WorldWideScience

Sample records for human dna fragments

  1. Sperm DNA fragmentation affects epigenetic feature in human male pronucleus.

    Science.gov (United States)

    Rajabi, H; Mohseni-Kouchesfehani, H; Eslami-Arshaghi, T; Salehi, M

    2018-02-01

    To evaluate whether the sperm DNA fragmentation affects male pronucleus epigenetic factors, semen analysis was performed and DNA fragmentation was assessed by the method of sperm chromatin structure assay (SCSA). Human-mouse interspecies fertilisation was used to create human male pronucleus. Male pronucleus DNA methylation and H4K12 acetylation were evaluated by immunostaining. Results showed a significant positive correlation between the level of sperm DNA fragmentation and DNA methylation in male pronuclei. In other words, an increase in DNA damage caused an upsurge in DNA methylation. In the case of H4K12 acetylation, no correlation was detected between DNA damage and the level of histone acetylation in the normal group, but results for the group in which male pronuclei were derived from sperm cells with DNA fragmentation, increased DNA damage led to a decreased acetylation level. Sperm DNA fragmentation interferes with the active demethylation process and disrupts the insertion of histones into the male chromatin in the male pronucleus, following fertilisation. © 2017 Blackwell Verlag GmbH.

  2. DNA fragmentation and cytotoxicity by recombinant human tumor necrosis factor in L929 fibroblast cells

    International Nuclear Information System (INIS)

    Kosaka, T.; Kuwabara, M.; Koide, F.

    1992-01-01

    Induction of cell DNA fragmentation by treatment of recombinant human Tumor Necrosis Factor alpha (rhTNF alpha) was examined by using mouse L929 cells derived from mouse fibroblast cells. The amount of DNA fragments derived from rhTNF alpha-treated cells, detected by alkaline elution technique, was smaller than that derived from X-irradiated cells. The rhTNF alpha caused the DNA fragmentation depending on its incubation time and concentration. The DNA damage caused by rhTNF alpha treatment correlated with its cytotoxicity. This result suggested that the DNA fragmentation is one of causes of cell death. The treatment with proteinase K of DNA obtained from rhTNF alpha-treated cells did not increase the amount of DNA fragmentation, which indicates that rhTNF alpha causes DNA-fragmentation but not DNA-protein cross-linking

  3. No increased sperm DNA fragmentation index in semen containing human papillomavirus or herpesvirus

    DEFF Research Database (Denmark)

    Kaspersen, Maja Døvling; Bungum, Mona; Fedder, Jens

    2013-01-01

    It remains unknown whether human papillomaviruses (HPVs) or human herpesviruses (HHVs) in semen affect sperm DNA integrity. We investigated whether the presence of these viruses in semen was associated with an elevated sperm DNA fragmentation index. Semen from 76 sperm donors was examined by a PCR......-based hybridization array that identifies all HHVs and 35 of the most common HPVs. Sperm DNA integrity was determined by the sperm chromatin structure assay. HPVs or HHVs, or both, were found in 57% of semen samples; however, sperm DNA fragmentation index was not increased in semen containing these viruses....

  4. Mitochondrial DNA content in embryo culture medium is significantly associated with human embryo fragmentation.

    Science.gov (United States)

    Stigliani, S; Anserini, P; Venturini, P L; Scaruffi, P

    2013-10-01

    Is the amount of cell-free DNA released by human embryos into culture medium correlated with embryo morphological features? The mitochondrial DNA (mtDNA) content of culture medium is significantly associated with the fragmentation rate on Days 2 and 3 of embryo development, whether the oocyte came from women ≤ 35 or >35 years old. Cellular fragmentation is often utilized as one of the morphological parameters for embryo quality assessment. The amount of cellular fragments is considered to be an important morphological parameter for embryo implantation potential. It has been hypothesized that fragments are apoptotic bodies or anuclear cytoplasmatic pieces of blastomeres, although no definitive conclusion has been drawn about their pathogenesis. Human fertilized oocytes were individually cultured from Day 1 to Days 2 and 3. A total of 800 samples (166 spent media from Day 2 and 634 from Day 3) were enrolled into the present study. Double-stranded DNA (dsDNA) was quantified in 800 spent embryo culture media by Pico Green dye fluorescence assay. After DNA purification, genomic DNA (gDNA) and mtDNA were profiled by specific quantitative PCR. Statistical analyses defined correlations among DNA contents, embryo morphology and maternal age. Different independent tests confirmed the presence of DNA into embryo culture medium and, for the first time, we demonstrate that both gDNA and mtDNA are detectable in the secretome. The amount of DNA is larger in embryos with bad quality cleavage compared with high-grade embryos, suggesting that the DNA profile of culture medium is an objective marker for embryo quality assessment. In particular, DNA profiles are significantly associated with fragmentation feature (total dsDNA: P = 0.0010; mtDNA; P = 0.0247) and advanced maternal age. It is necessary to establish whether DNA profiling of spent embryo culture medium is a robust onsite test that can improve the prediction of blastulation, implantation and/or pregnancy rate. The

  5. Development of procedures for the identification of human papilloma virus DNA fragments in laser plume

    Science.gov (United States)

    Woellmer, Wolfgang; Meder, Tom; Jappe, Uta; Gross, Gerd; Riethdorf, Sabine; Riethdorf, Lutz; Kuhler-Obbarius, Christina; Loening, Thomas

    1996-01-01

    For the investigation of laser plume for the existence of HPV DNA fragments, which possibly occur during laser treatment of virus infected tissue, human papillomas and condylomas were treated in vitro with the CO2-laser. For the sampling of the laser plume a new method for the trapping of the material was developed by use of water-soluble gelatine filters. These samples were analyzed with the polymerase chain reaction (PCR) technique, which was optimized in regard of the gelatine filters and the specific primers. Positive PCR results for HPV DNA fragments up to the size of a complete oncogene were obtained and are discussed regarding infectiousity.

  6. DNA fragmentation in spermatozoa

    DEFF Research Database (Denmark)

    Rex, A S; Aagaard, J.; Fedder, J

    2017-01-01

    Sperm DNA Fragmentation has been extensively studied for more than a decade. In the 1940s the uniqueness of the spermatozoa protein complex which stabilizes the DNA was discovered. In the fifties and sixties, the association between unstable chromatin structure and subfertility was investigated....... In the seventies, the impact of induced DNA damage was investigated. In the 1980s the concept of sperm DNA fragmentation as related to infertility was introduced as well as the first DNA fragmentation test: the Sperm Chromatin Structure Assay (SCSA). The terminal deoxynucleotidyl transferase nick end labelling...... (TUNEL) test followed by others was introduced in the nineties. The association between DNA fragmentation in spermatozoa and pregnancy loss has been extensively investigated spurring the need for a therapeutic tool for these patients. This gave rise to an increased interest in the aetiology of DNA damage...

  7. DNA fragmentation in human fibroblasts under extremely low frequency electromagnetic field exposure

    International Nuclear Information System (INIS)

    Focke, Frauke; Schuermann, David; Kuster, Niels; Schaer, Primo

    2010-01-01

    Extremely low frequency electromagnetic fields (ELF-EMFs) were reported to affect DNA integrity in human cells with evidence based on the Comet assay. These findings were heavily debated for two main reasons; the lack of reproducibility, and the absence of a plausible scientific rationale for how EMFs could damage DNA. Starting out from a replication of the relevant experiments, we performed this study to clarify the existence and explore origin and nature of ELF-EMF induced DNA effects. Our data confirm that intermittent (but not continuous) exposure of human primary fibroblasts to a 50 Hz EMF at a flux density of 1 mT induces a slight but significant increase of DNA fragmentation in the Comet assay, and we provide first evidence for this to be caused by the magnetic rather than the electric field. Moreover, we show that EMF-induced responses in the Comet assay are dependent on cell proliferation, suggesting that processes of DNA replication rather than the DNA itself may be affected. Consistently, the Comet effects correlated with a reduction of actively replicating cells and a concomitant increase of apoptotic cells in exposed cultures, whereas a combined Fpg-Comet test failed to produce evidence for a notable contribution of oxidative DNA base damage. Hence, ELF-EMF induced effects in the Comet assay are reproducible under specific conditions and can be explained by minor disturbances in S-phase processes and occasional triggering of apoptosis rather than by the generation of DNA damage.

  8. DNA fragmentation in human fibroblasts under extremely low frequency electromagnetic field exposure

    Energy Technology Data Exchange (ETDEWEB)

    Focke, Frauke; Schuermann, David [Institute of Biochemistry and Genetics, Department of Biomedicine, University of Basel, Mattenstrasse 28, CH-4058 Basel (Switzerland); Kuster, Niels [IT' IS Foundation, Zeughausstrasse 43, CH-8004 Zurich (Switzerland); Schaer, Primo, E-mail: primo.schaer@unibas.ch [Institute of Biochemistry and Genetics, Department of Biomedicine, University of Basel, Mattenstrasse 28, CH-4058 Basel (Switzerland)

    2010-01-05

    Extremely low frequency electromagnetic fields (ELF-EMFs) were reported to affect DNA integrity in human cells with evidence based on the Comet assay. These findings were heavily debated for two main reasons; the lack of reproducibility, and the absence of a plausible scientific rationale for how EMFs could damage DNA. Starting out from a replication of the relevant experiments, we performed this study to clarify the existence and explore origin and nature of ELF-EMF induced DNA effects. Our data confirm that intermittent (but not continuous) exposure of human primary fibroblasts to a 50 Hz EMF at a flux density of 1 mT induces a slight but significant increase of DNA fragmentation in the Comet assay, and we provide first evidence for this to be caused by the magnetic rather than the electric field. Moreover, we show that EMF-induced responses in the Comet assay are dependent on cell proliferation, suggesting that processes of DNA replication rather than the DNA itself may be affected. Consistently, the Comet effects correlated with a reduction of actively replicating cells and a concomitant increase of apoptotic cells in exposed cultures, whereas a combined Fpg-Comet test failed to produce evidence for a notable contribution of oxidative DNA base damage. Hence, ELF-EMF induced effects in the Comet assay are reproducible under specific conditions and can be explained by minor disturbances in S-phase processes and occasional triggering of apoptosis rather than by the generation of DNA damage.

  9. Fragment Length of Circulating Tumor DNA.

    Science.gov (United States)

    Underhill, Hunter R; Kitzman, Jacob O; Hellwig, Sabine; Welker, Noah C; Daza, Riza; Baker, Daniel N; Gligorich, Keith M; Rostomily, Robert C; Bronner, Mary P; Shendure, Jay

    2016-07-01

    Malignant tumors shed DNA into the circulation. The transient half-life of circulating tumor DNA (ctDNA) may afford the opportunity to diagnose, monitor recurrence, and evaluate response to therapy solely through a non-invasive blood draw. However, detecting ctDNA against the normally occurring background of cell-free DNA derived from healthy cells has proven challenging, particularly in non-metastatic solid tumors. In this study, distinct differences in fragment length size between ctDNAs and normal cell-free DNA are defined. Human ctDNA in rat plasma derived from human glioblastoma multiforme stem-like cells in the rat brain and human hepatocellular carcinoma in the rat flank were found to have a shorter principal fragment length than the background rat cell-free DNA (134-144 bp vs. 167 bp, respectively). Subsequently, a similar shift in the fragment length of ctDNA in humans with melanoma and lung cancer was identified compared to healthy controls. Comparison of fragment lengths from cell-free DNA between a melanoma patient and healthy controls found that the BRAF V600E mutant allele occurred more commonly at a shorter fragment length than the fragment length of the wild-type allele (132-145 bp vs. 165 bp, respectively). Moreover, size-selecting for shorter cell-free DNA fragment lengths substantially increased the EGFR T790M mutant allele frequency in human lung cancer. These findings provide compelling evidence that experimental or bioinformatic isolation of a specific subset of fragment lengths from cell-free DNA may improve detection of ctDNA.

  10. Analysis of human blood plasma cell-free DNA fragment size distribution using EvaGreen chemistry based droplet digital PCR assays.

    Science.gov (United States)

    Fernando, M Rohan; Jiang, Chao; Krzyzanowski, Gary D; Ryan, Wayne L

    2018-04-12

    Plasma cell-free DNA (cfDNA) fragment size distribution provides important information required for diagnostic assay development. We have developed and optimized droplet digital PCR (ddPCR) assays that quantify short and long DNA fragments. These assays were used to analyze plasma cfDNA fragment size distribution in human blood. Assays were designed to amplify 76,135, 490 and 905 base pair fragments of human β-actin gene. These assays were used for fragment size analysis of plasma cell-free, exosome and apoptotic body DNA obtained from normal and pregnant donors. The relative percentages for 76, 135, 490 and 905 bp fragments from non-pregnant plasma and exosome DNA were 100%, 39%, 18%, 5.6% and 100%, 40%, 18%,3.3%, respectively. The relative percentages for pregnant plasma and exosome DNA were 100%, 34%, 14%, 23%, and 100%, 30%, 12%, 18%, respectively. The relative percentages for non-pregnant plasma pellet (obtained after 2nd centrifugation step) were 100%, 100%, 87% and 83%, respectively. Non-pregnant Plasma cell-free and exosome DNA share a unique fragment distribution pattern which is different from pregnant donor plasma and exosome DNA fragment distribution indicating the effect of physiological status on cfDNA fragment size distribution. Fragment distribution pattern for plasma pellet that includes apoptotic bodies and nuclear DNA was greatly different from plasma cell-free and exosome DNA. Copyright © 2018 The Authors. Published by Elsevier B.V. All rights reserved.

  11. DNA fragmentation and apoptosis induced by safranal in human prostate cancer cell line

    Directory of Open Access Journals (Sweden)

    Saeed Samarghandian

    2013-01-01

    Full Text Available Objectives: Apoptosis, an important mechanism that contributes to cell growth reduction, is reported to be induced by Crocus sativus (Saffron in different cancer types. However, limited effort has been made to correlate these effects to the active ingredients of saffron. The present study was designed to elucidate cytotoxic and apoptosis induction by safranal, the major coloring compound in saffron, in a human prostate cancer cell line (PC-3. Materials and Methods: PC-3 and human fetal lung fibroblast (MRC-5 cells were cultured and exposed to safranal (5, 10, 15, and 20 μg/ml. The 3-(4,5-dimethylthiazol-2-yl-2,5-diphenyltetrazolium bromide (MTT assay was performed to assess cytotoxicity. DNA fragmentation was assessed by gel electrophoresis. Cells were incubated with different concentrations of safranal, and cell morphologic changes and apoptosis were determined by the normal inverted microscope, Annexin V, and propidium iodide, followed by flow cytometric analysis, respectively. Results: MTT assay revealed a remarkable and concentration-dependent cytotoxic effect of safranal on PC-3 cells in comparison with non-malignant cell line. The morphologic alterations of the cells confirmed the MTT results. The IC 50 values against PC-3 cells were found to be 13.0 ΁ 0.07 and 6.4 ΁ 0.09 μg/ml at 48 and 72 h, respectively. Safranal induced an early and late apoptosis in the flow cytometry histogram of treated cells, indicating apoptosis is involved in this toxicity. DNA analysis revealed typical ladders as early as 48 and 72 h after treatment, indicative of apoptosis. Conclusions: Our preclinical study demonstrated a prostate cancer cell line to be highly sensitive to safranal-mediated growth inhibition and apoptotic cell death. Although the molecular mechanisms of safranal action are not clearly understood, it appears to have potential as a therapeutic agent.

  12. Analysis of DNA restriction fragments greater than 5.7 Mb in size from the centromeric region of human chromosomes.

    Science.gov (United States)

    Arn, P H; Li, X; Smith, C; Hsu, M; Schwartz, D C; Jabs, E W

    1991-01-01

    Pulsed electrophoresis was used to study the organization of the human centromeric region. Genomic DNA was digested with rare-cutting enzymes. DNA fragments from 0.2 to greater than 5.7 Mb were separated by electrophoresis and hybridized with alphoid and simple DNA repeats. Rare-cutting enzymes (Mlu I, Nar I, Not I, Nru I, Sal I, Sfi I, Sst II) demonstrated fewer restriction sites at centromeric regions than elsewhere in the genome. The enzyme Not I had the fewest restriction sites at centromeric regions. As much as 70% of these sequences from the centromeric region are present in Not I DNA fragments greater than 5.7 and estimated to be as large as 10 Mb in size. Other repetitive sequences such as short interspersed repeated segments (SINEs), long interspersed repeated segments (LINEs), ribosomal DNA, and mini-satellite DNA that are not enriched at the centromeric region, are not enriched in Not I fragments of greater than 5.7 Mb in size.

  13. The Effect of Glyphosate on Human Sperm Motility and Sperm DNA Fragmentation

    Directory of Open Access Journals (Sweden)

    George Anifandis

    2018-05-01

    Full Text Available Glyphosate is the active ingredient of Roundup®, which is one of the most popular herbicides worldwide. Although many studies have focused on the reproductive toxicity of glyphosate or glyphosate-based herbicides, the majority of them have concluded that the effect of the specific herbicide is negligible, while only a few studies indicate the male reproductive toxicity of glyphosate alone. The aim of the present study was to investigate the effect of 0.36 mg/L glyphosate on sperm motility and sperm DNA fragmentation (SDF. Thirty healthy men volunteered to undergo semen analysis for the purpose of the study. Sperm motility was calculated according to WHO 2010 guidelines at collection time (zero time and 1 h post-treatment with glyphosate. Sperm DNA fragmentation was evaluated with Halosperm® G2 kit for both the control and glyphosate-treated sperm samples. Sperm progressive motility of glyphosate-treated samples was significantly reduced after 1 h post-treatment in comparison to the respective controls, in contrast to the SDF of glyphosate-treated samples, which was comparable to the respective controls. Conclusively, under these in vitro conditions, at high concentrations that greatly exceed environmental exposures, glyphosate exerts toxic effects on sperm progressive motility but not on sperm DNA integrity, meaning that the toxic effect is limited only to motility, at least in the first hour.

  14. cDNA cloning of human DNA topoisomerase I. Catalytic activity of a 67.7-kDa carboxyl-terminal fragment

    International Nuclear Information System (INIS)

    D'Arpa, P.; Machlin, P.S.; Ratrie, H. III; Rothfield, N.F.; Cleveland, D.W.; Earnshaw, W.C.

    1988-01-01

    cDNA clones encoding human topoisomerase I were isolated from an expression vector library (λgt11) screened with autoimmune anti-topoisomerase I serum. One of these clones has been expressed as a fusion protein comprised of a 32-kDa fragment of the bacterial TrpE protein linked to 67.7 kDa of protein encoded by the cDNA. Three lines of evidence indicate that the cloned cDNA encodes topoisomerase I. (i) Proteolysis maps of the fusion protein and human nuclear topoisomerase I are essentially identical. (ii) The fusion protein relaxes supercoiled DNA, an activity that can be immunoprecipitated by anti-topoisomerase I serum. (iii) Sequence analysis has revealed that the longest cDNA clone (3645 base pairs) encodes a protein of 765 amino acids that shares 42% identity with Saccharomyces cerevisiae topoisomerase I. The sequence data also show that the catalytically active 67.7-kDa fragment is comprised of the carboxyl terminus

  15. i-Motif of cytosine-rich human telomere DNA fragments containing natural base lesions

    Czech Academy of Sciences Publication Activity Database

    Dvořáková, Zuzana; Renčiuk, Daniel; Kejnovská, Iva; Školáková, Petra; Bednářová, Klára; Sagi, J.; Vorlíčková, Michaela

    2018-01-01

    Roč. 46, č. 4 (2018), s. 1624-1634 ISSN 1362-4962 R&D Projects: GA ČR(CZ) GA15-06785S; GA ČR GA17-12075S; GA ČR(CZ) GJ17-19170Y; GA MŠk EF15_003/0000477 Institutional support: RVO:68081707 Keywords : pair opening kinetics * g-quadruplex dna Subject RIV: CE - Biochemistry OBOR OECD: Biochemistry and molecular biology

  16. Complementary DNA-amplified fragment length polymorphism ...

    African Journals Online (AJOL)

    Complementary DNA-amplified fragment length polymorphism (AFLP-cDNA) analysis of differential gene expression from the xerophyte Ammopiptanthus mongolicus in response to cold, drought and cold together with drought.

  17. ERIC-PCR fingerprinting-based community DNA hybridization to pinpoint genome-specific fragments as molecular markers to identify and track populations common to healthy human guts.

    Science.gov (United States)

    Wei, Guifang; Pan, Li; Du, Huimin; Chen, Junyi; Zhao, Liping

    2004-10-01

    Bacterial populations common to healthy human guts may play important roles in human health. A new strategy for discovering genomic sequences as markers for these bacteria was developed using Enterobacterial Repetitive Intergenic Consensus (ERIC)-PCR fingerprinting. Structural features within microbial communities are compared with ERIC-PCR followed by DNA hybridization to identify genomic fragments shared by samples from healthy human individuals. ERIC-PCR profiles of fecal samples from 12 diseased or healthy human and piglet subjects demonstrated stable, unique banding patterns for each individual tested. Sequence homology of DNA fragments in bands of identical size was examined between samples by hybridization under high stringency conditions with DIG-labeled ERIC-PCR products derived from the fecal sample of one healthy child. Comparative analysis of the hybridization profiles with the original agarose fingerprints identified three predominant bands as signatures for populations associated with healthy human guts with sizes of 500, 800 and 1000 bp. Clone library profiling of the three bands produced 17 genome fragments, three of which showed high similarity only with regions of the Bacteroides thetaiotaomicron genome, while the remainder were orphan sequences. Association of these sequences with healthy guts was validated by sequence-selective PCR experiments, which showed that a single fragment was present in all 32 healthy humans and 13 healthy piglets tested. Two fragments were present in the healthy human group and in 18 children with non-infectious diarrhea but not in eight children with infectious diarrhea. Genome fragments identified with this novel strategy may be used as genome-specific markers for dynamic monitoring and sequence-guided isolation of functionally important bacterial populations in complex communities such as human gut microflora.

  18. The influence of ginger (Zingiber officinale on human sperm quality and DNA fragmentation: A double-blind randomized clinical trial

    Directory of Open Access Journals (Sweden)

    Jalil Hosseini

    2016-08-01

    Full Text Available Background: Although the effectiveness of ginger as an antioxidant agent has been exploited, little human research has been conducted on its activity on male reproductive functions. Objective: This study was designed to investigate the effects of ginger (Zingiber officinale on sperm DNA fragmentation (SDF in infertile men. Materials and Methods: This randomized double-blind, placebo-controlled trial with a 1:1 allocation was performed on 100 infertility treatment candidates who were admitted to Royan Institute for Reproductive Biomedicine, Tehran, Iran. Patients were randomly assigned to receive one of two treatments: ginger and placebo. Patients were given a 3-month oral treatment (members received capsules containing 250 mg of ginger powder twice a day in ginger and a placebo in other group. Before and after treatment, standardized semen samples were obtained to determine sperm concentration, motility, and SDF according to World Health Organization. Results: There was no significant difference between two groups regarding SDF at baseline (53.48. 95%CI: 37.95-69.02 in cases and (56.75, 95%CI: 40.01-73.5 in controls. The average positive percentage of SDF in patients receiving ginger (17.77, 95%CI: 6.16-29.39 was lower compared with placebo (40.54, 95%CI: 23.94-57.13 after three month of treatment (p=0.02. In multivariate analysis, SDF was significantly lower in patients receiving ginger compared with placebo (mean difference: 3.21, 95%CI: 0.78-5.63, p=0.009. There were no significant differences between two groups regarding to semen parameters. Conclusion: The present study has demonstrated that ginger in a controlled study of efficacy was effective in decreasing SDF in infertile men.

  19. Supramolecular gel electrophoresis of large DNA fragments.

    Science.gov (United States)

    Tazawa, Shohei; Kobayashi, Kazuhiro; Oyoshi, Takanori; Yamanaka, Masamichi

    2017-10-01

    Pulsed-field gel electrophoresis is a frequent technique used to separate exceptionally large DNA fragments. In a typical continuous field electrophoresis, it is challenging to separate DNA fragments larger than 20 kbp because they migrate at a comparable rate. To overcome this challenge, it is necessary to develop a novel matrix for the electrophoresis. Here, we describe the electrophoresis of large DNA fragments up to 166 kbp using a supramolecular gel matrix and a typical continuous field electrophoresis system. C 3 -symmetric tris-urea self-assembled into a supramolecular hydrogel in tris-boric acid-EDTA buffer, a typical buffer for DNA electrophoresis, and the supramolecular hydrogel was used as a matrix for electrophoresis to separate large DNA fragments. Three types of DNA marker, the λ-Hind III digest (2 to 23 kbp), Lambda DNA-Mono Cut Mix (10 to 49 kbp), and Marker 7 GT (10 to 165 kbp), were analyzed in this study. Large DNA fragments of greater than 100 kbp showed distinct mobility using a typical continuous field electrophoresis system. © 2017 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  20. DNA fragmentation and cell cycle arrest: a hallmark of apoptosis induced by Ruta graveolens in human colon cancer cells.

    Science.gov (United States)

    Arora, Shagun; Tandon, Simran

    2015-01-01

    In the present study, we investigated the anti-cancer effect of various potencies of Ruta graveolens (Ruta) on COLO-205 cell line, as evidenced by cytotoxicity, migration, clonogenecity, morphological and biochemical changes and modification in the levels of genes associated with apoptosis and cell cycle. On treatment of COLO-205 cells maximal effects were seen with mother tincture (MT) and 30C potencies, wherein decrease in cell viability along with reduced clonogenecity and migration capabilities were noted. In addition morphological and biochemical alterations such as nuclear changes (fragmented nuclei with condensed chromatin) and DNA ladder-like pattern (increased amount of fragmented DNA) in COLO-205 cells indicating apoptotic related cell death were seen. The expression of apoptosis and cell-cycle related regulatory genes assessed by reverse transcriptase-PCR revealed an up-regulation of caspase 9, caspase-3, Bax, p21 and p27 expression and down-regulation of Bcl-2 expression in treated cells. The mode of cell death was suggestive of intrinsic apoptotic pathway along with cell cycle arrest at the G2/M of the cell cycle. Our findings indicate that phytochemicals present in Ruta showed potential for natural therapeutic product development for colon carcinoma. Copyright © 2014 The Faculty of Homeopathy. Published by Elsevier Ltd. All rights reserved.

  1. Fragmentation in DNA double-strand breaks

    International Nuclear Information System (INIS)

    Wei Zhiyong; Suzhou Univ., Suzhou; Zhang Lihui; Li Ming; Fan Wo; Xu Yujie

    2005-01-01

    DNA double strand breaks are important lesions induced by irradiations. Random breakage model or quantification supported by this concept is suitable to analyze DNA double strand break data induced by low LET radiation, but deviation from random breakage model is more evident in high LET radiation data analysis. In this work we develop a new method, statistical fragmentation model, to analyze the fragmentation process of DNA double strand breaks. After charged particles enter the biological cell, they produce ionizations along their tracks, and transfer their energies to the cells and break the cellular DNA strands into fragments. The probable distribution of the fragments is obtained under the condition in which the entropy is maximum. Under the approximation E≅E 0 + E 1 l + E 2 l 2 , the distribution functions are obtained as exp(αl + βl 2 ). There are two components, the one proportional to exp(βl 2 ), mainly contributes to the low mass fragment yields, the other component, proportional to exp(αl), decreases slowly as the mass of the fragments increases. Numerical solution of the constraint equations provides parameters α and β. Experimental data, especially when the energy deposition is higher, support the statistical fragmentation model. (authors)

  2. Mitochondrial outer membrane permeabilization increases reactive oxygen species production and decreases mean sperm velocity but is not associated with DNA fragmentation in human sperm.

    Science.gov (United States)

    Treulen, F; Uribe, P; Boguen, R; Villegas, J V

    2016-02-01

    Does induction of mitochondrial outer membrane permeabilization (MOMP) in vitro affect specific functional parameters of human spermatozoa? Our findings show that MOMP induction increases intracellular reactive oxygen species (ROS) and decreases mean sperm velocity but does not alter DNA integrity. MOMP in somatic cells is related to a variety of apoptotic traits, such as alteration of mitochondrial membrane potential (ΔΨm), and increase in ROS production and DNA fragmentation. Although the presence of these apoptotic features has been reported in spermatozoa, to date the effects of MOMP on sperm function and DNA integrity have not been analysed. The study included spermatozoa from fertile donors. Motile sperm were obtained using the swim-up method. The highly motile sperm were collected and diluted with human tubal fluid to a final cell concentration of 5 × 10(6) ml(-1). To induce MOMP, selected sperm were treated at 37°C for 4 h with a mimetic of a Bcl-2 pro-apoptotic protein, ABT-737. MOMP was evaluated by relocating of cytochrome c. In addition, the effect of ABT-737 on mitochondrial inner membrane permeabilization was assessed using the calcein-AM/cobalt chloride method. In turn, ΔΨm was evaluated with JC-1 staining, intracellular ROS production with dihydroethidium, sperm motility was analysed by computer-assisted sperm analysis and DNA fragmentation by terminal deoxynucleotidyl transferase-mediated dUTP nick-end labelling (TUNEL) assay. Measurements were performed by flow cytometry. MOMP was associated with ΔΨm dissipation (P < 0.05), increased ROS production (P < 0.05) and decreased mean sperm velocity (P < 0.05), but it was not associated with DNA fragmentation. MOMP did not induce a large increase in ROS, which could explain the negligible effect of MOMP on sperm DNA fragmentation under our experimental conditions. The study was carried out in vitro using highly motile sperm, selected by swim-up, from healthy donors. The results obtained in this

  3. DNA fragmentation dynamics allows the assessment of cryptic sperm damage in human: Evaluation of exposure to ionizing radiation, hyperthermia, acidic pH and nitric oxide

    Energy Technology Data Exchange (ETDEWEB)

    Santiso, Rebeca; Tamayo, Maria [Laboratorio de Genetica Molecular y Radiobiologia, Centro Oncologico de Galicia, Doctor Camilo Veiras 1, 15009-A Coruna (Spain); Genetics Unit, INIBIC-Complejo Hospitalario Universitario A Coruna (CHUAC), As Xubias, 84, 15006-A Coruna (Spain); Gosalvez, Jaime [Genetics Unit, Facultad de Biologia, Universidad Autonoma de Madrid, Ciudad Universitaria de Cantoblanco, 28049 Madrid (Spain); Johnston, Steve [School of Agriculture and Food Science, University of Queensland, Gatton 4343 (Australia); Marino, Alfonso [Servicio de Oncologia Radioterapica, Centro Oncologico de Galicia, Doctor Camilo Veiras 1, 15009-A Coruna (Spain); Fernandez, Carlos; Losada, Carlos [Servicio de Radiofisica, Centro Oncologico de Galicia, Doctor Camilo Veiras 1, 15009-A Coruna (Spain); Fernandez, Jose Luis, E-mail: Jose.Luis.Fernandez.Garcia@sergas.es [Laboratorio de Genetica Molecular y Radiobiologia, Centro Oncologico de Galicia, Doctor Camilo Veiras 1, 15009-A Coruna (Spain); Genetics Unit, INIBIC-Complejo Hospitalario Universitario A Coruna (CHUAC), As Xubias, 84, 15006-A Coruna (Spain)

    2012-06-01

    Sperm DNA fragmentation (SDF) is not a static seminal parameter, since the longevity of sperm DNA decreases progressively with time following ejaculation or thawing. While the dynamics of SDF is a species-specific characteristic, in the case of humans, there is still significant variation within patients. To evaluate the suitability of the dynamic SDF assay to assess the adverse effects of agents that cause genetic damage, fresh semen samples from different donors were exposed in vitro to (1) increasing acute doses of ionizing radiation, (2) elevated temperature (41 Degree-Sign C and 45 Degree-Sign C), (3) acidic pH (pH 4) and (4) the nitric oxide (NO) donor sodium nitroprusside (SNP). Sperm DNA fragmentation was analyzed after an incubation period of chronic (24 h), or acute (1 h) exposure to each treatment followed by incubation at 37 Degree-Sign C over a period of 24 h. SDF was assessed using the sperm chromatin dispersion (SCD) test. Dynamic SDF for each treatment was analyzed using Kaplan-Meier survival curves. All agents, except for ionizing radiation, accelerated SDF kinetics following chronic exposure over a 24 h period. Transient exposure to NO and heat but not acidic pH increased the basal (T0) level of SDF. Despite the removal of the three toxicants, the remaining sperm following acute exposure showed a decrease in their expected DNA longevity. It is concluded that the assessment of sperm DNA fragmentation dynamics is an effective methodological approach for revealing latent damage associated with toxicants that is not initially expressed following a single initial observation of SDF.

  4. Episodic air pollution is associated with increased DNA fragmentation in human sperm without other changes in semen quality

    Energy Technology Data Exchange (ETDEWEB)

    Rubes, J.; Selevan, S.G.; Evenson, D.P.; Zudova, D.; Vozdova, M.; Zudova, Z.; Robbins, W.A.; Perreault, S.D. [US EPA, Research Triangle Park, NC (United States)

    2005-10-01

    This study examined potential associations between exposure to episodes of air pollution and alterations in semen quality. The air pollution, resulting from combustion of coal for industry and home heating in the Teplice district of the Czech Republic, was much higher during the winter than at other times of year with peaks exceeding US air quality standards. Young men from Teplice were sampled up to seven times over 2 years allowing evaluation of semen quality after periods of exposure to both low and high air pollution. Routine semen analysis (sperm concentration, motility and morphology) and tests for sperm aneuploidy and chromatin integrity were performed, comparing measurements within each subject. Exposure was classified as high or low based on data from ambient air pollution monitoring. Using repeated measures analysis, a significant association was found between exposure to periods of high air pollution (at or above the upper limit of US air quality standards) and the percentage of sperm with DNA fragmentation according to sperm chromatin structure assay (SCSA). Other semen measures were not associated with air pollution. It is concluded that exposure to intermittent air pollution may result in sperm DNA damage and thereby increase the rates of male-mediated infertility, miscarriage, and other adverse reproductive outcomes.

  5. Isolation and characterization of DNA probes from a flow-sorted human chromosome 8 library that detect restriction fragment length polymorphism (RFLP).

    Science.gov (United States)

    Wood, S; Starr, T V; Shukin, R J

    1986-01-01

    We have used a recombinant DNA library constructed from flow-sorted human chromosome 8 as a source of single-copy human probes. These probes have been screened for restriction fragment length polymorphism (RFLP) by hybridization to Southern transfers of genomic DNA from five unrelated individuals. We have detected six RFLPs distributed among four probes after screening 741 base pairs for restriction site variation. These RFLPs all behave as codominant Mendelian alleles. Two of the probes detect rare variants, while the other two detect RFLPs with PIC values of .36 and .16. Informative probes will be useful for the construction of a linkage map for chromosome 8 and for the localization of mutant alleles to this chromosome. Images Fig. 1 PMID:2879441

  6. Mutant DNA quantification by digital PCR can be confounded by heating during DNA fragmentation.

    Science.gov (United States)

    Kang, Qing; Parkin, Brian; Giraldez, Maria D; Tewari, Muneesh

    2016-04-01

    Digital PCR (dPCR) is gaining popularity as a DNA mutation quantification method for clinical specimens. Fragmentation prior to dPCR is required for non-fragmented genomic DNA samples; however, the effect of fragmentation on DNA analysis has not been well-studied. Here we evaluated three fragmentation methods for their effects on dPCR point mutation assay performance. Wild-type (WT) human genomic DNA was fragmented by heating, restriction digestion, or acoustic shearing using a Covaris focused-ultrasonicator. dPCR was then used to determine the limit of blank (LoB) by quantifying observed WT and mutant allele counts of the proto-oncogenes KRAS and BRAF in the WT DNA sample. DNA fragmentation by heating to 95°C, while the simplest and least expensive method, produced a high background mutation frequency for certain KRAS mutations relative to the other methods. This was due to heat-induced mutations, specifically affecting dPCR assays designed to interrogate guanine to adenine (G>A) mutations. Moreover, heat-induced fragmentation overestimated gene copy number, potentially due to denaturation and partition of single-stranded DNA into different droplets. Covaris acoustic shearing and restriction enzyme digestion showed similar LoBs and gene copy number estimates to one another. It should be noted that moderate heating, commonly used in genomic DNA extraction protocols, did not significantly increase observed KRAS mutation counts.

  7. Accumulation of single-strand breaks doses not result in double-strand DNA breaks: peculiarity of transcribing fragment of human ribosomal operon that allows its detection in biological fluids at the death of various cells in organism

    International Nuclear Information System (INIS)

    Vejko, N.N.; Spitkovskij, D.M.

    2000-01-01

    The evidences of stability of the human ribosomal gene in the transcribing range (TR-rDNA) to fragmentation are presented in two groups of experiments: 1) in the case of availability of the fragments in the cells of sectional corpse material (necrosis and apoptosis) and by pathologies accompanied by the cells death through the apoptosis or necrosis mechanism; 2) in the model experiments, wherein the separated genomes DNA is subjected to the impact of nucleases initiating single-strand breaks (SB), or chemical introduction with a subsequent comparative analysis of stability to fragmentation of various DNA sequences including TR-rDNA. The DNA solutions were subjected to γ-radiation with the dose rate of 4.8 Gy/min. It is shown that in spite of the great number of the SBs the TR-rDNA is characterized by increased stability to fragmentation, which makes it possible to propose this DNA fragment for application as a cell death marker in biological fluids [ru

  8. A homicide in the Ukraine: DNA-based identification of a boiled, skeletonized, and varnished human skull, and of bone fragments found in a fireplace.

    Science.gov (United States)

    Sivolap, Y; Krivda, G; Kozhuhova, N; Chebotar, S; Benecke, M

    2001-12-01

    In an apartment, bone fragments were found in a fireplace. Furthermore, a varnished skull was found elsewhere in the same apartment. The tenant confessed to a murder and stated that the head of a victim, a girl, was boiled for 12 hours. He stated that the soft tissue was then removed and the skull was varnished. Other parts of the body were burned to ashes in an open field. Comparison of loci D19S252, CD4, CYAR04, TII01, F13A01, F13B, and D6S366 from the skull and the bone remains to loci of the mother of a missing girl showed that the skull came from that missing child. Biological maternity was calculated as 99.99%. The bone pieces were DNA typed as male and did not share alleles with the mother in several systems. Therefore, they belonged to a different (human) victim.

  9. Characterization of a human MSX-2 cDNA and its fragment isolated as a transformation suppressor gene against v-Ki-ras oncogene.

    Science.gov (United States)

    Takahashi, C; Akiyama, N; Matsuzaki, T; Takai, S; Kitayama, H; Noda, M

    1996-05-16

    A cDNA (termed CT124) encoding a carboxyl-terminal fragment of the human homeobox protein MSX-2 was found to induce flat reversion when expressed in v-Ki-ras-transformed NIH3T3 cells. Although the expression of endogenous MSX-2 gene is low in most of the normal adult tissues examined, it is frequently activated in carcinoma-derived cell lines. Likewise, the gene is inactive in NIH3T3 cells but is transcriptionally activated after transformation by v-Ki-ras oncogene, suggesting that the intact MSX-2 may play a positive, rather than suppressive, role in cell transformation. To test this possibility, we isolated a near full-length human MSX-2 cDNA and tested its activities in two cell systems, i.e. fibroblast and myoblast. In NIH3T3 fibroblasts, although the gene by itself failed to confer a transformed phenotype, antisense MSX-2 cDNA as well as truncated CT124 cDNA interfered with the transforming activities of v-Ki-ras oncogene. In C2C12 myoblasts, MSX-2 was found to suppress MyoD gene expression, as do activated ras oncogenes, under certain culture conditions, and CT124 was found to inhibit the activities of both MSX-2 and ras in this system as well. Our findings not only suggest that CT124 may act as a dominant suppressor of MSX-2 but also raise the possibility that MSX-2 gene may be an important downstream target for the Ras signaling pathways.

  10. Menadione-induced DNA fragmentation without 8-hydroxy-2'-deoxyguanosine formation in isolated rat hepatocytes

    DEFF Research Database (Denmark)

    Fischer-Nielsen, Anne; Corcoran, George B.; Poulsen, Henrik E.

    1995-01-01

    Farmakologi, frie iltradikaler, menadion, DNA fragmentering, rotteleverceller, oksidativ DNA skade......Farmakologi, frie iltradikaler, menadion, DNA fragmentering, rotteleverceller, oksidativ DNA skade...

  11. DNA fragmentation and cell cycle arrest: a hallmark of apoptosis induced by crocin from kashmiri saffron in a human pancreatic cancer cell line.

    Science.gov (United States)

    Bakshi, Hamid; Sam, Smitha; Rozati, Roya; Sultan, Phalisteen; Islam, Tajamul; Rathore, Babita; Lone, Zahoor; Sharma, Manik; Triphati, Jagrati; Saxena, Ramesh Chand

    2010-01-01

    Apoptosis, a widely important mechanism that contributes to cell growth reduction, is reported to be induced by Crocus sativus in different cancer types. The present study was designed to elucidate apoptosis induction by crocin, a main component of Crocus sativus in a human pancreatic cancer cell line (BxPC-3). Cell viability was measured by MTT assay, Hoechest33258 staining was used to detect the chromatin condensation characteristic of apoptosis, and DNA fragmentation was assessed by gel electrophoresis and cell cycle analysis by flow cytometry. Crocin induced apoptosis and G1-phase cell cycle arrest of BxPC-3 cells, while decreasing cell viability in a dose dependent and time dependent manner. Cells treated with 10μg/L crocin exhibited apoptotic morphology (brightly blue-fluorescent condensed nuclei on Hoechst 33258 staining) and reduction of volume. DNA analysis revealed typical ladders as early as 12 hours after treatment indicative of apoptosis. Our preclinical study demonstrated a pancreatic cancer cell line to be highly sensitive to crocin-mediated growth inhibition and apoptotic cell death. Although the molecular mechanisms of crocin action are not yet clearly understood, it appears to have potential as a therapeutic agent.

  12. High efficiency hydrodynamic DNA fragmentation in a bubbling system

    NARCIS (Netherlands)

    Li, Lanhui; Jin, Mingliang; Sun, Chenglong; Wang, Xiaoxue; Xie, Shuting; Zhou, Guofu; Van Den Berg, Albert; Eijkel, Jan C.T.; Shui, Lingling

    2017-01-01

    DNA fragmentation down to a precise fragment size is important for biomedical applications, disease determination, gene therapy and shotgun sequencing. In this work, a cheap, easy to operate and high efficiency DNA fragmentation method is demonstrated based on hydrodynamic shearing in a bubbling

  13. Accumulation of linear mitochondrial DNA fragments in the nucleus shortens the chronological life span of yeast.

    Science.gov (United States)

    Cheng, Xin; Ivessa, Andreas S

    2012-10-01

    Translocation of mitochondrial DNA (mtDNA) fragments to the nucleus and insertion of those fragments into nuclear DNA has been observed in several organisms ranging from yeast to plants and mammals. Disruption of specific nuclear genes by de novo insertions of mtDNA fragments has even been linked to the initiation of several human diseases. Recently, we demonstrated that baker's yeast strains with high rates of mtDNA fragments migrating to the nucleus (yme1-1 mutant) exhibit short chronological life spans (CLS). The yeast CLS is determined by the survival of non-dividing cell populations. Here, we show that lack of the non-homologous-end-joining enzyme DNA ligase IV (DNL4) can rescue the short CLS of the yme1-1 mutant. In fission yeast, DNA ligase IV has been shown to be required for the capture of mtDNA fragments during the repair of double-stranded DNA breaks in nuclear DNA. In further analyses using pulse field gel and 2D gel electrophoresis we demonstrate that linear mtDNA fragments with likely nuclear localization accumulate in the yme1-1 mutant. The accumulation of the linear mtDNA fragments in the yme1-1 mutant is suppressed when Dnl4 is absent. We propose that the linear nuclear mtDNA fragments accelerate the aging process in the yme1-1 mutant cells by possibly affecting nuclear processes including DNA replication, recombination, and repair as well as transcription of nuclear genes. We speculate further that Dnl4 protein has besides its function as a ligase also a role in DNA protection. Dnl4 protein may stabilize the linear mtDNA fragments in the nucleus by binding to their physical ends. In the absence of Dnl4 protein the linear fragments are therefore unprotected and possibly degraded by nuclear nucleases. Copyright © 2012 Elsevier GmbH. All rights reserved.

  14. Circulating levels of chromatin fragments are inversely correlated with anti-dsDNA antibody levels in human and murine systemic lupus erythematosus

    DEFF Research Database (Denmark)

    Jørgensen, Mariann H; Rekvig, Ole Petter; Jacobsen, Rasmus S

    2011-01-01

    Anti-dsDNA antibodies represent a central pathogenic factor in Lupus nephritis. Together with nucleosomes they deposit as immune complexes in the mesangial matrix and along basement membranes within the glomeruli. The origin of the nucleosomes and when they appear e.g. in circulation is not known...... an inverse correlation between anti-dsDNA antibodies and the DNA concentration in the circulation in both murine and human serum samples. High titer of anti-DNA antibodies in human sera correlated with reduced levels of circulating chromatin, and in lupus prone mice with deposition within glomeruli....... The inverse correlation between DNA concentration and anti-dsDNA antibodies may reflect antibody-dependent deposition of immune complexes during the development of lupus nephritis in autoimmune lupus prone mice. The measurement of circulating DNA in SLE sera by using qPCR may indicate and detect...

  15. Morphometric comparison by the ISAS® CASA-DNAf system of two techniques for the evaluation of DNA fragmentation in human spermatozoa.

    Science.gov (United States)

    Sadeghi, Sara; García-Molina, Almudena; Celma, Ferran; Valverde, Anthony; Fereidounfar, Sogol; Soler, Carles

    2016-01-01

    DNA fragmentation has been shown to be one of the causes of male infertility, particularly related to repeated abortions, and different methods have been developed to analyze it. In the present study, two commercial kits based on the SCD technique (Halosperm ® and SDFA) were evaluated by the use of the DNA fragmentation module of the ISAS ® v1 CASA system. Seven semen samples from volunteers were analyzed. To compare the results between techniques, the Kruskal-Wallis test was used. Data were used for calculation of Principal Components (two PCs were obtained), and subsequent subpopulations were identified using the Halo, Halo/Core Ratio, and PC data. Results from both kits were significantly different (P < 0.001). In each case, four subpopulations were obtained, independently of the classification method used. The distribution of subpopulations differed depending on the kit used. From the PC data, a discriminant analysis matrix was obtained and a good a posteriori classification was obtained (97.1% for Halosperm and 96.6% for SDFA). The present results are the first approach on morphometric evaluation of DNA fragmentation from the SCD technique. This approach could be used for the future definition of a classification matrix surpassing the current subjective evaluation of this important sperm factor.

  16. Morphometric comparison by the ISAS® CASA-DNAf system of two techniques for the evaluation of DNA fragmentation in human spermatozoa

    Directory of Open Access Journals (Sweden)

    Sara Sadeghi

    2016-01-01

    Full Text Available DNA fragmentation has been shown to be one of the causes of male infertility, particularly related to repeated abortions, and different methods have been developed to analyze it. In the present study, two commercial kits based on the SCD technique (Halosperm ® and SDFA were evaluated by the use of the DNA fragmentation module of the ISAS ® v1 CASA system. Seven semen samples from volunteers were analyzed. To compare the results between techniques, the Kruskal-Wallis test was used. Data were used for calculation of Principal Components (two PCs were obtained, and subsequent subpopulations were identified using the Halo, Halo/Core Ratio, and PC data. Results from both kits were significantly different (P < 0.001. In each case, four subpopulations were obtained, independently of the classification method used. The distribution of subpopulations differed depending on the kit used. From the PC data, a discriminant analysis matrix was obtained and a good a posteriori classification was obtained (97.1% for Halosperm and 96.6% for SDFA. The present results are the first approach on morphometric evaluation of DNA fragmentation from the SCD technique. This approach could be used for the future definition of a classification matrix surpassing the current subjective evaluation of this important sperm factor.

  17. Biochemical analyses indicate that binding and cleavage specificities define the ordered processing of human Okazaki fragments by Dna2 and FEN1.

    Science.gov (United States)

    Gloor, Jason W; Balakrishnan, Lata; Campbell, Judith L; Bambara, Robert A

    2012-08-01

    In eukaryotic Okazaki fragment processing, the RNA primer is displaced into a single-stranded flap prior to removal. Evidence suggests that some flaps become long before they are cleaved, and that this cleavage involves the sequential action of two nucleases. Strand displacement characteristics of the polymerase show that a short gap precedes the flap during synthesis. Using biochemical techniques, binding and cleavage assays presented here indicate that when the flap is ∼ 30 nt long the nuclease Dna2 can bind with high affinity to the flap and downstream double strand and begin cleavage. When the polymerase idles or dissociates the Dna2 can reorient for additional contacts with the upstream primer region, allowing the nuclease to remain stably bound as the flap is further shortened. The DNA can then equilibrate to a double flap that can bind Dna2 and flap endonuclease (FEN1) simultaneously. When Dna2 shortens the flap even more, FEN1 can displace the Dna2 and cleave at the flap base to make a nick for ligation.

  18. A mechanism of gene amplification driven by small DNA fragments.

    Directory of Open Access Journals (Sweden)

    Kuntal Mukherjee

    Full Text Available DNA amplification is a molecular process that increases the copy number of a chromosomal tract and often causes elevated expression of the amplified gene(s. Although gene amplification is frequently observed in cancer and other degenerative disorders, the molecular mechanisms involved in the process of DNA copy number increase remain largely unknown. We hypothesized that small DNA fragments could be the trigger of DNA amplification events. Following our findings that small fragments of DNA in the form of DNA oligonucleotides can be highly recombinogenic, we have developed a system in the yeast Saccharomyces cerevisiae to capture events of chromosomal DNA amplification initiated by small DNA fragments. Here we demonstrate that small DNAs can amplify a chromosomal region, generating either tandem duplications or acentric extrachromosomal DNA circles. Small fragment-driven DNA amplification (SFDA occurs with a frequency that increases with the length of homology between the small DNAs and the target chromosomal regions. SFDA events are triggered even by small single-stranded molecules with as little as 20-nt homology with the genomic target. A double-strand break (DSB external to the chromosomal amplicon region stimulates the amplification event up to a factor of 20 and favors formation of extrachromosomal circles. SFDA is dependent on Rad52 and Rad59, partially dependent on Rad1, Rad10, and Pol32, and independent of Rad51, suggesting a single-strand annealing mechanism. Our results reveal a novel molecular model for gene amplification, in which small DNA fragments drive DNA amplification and define the boundaries of the amplicon region. As DNA fragments are frequently found both inside cells and in the extracellular environment, such as the serum of patients with cancer or other degenerative disorders, we propose that SFDA may be a common mechanism for DNA amplification in cancer cells, as well as a more general cause of DNA copy number variation

  19. Fragmentation of DNA affects the accuracy of the DNA quantitation by the commonly used methods

    Directory of Open Access Journals (Sweden)

    Sedlackova Tatiana

    2013-02-01

    Full Text Available Abstract Background Specific applications and modern technologies, like non-invasive prenatal testing, non-invasive cancer diagnostic and next generation sequencing, are currently in the focus of researchers worldwide. These have common characteristics in use of highly fragmented DNA molecules for analysis. Hence, for the performance of molecular methods, DNA concentration is a crucial parameter; we compared the influence of different levels of DNA fragmentation on the accuracy of DNA concentration measurements. Results In our comparison, the performance of the currently most commonly used methods for DNA concentration measurement (spectrophotometric, fluorometric and qPCR based were tested on artificially fragmented DNA samples. In our comparison, unfragmented and three specifically fragmented DNA samples were used. According to our results, the level of fragmentation did not influence the accuracy of spectrophotometric measurements of DNA concentration, while other methods, fluorometric as well as qPCR-based, were significantly influenced and a decrease in measured concentration was observed with more intensive DNA fragmentation. Conclusions Our study has confirmed that the level of fragmentation of DNA has significant impact on accuracy of DNA concentration measurement with two of three mostly used methods (PicoGreen and qPCR. Only spectrophotometric measurement was not influenced by the level of fragmentation, but sensitivity of this method was lowest among the three tested. Therefore if it is possible the DNA quantification should be performed with use of equally fragmented control DNA.

  20. Homology of yeast photoreactivating gene fragment with human genomic digests

    International Nuclear Information System (INIS)

    Meechan, P.J.; Milam, K.M.; Cleaver, J.E.

    1984-01-01

    Enzymatic photoreactivation of UV-induced DNA lesions has been demonstrated for a variety of prokaryotic and eukaryotic organisms. Its presence in placental mammals, however, has not been clearly established. The authors attempted to resolve this question by assaying for the presence (or absence) of sequences in human DNA complimentary to a fragment of the photoreactivating gene from S. cerevisiae that has recently been cloned. In another study, DNA from human, chick E. coli and yeast cells was digested with either HindIII of BglII, electrophoresed on a 0.5% agarose gel, transferred (Southern blot) to a nylon membrane and probed for homology against a Sau3A restriction fragment from S. cerevisiae that compliments phr/sup -/ cells. Hybridization to human DNA digests was observed only under relatively non-stringent conditions indicating the gene is not conserved in placental mammals. These results are correlated with current literature data concerning photoreactivating enzymes

  1. Amplification of deoxyribonucleic acid (DNA) fragment using two ...

    African Journals Online (AJOL)

    user

    2011-04-11

    Apr 11, 2011 ... polymerases on this method, whether different lengths of. DNA fragments could be amplified by two-step PCR and the difference of DNA product quality produced by the two methods. MATERIALS AND METHODS. PCR template and reagents. Enterobacteria phage lambda DNA (GenBank no: V00636) ...

  2. Lower sperm DNA fragmentation after r-FSH administration in functional hypogonadotropic hypogonadism.

    Science.gov (United States)

    Ruvolo, Giovanni; Roccheri, Maria Carmela; Brucculeri, Anna Maria; Longobardi, Salvatore; Cittadini, Ettore; Bosco, Liana

    2013-04-01

    An observational clinical and molecular study was designed to evaluate the effects of the administration of recombinant human FSH on sperm DNA fragmentation in men with a non-classical form of hypogonadotropic hypogonadism and idiopathic oligoasthenoteratozoospermia. In the study were included 53 men with a non-classical form of hypogonadotropic hypogonadism and idiopathic oligoasthenoteratozoospermia. In all patients, sperm DNA fragmentation index (DFI), assessed by terminal deoxynucleotidyl transferase-mediated deoxyuridine triphosphate (dUTP) in situ DNA nick end-labelling (TUNEL) assay, was evaluated before starting the treatment with 150 IU of recombinant human FSH, given three times a week for at least 3 months. Patients' semen analysis and DNA fragmentation index were re-evaluated after the 3-month treatment period. After recombinant human FSH therapy, we did not find any differences in terms of sperm count, motility and morphology. The average DNA fragmentation index was significantly reduced (21.15 vs 15.2, p15 %), while no significant variation occurred in the patients with DFI values ≤ 15 %. Recombinant human FSH administration improves sperm DNA integrity in hypogonadotropic hypogonadism and idiopathic oligoasthenoteratozoospermia men with DNA fragmentation index value >15 % .

  3. Linkage map of the fragments of herpesvirus papio DNA.

    Science.gov (United States)

    Lee, Y S; Tanaka, A; Lau, R Y; Nonoyama, M; Rabin, H

    1981-01-01

    Herpesvirus papio (HVP), an Epstein-Barr-like virus, causes lymphoblastoid disease in baboons. The physical map of HVP DNA was constructed for the fragments produced by cleavage of HVP DNA with restriction endonucleases EcoRI, HindIII, SalI, and PvuI, which produced 12, 12, 10, and 4 fragments, respectively. The total molecular size of HVP DNA was calculated as close to 110 megadaltons. The following methods were used for construction of the map; (i) fragments near the ends of HVP DNA were identified by treating viral DNA with lambda exonuclease before restriction enzyme digestion; (ii) fragments containing nucleotide sequences in common with fragments from the second enzyme digest of HVP DNA were examined by Southern blot hybridization; and (iii) the location of some fragments was determined by isolating individual fragments from agarose gels and redigesting the isolated fragments with a second restriction enzyme. Terminal heterogeneity and internal repeats were found to be unique features of HVP DNA molecule. One to five repeats of 0.8 megadaltons were found at both terminal ends. Although the repeats of both ends shared a certain degree of homology, it was not determined whether they were identical repeats. The internal repeat sequence of HVP DNA was found in the EcoRI-C region, which extended from 8.4 to 23 megadaltons from the left end of the molecule. The average number of the repeats was calculated to be seven, and the molecular size was determined to be 1.8 megadaltons. Similar unique features have been reported in EBV DNA (D. Given and E. Kieff, J. Virol. 28:524-542, 1978). Images PMID:6261015

  4. Bacterial natural transformation by highly fragmented and damaged DNA

    DEFF Research Database (Denmark)

    Overballe-Petersen, Søren; Harms, Klaus; Orlando, Ludovic Antoine Alexandre

    2013-01-01

    for microbes, but not as potential substrate for bacterial evolution. Here, we show that fragmented DNA molecules (≥20 bp) that additionally may contain abasic sites, cross-links, or miscoding lesions are acquired by the environmental bacterium Acinetobacter baylyi through natural transformation. With uptake......DNA molecules are continuously released through decomposition of organic matter and are ubiquitous in most environments. Such DNA becomes fragmented and damaged (often DNA is recognized as nutrient source...... of DNA from a 43,000-y-old woolly mammoth bone, we further demonstrate that such natural transformation events include ancient DNA molecules. We find that the DNA recombination is RecA recombinase independent and is directly linked to DNA replication. We show that the adjacent nucleotide variations...

  5. (PCR) for direct cloning of blunt-end DNA fragments

    African Journals Online (AJOL)

    Administrator

    2011-09-19

    Sep 19, 2011 ... Key words: Blunt-end cloning, phosphorylated DNA fragment, dephosphorylated blunt-end vector. INTRODUCTION ... With this method, a lot of steps are saved, which includes restriction .... pBSK-blunt (data not shown).

  6. Sperm DNA fragmentation, recurrent implantation failure and recurrent miscarriage

    Directory of Open Access Journals (Sweden)

    Carol Coughlan

    2015-01-01

    Full Text Available Evidence is increasing that the integrity of sperm DNA may also be related to implantation failure and recurrent miscarriage (RM. To investigate this, the sperm DNA fragmentation in partners of 35 women with recurrent implantation failure (RIF following in vitro fertilization, 16 women diagnosed with RM and seven recent fathers (control were examined. Sperm were examined pre- and post-density centrifugation by the sperm chromatin dispersion (SCD test and the terminal deoxynucleotidyl transferase dUTP nick end labeling (TUNEL assay. There were no significant differences in the age of either partner or sperm concentration, motility or morphology between three groups. Moreover, there were no obvious differences in sperm DNA fragmentation measured by either test. However, whilst on average sperm DNA fragmentation in all groups was statistically lower in prepared sperm when measured by the SCD test, this was not seen with the results from the TUNEL assay. These results do not support the hypothesis that sperm DNA fragmentation is an important cause of RIF or RM, or that sperm DNA integrity testing has value in such patients. It also highlights significant differences between test methodologies and sperm preparation methods in interpreting the data from sperm DNA fragmentation tests.

  7. Electronic transport in methylated fragments of DNA

    International Nuclear Information System (INIS)

    Almeida, M. L. de; Oliveira, J. I. N.; Lima Neto, J. X.; Gomes, C. E. M.; Fulco, U. L.; Albuquerque, E. L.; Freire, V. N.; Caetano, E. W. S.; Moura, F. A. B. F. de; Lyra, M. L.

    2015-01-01

    We investigate the electronic transport properties of methylated deoxyribonucleic-acid (DNA) strands, a biological system in which methyl groups are added to DNA (a major epigenetic modification in gene expression), sandwiched between two metallic platinum electrodes. Our theoretical simulations apply an effective Hamiltonian based on a tight-binding model to obtain current-voltage curves related to the non-methylated/methylated DNA strands. The results suggest potential applications in the development of novel biosensors for molecular diagnostics

  8. Electronic transport in methylated fragments of DNA

    Energy Technology Data Exchange (ETDEWEB)

    Almeida, M. L. de; Oliveira, J. I. N.; Lima Neto, J. X.; Gomes, C. E. M.; Fulco, U. L., E-mail: umbertofulco@gmail.com; Albuquerque, E. L. [Departamento de Biofísica e Farmacologia, Universidade Federal do Rio Grande do Norte, 59072-970 Natal-RN (Brazil); Freire, V. N. [Departamento de Física, Universidade Federal do Ceará, 60455-760 Fortaleza, CE (Brazil); Caetano, E. W. S. [Instituto Federal de Educação, Ciência e Tecnologia do Ceará, 60040-531 Fortaleza, CE (Brazil); Moura, F. A. B. F. de; Lyra, M. L. [Instituto de Física, Universidade Federal de Alagoas, 57072-900 Maceió-AL (Brazil)

    2015-11-16

    We investigate the electronic transport properties of methylated deoxyribonucleic-acid (DNA) strands, a biological system in which methyl groups are added to DNA (a major epigenetic modification in gene expression), sandwiched between two metallic platinum electrodes. Our theoretical simulations apply an effective Hamiltonian based on a tight-binding model to obtain current-voltage curves related to the non-methylated/methylated DNA strands. The results suggest potential applications in the development of novel biosensors for molecular diagnostics.

  9. Agarose gel electrophoresis for the separation of DNA fragments.

    Science.gov (United States)

    Lee, Pei Yun; Costumbrado, John; Hsu, Chih-Yuan; Kim, Yong Hoon

    2012-04-20

    Agarose gel electrophoresis is the most effective way of separating DNA fragments of varying sizes ranging from 100 bp to 25 kb(1). Agarose is isolated from the seaweed genera Gelidium and Gracilaria, and consists of repeated agarobiose (L- and D-galactose) subunits(2). During gelation, agarose polymers associate non-covalently and form a network of bundles whose pore sizes determine a gel's molecular sieving properties. The use of agarose gel electrophoresis revolutionized the separation of DNA. Prior to the adoption of agarose gels, DNA was primarily separated using sucrose density gradient centrifugation, which only provided an approximation of size. To separate DNA using agarose gel electrophoresis, the DNA is loaded into pre-cast wells in the gel and a current applied. The phosphate backbone of the DNA (and RNA) molecule is negatively charged, therefore when placed in an electric field, DNA fragments will migrate to the positively charged anode. Because DNA has a uniform mass/charge ratio, DNA molecules are separated by size within an agarose gel in a pattern such that the distance traveled is inversely proportional to the log of its molecular weight(3). The leading model for DNA movement through an agarose gel is "biased reptation", whereby the leading edge moves forward and pulls the rest of the molecule along(4). The rate of migration of a DNA molecule through a gel is determined by the following: 1) size of DNA molecule; 2) agarose concentration; 3) DNA conformation(5); 4) voltage applied, 5) presence of ethidium bromide, 6) type of agarose and 7) electrophoresis buffer. After separation, the DNA molecules can be visualized under uv light after staining with an appropriate dye. By following this protocol, students should be able to: Understand the mechanism by which DNA fragments are separated within a gel matrix Understand how conformation of the DNA molecule will determine its mobility through a gel matrix Identify an agarose solution of appropriate

  10. High Efficiency Hydrodynamic DNA Fragmentation in a Bubbling System.

    Science.gov (United States)

    Li, Lanhui; Jin, Mingliang; Sun, Chenglong; Wang, Xiaoxue; Xie, Shuting; Zhou, Guofu; van den Berg, Albert; Eijkel, Jan C T; Shui, Lingling

    2017-01-18

    DNA fragmentation down to a precise fragment size is important for biomedical applications, disease determination, gene therapy and shotgun sequencing. In this work, a cheap, easy to operate and high efficiency DNA fragmentation method is demonstrated based on hydrodynamic shearing in a bubbling system. We expect that hydrodynamic forces generated during the bubbling process shear the DNA molecules, extending and breaking them at the points where shearing forces are larger than the strength of the phosphate backbone. Factors of applied pressure, bubbling time and temperature have been investigated. Genomic DNA could be fragmented down to controllable 1-10 Kbp fragment lengths with a yield of 75.30-91.60%. We demonstrate that the ends of the genomic DNAs generated from hydrodynamic shearing can be ligated by T4 ligase and the fragmented DNAs can be used as templates for polymerase chain reaction. Therefore, in the bubbling system, DNAs could be hydrodynamically sheared to achieve smaller pieces in dsDNAs available for further processes. It could potentially serve as a DNA sample pretreatment technique in the future.

  11. In-gel multiple displacement amplification of long DNA fragments diluted to the single molecule level.

    Science.gov (United States)

    Michikawa, Yuichi; Sugahara, Keisuke; Suga, Tomo; Ohtsuka, Yoshimi; Ishikawa, Kenichi; Ishikawa, Atsuko; Shiomi, Naoko; Shiomi, Tadahiro; Iwakawa, Mayumi; Imai, Takashi

    2008-12-15

    The isolation and multiple genotyping of long individual DNA fragments are needed to obtain haplotype information for diploid organisms. Limiting dilution of sample DNA followed by multiple displacement amplification is a useful technique but is restricted to short (reaction (PCR)-ready form. The haplotypes of seven SNPs spanning 240 kb of the DNA surrounding the human ATM gene region on chromosome 11 were determined for 10 individuals, demonstrating the feasibility of this new method.

  12. DNA fragments assembly based on nicking enzyme system.

    Directory of Open Access Journals (Sweden)

    Rui-Yan Wang

    Full Text Available A couple of DNA ligation-independent cloning (LIC methods have been reported to meet various requirements in metabolic engineering and synthetic biology. The principle of LIC is the assembly of multiple overlapping DNA fragments by single-stranded (ss DNA overlaps annealing. Here we present a method to generate single-stranded DNA overlaps based on Nicking Endonucleases (NEases for LIC, the method was termed NE-LIC. Factors related to cloning efficiency were optimized in this study. This NE-LIC allows generating 3'-end or 5'-end ss DNA overlaps of various lengths for fragments assembly. We demonstrated that the 10 bp/15 bp overlaps had the highest DNA fragments assembling efficiency, while 5 bp/10 bp overlaps showed the highest efficiency when T4 DNA ligase was added. Its advantage over Sequence and Ligation Independent Cloning (SLIC and Uracil-Specific Excision Reagent (USER was obvious. The mechanism can be applied to many other LIC strategies. Finally, the NEases based LIC (NE-LIC was successfully applied to assemble a pathway of six gene fragments responsible for synthesizing microbial poly-3-hydroxybutyrate (PHB.

  13. Real-time Tracking of DNA Fragment Separation by Smartphone.

    Science.gov (United States)

    Tao, Chunxian; Yang, Bo; Li, Zhenqing; Zhang, Dawei; Yamaguchi, Yoshinori

    2017-06-01

    Slab gel electrophoresis (SGE) is the most common method for the separation of DNA fragments; thus, it is broadly applied to the field of biology and others. However, the traditional SGE protocol is quite tedious, and the experiment takes a long time. Moreover, the chemical consumption in SGE experiments is very high. This work proposes a simple method for the separation of DNA fragments based on an SGE chip. The chip is made by an engraving machine. Two plastic sheets are used for the excitation and emission wavelengths of the optical signal. The fluorescence signal of the DNA bands is collected by smartphone. To validate this method, 50, 100, and 1,000 bp DNA ladders were separated. The results demonstrate that a DNA ladder smaller than 5,000 bp can be resolved within 12 min and with high resolution when using this method, indicating that it is an ideal substitute for the traditional SGE method.

  14. Melatonin sensitizes human cervical cancer HeLa cells to cisplatin-induced cytotoxicity and apoptosis: effects on oxidative stress and DNA fragmentation.

    Science.gov (United States)

    Pariente, Roberto; Pariente, José A; Rodríguez, Ana B; Espino, Javier

    2016-01-01

    Melatonin has antitumor activity via several mechanisms including its antiproliferative and pro-apoptotic effects as well as its potent antioxidant actions, although recent evidence has indicated that melatonin may perform pro-oxidant actions in tumor cells. Therefore, melatonin may be useful in the treatment of tumors in association with chemotherapy drugs. This study was intended to evaluate the in vitro effect of melatonin on the cytotoxic and pro-apoptotic actions of various chemotherapeutic agents in cervical cancer HeLa cells. Herein, we found that both melatonin and three of the chemotherapeutic drugs tested, namely cisplatin (CIS), 5-fluorouracil (5-FU), and doxorubicin, induced a decrease in HeLa cell viability. Furthermore, melatonin significantly increased the cytotoxic effect of such chemotherapeutic agents. Consistently, costimulation of HeLa cells with any chemotherapeutic agent in the presence of melatonin further increased caspase-3 activation, particularly in CIS- and 5-FU-challenged cells. Likewise, concomitant treatments with melatonin and CIS significantly enhanced the ratio of cells entering mitochondrial apoptosis due to reactive oxygen species (ROS) overproduction, substantially augmented the population of apoptotic cells, and markedly enlarged DNA fragmentation compared to the treatments with CIS alone. Nonetheless, melatonin only displayed moderate chemosensitizing effects in 5-FU-stimulated HeLa cells, as suggested by slight increments in the percentage of cells stimulated for ROS production and in the proportion of early apoptotic cells compared to the treatments with 5-FU alone. In summary, our findings provided evidence that in vitro melatonin strongly enhances CIS-induced cytotoxicity and apoptosis in HeLa cells and, hence, the indoleamine could be potentially applied to cervical cancer treatment as a powerful synergistic agent. © 2015 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.

  15. DNA Length Modulates the Affinity of Fragments of Genomic DNA for the Nuclear Matrix In Vitro.

    Science.gov (United States)

    García-Vilchis, David; Aranda-Anzaldo, Armando

    2017-12-01

    Classical observations have shown that during the interphase the chromosomal DNA of metazoans is organized in supercoiled loops attached to a compartment known as the nuclear matrix (NM). Fragments of chromosomal DNA able to bind the isolated NM in vitro are known as matrix associated/attachment/addressed regions or MARs. No specific consensus sequence or motif has been found that may constitute a universal, defining feature of MARs. On the other hand, high-salt resistant DNA-NM interactions in situ define true DNA loop anchorage regions or LARs, that might correspond to a subset of the potential MARs but are not necessarily identical to MARs characterized in vitro, since there are several examples of MARs able to bind the NM in vitro but which are not actually bound to the NM in situ. In the present work we assayed the capacity of two LARs, as well as of shorter fragments within such LARs, for binding to the NM in vitro. Paradoxically the isolated (≈2 kb) LARs cannot bind to the NM in vitro while their shorter (≈300 pb) sub-fragments and other non-related but equally short DNA fragments, bind to the NM in a high-salt resistant fashion. Our results suggest that the ability of a given DNA fragment for binding to the NM in vitro primarily depends on the length of the fragment, suggesting that binding to the NM is modulated by the local topology of the DNA fragment in suspension that it is known to depend on the DNA length. J. Cell. Biochem. 118: 4487-4497, 2017. © 2017 Wiley Periodicals, Inc. © 2017 Wiley Periodicals, Inc.

  16. Fragmentation of sperm DNA using the TUNEL method.

    Science.gov (United States)

    Chenlo, P H; Curi, S M; Pugliese, M N; Ariagno, J I; Sardi-Segovia, M; Furlan, M J; Repetto, H E; Zeitler, E; Cohen, M; Mendeluk, G R

    2014-11-01

    To establish the validity of the TUNEL assay in determining sperm DNA fragmentation, the relationship between the degree of fragmentation and the seminal parameters and the sample needed to conduct the test. We used semen samples from healthy fertile men (n=33), patients who consulted for infertility with a prescription for the TUNEL assay (n=77) and patients with intracytoplasmic sperm injection failure (n=20), analyzed according to the 2010 WHO. The TUNEL/propidium iodide test was performed by flow cytometry, on baseline and post-swim-up samples. The cutoff value for the TUNEL assay (ROC curves) was 26%, with a sensitivity and specificity of 85% and 89%, respectively. The pre-swim-up and post-swim-up medians of the results from the TUNEL assay showed no significant differences (17.0% vs. 12.9%, respectively). However, 39.1% of the samples showed a difference greater than 15 in absolute value between the results of the baseline and post-swim-up TUNEL assays. The linear correlation study of the morphology, mobility and vitality using the post-swim-up TUNEL assay showed a greater correlation than preselection, with significant results (r: -0.394, P<.0001; r: -0.461, P<.0001; r: -0.526, P<.0001). The TUNEL assay is a valid test for clinical use. DNA fragmentation is a factor independent from traditional semen tests. We found a greater susceptibility to damage generated in the laboratory procedures in the samples with lower quality. The sample of choice for evaluating DNA fragmentation will depend on whether the clinician is treating a natural or assisted fertilization. Copyright © 2014 AEU. Published by Elsevier Espana. All rights reserved.

  17. Ionization and fragmentation of DNA-RNA bases: a density functional theory study

    International Nuclear Information System (INIS)

    Sadr-Arani, Leila

    2014-01-01

    Ionizing radiation (IR) cross human tissue, deposit energy and dissipate fragmenting molecules. The resulting fragments may be highlighted by mass spectrometry. Despite the amount of information obtained experimentally by the interpretation of the mass spectrum, experience alone cannot answer all the questions of the mechanism of fragmentation of DNA/RNA bases and a theoretical study is a complement to this information. A theoretical study allows us to know the weakest bonds in the molecule during ionization and thus may help to provide mechanisms of dissociation and produced fragments. The purpose of this work, using the DFT with the PBE functional, is to study the ionization and fragmentation mechanisms of DNA/RNA bases (Uracil, Cytosine, Adenine and Guanine) and to identify the cations corresponding to each peak in mass spectra. For all RNA bases, the retro Diels-Alder reaction (elimination of HNCO or NCO*) is a major route for dissociating, with the exception of adenine for which there is no atom oxygen in its structure. Loss of NH 3 (NH 2 *) molecule is another common way to all bases that contain amine group. The possibility of the loss of hydrogen from the cations is also investigated, as well as the dissociation of dehydrogenated cations and protonated uracil. This work shows the interest of providing DFT calculation in the interpretation of mass spectra of DNA bases. (author)

  18. Nondetectability of restriction fragments and independence of DNA fragment sizes within and between loci in RFLP typing of DNA

    Energy Technology Data Exchange (ETDEWEB)

    Chakraborty, R.; Zhong, Y.; Jin, L. (Univ. of Texas Health Science Center, Houston, TX (United States)); Budowle, B. (FBI Academy, Quantico, VA (United States))

    1994-08-01

    The authors provide experimental evidence showing that, during the restriction-enzyme digestion of DNA samples, some of the HaeIII-digested DNA fragments are small enough to prevent their reliable sizing on a Southern gel. As a result of such nondetectability of DNA fragments, individuals who show a single-band DNA profile at a VNTR locus may not necessarily be true homozygotes. In a population database, when the presence of such nondetectable alleles is ignored, they show that a pseudodependence of alleles within as well as across loci may occur. Using a known statistical method, under the hypothesis of independence of alleles within loci, they derive an efficient estimate of null allele frequency, which may be subsequently used for testing allelic independence within and across loci. The estimates of null allele frequencies, thus derived, are shown to agree with direct experimental data on the frequencies of HaeIII-null alleles. Incorporation of null alleles into the analysis of the forensic VNTR database suggests that the assumptions of allelic independence within and between loci are appropriate. In contrast, a failure to incorporate the occurrence of null alleles would provide a wrong inference regarding the independence of alleles within and between loci. 47 refs., 2 figs., 4 tabs.

