WorldWideScience

Sample records for human amphiphysin-1 sh3

  1. SH3 domain-mediated recruitment of host cell amphiphysins by alphavirus nsP3 promotes viral RNA replication.

    Directory of Open Access Journals (Sweden)

    Maarit Neuvonen

    2011-11-01

    Full Text Available Among the four non-structural proteins of alphaviruses the function of nsP3 is the least well understood. NsP3 is a component of the viral replication complex, and composed of a conserved aminoterminal macro domain implicated in viral RNA synthesis, and a poorly conserved carboxyterminal region. Despite the lack of overall homology we noted a carboxyterminal proline-rich sequence motif shared by many alphaviral nsP3 proteins, and found it to serve as a preferred target site for the Src-homology 3 (SH3 domains of amphiphysin-1 and -2. Nsp3 proteins of Semliki Forest (SFV, Sindbis (SINV, and Chikungunya viruses all showed avid and SH3-dependent binding to amphiphysins. Upon alphavirus infection the intracellular distribution of amphiphysin was dramatically altered and colocalized with nsP3. Mutations in nsP3 disrupting the amphiphysin SH3 binding motif as well as RNAi-mediated silencing of amphiphysin-2 expression resulted in impaired viral RNA replication in HeLa cells infected with SINV or SFV. Infection of Balb/c mice with SFV carrying an SH3 binding-defective nsP3 was associated with significantly decreased mortality. These data establish SH3 domain-mediated binding of nsP3 with amphiphysin as an important host cell interaction promoting alphavirus replication.

  2. Expression, purification, crystallization and preliminary X-ray crystallographic analysis of the SH3 domain of human AHI1

    International Nuclear Information System (INIS)

    Shi, Zhuliang; Liang, Ning; Xu, Wei; Li, Kuai; Sheng, Guoqing; Liu, Jinsong; Xu, Aimin; Li, Xiao-Jiang; Wu, Donghai

    2009-01-01

    The SH3 domain of human AHI1 has been cloned and expressed in Escherichia coli. The protein was purified by affinity and size-exclusion chromatography and was crystallized using the sitting-drop vapour-diffusion method at 293 K. The SH3 domain of human AHI1 was cloned and expressed in Escherichia coli. The protein was purified by affinity and size-exclusion chromatography and was crystallized using the sitting-drop vapour-diffusion method at 293 K. A complete data set was collected to 2.5 Å resolution at 110 K. The crystal belonged to space group P4 1 2 1 2, with unit-cell parameters a = 67.377, b = 67.377, c = 98.549 Å

  3. Structure of the SH3 domain of human osteoclast-stimulating factor at atomic resolution

    International Nuclear Information System (INIS)

    Chen, Liqing; Wang, Yujun; Wells, David; Toh, Diana; Harold, Hunt; Zhou, Jing; DiGiammarino, Enrico; Meehan, Edward J.

    2006-01-01

    The crystal structure of the SH3 domain of human osteoclast-stimulating factor has been determined and refined to the ultrahigh resolution of 1.07 Å. The structure at atomic resolution provides an accurate framework for structure-based design of its inhibitors. Osteoclast-stimulating factor (OSF) is an intracellular signaling protein, produced by osteoclasts themselves, that enhances osteoclast formation and bone resorption. It is thought to act via an Src-related signaling pathway and contains SH3 and ankyrin-repeat domains which are involved in protein–protein interactions. As part of a structure-based anti-bone-loss drug-design program, the atomic resolution X-ray structure of the recombinant human OSF SH3 domain (hOSF-SH3) has been determined. The domain, residues 12–72, yielded crystals that diffracted to the ultrahigh resolution of 1.07 Å. The overall structure shows a characteristic SH3 fold consisting of two perpendicular β-sheets that form a β-barrel. Structure-based sequence alignment reveals that the putative proline-rich peptide-binding site of hOSF-SH3 consists of (i) residues that are highly conserved in the SH3-domain family, including residues Tyr21, Phe23, Trp49, Pro62, Asn64 and Tyr65, and (ii) residues that are less conserved and/or even specific to hOSF, including Thr22, Arg26, Thr27, Glu30, Asp46, Thr47, Asn48 and Leu60, which might be key to designing specific inhibitors for hOSF to fight osteoporosis and related bone-loss diseases. There are a total of 13 well defined water molecules forming hydrogen bonds with the above residues in and around the peptide-binding pocket. Some of those water molecules might be important for drug-design approaches. The hOSF-SH3 structure at atomic resolution provides an accurate framework for structure-based design of its inhibitors

  4. Structure determination of human Lck unique and SH3 domains by nuclear magnetic resonance spectroscopy

    Directory of Open Access Journals (Sweden)

    Willbold Dieter

    2003-05-01

    Full Text Available Abstract Background Protein tyrosine kinases are involved in signal transduction pathways that regulate cell growth, differentiation, activation and transformation. Human lymphocyte specific kinase (Lck is a 56 kDa protein involved in T-cell- and IL2-receptor signaling. Three-dimensional structures are known for SH3, SH2 and kinase domains of Lck as well as for other tyrosine kinases. No structure is known for the unique domain of any Src-type tyrosine kinase. Results Lck(1–120 comprising unique and SH3 domains was structurally investigated by nuclear magnetic resonance spectroscopy. We found the unique domain, in contrast to the SH3 part, to have basically no defined structural elements. The solution structure of the SH3 part could be determined with very high precision. It does not show significant differences to Lck SH3 in the absence of the unique domain. Minor differences were observed to the X-ray structure of Lck SH3. Conclusion The unique domain of Lck does not contain any defined structure elements in the absence of ligands and membranes. Presence of the unique domain is not relevant to the three-dimensional structure of the Lck SH3 domain.

  5. Stiff person syndrome associated anti-amphiphysin antibodies reduce GABA associated [Ca(2+)]i rise in embryonic motoneurons.

    Science.gov (United States)

    Geis, C; Beck, M; Jablonka, S; Weishaupt, A; Toyka, K V; Sendtner, M; Sommer, C

    2009-10-01

    Autoantibodies to the synaptic protein amphiphysin play a crucial pathogenic role in paraneoplastic stiff-person syndrome. Impairment of GABAergic inhibition is the presumed pathophysiological mechanism by which these autoantibodies become pathogenic. Here we used calcium imaging on rat embryonic motor neurons to investigate whether antibodies to amphiphysin directly hinder GABAergic signaling. We found that the immunoglobulin G fraction from a patient with stiff-person syndrome, containing high titer antibodies to amphiphysin and inducing stiffness in rats upon passive transfer, reduced GABA-induced calcium influx in embryonic motor neurons. Depletion of the anti-amphiphysin fraction from the patient's IgG by selective affinity chromatography abolished this effect, showing its specificity for amphiphysin. Quantification of the surface expression of the Na(+)/K(+)/2Cl(2-) cotransporter revealed a reduction after incubation with anti-amphiphysin IgG, which is concordant with a lower intracellular chloride concentration and thus impairment of GABA mediated calcium influx. Thus, anti-amphiphysin antibodies exert a direct effect on GABA signaling, which is likely to contribute to the pathogenesis of SPS.

  6. SH2/SH3 signaling proteins.

    Science.gov (United States)

    Schlessinger, J

    1994-02-01

    SH2 and SH3 domains are small protein modules that mediate protein-protein interactions in signal transduction pathways that are activated by protein tyrosine kinases. SH2 domains bind to short phosphotyrosine-containing sequences in growth factor receptors and other phosphoproteins. SH3 domains bind to target proteins through sequences containing proline and hydrophobic amino acids. SH2 and SH3 domain containing proteins, such as Grb2 and phospholipase C gamma, utilize these modules in order to link receptor and cytoplasmic protein tyrosine kinases to the Ras signaling pathway and to phosphatidylinositol hydrolysis, respectively. The three-dimensional structures of several SH2 and SH3 domains have been determined by NMR and X-ray crystallography, and the molecular basis of their specificity is beginning to be unveiled.

  7. Solution structure of the first SH3 domain of human vinexin and its interaction with vinculin peptides

    International Nuclear Information System (INIS)

    Zhang, Jiahai; Li, Xiang; Yao, Bo; Shen, Weiqun; Sun, Hongbin; Xu, Chao; Wu, Jihui; Shi, Yunyu

    2007-01-01

    Solution structure of the first Src homology (SH) 3 domain of human vinexin (V S H3 1 ) was determined using nuclear magnetic resonance (NMR) method and revealed that it was a canonical SH3 domain, which has a typical β-β-β-β-α-β fold. Using chemical shift perturbation and surface plasmon resonance experiments, we studied the binding properties of the SH3 domain with two different peptides from vinculin hinge regions: P856 and P868. The observations illustrated slightly different affinities of the two peptides binding to V S H3 1 . The interaction between P868 and V S H3 1 belonged to intermediate exchange with a modest binding affinity, while the interaction between P856 and V S H3 1 had a low binding affinity. The structure and ligand-binding interface of V S H3 1 provide a structural basis for the further functional study of this important molecule

  8. A unique set of SH3-SH3 interactions controls IB1 homodimerization

    DEFF Research Database (Denmark)

    Kristensen, Ole; Guenat, Sylvie; Dar, Imran

    2006-01-01

    Islet-brain 1 (IB1 or JIP-1) is a scaffold protein that interacts with components of the c-Jun N-terminal kinase (JNK) signal-transduction pathway. IB1 is expressed at high levels in neurons and in pancreatic beta-cells, where it controls expression of several insulin-secretory components...... reduces IB1-dependent basal JNK activity in 293T cells. Impaired dimerization also results in a reduction in glucose transporter type 2 expression and in glucose-dependent insulin secretion in pancreatic beta-cells. Taken together, these results indicate that IB1 homodimerization through its SH3 domain...

  9. In silico simulations of STAT1 and STAT3 inhibitors predict SH2 domain cross-binding specificity.

    Science.gov (United States)

    Szelag, Malgorzata; Sikorski, Krzysztof; Czerwoniec, Anna; Szatkowska, Katarzyna; Wesoly, Joanna; Bluyssen, Hans A R

    2013-11-15

    Signal transducers and activators of transcription (STATs) comprise a family of transcription factors that are structurally related and which participate in signaling pathways activated by cytokines, growth factors and pathogens. Activation of STAT proteins is mediated by the highly conserved Src homology 2 (SH2) domain, which interacts with phosphotyrosine motifs for specific contacts between STATs and receptors and for STAT dimerization. By generating new models for human (h)STAT1, hSTAT2 and hSTAT3 we applied comparative in silico docking to determine SH2-binding specificity of the STAT3 inhibitor stattic, and of fludarabine (STAT1 inhibitor). Thus, we provide evidence that by primarily targeting the highly conserved phosphotyrosine (pY+0) SH2 binding pocket stattic is not a specific hSTAT3 inhibitor, but is equally effective towards hSTAT1 and hSTAT2. This was confirmed in Human Micro-vascular Endothelial Cells (HMECs) in vitro, in which stattic inhibited interferon-α-induced phosphorylation of all three STATs. Likewise, fludarabine inhibits both hSTAT1 and hSTAT3 phosphorylation, but not hSTAT2, by competing with the highly conserved pY+0 and pY-X binding sites, which are less well-preserved in hSTAT2. Moreover we observed that in HMECs in vitro fludarabine inhibits cytokine and lipopolysaccharide-induced phosphorylation of hSTAT1 and hSTAT3 but does not affect hSTAT2. Finally, multiple sequence alignment of STAT-SH2 domain sequences confirmed high conservation between hSTAT1 and hSTAT3, but not hSTAT2, with respect to stattic and fludarabine binding sites. Together our data offer a molecular basis that explains STAT cross-binding specificity of stattic and fludarabine, thereby questioning the present selection strategies of SH2 domain-based competitive small inhibitors. © 2013 Elsevier B.V. All rights reserved.

  10. Therapeutic effects of lentivirus-mediated shRNA targeting of cyclin D1 in human gastric cancer

    International Nuclear Information System (INIS)

    Seo, Jin-Hee; Jeong, Eui-Suk; Choi, Yang-Kyu

    2014-01-01

    Gastric cancer is the second most common cause of cancer-related death in males and the fourth in females. Traditional treatment has poor prognosis because of recurrence and systemic side effects. Therefore, the development of new therapeutic strategies is an important issue. Lentivirus-mediated shRNA stably inhibits target genes and can efficiently transduce most cells. Since overexpressed cyclin D1 is closely related to human gastric cancer progression, inhibition of cyclin D1 using specific targeting could be an effective treatment method of human gastric cancer. The therapeutic effect of lentivirus-mediated shRNA targeting of cyclin D1 (ShCCND1) was analyzed both in vitro and in vivo experiments. In vitro, NCI-N87 cells with downregulation of cyclin D1 by ShCCND1 showed significant inhibition of cell proliferation, cell motility, and clonogenicity. Downregulation of cyclin D1 in NCI-N87 cells also resulted in significantly increased G1 arrest and apoptosis. In vivo, stable NCI-N87 cells expressing ShCCND1 were engrafted into nude mice. Then, the cancer-growth inhibition effect of lentivirus was confirmed. To assess lentivirus including ShCCND1 as a therapeutic agent, intratumoral injection was conducted. Tumor growth of the lentivirus-treated group was significantly inhibited compared to growth of the control group. These results are in accordance with the in vitro data and lend support to the mitotic figure count and apoptosis analysis of the tumor mass. The lentivirus-mediated ShCCND1 was constructed, which effectively inhibited growth of NCI-N87-derived cancer both in vitro and in vivo. The efficiency of shRNA knockdown and variation in the degree of inhibition is mediated by different shRNA sequences and cancer cell lines. These experimental results suggest the possibility of developing new gastric cancer therapies using lentivirus-mediated shRNA

  11. Crystal structure of the Src family kinase Hck SH3-SH2 linker regulatory region supports an SH3-dominant activation mechanism.

    Science.gov (United States)

    Alvarado, John J; Betts, Laurie; Moroco, Jamie A; Smithgall, Thomas E; Yeh, Joanne I

    2010-11-12

    Most mammalian cell types depend on multiple Src family kinases (SFKs) to regulate diverse signaling pathways. Strict control of SFK activity is essential for normal cellular function, and loss of kinase regulation contributes to several forms of cancer and other diseases. Previous x-ray crystal structures of the SFKs c-Src and Hck revealed that intramolecular association of their Src homology (SH) 3 domains and SH2 kinase linker regions has a key role in down-regulation of kinase activity. However, the amino acid sequence of the Hck linker represents a suboptimal ligand for the isolated SH3 domain, suggesting that it may form the polyproline type II helical conformation required for SH3 docking only in the context of the intact structure. To test this hypothesis directly, we determined the crystal structure of a truncated Hck protein consisting of the SH2 and SH3 domains plus the linker. Despite the absence of the kinase domain, the structures and relative orientations of the SH2 and SH3 domains in this shorter protein were very similar to those observed in near full-length, down-regulated Hck. However, the SH2 kinase linker adopted a modified topology and failed to engage the SH3 domain. This new structure supports the idea that these noncatalytic regions work together as a "conformational switch" that modulates kinase activity in a manner unique to the SH3 domain and linker topologies present in the intact Hck protein. Our results also provide fresh structural insight into the facile induction of Hck activity by HIV-1 Nef and other Hck SH3 domain binding proteins and implicate the existence of innate conformational states unique to individual Src family members that "fine-tune" their sensitivities to activation by SH3-based ligands.

  12. Preferred SH3 domain partners of ADAM metalloproteases include shared and ADAM-specific SH3 interactions.

    Directory of Open Access Journals (Sweden)

    Iivari Kleino

    Full Text Available A disintegrin and metalloproteinases (ADAMs constitute a protein family essential for extracellular signaling and regulation of cell adhesion. Catalytic activity of ADAMs and their predicted potential for Src-homology 3 (SH3 domain binding show a strong correlation. Here we present a comprehensive characterization of SH3 binding capacity and preferences of the catalytically active ADAMs 8, 9, 10, 12, 15, 17, and 19. Our results revealed several novel interactions, and also confirmed many previously reported ones. Many of the identified SH3 interaction partners were shared by several ADAMs, whereas some were ADAM-specific. Most of the ADAM-interacting SH3 proteins were adapter proteins or kinases, typically associated with sorting and endocytosis. Novel SH3 interactions revealed in this study include TOCA1 and CIP4 as preferred partners of ADAM8, and RIMBP1 as a partner of ADAM19. Our results suggest that common as well as distinct mechanisms are involved in regulation and execution of ADAM signaling, and provide a useful framework for addressing the pathways that connect ADAMs to normal and aberrant cell behavior.

  13. Chemical shift assignments of the partially deuterated Fyn SH2-SH3 domain.

    Science.gov (United States)

    Kieken, Fabien; Loth, Karine; van Nuland, Nico; Tompa, Peter; Lenaerts, Tom

    2018-04-01

    Src Homology 2 and 3 (SH2 and SH3) are two key protein interaction modules involved in regulating the activity of many proteins such as tyrosine kinases and phosphatases by respective recognition of phosphotyrosine and proline-rich regions. In the Src family kinases, the inactive state of the protein is the direct result of the interaction of the SH2 and the SH3 domain with intra-molecular regions, leading to a closed structure incompetent with substrate modification. Here, we report the 1 H, 15 N and 13 C backbone- and side-chain chemical shift assignments of the partially deuterated Fyn SH3-SH2 domain and structural differences between tandem and single domains. The BMRB accession number is 27165.

  14. SH3 domain tyrosine phosphorylation--sites, role and evolution.

    Directory of Open Access Journals (Sweden)

    Zuzana Tatárová

    Full Text Available BACKGROUND: SH3 domains are eukaryotic protein domains that participate in a plethora of cellular processes including signal transduction, proliferation, and cellular movement. Several studies indicate that tyrosine phosphorylation could play a significant role in the regulation of SH3 domains. RESULTS: To explore the incidence of the tyrosine phosphorylation within SH3 domains we queried the PhosphoSite Plus database of phosphorylation sites. Over 100 tyrosine phosphorylations occurring on 20 different SH3 domain positions were identified. The tyrosine corresponding to c-Src Tyr-90 was by far the most frequently identified SH3 domain phosphorylation site. A comparison of sequences around this tyrosine led to delineation of a preferred sequence motif ALYD(Y/F. This motif is present in about 15% of human SH3 domains and is structurally well conserved. We further observed that tyrosine phosphorylation is more abundant than serine or threonine phosphorylation within SH3 domains and other adaptor domains, such as SH2 or WW domains. Tyrosine phosphorylation could represent an important regulatory mechanism of adaptor domains. CONCLUSIONS: While tyrosine phosphorylation typically promotes signaling protein interactions via SH2 or PTB domains, its role in SH3 domains is the opposite - it blocks or prevents interactions. The regulatory function of tyrosine phosphorylation is most likely achieved by the phosphate moiety and its charge interfering with binding of polyproline helices of SH3 domain interacting partners.

