoma (PC12) cell apoptosis.

    Science.gov (United States)

    Pino, María Teresa Luján; Marotte, Clarisa; Verstraeten, Sandra Viviana

    2017-03-01

    We have reported recently that the proliferation of PC12 cells exposed to micromolar concentrations of Tl(I) or Tl(III) has different outcomes, depending on the absence (EGF - cells) or the presence (EGF + cells) of epidermal growth factor (EGF) added to the media. In the current work, we investigated whether EGF supplementation could also modulate the extent of Tl(I)- or Tl(III)-induced cell apoptosis. Tl(I) and Tl(III) (25-100 μM) decreased cell viability in EGF - but not in EGF + cells. In EGF - cells, Tl(I) decreased mitochondrial potential, enhanced H 2 O 2 generation, and activated mitochondrial-dependent apoptosis. In addition, Tl(III) increased nitric oxide production and caused a misbalance between the anti- and pro-apoptotic members of Bcl-2 family. Tl(I) increased ERK1/2, JNK, p38, and p53 phosphorylation in EGF - cells. In these cells, Tl(III) did not affect ERK1/2 and JNK phosphorylation but increased p53 phosphorylation that was related to the promotion of cell senescence. In addition, this cation significantly activated p38 in both EGF - and EGF + cells. The specific inhibition of ERK1/2, JNK, p38, or p53 abolished Tl(I)-mediated EGF - cell apoptosis. Only when p38 activity was inhibited, Tl(III)-mediated apoptosis was prevented in EGF - and EGF + cells. Together, current results indicate that EGF partially prevents the noxious effects of Tl by preventing the sustained activation of MAPKs signaling cascade that lead cells to apoptosis and point to p38 as a key mediator of Tl(III)-induced PC12 cell apoptosis.

  2. Multiple Mechanisms are Responsible for Transactivation of the Epidermal Growth Factor Receptor in Mammary Epithelial Cells

    Energy Technology Data Exchange (ETDEWEB)

    Rodland, Karin D.; Bollinger, Nikki; Ippolito, Danielle L.; Opresko, Lee; Coffey, Robert J.; Zangar, Richard C.; Wiley, H. S.

    2008-11-14

    REVIEW ENTIRE DOCUMENT AT: https://pnlweb.pnl.gov/projects/bsd/ERICA%20Manuscripts%20for%20Review/KD%20Rodland%20D7E80/HMEC_transactivation_ms01_15+Figs.pdf ABSTRACT: Using a single nontransformed strain of human mammary epithelial cells, we found that the ability of multiple growth factors and cytokines to induce ERK phosphorylation was dependent on EGFR activity. These included lysophosphatidic acid (LPA), uridine triphosphate, growth hormone, vascular endothelial growth factor, insulin-like growth factor-1 (IGF-1), and tumor necrosis factoralpha. In contrast, hepatocyte growth factor could stimulate ERK phosphorylation independent of EGFR activity...

  3. Cytogenetic evaluation of human glial tumors: correlation of overexpression of epidermal growth factor receptor (EGFB) with abnormalities of chromosome 7

    International Nuclear Information System (INIS)

    Bell, C.W.

    1987-01-01

    Chromosome banding analysis of human glial tumors were performed using G- and Q-banding techniques in an attempt to establish recurring sites of chromosome change. Results revealed a nonrandom karyotypic profile including aneuploidy and considerable variation in chromosome number (range 40 → 200). All tumors examined displayed numerical abnormalities, with the most common numeric change being a gain of chromosome 7. An attempt was then made to correlate the observed chromosome 7 changes with activation of the cellular proto-oncogene c-erb-B, whose produce is the epidermal growth factor receptor (EGFR). Six human glial tumors were analyzed for 125 I-EGF binding, EGFR gene copy number, EGFR gene rearrangement, mRNA expression, and karyotypic profile. Saturation analysis at 4 0 C revealed significant numbers of EGFR's in all 6 tumors. Southern blotting analysis utilizing cDNA probes for the EGFR failed to demonstrate significant amplification or structural rearrangement of the EFGR gene. The results suggest that overexpression of the EGFR may be related to an alternative mechanism, other than gene amplification and elevated mRNA levels, such as the regulation of receptor biosynthesis and degradation. In summary, findings indicate that alterations of chromosome 7 are the most prevalent chromosomal change in human glial tumors, and that these alterations may lead to overexpression of the protooncogene c-erb-B

  4. Upregulated epidermal growth factor receptor expression following near-infrared irradiation simulating solar radiation in a three-dimensional reconstructed human corneal epithelial tissue culture model.

    Science.gov (United States)

    Tanaka, Yohei; Nakayama, Jun

    2016-01-01

    Humans are increasingly exposed to near-infrared (NIR) radiation from both natural (eg, solar) and artificial (eg, electrical appliances) sources. Although the biological effects of sun and ultraviolet (UV) exposure have been extensively investigated, the biological effect of NIR radiation is still unclear. We previously reported that NIR as well as UV induces photoaging and standard UV-blocking materials, such as sunglasses, do not sufficiently block NIR. The objective of this study was to investigate changes in gene expression in three-dimensional reconstructed corneal epithelial tissue culture exposed to broad-spectrum NIR irradiation to simulate solar NIR radiation that reaches human tissues. DNA microarray and quantitative real-time polymerase chain reaction analysis were used to assess gene expression levels in a three-dimensional reconstructed corneal epithelial model composed of normal human corneal epithelial cells exposed to water-filtered broad-spectrum NIR irradiation with a contact cooling (20°C). The water-filter allowed 1,000-1,800 nm wavelengths and excluded 1,400-1,500 nm wavelengths. A DNA microarray with >62,000 different probes showed 25 and 150 genes that were up- or downregulated by at least fourfold and twofold, respectively, after NIR irradiation. In particular, epidermal growth factor receptor (EGFR) was upregulated by 19.4-fold relative to control cells. Quantitative real-time polymerase chain reaction analysis revealed that two variants of EGFR in human corneal epithelial tissue were also significantly upregulated after five rounds of 10 J/cm(2) irradiation (Psolar energy reaching the Earth is in the NIR region, which cannot be adequately blocked by eyewear and thus can induce eye damage with intensive or long-term exposure, protection from both UV and NIR radiation may prevent changes in gene expression and in turn eye damage.

  5. Simultaneous screening of four epidermal growth factor receptor antagonists from Curcuma longa via cell membrane chromatography online coupled with HPLC-MS.

    Science.gov (United States)

    Sun, Meng; Ma, Wei-na; Guo, Ying; Hu, Zhi-gang; He, Lang-chong

    2013-07-01

    The epidermal growth factor receptors (EGFRs) are significant targets for screening active compounds. In this work, an analytical method was established for rapid screening, separation, and identification of EGFRs antagonists from Curcuma longa. Human embryonic kidney 293 cells with a steadily high expression of EGFRs were used to prepare the cell membrane stationary phase in a cell membrane chromatography model for screening active compounds. Separation and identification of the retention chromatographic peaks was achieved by HPLC-MS. The active sites, docking extents and inhibitory effects of the active compounds were also demonstrated. The screening result found that ar-turmerone, curcumin, demethoxycurcumin, and bisdemethoxycurcumin from Curcuma longa could be active components in a similar manner to gefitinib. Biological trials showed that all of four compounds can inhibit EGFRs protein secretion and cell growth in a dose-dependent manner, and downregulate the phosphorylation of EGFRs. This analytical method demonstrated fast and effective characteristics for screening, separation and identification of the active compounds from a complex system and should be useful for drug discovery with natural medicinal herbs. © 2013 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  6. Myosin II activity is required for functional leading-edge cells and closure of epidermal sheets in fish skin ex vivo.

    Science.gov (United States)

    Morita, Toshiyuki; Tsuchiya, Akiko; Sugimoto, Masazumi

    2011-09-01

    Re-epithelialization in skin wound healing is a process in which epidermal sheets grow and close the wound. Although the actin-myosin system is thought to have a pivotal role in re-epithelialization, its role is not clear. In fish skin, re-epithelialization occurs around 500 μm/h and is 50 times faster than in mammalian skin. We had previously reported that leading-edge cells of the epidermal outgrowth have both polarized large lamellipodia and "purse string"-like actin filament cables in the scale-skin culture system of medaka fish, Oryzias latipes (Cell Tissue Res, 2007). The actin purse-string (APS) is a supracellular contractile machinery in which adherens junctions (AJs) link intracellular myosin II-including actin cables between neighboring cells. In this study, we developed a modified "face-to-face" scale-skin culture system as an ex vivo model to study epidermal wound healing, and examined the role of the actin-myosin system in the rapid re-epithelialization using a myosin II ATPase inhibitor, blebbistatin. A low level of blebbistatin suppressed the formation of APS and induced the dissociation of keratocytes from the leading edge without attenuating the growth of the epidermal sheet or the migration rate of solitary keratocytes. AJs in the superficial layer showed no obvious changes elicited by blebbistatin. However, two epidermal sheets without APSs did not make a closure with each other, which was confirmed by inhibiting the connecting AJs between the superficial layers. These results suggest that myosin II activity is required for functional leading-edge cells and for epidermal closure.

  7. Comet assay in reconstructed 3D human epidermal skin models—investigation of intra- and inter-laboratory reproducibility with coded chemicals

    Science.gov (United States)

    Pfuhler, Stefan

    2013-01-01

    Reconstructed 3D human epidermal skin models are being used increasingly for safety testing of chemicals. Based on EpiDerm™ tissues, an assay was developed in which the tissues were topically exposed to test chemicals for 3h followed by cell isolation and assessment of DNA damage using the comet assay. Inter-laboratory reproducibility of the 3D skin comet assay was initially demonstrated using two model genotoxic carcinogens, methyl methane sulfonate (MMS) and 4-nitroquinoline-n-oxide, and the results showed good concordance among three different laboratories and with in vivo data. In Phase 2 of the project, intra- and inter-laboratory reproducibility was investigated with five coded compounds with different genotoxicity liability tested at three different laboratories. For the genotoxic carcinogens MMS and N-ethyl-N-nitrosourea, all laboratories reported a dose-related and statistically significant increase (P 30% cell loss), and the overall response was comparable in all laboratories despite some differences in doses tested. The results of the collaborative study for the coded compounds were generally reproducible among the laboratories involved and intra-laboratory reproducibility was also good. These data indicate that the comet assay in EpiDerm™ skin models is a promising model for the safety assessment of compounds with a dermal route of exposure. PMID:24150594

  8. Impaired degradation followed by enhanced recycling of epidermal growth factor receptor caused by hypo-phosphorylation of tyrosine 1045 in RBE cells

    International Nuclear Information System (INIS)

    Gui, Anping; Kobayashi, Akira; Motoyama, Hiroaki; Kitazawa, Masato; Takeoka, Michiko; Miyagawa, Shinichi

    2012-01-01

    Since cholangiocarcinoma has a poor prognosis, several epidermal growth factor receptor (EGFR)-targeted therapies with antibody or small molecule inhibitor treatment have been proposed. However, their effect remains limited. The present study sought to understand the molecular genetic characteristics of cholangiocarcinoma related to EGFR, with emphasis on its degradation and recycling. We evaluated EGFR expression and colocalization by immunoblotting and immunofluorescence, cell surface EGFR expression by fluorescence-activated cell sorting (FACS), and EGFR ubiquitination and protein binding by immunoprecipitation in the human cholangiocarcinoma RBE and immortalized cholangiocyte MMNK-1 cell lines. Monensin treatment and Rab11a depletion by siRNA were adopted for inhibition of EGFR recycling. Upon stimulation with EGF, ligand-induced EGFR degradation was impaired and the expression of phospho-tyrosine 1068 and phospho-p44/42 MAPK was sustained in RBE cells as compared with MMNK-1 cells. In RBE cells, the process of EGFR sorting for lysosomal degradation was blocked at the early endosome stage, and non-degradated EGFR was recycled to the cell surface. A disrupted association between EGFR and the E3 ubiquitin ligase c-Cbl, as well as hypo-phosphorylation of EGFR at tyrosine 1045 (Tyr1045), were also observed in RBE cells. In RBE cells, up-regulation of EGFR Tyr1045 phosphorylation is a potentially useful molecular alteration in EGFR-targeted therapy. The combination of molecular-targeted therapy determined by the characteristics of individual EGFR phosphorylation events and EGFR recycling inhibition show promise in future treatments of cholangiocarcinoma

  9. Human mesenchymal stem cells

    DEFF Research Database (Denmark)

    Abdallah, Basem; Kassem, Moustapha

    2008-01-01

    Mesenchymal stem cells (MSC) are a group of clonogenic cells present among the bone marrow stroma and capable of multilineage differentiation into mesoderm-type cells such as osteoblasts, adipocytes and chondrocytes. Due to their ease of isolation and their differentiation potential, MSC are being...... introduced into clinical medicine in variety of applications and through different ways of administration. Here, we discuss approaches for isolation, characterization and directing differentiation of human mesenchymal stem cells (hMSC). An update of the current clinical use of the cells is also provided....

  10. New Whitening Constituents from Taiwan-Native Pyracantha koidzumii: Structures and Tyrosinase Inhibitory Analysis in Human Epidermal Melanocytes

    Directory of Open Access Journals (Sweden)

    Rong-Dih Lin

    2015-12-01

    Full Text Available Nontoxic natural products useful in skin care cosmetics are of considerable interest. Tyrosinase is a rate-limiting enzyme for which its inhibitor is useful in developing whitening cosmetics. Pyracantha koidzumii (Hayata Rehder is an endemic species in Taiwan that exhibits tyrosinase-inhibitory activity. To find new active natural compounds from P. koidzumii, we performed bioguided isolation and studied the related activity in human epidermal melanocytes. In total, 13 compounds were identified from P. koidzumii in the present study, including two new compounds, 3,6-dihydroxy-2,4-dimethoxy-dibenzofuran (9 and 3,4-dihydroxy-5-methoxybiphenyl-2ʹ-O-β-d-glucopyranoside (13, as well as 11 known compounds. The new compound 13 exhibited maximum potency in inhibiting cellular tyrosinase activity, the protein expression of cellular tyrosinase and tyrosinase-related protein-2, as well as the mRNA expression of Paired box 3 and microphthalmia-associated transcription factor in a concentration-dependent manner. In the enzyme kinetic assay, the new compound 13 acted as an uncompetitive mixed-type inhibitor against the substrate l-3,4-dihydroxyphenylalanine and had a Km value against this substrate of 0.262 mM, as calculated using the Lineweaver–Burk plots. Taken together, our findings show compound 13 exhibits tyrosinase inhibition in human melanocytes and compound 13 may be a potential candidate for use in cosmetics.

  11. 125I-human epidermal growth factor specific binding to placentas and fetal membranes from varoius pregnancy states

    International Nuclear Information System (INIS)

    Hofmann, G.E.; Siddiqi, T.A.; Rao, Ch. V.; Carman, F.R.

    1988-01-01

    Specific binding of 125 I-human epidermal growth factor (hEGF) to homogenates of term human placentas and fetal membranes from normal and appropriate for gestational age (N = 20), intrauterine growth retarded (N = 9), twin (N = 11), White class A/B diabetic (N = 12), and large for gestational age (N = 13) pregnancies was measured. In all pregnancy states, placentas bound approximately four times more 125 I-hEGF than did fetal membranes (P 125 I-hEGF binding to fetal membranes from the various pregnancy states (P 125 I-hEGF specific binding to placentas from intrauterine growth retarded or twin pregnancies was significantly greater compared with placentas from normal and appropriate for gestational age pregnancies (P 125 I-hEGF specific binding did not differ between placentas from intrauterine growth retarded or twin pregnancies (P 125 I-hEGF binding did not vary with fetal sex, maternal race, placental weight, or gestational age between 37 to 42 weeks (P 125 I-hEGF binding increased with increasing infant weight when appropriate for gestational age and large for gestational age infants were included (P<0.05, r = 0.38, N = 32) but not for intrauterine growth retarded, appropriate for gestational age, or large for gestational age infants alone. (author)

  12. New Whitening Constituents from Taiwan-Native Pyracantha koidzumii: Structures and Tyrosinase Inhibitory Analysis in Human Epidermal Melanocytes

    Science.gov (United States)

    Lin, Rong-Dih; Chen, Mei-Chuan; Liu, Yan-Ling; Lin, Yi-Tzu; Lu, Mei-Kuang; Hsu, Feng-Lin; Lee, Mei-Hsien

    2015-01-01

    Nontoxic natural products useful in skin care cosmetics are of considerable interest. Tyrosinase is a rate-limiting enzyme for which its inhibitor is useful in developing whitening cosmetics. Pyracantha koidzumii (Hayata) Rehder is an endemic species in Taiwan that exhibits tyrosinase-inhibitory activity. To find new active natural compounds from P. koidzumii, we performed bioguided isolation and studied the related activity in human epidermal melanocytes. In total, 13 compounds were identified from P. koidzumii in the present study, including two new compounds, 3,6-dihydroxy-2,4-dimethoxy-dibenzofuran (9) and 3,4-dihydroxy-5-methoxybiphenyl-2ʹ-O-β-d-glucopyranoside (13), as well as 11 known compounds. The new compound 13 exhibited maximum potency in inhibiting cellular tyrosinase activity, the protein expression of cellular tyrosinase and tyrosinase-related protein-2, as well as the mRNA expression of Paired box 3 and microphthalmia-associated transcription factor in a concentration-dependent manner. In the enzyme kinetic assay, the new compound 13 acted as an uncompetitive mixed-type inhibitor against the substrate l-3,4-dihydroxyphenylalanine and had a Km value against this substrate of 0.262 mM, as calculated using the Lineweaver–Burk plots. Taken together, our findings show compound 13 exhibits tyrosinase inhibition in human melanocytes and compound 13 may be a potential candidate for use in cosmetics. PMID:26633381

  13. Synergistic Induction of Cyclooxygenase-2 by Transforming Growth Factor-β1 and Epidermal Growth Factor Inhibits Apoptosis in Epithelial Cells

    Directory of Open Access Journals (Sweden)

    Debabrata Saha

    1999-12-01

    Full Text Available Increased expression of cyclooxygenase-2 (COX-2 expression has been observed in several human tumor types and in selected animal and cell culture models of carcinogenesis, including lung cancer. Increased expression of COX-2 and production of prostaglandins appear to provide a survival advantage to transformed cells through the inhibition of apoptosis, increased attachment to extracellular matrix, increased invasiveness, the stimulation of angiogenesis. In the present studies, we found that transforming growth factor β1 (TGF-β1 and epidermal growth factor (EGF synergistically induced the expression of COX-2 and prostaglandin E2 (PGE2 production in mink lung epithelial (Mvi Lu cells. EGF, but not PDGF or IGF-1, was able to inhibit TGF-β1-induced apoptosis in Mvi Lu cells and this effect was blocked by NS-398, a selective inhibitor of COX-2 activity, suggesting a possible role for COX-2 in the anti-apoptosic effect of EGF receptor ligands. The combination of TGF-β1 and EGF also significantly induced COX-2 expression in rat intestinal epithelial (RIE-1 cells and completely prevented sodium butyrate (NaBu-induced apoptosis. The synergistic induction of COX-2 by TGF-β1 and EGF was not observed in R1B-L17 cells, a line derived from Mvi Lu cells that lacks the TGF-β type-I receptor. AG1478, a selective inhibitor of EGF receptor tyrosine kinase activity, completely suppressed the induction of COX-2 expression by either EGF or TGF-β1+EGF. Also, PD98059, a specific inhibitor of MEK/ERK pathway, SB203580, a specific inhibitor of p38 MAPK activity, significantly inhibited the induction of COX-2 in response to combined EGF and TGF-β1. These results suggest an important collaborative interaction of TGF-β1 and EGF signaling in the induction of COX-2 and prostaglandin production in Mv1Lu cells.

  14. Combined inhibition of EMMPRIN and epidermal growth factor receptor prevents the growth and migration of head and neck squamous cell carcinoma cells.

    Science.gov (United States)

    Suzuki, Shinsuke; Ishikawa, Kazuo

    2014-03-01

    It has been reported that the epidermal growth factor receptor (EGFR) expression is associated with the extracellular matrix metalloproteinase inducer (EMMPRIN) in some solid tumors; however, the relationship of EMMPRIN with EGFR in head and neck cancers is not fully understood. To determine the relationship between EMMPRIN and EGFR in head and neck squamous cell carcinoma (HNSCC), HNSCC cells were stimulated with epidermal growth factor (EGF), a ligand of EGFR. EMMPRIN expression in HNSCC cells was upregulated by EGF. In addition, EGF stimulation induced HNSCC cell invasion and MMP-9 expression. This increase in invasion and MMP-9 expression was abrogated by downmodulation of EMMPRIN. Furthermore, to determine the effects of combined EMMPRIN and EGFR targeting in HNSCC, HNSCC cells were treated with an EMMPRIN function-blocking antibody and the EGFR inhibitor AG1478. This combined treatment resulted in greater inhibition of HNSCC cell proliferation and migration compared with the individual agents alone. These results suggest that EMMPRIN mediates EGFR-induced tumorigenicity and that combined targeting of EMMPRIN and EGFR may be an efficacious treatment approach.

  15. Anti-Epidermal Growth Factor Receptor Therapy in Head and Neck Squamous Cell Carcinoma: Focus on Potential Molecular Mechanisms of Drug Resistance

    OpenAIRE

    Boeckx, Carolien; Baay, Marc; Wouters, An; Specenier, Pol; Vermorken, Jan B.; Peeters, Marc; Lardon, Filip

    2013-01-01

    Targeted therapy against epidermal growth factor receptor (EGFR) is one of the most promising therapeutics for head and neck squamous cell carcinoma, and EGFR is overexpressed in a wide range of malignancies. An improved understanding of the resistance to EGFR inhibitors may provide new treatment options. This review summarizes some mechanisms and decribes strategies to overcome this resistance.

  16. Comparison of rat epidermal keratinocyte organotypic culture (ROC) with intact human skin

    DEFF Research Database (Denmark)

    Pappinen, Sari; Hermansson, Martin; Kuntsche, Judith

    2008-01-01

    study was to compare the stratum corneum lipid content of ROC with the corresponding material from human skin. The lipid composition was determined by thin-layer chromatography (TLC) and mass-spectrometry, and the thermal phase transitions of stratum corneum were studied by differential scanning...... calorimetry (DSC). All major lipid classes of the stratum corneum were present in ROC in a similar ratio as found in human stratum corneum. Compared to human skin, the level of non-hydroxyacid-sphingosine ceramide (NS) was increased in ROC, while alpha-hydroxyacid-phytosphingosine ceramide (AP) and non...... compared to human skin, in agreement with the results from DSC. ROC underwent a lipid lamellar order to disorder transition (T2) at a slightly lower temperature (68 degrees C) than human skin (74 degrees C). These differences in stratum corneum lipid composition and the thermal phase transitions may...

  17. Inhibition of iodine-125-labeled human follitropin binding to testicular receptor by epidermal growth factor and synthetic peptides

    International Nuclear Information System (INIS)

    Sluss, P.M.; Krystek, S.R. Jr.; Andersen, T.T.; Melson, B.E.; Huston, J.S.; Ridge, R.; Reichert, L.E. Jr.