  19. PCR typing of DNA fragments of the two short tandem repeat (STR) systems upstream of the human myelin basic protein (MBP) gene in Danes and Greenland Eskimos

    DEFF Research Database (Denmark)

    Nellemann, L J; Frederiksen, J; Morling, N

    1996-01-01

    -A and MBP-B were analyzed by vertical electrophoresis in polyacrylamide gels followed by silver staining. DNA samples from 112 unrelated Danes, 140 unrelated Greenland Eskimos, and 88 Danish mother/child pairs were analyzed. The distributions of MBP phenotypes were in Hardy-Weinberg equilibrium in both...

  20. Circulating levels of chromatin fragments are inversely correlated with anti-dsDNA antibody levels in human and murine systemic lupus erythematosus

    DEFF Research Database (Denmark)

    Jørgensen, Mariann H; Rekvig, Ole Petter; Jacobsen, Rasmus S

    2011-01-01

    Anti-dsDNA antibodies represent a central pathogenic factor in Lupus nephritis. Together with nucleosomes they deposit as immune complexes in the mesangial matrix and along basement membranes within the glomeruli. The origin of the nucleosomes and when they appear e.g. in circulation is not known...

  1. Environmental toxicants cause sperm DNA fragmentation as detected by the Sperm Chromatin Structure Assay (SCSA[reg])

    International Nuclear Information System (INIS)

    Evenson, Donald P.; Wixon, Regina

    2005-01-01

    Studies over the past two decades have clearly shown that reproductive toxicants cause sperm DNA fragmentation. This DNA fragmentation can usually be detected prior to observing alterations of metaphase chromosomes in embryos. Thus, Sperm Chromatin Structure Assay (SCSA)-detected DNA damage is viewed as the molecular precursor to later gross chromosome damage observed under the light microscope. SCSA measurements of animal or human sperm consist of first obtaining a fresh or flash frozen neat semen sample in LN2 or dry ice. Samples are then sent to a SCSA diagnostic laboratory where the samples are thawed, diluted to ∼1-2 x 106 sperm/ml, treated for 30 s with a pH 1.2 detergent buffer and then stained with acridine orange (AO). The low pH partially denatures DNA at the sites of DNA strand breaks and the AO-ssDNA fluoresces red while the AO-dsDNA fluoresces green. Flow cytometry measurements of 5000 sperm/sample provide statistically robust data on the ratio of red to green sperm, the extent of the DNA fragmentation and the standard deviations of measures. Numerous experiments on rodents treated with reproductive toxicants clearly showed that SCSA measures are highly dose responsive and have a very low CV. Different agents that act on germ cells at various stages of development usually showed sperm DNA fragmentation when that germ cell fraction arrived in the epididymis or ejaculate. Some of these treated samples were capable of successful in vitro fertilization but with frequent embryo failure. A 2-year longitudinal study of men living a valley town with a reported abnormal level of infertility and spontaneous miscarriages and also a seasonal atmospheric smog pollution, showed, for the first time, that SCSA measurements of human sperm DNA fragmentation were detectable and correlated with dosage of air pollution while the classical semen measures were not correlated. Also, young men spraying pesticides without protective gear are at an increased risk for elevated

  2. Effect of superoxide dismutase supplementation on sperm DNA fragmentation

    Directory of Open Access Journals (Sweden)

    Luciano Negri

    2017-10-01

    Full Text Available Background: antioxidants supplementation improves sperm quality, but few trials have analyzed the effects on sperm DNA fragmentation (SDF. This study compares the effectiveness of SOD-based antioxidant supplementation plus hydroxytyrosol and carnosol in reducing SDF with other antioxidants without SOD, hydroxytyrosol, and carnosol. Materials and methods: men with high SDF at baseline were selected in our clinical database. The patients taken into account had a 2-month control. SDF was measured by Sperm Chromatin Dispersion test (SCD. Untreated men were used as a control group. The remaining subjects received some oral antioxidant supplements (12 different combinations of both hydrophilic and lipophilic antioxidants, with some of them receiving nutritional support with a SOD-based antioxidant supplementation plus hydroxytyrosol and carnosol. Results: 118 men were selected for a retrospective study. Mean age 39.3 ± 5.4 years. Fifteen had no treatment, 55 were treated with a SOD-based antioxidant supplementation plus hydroxytyrosol and carnosol, and 48 took some antioxidant supplements for 2 months. Clinically, variations of at least 10% in baseline values of classic semen parameters and sperm DNA fragmentation were taken into consideration. Classic seminal parameters did not vary significantly in the three groups, with the exception of viability (p = 0.001. We assessed which of the active substances (no. 19 in different formulations were associated with variations in SDF. In the multivariable analysis of the 7 active substances that passed the univariable analysis, only the SOD molecule appeared to be linked to an improvement in SDF (< 0.0001. In detail, only one patient in the control group showed a spontaneous improvement in SDF (6%, compared to 16/48 (33% of those taking various oral antioxidant supplements, and 31/55 (56% of those taking a SOD-based antioxidant supplementation plus hydroxytyrosol and carnosol. Conclusions: SOD

  3. A systematic review on sperm DNA fragmentation in male factor infertility: Laboratory assessment

    Directory of Open Access Journals (Sweden)

    Manesh Kumar Panner Selvam

    2018-03-01

    Full Text Available Objective: To review sperm DNA fragmentation (SDF testing as an important sperm function test in addition to conventional semen analysis. High SDF is negatively associated with semen quality, the fertilisation process, embryo quality, and pregnancy outcome. Over recent decades, different SDF assays have been developed and reviewed extensively to assess their applicability and accuracy as advanced sperm function tests. Amongst them, the standardisation of the terminal deoxynucleotidyl transferased UTP nick-end labelling (TUNEL assay with a bench top flow cytometer in clinical practice deserves special mention with a threshold value of 16.8% to differentiate infertile men with DNA damage from fertile men. Materials and methods: A systematic literature search was performed through the PubMed, Medline, and ScienceDirect databases using the keywords ‘sperm DNA fragmentation’ and ‘laboratory assessment’. Non-English articles were excluded and studies related to humans were only included. Results: Of the 618 identified, 87 studies (original research and reviews and in addition eight book chapters meeting the selection criteria were included in this review. In all, 366 articles were rejected in the preliminary screening and a further 165 articles related to non-human subjects were excluded. Conclusion: There are pros and cons to all the available SDF assays. TUNEL is a reliable technique with greater accuracy and as an additional diagnostic test in Andrology laboratories along with basic semen analysis can predict fertility outcome, and thus direct the choice of an assisted reproductive technology procedure for infertile couples. Also, the TUNEL assay can be used as a prognostic test and results are beneficial in deciding personalised treatment for infertile men. Keywords: Sperm DNA fragmentation (SDF, Terminal deoxynucleotidyl transferased UTP nick-end labelling (TUNEL, DNA damage, Sperm DNA fragmentation (SDF assay

  4. Human Genome Research: Decoding DNA

    Science.gov (United States)

    dropdown arrow Site Map A-Z Index Menu Synopsis Human Genome Research: Decoding DNA Resources with of the DNA double helix during April 2003. James D. Watson, Francis Crick, and Maurice Wilkins were company Celera announced the completion of a "working draft" reference DNA sequence of the human

  5. Subacute Low Dose Nerve Agent Exposure Causes DNA Fragmentation in Guinea Pig Leukocytes

    Science.gov (United States)

    2005-10-01

    1 SUBACUTE LOW DOSE NERVE AGENT EXPOSURE CAUSES DNA FRAGMENTATION IN GUINEA PIG LEUKOCYTES. Jitendra R. Dave1, John R. Moffett1, Sally M...DNA fragmentation in blood leukocytes from guinea pigs by ‘Comet’ assay after exposure to soman at doses ranging from 0.1LD50 to 0.4 LD50, once per...computer. Data obtained for exposure to soman demonstrated significant increases in DNA fragmentation in circulating leukocytes in CWNA treated guinea pigs as

  6. Xanthorrhizol induced DNA fragmentation in HepG2 cells involving Bcl-2 family proteins

    Energy Technology Data Exchange (ETDEWEB)

    Tee, Thiam-Tsui, E-mail: thiamtsu@yahoo.com [School of Biosciences and Biotechnology, Faculty of Science and Technology, Universiti Kebangsaan Malaysia, 43600 Bangi, Selangor (Malaysia); Cheah, Yew-Hoong [School of Biosciences and Biotechnology, Faculty of Science and Technology, Universiti Kebangsaan Malaysia, 43600 Bangi, Selangor (Malaysia); Bioassay Unit, Herbal Medicine Research Center, Institute for Medical Research, Jalan Pahang, Kuala Lumpur (Malaysia); Meenakshii, Nallappan [Biology Department, Faculty of Science, Universiti Putra Malaysia, 43400 Serdang, Selangor (Malaysia); Mohd Sharom, Mohd Yusof; Azimahtol Hawariah, Lope Pihie [School of Biosciences and Biotechnology, Faculty of Science and Technology, Universiti Kebangsaan Malaysia, 43600 Bangi, Selangor (Malaysia)

    2012-04-20

    Highlights: Black-Right-Pointing-Pointer We isolated xanthorrhizol, a sesquiterpenoid compound from Curcuma xanthorrhiza. Black-Right-Pointing-Pointer Xanthorrhizol induced apoptosis in HepG2 cells as observed using SEM. Black-Right-Pointing-Pointer Apoptosis in xanthorrhizol-treated HepG2 cells involved Bcl-2 family proteins. Black-Right-Pointing-Pointer DNA fragmentation was observed in xanthorrhizol-treated HepG2 cells. Black-Right-Pointing-Pointer DNA fragmentation maybe due to cleavage of PARP and DFF45/ICAD proteins. -- Abstract: Xanthorrhizol is a plant-derived pharmacologically active sesquiterpenoid compound isolated from Curcuma xanthorrhiza. Previously, we have reported that xanthorrhizol inhibited the proliferation of HepG2 human hepatoma cells by inducing apoptotic cell death via caspase activation. Here, we attempt to further elucidate the mode of action of xanthorrhizol. Apoptosis in xanthorrhizol-treated HepG2 cells as observed by scanning electron microscopy was accompanied by truncation of BID; reduction of both anti-apoptotic Bcl-2 and Bcl-X{sub L} expression; cleavage of PARP and DFF45/ICAD proteins and DNA fragmentation. Taken together, these results suggest xanthorrhizol as a potent antiproliferative agent on HepG2 cells by inducing apoptosis via Bcl-2 family members. Hence we proposed that xanthorrhizol could be used as an anti-liver cancer drug for future studies.

  7. Xanthorrhizol induced DNA fragmentation in HepG2 cells involving Bcl-2 family proteins

    International Nuclear Information System (INIS)

    Tee, Thiam-Tsui; Cheah, Yew-Hoong; Meenakshii, Nallappan; Mohd Sharom, Mohd Yusof; Azimahtol Hawariah, Lope Pihie

    2012-01-01

    Highlights: ► We isolated xanthorrhizol, a sesquiterpenoid compound from Curcuma xanthorrhiza. ► Xanthorrhizol induced apoptosis in HepG2 cells as observed using SEM. ► Apoptosis in xanthorrhizol-treated HepG2 cells involved Bcl-2 family proteins. ► DNA fragmentation was observed in xanthorrhizol-treated HepG2 cells. ► DNA fragmentation maybe due to cleavage of PARP and DFF45/ICAD proteins. -- Abstract: Xanthorrhizol is a plant-derived pharmacologically active sesquiterpenoid compound isolated from Curcuma xanthorrhiza. Previously, we have reported that xanthorrhizol inhibited the proliferation of HepG2 human hepatoma cells by inducing apoptotic cell death via caspase activation. Here, we attempt to further elucidate the mode of action of xanthorrhizol. Apoptosis in xanthorrhizol-treated HepG2 cells as observed by scanning electron microscopy was accompanied by truncation of BID; reduction of both anti-apoptotic Bcl-2 and Bcl-X L expression; cleavage of PARP and DFF45/ICAD proteins and DNA fragmentation. Taken together, these results suggest xanthorrhizol as a potent antiproliferative agent on HepG2 cells by inducing apoptosis via Bcl-2 family members. Hence we proposed that xanthorrhizol could be used as an anti-liver cancer drug for future studies.

  8. Toward The Reconstitution of the Maturation of Okazaki Fragments Multiprotein Complex in Human At The Single Molecule Level

    KAUST Repository

    Joudeh, Luay

    2017-01-01

    The maturation of Okazaki fragments on the lagging strand in eukaryotes is mediated by a highly coordinated multistep process involving several proteins that ensure the accurate and efficient replication of genomic DNA. Human proliferating cell

  9. qPCR-based mitochondrial DNA quantification: Influence of template DNA fragmentation on accuracy

    International Nuclear Information System (INIS)

    Jackson, Christopher B.; Gallati, Sabina; Schaller, André

    2012-01-01

    Highlights: ► Serial qPCR accurately determines fragmentation state of any given DNA sample. ► Serial qPCR demonstrates different preservation of the nuclear and mitochondrial genome. ► Serial qPCR provides a diagnostic tool to validate the integrity of bioptic material. ► Serial qPCR excludes degradation-induced erroneous quantification. -- Abstract: Real-time PCR (qPCR) is the method of choice for quantification of mitochondrial DNA (mtDNA) by relative comparison of a nuclear to a mitochondrial locus. Quantitative abnormal mtDNA content is indicative of mitochondrial disorders and mostly confines in a tissue-specific manner. Thus handling of degradation-prone bioptic material is inevitable. We established a serial qPCR assay based on increasing amplicon size to measure degradation status of any DNA sample. Using this approach we can exclude erroneous mtDNA quantification due to degraded samples (e.g. long post-exicision time, autolytic processus, freeze–thaw cycles) and ensure abnormal DNA content measurements (e.g. depletion) in non-degraded patient material. By preparation of degraded DNA under controlled conditions using sonification and DNaseI digestion we show that erroneous quantification is due to the different preservation qualities of the nuclear and the mitochondrial genome. This disparate degradation of the two genomes results in over- or underestimation of mtDNA copy number in degraded samples. Moreover, as analysis of defined archival tissue would allow to precise the molecular pathomechanism of mitochondrial disorders presenting with abnormal mtDNA content, we compared fresh frozen (FF) with formalin-fixed paraffin-embedded (FFPE) skeletal muscle tissue of the same sample. By extrapolation of measured decay constants for nuclear DNA (λ nDNA ) and mtDNA (λ mtDNA ) we present an approach to possibly correct measurements in degraded samples in the future. To our knowledge this is the first time different degradation impact of the two

  10. qPCR-based mitochondrial DNA quantification: Influence of template DNA fragmentation on accuracy

    Energy Technology Data Exchange (ETDEWEB)

    Jackson, Christopher B., E-mail: Christopher.jackson@insel.ch [Division of Human Genetics, Departements of Pediatrics and Clinical Research, Inselspital, University of Berne, Freiburgstrasse, CH-3010 Berne (Switzerland); Gallati, Sabina, E-mail: sabina.gallati@insel.ch [Division of Human Genetics, Departements of Pediatrics and Clinical Research, Inselspital, University of Berne, Freiburgstrasse, CH-3010 Berne (Switzerland); Schaller, Andre, E-mail: andre.schaller@insel.ch [Division of Human Genetics, Departements of Pediatrics and Clinical Research, Inselspital, University of Berne, Freiburgstrasse, CH-3010 Berne (Switzerland)

    2012-07-06

    Highlights: Black-Right-Pointing-Pointer Serial qPCR accurately determines fragmentation state of any given DNA sample. Black-Right-Pointing-Pointer Serial qPCR demonstrates different preservation of the nuclear and mitochondrial genome. Black-Right-Pointing-Pointer Serial qPCR provides a diagnostic tool to validate the integrity of bioptic material. Black-Right-Pointing-Pointer Serial qPCR excludes degradation-induced erroneous quantification. -- Abstract: Real-time PCR (qPCR) is the method of choice for quantification of mitochondrial DNA (mtDNA) by relative comparison of a nuclear to a mitochondrial locus. Quantitative abnormal mtDNA content is indicative of mitochondrial disorders and mostly confines in a tissue-specific manner. Thus handling of degradation-prone bioptic material is inevitable. We established a serial qPCR assay based on increasing amplicon size to measure degradation status of any DNA sample. Using this approach we can exclude erroneous mtDNA quantification due to degraded samples (e.g. long post-exicision time, autolytic processus, freeze-thaw cycles) and ensure abnormal DNA content measurements (e.g. depletion) in non-degraded patient material. By preparation of degraded DNA under controlled conditions using sonification and DNaseI digestion we show that erroneous quantification is due to the different preservation qualities of the nuclear and the mitochondrial genome. This disparate degradation of the two genomes results in over- or underestimation of mtDNA copy number in degraded samples. Moreover, as analysis of defined archival tissue would allow to precise the molecular pathomechanism of mitochondrial disorders presenting with abnormal mtDNA content, we compared fresh frozen (FF) with formalin-fixed paraffin-embedded (FFPE) skeletal muscle tissue of the same sample. By extrapolation of measured decay constants for nuclear DNA ({lambda}{sub nDNA}) and mtDNA ({lambda}{sub mtDNA}) we present an approach to possibly correct measurements in

  11. Clusters of DNA induced by ionizing radiation: formation of short DNA fragments. I. Theoretical modeling

    Science.gov (United States)

    Holley, W. R.; Chatterjee, A.

    1996-01-01

    We have developed a general theoretical model for the interaction of ionizing radiation with chromatin. Chromatin is modeled as a 30-nm-diameter solenoidal fiber comprised of 20 turns of nucleosomes, 6 nucleosomes per turn. Charged-particle tracks are modeled by partitioning the energy deposition between primary track core, resulting from glancing collisions with 100 eV or less per event, and delta rays due to knock-on collisions involving energy transfers >100 eV. A Monte Carlo simulation incorporates damages due to the following molecular mechanisms: (1) ionization of water molecules leading to the formation of OH, H, eaq, etc.; (2) OH attack on sugar molecules leading to strand breaks: (3) OH attack on bases; (4) direct ionization of the sugar molecules leading to strand breaks; (5) direct ionization of the bases. Our calculations predict significant clustering of damage both locally, over regions up to 40 bp and over regions extending to several kilobase pairs. A characteristic feature of the regional damage predicted by our model is the production of short fragments of DNA associated with multiple nearby strand breaks. The shapes of the spectra of DNA fragment lengths depend on the symmetries or approximate symmetries of the chromatin structure. Such fragments have subsequently been detected experimentally and are reported in an accompanying paper (B. Rydberg, Radiat, Res. 145, 200-209, 1996) after exposure to both high- and low-LET radiation. The overall measured yields agree well quantitatively with the theoretical predictions. Our theoretical results predict the existence of a strong peak at about 85 bp, which represents the revolution period about the nucleosome. Other peaks at multiples of about 1,000 bp correspond to the periodicity of the particular solenoid model of chromatin used in these calculations. Theoretical results in combination with experimental data on fragmentation spectra may help determine the consensus or average structure of the

  12. Modeling the integration of bacterial rRNA fragments into the human cancer genome.

    Science.gov (United States)

    Sieber, Karsten B; Gajer, Pawel; Dunning Hotopp, Julie C

    2016-03-21

    Cancer is a disease driven by the accumulation of genomic alterations, including the integration of exogenous DNA into the human somatic genome. We previously identified in silico evidence of DNA fragments from a Pseudomonas-like bacteria integrating into the 5'-UTR of four proto-oncogenes in stomach cancer sequencing data. The functional and biological consequences of these bacterial DNA integrations remain unknown. Modeling of these integrations suggests that the previously identified sequences cover most of the sequence flanking the junction between the bacterial and human DNA. Further examination of these reads reveals that these integrations are rich in guanine nucleotides and the integrated bacterial DNA may have complex transcript secondary structures. The models presented here lay the foundation for future experiments to test if bacterial DNA integrations alter the transcription of the human genes.

  13. [Molecular dynamics of immune complex of photoadduct-containing DNA with Fab-Anti-DNA antibody fragment].

    Science.gov (United States)

    Akberova, N I; Zhmurov, A A; Nevzorova, T A; Litvinov, R I

    2016-01-01

    Antibodies to DNA play an important role in the pathogenesis of autoimmune diseases. The elucidation of structural mechanisms of both the antigen recognition and the interaction of anti-DNA antibodies with DNA will help to understand the role of DNA-containing immune complexes in various pathologies and can provide a basis for new treatment modalities. Moreover, the DNA-antibody complex is an analog of specific intracellular DNA-protein interactions. In this work, we used in silico molecular dynamic simulations of bimolecular complexes of the dsDNA segment containing the Fab fragment of an anti-DNA antibody to obtain the detailed thermodynamic and structural characteristics of dynamic intermolecular interactions. Using computationally modified crystal structure of the Fab-DNA complex (PDB ID: 3VW3), we studied the equilibrium molecular dynamics of the 64M-5 antibody Fab fragment associated with the dsDNA fragment containing the thymine dimer, the product of DNA photodamage. Amino acid residues that constitute paratopes and the complementary nucleotide epitopes for the Fab-DNA construct were identified. Stacking and electrostatic interactions were found to play the main role in mediating the most specific antibody-dsDNA contacts, while hydrogen bonds were less significant. These findings may shed light on the formation and properties of pathogenic anti-DNA antibodies in autoimmune diseases, such as systemic lupus erythematosus associated with skin photosensitivity and DNA photodamage.

  14. Isolation and Cloning of cDNA Fragment of Gene Encoding for Multidrug Resistance Associated Protein from M. affine.

    Directory of Open Access Journals (Sweden)

    Utut Widyastuti Suharsono

    2008-11-01

    Full Text Available Isolation and Cloning of cDNA Fragment of Gene Encoding for Multidrug Resistance Associated Protein from M. affine. M. affine can grow well in acid soil with high level of soluble aluminum. One of the important proteins in the detoxifying xenobiotic stress including acid and Al stresses is a multidrug resistance associated protein (MRP encoded by mrp gene. The objective of this research is to isolate and clone the cDNA fragment of MaMrp encoding MRP from M. affine. By reverse transcription, total cDNA had been synthesized from the total RNA as template. The fragment of cDNA MaMrp had been successfully isolated by PCR by using total cDNA as template and mrp primer designed from A. thaliana, yeast, and human. This fragment was successfully inserted into pGEM-T Easy and the recombinant plasmid was successfully introduced into E. coli DH5α. Nucleotide sequence analysis showed that the lenght of MaMrp fragment is 633 bp encoding 208 amino acids. Local alignment analysis based on nucleotide of mRNA showed that MaMrp fragment is 69% identical to AtMrp1 and 63% to AtMrp from A. thaliana. Based on deduced amino acid sequence, MaMRP is 84% identical to part of AtMRP13, 77% to AtMRP12, and 73% to AtMRP1 from A. thaliana respectively. Alignment analysis with AtMRP1 showed that MaMRP fragment is located in TM1 and NBF1 domains and has a specific amino acid sequence QCKAQLQNMEEE.

  15. General method of preparation of uniformly 13C, 15N-labeled DNA fragments for NMR analysis of DNA structures

    International Nuclear Information System (INIS)

    Rene, Brigitte; Masliah, Gregoire; Zargarian, Loussine; Mauffret, Olivier; Fermandjian, Serge

    2006-01-01

    Summary 13 C, 15 N labeling of biomolecules allows easier assignments of NMR resonances and provides a larger number of NMR parameters, which greatly improves the quality of DNA structures. However, there is no general DNA-labeling procedure, like those employed for proteins and RNAs. Here, we describe a general and widely applicable approach designed for preparation of isotopically labeled DNA fragments that can be used for NMR studies. The procedure is based on the PCR amplification of oligonucleotides in the presence of labeled deoxynucleotides triphosphates. It allows great flexibility thanks to insertion of a short DNA sequence (linker) between two repeats of DNA sequence to study. Size and sequence of the linker are designed as to create restriction sites at the junctions with DNA of interest. DNA duplex with desired sequence and size is released upon enzymatic digestion of the PCR product. The suitability of the procedure is validated through the preparation of two biological relevant DNA fragments

  16. Rapid assessment of the effect of ciprofloxacin on chromosomal DNA from Escherichia coli using an in situ DNA fragmentation assay

    Directory of Open Access Journals (Sweden)

    Gosalvez Jaime

    2009-04-01

    Full Text Available Abstract Background Fluoroquinolones are extensively used antibiotics that induce DNA double-strand breaks (DSBs by trapping DNA gyrase and topoisomerase IV on DNA. This effect is usually evaluated using biochemical or molecular procedures, but these are not effective at the single-cell level. We assessed ciprofloxacin (CIP-induced chromosomal DNA breakage in single-cell Escherichia coli by direct visualization of the DNA fragments that diffused from the nucleoid obtained after bacterial lysis in an agarose microgel on a slide. Results Exposing the E. coli strain TG1 to CIP starting at a minimum inhibitory concentration (MIC of 0.012 μg/ml and at increasing doses for 40 min increased the DNA fragmentation progressively. DNA damage started to be detectable at the MIC dose. At a dose of 1 μg/ml of CIP, DNA damage was visualized clearly immediately after processing, and the DNA fragmentation increased progressively with the antibiotic incubation time. The level of DNA damage was much higher when the bacteria were taken from liquid LB broth than from solid LB agar. CIP treatment produced a progressively slower rate of DNA damage in bacteria in the stationary phase than in the exponentially growing phase. Removing the antibiotic after the 40 min incubation resulted in progressive DSB repair activity with time. The magnitude of DNA repair was inversely related to CIP dose and was noticeable after incubation with CIP at 0.1 μg/ml but scarce after 10 μg/ml. The repair activity was not strictly related to viability. Four E. coli strains with identified mechanisms of reduced sensitivity to CIP were assessed using this procedure and produced DNA fragmentation levels that were inversely related to MIC dose, except those with very high MIC dose. Conclusion This procedure for determining DNA fragmentation is a simple and rapid test for studying and evaluating the effect of quinolones.

  17. Quantification of DNA fragmentation in processed foods using real-time PCR.

    Science.gov (United States)

    Mano, Junichi; Nishitsuji, Yasuyuki; Kikuchi, Yosuke; Fukudome, Shin-Ichi; Hayashida, Takuya; Kawakami, Hiroyuki; Kurimoto, Youichi; Noguchi, Akio; Kondo, Kazunari; Teshima, Reiko; Takabatake, Reona; Kitta, Kazumi

    2017-07-01

    DNA analysis of processed foods is performed widely to detect various targets, such as genetically modified organisms (GMOs). Food processing often causes DNA fragmentation, which consequently affects the results of PCR analysis. In order to assess the effects of DNA fragmentation on the reliability of PCR analysis, we investigated a novel methodology to quantify the degree of DNA fragmentation. We designed four real-time PCR assays that amplified 18S ribosomal RNA gene sequences common to various plants at lengths of approximately 100, 200, 400, and 800 base pairs (bp). Then, we created an indicator value, "DNA fragmentation index (DFI)", which is calculated from the Cq values derived from the real-time PCR assays. Finally, we demonstrated the efficacy of this method for the quality control of GMO detection in processed foods by evaluating the relationship between the DFI and the limit of detection. Copyright © 2017 Elsevier Ltd. All rights reserved.

  18. Molecular cloning and restriction analysis of EcoRI-fragments of Vicia faba rDNA

    International Nuclear Information System (INIS)

    Yakura, Kimitaka; Tanifuji, Shigeyuki.

    1983-01-01

    EcoRI-fragments of Vicia faba rDNA were cloned in plasmid pBR325. Southern blot hybridization of BamHI-digests of these cloned plasmids and Vicia genomic DNA led to the determination of relative positions of BamHI sites in the rDNA and the physical map that had been tentatively made is corrected. (author)

  19. Determination of size distribution of small DNA fragments by polyacrylamide gel electrophoresis

    International Nuclear Information System (INIS)

    Lau How Mooi

    1998-01-01

    Size distribution determination of DNA fragments can be normally determined by the agarose gel electrophoresis, including the normal DNA banding pattern analysis. However this method is only good for large DNA, such as the DNA of the size of kilo base pairs to mega base pairs range. DNA of size less than kilo base pairs is difficult to be quantified by the agarose gel method. Polyacrylamide gel electrophoresis however can be used to measure the quantity of DNA fragments of size less than kilo base pairs in length, down to less than ten base pairs. This method is good for determining the quantity of the smaller size DNA, single stranded polymers or even some proteins, if the known standards are available. In this report detail description of the method of preparing the polyacrylamide gel, and the experimental set up is discussed. Possible uses of this method, and the comparison with the standard sizes of DNA is also shown. This method is used to determine the distribution of the amount of the fragmented DNA after the Calf-thymus DNA has been exposed to various types of radiation and of different doses. The standards were used to determine the sizes of the fragmented Calf-thymus DNA. The higher the dose the higher is the amount of the smaller size DNA measured

  20. Detection of DNA fingerprints of cultivated rice by hybridization with a human minisatellite DNA probe

    International Nuclear Information System (INIS)

    Dallas, J.F.

    1988-01-01

    A human minisatellite DNA probe detects several restriction fragment length polymorphisms in cultivars of Asian and African rice. Certain fragments appear to be inherited in a Mendelian fashion and may represent unlinked loci. The hybridization patterns appear to be cultivar-specific and largely unchanged after the regeneration of plants from tissue culture. The results suggest that these regions of the rice genome may be used to generate cultivar-specific DNA fingerprints. The demonstration of similarity between a human minisatellite sequence and polymorphic regions in the rice genome suggests that such regions also occur in the genomes of many other plant species

  1. Isolation and characterization of the human uracil DNA glycosylase gene

    International Nuclear Information System (INIS)

    Vollberg, T.M.; Siegler, K.M.; Cool, B.L.; Sirover, M.A.

    1989-01-01

    A series of anti-human placental uracil DNA glycosylase monoclonal antibodies was used to screen a human placental cDNA library in phage λgt11. Twenty-seven immunopositive plaques were detected and purified. One clone containing a 1.2-kilobase (kb) human cDNA insert was chosen for further study by insertion into pUC8. The resultant recombinant plasmid selected by hybridization a human placental mRNA that encoded a 37-kDa polypeptide. This protein was immunoprecipitated specifically by an anti-human placenta uracil DNA glycosylase monoclonal antibody. RNA blot-hybridization (Northern) analysis using placental poly(A) + RNA or total RNA from four different human fibroblast cell strains revealed a single 1.6-kb transcript. Genomic blots using DNA from each cell strain digested with either EcoRI or PstI revealed a complex pattern of cDNA-hydridizing restriction fragments. The genomic analysis for each enzyme was highly similar in all four human cell strains. In contrast, a single band was observed when genomic analysis was performed with the identical DNA digests with an actin gene probe. During cell proliferation there was an increase in the level of glycosylase mRNA that paralleled the increase in uracil DNA glycosylase enzyme activity. The isolation of the human uracil DNA glycosylase gene permits an examination of the structure, organization, and expression of a human DNA repair gene

  2. Menadione-induced DNA fragmentation without 8-oxo-2'-deoxyguanosine formation in isolated rat hepatocytes

    DEFF Research Database (Denmark)

    Fischer-Nielsen, A; Corcoran, G B; Poulsen, H E

    1995-01-01

    Menadione (2-methyl-1,4-naphthoquinone) induces oxidative stress in cells causing perturbations in the cytoplasm as well as nicking of DNA. The mechanisms by which DNA damage occurs are still unclear, but a widely discussed issue is whether menadione-generated reactive oxygen species (ROS) directly...... damage DNA. In the present study, we measured the effect of menadione on formation of 7,8-dihydro-8-oxo-2'-deoxyguanosine (8-oxodG), an index of oxidative DNA base modifications, and on DNA fragmentation. Isolated hepatocytes from phenobarbital-pretreated rats were exposed to menadione, 25-400 micro......M, for 15, 90 or 180 min with or without prior depletion of reduced glutathione (GSH) by diethyl maleate. Menadione caused profound GSH depletion and internucleosomal DNA fragmentation, which was demonstrated by a prominent fragmentation ladder on agarose gel electrophoresis. We found no oxidative...

  3. Clusters of DNA damage induced by ionizing radiation: Formation of short DNA fragments. I. Theoretical modeling

    International Nuclear Information System (INIS)

    Holley, W.R.; Chatterjee, A.

    1996-01-01

    We have developed a general theoretical model for the interaction of ionizing radiation with chromatin. Chromatin is modeled as a 30-nm-diameter solenoidal fiber composed of 20 turns of nucleosomes, 6 nucleosomes per turn. Charged-particle tracks are modeled by partitioning the energy deposition between primary track core, resulting from glancing collisions with 100 eV or less per event, and δ rays due to knock-on collisions involving energy transfers > 100 eV. A Monte Carlo simulation incorporates damages due to the following molecular mechanisms: (1) ionization of water molecules leading to the formation of circ OH, circ H, e aq , etc.; circ OH attack on sugar molecules leading to strand breaks; circ OH attack on bases; direct ionization of the sugar molecules leading to strand breaks; direct ionization of the bases. Our calculations predict significant clustering of damage both locally, over regions up to 40 hp and over regions extending to several kilobase pairs. A characteristic feature of the regional damage predicted by our model is the production of short fragments of DNA associated with multiple nearby strand breaks. Such fragments have subsequently been detected experimentally and are reported in an accompanying paper after exposure to both high- and low-LET radiation. The overall measured yields agree well quantitatively with the theoretical predictions. Our theoretical results predict the existence of a strong peak at about 85 bp, which represents the revolution period about the nucleosome. Other peaks at multiples of about 1,000 bp correspond to the periodicity of the particular solenoid model of chromatin used in these calculations. Theoretical results in combination with experimental data on fragmentation spectra may help determine the consensus or average structure of the chromatin fibers in mammalian DNA. 27 refs., 7 figs

  4. A simple strategy for subcloning and amplifying random multimegabase subchromosomal acentric DNA fragments as double minute chromosomes

    International Nuclear Information System (INIS)

    Hahn, P.J.; Giddings, L.; Lane, M.J.

    1989-01-01

    Restriction mapping of relatively large genomes (e.g. human) utilizing randomly generated DNA segments requires high mapping redundancy to successfully organize 'contigs' to represent the entire genome. The number of independent DNA segment maps required is dependent on the average size of a mapping segment; the larger the segment, the fewer required. The authors have developed a strategy for subcloning intact multimegabase subchromosomal fragments as double minute chromosomes. Such fragments could serve as primary mapping elements or as adjunct (linking) fragments to rapidly connect already existent contigs generated using yeast artificial chromosomes or cosmids. They present several lines of evidence supporting the viability of this approach. (1) X-ray treated EMT-6 mouse cells (7.5 Gr.) which are selected over several months with increasing levels of methotrexate (MTX) contain highly amplified circular DNA molecules (double minutes) which include the dihydrofolate reductase (DHFR) gene in a size range between 1,000 and 3,500 kilobases as determined by pulsed-field gel electrophoresis and these acentric chromosomal fragments have been stably maintained in culture for at least a year. (2) Preliminary data based on experiments involving fusion of X-irradiated Chinese Hamster Ovary (CH0 DG44) cells containing randomly inserted cotransfected Neomycin resistance and DHFR genes to mouse EMT-6 cells shows that the linked genes can be readily cotransferred as acentric subchromosomal fragment(s) suitable for gene amplification. (3) The studies of CHO cells with cell fusion transferred X-ray induced chromosomal fragments containing the natural CHO DHFR gene suggest that transferred chromosome fragments undergo gene amplification much more readily than nonfragmented endogenous DHFR genes

  5. Impact of the Z potential technique on reducing the sperm DNA fragmentation index, fertilization rate and embryo development.

    Science.gov (United States)

    Duarte, Carlos; Núñez, Víctor; Wong, Yat; Vivar, Carlos; Benites, Elder; Rodriguez, Urso; Vergara, Carlos; Ponce, Jorge

    2017-12-01

    In assisted reproduction procedures, we need to develop and enhance new protocols to optimize sperm selection. The aim of this study is to evaluate the ability of the Z potential technique to select sperm with intact DNA in non-normospermic patients and evaluate the impact of this selection on embryonic development. We analyzed a total of 174 human seminal samples with at least one altered parameter. We measured basal, post density gradients, and post density gradients + Z potential DNA fragmentation index. To evaluate the impact of this technique on embryo development, 54 cases were selected. The embryo development parameters evaluated were fertilization rate, cleavage rate, top quality embryos at the third day and blastocysts rate. We found significant differences in the study groups when we compared the sperm fragmentation index by adding the Z potential technique to density gradient selection vs. density gradients alone. Furthermore, there was no significant difference in the embryo development parameters between the low sperm fragmentation index group vs. the moderate and high sperm fragmentation index groups, when selecting sperms with this new technique. The Z potential technique is a very useful tool for sperm selection; it significantly reduces the DNA fragmentation index and improves the parameters of embryo development. This technique could be considered routine for its simplicity and low cost.

  6. Crystallization of DNA fragments from water-salt solutions, containing 2-methylpentane-2,3-diol.

    Science.gov (United States)

    Osica, V D; Sukharevsky, B Y; Vasilchenko, V N; Verkin, B I; Polyvtsev, O F

    1976-09-01

    Fragments of calf thymus DNA have been crystallized by precipitation from water-salt solutions, containing 2-methylpentane-2,3-diol (MPD). DNA crystals usually take the form either of spherulites up to 100 mu in diameter or of needles with the length up to 50 mu. No irreversible denaturation of DNA occurs during the crystallization process. X-ray diffraction from dense slurries of DNA crystals yields crystalline powder patterns.

  7. Efficient Double Fragmentation ChIP-seq Provides Nucleotide Resolution Protein-DNA Binding Profiles

    NARCIS (Netherlands)

    Mokry, Michal; Hatzis, Pantelis; de Bruijn, Ewart; Koster, Jan; Versteeg, Rogier; Schuijers, Jurian; van de Wetering, Marc; Guryev, Victor; Clevers, Hans; Cuppen, Edwin

    2010-01-01

    Immunoprecipitated crosslinked protein-DNA fragments typically range in size from several hundred to several thousand base pairs, with a significant part of chromatin being much longer than the optimal length for next-generation sequencing (NGS) procedures. Because these larger fragments may be

  8. Endometrial Polyps and Benign Endometrial Hyperplasia Present Increased Prevalence of DNA Fragmentation Factors 40 and 45 (DFF40 and DFF45) Together With the Antiapoptotic B-Cell Lymphoma (Bcl-2) Protein Compared With Normal Human Endometria.

    Science.gov (United States)

    Banas, Tomasz; Pitynski, Kazimierz; Mikos, Marcin; Cielecka-Kuszyk, Joanna

    2017-09-13

    DNA fragmentation factor 40 (DFF40) is a key executor of apoptosis. It localizes to the nucleus together with DNA fragmentation factor 45 (DFF45), which acts as a DFF40 inhibitor and chaperone. B-cell lymphoma (Bcl-2) protein is a proven antiapoptotic factor present in the cytoplasm. In this study, we aimed to investigate DFF40, DFF45, and Bcl-2 immunoexpression in endometrial polyps (EPs) and benign endometrial hyperplasia (BEH) tissue compared with that in normal proliferative endometrium (NPE) and normal secretory endometrium (NSE) as well as normal post menopausal endometrium (NAE). This study used archived samples from 65 and 62 cases of EPs and BEH, respectively. The control group consisted of 52 NPE, 54 NSE, and 54 NAE specimens. Immunohistochemistry was used to detect DFF40, DFF45, and Bcl-2. DFF40, DFF45, and Bcl-2 were more highly expressed in the glandular layer of EPs and BEH compared with the stroma, and this was not influenced by menopausal status. Both glandular and stromal expression of DFF40, DFF45, and Bcl-2 were significantly higher in EPs compared with NPE, NSE, and NAE. Glandular BEH tissue showed significantly higher DFF40, DFF45, and Bcl-2 expression than in NPE, NSE, and NAE. No differences in the glandular expression of DFF40, DFF45, and Bcl-2 were observed between EP and BEH tissues, while Bcl-2 stromal expression in BEH was significantly lower than in EPs. Glandular, menopause-independent DFF40, DFF45, and Bcl-2 overexpression may play an important role in the pathogenesis of EPs and BEH.

  9. Electronic cigarette aerosols and copper nanoparticles induce mitochondrial stress and promote DNA fragmentation in lung fibroblasts

    Energy Technology Data Exchange (ETDEWEB)

    Lerner, Chad A.; Rutagarama, Pierrot; Ahmad, Tanveer; Sundar, Isaac K.; Elder, Alison; Rahman, Irfan, E-mail: irfan_rahman@urmc.rochester.edu

    2016-09-02

    Oxidants or nanoparticles have recently been identified as constituents of aerosols released from various styles of electronic cigarettes (E-cigs). Cells in the lung may be directly exposed to these constituents and harbor reactive properties capable of incurring acute cell injury. Our results show mitochondria are sensitive to both E-cig aerosols and aerosol containing copper nanoparticles when exposed to human lung fibroblasts (HFL-1) using an Air-Liquid Interface culture system, evident by elevated levels of mitochondrial ROS (mtROS). Increased mtROS after aerosol exposure is associated with reduced stability of OxPhos electron transport chain (ETC) complex IV subunit and nuclear DNA fragmentation. Increased levels of IL-8 and IL-6 in HFL-1 conditioned media were also observed. These findings reveal both mitochondrial, genotoxic, and inflammatory stresses are features of direct cell exposure to E-cig aerosols which are ensued by inflammatory duress, raising a concern on deleterious effect of vaping. - Graphical abstract: Oxidants and possibly reactive properties of metal particles in E-cig aerosols impart mitochondrial oxidative stress and DNA damage. These biological effects accompany inflammatory response which may raise concern regarding long term E-cig use. Mitochondria may be particularly sensitive to reactive properties of E-cig aerosols in addition to the potential for them to induce genotoxic stress by generating increased ROS. - Highlights: • Mitochondria are sensitive to both E-cig aerosols and metal nanoparticles. • Increased mtROS by E-cig aerosol is associated with disrupted mitochondrial energy. • E-cig causes nuclear DNA fragmentation. • E-cig aerosols induce pro-inflammatory response in human fibroblasts.

  10. Electronic cigarette aerosols and copper nanoparticles induce mitochondrial stress and promote DNA fragmentation in lung fibroblasts

    International Nuclear Information System (INIS)

    Lerner, Chad A.; Rutagarama, Pierrot; Ahmad, Tanveer; Sundar, Isaac K.; Elder, Alison; Rahman, Irfan

    2016-01-01

    Oxidants or nanoparticles have recently been identified as constituents of aerosols released from various styles of electronic cigarettes (E-cigs). Cells in the lung may be directly exposed to these constituents and harbor reactive properties capable of incurring acute cell injury. Our results show mitochondria are sensitive to both E-cig aerosols and aerosol containing copper nanoparticles when exposed to human lung fibroblasts (HFL-1) using an Air-Liquid Interface culture system, evident by elevated levels of mitochondrial ROS (mtROS). Increased mtROS after aerosol exposure is associated with reduced stability of OxPhos electron transport chain (ETC) complex IV subunit and nuclear DNA fragmentation. Increased levels of IL-8 and IL-6 in HFL-1 conditioned media were also observed. These findings reveal both mitochondrial, genotoxic, and inflammatory stresses are features of direct cell exposure to E-cig aerosols which are ensued by inflammatory duress, raising a concern on deleterious effect of vaping. - Graphical abstract: Oxidants and possibly reactive properties of metal particles in E-cig aerosols impart mitochondrial oxidative stress and DNA damage. These biological effects accompany inflammatory response which may raise concern regarding long term E-cig use. Mitochondria may be particularly sensitive to reactive properties of E-cig aerosols in addition to the potential for them to induce genotoxic stress by generating increased ROS. - Highlights: • Mitochondria are sensitive to both E-cig aerosols and metal nanoparticles. • Increased mtROS by E-cig aerosol is associated with disrupted mitochondrial energy. • E-cig causes nuclear DNA fragmentation. • E-cig aerosols induce pro-inflammatory response in human fibroblasts.

  11. Simultaneous vitality and DNA-fragmentation measurement in spermatozoa of smokers and non-smokers.

    Science.gov (United States)

    De Bantel, A; Fleury-Feith, J; Poirot, C; Berthaut, I; Garcin, C; Landais, P; Ravel, C

    2015-03-01

    Because cigarette smoke is a powerful ROS producer, we hypothesized that the spermatozoa of smokers would be more at risk of having increased DNA fragmentation than spermatozoa of non-smoking men. A cross-sectional study was performed on consenting smokers and non-smokers, consulting in an infertility clinic for routine sperm analysis. The application of a novel TUNEL assay coupled to a vitality marker, LIVE/DEAD®, allowed both DNA fragmentation and viability measurement within spermatozoa of participants to be analyzed by flow cytometry. The coupled vitality-DNA fragmentation analysis revealed that non-smokers and smokers, respectively presented medians of 3.6% [0.6-36.8] and 3.3% [0.9-9.6] DNA fragmented spermatozoa among the living spermatozoa population (P > 0.05). No deleterious effect of smoking on spermatozoa was found in our study. More studies concerning potential mutagenic capacities of cigarette smoke on spermatozoa are necessary. In addition, the coupled vitality-DNA fragmentation analysis may orient Assisted Reproductive Technology teams when confronted with patients having a high percentage of DNA-fragmented living spermatozoa. © 2014 International Clinical Cytometry Society.

  12. SPERM MORPHOLOGICAL ABNORMALITIES AS INDICATORS OF DNA FRAGMENTATION AND FERTILIZATION IN ASSISTED REPRODUCTION

    Directory of Open Access Journals (Sweden)

    Barbara Dariš

    2018-02-01

    Full Text Available Background. To determine the relationship between sperm morphological abnormalities, DNA fragmentation and fertilization rate in IVF and ICSI. Methods. Sperm samples from 10 IVF and 20 ICSI cycles were analyzed. Morphology was assessed according to strict criteria, and DNA fragmentation was measured by terminal deoxynucleotidyl transferase (TdT-mediated fluorescein-dUTP nick end labelling (TUNEL using a flow cytometry. Results. There was a significant difference in the amount of morphological abnormalities between sperm samples with low (< 20 % and high (≥ 20 % degree of DNA fragmentation. The percentages of amorphous heads (10 vs. 4 % and overall head abnormalities (42 vs. 30 % were significantly higher in sperm samples with elevated degree of DNA fragmentation. No correlation was found between sperm DNA fragmentation and fertilization rate after IVF and ICSI. When the predominant morphological abnormality in sperm samples was determined, a negative correlation was found between the percentage of spermatozoa with elongated heads and fertilization rate in ICSI (r = –0.45, P < 0.05. The fertilization rate after IVF was lower in the case of acrosomal abnormalities (35.3 %, compared to the cases of other predominant morphological abnormalities. Conclusions. Head abnormalities, especially amorphous heads, are related to elevated degree of DNA fragmentation. Predominant abnormal form in sperm samples, such as elongated heads and acrosomal abnormalities, may affect fertilization in ART.

  13. Effects of fluorescence excitation geometry on the accuracy of DNA fragment sizing by flow cytometry

    Energy Technology Data Exchange (ETDEWEB)

    Werner, James H. [Division of Bioscience, Los Alamos National Laboratory, Mail Stop M888, Los Alamos, New Mexico 87545-0001 (United States); Larson, Erica J. [Division of Bioscience, Los Alamos National Laboratory, Mail Stop M888, Los Alamos, New Mexico 87545-0001 (United States); Goodwin, Peter M. [Division of Bioscience, Los Alamos National Laboratory, Mail Stop M888, Los Alamos, New Mexico 87545-0001 (United States); Ambrose, W. Patrick [Division of Bioscience, Los Alamos National Laboratory, Mail Stop M888, Los Alamos, New Mexico 87545-0001 (United States); Keller, Richard A. [Division of Bioscience, Los Alamos National Laboratory, Mail Stop M888, Los Alamos, New Mexico 87545-0001 (United States)

    2000-06-01

    We report on various excitation geometries used in ultrasensitive flow cytometry that yield a linear relation between the fluorescence intensity measured from individual strained DNA fragments and the lengths of the fragments (in base pairs). This linearity holds for DNA samples that exhibit a wide range of conformations. The variety of DNA conformations leads to a distribution of dipole moment orientations for the dye molecules intercalated into the DNA. It is consequently important to use an excitation geometry such that all dye molecules are detected with similar efficiency. To estimate the conformation and the extent of elongation of the strained fragments in the flow, fluorescence polarization anisotropy and autocorrelation measurements were performed. Significant extension was observed for DNA fragments under the flow conditions frequently used for DNA fragment sizing. Classical calculations of the fluorescence emission collected over a finite solid angle are in agreement with the experimental measurements and have confirmed the relative insensitivity to DNA conformation of an orthogonal excitation geometry. Furthermore, the calculations suggested a modified excitation geometry that has increased our sizing resolution. (c) 2000 Optical Society of America.

  14. Effects of fluorescence excitation geometry on the accuracy of DNA fragment sizing by flow cytometry

    International Nuclear Information System (INIS)

    Werner, James H.; Larson, Erica J.; Goodwin, Peter M.; Ambrose, W. Patrick; Keller, Richard A.

    2000-01-01

    We report on various excitation geometries used in ultrasensitive flow cytometry that yield a linear relation between the fluorescence intensity measured from individual strained DNA fragments and the lengths of the fragments (in base pairs). This linearity holds for DNA samples that exhibit a wide range of conformations. The variety of DNA conformations leads to a distribution of dipole moment orientations for the dye molecules intercalated into the DNA. It is consequently important to use an excitation geometry such that all dye molecules are detected with similar efficiency. To estimate the conformation and the extent of elongation of the strained fragments in the flow, fluorescence polarization anisotropy and autocorrelation measurements were performed. Significant extension was observed for DNA fragments under the flow conditions frequently used for DNA fragment sizing. Classical calculations of the fluorescence emission collected over a finite solid angle are in agreement with the experimental measurements and have confirmed the relative insensitivity to DNA conformation of an orthogonal excitation geometry. Furthermore, the calculations suggested a modified excitation geometry that has increased our sizing resolution. (c) 2000 Optical Society of America

  15. DNA Sequences of RAPD Fragments in the Egyptian cotton ...

    African Journals Online (AJOL)

    Random Amplified Polymorphic DNAs (RAPDs) is a DNA polymorphism assay based on the amplification of random DNA segments with single primers of arbitrary nucleotide sequence. Despite the fact that the RAPD technique has become a very powerful tool and has found use in numerous applications, yet, the nature of ...

  16. Luciferase assay to study the activity of a cloned promoter DNA fragment.

    Science.gov (United States)

    Solberg, Nina; Krauss, Stefan

    2013-01-01

    Luciferase based assays have become an invaluable tool for the analysis of cloned promoter DNA fragments, both for verifying the ability of a potential promoter fragment to drive the expression of a luciferase reporter gene in various cellular contexts, and for dissecting binding elements in the promoter. Here, we describe the use of the Dual-Luciferase(®) Reporter Assay System created by Promega (Promega Corporation, Wisconsin, USA) to study the cloned 6.7 kilobases (kb) mouse (m) Tcf3 promoter DNA fragment in mouse embryonic derived neural stem cells (NSC). In this system, the expression of the firefly luciferase driven by the cloned mTcf3 promoter DNA fragment (including transcription initiation sites) is correlated with a co-transfected control reporter expressing Renilla luciferase from the herpes simplex virus (HSV) thymidine kinase promoter. Using an internal control reporter allows to normalize the activity of the experimental reporter to the internal control, which minimizes experimental variability.

  17. AN IMAGE-ANALYSIS TECHNIQUE FOR DETECTION OF RADIATION-INDUCED DNA FRAGMENTATION AFTER CHEF ELECTROPHORESIS

    NARCIS (Netherlands)

    ROSEMANN, M; KANON, B; KONINGS, AWT; KAMPINGA, HH

    CHEF-electrophoresis was used as a technique to detect radiation-induced DNA breakage with special emphasis to biological relevant X-ray doses (0-10 Gy). Fluorescence detection of DNA-fragments using a sensitive image analysis system was directly compared with conventional scintillation counting of

  18. Distant homology between yeast photoreactivating gene fragment and human genomic digests

    International Nuclear Information System (INIS)

    Meechan, P.J.; Milam, K.M.; Cleaver, J.E.

    1985-01-01

    Hybridization of DNA coding for the yeast DNA photolyase to human genomic DNA appears to allow one to determine whether a conserved enzyme is coded for in human cells. Under stringent conditions (68 0 C), hybridization is not found between the cloned yeast fragment (YEp13-phr1) and human or chick genomic digests. At less stringent conditions (60 0 C), hybridization is observed with chick digests, indicating evolutionary divergence even among organisms capable of photo-reactivation. At 50 0 C, weak hybridization with human digests was observed, indicating further divergence from the cloned gene. Data concerning the precise extent of homology and methods to clone the chick gene for use as another probe are discussed

  19. Natural transformation of bacteria by fragmented, damaged and ancient DNA

    DEFF Research Database (Denmark)

    Overballe-Petersen, Søren

    with fullgenome comparisons that the process has general relevance in extant bacteria. Our findings reveal that the large environmental reservoir of short and damaged DNA retains capacity for natural transformation, even after thousands of years. This describes for the first time a process by which cells can...... transfer playing an important role early in the evolution of life. The published article explains the chemical structure behind an observed degradation difference between the two purine-nucleotides guanosine and adenosine in ancient DNA. We also point at new uses for high-through-put DNA sequencing...

  20. Sperm DNA fragmentation in boars is delayed or abolished by using sperm extenders.

    Science.gov (United States)

    Pérez-Llano, Begoña; Enciso, María; García-Casado, Pedro; Sala, Rubén; Gosálvez, Jaime

    2006-12-01

    The semen quality of seven young adult boars was assessed for percentages of sperm motility, normal acrosomes, abnormal sperm, cells positive to sHOST (short Hipoosmotic Swelling Test), HPNA cells (sHOST Positive with Normal Acrosome cells) and the percentage of sperm heads, which exhibited DNA fragmentation using the Sperm Chromatin Dispersion test (SCD). These parameters were analysed in sperm samples both undiluted and diluted using a commercial extender and stored at 15 degrees C for 21 days. Results showed that semen quality decreases faster in the undiluted semen samples from day 0 to day 7 compared to diluted semen samples that remained with a high quality up to day 11. The undiluted semen exhibited a low DNA fragmentation index (DFI) during the first days and then a significant increase from day 7 up to day 21. This increase in the DFI coincided with the lowest levels of the other semen quality parameters. On the contrary, the samples diluted in the commercial extender showed very low levels of DNA fragmentation in all boars during the preservation period. When the evolution of DNA fragmentation was analysed in the undiluted samples, differences were found among boars. These differences were not shown in the samples diluted in the extender where the basal DFI remained stable during the 21 days. The main conclusion of this study was that some sperm extenders delay or partially prevent sperm DNA fragmentation.

  1. A feasibility study of the use of DNA fragmentation as a method for detecting irradiation of food

    International Nuclear Information System (INIS)

    Jones, J.L.; Bulford, B.B.

    1990-07-01

    The main conclusions of the study are: 1. Gamma-irradiation at doses of 1-10 kGy, as recommended for use in food irradiation, causes extensive fragmentation of DNA molecules. The degree of fragmentation increases with increasing doses of irradiation treatment. 2. Irradiation-induced DNA fragments can be rapidly separated from intact DNA using a simple ultra-filtration method. 3. The separated DNA fragments can be detected/quantified rapidly using the simple Invitrogen DNA DipStick procedure. Dot-blot assays based on probes to widely conserved genes (e.g. histone genes) may also prove of value, but will require further development. 4. As DNA is present in a wide range of foods, DNA fragmentation offers a potentially useful marker for the irradiation treatment of foods. The assay now requires assessment with DNA extracts of a variety of foods. (author)

  2. Genetic alterations of hepatocellular carcinoma by random amplified polymorphic DNA analysis and cloning sequencing of tumor differential DNA fragment

    Science.gov (United States)

    Xian, Zhi-Hong; Cong, Wen-Ming; Zhang, Shu-Hui; Wu, Meng-Chao

    2005-01-01

    AIM: To study the genetic alterations and their association with clinicopathological characteristics of hepatocellular carcinoma (HCC), and to find the tumor related DNA fragments. METHODS: DNA isolated from tumors and corresponding noncancerous liver tissues of 56 HCC patients was amplified by random amplified polymorphic DNA (RAPD) with 10 random 10-mer arbitrary primers. The RAPD bands showing obvious differences in tumor tissue DNA corresponding to that of normal tissue were separated, purified, cloned and sequenced. DNA sequences were analyzed and compared with GenBank data. RESULTS: A total of 56 cases of HCC were demonstrated to have genetic alterations, which were detected by at least one primer. The detestability of genetic alterations ranged from 20% to 70% in each case, and 17.9% to 50% in each primer. Serum HBV infection, tumor size, histological grade, tumor capsule, as well as tumor intrahepatic metastasis, might be correlated with genetic alterations on certain primers. A band with a higher intensity of 480 bp or so amplified fragments in tumor DNA relative to normal DNA could be seen in 27 of 56 tumor samples using primer 4. Sequence analysis of these fragments showed 91% homology with Homo sapiens double homeobox protein DUX10 gene. CONCLUSION: Genetic alterations are a frequent event in HCC, and tumor related DNA fragments have been found in this study, which may be associated with hepatocarcin-ogenesis. RAPD is an effective method for the identification and analysis of genetic alterations in HCC, and may provide new information for further evaluating the molecular mechanism of hepatocarcinogenesis. PMID:15996039

  3. Synthesis and NMR of {sup 15}N-labeled DNA fragments

    Energy Technology Data Exchange (ETDEWEB)

    Jones, R.A. [Rutgers, The State Univ. of New Jersey, Piscataway, NJ (United States)

    1994-12-01

    DNA fragments labeled with {sup 15}N at the ring nitrogens and at the exocyclic amino groups can be used to obtain novel insight into interactions such as base pairing, hydration, drug binding, and protein binding. A number of synthetic routes to {sup 15}N-labeled pyrimidine nucleosides, purines, and purine nucleosides have been reported. Moreover, many of these labeled bases or monomers have been incorporated into nucleic acids, either by chemical synthesis or by biosynthetic procedures. The focus of this chapter will be on the preparation of {sup 15}N-labeled purine 2{prime}-deoxynucleosides, their incorporation into DNA fragments by chemical synthesis, and the results of NMR studies using these labeled DNA fragments.

  4. Accurate phylogenetic classification of DNA fragments based onsequence composition

    Energy Technology Data Exchange (ETDEWEB)

    McHardy, Alice C.; Garcia Martin, Hector; Tsirigos, Aristotelis; Hugenholtz, Philip; Rigoutsos, Isidore

    2006-05-01

    Metagenome studies have retrieved vast amounts of sequenceout of a variety of environments, leading to novel discoveries and greatinsights into the uncultured microbial world. Except for very simplecommunities, diversity makes sequence assembly and analysis a verychallenging problem. To understand the structure a 5 nd function ofmicrobial communities, a taxonomic characterization of the obtainedsequence fragments is highly desirable, yet currently limited mostly tothose sequences that contain phylogenetic marker genes. We show that forclades at the rank of domain down to genus, sequence composition allowsthe very accurate phylogenetic 10 characterization of genomic sequence.We developed a composition-based classifier, PhyloPythia, for de novophylogenetic sequence characterization and have trained it on adata setof 340 genomes. By extensive evaluation experiments we show that themethodis accurate across all taxonomic ranks considered, even forsequences that originate fromnovel organisms and are as short as 1kb.Application to two metagenome datasets 15 obtained from samples ofphosphorus-removing sludge showed that the method allows the accurateclassification at genus level of most sequence fragments from thedominant populations, while at the same time correctly characterizingeven larger parts of the samples at higher taxonomic levels.

  5. A DNA metabarcoding study of a primate dietary diversity and plasticity across its entire fragmented range.

    Directory of Open Access Journals (Sweden)

    Erwan Quéméré

    Full Text Available In tropical regions, most primary ecosystems have been replaced by mosaic landscapes in which species must cope with a large shift in the distribution of their habitat and associated food resources. Primates are particularly vulnerable to habitat modifications. Most species persist in small fragments surrounded by complex human-mediated matrices whose structure and connectivity may strongly influence their dispersal and feeding behavior. Behavioral plasticity appears to be a crucial parameter governing the ability of organisms to exploit the resources offered by new matrix habitats and thus to persist in fragmented habitats. In this study, we were interested in the dietary plasticity of the golden-crowned sifaka (Propithecus tattersalli, an endangered species of lemur, found only in the Daraina region in north-eastern Madagascar. We used a DNA-based approach combining the barcoding concept and Illumina next-generation sequencing to (i describe the species diet across its entire range and (ii evaluate the influence of landscape heterogeneity on diet diversity and composition. Faeces from 96 individuals were sampled across the entire species range and their contents were analyzed using the trnL metabarcoding approach. In parallel, we built a large DNA reference database based on a checklist of the plant species of the Daraina region. Our results suggest that golden-crowned sifakas exhibit remarkable dietary diversity with at least 130 plant species belonging to 80 genera and 49 different families. We highlighted an influence of both habitat type and openness on diet composition suggesting a high flexibility of foraging strategies. Moreover, we observed the presence of numerous cultivated and naturalized plants in the faeces of groups living in forest edge areas. Overall, our findings support our initial expectation that P. tattersalli is able to cope with the current level of alteration of the landscape and confirm our previous results on the

  6. FragIdent – Automatic identification and characterisation of cDNA-fragments

    Directory of Open Access Journals (Sweden)

    Goehler Heike

    2009-03-01

    Full Text Available Abstract Background Many genetic studies and functional assays are based on cDNA fragments. After the generation of cDNA fragments from an mRNA sample, their content is at first unknown and must be assigned by sequencing reactions or hybridisation experiments. Even in characterised libraries, a considerable number of clones are wrongly annotated. Furthermore, mix-ups can happen in the laboratory. It is therefore essential to the relevance of experimental results to confirm or determine the identity of the employed cDNA fragments. However, the manual approach for the characterisation of these fragments using BLAST web interfaces is not suited for larger number of sequences and so far, no user-friendly software is publicly available. Results Here we present the development of FragIdent, an application for the automatic identification of open reading frames (ORFs within cDNA-fragments. The software performs BLAST analyses to identify the genes represented by the sequences and suggests primers to complete the sequencing of the whole insert. Gene-specific information as well as the protein domains encoded by the cDNA fragment are retrieved from Internet-based databases and included in the output. The application features an intuitive graphical interface and is designed for researchers without any bioinformatics skills. It is suited for projects comprising up to several hundred different clones. Conclusion We used FragIdent to identify 84 cDNA clones from a yeast two-hybrid experiment. Furthermore, we identified 131 protein domains within our analysed clones. The source code is freely available from our homepage at http://compbio.charite.de/genetik/FragIdent/.

  7. FragIdent--automatic identification and characterisation of cDNA-fragments.

    Science.gov (United States)

    Seelow, Dominik; Goehler, Heike; Hoffmann, Katrin

    2009-03-02

    Many genetic studies and functional assays are based on cDNA fragments. After the generation of cDNA fragments from an mRNA sample, their content is at first unknown and must be assigned by sequencing reactions or hybridisation experiments. Even in characterised libraries, a considerable number of clones are wrongly annotated. Furthermore, mix-ups can happen in the laboratory. It is therefore essential to the relevance of experimental results to confirm or determine the identity of the employed cDNA fragments. However, the manual approach for the characterisation of these fragments using BLAST web interfaces is not suited for larger number of sequences and so far, no user-friendly software is publicly available. Here we present the development of FragIdent, an application for the automatic identification of open reading frames (ORFs) within cDNA-fragments. The software performs BLAST analyses to identify the genes represented by the sequences and suggests primers to complete the sequencing of the whole insert. Gene-specific information as well as the protein domains encoded by the cDNA fragment are retrieved from Internet-based databases and included in the output. The application features an intuitive graphical interface and is designed for researchers without any bioinformatics skills. It is suited for projects comprising up to several hundred different clones. We used FragIdent to identify 84 cDNA clones from a yeast two-hybrid experiment. Furthermore, we identified 131 protein domains within our analysed clones. The source code is freely available from our homepage at http://compbio.charite.de/genetik/FragIdent/.

  8. Origin of DNA in human serum and usefulness of serum as a material for DNA typing.

    Science.gov (United States)

    Takayama, T; Yamada, S; Watanabe, Y; Hirata, K; Nagai, A; Nakamura, I; Bunai, Y; Ohya, I

    2001-06-01

    The aims of this study were to clarify the origin of DNA in human serum and to investigate whether serum is a material available for DNA typing in routine forensic practice. Blood was donated from 10 healthy adult volunteers and stored for up to 8 days, at 4 degrees C and at room temperature. The serum DNA concentration at zero time was in the range of 5.6 to 21.8 ng/ml with a mean of 12.2+/-1.6 ng/ml. The concentrations increased with storage time. On agarose gel electrophoresis, all serum samples showed ladder patterns and the size of each band was an integer multiple of approximately 180 bp considered to be characteristic of apoptosis. DNA typing from DNA released by apoptosis was possible. Exact DNA typing of D1S80, HLA DQA1, PM, CSF1PO, TPOX, TH01 and vWA was possible for each sample. These results indicate that serum contains fragmented DNA derived from apoptosis of leukocytes, especially neutrophils, and that fragmented DNA is an appropriate material for DNA typing.

  9. Jus Cogens and the Humanization and Fragmentation of International Law

    NARCIS (Netherlands)

    den Heijer, M.; van der Wilt, H.; den Heijer, M.; van der Wilt, H.

    2016-01-01

    This editorial explores how two developments—the humanization and fragmentation of international law—permeate all aspects of jus cogens: its foundations, content and consequences. The authors are particularly intrigued by the question of how the unceasing popularity of jus cogens can be reconciled

  10. Molecular cloning and characterization of human papilloma virus DNA derived from a laryngeal papilloma.

    OpenAIRE

    Gissmann, L; Diehl, V; Schultz-Coulon, H J; zur Hausen, H

    1982-01-01

    Papilloma virus DNA from a laryngeal papilloma was cloned in phage lambda L 47 and characterized after cleavage with different restriction enzymes. Hybridization with the DNAs of human papilloma virus types 1, 2, 3, 4, 5, and 8 showed no homology under stringent hybridization conditions. Human papilloma virus type 6 DNA, however, was partially identical to laryngeal papilloma virus DNA; different restriction enzyme fragments hybridizing with the other DNA were identified on each genome. The d...

  11. Quadruplexes of human telomere DNA

    Czech Academy of Sciences Publication Activity Database

    Vorlíčková, Michaela; Chládková, Jana; Kejnovská, Iva; Kypr, Jaroslav

    2007-01-01

    Roč. 24, č. 6 (2007), s. 710 ISSN 0739-1102. [The 15th Conversation . 19.06.2007-23.06.2007, Albany] R&D Projects: GA ČR(CZ) GA204/07/0057; GA AV ČR(CZ) IAA100040701 Institutional research plan: CEZ:AV0Z50040507; CEZ:AV0Z50040702 Keywords : DNA tetraplex * human telomere * CD spectroscopy Subject RIV: BO - Biophysics

  12. Nature of defects produced on thymine fragment by gamma irradiation of DNA

    International Nuclear Information System (INIS)

    Teoule, R.; Bonicel, A.

    1975-01-01

    A study is reported of the nature of the DNA thymine fragment damage induced by gamma radiation in vitro conditions, by a new method involving hydrolysis in mild conditions. It is highly probable that the main lesions observed in vitro on the DNA polynucleotide chain, namely thymine glycol, 5,6-dihydroxy-5,6-dihydrothymine and 1'-(N-formamidol) deoxyribose, are formed in vivo conditions

  13. Characterization and immunological identification of cDNA clones encoding two human DNA topoisomerase II isozymes

    International Nuclear Information System (INIS)

    Chung, T.D.Y.; Drake, F.H.; Tan, K.B.; Per, S.R.; Crooke, S.T.; Mirabelli, C.K.

    1989-01-01

    Several DNA topoisomerase II partial cDNA clones obtained from a human Raji-HN2 cDNA library were sequenced and two classes of nucleotide sequences were found. One member of the first class, SP1, was identical to an internal fragment of human HeLa cell Topo II cDNA described earlier. A member of the second class, SP11, shared extensive nucleotide (75%) and predicted peptide (92%) sequence similarities with the first two-thirds of HeLa Topo II. Each class of cDNAs hybridized to unique, nonoverlapping restriction enzyme fragments of genomic DNA from several human cell lines. Synthetic 24-mer oligonucleotide probes specific for each cDNA class hybridized to 6.5-kilobase mRNAs; furthermore, hybridization of probe specific for one class was not blocked by probe specific for the other. Antibodies raised against a synthetic SP1-encoded dodecapeptide specifically recognized the 170-kDa form of Topo II, while antibodies raised against the corresponding SP11-encoded dodecapeptide, or a second unique SP11-encoded tridecapeptide, selectively recognized the 180-kDa form of Topo II. These data provide genetic and immunochemical evidence for two Topo II isozymes

  14. Electrostatic field of the large fragment of Escherichia coli DNA polymerase I.

    Science.gov (United States)

    Warwicker, J; Ollis, D; Richards, F M; Steitz, T A

    1985-12-05

    The electrostatic field of the large fragment of Escherichia coli DNA polymerase I (Klenow fragment) has been calculated by the finite difference procedure on a 2 A grid. The potential field is substantially negative at physiological pH (reflecting the net negative charge at this pH). The largest regions of positive potential are in the deep crevice of the C-terminal domain, which is the proposed binding site for the DNA substrate. Within the crevice, the electrostatic potential has a partly helical form. If the DNA is positioned to fulfil stereochemical requirements, then the positive potential generally follows the major groove and (to a lesser extent) the negative potential is in the minor groove. Such an arrangement could stabilize DNA configurations related by screw symmetry. The histidine residues of the Klenow fragment give the positive field of the groove a sensitivity to relatively small pH changes around neutrality. We suggest that the histidine residues could change their ionization states in response to DNA binding, and that this effect could contribute to the protein-DNA binding energy.

  15. Chromosomal location of the human gene for DNA polymerase β

    International Nuclear Information System (INIS)

    McBride, O.W.; Zmudzka, B.Z.; Wilson, S.H.

    1987-01-01

    Inhibition studies indicate that DNA polymerase β has a synthetic role in DNA repair after exposure of mammalian cells to some types of DNA-damaging agents. The primary structure of the enzyme is highly conserved in vertebrates, and nearly full-length cDNAs for the enzyme were recently cloned from mammalian cDNA libraries. Southern blot analysis of DNA from a panel of human-rodent somatic cell hybrids, using portions of the cDNA as probe, indicates that the gene for human DNA polymerase β is single copy and located on the short arm or proximal long arm of chromosome 8 (8pter-8q22). A restriction fragment length polymorphism (RFLP) was detected in normal individuals by using a probe from the 5' end of the cDNA, and this RFLP probably is due to an insertion or duplication of DNA in 20-25% of the population. This restriction site can be used as one marker for chromosome 8 genetic linkage studies and for family studies of traits potentially involving this DNA repair gene

  16. Analysis of different DNA fragments of Corynebacterium glutamicum complementing dapE of Escherichia coli.

    Science.gov (United States)

    Wehrmann, A; Eggeling, L; Sahm, H

    1994-12-01

    In Corynebacterium glutamicum L-lysine is synthesized simultaneously via the succinylase and dehydrogenase variant of the diaminopimelate pathway. Starting from a strain with a disrupted dehydrogenase gene, three different-sized DNA fragments were isolated which complemented defective Escherichia coli mutants in the succinylase pathway. Enzyme studies revealed that in one case the dehydrogenase gene had apparently been reconstituted in the heterologous host. The two other fragments resulted in desuccinylase activity; one of them additionally in succinylase activity. However, the physical analysis showed that structural changes had taken place in all fragments. Using a probe derived from one of the fragments we isolated a 3.4 kb BamHI DNA fragment without selective pressure (by colony hybridization). This was structurally intact and proved functionally to result in tenfold desuccinylase overexpression. The nucleotide sequence of a 1966 bp fragment revealed the presence of one truncated open reading frame of unknown function and that of dapE encoding N-succinyl diaminopimelate desuccinylase (EC 3.5.1.18). The deduced amino acid sequence of the dapE gene product shares 23% identical residues with that from E. coli. The C. glutamicum gene now available is the first gene from the succinylase branch of lysine synthesis of this biotechnologically important organism.

  17. Differential diagnosis of genetic disease by DNA restriction fragment length polymorphisms

    NARCIS (Netherlands)

    Bolhuis, P. A.; Defesche, J. C.; van der Helm, H. J.

    1987-01-01

    DNA restriction fragment length polymorphisms (RFLPs) are used for diagnosis of genetic disease in families known to be affected by specific disorders, but RFLPs can be also useful for the differential diagnosis of hereditary disease. An RFLP pattern represents the inheritance of chromosomal markers

  18. Cloning human DNA repair genes

    International Nuclear Information System (INIS)

    Jeggo, P.A.; Carr, A.M.; Lehmann, A.R.

    1994-01-01

    Many human genes involved in the repair of UV damage have been cloned using different procedures and they have been of great value in assisting the understanding of the mechanism of nucleotide excision-repair. Genes involved in repair of ionizing radiation damage have proved more difficult to isolate. Positional cloning has localized the XRCC5 gene to a small region of chromosome 2q33-35, and a series of yeast artificial chromosomes covering this region have been isolated. Very recent work has shown that the XRCC5 gene encodes the 80 kDa subunit of the Ku DNA-binding protein. The Ku80 gene also maps to this region. Studies with fission yeast have shown that radiation sensitivity can result not only from defective DNA repair but also from abnormal cell cycle control following DNA damage. Several genes involved in this 'check-point' control in fission yeast have been isolated and characterized in detail. It is likely that a similar checkpoint control mechanism exists in human cells. (author)

  19. [Cleavage of DNA fragments induced by UV nanosecond laser excitation at 193 nm].

    Science.gov (United States)

    Vtiurina, N N; Grokhovskiĭ, S L; Filimonov, I V; Medvedkov, O I; Nechipurenko, D Iu; Vasil'ev, S A; Nechipurenko, Iu D

    2011-01-01

    The cleavage of dsDNA fragments in aqueous solution after irradiation with UV laser pulses at 193 nm has been studied. Samples were investigated using polyacrylamide gel electrophoresis. The intensity of damage of particular phosphodiester bond after hot alkali treatment was shown to depend on the base pair sequence. It was established that the probability of cleavage is twice higher for sites of DNA containing two or more successively running guanine residues. A possible mechanism of damage to the DNA molecule connected with the migration of holes along the helix is discussed.