  15. Loss of Sh3gl2/Endophilin A1 Is a Common Event in Urothelial Carcinoma that Promotes Malignant Behavior

    Directory of Open Access Journals (Sweden)

    Shyama Majumdar

    2013-07-01

    Full Text Available Urothelial carcinoma (UC causes substantial morbidity and mortality worldwide. However, the molecular mechanisms underlying urothelial cancer development and tumor progression are still largely unknown. Using informatics analysis, we identified Sh3gl2 (endophilin A1 as a bladder urothelium-enriched transcript. The gene encoding Sh3gl2 is located on chromosome 9p, a region frequently altered in UC. Sh3gl2 is known to regulate endocytosis of receptor tyrosine kinases implicated in oncogenesis, such as the epidermal growth factor receptor (EGFR and c-Met. However, its role in UC pathogenesis is unknown. Informatics analysis of expression profiles as well as immunohistochemical staining of tissue microarrays revealed Sh3gl2 expression to be decreased in UC specimens compared to nontumor tissues. Loss of Sh3gl2 was associated with increasing tumor grade and with muscle invasion, which is a reliable predictor of metastatic disease and cancer-derived mortality. Sh3gl2 expression was undetectable in 19 of 20 human UC cell lines but preserved in the low-grade cell line RT4. Stable silencing of Sh3gl2 in RT4 cells by RNA interference 1 enhanced proliferation and colony formation in vitro, 2 inhibited EGF-induced EGFR internalization and increased EGFR activation, 3 stimulated phosphorylation of Src family kinases and STAT3, and 4 promoted growth of RT4 xenografts in subrenal capsule tissue recombination experiments. Conversely, forced re-expression of Sh3gl2 in T24 cells and silenced RT4 clones attenuated oncogenic behaviors, including growth and migration. Together, these findings identify loss of Sh3gl2 as a frequent event in UC development that promotes disease progression.

  16. Mutation of CD2AP and SH3KBP1 Binding Motif in Alphavirus nsP3 Hypervariable Domain Results in Attenuated Virus.

    Science.gov (United States)

    Mutso, Margit; Morro, Ainhoa Moliner; Smedberg, Cecilia; Kasvandik, Sergo; Aquilimeba, Muriel; Teppor, Mona; Tarve, Liisi; Lulla, Aleksei; Lulla, Valeria; Saul, Sirle; Thaa, Bastian; McInerney, Gerald M; Merits, Andres; Varjak, Margus

    2018-04-27

    Infection by Chikungunya virus (CHIKV) of the Old World alphaviruses (family Togaviridae) in humans can cause arthritis and arthralgia. The virus encodes four non-structural proteins (nsP) (nsP1, nsp2, nsP3 and nsP4) that act as subunits of the virus replicase. These proteins also interact with numerous host proteins and some crucial interactions are mediated by the unstructured C-terminal hypervariable domain (HVD) of nsP3. In this study, a human cell line expressing EGFP tagged with CHIKV nsP3 HVD was established. Using quantitative proteomics, it was found that CHIKV nsP3 HVD can bind cytoskeletal proteins, including CD2AP, SH3KBP1, CAPZA1, CAPZA2 and CAPZB. The interaction with CD2AP was found to be most evident; its binding site was mapped to the second SH3 ligand-like element in nsP3 HVD. Further assessment indicated that CD2AP can bind to nsP3 HVDs of many different New and Old World alphaviruses. Mutation of the short binding element hampered the ability of the virus to establish infection. The mutation also abolished ability of CD2AP to co-localise with nsP3 and replication complexes of CHIKV; the same was observed for Semliki Forest virus (SFV) harbouring a similar mutation. Similar to CD2AP, its homolog SH3KBP1 also bound the identified motif in CHIKV and SFV nsP3.

  17. Regulation of the interaction between the neuronal BIN1 isoform 1 and Tau proteins - role of the SH3 domain.

    Science.gov (United States)

    Malki, Idir; Cantrelle, François-Xavier; Sottejeau, Yoann; Lippens, Guy; Lambert, Jean-Charles; Landrieu, Isabelle

    2017-10-01

    Bridging integrator 1 (bin1) gene is a genetic determinant of Alzheimer's disease (AD) and has been reported to modulate Alzheimer's pathogenesis through pathway(s) involving Tau. The functional impact of Tau/BIN1 interaction as well as the molecular details of this interaction are still not fully resolved. As a consequence, how BIN1 through its interaction with Tau affects AD risk is also still not determined. To progress in this understanding, interaction of Tau with two BIN1 isoforms was investigated using Nuclear Magnetic Resonance spectroscopy. 1 H, 15 N spectra showed that the C-terminal SH3 domain of BIN1 isoform 1 (BIN1Iso1) is not mobile in solution but locked with the core of the protein. In contrast, the SH3 domain of BIN1 isoform 9 (BIN1Iso9) behaves as an independent mobile domain. This reveals an equilibrium between close and open conformations for the SH3 domain. Interestingly, a 334-376 peptide from the clathrin and AP-2-binding domain (CLAP) domain of BIN1Iso1, which contains a SH3-binding site, is able to compete with BIN1-SH3 intramolecular interaction. For both BIN1 isoforms, the SH3 domain can interact with Tau(210-240) sequence. Tau(210-240) peptide can indeed displace the intramolecular interaction of the BIN1-SH3 of BIN1Iso1 and form a complex with the released domain. The measured K d were in agreement with a stronger affinity of Tau peptide. Both CLAP and Tau peptides occupied the same surface on the BIN1-SH3 domain, showing that their interaction is mutually exclusive. These results emphasize an additional level of complexity in the regulation of the interaction between BIN1 and Tau dependent of the BIN1 isoforms. © 2017 Federation of European Biochemical Societies.

  18. A graph kernel approach for alignment-free domain-peptide interaction prediction with an application to human SH3 domains.

    Science.gov (United States)

    Kundu, Kousik; Costa, Fabrizio; Backofen, Rolf

    2013-07-01

    State-of-the-art experimental data for determining binding specificities of peptide recognition modules (PRMs) is obtained by high-throughput approaches like peptide arrays. Most prediction tools applicable to this kind of data are based on an initial multiple alignment of the peptide ligands. Building an initial alignment can be error-prone, especially in the case of the proline-rich peptides bound by the SH3 domains. Here, we present a machine-learning approach based on an efficient graph-kernel technique to predict the specificity of a large set of 70 human SH3 domains, which are an important class of PRMs. The graph-kernel strategy allows us to (i) integrate several types of physico-chemical information for each amino acid, (ii) consider high-order correlations between these features and (iii) eliminate the need for an initial peptide alignment. We build specialized models for each human SH3 domain and achieve competitive predictive performance of 0.73 area under precision-recall curve, compared with 0.27 area under precision-recall curve for state-of-the-art methods based on position weight matrices. We show that better models can be obtained when we use information on the noninteracting peptides (negative examples), which is currently not used by the state-of-the art approaches based on position weight matrices. To this end, we analyze two strategies to identify subsets of high confidence negative data. The techniques introduced here are more general and hence can also be used for any other protein domains, which interact with short peptides (i.e. other PRMs). The program with the predictive models can be found at http://www.bioinf.uni-freiburg.de/Software/SH3PepInt/SH3PepInt.tar.gz. We also provide a genome-wide prediction for all 70 human SH3 domains, which can be found under http://www.bioinf.uni-freiburg.de/Software/SH3PepInt/Genome-Wide-Predictions.tar.gz. Supplementary data are available at Bioinformatics online.

  19. A graph kernel approach for alignment-free domain–peptide interaction prediction with an application to human SH3 domains

    Science.gov (United States)

    Kundu, Kousik; Costa, Fabrizio; Backofen, Rolf

    2013-01-01

    Motivation: State-of-the-art experimental data for determining binding specificities of peptide recognition modules (PRMs) is obtained by high-throughput approaches like peptide arrays. Most prediction tools applicable to this kind of data are based on an initial multiple alignment of the peptide ligands. Building an initial alignment can be error-prone, especially in the case of the proline-rich peptides bound by the SH3 domains. Results: Here, we present a machine-learning approach based on an efficient graph-kernel technique to predict the specificity of a large set of 70 human SH3 domains, which are an important class of PRMs. The graph-kernel strategy allows us to (i) integrate several types of physico-chemical information for each amino acid, (ii) consider high-order correlations between these features and (iii) eliminate the need for an initial peptide alignment. We build specialized models for each human SH3 domain and achieve competitive predictive performance of 0.73 area under precision-recall curve, compared with 0.27 area under precision-recall curve for state-of-the-art methods based on position weight matrices. We show that better models can be obtained when we use information on the noninteracting peptides (negative examples), which is currently not used by the state-of-the art approaches based on position weight matrices. To this end, we analyze two strategies to identify subsets of high confidence negative data. The techniques introduced here are more general and hence can also be used for any other protein domains, which interact with short peptides (i.e. other PRMs). Availability: The program with the predictive models can be found at http://www.bioinf.uni-freiburg.de/Software/SH3PepInt/SH3PepInt.tar.gz. We also provide a genome-wide prediction for all 70 human SH3 domains, which can be found under http://www.bioinf.uni-freiburg.de/Software/SH3PepInt/Genome-Wide-Predictions.tar.gz. Contact: backofen@informatik.uni-freiburg.de Supplementary

  20. Mutation of CD2AP and SH3KBP1 Binding Motif in Alphavirus nsP3 Hypervariable Domain Results in Attenuated Virus

    Directory of Open Access Journals (Sweden)

    Margit Mutso

    2018-04-01

    Full Text Available Infection by Chikungunya virus (CHIKV of the Old World alphaviruses (family Togaviridae in humans can cause arthritis and arthralgia. The virus encodes four non-structural proteins (nsP (nsP1, nsp2, nsP3 and nsP4 that act as subunits of the virus replicase. These proteins also interact with numerous host proteins and some crucial interactions are mediated by the unstructured C-terminal hypervariable domain (HVD of nsP3. In this study, a human cell line expressing EGFP tagged with CHIKV nsP3 HVD was established. Using quantitative proteomics, it was found that CHIKV nsP3 HVD can bind cytoskeletal proteins, including CD2AP, SH3KBP1, CAPZA1, CAPZA2 and CAPZB. The interaction with CD2AP was found to be most evident; its binding site was mapped to the second SH3 ligand-like element in nsP3 HVD. Further assessment indicated that CD2AP can bind to nsP3 HVDs of many different New and Old World alphaviruses. Mutation of the short binding element hampered the ability of the virus to establish infection. The mutation also abolished ability of CD2AP to co-localise with nsP3 and replication complexes of CHIKV; the same was observed for Semliki Forest virus (SFV harbouring a similar mutation. Similar to CD2AP, its homolog SH3KBP1 also bound the identified motif in CHIKV and SFV nsP3.

  1. Comparison of SH3 and SH2 domain dynamics when expressed alone or in an SH(3+2) construct: the role of protein dynamics in functional regulation.

    Science.gov (United States)

    Engen, J R; Smithgall, T E; Gmeiner, W H; Smith, D L

    1999-04-02

    Protein dynamics play an important role in protein function and regulation of enzymatic activity. To determine how additional interactions with surrounding structure affects local protein dynamics, we have used hydrogen exchange and mass spectrometry to investigate the SH2 and SH3 domains of the protein tyrosine kinase Hck. Exchange rates of isolated Hck SH3 and SH2 domains were compared with rates for the same domains when part of a larger SH(3+2) construct. Increased deuterium incorporation was observed for the SH3 domain in the joint construct, particularly near the SH2 interface and the short sequence that connects SH3 to SH2, implying greater flexibility of SH3 when it is part of SH(3+2). Slow cooperative unfolding of the SH3 domain occurred at the same rate in isolated SH3 as in the SH(3+2) construct, suggesting a functional significance for this unfolding. The SH2 domain displayed relatively smaller changes in flexibility when part of the SH(3+2) construct. These results suggest that the domains influence each other. Further, our results imply a link between functional regulation and structural dynamics of SH3 and SH2 domains. Copyright 1999 Academic Press.

  2. Characterization of a novel weak interaction between MUC1 and Src-SH3 using nuclear magnetic resonance spectroscopy

    Energy Technology Data Exchange (ETDEWEB)

    Gunasekara, Nirosha [Department of Laboratory Medicine and Pathology, University of Alberta, 5B4.21 WCM Health Science Centre, 8440-112th Street, Edmonton, Alberta, Canada T6G 2R7 (Canada); Sykes, Brian, E-mail: brian.sykes@ualberta.ca [Department of Biochemistry, 4-19B Medical Sciences Bldg., University of Alberta Edmonton, Alberta, Canada T6G 2H7 (Canada); Hugh, Judith, E-mail: judithh@ualberta.ca [Department of Laboratory Medicine and Pathology, University of Alberta, 5B4.21 WCM Health Science Centre, 8440-112th Street, Edmonton, Alberta, Canada T6G 2R7 (Canada)

    2012-05-18

    Highlights: Black-Right-Pointing-Pointer MUC1 binds the Src-SH3 domain potentially triggering Src dependent cell migration. Black-Right-Pointing-Pointer NMR Spectroscopy was used to monitor MUC1-CD and Src SH3 domain titrations. Black-Right-Pointing-Pointer MUC1-CD peptides bind with a low affinity (K{sub d} of 2-3 mM) to a non-canonical site. Black-Right-Pointing-Pointer Weak interactions may mediate dynamic processes like migration. Black-Right-Pointing-Pointer The MUC1-CD and Src-SH3 interaction may be a prime target to inhibit cell migration. -- Abstract: Breast cancer causes death through cancer cell migration and subsequent metastasis to distant organs. In vitro, the MUC1 mucin can mediate breast cancer cell migration by binding to intercellular adhesion molecule-1 (ICAM-1). This migration is dependent on MUC1 cytoplasmic domain (MUC1-CD) activation of the non-receptor tyrosine kinase, Src, possibly through competitive displacement of an inhibitory Src intramolecular SH3 binding. Therefore, we characterized the binding site and affinity of the MUC1-CD for Src-SH3 using multidimensional nuclear magnetic resonance (NMR) spectroscopy to monitor the titration of the {sup 15}N labeled Src-SH3 domain with synthetic native and mutant peptides of MUC1-CD. The results revealed that the dissociation constant (K{sub d}) for the interaction of the native MUC1-CD peptides and Src-SH3 domain was weak with a K{sub d} of 2-3 mM. Notably, the SH3 residues most perturbed upon peptide binding were located outside the usual hydrophobic binding cleft in a previously described alternate binding site on the Src-SH3, suggesting that MUC1-CD binds to a non-canonical site. The binding characteristics outlined here suggest that the interaction between Src-SH3 and MUC1-CD represents a novel weak electrostatic interaction of the type which is increasingly recognized as important in transient and dynamic protein complexes required for cell migration and signal transduction. As such, this

  3. Diversity in peptide recognition by the SH2 domain of SH2B1.

    Science.gov (United States)

    McKercher, Marissa A; Guan, Xiaoyang; Tan, Zhongping; Wuttke, Deborah S

    2018-02-01

    SH2B1 is a multidomain protein that serves as a key adaptor to regulate numerous cellular events, such as insulin, leptin, and growth hormone signaling pathways. Many of these protein-protein interactions are mediated by the SH2 domain of SH2B1, which recognizes ligands containing a phosphorylated tyrosine (pY), including peptides derived from janus kinase 2, insulin receptor, and insulin receptor substrate-1 and -2. Specificity for the SH2 domain of SH2B1 is conferred in these ligands either by a hydrophobic or an acidic side chain at the +3 position C-terminal to the pY. This specificity for chemically disparate species suggests that SH2B1 relies on distinct thermodynamic or structural mechanisms to bind to peptides. Using binding and structural strategies, we have identified unique thermodynamic signatures for each peptide binding mode, and several SH2B1 residues, including K575 and R578, that play distinct roles in peptide binding. The high-resolution structure of the SH2 domain of SH2B1 further reveals conformationally plastic protein loops that may contribute to the ability of the protein to recognize dissimilar ligands. Together, numerous hydrophobic and electrostatic interactions, in addition to backbone conformational flexibility, permit the recognition of diverse peptides by SH2B1. An understanding of this expanded peptide recognition will allow for the identification of novel physiologically relevant SH2B1/peptide interactions, which can contribute to the design of obesity and diabetes pharmaceuticals to target the ligand-binding interface of SH2B1 with high specificity. © 2017 Wiley Periodicals, Inc.

  4. Complex formation of EphB1/Nck/Caskin1 leads to tyrosine phosphorylation and structural changes of the Caskin1 SH3 domain

    Directory of Open Access Journals (Sweden)

    Pesti Szabolcs

    2012-11-01

    Full Text Available Abstract Background Scaffold proteins have an important role in the regulation of signal propagation. These proteins do not possess any enzymatic activity but can contribute to the formation of multiprotein complexes. Although scaffold proteins are present in all cell types, the nervous system contains them in the largest amount. Caskin proteins are typically present in neuronal cells, particularly, in the synapses. However, the signaling mechanisms by which Caskin proteins are regulated are largely unknown. Results Here we demonstrate that EphB1 receptor tyrosine kinase can recruit Caskin1 through the adaptor protein Nck. Upon activation of the receptor kinase, the SH2 domain of Nck binds to one of its tyrosine residues, while Nck SH3 domains interact with the proline-rich domain of Caskin1. Complex formation of the receptor, adaptor and scaffold proteins results in the tyrosine phosphorylation of Caskin1 on its SH3 domain. The phosphorylation sites were identified by mass-spectrometry as tyrosines 296 and 336. To reveal the structural consequence of this phosphorylation, CD spectroscopy was performed. This measurement suggests that upon tyrosine phosphorylation the structure of the Caskin1 SH3 domain changes significantly. Conclusion Taken together, we propose that the scaffold protein Caskin1 can form a complex with the EphB1 tyrosine kinase via the Nck protein as a linker. Complex formation results in tyrosine phosphorylation of the Caskin1 SH3 domain. Although we were not able to identify any physiological partner of the SH3 domain so far, we could demonstrate that phosphorylation on conserved tyrosine residues results in marked changes in the structure of the SH3 domain.