    1986-01-01

    Two tetrapeptide sequence homologies between mouse epidermal growth factor precursor (mEGFP) and human follitropin (FSH) were revealed by a computer program that identifies identical residues among polypeptide sequences. The two tetrapeptides, Lys-Thr-Cys-Thr (KTCT) and Thr-Arg-Asp-Leu (TRDL), are present in the hormone-specific beta subunit of FSH from all species studied. These tetrapeptides are not present in the alpha subunit, which is common to all pituitary glycoprotein hormones. Both tetrapeptides are also found in mEGFP, and one tetrapeptide, TRDL, is located within the 53-residue form of mEGF purified from mouse submaxillary glands. Computer-generated hydropathy profiles predicted that both tetrapeptides are located in hydrophilic portions of the FSH beta subunit and that TRDL is in a hydrophilic portion of commercially available mEGF. Therefore, the tetrapeptides might be accessible to receptor binding sites for FSH. We report that mEGF inhibits binding of 125 I-labeled human FSH to receptors in testis by 50% (I50) at a concentration of 1.8 X 10(-5) M. No binding inhibition was observed by GnRH or arginine-vasopressin at 10(-4) M, neither of which contain the tetrapeptide sequences. FSH beta subunit, which contains both tetrapeptides, also inhibited binding (I50 = 9 X 10(-8) M) of 125 I-labeled human FSH to testis receptor. Thus, it appears that FSH beta subunit and mEGF are capable of inhibiting binding of FSH to testicular FSH receptors, presumably through interactions that include the homologous tetrapeptides. This presumption was supported by the observation that the synthetic tetrapeptides (KTCT or TRDL) were also active in inhibiting binding of 125 I-labeled human FSH to testis receptor

  18. CD147, CD44, and the epidermal growth factor receptor (EGFR) signaling pathway cooperate to regulate breast epithelial cell invasiveness.

    Science.gov (United States)

    Grass, G Daniel; Tolliver, Lauren B; Bratoeva, Momka; Toole, Bryan P

    2013-09-06

    The immunoglobulin superfamily glycoprotein CD147 (emmprin; basigin) is associated with an invasive phenotype in various types of cancers, including malignant breast cancer. We showed recently that up-regulation of CD147 in non-transformed, non-invasive breast epithelial cells is sufficient to induce an invasive phenotype characterized by membrane type-1 matrix metalloproteinase (MT1-MMP)-dependent invadopodia activity (Grass, G. D., Bratoeva, M., and Toole, B. P. (2012) Regulation of invadopodia formation and activity by CD147. J. Cell Sci. 125, 777-788). Here we found that CD147 induces breast epithelial cell invasiveness by promoting epidermal growth factor receptor (EGFR)-Ras-ERK signaling in a manner dependent on hyaluronan-CD44 interaction. Furthermore, CD147 promotes assembly of signaling complexes containing CD147, CD44, and EGFR in lipid raftlike domains. We also found that oncogenic Ras regulates CD147 expression, hyaluronan synthesis, and formation of CD147-CD44-EGFR complexes, thus forming a positive feedback loop that may amplify invasiveness. Last, we showed that malignant breast cancer cells are heterogeneous in their expression of surface-associated CD147 and that high levels of membrane CD147 correlate with cell surface EGFR and CD44 levels, activated EGFR and ERK1, and activated invadopodia. Future studies should evaluate CD147 as a potential therapeutic target and disease stratification marker in breast cancer.

  19. CD147, CD44, and the Epidermal Growth Factor Receptor (EGFR) Signaling Pathway Cooperate to Regulate Breast Epithelial Cell Invasiveness*

    Science.gov (United States)

    Grass, G. Daniel; Tolliver, Lauren B.; Bratoeva, Momka; Toole, Bryan P.

    2013-01-01

    The immunoglobulin superfamily glycoprotein CD147 (emmprin; basigin) is associated with an invasive phenotype in various types of cancers, including malignant breast cancer. We showed recently that up-regulation of CD147 in non-transformed, non-invasive breast epithelial cells is sufficient to induce an invasive phenotype characterized by membrane type-1 matrix metalloproteinase (MT1-MMP)-dependent invadopodia activity (Grass, G. D., Bratoeva, M., and Toole, B. P. (2012) Regulation of invadopodia formation and activity by CD147. J. Cell Sci. 125, 777–788). Here we found that CD147 induces breast epithelial cell invasiveness by promoting epidermal growth factor receptor (EGFR)-Ras-ERK signaling in a manner dependent on hyaluronan-CD44 interaction. Furthermore, CD147 promotes assembly of signaling complexes containing CD147, CD44, and EGFR in lipid raftlike domains. We also found that oncogenic Ras regulates CD147 expression, hyaluronan synthesis, and formation of CD147-CD44-EGFR complexes, thus forming a positive feedback loop that may amplify invasiveness. Last, we showed that malignant breast cancer cells are heterogeneous in their expression of surface-associated CD147 and that high levels of membrane CD147 correlate with cell surface EGFR and CD44 levels, activated EGFR and ERK1, and activated invadopodia. Future studies should evaluate CD147 as a potential therapeutic target and disease stratification marker in breast cancer. PMID:23888049

  20. Combination effects of epidermal growth factor and glial cell line-derived neurotrophic factor on the in vitro developmental potential of porcine oocytes

    DEFF Research Database (Denmark)

    Valleh, Mehdi Vafaye; Rasmussen, Mikkel Aabech; Hyttel, Poul

    2016-01-01

    of improving this issue, the single and combined effects of epidermal growth factor (EGF) and glial cell line-derived neurotrophic factor (GDNF) on oocyte developmental competence were investigated. Porcine cumulus–oocyte cell complexes (COCs) were matured in serum-free medium supplemented with EGF (0, 10...... with the combination of EGF and GDNF was shown to significantly improve oocyte competence in terms of blastocyst formation, blastocyst cell number and blastocyst hatching rate (P

  1. Radionecrosis skin model induced an athymic mouse nude (Nu/Nu) for development of dermal-epidermal human substitute based regenerative therapy

    International Nuclear Information System (INIS)

    Mosca, Rodrigo Crespo

    2014-01-01

    The neoplasms incidence has increased significantly in recent years and continued population growth and aging will increase the statistics of this illness in the world's diseases. The cancer treatment usually consists in individual or combined use of chemotherapy, surgery and radiotherapy depending on the etiology of the tumor. In cases where radiotherapy is used in addition to the therapeutic effects of radiation, specific complications can occur, and in the skin, these complications can be present with a clinical expression ranging from erythema to radionecrosis, and this latter being the adverse effect with greater severity. The radionecrosis treatment consists in debridement necrotic areas and covering the surgical wounds. Autologous grafts are most commonly used for this covering, however when large areas are affected, allografts can be used for occlusive treatment and the keratinocytes and adipose derived stem cells (ADSC) addition becomes an alternative, due to the knowing for immunomodulatory and regenerative response. For that reason, aiming to simulate the radionecrosis adverse effects, an animal model of induced cutaneous radionecrosis was created, in athymic mouse Nude (Nu/Nu), for developing regenerative therapies based on human dermal-epidermal substitutes containing keratinocytes and ADSC, which proved occlusive as an efficient treatment, furthermore, having this radionecrosis animal model established, new possibilities for treatment of diseases involving dermal regeneration, can be tested. (author)

  2. Structural model for the interaction of a designed Ankyrin Repeat Protein with the human epidermal growth factor receptor 2.

    Directory of Open Access Journals (Sweden)

    V Chandana Epa

    Full Text Available Designed Ankyrin Repeat Proteins are a class of novel binding proteins that can be selected and evolved to bind to targets with high affinity and specificity. We are interested in the DARPin H10-2-G3, which has been evolved to bind with very high affinity to the human epidermal growth factor receptor 2 (HER2. HER2 is found to be over-expressed in 30% of breast cancers, and is the target for the FDA-approved therapeutic monoclonal antibodies trastuzumab and pertuzumab and small molecule tyrosine kinase inhibitors. Here, we use computational macromolecular docking, coupled with several interface metrics such as shape complementarity, interaction energy, and electrostatic complementarity, to model the structure of the complex between the DARPin H10-2-G3 and HER2. We analyzed the interface between the two proteins and then validated the structural model by showing that selected HER2 point mutations at the putative interface with H10-2-G3 reduce the affinity of binding up to 100-fold without affecting the binding of trastuzumab. Comparisons made with a subsequently solved X-ray crystal structure of the complex yielded a backbone atom root mean square deviation of 0.84-1.14 Ångstroms. The study presented here demonstrates the capability of the computational techniques of structural bioinformatics in generating useful structural models of protein-protein interactions.

  3. Evolving landscape of human epidermal growth factor receptor 2-positive breast cancer treatment and the future of biosimilars.

    Science.gov (United States)

    Jackisch, Christian; Lammers, Philip; Jacobs, Ira

    2017-04-01

    Human epidermal growth factor receptor 2-positive (HER2+) breast cancer comprises approximately 15%-20% of all breast cancers and is associated with a poor prognosis. The introduction of anti-HER2 therapy has significantly improved clinical outcomes for patients with HER2+ breast cancer, and multiple HER2-directed agents (ie, trastuzumab, pertuzumab, lapatinib, and ado-trastuzumab emtansine [T-DM1]) are approved for clinical use in various settings. The treatment landscape for patients with HER2+ breast cancer is continuing to evolve. While novel agents and therapeutic strategies are emerging, biologic therapies, particularly trastuzumab, are likely to remain a mainstay of treatment. However, access issues create barriers to the use of biologics, and there is evidence for underuse of trastuzumab worldwide. A biosimilar is a biologic product that is highly similar to a licensed biologic in terms of product safety and effectiveness. Biosimilars of trastuzumab are in development and may soon become available. The introduction of biosimilars may improve access to anti-HER2 therapies by providing additional treatment options and lower-cost alternatives. Because HER2-targeted drugs may be administered for extended periods of time and in combination with other systemic therapies, biosimilars have the potential to result in significant savings for healthcare systems. Herein we review current and emerging treatment options for, and discuss the possible role of biosimilars in, treating patients with HER2+ breast cancer. Copyright © 2017 Authors, Pfizer Inc. Published by Elsevier Ltd.. All rights reserved.

  4. Association of Polymorphisms in Connective Tissue Growth Factor and Epidermal Growth Factor Receptor Genes With Human Longevity.

    Science.gov (United States)

    Donlon, Timothy A; Morris, Brian J; He, Qimei; Chen, Randi; Masaki, Kamal H; Allsopp, Richard C; Willcox, D Craig; Tranah, Gregory J; Parimi, Neeta; Evans, Daniel S; Flachsbart, Friederike; Nebel, Almut; Kim, Duk-Hwan; Park, Joobae; Willcox, Bradley J

    2017-08-01

    Growth pathways play key roles in longevity. The present study tested single-nucleotide polymorphisms (SNPs) in the connective tissue growth factor gene (CTGF) and the epidermal growth factor receptor gene (EGFR) for association with longevity. Comparison of allele and genotype frequencies of 12 CTGF SNPs and 41 EGFR SNPs between 440 American men of Japanese ancestry aged ≥95 years and 374 men of average life span revealed association with longevity at the p cases, consistent with heterozygote advantage in living to extreme old age. No associations of the most significant SNPs were observed in whites or Koreans. In conclusion, the present findings indicate that genetic variation in CTGF and EGFR may contribute to the attainment of extreme old age in Japanese. More research is needed to confirm that genetic variation in CTGF and EGFR contributes to the attainment of extreme old age across human populations. © The Author 2016. Published by Oxford University Press on behalf of The Gerontological Society of America. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com.

  5. Cell wall accumulation of fluorescent proteins derived from a trans-Golgi cisternal membrane marker and paramural bodies in interdigitated Arabidopsis leaf epidermal cells.

    Science.gov (United States)

    Akita, Kae; Kobayashi, Megumi; Sato, Mayuko; Kutsuna, Natsumaro; Ueda, Takashi; Toyooka, Kiminori; Nagata, Noriko; Hasezawa, Seiichiro; Higaki, Takumi

    2017-01-01

    In most dicotyledonous plants, leaf epidermal pavement cells develop jigsaw puzzle-like shapes during cell expansion. The rapid growth and complicated cell shape of pavement cells is suggested to be achieved by targeted exocytosis that is coordinated with cytoskeletal rearrangement to provide plasma membrane and/or cell wall materials for lobe development during their morphogenesis. Therefore, visualization of membrane trafficking in leaf pavement cells should contribute an understanding of the mechanism of plant cell morphogenesis. To reveal membrane trafficking in pavement cells, we observed monomeric red fluorescent protein-tagged rat sialyl transferases, which are markers of trans-Golgi cisternal membranes, in the leaf epidermis of Arabidopsis thaliana. Quantitative fluorescence imaging techniques and immunoelectron microscopic observations revealed that accumulation of the red fluorescent protein occurred mostly in the curved regions of pavement cell borders and guard cell ends during leaf expansion. Transmission electron microscopy observations revealed that apoplastic vesicular membrane structures called paramural bodies were more frequent beneath the curved cell wall regions of interdigitated pavement cells and guard cell ends in young leaf epidermis. In addition, pharmacological studies showed that perturbations in membrane trafficking resulted in simple cell shapes. These results suggested possible heterogeneity of the curved regions of plasma membranes, implying a relationship with pavement cell morphogenesis.

  6. Construction of multifunctional proteins for tissue engineering: epidermal growth factor with collagen binding and cell adhesive activities.

    Science.gov (United States)

    Hannachi Imen, Elloumi; Nakamura, Makiko; Mie, Masayasu; Kobatake, Eiry

    2009-01-01

    The development of different techniques based on natural and polymeric scaffolds are useful for the design of different biomimetic materials. These approaches, however, require supplementary steps for the chemical or physical modification of the biomaterial. To avoid such steps, in the present study, we constructed a new multifunctional protein that can be easily immobilized onto hydrophobic surfaces, and at the same time helps enhance specific cell adhesion and proliferation onto collagen substrates. A collagen binding domain was fused to a previously constructed protein, which had an epidermal growth factor fused to a hydrophobic peptide that allows for cell adhesion. The new fusion protein, designated fnCBD-ERE-EGF is produced in Escherichia coli, and its abilities to bind to collagen and promote cell proliferation were investigated. fnCBD-ERE-EGF was shown to keep both collagen binding and cell growth-promoting activities comparable to those of the corresponding unfused proteins. The results obtained in this study also suggest the use of a fnCBD-ERE-EGF as an alternative for the design of multifunctional ECM-bound growth factor based materials.

  7. Stimulation of prostaglandin E2 production by phorbol esters and epidermal growth factor in porcine thyroid cells

    International Nuclear Information System (INIS)

    Kasai, K.; Hiraiwa, M.; Emoto, T.; Akimoto, K.; Takaoka, T.; Shimoda, S.I.

    1987-01-01

    Effects of phorbol esters and epidermal growth factor (EGF) on prostaglandin E 2 production by cultured porcine thyroid cells were examined. Both phorbol 12-myristate 13-acetate (PMA) and EGF stimulated prostaglandin E 2 production by the cells in dose related fashion. PMA stimulated prostaglandin E 2 production over fifty-fold with the dose of 10 -7 M compared with control. EGF (10 -7 M) also stimulated it about ten-fold. The ED 50 values of PMA and EGF were respectively around 1 x 10 -9 M and 5 x 10 -10 M. Thyroid stimulating hormone (TSH), however, did not stimulate prostaglandin E 2 production from 1 to 24-h incubation. The release of radioactivity from [ 3 H]-arachidonic acid prelabeled cells was also stimulated by PMA and EGF, but not by TSH. These results indicate that both PMA and EGF are potent stimulators of prostaglandin E 2 production, associated with the activity to stimulate arachidonic acid release in porcine thyroid cells. 36 references, 2 figures, 1 table

  8. Upregulated epidermal growth factor receptor expression following near-infrared irradiation simulating solar radiation in a three-dimensional reconstructed human corneal epithelial tissue culture model

    Directory of Open Access Journals (Sweden)

    Tanaka Y

    2016-08-01

    Full Text Available Yohei Tanaka,1,2 Jun Nakayama2 1Department of Plastic Surgery, Clinica Tanaka Plastic, Reconstructive Surgery and Anti-aging Center, 2Department of Molecular Pathology, Shinshu University Graduate School of Medicine, Matsumoto, Nagano, Japan Background and objective: Humans are increasingly exposed to near-infrared (NIR radiation from both natural (eg, solar and artificial (eg, electrical appliances sources. Although the biological effects of sun and ultraviolet (UV exposure have been extensively investigated, the biological effect of NIR radiation is still unclear. We previously reported that NIR as well as UV induces photoaging and standard UV-blocking materials, such as sunglasses, do not sufficiently block NIR. The objective of this study was to investigate changes in gene expression in three-dimensional reconstructed corneal epithelial tissue culture exposed to broad-spectrum NIR irradiation to simulate solar NIR radiation that reaches human tissues.Materials and methods: DNA microarray and quantitative real-time polymerase chain reaction analysis were used to assess gene expression levels in a three-dimensional reconstructed corneal epithelial model composed of normal human corneal epithelial cells exposed to water-filtered broad-spectrum NIR irradiation with a contact cooling (20°C. The water-filter allowed 1,000–1,800 nm wavelengths and excluded 1,400–1,500 nm wavelengths.Results: A DNA microarray with >62,000 different probes showed 25 and 150 genes that were up- or downregulated by at least fourfold and twofold, respectively, after NIR irradiation. In particular, epidermal growth factor receptor (EGFR was upregulated by 19.4-fold relative to control cells. Quantitative real-time polymerase chain reaction analysis revealed that two variants of EGFR in human corneal epithelial tissue were also significantly upregulated after five rounds of 10 J/cm2 irradiation (P<0.05.Conclusion: We found that NIR irradiation induced the

  9. Protein structure of fetal antigen 1 (FA1). A novel circulating human epidermal-growth-factor-like protein expressed in neuroendocrine tumors and its relation to the gene products of dlk and pG2

    DEFF Research Database (Denmark)

    Jensen, Charlotte Harken; Krogh, Thomas N; Højrup, Peter

    1994-01-01

    The present paper describes the primary structure, glycosylation and tissue localization of fetal antigen 1 (FA1) isolated from second-trimester human amniotic fluid. FA1 is a single-chained, heterogeneous glycoprotein of 225-262 amino acid residues. FA1 has six well conserved epidermal...... extends with minor corrections to the human adrenal-specific mRNA, pG2 as well. Immunohistochemical analysis demonstrated the presence of FA1 in 10 out of 14 lung tumors containing neuroendocrine elements, and in the placental villi where FA1 was exclusively seen in stromal cells in close contact...... to the vascular structure. In the pancreas, FA1 co-localized with insulin in the insulin secretory granules of the beta cells within the islets of Langerhans. Our findings suggest that FA1 is synthesized as a membrane anchored protein and released into the circulation after enzymic cleavage, and that circulating...

  10. Single-cell-type quantitative proteomic and ionomic analysis of epidermal bladder cells from the halophyte model plant Mesembryanthemum crystallinum to identify salt-responsive proteins.

    Science.gov (United States)

    Barkla, Bronwyn J; Vera-Estrella, Rosario; Raymond, Carolyn

    2016-05-10

    Epidermal bladder cells (EBC) are large single-celled, specialized, and modified trichomes found on the aerial parts of the halophyte Mesembryanthemum crystallinum. Recent development of a simple but high throughput technique to extract the contents from these cells has provided an opportunity to conduct detailed single-cell-type analyses of their molecular characteristics at high resolution to gain insight into the role of these cells in the salt tolerance of the plant. In this study, we carry out large-scale complementary quantitative proteomic studies using both a label (DIGE) and label-free (GeLC-MS) approach to identify salt-responsive proteins in the EBC extract. Additionally we perform an ionomics analysis (ICP-MS) to follow changes in the amounts of 27 different elements. Using these methods, we were able to identify 54 proteins and nine elements that showed statistically significant changes in the EBC from salt-treated plants. GO enrichment analysis identified a large number of transport proteins but also proteins involved in photosynthesis, primary metabolism and Crassulacean acid metabolism (CAM). Validation of results by western blot, confocal microscopy and enzyme analysis helped to strengthen findings and further our understanding into the role of these specialized cells. As expected EBC accumulated large quantities of sodium, however, the most abundant element was chloride suggesting the sequestration of this ion into the EBC vacuole is just as important for salt tolerance. This single-cell type omics approach shows that epidermal bladder cells of M. crystallinum are metabolically active modified trichomes, with primary metabolism supporting cell growth, ion accumulation, compatible solute synthesis and CAM. Data are available via ProteomeXchange with identifier PXD004045.

  11. Limiting dilution analysis for precursor frequency of Con A-responsive mouse Thy-1+ dendritic epidermal cells

    International Nuclear Information System (INIS)

    Takashima, A.; Bergstresser, P.R.; Nixon-Fulton, J.L.; Tigelaar, R.E.

    1986-01-01

    The authors have recently demonstrated in vitro proliferation of mouse Thy-1 + dendritic epidermal cells (EC) to Con A and IL-2. The purpose of the present study was to utilize limiting dilution analysis to determine the precursor frequency (PF) of Con A-responsive cells within EC enriched by Isolymph centrifugation for Thy-1 + cells (IEC). AKR IEC were cultured in 96 well U-plates (25-75 cells/well) with 2 μg/ml Con A and 2 x 10 5 irradiated (1600 R) AKR spleen cells/well. Cultures were harvested after 7-21 days following 3 H-thymidine pulsing. Results indicated a PF within IEC of 1.5-4.5%. Inclusion of 10 U/ml IL-2 enhanced significantly the proliferation in positive wells but did not alter this PF. In AKR mice, monoclonal antibody 20-10-5S has been shown to react with Thy-1 + EC, but not with peripheral T cells. FACS purification of IEC using 20-10-5S indicated that Con A responsiveness resides exclusively within the 20-10-5S + population. The PF of Con A-responsive Thy-1 + EC was calculated by dividing the PF of IEC by the fraction of 20-10-5S + cells (13-30%) in the IEC suspension. A significant proportion of Thy-1 + EC (∼12%) were found to possess Con A proliferative capacity. These studies will facilitate analysis at a clonal level of possible functional and phenotypic heterogeneity within the Thy-1 + EC population

  12. An Immunohistochemical Study of Anaplastic Lymphoma Kinase and Epidermal Growth Factor Receptor Mutation in Non-Small Cell Lung Carcinoma.

    Science.gov (United States)

    Verma, Sonal; Kumar, Madhu; Kumari, Malti; Mehrotra, Raj; Kushwaha, R A S; Goel, Madhumati; Kumar, Ashutosh; Kant, Surya

    2017-07-01

    Lung cancer is one of the leading causes of cancer related death. Targeted treatment for specific markers may help in reducing the cancer related morbidity and mortality. To study expression of Anaplastic Lymphoma Kinase (ALK)and Epidermal Growth Factor Receptor (EGFR) mutations in patients of Non-Small Cell Lung Cancer NSCLC, that are the targets for specific ALK inhibitors and EGFR tyrosine kinase inhibitors. Total 69 cases of histologically diagnosed NSCLC were examined retrospectively for immunohistochemical expression of EGFR and ALK, along with positive control of normal placental tissue and anaplastic large cell lymphoma respectively. Of the NSCLC, Squamous Cell Carcinoma (SCC) accounted for 71.0% and adenocarcinoma was 26.1%. ALK expression was seen in single case of 60-year-old female, non-smoker with adenocarcinoma histology. EGFR expression was seen in both SCC (59.18%) and adenocarcinoma in (77.78%) accounting for 63.77% of all cases. Both ALK and EGFR mutation were mutually exclusive. EGFR expression was seen in 63.77% of cases, highlighting the importance of its use in routine analysis, for targeted therapy and better treatment results. Although, ALK expression was seen in 1.45% of all cases, it is an important biomarker in targeted cancer therapy. Also, the mutually exclusive expression of these two markers need further studies to develop a diagnostic algorithm for NSCLC patients.

  13. Advanced glycosylation end product promotes forkhead box O1 and inhibits Wnt pathway to suppress capacities of epidermal stem cells.