  20. Rapid construction of a Bacterial Artificial Chromosomal (BAC) expression vector using designer DNA fragments.

    Science.gov (United States)

    Chen, Chao; Zhao, Xinqing; Jin, Yingyu; Zhao, Zongbao Kent; Suh, Joo-Won

    2014-11-01

    Bacterial artificial chromosomal (BAC) vectors are increasingly being used in cloning large DNA fragments containing complex biosynthetic pathways to facilitate heterologous production of microbial metabolites for drug development. To express inserted genes using Streptomyces species as the production hosts, an integration expression cassette is required to be inserted into the BAC vector, which includes genetic elements encoding a phage-specific attachment site, an integrase, an origin of transfer, a selection marker and a promoter. Due to the large sizes of DNA inserted into the BAC vectors, it is normally inefficient and time-consuming to assemble these fragments by routine PCR amplifications and restriction-ligations. Here we present a rapid method to insert fragments to construct BAC-based expression vectors. A DNA fragment of about 130 bp was designed, which contains upstream and downstream homologous sequences of both BAC vector and pIB139 plasmid carrying the whole integration expression cassette. In-Fusion cloning was performed using the designer DNA fragment to modify pIB139, followed by λ-RED-mediated recombination to obtain the BAC-based expression vector. We demonstrated the effectiveness of this method by rapid construction of a BAC-based expression vector with an insert of about 120 kb that contains the entire gene cluster for biosynthesis of immunosuppressant FK506. The empty BAC-based expression vector constructed in this study can be conveniently used for construction of BAC libraries using either microbial pure culture or environmental DNA, and the selected BAC clones can be directly used for heterologous expression. Alternatively, if a BAC library has already been constructed using a commercial BAC vector, the selected BAC vectors can be manipulated using the method described here to get the BAC-based expression vectors with desired gene clusters for heterologous expression. The rapid construction of a BAC-based expression vector facilitates

  1. DNA repair synthesis in human fibroblasts requires DNA polymerase delta

    International Nuclear Information System (INIS)

    Nishida, C.; Reinhard, P.; Linn, S.

    1988-01-01

    When UV-irradiated cultured diploid human fibroblasts were permeabilized with Brij-58 then separated from soluble material by centrifugation, conservative DNA repair synthesis could be restored by a soluble factor obtained from the supernatant of similarly treated HeLa cells. Extensive purification of this factor yielded a 10.2 S, 220,000-dalton polypeptide with the DNA polymerase and 3'- to 5'-exonuclease activities reported for DNA polymerase delta II. Monoclonal antibody to KB cell DNA polymerase alpha, while binding to HeLa DNA polymerase alpha, did not bind to the HeLa DNA polymerase delta. Moreover, at micromolar concentrations N2-(p-n-butylphenyl)-2'-deoxyguanosine 5'-triphosphate (BuPdGTP) and 2-(p-n-butylanilino)-2'-deoxyadenosine 5'-triphosphate (BuAdATP) were potent inhibitors of DNA polymerase alpha, but did not inhibit the DNA polymerase delta. Neither purified DNA polymerase alpha nor beta could promote repair DNA synthesis in the permeabilized cells. Furthermore, under conditions which inhibited purified DNA polymerase alpha by greater than 90%, neither monoclonal antibodies to DNA polymerase alpha, BuPdGTP, nor BuAdATP was able to inhibit significantly the DNA repair synthesis mediated by the DNA polymerase delta. Thus, it appears that a major portion of DNA repair synthesis induced by UV irradiation might be catalyzed by DNA polymerase delta. When xeroderma pigmentosum human diploid fibroblasts were utilized, DNA repair synthesis dependent upon ultraviolet light could be restored by addition of both T4 endonuclease V and DNA polymerase delta, but not by addition of either one alone

  2. Complete mitochondrial genome sequence of a Middle Pleistocene cave bear reconstructed from ultrashort DNA fragments.

    Science.gov (United States)

    Dabney, Jesse; Knapp, Michael; Glocke, Isabelle; Gansauge, Marie-Theres; Weihmann, Antje; Nickel, Birgit; Valdiosera, Cristina; García, Nuria; Pääbo, Svante; Arsuaga, Juan-Luis; Meyer, Matthias

    2013-09-24

    Although an inverse relationship is expected in ancient DNA samples between the number of surviving DNA fragments and their length, ancient DNA sequencing libraries are strikingly deficient in molecules shorter than 40 bp. We find that a loss of short molecules can occur during DNA extraction and present an improved silica-based extraction protocol that enables their efficient retrieval. In combination with single-stranded DNA library preparation, this method enabled us to reconstruct the mitochondrial genome sequence from a Middle Pleistocene cave bear (Ursus deningeri) bone excavated at Sima de los Huesos in the Sierra de Atapuerca, Spain. Phylogenetic reconstructions indicate that the U. deningeri sequence forms an early diverging sister lineage to all Western European Late Pleistocene cave bears. Our results prove that authentic ancient DNA can be preserved for hundreds of thousand years outside of permafrost. Moreover, the techniques presented enable the retrieval of phylogenetically informative sequences from samples in which virtually all DNA is diminished to fragments shorter than 50 bp.

  3. DNA repair in human cells

    International Nuclear Information System (INIS)

    Regan, J.D.; Carrier, W.L.; Kusano, I.; Furuno-Fukushi, I.; Dunn, W.C. Jr.; Francis, A.A.; Lee, W.H.

    1982-01-01

    Our primary objective is to elucidate the molecular events in human cells when cellular macromolecules such as DNA are damaged by radiation or chemical agents. We study and characterize (i) the sequence of DNA repair events, (ii) the various modalities of repair, (iii) the genetic inhibition of repair due to mutation, (iv) the physiological inhibition of repair due to mutation, (v) the physiological inhibition of repair due to biochemical inhibitors, and (vi) the genetic basis of repair. Our ultimate goals are to (i) isolate and analyze the repair component of the mutagenic and/or carcinogenic event in human cells, and (ii) elucidate the magnitude and significance of this repair component as it impinges on the practical problems of human irradiation or exposure to actual or potential chemical mutagens and carcinogens. The significance of these studies lies in (i) the ubiquitousness of repair (most organisms, including man, have several complex repair systems), (ii) the belief that mutagenic and carcinogenic events may arise only from residual (nonrepaired) lesions or that error-prone repair systems may be the major induction mechanisms of the mutagenic or carcinogenic event, and (iii) the clear association of repair defects and highly carcinogenic disease states in man [xeroderma pigmentosum (XP)

  4. Understanding human DNA sequence variation.

    Science.gov (United States)

    Kidd, K K; Pakstis, A J; Speed, W C; Kidd, J R

    2004-01-01

    Over the past century researchers have identified normal genetic variation and studied that variation in diverse human populations to determine the amounts and distributions of that variation. That information is being used to develop an understanding of the demographic histories of the different populations and the species as a whole, among other studies. With the advent of DNA-based markers in the last quarter century, these studies have accelerated. One of the challenges for the next century is to understand that variation. One component of that understanding will be population genetics. We present here examples of many of the ways these new data can be analyzed from a population perspective using results from our laboratory on multiple individual DNA-based polymorphisms, many clustered in haplotypes, studied in multiple populations representing all major geographic regions of the world. These data support an "out of Africa" hypothesis for human dispersal around the world and begin to refine the understanding of population structures and genetic relationships. We are also developing baseline information against which we can compare findings at different loci to aid in the identification of loci subject, now and in the past, to selection (directional or balancing). We do not yet have a comprehensive understanding of the extensive variation in the human genome, but some of that understanding is coming from population genetics.

  5. Prophagic DNA Fragments in Streptococcus agalactiae Strains and Association with Neonatal Meningitis

    Science.gov (United States)

    van der Mee-Marquet, Nathalie; Domelier, Anne-Sophie; Mereghetti, Laurent; Lanotte, Philippe; Rosenau, Agnès; van Leeuwen, Willem; Quentin, Roland

    2006-01-01

    We identified—by randomly amplified polymorphic DNA (RAPD) analysis at the population level followed by DNA differential display, cloning, and sequencing—three prophage DNA fragments (F5, F7, and F10) in Streptococcus agalactiae that displayed significant sequence similarity to the DNA of S. agalactiae and Streptococcus pyogenes. The F5 sequence aligned with a prophagic gene encoding the large subunit of a terminase, F7 aligned with a phage-associated cell wall hydrolase and a phage-associated lysin, and F10 aligned with a transcriptional regulator (ArpU family) and a phage-associated endonuclease. We first determined the prevalence of F5, F7, and F10 by PCR in a collection of 109 strains isolated in the 1980s and divided into two populations: one with a high risk of causing meningitis (HR group) and the other with a lower risk of causing meningitis (LR group). These fragments were significantly more prevalent in the HR group than in the LR group (P S. agalactiae strains to invade the neonatal brain endothelium. We then determined the prevalence of F5, F7, and F10 by PCR in a collection of 40 strains recently isolated from neonatal meningitis cases for comparison with the cerebrospinal fluid (CSF) strains isolated in the 1980s. The prevalence of the three prophage DNA fragments was similar in these two populations isolated 15 years apart. We suggest that the prophage DNA fragments identified have remained stable in many CSF S. agalactiae strains, possibly due to their importance in virulence or fitness. PMID:16517893

  6. Sortilin Fragments Deposit at Senile Plaques in Human Cerebrum

    Directory of Open Access Journals (Sweden)

    Xia Hu

    2017-06-01

    Full Text Available Genetic variations in the vacuolar protein sorting 10 protein (Vps10p family have been linked to Alzheimer’s disease (AD. Here we demonstrate deposition of fragments from the Vps10p member sortilin at senile plaques (SPs in aged and AD human cerebrum. Sortilin changes were characterized in postmortem brains with antibodies against the extracellular and intracellular C-terminal domains. The two antibodies exhibited identical labeling in normal human cerebrum, occurring in the somata and dendrites of cortical and hippocampal neurons. The C-terminal antibody also marked extracellular lesions in some aged and all AD cases, appearing as isolated fibrils, mini-plaques, dense-packing or circular mature-looking plaques. Sortilin and β-amyloid (Aβ deposition were correlated overtly in a region/lamina- and case-dependent manner as analyzed in the temporal lobe structures, with co-localized immunofluorescence seen at individual SPs. However, sortilin deposition rarely occurred around the pia, at vascular wall or in areas with typical diffuse Aβ deposition, with the labeling not enhanced by section pretreatment with heating or formic acid. Levels of a major sortilin fragment ~15 kDa, predicted to derive from the C-terminal region, were dramatically elevated in AD relative to control cortical lysates. Thus, sortilin fragments are a prominent constituent of the extracellularly deposited protein products at SPs in human cerebrum.

  7. Amplification of a transcriptionally active DNA sequence in the human brain

    International Nuclear Information System (INIS)

    Yakovlev, A.G.; Sazonov, A.E.; Spunde, A.Ya.; Gindilis, V.M.

    1986-01-01

    The authors present their findings of tissue-specific amplification of a DNA fragment actively transcribed in the human brain. This genome fragment was found in the library complement of cDNA of the human brain and evidently belongs to a new class of moderate repetitions of DNA with an unstable copying capacity in the human genome. The authors isolated total cell RNA from various human tissues (brain, placenta), and rat tissues (brain, liver), by the method of hot phenol extraction with guanidine thiocynate. The poly(A + ) RNA fraction was isolated by chromatography. Synthesis of cDNA was done on a matrix of poly(A + ) RNA of human brain. The cDNA obtained was cloned in plasmid pBR322 for the PstI site using (dC/dG) sequences synthesized on the 3' ends of the vector molecule and cDNA respectively. In cloning 75 ng cDNA, the authors obtained approximately 10 5 recombinant. This library was analyzed by the hybridization method on columns with two radioactive ( 32 P) probes: the total cDNA preparation and the total nuclear DNA from the human brain. The number of copies of the cloned DNA fragment in the genome was determined by dot hybridization. Restricting fragments of human and rat DNA genomes homologous to the cloned cDNA were identified on radio-autographs. In each case, 10 micrograms of EcoRI DNA hydrolyzate was fractionated in 1% agarose gel. The probe was also readied with RNA samples fractionated in agarose gel with formaldehyde and transferred to a nitrocellulose filter under weak vacuum. The filter was hybridized with 0.1 micrograms DNA pAG 02, labeled with ( 32 P) to a specific activity of 0.5-1 x 10 9 counts/min x microgram. The autograph was exposed with amplifying screens at -70 0 C for 2 days

  8. Oncogenic transformation of rat lung epithelioid cells by SV40 DNA and restriction enzyme fragments

    International Nuclear Information System (INIS)

    Daya-Grosjean, L.; Lasne, C.; Nardeux, P.; Chouroulinkov, I.; Monier, R.

    1979-01-01

    Rat epithelioid lung cells were transformed with various preparations of SV40 DNA using the Ca 2+ -precipitation technique. The amount of SV40 genetic information integrated into transformed clones was evaluated by DNA-DNA renaturation kinetics. The growth properties on plastic and in soft-agar were examined, as well as the ability to induce tumors in syngeneic newborn animals or in adult nude mice. One particular transformed line, which had received the HpaII/BamHIA (59 per cent) fragment, was found to contain about 3 integrated copies of this fragment per cell and no significant amount of the HpaII/BamHIB (41 per cent fragment). This line which grew to high saturatio densities and efficiently formed clones in low serum on plastic, produced tumors in both syngeneic rats and nude mice. Thus the HpaII/BamHIA fragment, which mainly includes early viral information, was sufficient to impart these properties to rat epithelioid lung cells. (author)

  9. [Fingerprints identification of Gynostemma pentaphyllum by RAPD and cloning and analysis of its specific DNA fragment].

    Science.gov (United States)

    Jiang, Jun-fu; Li, Xiong-ying; Wu, Yao-sheng; Luo, Yu; Zhao, Rui-qiang; Lan, Xiu-wan

    2009-02-01

    To identify the resources of Gynostemma pentaphyllum and its spurious breed plant Cayratia japonica at level of DNA. Two random primers ( WGS001, WGS004) screened were applied to do random amplification with genomic DNA extracted from Gynostemma pentaphyllum and Cayratia japonica which were collected from different habitats. After amplificated with WGS004, one characteristic fragment about 500 bp which was common to all Gynostemma pentaphyllum samples studied but not to Cayratia japonica was cloned and sequenced. Then these sequences obtained were analyzed for identity and compared by Blastn program in GenBank. There were obvious different bands amplified by above two primers in their fingerprints of genomic DNA. On the basis of these different bands of DNA fingerprints, they could distinguish Gynostemma pentaphyllum and Cayratia japonica obviously. Sequence alignment of seven cloned bands showed that their identities ranged from 45.7% - 94.5%. There was no similar genome sequences searched in GenBank. This indicated that these seven DNA fragments had not been reported before and they should be new sequences. RAPD technique can be used for the accurate identification of Gynostemma pentaphyllum and its counterfeit goods Cayratia japonica. Besides, these specific DNA sequences for Gynostemmna pentaphyllum in this study are useful for the further research on identification of species and assisted selection breeding in Gynostemma pentaphyllum.

  10. Effect of DNA sequence of Fab fragment on yield characteristics and cell growth of E. coli.

    Science.gov (United States)

    Kulmala, Antti; Huovinen, Tuomas; Lamminmäki, Urpo

    2017-06-19

    Codon usage is one of the factors influencing recombinant protein expression. We were interested in the codon usage of an antibody Fab fragment gene exhibiting extreme toxicity in the E. coli host. The toxic synthetic human Fab gene contained domains optimized by the "one amino acid-one codon" method. We redesigned five segments of the Fab gene with a "codon harmonization" method described by Angov et al. and studied the effects of these changes on cell viability, Fab yield and display on filamentous phage using different vectors and bacterial strains. The harmonization considerably reduced toxicity, increased Fab expression from negligible levels to 10 mg/l, and restored the display on phage. Testing the impact of the individual redesigned segments revealed that the most significant effects were conferred by changes in the constant domain of the light chain. For some of the Fab gene variants, we also observed striking differences in protein yields when cloned from a chloramphenicol resistant vector into an identical vector, except with ampicillin resistance. In conclusion, our results show that the expression of a heterodimeric secretory protein can be improved by harmonizing selected DNA segments by synonymous codons and reveal additional complexity involved in heterologous protein expression.

  11. DNA Barcoding for Identification of "Candidatus Phytoplasmas" Using a Fragment of the Elongation Factor Tu Gene

    DEFF Research Database (Denmark)

    Makarova, Olga; Contaldo, Nicoletta; Paltrinieri, Samanta

    2012-01-01

    Background Phytoplasmas are bacterial phytopathogens responsible for significant losses in agricultural production worldwide. Several molecular markers are available for identification of groups or strains of phytoplasmas. However, they often cannot be used for identification of phytoplasmas from...... different groups simultaneously or are too long for routine diagnostics. DNA barcoding recently emerged as a convenient tool for species identification. Here, the development of a universal DNA barcode based on the elongation factor Tu (tuf) gene for phytoplasma identification is reported. Methodology....../Principal Findings We designed a new set of primers and amplified a 420–444 bp fragment of tuf from all 91 phytoplasmas strains tested (16S rRNA groups -I through -VII, -IX through -XII, -XV, and -XX). Comparison of NJ trees constructed from the tuf barcode and a 1.2 kbp fragment of the 16S ribosomal gene revealed...

  12. Magnetic bead purification of labeled DNA fragments forhigh-throughput capillary electrophoresis sequencing

    Energy Technology Data Exchange (ETDEWEB)

    Elkin, Christopher; Kapur, Hitesh; Smith, Troy; Humphries, David; Pollard, Martin; Hammon, Nancy; Hawkins, Trevor

    2001-09-15

    We have developed an automated purification method for terminator sequencing products based on a magnetic bead technology. This 384-well protocol generates labeled DNA fragments that are essentially free of contaminates for less than $0.005 per reaction. In comparison to laborious ethanol precipitation protocols, this method increases the phred20 read length by forty bases with various DNA templates such as PCR fragments, Plasmids, Cosmids and RCA products. Our method eliminates centrifugation and is compatible with both the MegaBACE 1000 and ABIPrism 3700 capillary instruments. As of September 2001, this method has produced over 1.6 million samples with 93 percent averaging 620 phred20 bases as part of Joint Genome Institutes Production Process.

  13. Fragmentation

    Science.gov (United States)

    K.H. Riitters

    2009-01-01

    Effective resource management takes into account the administrative and biophysical settings within which natural resources occur. A setting may be described in many ways; for example, by forest land ownership, by reserved and roadless designation, or by the distribution of human populations in relation to forest (chapter 3). The physical arrangement of forest in a...

  14. DNA repair in PHA stimulated human lymphocytes

    International Nuclear Information System (INIS)

    Catena, C.; Mattoni, A.

    1984-01-01

    Damage an repair of radiation induced DNA strand breaks were measured by alkaline lysis and hydroxyapatite chromatography. PHA stimulated human lymphocytes show that the rejoining process is complete within the first 50 min., afterwords secondary DNA damage and chromatid aberration. DNA repair, in synchronized culture, allows to evaluate individual repair capacity and this in turn can contribute to the discovery of individual who, although they do not demonstrate apparent clinical signs, are carriers of DNA repair deficiency. Being evident that a correlation exists between DNA repair capacity and carcinogenesis, the possibility of evaluating the existent relationship between DNA repair and survival in tumor cells comes therefore into discussion

  15. Sex Determination from Fragmented and Degenerated DNA by Amplified Product-Length Polymorphism Bidirectional SNP Analysis of Amelogenin and SRY Genes

    Science.gov (United States)

    Masuyama, Kotoka; Shojo, Hideki; Nakanishi, Hiroaki; Inokuchi, Shota; Adachi, Noboru

    2017-01-01

    Sex determination is important in archeology and anthropology for the study of past societies, cultures, and human activities. Sex determination is also one of the most important components of individual identification in criminal investigations. We developed a new method of sex determination by detecting a single-nucleotide polymorphism in the amelogenin gene using amplified product-length polymorphisms in combination with sex-determining region Y analysis. We particularly focused on the most common types of postmortem DNA damage in ancient and forensic samples: fragmentation and nucleotide modification resulting from deamination. Amplicon size was designed to be less than 60 bp to make the method more useful for analyzing degraded DNA samples. All DNA samples collected from eight Japanese individuals (four male, four female) were evaluated correctly using our method. The detection limit for accurate sex determination was determined to be 20 pg of DNA. We compared our new method with commercial short tandem repeat analysis kits using DNA samples artificially fragmented by ultraviolet irradiation. Our novel method was the most robust for highly fragmented DNA samples. To deal with allelic dropout resulting from deamination, we adopted “bidirectional analysis,” which analyzed samples from both sense and antisense strands. This new method was applied to 14 Jomon individuals (3500-year-old bone samples) whose sex had been identified morphologically. We could correctly identify the sex of 11 out of 14 individuals. These results show that our method is reliable for the sex determination of highly degenerated samples. PMID:28052096

  16. Sex Determination from Fragmented and Degenerated DNA by Amplified Product-Length Polymorphism Bidirectional SNP Analysis of Amelogenin and SRY Genes.

    Directory of Open Access Journals (Sweden)

    Kotoka Masuyama

    Full Text Available Sex determination is important in archeology and anthropology for the study of past societies, cultures, and human activities. Sex determination is also one of the most important components of individual identification in criminal investigations. We developed a new method of sex determination by detecting a single-nucleotide polymorphism in the amelogenin gene using amplified product-length polymorphisms in combination with sex-determining region Y analysis. We particularly focused on the most common types of postmortem DNA damage in ancient and forensic samples: fragmentation and nucleotide modification resulting from deamination. Amplicon size was designed to be less than 60 bp to make the method more useful for analyzing degraded DNA samples. All DNA samples collected from eight Japanese individuals (four male, four female were evaluated correctly using our method. The detection limit for accurate sex determination was determined to be 20 pg of DNA. We compared our new method with commercial short tandem repeat analysis kits using DNA samples artificially fragmented by ultraviolet irradiation. Our novel method was the most robust for highly fragmented DNA samples. To deal with allelic dropout resulting from deamination, we adopted "bidirectional analysis," which analyzed samples from both sense and antisense strands. This new method was applied to 14 Jomon individuals (3500-year-old bone samples whose sex had been identified morphologically. We could correctly identify the sex of 11 out of 14 individuals. These results show that our method is reliable for the sex determination of highly degenerated samples.

  17. DNA barcoding for identification of 'Candidatus Phytoplasmas' using a fragment of the elongation factor Tu gene.

    Directory of Open Access Journals (Sweden)

    Olga Makarova

    Full Text Available Phytoplasmas are bacterial phytopathogens responsible for significant losses in agricultural production worldwide. Several molecular markers are available for identification of groups or strains of phytoplasmas. However, they often cannot be used for identification of phytoplasmas from different groups simultaneously or are too long for routine diagnostics. DNA barcoding recently emerged as a convenient tool for species identification. Here, the development of a universal DNA barcode based on the elongation factor Tu (tuf gene for phytoplasma identification is reported.We designed a new set of primers and amplified a 420-444 bp fragment of tuf from all 91 phytoplasmas strains tested (16S rRNA groups -I through -VII, -IX through -XII, -XV, and -XX. Comparison of NJ trees constructed from the tuf barcode and a 1.2 kbp fragment of the 16S ribosomal gene revealed that the tuf tree is highly congruent with the 16S rRNA tree and had higher inter- and intra- group sequence divergence. Mean K2P inter-/intra- group divergences of the tuf barcode did not overlap and had approximately one order of magnitude difference for most groups, suggesting the presence of a DNA barcoding gap. The use of the tuf barcode allowed separation of main ribosomal groups and most of their subgroups. Phytoplasma tuf barcodes were deposited in the NCBI GenBank and Q-bank databases.This study demonstrates that DNA barcoding principles can be applied for identification of phytoplasmas. Our findings suggest that the tuf barcode performs as well or better than a 1.2 kbp fragment of the 16S rRNA gene and thus provides an easy procedure for phytoplasma identification. The obtained sequences were used to create a publicly available reference database that can be used by plant health services and researchers for online phytoplasma identification.

  18. Multiple Determinations of Sperm DNA Fragmentation Show That Varicocelectomy Is Not Indicated for Infertile Patients with Subclinical Varicocele

    Directory of Open Access Journals (Sweden)

    Agustín García-Peiró

    2014-01-01

    Full Text Available Varicocele is one of the most common causes of low semen quality, which is reflected in high percentages of sperm cells with fragmented DNA. While varicocelectomy is usually performed to ameliorate a patient’s fertility, its impact on sperm DNA integrity in the case of subclinical varicocele is poorly documented. In this study, multiple DNA fragmentation analyses (TUNEL, SCD, and SCSA were performed on semen samples from sixty infertile patients with varicocele (15 clinical varicoceles, 19 clinical varicoceles after surgical treatment, 16 subclinical varicoceles, and 10 subclinical varicoceles after surgical treatment. TUNEL, SCD, and SCSA assays all showed substantial sperm DNA fragmentation levels that were comparable between subclinical and clinical varicocele patients. Importantly, varicocelectomy did improve sperm quality in patients with clinical varicocele; however, this was not the case in patients with subclinical varicocele. In summary, although infertile patients with clinical and subclinical varicocele have similar sperm DNA quality, varicocelectomy should only be advised for patients with clinical varicocele.

  19. Identification of column edges of DNA fragments by using K-means clustering and mean algorithm on lane histograms of DNA agarose gel electrophoresis images

    Science.gov (United States)

    Turan, Muhammed K.; Sehirli, Eftal; Elen, Abdullah; Karas, Ismail R.

    2015-07-01

    Gel electrophoresis (GE) is one of the most used method to separate DNA, RNA, protein molecules according to size, weight and quantity parameters in many areas such as genetics, molecular biology, biochemistry, microbiology. The main way to separate each molecule is to find borders of each molecule fragment. This paper presents a software application that show columns edges of DNA fragments in 3 steps. In the first step the application obtains lane histograms of agarose gel electrophoresis images by doing projection based on x-axis. In the second step, it utilizes k-means clustering algorithm to classify point values of lane histogram such as left side values, right side values and undesired values. In the third step, column edges of DNA fragments is shown by using mean algorithm and mathematical processes to separate DNA fragments from the background in a fully automated way. In addition to this, the application presents locations of DNA fragments and how many DNA fragments exist on images captured by a scientific camera.

  20. Nucleotide sequence preservation of human mitochondrial DNA

    International Nuclear Information System (INIS)

    Monnat, R.J. Jr.; Loeb, L.A.

    1985-01-01

    Recombinant DNA techniques have been used to quantitate the amount of nucleotide sequence divergence in the mitochondrial DNA population of individual normal humans. Mitochondrial DNA was isolated from the peripheral blood lymphocytes of five normal humans and cloned in M13 mp11; 49 kilobases of nucleotide sequence information was obtained from 248 independently isolated clones from the five normal donors. Both between- and within-individual differences were identified. Between-individual differences were identified in approximately = to 1/200 nucleotides. In contrast, only one within-individual difference was identified in 49 kilobases of nucleotide sequence information. This high degree of mitochondrial nucleotide sequence homogeneity in human somatic cells is in marked contrast to the rapid evolutionary divergence of human mitochondrial DNA and suggests the existence of mechanisms for the concerted preservation of mammalian mitochondrial DNA sequences in single organisms

  1. Fragmentation of chromatin DNA in mouse thymus cells after whole body γ-irradiation

    International Nuclear Information System (INIS)

    Wei Kang; Liu Xueying; Zhu Xuefen

    1984-01-01

    The characteristics of soluble chromatin in mouse thymus nuclei after whole body γ-irradiation were investigated by means of polyacrylamide gel electrophoresis. After deproteinization and electrophoresis eight regular DNA bands were revealed. The molecular weights of these bands were estimated by comparing their migration rates with those of the standard fragments obtained from PBR 322 digested completely by restrictive endonuclease Hae III. The molecular weight of the first band was calculated to be 186 base pairs corresponding approximately to the size of DNA fragment from a single nucleosome, and those of other bands appeared to be its multiples. The results suggested that the disintegration of chromatin DNA after γ-irradiation might have occurred at the linkage regions of chromatin. The autolysis product of normal thymus chromatin under sterile condition were also analyzed and its electrophoretic pattern was found to be just the same as that of the postirradiation product. It seems, therefore, that the endonuclease existing in normal tissues might be responsible for the postirradiation chromatin degradation. The mechanism of this kind of enzymatic digestion remains to be elucidated in further investigation. (author)

  2. DNA fragmentation and nuclear phenotype in tendons exposed to low-intensity infrared laser

    Science.gov (United States)

    de Paoli, Flavia; Ramos Cerqueira, Larissa; Martins Ramos, Mayara; Campos, Vera M.; Ferreira-Machado, Samara C.; Geller, Mauro; de Souza da Fonseca, Adenilson

    2015-03-01

    Clinical protocols are recommended in device guidelines outlined for treating many diseases on empirical basis. However, effects of low-intensity infrared lasers at fluences used in clinical protocols on DNA are controversial. Excitation of endogenous chromophores in tissues and free radicals generation could be described as a consequence of laser used. DNA lesions induced by free radicals cause changes in DNA structure, chromatin organization, ploidy degrees and cell death. In this work, we investigated whether low-intensity infrared laser therapy could alter the fibroblasts nuclei characteristics and induce DNA fragmentation. Tendons of Wistar rats were exposed to low-intensity infrared laser (830 nm), at different fluences (1, 5 and 10 J/cm2), in continuous wave (power output of 10mW, power density of 79.6 mW/cm2). Different frequencies were analyzed for the higher fluence (10 J/cm2), at pulsed emission mode (2.5, 250 and 2500 Hz), with the laser source at surface of skin. Geometric, densitometric and textural parameters obtained for Feulgen-stained nuclei by image analysis were used to define nuclear phenotypes. Significant differences were observed on the nuclear phenotype of tendons after exposure to laser, as well as, high cell death percentages was observed for all fluences and frequencies analyzed here, exception 1 J/cm2 fluence. Our results indicate that low-intensity infrared laser can alter geometric, densitometric and textural parameters in tendon fibroblasts nuclei. Laser can also induce DNA fragmentation, chromatin lost and consequently cell death, using fluences, frequencies and emission modes took out from clinical protocols.

  3. Sequence context effects on 8-methoxypsoralen photobinding to defined DNA fragments

    International Nuclear Information System (INIS)

    Sage, E.; Moustacchi, E.

    1987-01-01

    The photoreaction of 8-methoxypsoralen (8-MOP) with DNA fragments of defined sequence was studied. The authors took advantage of the blockage by bulky adducts of the 3'-5'-exonuclease activity associated with the T4 DNA polymerase. The action of the exonuclease is stopped by biadducts as well as by monoadducts. The termination products were analyzed on sequencing gels. A strong sequence specificity was observed in the DNA photobinding of 8-MOP. The exonuclease terminates its digestion near thymine residues, mainly at potentially cross-linkable sites. There is an increasing reactivity of thymine residues in the order T < TT << TTT in a GC environment. For thymine residues in cross-linkable sites, the reactivity follows the order AT << TA ∼ TAT << ATA < ATAT < ATATAA. Repeated A-T sequences are hot spots for the photochemical reaction of 8-MOP with DNA. Both monoadducts and interstrand cross-links are formed preferentially in 5'-TpA sites. The results highlight the role of the sequence and consequently of the conformation around a potential site in the photobinding of 8-MOP to DNA

  4. Continued colonization of the human genome by mitochondrial DNA.

    Directory of Open Access Journals (Sweden)

    Miria Ricchetti

    2004-09-01

    Full Text Available Integration of mitochondrial DNA fragments into nuclear chromosomes (giving rise to nuclear DNA sequences of mitochondrial origin, or NUMTs is an ongoing process that shapes nuclear genomes. In yeast this process depends on double-strand-break repair. Since NUMTs lack amplification and specific integration mechanisms, they represent the prototype of exogenous insertions in the nucleus. From sequence analysis of the genome of Homo sapiens, followed by sampling humans from different ethnic backgrounds, and chimpanzees, we have identified 27 NUMTs that are specific to humans and must have colonized human chromosomes in the last 4-6 million years. Thus, we measured the fixation rate of NUMTs in the human genome. Six such NUMTs show insertion polymorphism and provide a useful set of DNA markers for human population genetics. We also found that during recent human evolution, Chromosomes 18 and Y have been more susceptible to colonization by NUMTs. Surprisingly, 23 out of 27 human-specific NUMTs are inserted in known or predicted genes, mainly in introns. Some individuals carry a NUMT insertion in a tumor-suppressor gene and in a putative angiogenesis inhibitor. Therefore in humans, but not in yeast, NUMT integrations preferentially target coding or regulatory sequences. This is indeed the case for novel insertions associated with human diseases and those driven by environmental insults. We thus propose a mutagenic phenomenon that may be responsible for a variety of genetic diseases in humans and suggest that genetic or environmental factors that increase the frequency of chromosome breaks provide the impetus for the continued colonization of the human genome by mitochondrial DNA.

  5. Electron microscopic observations and DNA chain fragmentation studies on apoptosis in bone tumor cells induced by 153Sm-EDTMP

    International Nuclear Information System (INIS)

    Zhu Shoupeng; Xiao Dong; Han Xiaofeng

    1997-01-01

    The morphological changes observed by electron microscopy indicate that after internal irradiation with 153 Sm-EDTMP bone tumor cells displayed feature of apoptosis, such as margination of condensed chromatin, chromatin fragmentation, as well as the membrane bounded apoptotic bodies formation. The quantification analysis of fragmentation DNA for bone tumor cells induced by 153 Sm-EDTMP shows that the DNA fragmentation is enhanced with the prolongation of internally irradiated time. These characteristics suggest that 153 Sm-EDTMP internal irradiation could induce bone tumor cells to go to apoptosis

  6. Human mitochondrial DNA (mtDNA) types in Malaysia

    International Nuclear Information System (INIS)

    Lian, L.H.; Koh, C.L.; Lim, M.E.

    2000-01-01

    Each human cell contains hundreds of mitochondria and thousands of double-stranded circular mtDNA. The delineation of human mtDNA variation and genetics over the past decade has provided unique and often startling insights into human evolution, degenerative diseases, and aging. Each mtDNA of 16,569 base pairs, encodes 13 polypeptides essential to the enzymes of the mitochondrial energy generating pathway, plus the necessary tRNAs and rRNAs. The highly polymorphic noncoding D-(displacement) loop region, also called the control region, is approximately 1.2 kb long. It contains two well-characterized hypervariable (HV-) regions, HV1 and HV2. MtDNA identification is usually based on these sequence differences. According to the TWTGDAM (Technical Working Group for DNA Analysis Methods), the minimum requirement for a mtDNA database for HV1 is from positions 16024 to 16365 and for HV2, from positions 00073 to 00340. The targeted Malaysian population subgroups for this study were mainly the Malays, Chinese, Indians, and indigenous Ibans, Bidayuhs, Kadazan-Dusuns, and Bajaus. Research methodologies undertaken included DNA extraction of samples from unrelated individuals, amplification of the specific regions via the polymerase chain reaction (PCR), and preparation of template DNA for sequencing by using an automated DNA sequencer. Sufficient nucleotide sequence data were generated from the mtDNA analysis. When the sequences were analyzed, sequence variations were found to be caused by nucleotide substitutions, insertions, and deletions. Of the three causes of the sequence variations, nucleotide substitutions (86.1%) accounted for the vast majority of polymorphism. It is noted that transitions (83.5%) were predominant when compared to the significantly lower frequencies of transversions (2.6%). Insertions (0.9%) and deletions (13.0%) were rather rare and found only in HV2. The data generated will also form the basis of a Malaysian DNA sequence database of mtDNA D

  7. The roles of family B and D DNA polymerases in Thermococcus species 9°N Okazaki fragment maturation.

    Science.gov (United States)

    Greenough, Lucia; Kelman, Zvi; Gardner, Andrew F

    2015-05-15

    During replication, Okazaki fragment maturation is a fundamental process that joins discontinuously synthesized DNA fragments into a contiguous lagging strand. Efficient maturation prevents repeat sequence expansions, small duplications, and generation of double-stranded DNA breaks. To address the components required for the process in Thermococcus, Okazaki fragment maturation was reconstituted in vitro using purified proteins from Thermococcus species 9°N or cell extracts. A dual color fluorescence assay was developed to monitor reaction substrates, intermediates, and products. DNA polymerase D (polD) was proposed to function as the replicative polymerase in Thermococcus replicating both the leading and the lagging strands. It is shown here, however, that it stops before the previous Okazaki fragments, failing to rapidly process them. Instead, Family B DNA polymerase (polB) was observed to rapidly fill the gaps left by polD and displaces the downstream Okazaki fragment to create a flap structure. This flap structure was cleaved by flap endonuclease 1 (Fen1) and the resultant nick was ligated by DNA ligase to form a mature lagging strand. The similarities to both bacterial and eukaryotic systems and evolutionary implications of archaeal Okazaki fragment maturation are discussed. © 2015 by The American Society for Biochemistry and Molecular Biology, Inc.

  8. The Roles of Family B and D DNA Polymerases in Thermococcus Species 9°N Okazaki Fragment Maturation*

    Science.gov (United States)

    Greenough, Lucia; Kelman, Zvi; Gardner, Andrew F.

    2015-01-01

    During replication, Okazaki fragment maturation is a fundamental process that joins discontinuously synthesized DNA fragments into a contiguous lagging strand. Efficient maturation prevents repeat sequence expansions, small duplications, and generation of double-stranded DNA breaks. To address the components required for the process in Thermococcus, Okazaki fragment maturation was reconstituted in vitro using purified proteins from Thermococcus species 9°N or cell extracts. A dual color fluorescence assay was developed to monitor reaction substrates, intermediates, and products. DNA polymerase D (polD) was proposed to function as the replicative polymerase in Thermococcus replicating both the leading and the lagging strands. It is shown here, however, that it stops before the previous Okazaki fragments, failing to rapidly process them. Instead, Family B DNA polymerase (polB) was observed to rapidly fill the gaps left by polD and displaces the downstream Okazaki fragment to create a flap structure. This flap structure was cleaved by flap endonuclease 1 (Fen1) and the resultant nick was ligated by DNA ligase to form a mature lagging strand. The similarities to both bacterial and eukaryotic systems and evolutionary implications of archaeal Okazaki fragment maturation are discussed. PMID:25814667

  9. Human Chromosome 7: DNA Sequence and Biology

    OpenAIRE

    Scherer, Stephen W.; Cheung, Joseph; MacDonald, Jeffrey R.; Osborne, Lucy R.; Nakabayashi, Kazuhiko; Herbrick, Jo-Anne; Carson, Andrew R.; Parker-Katiraee, Layla; Skaug, Jennifer; Khaja, Razi; Zhang, Junjun; Hudek, Alexander K.; Li, Martin; Haddad, May; Duggan, Gavin E.

    2003-01-01

    DNA sequence and annotation of the entire human chromosome 7, encompassing nearly 158 million nucleotides of DNA and 1917 gene structures, are presented. To generate a higher order description, additional structural features such as imprinted genes, fragile sites, and segmental duplications were integrated at the level of the DNA sequence with medical genetic data, including 440 chromosome rearrangement breakpoints associated with disease. This approach enabled the discovery of candidate gene...

  10. Mapped DNA probes from Ioblolly pine can be used for restriction fragment length polymorphism mapping in other conifers

    Science.gov (United States)

    M.R. Ahuja; M.E. Devey; A.T. Groover; K.D. Jermstad; D.B Neale

    1994-01-01

    A high-density genetic map based on restriction fragment length polymorphisms (RFLPs) is being constructed for loblolly pine (Pinus taeda L.). Consequently, a large number of DNA probes from loblolly pine are potentially available for use in other species. We have used some of these DNA probes to detect RFLPs in 12 conifers and an angiosperm....

  11. GC-Rich Extracellular DNA Induces Oxidative Stress, Double-Strand DNA Breaks, and DNA Damage Response in Human Adipose-Derived Mesenchymal Stem Cells.

    Science.gov (United States)

    Kostyuk, Svetlana; Smirnova, Tatiana; Kameneva, Larisa; Porokhovnik, Lev; Speranskij, Anatolij; Ershova, Elizaveta; Stukalov, Sergey; Izevskaya, Vera; Veiko, Natalia

    2015-01-01

    Cell free DNA (cfDNA) circulates throughout the bloodstream of both healthy people and patients with various diseases. CfDNA is substantially enriched in its GC-content as compared with human genomic DNA. Exposure of haMSCs to GC-DNA induces short-term oxidative stress (determined with H2DCFH-DA) and results in both single- and double-strand DNA breaks (comet assay and γH2AX, foci). As a result in the cells significantly increases the expression of repair genes (BRCA1 (RT-PCR), PCNA (FACS)) and antiapoptotic genes (BCL2 (RT-PCR and FACS), BCL2A1, BCL2L1, BIRC3, and BIRC2 (RT-PCR)). Under the action of GC-DNA the potential of mitochondria was increased. Here we show that GC-rich extracellular DNA stimulates adipocyte differentiation of human adipose-derived mesenchymal stem cells (haMSCs). Exposure to GC-DNA leads to an increase in the level of RNAPPARG2 and LPL (RT-PCR), in the level of fatty acid binding protein FABP4 (FACS analysis) and in the level of fat (Oil Red O). GC-rich fragments in the pool of cfDNA can potentially induce oxidative stress and DNA damage response and affect the direction of mesenchymal stem cells differentiation in human adipose-derived mesenchymal stem cells. Such a response may be one of the causes of obesity or osteoporosis.

  12. DNA repair in human bronchial epithelial cells

    International Nuclear Information System (INIS)

    Fornace, A.J. Jr.; Lechner, J.F.; Grafstrom, R.C.; Harris, C.C.

    1982-01-01

    The purpose of this investigation was to compare the response of human cell types (bronchial epithelial cells and fibroblasts and skin fibroblasts) to various DNA damaging agents. Repair of DNA single strand breaks (SSB) induced by 5 krads of X-ray was similar for all cell types; approximately 90% of the DNA SSB were rejoined within one hour. During excision repair of DNA damage from u.v.-radiation, the frequencies of DNA SSB as estimated by the alkaline elution technique, were similar in all cell types. Repair replication as measured by BND cellulose chromatography was also similar in epithelial and fibroblastic cells after u.v.-irradiation. Similar levels of SSB were also observed in epithelial and fibroblastic cells after exposure to chemical carcinogens: 7,12-dimethylbenz[a]anthracene; benzo[a]pyrene diol epoxide (BPDE); or N-methyl-N-nitro-N-nitrosoguanidine. Significant repair replication of BPDE-induced DNA damage was detected in both bronchial epithelial and fibroblastic cells, although the level in fibroblasts was approximately 40% of that in epithelial cells. The pulmonary carcinogen asbestos did not damage DNA. DNA-protein crosslinks induced by formaldehyde were rapidly removed in bronchial cells. Further, epithelial and fibroblastic cells, which were incubated with formaldehyde and the polymerase inhibitor combination of cytosine arabinoside and hydroxyurea, accumulated DNA SSB at approximately equal frequencies. These results should provide a useful background for further investigations of the response of human bronchial cells to various DNA damaging agents

  13. DNA Methylation Landscapes of Human Fetal Development

    NARCIS (Netherlands)

    Slieker, Roderick C.; Roost, Matthias S.; van Iperen, Liesbeth; Suchiman, H. Eka D; Tobi, Elmar W.; Carlotti, Françoise; de Koning, Eelco J P; Slagboom, P. Eline; Heijmans, Bastiaan T.; Chuva de Sousa Lopes, Susana M.

    2015-01-01

    Remodelling the methylome is a hallmark of mammalian development and cell differentiation. However, current knowledge of DNA methylation dynamics in human tissue specification and organ development largely stems from the extrapolation of studies in vitro and animal models. Here, we report on the DNA

  14. The effect of swim-up and gradient sperm preparation techniques on deoxyribonucleic acid (DNA) fragmentation in subfertile patients.

    Science.gov (United States)

    Oguz, Yuksel; Guler, Ismail; Erdem, Ahmet; Mutlu, Mehmet Firat; Gumuslu, Seyhan; Oktem, Mesut; Bozkurt, Nuray; Erdem, Mehmet

    2018-03-23

    To compare the effect of two different sperm preparation techniques, including swim-up and gradient methods on sperm deoxyribonucleic acid (DNA) fragmentation status of semen samples from unexplained and mild male factor subfertile patients undergoing intrauterine insemination (IUI). A prospective randomized study was conducted in 65 subfertile patients, including 34 unexplained and 31 male factor infertility to compare basal and post-procedure DNA fragmentation rates in swim-up and gradient techniques. Sperm DNA fragmentation rates were evaluated by a sperm chromatin dispersion (SCD) test in two portions of each sample of semen that was prepared with either swim-up or gradient techniques. Sperm motility and morphology were also assessed based on WHO 2010 criteria. Swim-up but not gradient method yielded a statistically significant reduction in the DNA fragmented sperm rate after preparation as compared to basal rates, in the semen samples of both unexplained (41.85 ± 22.04 vs. 28.58 ± 21.93, p gradient) and mild male factor (46.61 ± 19.38 vs. 30.32 ± 18.20, p gradient) subgroups. Swim-up method significantly reduces sperm DNA fragmentation rates and may have some prognostic value on intrauterine insemination in patients with decreased sperm DNA integrity.

  15. A LDR-PCR approach for multiplex polymorphisms genotyping of severely degraded DNA with fragment sizes <100 bp.

    Science.gov (United States)

    Zhang, Zhen; Wang, Bao-Jie; Guan, Hong-Yu; Pang, Hao; Xuan, Jin-Feng

    2009-11-01

    Reducing amplicon sizes has become a major strategy for analyzing degraded DNA typical of forensic samples. However, amplicon sizes in current mini-short tandem repeat-polymerase chain reaction (PCR) and mini-sequencing assays are still not suitable for analysis of severely degraded DNA. In this study, we present a multiplex typing method that couples ligase detection reaction with PCR that can be used to identify single nucleotide polymorphisms and small-scale insertion/deletions in a sample of severely fragmented DNA. This method adopts thermostable ligation for allele discrimination and subsequent PCR for signal enhancement. In this study, four polymorphic loci were used to assess the ability of this technique to discriminate alleles in an artificially degraded sample of DNA with fragment sizes <100 bp. Our results showed clear allelic discrimination of single or multiple loci, suggesting that this method might aid in the analysis of extremely degraded samples in which allelic drop out of larger fragments is observed.

  16. Seasonal changes of DNA fragmentation and quality of raw and cold-stored stallion spermatozoa.

    Science.gov (United States)

    Wach-Gygax, L; Burger, D; Malama, E; Bollwein, H; Fleisch, A; Jeannerat, E; Thomas, S; Schuler, G; Janett, F

    2017-09-01

    In this study annual fluctuations of DNA fragmentation and quality of cold-stored equine sperm were evaluated. Ejaculates were collected weekly during one year from 15 stallions. Ejaculate volume, sperm concentration and total sperm count were determined and semen was then extended and cold-stored for 48 h. Sperm motility was evaluated by CASA before and after 24 as well as 48 h of cold storage. In addition, the percentages of sperm with intact plasma membrane and acrosome (PMAI %) and with low intracellular Ca 2+ level were determined in cold-stored semen (24 h, 48 h). SCSA™ was performed to assess mean DFI, SD of DFI and % DFI in raw frozen-thawed as well as in extended sperm after 24 and 48 h of storage. The month of semen collection affected (P sperm concentration lower in summer compared to winter and motility lower in July than in any other month of the year (P sperm with low intracellular Ca +2 level (%) after storage for 24 and 48 h, higher values were measured in winter and in October compared to April, June and July (P sperm. Semen quality was impaired in midsummer when low sperm motility and viability were combined with an elevated DNA fragmentation and Ca 2+ level of sperm. Copyright © 2017. Published by Elsevier Inc.

  17. Preparation of a differentially expressed, full-length cDNA expression library by RecA-mediated triple-strand formation with subtractively enriched cDNA fragments

    NARCIS (Netherlands)

    Hakvoort, T. B.; Spijkers, J. A.; Vermeulen, J. L.; Lamers, W. H.

    1996-01-01

    We have developed a fast and general method to obtain an enriched, full-length cDNA expression library with subtractively enriched cDNA fragments. The procedure relies on RecA-mediated triple-helix formation of single-stranded cDNA fragments with a double-stranded cDNA plasmid library. The complexes

  18. Enhanced resolution of DNA restriction fragments: A procedure by two-dimensional electrophoresis and double-labeling

    International Nuclear Information System (INIS)

    Yi, M.; Au, L.C.; Ichikawa, N.; Ts'o, P.O.

    1990-01-01

    A probe-free method was developed to detect DNA rearrangement in bacteria based on the electrophoretic separation of twice-digested restriction fragments of genomic DNA into a two-dimensional (2-D) pattern. The first restriction enzyme digestion was done in solution, followed by electrophoresis of the restriction fragments in one dimension. A second restriction enzyme digestion was carried out in situ in the gel, followed by electrophoresis in a second dimension perpendicular to the first electrophoresis. The 2-D pattern provides for the resolution of 300-400 spots, which are defined and indexed by an x,y coordinate system with size markers. This approach has greatly increased the resolution power over conventional one-dimensional (1-D) electrophoresis. To study DNA rearrangement, a 2-D pattern from a test strain was compared with the 2-D pattern from a reference strain. After the first digestion, genomic DNA fragments from the test strain were labeled with 35S, while those from the reference strain were labeled with 32P. This was done to utilize the difference in the energy emission of 35S and 32P isotopes for autoradiography when two x-ray films were exposed simultaneously on top of the gel after the 2-D electrophoresis. The irradiation from the decay of 35S exposed only the lower film, whereas the irradiation from the decay of 32P exposed both the lower and upper films. Different DNA fragments existed in the test DNA compared with the reference DNA can be identified unambiguously by the differential two 2-D patterns produced on two films upon exposure to the 35S and 32P fragments in the same gel. An appropriate photographic procedure further simplified the process, allowing only the difference in DNA fragments between these two patterns to be shown in the map

  19. Human diseases associated with defective DNA repair

    International Nuclear Information System (INIS)

    Friedberg, E.C.; Ehmann, U.K.; Williams, J.I.

    1979-01-01

    The observations on xeroderma pigmentosum (XP) cells in culture were the first indications of defective DNA repair in association with human disease. Since then, a wealth of information on DNA repair in XP, and to a lesser extent in other diseases, has accumulated in the literature. Rather than clarifying the understanding of DNA repair mechanisms in normal cells and of defective DNA repair in human disease, the literature suggests an extraordinary complexity of both of the phenomena. In this review a number of discrete human diseases are considered separately. An attempt was made to systematically describe the pertinent clinical features and cellular and biochemical defects in these diseases, with an emphasis on defects in DNA metabolism, particularly DNA repair. Wherever possible observations have been correlated and unifying hypotheses presented concerning the nature of the basic defect(s) in these diseases. Discussions of the following diseases are presented: XP, ataxia telangiectasia; Fanconi's anemia; Hutchinson-Gilford progeria syndrome; Bloom's syndrome, Cockayne's syndrome; Down's syndrome; retinoblastoma; chronic lymphocytic leukemia; and other miscellaneous human diseases with possble DNA repair defects

  20. The future of human DNA vaccines.

    Science.gov (United States)

    Li, Lei; Saade, Fadi; Petrovsky, Nikolai

    2012-12-31

    DNA vaccines have evolved greatly over the last 20 years since their invention, but have yet to become a competitive alternative to conventional protein or carbohydrate based human vaccines. Whilst safety concerns were an initial barrier, the Achilles heel of DNA vaccines remains their poor immunogenicity when compared to protein vaccines. A wide variety of strategies have been developed to optimize DNA vaccine immunogenicity, including codon optimization, genetic adjuvants, electroporation and sophisticated prime-boost regimens, with each of these methods having its advantages and limitations. Whilst each of these methods has contributed to incremental improvements in DNA vaccine efficacy, more is still needed if human DNA vaccines are to succeed commercially. This review foresees a final breakthrough in human DNA vaccines will come from application of the latest cutting-edge technologies, including "epigenetics" and "omics" approaches, alongside traditional techniques to improve immunogenicity such as adjuvants and electroporation, thereby overcoming the current limitations of DNA vaccines in humans. Copyright © 2012 Elsevier B.V. All rights reserved.

  1. Spontaneous unscheduled DNA synthesis in human lymphocytes

    International Nuclear Information System (INIS)

    Forell, B.; Myers, L.S. Jr.; Norman, A.

    1979-01-01

    The rate of spontaneous unscheduled DNA synthesis in human lymphocytes was estimated from measurements of tritiated thymidine incorporation into double-stranded DNA (ds-DNA) during incubation of cells in vitro. The contribution of scheduled DNA synthesis to the observed incorporation was reduced by inhibiting replication with hydroxyurea and by separating freshly replicated single-stranded DNA (ss-DNA) from repaired ds-DNA by column chromatography. The residual contribution of scheduled DNA synthesis was estimated by observing effects on thymidine incorporation of: (a) increasing the rate of production of apurinic sites, and alternatively, (b) increasing the number of cells in S-phase. Corrections based on estimates of endogenous pool size were also made. The rate of spontaneous unscheduled DNA synthesis is estimated to be 490 +- 120 thymidine molecules incorporated per cell per hour. These results compare favorably with estimates made from rates of depurination and depyrimidination of DNA, measured in molecular systems if we assume thymidine is incorporated by a short patch mechanism which incorporates an average of four bases per lesion

  2. Apple Flavonoids Suppress Carcinogen-Induced DNA Damage in Normal Human Bronchial Epithelial Cells

    Directory of Open Access Journals (Sweden)

    Vazhappilly Cijo George

    2017-01-01

    Full Text Available Scope. Human neoplastic transformation due to DNA damage poses an increasing global healthcare concern. Maintaining genomic integrity is crucial for avoiding tumor initiation and progression. The present study aimed to investigate the efficacy of an apple flavonoid fraction (AF4 against various carcinogen-induced toxicity in normal human bronchial epithelial cells and its mechanism of DNA damage response and repair processes. Methods and Results. AF4-pretreated cells were exposed to nicotine-derived nitrosamine ketones (NNK, NNK acetate (NNK-Ae, methotrexate (MTX, and cisplatin to validate cytotoxicity, total reactive oxygen species, intracellular antioxidants, DNA fragmentation, and DNA tail damage. Furthermore, phosphorylated histone (γ-H2AX and proteins involved in DNA damage (ATM/ATR, Chk1, Chk2, and p53 and repair (DNA-PKcs and Ku80 mechanisms were evaluated by immunofluorescence and western blotting, respectively. The results revealed that AF4-pretreated cells showed lower cytotoxicity, total ROS generation, and DNA fragmentation along with consequent inhibition of DNA tail moment. An increased level of γ-H2AX and DNA damage proteins was observed in carcinogen-treated cells and that was significantly (p≤0.05 inhibited in AF4-pretreated cells, in an ATR-dependent manner. AF4 pretreatment also facilitated the phosphorylation of DNA-PKcs and thus initiation of repair mechanisms. Conclusion. Apple flavonoids can protect in vitro oxidative DNA damage and facilitate repair mechanisms.

  3. Is there a relationship between the chromatin status and DNA fragmentation of boar spermatozoa following freezing-thawing?

    Science.gov (United States)

    Fraser, L; Strzezek, J

    2007-07-15

    In this study a radioisotope method, which is based on the quantitative measurements of tritiated-labeled actinomycin D ((3)H-AMD) incorporation into the sperm nuclei ((3)H-AMD incorporation assay), was used to assess the chromatin status of frozen-thawed boar spermatozoa. This study also tested the hypothesis that frozen-thawed spermatozoa with altered chromatin were susceptible to DNA fragmentation measured with the neutral comet assay (NCA). Boar semen was diluted in lactose-hen egg yolk-glycerol extender (L-HEY) or lactose ostrich egg yolk lipoprotein fractions-glycerol extender (L-LPFo), packaged into aluminum tubes or plastic straws and frozen in a controlled programmable freezer. In Experiment 1, the chromatin status and DNA fragmentation were measured in fresh and frozen-thawed spermatozoa from the same ejaculates. There was a significant increase in sperm chromatin destabilization and DNA fragmentation in frozen-thawed semen as compared with fresh semen. The proportions of spermatozoa labeled with (3)H-AMD were concurrent with elevated levels of sperm DNA fragmentation in K-3 extender, without cryoprotective substances, compared with L-HEY or L-LPFo extender. Regression analysis revealed that the results of the (3)H-AMD incorporation assay and NCA for frozen-thawed spermatozoa were correlated. Boars differed significantly in terms of post-thaw sperm DNA damage. In Experiment 2, the susceptibility of sperm chromatin to decondensation was assessed using a low concentration of heparin. Treatment of frozen-thawed spermatozoa with heparin revealed enhanced (3)H-AMD binding, suggesting nuclear chromatin decondensation. The deterioration in post-thaw sperm viability, such as motility, mitochondrial function and plasma membrane integrity, was concurrent with increased chromatin instability and DNA fragmentation. This is the first report to show that freezing-thawing procedure facilitated destabilization in the chromatin structure of boar spermatozoa, resulting in

  4. cDNA cloning, sequence analysis, and chromosomal localization of the gene for human carnitine palmitoyltransferase

    International Nuclear Information System (INIS)

    Finocchiaro, G.; Taroni, F.; Martin, A.L.; Colombo, I.; Tarelli, G.T.; DiDonato, S.; Rocchi, M.

    1991-01-01

    The authors have cloned and sequenced a cDNA encoding human liver carnitine palmitoyltransferase an inner mitochondrial membrane enzyme that plays a major role in the fatty acid oxidation pathway. Mixed oligonucleotide primers whose sequences were deduced from one tryptic peptide obtained from purified CPTase were used in a polymerase chain reaction, allowing the amplification of a 0.12-kilobase fragment of human genomic DNA encoding such a peptide. A 60-base-pair (bp) oligonucleotide synthesized on the basis of the sequence from this fragment was used for the screening of a cDNA library from human liver and hybridized to a cDNA insert of 2255 bp. This cDNA contains an open reading frame of 1974 bp that encodes a protein of 658 amino acid residues including 25 residues of an NH 2 -terminal leader peptide. The assignment of this open reading frame to human liver CPTase is confirmed by matches to seven different amino acid sequences of tryptic peptides derived from pure human CPTase and by the 82.2% homology with the amino acid sequence of rat CPTase. The NH 2 -terminal region of CPTase contains a leucine-proline motif that is shared by carnitine acetyl- and octanoyltransferases and by choline acetyltransferase. The gene encoding CPTase was assigned to human chromosome 1, region 1q12-1pter, by hybridization of CPTase cDNA with a DNA panel of 19 human-hanster somatic cell hybrids

  5. DNA excision repair in permeable human fibroblasts

    International Nuclear Information System (INIS)

    Kaufmann, W.K.; Bodell, W.J.; Cleaver, J.E.

    1983-01-01

    U.v. irradiation of confluent human fibroblasts activated DNA repair, aspects of which were characterized in the cells after they were permeabilized. Incubation of intact cells for 20 min between irradiation and harvesting was necessary to obtain a maximum rate of reparative DNA synthesis. Cells harvested immediately after irradiation before repair was initiated displayed only a small stimulation of DNA synthesis, indicating that permeable cells have a reduced capacity to recognize pyrimidine dimers and activate repair. The distribution of sizes of DNA strands labeled during 10 min of reparative DNA synthesis resembled that of parental DNA. However, during a 60-min incubation of permeable cells at 37 degrees C, parental DNA and DNA labeled by reparative DNA synthesis were both cleaved to smaller sizes. Cleavage also occurred in unirradiated cells, indicating that endogenous nuclease was active during incubation. Repair patches synthesized in permeable cells displayed increased sensitivity to digestion by micrococcal nuclease. However, the change in sensitivity during a chase with unlabeled DNA precursors was small, suggesting that reassembly of nucleosome structure at sites of repair was impaired. To examine whether this deficiency was due to a preponderance of incomplete or unligated repair patches, 3H-labeled (repaired) DNA was purified, then digested with exonuclease III and nuclease S1 to probe for free 3' ends and single-stranded regions. About 85% of the [3H]DNA synthesized during a 10-min pulse resisted digestion, suggesting that a major fraction of the repair patches that were filled were also ligated. U.v. light-activated DNA synthesis in permeable cells, therefore, appears to represent the continuation of reparative gap-filling at sites of excision repair activated within intact cells. Gap-filling and ligation were comparatively efficient processes in permeable cells

  6. Analysis of mutation/rearrangement frequencies and methylation patterns at a given DNA locus using restriction fragment length polymorphism.

    Science.gov (United States)

    Boyko, Alex; Kovalchuk, Igor

    2010-01-01

    Restriction fragment length polymorphism (RFLP) is a difference in DNA sequences of organisms belonging to the same species. RFLPs are typically detected as DNA fragments of different lengths after digestion with various restriction endonucleases. The comparison of RFLPs allows investigators to analyze the frequency of occurrence of mutations, such as point mutations, deletions, insertions, and gross chromosomal rearrangements, in the progeny of stressed plants. The assay involves restriction enzyme digestion of DNA followed by hybridization of digested DNA using a radioactively or enzymatically labeled probe. Since DNA can be digested with methylation sensitive enzymes, the assay can also be used to analyze a methylation pattern of a particular locus. Here, we describe RFLP analysis using methylation-insensitive and methylation-sensitive enzymes.

  7. DNA fingerprinting of Mycobacterium leprae strains using variable number tandem repeat (VNTR) - fragment length analysis (FLA).

    Science.gov (United States)

    Jensen, Ronald W; Rivest, Jason; Li, Wei; Vissa, Varalakshmi

    2011-07-15

    presence of the desired DNA segments, and then submitted for fluorescent fragment length analysis (FLA) using capillary electrophoresis. DNA from armadillo passaged bacteria with a known number of repeat copies for each locus is used as a positive control. The FLA chromatograms are then examined using Peak Scanner software and fragment length is converted to number of VNTR copies (allele). Finally, the VNTR haplotypes are analyzed for patterns, and when combined with patient clinical data can be used to track distribution of strain types.

  8. TbPIF5 is a Trypanosoma brucei mitochondrial DNA helicase involved in processing of minicircle Okazaki fragments.

    Directory of Open Access Journals (Sweden)

    Beiyu Liu

    2009-09-01

    Full Text Available Trypanosoma brucei's mitochondrial genome, kinetoplast DNA (kDNA, is a giant network of catenated DNA rings. The network consists of a few thousand 1 kb minicircles and several dozen 23 kb maxicircles. Here we report that TbPIF5, one of T. brucei's six mitochondrial proteins related to Saccharomyces cerevisiae mitochondrial DNA helicase ScPIF1, is involved in minicircle lagging strand synthesis. Like its yeast homolog, TbPIF5 is a 5' to 3' DNA helicase. Together with other enzymes thought to be involved in Okazaki fragment processing, TbPIF5 localizes in vivo to the antipodal sites flanking the kDNA. Minicircles in wild type cells replicate unidirectionally as theta-structures and are unusual in that Okazaki fragments are not joined until after the progeny minicircles have segregated. We now report that overexpression of TbPIF5 causes premature removal of RNA primers and joining of Okazaki fragments on theta structures. Further elongation of the lagging strand is blocked, but the leading strand is completed and the minicircle progeny, one with a truncated H strand (ranging from 0.1 to 1 kb, are segregated. The minicircles with a truncated H strand electrophorese on an agarose gel as a smear. This replication defect is associated with kinetoplast shrinkage and eventual slowing of cell growth. We propose that TbPIF5 unwinds RNA primers after lagging strand synthesis, thus facilitating processing of Okazaki fragments.

  9. Flexible bent rod model with a saturating induced dipole moment to study the electric linear dichroism of DNA fragments

    Science.gov (United States)

    Bertolotto, Jorge A.; Umazano, Juan P.

    2016-06-01

    In the present work we make a theoretical study of the steady state electric linear dichroism of DNA fragments in aqueous solution. The here developed theoretical approach considers a flexible bent rod model with a saturating induced dipole moment. The electric polarizability tensor of bent DNA fragments is calculated considering a phenomenological model which theoretical and experimental backgroung is presented here. The model has into account the electric polarizability longitudinal and transversal to the macroion. Molecular flexibility is described using an elastic potential. We consider DNA fragments originally bent with bending fluctuations around an average bending angle. The induced dipole moment is supposed constant once the electric field strength grows up at critical value. To calculate the reduced electric linear dichroism we determine the optical factor considering the basis of the bent DNA perpendicular to the molecular axis. The orientational distribution function has into account the anisotropic electric properties and the molecule flexibility. We applied the present theoretical background to fit electric dichroism experimental data of DNA fragments reported in the bibliography in a wide range of molecular weight and electric field. From these fits, values of DNA physical properties are estimated. We compare and discuss the results here obtained with the theoretical and experimental data presented by other authors. The original contributions of this work are: the inclusion of the transversal electric polarizability saturating with the electric field, the description of the electric properties with an electric polarizability tensor dependant on the bending angle and the use of an arc model originally bent.

  10. [Value of specific 16S rDNA fragment of algae in diagnosis of drowning: an experiment with rabbits].

    Science.gov (United States)

    Li, Peng; Xu, Qu-Yi; Chen, Ling; Liu, Chao; Zhao, Jian; Wang, Yu-Zhong; Yu, Zheng-Liang; Hu, Sun-Lin; Wang, Hui-Jun

    2015-08-01

    To establish a method for amplifying specific 16S rDNA fragment of algae related with drowning and test its value in drowning diagnosis. Thirty-five rabbits were randomly divided into 3 the drowning group (n=15), postmortem water immersion group (n=15, subjected to air embolism before seawater immersion), and control group(n=5, with air embolism only). Twenty samples of the liver tissues from human corpses found in water were also used, including 14 diatom-positive and 6 diatom-negative samples identified by microwave digestion-vacuum filtration-automated scanning electron microscopy (MD-VF-Auto SEM). Seven known species of algae served as the control algae (Melosira sp, Nitzschia sp, Synedra sp, Navicula sp, Microcystis sp, Cyclotella meneghiniana, and Chlorella sp). The total DNA was extracted from the tissues and algae to amplify the specific fragment of algae followed by 8% polyacrylamide gelelectrophoresis and sliver-staining. In the drowning group, algae was detected in the lungs (100%), liver (86%), and kidney (86%); algae was detected in the lungs in 2 rabbits in the postmortem group (13%) and none in the control group. The positivity rates of algae were significantly higher in the drowning group than in the postmortem group (Palgae, including sample that had been identified as diatom-negative by MD-VF-Auto SEM. All the 7 control algae samples yielded positive results in PCR. The PCR-based method has a high sensitivity in algae detection for drowning diagnosis and allows simultaneous detection of multiple algae species related with drowning.

  11. CHARACTERIZATION OF 0.58 kb DNA STILBENE SYNTHASE ENCODING GENE FRAGMENT FROM MELINJO PLANT (Gnetum gnemon

    Directory of Open Access Journals (Sweden)

    Tri Joko Raharjo

    2011-12-01

    Full Text Available Resveratrol is a potent anticancer agent resulted as the main product of enzymatic reaction between common precursor in plants and Stilbene Synthase enzyme, which is expressed by sts gene. Characterization of internal fragment of Stilbene Synthase (STS encoding gene from melinjo plant (Gnetum gnemon L. has been carried out as part of a larger work to obtain a full length of Stilbene Synthase encoding gene of the plant. RT-PCR (Reverse Transcriptase Polymerase Chain Reaction was performed using two degenerated primers to amplify the gene fragment. Ten published STS conserved amino acid sequences from various plant species from genebank were utilized to construct a pair of GGF2 (5' GTTCCACCTGCGAAGCAGCC 3' and GGR2 (5' CTGGATCGCACATCC TGGTG 3' primers. Both designed primers were predicted to be in the position of 334-354 and 897-916 kb of the gene respectively. Total RNA isolated from melinjo leaves was used as template for the RT-PCR amplification process using two-step technique. A collection of 0.58 DNA fragments was generated from RT-PCR amplification and met the expected results. The obtained DNA fragments were subsequently isolated, refined and sequenced. A nucleotide sequence analysis was accomplished by comparing it to the existed sts genes available in genebank. Homology analysis of the DNA fragments with Arachis hypogaea L00952 sts gene showed high similarity level. Taken together, the results are evidence that the amplified fragment obtained in this study is part of melinjo sts gene

  12. Adenovirus 36 DNA in human adipose tissue.

    Science.gov (United States)

    Ponterio, E; Cangemi, R; Mariani, S; Casella, G; De Cesare, A; Trovato, F M; Garozzo, A; Gnessi, L

    2015-12-01

    Recent studies have suggested a possible correlation between obesity and adenovirus 36 (Adv36) infection in humans. As information on adenoviral DNA presence in human adipose tissue are limited, we evaluated the presence of Adv36 DNA in adipose tissue of 21 adult overweight or obese patients. Total DNA was extracted from adipose tissue biopsies. Virus detection was performed using PCR protocols with primers against specific Adv36 fiber protein and the viral oncogenic E4orf1 protein nucleotide sequences. Sequences were aligned with the NCBI database and phylogenetic analyses were carried out with MEGA6 software. Adv36 DNA was found in four samples (19%). This study indicates that some individuals carry Adv36 in the visceral adipose tissue. Further studies are needed to determine the specific effect of Adv36 infection on adipocytes, the prevalence of Adv36 infection and its relationship with obesity in the perspective of developing a vaccine that could potentially prevent or mitigate infection.

  13. DNA molecules and human therapeutics

    African Journals Online (AJOL)

    PRECIOUS

    2009-12-29

    Dec 29, 2009 ... vectors, display non-toxicity and are simpler to develop. This review ... technology as well as a staged delivery mechanism for the introduction of plasmid-borne gene to target cells via the ... pathogen's gene to provide immunity against diseases by ... human cytomegalovirus, simian virus, human elongation.

  14. Complementarily addressed modification and cleavage of a single-stranded fragment of DNA with the aid of alkylating derivatives of oligonucleotides

    International Nuclear Information System (INIS)

    Brosalina, E.B.; Vlasov, V.V.; Kutyavin, I.V.; Mamaev, S.V.; Pletnev, A.G.; Podyminogin, M.A.

    1986-01-01

    The chemical modification of a 303-nucleotide single-stranded fragment of DNA by alkylating oligonucleotide derivatives bearing 4-[N-methyl-N-(2-chloroethyl)amino]benzyl groups in the 5'-terminal phosphate of the 3'-terminal ribose residue has been investigated. It has been shown that under the conditions of the formation of a complex with the DNA fragment both types of derivatives specifically alkylate nucleotides of the DNA fragments that are located directly adjacent to the sections complementary to the oligonucleotides bearing the reactive groups. Alkylation takes place with a high efficiency, and the DNA fragment can be cleaved specifically at the position of the alkylated nucleotides

  15. Detection and location of metal fragments in the human body

    Science.gov (United States)

    Brown, R. L.; Neuschaefer, R. W.

    1970-01-01

    Portable electronic device, based on the design of an eddy current gage, detects ferrous and nonferrous metal fragments. Device is more easily transported than X-ray equipment and does not present a radiation hazard.

  16. Activation of human monocytes by proteolytic fragments of gliadin

    Czech Academy of Sciences Publication Activity Database

    Jelínková, Lenka; Tučková, Ludmila; Cinová, Jana; Cimburek, Zdeněk; Tlaskalová, Helena

    2003-01-01

    Roč. 87, č. 1 (2003), s. 08 ISSN 0165-2478 Institutional research plan: CEZ:AV0Z5020903 Keywords : proteolytic * fragments * gliadin Subject RIV: EE - Microbiology, Virology Impact factor: 1.710, year: 2003

  17. Dietary supplementation with docosahexaenoic acid (DHA) improves seminal antioxidant status and decreases sperm DNA fragmentation.

    Science.gov (United States)

    Martínez-Soto, Juan Carlos; Domingo, Joan Carles; Cordobilla, Begoña; Nicolás, María; Fernández, Laura; Albero, Pilar; Gadea, Joaquín; Landeras, José

    2016-12-01

    The purpose of this study was to evaluate the effect of docosahexaenoic acid (DHA) dietary supplementation on semen quality, fatty acid composition, antioxidant capacity, and DNA fragmentation. In this randomized, double blind, placebo-controlled, parallel-group study, 74 subjects were recruited and randomly assigned to either the placebo group (n=32) or to the DHA group (n=42) to consume three 500-mg capsules of oil per day over 10 weeks. The placebo group received 1,500 mg/day of sunflower oil and the DHA group 1,500 mg/day of DHA-enriched oil. Seminal parameters (semen volume, sperm concentration, motility, morphology, and vitality), total antioxidant capacity, deoxyribonucleic acid fragmentation, and lipid composition were evaluated prior to the treatment and after 10 weeks. Finally, 57 subjects were included in the study with 25 in the placebo group and 32 in the DHA group. No differences were found in traditional sperm parameters or lipid composition of the sperm membrane after treatment. However, an increase in DHA and Omega-3 fatty acid content in seminal plasma, an improvement in antioxidant status, and a reduction in the percentage of spermatozoa with deoxyribonucleic acid damage were observed in the DHA group after 10 weeks of treatment.

  18. Individual and combined effects of ochratoxin A and citrinin on viability and DNA fragmentation in cultured Vero cells and on chromosome aberrations in mice bone marrow cells

    International Nuclear Information System (INIS)

    Bouslimi, Amel; Bouaziz, Chayma; Ayed-Boussema, Imen; Hassen, Wafa; Bacha, Hassen

    2008-01-01

    Ochratoxin A (OTA) and citrinin (CTN) are two common contaminant mycotoxins which can occur jointly in a wide range of food commodities. Both mycotoxins have several toxic effects but share a significant nephrotoxic and carcinogenic potential since OTA and CTN were reported to be responsible for naturally occurring human and animal kidney diseases and tumors. Considering the concomitant production of OTA and CTN, it is very likely that humans and animals are always exposed to the mixture rather than to individual compounds. Therefore, the aim of the present study was to investigate, in vivo and in vitro, whether DNA damage is enhanced by combination of both mycotoxins as compared to their effect separately. To this end, we have assessed their effects individually or combined on cell proliferation and DNA fragmentation in cultured Vero cells and in vivo by monitoring the induction of chromosome aberrations. Our results clearly showed that cultured renal cells respond to OTA and CTN exposure by a moderate and weak inhibition of cell proliferation, respectively. However, when combined, they exert a significant increase in inhibition of cell viability. Similar results were found for the investigated genotoxicity endpoints (DNA fragmentation and chromosome aberrations). Altogether, our study showed that OTA and CTN combination effects are clearly synergistic. The synergistic induction of DNA damage observed with OTA and CTN taken concomitantly could be relevant to explain the molecular basis of the renal diseases and tumorogenesis induced by naturally occurring mycotoxins

  19. Proteolytic fragmentation and peptide mapping of human carboxyamidomethylated tracheobronchial mucin

    International Nuclear Information System (INIS)

    Rose, M.C.; Kaufman, B.; Martin, B.M.