  5. Critical Role of the Src Homology 2 (SH2) Domain of Neuronal SH2B1 in the Regulation of Body Weight and Glucose Homeostasis in Mice

    OpenAIRE

    Morris, David L.; Cho, Kae Won; Rui, Liangyou

    2010-01-01

    SH2B1 is an SH2 domain-containing adaptor protein that plays a key role in the regulation of energy and glucose metabolism in both rodents and humans. Genetic deletion of SH2B1 in mice results in obesity and type 2 diabetes. Single-nucleotide polymorphisms in the SH2B1 loci and chromosomal deletions of the SH2B1 loci associate with obesity and insulin resistance in humans. In cultured cells, SH2B1 promotes leptin and insulin signaling by binding via its SH2 domain to phosphorylated tyrosines ...

  6. Development of Highly Selective Kv1.3-Blocking Peptides Based on the Sea Anemone Peptide ShK

    Directory of Open Access Journals (Sweden)

    Michael W. Pennington

    2015-01-01

    Full Text Available ShK, from the sea anemone Stichodactyla helianthus, is a 35-residue disulfide-rich peptide that blocks the voltage-gated potassium channel Kv1.3 at ca. 10 pM and the related channel Kv1.1 at ca. 16 pM. We developed an analog of this peptide, ShK-186, which is currently in Phase 1b-2a clinical trials for the treatment of autoimmune diseases such as multiple sclerosis and rheumatoid arthritis. While ShK-186 displays a >100-fold improvement in selectivity for Kv1.3 over Kv1.1 compared with ShK, there is considerable interest in developing peptides with an even greater selectivity ratio. In this report, we describe several variants of ShK that incorporate p-phophono-phenylalanine at the N-terminus coupled with internal substitutions at Gln16 and Met21. In addition, we also explored the combinatorial effects of these internal substitutions with an alanine extension at the C-terminus. Their selectivity was determined by patch-clamp electrophysiology on Kv1.3 and Kv1.1 channels stably expressed in mouse fibroblasts. The peptides with an alanine extension blocked Kv1.3 at low pM concentrations and exhibited up to 2250-fold selectivity for Kv1.3 over Kv1.1. Analogs that incorporates p-phosphono-phenylalanine at the N-terminus blocked Kv1.3 with IC50s in the low pM range and did not affect Kv1.1 at concentrations up to 100 nM, displaying a selectivity enhancement of >10,000-fold for Kv1.3 over Kv1.1. Other potentially important Kv channels such as Kv1.4 and Kv1.6 were only partially blocked at 100 nM concentrations of each of the ShK analogs.

  7. An Amphiphysin-Like Domain in Fus2p Is Required for Rvs161p Interaction and Cortical Localization

    Directory of Open Access Journals (Sweden)

    Richard A. Stein

    2016-02-01

    Full Text Available Cell–cell fusion fulfils essential roles in fertilization, development and tissue repair. In the budding yeast, Saccharomyces cerevisiae, fusion between two haploid cells of opposite mating type generates the diploid zygote. Fus2p is a pheromone-induced protein that regulates cell wall removal during mating. Fus2p shuttles from the nucleus to localize at the shmoo tip, bound to Rvs161p, an amphiphysin. However, Rvs161p independently binds a second amphiphysin, Rvs167p, playing an essential role in endocytosis. To understand the basis of the Fus2p–Rvs161p interaction, we analyzed Fus2p structural domains. A previously described N-terminal domain (NTD is necessary and sufficient to regulate nuclear/cytoplasmic trafficking of Fus2p. The Dbl homology domain (DBH binds GTP-bound Cdc42p; binding is required for cell fusion, but not localization. We identified an approximately 200 amino acid region of Fus2p that is both necessary and sufficient for Rvs161p binding. The Rvs161p binding domain (RBD contains three predicted alpha-helices; structural modeling suggests that the RBD adopts an amphiphysin-like structure. The RBD contains a 13-amino-acid region, conserved with Rvs161p and other amphiphysins, which is essential for binding. Mutations in the RBD, predicted to affect membrane binding, abolish cell fusion without affecting Rvs161p binding. We propose that Fus2p/Rvs161p form a novel heterodimeric amphiphysin required for cell fusion. Rvs161p binding is required but not sufficient for Fus2p localization. Mutations in the C-terminal domain (CTD of Fus2p block localization, but not Rvs161p binding, causing a significant defect in cell fusion. We conclude that the Fus2p CTD mediates an additional, Rvs161p-independent interaction at the shmoo tip.

  8. Biochemical and genetic analysis of the Drk SH2/SH3 adaptor protein of Drosophila.

    Science.gov (United States)

    Raabe, T; Olivier, J P; Dickson, B; Liu, X; Gish, G D; Pawson, T; Hafen, E

    1995-06-01

    The Drk SH3-SH2-SH3 adaptor protein has been genetically identified in a screen for rate-limiting components acting downstream of the Sevenless (Sev) receptor tyrosine kinase in the developing eye of Drosophila. It provides a link between the activated Sev receptor and Sos, a guanine nucleotide release factor that activates Ras1. We have used a combined biochemical and genetic approach to study the interactions between Sev, Drk and Sos. We show that Tyr2546 in the cytoplasmic tail of Sev is required for Drk binding, probably because it provides a recognition site for the Drk SH2 domain. Interestingly, a mutation at this site does not completely block Sev function in vivo. This may suggest that Sev can signal in a Drk-independent, parallel pathway or that Drk can also bind to an intermediate docking protein. Analysis of the Drk-Sos interaction has identified a high affinity binding site for Drk SH3 domains in the Sos tail. We show that the N-terminal Drk SH3 domain is primarily responsible for binding to the tail of Sos in vitro, and for signalling to Ras in vivo.

  9. The SH2 and SH3 domains of mammalian Grb2 couple the EGF receptor to the Ras activator mSos1.

    Science.gov (United States)

    Rozakis-Adcock, M; Fernley, R; Wade, J; Pawson, T; Bowtell, D

    1993-05-06

    Many tyrosine kinases, including the receptors for hormones such as epidermal growth factor (EGF), nerve growth factor and insulin, transmit intracellular signals through Ras proteins. Ligand binding to such receptors stimulates Ras guanine-nucleotide-exchange activity and increases the level of GTP-bound Ras, suggesting that these tyrosine kinases may activate a guanine-nucleotide releasing protein (GNRP). In Caenorhabditis elegans and Drosophila, genetic studies have shown that Ras activation by tyrosine kinases requires the protein Sem-5/drk, which contains a single Src-homology (SH) 2 domain and two flanking SH3 domains. Sem-5 is homologous to the mammalian protein Grb2, which binds the autophosphorylated EGF receptor and other phosphotyrosine-containing proteins such as Shc through its SH2 domain. Here we show that in rodent fibroblasts, the SH3 domains of Grb2 are bound to the proline-rich carboxy-terminal tail of mSos1, a protein homologous to Drosophila Sos. Sos is required for Ras signalling and contains a central domain related to known Ras-GNRPs. EGF stimulation induces binding of the Grb2-mSos1 complex to the autophosphorylated EGF receptor, and mSos1 phosphorylation. Grb2 therefore appears to link tyrosine kinases to a Ras-GNRP in mammalian cells.

  10. Interaction with the Src homology (SH3-SH2) region of the Src-family kinase Hck structures the HIV-1 Nef dimer for kinase activation and effector recruitment.

    Science.gov (United States)

    Alvarado, John Jeff; Tarafdar, Sreya; Yeh, Joanne I; Smithgall, Thomas E

    2014-10-10

    HIV-1 Nef supports high titer viral replication in vivo and is essential for AIDS progression. Nef function depends on interactions with multiple host cell effectors, including Hck and other Src-family kinases. Here we describe the x-ray crystal structure of Nef in complex with the Hck SH3-SH2 regulatory region to a resolution of 1.86 Å. The complex crystallized as a dimer of complexes, with the conserved Nef PXXPXR motif engaging the Hck SH3 domain. A new intercomplex contact was found between SH3 Glu-93, and Nef Arg-105. Mutagenesis of Hck SH3 Glu-93 interfered with Nef·Hck complex formation and kinase activation in cells. The Hck SH2 domains impinge on the N-terminal region of Nef to stabilize a dimer conformation that exposes Asp-123, a residue critical for Nef function. Our results suggest that in addition to serving as a kinase effector for Nef, Hck binding may reorganize the Nef dimer for functional interaction with other signaling partners. © 2014 by The American Society for Biochemistry and Molecular Biology, Inc.

  11. Interaction with the Src Homology (SH3-SH2) Region of the Src-family Kinase Hck Structures the HIV-1 Nef Dimer for Kinase Activation and Effector Recruitment*

    Science.gov (United States)

    Alvarado, John Jeff; Tarafdar, Sreya; Yeh, Joanne I.; Smithgall, Thomas E.

    2014-01-01

    HIV-1 Nef supports high titer viral replication in vivo and is essential for AIDS progression. Nef function depends on interactions with multiple host cell effectors, including Hck and other Src-family kinases. Here we describe the x-ray crystal structure of Nef in complex with the Hck SH3-SH2 regulatory region to a resolution of 1.86 Å. The complex crystallized as a dimer of complexes, with the conserved Nef PXXPXR motif engaging the Hck SH3 domain. A new intercomplex contact was found between SH3 Glu-93, and Nef Arg-105. Mutagenesis of Hck SH3 Glu-93 interfered with Nef·Hck complex formation and kinase activation in cells. The Hck SH2 domains impinge on the N-terminal region of Nef to stabilize a dimer conformation that exposes Asp-123, a residue critical for Nef function. Our results suggest that in addition to serving as a kinase effector for Nef, Hck binding may reorganize the Nef dimer for functional interaction with other signaling partners. PMID:25122770

  12. Biochemical and genetic analysis of the Drk SH2/SH3 adaptor protein of Drosophila.

    OpenAIRE

    Raabe, T; Olivier, J P; Dickson, B J; Liu, X; Gish, G D; Pawson, T; Hafen, E

    1995-01-01

    The Drk SH3-SH2-SH3 adaptor protein has been genetically identified in a screen for rate-limiting components acting downstream of the Sevenless (Sev) receptor tyrosine kinase in the developing eye of Drosophila. It provides a link between the activated Sev receptor and Sos, a guanine nucleotide release factor that activates Ras1. We have used a combined biochemical and genetic approach to study the interactions between Sev, Drk and Sos. We show that Tyr2546 in the cytoplasmic tail of Sev is r...

  13. SH2 and SH3 domains: elements that control interactions of cytoplasmic signaling proteins.

    Science.gov (United States)

    Koch, C A; Anderson, D; Moran, M F; Ellis, C; Pawson, T

    1991-05-03

    Src homology (SH) regions 2 and 3 are noncatalytic domains that are conserved among a series of cytoplasmic signaling proteins regulated by receptor protein-tyrosine kinases, including phospholipase C-gamma, Ras GTPase (guanosine triphosphatase)-activating protein, and Src-like tyrosine kinases. The SH2 domains of these signaling proteins bind tyrosine phosphorylated polypeptides, implicated in normal signaling and cellular transformation. Tyrosine phosphorylation acts as a switch to induce the binding of SH2 domains, thereby mediating the formation of heteromeric protein complexes at or near the plasma membrane. The formation of these complexes is likely to control the activation of signal transduction pathways by tyrosine kinases. The SH3 domain is a distinct motif that, together with SH2, may modulate interactions with the cytoskeleton and membrane. Some signaling and transforming proteins contain SH2 and SH3 domains unattached to any known catalytic element. These noncatalytic proteins may serve as adaptors to link tyrosine kinases to specific target proteins. These observations suggest that SH2 and SH3 domains participate in the control of intracellular responses to growth factor stimulation.

  14. Presenilin-1 mutations alter K+ currents in the human neuroblastoma cell line, SH-SY5Y

    DEFF Research Database (Denmark)

    Plant, Leigh D; Boyle, John P; Thomas, Natasha M

    2002-01-01

    Mutations in presenilin 1 (PS1) are the major cause of autosomal dominant Alzheimer's disease. We have measured the voltage-gated K+ current in the human neuroblastoma cell line SH-SY5Y using whole-cell patch-clamp. When cells were stably transfected to over-express PS1, no change in K+ current...

  15. SH2/SH3 adaptor proteins can link tyrosine kinases to a Ste20-related protein kinase, HPK1.

    Science.gov (United States)

    Anafi, M; Kiefer, F; Gish, G D; Mbamalu, G; Iscove, N N; Pawson, T

    1997-10-31

    Ste20-related protein kinases have been implicated as regulating a range of cellular responses, including stress-activated protein kinase pathways and the control of cytoskeletal architecture. An important issue involves the identities of the upstream signals and regulators that might control the biological functions of mammalian Ste20-related protein kinases. HPK1 is a protein-serine/threonine kinase that possesses a Ste20-like kinase domain, and in transfected cells activates a protein kinase pathway leading to the stress-activated protein kinase SAPK/JNK. Here we have investigated candidate upstream regulators that might interact with HPK1. HPK1 possesses an N-terminal catalytic domain and an extended C-terminal tail with four proline-rich motifs. The SH3 domains of Grb2 bound in vitro to specific proline-rich motifs in the HPK1 tail and functioned synergistically to direct the stable binding of Grb2 to HPK1 in transfected Cos1 cells. Epidermal growth factor (EGF) stimulation did not affect the binding of Grb2 to HPK1 but induced recruitment of the Grb2.HPK1 complex to the autophosphorylated EGF receptor and to the Shc docking protein. Several activated receptor and cytoplasmic tyrosine kinases, including the EGF receptor, stimulated the tyrosine phosphorylation of the HPK1 serine/threonine kinase. These results suggest that HPK1, a mammalian Ste20-related protein-serine/threonine kinase, can potentially associate with protein-tyrosine kinases through interactions mediated by SH2/SH3 adaptors such as Grb2. Such interaction may provide a possible mechanism for cross-talk between distinct biochemical pathways following the activation of tyrosine kinases.

  16. SH2-B promotes insulin receptor substrate 1 (IRS1)- and IRS2-mediated activation of the phosphatidylinositol 3-kinase pathway in response to leptin.

    Science.gov (United States)

    Duan, Chaojun; Li, Minghua; Rui, Liangyou

    2004-10-15

    Leptin regulates energy homeostasis primarily by binding and activating its long form receptor (LRb). Deficiency of either leptin or LRb causes morbid obesity. Leptin stimulates LRb-associated JAK2, thus initiating multiple pathways including the Stat3 and phosphatidylinositol (PI) 3-kinase pathways that mediate leptin biological actions. Here we report that SH2-B, a JAK2-interacting protein, promotes activation of the PI 3-kinase pathway by recruiting insulin receptor substrate 1 (IRS1) and IRS2 in response to leptin. SH2-B directly bound, via its PH and SH2 domain, to both IRS1 and IRS2 both in vitro and in intact cells and mediated formation of a JAK2/SH2-B/IRS1 or IRS2 tertiary complex. Consequently, SH2-B dramatically enhanced leptin-stimulated tyrosine phosphorylation of IRS1 and IRS2 in HEK293 cells stably expressing LRb, thus promoting association of IRS1 and IRS2 with the p85 regulatory subunit of PI 3-kinase and phosphorylation and activation of Akt. SH2-B mutants with lower affinity for IRS1 and IRS2 exhibited reduced ability to promote association of JAK2 with IRS1, tyrosine phosphorylation of IRS1, and association of IRS1 with p85 in response to leptin. Moreover, deletion of the SH2-B gene impaired leptin-stimulated tyrosine phosphorylation of endogenous IRS1 in mouse embryonic fibroblasts (MEF), which was reversed by reintroduction of SH2-B. Similarly, SH2-B promoted growth hormone-stimulated tyrosine phosphorylation of IRS1 in both HEK293 and MEF cells. Our data suggest that SH2-B is a novel mediator of the PI 3-kinase pathway in response to leptin or other hormones and cytokines that activate JAK2.

  17. The Abl SH2-kinase linker naturally adopts a conformation competent for SH3 domain binding.

    Science.gov (United States)

    Chen, Shugui; Brier, Sébastien; Smithgall, Thomas E; Engen, John R

    2007-04-01

    The core of the Abelson tyrosine kinase (c-Abl) is structurally similar to Src-family kinases where SH3 and SH2 domains pack against the backside of the kinase domain in the down-regulated conformation. Both kinase families depend upon intramolecular association of SH3 with the linker joining the SH2 and kinase domains for suppression of kinase activity. Hydrogen deuterium exchange (HX) and mass spectrometry (MS) were used to probe intramolecular interaction of the c-Abl SH3 domain with the linker in recombinant constructs lacking the kinase domain. Under physiological conditions, the c-Abl SH3 domain undergoes partial unfolding, which is stabilized by ligand binding, providing a unique assay for SH3:linker interaction in solution. Using this approach, we observed dynamic association of the SH3 domain with the linker in the absence of the kinase domain. Truncation of the linker before W254 completely prevented cis-interaction with SH3, while constructs containing amino acids past this point showed SH3:linker interactions. The observation that the Abl linker sequence exhibits SH3-binding activity in the absence of the kinase domain is unique to Abl and was not observed with Src-family kinases. These results suggest that SH3:linker interactions may have a more prominent role in Abl regulation than in Src kinases, where the down-regulated conformation is further stabilized by a second intramolecular interaction between the C-terminal tail and the SH2 domain.

  18. Critical role of the Src homology 2 (SH2) domain of neuronal SH2B1 in the regulation of body weight and glucose homeostasis in mice.