    Science.gov (United States)

    Zhu, Jie; Wang, Peng; Yu, Zhimin; Lai, Wei; Cao, Yi; Huang, Pinbo; Xu, Qiaodong; Yu, Menglei; Xu, Junyao; Huang, Zitong; Zeng, Bing

    2016-01-01

    Diabetes mellitus is frequently accompanied by chronic complications like delayed wound healing, which is consider to be attributed to the accumulation of advanced glycosylation end product (AGE). However, the impacts of AGE on epidermal stem cells (ESCs) are largely unknown. This study aims to address the influence and mechanism of AGE on ESCs. ESCs isolated from rats were cultured in AGE-modified bovine serum albumin and transfected with small interfering RNA to knock down AGE-specific receptor (AGER). Expression of stem cell markers integrin β1 (ITGB1) and keratin 19 (KRT19), cell viability, apoptosis and reactive oxygen species (ROS) were examined. Wnt pathway-related factors Wnt family member 1 (WNT1), WNT3A, β-catenin, v-myc avian myelocytomatosis viral oncogene homolog (MYC), cyclin D1 (CCND1) and matrix metallopeptidase 7 (MMP7) were quantified. The interaction between forkhead box O1 (FOXO1) and β-catenin was assessed by co-immunoprecipitation. Results indicated that AGE down-regulated ITGB1 and KRT19 expression, suppressed ESC viability and promoted apoptosis, and ROS level ( P factor 1 to interact with β-catenin, which might help to elucidate the mechanism of AGE repressing ESCs. This study helps to understand the mechanism of accumulated AGE in affecting ESC capacities, and provides potential therapeutic targets to meliorate diabetic wound healing.

  14. Lipidomic analysis of epidermal lipids: a tool to predict progression of inflammatory skin disease in humans.

    Science.gov (United States)

    Li, Shan; Ganguli-Indra, Gitali; Indra, Arup K

    2016-05-01

    Lipidomics is the large-scale profiling and characterization of lipid species in a biological system using mass spectrometry. The skin barrier is mainly comprised of corneocytes and a lipid-enriched extracellular matrix. The major skin lipids are ceramides, cholesterol and free fatty acids (FFA). Lipid compositions are altered in inflammatory skin disorders with disrupted skin barrier such as atopic dermatitis (AD). Here we discuss some of the recent applications of lipidomics in human skin biology and in inflammatory skin diseases such as AD, psoriasis and Netherton syndrome. We also review applications of lipidomics in human skin equivalent and in pre-clinical animal models of skin diseases to gain insight into the pathogenesis of the skin disease. Expert commentary: Skin lipidomics analysis could be a fast, reliable and noninvasive tool to characterize the skin lipid profile and to monitor the progression of inflammatory skin diseases such as AD.

  15. Materials and optimized designs for human-machine interfaces via epidermal electronics.

    Science.gov (United States)

    Jeong, Jae-Woong; Yeo, Woon-Hong; Akhtar, Aadeel; Norton, James J S; Kwack, Young-Jin; Li, Shuo; Jung, Sung-Young; Su, Yewang; Lee, Woosik; Xia, Jing; Cheng, Huanyu; Huang, Yonggang; Choi, Woon-Seop; Bretl, Timothy; Rogers, John A

    2013-12-17

    Thin, soft, and elastic electronics with physical properties well matched to the epidermis can be conformally and robustly integrated with the skin. Materials and optimized designs for such devices are presented for surface electromyography (sEMG). The findings enable sEMG from wide ranging areas of the body. The measurements have quality sufficient for advanced forms of human-machine interface. © 2013 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  16. /sup 125/I-human epidermal growth factor specific binding to placentas and fetal membranes from varoius pregnancy states

    Energy Technology Data Exchange (ETDEWEB)

    Hofmann, G.E.; Siddiqi, T.A.; Rao, Ch. V.; Carman, F.R.

    1988-01-01

    Specific binding of /sup 125/I-human epidermal growth factor (hEGF) to homogenates of term human placentas and fetal membranes from normal and appropriate for gestational age (N = 20), intrauterine growth retarded (N = 9), twin (N = 11), White class AB diabetic (N = 12), and large for gestational age (N = 13) pregnancies was measured. In all pregnancy states, placentas bound approximately four times more /sup 125/I-hEGF than did fetal membranes (P<0.0001). There was no significant differnce in /sup 125/I-hEGF binding to fetal membranes from the various pregnancy states (P<0.05). /sup 125/I-hEGF specific binding to placentas from intrauterine growth retarded or twin pregnancies was significantly greater compared with placentas from normal and appropriate for gestational age pregnancies (P<0.05). The binding to placentas from pregnancies complicated by White class AB diabetes or large for gestational age infants, on the other hand, was not significantly different from that to placentas from normal and appropriate for gestational age pregnancies. /sup 125/I-hEGF specific binding did not differ between placentas from intrauterine growth retarded or twin pregnancies (P<0.05). Placental and fetal membrane /sup 125/I-hEGF binding did not vary with fetal sex, maternal race, placental weight, or gestational age between 37 to 42 weeks (P<0.05). Placental but not fetal membrane /sup 125/I-hEGF binding increased with increasing infant weight when appropriate for gestational age and large for gestational age infants were included (P<0.05, r = 0.38, N = 32) but not for intrauterine growth retarded, appropriate for gestational age, or large for gestational age infants alone.

  17. Epidermal Growth Factor and Intestinal Barrier Function

    Directory of Open Access Journals (Sweden)

    Xiaopeng Tang

    2016-01-01

    Full Text Available Epidermal growth factor (EGF is a 53-amino acid peptide that plays an important role in regulating cell growth, survival, migration, apoptosis, proliferation, and differentiation. In addition, EGF has been established to be an effective intestinal regulator helping to protect intestinal barrier integrity, which was essential for the absorption of nutrients and health in humans and animals. Several researches have demonstrated that EGF via binding to the EGF receptor and subsequent activation of Ras/MAPK, PI3K/AKT, PLC-γ/PKC, and STATS signal pathways regulates intestinal barrier function. In this review, the relationship between epidermal growth factor and intestinal development and intestinal barrier is described, to provide a better understanding of the effects of EGF on intestine development and health.

  18. Human innate lymphoid cells.

    Science.gov (United States)

    Mjösberg, Jenny; Spits, Hergen

    2016-11-01

    Innate lymphoid cells (ILCs) are increasingly acknowledged as important mediators of immune homeostasis and pathology. ILCs act as early orchestrators of immunity, responding to epithelium-derived signals by expressing an array of cytokines and cell-surface receptors, which shape subsequent immune responses. As such, ILCs make up interesting therapeutic targets for several diseases. In patients with allergy and asthma, group 2 innate lymphoid cells produce high amounts of IL-5 and IL-13, thereby contributing to type 2-mediated inflammation. Group 3 innate lymphoid cells are implicated in intestinal homeostasis and psoriasis pathology through abundant IL-22 production, whereas group 1 innate lymphoid cells are accumulated in chronic inflammation of the gut (inflammatory bowel disease) and lung (chronic obstructive pulmonary disease), where they contribute to IFN-γ-mediated inflammation. Although the ontogeny of mouse ILCs is slowly unraveling, the development of human ILCs is far from understood. In addition, the growing complexity of the human ILC family in terms of previously unrecognized functional heterogeneity and plasticity has generated confusion within the field. Here we provide an updated view on the function and plasticity of human ILCs in tissue homeostasis and disease. Copyright © 2016 American Academy of Allergy, Asthma & Immunology. Published by Elsevier Inc. All rights reserved.

  19. Quantitative proteomic analysis reveals effects of epidermal growth factor receptor (EGFR) on invasion-promoting proteins secreted by glioblastoma cells.

    Science.gov (United States)

    Sangar, Vineet; Funk, Cory C; Kusebauch, Ulrike; Campbell, David S; Moritz, Robert L; Price, Nathan D

    2014-10-01

    Glioblastoma multiforme is a highly invasive and aggressive brain tumor with an invariably poor prognosis. The overexpression of epidermal growth factor receptor (EGFR) is a primary influencer of invasion and proliferation in tumor cells and the constitutively active EGFRvIII mutant, found in 30-65% of Glioblastoma multiforme, confers more aggressive invasion. To better understand how EGFR contributes to tumor aggressiveness, we investigated the effect of EGFR on the secreted levels of 65 rationally selected proteins involved in invasion. We employed selected reaction monitoring targeted mass spectrometry using stable isotope labeled internal peptide standards to quantity proteins in the secretome from five GBM (U87) isogenic cell lines in which EGFR, EGFRvIII, and/or PTEN were expressed. Our results show that cell lines with EGFR overexpression and constitutive EGFRvIII expression differ remarkably in the expression profiles for both secreted and intracellular signaling proteins, and alterations in EGFR signaling result in reproducible changes in concentrations of secreted proteins. Furthermore, the EGFRvIII-expressing mutant cell line secretes the majority of the selected invasion-promoting proteins at higher levels than other cell lines tested. Additionally, the intracellular and extracellular protein measurements indicate elevated oxidative stress in the EGFRvIII-expressing cell line. In conclusion, the results of our study demonstrate that EGFR signaling has a significant effect on the levels of secreted invasion-promoting proteins, likely contributing to the aggressiveness of Glioblastoma multiforme. Further characterization of these proteins may provide candidates for new therapeutic strategies and targets as well as biomarkers for this aggressive disease. © 2014 by The American Society for Biochemistry and Molecular Biology, Inc.

  20. Urinary transforming growth factors in neoplasia: separation of 125I-labeled transforming growth factor-alpha from epidermal growth factor in human urine

    International Nuclear Information System (INIS)

    Stromberg, K.; Hudgins, W.R.

    1986-01-01

    Purified human epidermal growth factor (hEGF) from urine promotes anchorage-independent cell growth in soft agar medium. This growth is enhanced by transforming growth factor-beta (TGF-beta), and is specifically inhibited by hEGF antiserum. Transforming growth factors of the alpha type (TGF-alpha), potentially present in normal human urine or urine from tumor-bearing patients, also promote anchorage-independent cell growth and compete with EGF for membrane receptor binding. Consequently, TGF-alpha cannot be distinguished from urinary hEGF by these two functional assays. Therefore, a technique for separation of TGF-alpha and related peptides from urinary EGF based on biochemical characteristics would be useful. Radioiodination of characterized growth factors [mouse EGF (mEGF), hEGF, and rat TGF-alpha (rTGF-alpha)], which were then separately added to human urine, was used to evaluate a resolution scheme that separates TGF-alpha from the high level of background hEGF present in human urine. Methyl bonded microparticulate silica efficiently adsorbed the 125 I-labeled mEGF, 125 I-labeled hEGF, and 125 I-labeled rTGF-alpha that were added to 24-h human urine samples. Fractional elution with acetonitrile (MeCN) of the adsorbed silica released approximately 70 to 80% of the 125 I-labeled mEGF and 125 I-labeled hEGF between 25 and 30% MeCN, and over 80% of the 125 I-labeled rTGF-alpha between 15 and 25% MeCN, with retention after dialysis of less than 0.2 and 1.7% of the original urinary protein, respectively. A single-step enrichment of about 400-fold for mEGF and hEGF, and 50-fold for rTGF-alpha were achieved rapidly. 125 I-labeled mEGF and 125 I-labeled hEGF eluted later than would be predicted on the basis of their reported molecular weight of approximately 6000, whereas 125 I-labeled rTGF-alpha eluted from Bio-Gel P-10 at an approximate molecular weight of 8000 to 9000

  1. Transient gibberellin application promotes Arabidopsis thaliana hypocotyl cell elongation without maintaining transverse orientation of microtubules on the outer tangential wall of epidermal cells

    KAUST Repository

    Sauret-Güeto, Susanna

    2011-11-25

    The phytohormone gibberellin (GA) promotes plant growth by stimulating cellular expansion. Whilst it is known that GA acts by opposing the growth-repressing effects of DELLA proteins, it is not known how these events promote cellular expansion. Here we present a time-lapse analysis of the effects of a single pulse of GA on the growth of Arabidopsis hypocotyls. Our analyses permit kinetic resolution of the transient growth effects of GA on expanding cells. We show that pulsed application of GA to the relatively slowly growing cells of the unexpanded light-grown Arabidopsis hypocotyl results in a transient burst of anisotropic cellular growth. This burst, and the subsequent restoration of initial cellular elongation rates, occurred respectively following the degradation and subsequent reappearance of a GFP-tagged DELLA (GFP-RGA). In addition, we used a GFP-tagged α-tubulin 6 (GFP-TUA6) to visualise the behaviour of microtubules (MTs) on the outer tangential wall (OTW) of epidermal cells. In contrast to some current hypotheses concerning the effect of GA on MTs, we show that the GA-induced boost of hypocotyl cell elongation rate is not dependent upon the maintenance of transverse orientation of the OTW MTs. This confirms that transverse alignment of outer face MTs is not necessary to maintain rapid elongation rates of light-grown hypocotyls. Together with future studies on MT dynamics in other faces of epidermal cells and in cells deeper within the hypocotyl, our observations advance understanding of the mechanisms by which GA promotes plant cell and organ growth. © 2011 Blackwell Publishing Ltd.

  2. IL-1β-Dependent Activation of Dendritic Epidermal T Cells in Contact Hypersensitivity

    DEFF Research Database (Denmark)

    Nielsen, Morten M; Lovato, Paola; Macleod, Amanda S

    2014-01-01

    Substances that penetrate the skin surface can act as allergens and induce a T cell-mediated inflammatory skin disease called contact hypersensitivity (CHS). IL-17 is a key cytokine in CHS and was originally thought to be produced solely by CD4(+) T cells. However, it is now known that several cell...

  3. A role for the epidermal growth factor receptor signaling in development of intestinal serrated polyps in mice and humans.

    Science.gov (United States)

    Bongers, Gerold; Muniz, Luciana R; Pacer, Michelle E; Iuga, Alina C; Thirunarayanan, Nanthakumar; Slinger, Erik; Smit, Martine J; Reddy, E Premkumar; Mayer, Lloyd; Furtado, Glaucia C; Harpaz, Noam; Lira, Sergio A

    2012-09-01

    Epithelial cancers can be initiated by activating mutations in components of the mitogen-activated protein kinase signaling pathway such as v-raf murine sarcoma viral oncogene homolog B1 (BRAF), v-Ki-ras2 Kirsten rat sarcoma viral oncogene homolog (KRAS), or epidermal growth factor receptor (EGFR). Human intestinal serrated polyps are a heterogeneous group of benign lesions, but some progress to colorectal cancer. Tumors that arise from these polyps frequently contain activating mutations in BRAF or KRAS, but little is known about the role of EGFR activation in their development. Polyp samples were obtained from adults during screening colonoscopies at Mount Sinai Hospital in New York. We measured levels of EGFR protein and phosphorylation in human serrated polyps by immunohistochemical and immunoblot analyses. We generated transgenic mice that express the ligand for EGFR, Heparin-binding EGF-like growth factor (HB-EGF), in the intestine. EGFR and the extracellular-regulated kinases (ERK)1/2 were phosphorylated in serrated areas of human hyperplastic polyps (HPPs), sessile serrated adenomas, and traditional serrated adenomas. EGFR and ERK1/2 were phosphorylated in the absence of KRAS or BRAF activating mutations in a subset of HPP. Transgenic expression of the EGFR ligand HB-EGF in the intestines of mice promoted development of small cecal serrated polyps. Mice that expressed a combination of HB-EGF and US28 (a constitutively active, G-protein-coupled receptor that increases processing of HB-EGF from the membrane) rapidly developed large cecal serrated polyps. These polyps were similar to HPPs and had increased phosphorylation of EGFR and ERK1/2 within the serrated epithelium. Administration of pharmacologic inhibitors of EGFR or MAPK to these transgenic mice significantly reduced polyp development. Activation of EGFR signaling in the intestine of mice promotes development of serrated polyps. EGFR signaling also is activated in human HPPs, sessile serrated adenomas

  4. Circulating chromatin-anti-chromatin antibody complexes bind with high affinity to dermo-epidermal structures in murine and human lupus nephritis

    DEFF Research Database (Denmark)

    Fismen, S; Hedberg, A; Fenton, K A

    2009-01-01

    Murine and human lupus nephritis are characterized by glomerular deposits of electron-dense structures (EDS). Dominant components of EDS are chromatin fragments and IgG antibodies. Whether glomerular EDS predispose for similar deposits in skin is unknown. We analysed (i) whether dermo-epidermal i......Murine and human lupus nephritis are characterized by glomerular deposits of electron-dense structures (EDS). Dominant components of EDS are chromatin fragments and IgG antibodies. Whether glomerular EDS predispose for similar deposits in skin is unknown. We analysed (i) whether dermo......-epidermal immune complex deposits have similar molecular composition as glomerular deposits, (ii) whether chromatin fragments bind dermo-epidermal structures, and (iii) whether deposits in nephritic glomeruli predispose for accumulation of similar deposits in skin. Paired skin and kidney biopsies from nephritic...... (NZBxNZW)F1 and MRL-lpr/lpr mice and from five patients with lupus nephritis were analysed by immunofluorescence, immune electron microscopy (IEM) and co-localization TUNEL IEM. Affinity of chromatin fragments for membrane structures was determined by surface plasmon resonance. Results demonstrated (i...

  5. Microtubule heterogeneity of Ornithogalum umbellatum ovary epidermal cells: non-stable cortical microtubules and stable lipotubuloid microtubules.

    Science.gov (United States)

    Kwiatkowska, Maria; Stępiński, Dariusz; Polit, Justyna T; Popłońska, Katarzyna; Wojtczak, Agnieszka

    2011-01-01

    Lipotubuloids, structures containing lipid bodies and microtubules, are described in ovary epidermal cells of Ornithogalum umbellatum. Microtubules of lipotubuloids can be fixed in electron microscope fixative containing only buffered OsO(4) or in glutaraldehyde with OsO(4) post-fixation, or in a mixture of OsO(4) and glutaraldehyde. None of these substances fixes cortical microtubules of ovary epidermis of this plant which is characterized by dynamic longitudinal growth. However, cortical microtubules can be fixed with cold methanol according immunocytological methods with the use of β-tubulin antibodies and fluorescein. The existence of cortical microtubules has also been evidenced by EM observations solely after the use of taxol, microtubule stabilizer, and fixation in a glutaraldehyde/OsO(4) mixture. These microtubules mostly lie transversely, sometimes obliquely, and rarely parallel to the cell axis. Staining, using Ruthenium Red and silver hexamine, has revealed that lipotubuloid microtubules surface is covered with polysaccharides. The presumption has been made that the presence of a polysaccharide layer enhances the stability of lipotubuloid microtubules.

  6. The Mediator Kinase Module Restrains Epidermal Growth Factor Receptor Signaling and Represses Vulval Cell Fate Specification in Caenorhabditis elegans.

    Science.gov (United States)

    Grants, Jennifer M; Ying, Lisa T L; Yoda, Akinori; You, Charlotte C; Okano, Hideyuki; Sawa, Hitoshi; Taubert, Stefan

    2016-02-01

    Cell signaling pathways that control proliferation and determine cell fates are tightly regulated to prevent developmental anomalies and cancer. Transcription factors and coregulators are important effectors of signaling pathway output, as they regulate downstream gene programs. In Caenorhabditis elegans, several subunits of the Mediator transcriptional coregulator complex promote or inhibit vulva development, but pertinent mechanisms are poorly defined. Here, we show that Mediator's dissociable cyclin dependent kinase 8 (CDK8) module (CKM), consisting of cdk-8, cic-1/Cyclin C, mdt-12/dpy-22, and mdt-13/let-19, is required to inhibit ectopic vulval cell fates downstream of the epidermal growth factor receptor (EGFR)-Ras-extracellular signal-regulated kinase (ERK) pathway. cdk-8 inhibits ectopic vulva formation by acting downstream of mpk-1/ERK, cell autonomously in vulval cells, and in a kinase-dependent manner. We also provide evidence that the CKM acts as a corepressor for the Ets-family transcription factor LIN-1, as cdk-8 promotes transcriptional repression by LIN-1. In addition, we find that CKM mutation alters Mediator subunit requirements in vulva development: the mdt-23/sur-2 subunit, which is required for vulva development in wild-type worms, is dispensable for ectopic vulva formation in CKM mutants, which instead display hallmarks of unrestrained Mediator tail module activity. We propose a model whereby the CKM controls EGFR-Ras-ERK transcriptional output by corepressing LIN-1 and by fine tuning Mediator specificity, thus balancing transcriptional repression vs. activation in a critical developmental signaling pathway. Collectively, these data offer an explanation for CKM repression of EGFR signaling output and ectopic vulva formation and provide the first evidence of Mediator CKM-tail module subunit crosstalk in animals. Copyright © 2016 by the Genetics Society of America.

  7. Optical characterization of epidermal cells and their relationship to DNA recovery from touch samples [version 1; referees: 2 approved

    Directory of Open Access Journals (Sweden)

    Cristina E. Stanciu

    2015-11-01

    Full Text Available The goal of this study was to investigate the relative contributions of different cellular and genetic components to biological samples created by touch or contact with a surface – one of the most challenging forms of forensic evidence. Touch samples were generated by having individuals hold an object for five minutes and analyzed for quantity of intact epidermal cells, extracellular DNA, and DNA from pelleted cell material after elution from the collection swab. Comparisons were made between samples where individuals had washed their hands immediately prior to handling and those where hand washing was not controlled. The vast majority (84-100% of DNA detected in these touch samples was extracellular and was uncorrelated to the number of epidermal cells detected. Although little to no extracellular or cell pellet-associated DNA was detected when individuals washed their hands prior to substrate handling, we found that a significant number of epidermal cells (between ~5x103 and ~1x105 could still be recovered from these samples, suggesting that other types of biological information may be present even when no amplifiable nuclear DNA is present. These results help to elucidate the biological context for touch samples and characterize factors that may contribute to patterns of transfer and persistence of genetic material in forensic evidence.

  8. Human epidermal growth factor receptor 2 status of gastric cancer patients in Asia: results from a large, multicountry study.

    Science.gov (United States)

    Pathmanathan, Nirmala; Geng, Jing-Shu; Li, Wencai; Nie, Xiu; Veloso, Januario; Wang, John; Hill, Julie; Mccloud, Philip; Bilous, Michael

    2017-06-01

    Current estimates of the human epidermal growth factor receptor 2 (HER2)-positivity rate in gastric cancer vary widely in the literature, and there are limited data from countries in Asia. The primary aim of this study was to conduct a clinical audit of laboratories across seven countries in Asia to determine the incidence of HER2-positive gastric cancer in this region. Pathologists were asked to collect data on patient gender, age, cancer site, specimen type, tumor spread, type and grade, HER2 test results, including protein and/or gene copy enumeration, and final HER2 status on consecutive gastric cancer cases tested for HER2 in their laboratory over a 2-year period. HER2 results from 5,301 gastric cancers were submitted by 50 laboratories. The overall HER2-positivity rate was 9.7% which, after the exclusion of China, increased to 18.1%. The rate between countries ranged from 0% to 23.1%, and from 0% to 50.0% between laboratories. An equivocal HER2 result was recorded in 19.5% of cases. Despite the lack of centralized testing to confirm the accuracy of HER2 diagnoses, the incidence of HER2-positive gastric cancer observed here was comparable to that reported in the literature. Nevertheless, rates were highly variable between countries and laboratories, which suggests a lack of HER2 testing expertise in gastric cancer. Given that the mortality rates for gastric cancer in Eastern Asia are the highest in the world, efforts should focus on improving HER2 testing expertise in the region so that patients receive the appropriate treatment early in their disease. © 2016 The Authors. Asia-Pacific Journal of Clinical Oncology Published by John Wiley & Sons Australia, Ltd.

  9. Nrf2 but not autophagy inhibition is associated with the survival of wild-type epidermal growth factor receptor non-small cell lung cancer cells

    International Nuclear Information System (INIS)

    Zhou, Yan; Li, Yuan; Ni, Hong-Min; Ding, Wen-Xing; Zhong, Hua

    2016-01-01

    Non-small cell lung cancer (NSCLC) is one of the most common malignancies in the world. Icotinib and Gefitinib are two epidermal growth factor receptor (EGFR) tyrosine kinase inhibitors (TKIs) that have been used to treat NSCLC. While it is well known that mutations of EGFR can affect the sensitivity of NSCLC to the EGFR-TKI, other mechanisms may also be adopted by lung cancer cells to develop resistance to EGFR-TKI treatment. Cancer cells can use multiple adaptive mechanisms such as activation of autophagy and Nrf2 to protect against various stresses and chemotherapeutic drugs. Whether autophagy or Nrf2 activation contributes to the resistance of NSCLC to EGFR-TKI treatment in wild-type EGFR NSCLC cells remains elusive. In the present study, we confirmed that Icotinib and Gefitinib induced apoptosis in EGFR mutant HCC827 but not in EGFR wild-type A549 NSCLC cells. Icotinib and Gefitinib did not induce autophagic flux or inhibit mTOR in A549 cells. Moreover, suppression of autophagy by chloroquine, a lysosomal inhibitor, did not affect Icotinib- or Gefitinib-induced cell death in A549 cells. In contrast, Brusatol, an Nrf2 inhibitor, significantly suppressed the cell survival of A549 cells. However, Brusatol did not further sensitize A549 cells to EGFR TKI-induced cell death. Results from this study suggest that inhibition of Nrf2 can decrease cell vitality of EGFR wild-type A549 cells independent of autophagy. - Highlights: • Cancer cells use adaptive mechanisms against chemotherapy. • Autophagy is not essential for the drug resistance of lung cancer A549 cells. • Inhibition of Nrf2 decreases cell survival of lung cancer A549 cells.