    1989-01-01

    Human tracheobronchial mucin was isolated from lung mucosal gel by chromatography on Sepharose 4B in the presence of dissociating and reducing agents, and its thiol residues were carboxyamidomethylated with iodo[1(-14)C]acetamide. The 14C-carboxyamido-methylated mucin was purified by chromatography on Sepharose 2B. No low molecular weight components were detected by molecular sieve chromatography or polyacrylamide gel electrophoresis in the presence of dissociating and reducing agents or by analytical density centrifugation in CsCl/guanidinium chloride. After digestion of the purified 14C-mucin with trypsin-L-1-tosylamido-2-phenylethyl chloromethyl ketone, three fractions (TR-1, TR-2, and TR-3) were observed by chromatography on Sepharose 4B. TR-1, a 260-kDa mucin glycopeptide fragment, contained all of the neutral hexose and blood group activity and 20% of the radioactivity in the undigested mucin. TR-1 was refractory to a second incubation with trypsin but could be digested by papain or Pronase to a smaller mucin glycopeptide fraction, as judged by the slight decrease in apparent molecular weight on Sepharose CL-4B. These mucin glycopeptides contained approximately 50% of the radioactivity in the TR-1 fraction, indicating that the glycosylated domains of carboxyamidomethylated tracheobronchial mucin contained thiol residues. The remainder of the radioactivity from papain or Pronase digests of TR-1 eluted, like the TR-3 fractions, in the salt fraction on Sepharose CL-4B. Peptide mapping of the nonglycosylated TR-3 fraction by TLC and high voltage electrophoresis yielded six principal and several less intensely stained ninhydrin reactive components, with the radiolabel concentrated in one of the latter peptides

  20. DNA typing of Calliphorids collected from human corpses in Malaysia.

    Science.gov (United States)

    Kavitha, R; Tan, T C; Lee, H L; Nazni, W A; Sofian-Azirun, M

    2013-03-01

    Estimation of post-mortem interval (PMI) is crucial for time of death determination. The advent of DNA-based identification techniques forensic entomology saw the beginning of a proliferation of molecular studies into forensically important Calliphoridae (Diptera). The use of DNA to characterise morphologically indistinguishable immature calliphorids was recognised as a valuable molecular tool with enormous practical utility. The local entomofauna in most cases is important for the examination of entomological evidences. The survey of the local entomofauna has become a fundamental first step in forensic entomological studies, because different geographical distributions, seasonal and environmental factors may influence the decomposition process and the occurrence of different insect species on corpses. In this study, calliphorids were collected from 13 human corpses recovered from indoors, outdoors and aquatic conditions during the post-mortem examination by pathologists from the government hospitals in Malaysia. Only two species, Chrysomya megacephala and Chrysomya rufifacies were recovered from human corpses. DNA sequencing was performed to study the mitochondrial encoded COI gene and to evaluate the suitability of the 1300 base pairs of COI fragments for identification of blow fly species collected from real crime scene. The COI gene from blow fly specimens were sequenced and deposited in GenBank to expand local databases. The sequenced COI gene was useful in identifying calliphorids retrieved from human corpses.

  1. [Real-time quantification to analyze historical Colombian samples detecting a short fragment of hypervariable region II of mitochondrial DNA].

    Science.gov (United States)

    Pérez, Luz Adriana; Rodríguez, Freddy; Langebaek, Carl Henrik; Groot, Helena

    2016-09-01

    Unlike other molecular biology studies, the analysis of ancient DNA (aDNA) requires special infrastructure and methodological conditions to guarantee the quality of the results. One of the main authenticity criteria is DNA quantification, where quantitative real-time PCR is often used given its sensitivity and specificity. Nevertheless, the implementation of these conditions and methodologies to fulfill authenticity criteria imply higher costs. Objective: To develop a simple and less costly method for mitochondrial DNA quantification suitable for highly degraded samples. Materials and methods: The proposed method is based on the use of mini-primers for the specific amplification of short fragments of mitochondrial DNA. The subsequent purification of these amplified fragments allows a standard curve to be constructed with concentrations in accordance to the state of degradation of the samples. Results: The proposed method successfully detected DNA from ancient samples including bone remains and mummified tissue. DNA inhibitory substances were also detected. Conclusion: The proposed method represents a simpler and cost-effective way to detect low amounts of aDNA, and a tool to differentiate DNA-free samples from samples with inhibitory substances.

  2. Perinatal transmission of human papilomavirus DNA

    Directory of Open Access Journals (Sweden)

    Serafini Eduardo P

    2009-06-01

    Full Text Available Abstract The purpose was to study the perinatal transmission of human papillomavirus DNA (HPV-DNA in 63 mother-newborn pairs, besides looking at the epidemiological factors involved in the viral DNA transmission. The following sampling methods were used: (1 in the pregnant woman, when was recruited, in cervix and clinical lesions of the vagina, vulva and perineal region; (2 in the newborn, (a buccal, axillary and inguinal regions; (b nasopharyngeal aspirate, and (c cord blood; (3 in the children, buccal was repeated in the 4th week and 6th and 12th month of life. HPV-DNA was identified using two methodologies: multiplex PCR (PGMY09 and MY11 primers and nested-PCR (genotypes 6/11, 16, 18, 31, 33, 42, 52 and 58. Perinatal transmission was considered when concordance was found in type-specific HPV between mother/newborn or mother/child. HPV-DNA genital was detected in 49 pregnant women submitted to delivery. Eleven newborns (22.4%, n = 11/49 were HPV-DNA positive. In 8 cases (16.3%, n = 8/49 there was type specific HPV concordance between mother/newborn samples. At the end of the first month of life three children (6.1%, n = 3/49 became HPV-DNA positive, while two remained positive from birth. In 3 cases (100%, n = 3/3 there was type specific HPV concordance between mother/newborn samples. In the 6th month, a child (2%, n = 1/49 had become HPV-DNA positive between the 1st and 6th month of life, and there was type specific HPV concordance of mother/newborn samples. All the HPV-DNA positive children (22.4%, n = 11/49 at birth and at the end first month of life (6.1%, n = 3/49 became HPV-DNA negative at the age of 6 months. The HPV-DNA positive child (2%, n = 1/49 from 1st to the 6th month of life became HPV-DNA negative between the 6th and 12th month of life and one child had anogenital warts. In the twelfth month all (100%, n = 49/49 the children studied were HPV-DNA negative. A positive and significant correlation was observed between perinatal

  3. THE HUMAN FUMARYLACETOACETATE GENE : CHARACTERIZATION OF RESTRICTION-FRAGMENT-LENGTH-POLYMORPHISMS AND IDENTIFICATION OF HAPLOTYPES IN TYROSINEMIA TYPE-1 AND PSEUDODEFICIENCY

    NARCIS (Netherlands)

    ROOTWELT, H; KVITTINGEN, EA; HOIE, K; AGSTERIBBE, E; HARTOG, M; BERGER, R

    Deficiency of human fumarylacetoacetase (FAH) activity results in hereditary tyrosinemia type I. Using the restriction enzymes BglII, KpnI and StuI and a 1.3-kb cDNA probe for the FAH gene, we have found 6 restriction fragment length polymorphisms (RFLPs). These RFLPs were utilised in 3 tyrosinemia

  4. Restriction site extension PCR: a novel method for high-throughput characterization of tagged DNA fragments and genome walking.

    Directory of Open Access Journals (Sweden)

    Jiabing Ji

    Full Text Available BACKGROUND: Insertion mutant isolation and characterization are extremely valuable for linking genes to physiological function. Once an insertion mutant phenotype is identified, the challenge is to isolate the responsible gene. Multiple strategies have been employed to isolate unknown genomic DNA that flanks mutagenic insertions, however, all these methods suffer from limitations due to inefficient ligation steps, inclusion of restriction sites within the target DNA, and non-specific product generation. These limitations become close to insurmountable when the goal is to identify insertion sites in a high throughput manner. METHODOLOGY/PRINCIPAL FINDINGS: We designed a novel strategy called Restriction Site Extension PCR (RSE-PCR to efficiently conduct large-scale isolation of unknown genomic DNA fragments linked to DNA insertions. The strategy is a modified adaptor-mediated PCR without ligation. An adapter, with complementarity to the 3' overhang of the endonuclease (KpnI, NsiI, PstI, or SacI restricted DNA fragments, extends the 3' end of the DNA fragments in the first cycle of the primary RSE-PCR. During subsequent PCR cycles and a second semi-nested PCR (secondary RSE-PCR, touchdown and two-step PCR are combined to increase the amplification specificity of target fragments. The efficiency and specificity was demonstrated in our characterization of 37 tex mutants of Arabidopsis. All the steps of RSE-PCR can be executed in a 96 well PCR plate. Finally, RSE-PCR serves as a successful alternative to Genome Walker as demonstrated by gene isolation from maize, a plant with a more complex genome than Arabidopsis. CONCLUSIONS/SIGNIFICANCE: RSE-PCR has high potential application in identifying tagged (T-DNA or transposon sequence or walking from known DNA toward unknown regions in large-genome plants, with likely application in other organisms as well.

  5. The metabolic enhancer piracetam attenuates mitochondrion-specific endonuclease G translocation and oxidative DNA fragmentation.

    Science.gov (United States)

    Gupta, Sonam; Verma, Dinesh Kumar; Biswas, Joyshree; Rama Raju, K Siva; Joshi, Neeraj; Wahajuddin; Singh, Sarika

    2014-08-01

    This study was performed to investigate the involvement of mitochondrion-specific endonuclease G in piracetam (P)-induced protective mechanisms. Studies have shown the antiapoptotic effects of piracetam but the mechanism of action of piracetam is still an enigma. To assess the involvement of endonuclease G in piracetam-induced protective effects, astrocyte glial cells were treated with lipopolysaccharide (LPS) and piracetam. LPS treatment caused significantly decreased viability, mitochondrial activity, oxidative stress, chromatin condensation, and DNA fragmentation, which were attenuated by piracetam cotreatment. Cotreatment of astrocytes with piracetam showed its significantly time-dependent absorption as observed with high-performance liquid chromatography. Astrocytes treated with piracetam alone showed enhanced mitochondrial membrane potential (MMP) in comparison to control astrocytes. However, in LPS-treated cells no significant alteration in MMP was observed in comparison to control cells. Protein and mRNA levels of the terminal executor of the caspase-mediated pathway, caspase-3, were not altered significantly in LPS or LPS + piracetam-treated astrocytes, whereas endonuclease G was significantly translocated to the nucleus in LPS-treated astrocytes. Piracetam cotreatment attenuated the LPS-induced endonuclease G translocation. In conclusion this study indicates that LPS treatment of astrocytes caused decreased viability, oxidative stress, mitochondrial dysfunction, chromatin condensation, DNA damage, and translocation of endonuclease G to the nucleus, which was inhibited by piracetam cotreatment, confirming that the mitochondrion-specific endonuclease G is one of the factors involved in piracetam-induced protective mechanisms. Copyright © 2014 Elsevier Inc. All rights reserved.

  6. Enhancement of gene expression under hypoxic conditions using fragments of the human vascular endothelial growth factor and the erythropoietin genes

    International Nuclear Information System (INIS)

    Shibata, Toru; Akiyama, Nobutake; Noda, Makoto; Sasai, Keisuke; Hiraoka, Masahiro

    1998-01-01

    Purpose: Selective gene expression in response to tumor hypoxia may provide new avenues, not only for radiotherapy and chemotherapy, but also for gene therapy. In this study, we have assessed the extent of hypoxia responsiveness of various DNA constructs by the luciferase assay to help design vectors suitable for cancer therapy. Materials and Methods: Reporter plasmids were constructed with fragments of the human vascular endothelial growth factor (VEGF) and the erythropoietin (Epo) genes encompassing the putative hypoxia-responsive elements (HRE) and the pGL3 promoter vector. Test plasmids and the control pRL-CMV plasmid were cotransfected into tumor cells by the calcium phosphate method. After 6 h hypoxic treatment, the reporter assay was performed. Results: The construct pGL3/VEGF containing the 385 bp fragment of the 5' flanking region in human VEGF gene showed significant increases in luciferase activity in response to hypoxia. The hypoxic/aerobic ratios were about 3-4, and 8-12 for murine and human tumor cells, respectively. Despite the very high degree of conservation among the HREs of mammalian VEGF genes, murine cells showed lower responsiveness than human cells. We next tested the construct pGL3/Epo containing the 150 bp fragment of the 3' flanking region in the Epo gene. Luciferase activity of pGL3/Epo was increased with hypoxia only in human cell lines. The insertion of 5 copies of the 35-bp fragments derived from the VEGF HREs and 32 bp of the E1b minimal promoter resulted in maximal enhancement of hypoxia responsiveness. Conclusions: The constructs with VEGF or Epo fragments containing HRE may be useful for inducing specific gene expression in hypoxic cells. Especially, the application of multiple copies of the HREs and an E1b minimal promoter appears to have the advantage of great improvement in hypoxia responsiveness

  7. Study on detection of mutation DNA fragment in gastric cancer by restriction endonuclease fingerprinting with capillary electrophoresis.

    Science.gov (United States)

    Wang, Rong; Xie, Hua; Xu, Yue-Bing; Jia, Zheng-Ping; Meng, Xian-Dong; Zhang, Juan-Hong; Ma, Jun; Wang, Juan; Wang, Xian-Hua

    2012-03-01

    The DNA fragment detection focusing technique has further enhanced the sensitivity and information of DNA targets. The DNA fragment detection method was established by capillary electrophoresis with laser-induced fluorescence detection and restriction endonuclease chromatographic fingerprinting (CE-LIF-REF) in our experiment. The silica capillary column was coated with short linear polyarclarylamide (SLPA) using nongel sieving technology. The excision product of various restricted enzymes of DNA fragments was obtained by REF with the molecular biology software Primer Premier 5. The PBR322/BsuRI DNA marker was used to establish the optimization method. The markers were focused electrophoretically and detected by CE-LIF. The results demonstrate that the CE-LIF-REF with SLPA can improve separation, sensitivity and speed of analysis. This technique may be applied to analysis of the excision product of various restricted enzymes of prokaryotic plasmid (pIRES2), eukaryote plasmid (pcDNA3.1) and the PCR product of codon 248 region of gastric cancer tissue. The results suggest that this method could very sensitively separate the excision products of various restricted enzymes at a much better resolution than the traditional agarose electrophoresis. Copyright © 2011 John Wiley & Sons, Ltd.

  8. Detection of herpes simplex virus-specific DNA sequences in latently infected mice and in humans.

    Science.gov (United States)

    Efstathiou, S; Minson, A C; Field, H J; Anderson, J R; Wildy, P

    1986-02-01

    Herpes simplex virus-specific DNA sequences have been detected by Southern hybridization analysis in both central and peripheral nervous system tissues of latently infected mice. We have detected virus-specific sequences corresponding to the junction fragment but not the genomic termini, an observation first made by Rock and Fraser (Nature [London] 302:523-525, 1983). This "endless" herpes simplex virus DNA is both qualitatively and quantitatively stable in mouse neural tissue analyzed over a 4-month period. In addition, examination of DNA extracted from human trigeminal ganglia has shown herpes simplex virus DNA to be present in an "endless" form similar to that found in the mouse model system. Further restriction enzyme analysis of latently infected mouse brainstem and human trigeminal DNA has shown that this "endless" herpes simplex virus DNA is present in all four isomeric configurations.

  9. Sequence of a cloned cDNA encoding human ribosomal protein S11

    Energy Technology Data Exchange (ETDEWEB)

    Lott, J B; Mackie, G A

    1988-02-11

    The authors have isolated a cloned cDNA that encodes human ribosomal protein (rp) S11 by screening a human fibroblast cDNA library with a labelled 204 bp DNA fragment encompassing residues 212-416 of pRS11, a rat rp Sll cDNA clone. The human rp S11 cloned cDNA consists of 15 residues of the 5' leader, the entire coding sequence and all 51 residues of the 3' untranslated region. The predicted amino acid sequence of 158 residues is identical to rat rpS11. The nucleotide sequence in the coding region differs, however, from that in rat in the first position in two codons and in the third position in 44 codons.

  10. DNA methylation in human fibroblasts following DNA damage and repair

    International Nuclear Information System (INIS)

    Kastan, M.B.

    1984-01-01

    Methylation of deoxycytidine (dCyd) incorporated by DNA excision repair synthesis in human diploid fibroblasts following damage with ultraviolet radiation (UV), N-methyl-N-nitrosourea, or N-acetoxy-2-acetylaminofluorene was studied utilizing [6- 3 H]dCyd to label repaired DNA specifically and high performance liquid chromatographic analysis to quantify the percentage of deoxycytidine converted to 5-methyldeoxycytidine (m 5 dCyd). In confluent, nondividing cells, methylation in repair patches induced by all three agents is slow and incomplete. Whereas after DNA replication a level of 3.4% m 5 dCyd is reached in less than 2 hours, following UV-stimulated repair synthesis in confluent cells it takes about 3 days to reach a level of approx.2.0% m 5 dCyd in the repair patch. This undermethylation of repair patches occurs throughout the genome. In cells from cultures in logarithmic-phase growth, m 5 dCyd formation in UV-induced repair patches occurs faster and to a greater extent, reaching a level of approx.2.7% in 10-20 hours. Pre-existing hypomethylated repair patches in confluent cells are methylated further when the cells are stimulated to divide; however, the repair patch may still not be fully methylated before cell division occurs. Thus DNA damage and repair may lead to heritable loss of methylation at some sites. The distribution within chromatin of m 5 dCyd in repair patches was also investigated. Over a wide range of extents of digestion by staphylococcal nuclease or deoxyribonuclease I, the level of hypomethylation in repaired DNA in nuclease sensitive and resistant regions of chromatin was constant relative to the genomic level of methylation in these regions. Similar conclusions were reached in experiments with isolated mononucleosomes

  11. Menadione-Induced DNA Damage Leads to Mitochondrial Dysfunction and Fragmentation During Rosette Formation in Fuchs Endothelial Corneal Dystrophy.

    Science.gov (United States)

    Halilovic, Adna; Schmedt, Thore; Benischke, Anne-Sophie; Hamill, Cecily; Chen, Yuming; Santos, Janine Hertzog; Jurkunas, Ula V

    2016-06-20

    Fuchs endothelial corneal dystrophy (FECD), a leading cause of age-related corneal edema requiring transplantation, is characterized by rosette formation of corneal endothelium with ensuing apoptosis. We sought to determine whether excess of mitochondrial reactive oxygen species leads to chronic accumulation of oxidative DNA damage and mitochondrial dysfunction, instigating cell death. We modeled the pathognomonic rosette formation of postmitotic corneal cells by increasing endogenous cellular oxidative stress with menadione (MN) and performed a temporal analysis of its effect in normal (HCEnC, HCECi) and FECD (FECDi) cells and ex vivo specimens. FECDi and FECD ex vivo specimens exhibited extensive mtDNA and nDNA damage as detected by quantitative PCR. Exposure to MN triggered an increase in mitochondrial superoxide levels and led to mtDNA and nDNA damage, while DNA amplification was restored with NAC pretreatment. Furthermore, MN exposure led to a decrease in ΔΨm and adenosine triphosphate levels in normal cells, while FECDi exhibited mitochondrial dysfunction at baseline. Mitochondrial fragmentation and cytochrome c release were detected in FECD tissue and after MN treatment of HCEnCs. Furthermore, cleavage of caspase-9 and caspase-3 followed MN-induced cytochrome c release in HCEnCs. This study provides the first line of evidence that accumulation of oxidative DNA damage leads to rosette formation, loss of functionally intact mitochondria via fragmentation, and subsequent cell death during postmitotic cell degeneration of ocular tissue. MN induced rosette formation, along with mtDNA and nDNA damage, mitochondrial dysfunction, and fragmentation, leading to activation of the intrinsic apoptosis via caspase cleavage and cytochrome c release. Antioxid. Redox Signal. 24, 1072-1083.

  12. Anethole induces apoptotic cell death accompanied by reactive oxygen species production and DNA fragmentation in Aspergillus fumigatus and Saccharomyces cerevisiae.

    Science.gov (United States)

    Fujita, Ken-Ichi; Tatsumi, Miki; Ogita, Akira; Kubo, Isao; Tanaka, Toshio

    2014-02-01

    trans-Anethole (anethole), a major component of anise oil, has a broad antimicrobial spectrum, and antimicrobial activity that is weaker than that of other antibiotics on the market. When combined with polygodial, nagilactone E, and n-dodecanol, anethole has been shown to possess significant synergistic antifungal activity against a budding yeast, Saccharomyces cerevisiae, and a human opportunistic pathogenic yeast, Candida albicans. However, the antifungal mechanism of anethole has not been completely determined. We found that anethole stimulated cell death of a human opportunistic pathogenic fungus, Aspergillus fumigatus, in addition to S. cerevisiae. The anethole-induced cell death was accompanied by reactive oxygen species production, metacaspase activation, and DNA fragmentation. Several mutants of S. cerevisiae, in which genes related to the apoptosis-initiating execution signals from mitochondria were deleted, were resistant to anethole. These results suggest that anethole-induced cell death could be explained by oxidative stress-dependent apoptosis via typical mitochondrial death cascades in fungi, including A. fumigatus and S. cerevisiae. © 2014 FEBS.

  13. Duplex Alu Screening for Degraded DNA of Skeletal Human Remains

    Directory of Open Access Journals (Sweden)

    Fabian Haß

    2017-10-01

    Full Text Available The human-specific Alu elements, belonging to the class of Short INterspersed Elements (SINEs, have been shown to be a powerful tool for population genetic studies. An earlier study in this department showed that it was possible to analyze Alu presence/absence in 3000-year-old skeletal human remains from the Bronze Age Lichtenstein cave in Lower Saxony, Germany. We developed duplex Alu screening PCRs with flanking primers for two Alu elements, each combined with a single internal Alu primer. By adding an internal primer, the approximately 400–500 bp presence signals of Alu elements can be detected within a range of less than 200 bp. Thus, our PCR approach is suited for highly fragmented ancient DNA samples, whereas NGS analyses frequently are unable to handle repetitive elements. With this analysis system, we examined remains of 12 individuals from the Lichtenstein cave with different degrees of DNA degradation. The duplex PCRs showed fully informative amplification results for all of the chosen Alu loci in eight of the 12 samples. Our analysis system showed that Alu presence/absence analysis is possible in samples with different degrees of DNA degradation and it reduces the amount of valuable skeletal material needed by a factor of four, as compared with a singleplex approach.

  14. Apoptotic DNA Degradation into Oligonucleosomal Fragments, but Not Apoptotic Nuclear Morphology, Relies on a Cytosolic Pool of DFF40/CAD Endonuclease*

    Science.gov (United States)

    Iglesias-Guimarais, Victoria; Gil-Guiñon, Estel; Gabernet, Gisela; García-Belinchón, Mercè; Sánchez-Osuna, María; Casanelles, Elisenda; Comella, Joan X.; Yuste, Victor J.

    2012-01-01

    Apoptotic cell death is characterized by nuclear fragmentation and oligonucleosomal DNA degradation, mediated by the caspase-dependent specific activation of DFF40/CAD endonuclease. Here, we describe how, upon apoptotic stimuli, SK-N-AS human neuroblastoma-derived cells show apoptotic nuclear morphology without displaying concomitant internucleosomal DNA fragmentation. Cytotoxicity afforded after staurosporine treatment is comparable with that obtained in SH-SY5Y cells, which exhibit a complete apoptotic phenotype. SK-N-AS cell death is a caspase-dependent process that can be impaired by the pan-caspase inhibitor q-VD-OPh. The endogenous inhibitor of DFF40/CAD, ICAD, is correctly processed, and dff40/cad cDNA sequence does not reveal mutations altering its amino acid composition. Biochemical approaches show that both SH-SY5Y and SK-N-AS resting cells express comparable levels of DFF40/CAD. However, the endonuclease is poorly expressed in the cytosolic fraction of healthy SK-N-AS cells. Despite this differential subcellular distribution of DFF40/CAD, we find no differences in the subcellular localization of both pro-caspase-3 and ICAD between the analyzed cell lines. After staurosporine treatment, the preferential processing of ICAD in the cytosolic fraction allows the translocation of DFF40/CAD from this fraction to a chromatin-enriched one. Therefore, the low levels of cytosolic DFF40/CAD detected in SK-N-AS cells determine the absence of DNA laddering after staurosporine treatment. In these cells DFF40/CAD cytosolic levels can be restored by the overexpression of their own endonuclease, which is sufficient to make them proficient at degrading their chromatin into oligonucleosome-size fragments after staurosporine treatment. Altogether, the cytosolic levels of DFF40/CAD are determinants in achieving a complete apoptotic phenotype, including oligonucleosomal DNA degradation. PMID:22253444

  15. Human papillomavirus DNA in aerodigestive squamous carcinomas ...

    African Journals Online (AJOL)

    A series of 10 oesophageal and 10 laryngeal squamous carcinomas was examined by means of immuno cytochemistry and in situ DNA hybridisation to demonstrate human papillomavirus (HPV) infection. Changes in the epithelium adjacent to the carcinoma were found in 5 of 10 oesophageal and 7 of 10 laryngeal ...

  16. Migration of human dendritic cells induced by gliadin fragments

    Czech Academy of Sciences Publication Activity Database

    Pecharová, Barbara; Jelínková, Lenka; Kamanová, Jana; Tučková, Ludmila

    2009-01-01

    Roč. 39, - (2009), s. 649-649 ISSN 0014-2980. [European Congress of Immunology /2./. 13.09.2009-16.09.2009, Berlin] Institutional research plan: CEZ:AV0Z50200510 Keywords : gliadin fragments * celiac disease * migration Subject RIV: EC - Immunology

  17. Progress towards construction of a total restriction fragment map of a human chromosome.

    NARCIS (Netherlands)

    H. Vissing; F.G. Grosveld (Frank); E. Solomon; G. Moore; N. Lench; N. Shennan; R. Williamson

    1987-01-01

    textabstractWe present an approach to the construction of an overlapping restriction fragment map of a single human chromosome. A genomic cosmid library genome was constructed from a mouse-human hybrid cell line containing chromosome 17 as its only human genetic component. Cosmids containing human

  18. Radioimmunoassay of an early plasmin degradation product of human fibrinogen, 'fragment A', and its clinical application

    Energy Technology Data Exchange (ETDEWEB)

    Takagi, K; Kawai, T [Jichi Medical School, Kawachi, Tochigi (Japan)

    1978-02-01

    Upon the plasmin digestion of human fibrinogen, an early cleavage product, which has been designated as fragment A, was isolated, and to study the action of plasmin in the circulation, radioimmunoassay for fragment A was carried out. This assay used rabbit immune serum obtained by injection of fragment A mixed with complete Freund's adjuvant, and fragment A was labelled with /sup 125/I using the Chloramin-T method. In 20 normal healthy donors its serum level was 3.57 +- 1.62..mu..g/ml (mean+-SD), and it was increased significantly in certain diseases, such as acute leukemias, candiovascular disorders, malignancies, renal failure, systemic lupus erythematosus and sepsis.

  19. A comparison of synthetic oligodeoxynucleotides, DNA fragments and AAV-1 for targeted episomal and chromosomal gene repair

    Directory of Open Access Journals (Sweden)

    Leclerc Xavier

    2009-04-01

    Full Text Available Abstract Background Current strategies for gene therapy of inherited diseases consist in adding functional copies of the gene that is defective. An attractive alternative to these approaches would be to correct the endogenous mutated gene in the affected individual. This study presents a quantitative comparison of the repair efficiency using different forms of donor nucleic acids, including synthetic DNA oligonucleotides, double stranded DNA fragments with sizes ranging from 200 to 2200 bp and sequences carried by a recombinant adeno-associated virus (rAAV-1. Evaluation of each gene repair strategy was carried out using two different reporter systems, a mutated eGFP gene or a dual construct with a functional eGFP and an inactive luciferase gene, in several different cell systems. Gene targeting events were scored either following transient co-transfection of reporter plasmids and donor DNAs, or in a system where a reporter construct was stably integrated into the chromosome. Results In both episomal and chromosomal assays, DNA fragments were more efficient at gene repair than oligonucleotides or rAAV-1. Furthermore, the gene targeting frequency could be significantly increased by using DNA repair stimulating drugs such as doxorubicin and phleomycin. Conclusion Our results show that it is possible to obtain repair frequencies of 1% of the transfected cell population under optimized transfection protocols when cells were pretreated with phleomycin using rAAV-1 and dsDNA fragments.

  20. A domain of the Klenow fragment of Escherichia coli DNA polymerase I has polymerase but no exonuclease activity.

    Science.gov (United States)

    Freemont, P S; Ollis, D L; Steitz, T A; Joyce, C M

    1986-09-01

    The Klenow fragment of DNA polymerase I from Escherichia coli has two enzymatic activities: DNA polymerase and 3'-5' exonuclease. The crystal structure showed that the fragment is folded into two distinct domains. The smaller domain has a binding site for deoxynucleoside monophosphate and a divalent metal ion that is thought to identify the 3'-5' exonuclease active site. The larger C-terminal domain contains a deep cleft that is believed to bind duplex DNA. Several lines of evidence suggested that the large domain also contains the polymerase active site. To test this hypothesis, we have cloned the DNA coding for the large domain into an expression system and purified the protein product. We find that the C-terminal domain has polymerase activity (albeit at a lower specific activity than the native Klenow fragment) but no measurable 3'-5' exonuclease activity. These data are consistent with the hypothesis that each of the three enzymatic activities of DNA polymerase I from E. coli resides on a separate protein structural domain.

  1. Cloning Should Be Simple: Escherichia coli DH5α-Mediated Assembly of Multiple DNA Fragments with Short End Homologies

    Science.gov (United States)

    Richardson, Ruth E.; Suzuki, Yo

    2015-01-01

    Numerous DNA assembly technologies exist for generating plasmids for biological studies. Many procedures require complex in vitro or in vivo assembly reactions followed by plasmid propagation in recombination-impaired Escherichia coli strains such as DH5α, which are optimal for stable amplification of the DNA materials. Here we show that despite its utility as a cloning strain, DH5α retains sufficient recombinase activity to assemble up to six double-stranded DNA fragments ranging in size from 150 bp to at least 7 kb into plasmids in vivo. This process also requires surprisingly small amounts of DNA, potentially obviating the need for upstream assembly processes associated with most common applications of DNA assembly. We demonstrate the application of this process in cloning of various DNA fragments including synthetic genes, preparation of knockout constructs, and incorporation of guide RNA sequences in constructs for clustered regularly interspaced short palindromic repeats (CRISPR) genome editing. This consolidated process for assembly and amplification in a widely available strain of E. coli may enable productivity gain across disciplines involving recombinant DNA work. PMID:26348330

  2. Flexible bent rod model with a saturating induced dipole moment to study the electric linear dichroism of DNA fragments

    Directory of Open Access Journals (Sweden)

    Jorge A. Bertolotto

    2016-06-01

    Full Text Available In the present work we make a theoretical study of the steady state electric linear dichroism of DNA fragments in aqueous solution. The here developed theoretical approach considers a flexible bent rod model with a saturating induced dipole moment. The electric polarizability tensor of bent DNA fragments is calculated considering a phenomenological model which theoretical and experimental backgroung is presented here. The model has into account the electric polarizability longitudinal and transversal to the macroion. Molecular flexibility is described using an elastic potential. We consider DNA fragments originally bent with bending fluctuations around an average bending angle. The induced dipole moment is supposed constant once the electric field strength grows up at critical value. To calculate the reduced electric linear dichroism we determine the optical factor considering the basis of the bent DNA perpendicular to the molecular axis. The orientational distribution function has into account the anisotropic electric properties and the molecule flexibility. We applied the present theoretical background to fit electric dichroism experimental data of DNA fragments reported in the bibliography in a wide range of molecular weight and electric field. From these fits, values of DNA physical properties are estimated. We compare and discuss the results here obtained with the theoretical and experimental data presented by other authors. The original contributions of this work are: the inclusion of the transversal electric polarizability saturating with the electric field, the description of the electric properties with an electric polarizability tensor dependant on the bending angle and the use of an arc model originally bent.

  3. Construction and confirmation of the plasmid of human mitochondrial DNA 4977 bp deletion induced by ionizing radiation

    International Nuclear Information System (INIS)

    Chen Xiaosui; Zhou Lijun; Wang Yuxiao; Qu Jia; Feng Jiangbing; Lu Xue; Chen Deqing; Liu Qingjie

    2006-01-01

    Objective: To construct a stable plasmid that spanning deleted human mitochondrial DNA (mtDNA) 4977 bp induced by ionizing radiation and another one for control DNA fragment, in order to use in the human mitochondrial genome study in the future. Methods: The peripheral blood, which had no mtDNA 4977 bp deletion found in previous study, was exposed to 10 Gy 60 Co γ-rays in vitro. The total cell DNA was extracted and PCR was carried out: a nest-PCR of three-round PCR was used for the mtDNA 4977 bp deletion and one- round regular PCR was used for the control ND1 gene. The PCR products were used for transfection by electroporation and the positive clones were obtained after screening. The plasmid DNA was isolated and sequenced after enzymatic digestion and purification. The sequence result was BLASTed with the human mitochondrial genome. Results: The sizes of PCR products for the flanked 4977 bp deletion and the ND1 gene were similar with those predicted according to GeneBank. The sequences for the positive clones were above 99 per cent homologous with the human mitochondrial genome after BLASTed. Conclusion: The plasmids for deleted human mtDNA 4977 bp and control DNA fragment have been constructed successfully, and they could be used in the quality and quantity studies on human mtDNA 4977 bp deletion. (authors)

  4. GC-Rich Extracellular DNA Induces Oxidative Stress, Double-Strand DNA Breaks, and DNA Damage Response in Human Adipose-Derived Mesenchymal Stem Cells

    Directory of Open Access Journals (Sweden)

    Svetlana Kostyuk

    2015-01-01

    Full Text Available Background. Cell free DNA (cfDNA circulates throughout the bloodstream of both healthy people and patients with various diseases. CfDNA is substantially enriched in its GC-content as compared with human genomic DNA. Principal Findings. Exposure of haMSCs to GC-DNA induces short-term oxidative stress (determined with H2DCFH-DA and results in both single- and double-strand DNA breaks (comet assay and γH2AX, foci. As a result in the cells significantly increases the expression of repair genes (BRCA1 (RT-PCR, PCNA (FACS and antiapoptotic genes (BCL2 (RT-PCR and FACS, BCL2A1, BCL2L1, BIRC3, and BIRC2 (RT-PCR. Under the action of GC-DNA the potential of mitochondria was increased. Here we show that GC-rich extracellular DNA stimulates adipocyte differentiation of human adipose-derived mesenchymal stem cells (haMSCs. Exposure to GC-DNA leads to an increase in the level of RNAPPARG2 and LPL (RT-PCR, in the level of fatty acid binding protein FABP4 (FACS analysis and in the level of fat (Oil Red O. Conclusions. GC-rich fragments in the pool of cfDNA can potentially induce oxidative stress and DNA damage response and affect the direction of mesenchymal stem cells differentiation in human adipose—derived mesenchymal stem cells. Such a response may be one of the causes of obesity or osteoporosis.

  5. Fragment Screening of Human Kynurenine Aminotransferase-II.

    Science.gov (United States)

    Jayawickrama, Gayan S; Nematollahi, Alireza; Sun, Guanchen; Church, W Bret

    2018-03-01

    Kynurenine aminotransferase-II (KAT-II) is a pyridoxal 5'-phosphate (PLP)-dependent enzyme that acts in the tryptophan metabolic pathway by catalyzing the transamination of kynurenine into kynurenic acid (KYNA). It is one of four isoforms in the KAT family, of which it is the primary homologue responsible for KYNA production in the mammalian brain. KAT-II is targeted for inhibition as KYNA is implicated in diseases such as schizophrenia, where it is found in elevated concentrations. Previously, many different approaches have been taken to develop KAT-II inhibitors, and herein fragment-based drug design (FBDD) approaches have been exploited to provide further lead compounds that can be designed into novel inhibitors. Surface plasmon resonance (SPR) was used to screen a fragment library containing 1000 compounds, of which 41 hits were identified. These hits were further evaluated with SPR, and 18 were selected for inhibition studies. From these hits, two fragments, F6037-0164 and F0037-7280, were pursued and determined to have an IC 50 of 524.5 (± 25.6) μM and 115.2 (± 4.5) μM, respectively. This strategy shows the viability of using FBDD in gleaning knowledge about KAT-II inhibition and generating leads for the production of KAT-II inhibitors.

  6. Circulating bacterial-derived DNA fragment level is a strong predictor of cardiovascular disease in peritoneal dialysis patients.

    Directory of Open Access Journals (Sweden)

    Cheuk-Chun Szeto

    Full Text Available Circulating bacterial DNA fragment is related to systemic inflammatory state in peritoneal dialysis (PD patients. We hypothesize that plasma bacterial DNA level predicts cardiovascular events in new PD patients.We measured plasma bacterial DNA level in 191 new PD patients, who were then followed for at least a year for the development of cardiovascular event, hospitalization, and patient survival.The average age was 59.3 ± 11.8 years; plasma bacterial DNA level 34.9 ± 1.5 cycles; average follow up 23.2 ± 9.7 months. At 24 months, the event-free survival was 86.1%, 69.8%, 55.4% and 30.8% for plasma bacterial DNA level quartiles I, II, III and IV, respectively (p < 0.0001. After adjusting for confounders, plasma bacterial DNA level, baseline residual renal function and malnutrition-inflammation score were independent predictors of composite cardiovascular end-point; each doubling in plasma bacterial DNA level confers a 26.9% (95% confidence interval, 13.0 - 42.5% excess in risk. Plasma bacterial DNA also correlated with the number of hospital admission (r = -0.379, p < 0.0001 and duration of hospitalization for cardiovascular reasons (r = -0.386, p < 0.0001. Plasma bacterial DNA level did not correlate with baseline arterial pulse wave velocity (PWV, but with the change in carotid-radial PWV in one year (r = -0.238, p = 0.005.Circulating bacterial DNA fragment level is a strong predictor of cardiovascular event, need of hospitalization, as well as the progressive change in arterial stiffness in new PD patients.

  7. Molecular and FISH analyses of a 53-kbp intact DNA fragment inserted by biolistics in wheat (Triticum aestivum L.) genome.

    Science.gov (United States)

    Partier, A; Gay, G; Tassy, C; Beckert, M; Feuillet, C; Barret, P

    2017-10-01

    A large, 53-kbp, intact DNA fragment was inserted into the wheat ( Triticum aestivum L.) genome. FISH analyses of individual transgenic events revealed multiple insertions of intact fragments. Transferring large intact DNA fragments containing clusters of resistance genes or complete metabolic pathways into the wheat genome remains a challenge. In a previous work, we showed that the use of dephosphorylated cassettes for wheat transformation enabled the production of simple integration patterns. Here, we used the same technology to produce a cassette containing a 44-kb Arabidopsis thaliana BAC, flanked by one selection gene and one reporter gene. This 53-kb linear cassette was integrated in the bread wheat (Triticum aestivum L.) genome by biolistic transformation. Our results showed that transgenic plants harboring the entire cassette were generated. The inheritability of the cassette was demonstrated in the T1 and T2 generation. Surprisingly, FISH analysis performed on T1 progeny of independent events identified double genomic insertions of intact fragments in non-homoeologous positions. Inheritability of these double insertions was demonstrated by FISH analysis of the T1 generation. Relative conclusions that can be drawn from molecular or FISH analysis are discussed along with future prospects of the engineering of large fragments for wheat transformation or genome editing.

  8. Hairpin and duplex formation in DNA fragments CCAATTTTGG, CCAATTTTTTGG, and CCATTTTTGG: a proton NMR study

    International Nuclear Information System (INIS)

    Pramanik, P.; Kanhouwa, N.; Kan, L.

    1988-01-01

    Three DNA fragments, CCAATTTTGG (1), CCAATTTTTTGG (2), AND CCATTTTTGG (3), were studied by proton NMR spectroscopy in aqueous solution. All these oligodeoxyribonucleotides contain common sequences at the 5' and 3' ends (5'-CCA and TGG-3'). 2 as well as 3 forms only hairpin structures with four unpaired thymidylyl units, four and three base pair stems, respectively, in neutral solution under low and high NaCl concentrations. At high salt concentration the oligomer 1 forms a duplex structure with -TT- internal loop. On the other hand, the same oligomer forms a stable hairpin structure at low salt and low strand concentrations at pH 7. The hairpin structure of 1 has a stem containing only three base pairs (CCA x TGG) and a loop containing four nucleotides (-ATTT-) that includes a dissociated A x T base pair. The two secondary structures of 1 coexist in an aqueous solution containing 0.1 M NaCl, at pH 7. The equilibrium shifts to the hairpin side when the temperature is raised. The stabilities and base-stacking modes of all three oligonucleotides in tow different structures are reported

  9. Utilization of a cloned alphoid repeating sequence of human DNA in the study of polymorphism of chromosomal heterochromatin regions

    International Nuclear Information System (INIS)

    Kruminya, A.R.; Kroshkina, V.G.; Yurov, Yu.B.; Aleksandrov, I.A.; Mitkevich, S.P.; Gindilis, V.M.

    1988-01-01

    The chromosomal distribution of the cloned PHS05 fragment of human alphoid DNA was studied by in situ hybridization in 38 individuals. It was shown that this DNA fraction is primarily localized in the pericentric regions of practically all chromosomes of the set. Significant interchromosomal differences and a weakly expressed interindividual polymorphism were discovered in the copying ability of this class of repeating DNA sequences; associations were not found between the results of hybridization and the pattern of Q-polymorphism

  10. Alu polymerase chain reaction: A method for rapid isolation of human-specific sequences from complex DNA sources

    International Nuclear Information System (INIS)

    Nelson, D.L.; Ledbetter, S.A.; Corbo, L.; Victoria, M.F.; Ramirez-Solis, R.; Webster, T.D.; Ledbetter, D.H.; Caskey, C.T.

    1989-01-01

    Current efforts to map the human genome are focused on individual chromosomes or smaller regions and frequently rely on the use of somatic cell hybrids. The authors report the application of the polymerase chain reaction to direct amplification of human DNA from hybrid cells containing regions of the human genome in rodent cell backgrounds using primers directed to the human Alu repeat element. They demonstrate Alu-directed amplification of a fragment of the human HPRT gene from both hybrid cell and cloned DNA and identify through sequence analysis the Alu repeats involved in this amplification. They also demonstrate the application of this technique to identify the chromosomal locations of large fragments of the human X chromosome cloned in a yeast artificial chromosome and the general applicability of the method to the preparation of DNA probes from cloned human sequences. The technique allows rapid gene mapping and provides a simple method for the isolation and analysis of specific chromosomal regions

  11. Rational Design of High-Number dsDNA Fragments Based on Thermodynamics for the Construction of Full-Length Genes in a Single Reaction.

    Science.gov (United States)

    Birla, Bhagyashree S; Chou, Hui-Hsien

    2015-01-01

    Gene synthesis is frequently used in modern molecular biology research either to create novel genes or to obtain natural genes when the synthesis approach is more flexible and reliable than cloning. DNA chemical synthesis has limits on both its length and yield, thus full-length genes have to be hierarchically constructed from synthesized DNA fragments. Gibson Assembly and its derivatives are the simplest methods to assemble multiple double-stranded DNA fragments. Currently, up to 12 dsDNA fragments can be assembled at once with Gibson Assembly according to its vendor. In practice, the number of dsDNA fragments that can be assembled in a single reaction are much lower. We have developed a rational design method for gene construction that allows high-number dsDNA fragments to be assembled into full-length genes in a single reaction. Using this new design method and a modified version of the Gibson Assembly protocol, we have assembled 3 different genes from up to 45 dsDNA fragments at once. Our design method uses the thermodynamic analysis software Picky that identifies all unique junctions in a gene where consecutive DNA fragments are specifically made to connect to each other. Our novel method is generally applicable to most gene sequences, and can improve both the efficiency and cost of gene assembly.

  12. Rational Design of High-Number dsDNA Fragments Based on Thermodynamics for the Construction of Full-Length Genes in a Single Reaction.

    Directory of Open Access Journals (Sweden)

    Bhagyashree S Birla

    Full Text Available Gene synthesis is frequently used in modern molecular biology research either to create novel genes or to obtain natural genes when the synthesis approach is more flexible and reliable than cloning. DNA chemical synthesis has limits on both its length and yield, thus full-length genes have to be hierarchically constructed from synthesized DNA fragments. Gibson Assembly and its derivatives are the simplest methods to assemble multiple double-stranded DNA fragments. Currently, up to 12 dsDNA fragments can be assembled at once with Gibson Assembly according to its vendor. In practice, the number of dsDNA fragments that can be assembled in a single reaction are much lower. We have developed a rational design method for gene construction that allows high-number dsDNA fragments to be assembled into full-length genes in a single reaction. Using this new design method and a modified version of the Gibson Assembly protocol, we have assembled 3 different genes from up to 45 dsDNA fragments at once. Our design method uses the thermodynamic analysis software Picky that identifies all unique junctions in a gene where consecutive DNA fragments are specifically made to connect to each other. Our novel method is generally applicable to most gene sequences, and can improve both the efficiency and cost of gene assembly.

  13. Lead bullet fragments in venison from rifle-killed deer: potential for human dietary exposure.

    Directory of Open Access Journals (Sweden)

    W Grainger Hunt

    Full Text Available Human consumers of wildlife killed with lead ammunition may be exposed to health risks associated with lead ingestion. This hypothesis is based on published studies showing elevated blood lead concentrations in subsistence hunter populations, retention of ammunition residues in the tissues of hunter-killed animals, and systemic, cognitive, and behavioral disorders associated with human lead body burdens once considered safe. Our objective was to determine the incidence and bioavailability of lead bullet fragments in hunter-killed venison, a widely-eaten food among hunters and their families. We radiographed 30 eviscerated carcasses of White-tailed Deer (Odocoileus virginianus shot by hunters with standard lead-core, copper-jacketed bullets under normal hunting conditions. All carcasses showed metal fragments (geometric mean = 136 fragments, range = 15-409 and widespread fragment dispersion. We took each carcass to a separate meat processor and fluoroscopically scanned the resulting meat packages; fluoroscopy revealed metal fragments in the ground meat packages of 24 (80% of the 30 deer; 32% of 234 ground meat packages contained at least one fragment. Fragments were identified as lead by ICP in 93% of 27 samples. Isotope ratios of lead in meat matched the ratios of bullets, and differed from background lead in bone. We fed fragment-containing venison to four pigs to test bioavailability; four controls received venison without fragments from the same deer. Mean blood lead concentrations in pigs peaked at 2.29 microg/dL (maximum 3.8 microg/dL 2 days following ingestion of fragment-containing venison, significantly higher than the 0.63 microg/dL averaged by controls. We conclude that people risk exposure to bioavailable lead from bullet fragments when they eat venison from deer killed with standard lead-based rifle bullets and processed under normal procedures. At risk in the U.S. are some ten million hunters, their families, and low

  14. Cloning and sequencing of cDNA encoding human DNA topoisomerase II and localization of the gene to chromosome region 17q21-22

    International Nuclear Information System (INIS)

    Tsai-Pflugfelder, M.; Liu, L.F.; Liu, A.A.; Tewey, K.M.; Whang-Peng, J.; Knutsen, T.; Huebner, K.; Croce, C.M.; Wang, J.C.

    1988-01-01

    Two overlapping cDNA clones encoding human DNA topoisomerase II were identified by two independent methods. In one, a human cDNA library in phage λ was screened by hybridization with a mixed oligonucleotide probe encoding a stretch of seven amino acids found in yeast and Drosophila DNA topoisomerase II; in the other, a different human cDNA library in a λgt11 expression vector was screened for the expression of antigenic determinants that are recognized by rabbit antibodies specific to human DNA topoisomerase II. The entire coding sequences of the human DNA topoisomerase II gene were determined from these and several additional clones, identified through the use of the cloned human TOP2 gene sequences as probes. Hybridization between the cloned sequences and mRNA and genomic DNA indicates that the human enzyme is encoded by a single-copy gene. The location of the gene was mapped to chromosome 17q21-22 by in situ hybridization of a cloned fragment to metaphase chromosomes and by hybridization analysis with a panel of mouse-human hybrid cell lines, each retaining a subset of human chromosomes

  15. HindIII identifies a two allele DNA polymorphism of the human cannabinoid receptor gene (CNR)

    Energy Technology Data Exchange (ETDEWEB)

    Caenazzo, L.; Hoehe, M.R.; Hsieh, W.T.; Berrettini, W.H.; Bonner, T.I.; Gershon, E.S. (National Inst. of Health, Bethesda, MD (United States))

    1991-09-11

    HCNR p5, a 0.9 kb BamHI/EcoRI fragment from the human cannabinoid receptor gene inserted into pUC19, was used as probe. The fragment is located in an intron approximately 14 kb 5{prime} of the initiation codon. This fragment is a clean single copy sequence by genomic blotting. Hybridization of human genomic DNA digested with HindIII identified a two allele RFLP with bands at 5.5 (A1) and 3.3 kb (A2). The human cannabinoid receptor gene has been genetically mapped in CEPH reference pedigrees to the centromeric/q region of chromosome 6. In situ hybridization localizes it to 6q14-q15. Codominant segregation has been observed in 26 informative two- and three-generation CEPH pedigrees and in 14 medium-sized disease families.

  16. DNA methylation and healthy human aging.

    Science.gov (United States)

    Jones, Meaghan J; Goodman, Sarah J; Kobor, Michael S

    2015-12-01

    The process of aging results in a host of changes at the cellular and molecular levels, which include senescence, telomere shortening, and changes in gene expression. Epigenetic patterns also change over the lifespan, suggesting that epigenetic changes may constitute an important component of the aging process. The epigenetic mark that has been most highly studied is DNA methylation, the presence of methyl groups at CpG dinucleotides. These dinucleotides are often located near gene promoters and associate with gene expression levels. Early studies indicated that global levels of DNA methylation increase over the first few years of life and then decrease beginning in late adulthood. Recently, with the advent of microarray and next-generation sequencing technologies, increases in variability of DNA methylation with age have been observed, and a number of site-specific patterns have been identified. It has also been shown that certain CpG sites are highly associated with age, to the extent that prediction models using a small number of these sites can accurately predict the chronological age of the donor. Together, these observations point to the existence of two phenomena that both contribute to age-related DNA methylation changes: epigenetic drift and the epigenetic clock. In this review, we focus on healthy human aging throughout the lifetime and discuss the dynamics of DNA methylation as well as how interactions between the genome, environment, and the epigenome influence aging rates. We also discuss the impact of determining 'epigenetic age' for human health and outline some important caveats to existing and future studies. © 2015 The Authors. Aging Cell published by the Anatomical Society and John Wiley & Sons Ltd.

  17. A Saccharomyces cerevisiae mitochondrial DNA fragment activates Reg1p-dependent glucose-repressible transcription in the nucleus.

    Science.gov (United States)

    Santangelo, G M; Tornow, J

    1997-12-01

    As part of an effort to identify random carbon-source-regulated promoters in the Saccharomyces cerevisiae genome, we discovered that a mitochondrial DNA fragment is capable of directing glucose-repressible expression of a reporter gene. This fragment (CR24) originated from the mitochondrial genome adjacent to a transcription initiation site. Mutational analyses identified a GC cluster within the fragment that is required for transcriptional induction. Repression of nuclear CR24-driven transcription required Reg1p, indicating that this mitochondrially derived promoter is a member of a large group of glucose-repressible nuclear promoters that are similarly regulated by Reg1p. In vivo and in vitro binding assays indicated the presence of factors, located within the nucleus and the mitochondria, that bind to the GC cluster. One or more of these factors may provide a regulatory link between the nucleus and mitochondria.

  18. Fibered confocal fluorescence microscopy for imaging apoptotic DNA fragmentation at the single-cell level in vivo

    International Nuclear Information System (INIS)

    Al-Gubory, Kais H.

    2005-01-01

    The major characteristic of cell death by apoptosis is the loss of nuclear DNA integrity by endonucleases, resulting in the formation of small DNA fragments. The application of confocal imaging to in vivo monitoring of dynamic cellular events, like apoptosis, within internal organs and tissues has been limited by the accessibility to these sites. Therefore, the aim of the present study was to test the feasibility of fibered confocal fluorescence microscopy (FCFM) to image in situ apoptotic DNA fragmentation in surgically exteriorized sheep corpus luteum in the living animal. Following intra-luteal administration of a fluorescent DNA-staining dye, YO-PRO-1, DNA cleavage within nuclei of apoptotic cells was serially imaged at the single-cell level by FCFM. This imaging technology is sufficiently simple and rapid to allow time series in situ detection and visualization of cells undergoing apoptosis in the intact animal. Combined with endoscope, this approach can be used for minimally invasive detection of fluorescent signals and visualization of cellular events within internal organs and tissues and thereby provides the opportunity to study biological processes in the natural physiological environment of the cell in living animals

  19. Sperm DNA fragmentation index does not correlate with blastocyst aneuploidy or morphological grading.

    Directory of Open Access Journals (Sweden)

    Itai Gat

    Full Text Available High DNA fragmentation index (DFI may be associated with poor outcome after IVF. Our aim was to determine whether DFI impacts blastocyst quality or clinical outcome. This retrospective study included 134 couples who underwent 177 IVF-ICSI and pre-implantation genetic screening (PGS cycles during January 1st, 2014-March 31st, 2016 and had documented previous DFI. Group 1 (DFI>30% encompassed 25 couples who underwent 36 cycles; Group 2 (DFI 15-30% included 45 couples and 57 cycles; group 3 (DFI<15% included 64 couples and 83 cycles. Male partners within group 1 were older (45.1 compared to 40.6 and 38.3 years, respectively, p<0.05, had higher BMI (32.4 compared to 26.6 and 25.8 respectively, p<0.05 and lower sperm count and motility (46*106/ml and 35.5%, respectively compared to groups 2 (61.8*106/ml and 46.6%, respectively and 3 (75.8*106/ml and 55.1%, respectively, p<0.05. Female parameters including ovarian reserve and response and embryo development were similar. Total numbers of biopsied blastocysts were 116, 175 and 259 in groups 1, 2 and 3, respectively. PGS for 24 chromosomes revealed comparable euploidy rate of 46-50.4%, with a similar morphological classification. No significant differences were found regarding pregnancy rates or pregnancy loss. It seems that DFI doesn't correlate with blastocyst aneuploidy or morphological grading.

  20. Directly Transforming PCR-Amplified DNA Fragments into Plant Cells Is a Versatile System That Facilitates the Transient Expression Assay

    Science.gov (United States)

    Lu, Yuming; Chen, Xi; Wu, Yuxuan; Wang, Yanping; He, Yuqing; Wu, Yan

    2013-01-01

    A circular plasmid containing a gene coding sequence has been broadly used for studying gene regulation in cells. However, to accommodate a quick screen plasmid construction and preparation can be time consuming. Here we report a PCR amplified dsDNA fragments (PCR-fragments) based transient expression system (PCR-TES) for suiting in the study of gene regulation in plant cells. Instead of transforming plasmids into plant cells, transient expression of PCR-fragments can be applicable. The transformation efficiency and expression property of PCR-fragments are comparable to transformation using plasmids. We analyzed the transformation efficiency in PCR-TES at transcription and protein levels. Our results indicate that the PCR-TES is as versatile as the conventional transformation system using plasmid DNA. Through reconstituting PYR1-mediated ABA signaling pathway in Arabidopsis mesophyll protoplasts, we were not only validating the practicality of PCR-TES but also screening potential candidates of CDPK family members which might be involved in the ABA signaling. Moreover, we determined that phosphorylation of ABF2 by CPK4 could be mediated by ABA-induced PYR1 and ABI1, demonstrating a crucial role of CDPKs in the ABA signaling. In summary, PCR-TES can be applicable to facilitate analyzing gene regulation and for the screen of putative regulatory molecules at the high throughput level in plant cells. PMID:23468926

  1. Directly transforming PCR-amplified DNA fragments into plant cells is a versatile system that facilitates the transient expression assay.

    Directory of Open Access Journals (Sweden)

    Yuming Lu

    Full Text Available A circular plasmid containing a gene coding sequence has been broadly used for studying gene regulation in cells. However, to accommodate a quick screen plasmid construction and preparation can be time consuming. Here we report a PCR amplified dsDNA fragments (PCR-fragments based transient expression system (PCR-TES for suiting in the study of gene regulation in plant cells. Instead of transforming plasmids into plant cells, transient expression of PCR-fragments can be applicable. The transformation efficiency and expression property of PCR-fragments are comparable to transformation using plasmids. We analyzed the transformation efficiency in PCR-TES at transcription and protein levels. Our results indicate that the PCR-TES is as versatile as the conventional transformation system using plasmid DNA. Through reconstituting PYR1-mediated ABA signaling pathway in Arabidopsis mesophyll protoplasts, we were not only validating the practicality of PCR-TES but also screening potential candidates of CDPK family members which might be involved in the ABA signaling. Moreover, we determined that phosphorylation of ABF2 by CPK4 could be mediated by ABA-induced PYR1 and ABI1, demonstrating a crucial role of CDPKs in the ABA signaling. In summary, PCR-TES can be applicable to facilitate analyzing gene regulation and for the screen of putative regulatory molecules at the high throughput level in plant cells.

  2. A polymer, random walk model for the size-distribution of large DNA fragments after high linear energy transfer radiation

    Science.gov (United States)

    Ponomarev, A. L.; Brenner, D.; Hlatky, L. R.; Sachs, R. K.

    2000-01-01

    DNA double-strand breaks (DSBs) produced by densely ionizing radiation are not located randomly in the genome: recent data indicate DSB clustering along chromosomes. Stochastic DSB clustering at large scales, from > 100 Mbp down to simulations and analytic equations. A random-walk, coarse-grained polymer model for chromatin is combined with a simple track structure model in Monte Carlo software called DNAbreak and is applied to data on alpha-particle irradiation of V-79 cells. The chromatin model neglects molecular details but systematically incorporates an increase in average spatial separation between two DNA loci as the number of base-pairs between the loci increases. Fragment-size distributions obtained using DNAbreak match data on large fragments about as well as distributions previously obtained with a less mechanistic approach. Dose-response relations, linear at small doses of high linear energy transfer (LET) radiation, are obtained. They are found to be non-linear when the dose becomes so large that there is a significant probability of overlapping or close juxtaposition, along one chromosome, for different DSB clusters from different tracks. The non-linearity is more evident for large fragments than for small. The DNAbreak results furnish an example of the RLC (randomly located clusters) analytic formalism, which generalizes the broken-stick fragment-size distribution of the random-breakage model that is often applied to low-LET data.

  3. Findings on sperm alterations and DNA fragmentation, nutritional, hormonal and antioxidant status in an elite triathlete: case report

    OpenAIRE

    Vaamonde, D.; Silva-Grigoletto, M.E. Da; Fernandez, J.M.; Algar-Santacruz, C.; García-Manso, J.M.

    2014-01-01

    Objective: The present case study analyzes semen quality, nutritional patterns, and hormonal and oxidative status of an international high-level triathlete with a low-volume, high-intensity training load. Method: The athlete was 26 years old, having participated in competitions since he was 13 years old, and practiced professional triathlon for the last five years. The qualitative sperm parameters analyzed were volume, sperm count, motility, morphology, and DNA fragmentation (additional testi...

  4. Findings on sperm alterations and DNA fragmentation, nutritional, hormonal and antioxidant status in an elite triathlete. Case report

    Directory of Open Access Journals (Sweden)

    D. Vaamonde

    2014-12-01

    Conclusions: In this high-intensity endurance athlete, sperm parameters, mainly sperm morphology and DNA fragmentation, are altered. Further knowledge is needed with regards nutritional antioxidant intake and other dietetic strategies oriented toward avoiding oxidative damage in semen of high-performance triathletes. Moreover, adequate nutritional strategies must be found and nutritional advice given to athletes so as to palliate or dampen the effects of exercise on semen quality.

  5. HYPOLIPEDEMIC EFFECT OF CYNODON DACTYLON ON HISTOPATHOLOGICAL STUDY AND DNA FRAGMENTATION ANALYSIS IN EXPERIMENTALLY INDUCED HYPERCHOLESTEREMIC RATS

    OpenAIRE

    C. Selva Kumar

    2011-01-01

    Hypercholesteremia is one of the risk factors for coronary artery disease. The present study highlights the efficacy of Ayurvedic herbal formulation Cynodon dactylon (Bermuda grass) on histopathological study and DNA fragmentation analysis in experimentally induced hypercholesteremic rats. Four groups of rats were employed namely control, hypercholesterolemia rats (4% Cholesterol+1% cholic acid), Cynodon dactylon treatment in hypercholesteremic rats and Cynodon dactylon alone treated rats. Re...

  6. Expression of a humanized SZ-63 McAb functional recombinant Fab fragment in E. Coli

    International Nuclear Information System (INIS)

    Xia Lijun; Gu Jianming; Zhang Xiaoming; Liu Yue; Wan Haiying; Li Peixia; Ruan Changgeng

    1995-06-01

    MRNA was selected on oligo(dT)-cellulose from total RNA isolated from SZ-63 hybridoma cells by CsCl ultracentrifugation. cDNA coding for heavy and light variable regions were amplified by reverse transcriptase-polymerase chain reaction (RT-PCR). The amplified fragments were then cloned and sequenced by the 32 P labelled sanger dideoxy-mediated chain-termination method. The nucleotides of VH and Vκ are 354 and 321 respectively, the amino acid sequence of heavy and light chain of SZ-63 were also deduced. Then, linking the variable genes of SZ-63 with human immunoglobulin γ 1 CH and κ VL genes, constructing pHEN1-63 Fab/Hu chimera for expression and transforming E. coli HB2151. The expressed chimeric SZ-63 Fab was soluble. Both ELISA and Western blot results showed the expression products could specifically bind with cross-linked fibrin and the content in expression culture was about 225 μg/L. (5 figs.)

  7. Production and characterization of anti-human IgG F(ab')2 antibody fragment.

    Science.gov (United States)

    Valedkarimi, Zahra; Nasiri, Hadi; Aghebati-Maleki, Leili; Abdolalizadeh, Jalal; Esparvarinha, Mojghan; Majidi, Jafar

    2018-04-10

    In present study an optimized protocol for the separation of antibodies into antigen-binding fragments F(ab')2 using pepsin digestion was investigated. The production of these fragments is a consequential step in the development of medical research, treatment and diagnosis. For production of polyclonal antibody rabbit received antigen in four steps. The rabbit serum at 1/128000 dilution showed high absorbance in reaction with human IgG at the designed ELISA method. Rabbit IgG was purified by Ion-Exchange Chromatography (IEC) method. Purity was assessed by SDS-PAGE method. In non-reduced condition only one band was seen in about 150 kDa MW position and in reduced form, two bands were seen in 50 and 25 kDa MW positions. Rabbit IgG was digested by pepsin enzyme. The antibody fragments solution was applied to Gel filtration column to isolate the F(ab')2. Non-reduced SDS-PAGE for determining the purity of F(ab')2 fragment resulted in one band in 100 kDa corresponds to F(ab')2 fragment and a band in 150 kDa MW position corresponds to undigested IgG antibodies. The activities of FITC conjugated F(ab')2 fragment and commercial ones were compared using flowcytometry method. The activity results implied that the FITC conjugated- anti human F(ab')2 fragment worked as efficiently as the commercial one.

  8. Quantifying the Number of Independent Organelle DNA Insertions in Genome Evolution and Human Health.

    Science.gov (United States)

    Hazkani-Covo, Einat; Martin, William F

    2017-05-01

    Fragments of organelle genomes are often found as insertions in nuclear DNA. These fragments of mitochondrial DNA (numts) and plastid DNA (nupts) are ubiquitous components of eukaryotic genomes. They are, however, often edited out during the genome assembly process, leading to systematic underestimation of their frequency. Numts and nupts, once inserted, can become further fragmented through subsequent insertion of mobile elements or other recombinational events that disrupt the continuity of the inserted sequence relative to the genuine organelle DNA copy. Because numts and nupts are typically identified through sequence comparison tools such as BLAST, disruption of insertions into smaller fragments can lead to systematic overestimation of numt and nupt frequencies. Accurate identification of numts and nupts is important, however, both for better understanding of their role during evolution, and for monitoring their increasingly evident role in human disease. Human populations are polymorphic for 141 numt loci, five numts are causal to genetic disease, and cancer genomic studies are revealing an abundance of numts associated with tumor progression. Here, we report investigation of salient parameters involved in obtaining accurate estimates of numt and nupt numbers in genome sequence data. Numts and nupts from 44 sequenced eukaryotic genomes reveal lineage-specific differences in the number, relative age and frequency of insertional events as well as lineage-specific dynamics of their postinsertional fragmentation. Our findings outline the main technical parameters influencing accurate identification and frequency estimation of numts in genomic studies pertinent to both evolution and human health. © The Author 2017. Published by Oxford University Press on behalf of the Society for Molecular Biology and Evolution.

  9. Toward The Reconstitution of the Maturation of Okazaki Fragments Multiprotein Complex in Human At The Single Molecule Level

    KAUST Repository

    Joudeh, Luay

    2017-04-01

    The maturation of Okazaki fragments on the lagging strand in eukaryotes is mediated by a highly coordinated multistep process involving several proteins that ensure the accurate and efficient replication of genomic DNA. Human proliferating cell nuclear antigen (PCNA) that slides on double-stranded DNA is the key player that coordinates the access of various proteins to the different intermediary steps in this process. In this study, I am focusing on characterizing how PCNA recruits and stimulates the structure specific flap endonuclease 1 (FEN1) to process the aberrant double flap (DF) structures that are produced during maturation of Okazaki fragments. FEN1 distorts the DF structures into a bent conformer to place the scissile phosphate into the active site for cleavage. The product is a nick substrate that can be sealed by DNA ligase I whose recruitment is also mediated by its interaction with PCNA. Using single-molecule Förster resonance energy transfer (smFRET) measurements that simultaneously monitored bending and cleavage of various DF substrates by FEN1 alone or in the presence of PCNA, we found that FEN1 and PCNA bends cognate and non-cognate substrates but display remarkable selectivity to stabilize the bent conformer in cognate substrate while promoting the dissociation of non-cognate substrates. This mechanism provides efficiency and accuracy for FEN1 and PCNA to cleave the correct substrate while avoiding the deleterious cleavage of incorrect substrates. This work provides a true molecular level understanding of the key step during the maturation of Okazaki fragment and contributes towards the reconstitution of its entire activity at the single molecule level.

  10. Kaempferol induces DNA damage and inhibits DNA repair associated protein expressions in human promyelocytic leukemia HL-60 cells.

    Science.gov (United States)

    Wu, Lung-Yuan; Lu, Hsu-Feng; Chou, Yu-Cheng; Shih, Yung-Luen; Bau, Da-Tian; Chen, Jaw-Chyun; Hsu, Shu-Chun; Chung, Jing-Gung

    2015-01-01

    Numerous evidences have shown that plant flavonoids (naturally occurring substances) have been reported to have chemopreventive activities and protect against experimental carcinogenesis. Kaempferol, one of the flavonoids, is widely distributed in fruits and vegetables, and may have cancer chemopreventive properties. However, the precise underlying mechanism regarding induced DNA damage and suppressed DNA repair system are poorly understood. In this study, we investigated whether kaempferol induced DNA damage and affected DNA repair associated protein expression in human leukemia HL-60 cells in vitro. Percentages of viable cells were measured via a flow cytometry assay. DNA damage was examined by Comet assay and DAPI staining. DNA fragmentation (ladder) was examined by DNA gel electrophoresis. The changes of protein levels associated with DNA repair were examined by Western blotting. Results showed that kaempferol dose-dependently decreased the viable cells. Comet assay indicated that kaempferol induced DNA damage (Comet tail) in a dose-dependent manner and DAPI staining also showed increased doses of kaempferol which led to increased DNA condensation, these effects are all of dose-dependent manners. Western blotting indicated that kaempferol-decreased protein expression associated with DNA repair system, such as phosphate-ataxia-telangiectasia mutated (p-ATM), phosphate-ataxia-telangiectasia and Rad3-related (p-ATR), 14-3-3 proteins sigma (14-3-3σ), DNA-dependent serine/threonine protein kinase (DNA-PK), O(6)-methylguanine-DNA methyltransferase (MGMT), p53 and MDC1 protein expressions, but increased the protein expression of p-p53 and p-H2AX. Protein translocation was examined by confocal laser microscopy, and we found that kaempferol increased the levels of p-H2AX and p-p53 in HL-60 cells. Taken together, in the present study, we found that kaempferol induced DNA damage and suppressed DNA repair and inhibited DNA repair associated protein expression in HL-60

  11. Preparation of methacrylate-based anion-exchange monolithic microbore column for chromatographic separation of DNA fragments and oligonucleotides

    Energy Technology Data Exchange (ETDEWEB)

    Sabarudin, Akhmad, E-mail: sabarjpn@ub.ac.id [Division of Nano-materials Science, EcoTopia Science Institute, Nagoya University, Furu-Cho, Chikusa-Ku, Nagoya 464-8603 (Japan); Department of Chemistry, Faculty of Science, Brawijaya University, Jl Veteran Malang 65145 (Indonesia); Huang, Junchao; Shu, Shin; Sakagawa, Shinnosuke [Division of Nano-materials Science, EcoTopia Science Institute, Nagoya University, Furu-Cho, Chikusa-Ku, Nagoya 464-8603 (Japan); Umemura, Tomonari, E-mail: umemura@apchem.nagoya-u.ac.jp [Division of Nano-materials Science, EcoTopia Science Institute, Nagoya University, Furu-Cho, Chikusa-Ku, Nagoya 464-8603 (Japan)

    2012-07-29

    Highlights: Black-Right-Pointing-Pointer Microbore-scale (1 mm i.d.) anion-exchange monolithic column. Black-Right-Pointing-Pointer Potentially preparative applications. Black-Right-Pointing-Pointer Separation of oligodeoxythymidylic acids and DNA fragments. - Abstract: In this paper, we report on the preparation of a microbore-scale (1 mm i.d.) anion-exchange monolithic column suitable not only for analytical purposes but also for potentially preparative applications. In order to meet the conflicting requirements of high permeability and good mechanical strength, the following two-step procedure was applied. First, an epoxy-containing monolith was synthesized by in situ copolymerization of glycidyl methacrylate (GMA) and ethylene dimethacrylate (EDMA) within the confines of a silicosteel tubing of 1.02 mm i.d. and 1/16 Double-Prime o.d. in the presence of a ternary porogenic mixture of 1-propanol, 1,4-butanediol, and water. The monolithic matrix was subsequently converted into weak anion-exchanger via the ring-opening reaction of epoxy group with diethyl amine. The dynamic binding capacity was 21.4 mg mL{sup -1} for bovine serum albumin (BSA) at 10% breakthrough. The morphology and porous structure of this monolith were assessed by scanning electron microscope (SEM) and inverse size exclusion chromatography (ISEC). To optimize the separation efficiency, the effects of various chromatographic parameters upon the separation of DNA fragments were investigated. The resulting monolithic anion exchanger demonstrated good potential for the separation of both single- and double-stranded DNA molecules using a gradient elution with NaCl in Tris-HCl buffer (20 mM). Oligodeoxythymidylic acids (dT{sub 12}-dT{sub 18}) were successfully resolved at pH 8, while the fragments of 20 bp DNA ladder, 100 bp DNA ladder, and pBR322-HaeIII digest were efficiently separated at pH 9.

  12. How much DNA is lost? Measuring DNA loss of short-tandem-repeat length fragments targeted by the PowerPlex 16® system using the Qiagen MinElute Purification Kit.

    Science.gov (United States)

    Kemp, Brian M; Winters, Misa; Monroe, Cara; Barta, Jodi Lynn

    2014-01-01

    The success in recovering genetic profiles from aged and degraded biological samples is diminished by fundamental aspects of DNA extraction, as well as its long-term preservation, that are not well understood. While numerous studies have been conducted to determine whether one extraction method was superior to others, nearly all of them were initiated with no knowledge of the actual starting DNA quantity in the samples prior to extraction, so they ultimately compared the outcome of all methods relative to the best. Using quantitative PCR to estimate the copy count of synthetic standards before (i.e., "copies in") and after (i.e., "copies out") purification by the Qiagen MinElute PCR Purification Kit, we documented DNA loss within a pool of 16 different-sized fragments ranging from 106 to 409 bp in length, corresponding to those targeted by the PowerPlex 16 System (Promega, Madison, WI). Across all standards from 10(4) to 10(7) copies/μL, loss averaged between 21.75% and 60.56% (mean, 39.03%), which is not congruent with Qiagen's claim that 80% of 70 bp to 4 kb fragments are retained using this product (i.e., 20% loss). Our study also found no clear relationship either between DNA strand length and retention or between starting copy number and retention. This suggests that there is no molecule bias across the MinElute column membrane and highlights the need for manufacturers to clearly and accurately describe on what their claims are based, and should also encourage researchers to document DNA retention efficiencies of their own methods and protocols. Understanding how and where to reduce loss of molecules during extraction and purification will serve to generate clearer and more accurate data, which will enhance the utility of ancient and low-copy-number DNA as a tool for closing forensic cases or in reconstructing the evolutionary history of humans and other organisms.

  13. Quantification and presence of human ancient DNA in burial place ...

    African Journals Online (AJOL)

    Quantification and presence of human ancient DNA in burial place remains of Turkey using real time polymerase chain reaction. ... A published real-time PCR assay, which allows for the combined analysis of nuclear or ancient DNA and mitochondrial DNA, was modified. This approach can be used for recovering DNA from ...

  14. Ancient pathogen DNA in human teeth and petrous bones

    DEFF Research Database (Denmark)

    Margaryan, Ashot; Hansen, Henrik B.; Rasmussen, Simon

    2018-01-01

    Recent ancient DNA (aDNA) studies of human pathogens have provided invaluable insights into their evolutionary history and prevalence in space and time. Most of these studies were based on DNA extracted from teeth or postcranial bones. In contrast, no pathogen DNA has been reported from the petro...

  15. Comparative Analysis of Human and Canine Campylobacter upsaliensis Isolates by Amplified Fragment Length Polymorphism

    DEFF Research Database (Denmark)

    Damborg, Peter; Guardabassi, Luca; Pedersen, Karl

    2008-01-01

    Human (n = 33) and canine (n = 53) Campylobacter upsaliensis isolates from seven countries were genotyped by a new amplified fragment length polymorphism method. We observed 100% typeability and high overall diversity. The majority of human strains (23/33) clustered separately from canine strains...

  16. DNA fork displacement rates in human cells

    International Nuclear Information System (INIS)

    Kapp, L.N.; Painter, R.B.

    1981-01-01

    DNA fork displacement rates were measured in 20 human cell lines by a bromodeoxyuridine-313 nm photolysis technique. Cell lines included representatives of normal diploid, Fanconi's anemia, ataxia telangiectasia, xeroderma pigmentosum, trisomy-21 and several transformed lines. The average value for all the cell lines was 0.53 +- 0.08 μm/min. The average value for individual cell lines, however, displayed a 30% variation. Less than 10% of variation in the fork displacement rate appears to be due to the experimental technique; the remainder is probably due to true variation among the cell types and to culture conditions. (Auth.)

  17. DNA fork displacement rates in human cells

    Energy Technology Data Exchange (ETDEWEB)

    Kapp, L.N.; Painter, R.B. (California Univ., San Francisco (USA). Lab. of Radiobiology)

    1981-11-27

    DNA fork displacement rates were measured in 20 human cell lines by a bromodeoxyuridine-313 nm photolysis technique. Cell lines included representatives of normal diploid, Fanconi's anemia, ataxia telangiectasia, xeroderma pigmentosum, trisomy-21 and several transformed lines. The average value for all the cell lines was 0.53 +- 0.08 ..mu..m/min. The average value for individual cell lines, however, displayed a 30% variation. Less than 10% of variation in the fork displacement rate appears to be due to the experimental technique; the remainder is probably due to true variation among the cell types and to culture conditions.