    Science.gov (United States)

    Morris, David L; Cho, Kae Won; Rui, Liangyou

    2010-08-01

    SH2B1 is an SH2 domain-containing adaptor protein that plays a key role in the regulation of energy and glucose metabolism in both rodents and humans. Genetic deletion of SH2B1 in mice results in obesity and type 2 diabetes. Single-nucleotide polymorphisms in the SH2B1 loci and chromosomal deletions of the SH2B1 loci associate with obesity and insulin resistance in humans. In cultured cells, SH2B1 promotes leptin and insulin signaling by binding via its SH2 domain to phosphorylated tyrosines in Janus kinase 2 and the insulin receptor, respectively. Here we generated three lines of mice to analyze the role of the SH2 domain of SH2B1 in the central nervous system. Transgenic mice expressing wild-type, SH2 domain-defective (R555E), or SH2 domain-alone (DeltaN503) forms of SH2B1 specifically in neurons were crossed with SH2B1 knockout mice to generate KO/SH2B1, KO/R555E, or KO/DeltaN503 compound mutant mice. R555E had a replacement of Arg(555) with Glu within the SH2 domain. DeltaN503 contained an intact SH2 domain but lacked amino acids 1-503. Neuron-specific expression of recombinant SH2B1, but not R555E or DeltaN503, corrected hyperphagia, obesity, glucose intolerance, and insulin resistance in SH2B1 null mice. Neuron-specific expression of R555E in wild-type mice promoted obesity and insulin resistance. These results indicate that in addition to the SH2 domain, N-terminal regions of neuronal SH2B1 are also required for the maintenance of normal body weight and glucose metabolism. Additionally, mutations in the SH2 domain of SH2B1 may increase the susceptibility to obesity and type 2 diabetes in a dominant-negative manner.

  19. Identification of SH2B2β as an Inhibitor for SH2B1- and SH2B2α-Promoted Janus Kinase-2 Activation and Insulin Signaling

    OpenAIRE

    Li, Minghua; Li, Zhiqin; Morris, David L.; Rui, Liangyou

    2007-01-01

    The SH2B family has three members (SH2B1, SH2B2, and SH2B3) that contain conserved dimerization (DD), pleckstrin homology, and SH2 domains. The DD domain mediates the formation of homo- and heterodimers between members of the SH2B family. The SH2 domain of SH2B1 (previously named SH2-B) or SH2B2 (previously named APS) binds to phosphorylated tyrosines in a variety of tyrosine kinases, including Janus kinase-2 (JAK2) and the insulin receptor, thereby promoting the activation of JAK2 or the ins...

  20. Differentiated Human SH-SY5Y Cells Provide a Reductionist Model of Herpes Simplex Virus 1 Neurotropism.

    Science.gov (United States)

    Shipley, Mackenzie M; Mangold, Colleen A; Kuny, Chad V; Szpara, Moriah L

    2017-12-01

    Neuron-virus interactions that occur during herpes simplex virus (HSV) infection are not fully understood. Neurons are the site of lifelong latency and are a crucial target for long-term suppressive therapy or viral clearance. A reproducible neuronal model of human origin would facilitate studies of HSV and other neurotropic viruses. Current neuronal models in the herpesvirus field vary widely and have caveats, including incomplete differentiation, nonhuman origins, or the use of dividing cells that have neuropotential but lack neuronal morphology. In this study, we used a robust approach to differentiate human SH-SY5Y neuroblastoma cells over 2.5 weeks, producing a uniform population of mature human neuronal cells. We demonstrate that terminally differentiated SH-SY5Y cells have neuronal morphology and express proteins with subcellular localization indicative of mature neurons. These neuronal cells are able to support a productive HSV-1 infection, with kinetics and overall titers similar to those seen in undifferentiated SH-SY5Y cells and the related SK-N-SH cell line. However, terminally differentiated, neuronal SH-SY5Y cells release significantly less extracellular HSV-1 by 24 h postinfection (hpi), suggesting a unique neuronal response to viral infection. With this model, we are able to distinguish differences in neuronal spread between two strains of HSV-1. We also show expression of the antiviral protein cyclic GMP-AMP synthase (cGAS) in neuronal SH-SY5Y cells, which is the first demonstration of the presence of this protein in nonepithelial cells. These data provide a model for studying neuron-virus interactions at the single-cell level as well as via bulk biochemistry and will be advantageous for the study of neurotropic viruses in vitro IMPORTANCE Herpes simplex virus (HSV) affects millions of people worldwide, causing painful oral and genital lesions, in addition to a multitude of more severe symptoms such as eye disease, neonatal infection, and, in rare

  1. Drosophila photoreceptor axon guidance and targeting requires the dreadlocks SH2/SH3 adapter protein.

    Science.gov (United States)

    Garrity, P A; Rao, Y; Salecker, I; McGlade, J; Pawson, T; Zipursky, S L

    1996-05-31

    Mutations in the Drosophila gene dreadlocks (dock) disrupt photoreceptor cell (R cell) axon guidance and targeting. Genetic mosaic analysis and cell-type-specific expression of dock transgenes demonstrate dock is required in R cells for proper innervation. Dock protein contains one SH2 and three SH3 domains, implicating it in tyrosine kinase signaling, and is highly related to the human proto-oncogene Nck. Dock expression is detected in R cell growth cones in the target region. We propose Dock transmits signals in the growth cone in response to guidance and targeting cues. These findings provide an important step for dissection of signaling pathways regulating growth cone motility.

  2. Tyr721 regulates specific binding of the CSF-1 receptor kinase insert to PI 3'-kinase SH2 domains: a model for SH2-mediated receptor-target interactions.

    Science.gov (United States)

    Reedijk, M; Liu, X; van der Geer, P; Letwin, K; Waterfield, M D; Hunter, T; Pawson, T

    1992-01-01

    Efficient binding of active phosphatidylinositol (PI) 3'-kinase to the autophosphorylated macrophage colony stimulating factor receptor (CSF-1R) requires the noncatalytic kinase insert (KI) region of the receptor. To test whether this region could function independently to bind PI 3'-kinase, the isolated CSF-1R KI was expressed in Escherichia coli, and was inducibly phosphorylated on tyrosine. The tyrosine phosphorylated form of the CSF-1R KI bound PI 3'-kinase in vitro, whereas the unphosphorylated form had no binding activity. The p85 alpha subunit of PI 3'-kinase contains two Src homology (SH)2 domains, which are implicated in the interactions of signalling proteins with activated receptors. Bacterially expressed p85 alpha SH2 domains complexed in vitro with the tyrosine phosphorylated CSF-1R KI. Binding of the CSF-1R KI to PI 3'-kinase activity, and to the p85 alpha SH2 domains, required phosphorylation of Tyr721 within the KI domain, but was independent of phosphorylation at Tyr697 and Tyr706. Tyr721 was also critical for the association of activated CSF-1R with PI 3'-kinase in mammalian cells. Complex formation between the CSF-1R and PI 3'-kinase can therefore be reconstructed in vitro in a specific interaction involving the phosphorylated receptor KI and the SH2 domains of p85 alpha. Images PMID:1314163

  3. Atractylenolide-I Protects Human SH-SY5Y Cells from 1-Methyl-4-Phenylpyridinium-Induced Apoptotic Cell Death

    Directory of Open Access Journals (Sweden)

    Sandeep Vasant More

    2017-05-01

    Full Text Available Oxidative stress and apoptosis are the major mechanisms that induce dopaminergic cell death. Our study investigates the protective effects of atractylenolide-I (ATR-I on 1-methyl-4-phenylpyridinium (MPP+-induced cytotoxicity in human dopaminergic SH-SY5Y cells, as well as its underlying mechanism. Our experimental data indicates that ATR-I significantly inhibits the loss of cell viability induced by MPP+ in SH-SY5Y cells. To further unravel the mechanism, we examined the effect of ATR-I on MPP+-induced apoptotic cell death characterized by an increase in the Bax/Bcl-2 mRNA ratio, the release of cytochrome-c, and the activation of caspase-3 leading to elevated levels of cleaved poly(ADP-ribose polymerase (PARP resulting in SH-SY5Y cell death. Our results demonstrated that ATR-I decreases the level of pro-apoptotic proteins induced by MPP+ and also restored Bax/Bcl-2 mRNA levels, which are critical for inducing apoptosis. In addition, ATR-I demonstrated a significant increase in the protein expression of heme-oxygenase in MPP+-treated SH-SY5Y cells. These results suggest that the pharmacological effect of ATR-I may be, at least in part, caused by the reduction in pro-apoptotic signals and also by induction of anti-oxidant protein.

  4. Activation of PI3K/Akt signaling by n-terminal SH2 domain mutants of the p85α regulatory subunit of PI3K is enhanced by deletion of its c-terminal SH2 domain.

    Science.gov (United States)

    Hofmann, Bianca T; Jücker, Manfred

    2012-10-01

    The phosphoinositide 3-kinase (PI3K) is frequently activated in human cancer cells due to gain of function mutations in the catalytic (p110) and the regulatory (p85) subunits. The regulatory subunit consists of an SH3 domain and two SH2 domains. An oncogenic form of p85α named p65 lacking the c-terminal SH2 domain (cSH2) has been cloned from an irradiation-induced murine thymic lymphoma and transgenic mice expressing p65 in T lymphocytes develop a lymphoproliferative disorder. We have recently detected a c-terminal truncated form of p85α named p76α in a human lymphoma cell line lacking most of the cSH2 domain due to a frame shift mutation. Here, we report that the deletion of the cSH2 domain enhances the activating effects of the n-terminal SH2 domain (nSH2) mutants K379E and R340E on the PI3K/Akt pathway and micro tumor formation in a focus assay. Further analysis revealed that this transforming effect is mediated by activation of the catalytic PI3K isoform p110α and downstream signaling through mTOR. Our data further support a mechanistic model in which mutations of the cSH2 domain of p85α can abrogate its negative regulatory function on PI3K activity via the nSH2 domain of p85α. Copyright © 2012 Elsevier Inc. All rights reserved.

  5. Roles of the SH2 and SH3 domains in the regulation of neuronal Src kinase functions.

    Science.gov (United States)

    Groveman, Bradley R; Xue, Sheng; Marin, Vedrana; Xu, Jindong; Ali, Mohammad K; Bienkiewicz, Ewa A; Yu, Xian-Min

    2011-02-01

    Previous studies demonstrated that intra-domain interactions between Src family kinases (SFKs), stabilized by binding of the phosphorylated C-terminus to the SH2 domain and/or binding of the SH2 kinase linker to the SH3 domain, lock the molecules in a closed conformation, disrupt the kinase active site, and inactivate SFKs. Here we report that the up-regulation of N-methyl-D-aspartate receptors (NMDARs) induced by expression of constitutively active neuronal Src (n-Src), in which the C-terminus tyrosine is mutated to phenylalanine (n-Src/Y535F), is significantly reduced by dysfunctions of the SH2 and/or SH3 domains of the protein. Furthermore, we found that dysfunctions of SH2 and/or SH3 domains reduce auto-phosphorylation of the kinase activation loop, depress kinase activity, and decrease NMDAR phosphorylation. The SH2 domain plays a greater regulatory role than the SH3 domain. Our data also show that n-Src binds directly to the C-terminus of the NMDAR NR2A subunit in vitro, with a K(D) of 108.2 ± 13.3 nM. This binding is not Src kinase activity-dependent, and dysfunctions of the SH2 and/or SH3 domains do not significantly affect the binding. These data indicate that the SH2 and SH3 domains may function to promote the catalytic activity of active n-Src, which is important in the regulation of NMDAR functions. © 2010 The Authors Journal compilation © 2010 FEBS.

  6. Kinase activation through dimerization by human SH2-B.

    Science.gov (United States)

    Nishi, Masahiro; Werner, Eric D; Oh, Byung-Chul; Frantz, J Daniel; Dhe-Paganon, Sirano; Hansen, Lone; Lee, Jongsoon; Shoelson, Steven E

    2005-04-01

    The isoforms of SH2-B, APS, and Lnk form a family of signaling proteins that have been described as activators, mediators, or inhibitors of cytokine and growth factor signaling. We now show that the three alternatively spliced isoforms of human SH2-B readily homodimerize in yeast two-hybrid and cellular transfections assays, and this is mediated specifically by a unique domain in its amino terminus. Consistent with previous reports, we further show that the SH2 domains of SH2-B and APS bind JAK2 at Tyr813. These findings suggested a model in which two molecules of SH2-B or APS homodimerize with their SH2 domains bound to two JAK2 molecules, creating heterotetrameric JAK2-(SH2-B)2-JAK2 or JAK2-(APS)2-JAK2 complexes. We further show that APS and SH2-B isoforms heterodimerize. At lower levels of SH2-B or APS expression, dimerization approximates two JAK2 molecules to induce transactivation. At higher relative concentrations of SH2-B or APS, kinase activation is blocked. SH2-B or APS homodimerization and SH2-B/APS heterodimerization thus provide direct mechanisms for activating and inhibiting JAK2 and other kinases from the inside of the cell and for potentiating or attenuating cytokine and growth factor receptor signaling when ligands are present.

  7. Novel high-throughput screening system for identifying STAT3-SH2 antagonists

    International Nuclear Information System (INIS)

    Uehara, Yutaka; Mochizuki, Masato; Matsuno, Kenji; Haino, Takeharu; Asai, Akira

    2009-01-01

    Constitutive activation of the oncogenic transcription factor STAT3 frequently occurs in various human malignancies. STAT3 activation involves dimerization via intermolecular pTyr-SH2 interaction. Thus, antagonizing this interaction is a feasible approach to inhibit STAT3 activation for cancer therapy. In order to identify selective STAT3 inhibitors, we developed a biochemical HTS system based on AlphaScreen technology, which measures the abilities of test compounds to antagonize pTyr-SH2 interactions. We screened our chemical libraries using this system and identified 5,15-diphenylporphyrin (5,15-DPP) as a selective STAT3-SH2 antagonist. Selective inhibition of STAT3 nuclear translocation and DNA biding activity was observed in cells treated with 5,15-DPP. IL-6-dependent dimerization of STAT3, c-myc promoter binding and c-myc protein expression were all suppressed by 5,15-DPP, whereas no decrement in either expression or phosphorylation level of STAT3 was observed. Thus, the HTS assay system represented herein may be useful for identifying novel STAT3-SH2 antagonists.

  8. SH2B1 regulation of energy balance, body weight, and glucose metabolism

    OpenAIRE

    Rui, Liangyou

    2014-01-01

    The Src homology 2B (SH2B) family members (SH2B1, SH2B2 and SH2B3) are adaptor signaling proteins containing characteristic SH2 and PH domains. SH2B1 (also called SH2-B and PSM) and SH2B2 (also called APS) are able to form homo- or hetero-dimers via their N-terminal dimerization domains. Their C-terminal SH2 domains bind to tyrosyl phosphorylated proteins, including Janus kinase 2 (JAK2), TrkA, insulin receptors, insulin-like growth factor-1 receptors, insulin receptor substrate-1 (IRS1), and...

  9. Genetic loss of SH2B3 in acute lymphoblastic leukemia.

    Science.gov (United States)

    Perez-Garcia, Arianne; Ambesi-Impiombato, Alberto; Hadler, Michael; Rigo, Isaura; LeDuc, Charles A; Kelly, Kara; Jalas, Chaim; Paietta, Elisabeth; Racevskis, Janis; Rowe, Jacob M; Tallman, Martin S; Paganin, Maddalena; Basso, Giuseppe; Tong, Wei; Chung, Wendy K; Ferrando, Adolfo A

    2013-10-03

    The SH2B adaptor protein 3 (SH2B3) gene encodes a negative regulator of cytokine signaling with a critical role in the homeostasis of hematopoietic stem cells and lymphoid progenitors. Here, we report the identification of germline homozygous SH2B3 mutations in 2 siblings affected with developmental delay and autoimmunity, one in whom B-precursor acute lymphoblastic leukemia (ALL) developed. Mechanistically, loss of SH2B3 increases Janus kinase-signal transducer and activator of transcription signaling, promotes lymphoid cell proliferation, and accelerates leukemia development in a mouse model of NOTCH1-induced ALL. Moreover, extended mutation analysis showed homozygous somatic mutations in SH2B3 in 2 of 167 ALLs analyzed. Overall, these results demonstrate a Knudson tumor suppressor role for SH2B3 in the pathogenesis of ALL and highlight a possible link between genetic predisposition factors in the pathogenesis of autoimmunity and leukemogenesis.

  10. Bee venom protects SH-SY5Y human neuroblastoma cells from 1-methyl-4-phenylpyridinium-induced apoptotic cell death.

    Science.gov (United States)

    Doo, Ah-Reum; Kim, Seung-Nam; Kim, Seung-Tae; Park, Ji-Yeun; Chung, Sung-Hyun; Choe, Bo-Young; Chae, Younbyoung; Lee, Hyejung; Yin, Chang-Shik; Park, Hi-Joon

    2012-01-06

    Parkinson's disease (PD) is a progressive neurodegenerative disorder characterized by progressive selective loss of dopaminergic neurons in the substantia nigra. Recently, bee venom was reported to protect dopaminergic neurons in the 1-methyl-4-phenyl-1,2,3,6-tetrahydropyridine induced mice PD model, however, the underlying mechanism is not fully understood. The objective of the present study is to investigate the neuroprotective mechanism of bee venom against Parkinsonian toxin, 1-methyl-4-phenylpyridine (MPP(+)), in SH-SY5Y human neuroblastoma cells. Our results revealed that bee venom pretreatment (1-100 ng/ml) increased the cell viability and decreased apoptosis assessed by DNA fragmentation and caspase-3 activity assays in MPP(+)-induced cytotoxicity in SH-SY5Y cells. Bee venom increased the anti-apoptotic Bcl-2 expression and decreased the pro-apoptotic Bax, cleaved PARP expressions. In addition, bee venom prevented the MPP(+)-induced suppression of Akt phosphorylation, and the neuroprotective effect of bee venom against MPP(+)-induced cytotoxicity was inhibited by a phosphatidylinositol 3-kinase (PI3K) inhibitor, LY294002. These results suggest that the anti-apoptotic effect of bee venom is mediated by the cell survival signaling, the PI3K/Akt pathway. These results provide new evidence for elucidating the mechanism of neuroprotection of bee venom against PD. Copyright © 2011 Elsevier B.V. All rights reserved.