  10. Nrf2 but not autophagy inhibition is associated with the survival of wild-type epidermal growth factor receptor non-small cell lung cancer cells

    Energy Technology Data Exchange (ETDEWEB)

    Zhou, Yan [Department of Pulmonary, Shanghai Chest Hospital, Shanghai Jiao Tong University, Shanghai 200030 (China); Department of Pharmacology, Toxicology and Therapeutics, The University of Kansas Medical Center, Kansas City, KS 66160 (United States); Li, Yuan; Ni, Hong-Min; Ding, Wen-Xing [Department of Pharmacology, Toxicology and Therapeutics, The University of Kansas Medical Center, Kansas City, KS 66160 (United States); Zhong, Hua, E-mail: eddiedong8@hotmail.com [Department of Pulmonary, Shanghai Chest Hospital, Shanghai Jiao Tong University, Shanghai 200030 (China)

    2016-11-01

    Non-small cell lung cancer (NSCLC) is one of the most common malignancies in the world. Icotinib and Gefitinib are two epidermal growth factor receptor (EGFR) tyrosine kinase inhibitors (TKIs) that have been used to treat NSCLC. While it is well known that mutations of EGFR can affect the sensitivity of NSCLC to the EGFR-TKI, other mechanisms may also be adopted by lung cancer cells to develop resistance to EGFR-TKI treatment. Cancer cells can use multiple adaptive mechanisms such as activation of autophagy and Nrf2 to protect against various stresses and chemotherapeutic drugs. Whether autophagy or Nrf2 activation contributes to the resistance of NSCLC to EGFR-TKI treatment in wild-type EGFR NSCLC cells remains elusive. In the present study, we confirmed that Icotinib and Gefitinib induced apoptosis in EGFR mutant HCC827 but not in EGFR wild-type A549 NSCLC cells. Icotinib and Gefitinib did not induce autophagic flux or inhibit mTOR in A549 cells. Moreover, suppression of autophagy by chloroquine, a lysosomal inhibitor, did not affect Icotinib- or Gefitinib-induced cell death in A549 cells. In contrast, Brusatol, an Nrf2 inhibitor, significantly suppressed the cell survival of A549 cells. However, Brusatol did not further sensitize A549 cells to EGFR TKI-induced cell death. Results from this study suggest that inhibition of Nrf2 can decrease cell vitality of EGFR wild-type A549 cells independent of autophagy. - Highlights: • Cancer cells use adaptive mechanisms against chemotherapy. • Autophagy is not essential for the drug resistance of lung cancer A549 cells. • Inhibition of Nrf2 decreases cell survival of lung cancer A549 cells.

  11. Expression of hypoxia-inducible factor-1 by trophectoderm cells in response to hypoxia and epidermal growth factor

    International Nuclear Information System (INIS)

    Jeong, Wooyoung; Bazer, Fuller W.; Song, Gwonhwa; Kim, Jinyoung

    2016-01-01

    The low oxygen environment in the uterine environment requires pre-implantation embryos to adapt to oxygen deficiency. Hypoxia-inducible factor (HIF)-1 is a master regulator whereby cells adapt to changes in oxygen concentrations. In addition to hypoxic conditions, non-hypoxic stimuli such as growth factors also activate expression of HIF-1. In this study, the mechanisms underlying low oxygen-dependent and epidermal growth factor (EGF)-dependent expression of HIF-1α were explored using porcine trophectoderm (pTr) cells. The results indicated that expression of HIF-1α and HIF-1β mRNAs was not affected by low concentrations of oxygen; however, hypoxic conditions markedly increased the abundance of HIF-1α protein, especially in nuclei of pTr cells. Even under normoxic conditions, the abundance of HIF-1α protein increased in response to EGF. This EGF-mediated increase in HIF-1α protein was blocked through inhibition of translation by cycloheximide. The inhibitors LY294002 (PI3K-AKT inhibitor), U0126 (inhibitor of ERK1/2) and rapamycin (mTOR inhibitor) also blocked the ability of EGF to increase HIF-1α protein and to phosphorylate AKT, ERK1/2 and mTOR proteins. Both hypoxia and EGF induced proliferation of pTr cells. This ability of EGF to stimulate proliferation of pTr cells was suppressed by EGFR siRNA, but not HIF-1α siRNA, but a significant decrease in EGF-induced HIF-1α protein occurred when pTr cells were transfected with HIF-1α siRNA. The results of the present study suggest that pTr cells adapt to oxygen deficiency and proliferate in response to an oxygen-dependent HIF-1 system, and that EGF at maternal–conceptus interface can increase the abundance of HIF-1α protein via translational regulation through AKT, ERK1/2 and mTOR signaling cascades. - Highlights: • HIF-1α expression is up-regulated in pTr cells under low oxygen concentrations. • EGF induces HIF-1α accumulation in pTr cells. • EGF-induced HIF-1α accumulation is blocked by de

  12. Expression of hypoxia-inducible factor-1 by trophectoderm cells in response to hypoxia and epidermal growth factor

    Energy Technology Data Exchange (ETDEWEB)

    Jeong, Wooyoung [Department of Animal Resources Science, Dankook University, Cheonan (Korea, Republic of); Bazer, Fuller W. [Center for Animal Biotechnology and Genomics and Department of Animal Science, Texas A& M University, College Station, TX (United States); Song, Gwonhwa, E-mail: ghsong@korea.ac.kr [Department of Biotechnology, College of Life Sciences and Biotechnology, Korea University, Seoul (Korea, Republic of); Kim, Jinyoung, E-mail: jinyoungkim@dankook.ac.kr [Department of Animal Resources Science, Dankook University, Cheonan (Korea, Republic of)

    2016-01-08

    The low oxygen environment in the uterine environment requires pre-implantation embryos to adapt to oxygen deficiency. Hypoxia-inducible factor (HIF)-1 is a master regulator whereby cells adapt to changes in oxygen concentrations. In addition to hypoxic conditions, non-hypoxic stimuli such as growth factors also activate expression of HIF-1. In this study, the mechanisms underlying low oxygen-dependent and epidermal growth factor (EGF)-dependent expression of HIF-1α were explored using porcine trophectoderm (pTr) cells. The results indicated that expression of HIF-1α and HIF-1β mRNAs was not affected by low concentrations of oxygen; however, hypoxic conditions markedly increased the abundance of HIF-1α protein, especially in nuclei of pTr cells. Even under normoxic conditions, the abundance of HIF-1α protein increased in response to EGF. This EGF-mediated increase in HIF-1α protein was blocked through inhibition of translation by cycloheximide. The inhibitors LY294002 (PI3K-AKT inhibitor), U0126 (inhibitor of ERK1/2) and rapamycin (mTOR inhibitor) also blocked the ability of EGF to increase HIF-1α protein and to phosphorylate AKT, ERK1/2 and mTOR proteins. Both hypoxia and EGF induced proliferation of pTr cells. This ability of EGF to stimulate proliferation of pTr cells was suppressed by EGFR siRNA, but not HIF-1α siRNA, but a significant decrease in EGF-induced HIF-1α protein occurred when pTr cells were transfected with HIF-1α siRNA. The results of the present study suggest that pTr cells adapt to oxygen deficiency and proliferate in response to an oxygen-dependent HIF-1 system, and that EGF at maternal–conceptus interface can increase the abundance of HIF-1α protein via translational regulation through AKT, ERK1/2 and mTOR signaling cascades. - Highlights: • HIF-1α expression is up-regulated in pTr cells under low oxygen concentrations. • EGF induces HIF-1α accumulation in pTr cells. • EGF-induced HIF-1α accumulation is blocked by de

  13. The Effects of Epidermal Neural Crest Stem Cells on Local Inflammation Microenvironment in the Defected Sciatic Nerve of Rats

    Directory of Open Access Journals (Sweden)

    Yue Li

    2017-05-01

    Full Text Available Cell-based therapy is a promising strategy for the repair of peripheral nerve injuries (PNIs. epidermal neural crest stems cells (EPI-NCSCs are thought to be important donor cells for repairing PNI in different animal models. Following PNI, inflammatory response is important to regulate the repair process. However, the effects of EPI-NCSCs on regulation of local inflammation microenviroment have not been investigated extensively. In the present study, these effects were studied by using 10 mm defected sciatic nerve, which was bridged with 15 mm artificial nerve composed of EPI-NCSCs, extracellular matrix (ECM and poly (lactide-co-glycolide (PLGA. Then the expression of pro- and anti-inflammatory cytokines, polarization of macrophages, regulation of fibroblasts and shwann cells (SCs were assessed by western blot, immunohistochemistry, immunofluorescence staining at 1, 3, 7 and 21 days after bridging. The structure and the function of the bridged nerve were determined by observation under light microscope and by examination of right lateral foot retraction time (LFRT, sciatic function index (SFI, gastrocnemius wet weight and electrophysiology at 9 weeks. After bridging with EPI-NCSCs, the expression of anti-inflammatory cytokines (IL-4 and IL-13 was increased, but decreased for pro-inflammatory cytokines (IL-6 and TNF-α compared to the control bridging, which was consistent with increase of M2 macrophages and decrease of M1 macrophages at 7 days after transplantation. Likewise, myelin-formed SCs were significantly increased, but decreased for the activated fibroblasts in their number at 21 days. The recovery of structure and function of nerve bridged with EPI-NCSCs was significantly superior to that of DMEM. These results indicated that EPI-NCSCs could be able to regulate and provide more suitable inflammation microenvironment for the repair of defected sciatic nerve.

  14. Epidermal growth factor receptor inhibition reduces angiogenesis via hypoxia-inducible factor-1α and Notch1 in head neck squamous cell carcinoma.

    Directory of Open Access Journals (Sweden)

    Wei-Ming Wang

    Full Text Available Angiogenesis, a marker of cancer development, affects response to radiotherapy sensibility. This preclinical study aims to understand the receptor tyrosine kinase-mediated angiogenesis in head neck squamous cell carcinoma (HNSCC. The receptor tyrosine kinase activity in a transgenic mouse model of HNSCC was assessed. The anti-tumorigenetic and anti-angiogenetic effects of cetuximab-induced epidermal growth factor receptor (EGFR inhibition were investigated in xenograft and transgenic mouse models of HNSCC. The signaling transduction of Notch1 and hypoxia-inducible factor-1α (HIF-1α was also analyzed. EGFR was overexpressed and activated in the Tgfbr1/Pten deletion (2cKO mouse model of HNSCC. Cetuximab significantly delayed tumor onset by reducing tumor angiogenesis. This drug exerted similar effects on heterotopic xenograft tumors. In the human HNSCC tissue array, increased EGFR expression correlated with increased HIF-1α and micro vessel density. Cetuximab inhibited tumor-induced angiogenesis in vitro and in vivo by significantly downregulating HIF-1α and Notch1. EGFR is involved in the tumor angiogenesis of HNSCC via the HIF-1α and Notch1 pathways. Therefore, targeting EGFR by suppressing hypoxia- and Notch-induced angiogenesis may benefit HNSCC therapy.

  15. Combining laser-assisted microdissection (LAM) and RNA-seq allows to perform a comprehensive transcriptomic analysis of epidermal cells of Arabidopsis embryo.

    Science.gov (United States)

    Sakai, Kaori; Taconnat, Ludivine; Borrega, Nero; Yansouni, Jennifer; Brunaud, Véronique; Paysant-Le Roux, Christine; Delannoy, Etienne; Martin Magniette, Marie-Laure; Lepiniec, Loïc; Faure, Jean Denis; Balzergue, Sandrine; Dubreucq, Bertrand

    2018-01-01

    Genome-wide characterization of tissue- or cell-specific gene expression is a recurrent bottleneck in biology. We have developed a sensitive approach based on ultra-low RNA sequencing coupled to laser assisted microdissection for analyzing different tissues of the small Arabidopsis embryo. We first characterized the number of genes detected according to the quantity of tissue yield and total RNA extracted. Our results revealed that as low as 0.02 mm 2 of tissue and 50 pg of total RNA can be used without compromising the number of genes detected. The optimised protocol was used to compare the epidermal versus mesophyll cell transcriptomes of cotyledons at the torpedo-shaped stage of embryo development. The approach was validated by the recovery of well-known epidermal genes such AtML1 or AtPDF2 and genes involved in flavonoid and cuticular waxes pathways. Moreover, the interest and sensitivity of this approach were highlighted by the characterization of several transcription factors preferentially expressed in epidermal cells. This technical advance unlocks some current limitations of transcriptomic analyses and allows to investigate further and efficiently new biological questions for which only a very small amounts of cells need to be isolated. For instance, it paves the way to increasing the spatial accuracy of regulatory networks in developing small embryo of Arabidopsis or other plant tissues.

  16. Epidermal Notch1 recruits RORγ + group 3 innate lymphoid cells to orchestrate normal skin repair

    NARCIS (Netherlands)

    Z. Li (Zhi); T. Hodgkinson (Tom); E.J. Gothard (Elizabeth J.); S. Boroumand (Soulmaz); R. Lamb (Rebecca); I. Cummins (Ian); P. Narang (Priyanka); A. Sawtell (Amy); J. Coles (Jenny); G. Leonov (German); A. Reboldi (Andrea); C.D. Buckley; T. Cupedo (Tom); C. Siebel (Christian); A. Bayat (Ardeshir); M. Coles (Mark); C.A. Ambler (Carrie A.)

    2016-01-01

    textabstractNotch has a well-defined role in controlling cell fate decisions in the embryo and the adult epidermis and immune systems, yet emerging evidence suggests Notch also directs non-cell-autonomous signalling in adult tissues. Here, we show that Notch1 works as a damage response signal.

  17. Barley disease susceptibility factor RACB acts in epidermal cell polarity and positioning of the nucleus.

    Science.gov (United States)

    Scheler, Björn; Schnepf, Vera; Galgenmüller, Carolina; Ranf, Stefanie; Hückelhoven, Ralph

    2016-05-01

    RHO GTPases are regulators of cell polarity and immunity in eukaryotes. In plants, RHO-like RAC/ROP GTPases are regulators of cell shaping, hormone responses, and responses to microbial pathogens. The barley (Hordeum vulgare L.) RAC/ROP protein RACB is required for full susceptibility to penetration by Blumeria graminis f.sp. hordei (Bgh), the barley powdery mildew fungus. Disease susceptibility factors often control host immune responses. Here we show that RACB does not interfere with early microbe-associated molecular pattern-triggered immune responses such as the oxidative burst or activation of mitogen-activated protein kinases. RACB also supports rather than restricts expression of defence-related genes in barley. Instead, silencing of RACB expression by RNAi leads to defects in cell polarity. In particular, initiation and maintenance of root hair growth and development of stomatal subsidiary cells by asymmetric cell division is affected by silencing expression of RACB. Nucleus migration is a common factor of developmental cell polarity and cell-autonomous interaction with Bgh RACB is required for positioning of the nucleus near the site of attack from Bgh We therefore suggest that Bgh profits from RACB's function in cell polarity rather than from immunity-regulating functions of RACB. © The Author 2016. Published by Oxford University Press on behalf of the Society for Experimental Biology.

  18. Regulators of floral fragrance production and their target genes in petunia are not exclusively active in the epidermal cells of petals.

    Science.gov (United States)

    Van Moerkercke, Alex; Galván-Ampudia, Carlos S; Verdonk, Julian C; Haring, Michel A; Schuurink, Robert C

    2012-05-01

    In which cells of the flower volatile biosynthesis takes place is unclear. In rose and snapdragon, some enzymes of the volatile phenylpropanoid/benzenoid pathway have been shown to be present in the epidermal cells of petals. It is therefore generally believed that the production of these compounds occurs in these cells. However, whether the entire pathway is active in these cells and whether it is exclusively active in these cells remains to be proven. Cell-specific transcription factors activating these genes will determine in which cells they are expressed. In petunia, the transcription factor EMISSION OF BENZENOIDS II (EOBII) activates the ODORANT1 (ODO1) promoter and the promoter of the biosynthetic gene isoeugenol synthase (IGS). The regulator ODO1 in turn activates the promoter of the shikimate gene 5-enolpyruvylshikimate-3-phosphate synthase (EPSPS). Here the identification of a new target gene of ODO1, encoding an ABC transporter localized on the plasma membrane, PhABCG1, which is co-expressed with ODO1, is described. PhABCG1 expression is up-regulated in petals overexpressing ODO1 through activation of the PhABCG1 promoter. Interestingly, the ODO1, PhABCG1, and IGS promoters were active in petunia protoplasts originating from both epidermal and mesophyll cell layers of the petal, suggesting that the volatile phenylpropanoid/benzenoid pathway in petunia is active in these different cell types. Since volatile release occurs from epidermal cells, trafficking of (volatile) compounds between cell layers must be involved, but the exact function of PhABCG1 remains to be resolved.

  19. Human leukaemic cells

    International Nuclear Information System (INIS)

    Andronikashvili, E.L.; Mosulishvili, L.M.; Belokobil'skiy, A.I.; Kharabadze, N.E.; Shonia, N.I.; Desai, L.S.; Foley, G.E.

    1976-01-01

    The results of the determination of trace elements in nucleic acids and histones in human leukaemic cells by activation analysis are reported. The Cr 2+ , Fe 2+ , Zn 2+ , Co 2+ and Sb 2+ content of DNA and RNA of leukaemic cells compared to that of lymphocytes from a patient with infectious mononucleosis or a normal donor are shown tabulated. Similar comparisons are shown for the same trace metal content of histones isolated from the same type of cells. It is felt that the results afford further interesting speculation that trace metals may be involved in the interactions between histones and DNA (especially at the binding sites of histones to DNA), which affect transcription characteristics. (U.K.)

  20. Attenuation fluctuations and local dermal reflectivity are indicators of immune cell infiltrate and epidermal hyperplasia in skin inflammation

    Science.gov (United States)

    Phillips, Kevin G.; Wang, Yun; Choudhury, Niloy; Levitz, David; Swanzey, Emily; Lagowski, James; Kulesz-Martin, Molly; Jacques, Steven

    2012-02-01

    Psoriasis is a common inflammatory skin disease resulting from genetic and environmental alterations of cutaneous immune responses responsible for skin homeostasis. While numerous therapeutic targets involved in the immunopathogenesis of psoriasis have been identified, the in vivo dynamics of psoriasis remains under investigated. To elucidate the spatial-temporal morphological evolution of psoriasis we undertook in vivo time course focus-tracked optical coherence tomography (OCT) imaging to non-invasively document dermal alterations due to immune cell infiltration and epidermal hyperplasia in an Imiquimod (IMQ) induced model of psoriasis-like inflammation in DBA2/C57Bl6 hybrid mice. Quantitative appraisal of dermal architectural changes was achieved through a three parameter fit of OCT axial scans in the dermis of the form A(z) = ρ exp(-mu;z +ɛ(z)). Ensemble averaging of the fit parameters over 2000 axial scans per mouse in each treatment arm revealed that the local dermal reflectivity ρ, decreased significantly in response to 6 day IMQ treatment (p = 0.0001), as did the standard deviation of the attenuation fluctuation std(ɛ(z)), (p = 0.04), in comparison to cream controls and day 1 treatments. No significant changes were observed in the average dermal attenuation rate, μ. Our results suggest these label-free OCT-based metrics can be deployed to investigate new therapeutic targets in animal models as well as aid in clinical staging of psoriasis in conjunction with the psoriasis area and severity index.

  1. Potential role for epidermal growth factor receptor inhibitors in combined-modality therapy for non-small-cell lung cancer

    International Nuclear Information System (INIS)

    Kim, Dong Wook; Choy, Hak

    2004-01-01

    There has been a surge of interest in the translation of discoveries in molecular biology into clinically relevant therapies in the field of hematology/oncology. The epidermal growth factor receptor (EGFR) has been a molecular target of significant interest and investigation, and preclinical and clinical studies support a role for targeted therapy in a variety of cancers, including non-small-cell lung cancer (NSCLC) via compounds that specifically inhibit EGFR. ZD1839, IMC-C225, and OSI-774 are the most clinically developed of these compounds. Interestingly, preclinical studies have demonstrated that EGFR inhibitors may have radiation-sensitizing properties, as well as increased cytotoxic activity in combination with chemotherapeutic agents, suggesting a potential role for EGFR inhibitors as an adjunct to the current combined-modality approach for therapy of Stage III NSCLC. Therefore, clinical trials have been proposed and initiated to address the issue of determining the impact of the addition of EGFR inhibitors to the standard combined-modality regimen (chemotherapy/radiation therapy ± surgery) for Stage III NSCLC. This article reviews preclinical and clinical data supporting the role for EGFR inhibitors alone or in combination with chemotherapy/radiation therapy for locally advanced NSCLC. Also, it will provide an overview of ongoing and proposed clinical studies investigating the potential role for EGFR inhibitors in Stage III NSCLC

  2. Epidermal growth factor receptor (EGFR) mutations and expression in squamous cell carcinoma of the esophagus in central Asia

    International Nuclear Information System (INIS)

    Abedi-Ardekani, Behnoush; Malekzadeh, Reza; Hainaut, Pierre; Dar, Nazir Ahmad; Mir, Mohammad Muzaffar; Zargar, Showkat Ahmad; Lone, M Muqbool; Martel-Planche, Ghyslaine; Villar, Stéphanie; Mounawar, Mounia; Saidi, Farrokh

    2012-01-01

    Esophageal squamous cell carcinoma (ESCC) shows geographic variations in incidence, with high incidences (>50/10 5 person-years) in central Asia, including North Eastern Iran (Golestan) and Northern India (Kashmir). In contrast to Western countries, smoking does not appear to be a significant risk factor for ESCC in central Asia. In lung adenocarcinoma, activating mutations in the gene encoding epidermal growth factor receptor (EGFR) are frequent in tumors of never smokers of Asian origin, predicting therapeutic sensitivity to Egfr-targeting drugs. In this study 152 cases of histologically confirmed ESCC from Iran (Tehran and Golestan Province) and North India (Kashmir Valley) have been analyzed for EGFR mutation by direct sequencing of exons 18–21. Egfr protein expression was evaluated by immunohistochemistry in 34 samples from Tehran and HER2 mutations were analyzed in 54 cases from Kashmir. A total of 14 (9.2%) EGFR variations were detected, including seven variations in exons. Among those, four (2.6%) were already documented in lung cancers, two were reported as polymorphisms and one was a potentially new activating mutation. All but one variation in introns were previously identified as polymorphisms. Over-expression of Egfr was detected in 22/34 (65%) of tested cases whereas no HER2 mutation was found in 54 cases from Kashmir. Overall, EGFR mutations appear to be a rare event in ESCC in high incidence areas of central Asia, although a very small proportion of cases may harbor mutations predicting sensitivity to anti-Egfr drugs

  3. Epidermal Growth Factor Receptor targeting in non-small cell lung cancer: revisiting different strategies against the same target.