  18. Human DNA repair and recombination genes

    International Nuclear Information System (INIS)

    Thompson, L.H.; Weber, C.A.; Jones, N.J.

    1988-09-01

    Several genes involved in mammalian DNA repair pathways were identified by complementation analysis and chromosomal mapping based on hybrid cells. Eight complementation groups of rodent mutants defective in the repair of uv radiation damage are now identified. At least seven of these genes are probably essential for repair and at least six of them control the incision step. The many genes required for repair of DNA cross-linking damage show overlap with those involved in the repair of uv damage, but some of these genes appear to be unique for cross-link repair. Two genes residing on human chromosome 19 were cloned from genomic transformants using a cosmid vector, and near full-length cDNA clones of each gene were isolated and sequenced. Gene ERCC2 efficiently corrects the defect in CHO UV5, a nucleotide excision repair mutant. Gene XRCC1 normalizes repair of strand breaks and the excessive sister chromatid exchange in CHO mutant EM9. ERCC2 shows a remarkable /approximately/52% overall homology at both the amino acid and nucleotide levels with the yeast RAD3 gene. Evidence based on mutation induction frequencies suggests that ERCC2, like RAD3, might also be an essential gene for viability. 100 refs., 4 tabs

  19. Protective role of probiotic lactic acid bacteria against dietary fumonisin B1-induced toxicity and DNA-fragmentation in sprague-dawley rats.

    Science.gov (United States)

    Khalil, Ashraf A; Abou-Gabal, Ashgan E; Abdellatef, Amira A; Khalid, Ahmed E

    2015-08-18

    The genus Fusarium, especially F. verticillioides and F. proliferatum, has been found in several agricultural products worldwide, especially in maize. Regardless the occurrence of symptoms, the presence of Fusarium in maize constitutes an imminent risk due to its ability to produce fumonisins, mycotoxins with proven carcinogenic effect on rats, swine, and equines and already classified as possible carcinogens to humans. The toxicity of incremental levels of fumonisin B1 (FB1), that is, 50, 100, and 200 mg FB1/kg diet, and the role of Lactobacillus delbrueckii subsp. lactis DSM 20076 (LL) and Pediococcus acidilactici NNRL B-5627 (PA) supplementation in counteracting the FB1 effects in intoxicated rats were monitored over a period of 4 weeks. Effects on the feed intake and body weight gain were noticed. A significant (p ≤ 0.05) increase in the level of liver and kidney functions markers and DNA fragmentation was also noticed in rat groups T100 and T200. The lactic acid bacteria (LAB) supplementation could bring back the normal serum biochemical parameters in rats fed on fumonisin B1-contaminated diets (T50 and T100) compared to FB1-treated groups. In rats of high-dosage dietary groups supplemented with LAB (T200-LL and T200-PA), the supplementation reduced the serum activity levels of alanine aminotransferase (ALT), aspartate aminotransferase (AST), alkaline phosphatase (ALP), and creatinine by 11.3, 11.9, 32, and 20%, respectively. DNA fragmentations were observed in the rat group treated with 200 mg FB1 after 3 weeks, while fragmentation was noticed in treated groups with 100 and 200 mg FB1 after 4 weeks. No DNA fragmentation was apparent in FB1-treated rats co-administered the LL or PA strain. These results suggest that in male rats consuming diets containing FB1, there is a time- and dose-dependent increase in serum enzyme activities and DNA lesions. Moreover, Lb. delbrueckii subsp. lactis (LL) and P. acidilactici (PA) strains have a protective effect

  20. Generation of a panel of somatic cell hybrids containing unselected fragments of human chromosome 10 by X-ray irradiation and cell fusion: Application to isolating the MEN2A region in hybrid cells

    International Nuclear Information System (INIS)

    Goodfellow, P.J.; Povey, S.; Nevanlinna, H.A.; Goodfellow, P.N.

    1990-01-01

    We have used X-ray irradiation and cell fusion to generate somatic cell hybrids containing fragments of human chromosome 10. Our experiments were directed towards isolating the region of the MEN2A gene in hybrids and to use those as the source of DNA for cloning and mapping new markers from near the MEN2A locus. A number of hybrid clones containing human sequences that are tightly linked to the MEN2A gene were identified. Some 25% of our hybrids, however, proved to contain more than one human chromosome 10-derived fragment or showed evidence of deletions and/or rearrangements. A detailed analysis of the human content of X-ray irradiation hybrids is required to assess the integrity and number of human fragments retained. Despite retention of multiple human-derived fragments, these hybrids will prove useful as cloning and mapping resources

  1. Pst I restriction fragment length polymorphism of the human placental alkaline phosphatase gene in normal placentae and tumors

    International Nuclear Information System (INIS)

    Tsavaler, L.; Penhallow, R.C.; Kam, W.; Sussman, H.H.

    1987-01-01

    The structure of the human placental alkaline phosphatase gene from normal term placentae was studied by restriction enzyme digestion and Southern blot analysis using a cDNA probe to the gene for the placental enzyme. The DNA digests fall into three distinct patterns based on the presence and intensity of an extra 1.1-kilobase Pst I Band. The extra 1.1-kilobase band is present in 9 of 27 placenta samples, and in 1 of these samples the extra band is present at double intensity. No polymorphism was revealed by digestion with restriction enzymes EcoRI, Sma I, BamHI, or Sac I. The extra Pst I-digestion site may lie in a noncoding region of the gene because no correlation was observed between the restriction fragment length polymorphism and the common placental alkaline phosphatase alleles identified by starch gel electrophoresis. In addition, because placental alkaline phosphatase is frequently re-expressed in neoplasms, the authors examined tissue from ovarian, testicular, and endometrial tumors and from BeWo choriocarcinoma cells in culture. The Pst I-DNA digestion patterns from these cells and tissues were identical to those seen in the normal ovary and term placentae. The consistent reproducible digestion patterns seen in DNA from normal and tumor tissue indicate that a major gene rearrangement is not the basis for the ectopic expression of placental alkaline phosphatase in neoplasia

  2. Radioimmunodetection of human tumor xenografts by monoclonal antibody F(ab')/sub 2/ fragments

    Energy Technology Data Exchange (ETDEWEB)

    Herlyn, D.; Munz, D.L.; Herlyn, M.; Koprowski, H.; Powe, J.; Alavi, A.; Meinken, G.E.; Srivastava, S.C.

    1986-01-01

    Procedures are described for the radiolocalization of human tumors by murine monoclonal antibodies (MAb) in animal model systems. Visualization of tumor xenografts was clearer in nude mice compared to experimentally immunosuppressed mice due to the higher tumor viability. MAb localization in tumor tissue was greatly enhanced when F(ab')/sub 2/ fragments rather than intact antibody molecules were used. Although tumors could be visualized with /sup 131/I-, /sup 123/I-or /sup 111/In-labeled MAb fragments without background subtraction, tumor-to-background ratios of radioactivity were highest for /sup 131/I-labeled fragments. /sup 131/I-labeled F(ab')/sub 2/ fragments of eight MAb against human colorectal carcinoma, melanoma or lung carcinoma localized specifically only in those tumors that bound the MAb in vitro and not in unrelated tumors. Radiolabeled fragments of MAb with other specificities (anti-hepatitis virus MAb) did not localize in tumors. All MAb that inhibited tumor growth in nude mice effectively localized these tumors by ..gamma..-scintigraphy. Some MAb were effective in localizing tumors but ineffective in inhibiting their growth. The ability of the specific radiolabeled F(ab')/sub 2/ fragments to localize in tumor grafts correlated significantly with MAb binding affinity and density of antigenic sites on tumor cells together, but not with either in vitro binding parameter alone.

  3. Sperm DNA fragmentation induced by cryopreservation: new insights and effect of a natural extract from Opuntia ficus-indica.

    Science.gov (United States)

    Meamar, Mehrdad; Zribi, Nassira; Cambi, Marta; Tamburrino, Lara; Marchiani, Sara; Filimberti, Erminio; Fino, Maria Grazia; Biggeri, Annibale; Menezo, Yves; Forti, Gianni; Baldi, Elisabetta; Muratori, Monica

    2012-08-01

    To analyze the effect of cryopreservation on sperm DNA fragmentation (SDF) in two cytometric sperm populations, PI(brighter) and PI(dimmer), and to test the effects of Opuntia ficus-indica (OFI) extracts, which contain antioxidants and flavanoids, and of resveratrol on cryopreservation of human semen. In vitro prospective study. Institutional study. Twenty-one normozoospermic men undergoing semen analysis for couple infertility. Cryopreservation using the routine method in the presence of OFI extracts or resveratrol. Measurement of SDF by TUNEL/PI flow cytometric method to evaluate sperm motility (by automated motion analysis, CASA system) and viability (by eosin/nigrosin staining) in the two populations of sperm PI(br) and PI(dim). Cryopreservation induced an increase of SDF only in the PI(br) sperm population. The increase was negatively dependent on the basal values of SDF in the same population. Addition of OFI extracts and resveratrol to the cryopreservation medium slightly but statistically significantly reduced SDF in the PI(br) population without affecting the deleterious effect of cryopreservation on sperm motion parameters or viability. The increase of SDF in the PI(br) population, which is unrelated to semen quality, suggests that caution must be taken in using cryopreserved semen, as morphologically normal and motile sperm may be damaged. The addition of substances with multifunctional properties such as OFI extracts to cryopreservation medium is only slightly effective in preventing the dramatic effects on SDF. Copyright © 2012 American Society for Reproductive Medicine. Published by Elsevier Inc. All rights reserved.

  4. Screening and identification of male-specific DNA fragments in common carps Cyprinus carpio using suppression subtractive hybridization.

    Science.gov (United States)

    Chen, J J; Du, Q Y; Yue, Y Y; Dang, B J; Chang, Z J

    2010-08-01

    In this study, a sex subtractive genomic DNA library was constructed using suppression subtractive hybridization (SSH) between male and female Cyprinus carpio. Twenty-two clones with distinguishable hybridization signals were selected and sequenced. The specific primers were designed based on the sequence data. Those primers were then used to amplify the sex-specific fragments from the genomic DNA of male and female carp. The amplified fragments from two clones showed specificity to males but not to females, which were named as Ccmf2 [387 base pairs (bp)] and Ccmf3 (183 bp), respectively. The sex-specific pattern was analysed in a total of 40 individuals from three other different C. carpio. stocks and grass carp Ctenopharyngodon idella using Ccmf2 and Ccmf3 as dot-blotting probes. The results revealed that the molecular diversity exists on the Y chromosome of C. carpio. No hybridization signals, however, were detected from individuals of C. idella, suggesting that the two sequences are specific to C. carpio. No significant homologous sequences of Ccmf2 and Ccmf3 were found in GenBank. Therefore, it was interpreted that the results as that Ccmf2 and Ccmf3 are two novel male-specific sequences; and both fragments could be used as markers to rapidly and accurately identify the genetic sex of part of C. carpio. This may provide a very efficient selective tool for practically breeding monosex female populations in aquacultural production.

  5. Analysis of Endonuclease R·EcoRI Fragments of DNA from Lambdoid Bacteriophages and Other Viruses by Agarose-Gel Electrophoresis

    Science.gov (United States)

    Helling, Robert B.; Goodman, Howard M.; Boyer, Herbert W.

    1974-01-01

    By means of agarose-gel electrophoresis, endonuclease R·EcoRI-generated fragments of DNA from various viruses were separated, their molecular weights were determined, and complete or partial fragment maps for lambda, φ80, and hybrid phages were constructed. Images PMID:4372397

  6. OCCURRENCE OF SMALL HOMOLOGOUS AND COMPLEMENTARY FRAGMENTS IN HUMAN VIRUS GENOMES AND THEIR POSSIBLE ROLE

    Directory of Open Access Journals (Sweden)

    E. P. Kharchenko

    2017-01-01

    Full Text Available With computer analysis occurrence of small homologous and complementary fragments (21 nucleotides in length has been studied in genomes of 14 human viruses causing most dangerous infections. The sample includes viruses with (+ and (– single stranded RNA and DNA-containing hepatitis A virus. Analysis of occurrence of homologous sequences has shown the existence two extreme situations. On the one hand, the same virus contains homologous sequences to almost all other viruses (for example, Ebola virus, severe acute respiratory syndrome-related coronavirus, and mumps virus, and numerous homologous sequences to the same other virus (especially in severe acute respiratory syndrome-related coronavirus to Dengue virus and in Ebola virus to poliovirus. On the other hand, there are rare occurrence and not numerous homologous sequences in genomes of other viruses (rubella virus, hepatitis A virus, and hepatitis B virus. Similar situation exists for occurrence of complementary sequences. Rubella virus, the genome of which has the high content of guanine and cytosine, has no complementary sequences to almost all other viruses. Most viruses have moderate level of occurrence for homologous and complementary sequences. Autocomplementary sequences are numerous in most viruses and one may suggest that the genome of single stranded RNA viruses has branched secondary structure. In addition to possible role in recombination among strains autocomplementary sequences could be regulators of translation rate of virus proteins and determine its optimal proportion in virion assembly with genome and mRNA folding. Occurrence of small homologous and complementary sequences in RNA- and DNA-containing viruses may be the result of multiple recombinations in the past and the present and determine their adaptation and variability. Recombination may take place in coinfection of human and/or common hosts. Inclusion of homologous and complementary sequences into genome could not

  7. Generation of biologically active endostatin fragments from human collagen XVIII by distinct matrix metalloproteases

    International Nuclear Information System (INIS)

    Heljasvaara, Ritva; Nyberg, Pia; Luostarinen, Jani; Parikka, Mataleena; Heikkilae, Pia; Rehn, Marko; Sorsa, Timo; Salo, Tuula; Pihlajaniemi, Taina

    2005-01-01

    Endostatin, a potent inhibitor of endothelial cell proliferation, migration, angiogenesis and tumor growth, is proteolytically cleaved from the C-terminal noncollagenous NC1 domain of type XVIII collagen. We investigated the endostatin formation from human collagen XVIII by several MMPs in vitro. The generation of endostatin fragments differing in molecular size (24-30 kDa) and in N-terminal sequences was identified in the cases of MMP-3, -7, -9, -13 and -20. The cleavage sites were located in the protease-sensitive hinge region between the trimerization and endostatin domains of NC1. MMP-1, -2, -8 and -12 did not show any significant activity against the C-terminus of collagen XVIII. The anti-proliferative effect of the 20-kDa endostatin, three longer endostatin-containing fragments generated in vitro by distinct MMPs and the entire NC1 domain, on bFGF-stimulated human umbilical vein endothelial cells was established. The anti-migratory potential of some of these fragments was also studied. In addition, production of endostatin fragments between 24-30 kDa by human hepatoblastoma cells was shown to be due to MMP action on type XVIII collagen. Our results indicate that certain, especially cancer-related, MMP family members can generate biologically active endostatin-containing polypeptides from collagen XVIII and thus, by releasing endostatin fragments, may participate in the inhibition of endothelial cell proliferation, migration and angiogenesis

  8. Human impacts affect tree community features of 20 forest fragments of a vanishing neotropical hotspot.

    Science.gov (United States)

    Pereira, José Aldo Alves; de Oliveira-Filho, Ary Teixeira; Eisenlohr, Pedro V; Miranda, Pedro L S; de Lemos Filho, José Pires

    2015-02-01

    The loss in forest area due to human occupancy is not the only threat to the remaining biodiversity: forest fragments are susceptible to additional human impact. Our aim was to investigate the effect of human impact on tree community features (species composition and abundance, and structural descriptors) and check if there was a decrease in the number of slender trees, an increase in the amount of large trees, and also a reduction in the number of tree species that occur in 20 fragments of Atlantic montane semideciduous forest in southeastern Brazil. We produced digital maps of each forest fragment using Landsat 7 satellite images and processed the maps to obtain morphometric variables. We used investigative questionnaires and field observations to survey the history of human impact. We then converted the information into scores given to the extent, severity, and duration of each impact, including proportional border area, fire, trails, coppicing, logging, and cattle, and converted these scores into categorical levels. We used linear models to assess the effect of impacts on tree species abundance distribution and stand structural descriptors. Part of the variation in floristic patterns was significantly correlated to the impacts of fire, logging, and proportional border area. Structural descriptors were influenced by cattle and outer roads. Our results provided, for the first time, strong evidence that tree species occurrence and abundance, and forest structure of Atlantic seasonal forest fragments respond differently to various modes of disturbance by humans.

  9. [Whole Genome Sequencing of Human mtDNA Based on Ion Torrent PGM™ Platform].

    Science.gov (United States)

    Cao, Y; Zou, K N; Huang, J P; Ma, K; Ping, Y

    2017-08-01

    To analyze and detect the whole genome sequence of human mitochondrial DNA (mtDNA) by Ion Torrent PGM™ platform and to study the differences of mtDNA sequence in different tissues. Samples were collected from 6 unrelated individuals by forensic postmortem examination, including chest blood, hair, costicartilage, nail, skeletal muscle and oral epithelium. Amplification of whole genome sequence of mtDNA was performed by 4 pairs of primer. Libraries were constructed with Ion Shear™ Plus Reagents kit and Ion Plus Fragment Library kit. Whole genome sequencing of mtDNA was performed using Ion Torrent PGM™ platform. Sanger sequencing was used to determine the heteroplasmy positions and the mutation positions on HVⅠ region. The whole genome sequence of mtDNA from all samples were amplified successfully. Six unrelated individuals belonged to 6 different haplotypes. Different tissues in one individual had heteroplasmy difference. The heteroplasmy positions and the mutation positions on HVⅠ region were verified by Sanger sequencing. After a consistency check by the Kappa method, it was found that the results of mtDNA sequence had a high consistency in different tissues. The testing method used in present study for sequencing the whole genome sequence of human mtDNA can detect the heteroplasmy difference in different tissues, which have good consistency. The results provide guidance for the further applications of mtDNA in forensic science. Copyright© by the Editorial Department of Journal of Forensic Medicine

  10. Use of testicular sperm for intracytoplasmic sperm injection in men with high sperm DNA fragmentation: a SWOT analysis.

    Science.gov (United States)

    Esteves, Sandro C; Roque, Matheus; Garrido, Nicolás

    2018-01-01

    Spermatozoa retrieved from the testis of men with high levels of sperm DNA fragmentation (SDF) in the neat semen tend to have better DNA quality. Given the negative impact of SDF on the outcomes of Assisted Reproductive Technology (ART), an increased interest has emerged about the use of testicular sperm for intracytoplasmic sperm injection (Testi-ICSI). In this article, we used a SWOT (strengths, weaknesses, opportunities, and threats) analysis to summarize the advantages and drawbacks of this intervention. The rationale of Testi-ICSI is bypass posttesticular DNA fragmentation caused by oxidative stress during sperm transit through the epididymis. Hence, oocyte fertilization by genomically intact testicular spermatozoa may be optimized, thus increasing the chances of creating a normal embryonic genome and the likelihood of achieving a live birth, as recently demonstrated in men with high SDF. However, there is still limited evidence as regards the clinical efficacy of Testi-ICSI, thus creating opportunities for further confirmatory clinical research as well as investigation of Testi-ICSI in clinical scenarios other than high SDF. Furthermore, Testi-ICSI can be compared to other laboratory preparation methods for deselecting sperm with damaged DNA. At present, the available literature supports the use of testicular sperm when performing ICSI in infertile couples whose male partners have posttesticular SDF. Due to inherent risks of sperm retrieval, Testi-ICSI should be offered when less invasive treatments for alleviating DNA damage have failed. A call for continuous monitoring is nonetheless required concerning the health of generated offspring and the potential complications of sperm retrieval.

  11. The persistence of human DNA in soil following surface decomposition.

    Science.gov (United States)

    Emmons, Alexandra L; DeBruyn, Jennifer M; Mundorff, Amy Z; Cobaugh, Kelly L; Cabana, Graciela S

    2017-09-01

    Though recent decades have seen a marked increase in research concerning the impact of human decomposition on the grave soil environment, the fate of human DNA in grave soil has been relatively understudied. With the purpose of supplementing the growing body of literature in forensic soil taphonomy, this study assessed the relative persistence of human DNA in soil over the course of decomposition. Endpoint PCR was used to assess the presence or absence of human nuclear and mitochondrial DNA, while qPCR was used to evaluate the quantity of human DNA recovered from the soil beneath four cadavers at the University of Tennessee's Anthropology Research Facility (ARF). Human nuclear DNA from the soil was largely unrecoverable, while human mitochondrial DNA was detectable in the soil throughout all decomposition stages. Mitochondrial DNA copy abundances were not significantly different between decomposition stages and were not significantly correlated to soil edaphic parameters tested. There was, however, a significant positive correlation between mitochondrial DNA copy abundances and the human associated bacteria, Bacteroides, as estimated by 16S rRNA gene abundances. These results show that human mitochondrial DNA can persist in grave soil and be consistently detected throughout decomposition. Copyright © 2017 The Chartered Society of Forensic Sciences. Published by Elsevier B.V. All rights reserved.

  12. Phage-display libraries of murine and human antibody Fab fragments

    DEFF Research Database (Denmark)

    Engberg, J; Andersen, P S; Nielsen, L K

    1996-01-01

    We provide efficient and detailed procedures for construction, expression, and screening of comprehensive libraries of murine or human antibody Fab fragments displayed on the surface of filamentous phage. In addition, protocols for producing and using ultra-electrocompetent cells, for producing Fab...

  13. A recombinant, fully human monoclonal antibody with antitumor activity constructed from phage-displayed antibody fragments

    NARCIS (Netherlands)

    Huls, GA; Heijnen, IAFM; Cuomo, ME; Koningsberger, JC; Boel, E; de Vries, ARV; Loyson, SAJ; Helfrich, W; Henegouwen, GPV; van Meijer, M; de Kruif, J; Logtenberg, T

    A single-chain Fv antibody fragment specific for the tumor-associated Ep-CAM molecule was isolated from a semisynthetic phage display library and converted into an intact, fully human IgG1 monoclonal antibody (huMab), The purified huMab had an affinity of 5 nM and effectively mediated tumor cell

  14. EFFECT OF PROSTATILEN® AC ON SPERM DNA FRAGMENTATION DURING TREATMENT OF PATIENTS WITH CHRONIC NONBACTERIAL PROSTATITIS AND CONCOMITANT DISORDERS OF THE REPRODUCTIVE FUNCTION

    Directory of Open Access Journals (Sweden)

    S. Yu. Borovets

    2017-01-01

    Full Text Available The study objective is to analyze the effect of Prostatilen® AC on sperm DNA fragmentation during treatment of patients with chronic nonbacterial prostatitis and concomitant disorders of the reproductive function.Materials and methods. The study is based on the results of treatment of 25 men aged 24 to 45 years (mean age 35.3 ± 4.4 years with a verified diagnosis of chronic nonbacterial prostatitis and complaints of early-stage missed miscarriage in a spouse/sexual partner. All patients received Prostatilen® AC daily in rectal suppositories formulation. The duration of treatment was 10 days with retreatment after 20 days. In all patients before treatment and 20 days after it, spermiogram parameters (5th ed., WHO, 2010 and sperm DNA fragmentation level using SCSA (sperm chromatin structure assay by FACSCantoll with monoclonal antibodies (Roche, Germany were determined, and all patients underwent the MAR (mixed antiglobulin reaction test with normal value considered to be 10 % or less. The normal value of sperm DNA fragmentation was considered to be 15 % or less (low risk of fertility impairment. The analysis of the obtained data was carried out using the IBM SPSS Statistics program 22.Results. Before the treatment, pathologic level of sperm DNA fragmentation was observed in 6 (43 % of 14 patients with normozoospermia and in 7 (63 % of 11 patients with pathozoospermia (χ² = 1.06; p <0.3. Thus, there weren’t any significant difference between the rates of occurrence of increased sperm DNA fragmentation in patients with normo- and pathozoospermia. A correlation was found between the level of sperm DNA fragmentation and the results of MAR test before treatment (r = 0.8, p <0.05, which varied between 0 and 99 % (mean 16.48 ± 31.64 %. Meanwhile, increased sperm DNA fragmentation was observed in 7 (53 % of 13 patients with pathological MAR test results, and in 2 (40 % of 5 patients with normal MAR test results (χ² = 0.67; p <0.01. The level

  15. DNA fragmentation and membrane damage of bocachico Prochilodus magdalenae (Ostariophysi: Prochilodontidae sperm following cryopreservation with dimethylsulfoxide and glucose

    Directory of Open Access Journals (Sweden)

    José Gregorio Martínez

    Full Text Available The endangered bocachico Prochilodus magdalenae is a native freshwater fish of Colombia, the most captured species locally and one of the most important species for ex-situ conservation (germplasm banks. The aim of this study was to examine the effect of three concentrations of Dimethylsulfoxide (DMSO (5%, 10%, 15% and three of glucose (305, 333, 361 mM in the extender on spermatic DNA fragmentation (F-DNA (by Halomax®, Chromatin dispersion and membrane damage (D-Me (by eosin-nigrosin staining. After assessment of sperm quality by computer analysis of motility, one part of semen from males was diluted separately with three parts of extender and filled into 0.5 ml straws. Freezing was carried out in liquid nitrogen vapor dry shipper for 30 minutes and thawed at 60ºC for 8 seconds in a water bath and evaluated for the percentage of cells found with F-DNA and D-Me. The results demonstrated that cryopreservation causes greater F-DNA (13.62 ± 1.6% to 28.91 ± 3.25 and D-Me (24.27 ± 1.1% to 58.33 ± 2.81% when compared with pre-freezing semen (PFS (6.71 ± 1.54% and 2.34 ± 0.5%, respectively for F-DNA and D-Me. A significant interaction was found between DMSO and glucose concentration in this experiment. Use of extender: 10% DMSO + 305 mM glucose + 12% chicken egg yolk and, 10% DMSO + 333 mM glucose + 12% chicken egg yolk, allow for lower F-DNA and D-Me during cryopreservation of bocachico semen. A high correlation between F-DNA and D-Me was found (r = 0.771.

  16. Human Parvovirus B19 Utilizes Cellular DNA Replication Machinery for Viral DNA Replication.

    Science.gov (United States)

    Zou, Wei; Wang, Zekun; Xiong, Min; Chen, Aaron Yun; Xu, Peng; Ganaie, Safder S; Badawi, Yomna; Kleiboeker, Steve; Nishimune, Hiroshi; Ye, Shui Qing; Qiu, Jianming

    2018-03-01

    Human parvovirus B19 (B19V) infection of human erythroid progenitor cells (EPCs) induces a DNA damage response and cell cycle arrest at late S phase, which facilitates viral DNA replication. However, it is not clear exactly which cellular factors are employed by this single-stranded DNA virus. Here, we used microarrays to systematically analyze the dynamic transcriptome of EPCs infected with B19V. We found that DNA metabolism, DNA replication, DNA repair, DNA damage response, cell cycle, and cell cycle arrest pathways were significantly regulated after B19V infection. Confocal microscopy analyses revealed that most cellular DNA replication proteins were recruited to the centers of viral DNA replication, but not the DNA repair DNA polymerases. Our results suggest that DNA replication polymerase δ and polymerase α are responsible for B19V DNA replication by knocking down its expression in EPCs. We further showed that although RPA32 is essential for B19V DNA replication and the phosphorylated forms of RPA32 colocalized with the replicating viral genomes, RPA32 phosphorylation was not necessary for B19V DNA replication. Thus, this report provides evidence that B19V uses the cellular DNA replication machinery for viral DNA replication. IMPORTANCE Human parvovirus B19 (B19V) infection can cause transient aplastic crisis, persistent viremia, and pure red cell aplasia. In fetuses, B19V infection can result in nonimmune hydrops fetalis and fetal death. These clinical manifestations of B19V infection are a direct outcome of the death of human erythroid progenitors that host B19V replication. B19V infection induces a DNA damage response that is important for cell cycle arrest at late S phase. Here, we analyzed dynamic changes in cellular gene expression and found that DNA metabolic processes are tightly regulated during B19V infection. Although genes involved in cellular DNA replication were downregulated overall, the cellular DNA replication machinery was tightly

  17. SINGLE CHAIN VARIABLE FRAGMENTS OF ANTIBODIES AGAINST DIPHTHERIA TOXIN B-SUBUNIT ISOLATED FROM PHAGE DISPLAY HUMAN ANTIBODY LIBRARY

    Directory of Open Access Journals (Sweden)

    Oliinyk O. S.

    2014-02-01

    Full Text Available Diphtheria toxin is an exoantigen of Corynebacterium diphtheriae that inhibits protein synthesis and kills sensitive cells. The aim of this study was to obtain human recombinant single-chain variable fragment (scFv antibodies against receptor-binding B subunit of diphtheria toxin. 12 specific clones were selected after three rounds of a phage display naїve (unimmunized human antibody library against recombinant B-subunit. scFv DNA inserts from these 12 clones were digested with MvaI, and 6 unique restriction patterns were found. Single-chain antibodies were expressed in Escherichia coli XL1-blue. The recombinant proteins were characterized by immunoblotting of bacterial extracts and detection with an anti-E-tag antibody. The toxin B-subunit-binding function of the single-chain antibody was shown by ELISA. The affinity constants for different clones were found to be from 106 to 108 М–1. Due to the fact, that these antibody fragments recognized epitopes in the receptor-binding Bsubunit of diphtheria toxin, further studies are interesting to evaluate their toxin neutralization properties and potential for therapeutic applications. Obtained scFv-antibodies can also be used for detection and investigation of biological properties of diphtheria toxin.

  18. Homologous subfamilies of human alphoid repetitive DNA on different nucleolus organizing chromosomes

    International Nuclear Information System (INIS)

    Joergensen, A.L.; Bostock, C.J.; Bak, A.L.

    1987-01-01

    The organization of alphoid repeated sequences on human nucleolus-organizing (NOR) chromosomes 13, 21, and 22 has been investigated. Analysis of hybridization of alphoid DNA probes to Southern transfers of restriction enzyme-digested DNA fragments from hybrid cells containing single human chromosomes shows that chromosomes 13 and 21 share one subfamily of alphoid repeats, whereas a different subfamily may be held in common by chromosomes 13 and 22. The sequences of cloned 680-base-pair EcoRI fragments of the alphoid DNA from chromosomes 13 and 21 show that the basic unit of this subfamily is indistinguishable on each chromosome. The sequence of cloned 1020-base-pair Xba I fragments from chromosome 22 is related to, but distinguishable from, that of the 680-base-pair EcoRI alphoid subfamily of chromosomes 13 and 21. These results suggest that, at some point after they originated and were homogenized, different subfamilies of alphoid sequences must have exchanged between chromosomes 13 and 21 and separately between chromosomes 13 and 22

  19. Genomic DNA fingerprinting of clinical Haemophilus influenzae isolates by polymerase chain reaction amplification: comparison with major outer-membrane protein and restriction fragment length polymorphism analysis

    NARCIS (Netherlands)

    van Belkum, A.; Duim, B.; Regelink, A.; Möller, L.; Quint, W.; van Alphen, L.

    1994-01-01

    Non-capsulate strains of Haemophilus influenzae were genotyped by analysis of variable DNA segments obtained by amplification of genomic DNA with the polymerase chain reaction (PCR fingerprinting). Discrete fragments of 100-2000 bp were obtained. The reproducibility of the procedure was assessed by

  20. Discovery of human inversion polymorphisms by comparative analysis of human and chimpanzee DNA sequence assemblies.

    Directory of Open Access Journals (Sweden)

    2005-10-01

    Full Text Available With a draft genome-sequence assembly for the chimpanzee available, it is now possible to perform genome-wide analyses to identify, at a submicroscopic level, structural rearrangements that have occurred between chimpanzees and humans. The goal of this study was to investigate chromosomal regions that are inverted between the chimpanzee and human genomes. Using the net alignments for the builds of the human and chimpanzee genome assemblies, we identified a total of 1,576 putative regions of inverted orientation, covering more than 154 mega-bases of DNA. The DNA segments are distributed throughout the genome and range from 23 base pairs to 62 mega-bases in length. For the 66 inversions more than 25 kilobases (kb in length, 75% were flanked on one or both sides by (often unrelated segmental duplications. Using PCR and fluorescence in situ hybridization we experimentally validated 23 of 27 (85% semi-randomly chosen regions; the largest novel inversion confirmed was 4.3 mega-bases at human Chromosome 7p14. Gorilla was used as an out-group to assign ancestral status to the variants. All experimentally validated inversion regions were then assayed against a panel of human samples and three of the 23 (13% regions were found to be polymorphic in the human genome. These polymorphic inversions include 730 kb (at 7p22, 13 kb (at 7q11, and 1 kb (at 16q24 fragments with a 5%, 30%, and 48% minor allele frequency, respectively. Our results suggest that inversions are an important source of variation in primate genome evolution. The finding of at least three novel inversion polymorphisms in humans indicates this type of structural variation may be a more common feature of our genome than previously realized.

  1. Ionizing Radiation-Induced DNA Damage and Its Repair in Human Cells

    Energy Technology Data Exchange (ETDEWEB)

    Dizdaroglu, Miral

    1999-05-12

    DNA damage in mammalian chromatin in vitro and in cultured mammalian cells including human cells was studied. In the first phase of these studies, a cell culture laboratory was established. Necessary equipment including an incubator, a sterile laminar flow hood and several centrifuges was purchased. We have successfully grown several cell lines such as murine hybridoma cells, V79 cells and human K562 leukemia cells. This was followed by the establishment of a methodology for the isolation of chromatin from cells. This was a very important step, because a routine and successful isolation of chromatin was a prerequisite for the success of the further studies in this project, the aim of which was the measurement of DNA darnage in mammalian chromatin in vitro and in cultured cells. Chromatin isolation was accomplished using a slightly modified procedure of the one described by Mee & Adelstein (1981). For identification and quantitation of DNA damage in cells, analysis of chromatin was preferred over the analysis of "naked DNA" for the following reasons: i. DNA may not be extracted efficiently from nucleoprotein in exposed cells, due to formation of DNA-protein cross-links, ii. the extractability of DNA is well known to decrease with increasing doses of radiation, iii. portions of DNA may not be extracted due to fragmentation, iv. unextracted DNA may contain a significant portion of damaged DNA bases and DNA-protein cross-links. The technique of gas chromatography/mass spectrometry (GC/MS), which was used in the present project, permits the identification and quantitation of modified DNA bases in chromatin in the presence of proteins without the necessity of first isolating DNA from chromatin. This has been demonstrated previously by the results from our laboratory and by the results obtained during the course of the present project. The quality of isolated chromatin was tested by measurement of its content of DNA, proteins, and RNA, by analysis of its protein

  2. Ionizing Radiation-Induced DNA Damage and Its Repair in Human Cells

    International Nuclear Information System (INIS)

    Dizdaroglu, Miral

    1999-01-01

    DNA damage in mammalian chromatin in vitro and in cultured mammalian cells including human cells was studied. In the first phase of these studies, a cell culture laboratory was established. Necessary equipment including an incubator, a sterile laminar flow hood and several centrifuges was purchased. We have successfully grown several cell lines such as murine hybridoma cells, V79 cells and human K562 leukemia cells. This was followed by the establishment of a methodology for the isolation of chromatin from cells. This was a very important step, because a routine and successful isolation of chromatin was a prerequisite for the success of the further studies in this project, the aim of which was the measurement of DNA darnage in mammalian chromatin in vitro and in cultured cells. Chromatin isolation was accomplished using a slightly modified procedure of the one described by Mee ampersand Adelstein (1981). For identification and quantitation of DNA damage in cells, analysis of chromatin was preferred over the analysis of ''naked DNA'' for the following reasons: i. DNA may not be extracted efficiently from nucleoprotein in exposed cells, due to formation of DNA-protein cross-links, ii. the extractability of DNA is well known to decrease with increasing doses of radiation, iii. portions of DNA may not be extracted due to fragmentation, iv. unextracted DNA may contain a significant portion of damaged DNA bases and DNA-protein cross-links. The technique of gas chromatography/mass spectrometry (GC/MS), which was used in the present project, permits the identification and quantitation of modified DNA bases in chromatin in the presence of proteins without the necessity of first isolating DNA from chromatin. This has been demonstrated previously by the results from our laboratory and by the results obtained during the course of the present project. The quality of isolated chromatin was tested by measurement of its content of DNA, proteins, and RNA, by analysis of its protein

  3. Excessive cytosolic DNA fragments as a potential trigger of Graves’ disease: an encrypted message sent by animal models

    Directory of Open Access Journals (Sweden)

    Yuqian Luo

    2016-11-01

    Full Text Available Graves’ hyperthyroidism is caused by autoantibodies directed against the thyroid stimulating hormone receptor (TSHR that mimic the action of TSH. The establishment of Graves’ hyperthyroidism in experimental animals has proven to be an important approach to dissect the mechanisms of self-tolerance breakdown that lead to the production of thyroid-stimulating TSHR autoantibodies (TSAbs. ‘Shimojo’s model was the first successful Graves’ animal model, wherein immunization with fibroblasts cells expressing TSHR and a major histocompatibility complex (MHC class II molecule, but not either alone, induced TSAb production in AKR/N (H-2k mice. This model highlights the importance of coincident MHC class II expression on TSHR-expressing cells in the development of Graves’ hyperthyroidism. These data are also in agreement with the observation that Graves’ thyrocytes often aberrantly express MHC class II antigens via mechanisms that remain unclear. Our group demonstrated that cytosolic self-genomic DNA fragments derived from sterile injured cells can induce aberrant MHC class II expression and production of multiple inflammatory cytokines and chemokines in thyrocytes in vitro, suggesting that severe cell injury may initiate immune responses in a way that is relevant to thyroid autoimmunity mediated by cytosolic DNA signaling. Furthermore, more recent successful Graves’ animal models were primarily established by immunizing mice with TSHR-expressing plasmids or adenovirus. In these models, double-stranded DNA vaccine contents presumably exert similar immune-activating effect in cells at inoculation sites and thus might pave the way toward successful Graves’ animal models. This review focuses on evidence suggesting that cell injury-derived self-DNA fragments could act as Graves’ disease triggers.

  4. Repair of DNA-polypeptide crosslinks by human excision nuclease

    Science.gov (United States)

    Reardon, Joyce T.; Sancar, Aziz

    2006-03-01

    DNA-protein crosslinks are relatively common DNA lesions that form during the physiological processing of DNA by replication and recombination proteins, by side reactions of base excision repair enzymes, and by cellular exposure to bifunctional DNA-damaging agents such as platinum compounds. The mechanism by which pathological DNA-protein crosslinks are repaired in humans is not known. In this study, we investigated the mechanism of recognition and repair of protein-DNA and oligopeptide-DNA crosslinks by the human excision nuclease. Under our assay conditions, the human nucleotide excision repair system did not remove a 16-kDa protein crosslinked to DNA at a detectable level. However, 4- and 12-aa-long oligopeptides crosslinked to the DNA backbone were recognized by some of the damage recognition factors of the human excision nuclease with moderate selectivity and were excised from DNA at relatively efficient rates. Our data suggest that, if coupled with proteolytic degradation of the crosslinked protein, the human excision nuclease may be the major enzyme system for eliminating protein-DNA crosslinks from the genome. damage recognition | nucleotide excision repair

  5. Human β satellite DNA: Genomic organization and sequence definition of a class of highly repetitive tandem DNA

    International Nuclear Information System (INIS)

    Waye, J.S.; Willard, H.F.

    1989-01-01

    The authors describe a class of human repetitive DNA, called β satellite, that, at a most fundamental level, exists as tandem arrays of diverged ∼68-base-pair monomer repeat units. The monomer units are organized as distinct subsets, each characterized by a multimeric higher-order repeat unit that is tandemly reiterated and represents a recent unit of amplification. They have cloned, characterized, and determined the sequence of two β satellite higher-order repeat units: one located on chromosome 9, the other on the acrocentric chromosomes (13, 14, 15, 21, and 22) and perhaps other sites in the genome. Analysis by pulsed-field gel electrophoresis reveals that these tandem arrays are localized in large domains that are marked by restriction fragment length polymorphisms. In total, β-satellite sequences comprise several million base pairs of DNA in the human genome. Analysis of this DNA family should permit insights into the nature of chromosome-specific and nonspecific modes of satellite DNA evolution and provide useful tools for probing the molecular organization and concerted evolution of the acrocentric chromosomes

  6. Absence of superoxide dismutase activity causes nuclear DNA fragmentation during the aging process

    International Nuclear Information System (INIS)

    Muid, Khandaker Ashfaqul; Karakaya, Hüseyin Çaglar; Koc, Ahmet

    2014-01-01

    Highlights: • Aging process increases ROS accumulation. • Aging process increases DNA damage levels. • Absence of SOD activity does not cause DNA damage in young cells. • Absence of SOD activity accelerate aging and increase oxidative DNA damages during the aging process. - Abstract: Superoxide dismutases (SOD) serve as an important antioxidant defense mechanism in aerobic organisms, and deletion of these genes shortens the replicative life span in the budding yeast Saccharomyces cerevisiae. Even though involvement of superoxide dismutase enzymes in ROS scavenging and the aging process has been studied extensively in different organisms, analyses of DNA damages has not been performed for replicatively old superoxide dismutase deficient cells. In this study, we investigated the roles of SOD1, SOD2 and CCS1 genes in preserving genomic integrity in replicatively old yeast cells using the single cell comet assay. We observed that extend of DNA damage was not significantly different among the young cells of wild type, sod1Δ and sod2Δ strains. However, ccs1Δ mutants showed a 60% higher amount of DNA damage in the young stage compared to that of the wild type cells. The aging process increased the DNA damage rates 3-fold in the wild type and more than 5-fold in sod1Δ, sod2Δ, and ccs1Δ mutant cells. Furthermore, ROS levels of these strains showed a similar pattern to their DNA damage contents. Thus, our results confirm that cells accumulate DNA damages during the aging process and reveal that superoxide dismutase enzymes play a substantial role in preserving the genomic integrity in this process

  7. Absence of superoxide dismutase activity causes nuclear DNA fragmentation during the aging process

    Energy Technology Data Exchange (ETDEWEB)

    Muid, Khandaker Ashfaqul; Karakaya, Hüseyin Çaglar; Koc, Ahmet, E-mail: ahmetkoc@iyte.edu.tr

    2014-02-07

    Highlights: • Aging process increases ROS accumulation. • Aging process increases DNA damage levels. • Absence of SOD activity does not cause DNA damage in young cells. • Absence of SOD activity accelerate aging and increase oxidative DNA damages during the aging process. - Abstract: Superoxide dismutases (SOD) serve as an important antioxidant defense mechanism in aerobic organisms, and deletion of these genes shortens the replicative life span in the budding yeast Saccharomyces cerevisiae. Even though involvement of superoxide dismutase enzymes in ROS scavenging and the aging process has been studied extensively in different organisms, analyses of DNA damages has not been performed for replicatively old superoxide dismutase deficient cells. In this study, we investigated the roles of SOD1, SOD2 and CCS1 genes in preserving genomic integrity in replicatively old yeast cells using the single cell comet assay. We observed that extend of DNA damage was not significantly different among the young cells of wild type, sod1Δ and sod2Δ strains. However, ccs1Δ mutants showed a 60% higher amount of DNA damage in the young stage compared to that of the wild type cells. The aging process increased the DNA damage rates 3-fold in the wild type and more than 5-fold in sod1Δ, sod2Δ, and ccs1Δ mutant cells. Furthermore, ROS levels of these strains showed a similar pattern to their DNA damage contents. Thus, our results confirm that cells accumulate DNA damages during the aging process and reveal that superoxide dismutase enzymes play a substantial role in preserving the genomic integrity in this process.

  8. Crystallization and preliminary X-ray diffraction studies of an RNA aptamer in complex with the human IgG Fc fragment

    International Nuclear Information System (INIS)

    Sugiyama, Shigeru; Nomura, Yusuke; Sakamoto, Taiichi; Kitatani, Tomoya; Kobayashi, Asako; Miyakawa, Shin; Takahashi, Yoshinori; Adachi, Hiroaki; Takano, Kazufumi; Murakami, Satoshi; Inoue, Tsuyoshi; Mori, Yusuke; Nakamura, Yoshikazu; Matsumura, Hiroyoshi

    2008-01-01

    An RNA aptamer in complex with the human IgG Fc fragment have been crystallized. The stirring technique with a rotary shaker was used to improve the crystals and to ensure that they were of high quality and single, resulting in crystals that diffracted to 2.2 Å resolution. Aptamers, which are folded DNA or RNA molecules, bind to target molecules with high affinity and specificity. An RNA aptamer specific for the Fc fragment of human immunoglobulin G (IgG) has recently been identified and it has been demonstrated that an optimized 24-nucleotide RNA aptamer binds to the Fc fragment of human IgG and not to other species. In order to clarify the structural basis of the high specificity of the RNA aptamer, it was crystallized in complex with the Fc fragment of human IgG1. Preliminary X-ray diffraction studies revealed that the crystals belonged to the orthorhombic space group P2 1 2 1 2, with unit-cell parameters a = 83.7, b = 107.2, c = 79.0 Å. A data set has been collected to 2.2 Å resolution

  9. Single-Cell-Based Platform for Copy Number Variation Profiling through Digital Counting of Amplified Genomic DNA Fragments.

    Science.gov (United States)

    Li, Chunmei; Yu, Zhilong; Fu, Yusi; Pang, Yuhong; Huang, Yanyi

    2017-04-26

    We develop a novel single-cell-based platform through digital counting of amplified genomic DNA fragments, named multifraction amplification (mfA), to detect the copy number variations (CNVs) in a single cell. Amplification is required to acquire genomic information from a single cell, while introducing unavoidable bias. Unlike prevalent methods that directly infer CNV profiles from the pattern of sequencing depth, our mfA platform denatures and separates the DNA molecules from a single cell into multiple fractions of a reaction mix before amplification. By examining the sequencing result of each fraction for a specific fragment and applying a segment-merge maximum likelihood algorithm to the calculation of copy number, we digitize the sequencing-depth-based CNV identification and thus provide a method that is less sensitive to the amplification bias. In this paper, we demonstrate a mfA platform through multiple displacement amplification (MDA) chemistry. When performing the mfA platform, the noise of MDA is reduced; therefore, the resolution of single-cell CNV identification can be improved to 100 kb. We can also determine the genomic region free of allelic drop-out with mfA platform, which is impossible for conventional single-cell amplification methods.

  10. IRMA iterative relaxation matrix approach for NMR structure determination application to DNA fragments

    International Nuclear Information System (INIS)

    Koning, M.M.G.

    1990-01-01

    The subject of this thesis is the structure determination of DNA molecules in solution with the use of NMR. For this purpose a new relaxation matrix approach is introduced. The emphasis is on the interpretation of nuclear Overhauser effects (NOEs) in terms of proton-proton distances and related three dimensional structures. The DNA molecules studied are obligonucleotides, unmodifief as well as modified molecules bu UV radiation. From comparison with unmodified molecules it turned out that UV irradiation scarcely influences the helical structure of the DNA string. At one place of the string a nucleotide is rotated towards the high-ANTI conformation which results in a slight unwinding of the DNA string but sufficient for blocking of the normal reading of genetic information. (H.W.). 456 refs.; 50 figs.; 30 tabs

  11. Studies on the antigenic properties of the Fd-fragment of a human G-myeloma protein (Daw)

    NARCIS (Netherlands)

    Zegers, Ben J.M.; Ballieux, R.E.

    The present investigation deals with an immunochemical approach in studies on the structure of Fd-fragments of human immunoglobulins. Rabbits were immunized with a preparation of Fd-fragment of a human G-myeloma protein (Daw) [1]. Detailed studies on the reactions of the rabbit antiserum with a

  12. Unusual structures are present in DNA fragments containing super-long Huntingtin CAG repeats.

    Directory of Open Access Journals (Sweden)

    Daniel Duzdevich

    2011-02-01

    Full Text Available In the R6/2 mouse model of Huntington's disease (HD, expansion of the CAG trinucleotide repeat length beyond about 300 repeats induces a novel phenotype associated with a reduction in transcription of the transgene.We analysed the structure of polymerase chain reaction (PCR-generated DNA containing up to 585 CAG repeats using atomic force microscopy (AFM. As the number of CAG repeats increased, an increasing proportion of the DNA molecules exhibited unusual structural features, including convolutions and multiple protrusions. At least some of these features are hairpin loops, as judged by cross-sectional analysis and sensitivity to cleavage by mung bean nuclease. Single-molecule force measurements showed that the convoluted DNA was very resistant to untangling. In vitro replication by PCR was markedly reduced, and TseI restriction enzyme digestion was also hindered by the abnormal DNA structures. However, significantly, the DNA gained sensitivity to cleavage by the Type III restriction-modification enzyme, EcoP15I."Super-long" CAG repeats are found in a number of neurological diseases and may also appear through CAG repeat instability. We suggest that unusual DNA structures associated with super-long CAG repeats decrease transcriptional efficiency in vitro. We also raise the possibility that if these structures occur in vivo, they may play a role in the aetiology of CAG repeat diseases such as HD.

  13. Human Albumin Fragments Nanoparticles as PTX Carrier for Improved Anti-cancer Efficacy

    Directory of Open Access Journals (Sweden)

    Liang Ge

    2018-06-01

    Full Text Available For enhanced anti-cancer performance, human serum albumin fragments (HSAFs nanoparticles (NPs were developed as paclitaxel (PTX carrier in this paper. Human albumins were broken into fragments via degradation and crosslinked by genipin to form HSAF NPs for better biocompatibility, improved PTX drug loading and sustained drug release. Compared with crosslinked human serum albumin NPs, the HSAF-NPs showed relative smaller particle size, higher drug loading, and improved sustained release. Cellular and animal results both indicated that the PTX encapsulated HSAF-NPs have shown good anti-cancer performance. And the anticancer results confirmed that NPs with fast cellular internalization showed better tumor inhibition. These findings will not only provide a safe and robust drug delivery NP platform for cancer therapy, but also offer fundamental information for the optimal design of albumin based NPs.

  14. Alkaline DNA fragmentation, DNA disentanglement evaluated viscosimetrically and sister chromatid exchanges, after treatment in vivo with nitrofurantoin.

    Science.gov (United States)

    Parodi, S; Pala, M; Russo, P; Balbi, C; Abelmoschi, M L; Taningher, M; Zunino, A; Ottaggio, L; de Ferrari, M; Carbone, A; Santi, L

    1983-07-01

    Nitrofurantoin was not positive as a carcinogen in long term assays. In vitro it was positive in some short term tests and negative in others. We have examined Nitrofurantoin for its capability of inducing DNA damage in vivo. With the alkaline elution technique, Nitrofurantoin appeared clearly positive in all the tissues examined (liver, kidney, lung, spleen and bone marrow). In the liver we also observed some cross-linking effect. In bone marrow cells Nitrofurantoin was also clearly positive in terms of sister chromatid exchanges (SCEs) induction. DNA damage in vivo was also examined with a viscosimetric method, more sensitive than alkaline elution. With this method the results were essentially negative, suggesting that the two methods detect different types of damage. In view of its positivity in many organs and in two short term tests in vivo, the carcinogenic potential of Nitrofurantoin should be reconsidered.

  15. Positive and negative ion mode comparison for the determination of DNA/peptide noncovalent binding sites through the formation of "three-body" noncovalent fragment ions.

    Science.gov (United States)

    Brahim, Bessem; Tabet, Jean-Claude; Alves, Sandra

    2018-02-01

    Gas-phase fragmentation of single strand DNA-peptide noncovalent complexes is investigated in positive and negative electrospray ionization modes.Collision-induced dissociation experiments, performed on the positively charged noncovalent complex precursor ions, have confirmed the trend previously observed in negative ion mode, i.e. a high stability of noncovalent complexes containing very basic peptidic residues (i.e. R > K) and acidic nucleotide units (i.e. Thy units), certainly incoming from the existence of salt bridge interactions. Independent of the ion polarity, stable noncovalent complex precursor ions were found to dissociate preferentially through covalent bond cleavages of the partners without disrupting noncovalent interactions. The resulting DNA fragment ions were found to be still noncovalently linked to the peptides. Additionally, the losses of an internal nucleic fragment producing "three-body" noncovalent fragment ions were also observed in both ion polarities, demonstrating the spectacular salt bridge interaction stability. The identical fragmentation patterns (regardless of the relative fragment ion abundances) observed in both polarities have shown a common location of salt bridge interaction certainly preserved from solution. Nonetheless, most abundant noncovalent fragment ions (and particularly three-body ones) are observed from positively charged noncovalent complexes. Therefore, we assume that, independent of the preexisting salt bridge interaction and zwitterion structures, multiple covalent bond cleavages from single-stranded DNA/peptide complexes rely on an excess of positive charges in both electrospray ionization ion polarities.

  16. Maternal exposure to a mixture of persistent organic pollutants (POPs) affects testis histology, epididymal sperm count and induces sperm DNA fragmentation in mice.

    Science.gov (United States)

    Khezri, Abdolrahman; Lindeman, Birgitte; Krogenæs, Anette K; Berntsen, Hanne F; Zimmer, Karin E; Ropstad, Erik

    2017-08-15

    Persistent organic pollutants (POPs) are widespread throughout the environment and some are suspected to induce reproductive toxicity. As animals and humans are exposed to complex mixtures of POPs, it is reasonable to assess how such mixtures could interact with the reproductive system. Our aim is to investigate how maternal exposure to a mixture of 29 different persistent organic pollutants, formulated to mimic the relative POP levels in the food basket of the Scandinavian population, could alter reproductive endpoints. Female mice were exposed via feed from weaning, during pregnancy and lactation in 3 exposure groups (control (C), low (L) and high (H)). Testicular morphometric endpoints, epididymal sperm concentration and sperm DNA integrity were assessed in adult male offspring. We found that the number of tubules, proportion of tubule compartments and epididymal sperm concentration significantly decreased in both POP exposed groups. Epididymal sperm from both POP exposed groups showed increased DNA fragmentation. It is concluded that maternal exposure to a defined POP mixture relevant to human exposure can affect testicular development, sperm production and sperm chromatin integrity. Copyright © 2017 Elsevier Inc. All rights reserved.

  17. Experience in the use of docosahexaenoic acid (BrudiPlus in patients with increased sperm DNA fragmentation index in Acad. V.I. Kulakov Research Center for Obstetrics, Gynecology and Perinatology

    Directory of Open Access Journals (Sweden)

    A. Yu. Popova

    2015-01-01

    Full Text Available Male factor is the reason of infertility in almost half of marriages. Infertile men have the percentage of sperm with violations of DNA integrity of over 30 %; with that, healthy fertile men have that indicator of less than 15 %. Understanding of importance of damages of sperm DNA is growing with distribution ofauxiliary reproductive technologies. As of today, these consequences have not been studies yet, and the therapeutic effect of intake of antioxidants has not direct correlation with the sperm DNA fragmentation level. Docosahexaenoic acid is one of the most valuable omega-3 polyunsaturated fatty acids for human health. Docosahexaenoic acid is the main component of the brain gray matter, retina, testes, and sperm cell membranes. In connection with that, a study was held the purpose of which was to assess the effect of the nutraceutical enzymatic docosahexaenoic acid triglyceride (BrudiPlus in high concentrations on damaged sperm DNA of patients with idiopathic pathozoospermia. 40 patients with idiopathic pathozoospermia and the level of DNA fragmentation over the statutory value took part in this study. The following positive results were received: intake of BrudiPlus allowed decreasing sperm DNA damages and improving of antioxidant system of sperm. 

  18. Covalent Bonding of Pyrrolobenzodiazepines (PBDs) to Terminal Guanine Residues within Duplex and Hairpin DNA Fragments

    Science.gov (United States)

    Mantaj, Julia; Jackson, Paul J. M.; Karu, Kersti; Rahman, Khondaker M.; Thurston, David E.

    2016-01-01

    Pyrrolobenzodiazepines (PBDs) are covalent-binding DNA-interactive agents with growing importance as payloads in Antibody Drug Conjugates (ADCs). Until now, PBDs were thought to covalently bond to C2-NH2 groups of guanines in the DNA-minor groove across a three-base-pair recognition sequence. Using HPLC/MS methodology with designed hairpin and duplex oligonucleotides, we have now demonstrated that the PBD Dimer SJG-136 and the C8-conjugated PBD Monomer GWL-78 can covalently bond to a terminal guanine of DNA, with the PBD skeleton spanning only two base pairs. Control experiments with the non-C8-conjugated anthramycin along with molecular dynamics simulations suggest that the C8-substituent of a PBD Monomer, or one-half of a PBD Dimer, may provide stability for the adduct. This observation highlights the importance of PBD C8-substituents, and also suggests that PBDs may bind to terminal guanines within stretches of DNA in cells, thus representing a potentially novel mechanism of action at the end of DNA strand breaks. PMID:27055050

  19. I-motif DNA structures are formed in the nuclei of human cells

    Science.gov (United States)

    Zeraati, Mahdi; Langley, David B.; Schofield, Peter; Moye, Aaron L.; Rouet, Romain; Hughes, William E.; Bryan, Tracy M.; Dinger, Marcel E.; Christ, Daniel

    2018-06-01

    Human genome function is underpinned by the primary storage of genetic information in canonical B-form DNA, with a second layer of DNA structure providing regulatory control. I-motif structures are thought to form in cytosine-rich regions of the genome and to have regulatory functions; however, in vivo evidence for the existence of such structures has so far remained elusive. Here we report the generation and characterization of an antibody fragment (iMab) that recognizes i-motif structures with high selectivity and affinity, enabling the detection of i-motifs in the nuclei of human cells. We demonstrate that the in vivo formation of such structures is cell-cycle and pH dependent. Furthermore, we provide evidence that i-motif structures are formed in regulatory regions of the human genome, including promoters and telomeric regions. Our results support the notion that i-motif structures provide key regulatory roles in the genome.

  20. Transfer of Chinese hamster DNA repair gene(s) into repair-deficient human cells (Xeroderma pigmentosum)

    International Nuclear Information System (INIS)

    Karentz, D.; Cleaver, J.E.

    1985-01-01

    Transfer of repair genes by DNA transfection into repair-deficient Xeroderma pigmentosum (XP) cells has thus far been unsuccessful, presenting an obstacle to cloning XP genes. The authors chose an indirect route to transfer repair genes in chromosome fragments. DNA repair-competent (UV resistant) hybrid cell lines were established by PEG-mediated fusions of DNA repair-deficient (UV sensitive) human fibroblasts (XP12RO) with wild type Chinese hamster (CHO) cells (AA8). CHO cells were exposed to 5 Krad X-rays prior to fusions, predisposing hybrid cells to lose CHO chromosome fragments preferentially. Repair-competent hybrids were selected by periodic exposures to UV light. Secondary and tertiary hybrid cell lines were developed by fusion of X-irradiated hybrids to XP12RO. The hybrid cell lines exhibit resistance to UV that is comparable to that of CHO cells and they are proficient at repair replication after UV exposure. Whole cell DNA-DNA hybridizations indicate that the hybrids have greater homology to CHO DNA than is evident between XP12RO and CHO. These observations indicate that CHO DNA sequences which can function in repair of UV-damaged DNA in human cells have been transferred into the genome of the repair-deficient XP12RO cells

  1. Genomic localization, sequence analysis, and transcription of the putative human cytomegalovirus DNA polymerase gene

    International Nuclear Information System (INIS)

    Heilbronn, T.; Jahn, G.; Buerkle, A.; Freese, U.K.; Fleckenstein, B.; Zur Hausen, H.

    1987-01-01

    The human cytomegalovirus (HCMV)-induced DNA polymerase has been well characterized biochemically and functionally, but its genomic location has not yet been assigned. To identify the coding sequence, cross-hybridization with the herpes simplex virus type 1 (HSV-1) polymerase gene was used, as suggested by the close similarity of the herpes group virus-induced DNA polymerases to the HCMV DNA polymerase. A cosmid and plasmid library of the entire HCMV genome was screened with the BamHI Q fragment of HSF-1 at different stringency conditions. One PstI-HincII restriction fragment of 850 base pairs mapping within the EcoRI M fragment of HCMV cross-hybridized at T/sub m/ - 25/degrees/C. Sequence analysis revealed one open reading frame spanning the entire sequence. The amino acid sequence showed a highly conserved domain of 133 amino acids shared with the HSV and putative Esptein-Barr virus polymerase sequences. This domain maps within the C-terminal part of the HSV polymerase gene, which has been suggested to contain part of the catalytic center of the enzyme. Transcription analysis revealed one 5.4-kilobase early transcript in the sense orientation with respect to the open reading frame identified. This transcript appears to code for the 140-kilodalton HCMV polymerase protein

  2. Evaluating Digital PCR for the Quantification of Human Genomic DNA: Accessible Amplifiable Targets.

    Science.gov (United States)

    Kline, Margaret C; Romsos, Erica L; Duewer, David L

    2016-02-16

    Polymerase chain reaction (PCR) multiplexed assays perform best when the input quantity of template DNA is controlled to within about a factor of √2. To help ensure that PCR assays yield consistent results over time and place, results from methods used to determine DNA quantity need to be metrologically traceable to a common reference. Many DNA quantitation systems can be accurately calibrated with solutions of DNA in aqueous buffer. Since they do not require external calibration, end-point limiting dilution technologies, collectively termed "digital PCR (dPCR)", have been proposed as suitable for value assigning such DNA calibrants. The performance characteristics of several commercially available dPCR systems have recently been documented using plasmid, viral, or fragmented genomic DNA; dPCR performance with more complex materials, such as human genomic DNA, has been less studied. With the goal of providing a human genomic reference material traceably certified for mass concentration, we are investigating the measurement characteristics of several dPCR systems. We here report results of measurements from multiple PCR assays, on four human genomic DNAs treated with four endonuclease restriction enzymes using both chamber and droplet dPCR platforms. We conclude that dPCR does not estimate the absolute number of PCR targets in a given volume but rather the number of accessible and amplifiable targets. While enzymatic restriction of human genomic DNA increases accessibility for some assays, in well-optimized PCR assays it can reduce the number of amplifiable targets and increase assay variability relative to uncut sample.

  3. Oxidized DNA induces an adaptive response in human fibroblasts

    Energy Technology Data Exchange (ETDEWEB)

    Kostyuk, Svetlana V., E-mail: svet.kostyuk@gmail.com [Research Centre for Medical Genetics, Russian Academy of Medical Sciences, Moscow (Russian Federation); Tabakov, Viacheslav J.; Chestkov, Valerij V.; Konkova, Marina S.; Glebova, Kristina V.; Baydakova, Galina V.; Ershova, Elizaveta S.; Izhevskaya, Vera L. [Research Centre for Medical Genetics, Russian Academy of Medical Sciences, Moscow (Russian Federation); Baranova, Ancha, E-mail: abaranov@gmu.edu [Research Centre for Medical Genetics, Russian Academy of Medical Sciences, Moscow (Russian Federation); Center for the Study of Chronic Metabolic Diseases, School of System Biology, George Mason University, Fairfax, VA 22030 (United States); Veiko, Natalia N. [Research Centre for Medical Genetics, Russian Academy of Medical Sciences, Moscow (Russian Federation)

    2013-07-15

    Highlights: • We describe the effects of gDNAOX on human fibroblasts cultivated in serum withdrawal conditions. • gDNAOX evokes an adaptive response in human fibroblasts. • gDNAOX increases the survival rates in serum starving cell populations. • gDNAOX enhances the survival rates in cell populations irradiated at 1.2 Gy dose. • gDNAOX up-regulates NRF2 and inhibits NF-kappaB-signaling. - Abstract: Cell-free DNA (cfDNA) released from dying cells contains a substantial proportion of oxidized nucleotides, thus, forming cfDNA{sup OX}. The levels of cfDNA{sup OX} are increased in the serum of patients with chronic diseases. Oxidation of DNA turns it into a stress signal. The samples of genomic DNA (gDNA) oxidized by H{sub 2}O{sub 2}in vitro (gDNA{sup OX}) induce effects similar to that of DNA released from damaged cells. Here we describe the effects of gDNA{sup OX} on human fibroblasts cultivated in the stressful conditions of serum withdrawal. In these cells, gDNA{sup OX} evokes an adaptive response that leads to an increase in the rates of survival in serum starving cell populations as well as in populations irradiated at the dose of 1.2 Gy. These effects are not seen in control populations of fibroblasts treated with non-modified gDNA. In particular, the exposure to gDNA{sup OX} leads to a decrease in the expression of the proliferation marker Ki-67 and an increase in levels of PSNA, a decrease in the proportion of subG1- and G2/M cells, a decrease in proportion of cells with double strand breaks (DSBs). Both gDNA{sup OX} and gDNA suppress the expression of DNA sensors TLR9 and AIM2 and up-regulate nuclear factor-erythroid 2 p45-related factor 2 (NRF2), while only gDNA{sup OX} inhibits NF-κB signaling. gDNA{sup OX} is a model for oxidized cfDNA{sup OX} that is released from the dying tumor cells and being carried to the distant organs. The systemic effects of oxidized DNA have to be taken into account when treating tumors. In particular, the damaged DNA

  4. Expansion during PCR of short single-stranded DNA fragments carrying nonselfcomplementary dinucleotide or trinucleotide repeats

    Czech Academy of Sciences Publication Activity Database

    Reichová, Naďa; Kypr, Jaroslav

    2003-01-01

    Roč. 30, č. 3 (2003), s. 155-163 ISSN 0301-4851 R&D Projects: GA ČR GA301/01/0590 Institutional research plan: CEZ:AV0Z5004920 Keywords : DNA * PCR * expansion Subject RIV: BO - Biophysics Impact factor: 0.565, year: 2003

  5. Solution structure of a short dna fragment studied by neutron scattering

    DEFF Research Database (Denmark)

    Lederer, H.; May, R. P.; Kjems, Jørgen

    1986-01-01

    -DNA. The neutron scattering curve is well fitted by that of a rigid rod with a length of 44 nm and a diameter of 2 nm. The result were confirmed by quasi-elastic light scattering and analytical centrifugation. The neutron measurements in H2O and D2O buffer reveal a cross-sectional in homogeneity not detected by X...

  6. Radioimmunoimaging using F(ab')2 fragment of monoclonal antibodies against human alpha-fetoprotein

    International Nuclear Information System (INIS)

    Sakahara, Harumi; Endo, Keigo; Nakashima, Tetsuo; Koizumi, Mitsuru; Ohta, Hitoya; Torizuka, Kanji; Okada, Kenichiro; Yoshida, Osamu; Nishi, Shinzo.

    1985-01-01

    Using monoclonal antibodies against human α-fetoprotein (AFP), radioiodinated F(ab') 2 fragments were compared with whole IgG as a radiotracer for radioimmunoimaging of cancer. F(ab') 2 fragments were obtained by pepsin digestion of whole IgG (IgGl). IgG and F(ab') 2 were labeled with 125 I or 131 I by the chloramine-T method with almost full retention of antibody activity. F(ab') 2 fragments were cleared more rapidly from the circulation in normal mice with a half life of 6.3 hours than whole IgG with a half life of 5.5 days. Radioactivity of F(ab') 2 in various organs also decreased faster than IgG. In nude mice transplanted with AFP-producing human testicular tumor, F(ab') 2 fragments demonstrated superior scintigrams to whole IgG at 2 days after the injection, because of the fast disappearance of background radioactivity. Although absolute accumulation of 131 I labeled F(ab') 2 in the tumor was less than that of 131 I labeled IgG, tumor to other organ ratios were much higher with F(ab') 2 than those of IgG. The tumor to blood ratio of 131 I labeled F(ab') 2 was 1.04 at day 2, whereas tumor to blood ratio of 131 I labeled IgG was 0.55 at day 2 and 0.92 at day 4, respectively. These results indicated that for the radiolabeling of monoclonal antibodies, F(ab') 2 fragments would be superior to whole IgG in the radioimmunoimaging of cancer. (author)

  7. Structural organization of the human glucocorticoid receptor determined by one- and two-dimensional gel electrophoresis of proteolytic receptor fragments

    International Nuclear Information System (INIS)

    Smith, A.C.; Harmon, J.M.

    1987-01-01

    The structural organization of the steroid-binding protein of the IM-9 cell glucocorticoid receptor was investigated by using one- and two-dimensional gel electrophoresis of proteolytic receptor fragments. One-dimensional sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE) of receptor fragments isolated after trypsin digestion of immunopurified [ 3 H]dexamethasone 21-mesylate ([ 3 H]DM-) labeled receptor revealed the presence of a stable 26.5-kilodalton (kDa) steroid-containing non-DNA-binding fragment, derived from a larger, less stable, 29-kDa fragment. The 26.5-kDa tryptic fragment appeared to be completely contained within a 41-kDa, steroid-containing, DNA-binding species isolated after chymotrypsin digestion of the intact protein. Two-dimensional electrophoretic analysis of the [ 3 H]DM-labeled tryptic fragments resolved two 26.5-kDa and two 29-kDa components. This was the same number of isoforms seen in the intact protein, indicating that the charge heterogeneity of the steroid-binding protein is the result of modification within the steroid-containing, non-DNA-binding, 26.5-kDa tryptic fragment. Two-dimensional analysis of the 41-kDa [ 3 H]DM-labeled chymotryptic species revealed a pattern of isoforms more complex than that seen either in the intact protein or in the steroid-containing tryptic fragments. These results suggest that the 41-kDa [ 3 H]DM-labeled species resolved by one-dimensional SDS-PAGE after chymotrypsin digestion may be composed of several distinct proteolytic fragments

  8. Mechanism of Error-Free DNA Replication Past Lucidin-Derived DNA Damage by Human DNA Polymerase κ.

    Science.gov (United States)

    Yockey, Oliver P; Jha, Vikash; Ghodke, Pratibha P; Xu, Tianzuo; Xu, Wenyan; Ling, Hong; Pradeepkumar, P I; Zhao, Linlin

    2017-11-20

    DNA damage impinges on genetic information flow and has significant implications in human disease and aging. Lucidin-3-O-primeveroside (LuP) is an anthraquinone derivative present in madder root, which has been used as a coloring agent and food additive. LuP can be metabolically converted to genotoxic compound lucidin, which subsequently forms lucidin-specific N 2 -2'-deoxyguanosine (N 2 -dG) and N 6 -2'-deoxyadenosine (N 6 -dA) DNA adducts. Lucidin is mutagenic and carcinogenic in rodents but has low carcinogenic risks in humans. To understand the molecular mechanism of low carcinogenicity of lucidin in humans, we performed DNA replication assays using site-specifically modified oligodeoxynucleotides containing a structural analogue (LdG) of lucidin-N 2 -dG DNA adduct and determined the crystal structures of DNA polymerase (pol) κ in complex with LdG-bearing DNA and an incoming nucleotide. We examined four human pols (pol η, pol ι, pol κ, and Rev1) in their efficiency and accuracy during DNA replication with LdG; these pols are key players in translesion DNA synthesis. Our results demonstrate that pol κ efficiently and accurately replicates past the LdG adduct, whereas DNA replication by pol η, pol ι is compromised to different extents. Rev1 retains its ability to incorporate dCTP opposite the lesion albeit with decreased efficiency. Two ternary crystal structures of pol κ illustrate that the LdG adduct is accommodated by pol κ at the enzyme active site during insertion and postlesion-extension steps. The unique open active site of pol κ allows the adducted DNA to adopt a standard B-form for accurate DNA replication. Collectively, these biochemical and structural data provide mechanistic insights into the low carcinogenic risk of lucidin in humans.

  9. Mobile phone radiation induces reactive oxygen species production and DNA damage in human spermatozoa in vitro.

    Directory of Open Access Journals (Sweden)

    Geoffry N De Iuliis

    Full Text Available BACKGROUND: In recent times there has been some controversy over the impact of electromagnetic radiation on human health. The significance of mobile phone radiation on male reproduction is a key element of this debate since several studies have suggested a relationship between mobile phone use and semen quality. The potential mechanisms involved have not been established, however, human spermatozoa are known to be particularly vulnerable to oxidative stress by virtue of the abundant availability of substrates for free radical attack and the lack of cytoplasmic space to accommodate antioxidant enzymes. Moreover, the induction of oxidative stress in these cells not only perturbs their capacity for fertilization but also contributes to sperm DNA damage. The latter has, in turn, been linked with poor fertility, an increased incidence of miscarriage and morbidity in the offspring, including childhood cancer. In light of these associations, we have analyzed the influence of RF-EMR on the cell biology of human spermatozoa in vitro. PRINCIPAL FINDINGS: Purified human spermatozoa were exposed to radio-frequency electromagnetic radiation (RF-EMR tuned to 1.8 GHz and covering a range of specific absorption rates (SAR from 0.4 W/kg to 27.5 W/kg. In step with increasing SAR, motility and vitality were significantly reduced after RF-EMR exposure, while the mitochondrial generation of reactive oxygen species and DNA fragmentation were significantly elevated (P<0.001. Furthermore, we also observed highly significant relationships between SAR, the oxidative DNA damage bio-marker, 8-OH-dG, and DNA fragmentation after RF-EMR exposure. CONCLUSIONS: RF-EMR in both the power density and frequency range of mobile phones enhances mitochondrial reactive oxygen species generation by human spermatozoa, decreasing the motility and vitality of these cells while stimulating DNA base adduct formation and, ultimately DNA fragmentation. These findings have clear implications

  10. Isolation of CYP3A5P cDNA from human liver: a reflection of a novel cytochrome P-450 pseudogene.

    Science.gov (United States)

    Schuetz, J D; Guzelian, P S

    1995-03-14

    We have isolated, from a human liver cDNA library, a 1627 bp CYP3A5 cDNA variant (CYP3A5P) that contains several large insertions, deletions, and in-frame termination codons. By comparison with the genomic structure of other CYP3A genes, the major insertions in CYP3A5P cDNA demarcate the inferred sites of several CYP3A5 exons. The segments inserted in CYP3A5P have no homology with splice donor acceptor sites. It is unlikely that CYP3A5P cDNA represents an artifact of the cloning procedures since Southern blot analysis of human genomic DNA disclosed that CYP3A5P cDNA hybridized with a DNA fragment distinct from fragments that hybridized with either CYP3A5, CYP3A3 or CYP3A4. Moreover, analysis of adult human liver RNA on Northern blots hybridized with a CYP3A5P cDNA fragment revealed the presence of an mRNA with the predicted size of CYP3A5P. We conclude that CYP3A5P cDNA was derived from a separate gene, CYP3A5P, most likely a pseudogene evolved from CYP3A5.

  11. Cloning and characterization of BKV(MM) DNA and its use for detection of BKV DNA in human urine

    International Nuclear Information System (INIS)

    Harley, E.H.; Olliver, C.L.; Rhodes-Harrison, L.; Mew, R.T.; Lecatsas, G.; Naude, W. du T.

    1982-01-01

    The two fragments produced by restriction of BKV(MM) DNA with the endonucleases Pst I and Eco RI have been cloned separately into the vector pBR322 and amplified in E. coli HB101. Eight recombinant plasmids were characterized by gel electrophoresis of Pst I/Eco RI double digestions or Hind III digestions of the DNA and by hybridization of Southern gel blots to a nick-translated BKV(MM) DNA probe. Four of the recombinant plasmids contained the large Pst I/Eco RI BKV(MM) DNA fragment and four contained the small fragment. Two of these recombinant plasmids were then used to make a probe for the identification of BK DNA in a urine specimen from a patient known to be exreting particles with the morphological features of papovavirus [af

  12. [Comet assay of DNA fragmentation: modification of silver staining for obtaining permanent preparations].