  11. Lentiviral transgenic microRNA-based shRNA suppressed mouse cytochromosome P450 3A (CYP3A expression in a dose-dependent and inheritable manner.

    Directory of Open Access Journals (Sweden)

    Yong Wang

    Full Text Available Cytochomosome P450 enzymes (CYP are heme-containing monooxygenases responsible for oxidative metabolism of many exogenous and endogenous compounds including drugs. The species difference of CYP limits the extent to which data obtained from animals can be translated to humans in pharmacodynamics or pharmacokinetics studies. Transgenic expression of human CYP in animals lacking or with largely reduced endogenous CYP counterparts is recognized as an ideal strategy to correct CYP species difference. CYP3A is the most abundant CYP subfamily both in human and mammals. In this study, we designed a microRNA-based shRNA (miR-shRNA simultaneously targeting four members of mouse CYP3A subfamily (CYP3A11, CYP3A16, CYP3A41 and CYP3A44, and transgenic mice expressing the designed miR-shRNA were generated by lentiviral transgenesis. Results showed that the CYP3A expression level in transgenic mice was markedly reduced compared to that in wild type or unrelated miR-shRNA transgenic mice, and was inversely correlated to the miR-shRNA expression level. The CYP3A expression levels in transgenic offspring of different generations were also remarkably lower compared to those of controls, and moreover the inhibition rate of CYP3A expression remained comparable over generations. The ratio of the targeted CYP3A transcriptional levels was comparable between knockdown and control mice of the same gender as detected by RT-PCR DGGE analysis. These data suggested that transgenic miR-shRNA suppressed CYP3A expression in a dose-dependent and inheritable manner, and transcriptional levels of the targeted CYP3As were suppressed to a similar extent. The observed knockdown efficacy was further confirmed by enzymatic activity analysis, and data showed that CYP3A activities in transgenic mice were markedly reduced compared to those in wild-type or unrelated miR-shRNA transgenic controls (1.11±0.71 vs 5.85±1.74, 5.9±2.4; P<0.01. This work laid down a foundation to further knock

  12. CARMA2sh and ULK2 control pathogen-associated molecular patterns recognition in human keratinocytes: psoriasis-linked CARMA2sh mutants escape ULK2 censorship.

    Science.gov (United States)

    Scudiero, Ivan; Mazzone, Pellegrino; D'Andrea, Luca E; Ferravante, Angela; Zotti, Tiziana; Telesio, Gianluca; De Rubis, Gabriele; Reale, Carla; Pizzulo, Maddalena; Muralitharan, Shanmugakonar; Vito, Pasquale; Stilo, Romania

    2017-02-23

    The molecular complexes formed by specific members of the family of CARMA proteins, the CARD domain-containing adapter molecule BCL10 and MALT1 (CBM complex) represent a central hub in regulating activation of the pleiotropic transcription factor NF-κB. Recently, missense mutations in CARMA2sh have been shown to cause psoriasis in a dominant manner and with high penetrancy. Here, we demonstrate that in human keratinocytes CARMA2sh plays an essential role in the signal transduction pathway that connects pathogen-associated molecular patterns recognition to NF-κB activation. We also find that the serine/threonine kinase ULK2 binds to and phosphorylates CARMA2sh, thereby inhibiting its capacity to activate NF-κB by promoting lysosomal degradation of BCL10, which is essential for CARMA2sh-mediated NF-κB signaling. Remarkably, CARMA2sh mutants associated with psoriasis escape ULK2 inhibition. Finally, we show that a peptide blocking CARD-mediated BCL10 interactions reduces the capacity of psoriasis-linked CARMA2sh mutants to activate NF-κB. Our work elucidates a fundamental signaling mechanism operating in human keratinocytes and opens to novel potential tools for the therapeutical treatment of human skin disorders.

  13. Protective Effects of Fisetin Against 6-OHDA-Induced Apoptosis by Activation of PI3K-Akt Signaling in Human Neuroblastoma SH-SY5Y Cells.

    Science.gov (United States)

    Watanabe, Ryoko; Kurose, Takumi; Morishige, Yuta; Fujimori, Ko

    2018-02-01

    6-Hydroxydopamine (6-OHDA) induces the production of reactive oxygen species (ROS) that are associated with various neurodegenerative diseases such as Parkinson's disease. 3,3',4',7-Tetrahydroxyflavone (fisetin), a plant flavonoid has a variety of physiological effects such as antioxidant activity. In this study, we investigated the molecular mechanism of the neuroprotective effects of fisetin against 6-OHDA-induced cell death in human neuroblastoma SH-SY5Y cells. 6-OHDA-mediated cell toxicity was reduced in a fisetin concentration-dependent manner. 6-OHDA-mediated elevation of the expression of the oxidative stress-related genes such as hemeoxygenase-1, NAD(P)H dehydrogenase quinone 1, NF-E2-related factor 2, and γ-glutamate-cysteine ligase modifier was suppressed by fisetin. Fisetin also lowered the ratio of the proapoptotic Bax protein and the antiapoptotic Bcl-2 protein in SH-SY5Y cells. Moreover, fisetin effectively suppressed 6-OHDA-mediated activation of caspase-3 and caspase-9, which leads to the cell death, while, 6-OHDA-induced caspase-3/7 activity was lowered. Furthermore, fisetin activated the PI3K-Akt signaling, which inhibits the caspase cascade, and fisetin-mediated inhibition of 6-OHDA-induced cell death was negated by the co-treatment with an Akt inhibitor. These results indicate that fisetin protects 6-OHDA-induced cell death by activating PI3K-Akt signaling in human neuronal SH-SY5Y cells. This is the first report that the PI3K-Akt signaling is involved in the fisetin-protected ROS-mediated neuronal cell death.

  14. Polar Desolvation and Position 226 of Pancreatic and Neutrophil Elastases Are Crucial to their Affinity for the Kunitz-Type Inhibitors ShPI-1 and ShPI-1/K13L.

    Science.gov (United States)

    Hernández González, Jorge Enrique; García-Fernández, Rossana; Valiente, Pedro Alberto

    2015-01-01

    The Kunitz-type protease inhibitor ShPI-1 inhibits human neutrophil elastase (HNE, Ki = 2.35·10-8 M) but does not interact with the porcine pancreatic elastase (PPE); whereas its P1 site variant, ShPI-1/K13L, inhibits both HNE and PPE (Ki = 1.3·10-9 M, and Ki = 1.2·10-8 M, respectively). By employing a combination of molecular modeling tools, e.g., structural alignment, molecular dynamics simulations and Molecular Mechanics Generalized-Born/Poisson-Boltzmann Surface Area free energy calculations, we showed that D226 of HNE plays a critical role in the interaction of this enzyme with ShPI-1 through the formation of a strong salt bridge and hydrogen bonds with K13 at the inhibitor's P1 site, which compensate the unfavorable polar-desolvation penalty of the latter residue. Conversely, T226 of PPE is unable to establish strong interactions with K13, thereby precluding the insertion of K13 side-chain into the S1 subsite of this enzyme. An alternative conformation of K13 site-chain placed at the entrance of the S1 subsite of PPE, similar to that observed in the crystal structure of ShPI-1 in complex with chymotrypsin (PDB: 3T62), is also unfavorable due to the lack of stabilizing pair-wise interactions. In addition, our results suggest that the higher affinity of ShPI-1/K13L for both elastases mainly arises from the lower polar-desolvation penalty of L13 compared to that of K13, and not from stronger pair-wise interactions of the former residue with those of each enzyme. These results provide insights into the PPE and HNE inhibition and may contribute to the design of more potent and/or specific inhibitors toward one of these proteases.

  15. Contributions of F-BAR and SH2 domains of Fes protein tyrosine kinase for coupling to the FcepsilonRI pathway in mast cells.

    Science.gov (United States)

    McPherson, Victor A; Everingham, Stephanie; Karisch, Robert; Smith, Julie A; Udell, Christian M; Zheng, Jimin; Jia, Zongchao; Craig, Andrew W B

    2009-01-01

    This study investigates the roles of Fer-CIP4 homology (FCH)-Bin/amphiphysin/Rvs (F-BAR) and SH2 domains of Fes protein tyrosine kinase in regulating its activation and signaling downstream of the high-affinity immunoglobulin G (IgE) receptor (FcepsilonRI) in mast cells. Homology modeling of the Fes F-BAR domain revealed conservation of some basic residues implicated in phosphoinositide binding (R113/K114). The Fes F-BAR can bind phosphoinositides and induce tubulation of liposomes in vitro. Mutation of R113/K114 to uncharged residues (RK/QQ) caused a significant reduction in phosphoinositide binding in vitro and a more diffuse cytoplasmic localization in transfected COS-7 cells. RBL-2H3 mast cells expressing full-length Fes carrying the RK/QQ mutation show defects in FcepsilonRI-induced Fes tyrosine phosphorylation and degranulation compared to cells expressing wild-type Fes. This correlated with reduced localization to Lyn kinase-containing membrane fractions for the RK/QQ mutant compared to wild-type Fes in mast cells. The Fes SH2 domain also contributes to Fes signaling in mast cells, via interactions with the phosphorylated FcepsilonRI beta chain and the actin regulatory protein HS1. We show that Fes phosphorylates C-terminal tyrosine residues in HS1 implicated in actin stabilization. Thus, coordinated actions of the F-BAR and SH2 domains of Fes allow for coupling to FcepsilonRI signaling and potential regulation the actin reorganization in mast cells.

  16. Crystal structure of Src-like adaptor protein 2 reveals close association of SH3 and SH2 domains through β-sheet formation.

    Science.gov (United States)

    Wybenga-Groot, Leanne E; McGlade, C Jane

    2013-12-01

    The Src-like adaptor proteins (SLAP/SLAP2) are key components of Cbl-dependent downregulation of antigen receptor, cytokine receptor, and receptor tyrosine kinase signaling in hematopoietic cells. SLAP and SLAP2 consist of adjacent SH3 and SH2 domains that are most similar in sequence to Src family kinases (SFKs). Notably, the SH3-SH2 connector sequence is significantly shorter in SLAP/SLAP2 than in SFKs. To understand the structural implication of a short SH3-SH2 connector sequence, we solved the crystal structure of a protein encompassing the SH3 domain, SH3-SH2 connector, and SH2 domain of SLAP2 (SLAP2-32). While both domains adopt typical folds, the short SH3-SH2 connector places them in close association. Strand βe of the SH3 domain interacts with strand βA of the SH2 domain, resulting in the formation of a continuous β sheet that spans the length of the protein. Disruption of the SH3/SH2 interface through mutagenesis decreases SLAP-32 stability in vitro, consistent with inter-domain binding being an important component of SLAP2 structure and function. The canonical peptide binding pockets of the SH3 and SH2 domains are fully accessible, in contrast to other protein structures that display direct interaction between SH3 and SH2 domains, in which either peptide binding surface is obstructed by the interaction. Our results reveal potential sites of novel interaction for SH3 and SH2 domains, and illustrate the adaptability of SH2 and SH3 domains in mediating interactions. As well, our results suggest that the SH3 and SH2 domains of SLAP2 function interdependently, with implications on their mode of substrate binding. © 2013.

  17. Effect of the SH3-SH2 domain linker sequence on the structure of Hck kinase.

    Science.gov (United States)

    Meiselbach, Heike; Sticht, Heinrich

    2011-08-01

    The coordination of activity in biological systems requires the existence of different signal transduction pathways that interact with one another and must be precisely regulated. The Src-family tyrosine kinases, which are found in many signaling pathways, differ in their physiological function despite their high overall structural similarity. In this context, the differences in the SH3-SH2 domain linkers might play a role for differential regulation, but the structural consequences of linker sequence remain poorly understood. We have therefore performed comparative molecular dynamics simulations of wildtype Hck and of a mutant Hck in which the SH3-SH2 domain linker is replaced by the corresponding sequence from the homologous kinase Lck. These simulations reveal that linker replacement not only affects the orientation of the SH3 domain itself, but also leads to an alternative conformation of the activation segment in the Hck kinase domain. The sequence of the SH3-SH2 domain linker thus exerts a remote effect on the active site geometry and might therefore play a role in modulating the structure of the inactive kinase or in fine-tuning the activation process itself.

  18. Abl N-terminal cap stabilization of SH3 domain dynamics.

    Science.gov (United States)

    Chen, Shugui; Dumitrescu, Teodora Pene; Smithgall, Thomas E; Engen, John R

    2008-05-27

    Crystal structures and other biochemical data indicate that the N-terminal cap (NCap) region of the Abelson tyrosine kinase (c-Abl) is important for maintaining the downregulated conformation of the kinase domain. The exact contributions that the NCap makes in stabilizing the various intramolecular interactions within c-Abl are less clear. While the NCap appears to be important for locking the SH3 and SH2 domains to the back of the kinase domain, there may be other more subtle elements of regulation. Hydrogen exchange (HX) and mass spectrometry (MS) were used to determine if the NCap contributes to intramolecular interactions involving the Abl SH3 domain. Under physiological conditions, the Abl SH3 domain underwent partial unfolding and its unfolding half-life was slowed during binding to the SH2 kinase linker, providing a unique assay for testing NCap-induced stabilization of the SH3 domain in various constructs. The results showed that the NCap stabilizes the dynamics of the SH3 domain in certain constructs but does not increase the relative affinity of the SH3 domain for the native SH2 kinase linker. The stabilization effect was absent in constructs of just the NCap and SH3 but was obvious when the SH2 domain and the SH2 kinase linker were present. These results suggest that interactions between the NCap and the SH3 domain can contribute to c-Abl stabilization in constructs that contain at least the SH2 domain, an effect that may partially compensate for the absence of the negative regulatory C-terminal tail found in the related Src family of kinases.

  19. The C-terminus SH3-binding domain of Kv1.3 is required for the actin-mediated immobilization of the channel via cortactin

    Science.gov (United States)

    Hajdu, Peter; Martin, Geoffrey V.; Chimote, Ameet A.; Szilagyi, Orsolya; Takimoto, Koichi; Conforti, Laura

    2015-01-01

    Kv1.3 channels play a pivotal role in the activation and migration of T-lymphocytes. These functions are accompanied by the channels' polarization, which is essential for associated downstream events. However, the mechanisms that govern the membrane movement of Kv1.3 channels remain unclear. F-actin polymerization occurs concomitantly to channel polarization, implicating the actin cytoskeleton in this process. Here we show that cortactin, a factor initiating the actin network, controls the membrane mobilization of Kv1.3 channels. FRAP with EGFP-tagged Kv1.3 channels demonstrates that knocking down cortactin decreases the actin-based immobilization of the channels. Using various deletion and mutation constructs, we show that the SH3 motif of Kv1.3 mediates the channel immobilization. Proximity ligation assays indicate that deletion or mutation of the SH3 motif also disrupts interaction of the channel with cortactin. In T-lymphocytes, the interaction between HS1 (the cortactin homologue) and Kv1.3 occurs at the immune synapse and requires the channel's C-terminal domain. These results show that actin dynamics regulates the membrane motility of Kv1.3 channels. They also provide evidence that the SH3 motif of the channel and cortactin plays key roles in this process. PMID:25739456

  20. Insights into the folding and unfolding processes of wild-type and mutated SH3 domain by molecular dynamics and replica exchange molecular dynamics simulations.

    Directory of Open Access Journals (Sweden)

    Wen-Ting Chu

    Full Text Available Src-homology regions 3 (SH3 domain is essential for the down-regulation of tyrosine kinase activity. Mutation A39V/N53P/V55L of SH3 is found to be relative to the urgent misfolding diseases. To gain insight, the human and gallus SH3 domains (PDB ID: 1NYG and 2LP5, including 58 amino acids in each protein, were selected for MD simulations (Amber11, ff99SB force field and cluster analysis to investigate the influence of mutations on the spatial structure of the SH3 domain. It is found that the large conformational change of mutations mainly exists in three areas in the vicinity of protein core: RT loop, N-src loop, distal β-hairpin to 310 helix. The C-terminus of the mutated gallus SH3 is disordered after simulation, which represents the intermediate state of aggregation. The disappeared strong Hbond net in the mutated human and gallus systems will make these mutated proteins looser than the wild-type proteins. Additionally, by performing the REMD simulations on the gallus SH3 domain, the mutated domain is found to have an obvious effect on the unfolding process. These studies will be helpful for further aggregation mechanisms investigations on SH3 family.

  1. Molecular dissection of the interaction between the SH3 domain and the SH2-Kinase Linker region in PTK6.

    Science.gov (United States)

    Kim, Han Ie; Jung, Jinwon; Lee, Eun-Saem; Kim, Yong-Chul; Lee, Weontae; Lee, Seung-Taek

    2007-11-03

    PTK6 (also known as Brk) is an intracellular tyrosine kinase that contains SH3, SH2, and tyrosine kinase catalytic (Kinase) domains. The SH3 domain of PTK6 interacts with the N-terminal half of the linker (Linker) region between the SH2 and Kinase domains. Site-directed mutagenesis and surface plasmon resonance studies showed that a tryptophan residue (Trp44) in the SH3 domain and proline residues in the Linker region, in the order of Pro177, Pro175, and Pro179, contribute to the interaction. The three-dimensional modeled structure of the SH3-Linker complex was in agreement with the biochemical data. Disruption of the intramolecular interaction between the SH3 domain and the Linker region by mutation of Trp44, Pro175, Pro177, and Pro179 markedly increased the catalytic activity of PTK6 in HEK 293 cells. These results demonstrate that Trp44 in the SH3 domain and Pro177, Pro175, and Pro179 in the N-terminal half of the Linker region play important roles in the SH3-Linker interaction to maintain the protein in an inactive conformation along with the phosphorylated Tyr447-SH2 interaction.

  2. H-alpha observations of Sh2-190, Sh2-222, Sh2-229, Sh2-236 HII regions

    Science.gov (United States)

    Sahan, Muhittin

    2018-02-01

    Hα spectral line (6563Å) profiles of four northern HII regions in the our galaxy (Sh2-190, Sh2-222, Sh2-229, Sh2-236) have been obtained using DEFPOS spectrometer, located at coude focus of 150 cm RTT150 telescope at TUBITAK National Observatory (TUG, Antalya, Turkey). Observations were carried out at nights of 2015 December 24-27 with long exposure times ranging from 900s to 3600s. The LSR velocities and the linewidths (Full Width Half Maximum: FWHM) of the Hα emission lines were found to be in the range of -45.46 kms-1 to +3.57 kms-1 and 38.50 kms-1 to 44.10 kms-1, respectively. The Sh2-229 HII region is the faintest one (211.16 R), while the Sh2-236 HII region (IC410) is brightest source (535.75 R). The LSR velocity and the line width (FWHM) results of the DEFPOS/RTT150 system were compared with the data by several authors given in literature and results of DEFPOS data were found to be in good agreement with data given in literature.