    Science.gov (United States)

    Castañón, Eduardo; Martín, Patricia; Rolfo, Christian; Fusco, Juan P; Ceniceros, Lucía; Legaspi, Jairo; Santisteban, Marta; Gil-Bazo, Ignacio

    2014-01-01

    Epidermal Growth Factor Receptor (EGFR) tyrosine kinase inhibitors (TKIs) have changed the paradigm of treatment in non-small cell lung cancer (NSCLC). The molecular biology study of EGFR has led to clinical trials that select patients more accurately, regarding the presence of EGFR activating mutations. Nonetheless, a lack of response or a temporary condition of the response has been detected in patients on EGFR TKIs. This has urged to study potential resistance mechanisms underneath. The most important ones are the presence of secondary mutations in EGFR, such as T790M, or the overexpression of mesenchymal-epithelial transition factor (MET) that may explain why patients who initially respond to EGFR TKIs, may ultimately become refractory. Several approaches have been taken and new drugs both targeting EGFR resistance-mutation or MET are currently being developed. Here we review and update the EGFR biological pathway as well as the clinical data leading to approval of the EGFR TKIs currently in the market. New compounds under investigation targeting resistance mutations or dually targeting EGFR and other relevant receptors are also reviewed and discussed.

  4. Model-Based Analysis of Arabidopsis Leaf Epidermal Cells Reveals Distinct Division and Expansion Patterns for Pavement and Guard Cells1[W][OA

    Science.gov (United States)

    Asl, Leila Kheibarshekan; Dhondt, Stijn; Boudolf, Véronique; Beemster, Gerrit T.S.; Beeckman, Tom; Inzé, Dirk; Govaerts, Willy; De Veylder, Lieven

    2011-01-01

    To efficiently capture sunlight for photosynthesis, leaves typically develop into a flat and thin structure. This development is driven by cell division and expansion, but the individual contribution of these processes is currently unknown, mainly because of the experimental difficulties to disentangle them in a developing organ, due to their tight interconnection. To circumvent this problem, we built a mathematic model that describes the possible division patterns and expansion rates for individual epidermal cells. This model was used to fit experimental data on cell numbers and sizes obtained over time intervals of 1 d throughout the development of the first leaf pair of Arabidopsis (Arabidopsis thaliana). The parameters were obtained by a derivative-free optimization method that minimizes the differences between the predicted and experimentally observed cell size distributions. The model allowed us to calculate probabilities for a cell to divide into guard or pavement cells, the maximum size at which it can divide, and its average cell division and expansion rates at each point during the leaf developmental process. Surprisingly, average cell cycle duration remained constant throughout leaf development, whereas no evidence for a maximum cell size threshold for cell division of pavement cells was found. Furthermore, the model predicted that neighboring cells of different sizes within the epidermis expand at distinctly different relative rates, which could be verified by direct observations. We conclude that cell division seems to occur independently from the status of cell expansion, whereas the cell cycle might act as a timer rather than as a size-regulated machinery. PMID:21693673

  5. Strain differences in the expression of an H-2K/sup k/ gene product by epidermal and spleen cells

    International Nuclear Information System (INIS)

    Hadley, G.A.; Steinmuller, D.

    1986-01-01

    Cytotoxic T lymphocytes (CTL) directed against Epa-1, a non-H-2 alloantigen expressed by epidermal cells (EC) but no lymphoid cells, lyse EC of different H-2/sup k/, Epa-1 + strains at different levels. For example, the mean percent lysis values for EC of strains CBA, AKR, C58, and RF are 60, 46, 41, and 35 respectively. Since the CTL used to obtain these values recognize Epa-1 only in the context of H-2K/sup k/, the different levels of lysis could reflect differences in either Epa-1 or K/sup k/ antigens. The goal of this investigation was to test the second alternative. For this purpose, the authors obtained hybridoma 16-1-11N that secretes a K/sup k/-specific MoAb. They first demonstrated the capacity of MoAb 16-1-11N to block the lysis of CBA EC by Epa-1-specific CTL. They then utilized it as the probe in a cellar RIA, with 125 I-protein A as the second reagent, to quantitate the expression of K/sup k/ antigens on EC of strains CBA, AKR, C58, and RF. They found that C58 and RF EC bound significantly less of the K/sup k/ MoAb than CBA EC. Although AKR EC also bound less of the MoAb than CBA EC, the difference was not significant. Nonetheless, these data support the hypothesis that the differential susceptibility of the strains to lysis by Epa-1-specific CTL is due to differences in the expression of the H-2 restricting element. The authors also tested spleen cells (SC) of the four strains in the RIA described above and found that SC of RF, but not of C58 or AKR, express reduced levels of K/sup k/ antigens compared to CBA SC

  6. Synthetic inhibitors of matrix metalloproteinases prevent sulfur mustard-induced epidermal-dermal separation in human skin pieces

    NARCIS (Netherlands)

    Mol, M.A.E.; Alblas, S.W.; Hammer, A.; Benschop, H.P.

    2000-01-01

    Degradation of proteins of the basement membrane zone (BMZ) in the skin depends on the activity of proteolytic enzymes, particularly those belonging to the group of matrix metalloproteinases (MMPs). In the present study we have investigated the contribution of these enzymes to the epidermal-dermal

  7. Epidermal growth factor protects squamous cell carcinoma against cisplatin-induced cytotoxicity through increased interleukin-1β expression.

    Directory of Open Access Journals (Sweden)

    Shian-Chin Ko

    Full Text Available The expression of cytokines, such as IL-1β, and the activation of the epidermal growth factor receptor (EGFR are crucial regulators in the process of carcinogenesis. The correlation between growth factor and activated cytokine signals in the control of tumor development is a critical issue to be clarified. In our study, we found that the IL-1β gene and protein expression were induced by EGF in squamous cell carcinoma. To clarify the mechanism involved in EGF-regulated IL-1β expression, we examined the transcriptional activity and mRNA stability of IL-1β in EGF-treated cells. We found that EGF induced the expression of IL-1β and was mediated through transcriptional activation, but not through mRNA stability. The involvement of Akt and NF-κB signaling pathways in the EGF-induced IL-1β gene expression was confirmed by knockdown of RelA and Akt in cells or treating cells with Akt and NF-κB inhibitors, LY294002 and parthenolide, respectively. The expression of dominant negative IκB also repressed the activation of NF-κB and inhibited EGF-induced IL-1β expression. Using immunofluorescence staining assay, the EGF-stimulated nuclear translocation of NF-κB (p65 was inhibited by pre-treating cells with LY294002 and parthenolide. Furthermore, EGF increased the binding of NF-κB to the NF-κB binding site of the IL-1β promoter through the activation of the Akt/NF-κB pathway, which resulted in activating IL-1β promoter activity. The expression and secretion of IL-1β induced by EGF considerably reduced chemotherapeutic drug cisplatin-induced cell death. These results showed that EGF enhanced the expression of IL-1β, which was mediated by the Akt/NF-κB pathway. The activation of EGF signaling and increase of IL-1β contributed to chemotherapeutic resistance of cancer cells, suggesting that the expression of IL-1β may be used as a biomarker to evaluate successful cancer treatment.

  8. Gene expression profiling of histologically normal breast tissue in females with human epidermal growth factor receptor 2‑positive breast cancer.

    Science.gov (United States)

    Zubor, Pavol; Hatok, Jozef; Moricova, Petra; Kapustova, Ivana; Kajo, Karol; Mendelova, Andrea; Sivonova, Monika Kmetova; Danko, Jan

    2015-02-01

    Gene expression profile‑based taxonomy of breast cancer (BC) has been described as a significant breakthrough in comprehending the differences in the origin and behavior of cancer to allow individually tailored therapeutic approaches. In line with this, we hypothesized that the gene expression profile of histologically normal epithelium (HNEpi) could harbor certain genetic abnormalities predisposing breast tissue cells to develop human epidermal growth factor receptor 2 (HER2)‑positive BC. Thus, the aim of the present study was to assess gene expression in normal and BC tissue (BCTis) from patients with BC in order to establish its value as a potential diagnostic marker for cancer development. An array study evaluating a panel of 84 pathway‑ and disease‑specific genes in HER2‑positive BC and tumor‑adjacent HNEpi was performed using quantitative polymerase chain reaction in 12 patients using microdissected samples from frozen tissue. Common prognostic and predictive parameters of BC were assessed by immunohistochemistry and in situ hybridization. In the BCTis and HNEpi samples of 12 HER2‑positive subjects with BC, the expression of 2,016 genes was assessed. A total of 39.3% of genes were deregulated at a minimal two‑fold deregulation rate and 10.7% at a five‑fold deregulation rate in samples of HNEpi or BCTis. Significant differences in gene expression between BCTis and HNEpi samples were revealed for BCL2L2, CD44, CTSD, EGFR, ERBB2, ITGA6, NGFB, RPL27, SCBG2A1 and SCGB1D2 genes (Pbreast tissue revealed gene expression abnormalities that may represent potential markers of increased risk for HER2‑positive malignant transformation of breast tissue, and may be able to be employed as predictors of prognosis.

  9. Phase I study of neratinib in combination with temsirolimus in patients with human epidermal growth factor receptor 2-dependent and other solid tumors.

    Science.gov (United States)

    Gandhi, Leena; Bahleda, Rastislav; Tolaney, Sara M; Kwak, Eunice L; Cleary, James M; Pandya, Shuchi S; Hollebecque, Antoine; Abbas, Richat; Ananthakrishnan, Revathi; Berkenblit, Anna; Krygowski, Mizue; Liang, Yali; Turnbull, Kathleen W; Shapiro, Geoffrey I; Soria, Jean-Charles

    2014-01-10

    Human epidermal growth factor (HER) -mediated signaling is critical in many cancers, including subsets of breast and lung cancer. HER family members signal via the phosphatidylinositide 3-kinase (PI3K) -AKT/protein kinase B-mammalian target of rapamycin (mTOR) cascade; mTOR activation is critical for the expression of multiple contributors to tumor growth and invasion. On the basis of preclinical data suggesting synergy of HER2 inhibition and mTOR inhibition in breast and lung cancer models, we conducted a phase I combination study of neratinib, a small-molecule irreversible pan-HER tyrosine kinase inhibitor, and temsirolimus, an mTOR inhibitor, in patients with advanced solid tumors. This study enrolled patients to dosing combinations of neratinib and temsirolimus. The primary objective was to estimate the toxicity contour of the combination and establish recommended phase II doses. Sixty patients were treated on 12 of 16 possible dosing combinations. Diarrhea was the most common drug-related (93%) and dose-limiting toxicity (DLT), constituting four of 10 DLTs. Dose-limiting grade 3 metabolic abnormalities were also observed. Other frequent drug-related toxicities included nausea, stomatitis (both 53%), and anemia (48%). Two maximum-tolerated dose combinations were identified: 200 mg of neratinib/25 mg of temsirolimus and 160 mg of neratinib/50 mg of temsirolimus. Responses were noted in patients with HER2-amplified breast cancer resistant to trastuzumab, HER2-mutant non-small-cell lung cancer, and tumor types without identified mutations in the HER-PI3K-mTOR pathway. The combination of neratinib and temsirolimus was tolerable and demonstrated antitumor activity in multiple tumor types, warranting further evaluation.

  10. Pharmacokinetics, biodistribution and dosimetry of {sup 99m}Tc-labeled anti-human epidermal growth factor receptor humanized monoclonal antibody R3 in rats

    Energy Technology Data Exchange (ETDEWEB)

    Escobar, Normando Iznaga; Morales, Alejo Morales; Duconge, Jorge; Torres, Idania Caballero; Fernandez, Eduardo; Gomez, Jose A

    1998-01-01

    The pharmacokinetics, biodistribution and dosimetry of {sup 99m}Tc-labeled anti-human epidermal growth factor receptor (anti-hEGF-r) humanized monoclonal antibody (MAb) R3 was investigated following intravenous injection in normal Wistar rats. Serum disappearance curves were best fit by a two-compartment model having a mean distribution half-life (t{sub (1(2{alpha}}{sub ))}) of 0.250 h and a mean elimination (t{sub (1(2{beta}}{sub ))}) of 13.89 h. Among the various organs, a little accumulation of the radiolabeled antibody was found only in kidneys. Biodistribution and dosimetry studies in humans were performed by extrapolation of the animal data to humans. Absorbed dose to normal organs and the remainder of the whole body were estimated using the medical internal radiation dose formula, and dose contributions from radioactivity in transit through the gastrointestinal tract were estimated using a compartment model. Extrapolated values of radiation absorbed dose to normal organs in rads per millicurie administered were whole body, 0.0085; lower large intestine wall, 0.0898; small intestine, 0.0530; upper large intestine wall, 0.0731; and kidneys, 0.0455. The effective dose equivalent predicted was 0.0162 rem/mCi and the effective dose was found to be 0.015 rem/mCi. On the basis of the pharmacokinetics, biodistribution and internal radiation dosimetry information obtained in this study, a diagnostic phase I clinical trial with {sup 99m}Tc-labeled humanized MAb R3 conjugate in patients should be supported.

  11. Pharmacokinetics, biodistribution and dosimetry of 99mTc-labeled anti-human epidermal growth factor receptor humanized monoclonal antibody R3 in rats

    International Nuclear Information System (INIS)

    Escobar, Normando Iznaga; Morales, Alejo Morales; Duconge, Jorge; Torres, Idania Caballero; Fernandez, Eduardo; Gomez, Jose A.

    1998-01-01

    The pharmacokinetics, biodistribution and dosimetry of 99m Tc-labeled anti-human epidermal growth factor receptor (anti-hEGF-r) humanized monoclonal antibody (MAb) R3 was investigated following intravenous injection in normal Wistar rats. Serum disappearance curves were best fit by a two-compartment model having a mean distribution half-life (t (1(2α)) ) of 0.250 h and a mean elimination (t (1(2β)) ) of 13.89 h. Among the various organs, a little accumulation of the radiolabeled antibody was found only in kidneys. Biodistribution and dosimetry studies in humans were performed by extrapolation of the animal data to humans. Absorbed dose to normal organs and the remainder of the whole body were estimated using the medical internal radiation dose formula, and dose contributions from radioactivity in transit through the gastrointestinal tract were estimated using a compartment model. Extrapolated values of radiation absorbed dose to normal organs in rads per millicurie administered were whole body, 0.0085; lower large intestine wall, 0.0898; small intestine, 0.0530; upper large intestine wall, 0.0731; and kidneys, 0.0455. The effective dose equivalent predicted was 0.0162 rem/mCi and the effective dose was found to be 0.015 rem/mCi. On the basis of the pharmacokinetics, biodistribution and internal radiation dosimetry information obtained in this study, a diagnostic phase I clinical trial with 99m Tc-labeled humanized MAb R3 conjugate in patients should be supported

  12. Biochemistry of epidermal stem cells☆

    Science.gov (United States)

    Eckert, Richard L.; Adhikary, Gautam; Balasubramanian, Sivaprakasam; Rorke, Ellen A.; Vemuri, Mohan C.; Boucher, Shayne E.; Bickenbach, Jackie R.; Kerr, Candace

    2014-01-01

    Background The epidermis is an important protective barrier that is essential for maintenance of life. Maintaining this barrier requires continuous cell proliferation and differentiation. Moreover, these processes must be balanced to produce a normal epidermis. The stem cells of the epidermis reside in specific locations in the basal epidermis, hair follicle and sebaceous glands and these cells are responsible for replenishment of this tissue. Scope of review A great deal of effort has gone into identifying protein epitopes that mark stem cells, in identifying stem cell niche locations, and in understanding how stem cell populations are related. We discuss these studies as they apply to understanding normal epidermal homeostasis and skin cancer. Major conclusions An assortment of stem cell markers have been identified that permit assignment of stem cells to specific regions of the epidermis, and progress has been made in understanding the role of these cells in normal epidermal homeostasis and in conditions of tissue stress. A key finding is the multiple stem cell populations exist in epidermis that give rise to different structures, and that multiple stem cell types may contribute to repair in damaged epidermis. General significance Understanding epidermal stem cell biology is likely to lead to important therapies for treating skin diseases and cancer, and will also contribute to our understanding of stem cells in other systems. This article is part of a Special Issue entitled Biochemistry of Stem Cells. PMID:22820019

  13. Objective Quantification of Immune Cell Infiltrates and Epidermal Proliferation in Psoriatic Skin

    DEFF Research Database (Denmark)

    Soendergaard, Christoffer; Nielsen, Ole H; Skak, Kresten

    2015-01-01

    assessments by pathologists with the interobserver and intraobserver variation this includes. Automated quantitative assessment of immunohistochemical staining has the potential to objectively extract numerical measures from cell and tissue structures, and allows efficient high throughput analysis in clinical...... research. Published data of manual cell counts in psoriatic skin samples were in this study reevaluated using the digital image analysis (DIA) software. Whole slides immunohistochemically stained for CD3, CD4, CD8, CD45R0, and Ki-67 were scanned and quantitatively evaluated using simple threshold analysis...

  14. An Epidermal Biosensor for Carcinoembryonic Antigen

    National Research Council Canada - National Science Library

    Schwartz, Pauline

    2001-01-01

    ...). An epidermal biosensor is a new approach for the early continuous, in vivo detection of the onset of disease by the using genetically modified skin cells to respond to molecules secreted by tumor cells...

  15. An Epidermal Biosensor for Carcinoembryonic Antigen

    National Research Council Canada - National Science Library

    Schwartz, Pauline

    2003-01-01

    ...) An epidermal biosensor was conceived as a new approach for the early continuous, in vivo detection of the onset of disease by the using genetically modified skin cells to respond to molecules secreted by tumor cells...

  16. Studies in human skin epithelial cell carcinogenesis

    International Nuclear Information System (INIS)

    Lehman, T.A.

    1987-01-01

    Metabolism and DNA adduct formation of benzo[a]pyrene (BP) by human epidermal keratinocytes pretreated with inhibitors or inducer of cytochrame P450 was studied. To study DNA adduct analysis, cultures were pretreated as described above, and then treated with non-radiolabeled BP. DNA was prepared from these cultures, digested to the nucleotide level, and 32 P-postlabeled for adduct analysis. Cultures pretreated with BHA, 7,8-BF or disulfiralm formed significantly fewer BPDE I-dB adducts than non-pretreated cultures, while cultures pretreated with MeBHA formed more BPDE-I-dG adducts. MeBHA increased BP activation and adduct formation inhuman keratinocyte in cultures by inducing a specific isoenzyme of cytochrome P450 which preferentially increases the oxidative metabolism of BP to 7,8 diol BP and 7,8 diol BP to BPDE I. To approximate an in vivo human system, metabolism of BPDE I by human skin xenografts treated with cell cycles modulators was studied. When treated with BPDE I, specific carcinogen-DNA adducts were formed. Separation and identification of these adducts by the 32 P-postlabeling technique indicated that the 7R- and 7S-BPDE I-dG adducts were the major adducts

  17. The control of epidermal stem cells (holoclones) in the treatment of massive full-thickness burns with autologous keratinocytes cultured on fibrin.

    Science.gov (United States)

    Pellegrini, G; Ranno, R; Stracuzzi, G; Bondanza, S; Guerra, L; Zambruno, G; Micali, G; De Luca, M

    1999-09-27

    Cell therapy is an emerging therapeutic strategy aimed at replacing or repairing severely damaged tissues with cultured cells. Epidermal regeneration obtained with autologous cultured keratinocytes (cultured autografts) can be life-saving for patients suffering from massive full-thickness burns. However, the widespread use of cultured autografts has been hampered by poor clinical results that have been consistently reported by different burn units, even when cells were applied on properly prepared wound beds. This might arise from the depletion of epidermal stem cells (holoclones) in culture. Depletion of holoclones can occur because of (i) incorrect culture conditions, (ii) environmental damage of the exposed basal layer of cultured grafts, or (iii) use of new substrates or culture technologies not pretested for holoclone preservation. The aim of this study was to show that, if new keratinocyte culture technologies and/or "delivery systems" are proposed, a careful evaluation of epidermal stem cell preservation is essential for the clinical performance of this life-saving technology. Fibrin was chosen as a potential substrate for keratinocyte cultivation. Stem cells were monitored by clonal analysis using the culture system originally described by Rheinwald and Green as a reference. Massive full-thickness burns were treated with the composite allodermis/cultured autograft technique. We show that: (i) the relative percentage of holoclones, meroclones, and paraclones is maintained when keratinocytes are cultivated on fibrin, proving that fibrin does not induce clonal conversion and consequent loss of epidermal stem cells; (ii) the clonogenic ability, growth rate, and long-term proliferative potential are not affected by the new culture system; (iii) when fibrin-cultured autografts bearing stem cells are applied on massive full-thickness burns, the "take" of keratinocytes is high, reproducible, and permanent; and (iv) fibrin allows a significant reduction of the cost

  18. Bile acids induce hepatic stellate cell proliferation via activation of the epidermal growth factor receptor

    NARCIS (Netherlands)

    Svegliati-Baroni, G; Ridolfi, F; Hannivoort, R; Saccomanno, S; Homan, M; De Minicis, S; Jansen, PLM; Candelaresi, C; Benedetti, A; Moshage, H

    Background B Aims: Hepatic stellate cell (HSC) proliferation is a key event in the development of liver fibrosis. In many liver diseases, HSCs are exposed to inflammatory cytokines, reactive oxygen species, and bile acids. Although inflammatory cytokines and reactive oxygen species are known to

  19. Bile acids induce hepatic stellate cell proliferation via activation of the epidermal growth factor receptor

    NARCIS (Netherlands)

    Svegliati-Baroni, Gianluca; Ridolfi, Francesco; Hannivoort, Rebekka; Saccomanno, Stefania; Homan, Manon; de Minicis, Samuele; Jansen, Peter L. M.; Candelaresi, Cinzia; Benedetti, Antonio; Moshage, Han

    2005-01-01

    BACKGROUND & AIMS: Hepatic stellate cell (HSC) proliferation is a key event in the development of liver fibrosis. In many liver diseases, HSCs are exposed to inflammatory cytokines, reactive oxygen species, and bile acids. Although inflammatory cytokines and reactive oxygen species are known to

  20. Distribution and number of epidermal growth factor receptors in skin is related to epithelial cell growth

    DEFF Research Database (Denmark)

    Green, M R; Basketter, D A; Couchman, J R

    1983-01-01

    receptors are detected on the epithelial cells overlying the basement membranes of the epidermis, sebaceous gland, and regions of the hair follicle all of which have proliferative capacity. In marked contrast, tissues which have started to differentiate and lost their growth potential, carry either...... and temporal control of epithelial proliferation....

  1. Frank-ter Haar syndrome protein Tks4 regulates epidermal growth factor-dependent cell migration.

    Science.gov (United States)

    Bögel, Gábor; Gujdár, Annamária; Geiszt, Miklós; Lányi, Árpád; Fekete, Anna; Sipeki, Szabolcs; Downward, Julian; Buday, László

    2012-09-07

    Mutations in the SH3PXD2B gene coding for the Tks4 protein are responsible for the autosomal recessive Frank-ter Haar syndrome. Tks4, a substrate of Src tyrosine kinase, is implicated in the regulation of podosome formation. Here, we report a novel role for Tks4 in the EGF signaling pathway. In EGF-treated cells, Tks4 is tyrosine-phosphorylated and associated with the activated EGF receptor. This association is not direct but requires the presence of Src tyrosine kinase. In addition, treatment of cells with LY294002, an inhibitor of PI 3-kinase, or mutations of the PX domain reduces tyrosine phosphorylation and membrane translocation of Tks4. Furthermore, a PX domain mutant (R43W) Tks4 carrying a reported point mutation in a Frank-ter Haar syndrome patient showed aberrant intracellular expression and reduced phosphoinositide binding. Finally, silencing of Tks4 was shown to markedly inhibit HeLa cell migration in a Boyden chamber assay in response to EGF or serum. Our results therefore reveal a new function for Tks4 in the regulation of growth factor-dependent cell migration.