    Science.gov (United States)

    Kamins'kyĭ, V O; Lutsyk, M D; Stoĭka, R S

    2005-01-01

    Modification of comet analysis is proposed for obtaining permanent preparations by DNA staining with silver compounds. The sensitivity of staining is similar to that observed at the treatment by ethidium bromide and other fluorochromes. The advantages of the method are stability of slides and possibility of their reinvestigation by light microscopy. The method does not need expensive fluorescent microscope and lacks contacting with carcinogenic compounds and UV light irradiation.

  13. Fine resolution mapping of double-strand break sites for human ribosomal DNA units

    Directory of Open Access Journals (Sweden)

    Bernard J. Pope

    2016-12-01

    Full Text Available DNA breakage arises during a variety of biological processes, including transcription, replication and genome rearrangements. In the context of disease, extensive fragmentation of DNA has been described in cancer cells and during early stages of neurodegeneration (Stephens et al., 2011 Stephens et al. (2011 [5]; Blondet et al., 2001 Blondet et al. (2001 [1]. Stults et al. (2009 Stults et al. (2009 [6] reported that human rDNA gene clusters are hotspots for recombination and that rDNA restructuring is among the most common chromosomal alterations in adult solid tumours. As such, analysis of rDNA regions is likely to have significant prognostic and predictive value, clinically. Tchurikov et al. (2015a, 2016 Tchurikov et al. (2015a, 2016 [7,9] have made major advances in this direction, reporting that sites of human genome double-strand breaks (DSBs occur frequently at sites in rDNA that are tightly linked with active transcription - the authors used a RAFT (rapid amplification of forum termini protocol that selects for blunt-ended sites. They reported the relative frequency of these rDNA DSBs within defined co-ordinate ‘windows’ of varying size and made these data (as well as the relevant ‘raw’ sequencing information available to the public (Tchurikov et al., 2015b. Assay designs targeting rDNA DSB hotspots will benefit greatly from the publication of break sites at greater resolution. Here, we re-analyse public RAFT data and make available rDNA DSB co-ordinates to the single-nucleotide level.

  14. Cloning of the human androgen receptor cDNA

    International Nuclear Information System (INIS)

    Govindan, M.V.; Burelle, M.; Cantin, C.; Kabrie, C.; Labrie, F.; Lachance, Y.; Leblanc, G.; Lefebvre, C.; Patel, P.; Simard, J.

    1988-01-01

    The authors discuss how in order to define the functional domains of the human androgen receptor, complementary DNA (cDNA) clones encoding the human androgen receptor (hAR) have been isolated from a human testis λgtll cDNA library using synthetic oligonnucleotide probes, homologous to segments of the human glucocorticoid, estradiol and progesterone receptors. The cDNA clones corresponding to the human glucocorticoid, estradiol and progesterone receptors were eliminated after cross-hybridization with their respective cDNA probes and/or after restriction mapping of the cDNA clones. The remaining cDNA clones were classified into different groups after analysis by restriction digestion and cross-hybridization. Two of the largest cDNA clones from each group were inserted into an expression vector in both orientations. The linearized plasmids were used as templates in in vitro transcription with T7 RNA polymerase. Subsequent in vitro translation of the purified transcripts in rabbit reticulocyte lysate followed by sodium dodecylsulfate polyacrylamide gel electrophoresis (SDS-PAGE) permitted the characterization of the encoded polyeptides. The expressed proteins larger than 30,000 Da were analyzed for their ability to bind tritium-labelled dihydrotestosterone ([ 3 H] DHT) with high affinity and specificity

  15. Quantification of apoptotic DNA fragmentation in a transformed uterine epithelial cell line, HRE-H9, using capillary electrophoresis with laser-induced fluorescence detector (CE-LIF).

    Science.gov (United States)

    Fiscus, R R; Leung, C P; Yuen, J P; Chan, H C

    2001-01-01

    Apoptotic cell death of uterine epithelial cells is thought to play an important role in the onset of menstruation and the successful implantation of an embryo during early pregnancy. Abnormal apoptosis in these cells can result in dysmenorrhoea and infertility. In addition, decreased rate of epithelial apoptosis likely contributes to endometriosis. A key step in the onset of apoptosis in these cells is cleavage of the genomic DNA between nucleosomes, resulting in polynucleosomal-sized fragments of DNA. The conventional technique for assessing apoptotic DNA fragmentation uses agarose (slab) gel electrophoresis (i.e. DNA laddering). However, recent technological advances in the use of capillary electrophoresis (CE), particularly the introduction of the laser-induced fluorescence detector (LIF), has made it possible to perform DNA laddering with improved automation and much greater sensitivity. In the present study, we have further developed the CE-LIF technique by using a DNA standard curve to quantify accurately the amount of DNA in the apoptotic DNA fragments and have applied this new quantitative technique to study apoptosis in a transformed uterine epithelial cell line, the HRE-H9 cells. Apoptosis was induced in the HRE-H9 cells by serum deprivation for 5, 7 and 24 h, resulting in increased DNA fragmentation of 2.2-, 3.1- and 6.2-fold, respectively, above the 0 h or plus-serum controls. This ultrasensitive CE-LIF technique provides a novel method for accurately measuring the actions of pro- or anti-apoptotic agents or conditions on uterine epithelial cell lines. Copyright 2001 Academic Press.

  16. DNA translocation by human uracil DNA glycosylase: the case of single-stranded DNA and clustered uracils.

    Science.gov (United States)

    Schonhoft, Joseph D; Stivers, James T

    2013-04-16

    Human uracil DNA glycosylase (hUNG) plays a central role in DNA repair and programmed mutagenesis of Ig genes, requiring it to act on sparsely or densely spaced uracil bases located in a variety of contexts, including U/A and U/G base pairs, and potentially uracils within single-stranded DNA (ssDNA). An interesting question is whether the facilitated search mode of hUNG, which includes both DNA sliding and hopping, changes in these different contexts. Here we find that hUNG uses an enhanced local search mode when it acts on uracils in ssDNA, and also, in a context where uracils are densely clustered in duplex DNA. In the context of ssDNA, hUNG performs an enhanced local search by sliding with a mean sliding length larger than that of double-stranded DNA (dsDNA). In the context of duplex DNA, insertion of high-affinity abasic product sites between two uracil lesions serves to significantly extend the apparent sliding length on dsDNA from 4 to 20 bp and, in some cases, leads to directionally biased 3' → 5' sliding. The presence of intervening abasic product sites mimics the situation where hUNG acts iteratively on densely spaced uracils. The findings suggest that intervening product sites serve to increase the amount of time the enzyme remains associated with DNA as compared to nonspecific DNA, which in turn increases the likelihood of sliding as opposed to falling off the DNA. These findings illustrate how the search mechanism of hUNG is not predetermined but, instead, depends on the context in which the uracils are located.

  17. Protective effects of Opuntia ficus-indica extract on ram sperm quality, lipid peroxidation and DNA fragmentation during liquid storage.

    Science.gov (United States)

    Allai, Larbi; Druart, Xavier; Öztürk, Mehmet; BenMoula, Anass; Nasser, Boubker; El Amiri, Bouchra

    2016-12-01

    The present study aimed to assess the phenolic composition of the acetone extract from Opuntia ficus indica cladodes (ACTEX) and its effects on ram semen variables, lipid peroxidation and DNA fragmentation during liquid storage at 5°C for up to 72h in skim milk and Tris egg yolk extenders. Semen samples from five rams were pooled extended with Tris-egg yolk (TEY) or skim milk (SM) extenders containing ACTEX (0%, 1%, 2%, 4% and 8%) at a final concentration of 0.8×10 9 sperm/ml and stored for up to 72h at 5°C. The sperm variables were evaluated at different time periods (8, 24, 48 and 72h). Sperm total motility and viability were superior in TEY than in SM whereas the progressive motility, membrane integrity, abnormality and spontaneous lipid peroxidation were greater in SM compared to TEY (P<0.05). The results also indicated that the inclusion of 1% ACTEX in the SM or TEY extender increased the sperm motility, viability, membrane integrity, and decreased the abnormality, lipids peroxidation up to 72h in storage compared to control group. Similarly, even at 72h of storage, 1% ACTEX can efficiently decrease the negative effects of liquid storage on sperm DNA fragmentation (P<0.05). In conclusion, SM and TEY supplemented with 1% of ACTEX can improve the quality of ram semen. Further studies are required to identify the active components in ACTEX involved in its effect on ram sperm preservation. Copyright © 2016 Elsevier B.V. All rights reserved.

  18. Oxidative damage of mitochondrial and nuclear DNA induced by ionizing radiation in human hepatoblastoma cells

    International Nuclear Information System (INIS)

    Morales, Albert; Miranda, Merce; Sanchez-Reyes, Alberto; Biete, Alberto; Fernandez-Checa, Jose C.

    1998-01-01

    Purpose: Since reactive oxygen species (ROS) act as mediators of radiation-induced cellular damage, the aim of our studies was to determine the effects of ionizing radiation on the regulation of hepatocellular reduced glutathione (GSH), survival and integrity of nuclear and mitochondrial DNA (mtDNA) in human hepatoblastoma cells (Hep G2) depleted of GSH prior to radiation. Methods and Materials: GSH, oxidized glutathione (GSSG), and generation of ROS were determined in irradiated (50-500 cGy) Hep G2 cells. Clonogenic survival, nuclear DNA fragmentation, and integrity of mtDNA were assessed in cells depleted of GSH prior to radiation. Results: Radiation of Hep G2 cells (50-400 cGy) resulted in a dose-dependent generation of ROS, an effect accompanied by a decrease of reduced GSH, ranging from a 15% decrease for 50 cGy to a 25% decrease for 400 cGy and decreased GSH/GSSG from a ratio of 17 to a ratio of 7 for controls and from 16 to 6 for diethyl maleate (DEM)-treated cells. Depletion of GSH prior to radiation accentuated the increase of ROS by 40-50%. The depletion of GSH by radiation was apparent in different subcellular sites, being particularly significant in mitochondria. Furthermore, depletion of nuclear GSH to 50-60% of initial values prior to irradiation (400 cGy) resulted in DNA fragmentation and apoptosis. Consequently, the survival of Hep G2 to radiation was reduced from 25% of cells not depleted of GSH to 10% of GSH-depleted cells. Fitting the survival rate of cells as a function of GSH using a theoretical model confirmed cellular GSH as a key factor in determining intrinsic sensitivity of Hep G2 cells to radiation. mtDNA displayed an increased susceptibility to the radiation-induced loss of integrity compared to nuclear DNA, an effect that was potentiated by GSH depletion in mitochondria (10-15% intact mtDNA in GSH-depleted cells vs. 25-30% of repleted cells). Conclusion: GSH plays a critical protective role in maintaining nuclear and mtDNA functional

  19. [Applylication of new type combined fragments: nrDNA ITS+ nad 1-intron 2 for identification of Dendrobium species of Fengdous].

    Science.gov (United States)

    Geng, Li-xia; Zheng, Rui; Ren, Jie; Niu, Zhi-tao; Sun, Yu-long; Xue, Qing-yun; Liu, Wei; Ding, Xiao-yu

    2015-08-01

    In this study, 17 kinds of Dendrobium species of Fengdous including 39 individuals were collected from 4 provinces. Mitochondrial gene sequences co I, nad 5, nad 1-intron 2 and chloroplast gene sequences rbcL, matK amd psbA-trnH were amplified from these materials, as well as nrDNA ITS. Furthermore, suitable sequences for identification of Dendrobium species of Fengdous were screened by K-2-P and P-distance. The results showed that during the mentioned 7 sequences, nrDNA ITS, nad 1-intron 2 and psbA-trnH which had a high degree of variability could be used to identify Dendrobium species of Fengdous. However, single fragment could not be used to distinguish D. moniliforme and D. huoshanense. Moreover, compared to other combined fragments, new type combined fragments nrDNA ITS+nad 1-intron 2 was more effective in identifying the original plants of Dendrobium species and could be used to identify D. huoshanense and D. moniliforme. Besides, according to the UPGMA tree constructed with nrDNA ITS+nad 1-intron 2, 3 inspected Dendrobium plants were identified as D. huoshanense, D. moniliforme and D. officinale, respectively. This study identified Dendrobium species of Fengdous by combined fragments nrDNA ITS+nad 1-intron 2 for the first time, which provided a more effective basis for identification of Dendrobium species. And this study will be helpful for regulating the market of Fengdous.

  20. Effects of cyanoacrylate fuming, time after recovery, and location of biological material on the recovery and analysis of DNA from post-blast pipe bomb fragments*.

    Science.gov (United States)

    Bille, Todd W; Cromartie, Carter; Farr, Matthew

    2009-09-01

    This study investigated the effects of time, cyanoacrylate fuming, and location of the biological material on DNA analysis of post-blast pipe bomb fragments. Multiple aliquots of a cell suspension (prepared by soaking buccal swabs in water) were deposited on components of the devices prior to assembly. The pipe bombs were then deflagrated and the fragments recovered. Fragments from half of the devices were cyanoacrylate fumed. The cell spots on the fragments were swabbed and polymerase chain reaction/short tandem repeat analysis was performed 1 week and 3 months after deflagration. A significant decrease in the amount of DNA recovered was observed between samples collected and analyzed within 1 week compared with the samples collected and analyzed 3 months after deflagration. Cyanoacrylate fuming did not have a measurable effect on the success of the DNA analysis at either time point. Greater quantities of DNA were recovered from the pipe nipples than the end caps. Undeflagrated controls showed that the majority (>95%) of the DNA deposited on the devices was not recovered at a week or 3 months.

  1. The use of a DNA stabilizer in human dental tissues stored under different temperature conditions and time intervals

    Science.gov (United States)

    TERADA, Andrea Sayuri Silveira Dias; da SILVA, Luiz Antonio Ferreira; GALO, Rodrigo; de AZEVEDO, Aline; GERLACH, Raquel Fernanda; da SILVA, Ricardo Henrique Alves

    2014-01-01

    Objective The present study evaluated the use of a reagent to stabilize the DNA extracted from human dental tissues stored under different temperature conditions and time intervals. Material and Methods A total of 161 teeth were divided into two distinct groups: intact teeth and isolated dental pulp tissue. The samples were stored with or without the product at different time intervals and temperature. After storage, DNA extraction and genomic DNA quantification were performed using real-time PCR; the fragments of the 32 samples that represented each possible condition were analyzed to find the four pre-selected markers in STR analysis. Results The results of the quantification showed values ranging from 0.01 to 10,246.88 ng/μL of DNA. The statistical difference in the quantity of DNA was observed when the factors related to the time and temperature of storage were analyzed. In relation to the use of the specific reagent, its use was relevant in the group of intact teeth when they were at room temperature for 30 and 180 days. The analysis of the fragments in the 32 selected samples was possible irrespective of the amount of DNA, confirming that the STR analysis using an automated method yields good results. Conclusions The use of a specific reagent showed a significant difference in stabilizing DNA in samples of intact human teeth stored at room temperature for 30 and 180 days, while the results showed no justification for using the product under the other conditions tested. PMID:25141206

  2. Introducing Human Population Biology through an Easy Laboratory Exercise on Mitochondrial DNA

    Science.gov (United States)

    Pardinas, Antonio F.; Dopico, Eduardo; Roca, Agustin; Garcia-Vazquez, Eva; Lopez, Belen

    2010-01-01

    This article describes an easy and cheap laboratory exercise for students to discover their own mitochondrial haplogroup. Students use buccal swabs to obtain mucosa cells as noninvasive tissue samples, extract DNA, and with a simple polymerase chain reaction-restriction fragment length polymorphism analysis they can obtain DNA fragments of…

  3. Cloning of the cDNA for human 12-lipoxygenase

    International Nuclear Information System (INIS)

    Izumi, T.; Hoshiko, S.; Radmark, O.; Samuelsson, B.

    1990-01-01

    A full-length cDNA clone encoding 12-lipoxygenase was isolated from a human platelet cDNA library by using a cDNA for human reticulocyte 15-lipoxygenase as probe for the initial screening. The cDNA had an open reading frame encoding 662 amino acid residues with a calculated molecular weight of 75,590. Three independent clones revealed minor heterogeneities in their DNA sequences. Thus, in three positions of the deduced amino acid sequence, there is a choice between two different amino acids. The deduced sequence from the clone plT3 showed 65% identity with human reticulocyte 15-lipoxygenase and 42% identity with human leukocyte 5-lipoxygenase. The 12-lipoxygenase cDNA recognized a 3.0-kilobase mRNA species in platelets and human erythroleukemia cells (HEL cells). Phorbol 12-tetradecanoyl 13-acetate induced megakaryocytic differentiation of HEL cells and 12-lipoxygenase activity and increased mRNA for 12-lipoxygenase. The identity of the cloned 12-lipoxygenase was assured by expression in a mammalian cell line (COS cells). Human platelet 12-lipoxygenase has been difficult to purify to homogeneity. The cloning of this cDNA will increase the possibilities to elucidate the structure and function of this enzyme

  4. The innate immunity adaptor SARM translocates to the nucleus to stabilize lamins and prevent DNA fragmentation in response to pro-apoptotic signaling.

    Directory of Open Access Journals (Sweden)

    Chad R Sethman

    Full Text Available Sterile alpha and armadillo-motif containing protein (SARM, a highly conserved and structurally unique member of the MyD88 family of Toll-like receptor adaptors, plays an important role in innate immunity signaling and apoptosis. Its exact mechanism of intracellular action remains unclear. Apoptosis is an ancient and ubiquitous process of programmed cell death that results in disruption of the nuclear lamina and, ultimately, dismantling of the nucleus. In addition to supporting the nuclear membrane, lamins serve important roles in chromatin organization, epigenetic regulation, transcription, nuclear transport, and mitosis. Mutations and other damage that destabilize nuclear lamins (laminopathies underlie a number of intractable human diseases. Here, we report that SARM translocates to the nucleus of human embryonic kidney cells by using its amino-terminal Armadillo repeat region. Within the nucleus, SARM forms a previously unreported lattice akin to the nuclear lamina scaffold. Moreover, we show that SARM protects lamins from apoptotic degradation and reduces internucleosomal DNA fragmentation in response to signaling induced by the proinflammatory cytokine Tumor Necrosis Factor alpha. These findings indicate an important link between the innate immunity adaptor SARM and stabilization of nuclear lamins during inflammation-driven apoptosis in human cells.

  5. Anticoagulant and calcium-binding properties of high molecular weight derivatives of human fibrinogen, produced by plasmin (fragments X)

    NARCIS (Netherlands)

    Nieuwenhuizen, W.; Gravesen, M.

    1981-01-01

    Early plasmin degradation products (X fragments) of human fibrinogen were prepared in the presence of calcium-ions or EGTA, and purified on Sepharose 6B-CL. X fragments were characterized with respect to amino-terminal amino acids, polypeptide-chain composition, anticlotting properties and

  6. Location and characterization of the warfarin binding site of human serum albumin A comparative study of two large fragments

    NARCIS (Netherlands)

    Bos, O.J.M.; Remijn, J.P.M.; Fischer, M.J.E.; Wilting, J.; Janssen, L.H.M.

    1988-01-01

    The warfarin binding behaviour of a large tryptic fragment (residues 198–585 which comprise domains two and three) and of a large peptic fragment (residues 1–387 which comprise domains one and two) of human serum albumin has been studied by circular dichroism and equilibrium dialysis in order to

  7. Climate change and human colonization triggered habitat loss and fragmentation in Madagascar.

    Science.gov (United States)

    Salmona, Jordi; Heller, Rasmus; Quéméré, Erwan; Chikhi, Lounès

    2017-10-01

    The relative effect of past climate fluctuations and anthropogenic activities on current biome distribution is subject to increasing attention, notably in biodiversity hot spots. In Madagascar, where humans arrived in the last ~4 to 5,000 years, the exact causes of the demise of large vertebrates that cohabited with humans are yet unclear. The prevailing narrative holds that Madagascar was covered with forest before human arrival and that the expansion of grasslands was the result of human-driven deforestation. However, recent studies have shown that vegetation and fauna structure substantially fluctuated during the Holocene. Here, we study the Holocene history of habitat fragmentation in the north of Madagascar using a population genetics approach. To do so, we infer the demographic history of two northern Madagascar neighbouring, congeneric and critically endangered forest dwelling lemur species-Propithecus tattersalli and Propithecus perrieri-using population genetic analyses. Our results highlight the necessity to consider population structure and changes in connectivity in demographic history inferences. We show that both species underwent demographic fluctuations which most likely occurred after the mid-Holocene transition. While mid-Holocene climate change probably triggered major demographic changes in the two lemur species range and connectivity, human settlements that expanded over the last four millennia in northern Madagascar likely played a role in the loss and fragmentation of the forest cover. © 2017 John Wiley & Sons Ltd.

  8. Secreted osteopontin is highly polymerized in human airways and fragmented in asthmatic airway secretions.

    Directory of Open Access Journals (Sweden)

    Mehrdad Arjomandi

    Full Text Available Osteopontin (OPN is a member of the small integrin-binding ligand N-linked glycoprotein (SIBLING family and a cytokine with diverse biologic roles. OPN undergoes extensive post-translational modifications, including polymerization and proteolytic fragmentation, which alters its biologic activity. Recent studies suggest that OPN may contribute to the pathogenesis of asthma.To determine whether secreted OPN (sOPN is polymerized in human airways and whether it is qualitatively different in asthma, we used immunoblotting to examine sOPN in bronchoalveolar lavage (BAL fluid samples from 12 healthy and 21 asthmatic subjects (and in sputum samples from 27 healthy and 21 asthmatic subjects. All asthmatic subjects had mild to moderate asthma and abstained from corticosteroids during the study. Furthermore, we examined the relationship between airway sOPN and cellular inflammation.We found that sOPN in BAL fluid and sputum exists in polymeric, monomeric, and cleaved forms, with most of it in polymeric form. Compared to healthy subjects, asthmatic subjects had proportionately less polymeric sOPN and more monomeric and cleaved sOPN. Polymeric sOPN in BAL fluid was associated with increased alveolar macrophage counts in airways in all subjects.These results suggest that sOPN in human airways (1 undergoes extensive post-translational modification by polymerization and proteolytic fragmentation, (2 is more fragmented and less polymerized in subjects with mild to moderate asthma, and (3 may contribute to recruitment or survival of alveolar macrophages.

  9. DNA and bone structure preservation in medieval human skeletons.

    Science.gov (United States)

    Coulson-Thomas, Yvette M; Norton, Andrew L; Coulson-Thomas, Vivien J; Florencio-Silva, Rinaldo; Ali, Nadir; Elmrghni, Samir; Gil, Cristiane D; Sasso, Gisela R S; Dixon, Ronald A; Nader, Helena B

    2015-06-01

    Morphological and ultrastructural data from archaeological human bones are scarce, particularly data that have been correlated with information on the preservation of molecules such as DNA. Here we examine the bone structure of macroscopically well-preserved medieval human skeletons by transmission electron microscopy and immunohistochemistry, and the quantity and quality of DNA extracted from these skeletons. DNA technology has been increasingly used for analyzing physical evidence in archaeological forensics; however, the isolation of ancient DNA is difficult since it is highly degraded, extraction yields are low and the co-extraction of PCR inhibitors is a problem. We adapted and optimised a method that is frequently used for isolating DNA from modern samples, Chelex(®) 100 (Bio-Rad) extraction, for isolating DNA from archaeological human bones and teeth. The isolated DNA was analysed by real-time PCR using primers targeting the sex determining region on the Y chromosome (SRY) and STR typing using the AmpFlSTR(®) Identifiler PCR Amplification kit. Our results clearly show the preservation of bone matrix in medieval bones and the presence of intact osteocytes with well preserved encapsulated nuclei. In addition, we show how effective Chelex(®) 100 is for isolating ancient DNA from archaeological bones and teeth. This optimised method is suitable for STR typing using kits aimed specifically at degraded and difficult DNA templates since amplicons of up to 250bp were successfully amplified. Copyright © 2015 Elsevier Ireland Ltd. All rights reserved.

  10. Quantification and presence of human ancient DNA in burial place ...

    African Journals Online (AJOL)

    STORAGESEVER

    2009-10-19

    Oct 19, 2009 ... burial place remains of Turkey using real time ... DNA was isolaled from fossil bone tissue remains with Bio Robot EZ1 and ... the increase in the amount of DNA as it is amplified. The ... species or human blood in this work.

  11. Mitochondrial DNA mutations in human tumor cells

    OpenAIRE

    LI, HUI; HONG, ZE-HUI

    2012-01-01

    Mitochondria play significant roles in cellular energy metabolism, free radical generation and apoptosis. The dysfunction of mitochondria is correlated with the origin and progression of tumors; thus, mutations in the mitochondrial genome that affect mitochondrial function may be one of the causal factors of tumorigenesis. Although the role of mitochondrial DNA (mtDNA) mutations in carcinogenesis has been investigated extensively by various approaches, the conclusions remain controversial to ...

  12. Generation of human antibody fragments against Streptococcus mutans using a phage display chain shuffling approach

    Directory of Open Access Journals (Sweden)

    Barth Stefan

    2005-01-01

    Full Text Available Abstract Background Common oral diseases and dental caries can be prevented effectively by passive immunization. In humans, passive immunotherapy may require the use of humanized or human antibodies to prevent adverse immune responses against murine epitopes. Therefore we generated human single chain and diabody antibody derivatives based on the binding characteristics of the murine monoclonal antibody Guy's 13. The murine form of this antibody has been used successfully to prevent Streptococcus mutans colonization and the development of dental caries in non-human primates, and to prevent bacterial colonization in human clinical trials. Results The antibody derivatives were generated using a chain-shuffling approach based on human antibody variable gene phage-display libraries. Like the parent antibody, these derivatives bound specifically to SAI/II, the surface adhesin of the oral pathogen S. mutans. Conclusions Humanization of murine antibodies can be easily achieved using phage display libraries. The human antibody fragments bind the antigen as well as the causative agent of dental caries. In addition the human diabody derivative is capable of aggregating S. mutans in vitro, making it a useful candidate passive immunotherapeutic agent for oral diseases.

  13. Artificial Intelligence, DNA Mimicry, and Human Health.

    Science.gov (United States)

    Stefano, George B; Kream, Richard M

    2017-08-14

    The molecular evolution of genomic DNA across diverse plant and animal phyla involved dynamic registrations of sequence modifications to maintain existential homeostasis to increasingly complex patterns of environmental stressors. As an essential corollary, driver effects of positive evolutionary pressure are hypothesized to effect concerted modifications of genomic DNA sequences to meet expanded platforms of regulatory controls for successful implementation of advanced physiological requirements. It is also clearly apparent that preservation of updated registries of advantageous modifications of genomic DNA sequences requires coordinate expansion of convergent cellular proofreading/error correction mechanisms that are encoded by reciprocally modified genomic DNA. Computational expansion of operationally defined DNA memory extends to coordinate modification of coding and previously under-emphasized noncoding regions that now appear to represent essential reservoirs of untapped genetic information amenable to evolutionary driven recruitment into the realm of biologically active domains. Additionally, expansion of DNA memory potential via chemical modification and activation of noncoding sequences is targeted to vertical augmentation and integration of an expanded cadre of transcriptional and epigenetic regulatory factors affecting linear coding of protein amino acid sequences within open reading frames.

  14. Structure of human DNA polymerase iota and the mechanism of DNA synthesis.

    Science.gov (United States)

    Makarova, A V; Kulbachinskiy, A V

    2012-06-01

    Cellular DNA polymerases belong to several families and carry out different functions. Highly accurate replicative DNA polymerases play the major role in cell genome replication. A number of new specialized DNA polymerases were discovered at the turn of XX-XXI centuries and have been intensively studied during the last decade. Due to the special structure of the active site, these enzymes efficiently perform synthesis on damaged DNA but are characterized by low fidelity. Human DNA polymerase iota (Pol ι) belongs to the Y-family of specialized DNA polymerases and is one of the most error-prone enzymes involved in DNA synthesis. In contrast to other DNA polymerases, Pol ι is able to use noncanonical Hoogsteen interactions for nucleotide base pairing. This allows it to incorporate nucleotides opposite various lesions in the DNA template that impair Watson-Crick interactions. Based on the data of X-ray structural analysis of Pol ι in complexes with various DNA templates and dNTP substrates, we consider the structural peculiarities of the Pol ι active site and discuss possible mechanisms that ensure the unique behavior of the enzyme on damaged and undamaged DNA.

  15. Investigation of interaction between magnetic silica particles and lambda phage DNA fragment.

    Science.gov (United States)

    Smerkova, Kristyna; Dostalova, Simona; Vaculovicova, Marketa; Kynicky, Jindrich; Trnkova, Libuse; Kralik, Miroslav; Adam, Vojtech; Hubalek, Jaromir; Provaznik, Ivo; Kizek, Rene

    2013-12-01

    Nucleic acids belong to the most important molecules and therefore the understanding of their properties, function and behavior is crucial. Even though a range of analytical and biochemical methods have been developed for this purpose, one common step is essential for all of them - isolation of the nucleic acid from the from complex sample matrix. The use of magnetic particles for the separation of nucleic acids has many advantages over other isolation methods. In this study, an isolation procedure for extraction of DNA was optimized. Each step of the isolation process including washing, immobilization and elution was optimized and therefore the efficiency was increased from 1.7% to 28.7% and the total time was shortened from 75 to 30min comparing to the previously described method. Quantification of the particular parameter influence was performed by square-wave voltammetry using hanging drop mercury electrode. Further, we compared the optimized method with standard chloroform extraction and applied on isolation of DNA from Staphylococcus aureus and Escherichia coli. Copyright © 2013 Elsevier B.V. All rights reserved.

  16. Multidisciplinary team of intensive therapy: humanization and fragmentation of the work process.

    Science.gov (United States)

    Evangelista, Viviane Canhizares; Domingos, Thiago da Silva; Siqueira, Fernanda Paula Cerântola; Braga, Eliana Mara

    2016-01-01

    to understand the meaning of humanized care in intensive care units considering the experience of the multidisciplinary team. descriptive and exploratory qualitative research. For this purpose, we conducted semi-structured interviews with 24 professionals of the heath-care team, and, after transcription, we organized the qualitative data according to content analysis. from two main categories, we were able to understand that humanized care is characterized in the actions of health-care: effective communication, team work, empathy, singularity, and integrality; and mischaracterized in the management processes, specifically in the fragmentation of the work process and health-care, in the precarious work conditions, and in differing conceptual aspects of the political proposal of humanization. care activities in intensive therapy are guided by the humanization of care and corroborate the hospital management as a challenge to be overcome to boost advances in the operationalization of this Brazilian policy.

  17. Towards the onset of fruit tree growing north of the Alps: ancient DNA from waterlogged apple (Malus sp.) seed fragments.

    Science.gov (United States)

    Schlumbaum, Angela; van Glabeke, Sabine; Roldan-Ruiz, Isabel

    2012-01-20

    Wild apples (Malus sp.) have been a major food source in the northern Alpine region since prehistory and their use is well understood. The onset of deliberate fruit tree growing in the area is, however, less clear. It is generally assumed that horticulture was practised in Roman times, but it might be even earlier. In the archaeological record seed testa and pericarp remains are particularly frequent at sites with waterlogged preservation such as lakeshore settlements or wells, pits and ditches, but the distinction between wild and domestic plants is not morphologically possible. With waterlogged remains being one main source of information about past fruit cultivation, we have tested the feasibility of analysing ancient DNA from waterlogged preserved bulk samples of testa fragments. We studied apple seeds from three Neolithic and three Roman sites with waterlogged preservation in the Alpine foreland. Chloroplast markers failed in all samples, but nuclear ITS1 (internal transcribed spacer region 1) of the ribosomal DNA was successfully typed in two Roman samples from the site Oedenburg/Biesheim-Kunheim (Haut-Rhin, F). The retrieved ITS1 sequences are identical to each other and are shared with wild Malus sylvestris and Malus sieversii, and with domestic apple cultivars, supporting the potential of using waterlogged remains for identifying the genetic status of apple diachronically. Copyright © 2011 Elsevier GmbH. All rights reserved.

  18. Rapid identification and classification of bacteria by 16S rDNA restriction fragment melting curve analyses (RFMCA).

    Science.gov (United States)

    Rudi, Knut; Kleiberg, Gro H; Heiberg, Ragnhild; Rosnes, Jan T

    2007-08-01

    The aim of this work was to evaluate restriction fragment melting curve analyses (RFMCA) as a novel approach for rapid classification of bacteria during food production. RFMCA was evaluated for bacteria isolated from sous vide food products, and raw materials used for sous vide production. We identified four major bacterial groups in the material analysed (cluster I-Streptococcus, cluster II-Carnobacterium/Bacillus, cluster III-Staphylococcus and cluster IV-Actinomycetales). The accuracy of RFMCA was evaluated by comparison with 16S rDNA sequencing. The strains satisfying the RFMCA quality filtering criteria (73%, n=57), with both 16S rDNA sequence information and RFMCA data (n=45) gave identical group assignments with the two methods. RFMCA enabled rapid and accurate classification of bacteria that is database compatible. Potential application of RFMCA in the food or pharmaceutical industry will include development of classification models for the bacteria expected in a given product, and then to build an RFMCA database as a part of the product quality control.

  19. Detection of human papillomavirus DNA with in situ hybridisation in ...

    African Journals Online (AJOL)

    present study was undertaken to determine the prevalence of human papillomavirus (HPV) DNA in oral squamous carcinoma in the west of the Northern ... Immunocytochemistry for viral antigen was negative in all the specimens. HPV-18 was ...

  20. DNA double-strand breaks in mammalian cells exposed to γ-rays and very heavy ions. Fragment-size distributions determined by pulsed-field gel electrophoresis

    International Nuclear Information System (INIS)

    Kraxenberger, F.; Friedl, A.A.; Eckardt-Schupp, F.; Weber, K.J.; Flentje, M.; Quicken, P.; Kellerer, A.M.; Ludwig-Maximilians University, Munich

    1998-01-01

    The spatial distribution of DNA double-strand breaks (DSB) was assessed after treatment of mammalian cells (V79) with densely ionizing radiation. Cells were exposed to beams of heavy charged particles (calcium ions: 6.9 MeV/u, 2.1.10 3 keV/μm; uranium ions: 9.0 MeV/u, 1.4.10 4 keV/μm) at the linear accelerator UNILAC of GSI, Darmstadt. DNA was isolated in agarose plugs and subjected to pulsed-field gel electrophoresis under conditions that separated DNA fragments of size 50 kbp to 5 Mbp. The measured fragment distributions were compared to those obtained after γ-irradiation and were analyzed by means of a convolution and a deconvolution technique. In contrast to the finding for γ-radiation, the distributions produced by heavy ions do not correspond to the random breakage model. Their marked overdispersion and the observed excess of short fragments reflect spatial clustering of DSB that extends over large regions of the DNA, up to several mega base pairs (Mbp). At fluences of 0.75 and 1.5/μm 2 , calcium ions produce nearly the same shape of fragment spectrum, merely with a difference in the amount of DNA entering the gel; this suggests that the DNA is fragmented by individual calcium ions. At a fluence of 0.8/μm 2 uranium ions produce a profile that is shifted to smaller fragment sizes in comparison to the profile obtained at a fluence of 0.4/μm 2 ; this suggests cumulative action of two separate ions in the formation of fragments. These observations are not consistent with the expectation that the uranium ions, with their much larger LET, should be more likely to produce single particle action than the calcium ions. However, a consideration of the greater lateral extension of the tracks of the faster uranium ions explains the observed differences; it suggests that the DNA is closely coiled so that even DNA locations several Mbp apart are usually not separated by less than 0.1 or 0.2 μm. (orig.)

  1. Application of fluorescent amplified fragment length polymorphism for comparison of human and animal isolates of Yersinia enterocolitica

    DEFF Research Database (Denmark)

    Fearnley, C.; On, S.L.W.; Kokotovic, Branko

    2005-01-01

    An amplified fragment length polymorphism (AFLP) method, developed to genotype Yersinia enterocolitica, has been used to investigate 70 representative strains isolated from humans, pigs, sheep, and cattle in the United Kingdom. AFLP primarily distinguished Y enterocolitica strains according...

  2. Isolation and characterization of cDNA clones for human erythrocyte β-spectrin

    International Nuclear Information System (INIS)

    Prchal, J.T.; Morley, B.J.; Yoon, S.H.; Coetzer, T.L.; Palek, J.; Conboy, J.G.; Kan, Y.W.

    1987-01-01

    Spectrin is an important structural component of the membrane skeleton that underlies and supports the erythrocyte plasma membrane. It is composed of nonidentical α (M/sub r/ 240,000) and β (M/sub r/ 220,000) subunits, each of which contains multiple homologous 106-amino acid segments. The authors report here the isolation and characterization of a human erythroid-specific β-spectrin cDNA clone that encodes parts of the β-9 through β-12 repeat segments. This cDNA was used as a hybridization probe to assign the β-spectrin gene to human chromosome 14 and to begin molecular analysis of the gene and its mRNA transcripts. RNA transfer blot analysis showed that the reticulocyte β-spectrin mRNA is 7.8 kilobases in length. Southern blot analysis of genomic DNA revealed the presence of restriction fragment length polymorphisms (RFLPs) within the β-spectrin gene locus. The isolation of human spectrin cDNA probes and the identification of closely linked RFLPs will facilitate analysis of mutant spectrin genes causing congenital hemolytic anemias associated with quantitative and qualitative spectrin abnormalities

  3. Sequence of human protamine 2 cDNA

    Energy Technology Data Exchange (ETDEWEB)

    Domenjoud, L; Fronia, C; Uhde, F; Engel, W [Universitaet Goettingen (West Germany)

    1988-08-11

    The authors report the cloning and sequencing of a cDNA clone for human protamine 2 (hp2), isolated from a human testis cDNA library cloned in the vector {lambda}-gt11. A 66mer oligonucleotide, that corresponds to an amino acid sequence which is highly conserved between hp2 and mouse protamine 2 (mp2) served as hybridization probe. The homology between the amino acid sequence deduced from our cDNA and the published amino acid sequence for hp2 is 100%.

  4. Haplotyping the human T-cell receptor β-chain gene complex by use of restriction fragment length polymorphisms

    International Nuclear Information System (INIS)

    Charmley, P.; Chao, A.; Gatti, R.A.; Concannon, P.; Hood, L.

    1990-01-01

    The authors have studied the genetic segregation of human T-cell receptor β-chain (TCRβ) genes on chromosome 7q in 40 CEPH (Centre d'Etude du Polymorphisme Humain) families by using restriction fragment length polymorphisms (RFLPs). They constructed haplotypes from eight RFLPs by using variable- and constant-region cDNA probes, which detect polymorphisms that span more than 600 kilobases of the TCRβ gene complex. Analysis of allele distributions between TCRβ genes revealed significant linkage disequilibrium between only 6 of the 28 different pairs of RFLPs. This linkage disequilibrium strongly influences the most efficient order to proceed for typing of these RFLPs in order to achieve maximum genetic informativeness, which in this study revealed a 97.3% level of heterozygosity within the TCRβ gene complex. The results should provide new insight into recent reports of disease associations with the TCRβ gene complex and should assist in designing future experiments to detect or confirm the existence of disease-susceptibility loci in this region of the human genome

  5. Characterization of Mycoplasma hyosynoviae strains by amplified fragment length polymorphism analysis, pulsed-field gel electrophoresis and 16S ribosomal DNA sequencing

    DEFF Research Database (Denmark)

    Kokotovic, Branko; Friis, N.F.; Ahrens, Peter

    2002-01-01

    , were investigated by analysis of amplified fragment length polymorphisms of the Bgl II and Mfe I restriction sites and by pulsed-field gel electrophoresis of a Bss HII digest of chromosomal DNA. Both methods allowed unambiguous differentiation of the analysed strains and showed similar discriminatory...

  6. Evaluation of tumor targeting with radiolabeled F(ab2 fragment of a humanized monoclonal antibody

    Directory of Open Access Journals (Sweden)

    "Babaei MH

    2002-08-01

    Full Text Available Humanized monoclonal antibody U36 and its F(ab'2 fragment, radio labeled with 125I, were tested for tumor localization in nude mice bearing a squamous cell carcinoma xenograft line derived from a head and neck carcinoma. Monoclonal antibody IgG or F(ab'2 fragment were injected in parallel and at days 1, 2 and 3, mice were dissected for determination of isotope biodistribution. IgG as well as F(ab'2 showed highly specific localization in tumor tissue. The mean tumor uptake (n=3 is expressed as the percentage of the injected dose per gram of tumor tissue (%ID/g. %ID/g of IgG was 11.7% at day 1 and decreased to 10.9% at day 3 whereas %ID/g of F(ab'2 was 2.9% at day 1 and decreased on following days. Tumor to blood ratios (T/B at day 1 were 0.86 for IgG and 1.32 for F(ab'2 and reached a maximum at day 3 with values of 4.41 and 1.84 respectively. These findings suggest that the superior tumor to non-tumor ratios in the day of 1 render the F(ab'2 fragment more qualified for specific targeting radioisotopes to tumor xenografts in this exprimental setting.

  7. Characterization of a recombinant humanized anti-cocaine monoclonal antibody and its Fab fragment.

    Science.gov (United States)

    Kirley, Terence L; Norman, Andrew B

    2015-01-01

    Variations of post-translational modifications are important for stability and in vivo behavior of therapeutic antibodies. A recombinant humanized anti-cocaine monoclonal antibody (h2E2) was characterized for heterogeneity of N-linked glycosylation and disulfide bonds. In addition, charge heterogeneity, which is partially due to the presence or absence of C-terminal lysine on the heavy chains, was examined. For cocaine overdose therapy, Fab fragments may be therapeutic, and thus, a simplified method of generation, purification, and characterization of the Fab fragment generated by Endoproteinase Lys-C digestion was devised. Both the intact h2E2 antibody and purified Fab fragments were analyzed for their affinities for cocaine and 2 of its metabolites, benzoylecgonine and cocaethylene, by fluorescence quenching of intrinsic antibody tyrosine and tryptophan fluorescence resulting from binding of these drugs. Binding constants obtained from fluorescence quenching measurements are in agreement with recently published radioligand and ELISA binding assays. The dissociation constants determined for the h2E2 monoclonal and its Fab fragment are approximately 1, 5, and 20 nM for cocaethylene, cocaine, and benzoylecgonine, respectively. Tryptophan fluorescence quenching (emission at 330 nm) was measured after either excitation of tyrosine and tryptophan (280 nm) or selective excitation of tryptophan alone (295 nm). More accurate binding constants are obtained using tryptophan selective excitation at 295 nm, likely due to interfering absorption of cocaine and metabolites at 280 nm. These quenching results are consistent with multiple tryptophan and tyrosine residues in or near the predicted binding location of cocaine in a previously published 3-D model of this antibody's variable region.

  8. Human DNA ligase III bridges two DNA ends to promote specific intermolecular DNA end joining

    Science.gov (United States)

    Kukshal, Vandna; Kim, In-Kwon; Hura, Gregory L.; Tomkinson, Alan E.; Tainer, John A.; Ellenberger, Tom

    2015-01-01

    Mammalian DNA ligase III (LigIII) functions in both nuclear and mitochondrial DNA metabolism. In the nucleus, LigIII has functional redundancy with DNA ligase I whereas LigIII is the only mitochondrial DNA ligase and is essential for the survival of cells dependent upon oxidative respiration. The unique LigIII zinc finger (ZnF) domain is not required for catalytic activity but senses DNA strand breaks and stimulates intermolecular ligation of two DNAs by an unknown mechanism. Consistent with this activity, LigIII acts in an alternative pathway of DNA double strand break repair that buttresses canonical non-homologous end joining (NHEJ) and is manifest in NHEJ-defective cancer cells, but how LigIII acts in joining intermolecular DNA ends versus nick ligation is unclear. To investigate how LigIII efficiently joins two DNAs, we developed a real-time, fluorescence-based assay of DNA bridging suitable for high-throughput screening. On a nicked duplex DNA substrate, the results reveal binding competition between the ZnF and the oligonucleotide/oligosaccharide-binding domain, one of three domains constituting the LigIII catalytic core. In contrast, these domains collaborate and are essential for formation of a DNA-bridging intermediate by adenylated LigIII that positions a pair of blunt-ended duplex DNAs for efficient and specific intermolecular ligation. PMID:26130724

  9. DNA Adducts aand Human Atherosclerotis Lesions

    Czech Academy of Sciences Publication Activity Database

    Strejc, Přemysl; Boubelík, O.; Stávková, Zdena; Chvátalová, Irena; Šrám, Radim

    2001-01-01

    Roč. 42, - (2001), s. 662 ISSN 0008-5472. [Annual Meeting of Proceedings /92./. 24.03.2001-28.03.2001, New Orleans] R&D Projects: GA MZd NM10 Keywords : DNA adducts * LDL cholesterol Subject RIV: DN - Health Impact of the Environment Quality

  10. DNA fragmentation and membrane damage of bocachico Prochilodus magdalenae (Ostariophysi: Prochilodontidae sperm following cryopreservation with dimethylsulfoxide and glucose

    Directory of Open Access Journals (Sweden)

    José Gregorio Martínez

    2012-09-01

    Full Text Available The endangered bocachico Prochilodus magdalenae is a native freshwater fish of Colombia, the most captured species locally and one of the most important species for ex-situ conservation (germplasm banks. The aim of this study was to examine the effect of three concentrations of Dimethylsulfoxide (DMSO (5%, 10%, 15% and three of glucose (305, 333, 361 mM in the extender on spermatic DNA fragmentation (F-DNA (by Halomax®, Chromatin dispersion and membrane damage (D-Me (by eosin-nigrosin staining. After assessment of sperm quality by computer analysis of motility, one part of semen from males was diluted separately with three parts of extender and filled into 0.5 ml straws. Freezing was carried out in liquid nitrogen vapor dry shipper for 30 minutes and thawed at 60ºC for 8 seconds in a water bath and evaluated for the percentage of cells found with F-DNA and D-Me. The results demonstrated that cryopreservation causes greater F-DNA (13.62 ± 1.6% to 28.91 ± 3.25 and D-Me (24.27 ± 1.1% to 58.33 ± 2.81% when compared with pre-freezing semen (PFS (6.71 ± 1.54% and 2.34 ± 0.5%, respectively for F-DNA and D-Me. A significant interaction was found between DMSO and glucose concentration in this experiment. Use of extender: 10% DMSO + 305 mM glucose + 12% chicken egg yolk and, 10% DMSO + 333 mM glucose + 12% chicken egg yolk, allow for lower F-DNA and D-Me during cryopreservation of bocachico semen. A high correlation between F-DNA and D-Me was found (r = 0.771.O curimba Prochilodus magdalenae, é uma espécie nativa de água doce da Colômbia ameaçada de extinção, sendo a mais capturada localmente e uma das mais importantes para a conservação ex-situ (bancos de germoplasma. O objetivo deste estudo foi avaliar o efeito de três concentrações de dimetilsulfóxido (DMSO (5%, 10%, 15% e três de glicose (305, 333, 361 mM no diluente sobre a fragmentação do ADN espermático (F-DNA (através de Halomax®, dispersão da cromatina e danos em

  11. A DNA Vaccine Protects Human Immune Cells against Zika Virus Infection in Humanized Mice

    Directory of Open Access Journals (Sweden)

    Guohua Yi

    2017-11-01

    Full Text Available A DNA vaccine encoding prM and E protein has been shown to induce protection against Zika virus (ZIKV infection in mice and monkeys. However, its effectiveness in humans remains undefined. Moreover, identification of which immune cell types are specifically infected in humans is unclear. We show that human myeloid cells and B cells are primary targets of ZIKV in humanized mice. We also show that a DNA vaccine encoding full length prM and E protein protects humanized mice from ZIKV infection. Following administration of the DNA vaccine, humanized DRAG mice developed antibodies targeting ZIKV as measured by ELISA and neutralization assays. Moreover, following ZIKV challenge, vaccinated animals presented virtually no detectable virus in human cells and in serum, whereas unvaccinated animals displayed robust infection, as measured by qRT-PCR. Our results utilizing humanized mice show potential efficacy for a targeted DNA vaccine against ZIKV in humans.

  12. Linear Association Between Cellular DNA and Epstein-Barr Virus DNA in a Human Lymphoblastoid Cell Line

    Science.gov (United States)

    Adams, Alice; Lindahl, Tomas; Klein, George

    1973-01-01

    High-molecular-weight DNA from cell line Raji (derived from Burkitt's lymphoma), which contains 50-60 copies of Epstein-Barr virus DNA per cell, was fractionated in neutral solution by several cycles of CsCl gradient centrifugation in fixed-angle rotors. Under the fractionation conditions used, intact Epstein-Barr virus DNA from virus particles can be separated from the less-dense cellular DNA. In contrast, a large proportion of the intrinsic Epstein-Barr virus DNA component of Raji cells remains associated with cellular DNA, as determined by nucleic acid hybridization. This interaction, which is resistant to Pronase and phenol treatment, is not the result of aggregation. When the molecular weight of Raji DNA is reduced by hydrodynamic shear, the amount of virus DNA associated with cell DNA decreases. However, some virus DNA still remains bound to fragments of cellular DNA after shearing. The association is completely destroyed in alkaline solution. Molecular weight analysis of Raji DNA after denaturation showed that the alkali-induced release of Epstein-Barr virus DNA was specific and not the result of random single-strand breaks. These data indicate that Epstein-Barr virus DNA is linearly integrated into Raji cell DNA by alkali-labile bonds. PMID:4355371

  13. Human antibody fragments specific for Bothrops jararacussu venom reduce the toxicity of other Bothrops sp. venoms.

    Science.gov (United States)

    Roncolato, Eduardo Crosara; Pucca, Manuela Berto; Funayama, Jaqueline Carlos; Bertolini, Thaís Barboza; Campos, Lucas Benício; Barbosa, José Elpidio

    2013-01-01

    Approximately 20,000 snakebites are registered each year in Brazil. The classical treatment for venomous snakebite involves the administration of sera obtained from immunized horses. Moreover, the production and care of horses is costly, and the use of heterologous sera can cause hypersensitivity reactions. The production of human antibody fragments by phage display technology is seen as a means of overcoming some of these disadvantages. The studies here attempted to test human monoclonal antibodies specific to Bothrops jararacussu against other Bothrops sp. venoms, using the Griffin.1 library of human single-chain fragment-variable (scFv) phage antibodies. Using the Griffin.1 phage antibody library, this laboratory previously produced scFvs capable of inhibiting the phospholipase and myotoxic activities of Bothrops jararacussu venom. The structural and functional similarities of the various forms of phospholipase A2 (PLA₂) in Bothrops venom served as the basis for the present study wherein the effectiveness of those same scFvs were evaluated against B. jararaca, B. neuwiedi, and B. moojeni venoms. Each clone was found to recognize all three Bothrops venoms, and purified scFvs partially inhibited their in vitro phospholipase activity. In vivo assays demonstrated that the scFv clone P2B7 reduced myotoxicity and increased the survival of animals that received the test venoms. The results here indicate that the scFv P2B7 is a candidate for inclusion in a mixture of specific antibodies to produce a human anti-bothropic sera. This data demonstrates that the human scFv P2B7 represents an alternative therapeutic approach to heterologous anti-bothropic sera available today.

  14. DNA fragmentation and cell death mediated by T cell antigen receptor/CD3 complex on a leukemia T cell line.

    Science.gov (United States)

    Takahashi, S; Maecker, H T; Levy, R

    1989-10-01

    An anti-T cell receptor (TcR) monoclonal antibody (mAb), LC4, directed against a human leukemic T cell line, SUP-T13, caused DNA fragmentation ("apoptosis") and cell death upon binding to this cell line. Cross-linking of receptor molecules was necessary for this effect since F(ab')2, but not Fab', fragments of LC4 could induce cell death. Five anti-CD3 mAb tested also caused apoptosis, but only when they were presented on a solid phase. Interestingly, soluble anti-CD3 mAb induced calcium flux and had an additive effect on the calcium flux and interleukin 2 receptor expression induced by LC4, but these anti-CD3 mAb reversed the growth inhibition and apoptosis caused by LC4. The calcium ionophore A23187, but not the protein kinase C activator phorbol 12-myristate 13-acetate (PMA), also induced apoptosis, suggesting that protein kinase C activation alone does not cause apoptosis, although PMA is growth inhibitory. These results suggest that two distinct biological phenomena can accompany stimulation of the TcR/CD3 complex. In both cases, calcium flux and interleukin 2 receptor expression is induced, but only in one case is apoptosis and cell death seen. The signal initiating apoptosis can be selectively prevented by binding CD3 portion of the receptor in this cell line. This difference in signals mediated by the TcR/CD3 complex may be important in explaining the process of thymic selection, as well as in choosing anti-TcR mAb for therapeutic use.

  15. Renal targeted delivery of triptolide by conjugation to the fragment peptide of human serum albumin.

    Science.gov (United States)

    Yuan, Zhi-xiang; Wu, Xiao-juan; Mo, Jingxin; Wang, Yan-li; Xu, Chao-qun; Lim, Lee Yong

    2015-08-01

    We have previously demonstrated that peptide fragments (PFs) of the human serum albumin could be developed as potential renal targeting carriers, in particular, the peptide fragment, PF-A299-585 (A299-585 representing the amino acid sequence of the human serum albumin). In this paper, we conjugated triptolide (TP), the anti-inflammatory Chinese traditional medicine, to PF-A299-585 via a succinic acid spacer to give TPS-PF-A299-585 (TP loading 2.2% w/w). Compared with the free TP, TPS-PF-A299-585 exhibited comparable anti-inflammatory activity in the lipopolysaccharide stimulated MDCK cells, but was significantly less cytotoxic than the free drug. Accumulation of TPS-PF-A299-585 in the MDCK cells in vitro and in rodent kidneys in vivo was demonstrated using FITC-labeled TPS-PF-A299-585. Renal targeting was confirmed in vivo in a membranous nephropathic (MN) rodent model, where optical imaging and analyses of biochemical markers were combined to show that TPS-PF-A299-585 was capable of alleviating the characteristic symptoms of MN. The collective data affirm PF-A299-585 to be a useful carrier for targeting TP to the kidney. Copyright © 2015 Elsevier B.V. All rights reserved.

  16. Characterization of primary biogenic aerosol particles in urban, rural, and high-alpine air by DNA sequence and restriction fragment analysis of ribosomal RNA genes

    Directory of Open Access Journals (Sweden)

    V. R. Després

    2007-12-01

    Full Text Available This study explores the applicability of DNA analyses for the characterization of primary biogenic aerosol (PBA particles in the atmosphere. Samples of fine particulate matter (PM2.5 and total suspended particulates (TSP have been collected on different types of filter materials at urban, rural, and high-alpine locations along an altitude transect in the south of Germany (Munich, Hohenpeissenberg, Mt. Zugspitze.

    From filter segments loaded with about one milligram of air particulate matter, DNA could be extracted and DNA sequences could be determined for bacteria, fungi, plants and animals. Sequence analyses were used to determine the identity of biological organisms, and terminal restriction fragment length polymorphism analyses (T-RFLP were applied to estimate diversities and relative abundances of bacteria. Investigations of blank and background samples showed that filter materials have to be decontaminated prior to use, and that the sampling and handling procedures have to be carefully controlled to avoid artifacts in the analyses.

    Mass fractions of DNA in PM2.5 were found to be around 0.05% in urban, rural, and high-alpine aerosols. The average concentration of DNA determined for urban air was on the order of ~7 ng m−3, indicating that human adults may inhale about one microgram of DNA per day (corresponding to ~108 haploid bacterial genomes or ~105 haploid human genomes, respectively.

    Most of the bacterial sequences found in PM2.5 were from Proteobacteria (42 and some from Actinobacteria (10 and Firmicutes (1. The fungal sequences were characteristic for Ascomycota (3 and Basidiomycota (1, which are known to actively discharge spores into the atmosphere. The plant sequences could be attributed to green plants (2 and moss spores (2, while animal DNA was found only for one unicellular eukaryote (protist.

  17. DNA synthesis in vitro in human fibroblast preparations

    Energy Technology Data Exchange (ETDEWEB)

    Kaufmann, W.K.

    1983-01-01

    When confluent cultures of human fibroblasts were ultraviolet irradiated and either permeabilized or lysed, three types of DNA synthesis were subsequently observed during incubation in vitro: (A) a low level of DNA replication, which ceased after 15-30 min incubation at 37/sup 0/C; (B) radiation-dependent reparative gap-filling, which also ceased after 15 min at 37/sup 0/C; and (C) radiation-independent DNA synthesis, which was not semiconservative and proceeded at a linear rate for 1 hr at 37/sup 0/C. Normal and xeroderma pigmentosum fibroblasts displayed different rates of radiation-dependent reparative gap-filling after lysis but similar rates of radiation-independent DNA synthesis. The rates of DNA replication and radiation-independent DNA synthesis were less in the permeable cell system than in the lysed cell system, whereas radiation-dependent reparative gap-filling was the same in both. Preparations of permeable and lysed cells activated radiation-dependent reparative gap-filling at about 15% of the rate estimated for intact cells. No radiation-dependent DNA strand breaks, as assayed by alkaline elution, were observed in the lysed cell preparation. Some radiation-dependent breaks were observed in the permeable cell preparation, but radiation-dependent DNA breakage was less than that seen in intact cells. This inability to incise DNA at damaged sites could account for the low rate of activation of reparative gap-filling in vitro. DNA strand breaks were produced in fibroblast preparations nonspecifically during lysis or permeabilization and incubation in vitro, and this breakage of DNA probably was responsible for the radiation-independent DNA synthesis.

  18. Climate change and human colonization triggered habitat loss and fragmentation in Madagascar

    DEFF Research Database (Denmark)

    Salmona, Jordi; Heller, Rasmus; Quéméré, Erwan

    2017-01-01

    The relative effect of past climate fluctuations and anthropogenic activities on current biome distribution is subject to increasing attention, notably in biodiversity hot spots. In Madagascar, where humans arrived in the last ~4 to 5,000 years, the exact causes of the demise of large vertebrates......-Holocene transition. While mid-Holocene climate change probably triggered major demographic changes in the two lemur species range and connectivity, human settlements that expanded over the last four millennia in northern Madagascar likely played a role in the loss and fragmentation of the forest cover.......—Propithecus tattersalli and Propithecus perrieri—using population genetic analyses. Our results highlight the necessity to consider population structure and changes in connectivity in demographic history inferences. We show that both species underwent demographic fluctuations which most likely occurred after the mid...

  19. Radioimmunological assay of the biologically active fragment of the human parathyroid hormone

    International Nuclear Information System (INIS)

    Desplan, C.; Jullienne, A.; Raulais, D.; Rivaille, P.; Barlet, J.P.; Moukthar, M.S.; Milhaud, G.

    1977-01-01

    The authors describe a RIA of the biologically active fraction (N-terminal) of human parathyroid hormone. This homologous test uses antibodies obtained in goats against a N-terminal 1-34 fragment of hPTH synthetised according to the method of Niall and Coll. In this system, natural hPTH of different origin (extracts from parathyroid adenomas, adenomal culture medium, hyperparathyroid plasma, adsorption chromatography extract of normal human plasma) behaved in the same manner as the synthetic reference hormone 1-34 hPTHN. The RIA detected PTH in 65% of the normal subjects and distinguished the normal values from the values of hyperparathyroid patients, which makes it suitable for clinical practice. (AJ) [de

  20. Role of DNA lesions and DNA repair in mutagenesis by carcinogens in diploid human fibroblasts

    International Nuclear Information System (INIS)

    Maher, V.M.; McCormick, J.J.

    1986-01-01

    The authors investigated the cytotoxicity, mutagenicity, and transforming activity of carcinogens and radiation in diploid human fibroblasts, using cells which differ in their DNA repair capacity. The results indicate that cell killing and induction of mutations are correlated with the number of specific lesions remaining unrepaired in the cells at a particular time posttreatment. DNA excision repair acts to eliminate potentially cytotoxic and mutagenic (and transforming) damage from DNA before these can be converted into permanent cellular effects. Normal human fibroblasts were derived from skin biopsies or circumcision material. Skin fibroblasts from xeroderma pigmentosum (XP) patients provided cells deficient in nucleotide excision repair of pyrimidine dimers or DNA adducts formed by bulky ring structures. Cytotoxicity was determined from loss of ability to form a colony. The genetic marker used was resistance to 6-thioguanine (TG). Transformation was measured by determining the frequency of anchorage-independent cells

  1. Cellular radiosensitivity and DNA damage in primary human fibroblasts

    International Nuclear Information System (INIS)

    Wurm, R.; Burnet, N.G.; Duggal, N.

    1994-01-01

    To evaluate the relationship between radiation-induced cell survival and DNA damage in primary human fibroblasts to decide whether the initial or residual DNA damage levels are more predictive of normal tissue cellular radiosensitivity. Five primary human nonsyndromic and two primary ataxia telangiectasia fibroblast strains grown in monolayer were studied. Cell survival was assessed by clonogenic assay. Irradiation was given at high dose rate (HDR) 1-2 Gy/min. DNA damage was measured in stationary phase cells and expressed as fraction released from the well by pulsed-field gel electrophoresis (PFGE). For initial damage, cells were embedded in agarose and irradiated at HDR on ice. Residual DNA damage was measured in monolayer by allowing a 4-h repair period after HDR irradiation. Following HDR irradiation, cell survival varied between SF 2 0.025 to 0.23. Measurement of initial DNA damage demonstrated linear induction up to 30 Gy, with small differences in the slope of the dose-response curve between strains. No correlation between cell survival and initial damage was found. Residual damage increased linearly up to 80 Gy with a variation in slope by a factor of 3.2. Cell survival correlated with the slope of the dose-response curves for residual damage of the different strains (p = 0.003). The relationship between radiation-induced cell survival and DNA damage in primary human fibroblasts of differing radiosensitivity is closest with the amount of DNA damage remaining after repair. If assays of DNA damage are to be used as predictors of normal tissue response to radiation, residual DNA damage provides the most likely correlation with cell survival. 52 refs., 5 figs., 2 tabs

  2. 125IdUrd-induced chromosome fragments, assayed by premature chromosome condensation, and DNA double-strand breaks have similar repair kinetics in G1-phase CHO-cells

    International Nuclear Information System (INIS)

    Iliakis, George; Pantelias, G.E.; Okayasu, Ryuichi; Seaner, Robert

    1987-01-01

    The effect of 125 I-decay on cell lethality, and induction of chromosome and DNA damage, was studied in synchronous non-cycling, G 1 -phase CHO-cells. Neutral filter elution was used to assay repair of DNA double-strand breaks (dsbs), and premature chromosome condensation was used to assay repair of chromosome fragments and induction of ring chromosomes. The results indicate very little repair at the cell survival level (repair of PLD). At the DNA level an efficient repair of DNA dsbs was observed, with kinetics similar to those observed after exposure to X-rays. At the chromosome level a fast repair of prematurely condensed chromosome fragments was observed, with a concomitant increase in the number of ring chromosomes induced. The repair kinetics of chromosome fragments and DNA dsbs were very similar, suggesting that DNA dsbs may underlie chromosome fragmentation. (author)

  3. Caffeine and human DNA metabolism: the magic and the mystery

    Energy Technology Data Exchange (ETDEWEB)

    Kaufmann, William K.; Heffernan, Timothy P.; Beaulieu, Lea M.; Doherty, Sharon; Frank, Alexandra R.; Zhou Yingchun; Bryant, Miriam F.; Zhou Tong; Luche, Douglas D.; Nikolaishvili-Feinberg, Nana; Simpson, Dennis A.; Cordeiro-Stone, Marila

    2003-11-27

    The ability of caffeine to reverse cell cycle checkpoint function and enhance genotoxicity after DNA damage was examined in telomerase-expressing human fibroblasts. Caffeine reversed the ATM-dependent S and G2 checkpoint responses to DNA damage induced by ionizing radiation (IR), as well as the ATR- and Chk1-dependent S checkpoint response to ultraviolet radiation (UVC). Remarkably, under conditions in which IR-induced G2 delay was reversed by caffeine, IR-induced G1 arrest was not. Incubation in caffeine did not increase the percentage of cells entering the S phase 6-8 h after irradiation; ATM-dependent phosphorylation of p53 and transactivation of p21{sup Cip1/Waf1} post-IR were resistant to caffeine. Caffeine alone induced a concentration- and time-dependent inhibition of DNA synthesis. It inhibited the entry of human fibroblasts into S phase by 70-80% regardless of the presence or absence of wildtype ATM or p53. Caffeine also enhanced the inhibition of cell proliferation induced by UVC in XP variant fibroblasts. This effect was reversed by expression of DNA polymerase {eta}, indicating that translesion synthesis of UVC-induced pyrimidine dimers by DNA pol {eta} protects human fibroblasts against UVC genotoxic effects even when other DNA repair functions are compromised by caffeine.

  4. Caffeine and human DNA metabolism: the magic and the mystery

    International Nuclear Information System (INIS)

    Kaufmann, William K.; Heffernan, Timothy P.; Beaulieu, Lea M.; Doherty, Sharon; Frank, Alexandra R.; Zhou Yingchun; Bryant, Miriam F.; Zhou Tong; Luche, Douglas D.; Nikolaishvili-Feinberg, Nana; Simpson, Dennis A.; Cordeiro-Stone, Marila

    2003-01-01

    The ability of caffeine to reverse cell cycle checkpoint function and enhance genotoxicity after DNA damage was examined in telomerase-expressing human fibroblasts. Caffeine reversed the ATM-dependent S and G2 checkpoint responses to DNA damage induced by ionizing radiation (IR), as well as the ATR- and Chk1-dependent S checkpoint response to ultraviolet radiation (UVC). Remarkably, under conditions in which IR-induced G2 delay was reversed by caffeine, IR-induced G1 arrest was not. Incubation in caffeine did not increase the percentage of cells entering the S phase 6-8 h after irradiation; ATM-dependent phosphorylation of p53 and transactivation of p21 Cip1/Waf1 post-IR were resistant to caffeine. Caffeine alone induced a concentration- and time-dependent inhibition of DNA synthesis. It inhibited the entry of human fibroblasts into S phase by 70-80% regardless of the presence or absence of wildtype ATM or p53. Caffeine also enhanced the inhibition of cell proliferation induced by UVC in XP variant fibroblasts. This effect was reversed by expression of DNA polymerase η, indicating that translesion synthesis of UVC-induced pyrimidine dimers by DNA pol η protects human fibroblasts against UVC genotoxic effects even when other DNA repair functions are compromised by caffeine

  5. Inhibiting DNA-PKCS radiosensitizes human osteosarcoma cells

    International Nuclear Information System (INIS)

    Mamo, Tewodros; Mladek, Ann C.; Shogren, Kris L.; Gustafson, Carl; Gupta, Shiv K.; Riester, Scott M.; Maran, Avudaiappan; Galindo, Mario; Wijnen, Andre J. van; Sarkaria, Jann N.; Yaszemski, Michael J.

    2017-01-01

    Osteosarcoma survival rate has not improved over the past three decades, and the debilitating side effects of the surgical treatment suggest the need for alternative local control approaches. Radiotherapy is largely ineffective in osteosarcoma, indicating a potential role for radiosensitizers. Blocking DNA repair, particularly by inhibiting the catalytic subunit of DNA-dependent protein kinase (DNA-PK CS ), is an attractive option for the radiosensitization of osteosarcoma. In this study, the expression of DNA-PK CS in osteosarcoma tissue specimens and cell lines was examined. Moreover, the small molecule DNA-PK CS inhibitor, KU60648, was investigated as a radiosensitizing strategy for osteosarcoma cells in vitro. DNA-PK CS was consistently expressed in the osteosarcoma tissue specimens and cell lines studied. Additionally, KU60648 effectively sensitized two of those osteosarcoma cell lines (143B cells by 1.5-fold and U2OS cells by 2.5-fold). KU60648 co-treatment also altered cell cycle distribution and enhanced DNA damage. Cell accumulation at the G2/M transition point increased by 55% and 45%, while the percentage of cells with >20 γH2AX foci were enhanced by 59% and 107% for 143B and U2OS cells, respectively. These results indicate that the DNA-PK CS inhibitor, KU60648, is a promising radiosensitizing agent for osteosarcoma. - Highlights: • DNA-PKcs is consistently expressed in human osteosarcoma tissue and cell lines. • The DNA-PKcs inhibitor, KU60648, effectively radiosensitizes osteosarcoma cells. • Combining KU60648 with radiation increases G2/M accumulation and DNA damage.

  6. UV stimulation of DNA-mediated transformation of human cells

    International Nuclear Information System (INIS)

    van Duin, M.; Westerveld, A.; Hoeijmakers, J.H.

    1985-01-01

    Irradiation of dominant marker DNA with UV light (150 to 1,000 J/m2) was found to stimulate the transformation of human cells by this marker from two- to more than fourfold. This phenomenon is also displayed by xeroderma pigmentosum cells, which are deficient in the excision repair of UV-induced pyrimidine dimers in the DNA. Also, exposure to UV of the transfected (xeroderma pigmentosum) cells enhanced the transfection efficiency. Removal of the pyrimidine dimers from the DNA by photoreactivating enzyme before transfection completely abolished the stimulatory effect, indicating that dimer lesions are mainly responsible for the observed enhancement. A similar stimulation of the transformation efficiency is exerted by 2-acetoxy-2-acetylaminofluorene modification of the DNA. These findings suggest that lesions which are targets for the excision repair pathway induce the increase in transformation frequency. The stimulation was found to be independent of sequence homology between the irradiated DNA and the host chromosomal DNA. Therefore, the increase of the transformation frequency is not caused by a mechanism inducing homologous recombination between these two DNAs. UV treatment of DNA before transfection did not have a significant effect on the amount of DNA integrated into the xeroderma pigmentosum genome

  7. Allelic sequence variations in the hypervariable region of a T-cell receptor β chain: Correlation with restriction fragment length polymorphism in human families and populations

    International Nuclear Information System (INIS)

    Robinson, M.A.

    1989-01-01

    Direct sequence analysis of the human T-cell antigen receptor (TCR) V β1 variable gene identified a single base-pair allelic variation (C/G) located within the coding region. This change results in substitution of a histidine (CAC) for a glutamine (CAG) at position 48 of the TCR β chain, a position predicted to be in the TCR antigen binding site. The V β1 polymorphism was found by DNA sequence analysis of V β1 genes from seven unrelated individuals; V β1 genes were amplified by the polymerase chain reaction, the amplified fragments were cloned into M13 phage vectors, and sequences were determined. To determined the inheritance patterns of the V β1 substitution and to test correlation with V β1 restriction fragment length polymorphism detected with Pvu II and Taq I, allele-specific oligonucleotides were constructed and used to characterize amplified DNA samples. Seventy unrelated individuals and six families were tested for both restriction fragment length polymorphism and for the V β1 substitution. The correlation was also tested using amplified, size-selected, Pvu II- and Taq I-digested DNA samples from heterozygotes. Pvu II allele 1 (61/70) and Taq I allele 1 (66/70) were found to be correlated with the substitution giving rise to a histidine at position 48. Because there are exceptions to the correlation, the use of specific probes to characterize allelic forms of TCR variable genes will provide important tools for studies of basic TCR genetics and disease associations

  8. Detection of extracellular genomic DNA scaffold in human thrombus

    DEFF Research Database (Denmark)

    Oklu, Rahmi; Albadawi, Hassan; Watkins, Michael T

    2012-01-01

    into thrombus remodeling. MATERIALS AND METHODS: Ten human thrombus samples were collected during cases of thrombectomy and open surgical repair of abdominal aortic aneurysms (five samples 1 y old). Additionally, an acute murine hindlimb ischemia model was created to evaluate...... thrombus samples in mice. Human sections were immunostained for the H2A/H2B/DNA complex, myeloperoxidase, fibrinogen, and von Willebrand factor. Mouse sections were immunostained with the H2A antibody. All samples were further evaluated after hematoxylin and eosin and Masson trichrome staining. RESULTS......: An extensive network of extracellular histone/DNA complex was demonstrated in the matrix of human ex vivo thrombus. This network is present throughout the highly cellular acute thrombus. However, in chronic thrombi, detection of the histone/DNA network was predominantly in regions of low collagen content...

  9. Identification of DNA repair genes in the human genome

    International Nuclear Information System (INIS)

    Hoeijmakers, J.H.J.; van Duin, M.; Westerveld, A.; Yasui, A.; Bootsma, D.

    1986-01-01

    To identify human DNA repair genes we have transfected human genomic DNA ligated to a dominant marker to excision repair deficient xeroderma pigmentosum (XP) and CHO cells. This resulted in the cloning of a human gene, ERCC-1, that complements the defect of a UV- and mitomycin-C sensitive CHO mutant 43-3B. The ERCC-1 gene has a size of 15 kb, consists of 10 exons and is located in the region 19q13.2-q13.3. Its primary transcript is processed into two mRNAs by alternative splicing of an internal coding exon. One of these transcripts encodes a polypeptide of 297 aminoacids. A putative DNA binding protein domain and nuclear location signal could be identified. Significant AA-homology is found between ERCC-1 and the yeast excision repair gene RAD10. 58 references, 6 figures, 1 table

  10. Brain cDNA clone for human cholinesterase

    International Nuclear Information System (INIS)

    McTiernan, C.; Adkins, S.; Chatonnet, A.; Vaughan, T.A.; Bartels, C.F.; Kott, M.; Rosenberry, T.L.; La Du, B.N.; Lockridge, O.

    1987-01-01

    A cDNA library from human basal ganglia was screened with oligonucleotide probes corresponding to portions of the amino acid sequence of human serum cholinesterase. Five overlapping clones, representing 2.4 kilobases, were isolated. The sequenced cDNA contained 207 base pairs of coding sequence 5' to the amino terminus of the mature protein in which there were four ATG translation start sites in the same reading frame as the protein. Only the ATG coding for Met-(-28) lay within a favorable consensus sequence for functional initiators. There were 1722 base pairs of coding sequence corresponding to the protein found circulating in human serum. The amino acid sequence deduced from the cDNA exactly matched the 574 amino acid sequence of human serum cholinesterase, as previously determined by Edman degradation. Therefore, our clones represented cholinesterase rather than acetylcholinesterase. It was concluded that the amino acid sequences of cholinesterase from two different tissues, human brain and human serum, were identical. Hybridization of genomic DNA blots suggested that a single gene, or very few genes coded for cholinesterase

  11. Inaccurate DNA synthesis in cell extracts of yeast producing active human DNA polymerase iota.

    Science.gov (United States)

    Makarova, Alena V; Grabow, Corinn; Gening, Leonid V; Tarantul, Vyacheslav Z; Tahirov, Tahir H; Bessho, Tadayoshi; Pavlov, Youri I

    2011-01-31

    Mammalian Pol ι has an unusual combination of properties: it is stimulated by Mn(2+) ions, can bypass some DNA lesions and misincorporates "G" opposite template "T" more frequently than incorporates the correct "A." We recently proposed a method of detection of Pol ι activity in animal cell extracts, based on primer extension opposite the template T with a high concentration of only two nucleotides, dGTP and dATP (incorporation of "G" versus "A" method of Gening, abbreviated as "misGvA"). We provide unambiguous proof of the "misGvA" approach concept and extend the applicability of the method for the studies of variants of Pol ι in the yeast model system with different cation cofactors. We produced human Pol ι in baker's yeast, which do not have a POLI ortholog. The "misGvA" activity is absent in cell extracts containing an empty vector, or producing catalytically dead Pol ι, or Pol ι lacking exon 2, but is robust in the strain producing wild-type Pol ι or its catalytic core, or protein with the active center L62I mutant. The signature pattern of primer extension products resulting from inaccurate DNA synthesis by extracts of cells producing either Pol ι or human Pol η is different. The DNA sequence of the template is critical for the detection of the infidelity of DNA synthesis attributed to DNA Pol ι. The primer/template and composition of the exogenous DNA precursor pool can be adapted to monitor replication fidelity in cell extracts expressing various error-prone Pols or mutator variants of accurate Pols. Finally, we demonstrate that the mutation rates in yeast strains producing human DNA Pols ι and η are not elevated over the control strain, despite highly inaccurate DNA synthesis by their extracts.