  3. Linker length dependent binding of a focal adhesion kinase derived peptide to the Src SH3-SH2 domains.

    Science.gov (United States)

    Lindfors, Hanna E; Venkata, Bharat Somireddy; Drijfhout, Jan W; Ubbink, Marcellus

    2011-02-18

    The interaction between a peptide encompassing the SH3 and SH2 binding motifs of focal adhesion kinase (FAK) and the Src SH3-SH2 domains has been investigated with NMR spectroscopy and calorimetry. The binding to both motifs is anti-cooperative. Reduction of the long linker connecting the motifs does not lead to cooperativity. Short linkers that do not allow simultaneous intramolecular binding of the peptide to both motifs cause peptide-mediated dimerisation, even with a linker of only three amino acids. The role of the SH3 binding motif is discussed in view of the independent nature of the SH interactions. Copyright © 2011 Federation of European Biochemical Societies. Published by Elsevier B.V. All rights reserved.

  4. Crystal Structure of a Complex of the Intracellular Domain of Interferon λ Receptor 1 (IFNLR1) and the FERM/SH2 Domains of Human JAK1.

    Science.gov (United States)

    Zhang, Di; Wlodawer, Alexander; Lubkowski, Jacek

    2016-11-20

    The crystal structure of a construct consisting of the FERM and SH2-like domains of the human Janus kinase 1 (JAK1) bound to a fragment of the intracellular domain of the interferon-λ receptor 1 (IFNLR1) has been determined at the nominal resolution of 2.1Å. In this structure, the receptor peptide forms an 85-Å-long extended chain, in which both the previously identified box1 and box2 regions bind simultaneously to the FERM and SH2-like domains of JAK1. Both domains of JAK1 are generally well ordered, with regions not seen in the crystal structure limited to loops located away from the receptor-binding regions. The structure provides a much more complete and accurate picture of the interactions between JAK1 and IFNLR1 than those given in earlier reports, illuminating the molecular basis of the JAK-cytokine receptor association. A glutamate residue adjacent to the box2 region in IFNLR1 mimics the mode of binding of a phosphotyrosine in classical SH2 domains. It was shown here that a deletion of residues within the box1 region of the receptor abolishes stable interactions with JAK1, although it was previously shown that box2 alone is sufficient to stabilize a similar complex of the interferon-α receptor and TYK2. Published by Elsevier Ltd.

  5. Preparation of Ginsenoside Rg3 and Protection against H2O2-Induced Oxidative Stress in Human Neuroblastoma SK-N-SH Cells

    Directory of Open Access Journals (Sweden)

    Gang Li

    2014-01-01

    Full Text Available The aim of this study is to evaluate the protection of ginsenoside Rg3 against oxidative stress in human neuroblastoma SK-N-SH cells. 20(R-ginsenoside Rg3 (20(R-Rg3 and 20(S-ginsenoside Rg3 (20(S-Rg3 were prepared by the method of chemical degradation and column chromatography, and the structure of the two compounds was characterized by 1H-NMR and 13C-NMR spectroscopy. MTT assay and LDH leakage assay were used to determine the cell viability and the oxidative stress cellular model was established by means of H2O2 (600 μM for 4 h. We also investigated the changes of intracellular MDA content, SOD activity, and ROS formation after the treatment of ginsenoside Rg3 for 20 h. The results indicated that both 20 (R-Rg3 and 20 (S-Rg3 had obvious protection against H2O2-induced oxidative stress in SK-N-SH cells. Moreover, 20(R-Rg3 exhibited better antioxidant activity than 20(S-Rg3 in vitro. These findings are expected to provide some implication for further research and application of ginsenoside Rg3 in neuroprotection.

  6. Expression of plasmid-based shRNA against the E1 and nsP1 genes effectively silenced Chikungunya virus replication.

    Directory of Open Access Journals (Sweden)

    Shirley Lam

    Full Text Available BACKGROUND: Chikungunya virus (CHIKV is a re-emerging alphavirus that causes chikungunya fever and persistent arthralgia in humans. Currently, there is no effective vaccine or antiviral against CHIKV infection. Therefore, this study evaluates whether RNA interference which targets at viral genomic level may be a novel antiviral strategy to inhibit the medically important CHIKV infection. METHODS: Plasmid-based small hairpin RNA (shRNA was investigated for its efficacy in inhibiting CHIKV replication. Three shRNAs designed against CHIKV Capsid, E1 and nsP1 genes were transfected to establish stable shRNA-expressing cell clones. Following infection of stable shRNA cells clones with CHIKV at M.O.I. 1, viral plaque assay, Western blotting and transmission electron microscopy were performed. The in vivo efficacy of shRNA against CHIKV replication was also evaluated in a suckling murine model of CHIKV infection. RESULTS: Cell clones expressing shRNAs against CHIKV E1 and nsP1 genes displayed significant inhibition of infectious CHIKV production, while shRNA Capsid demonstrated a modest inhibitory effect as compared to scrambled shRNA cell clones and non-transfected cell controls. Western blot analysis of CHIKV E2 protein expression and transmission electron microscopy of shRNA E1 and nsP1 cell clones collectively demonstrated similar inhibitory trends against CHIKV replication. shRNA E1 showed non cell-type specific anti-CHIKV effects and broad-spectrum silencing against different geographical strains of CHIKV. Furthermore, shRNA E1 clones did not exert any inhibition against Dengue virus and Sindbis virus replication, thus indicating the high specificity of shRNA against CHIKV replication. Moreover, no shRNA-resistant CHIKV mutant was generated after 50 passages of CHIKV in the stable cell clones. More importantly, strong and sustained anti-CHIKV protection was conferred in suckling mice pre-treated with shRNA E1. CONCLUSION: Taken together, these

  7. Interaction between human BAP31 and respiratory syncytial virus small hydrophobic (SH) protein

    International Nuclear Information System (INIS)

    Li, Yan; Jain, Neeraj; Limpanawat, Suweeraya; To, Janet; Quistgaard, Esben M.; Nordlund, Par; Thanabalu, Thirumaran; Torres, Jaume

    2015-01-01

    The small hydrophobic (SH) protein is a short channel-forming polypeptide encoded by the human respiratory syncytial virus (hRSV). Deletion of SH protein leads to the viral attenuation in mice and primates, and delayed apoptosis in infected cells. We have used a membrane-based yeast two-hybrid system (MbY2H) and a library from human lung cDNA to detect proteins that bind SH protein. This led to the identification of a membrane protein, B-cell associated protein 31 (BAP31). Transfected SH protein co-localizes with transfected BAP31 in cells, and pulls down endogenous BAP31. Titration of purified C-terminal endodomain of BAP31 against isotopically labeled SH protein in detergent micelles suggests direct interaction between the two proteins. Given the key role of BAP31 in protein trafficking and its critical involvement in pro- and anti-apoptotic pathways, this novel interaction may constitute a potential drug target. - Highlights: • A yeast two-hybrid system (MbY2H) detected BAP31 as a binder of RSV SH protein. • Transfected SH and BAP31 co-localize in lung epithelial cells. • Endogenous BAP31 is pulled down by RSV SH protein. • BAP31 endodomain interacts with the N-terminal α-helix of SH protein in micelles. • This interaction is proposed to be a potential drug target

  8. Interaction between human BAP31 and respiratory syncytial virus small hydrophobic (SH) protein

    Energy Technology Data Exchange (ETDEWEB)

    Li, Yan; Jain, Neeraj; Limpanawat, Suweeraya; To, Janet [School of Biological Sciences, Nanyang Technological University, 637551 (Singapore); Quistgaard, Esben M. [Department of Medical Biochemistry and Biophysics, Karolinska Institutet, Stockholm (Sweden); Nordlund, Par [School of Biological Sciences, Nanyang Technological University, 637551 (Singapore); Department of Medical Biochemistry and Biophysics, Karolinska Institutet, Stockholm (Sweden); Thanabalu, Thirumaran [School of Biological Sciences, Nanyang Technological University, 637551 (Singapore); Torres, Jaume, E-mail: jtorres@ntu.edu.sg [School of Biological Sciences, Nanyang Technological University, 637551 (Singapore)

    2015-08-15

    The small hydrophobic (SH) protein is a short channel-forming polypeptide encoded by the human respiratory syncytial virus (hRSV). Deletion of SH protein leads to the viral attenuation in mice and primates, and delayed apoptosis in infected cells. We have used a membrane-based yeast two-hybrid system (MbY2H) and a library from human lung cDNA to detect proteins that bind SH protein. This led to the identification of a membrane protein, B-cell associated protein 31 (BAP31). Transfected SH protein co-localizes with transfected BAP31 in cells, and pulls down endogenous BAP31. Titration of purified C-terminal endodomain of BAP31 against isotopically labeled SH protein in detergent micelles suggests direct interaction between the two proteins. Given the key role of BAP31 in protein trafficking and its critical involvement in pro- and anti-apoptotic pathways, this novel interaction may constitute a potential drug target. - Highlights: • A yeast two-hybrid system (MbY2H) detected BAP31 as a binder of RSV SH protein. • Transfected SH and BAP31 co-localize in lung epithelial cells. • Endogenous BAP31 is pulled down by RSV SH protein. • BAP31 endodomain interacts with the N-terminal α-helix of SH protein in micelles. • This interaction is proposed to be a potential drug target.

  9. Production and characterization of soluble human TNFRI-Fc and human HO-1(HMOX1) transgenic pigs by using the F2A peptide.

    Science.gov (United States)

    Park, Sol Ji; Cho, Bumrae; Koo, Ok Jae; Kim, Hwajung; Kang, Jung Taek; Hurh, Sunghoon; Kim, Su Jin; Yeom, Hye Jung; Moon, Joonho; Lee, Eun Mi; Choi, Ji Yei; Hong, Ju Ho; Jang, Goo; Hwang, Joing-Ik; Yang, Jaeseok; Lee, Byeong Chun; Ahn, Curie

    2014-06-01

    Generation of transgenic pigs for xenotransplantation is one of the most promising technologies for resolving organ shortages. Human heme oxygenase-1 (hHO-1/HMOX1) can protect transplanted organs by its strong anti-oxidative, anti-apoptotic, and anti-inflammatory effects. Soluble human TNFRI-Fc (shTNFRI-Fc) can inhibit the binding of human TNF-α (hTNF-α) to TNF receptors on porcine cells, and thereby, prevent hTNF-α-mediated inflammation and apoptosis. Herein, we successfully generated shTNFRI-Fc-F2A-HA-hHO-1 transgenic (TG) pigs expressing both shTNFRI-Fc and hemagglutinin-tagged-human heme oxygenase-1 (HA-hHO-1) by using an F2A self-cleaving peptide. shTNFRI-Fc and HA-hHO-1 transgenes containing the F2A peptide were constructed under the control of the CAG promoter. Transgene insertion and copy number in the genome of transgenic pigs was confirmed by polymerase chain reaction (PCR) and Southern blot analysis. Expressions of shTNFRI-Fc and HA-hHO-1 in TG pigs were confirmed using PCR, RT-PCR, western blot, ELISA, and immunohistochemistry. shTNFRI-Fc and HA-hHO-1 were expressed in various organs, including the heart, lung, and spleen. ELISA assays detected shTNFRI-Fc in the sera of TG pigs. For functional analysis, fibroblasts isolated from a shTNFRI-Fc-F2A-HA-hHO-1 TG pig (i.e., #14; 1 × 10(5) cells) were cultured with hTNF-α (20 ng/mL) and cycloheximide (10 μg/mL). The viability of shTNFRI-Fc-F2A-HA-hHO-1 TG pig fibroblasts was significantly higher than that of the wild type (wild type vs. shTNFRI-Fc-F2A-HA-hHO-1 TG at 24 h, 31.6 ± 3.2 vs. 60.4 ± 8.3 %, respectively; p hHO-1 TG pig fibroblasts was lower than that of the wild type pig fibroblasts (wild type vs. shTNFRI-Fc-F2A-HA-hHO-1 TG at 12 h, 812,452 ± 113,078 RLU vs. 88,240 ± 10,438 RLU, respectively; p hHO-1 TG pigs generated by the F2A self-cleaving peptide express both shTNFRI-Fc and HA-hHO-1 molecules, which provides protection against oxidative and inflammatory injury

  10. Curcumin Protects -SH Groups and Sulphate Transport after Oxidative Damage in Human Erythrocytes

    Directory of Open Access Journals (Sweden)

    Rossana Morabito

    2015-05-01

    Full Text Available Background/Aims: Erythrocytes, continuously exposed to oxygen pressure and toxic compounds, are sensitive to oxidative stress, namely acting on integral Band 3 protein, with consequences on cell membranes deformability and anion transport efficiency. The aim of the present investigation, conducted on human erythrocytes, is to verify whether curcumin (1 or 10µM, a natural compound with proved antioxidant properties, may counteract Band 3-mediated anion transport alterations due to oxidative stress. Methods: Oxidative conditions were induced by exposure to, alternatively, either 2 mM N-ethylmaleimide (NEM or pH-modified solutions (6.5 and 8.5. Rate constant for SO4= uptake and -SH groups estimation were measured to verify the effect of oxidative stress on anion transport efficiency and erythrocyte membranes. Results: After the exposure of erythrocytes to, alternatively, NEM or pH-modified solutions, a significant decrease in both rate constant for SO4= uptake and -SH groups was observed, which was prevented by curcumin, with a dose-dependent effect. Conclusions: Our results show that: i the decreased efficiency of anion transport may be due to changes in Band 3 protein structure caused by cysteine -SH groups oxidation, especially after exposure to NEM and pH 6.5; ii 10 µM Curcumin is effective in protecting erythrocytes from oxidative stress events at level of cell membrane transport.

  11. Two-state dynamics of the SH3-SH2 tandem of Abl kinase and the allosteric role of the N-cap.

    Science.gov (United States)

    Corbi-Verge, Carles; Marinelli, Fabrizio; Zafra-Ruano, Ana; Ruiz-Sanz, Javier; Luque, Irene; Faraldo-Gómez, José D

    2013-09-03

    The regulation and localization of signaling enzymes is often mediated by accessory modular domains, which frequently function in tandems. The ability of these tandems to adopt multiple conformations is as important for proper regulation as the individual domain specificity. A paradigmatic example is Abl, a ubiquitous tyrosine kinase of significant pharmacological interest. SH3 and SH2 domains inhibit Abl by assembling onto the catalytic domain, allosterically clamping it in an inactive state. We investigate the dynamics of this SH3-SH2 tandem, using microsecond all-atom simulations and differential scanning calorimetry. Our results indicate that the Abl tandem is a two-state switch, alternating between the conformation observed in the structure of the autoinhibited enzyme and another configuration that is consistent with existing scattering data for an activated form. Intriguingly, we find that the latter is the most probable when the tandem is disengaged from the catalytic domain. Nevertheless, an amino acid stretch preceding the SH3 domain, the so-called N-cap, reshapes the free-energy landscape of the tandem and favors the interaction of this domain with the SH2-kinase linker, an intermediate step necessary for assembly of the autoinhibited complex. This allosteric effect arises from interactions between N-cap and the SH2 domain and SH3-SH2 connector, which involve a phosphorylation site. We also show that the SH3-SH2 connector plays a determinant role in the assembly equilibrium of Abl, because mutations thereof hinder the engagement of the SH2-kinase linker. These results provide a thermodynamic rationale for the involvement of N-cap and SH3-SH2 connector in Abl regulation and expand our understanding of the principles of modular domain organization.

  12. Survivin knockdown increased anti-cancer effects of (−)-epigallocatechin-3-gallate in human malignant neuroblastoma SK-N-BE2 and SH-SY5Y cells

    International Nuclear Information System (INIS)

    Hossain, Md. Motarab; Banik, Naren L.; Ray, Swapan K.

    2012-01-01

    Neuroblastoma is a solid tumor that mostly occurs in children. Malignant neuroblastomas have poor prognosis because conventional chemotherapeutic agents are hardly effective. Survivin, which is highly expressed in some malignant neuroblastomas, plays a significant role in inhibiting differentiation and apoptosis and promoting cell proliferation, invasion, and angiogenesis. We examined consequences of survivin knockdown by survivin short hairpin RNA (shRNA) plasmid and then treatment with (−)-epigallocatechin-3-gallate (EGCG), a green tea flavonoid, in malignant neuroblastoma cells. Our Western blotting and laser scanning confocal immunofluorescence microscopy showed that survivin was highly expressed in malignant neuroblastoma SK-N-BE2 and SH-SY5Y cell lines and slightly in SK-N-DZ cell line. Expression of survivin was very faint in malignant neuroblastoma IMR32 cell line. We transfected SK-N-BE2 and SH-SY-5Y cells with survivin shRNA, treated with EGCG, and confirmed knockdown of survivin at mRNA and protein levels. Survivin knockdown induced morphological features of neuronal differentiation, as we observed following in situ methylene blue staining. Combination of survivin shRNA and EGCG promoted neuronal differentiation biochemically by increases in the expression of NFP, NSE, and e-cadherin and also decreases in the expression of Notch-1, ID2, hTERT, and PCNA. Our in situ Wright staining and Annexin V-FITC/PI staining showed that combination therapy was highly effective in inducing, respectively, morphological and biochemical features of apoptosis. Apoptosis occurred with activation of caspase-8 and cleavage of Bid to tBid, increase in Bax:Bcl-2 ratio, mitochondrial release of cytochrome c, and increases in the expression and activity of calpain and caspase-3. Combination therapy decreased migration of cells through matrigel and inhibited proliferative (p-Akt and NF-κB), invasive (MMP-2 and MMP-9), and angiogenic (VEGF and b-FGF) factors. Also, in vitro

  13. MeSH Now: automatic MeSH indexing at PubMed scale via learning to rank.

    Science.gov (United States)

    Mao, Yuqing; Lu, Zhiyong

    2017-04-17

    MeSH indexing is the task of assigning relevant MeSH terms based on a manual reading of scholarly publications by human indexers. The task is highly important for improving literature retrieval and many other scientific investigations in biomedical research. Unfortunately, given its manual nature, the process of MeSH indexing is both time-consuming (new articles are not immediately indexed until 2 or 3 months later) and costly (approximately ten dollars per article). In response, automatic indexing by computers has been previously proposed and attempted but remains challenging. In order to advance the state of the art in automatic MeSH indexing, a community-wide shared task called BioASQ was recently organized. We propose MeSH Now, an integrated approach that first uses multiple strategies to generate a combined list of candidate MeSH terms for a target article. Through a novel learning-to-rank framework, MeSH Now then ranks the list of candidate terms based on their relevance to the target article. Finally, MeSH Now selects the highest-ranked MeSH terms via a post-processing module. We assessed MeSH Now on two separate benchmarking datasets using traditional precision, recall and F 1 -score metrics. In both evaluations, MeSH Now consistently achieved over 0.60 in F-score, ranging from 0.610 to 0.612. Furthermore, additional experiments show that MeSH Now can be optimized by parallel computing in order to process MEDLINE documents on a large scale. We conclude that MeSH Now is a robust approach with state-of-the-art performance for automatic MeSH indexing and that MeSH Now is capable of processing PubMed scale documents within a reasonable time frame. http://www.ncbi.nlm.nih.gov/CBBresearch/Lu/Demo/MeSHNow/ .