  2. Simultaneous cell death and desquamation of the embryonic diffusion barrier during epidermal development

    International Nuclear Information System (INIS)

    Saathoff, Manuela; Blum, Barbara; Quast, Thomas; Kirfel, Gregor; Herzog, Volker

    2004-01-01

    The periderm is an epithelial layer covering the emerging epidermis in early embryogenesis of vertebrates. In the chicken embryo, an additional cellular layer, the subperiderm, occurs at later embryonic stages underneath the periderm. The questions arose what is the function of both epithelial layers and, as they are transitory structures, by which mechanism are they removed. By immunocytochemistry, the tight junction (TJ) proteins occludin and claudin-1 were localized in the periderm and in the subperiderm, and sites of close contact between adjacent cells were detected by electron microscopy. Using horseradish peroxidase (HRP) as tracer, these contacts were identified as tight junctions involved in the formation of the embryonic diffusion barrier. This barrier was lost by desquamation at the end of the embryonic period, when the cornified envelope of the emerging epidermis was formed. By TUNEL and DNA ladder assays, we detected simultaneous cell death in the periderm and the subperiderm shortly before hatching. The absence of caspases-3, -6, and -7 activity, key enzymes of apoptosis, and the lack of typical morphological criteria of apoptosis such as cell fragmentation or membrane blebbing point to a special form of programmed cell death (PCD) leading to the desquamation of the embryonic diffusion barrier

  3. Immunohistochemical localization of epidermal growth factor in rat and man

    DEFF Research Database (Denmark)

    Poulsen, Steen Seier; Nexø, Ebba

    1986-01-01

    Epidermal growth factor (EGF) is a peptide which stimulates cell mitotic activity and differentiation, has a cytoprotective effect on the gastroduodenal mucosa, and inhibits gastric acid secretion. The immunohistochemical localization of EGF in the Brunner's glands and the submandibular glands is...... antisera against human urinary EGF worked in rat as well as man. EGF was found only in cells with an exocrine function.......Epidermal growth factor (EGF) is a peptide which stimulates cell mitotic activity and differentiation, has a cytoprotective effect on the gastroduodenal mucosa, and inhibits gastric acid secretion. The immunohistochemical localization of EGF in the Brunner's glands and the submandibular glands...... is well documented. The localization of EGF in other tissues is still unclarified. In the present study, the immunohistochemical localization of EGF in tissues from rat, man and a 20 week human fetus were investigated. In man and rat, immunoreaction was found in the submandibular glands, the serous glands...

  4. Epidermal Growth Factor Receptor and K-RAS status in two cohorts of squamous cell carcinomas

    International Nuclear Information System (INIS)

    Van Damme, Nancy; Pauwels, Patrick; Peeters, Marc; Deron, Philippe; Van Roy, Nadine; Demetter, Pieter; Bols, Alain; Dorpe, Jo Van; Baert, Filip; Van Laethem, Jean-Luc; Speleman, Franki

    2010-01-01

    With the availability of effective anti-EGFR therapies for various solid malignancies, such as non-cell small lung cancer, colorectal cancer and squamous cell carcinoma of the head and neck, the knowledge of EGFR and K-RAS status becomes clinically important. The aim of this study was to analyse EGFR expression, EGFR gene copy number and EGFR and K-RAS mutations in two cohorts of squamous cell carcinomas, specifically anal canal and tonsil carcinomas. Formalin fixed, paraffin-embedded tissues from anal and tonsil carcinoma were used. EGFR protein expression and EGFR gene copy number were analysed by means of immunohistochemistry and fluorescence in situ hybridisation. The somatic status of the EGFR gene was investigated by PCR using primers specific for exons 18 through 21. For the K-RAS gene, PCR was performed using exon 2 specific primers. EGFR immunoreactivity was present in 36/43 (83.7%) of anal canal and in 20/24 (83.3%) of tonsil squamous cell carcinomas. EGFR amplification was absent in anal canal tumours (0/23), but could be identified in 4 of 24 tonsil tumours. From 38 anal canal specimens, 26 specimens were successfully analysed for exon 18, 30 for exon 19, 34 for exon 20 and 30 for exon 21. No EGFR mutations were found in the investigated samples. Thirty samples were sequenced for K-RAS exon 2 and no mutation was identified. From 24 tonsil specimens, 22 were successfully analysed for exon 18 and all 24 specimens for exon 19, 20 and 21. No EGFR mutations were found. Twenty-two samples were sequenced for K-RAS exon 2 and one mutation c.53C > A was identified. EGFR mutations were absent from squamous cell carcinoma of the anus and tonsils, but EGFR protein expression was detected in the majority of the cases. EGFR amplification was seen in tonsil but not in anal canal carcinomas. In our investigated panel, only one mutation in the K-RAS gene of a tonsil squamous cell carcinoma was identified. This indicates that EGFR and K-RAS mutation analysis is not

  5. Epidermal Growth Factor Receptor and K-RAS status in two cohorts of squamous cell carcinomas

    Directory of Open Access Journals (Sweden)

    Van Laethem Jean-Luc

    2010-05-01

    Full Text Available Abstract Background With the availability of effective anti-EGFR therapies for various solid malignancies, such as non-cell small lung cancer, colorectal cancer and squamous cell carcinoma of the head and neck, the knowledge of EGFR and K-RAS status becomes clinically important. The aim of this study was to analyse EGFR expression, EGFR gene copy number and EGFR and K-RAS mutations in two cohorts of squamous cell carcinomas, specifically anal canal and tonsil carcinomas. Methods Formalin fixed, paraffin-embedded tissues from anal and tonsil carcinoma were used. EGFR protein expression and EGFR gene copy number were analysed by means of immunohistochemistry and fluorescence in situ hybridisation. The somatic status of the EGFR gene was investigated by PCR using primers specific for exons 18 through 21. For the K-RAS gene, PCR was performed using exon 2 specific primers. Results EGFR immunoreactivity was present in 36/43 (83.7% of anal canal and in 20/24 (83.3% of tonsil squamous cell carcinomas. EGFR amplification was absent in anal canal tumours (0/23, but could be identified in 4 of 24 tonsil tumours. From 38 anal canal specimens, 26 specimens were successfully analysed for exon 18, 30 for exon 19, 34 for exon 20 and 30 for exon 21. No EGFR mutations were found in the investigated samples. Thirty samples were sequenced for K-RAS exon 2 and no mutation was identified. From 24 tonsil specimens, 22 were successfully analysed for exon 18 and all 24 specimens for exon 19, 20 and 21. No EGFR mutations were found. Twenty-two samples were sequenced for K-RAS exon 2 and one mutation c.53C > A was identified. Conclusion EGFR mutations were absent from squamous cell carcinoma of the anus and tonsils, but EGFR protein expression was detected in the majority of the cases. EGFR amplification was seen in tonsil but not in anal canal carcinomas. In our investigated panel, only one mutation in the K-RAS gene of a tonsil squamous cell carcinoma was identified

  6. Sendai viroplexes for epidermal growth factor receptor-directed delivery of interleukin-12 and salmosin genes to cancer cells.

    Science.gov (United States)

    Kim, Jung Seok; Kim, Min Woo; Jeong, Hwa Yeon; Kang, Seong Jae; Park, Sang Il; Lee, Yeon Kyung; Kim, Hong Sung; Kim, Keun Sik; Park, Yong Serk

    2016-07-01

    The effective delivery of therapeutic genes to target cells has been a fundamental goal in cancer gene therapy because of its advantages with respect to both safety and transfection efficiency. In the present, study we describe a tumor-directed gene delivery system that demonstrates remarkable efficacy in gene delivery and minimizes the off-target effects of gene transfection. The system consists of a well-verified cationic O,O'-dimyristyl-N-lysyl glutamate (DMKE), Sendai virus fusion (F) protein and hemagglutinin-neuraminidase (HN) protein, referred to as cationic Sendai F/HN virosomes. To achieve tumor-specific recognition, anti-epidermal growth factor (EGF) receptor antibody was coupled to the surface of the virosomes containing interleukin-12 (IL-12) and/or salmosin genes that have potent anti-angiogenetic functions. Among the virosomal formulations, the anti-EGF receptor (EGFR) viroplexes, prepared via complexation of plasmid DNA (pDNA) with cationic DMKE lipid, exhibited more efficient gene transfection to tumor cells over-expressing EGF receptors compared to the neutrally-charged anti-EGFR virosomes encapsulating pDNA. In addition, the anti-EGFR viroplexes with IL-12 and salmosin genes exhibited the most effective therapeutic efficacy in a mouse tumor model. Especially when combined with doxorubicin, transfection of the two genes via the anti-EGFR viroplexes exhibited an enhanced inhibitory effect on tumor growth and metastasis in lungs. The results of the present study suggest that anti-EGFR viroplexes can be utilized as an effective strategy for tumor-directed gene delivery. Copyright © 2016 John Wiley & Sons, Ltd. Copyright © 2016 John Wiley & Sons, Ltd.

  7. Epidermal CYP2 family cytochromes P450

    International Nuclear Information System (INIS)

    Du Liping; Hoffman, Susan M.G.; Keeney, Diane S.

    2004-01-01

    Skin is the largest and most accessible drug-metabolizing organ. In mammals, it is the competent barrier that protects against exposure to harmful stimuli in the environment and in the systemic circulation. Skin expresses many cytochromes P450 that have critical roles in exogenous and endogenous substrate metabolism. Here, we review evidence for epidermal expression of genes from the large CYP2 gene family, many of which are expressed preferentially in extrahepatic tissues or specifically in epithelia at the environmental interface. At least 13 CYP2 genes (CYP2A6, 2A7, 2B6, 2C9, 2C18, 2C19, 2D6, 2E1, 2J2, 2R1, 2S1, 2U1, and 2W1) are expressed in skin from at least some human individuals, and the majority of these genes are expressed in epidermis or cultured keratinocytes. Where epidermal expression has been localized in situ by hybridization or immunocytochemistry, CYP2 transcripts and proteins are most often expressed in differentiated keratinocytes comprising the outer (suprabasal) cell layers of the epidermis and skin appendages. The tissue-specific transcriptional regulation of CYP2 genes in the epidermis, and in other epithelia that interface with the environment, suggests important roles for at least some CYP2 gene products in the production and disposition of molecules affecting competency of the epidermal barrier

  8. Impact of palbociclib combinations on treatment of advanced estrogen receptor-positive/human epidermal growth factor 2-negative breast cancer

    Directory of Open Access Journals (Sweden)

    Boér K

    2016-10-01

    Full Text Available Katalin Boér Department of Medical Oncology, Szent Margit Hospital, Budapest, Hungary Abstract: Breast cancer is a heterogeneous disease with multiple subgroups based on clinical and molecular characteristics. For the largest subgroup of breast cancers, hormone receptor-positive/human epidermal growth factor 2 (HER2-negative tumors, hormone treatment is the mainstay of therapy and is likely to result in significant improvement in disease outcomes. However, some of these cancers demonstrate de novo or acquired resistance to endocrine therapy. Despite intensive research to develop new strategies to enhance the efficacy of currently available treatment options for hormone receptor-positive breast cancer, progress has been slow, and there were few advances for a period of 10 years. In 2012, a new molecularly targeted therapeutic strategy, inhibition of mammalian target of rapamycin with everolimus, was introduced into clinical practice. Everolimus, in combination with a steroidal aromatase inhibitor, exemestane, resulted in an increase in progression-free survival, but not overall survival in patients with estrogen receptor (ER+ve advanced disease who had progressed on hormone therapy. In 2015, the first cyclin-dependent kinases 4/6 (CDK4/6 inhibitor, palbociclib, received accelerated US Food and Drug Administration approval for use in combination with letrozole for the treatment of postmenopausal ER+ve/HER2-ve advanced breast cancer as initial, endocrine-based therapy. The addition of palbociclib to endocrine therapy resulted in longer progression-free survival than letrozole alone. One year later, palbociclib received a new indication, use in combination with fulvestrant, in both premenopausal and postmenopausal females with advanced breast cancer of the same subtype with disease progression following endocrine therapy. Adding palbociclib to fulvestrant resulted in a significantly increased median progression-free survival compared to fulvestrant

  9. Genistein inhibits proliferation of colon cancer cells by attenuating a negative effect of epidermal growth factor on tumor suppressor FOXO3 activity

    International Nuclear Information System (INIS)

    Qi, Wentao; Weber, Christopher R; Wasland, Kaarin; Savkovic, Suzana D

    2011-01-01

    Soy consumption is associated with a lower incidence of colon cancer which is believed to be mediated by one of its of components, genistein. Genistein may inhibit cancer progression by inducing apoptosis or inhibiting proliferation, but mechanisms are not well understood. Epidermal growth factor (EGF)-induced proliferation of colon cancer cells plays an important role in colon cancer progression and is mediated by loss of tumor suppressor FOXO3 activity. The aim of this study was to assess if genistein exerts anti-proliferative properties by attenuating the negative effect of EGF on FOXO3 activity. The effect of genistein on proliferation stimulated by EGF-mediated loss of FOXO3 was examined in human colonic cancer HT-29 cells. EGF-induced FOXO3 phosphorylation and translocation were assessed in the presence of genistein. EGF-mediated loss of FOXO3 interactions with p53 (co-immunoprecipitation) and promoter of p27kip1 (ChIP assay) were examined in presence of genistein in cells with mutated p53 (HT-29) and wild type p53 (HCT116). Silencing of p53 determined activity of FOXO3 when it is bound to p53. Genistein inhibited EGF-induced proliferation, while favoring dephosphorylation and nuclear retention of FOXO3 (active state) in colon cancer cells. Upstream of FOXO3, genistein acts via the PI3K/Akt pathway to inhibit EGF-stimulated FOXO3 phosphorylation (i.e. favors active state). Downstream, EGF-induced disassociation of FOXO3 from mutated tumor suppressor p53, but not wild type p53, is inhibited by genistein favoring FOXO3-p53(mut) interactions with the promoter of the cell cycle inhibitor p27kip1 in colon cancer cells. Thus, the FOXO3-p53(mut) complex leads to elevated p27kip1 expression and promotes cell cycle arrest. These novel anti-proliferative mechanisms of genistein suggest a possible role of combining genistein with other chemoreceptive agents for the treatment of colon cancer

  10. NKG2D-Dependent Activation of Dendritic Epidermal T cells in Contact Hypersensitivity

    DEFF Research Database (Denmark)

    Nielsen, Morten Milek; Dyring-Andersen, Beatrice; Schmidt, Jonas Damgård

    2015-01-01

    activated and produce IL-17 in an IL-1β-dependent manner during CHS. Various receptors on DETC, including NKG2D, are involved in DETC responses against tumors and during wound healing. The ligands for NKG2D (NKG2DL) are stress-induced proteins such as Mult-1, H60, Rae-1 in mice and MICA, MICB and ULBP...... in humans. Here, we show that allergens up-regulate expression of the NKG2DL Mult-1, H60 and Rae-1 in cultured mouse KC and of MICA in primary human KC. We demonstrate that Mult-1 is expressed in mouse skin exposed to allergen. Furthermore, we find that the vast majority of DETC in murine epidermis and skin...

  11. Human leukaemic cells

    International Nuclear Information System (INIS)

    Andronikashvili, E.L.; Mosulishvili, L.M.; Belokobil'skiy, A.I.; Kharabadze, N.E.; Shonia, N.I.; Desai, L.S.; Foley, G.E.

    1976-01-01

    Trace metals were measured by neutron-activation analyses in purified nucleic acids and histone(s) of lymphocytes from patients with acute lymphocytic leukaemia or infectious mononucleosis, and from normal donors. DNA isolated from lymphocytes of a patient with infectious mononucleosis and a normal donor showed a high content of Cr 2+ , Sb 2+ , Fe 2+ , Zn 2+ , whereas DNA of lymphoblasts from a patient with acute lymphocytic leukaemia had a lower content of these trace metals, but the Co 2+ content was 20-fold higher than in DNA of normal donor lymphocytic cells. Total histones from leukaemic cells had higher contents of most of the trace metals except for Zn 2+ , which was present in lesser concentration than in histones from normal donor lymphocytic cells. Lysine-rich (F1) histones showed lower contents of Cr 2+ , Sb 2+ and Co 2+ , whereas arginine-rich (F3) histones had significantly higher contents of these trace metals. These observations may be of interest in that F3 histones more effectively inhibit RNA synthesis in human lymphocytic cells than do other species of histones. (author)

  12. Characterizing the mechanical response of epidermal cell monolayers during wound healing

    OpenAIRE

    Valencia Blanco, Leticia

    2017-01-01

    Mención Internacional en el título de doctor Epithelial migration plays an important role during re-epithelization phase in wound healing. Several skin diseases, such as chronic ulcers, fail during this stage. During last years a new insight into this problem has arisen introducing a mechanical point of view of this process. Kinematics and density distribution within the epithelium play key role during collective migration. Besides, the capacity of cells to proliferate and p...

  13. Modulation of estrogen and epidermal growth factor receptors by rosemary extract in breast cancer cells.

    Science.gov (United States)

    González-Vallinas, Margarita; Molina, Susana; Vicente, Gonzalo; Sánchez-Martínez, Ruth; Vargas, Teodoro; García-Risco, Mónica R; Fornari, Tiziana; Reglero, Guillermo; Ramírez de Molina, Ana

    2014-06-01

    Breast cancer is the leading cause of cancer-related mortality among females worldwide, and therefore the development of new therapeutic approaches is still needed. Rosemary (Rosmarinus officinalis L.) extract possesses antitumor properties against tumor cells from several organs, including breast. However, in order to apply it as a complementary therapeutic agent in breast cancer, more information is needed regarding the sensitivity of the different breast tumor subtypes and its effect in combination with the currently used chemotherapy. Here, we analyzed the antitumor activities of a supercritical fluid rosemary extract (SFRE) in different breast cancer cells, and used a genomic approach to explore its effect on the modulation of ER-α and HER2 signaling pathways, the most important mitogen pathways related to breast cancer progression. We found that SFRE exerts antitumor activity against breast cancer cells from different tumor subtypes and the downregulation of ER-α and HER2 receptors by SFRE might be involved in its antitumor effect against estrogen-dependent (ER+) and HER2 overexpressing (HER2+) breast cancer subtypes. Moreover, SFRE significantly enhanced the effect of breast cancer chemotherapy (tamoxifen, trastuzumab, and paclitaxel). Overall, our results support the potential utility of SFRE as a complementary approach in breast cancer therapy. © 2014 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  14. PDK1 Is a Regulator of Epidermal Differentiation that Activates and Organizes Asymmetric Cell Division

    Directory of Open Access Journals (Sweden)

    Teruki Dainichi

    2016-05-01

    Full Text Available Asymmetric cell division (ACD in a perpendicular orientation promotes cell differentiation and organizes the stratified epithelium. However, the upstream cues regulating ACD have not been identified. Here, we report that phosphoinositide-dependent kinase 1 (PDK1 plays a critical role in establishing ACD in the epithelium. Production of phosphatidyl inositol triphosphate (PIP3 is localized to the apical side of basal cells. Asymmetric recruitment of atypical protein kinase C (aPKC and partitioning defective (PAR 3 is impaired in PDK1 conditional knockout (CKO epidermis. PDK1CKO keratinocytes do not undergo calcium-induced activation of aPKC or IGF1-induced activation of AKT and fail to differentiate. PDK1CKO epidermis shows decreased expression of Notch, a downstream effector of ACD, and restoration of Notch rescues defective expression of differentiation-induced Notch targets in vitro. We therefore propose that PDK1 signaling regulates the basal-to-suprabasal switch in developing epidermis by acting as both an activator and organizer of ACD and the Notch-dependent differentiation program.

  15. Characterization of A Three-Dimensional Organotypic Co-Culture Skin Model for Epidermal Differentiation of Rat Adipose-Derived Stem Cells.

    Science.gov (United States)

    Ghanavati, Zeinab; Orazizadeh, Mahmoud; Bayati, Vahid; Abbaspour, Mohammad Reza; Khorsandi, Layasadat; Mansouri, Esrafil; Neisi, Niloofar

    2016-01-01

    The organotypic co-culture is a well-known technique to examine cellular interactions and their roles in stem cell proliferation and differentiation. This study aims to evaluate the effects of dermal fibroblasts (DFs) on epidermal differentiation of adipose-derived stem cells (ASCs) using a three-dimensional (3D) organotypic co- culture technique. In this experimental research study, rat DFs and ASCs were isolated and cultured separately on electrospun polycaprolactone (PCL) matrices. The PCL matrices seeded by ASCs were superimposed on to the matrices seeded by DFs in order to create a 3D organotypic co-culture. In the control groups, PCL matrices seeded by ASCs were placed on matrices devoid of DFs. After 10 days, we assessed the expressions of keratinocyte-related genes by real-time reverse transcriptase-polymerase chain reaction (RT-PCR) and expression of pan-cytokeratin protein by immunofluorescence in the differentiated keratinocyte-like cells from co- culture and control groups. Keratinocyte-like cell morphologies were also observed by scanning electron microscopy (SEM). The early, intermediate, and terminal differentiation keratinocyte markers-Cytokeratin14, Filaggrin, and Involucrin significantly expressed in the co-culture groups com- pared to the control ones (P<0.05). We observed pan-cytokeratin in keratinocyte-like cells of both groups by immunofluorescence. SEM observation of the co-culture groups showed that the differentiated keratinocyte-like cells developed a polygonal cobblestone shape, considered characteristic of keratinocytes. The 3D organotypic co-culture bilayered construct that consisted of DFs and ASCs was an effective technique for epidermal differentiation of ASCs. This co-culture might be useful for epidermal differentiation of stem cells for future applications in skin regeneration.

  16. Keratin 17 is overexpressed and predicts poor survival in estrogen receptor-negative/human epidermal growth factor receptor-2-negative breast cancer.

    Science.gov (United States)

    Merkin, Ross D; Vanner, Elizabeth A; Romeiser, Jamie L; Shroyer, A Laurie W; Escobar-Hoyos, Luisa F; Li, Jinyu; Powers, Robert S; Burke, Stephanie; Shroyer, Kenneth R

    2017-04-01

    Clinicopathological features of breast cancer have limited accuracy to predict survival. By immunohistochemistry (IHC), keratin 17 (K17) expression has been correlated with triple-negative status (estrogen receptor [ER]/progesterone receptor/human epidermal growth factor receptor-2 [HER2] negative) and decreased survival, but K17 messenger RNA (mRNA) expression has not been evaluated in breast cancer. K17 is a potential prognostic cancer biomarker, targeting p27, and driving cell cycle progression. This study compared K17 protein and mRNA expression to ER/progesterone receptor/HER2 receptor status and event-free survival. K17 IHC was performed on 164 invasive breast cancers and K17 mRNA was evaluated in 1097 breast cancers. The mRNA status of other keratins (16/14/9) was evaluated in 113 ER - /HER2 - ductal carcinomas. IHC demonstrated intense cytoplasmic and membranous K17 localization in myoepithelial cells of benign ducts and lobules and tumor cells of ductal carcinoma in situ. In ductal carcinomas, K17 protein was detected in most triple-negative tumors (28/34, 82%), some non-triple-negative tumors (52/112, 46%), but never in lobular carcinomas (0/15). In ductal carcinomas, high K17 mRNA was associated with reduced 5-year event-free survival in advanced tumor stage (n = 149, hazard ratio [HR] = 3.68, P = .018), and large (n = 73, HR = 3.95, P = .047), triple-negative (n = 103, HR = 2.73, P = .073), and ER - /HER2 - (n = 113, HR = 2.99, P = .049) tumors. There were significant correlations among keratins 17, 16, 14, and 9 mRNA levels suggesting these keratins (all encoded on chromosome 17) could be coordinately expressed in breast cancer. Thus, K17 is expressed in a subset of triple-negative breast cancers, and is a marker of poor prognosis in patients with advanced stage and ER - /HER2 - breast cancer. Copyright © 2016 Elsevier Inc. All rights reserved.

  17. In vitro invasion of small-cell lung cancer cell lines correlates with expression of epidermal growth factor receptor

    DEFF Research Database (Denmark)

    Damstrup, L; Rude Voldborg, B; Spang-Thomsen, M

    1998-01-01

    receptor (EGFR) in a panel of 21 small-cell lung cancer (SCLC) cell lines. We have previously reported that ten of these cell lines expressed EGFR protein detected by radioreceptor and affinity labelling assays. In 11 small-cell lung cancer (SCLC) cell lines, EGFR mRNA was detected by Northern blot...... analysis. In vitro invasion in a Boyden chamber assay was found in all EGFR-positive cell lines, whereas no invasion was detected in the EGFR-negative cell lines. Quantification of the in vitro invasion in 12 selected SCLC cell lines demonstrated that, in the EGFR-positive cell lines, between 5% and 16......-PCR). However, in vitro invasive SCLC cell lines could not be distinguished from non-invasive cell lines based on the expression pattern of these molecules. In six SCLC cell lines, in vitro invasion was also determined in the presence of the EGFR-neutralizing monoclonal antibody mAb528. The addition...