  12. Inaccurate DNA synthesis in cell extracts of yeast producing active human DNA polymerase iota.

    Directory of Open Access Journals (Sweden)

    Alena V Makarova

    2011-01-01

    Full Text Available Mammalian Pol ι has an unusual combination of properties: it is stimulated by Mn(2+ ions, can bypass some DNA lesions and misincorporates "G" opposite template "T" more frequently than incorporates the correct "A." We recently proposed a method of detection of Pol ι activity in animal cell extracts, based on primer extension opposite the template T with a high concentration of only two nucleotides, dGTP and dATP (incorporation of "G" versus "A" method of Gening, abbreviated as "misGvA". We provide unambiguous proof of the "misGvA" approach concept and extend the applicability of the method for the studies of variants of Pol ι in the yeast model system with different cation cofactors. We produced human Pol ι in baker's yeast, which do not have a POLI ortholog. The "misGvA" activity is absent in cell extracts containing an empty vector, or producing catalytically dead Pol ι, or Pol ι lacking exon 2, but is robust in the strain producing wild-type Pol ι or its catalytic core, or protein with the active center L62I mutant. The signature pattern of primer extension products resulting from inaccurate DNA synthesis by extracts of cells producing either Pol ι or human Pol η is different. The DNA sequence of the template is critical for the detection of the infidelity of DNA synthesis attributed to DNA Pol ι. The primer/template and composition of the exogenous DNA precursor pool can be adapted to monitor replication fidelity in cell extracts expressing various error-prone Pols or mutator variants of accurate Pols. Finally, we demonstrate that the mutation rates in yeast strains producing human DNA Pols ι and η are not elevated over the control strain, despite highly inaccurate DNA synthesis by their extracts.

  13. Cloning and characterization of the human colipase cDNA

    International Nuclear Information System (INIS)

    Lowe, M.E.; Rosenblum, J.L.; McEwen, P.; Strauss, A.W.

    1990-01-01

    Pancreatic lipase hydrolyzes dietary triglycerides to monoglycerides and fatty acids. In the presence of bile salts, the activity of pancreatic lipase is markedly decreased. The activity can be restored by the addition of colipase, a low molecular weight protein secreted by the pancreas. The action of pancreatic lipase in the gut lumen is dependent upon its interaction with colipase. As a first step in elucidating the molecular events governing the interaction of lipase and colipase with each other and with fatty acids, a cDNA encoding human colipase was isolated from a λgt11 cDNA library with a rabbit polyclonal anti-human colipase antibody. The full-length 525 bp cDNA contained an open reading frame encoding 112 amino acids, including a 17 amino acid signal peptide. The predicted sequence contains 100% of the published protein sequence for human colipase determined by chemical methods, but predicts the presence of five additional NH 2 -terminal amino acids and four additional COOH-terminal amino acids. Comparison of the predicted protein sequence with the known sequences of colipase from other species reveals regions of extensive identity. The authors report, for the first time, a cDNA for colipase. The cDNA predicts a human procolipase an suggests that there may also be processing at the COOH-terminus. The regions of identity with colipase from other species will aid in defining the interaction with lipase and lipids through site-specific mutagenesis

  14. Isolation and characterization of full-length cDNA clones coding for cholinesterase from fetal human tissues

    International Nuclear Information System (INIS)

    Prody, C.A.; Zevin-Sonkin, D.; Gnatt, A.; Goldberg, O.; Soreq, H.

    1987-01-01

    To study the primary structure and regulation of human cholinesterases, oligodeoxynucleotide probes were prepared according to a consensus peptide sequence present in the active site of both human serum pseudocholinesterase and Torpedo electric organ true acetylcholinesterase. Using these probes, the authors isolated several cDNA clones from λgt10 libraries of fetal brain and liver origins. These include 2.4-kilobase cDNA clones that code for a polypeptide containing a putative signal peptide and the N-terminal, active site, and C-terminal peptides of human BtChoEase, suggesting that they code either for BtChoEase itself or for a very similar but distinct fetal form of cholinesterase. In RNA blots of poly(A) + RNA from the cholinesterase-producing fetal brain and liver, these cDNAs hybridized with a single 2.5-kilobase band. Blot hybridization to human genomic DNA revealed that these fetal BtChoEase cDNA clones hybridize with DNA fragments of the total length of 17.5 kilobases, and signal intensities indicated that these sequences are not present in many copies. Both the cDNA-encoded protein and its nucleotide sequence display striking homology to parallel sequences published for Torpedo AcChoEase. These finding demonstrate extensive homologies between the fetal BtChoEase encoded by these clones and other cholinesterases of various forms and species

  15. Recombinational DNA repair and human disease

    Energy Technology Data Exchange (ETDEWEB)

    Thompson, Larry H.; Schild, David

    2002-11-30

    We review the genes and proteins related to the homologous recombinational repair (HRR) pathway that are implicated in cancer through either genetic disorders that predispose to cancer through chromosome instability or the occurrence of somatic mutations that contribute to carcinogenesis. Ataxia telangiectasia (AT), Nijmegen breakage syndrome (NBS), and an ataxia-like disorder (ATLD), are chromosome instability disorders that are defective in the ataxia telangiectasia mutated (ATM), NBS, and Mre11 genes, respectively. These genes are critical in maintaining cellular resistance to ionizing radiation (IR), which kills largely by the production of double-strand breaks (DSBs). Bloom syndrome involves a defect in the BLM helicase, which seems to play a role in restarting DNA replication forks that are blocked at lesions, thereby promoting chromosome stability. The Werner syndrome gene (WRN) helicase, another member of the RecQ family like BLM, has very recently been found to help mediate homologous recombination. Fanconi anemia (FA) is a genetically complex chromosomal instability disorder involving seven or more genes, one of which is BRCA2. FA may be at least partially caused by the aberrant production of reactive oxidative species. The breast cancer-associated BRCA1 and BRCA2 proteins are strongly implicated in HRR; BRCA2 associates with Rad51 and appears to regulate its activity. We discuss in detail the phenotypes of the various mutant cell lines and the signaling pathways mediated by the ATM kinase. ATM's phosphorylation targets can be grouped into oxidative stress-mediated transcriptional changes, cell cycle checkpoints, and recombinational repair. We present the DNA damage response pathways by using the DSB as the prototype lesion, whose incorrect repair can initiate and augment karyotypic abnormalities.

  16. Recombinational DNA repair and human disease

    International Nuclear Information System (INIS)

    Thompson, Larry H.; Schild, David

    2002-01-01

    We review the genes and proteins related to the homologous recombinational repair (HRR) pathway that are implicated in cancer through either genetic disorders that predispose to cancer through chromosome instability or the occurrence of somatic mutations that contribute to carcinogenesis. Ataxia telangiectasia (AT), Nijmegen breakage syndrome (NBS), and an ataxia-like disorder (ATLD), are chromosome instability disorders that are defective in the ataxia telangiectasia mutated (ATM), NBS, and Mre11 genes, respectively. These genes are critical in maintaining cellular resistance to ionizing radiation (IR), which kills largely by the production of double-strand breaks (DSBs). Bloom syndrome involves a defect in the BLM helicase, which seems to play a role in restarting DNA replication forks that are blocked at lesions, thereby promoting chromosome stability. The Werner syndrome gene (WRN) helicase, another member of the RecQ family like BLM, has very recently been found to help mediate homologous recombination. Fanconi anemia (FA) is a genetically complex chromosomal instability disorder involving seven or more genes, one of which is BRCA2. FA may be at least partially caused by the aberrant production of reactive oxidative species. The breast cancer-associated BRCA1 and BRCA2 proteins are strongly implicated in HRR; BRCA2 associates with Rad51 and appears to regulate its activity. We discuss in detail the phenotypes of the various mutant cell lines and the signaling pathways mediated by the ATM kinase. ATM's phosphorylation targets can be grouped into oxidative stress-mediated transcriptional changes, cell cycle checkpoints, and recombinational repair. We present the DNA damage response pathways by using the DSB as the prototype lesion, whose incorrect repair can initiate and augment karyotypic abnormalities

  17. Chemical shift changes provide evidence for overlapping single-stranded DNA and XPA binding sites on the 70 kDa subunit of human replication protein A

    Energy Technology Data Exchange (ETDEWEB)

    Daughdrill, Gary W.; Buchko, Garry W.; Botuyan, Maria V.; Arrowsmith, Cheryl H.; Wold, Marc S.; Kennedy, Michael A.; Lowry, David F.

    2003-07-15

    Replication protein A (RPA) is a heterotrimeric single-stranded DNA (ssDNA) binding protein that can form a complex with the xeroderma pigmentosum group A protein (XPA). This complex can preferentially recognize UV damaged DNA over undamaged DNA and has been implicated in the stabilization of open complex formation during nucleotide excision repair. In this report, NMR spectroscopy was used to investigate the interaction between a fragment of the 70 kDa subunit of human RPA, residues 1-326 (hRPA701-326), and a fragment of the human XPA protein, residues 98-219 (XPA-MBD). Intensity changes were observed for amide resonances in the 1H-15N correlation spectrum of uniformly 15N-labeled hRPA701-326 after the addition of unlabeled XPA-MBD. The intensity changes observed were restricted to an ssDNA binding domain that is between residues 183 and 296 of the hRPA701-326 fragment. The hRPA701-326 residues with the largest resonance intensity reductions were mapped onto the structure of the ssDNA binding domain to identify the binding surface with XPA-MBD. The XPA-MBD binding surface showed significant overlap with an ssDNA binding surface that was previously identified using NMR spectroscopy and X-ray crystallography.

  18. Prospects for DNA methods to measure human heritable mutation rates

    International Nuclear Information System (INIS)

    Mendelsohn, M.L.

    1985-01-01

    A workshop cosponsored by ICPEMC and the US Department of Energy was held in Alta, Utah, December 9-13, 1984 to examine the extent to which DNA-oriented methods might provide new approaches to the important but intractable problem of measuring mutation rates in control and exposed human populations. The workshop identified and analyzed six DNA methods for detection of human heritable mutation, including several created at the meeting, and concluded that none of the methods combine sufficient feasibility and efficiency to be recommended for general application. 8 refs

  19. DNA methylation-based variation between human populations.

    Science.gov (United States)

    Kader, Farzeen; Ghai, Meenu

    2017-02-01

    Several studies have proved that DNA methylation affects regulation of gene expression and development. Epigenome-wide studies have reported variation in methylation patterns between populations, including Caucasians, non-Caucasians (Blacks), Hispanics, Arabs, and numerous populations of the African continent. Not only has DNA methylation differences shown to impact externally visible characteristics, but is also a potential biomarker for underlying racial health disparities between human populations. Ethnicity-related methylation differences set their mark during early embryonic development. Genetic variations, such as single-nucleotide polymorphisms and environmental factors, such as age, dietary folate, socioeconomic status, and smoking, impacts DNA methylation levels, which reciprocally impacts expression of phenotypes. Studies show that it is necessary to address these external influences when attempting to differentiate between populations since the relative impacts of these factors on the human methylome remain uncertain. The present review summarises several reported attempts to establish the contribution of differential DNA methylation to natural human variation, and shows that DNA methylation could represent new opportunities for risk stratification and prevention of several diseases amongst populations world-wide. Variation of methylation patterns between human populations is an exciting prospect which inspires further valuable research to apply the concept in routine medical and forensic casework. However, trans-generational inheritance needs to be quantified to decipher the proportion of variation contributed by DNA methylation. The future holds thorough evaluation of the epigenome to understand quantification, heritability, and the effect of DNA methylation on phenotypes. In addition, methylation profiling of the same ethnic groups across geographical locations will shed light on conserved methylation differences in populations.

  20. Evaluation of two endometriosis models by transplantation of human endometrial tissue fragments and human endometrial mesenchymal cells

    Directory of Open Access Journals (Sweden)

    Mina Jafarabadi

    2017-08-01

    Full Text Available Background: The animal models of endometriosis could be a valuable alternative tool for clarifying the etiology of endometriosis. Objective: In this study two endometriosis models at the morphological and molecular levels was evaluated and compared. Materials and Methods: The human endometrial tissues were cut into small fragments then they were randomly considered for transplantation into γ irradiated mice as model A; or they were isolated and cultured up to fourth passages. 2×106 cultured stromal cells were transplanted into γ irradiated mice subcutaneously as model B. twenty days later the ectopic tissues in both models were studied morphologically by Periodic acid-Schiff and hematoxylin and eosin staining. The expression of osteopontin (OPN and matrix metalloproteinase 2 (MMP2 genes were also assessed using real time RT-PCR. 17-β estradiol levels of mice sera were compared before and after transplantation. Results: The endometrial like glands and stromal cells were formed in the implanted subcutaneous tissue of both endometriosis models. The gland sections per cubic millimeter, the expression of OPN and MMP2 genes and the level of 17-β estradiol were higher in model B than model A (p=0.03. Conclusion: Our observation demonstrated that endometrial mesenchymal stromal cells showed more efficiency to establish endometriosis model than human endometrial tissue fragments.

  1. DNA ligase III is involved in a DNA-PK independent pathway of NHEJ in human cells

    International Nuclear Information System (INIS)

    Wang, H.; Perrault, A.R.; Qin, W.; Wang, H.; Iliakis, G.

    2003-01-01

    Full text: Double strand breaks (DSB) induced by ionizing radiation (IR) and other cytotoxic agents in the genome of higher eukaryotes are thought to be repaired either by homologous recombination repair (HRR), or non-homologous endjoining (NHEJ). We previously reported the operation of two components of NHEJ in vivo: a DNA-PK dependent component that operates with fast kinetics (D-NHEJ), and a DNA-PK independent component that acts as a backup (basic or B-NHEJ) and operates with kinetics an order of magnitude slower. To gain further insight into the mechanisms of B-NHEJ, we investigated DNA endjoining in extracts 180BR, a human cell line deficient in DNA ligase IV, using an in vitro plasmid-based DNA endjoining assay. An anti DNA ligase III antibody inhibited almost completely DNA endjoining activity in these extracts. On the other hand, an anti DNA ligase I antibody had no measurable effect in DNA endjoining activity. Immunodepletion of DNA ligase III from 180BR cell extracts abolished the DNA endjoining activity, which could be restored by addition of purified human DNA ligase IIIb. Full-length DNA ligase III bound to double stranded DNA and stimulated DNA endjoining in both intermolecular and intramolecular ligation. Furthermore, fractionation of HeLa cell extracts demonstrated the presence of an activity stimulating the function of DNA ligase III. Based on these observations we propose that DNA ligase III is the ligase operating in B-NHEJ

  2. Fingerprinting of near-homogeneous DNA ligase I and II from human cells. Similarity of their AMP-binding domains.

    Science.gov (United States)

    Yang, S W; Becker, F F; Chan, J Y

    1990-10-25

    DNA ligases play obligatory roles during replication, repair, and recombination. Multiple forms of DNA ligase have been reported in mammalian cells including DNA ligase I, the high molecular mass species which functions during replication, and DNA ligase II, the low molecular mass species which is associated with repair. In addition, alterations in DNA ligase activities have been reported in acute lymphocytic leukemia cells, Bloom's syndrome cells, and cells undergoing differentiation and development. To better distinguish the biochemical and molecular properties of the various DNA ligases from human cells, we have developed a method of purifying multiple species of DNA ligase from HeLa cells by chromatography through DEAE-Bio-Gel, CM-Bio-Gel, hydroxylapatite, Sephacryl S-300, Mono P, and DNA-cellulose. DNA-cellulose chromatography of the partially purified enzymes resolved multiple species of DNA ligase after labeling the enzyme with [alpha-32P]ATP to form the ligase-[32P]AMP adduct. The early eluting enzyme activity (0.25 M NaCl) contained a major 67-kDa-labeled protein, while the late eluting activity (0.48 M NaCl) contained two major labeled proteins of 90 and 78 kDa. Neutralization experiments with antiligase I antibodies indicated that the early and late eluting activity peaks were DNA ligase II and I, respectively. The three major ligase-[32P]AMP polypeptides (90, 78, and 67 kDa) were subsequently purified to near homogeneity by elution from preparative sodium dodecyl sulfate-polyacrylamide gels. All three polypeptides retained DNA ligase activities after gel elution and renaturation. To further reveal the relationship between these enzymes, partial digestion by V8-protease was performed. All three purified polypeptides gave rise to a common 22-kDa-labeled fragment for their AMP-binding domains, indicating that the catalytic sites of ligase I and II are quite similar, if not identical. Similar findings were obtained from the two-dimensional gel

  3. DNA damage and repair in human skin in situ

    Energy Technology Data Exchange (ETDEWEB)

    Sutherland, B.M.; Gange, R.W.; Freeman, S.E.; Sutherland, J.C.

    1987-01-01

    Understanding the molecular and cellular origins of sunlight-induced skin cancers in man requires knowledge of the damages inflicted on human skin during sunlight exposure, as well as the ability of cells in skin to repair or circumvent such damage. Although repair has been studied extensively in procaryotic and eucaryotic cells - including human cells in culture - there are important differences between repair by human skin cells in culture and human skin in situ: quantitative differences in rates of repair, as well as qualitative differences, including the presence or absence of repair mechanisms. Quantitation of DNA damage and repair in human skin required the development of new approaches for measuring damage at low levels in nanogram quantities of non-radioactive DNA. The method allows for analysis of multiple samples and the resulting data should be related to behavior of the DNA molecules by analytic expressions. Furthermore, it should be possible to assay a variety of lesions using the same methodology. The development of new analysis methods, new technology, and new biochemical probes for the study of DNA damage and repair are described. 28 refs., 4 figs.

  4. DNA damage and repair in human skin in situ

    International Nuclear Information System (INIS)

    Sutherland, B.M.; Gange, R.W.; Freeman, S.E.; Sutherland, J.C.

    1987-01-01

    Understanding the molecular and cellular origins of sunlight-induced skin cancers in man requires knowledge of the damages inflicted on human skin during sunlight exposure, as well as the ability of cells in skin to repair or circumvent such damage. Although repair has been studied extensively in procaryotic and eucaryotic cells - including human cells in culture - there are important differences between repair by human skin cells in culture and human skin in situ: quantitative differences in rates of repair, as well as qualitative differences, including the presence or absence of repair mechanisms. Quantitation of DNA damage and repair in human skin required the development of new approaches for measuring damage at low levels in nanogram quantities of non-radioactive DNA. The method allows for analysis of multiple samples and the resulting data should be related to behavior of the DNA molecules by analytic expressions. Furthermore, it should be possible to assay a variety of lesions using the same methodology. The development of new analysis methods, new technology, and new biochemical probes for the study of DNA damage and repair are described. 28 refs., 4 figs

  5. A DNA fragment from Xq21 replaces a deleted region containing the entire FVIII gene in a severe hemophilia A patient

    Energy Technology Data Exchange (ETDEWEB)

    Murru, S.; Casula, L.; Moi, P. [Insituto di Clinica e Biologia dell` Eta Evolutiva, Cagliari (Italy)] [and others

    1994-09-15

    In this paper the authors report the molecular characterization of a large deletion that removes the entire Factor VIII gene in a severe hemophilia A patient. Accurate DNA analysis of the breakpoint region revealed that a large DNA fragment replaced the 300-kb one, which was removed by the deletion. Pulsed-field gel electrophoresis analysis revealed that the size of the inserted fragment is about 550 kb. In situ hybridization demonstrated that part of the inserted region normally maps to Xq21 and to the tip of the short arm of the Y chromosome (Yp). In this patient this locus is present both in Xq21 and in Xq28, in addition to the Yp, being thus duplicated in the X chromosome. Sequence analysis of the 3` breakpoint suggested that an illegitimate recombination is probably the cause of this complex rearrangement. 52 refs., 7 figs.

  6. Relationships between sperm DNA fragmentation, sperm apoptotic markers and serum levels of CB-153 and p,p'-DDE in European and Inuit populations

    DEFF Research Database (Denmark)

    Stronati, A; Manicardi, G C; Cecati, M

    2006-01-01

    Persistent organochlorine pollutants (POPs) are suspected to interfere with hormone activity and the normal homeostasis of spermatogenesis. We investigated the relationships between sperm DNA fragmentation, apoptotic markers identified on ejaculated spermatozoa and POP levels in the blood of 652...... adult males (200 Inuits from Greenland, 166 Swedish, 134 Polish and 152 Ukrainian). Serum levels of 2, 2', 4, 4', 5, 5'-hexachlorobiphenyl (CB-153), as a proxy of the total POP burden, and of 1,1-dichloro-2,2-bis(p-chlorophenyl)-ethylene (p,p'-DDE), as a proxy of the total DDT exposure were determined...... neither sperm DNA fragmentation nor apoptotic sperm parameters and the large variations in POPs exposure was observed for the separate study groups. However, considering the European populations taken together, we showed that both %TUNEL positivity and Bcl-xL were related to CB-153 serum levels, whereas...

  7. Genome-Wide Prediction of DNA Methylation Using DNA Composition and Sequence Complexity in Human.

    Science.gov (United States)

    Wu, Chengchao; Yao, Shixin; Li, Xinghao; Chen, Chujia; Hu, Xuehai

    2017-02-16

    DNA methylation plays a significant role in transcriptional regulation by repressing activity. Change of the DNA methylation level is an important factor affecting the expression of target genes and downstream phenotypes. Because current experimental technologies can only assay a small proportion of CpG sites in the human genome, it is urgent to develop reliable computational models for predicting genome-wide DNA methylation. Here, we proposed a novel algorithm that accurately extracted sequence complexity features (seven features) and developed a support-vector-machine-based prediction model with integration of the reported DNA composition features (trinucleotide frequency and GC content, 65 features) by utilizing the methylation profiles of embryonic stem cells in human. The prediction results from 22 human chromosomes with size-varied windows showed that the 600-bp window achieved the best average accuracy of 94.7%. Moreover, comparisons with two existing methods further showed the superiority of our model, and cross-species predictions on mouse data also demonstrated that our model has certain generalization ability. Finally, a statistical test of the experimental data and the predicted data on functional regions annotated by ChromHMM found that six out of 10 regions were consistent, which implies reliable prediction of unassayed CpG sites. Accordingly, we believe that our novel model will be useful and reliable in predicting DNA methylation.

  8. Fast DNA analysis by laser mass spectrometry for human genome analysis

    International Nuclear Information System (INIS)

    Tang, K.; Taranenko, N. I.; Allman, S. L.; Chang, L. Y.; Chen, C. H.

    1995-01-01

    Fast DNA sequencing by laser mass spectrometry is possible if the following 3 criteria are met: (1) Size of DNA fragment should be greater than 300 nucleotides. (2) Enough sensitivity to detect DNA produce from polymerases chain reactins (PCR). (3) Higher resolution of mass spectr. So far, the firt 2 criteria are met: If the resolution can be significantly improve, fast DNA sequencing by laser mass spectrometry weil be a reality in the near feature

  9. DNA repair processes and their impairment in some human diseases

    International Nuclear Information System (INIS)

    Cleaver, J.E.

    1977-01-01

    Some human diseases show enhanced sensitivity to the action of environmental mutagens, and among these several are known which are defective in the repair of damaged DNA. Xeroderma pigmentosum (XP) is mainly defective in excision repair of a large variety of damaged DNA bases caused by ultraviolet light and chemical mutagens. XP involves at least 6 distinct groups, some of which may lack cofactors required for excising damage from chromatin. As a result of these defects the sensitivity of XP cells to many mutagens is increased 5- to 10-fold. Ataxia telangiectasia and Fanconi's anemia may similarly involve defects in repair of certain DNA base damage or cross-links, respectively. But most of these and other mutagen-sensitive diseases only show increases of about 2-fold in sensitivity to mutagens, and the biochemical defects in the diseases may be more complex and less directly involved in DNA repair than in XP. (Auth.)

  10. Efficiency and Fidelity of Human DNA Polymerases λ and β during Gap-Filling DNA Synthesis

    Science.gov (United States)

    Brown, Jessica A.; Pack, Lindsey R.; Sanman, Laura E.; Suo, Zucai

    2010-01-01

    The base excision repair (BER) pathway coordinates the replacement of 1 to 10 nucleotides at sites of single-base lesions. This process generates DNA substrates with various gap sizes which can alter the catalytic efficiency and fidelity of a DNA polymerase during gap-filling DNA synthesis. Here, we quantitatively determined the substrate specificity and base substitution fidelity of human DNA polymerase λ (Pol λ), an enzyme proposed to support the known BER DNA polymerase β (Pol β), as it filled 1- to 10-nucleotide gaps at 1-nucleotide intervals. Pol λ incorporated a correct nucleotide with relatively high efficiency until the gap size exceeded 9 nucleotides. Unlike Pol λ, Pol β did not have an absolute threshold on gap size as the catalytic efficiency for a correct dNTP gradually decreased as the gap size increased from 2 to 10 nucleotides and then recovered for non-gapped DNA. Surprisingly, an increase in gap size resulted in lower polymerase fidelity for Pol λ, and this downregulation of fidelity was controlled by its non-enzymatic N-terminal domains. Overall, Pol λ was up to 160-fold more error-prone than Pol β, thereby suggesting Pol λ would be more mutagenic during long gap-filling DNA synthesis. In addition, dCTP was the preferred misincorporation for Pol λ and its N-terminal domain truncation mutants. This nucleotide preference was shown to be dependent upon the identity of the adjacent 5′-template base. Our results suggested that both Pol λ and Pol β would catalyze nucleotide incorporation with the highest combination of efficiency and accuracy when the DNA substrate contains a single-nucleotide gap. Thus, Pol λ, like Pol β, is better suited to catalyze gap-filling DNA synthesis during short-patch BER in vivo, although, Pol λ may play a role in long-patch BER. PMID:20961817

  11. Human antibody fragments specific for the epidermal growth factor receptor selected from large non-immunised phage display libraries.

    Science.gov (United States)

    Souriau, Christelle; Rothacker, Julie; Hoogenboom, Hennie R; Nice, Edouard

    2004-09-01

    Antibodies to EGFR have been shown to display anti-tumour effects mediated in part by inhibition of cellular proliferation and angiogenesis, and by enhancement of apoptosis. Humanised antibodies are preferred for clinical use to reduce complications with HAMA and HAHA responses frequently seen with murine and chimaeric antibodies. We have used depletion and subtractive selection strategies on cells expressing the EGFR to sample two large antibody fragment phage display libraries for the presence of human antibodies which are specific for the EGFR. Four Fab fragments and six scFv fragments were identified, with affinities of up to 2.2nM as determined by BIAcore analysis using global fitting of the binding curves to obtain the individual rate constants (ka and kd). This overall approach offers a generic screening method for the identification of growth factor specific antibodies and antibody fragments from large expression libraries and has potential for the rapid development of new therapeutic and diagnostic reagents.

  12. Fidelity and mutational spectrum of Pfu DNA polymerase on a human mitochondrial DNA sequence.

    Science.gov (United States)

    André, P; Kim, A; Khrapko, K; Thilly, W G

    1997-08-01

    The study of rare genetic changes in human tissues requires specialized techniques. Point mutations at fractions at or below 10(-6) must be observed to discover even the most prominent features of the point mutational spectrum. PCR permits the increase in number of mutant copies but does so at the expense of creating many additional mutations or "PCR noise". Thus, each DNA sequence studied must be characterized with regard to the DNA polymerase and conditions used to avoid interpreting a PCR-generated mutation as one arising in human tissue. The thermostable DNA polymerase derived from Pyrococcus furiosus designated Pfu has the highest fidelity of any DNA thermostable polymerase studied to date, and this property recommends it for analyses of tissue mutational spectra. Here, we apply constant denaturant capillary electrophoresis (CDCE) to separate and isolate the products of DNA amplification. This new strategy permitted direct enumeration and identification of point mutations created by Pfu DNA polymerase in a 96-bp low melting domain of a human mitochondrial sequence despite the very low mutant fractions generated in the PCR process. This sequence, containing part of the tRNA glycine and NADH dehydrogenase subunit 3 genes, is the target of our studies of mitochondrial mutagenesis in human cells and tissues. Incorrectly synthesized sequences were separated from the wild type as mutant/wild-type heteroduplexes by sequential enrichment on CDCE. An artificially constructed mutant was used as an internal standard to permit calculation of the mutant fraction. Our study found that the average error rate (mutations per base pair duplication) of Pfu was 6.5 x 10(-7), and five of its more frequent mutations (hot spots) consisted of three transversions (GC-->TA, AT-->TA, and AT-->CG), one transition (AT-->GC), and one 1-bp deletion (in an AAAAAA sequence). To achieve an even higher sensitivity, the amount of Pfu-induced mutants must be reduced.

  13. Pst I restriction fragment length polymorphism of human placental alkaline phosphatase gene: Mendelian in segregation and localization of mutation site in the gene

    International Nuclear Information System (INIS)

    Tsavaler, L.; Penhallow, R.C.; Sussman, H.H.

    1988-01-01

    The pattern of inheritance of a Pst I restriction fragment length polymorphism (RFLP) of the human placental alkaline phosphatase gene was studied in nine nuclear families by Southern blot hybridization analysis of genomic DNA. The dimorphic RFLP is defined by the presence of allelic fragments 1.0 kilobase and 0.8 kilobase long. The results of this study show that the two alleles of the Pst I RFLP of the placental alkaline phosphatase gene segregate as codominant traits according to Mendelian expectations. For a polymorphism to be useful as a genetic marker the probability that an offspring is informative (PIC) must be at least 0.15. The allelic frequency of the 1.0-kilobase allele is 0.21, which correlates to a probability that an offspring is informative of 0.275 and is indicative of a useful polymorphism. By using probes derived from different regions of the placental alkaline phosphatase cDNA, the mutated Pst I site causing the RFLP was located in the penultimate intron 2497 base pairs downstream from the transcriptional initiation site

  14. Complete cDNA sequence coding for human docking protein

    Energy Technology Data Exchange (ETDEWEB)

    Hortsch, M; Labeit, S; Meyer, D I

    1988-01-11

    Docking protein (DP, or SRP receptor) is a rough endoplasmic reticulum (ER)-associated protein essential for the targeting and translocation of nascent polypeptides across this membrane. It specifically interacts with a cytoplasmic ribonucleoprotein complex, the signal recognition particle (SRP). The nucleotide sequence of cDNA encoding the entire human DP and its deduced amino acid sequence are given.

  15. Persistent organic pollutants alter DNA methylation during human adipocyte differentiation

    NARCIS (Netherlands)

    Dungen, van den Myrthe W.; Murk, Albertinka J.; Gils-Kok, van Dieuwertje; Steegenga, Wilma T.

    2017-01-01

    Ubiquitous persistent organic pollutants (POPs) can accumulate in humans where they might influence differentiation of adipocytes. The aim of this study was to investigate whether DNA methylation is one of the underlying mechanisms by which POPs affect adipocyte differentiation, and to what

  16. False-positive Human Papillomavirus DNA tests in cervical screening

    DEFF Research Database (Denmark)

    Rebolj, Matejka; Pribac, Igor; Lynge, Elsebeth

    2011-01-01

    Based on data from randomised controlled trials (RCT) on primary cervical screening, it has been reported that the problem of more frequent false-positive tests in Human Papillomavirus (HPV) DNA screening compared to cytology could be overcome. However, these reports predominantly operated...

  17. The DNA-damage response in human biology and disease

    DEFF Research Database (Denmark)

    Jackson, Stephen P; Bartek, Jiri

    2009-01-01

    , signal its presence and mediate its repair. Such responses, which have an impact on a wide range of cellular events, are biologically significant because they prevent diverse human diseases. Our improving understanding of DNA-damage responses is providing new avenues for disease management....

  18. Generation of an approximately 2.4 Mb human X centromere-based minichromosome by targeted telomere-associated chromosome fragmentation in DT40.

    Science.gov (United States)

    Mills, W; Critcher, R; Lee, C; Farr, C J

    1999-05-01

    A linear mammalian artificial chromosome (MAC) will require at least three types of functional element: a centromere, two telomeres and origins of replication. As yet, our understanding of these elements, as well as many other aspects of structure and organization which may be critical for a fully functional mammalian chromosome, remains poor. As a way of defining these various requirements, minichromosome reagents are being developed and analysed. Approaches for minichromosome generation fall into two broad categories: de novo assembly from candidate DNA sequences, or the fragmentation of an existing chromosome to reduce it to a minimal size. Here we describe the generation of a human minichromosome using the latter, top-down, approach. A human X chromosome, present in a DT40-human microcell hybrid, has been manipulated using homologous recombination and the targeted seeding of a de novo telomere. This strategy has generated a linear approximately 2.4 Mb human X centromere-based minichromosome capped by two artificially seeded telomeres: one immediately flanking the centromeric alpha-satellite DNA and the other targeted to the zinc finger gene ZXDA in Xp11.21. The chromosome retains an alpha-satellite domain of approximately 1. 8 Mb, a small array of gamma-satellite repeat ( approximately 40 kb) and approximately 400 kb of Xp proximal DNA sequence. The mitotic stability of this minichromosome has been examined, both in DT40 and following transfer into hamster and human cell lines. In all three backgrounds, the minichromosome is retained efficiently, but in the human and hamster microcell hybrids its copy number is poorly regulated. This approach of engineering well-defined chromosome reagents will allow key questions in MAC development (such as whether a lower size limit exists) to be addressed. In addition, the 2.4 Mb minichromosome described here has potential to be developed as a vector for gene delivery.

  19. Genotoxic thresholds, DNA repair, and susceptibility in human populations

    International Nuclear Information System (INIS)

    Jenkins, Gareth J.S.; Zair, Zoulikha; Johnson, George E.; Doak, Shareen H.

    2010-01-01

    It has been long assumed that DNA damage is induced in a linear manner with respect to the dose of a direct acting genotoxin. Thus, it is implied that direct acting genotoxic agents induce DNA damage at even the lowest of concentrations and that no 'safe' dose range exists. The linear (non-threshold) paradigm has led to the one-hit model being developed. This 'one hit' scenario can be interpreted such that a single DNA damaging event in a cell has the capability to induce a single point mutation in that cell which could (if positioned in a key growth controlling gene) lead to increased proliferation, leading ultimately to the formation of a tumour. There are many groups (including our own) who, for a decade or more, have argued, that low dose exposures to direct acting genotoxins may be tolerated by cells through homeostatic mechanisms such as DNA repair. This argument stems from the existence of evolutionary adaptive mechanisms that allow organisms to adapt to low levels of exogenous sources of genotoxins. We have been particularly interested in the genotoxic effects of known mutagens at low dose exposures in human cells and have identified for the first time, in vitro genotoxic thresholds for several mutagenic alkylating agents (Doak et al., 2007). Our working hypothesis is that DNA repair is primarily responsible for these thresholded effects at low doses by removing low levels of DNA damage but becoming saturated at higher doses. We are currently assessing the roles of base excision repair (BER) and methylguanine-DNA methyltransferase (MGMT) for roles in the identified thresholds (Doak et al., 2008). This research area is currently important as it assesses whether 'safe' exposure levels to mutagenic chemicals can exist and allows risk assessment using appropriate safety factors to define such exposure levels. Given human variation, the mechanistic basis for genotoxic thresholds (e.g. DNA repair) has to be well defined in order that susceptible individuals are

  20. Evidence of authentic DNA from Danish Viking Age skeletons untouched by humans for 1,000 years.

    Directory of Open Access Journals (Sweden)

    Linea Melchior

    Full Text Available BACKGROUND: Given the relative abundance of modern human DNA and the inherent impossibility for incontestable proof of authenticity, results obtained on ancient human DNA have often been questioned. The widely accepted rules regarding ancient DNA work mainly affect laboratory procedures, however, pre-laboratory contamination occurring during excavation and archaeological-/anthropological handling of human remains as well as rapid degradation of authentic DNA after excavation are major obstacles. METHODOLOGY/PRINCIPAL FINDINGS: We avoided some of these obstacles by analyzing DNA from ten Viking Age subjects that at the time of sampling were untouched by humans for 1,000 years. We removed teeth from the subjects prior to handling by archaeologists and anthropologists using protective equipment. An additional tooth was removed after standard archaeological and anthropological handling. All pre-PCR work was carried out in a "clean- laboratory" dedicated solely to ancient DNA work. Mitochondrial DNA was extracted and overlapping fragments spanning the HVR-1 region as well as diagnostic sites in the coding region were PCR amplified, cloned and sequenced. Consistent results were obtained with the "unhandled" teeth and there was no indication of contamination, while the latter was the case with half of the "handled" teeth. The results allowed the unequivocal assignment of a specific haplotype to each of the subjects, all haplotypes being compatible in their character states with a phylogenetic tree drawn from present day European populations. Several of the haplotypes are either infrequent or have not been observed in modern Scandinavians. The observation of haplogroup I in the present study (<2% in modern Scandinavians supports our previous findings of a pronounced frequency of this haplogroup in Viking and Iron Age Danes. CONCLUSION: The present work provides further evidence that retrieval of ancient human DNA is a possible task provided adequate

  1. Evidence of authentic DNA from Danish Viking Age skeletons untouched by humans for 1,000 years.

    Science.gov (United States)

    Melchior, Linea; Kivisild, Toomas; Lynnerup, Niels; Dissing, Jørgen

    2008-05-28

    Given the relative abundance of modern human DNA and the inherent impossibility for incontestable proof of authenticity, results obtained on ancient human DNA have often been questioned. The widely accepted rules regarding ancient DNA work mainly affect laboratory procedures, however, pre-laboratory contamination occurring during excavation and archaeological-/anthropological handling of human remains as well as rapid degradation of authentic DNA after excavation are major obstacles. We avoided some of these obstacles by analyzing DNA from ten Viking Age subjects that at the time of sampling were untouched by humans for 1,000 years. We removed teeth from the subjects prior to handling by archaeologists and anthropologists using protective equipment. An additional tooth was removed after standard archaeological and anthropological handling. All pre-PCR work was carried out in a "clean- laboratory" dedicated solely to ancient DNA work. Mitochondrial DNA was extracted and overlapping fragments spanning the HVR-1 region as well as diagnostic sites in the coding region were PCR amplified, cloned and sequenced. Consistent results were obtained with the "unhandled" teeth and there was no indication of contamination, while the latter was the case with half of the "handled" teeth. The results allowed the unequivocal assignment of a specific haplotype to each of the subjects, all haplotypes being compatible in their character states with a phylogenetic tree drawn from present day European populations. Several of the haplotypes are either infrequent or have not been observed in modern Scandinavians. The observation of haplogroup I in the present study (Viking and Iron Age Danes. The present work provides further evidence that retrieval of ancient human DNA is a possible task provided adequate precautions are taken and well-considered sampling is applied.

  2. Immunoscintigraphy of human pancreatic carcinoma in nude mice with I-131-F(ab')/sub 2/-fragments of monoclonal antibodies

    International Nuclear Information System (INIS)

    Senekowitsch, R.; Maul, F.D.; Wenisch, H.J.C.; Kriegel, H.; Hor, G.

    1985-01-01

    In the present study radioiodinated F(ab')/sub 2/-fragments of CA19-9 and antibody that reacts specifically with human gastrointestinal cancer were examined for their ability to detect human pancreatic carcinoma hosted in nude mice. Tumor-bearing mice received 80μCi of I-131-F(ab')/sub 2/ with a specific activity of 1.8μCi/μg. All mice were imaged after the injection and every 24hr up to 6 days. The retained radioactivity was also registered with a whole-body counter immediately after imaging. As a control F(ab's)/sub 2/ of a nonspecific antibody were administered in parallel to another group of animals bearing the same tumor. Three animals of each group were killed at 1,2,4 and 8 days for determination of the distribution of both labeled antibody-fragments. On scintigraphic images obtained with the CA19-9-F(ab')/sub 2/ the tumors could be visualized 24hr after injection, the best dilineation however was achieved 96hr p.i.. The biodistribution data exhibited a more rapid blood clearance for the specific fragments compared to that for the unspecific ones. Tumors showed an increase in uptake up to 48hr reaching 1.7% of the injected dose per gram, declining to values of 0.08%/g at day 6 p.i.. The highest tumor-to-blood ratios were found after 96h. They were 7 for the CA19-9-fragments compared to 1.5 for the unspecific fragments. The whole body counting revealed a more rapid excretion for the fragments of the specific monoclonal antibodies than for the unspecific ones. In summary the authors were able to show that CA19-9-F(ab')/sub 2/-fragments can be used for immunodetection of human pancreatic carcinoma hosted in nude mice

  3. DNA repair of UV photoproducts and mutagenesis in human mitochondrial DNA

    International Nuclear Information System (INIS)

    Pascucci, B.; Dogliotti, E.; Versteegh, A.; Hoffen, A. van; Zeeland, A.A. van; Mullenders, L.H.F.

    1997-01-01

    The induction and repair of DNA photolesions and mutations in the mitochondrial (mt) DNA of human cells in culture were analysed after cell exposure to UV-C light. The level of induction of cyclobutane pyrimidine dimers (CPD) in mitochondrial and nuclear DNA was comparable, while a higher frequency of pyrimidine (6-4) pyrimidone photoproducts (6-4 PP) was detected in mitochondrial than in nuclear DNA. Besides the known defect in CPD removal, mitochondria were shown to be deficient also in the excision of 6-4 PP. The effects of repair-defective conditions for the two major UV photolesions on mutagensis was assessed by analysing the frequency and spectrum of spontaneous and UV-induced mutations by restriction site mutation (RSM) method in a restriction endonuclease site, NciI (5'CCCGG3') located within the coding sequence of the mitochondrial gene for tRNA Leu . The spontaneous mutation frequency and spectrum at the NciI site of mitochondrial DNA was very similar to the RSM background mutation frequency (approximately 10 -5 ) and type (predominantly GC > AT transitions at GL 1 ) of the NciI site). Conversely, an approximately tenfold increase over background mutation frequency was recorded after cell exposure to 20 J/m 2 . In this case, the majority of mutations were C > T transitions preferentially located on the non-transcribed DNA strand at C 1 and C 2 of the NciI site. This mutation spectrum is expected by UV mutagenesis. This is the first evidence of induction of mutations in mitochondrial DNA by treatment of human cells with a carcinogen. (author)

  4. Quantitative glycan profiling of normal human plasma derived immunoglobulin and its fragments Fab and Fc.

    Science.gov (United States)

    Anumula, Kalyan Rao

    2012-08-31

    Typical clinical grade human IgG (intravenous immunoglobulin, IVIG), used for carbohydrate analysis, is derived from thousands of healthy donors. Quantitative high-resolution glycan profiles of IgG and its Fc-Fab fragments are presented here. Glycan profiles were established following digestions with Fc specific endoglycosidase S and generic PNGase F under denaturing and non-denaturing (native) conditions. The native PNGase F glycan profile of IgG was similar (but not identical) to that of Endo S. Endo S profiles did not contain the glycans with bisecting GlcNAc. PNGase F glycan profiles were the same for Fc fragments that were isolated from pepsin and Ide S protease digests. Both isolated Fab fragments and the previously deglycosylated IVIG (native conditions) yielded the same glycan profile. Glycan profiles were established using high resolution HPLC with 2-aminobenzoic acid (2AA) labeling. An accurate determination of sialylation levels can be made by this method. Carbohydrate content in Fc and Fab was determined using an internal standard and corrected for both protein and glycan recoveries. Fab portion contained about 14% of the total carbohydrate which translates to 2.3 sugar chains per mol in IVIG where 2 chains are located in the CH2 domain of the Fc. Fc glycans consisted of neutral (N) 84.5%; mono-sialylated (S1) 15% and di-sialylated (S2) 0.5%. In contrast, Fab contained N, 21%; S1, 43% and S2, 36%. The distribution of bisecting N-acetylglucosamine and fucose was found to be very different in various glycans (N, S1 and S2) found in Fab and Fc. Total IgG glycan profile (Fab plus Fc) contained N, 78.5%; S1, 17% and S2, 4.5%. Percent distribution of glycans G0, G1 and G2 (with 0, 1 and 2 two galactoses) was 26, 49 and 25 respectively within the 78% of the neutral glycans. Glycan profiles were nearly the same for various clinical grade IVIG preparations from various manufacturers. A fast HPLC profiling method was developed for the separation and quantitation

  5. Signatures of Climatic Change In Human Mitochondrial Dna From Europe

    Science.gov (United States)

    Richards, M. B.; Macaulay, V. A.; Torroni, A.; Bandelt, H.-J.

    Founder analysis is an approach to analysing non-recombining DNA sequence data, such as variation in the mitochondrial DNA (mtDNA), which aims at identifying and dating migrations into new territory. We applied the approach to about 4,000 human mtDNA sequences from Europe and the Near East, in order to estimate the proportion of modern lineages whose ancestors arrived at various times during the continent's past. We found that the major signal dates to about 15,000 years ago, at the time of rewarming following the Last Glacial Maximum (LGM). There is little or no archaeological evidence for immigration into Europe at this time, and the record indicates that at least parts of southern Europe remained populated during the LGM. Therefore, we interpret this signal as the trace of a bottleneck at the time of the LGM, as a result of the retreat from northern Europe during the peak of the glaciation, followed by a re-expansion from one or more refugial zones. Immigration episodes then figure at the beginning of the Early Upper Palaeolithic, during the Middle Upper Palaeolithic, and with the Neolithic. The impact of the latter on the composition of the European mtDNA pool was evidently rather minor. This result implies that climate is likely to have been a major force shaping human demographic history in Europe.

  6. Structure and mechanism of human DNA polymerase [eta

    Energy Technology Data Exchange (ETDEWEB)

    Biertümpfel, Christian; Zhao, Ye; Kondo, Yuji; Ramón-Maiques, Santiago; Gregory, Mark; Lee, Jae Young; Masutani, Chikahide; Lehmann, Alan R.; Hanaoka, Fumio; Yang, Wei (Sussex); (NIH); (Gakushuin); (Osaka)

    2010-11-03

    The variant form of the human syndrome xeroderma pigmentosum (XPV) is caused by a deficiency in DNA polymerase {eta} (Pol{eta}), a DNA polymerase that enables replication through ultraviolet-induced pyrimidine dimers. Here we report high-resolution crystal structures of human Pol{eta} at four consecutive steps during DNA synthesis through cis-syn cyclobutane thymine dimers. Pol{eta} acts like a 'molecular splint' to stabilize damaged DNA in a normal B-form conformation. An enlarged active site accommodates the thymine dimer with excellent stereochemistry for two-metal ion catalysis. Two residues conserved among Pol{eta} orthologues form specific hydrogen bonds with the lesion and the incoming nucleotide to assist translesion synthesis. On the basis of the structures, eight Pol{eta} missense mutations causing XPV can be rationalized as undermining the molecular splint or perturbing the active-site alignment. The structures also provide an insight into the role of Pol{eta} in replicating through D loop and DNA fragile sites.

  7. cDNA library construction of two human Demodexspecies.

    Science.gov (United States)

    Niu, DongLing; Wang, RuiLing; Zhao, YaE; Yang, Rui; Hu, Li; Lei, YuYang; Dan, WeiChao

    2017-06-01

    The research of Demodex, a type of pathogen causing various dermatoses in animals and human beings, is lacking at RNA level. This study aims at extracting RNA and constructing cDNA library for Demodex. First, P. cuniculiand D. farinaewere mixed to establish homogenization method for RNA extraction. Second, D. folliculorumand D. breviswere collected and preserved in Trizol, which were mixed with D. farinaerespectively to extract RNA. Finally, cDNA library was constructed and its quality was assessed. The results indicated that for D. folliculorum& D. farinae, the recombination rate of cDNA library was 90.67% and the library titer was 7.50 × 104 pfu/ml. 17 of the 59 positive clones were predicted to be of D. folliculorum; For D. brevis& D. farinae, the recombination rate was 90.96% and the library titer was 7.85 x104 pfu/ml. 40 of the 59 positive clones were predicted to be of D. brevis. Further detection by specific primers demonstrated that mtDNA cox1, cox3and ATP6 detected from cDNA libraries had 96.52%-99.73% identities with the corresponding sequences in GenBank. In conclusion, the cDNA libraries constructed for Demodexmixed with D. farinaewere successful and could satisfy the requirements for functional genes detection.

  8. UV-induced DNA-binding proteins in human cells

    International Nuclear Information System (INIS)

    Glazer, P.M.; Greggio, N.A.; Metherall, J.E.; Summers, W.C.

    1989-01-01

    To investigate the response of human cells to DNA-damaging agents such as UV irradiation, the authors examined nuclear protein extracts of UV-irradiated HeLa cells for the presence of DNA-binding proteins. Electrophoretically separated proteins were transferred to a nitrocellulose filter that was subsequently immersed in a binding solution containing radioactively labeled DNA probes. Several DNA-binding proteins were induced in HeLa cells after UV irradiation. These included proteins that bind predominantly double-stranded DNA and proteins that bind both double-stranded and single-stranded DNA. The binding proteins were induced in a dose-dependent manner by UV light. Following a dose of 12 J/m 2 , the binding proteins in the nuclear extracts increased over time to a peak in the range of 18 hr after irradiation. Experiments with metabolic inhibitors (cycloheximide and actinomycin D) revealed that de novo synthesis of these proteins is not required for induction of the binding activities, suggesting that the induction is mediated by protein modification

  9. Targeting telomerase and DNA repair in human cancers

    International Nuclear Information System (INIS)

    Prakash Hande, M.

    2014-01-01

    Telomerase reactivation is essential for telomere maintenance in human cancer cells ensuring indefinite proliferation. Targeting telomere homeostasis has become one of the promising strategies in the therapeutic management of tumours. One major potential drawback, however, is the time lag between telomerase inhibition and critically shortened telomeres triggering cell death, allowing cancer cells to acquire drug resistance. Numerous studies over the last decade have highlighted the role of DNA repair proteins such as Poly (ADP-Ribose) Polymerase-1 (PARP-1), and DNA-dependent protein kinase (DNA-PKcs) in the maintenance of telomere homoeostasis. Dysfunctional telomeres, resulting from the loss of telomeric DNA repeats or the loss of function of telomere-associated proteins trigger DNA damage responses similar to that observed for double strand breaks. We have been working on unravelling such synthetic lethality in cancer cells and this talk would be on one such recently concluded study that demonstrates that inhibition of DNA repair pathways, i.e., NHEJ pathway and that of telomerase could be an alternative strategy to enhance anti-tumour effects and circumvent the possibility of drug resistance. (author)

  10. Recombinant methods for screening human DNA excision repair proficiency

    International Nuclear Information System (INIS)

    Athas, W.F.

    1988-01-01

    A method for measuring DNA excision repair in response to ultraviolet radiation (UV)-induced DNA damage has been developed, validated, and field-tested in cultured human lymphocytes. The methodology is amenable to population-based screening and should facilitate future epidemiologic studies seeking to investigate associations between excision repair proficiency and cancer susceptibility. The impetus for such endeavors derives from the belief that the high incidence of skin cancer in the genetic disorder xeroderma pigmentosum (XP) primarily is a result of the reduced capacity of patients cells to repair UV-induced DNA damage. For assay, UV-irradiated non-replicating recombinant plasmid DNA harboring a chloramphenicol acetyltransferase (CAT) indicator gene is introduced into lymphocytes using DEAE-dextran short-term transfection conditions. Exposure to UV induces transcriptionally-inactivating DNA photoproducts in the plasmid DNA which inactivate CAT gene expression. Excision repair of the damaged CAT gene is monitored indirectly as a function of reactivated CAT enzyme activity following a 40 hour repair/expression incubation period

  11. Assessment of okadaic acid effects on cytotoxicity, DNA damage and DNA repair in human cells.

    Science.gov (United States)

    Valdiglesias, Vanessa; Méndez, Josefina; Pásaro, Eduardo; Cemeli, Eduardo; Anderson, Diana; Laffon, Blanca

    2010-07-07

    Okadaic acid (OA) is a phycotoxin produced by several types of dinoflagellates causing diarrheic shellfish poisoning (DSP) in humans. Symptoms induced by DSP toxins are mainly gastrointestinal, but the intoxication does not appear to be fatal. Despite this, this toxin presents a potential threat to human health even at concentrations too low to induce acute toxicity, since previous animal studies have shown that OA has very potent tumour promoting activity. However, its concrete action mechanism has not been described yet and the results reported with regard to OA cytotoxicity and genotoxicity are often contradictory. In the present study, the genotoxic and cytotoxic effects of OA on three different types of human cells (peripheral blood leukocytes, HepG2 hepatoma cells, and SHSY5Y neuroblastoma cells) were evaluated. Cells were treated with a range of OA concentrations in the presence and absence of S9 fraction, and MTT test and Comet assay were performed in order to evaluate cytotoxicity and genotoxicity, respectively. The possible effects of OA on DNA repair were also studied by means of the DNA repair competence assay, using bleomycin as DNA damage inductor. Treatment with OA in absence of S9 fraction induced not statistically significant decrease in cell viability and significant increase in DNA damage in all cell types at the highest concentrations investigated. However, only SHSY5Y cells showed OA induced genotoxic and cytotoxic effects in presence of S9 fraction. Furthermore, we found that OA can induce modulations in DNA repair processes when exposure was performed prior to BLM treatment, in co-exposure, or during the subsequent DNA repair process. Copyright 2010 Elsevier B.V. All rights reserved.

  12. Cloning of the cDNA for a human homologue of the Drosophila white gene and mapping to chromosome 21q22.3.

    OpenAIRE

    Chen, H.; Rossier, C.; Lalioti, M. D.; Lynn, A.; Chakravarti, A.; Perrin, G.; Antonarakis, S. E.

    1996-01-01

    In an effort to contribute to the transcript map of human chromosome 21 and the understanding of the pathophysiology of trisomy 21, we have used exon trapping to identify fragments of chromosome 21 genes. Two trapped exons, from pools of chromosome 21-specific cosmids, showed homology to the Drosophila white (w) gene. We subsequently cloned the corresponding cDNA for a human homologue of the Drosophila w gene (hW) from human retina and fetal brain cDNA libraries. The gene belongs to the ATP-b...

  13. Cold-inducible RNA-binding protein through TLR4 signaling induces mitochondrial DNA fragmentation and regulates macrophage cell death after trauma.

    Science.gov (United States)

    Li, Zhigang; Fan, Erica K; Liu, Jinghua; Scott, Melanie J; Li, Yuehua; Li, Song; Xie, Wen; Billiar, Timothy R; Wilson, Mark A; Jiang, Yong; Wang, Ping; Fan, Jie

    2017-05-11

    Trauma is a major cause of systemic inflammatory response syndrome and multiple organ dysfunction syndrome. Macrophages (Mφ) direct trauma-induced inflammation, and Mφ death critically influences the progression of the inflammatory response. In the current study, we explored an important role of trauma in inducing mitochondrial DNA (mtDNA) damage in Mφ and the subsequent regulation of Mφ death. Using an animal pseudo-fracture trauma model, we demonstrated that tissue damage induced NADPH oxidase activation and increased the release of reactive oxygen species via cold-inducible RNA-binding protein (CIRP)-TLR4-MyD88 signaling. This in turn, activates endonuclease G, which serves as an executor for the fragmentation of mtDNA in Mφ. We further showed that fragmented mtDNA triggered both p62-related autophagy and necroptosis in Mφ. However, autophagy activation also suppressed Mφ necroptosis and pro-inflammatory responses. This study demonstrates a previously unidentified intracellular regulation of Mφ homeostasis in response to trauma.

  14. Paramecium putrinum (Ciliophora, Protozoa): the first insight into the variation of two DNA fragments - molecular support for the existence of cryptic species.

    Science.gov (United States)

    Tarcz, Sebastian; Rautian, Maria; Potekhin, Alexey; Sawka, Natalia; Beliavskaya, Alexandra; Kiselev, Andrey; Nekrasova, Irina; Przyboś, Ewa

    2014-04-01

    Paramecium putrinum (Claparede & Lachmann 1858) is one of the smallest (80-140 μm long) species of the genus Paramecium. Although it commonly occurs in freshwater reservoirs, no molecular studies of P. putrinum have been conducted to date. Herein we present an assessment of molecular variation in 27 strains collected from widely separated populations by using two selected DNA fragments (ITS1-5.8S-ITS2-5'LSU rDNA and COI mtDNA). Both the trees and haplotype networks reconstructed for both genome fragments show that the studied strains of P. putrinum form five main haplogroups. The mean distance between the studied strains is p-distance=0.007/0.068 (rDNA/COI) and exhibits similar variability as that between P. bursaria syngens. Based on these data, one could hypothesize that the clusters revealed in the present study may correspond to previously reported syngens and that there are at least five cryptic species within P. putrinum. Copyright © 2014 Elsevier Inc. All rights reserved.

  15. The DNA methylome of human peripheral blood mononuclear cells

    DEFF Research Database (Denmark)

    Li, Yingrui; Zhu, Jingde; Tian, Geng

    2010-01-01

    DNA methylation plays an important role in biological processes in human health and disease. Recent technological advances allow unbiased whole-genome DNA methylation (methylome) analysis to be carried out on human cells. Using whole-genome bisulfite sequencing at 24.7-fold coverage (12.3-fold per...... strand), we report a comprehensive (92.62%) methylome and analysis of the unique sequences in human peripheral blood mononuclear cells (PBMC) from the same Asian individual whose genome was deciphered in the YH project. PBMC constitute an important source for clinical blood tests world-wide. We found...... research and confirms new sequencing technology as a paradigm for large-scale epigenomics studies....

  16. Fluorescence-labeled methylation-sensitive amplified fragment length polymorphism (FL-MS-AFLP) analysis for quantitative determination of DNA methylation and demethylation status.

    Science.gov (United States)

    Kageyama, Shinji; Shinmura, Kazuya; Yamamoto, Hiroko; Goto, Masanori; Suzuki, Koichi; Tanioka, Fumihiko; Tsuneyoshi, Toshihiro; Sugimura, Haruhiko

    2008-04-01

    The PCR-based DNA fingerprinting method called the methylation-sensitive amplified fragment length polymorphism (MS-AFLP) analysis is used for genome-wide scanning of methylation status. In this study, we developed a method of fluorescence-labeled MS-AFLP (FL-MS-AFLP) analysis by applying a fluorescence-labeled primer and fluorescence-detecting electrophoresis apparatus to the existing method of MS-AFLP analysis. The FL-MS-AFLP analysis enables quantitative evaluation of more than 350 random CpG loci per run. It was shown to allow evaluation of the differences in methylation level of blood DNA of gastric cancer patients and evaluation of hypermethylation and hypomethylation in DNA from gastric cancer tissue in comparison with adjacent non-cancerous tissue.

  17. Bone fragments a body can make

    Energy Technology Data Exchange (ETDEWEB)

    Stout, S.D.; Ross, L.M. Jr. (Department of Anthropology, University of Missouri, Columbia (USA))

    1991-05-01

    Data obtained from various analytical techniques applied to a number of small bone fragments recovered from a crime scene were used to provide evidence for the occurrence of a fatality. Microscopic and histomorphometric analyses confirmed that the fragments were from a human skull. X-ray microanalysis of darkened areas on the bone fragments revealed a chemical signature that matched the chemical signature of a shotgun pellet recovered at the scene of the crime. The above findings supported the deoxyribonucleic acid (DNA) fingerprint evidence which, along with other evidence, was used to convict a man for the murder of his wife, even though her body was never recovered.

  18. In vitro and in vivo assay of radio-induced damage in Escherichia Coli, DNA labelled on thymidilic fragment

    International Nuclear Information System (INIS)

    Bonicel, A.

    1977-01-01

    A technique of rapid assay for a particular and very important damage, N-formamido (DNA), is described. Using this technique, the importance of radio-induced DNA damage can be evaluated before the repair enzymatic system takes place [fr

  19. Unscheduled synthesis of DNA and poly(ADP-ribose) in human fibroblasts following DNA damage

    International Nuclear Information System (INIS)

    McCurry, L.S.; Jacobson, M.K.

    1981-01-01

    Unscheduled DNA synthesis has been measured in human fibroblasts under conditions of reduced rates of conversion of NAD to poly)ADP-ribose). Cells heterozygous for the xeroderma pigmentosum genotype showed normal rates of uv induced unscheduled DNA synthesis under conditions in which the rate of poly(ADP-ribose) synthesis was one-half the rate of normal cells. The addition of theophylline, a potent inhibitor of poly(ADP-ribose) polymerase, to the culture medium of normal cells blocked over 90% of the conversion of NAD to poly(ADP-ribose) following treatment with uv or N-methyl-N'-nitro-N-nitro-soguanidine but did not affect the rate of unscheduled DNA synthesis

  20. Anticoagulant and calcium-binding properties of high molecular weight derivatives of human fibrinogen (plasmin fragments Y)

    NARCIS (Netherlands)

    Nieuwenhuizen, W.; Voskuilen, M.; Hermans, J.

    1982-01-01

    The present study was undertaken as a step to delineate further the localization of the calcium-binding sites in fibrinogen and to assess the anticlotting properties of fibrinogen degradation products. To this purpose, fragments Y were prepared by plasmin digestion of human fibrinogen in the

  1. A short synthetic peptide fragment of human C2ORF40 has therapeutic potential in breast cancer

    Energy Technology Data Exchange (ETDEWEB)

    Lin, Chaoyang [Shandong Univ., Jinan (China); Zhang, Pengju [Shandong Univ., Jinan (China); Jiang, Anli [Shandong Univ., Jinan (China); Mao, Jian-Hua [Lawrence Berkeley National Lab. (LBNL), Berkeley, CA (United States); Wei, Guangwei [Shandong Univ. School of Medicine, Jinan (China)

    2017-03-30

    C2ORF40 encodes a secreted protein which is cleaved to generate soluble peptides by proteolytic processing and this process is believed to be necessary for C2ORF40 to exert cell type specific biological activity. Here, we reported a short mimic peptide of human C2ORF40 acts potential therapeutic efficacy in human cancer cells in vitro and in vivo. We synthesized a short peptide of human C2ORF40, named C2ORF40 mimic peptide fragment and assessed its biological function on cancer cell growth, migration and tumorigenesis. Cell growth assay showed that C2ORF40 mimic peptide fragment significantly suppressed cell proliferation of breast and lung cancer cells. Moreover, C2ORF40 mimic peptide fragment significantly inhibited the migration and invasion of breast cancer cells. Furthermore, we showed that this peptide suppressed tumorigenesis in breast tumor xenograft model. Cell cycle assay indicated that the C2ORF40 mimic peptide fragment suppressed the growth of tumor cells through inducing mitotic phase arrest. In conclusion, our results firstly suggested that this short synthetic peptide of human C2ORF40 may be a candidate tumor therapeutic agent.

  2. DNA structure in human RNA polymerase II promoters

    DEFF Research Database (Denmark)

    Pedersen, Anders Gorm; Baldi, Pierre; Chauvin, Yves

    1998-01-01

    with a very low level of sequence similarity. The sequences, which include both TATA-containing and TATA-less promoters, are aligned by hidden Markov models. Using three different models of sequence-derived DNA bendability, the aligned promoters display a common structural profile with bendability being low...... protein in a manner reminiscent of DNA in a nucleosome. This notion is further supported by the finding that the periodic bendability is caused mainly by the complementary triplet pairs CAG/CTG and GGC/GCC, which previously have been found to correlate with nucleosome positioning. We present models where......The fact that DNA three-dimensional structure is important for transcriptional regulation begs the question of whether eukaryotic promoters contain general structural features independently of what genes they control. We present an analysis of a large set of human RNA polymerase II promoters...

  3. Determination of antimicrobial resistance of Enterococcus strains isolated from pigs and their genotypic characterization by method of amplification of DNA fragments surrounding rare restriction sites (ADSRRS fingerprinting).

    Science.gov (United States)

    Nowakiewicz, Aneta; Ziółkowska, Grażyna; Trościańczyk, Aleksandra; Zięba, Przemysław; Gnat, Sebastian

    2017-03-01

    In this study, we analysed phenotypic resistance profiles and their reflection in the genomic profiles of Enterococcus spp. strains isolated from pigs raised on different farms. Samples were collected from five pig farms (n=90 animals) and tested for Enterococcus. MICs of 12 antimicrobials were determined using the broth microdilution method, and epidemiological molecular analysis of strains belonging to selected species (faecalis, faecium and hirae) was performed using the ADSRRS-fingerprinting (amplification of DNA fragments surrounding rare restriction sites) method with a few modifications. The highest percentage of strains was resistant to tetracycline (73.4 %), erythromycin and tylosin (42.5 %) and rifampin (25.2 %), and a large number of strains exhibited high-level resistance to both kanamycin (25.2 %) and streptomycin (27.6 %). The strains of E. faecalis, E. faecium and E. hirae (n=184) revealed varied phenotypic resistance profiles, among which as many as seven met the criteria for multidrug resistance (30.4 % of strains tested). ADSRRS-fingerprinting analysis produced 17 genotypic profiles of individual strains which were correlated with their phenotypic resistance profiles. Only E. hirae strains susceptible to all of the chemotherapeutics tested had two different ADSRRS profiles. Moreover, eight animals were carriers of more than one genotype belonging to the same Enterococcus spp., mainly E. faecalis. Given the possibility of transmission to humans of the high-resistance/multidrug resistance enterococci and the significant role of pigs as food animals in this process, it is necessary to introduce a multilevel control strategy by carrying out research on the resistance and molecular characteristics of indicator bacterial strains isolated from animals on individual farms.

  4. The combi-targeting concept: in vitro and in vivo fragmentation of a stable combi-nitrosourea engineered to interact with the epidermal growth factor receptor while remaining DNA reactive.

    Science.gov (United States)

    Qiu, Qiyu; Domarkas, Juozas; Banerjee, Ranjita; Merayo, Nuria; Brahimi, Fouad; McNamee, James P; Gibbs, Bernard F; Jean-Claude, Bertrand J

    2007-01-01

    JDA58 (NSC 741282), a "combi-molecule" optimized in the context of the "combi-targeting concept," is a nitrosourea moiety tethered to an anilinoquinazoline. Here, we sought to show its binary epidermal growth factor receptor (EGFR)/DNA targeting property and to study its fragmentation in vitro and in vivo. The fragmentation of JDA58 was detected in cells in vitro and in vivo by fluorescence microscopy and tandem mass spectrometry. EGFR phosphorylation and DNA damage were determined by Western blotting and comet assay, respectively. Tumor data were examined for statistical significance using the Student's t test. JDA58 inhibited EGFR tyrosine kinase (IC(50), 0.2 micromol/L) and blocked EGFR phosphorylation in human DU145 prostate cancer cells. It induced significant levels of DNA damage in DU145 cells in vitro or in vivo and showed potent antiproliferative activity both in vitro and in a DU145 xenograft model. In cell-free medium, JDA58 was hydrolyzed to JDA35, a fluorescent amine that could be observed in tumor cells both in vitro and in vivo. In tumor cells in vitro or in vivo, or in plasma collected from mice, the denitrosated species JDA41 was the predominant metabolite. However, mass spectrometric analysis revealed detectable levels of the hydrolytic product JDA35 in tumor cells both in vitro and in vivo. The results in toto suggest that growth inhibition in vitro and in vivo may be sustained by the intact combi-molecule plus JDA35 plus JDA41, three inhibitors of EGFR, and the concomitantly released DNA-damaging species. This leads to a model wherein a single molecule carries a complex multitargeted-multidrug combination.

  5. Application of DNA fingerprints for cell-line individualization.

    OpenAIRE

    Gilbert, D A; Reid, Y A; Gail, M H; Pee, D; White, C; Hay, R J; O'Brien, S J

    1990-01-01

    DNA fingerprints of 46 human cell lines were derived using minisatellite probes for hypervariable genetic loci. The incidence of 121 HaeIII DNA fragments among 33 cell lines derived from unrelated individuals was used to estimate allelic and genotypic frequencies for each fragment and for composite individual DNA fingerprints. We present a quantitative estimate of the extent of genetic difference between individuals, an estimate based on the percentage of restriction fragments at which they d...

  6. Sickle erythrocytes inhibit human endothelial cell DNA synthesis

    International Nuclear Information System (INIS)

    Weinstein, R.; Zhou, M.A.; Bartlett-Pandite, A.; Wenc, K.

    1990-01-01

    Patients with sickle cell anemia experience severe vascular occlusive phenomena including acute pain crisis and cerebral infarction. Obstruction occurs at both the microvascular and the arterial level, and the clinical presentation of vascular events is heterogeneous, suggesting a complex etiology. Interaction between sickle erythrocytes and the endothelium may contribute to vascular occlusion due to alteration of endothelial function. To investigate this hypothesis, human vascular endothelial cells were overlaid with sickle or normal erythrocytes and stimulated to synthesize DNA. The erythrocytes were sedimented onto replicate monolayers by centrifugation for 10 minutes at 17 g to insure contact with the endothelial cells. Incorporation of 3H-thymidine into endothelial cell DNA was markedly inhibited during contact with sickle erythrocytes. This inhibitory effect was enhanced more than twofold when autologous sickle plasma was present during endothelial cell labeling. Normal erythrocytes, with or without autologous plasma, had a modest effect on endothelial cell DNA synthesis. When sickle erythrocytes in autologous sickle plasma were applied to endothelial monolayers for 1 minute, 10 minutes, or 1 hour and then removed, subsequent DNA synthesis by the endothelial cells was inhibited by 30% to 40%. Although adherence of sickle erythrocytes to the endothelial monolayers was observed under these experimental conditions, the effect of sickle erythrocytes on endothelial DNA synthesis occurred in the absence of significant adherence. Hence, human endothelial cell DNA synthesis is partially inhibited by contact with sickle erythrocytes. The inhibitory effect of sickle erythrocytes occurs during a brief (1 minute) contact with the endothelial monolayers, and persists for at least 6 hours of 3H-thymidine labeling

  7. Detecting multiple DNA human profile from a mosquito blood meal.

    Science.gov (United States)

    Rabêlo, K C N; Albuquerque, C M R; Tavares, V B; Santos, S M; Souza, C A; Oliveira, T C; Moura, R R; Brandão, L A C; Crovella, S

    2016-08-26

    Criminal traces commonly found at crime scenes may present mixtures from two or more individuals. The scene of the crime is important for the collection of various types of traces in order to find the perpetrator of the crime. Thus, we propose that hematophagous mosquitoes found at crime scenes can be used to perform genetic testing of human blood and aid in suspect investigation. The aim of the study was to obtain a single Aedes aegypti mosquito profile from a human DNA mixture containing genetic materials of four individuals. We also determined the effect of blood acquisition time by setting time intervals of 24, 48, and 72 h after the blood meal. STR loci and amelogenin were analyzed, and the results showed that human DNA profiles could be obtained from hematophagous mosquitos at 24 h following the blood meal. It is possible that hematophagous mosquitoes can be used as biological remains at the scene of the crime, and can be used to detect human DNA profiles of up to four individuals.

  8. Characterization of cDNA encoding human placental anticoagulant protein (PP4): Homology with the lipocortin family

    International Nuclear Information System (INIS)

    Grundmann, U.; Abel, K.J.; Bohn, H.; Loebermann, H.; Lottspeich, F.; Kuepper, H.

    1988-01-01

    A cDNA library prepared from human placenta was screened for sequences encoding the placental protein 4 (PP4). PP4 is an anticoagulant protein that acts as an indirect inhibitor of the thromboplastin-specific complex, which is involved in the blood coagulation cascade. Partial amino acid sequence information from PP4-derived cyanogen bromide fragments was used to design three oligonucleotide probes for screening the library. From 10 6 independent recombinants, 18 clones were identified that hybridized to all three probes. These 18 recombinants contained cDNA inserts encoding a protein of 320 amino acid residues. In addition to the PP4 cDNA the authors identified 9 other recombinants encoding a protein with considerable similarity (74%) to PP4, which was termed PP4-X. PP4 and PP4-X belong to the lipocortin family, as judged by their homology to lipocortin I and calpactin I

  9. Defining Driver DNA Methylation Changes in Human Cancer

    Directory of Open Access Journals (Sweden)

    Gerd P. Pfeifer

    2018-04-01

    Full Text Available Human malignant tumors are characterized by pervasive changes in the patterns of DNA methylation. These changes include a globally hypomethylated tumor cell genome and the focal hypermethylation of numerous 5′-cytosine-phosphate-guanine-3′ (CpG islands, many of them associated with gene promoters. It has been challenging to link specific DNA methylation changes with tumorigenesis in a cause-and-effect relationship. Some evidence suggests that cancer-associated DNA hypomethylation may increase genomic instability. Promoter hypermethylation events can lead to silencing of genes functioning in pathways reflecting hallmarks of cancer, including DNA repair, cell cycle regulation, promotion of apoptosis or control of key tumor-relevant signaling networks. A convincing argument for a tumor-driving role of DNA methylation can be made when the same genes are also frequently mutated in cancer. Many of the most commonly hypermethylated genes encode developmental transcription factors, the methylation of which may lead to permanent gene silencing. Inactivation of such genes will deprive the cells in which the tumor may initiate from the option of undergoing or maintaining lineage differentiation and will lock them into a perpetuated stem cell-like state thus providing an additional window for cell transformation.

  10. Recovery of latent fingerprints and DNA on human skin.

    Science.gov (United States)

    Färber, Doris; Seul, Andrea; Weisser, Hans-Joachim; Bohnert, Michael

    2010-11-01

    The project "Latent Fingerprints and DNA on Human Skin" was the first systematic research in Europe dealing with detection of fingerprints and DNA left by offenders on the skin of corpses. One thousand samples gave results that allow general statements on the materials and methods used. The tests were carried out according to a uniform trial structure. Fingerprints were deposited by natural donors on corpses. The latent fingerprints were treated with magnetic powder or black fingerprint powder. Afterward, they were lifted with silicone casting material (Isomark(®)) or gelatine foil. All lifts were swabbed to recover DNA. It was possible to visualize comparable and identifiable fingerprints on the skin of corpses (16%). In the same categories, magnetic powder (18.4%) yielded better results than black fingerprint powder (13.6%). The number of comparable and identifiable fingerprints decreased on the lifts (12.7%). Isomark(®) (14.9%) was the better lifting material in comparison with gelatine foil (10.1%). In one-third of the samples, DNA could be extracted from the powdered and lifted latents. Black fingerprint powder delivered the better result with a rate of 2.2% for full DNA profiles and profiles useful for exclusion in comparison with 1.8% for the magnetic powder traces. Isomark(®) (3.1%) yielded better results than gelatine foil (0.6%). © 2010 American Academy of Forensic Sciences.