  14. The role of SH3BP2 in the pathophysiology of cherubism

    Directory of Open Access Journals (Sweden)

    Reichenberger Ernst J

    2012-05-01

    Full Text Available Abstract Cherubism is a rare bone dysplasia that is characterized by symmetrical bone resorption limited to the jaws. Bone lesions are filled with soft fibrous giant cell-rich tissue that can expand and cause severe facial deformity. The disorder typically begins in children at ages of 2-5 years and the bone resorption and facial swelling continues until puberty; in most cases the lesions regress spontaneously thereafter. Most patients with cherubism have germline mutations in the gene encoding SH3BP2, an adapter protein involved in adaptive and innate immune response signaling. A mouse model carrying a Pro416Arg mutation in SH3BP2 develops osteopenia and expansile lytic lesions in bone and some soft tissue organs. In this review we discuss the genetics of cherubism, the biological functions of SH3BP2 and the analysis of the mouse model. The data suggest that the underlying cause for cherubism is a systemic autoinflammatory response to physiologic challenges despite the localized appearance of bone resorption and fibrous expansion to the jaws in humans.

  15. Survivin knockdown increased anti-cancer effects of (-)-epigallocatechin-3-gallate in human malignant neuroblastoma SK-N-BE2 and SH-SY5Y cells

    Energy Technology Data Exchange (ETDEWEB)

    Hossain, Md. Motarab [Department of Pathology, Microbiology, and Immunology, University of South Carolina School of Medicine, Columbia, SC (United States); Banik, Naren L. [Department of Neurosciences, Medical University of South Carolina, Charleston, SC (United States); Ray, Swapan K., E-mail: swapan.ray@uscmed.sc.edu [Department of Pathology, Microbiology, and Immunology, University of South Carolina School of Medicine, Columbia, SC (United States)

    2012-08-01

    Neuroblastoma is a solid tumor that mostly occurs in children. Malignant neuroblastomas have poor prognosis because conventional chemotherapeutic agents are hardly effective. Survivin, which is highly expressed in some malignant neuroblastomas, plays a significant role in inhibiting differentiation and apoptosis and promoting cell proliferation, invasion, and angiogenesis. We examined consequences of survivin knockdown by survivin short hairpin RNA (shRNA) plasmid and then treatment with (-)-epigallocatechin-3-gallate (EGCG), a green tea flavonoid, in malignant neuroblastoma cells. Our Western blotting and laser scanning confocal immunofluorescence microscopy showed that survivin was highly expressed in malignant neuroblastoma SK-N-BE2 and SH-SY5Y cell lines and slightly in SK-N-DZ cell line. Expression of survivin was very faint in malignant neuroblastoma IMR32 cell line. We transfected SK-N-BE2 and SH-SY-5Y cells with survivin shRNA, treated with EGCG, and confirmed knockdown of survivin at mRNA and protein levels. Survivin knockdown induced morphological features of neuronal differentiation, as we observed following in situ methylene blue staining. Combination of survivin shRNA and EGCG promoted neuronal differentiation biochemically by increases in the expression of NFP, NSE, and e-cadherin and also decreases in the expression of Notch-1, ID2, hTERT, and PCNA. Our in situ Wright staining and Annexin V-FITC/PI staining showed that combination therapy was highly effective in inducing, respectively, morphological and biochemical features of apoptosis. Apoptosis occurred with activation of caspase-8 and cleavage of Bid to tBid, increase in Bax:Bcl-2 ratio, mitochondrial release of cytochrome c, and increases in the expression and activity of calpain and caspase-3. Combination therapy decreased migration of cells through matrigel and inhibited proliferative (p-Akt and NF-{kappa}B), invasive (MMP-2 and MMP-9), and angiogenic (VEGF and b-FGF) factors. Also, in vitro

  16. New approaches to high-throughput structure characterization of SH3 complexes: the example of Myosin-3 and Myosin-5 SH3 domains from S. cerevisiae.

    Science.gov (United States)

    Musi, Valeria; Birdsall, Berry; Fernandez-Ballester, Gregorio; Guerrini, Remo; Salvatori, Severo; Serrano, Luis; Pastore, Annalisa

    2006-04-01

    SH3 domains are small protein modules that are involved in protein-protein interactions in several essential metabolic pathways. The availability of the complete genome and the limited number of clearly identifiable SH3 domains make the yeast Saccharomyces cerevisae an ideal proteomic-based model system to investigate the structural rules dictating the SH3-mediated protein interactions and to develop new tools to assist these studies. In the present work, we have determined the solution structure of the SH3 domain from Myo3 and modeled by homology that of the highly homologous Myo5, two myosins implicated in actin polymerization. We have then implemented an integrated approach that makes use of experimental and computational methods to characterize their binding properties. While accommodating their targets in the classical groove, the two domains have selectivity in both orientation and sequence specificity of the target peptides. From our study, we propose a consensus sequence that may provide a useful guideline to identify new natural partners and suggest a strategy of more general applicability that may be of use in other structural proteomic studies.

  17. Two-state dynamics of the SH3SH2 tandem of Abl kinase and the allosteric role of the N-cap

    Science.gov (United States)

    Corbi-Verge, Carles; Marinelli, Fabrizio; Zafra-Ruano, Ana; Ruiz-Sanz, Javier; Luque, Irene; Faraldo-Gómez, José D.

    2013-01-01

    The regulation and localization of signaling enzymes is often mediated by accessory modular domains, which frequently function in tandems. The ability of these tandems to adopt multiple conformations is as important for proper regulation as the individual domain specificity. A paradigmatic example is Abl, a ubiquitous tyrosine kinase of significant pharmacological interest. SH3 and SH2 domains inhibit Abl by assembling onto the catalytic domain, allosterically clamping it in an inactive state. We investigate the dynamics of this SH3SH2 tandem, using microsecond all-atom simulations and differential scanning calorimetry. Our results indicate that the Abl tandem is a two-state switch, alternating between the conformation observed in the structure of the autoinhibited enzyme and another configuration that is consistent with existing scattering data for an activated form. Intriguingly, we find that the latter is the most probable when the tandem is disengaged from the catalytic domain. Nevertheless, an amino acid stretch preceding the SH3 domain, the so-called N-cap, reshapes the free-energy landscape of the tandem and favors the interaction of this domain with the SH2-kinase linker, an intermediate step necessary for assembly of the autoinhibited complex. This allosteric effect arises from interactions between N-cap and the SH2 domain and SH3SH2 connector, which involve a phosphorylation site. We also show that the SH3SH2 connector plays a determinant role in the assembly equilibrium of Abl, because mutations thereof hinder the engagement of the SH2-kinase linker. These results provide a thermodynamic rationale for the involvement of N-cap and SH3SH2 connector in Abl regulation and expand our understanding of the principles of modular domain organization. PMID:23959873

  18. Ultraviolet absorption spectra and kinetics of CH3S and CH2SH radicals

    DEFF Research Database (Denmark)

    Anastasi, C.; Broomfield, M.; Nielsen, O.J.

    1991-01-01

    The ultraviolet absorption spectra of CH3S and CH2SH radicals have been measured between 215 and 380 nm using the pulse-radiolysis/kinetic-absorption method. One absorption band between 250 and 300 nm and one around 215 nm have been tentatively assigned to the CH2SH and CH3S radicals, respectively....... This spectrum has been used to measure the self-reaction rates of these radicals. Rate constants of 4 x 10(-11) and 7 x 10(-11) cm3 molecule-1 s-1 have been measured at 298 K for CH3S and CH2SH recombination, respectively. The possible reaction pathways are discussed....

  19. New function of the adaptor protein SH2B1 in brain-derived neurotrophic factor-induced neurite outgrowth.

    Directory of Open Access Journals (Sweden)

    Chien-Hung Shih

    Full Text Available Neurite outgrowth is an essential process for the establishment of the nervous system. Brain-derived neurotrophic factor (BDNF binds to its receptor TrkB and regulates axonal and dendritic morphology of neurons through signal transduction and gene expression. SH2B1 is a signaling adaptor protein that regulates cellular signaling in various physiological processes. The purpose of this study is to investigate the role of SH2B1 in the development of the central nervous system. In this study, we show that knocking down SH2B1 reduces neurite formation of cortical neurons whereas overexpression of SH2B1β promotes the development of hippocampal neurons. We further demonstrate that SH2B1β promotes BDNF-induced neurite outgrowth and signaling using the established PC12 cells stably expressing TrkB, SH2B1β or SH2B1β mutants. Our data indicate that overexpressing SH2B1β enhances BDNF-induced MEK-ERK1/2, and PI3K-AKT signaling pathways. Inhibition of MEK-ERK1/2 and PI3K-AKT pathways by specific inhibitors suggest that these two pathways are required for SH2B1β-promoted BDNF-induced neurite outgrowth. Moreover, SH2B1β enhances BDNF-stimulated phosphorylation of signal transducer and activator of transcription 3 at serine 727. Finally, our data indicate that the SH2 domain and tyrosine phosphorylation of SH2B1β contribute to BDNF-induced signaling pathways and neurite outgrowth. Taken together, these findings demonstrate that SH2B1β promotes BDNF-induced neurite outgrowth through enhancing pathways involved MEK-ERK1/2 and PI3K-AKT.

  20. Comparative Genomics and Disorder Prediction Identify Biologically Relevant SH3 Protein Interactions.

    Directory of Open Access Journals (Sweden)

    2005-08-01

    Full Text Available Protein interaction networks are an important part of the post-genomic effort to integrate a part-list view of the cell into system-level understanding. Using a set of 11 yeast genomes we show that combining comparative genomics and secondary structure information greatly increases consensus-based prediction of SH3 targets. Benchmarking of our method against positive and negative standards gave 83% accuracy with 26% coverage. The concept of an optimal divergence time for effective comparative genomics studies was analyzed, demonstrating that genomes of species that diverged very recently from Saccharomyces cerevisiae(S. mikatae, S. bayanus, and S. paradoxus, or a long time ago (Neurospora crassa and Schizosaccharomyces pombe, contain less information for accurate prediction of SH3 targets than species within the optimal divergence time proposed. We also show here that intrinsically disordered SH3 domain targets are more probable sites of interaction than equivalent sites within ordered regions. Our findings highlight several novel S. cerevisiae SH3 protein interactions, the value of selection of optimal divergence times in comparative genomics studies, and the importance of intrinsic disorder for protein interactions. Based on our results we propose novel roles for the S. cerevisiae proteins Abp1p in endocytosis and Hse1p in endosome protein sorting.

  1. Comparative genomics and disorder prediction identify biologically relevant SH3 protein interactions.

    Directory of Open Access Journals (Sweden)

    Pedro Beltrao

    2005-08-01

    Full Text Available Protein interaction networks are an important part of the post-genomic effort to integrate a part-list view of the cell into system-level understanding. Using a set of 11 yeast genomes we show that combining comparative genomics and secondary structure information greatly increases consensus-based prediction of SH3 targets. Benchmarking of our method against positive and negative standards gave 83% accuracy with 26% coverage. The concept of an optimal divergence time for effective comparative genomics studies was analyzed, demonstrating that genomes of species that diverged very recently from Saccharomyces cerevisiae(S. mikatae, S. bayanus, and S. paradoxus, or a long time ago (Neurospora crassa and Schizosaccharomyces pombe, contain less information for accurate prediction of SH3 targets than species within the optimal divergence time proposed. We also show here that intrinsically disordered SH3 domain targets are more probable sites of interaction than equivalent sites within ordered regions. Our findings highlight several novel S. cerevisiae SH3 protein interactions, the value of selection of optimal divergence times in comparative genomics studies, and the importance of intrinsic disorder for protein interactions. Based on our results we propose novel roles for the S. cerevisiae proteins Abp1p in endocytosis and Hse1p in endosome protein sorting.

  2. Neuronal SH2B1 is essential for controlling energy and glucose homeostasis.

    Science.gov (United States)

    Ren, Decheng; Zhou, Yingjiang; Morris, David; Li, Minghua; Li, Zhiqin; Rui, Liangyou

    2007-02-01

    SH2B1 (previously named SH2-B), a cytoplasmic adaptor protein, binds via its Src homology 2 (SH2) domain to a variety of protein tyrosine kinases, including JAK2 and the insulin receptor. SH2B1-deficient mice are obese and diabetic. Here we demonstrated that multiple isoforms of SH2B1 (alpha, beta, gamma, and/or delta) were expressed in numerous tissues, including the brain, hypothalamus, liver, muscle, adipose tissue, heart, and pancreas. Rat SH2B1beta was specifically expressed in neural tissue in SH2B1-transgenic (SH2B1(Tg)) mice. SH2B1(Tg) mice were crossed with SH2B1-knockout (SH2B1(KO)) mice to generate SH2B1(TgKO) mice expressing SH2B1 only in neural tissue but not in other tissues. Systemic deletion of the SH2B1 gene resulted in metabolic disorders in SH2B1(KO) mice, including hyperlipidemia, leptin resistance, hyperphagia, obesity, hyperglycemia, insulin resistance, and glucose intolerance. Neuron-specific restoration of SH2B1beta not only corrected the metabolic disorders in SH2B1(TgKO) mice, but also improved JAK2-mediated leptin signaling and leptin regulation of orexigenic neuropeptide expression in the hypothalamus. Moreover, neuron-specific overexpression of SH2B1 dose-dependently protected against high-fat diet-induced leptin resistance and obesity. These observations suggest that neuronal SH2B1 regulates energy balance, body weight, peripheral insulin sensitivity, and glucose homeostasis at least in part by enhancing hypothalamic leptin sensitivity.

  3. IGF-1 protects SH-SY5Y cells against MPP+-induced apoptosis via PI3K/PDK-1/Akt pathway.

    Science.gov (United States)

    Kim, Chanyang; Park, Seungjoon

    2018-03-01

    Insulin-like growth factor (IGF)-1 is a well-known anti-apoptotic pro-survival factor and phosphatidylinositol-3-kinase (PI3K)/Akt pathway is linked to cell survival induced by IGF-1. It is also reported that Akt signaling is modulated by 3-phosphoinositide-dependent kinase-1 (PDK1). In the current study, we investigated whether the anti-apoptotic effect of IGF-1 in SH-SY5Y cells exposed to 1-methyl-4-phenylpyridinium (MPP + ) is associated with the activity of PI3K/PDK1/Akt pathway. Treatment of cells with IGF-1 inhibited MPP + -induced apoptotic cell death. IGF-1-induced activation of Akt and the protective effect of IGF-1 on MPP + -induced apoptosis were abolished by chemical inhibition of PDK1 (GSK2334470) or PI3K (LY294002). The phosphorylated levels of Akt and PDK1 were significantly suppressed after MPP + exposure, while IGF-1 treatment completely restored MPP+-induced reductions in phosphorylation. IGF-1 protected cells from MPP + insult by suppressing intracellular reactive oxygen species (ROS) production and malondialdehyde levels and increasing superoxide dismutase activity. Mitochondrial ROS levels were also increased during MPP + exposure, which were attenuated by IGF-1 treatment. In addition, IGF-1-treated cells showed increased activities of succinate dehydrogenase and citrate synthase, stabilization of mitochondrial transmembrane potential, increased ratio of Bcl-2 to Bax, prevention of cytochrome c release and inhibition of caspase-3 activation with PARP cleavage. Furthermore, the protective effects of IGF-1 on oxidative stress and mitochondrial dysfunction were attenuated when cells were preincubated with GSK2334470 or LY294002. Our data suggest that IGF-1 protects SH-SY5Y cells against MPP + -associated oxidative stress by preserving mitochondrial integrity and inhibiting mitochondrial apoptotic cascades via the activation of PI3K/PDK1/Akt pathway. © 2018 The authors.

  4. Phosphatidylinositol 4,5-Bisphosphate (PtdIns(4,5)P2) Specifically Induces Membrane Penetration and Deformation by Bin/Amphiphysin/Rvs (BAR) Domains*

    Science.gov (United States)

    Yoon, Youngdae; Zhang, Xiuqi; Cho, Wonhwa

    2012-01-01

    Cellular proteins containing Bin/amphiphysin/Rvs (BAR) domains play a key role in clathrin-mediated endocytosis. Despite extensive structural and functional studies of BAR domains, it is still unknown how exactly these domains interact with the plasma membrane containing phosphatidylinositol 4,5-bisphosphate (PtdIns(4,5)P2) and whether they function by a universal mechanism or by different mechanisms. Here we report that PtdIns(4,5)P2 specifically induces partial membrane penetration of the N-terminal amphiphilic α-helix (H0) of two representative N-BAR domains from Drosophila amphiphysin (dAmp-BAR) and rat endophilin A1 (EndoA1-BAR). Our quantitative fluorescence imaging analysis shows that PtdIns(4,5)P2-dependent membrane penetration of H0 is important for self-association of membrane-bound dAmp-BAR and EndoA1-BAR and their membrane deformation activity. EndoA1-BAR behaves differently from dAmp-BAR because the former has an additional amphiphilic α-helix that penetrates the membrane in a PtdIns(4,5)P2-independent manner. Depletion of PtdIns(4,5)P2 from the plasma membrane of HEK293 cells abrogated the membrane deforming activity of EndoA1-BAR and dAmp-BAR. Collectively, these studies suggest that the local PtdIns(4,5)P2 concentration in the plasma membrane may regulate the membrane interaction and deformation by N-BAR domain-containing proteins during clathrin-mediated endocytosis. PMID:22888025

  5. Binding of the cSH3 domain of Grb2 adaptor to two distinct RXXK motifs within Gab1 docker employs differential mechanisms.