  18. Effect of X-ray irradiation on morphophysiological reactions of epidermal melanophor cells in the larvae of Rana temporaria L

    International Nuclear Information System (INIS)

    Popov, D.V.; Kalistratova, E.N.; Kaluzhina, A.V.

    1982-01-01

    Dynamics of physiological reactions of epidermal melanophors of larvae Rana temporaria L.. adapted to white and black backgrounds and irradiated with a dose of 700 R has been investigated. Ouring the first day after irradiation no day changes of melanophor index characteristic of intact tadpoles were discovered in whitebackground animals; melanophors preserve the aggregation state. Comparison of black background irradiated and control larvae didn't show confident differences in changes of their melanophor indices. Irradiation affects differently epidermal melanophors in the state of pigment dispersion and aggregation. It is suggested that pigment dispersion and aggregation in melanophor is realized at the expense of different cellular structures. It is shown that by the end of the experiment (21-st day) the amount of epidermal melanophor per surface unit is two times larger in black-ground larvae. General biological signaficance of revealed facts from the point of view of ontogenesis evolution is discussed

  19. Epidermal growth factor receptor (EGFR mutations and expression in squamous cell carcinoma of the esophagus in central Asia

    Directory of Open Access Journals (Sweden)

    Abedi-Ardekani Behnoush

    2012-12-01

    Full Text Available Abstract Background Esophageal squamous cell carcinoma (ESCC shows geographic variations in incidence, with high incidences (>50/105 person-years in central Asia, including North Eastern Iran (Golestan and Northern India (Kashmir. In contrast to Western countries, smoking does not appear to be a significant risk factor for ESCC in central Asia. In lung adenocarcinoma, activating mutations in the gene encoding epidermal growth factor receptor (EGFR are frequent in tumors of never smokers of Asian origin, predicting therapeutic sensitivity to Egfr-targeting drugs. Methods In this study 152 cases of histologically confirmed ESCC from Iran (Tehran and Golestan Province and North India (Kashmir Valley have been analyzed for EGFR mutation by direct sequencing of exons 18–21. Egfr protein expression was evaluated by immunohistochemistry in 34 samples from Tehran and HER2 mutations were analyzed in 54 cases from Kashmir. Results A total of 14 (9.2% EGFR variations were detected, including seven variations in exons. Among those, four (2.6% were already documented in lung cancers, two were reported as polymorphisms and one was a potentially new activating mutation. All but one variation in introns were previously identified as polymorphisms. Over-expression of Egfr was detected in 22/34 (65% of tested cases whereas no HER2 mutation was found in 54 cases from Kashmir. Conclusion Overall, EGFR mutations appear to be a rare event in ESCC in high incidence areas of central Asia, although a very small proportion of cases may harbor mutations predicting sensitivity to anti-Egfr drugs.

  20. Desmosomal Molecules In and Out of Adhering Junctions: Normal and Diseased States of Epidermal, Cardiac and Mesenchymally Derived Cells

    Directory of Open Access Journals (Sweden)

    Sebastian Pieperhoff

    2010-01-01

    Full Text Available Current cell biology textbooks mention only two kinds of cell-to-cell adhering junctions coated with the cytoplasmic plaques: the desmosomes (maculae adhaerentes, anchoring intermediate-sized filaments (IFs, and the actin microfilament-anchoring adherens junctions (AJs, including both punctate (puncta adhaerentia and elongate (fasciae adhaerentes structures. In addition, however, a series of other junction types has been identified and characterized which contain desmosomal molecules but do not fit the definition of desmosomes. Of these special cell-cell junctions containing desmosomal glycoproteins or proteins we review the composite junctions (areae compositae connecting the cardiomyocytes of mature mammalian hearts and their importance in relation to human arrhythmogenic cardiomyopathies. We also emphasize the various plakophilin-2-positive plaques in AJs (coniunctiones adhaerentes connecting proliferatively active mesenchymally-derived cells, including interstitial cells of the heart and several soft tissue tumor cell types. Moreover, desmoplakin has also been recognized as a constituent of the plaques of the complexus adhaerentes connecting certain lymphatic endothelial cells. Finally, we emphasize the occurrence of the desmosomal transmembrane glycoprotein, desmoglein Dsg2, out of the context of any junction as dispersed cell surface molecules in certain types of melanoma cells and melanocytes. This broadening of our knowledge on the diversity of AJ structures indicates that it may still be too premature to close the textbook chapters on cell-cell junctions.

  1. Hypoxia changes the expression of the epidermal growth factor (EGF) system in human hearts and cultured cardiomyocytes

    DEFF Research Database (Denmark)

    Munk, Mathias; Memon, Ashfaque Ahmed; Goetze, Jens Peter

    2012-01-01

    by treatment with trastuzumab (20 nM). This resulted in inhibition of cardiomyocyte proliferation, but interestingly only in hypoxic cells. Co-treatment of HL-1 cells with HB-EGF (10 nM) but not with NRG-1 (5 ng/ml) rescued the cardiomyocytes from HER2 inhibition. HL-1 cardiomyocytes exposed to hypoxia...... revealed nuclear translocation of activated MAPK and the activity of this downstream signaling molecule was decreased by HER2 inhibition (20 nM trastuzumab), and re-established by HB-EGF (10 nM). CONCLUSIONS/SIGNIFICANCE: Hypoxia in the human heart alters the expression of the EGF system. Mimicking the HER...

  2. Role of oxygen intermediates in UV-induced epidermal cell injury

    International Nuclear Information System (INIS)

    Danno, K.; Horio, T.; Takigawa, M.; Imamura, S.

    1984-01-01

    To investigate the role of oxygen intermediates (OIs) in sunburn cell (SC) formation and development of UV-inflammation in vivo, groups of mice were injected intravenously with OI scavengers, including bovine blood superoxide dismutase (SOD), bovine liver catalase, L-histidine, D-mannitol, and saline (controls) before and/or after UV irradiation with sunlamp tubes (mainly 280-320 nm; 300 mJ/cm2; UVR). Ear thickness was measured before and 6 and 24 h after UVR. Ears were removed 24 h after UVR and the number of SCs per unit length of ear epidermis was counted using hematoxylineosin stained sections. The number of SCs was significantly decreased (p less than 0.02) by a single injection of SOD (10-30 units/g body weight) given either just before or immediately after (less than 15 min) UVR, while SC formation was no longer suppressed by injections given more than 2 h before or after UVR. Four repeated injections of SOD (10 units/g) also reduced SC counts but did not significantly alter ear-swelling responses (ESR). Neither SC counts nor ESR were remarkably suppressed by 4 injections of any of the other active OI scavengers, inactivated SOD, or bovine serum albumin. A single injection of diethyldithiocarbamate, an SOD inactivator, significantly augmented SC formation (p less than 0.05), but did not change ESR. These findings suggest that OIs generated by UVR participate in SC formation but are not apparently involved in UV-edema

  3. Movement of beta-irradiated epidermal basal cells to the spinous-granular layers in the absence of cell division

    International Nuclear Information System (INIS)

    Etoh, H.; Taguchi, Y.H.; Tabachnick, J.

    1975-01-01

    Guinea-pig epidermis was irradiated with 3000 rad of beta rays 1 hr after two injections of [ 3 H]thymidine 5 hr apart (labeled cells in S phase and G 2 phase) or 18 hr after injection (labeled early G 1 cells). In nonirradiated epidermis labeled basal cells divided within 24 hr with daughter cells remaining in the basal layer, and approximately 50 percent of the labeled cells moved into the spinal layer by the 3rd day. Cell division in nonirradiated epidermis diluted the number of silver grains/nucleus, and lightly labeled cells were found in the granular layer by day 7. Beta irradiation inhibited cell division but it did not slow the rate of transit (ca 8 days) of irradiated labeled cells from basal to granular layer, some of these remaining heavily labeled. Although cell division may play some role in upward movement of basal cells in normal epidermis detachment of a basal cell from the basement membrane and its transit to the granular layer is unimpaired in the absence of cell division. These findings suggest that some radioresistant metabolic function(s), not cell division, is responsible for upward movement of basal cells. (auth)

  4. Blockade of epidermal growth factor receptors chemosensitizes breast cancer cells through up-regulation of Bnip3L

    NARCIS (Netherlands)

    Real, PJ; Benito, A; Cuevas, J; Berciano, MT; de Juan, A; Coffer, P; Gomez-Roman, J; Lafarga, M; Lopez-Vega, JM; Fernandez-Luna, JL

    2005-01-01

    Epidermal growth factor receptor-1 (EGFR) and EGFR-2 (HER2) have become major targets for cancer treatment. Blocking antibodies and small-molecule inhibitors are being used to silence the activity of these receptors in different tumors with varying efficacy. Thus, a better knowledge on the signaling

  5. Epidermal growth in the bottlenose dolphin, Tursiops truncatus

    International Nuclear Information System (INIS)

    Hicks, B.D.; St Aubin, D.J.; Geraci, J.R.; Brown, W.R.

    1985-01-01

    Epidermal growth in two mature female bottlenose dolphins, Tursiops truncatus, was investigated by following the movement of a cohort of tritiated thymidine-labeled epidermal cells for 59 days. The majority of the cells migrated in a cluster which was estimated to reach the skin surface in 73 days. The authors calculate that the outermost cell layer is sloughed 12 times per day. Turnover time and sloughing rate are estimated to be 1.7 times longer and 8.5 times faster than the respective values for epidermal cell kinetics in humans. This apparent inconsistency of slow transit time and rapid sloughing rate is reconciled by the convoluted structure of the stratum germinativum in the dolphin which results in a ratio of germinatival to superficial cells of 876:1. The stratum germinativum of dolphin epidermis appears to lack morphologically distinct, spatially segregated subpopulations of anchoring and stem cells. Dolphin epidermis has a large capacity for cell population, relatively long turnover time, and rapid sloughing rate. The adaptive advantages of these characteristics are discussed

  6. Epidermal growth in the bottlenose dolphin, Tursiops truncatus

    Energy Technology Data Exchange (ETDEWEB)

    Hicks, B.D.; St. Aubin, D.J.; Geraci, J.R.; Brown, W.R.

    1985-07-01

    Epidermal growth in two mature female bottlenose dolphins, Tursiops truncatus, was investigated by following the movement of a cohort of tritiated thymidine-labeled epidermal cells for 59 days. The majority of the cells migrated in a cluster which was estimated to reach the skin surface in 73 days. The authors calculate that the outermost cell layer is sloughed 12 times per day. Turnover time and sloughing rate are estimated to be 1.7 times longer and 8.5 times faster than the respective values for epidermal cell kinetics in humans. This apparent inconsistency of slow transit time and rapid sloughing rate is reconciled by the convoluted structure of the stratum germinativum in the dolphin which results in a ratio of germinatival to superficial cells of 876:1. The stratum germinativum of dolphin epidermis appears to lack morphologically distinct, spatially segregated subpopulations of anchoring and stem cells. Dolphin epidermis has a large capacity for cell population, relatively long turnover time, and rapid sloughing rate. The adaptive advantages of these characteristics are discussed.

  7. Responses of epidermal cell turgor pressure and photosynthetic activity of leaves of the atmospheric epiphyte Tillandsia usneoides (Bromeliaceae) after exposure to high humidity.

    Science.gov (United States)

    Martin, Craig E; Rux, Guido; Herppich, Werner B

    2013-01-01

    It has been well-established that many epiphytic bromeliads of the atmospheric-type morphology, i.e., with leaf surfaces completely covered by large, overlapping, multicellular trichomes, are capable of absorbing water vapor from the atmosphere when air humidity increases. It is much less clear, however, whether this absorption of water vapor can hydrate the living cells of the leaves and, as a consequence, enhance physiological processes in such cells. The goal of this research was to determine if the absorption of atmospheric water vapor by the atmospheric epiphyte Tillandsia usneoides results in an increase in turgor pressure in leaf epidermal cells that subtend the large trichomes, and, by using chlorophyll fluorescence techniques, to determine if the absorption of atmospheric water vapor by leaves of this epiphyte results in increased photosynthetic activity. Results of measurements on living cells of attached leaves of this epiphytic bromeliad, using a pressure probe and of whole-shoot fluorescence imaging analyses clearly illustrated that the turgor pressure of leaf epidermal cells did not increase, and the photosynthetic activity of leaves did not increase, following exposure of the leaves to high humidity air. These results experimentally demonstrate, for the first time, that the absorption of water vapor following increases in atmospheric humidity in atmospheric epiphytic bromeliads is mostly likely a physical phenomenon resulting from hydration of non-living leaf structures, e.g., trichomes, and has no physiological significance for the plant's living tissues. Copyright © 2012 Elsevier GmbH. All rights reserved.

  8. Functional imaging of human epidermal growth factor receptor 2-positive metastatic breast cancer using (64)Cu-DOTA-trastuzumab PET.

    Science.gov (United States)

    Mortimer, Joanne E; Bading, James R; Colcher, David M; Conti, Peter S; Frankel, Paul H; Carroll, Mary I; Tong, Shan; Poku, Erasmus; Miles, Joshua K; Shively, John E; Raubitschek, Andrew A

    2014-01-01

    Women with human epidermal growth factor receptor 2 (HER2)-positive breast cancer are candidates for treatment with the anti-HER2 antibody trastuzumab. Assessment of HER2 status in recurrent disease is usually made by core needle biopsy of a single lesion, which may not represent the larger tumor mass or other sites of disease. Our long-range goal is to develop PET of radiolabeled trastuzumab for systemically assessing tumor HER2 expression and identifying appropriate use of anti-HER2 therapies. The purpose of this study was to evaluate PET/CT of (64)Cu-DOTA-trastuzumab for detecting and measuring tumor uptake of trastuzumab in patients with HER2-positive metastatic breast cancer. Eight women with biopsy-confirmed HER2-positive metastatic breast cancer and no anti-HER2 therapy for 4 mo or longer underwent complete staging, including (18)F-FDG PET/CT. For 6 of the 8 patients, (64)Cu-DOTA-trastuzumab injection (364-512 MBq, 5 mg of trastuzumab) was preceded by trastuzumab infusion (45 mg). PET/CT (PET scan duration 1 h) was performed 21-25 (day 1) and 47-49 (day 2) h after (64)Cu-DOTA-trastuzumab injection. Scan fields of view were chosen on the basis of (18)F-FDG PET/CT. Tumor detection sensitivity and uptake analyses were limited to lesions identifiable on CT; lesions visualized relative to adjacent tissue on PET were considered PET-positive. Radiolabel uptake in prominent lesions was measured as maximum single-voxel standardized uptake value (SUVmax). Liver uptake of (64)Cu was reduced approximately 75% with the 45-mg trastuzumab predose, without significant effect on tumor uptake. The study included 89 CT-positive lesions. Detection sensitivity was 77%, 89%, and 93% for day 1, day 2, and (18)F-FDG, respectively. On average, tumor uptake was similar for (64)Cu-DOTA-trastuzumab and (18)F-FDG (SUVmax and range, 8.1 and 3.0-22.5 for day 1 [n = 48]; 8.9 and 0.9-28.9 for day 2 [n = 38]; 9.7 and 3.3-25.4 for (18)F-FDG [n = 56]), but same-lesion SUVmax was not correlated

  9. Non-small-cell lung cancer cells combat epidermal growth factor receptor tyrosine kinase inhibition through immediate adhesion-related responses

    Directory of Open Access Journals (Sweden)

    Wang HY

    2016-05-01

    Full Text Available Hsian-Yu Wang,1,2 Min-Kung Hsu,3,4 Kai-Hsuan Wang,1 Ching-Ping Tseng,2,4 Feng-Chi Chen,3,4 John T-A Hsu1,4 1Institute of Biotechnology and Pharmaceutical Research, National Health Research Institutes (NHRI, Zhunan, Miaoli County, 2Institute of Molecular Medicine and Bioengineering, National Chiao Tung University (NCTU, Hsinchu, 3Division of Biostatistics and Bioinformatics, Institute of Population Health Sciences, National Health Research Institutes (NHRI, Zhunan, Miaoli County, 4Department of Biological Science and Technology, National Chiao Tung University (NCTU, Hsinchu, Taiwan, Republic of China Background: Epidermal growth factor receptor (EGFR tyrosine kinase inhibitors (TKIs, such as gefitinib, erlotinib, and afatinib, have greatly improved treatment efficacy in non-small cell lung cancer (NSCLC patients with drug-sensitive EGFR mutations. However, in some TKI responders, the benefits of such targeted therapies are limited by the rapid development of resistance, and strategies to overcome this resistance are urgently needed. Studies of drug resistance in cancer cells typically involve long term in vitro induction to obtain stably acquired drug-resistant cells followed by elucidation of resistance mechanisms, but the immediate responses of cancer cells upon drug treatment have been ignored. The aim of this study was to investigate the immediate responses of NSCLC cells upon treatment with EGFR TKIs.Results: Both NSCLC cells, ie, PC9 and H1975, showed immediate enhanced adhesion-related responses as an apoptosis-countering mechanism upon first-time TKI treatment. By gene expression and pathway analysis, adhesion-related pathways were enriched in gefitinib-treated PC9 cells. Pathway inhibition by small-hairpin RNAs or small-molecule drugs revealed that within hours of EGFR TKI treatment, NSCLC cells used adhesion-related responses to combat the drugs. Importantly, we show here that the Src family inhibitor, dasatinib, dramatically inhibits

  10. Single cell-type analysis of cellular lipid remodelling in response to salinity in the epidermal bladder cells of the model halophyte Mesembryanthemum crystallinum.

    Science.gov (United States)

    Barkla, Bronwyn J; Garibay-Hernández, Adriana; Melzer, Michael; Rupasinghe, Thusitha W T; Roessner, Ute

    2018-05-29

    Salt stress causes dramatic changes in the organization and dynamic properties of membranes, however, little is known about the underlying mechanisms involved. Modified trichomes, known as epidermal bladder cells (EBC), on the leaves and stems of the halophyte Mesembryanthemum crystallinum can be successfully exploited as a single-cell-type system to investigate salt-induced changes to cellular lipid composition. In this study alterations in key molecular species from different lipid classes highlighted an increase in phospholipid species, particularly those from phosphatidylcholine (PC) and phosphatidic acid (PA), where the latter is central to the synthesis of membrane lipids. Triacylglycerol (TG) species decreased during salinity, while there was little change in plastidic galactolipids. EBC transcriptomic and proteomic data mining revealed changes in genes and proteins involved in lipid metabolism and the upregulation of transcripts for PIPKIB, PI5PII, PIPKIII, and PLDδ, suggested the induction of signalling processes mediated by phosphoinositides and PA. TEM and flow cytometry showed the dynamic nature of lipid droplets in these cells under salt stress. Altogether, this work indicates the metabolism of TG might play an important role in EBC response to salinity as either an energy reserve for sodium accumulation and/or driving membrane biosynthesis for EBC expansion. This article is protected by copyright. All rights reserved.

  11. Genome engineering in human cells.

    Science.gov (United States)

    Song, Minjung; Kim, Young-Hoon; Kim, Jin-Soo; Kim, Hyongbum

    2014-01-01

    Genome editing in human cells is of great value in research, medicine, and biotechnology. Programmable nucleases including zinc-finger nucleases, transcription activator-like effector nucleases, and RNA-guided engineered nucleases recognize a specific target sequence and make a double-strand break at that site, which can result in gene disruption, gene insertion, gene correction, or chromosomal rearrangements. The target sequence complexities of these programmable nucleases are higher than 3.2 mega base pairs, the size of the haploid human genome. Here, we briefly introduce the structure of the human genome and the characteristics of each programmable nuclease, and review their applications in human cells including pluripotent stem cells. In addition, we discuss various delivery methods for nucleases, programmable nickases, and enrichment of gene-edited human cells, all of which facilitate efficient and precise genome editing in human cells.

  12. PANC-1 pancreatic cancer cell growth inhibited by cucurmosin alone and in combination with an epidermal growth factor receptor-targeted drug.

    Science.gov (United States)

    Wang, Congfei; Yang, Aiqin; Zhang, Baoming; Yin, Qiang; Huang, Heguang; Chen, Minghuang; Xie, Jieming

    2014-03-01

    To investigate the inhibition of PANC-1 pancreatic cancer cell growth by cucurmosin (CUS) and its possible mechanism. We observed the inhibition of PANC-1 cell growth by sulforhodamine B and colony-forming experiments in vitro and established nonobese diabetic/severe combined immunodeficiency mouse subcutaneous tumor models in vivo. We used Western blot to analyze protein levels related to apoptosis and epidermal growth factor receptor (EGFR) signaling pathways after drug intervention, whereas the messenger RNA expression of EGFR was analyzed by quantitative real-time polymerase chain reaction. Sulforhodamine B and colony-forming experiments indicated that CUS inhibited PANC-1 cell proliferation in a dose- and time-dependent manner. A stronger inhibitory effect was observed when CUS was combined with gefitinib. The subcutaneous tumor growth was also inhibited. Western blot showed that all the examined proteins decreased, except for 4E-BP1 and the active fragments of caspase 3 and caspase 9 increased. Epidermal growth factor receptor expression did not change significantly in quantitative real-time polymerase chain reaction. Cucurmosin can strongly inhibit the growth of PANC-1 cells in vitro and in vivo. Cucurmosin can down-regulate EGFR protein expression, but not at the messenger RNA level. Cucurmosin can also inhibit the ras/raf and phosphatidylinositol 3-kinase/Akt downstream signaling pathways and enhance the sensitivity of the EGFR-targeted drug gefitinib.

  13. Calcium-dependent depletion zones in the cortical microtubule array coincide with sites of, but do not regulate, wall ingrowth papillae deposition in epidermal transfer cells

    Science.gov (United States)

    Zhang, Hui-ming; Talbot, Mark J.; McCurdy, David W.; Patrick, John W.; Offler, Christina E.

    2015-01-01

    Trans-differentiation to a transfer-cell morphology is characterized by the localized deposition of wall ingrowth papillae that protrude into the cytosol. Whether the cortical microtubule array directs wall ingrowth papillae formation was investigated using a Vicia faba cotyledon culture system in which their adaxial epidermal cells were spontaneously induced to trans-differentiate to transfer cells. During deposition of wall ingrowth papillae, the aligned cortical microtubule arrays in precursor epidermal cells were reorganized into a randomized array characterized by circular depletion zones. Concurrence of the temporal appearance, spatial pattern, and size of depletion zones and wall ingrowth papillae was consistent with each papilla occupying a depletion zone. Surprisingly, microtubules appeared not to regulate construction of wall ingrowth papillae, as neither depolymerization nor stabilization of cortical microtubules changed their deposition pattern or morphology. Moreover, the size and spatial pattern of depletion zones was unaltered when the formation of wall ingrowth papillae was blocked by inhibiting cellulose biosynthesis. In contrast, the depletion zones were absent when the cytosolic calcium plumes, responsible for directing wall ingrowth papillae formation, were blocked or dissipated. Thus, we conclude that the depletion zones within the cortical microtubule array result from localized depolymerization of microtubules initiated by elevated cytosolic Ca2+ levels at loci where wall ingrowth papillae are deposited. The physiological significance of the depletion zones as a mechanism to accommodate the construction of wall ingrowth papillae without compromising maintenance of the plasma membrane–microtubule inter-relationship is discussed. PMID:26136268

  14. Establishment of EMab-134, a Sensitive and Specific Anti-Epidermal Growth Factor Receptor Monoclonal Antibody for Detecting Squamous Cell Carcinoma Cells of the Oral Cavity.