  11. Androgen receptor function links human sexual dimorphism to DNA methylation.

    Directory of Open Access Journals (Sweden)

    Ole Ammerpohl

    Full Text Available Sex differences are well known to be determinants of development, health and disease. Epigenetic mechanisms are also known to differ between men and women through X-inactivation in females. We hypothesized that epigenetic sex differences may also result from sex hormone functions, in particular from long-lasting androgen programming. We aimed at investigating whether inactivation of the androgen receptor, the key regulator of normal male sex development, is associated with differences of the patterns of DNA methylation marks in genital tissues. To this end, we performed large scale array-based analysis of gene methylation profiles on genomic DNA from labioscrotal skin fibroblasts of 8 males and 26 individuals with androgen insensitivity syndrome (AIS due to inactivating androgen receptor gene mutations. By this approach we identified differential methylation of 167 CpG loci representing 162 unique human genes. These were significantly enriched for androgen target genes and low CpG content promoter genes. Additional 75 genes showed a significant increase of heterogeneity of methylation in AIS compared to a high homogeneity in normal male controls. Our data show that normal and aberrant androgen receptor function is associated with distinct patterns of DNA-methylation marks in genital tissues. These findings support the concept that transcription factor binding to the DNA has an impact on the shape of the DNA methylome. These data which derived from a rare human model suggest that androgen programming of methylation marks contributes to sexual dimorphism in the human which might have considerable impact on the manifestation of sex-associated phenotypes and diseases.

  12. The blood DNA virome in 8,000 humans.

    Directory of Open Access Journals (Sweden)

    Ahmed Moustafa

    2017-03-01

    Full Text Available The characterization of the blood virome is important for the safety of blood-derived transfusion products, and for the identification of emerging pathogens. We explored non-human sequence data from whole-genome sequencing of blood from 8,240 individuals, none of whom were ascertained for any infectious disease. Viral sequences were extracted from the pool of sequence reads that did not map to the human reference genome. Analyses sifted through close to 1 Petabyte of sequence data and performed 0.5 trillion similarity searches. With a lower bound for identification of 2 viral genomes/100,000 cells, we mapped sequences to 94 different viruses, including sequences from 19 human DNA viruses, proviruses and RNA viruses (herpesviruses, anelloviruses, papillomaviruses, three polyomaviruses, adenovirus, HIV, HTLV, hepatitis B, hepatitis C, parvovirus B19, and influenza virus in 42% of the study participants. Of possible relevance to transfusion medicine, we identified Merkel cell polyomavirus in 49 individuals, papillomavirus in blood of 13 individuals, parvovirus B19 in 6 individuals, and the presence of herpesvirus 8 in 3 individuals. The presence of DNA sequences from two RNA viruses was unexpected: Hepatitis C virus is revealing of an integration event, while the influenza virus sequence resulted from immunization with a DNA vaccine. Age, sex and ancestry contributed significantly to the prevalence of infection. The remaining 75 viruses mostly reflect extensive contamination of commercial reagents and from the environment. These technical problems represent a major challenge for the identification of novel human pathogens. Increasing availability of human whole-genome sequences will contribute substantial amounts of data on the composition of the normal and pathogenic human blood virome. Distinguishing contaminants from real human viruses is challenging.

  13. Short communication: Evaluation of the microbiota of kefir samples using metagenetic analysis targeting the 16S and 26S ribosomal DNA fragments.

    Science.gov (United States)

    Korsak, N; Taminiau, B; Leclercq, M; Nezer, C; Crevecoeur, S; Ferauche, C; Detry, E; Delcenserie, V; Daube, G

    2015-06-01

    Milk kefir is produced by fermenting milk in the presence of kefir grains. This beverage has several benefits for human health. The aim of this experiment was to analyze 5 kefir grains (and their products) using a targeted metagenetic approach. Of the 5 kefir grains analyzed, 1 was purchased in a supermarket, 2 were provided by the Ministry of Agriculture (Namur, Belgium), and 2 were provided by individuals. The metagenetic approach targeted the V1-V3 fragment of the 16S ribosomal (r)DNA for the grains and the resulting beverages at 2 levels of grain incorporation (5 and 10%) to identify the bacterial species population. In contrast, the 26S rDNA pyrosequencing was performed only on kefir grains with the aim of assessing the yeast populations. In parallel, pH measurements were performed on the kefir obtained from the kefir grains using 2 incorporation rates. Regarding the bacterial population, 16S pyrosequencing revealed the presence of 20 main bacterial species, with a dominance of the following: Lactobacillus kefiranofaciens, Lactococcus lactis ssp. cremoris, Gluconobacter frateurii, Lactobacillus kefiri, Acetobacter orientalis, and Acetobacter lovaniensis. An important difference was noticed between the kefir samples: kefir grain purchased from a supermarket (sample E) harbored a much higher proportion of several operational taxonomic units of Lactococcus lactis and Leuconostoc mesenteroides. This sample of grain was macroscopically different from the others in terms of size, apparent cohesion of the grains, structure, and texture, probably associated with a lower level of Lactobacillus kefiranofaciens. The kefir (at an incorporation rate of 5%) produced from this sample of grain was characterized by a lower pH value (4.5) than the others. The other 4 samples of kefir (5%) had pH values above 5. Comparing the kefir grain and the kefir, an increase in the population of Gluconobacter in grain sample B was observed. This was also the case for Acetobacter orientalis

  14. Human-sensitive bryophytes retreat into the depth of forest fragments in central European landscape

    Czech Academy of Sciences Publication Activity Database

    Hofmeister, Jeňýk; Hošek, J.; Brabec, Marek; Tenčík, A.

    2016-01-01

    Roč. 135, č. 3 (2016), s. 539-549 ISSN 1612-4669 Institutional support: RVO:67179843 ; RVO:67985807 Keywords : colonization * forest continuity * fragmentation * forest management * fragment size Subject RIV: EH - Ecology, Behaviour; BB - Applied Statistics, Operational Research (UIVT-O) Impact factor: 2.017, year: 2016

  15. A recombinant dromedary antibody fragment (VHH or nanobody) directed against human Duffy antigen receptor for chemokines.

    Science.gov (United States)

    Smolarek, Dorota; Hattab, Claude; Hassanzadeh-Ghassabeh, Gholamreza; Cochet, Sylvie; Gutiérrez, Carlos; de Brevern, Alexandre G; Udomsangpetch, Rachanee; Picot, Julien; Grodecka, Magdalena; Wasniowska, Kazimiera; Muyldermans, Serge; Colin, Yves; Le Van Kim, Caroline; Czerwinski, Marcin; Bertrand, Olivier

    2010-10-01

    Fy blood group antigens are carried by the Duffy antigen receptor for chemokines (DARC), a red cells receptor for Plasmodium vivax broadly implicated in human health and diseases. Recombinant VHHs, or nanobodies, the smallest intact antigen binding fragment derivative from the heavy chain-only antibodies present in camelids, were prepared from a dromedary immunized against DARC N-terminal extracellular domain and selected for DARC binding. A described VHH, CA52, does recognize native DARC on cells. It inhibits P. vivax invasion of erythrocytes and displaces interleukin-8 bound to DARC. The targeted epitope overlaps the well-defined DARC Fy6 epitope. K (D) of CA52-DARC equilibrium is sub-nanomolar, hence ideal to develop diagnostic or therapeutic compounds. Immunocapture by immobilized CA52 yielded highly purified DARC from engineered K562 cells. This first report on a VHH with specificity for a red blood cell protein exemplifies VHHs' potentialities to target, to purify, and to modulate the function of cellular markers.

  16. Monoclonal antibodies from rats immunized with fragment D of human fibrinogen

    International Nuclear Information System (INIS)

    Kennel, S.J.; Chen, J.P.; Lankford, P.K.; Foote, L.J.

    1981-01-01

    Fischer rats were immunized with fragment D (Fg-D) of human fibrinogen (Fg) to obtain antibody specific for neoantigens unique to this molecule. Absorption of serum with whole Fg indicated that some of the antibody produced reacted preferentially with Fg-D. Hybridoma cultures were prepared by fusion of immune rat spleen cells with mouse myeloma P3-X63-Ag8. Monoclonal antibodies obtained from these cultures fell into two classes: (a) Those reacting equally well with Fg and Fg-D. (b) Those reacting preferentially but not absolutely wth Fg-D. Antibody from hybridoma 104-14, a member of the first group had an affinity for Fg-D of 1.5 x 10 9 M -1 while antibodies from 106-59 and 106-71 (group 2) demonstrated much lower affinities of 1.0 x 10 7 and 4.7 x 10 6 M -1 , respectively. The cross reactivity of antibodies in the second group indicated that they react with protein conformations that are altered during production of Fg-D from Fg

  17. DNA amplification is rare in normal human cells

    International Nuclear Information System (INIS)

    Wright, J.A.; Watt, F.M.; Hudson, D.L.; Stark, G.R.; Smith, H.S.; Hancock, M.C.

    1990-01-01

    Three types of normal human cells were selected in tissue culture with three drugs without observing a single amplification event from a total of 5 x 10 8 cells. No drug-resistant colonies were observed when normal foreskin keratinocytes were selected with N-(phosphonacetyl)-L-aspartate or with hydroxyurea or when normal mammary epithelial cells were selected with methotrexate. Some slightly resistant colonies with limited potential for growth were obtained when normal diploid fibroblast cells derived from fetal lung were selected with methotrexate or hydroxyurea but careful copy-number analysis of the dihydrofolate reductase and ribonucleotide reductase genes revealed no evidence of amplification. The rarity of DNA amplification in normal human cells contrasts strongly with the situation in tumors and in established cell lines, where amplification of onogenes and of genes mediating drug resistance is frequent. The results suggest that tumors and cell lines have acquired the abnormal ability to amplify DNA with high frequency

  18. Conservative fragments in bacterial 16S rRNA genes and primer design for 16S ribosomal DNA amplicons in metagenomic studies

    KAUST Repository

    Wang, Yong

    2009-10-09

    Bacterial 16S ribosomal DNA (rDNA) amplicons have been widely used in the classification of uncultured bacteria inhabiting environmental niches. Primers targeting conservative regions of the rDNAs are used to generate amplicons of variant regions that are informative in taxonomic assignment. One problem is that the percentage coverage and application scope of the primers used in previous studies are largely unknown. In this study, conservative fragments of available rDNA sequences were first mined and then used to search for candidate primers within the fragments by measuring the coverage rate defined as the percentage of bacterial sequences containing the target. Thirty predicted primers with a high coverage rate (>90%) were identified, which were basically located in the same conservative regions as known primers in previous reports, whereas 30% of the known primers were associated with a coverage rate of <90%. The application scope of the primers was also examined by calculating the percentages of failed detections in bacterial phyla. Primers A519-539, E969- 983, E1063-1081, U515 and E517, are highly recommended because of their high coverage in almost all phyla. As expected, the three predominant phyla, Firmicutes, Gemmatimonadetes and Proteobacteria, are best covered by the predicted primers. The primers recommended in this report shall facilitate a comprehensive and reliable survey of bacterial diversity in metagenomic studies. © 2009 Wang, Qian.

  19. Defining functional DNA elements in the human genome

    Science.gov (United States)

    Kellis, Manolis; Wold, Barbara; Snyder, Michael P.; Bernstein, Bradley E.; Kundaje, Anshul; Marinov, Georgi K.; Ward, Lucas D.; Birney, Ewan; Crawford, Gregory E.; Dekker, Job; Dunham, Ian; Elnitski, Laura L.; Farnham, Peggy J.; Feingold, Elise A.; Gerstein, Mark; Giddings, Morgan C.; Gilbert, David M.; Gingeras, Thomas R.; Green, Eric D.; Guigo, Roderic; Hubbard, Tim; Kent, Jim; Lieb, Jason D.; Myers, Richard M.; Pazin, Michael J.; Ren, Bing; Stamatoyannopoulos, John A.; Weng, Zhiping; White, Kevin P.; Hardison, Ross C.

    2014-01-01

    With the completion of the human genome sequence, attention turned to identifying and annotating its functional DNA elements. As a complement to genetic and comparative genomics approaches, the Encyclopedia of DNA Elements Project was launched to contribute maps of RNA transcripts, transcriptional regulator binding sites, and chromatin states in many cell types. The resulting genome-wide data reveal sites of biochemical activity with high positional resolution and cell type specificity that facilitate studies of gene regulation and interpretation of noncoding variants associated with human disease. However, the biochemically active regions cover a much larger fraction of the genome than do evolutionarily conserved regions, raising the question of whether nonconserved but biochemically active regions are truly functional. Here, we review the strengths and limitations of biochemical, evolutionary, and genetic approaches for defining functional DNA segments, potential sources for the observed differences in estimated genomic coverage, and the biological implications of these discrepancies. We also analyze the relationship between signal intensity, genomic coverage, and evolutionary conservation. Our results reinforce the principle that each approach provides complementary information and that we need to use combinations of all three to elucidate genome function in human biology and disease. PMID:24753594

  20. Mycobacterium tuberculosis Cell Wall Fragments Released upon Bacterial Contact with the Human Lung Mucosa Alter the Neutrophil Response to Infection.

    Science.gov (United States)

    Scordo, Julia M; Arcos, Jesús; Kelley, Holden V; Diangelo, Lauren; Sasindran, Smitha J; Youngmin, Ellie; Wewers, Mark D; Wang, Shu-Hua; Balada-Llasat, Joan-Miquel; Torrelles, Jordi B

    2017-01-01

    In 2016, the World Health Organization reported that one person dies of tuberculosis (TB) every 21 s. A host environment that Mycobacterium tuberculosis ( M.tb ) finds during its route of infection is the lung mucosa bathing the alveolar space located in the deepest regions of the lungs. We published that human lung mucosa, or alveolar lining fluid (ALF), contains an array of hydrolytic enzymes that can significantly alter the M.tb surface during infection by cleaving off parts of its cell wall. This interaction results in two different outcomes: modifications on the M.tb cell wall surface and release of M.tb cell wall fragments into the environment. Typically, one of the first host immune cells at the site of M.tb infection is the neutrophil. Neutrophils can mount an extracellular and intracellular innate immune response to M.tb during infection. We hypothesized that exposure of neutrophils to ALF-induced M.tb released cell wall fragments would prime neutrophils to control M.tb infection better. Our results show that ALF fragments activate neutrophils leading to an increased production of inflammatory cytokines and oxidative radicals. However, neutrophil exposure to these fragments reduces production of chemoattractants (i.e., interleukin-8), and degranulation, with the subsequent reduction of myeloperoxidase release, and does not induce cytotoxicity. Unexpectedly, these ALF fragment-derived modulations in neutrophil activity do not further, either positively or negatively, contribute to the intracellular control of M.tb growth during infection. However, secreted products from neutrophils primed with ALF fragments are capable of regulating the activity of resting macrophages. These results indicate that ALF-induced M.tb fragments could further contribute to the control of M.tb growth and local killing by resident neutrophils by switching on the total oxidative response and limiting migration of neutrophils to the infection site.

  1. Identification of DNA Fragments that Showed Linkage to the Radiation-induced Yellow Vein Mosaic Disease Resistance Mutation in Okra

    International Nuclear Information System (INIS)

    Boonsirichai, Kanokporn; Phadvibulya, Valailak; Adthalungrong, Amnuai; Srithongchai, Wanphen; Puripunyavanich, Vichai

    2007-08-01

    Full text: The yellow vein mosaic disease resistant mutant of okra was crossed to Pichit 03, a susceptible variety. Their progeny showed prolonged resistance when compared with Pichit 03. DNA fingerprints of F2 and BC1F1 individuals from the cross indicated that most DNA bands did not segregate with either the resistance or the susceptible characteristics. Nonetheless, polymorphic DNA bands could be identified between the mutant and Okura, the parental variety

  2. Localization by whole-body autoradiography of intact and fragmented radiolabeled antibodies in a metastatic human colonic cancer model

    International Nuclear Information System (INIS)

    Fand, Irwin; Sharkey, R.M.; Grundy, J.P.; Goldenberg, D.M.

    1992-01-01

    In this report, we have employed macroautoradiography to compare the tumor targeting of 125 I-labeled anti-carcinoembryonic antigen (CEA) MAb (NP-4) to 125 I-labeled anti-colon-specific antigen-p (CSAp) MAb (Mu-9) and their labeled F(ab') 2 and Fab' fragments, in nude mice each bearing large dorsal human colonic tumor xenografts, and small nodular tumors in the liver and lungs. Using intact MAbs (NP-4 and Mu-9), clearance of background radioactivity was delayed to 3-7 days post-treatment. Treatment with F(ab') 2 and Fab' fragments of both NP-4 and Mu-9 MAbs, however, promoted clearance of background 125 I-radioactivity which was well advanced by 6-24 h and complete by 24-48 h after injection. Localization of 125 I-radioactivity in large and micrometastatic tumor perimeters was the most characteristic uptake pattern observed for both intact and fragmented MAbs. Qualitative analysis of macroautoradiographic images and quantitative densitometry indicated that the higher tumor-to-blood ratios achieved with labeled F(ab') 2 and Fab' fragments at early time points, compared to labeled whole immunoglobulin, appeared to be more a function of rapid plasma clearance, tumor mass, location of xenografts and specific tumor growth patterns than increased tumor penetrance by lower molecular weight univalent and bivalent immune fragments. (Author)

  3. The impact of partial manganese superoxide dismutase (SOD2)-deficiency on mitochondrial oxidant stress, DNA fragmentation and liver injury during acetaminophen hepatotoxicity

    International Nuclear Information System (INIS)

    Ramachandran, Anup; Lebofsky, Margitta; Weinman, Steven A.; Jaeschke, Hartmut

    2011-01-01

    Acetaminophen (APAP) hepatotoxicity is the most frequent cause of acute liver failure in many countries. The mechanism of cell death is initiated by formation of a reactive metabolite that binds to mitochondrial proteins and promotes mitochondrial dysfunction and oxidant stress. Manganese superoxide dismutase (SOD2) is a critical defense enzyme located in the mitochondrial matrix. The objective of this investigation was to evaluate the functional consequences of partial SOD2-deficiency (SOD2+/-) on intracellular signaling mechanisms of necrotic cell death after APAP overdose. Treatment of C57Bl/6J wild type animals with 200 mg/kg APAP resulted in liver injury as indicated by elevated plasma alanine aminotransferase activities (2870 ± 180 U/L) and centrilobular necrosis at 6 h. In addition, increased tissue glutathione disulfide (GSSG) levels and GSSG-to-GSH ratios, delayed mitochondrial GSH recovery, and increased mitochondrial protein carbonyls and nitrotyrosine protein adducts indicated mitochondrial oxidant stress. In addition, nuclear DNA fragmentation (TUNEL assay) correlated with translocation of Bax to the mitochondria and release of apoptosis-inducing factor (AIF). Furthermore, activation of c-jun-N-terminal kinase (JNK) was documented by the mitochondrial translocation of phospho-JNK. SOD2+/- mice showed 4-fold higher ALT activities and necrosis, an enhancement of all parameters of the mitochondrial oxidant stress, more AIF release and more extensive DNA fragmentation and more prolonged JNK activation. Conclusions: the impaired defense against mitochondrial superoxide formation in SOD2+/- mice prolongs JNK activation after APAP overdose and consequently further enhances the mitochondrial oxidant stress leading to exaggerated mitochondrial dysfunction, release of intermembrane proteins with nuclear DNA fragmentation and more necrosis.

  4. Mapping of the human APOB gene to chromosome 2p and demonstration of a two-allele restriction fragment length polymorphism

    International Nuclear Information System (INIS)

    Huang, L.; Miller, D.A.; Bruns, G.A.P.; Breslow, J.L.

    1986-01-01

    ApoB is a large glycoprotein with an apparent molecular mass of 550 kDa on NaDodSO 4 /PAGE. Recently, apoB cDNA clones have been isolated from an expression library made with mRNA from a human hepatoma cell line. These clones, which were all 1.5-1.6 kilobases (kb) long and corresponded to the 3' end of apoB mRNA, were used to demonstrate that hepatic apoB mRNA is ≅ 22 kb long. In the current report, a probe derived from one of these cDNA clones, pB8, was used for in situ hybridization experiments to map the human gene for apoB, APOB, to the distal half of the short arm of chromosome 2. This probe was also used to analyze somatic cell hybrids and, in agreement with the in situ hybridization studies, concordancy was demonstrated with chromosome 2. In addition, two hybrids with chromosome 2 translocations that contain only the short arm reacted with the pB8 probe. A third hybrid with a complex rearrangement of chromosome 2, which deleted an interstitial region and the tip of the short arm of chromosome 2, did not react. These data indicate that APOB maps to either 2p21-p23 or 2p24-pter. In further studies, DNA from normal individuals, digested with the restriction endonuclease EcoRI and subjected to Southern blot analysis with the pB8 probe, revealed a two-allele restriction fragment length polymorphism (RFLP). The mapping studies provide the means for understanding the relationship of the APOB locus to others in the human genome, whereas the demonstration of an APOB RFLP increases their ability to assess the role of this locus in determining plasma lipoprotein levels

  5. The study of human Y chromosome variation through ancient DNA.

    Science.gov (United States)

    Kivisild, Toomas

    2017-05-01

    High throughput sequencing methods have completely transformed the study of human Y chromosome variation by offering a genome-scale view on genetic variation retrieved from ancient human remains in context of a growing number of high coverage whole Y chromosome sequence data from living populations from across the world. The ancient Y chromosome sequences are providing us the first exciting glimpses into the past variation of male-specific compartment of the genome and the opportunity to evaluate models based on previously made inferences from patterns of genetic variation in living populations. Analyses of the ancient Y chromosome sequences are challenging not only because of issues generally related to ancient DNA work, such as DNA damage-induced mutations and low content of endogenous DNA in most human remains, but also because of specific properties of the Y chromosome, such as its highly repetitive nature and high homology with the X chromosome. Shotgun sequencing of uniquely mapping regions of the Y chromosomes to sufficiently high coverage is still challenging and costly in poorly preserved samples. To increase the coverage of specific target SNPs capture-based methods have been developed and used in recent years to generate Y chromosome sequence data from hundreds of prehistoric skeletal remains. Besides the prospects of testing directly as how much genetic change in a given time period has accompanied changes in material culture the sequencing of ancient Y chromosomes allows us also to better understand the rate at which mutations accumulate and get fixed over time. This review considers genome-scale evidence on ancient Y chromosome diversity that has recently started to accumulate in geographic areas favourable to DNA preservation. More specifically the review focuses on examples of regional continuity and change of the Y chromosome haplogroups in North Eurasia and in the New World.

  6. Toward metrological traceability for DNA fragment ratios in GM quantification. 3. Suitability of DNA calibrants studied with a MON 810 corn model.

    Science.gov (United States)

    Charels, Diana; Broeders, Sylvia; Corbisier, Philippe; Trapmann, Stefanie; Schimmel, Heinz; Emons, Hendrik

    2007-05-02

    The quantification of GMOs by real-time PCR relies on an external calibrant. In this paper the suitability of two DNA calibrants, genomic DNA from plant leaves and plasmidic DNA, was investigated. The PCR efficiencies, the correlation coefficients of the calibration curves, and the ratios between PCR efficiencies of transgenic and endogenous sequences were compared for both calibrants using 59 data sets produced by 43 laboratories. There were no significant differences between plasmidic and genomic DNA except for the PCR efficiencies of the calibration curves for the transgene of the construct-specific real-time PCR method. In the GM system investigated, PCR efficiencies of plasmidic calibrants were slightly closer to the PCR efficiencies observed for the unknowns than those of the genomic DNA calibrant. Therefore, plasmidic DNA was the more suitable calibrant for the PCR measurements on genomic DNA extracted from MON 810 seeds. It is shown that plasmidic DNA is an appropriate choice for the calibration of measurements of MON 810 corn with respect to the DNA copy number ratio.

  7. Human DNA quantification and sample quality assessment: Developmental validation of the PowerQuant(®) system.

    Science.gov (United States)

    Ewing, Margaret M; Thompson, Jonelle M; McLaren, Robert S; Purpero, Vincent M; Thomas, Kelli J; Dobrowski, Patricia A; DeGroot, Gretchen A; Romsos, Erica L; Storts, Douglas R

    2016-07-01

    Quantification of the total amount of human DNA isolated from a forensic evidence item is crucial for DNA normalization prior to short tandem repeat (STR) DNA analysis and a federal quality assurance standard requirement. Previous commercial quantification methods determine the total human DNA and total human male DNA concentrations, but provide limited information about the condition of the DNA sample. The PowerQuant(®) System includes targets for quantification of total human and total human male DNA as well as targets for evaluating whether the human DNA is degraded and/or PCR inhibitors are present in the sample. A developmental validation of the PowerQuant(®) System was completed, following SWGDAM Validation Guidelines, to evaluate the assay's specificity, sensitivity, precision and accuracy, as well as the ability to detect degraded DNA or PCR inhibitors. In addition to the total human DNA and total human male DNA concentrations in a sample, data from the degradation target and internal PCR control (IPC) provide a forensic DNA analyst meaningful information about the quality of the isolated human DNA and the presence of PCR inhibitors in the sample that can be used to determine the most effective workflow and assist downstream interpretation. Copyright © 2016 The Author(s). Published by Elsevier Ireland Ltd.. All rights reserved.

  8. The effect of chronic alcohol consumption on mitochondrial DNA mutagenesis in human blood

    Energy Technology Data Exchange (ETDEWEB)

    Wurmb-Schwark, N. von [Institute of Legal Medicine, Christian Albrecht University of Kiel, Arnold-Heller-Str. 12, 24105 Kiel (Germany)], E-mail: nvonwurmb@rechtsmedizin.uni-kiel.de; Ringleb, A.; Schwark, T. [Institute of Legal Medicine, Christian Albrecht University of Kiel, Arnold-Heller-Str. 12, 24105 Kiel (Germany); Broese, T.; Weirich, S.; Schlaefke, D. [Clinic of Psychiatry and Psychotherapy, University of Rostock, Gehlsheimer Str. 20, Rostock (Germany); Wegener, R. [Institute of Legal Medicine, St-Georg-Str. 108, University of Rostock, 18055 Rostock (Germany); Oehmichen, M. [Institute of Legal Medicine, Christian Albrecht University of Kiel, Arnold-Heller-Str. 12, 24105 Kiel (Germany)

    2008-01-01

    The 4977 bp deletion of mitochondrial DNA (mtDNA) is known to accumulate with increasing age in post mitotic tissues. Recently, studies came out detecting this specific alteration also in fast replicating cells, e.g. in blood or skin tissue, often in correlation to specific diseases or - specifically in skin - external stressors such as UV radiation. In this study, we investigated mitochondrial mutagenesis in 69 patients with a chronic alcoholic disease and 46 age matched controls with a moderate drinking behavior. Two different fragments, specific for total and for deleted mtDNA (dmtDNA) were amplified in a duplex-PCR. A subsequent fragment analysis was performed and for relative quantification, the quotient of the peak areas of amplification products specific for deleted and total mtDNA was determined. Additionally, a real time PCR was performed to quantify mtDNA copy number. The relative amount of 4977 bp deleted mtDNA in alcoholics was significantly increased compared to controls. On the other hand, no difference regarding the mtDNA/nuclear DNA ratio in both investigated groups was detected. Additionally, no age dependence could be found nor in alcoholics, neither in the control group. These findings indicate that mtDNA mutagenesis in blood can be influenced by stressors such as alcohol. Ethanol seems to be a significant factor to alter mitochondrial DNA in blood and might be an additional contributor for the cellular aging process.

  9. The effect of chronic alcohol consumption on mitochondrial DNA mutagenesis in human blood

    International Nuclear Information System (INIS)

    Wurmb-Schwark, N. von; Ringleb, A.; Schwark, T.; Broese, T.; Weirich, S.; Schlaefke, D.; Wegener, R.; Oehmichen, M.

    2008-01-01

    The 4977 bp deletion of mitochondrial DNA (mtDNA) is known to accumulate with increasing age in post mitotic tissues. Recently, studies came out detecting this specific alteration also in fast replicating cells, e.g. in blood or skin tissue, often in correlation to specific diseases or - specifically in skin - external stressors such as UV radiation. In this study, we investigated mitochondrial mutagenesis in 69 patients with a chronic alcoholic disease and 46 age matched controls with a moderate drinking behavior. Two different fragments, specific for total and for deleted mtDNA (dmtDNA) were amplified in a duplex-PCR. A subsequent fragment analysis was performed and for relative quantification, the quotient of the peak areas of amplification products specific for deleted and total mtDNA was determined. Additionally, a real time PCR was performed to quantify mtDNA copy number. The relative amount of 4977 bp deleted mtDNA in alcoholics was significantly increased compared to controls. On the other hand, no difference regarding the mtDNA/nuclear DNA ratio in both investigated groups was detected. Additionally, no age dependence could be found nor in alcoholics, neither in the control group. These findings indicate that mtDNA mutagenesis in blood can be influenced by stressors such as alcohol. Ethanol seems to be a significant factor to alter mitochondrial DNA in blood and might be an additional contributor for the cellular aging process

  10. Multivalent human papillomavirus l1 DNA vaccination utilizing electroporation.

    Directory of Open Access Journals (Sweden)

    Kihyuck Kwak

    Full Text Available Naked DNA vaccines can be manufactured simply and are stable at ambient temperature, but require improved delivery technologies to boost immunogenicity. Here we explore in vivo electroporation for multivalent codon-optimized human papillomavirus (HPV L1 and L2 DNA vaccination.Balb/c mice were vaccinated three times at two week intervals with a fusion protein comprising L2 residues ∼11-88 of 8 different HPV types (11-88×8 or its DNA expression vector, DNA constructs expressing L1 only or L1+L2 of a single HPV type, or as a mixture of several high-risk HPV types and administered utilizing electroporation, i.m. injection or gene gun. Serum was collected two weeks and 3 months after the last vaccination. Sera from immunized mice were tested for in-vitro neutralization titer, and protective efficacy upon passive transfer to naive mice and vaginal HPV challenge. Heterotypic interactions between L1 proteins of HPV6, HPV16 and HPV18 in 293TT cells were tested by co-precipitation using type-specific monoclonal antibodies.Electroporation with L2 multimer DNA did not elicit detectable antibody titer, whereas DNA expressing L1 or L1+L2 induced L1-specific, type-restricted neutralizing antibodies, with titers approaching those induced by Gardasil. Co-expression of L2 neither augmented L1-specific responses nor induced L2-specific antibodies. Delivery of HPV L1 DNA via in vivo electroporation produces a stronger antibody response compared to i.m. injection or i.d. ballistic delivery via gene gun. Reduced neutralizing antibody titers were observed for certain types when vaccinating with a mixture of L1 (or L1+L2 vectors of multiple HPV types, likely resulting from heterotypic L1 interactions observed in co-immunoprecipitation studies. High titers were restored by vaccinating with individual constructs at different sites, or partially recovered by co-expression of L2, such that durable protective antibody titers were achieved for each type

  11. Cryopreservation and xenografting of human ovarian fragments: medulla decreases the phosphatidylserine translocation rate

    Directory of Open Access Journals (Sweden)

    Vladimir Isachenko

    2016-11-01

    Full Text Available Abstract Background Phosphatidylserine is the phospholipid component which plays a key role in cell cycle signaling, specifically in regards to necrosis and apoptosis. When a cell affected by some negative factors, phosphatidylserine is no longer restricted to the intracellular side of membrane and can be translocated to the extracellular surface of the cell. Cryopreservation can induce translocation of phosphatidylserine in response to hypoxia, increasing intracellular Ca2+, osmotic disruption of cellular membranes, generation of reactive oxygen species and lipid peroxidation. As such the aim of this study was to test the level of phosphatidylserine translocation in frozen human medulla-contained and medulla-free ovarian tissue fragments. Methods Ovarian fragments from twelve patients were divided into small pieces of two types, medulla-free cortex (Group 1, n = 42, 1.5–3.0 × 1.5–3.0 × 0.5–0.8 mm and cortex with medulla (Group 2, n = 42, 1.5–3.0 × 1.5–3.0 × 1.5–2.0 mm, pre-cooled after operative removal to 5 °C for 24 h and then conventionally frozen with 6 % dimethyl sulfoxide, 6 % ethylene glycol and 0.15 M sucrose in standard 5-ml cryo-vials. After thawing at +100 °C and step-wise removal of cryoprotectants in 0.5 M sucrose, ovarian pieces were xenografted to SCID mice for 45 days. The efficacy of tissues cryopreservation, taking into account the presence or absence of medulla, was evaluated by the development of follicles (histology with hematoxylin-eosin and through the intensity of translocation of phosphatidylserine (FACS with FITC-Annexin V and Propidium Iodide. Results For Groups 1 and 2, the mean densities of follicles per 1 mm3 were 9.8, and 9.0, respectively. In these groups, 90 and 90 % preantral follicles appeared morphologically normal. However, FACS analysis showed a significantly decreased intensity of translocation of phosphatidylserine (FITC-Annexin V positive after

  12. Architectural fragments

    DEFF Research Database (Denmark)

    Bang, Jacob Sebastian

    2018-01-01

    I have created a large collection of plaster models: a collection of Obstructions, errors and opportunities that may develop into architecture. The models are fragments of different complex shapes as well as more simple circular models with different profiling and diameters. In this contect I have....... I try to invent the ways of drawing the models - that decode and unfold them into architectural fragments- into future buildings or constructions in the landscape. [1] Luigi Moretti: Italian architect, 1907 - 1973 [2] Man Ray: American artist, 1890 - 1976. in 2015, I saw the wonderful exhibition...... "Man Ray - Human Equations" at the Glyptotek in Copenhagen, organized by the Philips Collection in Washington D.C. and the Israel Museum in Jerusalem (in 2013). See also: "Man Ray - Human Equations" catalogue published by Hatje Cantz Verlag, Germany, 2014....

  13. GENOMIC DNA-FINGERPRINTING OF CLINICAL HAEMOPHILUS-INFLUENZAE ISOLATES BY POLYMERASE CHAIN-REACTION AMPLIFICATION - COMPARISON WITH MAJOR OUTER-MEMBRANE PROTEIN AND RESTRICTION-FRAGMENT-LENGTH-POLYMORPHISM ANALYSIS

    NARCIS (Netherlands)

    VANBELKUM, A; DUIM, B; REGELINK, A; MOLLER, L; QUINT, W; VANALPHEN, L

    Non-capsulate strains of Haemophilus influenzae were genotyped by analysis of variable DNA segments obtained by amplification of genomic DNA with the polymerase chain reaction (PCR fingerprinting). Discrete fragments of 100-2000 bp were obtained. The reproducibility of the procedure was assessed by

  14. [Peptide fragments of chemokine domain of fractalkine: effect on human monocyte migration].

    Science.gov (United States)

    Kukhtina, N B; Aref'eva, T I; Ruleva, N Iu; Sidorova, M V; Az'muko, A A; Bespalova, Zh D; Krasnikova, T L

    2012-01-01

    Leukocyte chemotaxis to the area of tissue damage is mediated by chemokines. According to the primary structure, chemokines are divided into four families, fractalkine (CX3CL1) is the only one member of CX3C family and the only membrane-bound chemokine. Fractalkine molecule includes the extracellular N-terminal chemokine domain, mucin-like rod, the transmembrane and the intracellular domains. In membrane-bound state fractalkine has the properties of an adhesion molecule. Chemokine domain of fractalkine (CDF) is released from cell membrane by proteolysis, and this soluble form acts as a chemoattractant for leukocytes expressing fractalkine receptor CX3CR1. Fractalkine is involved in development of a number of pathological processes caused by inflammation, and therefore a search for fractalkine inhibitors is very important. For this purpose we identified several antigenic determinants--the fragments of CDF, and the following peptides were synthesized--P41-52 H-Leu-Glu-Thr-Arg-Gln-His-Arg-Leu-Phe-Cys-Ala-Asp-NH2, P53-60 H-Pro-Lys-Glu-Gln-Trp-Val-Lys-Asp-NH2 and P60-71 H-Asp-Ala-Met-Gln-His-Leu-Asp-Arg-Gln-Ala-Ala-Ala-NH2. The peptide effects on adhesion and migration of human peripheral blood monocytes expressing fractalkine receptors were investigated. In the presence of CDF and P41-52 we observed the increased adhesion and migration of monocytes compared with spontaneous values. Peptides P53-60 and P60-71 significantly inhibited monocyte adhesion and migration stimulated by CDF. Since the chemotactic activity of chemokines was shown to be dependent on their binding to glycosaminoglycans of the cell surface and extracellular matrix, the effect ofpeptides on the interaction of CDF with heparin was analyzed by ELISA. Peptide P41-52 competed with CDF for heparin binding, while peptides P53-60 and P60-71 had no significant activity.

  15. The DNA methylome of human peripheral blood mononuclear cells.

    Directory of Open Access Journals (Sweden)

    Yingrui Li

    2010-11-01

    Full Text Available DNA methylation plays an important role in biological processes in human health and disease. Recent technological advances allow unbiased whole-genome DNA methylation (methylome analysis to be carried out on human cells. Using whole-genome bisulfite sequencing at 24.7-fold coverage (12.3-fold per strand, we report a comprehensive (92.62% methylome and analysis of the unique sequences in human peripheral blood mononuclear cells (PBMC from the same Asian individual whose genome was deciphered in the YH project. PBMC constitute an important source for clinical blood tests world-wide. We found that 68.4% of CpG sites and 80% displayed allele-specific expression (ASE. These data demonstrate that ASM is a recurrent phenomenon and is highly correlated with ASE in human PBMCs. Together with recently reported similar studies, our study provides a comprehensive resource for future epigenomic research and confirms new sequencing technology as a paradigm for large-scale epigenomics studies.

  16. Development of human antibody fragments using antibody phage display for the detection and diagnosis of Venezuelan equine encephalitis virus (VEEV

    Directory of Open Access Journals (Sweden)

    Hust Michael

    2008-09-01

    Full Text Available Abstract Background Venezuelan equine encephalitis virus (VEEV belongs to the Alphavirus group. Several species of this family are also pathogenic to humans and are recognized as potential agents of biological warfare and terrorism. The objective of this work was the generation of recombinant antibodies for the detection of VEEV after a potential bioterrorism assault or an natural outbreak of VEEV. Results In this work, human anti-VEEV single chain Fragments variable (scFv were isolated for the first time from a human naïve antibody gene library using optimized selection processes. In total eleven different scFvs were identified and their immunological specificity was assessed. The specific detection of the VEEV strains TC83, H12/93 and 230 by the selected antibody fragments was proved. Active as well as formalin inactivated virus particles were recognized by the selected antibody fragments which could be also used for Western blot analysis of VEEV proteins and immunohistochemistry of VEEV infected cells. The anti-VEEV scFv phage clones did not show any cross-reactivity with Alphavirus species of the Western equine encephalitis virus (WEEV and Eastern equine encephalitis virus (EEEV antigenic complex, nor did they react with Chikungunya virus (CHIKV, if they were used as detection reagent. Conclusion For the first time, this study describes the selection of antibodies against a human pathogenic virus from a human naïve scFv antibody gene library using complete, active virus particles as antigen. The broad and sensitive applicability of scFv-presenting phage for the immunological detection and diagnosis of Alphavirus species was demonstrated. The selected antibody fragments will improve the fast identification of VEEV in case of a biological warfare or terroristic attack or a natural outbreak.

  17. Molecular analysis of Leptospira spp. isolated from humans by restriction fragment length polymorphism, real-time PCR and pulsed-field gel electrophoresis.

    Science.gov (United States)

    Turk, Nenad; Milas, Zoran; Mojcec, Vesna; Ruzic-Sabljic, Eva; Staresina, Vilim; Stritof, Zrinka; Habus, Josipa; Postic, Daniele

    2009-11-01

    A total of 17 Leptospira clinical strains isolated from humans in Croatia were serologically and genetically analysed. For serovar identification, the microscopic agglutination test (MAT) and pulsed-field gel electrophoresis (PFGE) were used. To identify isolates on genomic species level, PCR-based restriction fragment length polymorphism (RFLP) and real-time PCR were performed. MAT revealed the following serogroup affinities: Grippotyphosa (seven isolates), Icterohaemorrhagiae (eight isolates) and Javanica (two isolates). RFLP of PCR products from a 331-bp-long fragment of rrs (16S rRNA gene) digested with endonucleases MnlI and DdeI and real-time PCR revealed three Leptospira genomic species. Grippotyphosa isolates belonged to Leptospira kirschneri, Icterohaemorrhagiae isolates to Leptospira interrogans and Javanica isolates to Leptospira borgpetersenii. Genomic DNA from 17 leptospiral isolates was digested with NotI and SgrAI restriction enzymes and analysed by PFGE. Results showed that seven isolates have the same binding pattern to serovar Grippotyphosa, eight isolates to serovar Icterohaemorrhagiae and two isolates to serovar Poi. Results demonstrate the diversity of leptospires circulating in Croatia. We point out the usefulness of a combination of PFGE, RFLP and real-time PCR as appropriate molecular methods in molecular analysis of leptospires.

  18. Differential Gene Expression in Response to Papaya ringspot virus Infection in Cucumis metuliferus Using cDNA- Amplified Fragment Length Polymorphism Analysis

    Science.gov (United States)

    Lin, Chia-Wei; Chung, Chien-Hung; Chen, Jo-Chu; Yeh, Shy-Dong; Ku, Hsin-Mei

    2013-01-01

    A better understanding of virus resistance mechanisms can offer more effective strategies to control virus diseases. Papaya ringspot virus (PRSV), Potyviridae, causes severe economical losses in papaya and cucurbit production worldwide. However, no resistance gene against PRSV has been identified to date. This study aimed to identify candidate PRSV resistance genes using cDNA-AFLP analysis and offered an open architecture and transcriptomic method to study those transcripts differentially expressed after virus inoculation. The whole genome expression profile of Cucumis metuliferus inoculated with PRSV was generated using cDNA-amplified fragment length polymorphism (cDNA-AFLP) method. Transcript derived fragments (TDFs) identified from the resistant line PI 292190 may represent genes involved in the mechanism of PRSV resistance. C. metuliferus susceptible Acc. 2459 and resistant PI 292190 lines were inoculated with PRSV and subsequently total RNA was isolated for cDNA-AFLP analysis. More than 400 TDFs were expressed specifically in resistant line PI 292190. A total of 116 TDFs were cloned and their expression patterns and putative functions in the PRSV-resistance mechanism were further characterized. Subsequently, 28 out of 116 candidates which showed two-fold higher expression levels in resistant PI 292190 than those in susceptible Acc. 2459 after virus inoculation were selected from the reverse northern blot and bioinformatic analysis. Furthermore, the time point expression profiles of these candidates by northern blot analysis suggested that they might play roles in resistance against PRSV and could potentially provide valuable information for controlling PRSV disease in the future. PMID:23874746

  19. PCR typing of DNA fragments of the short tandem repeat (STR) system HUMTH01 in Danes and Greenland Eskimos

    DEFF Research Database (Denmark)

    Nellemann, L J; Møller, A; Morling, N

    1994-01-01

    /child pairs were analyzed. Significant differences were observed between the distribution of fragments ('alleles'), whereby allele number 7 was considerably more frequent in Eskimos (0.687) than in Danes (0.201). The distributions of HUMTH01 phenotypes were in Hardy-Weinberg equilibrium in both the Eskimo...

  20. Involvement of DNA polymerase δ in DNA repair synthesis in human fibroblasts at late times after ultraviolet irradiation

    International Nuclear Information System (INIS)

    Dresler, S.L.; Gowans, B.J.; Robinson-Hill, R.M.; Hunting, D.J.

    1988-01-01

    DNA repair synthesis following UV irradiation of confluent human fibroblasts has a biphasic time course with an early phase of rapid nucleotide incorporation and a late phase of much slower nucleotide incorporation. The biphasic nature of this curve suggests that two distinct DNA repair systems may be operative. Previous studies have specifically implicated DNA polymerase δ as the enzyme involved in DNA repair synthesis occurring immediately after UV damage. In this paper, the authors describe studies of DNA polymerase involvement in DNA repair synthesis in confluent human fibroblasts at late times after UV irradiation. Late UV-induced DNA repair synthesis in both intact and permeable cells was found to be inhibited by aphidicolin, indicating the involvement of one of the aphidicolin-sensitive DNA polymerases, α or δ. In permeable cells, the process was further analyzed by using the nucleotide analogue (butylphenyl)-2'-deoxyguanosine 5'-triphosphate, which inhibits DNA polymerase α several hundred times more strongly than it inhibits DNA polymerase δ. The (butylphenyl)-2'-deoxyguanosine 5'-triphosphate inhibition curve for late UV-induced repair synthesis was very similar to that for polymerase δ. It appears that repair synthesis at late time after UV irradiation, like repair synthesis at early times, is mediated by DNA polymerase δ

  1. Generating and Purifying Fab Fragments from Human and Mouse IgG Using the Bacterial Enzymes IdeS, SpeB and Kgp.

    Science.gov (United States)

    Sjögren, Jonathan; Andersson, Linda; Mejàre, Malin; Olsson, Fredrik

    2017-01-01

    Fab fragments are valuable research tools in various areas of science including applications in imaging, binding studies, removal of Fc-mediated effector functions, mass spectrometry, infection biology, and many others. The enzymatic tools for the generation of Fab fragments have been discovered through basic research within the field of molecular bacterial pathogenesis. Today, these enzymes are widely applied as research tools and in this chapter, we describe methodologies based on bacterial enzymes to generate Fab fragments from both human and mouse IgG. For all human IgG subclasses, the IdeS enzyme from Streptococcus pyogenes has been applied to generate F(ab')2 fragments that subsequently can be reduced under mild conditions to generate a homogenous pool of Fab' fragments. The enzyme Kgp from Porphyromonas gingivalis has been applied to generate intact Fab fragments from human IgG1 and the Fab fragments can be purified using a CH1-specific affinity resin. The SpeB protease, also from S. pyogenes, is able to digest mouse IgGs and has been applied to digest antibodies and Fab fragments can be purified on light chain affinity resins. In this chapter, we describe methodologies that can be used to obtain Fab fragments from human and mouse IgG using bacterial proteases.

  2. Extrachromosomal circles of satellite repeats and 5S ribosomal DNA in human cells

    Directory of Open Access Journals (Sweden)

    Cohen Sarit

    2010-03-01

    Full Text Available Abstract Background Extrachomosomal circular DNA (eccDNA is ubiquitous in eukaryotic organisms and was detected in every organism tested, including in humans. A two-dimensional gel electrophoresis facilitates the detection of eccDNA in preparations of genomic DNA. Using this technique we have previously demonstrated that most of eccDNA consists of exact multiples of chromosomal tandemly repeated DNA, including both coding genes and satellite DNA. Results Here we report the occurrence of eccDNA in every tested human cell line. It has heterogeneous mass ranging from less than 2 kb to over 20 kb. We describe eccDNA homologous to human alpha satellite and the SstI mega satellite. Moreover, we show, for the first time, circular multimers of the human 5S ribosomal DNA (rDNA, similar to previous findings in Drosophila and plants. We further demonstrate structures that correspond to intermediates of rolling circle replication, which emerge from the circular multimers of 5S rDNA and SstI satellite. Conclusions These findings, and previous reports, support the general notion that every chromosomal tandem repeat is prone to generate eccDNA in eukryoric organisms including humans. They suggest the possible involvement of eccDNA in the length variability observed in arrays of tandem repeats. The implications of eccDNA on genome biology may include mechanisms of centromere evolution, concerted evolution and homogenization of tandem repeats and genomic plasticity.

  3. Biological activity of cloned mammary tumor virus DNA fragments that bind purified glucocorticoid receptor protein in vitro

    International Nuclear Information System (INIS)

    Yamamoto, K.R.; Payvar, F.; Firestone, G.L.; Maler, B.A.; Wrange, O.; Carlstedt-Duke, J.; Gustafsson, J.A.; Chandler, V.L.; Karolinska Institutet, Stockholm, Sweden)

    1983-01-01

    To test whether high-affinity receptor:DNA interactions can be correlated with receptor effects on promoter function in vivo, we have mapped in greater detail the receptor-binding regions on murine mammary tumor virus DNA, using both nitrocellulose-filter binding and electron microscopy. Recombinant plasmids bearing these receptor-binding domains have been transfected into cultured cells, and the expression of the plasmid sequences has been monitored for hormonal regulation. The results are considered in terms of a speculative proposal that the glucocorticoid receptor may effect changes in promoter activity via specific alteration of chromatin and/or DNA structure. 37 references, 6 figures, 2 tables

  4. Identification of a mammalian nuclear factor and human cDNA-encoded proteins that recognize DNA containing apurinic sites

    International Nuclear Information System (INIS)

    Lenz, J.; Okenquist, S.A.; LoSardo, J.E.; Hamilton, K.K.; Doetsch, P.W.

    1990-01-01

    Damage to DNA can have lethal or mutagenic consequences for cells unless it is detected and repaired by cellular proteins. Repair depends on the ability of cellular factors to distinguish the damaged sites. Electrophoretic binding assays were used to identify a factor from the nuclei of mammalian cells that bound to DNA containing apurinic sites. A binding assay based on the use of β-galactosidase fusion proteins was subsequently used to isolate recombinant clones of human cDNAs that encoded apurinic DNA-binding proteins. Two distinct human cDNAs were identified that encoded proteins that bound apurinic DNA preferentially over undamaged, methylated, or UV-irradiated DNA. These approaches may offer a general method for the detection of proteins that recognize various types of DNA damage and for the cloning of genes encoding such proteins

  5. Phage display selection of fully human antibody fragments to inhibit growth-promoting effects of glycine-extended gastrin 17 on human colorectal cancer cells.

    Science.gov (United States)

    Khajeh, Shirin; Tohidkia, Mohammad Reza; Aghanejad, Ayuob; Mehdipour, Tayebeh; Fathi, Farzaneh; Omidi, Yadollah

    2018-06-09

    Glycine-extended gastrin 17 (G17-Gly), a dominant processing intermediate of gastrin gene, has been implicated in the development or maintenance of colorectal cancers (CRCs). Hence, neutralizing G17-Gly activity by antibody entities can provide a potential therapeutic strategy in the patients with CRCs. To this end, we isolated fully human antibody fragments from a phage antibody library through biopanning against different epitopes of G17-Gly in order to obtain the highest possible antibody diversity. ELISA screening and sequence analysis identified 2 scFvs and 4 V L antibody fragments. Kinetic analysis of the antibody fragments by SPR revealed K D values to be in the nanomolar range (87.9-334 nM). The selected anti-G17-Gly antibody fragments were analyzed for growth inhibition and apoptotic assays in a CRC cell line, HCT-116, which is well-characterized for expressing gastrin intermediate species but not amidated gastrin. The antibody fragments exhibited significant inhibition of HCT-116 cells proliferation ranging from 36.5 to 73% of controls. Further, Annexin V/PI staining indicated that apoptosis rates of scFv H8 and V L G8 treated cells were 45.8 and 63%, respectively. Based on these results, we for the first time, demonstrated the isolation of anti-G17-Gly human scFv and V L antibodies with potential therapeutic applications in G17-Gly-responsive tumors.

  6. Validation of a new test for Schistosoma haematobium based on detection of Dra1 DNA fragments in urine: evaluation through latent class analysis.

    Directory of Open Access Journals (Sweden)

    Olufunmilola Ibironke

    2012-01-01

    Full Text Available Diagnosis of urogenital schistosomiasis in chronically infected adults is challenging but important, especially because long term infection of the bladder and urinary tract can have dire consequences. We evaluated three tests for viable infection: detection of parasite specific DNA Dra1 fragments, haematuria and presence of parasite eggs for sensitivity (Se and specificity (Sp.Over 400 urine specimens collected from adult volunteers in an endemic area in Western Nigeria were assessed for haematuria then filtered in the field, the filter papers dried and later examined for eggs and DNA. The results were stratified according to sex and age and subjected to Latent Class analysis.Presence of Dra1 in males (Se=100%; Sp=100% exceeded haematuria (Se=87.6%: Sp=34.7% and detection of eggs (Se=70.1%; Sp=100%. In females presence of Dra1 was Se=100%: Sp=100%, exceeding haematuria (Se=86.7%: Sp=77.0% and eggs (Se=70.1%; Sp=100%. Dra1 became undetectable 2 weeks after praziquantel treatment. We conclude detection of Dra1 fragment is a definitive test for the presence of Schistosoma haematobium infection.

  7. Reactive oxygen species levels and DNA fragmentation on astrocytes in primary culture after acute exposure to low intensity microwave electromagnetic field.

    Science.gov (United States)

    Campisi, Agata; Gulino, Marisa; Acquaviva, Rosaria; Bellia, Paolo; Raciti, Giuseppina; Grasso, Rosaria; Musumeci, Francesco; Vanella, Angelo; Triglia, Antonio

    2010-03-31

    The exposure of primary rat neocortical astroglial cell cultures to acute electromagnetic fields (EMF) in the microwave range was studied. Differentiated astroglial cell cultures at 14 days in vitro were exposed for 5, 10, or 20min to either 900MHz continuous waves or 900MHz waves modulated in amplitude at 50Hz using a sinusoidal waveform and 100% modulation index. The strength of the electric field (rms value) at the sample position was 10V/m. No change in cellular viability evaluated by MTT test and lactate dehydrogenase release was observed. A significant increase in ROS levels and DNA fragmentation was found only after exposure of the astrocytes to modulated EMF for 20min. No evident effects were detected when shorter time intervals or continuous waves were used. The irradiation conditions allowed the exclusion of any possible thermal effect. Our data demonstrate, for the first time, that even acute exposure to low intensity EMF induces ROS production and DNA fragmentation in astrocytes in primary cultures, which also represent the principal target of modulated EMF. Our findings also suggest the hypothesis that the effects could be due to hyperstimulation of the glutamate receptors, which play a crucial role in acute and chronic brain damage. Furthermore, the results show the importance of the amplitude modulation in the interaction between EMF and neocortical astrocytes. Copyright 2010 Elsevier Ireland Ltd. All rights reserved.

  8. Screening Test for Shed Skin Cells by Measuring the Ratio of Human DNA to Staphylococcus epidermidis DNA.

    Science.gov (United States)

    Nakanishi, Hiroaki; Ohmori, Takeshi; Hara, Masaaki; Takahashi, Shirushi; Kurosu, Akira; Takada, Aya; Saito, Kazuyuki

    2016-05-01

    A novel screening method for shed skin cells by detecting Staphylococcus epidermidis (S. epidermidis), which is a resident bacterium on skin, was developed. Staphylococcus epidermidis was detected using real-time PCR. Staphylococcus epidermidis was detected in all 20 human skin surface samples. Although not present in blood and urine samples, S. epidermidis was detected in 6 of 20 saliva samples, and 5 of 18 semen samples. The ratio of human DNA to S. epidermidisDNA was significantly smaller in human skin surface samples than in saliva and semen samples in which S. epidermidis was detected. Therefore, although skin cells could not be identified by detecting only S. epidermidis, they could be distinguished by measuring the S. epidermidis to human DNA ratio. This method could be applied to casework touch samples, which suggests that it is useful for screening whether skin cells and human DNA are present on potential evidentiary touch samples. © 2016 American Academy of Forensic Sciences.

  9. Human cDNA mapping using fluorescence in situ hybridization

    Energy Technology Data Exchange (ETDEWEB)

    Korenberg, J.R.

    1993-03-04

    Genetic mapping is approached using the techniques of high resolution fluorescence in situ hybridization (FISH). This technology and the results of its application are designed to rapidly generate whole genome as tool box of expressed sequence to speed the identification of human disease genes. The results of this study are intended to dovetail with and to link the results of existing technologies for creating backbone YAC and genetic maps. In the first eight months, this approach generated 60--80% of the expressed sequence map, the remainder expected to be derived through more long-term, labor-intensive, regional chromosomal gene searches or sequencing. The laboratory has made significant progress in the set-up phase, in mapping fetal and adult brain and other cDNAs, in testing a model system for directly linking genetic and physical maps using FISH with small fragments, in setting up a database, and in establishing the validity and throughput of the system.

  10. Hydroxytyrosol Protects against Oxidative DNA Damage in Human Breast Cells

    Directory of Open Access Journals (Sweden)

    José J. Gaforio

    2011-10-01

    Full Text Available Over recent years, several studies have related olive oil ingestion to a low incidence of several diseases, including breast cancer. Hydroxytyrosol and tyrosol are two of the major phenols present in virgin olive oils. Despite the fact that they have been linked to cancer prevention, there is no evidence that clarifies their effect in human breast tumor and non-tumor cells. In the present work, we present hydroxytyrosol and tyrosol’s effects in human breast cell lines. Our results show that hydroxytyrosol acts as a more efficient free radical scavenger than tyrosol, but both fail to affect cell proliferation rates, cell cycle profile or cell apoptosis in human mammary epithelial cells (MCF10A or breast cancer cells (MDA-MB-231 and MCF7. We found that hydroxytyrosol decreases the intracellular reactive oxygen species (ROS level in MCF10A cells but not in MCF7 or MDA-MB-231 cells while very high amounts of tyrosol is needed to decrease the ROS level in MCF10A cells. Interestingly, hydroxytyrosol prevents oxidative DNA damage in the three breast cell lines. Therefore, our data suggest that simple phenol hydroxytyrosol could contribute to a lower incidence of breast cancer in populations that consume virgin olive oil due to its antioxidant activity and its protection against oxidative DNA damage in mammary cells.

  11. Dating human DNA with the 14C bomb peak

    Energy Technology Data Exchange (ETDEWEB)

    Kutschera, Walter; Liebl, Jakob; Steier, Peter [VERA Laboratory, University of Vienna, Vienna (Austria)

    2013-07-01

    In 1963 the limited nuclear test ban treaty stopped nuclear weapons testing in the atmosphere. By then the addition from bomb-produced {sup 14}C had doubled the {sup 14}C content of the atmosphere. Through the CO{sub 2} cycle this excess exchanged with the hydrosphere and biosphere leading to a rapidly decreasing {sup 14}C level in the atmosphere. Today we are almost back to the pre-nuclear level. As a consequence all people on Earth who lived during the second half of the 20th century were exposed to this rapidly changing {sup 14}C signal. A few years ago, a group at the Department of Cell and Molecular Biology of the Karolinska Institute in Stockholm started to use the {sup 14}C bomb peak signal in DNA to determine retrospectively the age of cells from various parts of the human body (brain, heart, fat). In a collaboration with this group, we have studied the age of olfactory bulb neurons in the human brain. For this investigation, {sup 14}C AMS measurements were developed at VERA for very small carbon samples in the range from 2 to 4 micrograms. In the presentation the general concept of {sup 14}C bomb peak dating of human DNA and several applications are discussed.

  12. Radiolabeled monoclonal antibody 15 and its fragments for localization and imaging of xenografts of human lung cancer

    International Nuclear Information System (INIS)

    Endo, K.; Kamma, H.; Ogata, T.

    1988-01-01

    Monoclonal antibody (MAb) 15 and its F(ab')2 and Fab fragments were radioiodinated, and their biodistribution and imaging were compared in BALB/c nude mice bearing a xenograft of a human lung cancer (TKB-2). Association constants for 125I-labeled MAb 15 IgG, F(ab')2, and Fab were 1.9 X 10(9), 1.8 X 10(9), and 3.7 X 10(8) M-1, respectively. Immunoreactive fractions ranged from 0.59 to 0.50. Cultured TKB-2 cells expressed 1.1 X 10(4) binding sites/cell for MAb 15 IgG in vitro. The binding of a control antibody and the binding of its fragments to TKB-2 cells were less than 3% of the input doses. The mice with the TKB-2 tumors were given simultaneous injections of 10 microCi of 131I-labeled MAb 15 or its fragments and 10 microCi of 125I-labeled control IgG or its fragments. With MAb 15 IgG, the percentage of the injected dose bound per gram of tissue (ID/g) of the tumor was 3.68% at day 7, when the localization index (LI) was 4.38. At day 2 after MAb 15 F(ab')2 injection, 1.12% of the ID/g was localized in the tumor and the LI was 3.04. After MAb 15 Fab injection, the percentage of the ID/g of the tumor was 0.31% and the LI was 2.58 at day 1. MAb 15 IgG, F(ab')2, and Fab cleared from the blood early, with a half-life of 33, 16, and 9 hours, respectively. The distributions of MAb 15 and its fragments in the normal organs did not differ from those of the control. Radioimaging with 100 microCi of 131I-labeled MAb 15 and its fragments showed that 42%, 44%, and 32% of the total-body count were localized in the tumor with IgG at day 7, F(ab')2 at day 2, or Fab at day 1, respectively. Because the radioactivity remaining in the tumor with Fab was low, the image was insufficient. Throughout the period, less than 10% of the control IgG and its fragments remained in the tumor. Microautoradiography confirmed the binding of MAb 15 and its fragments to the tumor cells

  13. Pre-steady-state fluorescence analysis of damaged DNA transfer from human DNA glycosylases to AP endonuclease APE1.

    Science.gov (United States)

    Kuznetsova, Alexandra A; Kuznetsov, Nikita A; Ishchenko, Alexander A; Saparbaev, Murat K; Fedorova, Olga S

    2014-10-01

    DNA glycosylases remove the modified, damaged or mismatched bases from the DNA by hydrolyzing the N-glycosidic bonds. Some enzymes can further catalyze the incision of a resulting abasic (apurinic/apyrimidinic, AP) site through β- or β,δ-elimination mechanisms. In most cases, the incision reaction of the AP-site is catalyzed by special enzymes called AP-endonucleases. Here, we report the kinetic analysis of the mechanisms of modified DNA transfer from some DNA glycosylases to the AP endonuclease, APE1. The modified DNA contained the tetrahydrofurane residue (F), the analogue of the AP-site. DNA glycosylases AAG, OGG1, NEIL1, MBD4(cat) and UNG from different structural superfamilies were used. We found that all DNA glycosylases may utilise direct protein-protein interactions in the transient ternary complex for the transfer of the AP-containing DNA strand to APE1. We hypothesize a fast "flip-flop" exchange mechanism of damaged and undamaged DNA strands within this complex for monofunctional DNA glycosylases like MBD4(cat), AAG and UNG. Bifunctional DNA glycosylase NEIL1 creates tightly specific complex with DNA containing F-site thereby efficiently competing with APE1. Whereas APE1 fast displaces other bifunctional DNA glycosylase OGG1 on F-site thereby induces its shifts to undamaged DNA regions. Kinetic analysis of the transfer of DNA between human DNA glycosylases and APE1 allows us to elucidate the critical step in the base excision repair pathway. Copyright © 2014 Elsevier B.V. All rights reserved.

  14. Isolating human DNA repair genes using rodent-cell mutants

    International Nuclear Information System (INIS)

    Thompson, L.H.; Weber, C.A.; Brookman, K.W.; Salazar, E.P.; Stewart, S.A.; Mitchell, D.L.

    1987-01-01

    The DNA repair systems of rodent and human cells appear to be at least as complex genetically as those in lower eukaryotes and bacteria. The use of mutant lines of rodent cells as a means of identifying human repair genes by functional complementation offers a new approach toward studying the role of repair in mutagenesis and carcinogenesis. In each of six cases examined using hybrid cells, specific human chromosomes have been identified that correct CHO cell mutations affecting repair of damage from uv or ionizing radiations. This finding suggests that both the repair genes and proteins may be virtually interchangeable between rodent and human cells. Using cosmid vectors, human repair genes that map to chromosome 19 have cloned as functional sequences: ERCC2 and XRCC1. ERCC1 was found to have homology with the yeast excision repair gene RAD10. Transformants of repair-deficient cell lines carrying the corresponding human gene show efficient correction of repair capacity by all criteria examined. 39 refs., 1 fig., 1 tab

  15. Massive Pulmonary Embolism: Treatment with Thrombus Fragmentation and Local Fibrinolysis with Recombinant Human-Tissue Plasminogen Activator

    International Nuclear Information System (INIS)

    Stock, Klaus Wilhelm; Jacob, Augustinus Ludwig; Schnabel, Karl Jakob; Bongartz, Georg; Steinbrich, Wolfgang

    1997-01-01

    Purpose: To report the results of thrombus fragmentation in combination with local fibrinolysis using recombinant human-tissue plasminogen activator (rtPA) in patients with massive pulmonary embolism. Methods: Five patients with massive pulmonary embolism were treated with thrombus fragmentation followed by intrapulmonary injection of rtPA. Clot fragmentation was performed with a guidewire, angiographic catheter, and balloon catheter. Three patients had undergone recent surgery; one of them received a reduced dosage of rtPA. Results: All patients survived and showed clinical improvement with a resultant significant (p < 0.05) decrease in the pulmonary blood pressure (mean systolic pulmonary blood pressure before treatment, 49 mmHg; 4 hr after treatment, 28 mmHg). Angiographic follow-up in three patients revealed a decrease in thrombus material and an increase in pulmonary perfusion. Two patients developed retroperitoneal hematomas requiring transfusion. Conclusion: Clot fragmentation and local fibrinolysis with rtPA was an effective therapy for massive pulmonary embolism. Bleeding at the puncture site was a frequent complication

  16. Effect of ovarian tissue storage in Morus nigra extract on the morphology and DNA fragmentation of ovine preantral follicles

    Directory of Open Access Journals (Sweden)

    Agnes Yasmin Pitombeira Cavalcante

    2017-08-01

    Full Text Available This study demonstrated the effect of Morus nigra leaf extract during ovine ovarian tissue transportation on the survival and apoptosis of preantral follicles in vitro. High Performance Liquid Chromatography (HPLC was used to determine the fingerprint chromatogram of the crude ethanolic extract. Four pairs of ovaries from four sheep were collected. The ovarian cortex was fragmented and one fragment was fixed in 10% buffered formaldehyde and processed for histological and TUNEL analysis (fresh control. The other fragments were placed in Minimal Essential Medium (MEM – control medium or M. nigra extract (0.025; 0.05 or 0.1 mg/mL and stored (simulating transport at 4ºC for 6, 12 or 24 h. Preserved fragments (6 h were also destined to histological and TUNEL analysis. HPLC analysis confirmed the presence of antioxidant compounds (rutin, isoquercetin e kaempferitrin in the extract. There was a decrease (P 0.05 to 0.1 mg/mL of the extract. Apoptosis increased (P < 0.05 after conservation for 6 h in all treatments compared to the fresh control. Moreover, TUNEL positive cells decreased (P < 0.05 after preservation in 0.05 or 0.1 mg/mL M. nigra compared to MEM or 0.025 mg/mL M. nigra. In conclusion, 0.05 mg/mL M. nigra extract can be used as a preservation medium for ovine ovarian tissue at 4°C for up to 6 h.

  17. Human RAD50 makes a functional DNA-binding complex.

    Science.gov (United States)

    Kinoshita, Eri; van Rossum-Fikkert, Sari; Sanchez, Humberto; Kertokalio, Aryandi; Wyman, Claire

    2015-06-01

    The MRE11-RAD50-NBS1 (MRN) complex has several distinct functions in DNA repair including important roles in both non-homologous end-joining (NHEJ) and homologous recombination (HR). The biochemical activities of MR(N) have been well characterized implying specific functional roles for the components. The arrangement of proteins in the complex implies interdependence of their biochemical activities making it difficult to separate specific functions. We obtained purified human RAD50 and observed that it binds ATP, undergoes ATP-dependent conformational changes as well as having ATPase activity. Scanning force microscopy analysis clearly showed that RAD50 binds DNA although not as oligomers. RAD50 alone was not functional in tethering DNA molecules. ATP increased formation of RAD50 multimers which were however globular lacking extended coiled coils, in contrast to the MR complex where ATP induced oligomers have obvious coiled coils protruding from a central domain. These results suggest that MRE11 is important in maintaining the structural arrangement of RAD50 in the protein complex and perhaps has a role in reinforcing proper alignment of the coiled coils in the ATP-bound state. Copyright © 2015 Elsevier B.V. and Société Française de Biochimie et Biologie Moléculaire (SFBBM). All rights reserved.

  18. Human pro. cap alpha. 1)(I) collagen: cDNA sequence for the C-propeptide domain

    Energy Technology Data Exchange (ETDEWEB)

    Maekelae, J K; Raassina, M; Virta, A; Vuorio, E

    1988-01-11

    The authors have previously constructed a cDNA clone pHCAL1, covering most of the C-terminal propeptide domain of human pro..cap alpha..1(I) collagen mRNA,by inserting a 678 bp EcoRI-XhoI fragment of cDNA into pBR322. Since the XhoI/SalI ligation prevented removal of the insert, they used the same strategy to obtain a similar clone in pUC8. RNA was isolated from fetal calvarial bones. The cDNA was digested with EcoRI and XhoI and fractionated on a 1 % agarose gel. Fragments of 650-700 bp were cloned in pUC8 at the polylinker site, which now permits easy removal of the insert. The new clone was named pHCAL1U since the RNA was isolated from another individual. The approach outlined is useful for studies on individual variation which is important to recognize when searching for disease-related mutations in type I collagen.

  19. Human presence increases parasitic load in endangered lion-tailed macaques (Macaca silenus in its fragmented rainforest habitats in Southern India.

    Directory of Open Access Journals (Sweden)

    Shaik Hussain

    Full Text Available BACKGROUND: Understanding changes in the host-parasite relationship due to habitat fragmentation is necessary for better management and conservation of endangered species in fragmented landscapes. Pathogens and parasites can pose severe threat to species in restricted environments such as forest fragments where there is increased contact of wildlife with human and livestock populations. Environmental stress and reduced nutritional level in forest fragments can influence parasite infection and intensity on the native species. In this study, we examine the impact of habitat fragmentation on the prevalence of gastrointestinal parasites in lion-tailed macaques in a fragmented rainforest in Western Ghats. METHODS: The prevalence of different gastrointestinal parasites was estimated from 91 fecal samples collected from 9 lion-tailed macaque groups in nine forest fragments. The parasites were identified up to genus level on the basis of the morphology and coloration of the egg, larva and cyst. The covariates included forest fragment area, group size and the presence/absence of human settlements and livestock in proximity. We used a linear regression model to identify the covariates that significantly influenced the prevalence of different parasite taxa. RESULTS: Nine gastrointestinal parasite taxa were detected in lion-tailed macaque groups. The groups near human settlements had greater prevalence and number of taxa, and these variables also had significant positive correlations with group size. We found that these parameters were also greater in groups near human settlements after controlling for group size. Livestock were present in all five fragments that had human settlements in proximity. CONCLUSION: The present study suggests that high prevalence and species richness of gastrointestinal parasites in lion-tailed macaque groups are directly related to habitat fragmentation, high anthropogenic activities and high host density. The parasite load

  20. DNMT (DNA methyltransferase) inhibitors radiosensitize human cancer cells by suppressing DNA repair activity

    International Nuclear Information System (INIS)

    Kim, Hak Jae; Kim, Jin Ho; Chie, Eui Kyu; Da Young, Park; Kim, In Ah; Kim, Il Han

    2012-01-01

    Histone modifications and DNA methylation are two major factors in epigenetic phenomenon. Unlike the histone deacetylase inhibitors, which are known to exert radiosensitizing effects, there have only been a few studies thus far concerning the role of DNA methyltransferase (DNMT) inhibitors as radiosensitizers. The principal objective of this study was to evaluate the effects of DNMT inhibitors on the radiosensitivity of human cancer cell lines, and to elucidate the mechanisms relevant to that process. A549 (lung cancer) and U373MG (glioblastoma) cells were exposed to radiation with or without six DNMT inhibitors (5-azacytidine, 5-aza-2'-deoxycytidine, zebularine, hydralazine, epigallocatechin gallate, and psammaplin A) for 18 hours prior to radiation, after which cell survival was evaluated via clonogenic assays. Cell cycle and apoptosis were analyzed via flow cytometry. Expressions of DNMT1, 3A/3B, and cleaved caspase-3 were detected via Western blotting. Expression of γH2AX, a marker of radiation-induced DNA double-strand break, was examined by immunocytochemistry. Pretreatment with psammaplin A, 5-aza-2'-deoxycytidine, and zebularine radiosensitized both A549 and U373MG cells. Pretreatment with psammaplin A increased the sub-G1 fraction of A549 cells, as compared to cells exposed to radiation alone. Prolongation of γH2AX expression was observed in the cells treated with DNMT inhibitors prior to radiation as compared with those treated by radiation alone. Psammaplin A, 5-aza-2'-deoxycytidine, and zebularine induce radiosensitivity in both A549 and U373MG cell lines, and suggest that this effect might be associated with the inhibition of DNA repair

  1. TALE nickase mediates high efficient targeted transgene integration at the human multi-copy ribosomal DNA locus.

    Science.gov (United States)

    Wu, Yong; Gao, Tieli; Wang, Xiaolin; Hu, Youjin; Hu, Xuyun; Hu, Zhiqing; Pang, Jialun; Li, Zhuo; Xue, Jinfeng; Feng, Mai; Wu, Lingqian; Liang, Desheng

    2014-03-28

    Although targeted gene addition could be stimulated strikingly by a DNA double strand break (DSB) created by either zinc finger nucleases (ZFNs) or TALE nucleases (TALENs), the DSBs are really mutagenic and toxic to human cells. As a compromised solution, DNA single-strand break (SSB) or nick has been reported to mediate high efficient gene addition but with marked reduction of random mutagenesis. We previously demonstrated effective targeted gene addition at the human multicopy ribosomal DNA (rDNA) locus, a genomic safe harbor for the transgene with therapeutic potential. To improve the transgene integration efficiency by using TALENs while lowering the cytotoxicity of DSBs, we created both TALENs and TALE nickases (TALENickases) targeting this multicopy locus. A targeting vector which could integrate a GFP cassette at the rDNA locus was constructed and co-transfected with TALENs or TALENickases. Although the fraction of GFP positive cells using TALENs was greater than that using TALENickases during the first few days after transfection, it reduced to a level less than that using TALENickases after continuous culture. Our findings showed that the TALENickases were more effective than their TALEN counterparts at the multi-copy rDNA locus, though earlier studies using ZFNs and ZFNickases targeting the single-copy loci showed the reverse. Besides, TALENickases mediated the targeted integration of a 5.4 kb fragment at a frequency of up to 0.62% in HT1080 cells after drug selection, suggesting their potential application in targeted gene modification not being limited at the rDNA locus. Copyright © 2014 Elsevier Inc. All rights reserved.

  2. Impact of estrogenic compounds on DNA integrity in human spermatozoa: Evidence for cross-linking and redox cycling activities

    International Nuclear Information System (INIS)

    Bennetts, L.E.; De Iuliis, G.N.; Nixon, B.; Kime, M.; Zelski, K.; McVicar, C.M.; Lewis, S.E.; Aitken, R.J.

    2008-01-01

    A great deal of circumstantial evidence has linked DNA damage in human spermatozoa with adverse reproductive outcomes including reduced fertility and high rates of miscarriage. Although oxidative stress is thought to make a significant contribution to DNA damage in the male germ line, the factors responsible for creating this stress have not been elucidated. One group of compounds that are thought to be active in this context are the estrogens, either generated as a result of the endogenous metabolism of androgens within the male reproductive tract or gaining access to the latter as a consequence of environmental exposure. In this study, a wide variety of estrogenic compound