    Science.gov (United States)

    Itai, Shunsuke; Yamada, Shinji; Kaneko, Mika K; Chang, Yao-Wen; Harada, Hiroyuki; Kato, Yukinari

    2017-12-01

    Epidermal growth factor receptor (EGFR), a receptor tyrosine kinase, activates downstream signaling cascades in many tumors. In this study, we established novel anti-EGFR monoclonal antibodies (mAbs) and characterized their efficacy in flow cytometry, Western blot, and immunohistochemical analyses. We immunized mice with a combination of the extracellular domain of EGFR and EGFR-overexpressing LN229 glioblastoma cells (LN229/EGFR) and performed the first screening using enzyme-linked immunosorbent assay. Next, we selected mAbs using flow cytometry. Among 156 established clones, two mAbs, EMab-51 (IgG 1 , kappa) and EMab-134 (IgG 1 , kappa), reacted with EGFR in Western blot analysis; EMab-134 showed a much higher sensitivity compared with EMab-51. We compared the binding affinities of EMab-51 and EMab-134 using flow cytometry; the calculated K D values for EMab-51 and EMab-134 against SAS cells/HSC-2 cells were 9.2 × 10 -9 M/9.9 × 10 -9 M and 2.6 × 10 -9 M/8.3 × 10 -9 M, respectively, indicating that EMab-134 has a higher affinity to EGFR-expressing cells. Immunohistochemical analysis of EMab-51 and EMab-134 showed sensitive and specific reactions against oral cancer cells; EMab-134 demonstrated a much higher sensitivity (36/38 cases; 94.7%) to oral squamous cell carcinomas compared with EMab-51 (6/38 cases; 15.8%). This novel anti-EGFR mAb, EMab-134, could be advantageous for detecting EGFR in the pathological analysis of EGFR-expressing cancers.

  15. Templated green synthesis of plasmonic silver nanoparticles in onion epidermal cells suitable for surface-enhanced Raman and hyper-Raman scattering

    DEFF Research Database (Denmark)

    Palanco, Marta Espina; Mogensen, Klaus Bo; Guehlke, Marina

    2016-01-01

    We report fast and simple green synthesis of plasmonic silver nanoparticles in the epidermal cells of onions after incubation with AgNO3 solution. The biological environment supports the generation of silver nanostructures in two ways. The plant tissue delivers reducing chemicals for the initial...... for one-and two-photon-excited spectroscopy such as surface enhanced Raman scattering (SERS) and surface enhanced hyper-Raman scattering (SEHRS). Our studies demonstrate a templated green preparation of enhancing plasmonic nanoparticles and suggest a new route to deliver silver nanoparticles as basic...... building blocks of plasmonic nanosensors to plants by the uptake of solutions of metal salts....

  16. Quantitative Tyrosine Phosphoproteomics of Epidermal Growth Factor Receptor (EGFR) Tyrosine Kinase Inhibitor-treated Lung Adenocarcinoma Cells Reveals Potential Novel Biomarkers of Therapeutic Response.

    Science.gov (United States)

    Zhang, Xu; Maity, Tapan; Kashyap, Manoj K; Bansal, Mukesh; Venugopalan, Abhilash; Singh, Sahib; Awasthi, Shivangi; Marimuthu, Arivusudar; Charles Jacob, Harrys Kishore; Belkina, Natalya; Pitts, Stephanie; Cultraro, Constance M; Gao, Shaojian; Kirkali, Guldal; Biswas, Romi; Chaerkady, Raghothama; Califano, Andrea; Pandey, Akhilesh; Guha, Udayan

    2017-05-01

    Mutations in the Epidermal growth factor receptor (EGFR) kinase domain, such as the L858R missense mutation and deletions spanning the conserved sequence 747 LREA 750 , are sensitive to tyrosine kinase inhibitors (TKIs). The gatekeeper site residue mutation, T790M accounts for around 60% of acquired resistance to EGFR TKIs. The first generation EGFR TKIs, erlotinib and gefitinib, and the second generation inhibitor, afatinib are FDA approved for initial treatment of EGFR mutated lung adenocarcinoma. The predominant biomarker of EGFR TKI responsiveness is the presence of EGFR TKI-sensitizing mutations. However, 30-40% of patients with EGFR mutations exhibit primary resistance to these TKIs, underscoring the unmet need of identifying additional biomarkers of treatment response. Here, we sought to characterize the dynamics of tyrosine phosphorylation upon EGFR TKI treatment of mutant EGFR-driven human lung adenocarcinoma cell lines with varying sensitivity to EGFR TKIs, erlotinib and afatinib. We employed stable isotope labeling with amino acids in cell culture (SILAC)-based quantitative mass spectrometry to identify and quantify tyrosine phosphorylated peptides. The proportion of tyrosine phosphorylated sites that had reduced phosphorylation upon erlotinib or afatinib treatment correlated with the degree of TKI-sensitivity. Afatinib, an irreversible EGFR TKI, more effectively inhibited tyrosine phosphorylation of a majority of the substrates. The phosphosites with phosphorylation SILAC ratios that correlated with the TKI-sensitivity of the cell lines include sites on kinases, such as EGFR-Y1197 and MAPK7-Y221, and adaptor proteins, such as SHC1-Y349/350, ERRFI1-Y394, GAB1-Y689, STAT5A-Y694, DLG3-Y705, and DAPP1-Y139, suggesting these are potential biomarkers of TKI sensitivity. DAPP1, is a novel target of mutant EGFR signaling and Y-139 is the major site of DAPP1 tyrosine phosphorylation. We also uncovered several off-target effects of these TKIs, such as MST1R-Y1238

  17. Amplification and high-level expression of heat shock protein 90 marks aggressive phenotypes of human epidermal growth factor receptor 2 negative breast cancer.

    Science.gov (United States)

    Cheng, Qing; Chang, Jeffrey T; Geradts, Joseph; Neckers, Leonard M; Haystead, Timothy; Spector, Neil L; Lyerly, H Kim

    2012-04-17

    Although human epidermal growth factor receptor 2 (HER2) positive or estrogen receptor (ER) positive breast cancers are treated with clinically validated anti-HER2 or anti-estrogen therapies, intrinsic and acquired resistance to these therapies appears in a substantial proportion of breast cancer patients and new therapies are needed. Identification of additional molecular factors, especially those characterized by aggressive behavior and poor prognosis, could prioritize interventional opportunities to improve the diagnosis and treatment of breast cancer. We compiled a collection of 4,010 breast tumor gene expression data derived from 23 datasets that have been posted on the National Center for Biotechnology Information (NCBI) Gene Expression Omnibus (GEO) database. We performed a genome-scale survival analysis using Cox-regression survival analyses, and validated using Kaplan-Meier Estimates survival and Cox Proportional-Hazards Regression survival analyses. We conducted a genome-scale analysis of chromosome alteration using 481 breast cancer samples obtained from The Cancer Genome Atlas (TCGA), from which combined expression and copy number data were available. We assessed the correlation between somatic copy number alterations and gene expression using analysis of variance (ANOVA). Increased expression of each of the heat shock protein (HSP) 90 isoforms, as well as HSP transcriptional factor 1 (HSF1), was correlated with poor prognosis in different subtypes of breast cancer. High-level expression of HSP90AA1 and HSP90AB1, two cytoplasmic HSP90 isoforms, was driven by chromosome coding region amplifications and were independent factors that led to death from breast cancer among patients with triple-negative (TNBC) and HER2-/ER+ subtypes, respectively. Furthermore, amplification of HSF1 was correlated with higher HSP90AA1 and HSP90AB1 mRNA expression among the breast cancer cells without amplifications of these two genes. A collection of HSP90AA1, HSP90AB1 and HSF

  18. Epidermal growth factor in the rat prostate

    DEFF Research Database (Denmark)

    Tørring, Niels; Jørgensen, P E; Poulsen, Steen Seier

    1998-01-01

    Epidermal growth factor (EGF) induces proliferation in prostate epithelial and stromal cells in primary culture. This investigation was set up to characterize the time and spatial expression of EGF in the rat prostate.......Epidermal growth factor (EGF) induces proliferation in prostate epithelial and stromal cells in primary culture. This investigation was set up to characterize the time and spatial expression of EGF in the rat prostate....

  19. Foliar Epidermal Studies of Plants in Euphorbiaceae

    Directory of Open Access Journals (Sweden)

    H. A. Thakur

    2014-03-01

    Full Text Available This paper describes foliar epidermal structure in 17 species belonging to 17 genera of the family Euphoprbiaceae. Anomocytic stomata is predominant, rarely they are anisocytic, paracytic on the same foliar surface with different combinations. Leaves are hypostomatic and rarely amphistomatic. The foliar surface is smooth, rarely striated. The foliar epidermal cell walls are straight or undulate. Distribution of stomata, stomatal index, stomatal frequency, stomatal size and other cell wall contours are described in detail.

  20. Release of infectious cells from epidermal ulcers in Ichthyophonus sp.-infected Pacific herring (Clupea pallasii): evidence for multiple mechanisms of transmission.

    Science.gov (United States)

    Kocan, Richard M; Gregg, Jacob L; Hershberger, Paul K

    2010-04-01

    A common clinical sign of ichthyophoniasis in herring and trout is "sandpaper" skin, a roughening of the epidermis characterized by the appearance of small papules, followed by ulceration and sloughing of the epithelium; early investigators hypothesized that these ulcers might be a means of transmitting the parasite, Ichthyophonus sp., without the necessity of ingesting an infected host. We examined the cells associated with the epidermal lesions and confirmed that they were viable Ichthyophonus sp. cells that were readily released from the skin into the mucous layer and ultimately into the aquatic environment. The released cells were infectious when injected into the body cavity of specific-pathogen-free herring. Our hypothesis is that different mechanisms of transmission occur in carnivorous and planktivorous hosts: Planktonic feeders become infected by ingestion of ulcer-derived cells, while carnivores become infected by ingestion of whole infected fish.

  1. Release of infectious cells from epidermal ulcers in Ichthyophonus sp.–infected Pacific Herring (Clupea pallasii): Evidence for multiple mechanisms of transmission

    Science.gov (United States)

    Hershberger, Paul K.; Gregg, Jacob L.; Kocan, R.M.

    2010-01-01

    A common clinical sign of ichthyophoniasis in herring and trout is “sandpaper” skin, a roughening of the epidermis characterized by the appearance of small papules, followed by ulceration and sloughing of the epithelium; early investigators hypothesized that these ulcers might be a means of transmitting the parasite, Ichthyophonus sp., without the necessity of ingesting an infected host. We examined the cells associated with the epidermal lesions and confirmed that they were viable Ichthyophonus sp. cells that were readily released from the skin into the mucous layer and ultimately into the aquatic environment. The released cells were infectious when injected into the body cavity of specific-pathogen-free herring. Our hypothesis is that different mechanisms of transmission occur in carnivorous and planktivorous hosts: Planktonic feeders become infected by ingestion of ulcer-derived cells, while carnivores become infected by ingestion of whole infected fish.

  2. Ginsenosides Rb1 and Rg1 Stimulate Melanogenesis in Human Epidermal Melanocytes via PKA/CREB/MITF Signaling

    Directory of Open Access Journals (Sweden)

    Mao Lin

    2014-01-01

    Full Text Available Reduced or defective melanin skin pigmentation may cause many hypopigmentation disorders and increase the risk of damage to the skin triggered by UV irradiation. Ginsenosides Rb1 and Rg1 have many molecular targets including the cAMP-response element-binding protein (CREB, which is involved in melanogenesis. This study aimed to investigate the effects of ginsenosides Rb1 and Rg1 on melanogenesis in human melanocytes and their related mechanisms. The effects of Rb1 and Rg1 on cell viability, tyrosinase activity, cellular melanin content and protein levels of tyrosinase, microphthalmia-associated transcription factor (MITF, and activation of CREB in melanocytes were assessed. Results showed that Rb1 or Rg1 significantly increased cellular melanin content and tyrosinase activity in a dose-dependent manner. By contrast, the cell viability of melanocytes remained unchanged. After exposure to Rb1 or Rg1, the protein levels of tyrosinase, MITF, and phosphorylated CREB were significantly increased. Furthermore, pretreatment with the selective PKA inhibitor H-89 significantly blocked the Rb1- or Rg1-induced increase of melanin content. These findings indicated that Rb1 and Rg1 increased melanogenesis and tyrosinase activity in human melanocytes, which was associated with activation of PKA/CREB/MITF signaling. The effects and mechanisms of Rb1 or Rg1 on skin pigmentation deserve further study.

  3. Flipped script for gefitinib: A reapproved tyrosine kinase inhibitor for first-line treatment of epidermal growth factor receptor mutation positive metastatic nonsmall cell lung cancer.

    Science.gov (United States)

    Bogdanowicz, Brian S; Hoch, Matthew A; Hartranft, Megan E

    2017-04-01

    Purpose The approval history, pharmacology, pharmacokinetics, clinical trials, efficacy, dosing recommendations, drug interactions, safety, place in therapy, and economic considerations of gefitinib are reviewed. Summary Lung cancer is one of the most commonly diagnosed cancers and is the leading cause of cancer death. Platinum-based chemotherapy and tyrosine kinase inhibitors, such as erlotinib and afatinib, are recommended therapies for nonsmall cell lung cancer. The European Medicines Association based their approval of gefitinib on the randomized, multicenter Iressa Pan-Asia Study (IPASS, NCT00322452) and a single-arm study showing effectiveness in Caucasians (IFUM, NCT01203917). Both studies were recently referenced by the United States Food & Drug Administration to reapprove gefitinib for the first-line treatment of advanced nonsmall cell lung cancer with epidermal growth factor receptor exon 19 deletions or exon 21 substitution. Diarrhea, acneiform rash, and interstitial lung disease are known side effects of gefitinib. Conclusion Use of gefitinib for the first-line therapy of metastatic nonsmall cell lung cancer with epidermal growth factor receptor exon 19 deletions (residues 747-750) or exon 21 substitution mutation (L858R) is well-documented and supported.

  4. Despite the presence of UVB-induced DNA damage, HLA-DR+ cells from ex vivo UVB-exposed human skin are able to migrate and show no impaired allostimulatory capacity

    NARCIS (Netherlands)

    Kremer, I. B.; Sylva-Steenland, R. M.; Bos, J. D.; Teunissen, M. B.

    1997-01-01

    In this study, we investigated the effect of ultraviolet B radiation on human Langerhans cell function. Normal human skin was irradiated ex vivo with single doses of ultraviolet B. For assessment of T-cell stimulatory function, cells that spontaneously migrated from epidermal sheets were used,

  5. Antisense imaging of epidermal growth factor-induced p21{sup WAF-1/CIP-1} gene expression in MDA-MB-468 human breast cancer xenografts

    Energy Technology Data Exchange (ETDEWEB)

    Wang, Judy; Chen, Paul; Mrkobrada, Marko [Leslie Dan Faculty of Pharmacy, University of Toronto, 19 Russell Street, M5S 2S2, Toronto, Ontario (Canada); Hu, Meiduo [Leslie Dan Faculty of Pharmacy, University of Toronto, 19 Russell Street, M5S 2S2, Toronto, Ontario (Canada); Department of Pharmaceutical Sciences, University of Toronto, Toronto, Ontario (Canada); Vallis, Katherine A. [Department of Radiation Oncology, Princess Margaret Hospital, University Health Network, 610 University Avenue, Toronto, Ontario (Canada); Department of Radiation Oncology, University of Toronto, Toronto, Ontario (Canada); Department of Medical Biophysics, University of Toronto, Toronto, Ontario (Canada); Reilly, Raymond M. [Department of Medical Imaging, University of Toronto, Toronto, Ontario (Canada)

    2003-09-01

    Molecular imaging of the expression of key genes which determine the response to DNA damage following cancer treatment may predict the effectiveness of a particular treatment strategy. A prominent early response gene for DNA damage is the gene encoding p21{sup WAF-1/CIP-1}, a cyclin-dependent kinase inhibitor that regulates progression through the cell cycle. In this study, we explored the feasibility of imaging p21{sup WAF-1/CIP-1} gene expression at the mRNA level using an 18-mer phosphorothioated antisense oligodeoxynucleotide (ODN) labeled with {sup 111}In. The known induction of the p21{sup WAF-1/CIP-1} gene in MDA-MB-468 human breast cancer cells following exposure to epidermal growth factor (EGF) was used as an experimental tool. Treatment of MDA-MB-468 cells in vitro with EGF (20 nM) increased the ratio of p21{sup WAF-1/CIP-1} mRNA/{beta}-actin mRNA threefold within 2 h as measured by the reverse transcription polymerase chain reaction (RT-PCR). A concentration-dependent inhibition of EGF-induced p21{sup WAF-1/CIP-1} protein expression was achieved in MDA-MB-468 cells by treatment with antisense ODNs with up to a tenfold decrease observed at 1 {mu}M. There was a fourfold lower inhibition of p21{sup WAF-1/CIP-1} protein expression by control sense or random sequence ODNs. Intratumoral injections of EGF (15 {mu}g/day x 3 days) were employed to induce p21{sup WAF-1/CIP-1} gene expression in MDA-MB-468 xenografts implanted subcutaneously into athymic mice. RT-PCR of explanted tumors showed a threefold increased level of p21{sup WAF-1/CIP-1} mRNA compared with normal saline-treated tumors. Successful imaging of EGF-induced p21{sup WAF-1/CIP-1} gene expression in MDA-MB-468 xenografts was achieved at 48 h post injection of {sup 111}In-labeled antisense ODNs (3.7 MBq; 2 {mu}g). Tumors displaying basal levels of p21{sup WAF-1/CIP-1} gene expression in the absence of EGF treatment could not be visualized. Biodistribution studies showed a significantly higher tumor

  6. The biological activity of the human epidermal growth factor receptor is positively regulated by its C-terminal tyrosines

    DEFF Research Database (Denmark)

    Helin, K; Velu, T; Martin, P

    1991-01-01

    mutants in the full length receptor. EGF-dependent transforming ability of the single point mutants is similar to that of the wild type, while that of double mutants is decreased and an even lower activity is present in the triple mutant. In each bioassay, including EGF-dependent focal transformation...... biologically. The EGF-R kinase activity is affected by tyrosine substitution since in vitro phosphorylation of exogenous substrates is reduced in the double and triple mutants. Autophosphorylation, in vivo and in vitro, is also reduced, but not totally abolished in the triple point mutant and Dc123 indicating......The epidermal growth factor receptor (EGF-R) C-terminus contains three conserved tyrosines (Y-1068, Y-1148, Y-1173) which are phosphorylated upon EGF activation. To clarify the functional role of these tyrosines, each has been mutated to phenylalanine and studied as single, double and triple...

  7. A variety of human monoclonal antibodies against epidermal growth factor receptor isolated from a phage antibody library.

    Science.gov (United States)

    Kurosawa, Gene; Kondo, Mariko; Kurosawa, Yoshikazu

    2016-11-04

    When the technology for constructing human antibody (Ab) libraries using a phage-display system was developed, many researchers in Ab-related fields anticipated that it would be widely applied to the development of pharmaceutical drugs against various diseases, including cancers. However, successful examples of such applications are very limited. Moreover, researchers who utilize phage-display technology now show divergent ways of thinking about phage Ab libraries. For example, there is debate about what should be the source of V H and V L genes for the construction of libraries to cover the whole repertoire of Abs present in the human body. In the immune system, the introduction of mutations into V genes followed by selection based on binding activity, termed Ab maturation, is required for the production of Abs exhibiting high affinity to the antigen (Ag). Therefore, introduction of mutations and selection are required for isolation of Abs with high affinity after isolation of clones from phage Ab libraries. We constructed a large human Ab library termed AIMS, developed a screening method termed ICOS, and succeeded in isolating many human monoclonal Abs (mAbs) that specifically and strongly bind to various tumor-associated Ags. Eight anti-EGFR mAbs were included, which we characterized. These mAbs showed various different activities against EGFR-expressing cancer cells. In this paper, we describe these data and discuss the possibility and necessity that the mAbs isolated from the AIMS library might be developed as therapeutic drugs against cancers without introduction of mutations. Copyright © 2016 The Authors. Published by Elsevier Inc. All rights reserved.

  8. Induction of Skin-Derived Precursor Cells from Human Induced Pluripotent Stem Cells.

    Science.gov (United States)

    Sugiyama-Nakagiri, Yoriko; Fujimura, Tsutomu; Moriwaki, Shigeru

    2016-01-01

    The generation of full thickness human skin from dissociated cells is an attractive approach not only for treating skin diseases, but also for treating many systemic disorders. However, it is currently not possible to obtain an unlimited number of skin dermal cells. The goal of this study was to develop a procedure to produce skin dermal stem cells from induced pluripotent stem cells (iPSCs). Skin-derived precursor cells (SKPs) were isolated as adult dermal precursors that could differentiate into both neural and mesodermal progenies and could reconstitute the dermis. Thus, we attempted to generate SKPs from iPSCs that could reconstitute the skin dermis. Human iPSCs were initially cultured with recombinant noggin and SB431542, an inhibitor of activin/nodal and TGFβ signaling, to induce neural crest progenitor cells. Those cells were then treated with SKP medium that included CHIR99021, a WNT signal activator. The induction efficacy from neural crest progenitor cells to SKPs was more than 97%. No other modifiers tested were able to induce those cells. Those human iPSC-derived SKPs (hiPSC-SKPs) showed a similar gene expression signature to SKPs isolated from human skin dermis. Human iPSC-SKPs differentiated into neural and mesodermal progenies, including adipocytes, skeletogenic cell types and Schwann cells. Moreover, they could be induced to follicular type keratinization when co-cultured with human epidermal keratinocytes. We here provide a new efficient protocol to create human skin dermal stem cells from hiPSCs that could contribute to the treatment of various skin disorders.

  9. Porcine epidermal stem cells as a biomedical model for wound healing and normal/malignant epithelial cell propagation

    Czech Academy of Sciences Publication Activity Database

    Motlík, Jan; Klíma, Jiří; Dvořánková, B.; Smetana, K. Jr.

    2007-01-01

    Roč. 67, - (2007), s. 105-111 ISSN 0093-691X Grant - others:GA ČR(CZ) GA304/04/0171 Institutional research plan: CEZ:AV0Z50450515 Keywords : pig * stem cell * epidermis Subject RIV: EB - Genetics ; Molecular Biology Impact factor: 1.911, year: 2007

  10. Endothelial network formed with human dermal microvascular endothelial cells in autologous multicellular skin substitutes.

    Science.gov (United States)

    Ponec, Maria; El Ghalbzouri, Abdoelwaheb; Dijkman, Remco; Kempenaar, Johanna; van der Pluijm, Gabri; Koolwijk, Pieter

    2004-01-01

    A human skin equivalent from a single skin biopsy harboring keratinocytes and melanocytes in the epidermal compartment, and fibroblasts and microvascular dermal endothelial cells in the dermal compartment was developed. The results of the study revealed that the nature of the extracellular matrix of the dermal compartments plays an important role in establishment of endothelial network in vitro. With rat-tail type I collagen matrices only lateral but not vertical expansion of endothelial networks was observed. In contrast, the presence of extracellular matrix of entirely human origin facilitated proper spatial organization of the endothelial network. Namely, when human dermal fibroblasts and microvascular endothelial cells were seeded on the bottom of an inert filter and subsequently epidermal cells were seeded on top of it, fibroblasts produced extracellular matrix throughout which numerous branched tubes were spreading three-dimensionally. Fibroblasts also facilitated the formation of basement membrane at the epidermal/matrix interface. Under all culture conditions, fully differentiated epidermis was formed with numerous melanocytes present in the basal epidermal cell layer. The results of the competitive RT-PCR revealed that both keratinocytes and fibroblasts expressed VEGF-A, -B, -C, aFGF and bFGF mRNA, whereas fibroblasts also expressed VEGF-D mRNA. At protein level, keratinocytes produced 10 times higher amounts of VEGF-A than fibroblasts did. The generation of multicellular skin equivalent from a single human skin biopsy will stimulate further developments for its application in the treatment of full-thickness skin defects. The potential development of biodegradable, biocompatible material suitable for these purposes is a great challenge for future research.

  11. Toxic epidermal necrolysis successfully treated with etanercept.

    Science.gov (United States)</