    Science.gov (United States)

    McDonald, Caleb B; Seldeen, Kenneth L; Deegan, Brian J; Bhat, Vikas; Farooq, Amjad

    2011-01-01

    A ubiquitous component of cellular signaling machinery, Gab1 docker plays a pivotal role in routing extracellular information in the form of growth factors and cytokines to downstream targets such as transcription factors within the nucleus. Here, using isothermal titration calorimetry (ITC) in combination with macromolecular modeling (MM), we show that although Gab1 contains four distinct RXXK motifs, designated G1, G2, G3, and G4, only G1 and G2 motifs bind to the cSH3 domain of Grb2 adaptor and do so with distinct mechanisms. Thus, while the G1 motif strictly requires the PPRPPKP consensus sequence for high-affinity binding to the cSH3 domain, the G2 motif displays preference for the PXVXRXLKPXR consensus. Such sequential differences in the binding of G1 and G2 motifs arise from their ability to adopt distinct polyproline type II (PPII)- and 3(10) -helical conformations upon binding to the cSH3 domain, respectively. Collectively, our study provides detailed biophysical insights into a key protein-protein interaction involved in a diverse array of signaling cascades central to health and disease. Copyright © 2010 John Wiley & Sons, Ltd.

  6. Distinct ubiquitin binding modes exhibited by SH3 domains: molecular determinants and functional implications.

    Directory of Open Access Journals (Sweden)

    Jose L Ortega Roldan

    Full Text Available SH3 domains constitute a new type of ubiquitin-binding domains. We previously showed that the third SH3 domain (SH3-C of CD2AP binds ubiquitin in an alternative orientation. We have determined the structure of the complex between first CD2AP SH3 domain and ubiquitin and performed a structural and mutational analysis to decipher the determinants of the SH3-C binding mode to ubiquitin. We found that the Phe-to-Tyr mutation in CD2AP and in the homologous CIN85 SH3-C domain does not abrogate ubiquitin binding, in contrast to previous hypothesis and our findings for the first two CD2AP SH3 domains. The similar alternative binding mode of the SH3-C domains of these related adaptor proteins is characterised by a higher affinity to C-terminal extended ubiquitin molecules. We conclude that CD2AP/CIN85 SH3-C domain interaction with ubiquitin constitutes a new ubiquitin-binding mode involved in a different cellular function and thus changes the previously established mechanism of EGF-dependent CD2AP/CIN85 mono-ubiquitination.

  7. Expression and isotopic labelling of the potassium channel blocker ShK toxin as a thioredoxin fusion protein in bacteria.

    Science.gov (United States)

    Chang, Shih Chieh; Galea, Charles A; Leung, Eleanor W W; Tajhya, Rajeev B; Beeton, Christine; Pennington, Michael W; Norton, Raymond S

    2012-10-01

    The polypeptide toxin ShK is a potent blocker of Kv1.3 potassium channels, which play a crucial role in the activation of human effector memory T-cells (T(EM)). Selective blockers constitute valuable therapeutic leads for the treatment of autoimmune diseases mediated by T(EM) cells, such as multiple sclerosis, rheumatoid arthritis, and type-1 diabetes. We have established a recombinant peptide expression system in order to generate isotopically-labelled ShK and various ShK analogues for in-depth biophysical and pharmacological studies. ShK was expressed as a thioredoxin fusion protein in Escherichia coli BL21 (DE3) cells and purified initially by Ni²⁺ iminodiacetic acid affinity chromatography. The fusion protein was cleaved with enterokinase and purified to homogeneity by reverse-phase HPLC. NMR spectra of ¹⁵N-labelled ShK were similar to those reported previously for the unlabelled synthetic peptide, confirming that recombinant ShK was correctly folded. Recombinant ShK blocked Kv1.3 channels with a K(d) of 25 pM and inhibited the proliferation of human and rat T lymphocytes with a preference for T(EM) cells, with similar potency to synthetic ShK in all assays. This expression system also enables the efficient production of ¹⁵N-labelled ShK for NMR studies of peptide dynamics and of the interaction of ShK with Kv1.3 channels. Copyright © 2012 Elsevier Ltd. All rights reserved.

  8. Generation of CMAHKO/GTKO/shTNFRI-Fc/HO-1 quadruple gene modified pigs.

    Science.gov (United States)

    Kim, Geon A; Lee, Eun Mi; Jin, Jun-Xue; Lee, Sanghoon; Taweechaipaisankul, Anukul; Hwang, Jong Ik; Alam, Zahid; Ahn, Curie; Lee, Byeong Chun

    2017-08-01

    As an alternative source of organs for transplantation into humans, attention has been directed to pigs due to their similarities in biological features and organ size. However, severe immune rejection has prevented successful xenotransplantation using pig organs and tissues. To overcome immune rejection, recently developed genetic engineering systems such as TALEN coupled with somatic cell nuclear transfer (SCNT) to make embryos could be used to produce pigs compatible with xenotransplantation. We used the TALEN system to target the non-Gal antigen cytidine monophosphate-N-acetylneuraminic acid hydroxylase (CMAH) gene in pigs that is naturally deleted in humans. Gal-deleted cells expressing both soluble human tumor necrosis factor receptor I IgG 1 -Fc (shTNFRI-Fc) and human hemagglutinin -tagged-human heme oxygenase-1 (hHO-1) were transfected with a TALEN target for CMAH. Cells lacking CMAH were negatively selected using N-glyconeuraminic acid (Neu5Gc)/magnetic beads and the level of Neu5Gc expression of isolated cells were analyzed by FACS and DNA sequencing. Cloned embryos using 3 different genetically modified cell clones were respectively transferred into 3 recipients, with 55.6% (5/9) becoming pregnant and three cloned pigs were produced. Successful genetic disruption of the CMAH gene was confirmed by sequencing, showing lack of expression of CMAH in tail-derived fibroblasts of the cloned piglets. Besides decreased expression of Neu5Gc in piglets produced by SCNT, antibody-mediated complement-dependent cytotoxicity assays and natural antibody binding for examining immuno-reactivity of the quadruple gene modified pigs derived from endothelial cells and fibroblasts were reduced significantly compared to those of wild type animals. We conclude that by combining the TALEN system and transgenic cells, targeting of multiple genes could be useful for generating organs for xenotransplantation. We produced miniature pigs with quadruple modified genes CMAHKO/GTKO/sh

  9. Rayleigh SAW-Assisted SH-SAW Immunosensor on X-Cut 148-Y LiTaO3.

    Science.gov (United States)

    Kogai, Takashi; Yatsuda, Hiromi; Kondoh, Jun

    2017-09-01

    In this paper, we describe a shear horizontal surface acoustic wave (SH-SAW) immunosensor that utilizes induce agitation by a Rayleigh SAW (R-SAW) on an X-cut 148-Y LiTaO 3 substrate. On this substrate, SH-SAWs and R-SAWs with different frequencies can be effectively generated at an interdigital transducer (IDT). First, to consider the power flow angles of SH-SAWs and R-SAWs on this substrate, the 360-MHz delay lines with six different tilt angles were designed and fabricated. From the experiments, an optimal power flow angle of 9° for the SH-SAW on this substrate is obtained. Second, in order to consider the immunoreactions of the SH-SAW immunosensors, a delay line with a tilt angle of 9° was designed and fabricated on this substrate. The delay line, which can generate two SAWs, namely, a 100-MHz SH-SAW and an 88.8-MHz R-SAW, has a propagation area covered with antigens of human serum albumin between transmitting and receiving IDTs. The immunoreactions caused by antigen-antibody binding events on the surface of the delay line were investigated on the basis of the velocity changes of the SH-SAWs for sensing with and without the assistance of an R-SAW. As a result, it was confirmed that the SH-SAW velocity changes due to antigen-antibody reactions can be markedly increased by the assistance of R-SAW agitation.

  10. Differential sensitivity of Src-family kinases to activation by SH3 domain displacement.

    Directory of Open Access Journals (Sweden)

    Jamie A Moroco

    Full Text Available Src-family kinases (SFKs are non-receptor protein-tyrosine kinases involved in a variety of signaling pathways in virtually every cell type. The SFKs share a common negative regulatory mechanism that involves intramolecular interactions of the SH3 domain with the PPII helix formed by the SH2-kinase linker as well as the SH2 domain with a conserved phosphotyrosine residue in the C-terminal tail. Growing evidence suggests that individual SFKs may exhibit distinct activation mechanisms dictated by the relative strengths of these intramolecular interactions. To elucidate the role of the SH3:linker interaction in the regulation of individual SFKs, we used a synthetic SH3 domain-binding peptide (VSL12 to probe the sensitivity of downregulated c-Src, Hck, Lyn and Fyn to SH3-based activation in a kinetic kinase assay. All four SFKs responded to VSL12 binding with enhanced kinase activity, demonstrating a conserved role for SH3:linker interaction in the control of catalytic function. However, the sensitivity and extent of SH3-based activation varied over a wide range. In addition, autophosphorylation of the activation loops of c-Src and Hck did not override regulatory control by SH3:linker displacement, demonstrating that these modes of activation are independent. Our results show that despite the similarity of their downregulated conformations, individual Src-family members show diverse responses to activation by domain displacement which may reflect their adaptation to specific signaling environments in vivo.

  11. Neuroprotective Effect of Arctigenin via Upregulation of P-CREB in Mouse Primary Neurons and Human SH-SY5Y Neuroblastoma Cells

    Science.gov (United States)

    Zhang, Nan; Wen, Qingping; Ren, Lu; Liang, Wenbo; Xia, Yang; Zhang, Xiaodan; Zhao, Dan; Sun, Dong; Hu, Yv; Hao, Haiguang; Yan, Yaping; Zhang, Guangxian; Yang, Jingxian; Kang, Tingguo

    2013-01-01

    Arctigenin (Arc) has been shown to act on scopolamine-induced memory deficit mice and to provide a neuroprotective effect on cultured cortical neurons from glutamate-induced neurodegeneration through mechanisms not completely defined. Here, we investigated the neuroprotective effect of Arc on H89-induced cell damage and its potential mechanisms in mouse cortical neurons and human SH-SY5Y neuroblastoma cells. We found that Arc prevented cell viability loss induced by H89 in human SH-SY5Y cells. Moreover, Arc reduced intracellular beta amyloid (Aβ) production induced by H89 in neurons and human SH-SY5Y cells, and Arc also inhibited the presenilin 1(PS1) protein level in neurons. In addition, neural apoptosis in both types of cells, inhibition of neurite outgrowth in human SH-SY5Y cells and reduction of synaptic marker synaptophysin (SYN) expression in neurons were also observed after H89 exposure. All these effects induced by H89 were markedly reversed by Arc treatment. Arc also significantly attenuated downregulation of the phosphorylation of CREB (p-CREB) induced by H89, which may contribute to the neuroprotective effects of Arc. These results demonstrated that Arc exerted the ability to protect neurons and SH-SY5Y cells against H89-induced cell injury via upregulation of p-CREB. PMID:24025424

  12. Neuroprotective Effect of Arctigenin via Upregulation of P-CREB in Mouse Primary Neurons and Human SH-SY5Y Neuroblastoma Cells

    Directory of Open Access Journals (Sweden)

    Tingguo Kang

    2013-09-01

    Full Text Available Arctigenin (Arc has been shown to act on scopolamine-induced memory deficit mice and to provide a neuroprotective effect on cultured cortical neurons from glutamate-induced neurodegeneration through mechanisms not completely defined. Here, we investigated the neuroprotective effect of Arc on H89-induced cell damage and its potential mechanisms in mouse cortical neurons and human SH-SY5Y neuroblastoma cells. We found that Arc prevented cell viability loss induced by H89 in human SH-SY5Y cells. Moreover, Arc reduced intracellular beta amyloid (Aβ production induced by H89 in neurons and human SH-SY5Y cells, and Arc also inhibited the presenilin 1(PS1 protein level in neurons. In addition, neural apoptosis in both types of cells, inhibition of neurite outgrowth in human SH-SY5Y cells and reduction of synaptic marker synaptophysin (SYN expression in neurons were also observed after H89 exposure. All these effects induced by H89 were markedly reversed by Arc treatment. Arc also significantly attenuated downregulation of the phosphorylation of CREB (p-CREB induced by H89, which may contribute to the neuroprotective effects of Arc. These results demonstrated that Arc exerted the ability to protect neurons and SH-SY5Y cells against H89-induced cell injury via upregulation of p-CREB.

  13. Infrared Spectra and Band Strengths of CH3SH, an Interstellar Molecule

    Science.gov (United States)

    Hudson, R. L.

    2016-01-01

    Three solid phases of CH3SH (methanethiol or methyl mercaptan) have been prepared and their mid-infrared spectra recorded at 10-110 degrees Kelvin, with an emphasis on the 17-100 degrees Kelvin region. Refractive indices have been measured at two temperatures and used to estimate ice densities and infrared band strengths. Vapor pressures for the two crystalline phases of CH3SH at 110 degrees Kelvin are estimated. The behavior of amorphous CH3SH on warming is presented and discussed in terms of Ostwald's step rule. Comparisons to CH3OH under similar conditions are made, and some inconsistencies and ambiguities in the CH3SH literature are examined and corrected.

  14. SH2-catalytic domain linker heterogeneity influences allosteric coupling across the SFK family.

    Science.gov (United States)

    Register, A C; Leonard, Stephen E; Maly, Dustin J

    2014-11-11

    Src-family kinases (SFKs) make up a family of nine homologous multidomain tyrosine kinases whose misregulation is responsible for human disease (cancer, diabetes, inflammation, etc.). Despite overall sequence homology and identical domain architecture, differences in SH3 and SH2 regulatory domain accessibility and ability to allosterically autoinhibit the ATP-binding site have been observed for the prototypical SFKs Src and Hck. Biochemical and structural studies indicate that the SH2-catalytic domain (SH2-CD) linker, the intramolecular binding epitope for SFK SH3 domains, is responsible for allosterically coupling SH3 domain engagement to autoinhibition of the ATP-binding site through the conformation of the αC helix. As a relatively unconserved region between SFK family members, SH2-CD linker sequence variability across the SFK family is likely a source of nonredundant cellular functions between individual SFKs via its effect on the availability of SH3 and SH2 domains for intermolecular interactions and post-translational modification. Using a combination of SFKs engineered with enhanced or weakened regulatory domain intramolecular interactions and conformation-selective inhibitors that report αC helix conformation, this study explores how SH2-CD sequence heterogeneity affects allosteric coupling across the SFK family by examining Lyn, Fyn1, and Fyn2. Analyses of Fyn1 and Fyn2, isoforms that are identical but for a 50-residue sequence spanning the SH2-CD linker, demonstrate that SH2-CD linker sequence differences can have profound effects on allosteric coupling between otherwise identical kinases. Most notably, a dampened allosteric connection between the SH3 domain and αC helix leads to greater autoinhibitory phosphorylation by Csk, illustrating the complex effects of SH2-CD linker sequence on cellular function.

  15. Neuronal SH2B1 is essential for controlling energy and glucose homeostasis

    OpenAIRE

    Ren, Decheng; Zhou, Yingjiang; Morris, David; Li, Minghua; Li, Zhiqin; Rui, Liangyou

    2007-01-01

    SH2B1 (previously named SH2-B), a cytoplasmic adaptor protein, binds via its Src homology 2 (SH2) domain to a variety of protein tyrosine kinases, including JAK2 and the insulin receptor. SH2B1-deficient mice are obese and diabetic. Here we demonstrated that multiple isoforms of SH2B1 (α, β, γ, and/or δ) were expressed in numerous tissues, including the brain, hypothalamus, liver, muscle, adipose tissue, heart, and pancreas. Rat SH2B1β was specifically expressed in neural tissue in SH2B1-tran...

  16. Three new shRNA expression vectors targeting the CYP3A4 coding sequence to inhibit its expression

    Directory of Open Access Journals (Sweden)

    Siyun Xu

    2014-10-01

    Full Text Available RNA interference (RNAi is useful for selective gene silencing. Cytochrome P450 3A4 (CYP3A4, which metabolizes approximately 50% of drugs in clinical use, plays an important role in drug metabolism. In this study, we aimed to develop a short hairpin RNA (shRNA to modulate CYP3A4 expression. Three new shRNAs (S1, S2 and S3 were designed to target the coding sequence (CDS of CYP3A4, cloned into a shRNA expression vector, and tested in different cells. The mixture of three shRNAs produced optimal reduction (55% in CYP3A4 CDS-luciferase activity in both CHL and HEK293 cells. Endogenous CYP3A4 expression in HepG2 cells was decreased about 50% at both mRNA and protein level after transfection of the mixture of three shRNAs. In contrast, CYP3A5 gene expression was not altered by the shRNAs, supporting the selectivity of CYP3A4 shRNAs. In addition, HepG2 cells transfected with CYP3A4 shRNAs were less sensitive to Ginkgolic acids, whose toxic metabolites are produced by CYP3A4. These results demonstrate that vector-based shRNAs could modulate CYP3A4 expression in cells through their actions on CYP3A4 CDS, and CYP3A4 shRNAs may be utilized to define the role of CYP3A4 in drug metabolism and toxicity.

  17. Identification of amphiphysin 1 as an endogenous substrate for CDKL5, a protein kinase associated with X-linked neurodevelopmental disorder.

    Science.gov (United States)

    Sekiguchi, Mari; Katayama, Syouichi; Hatano, Naoya; Shigeri, Yasushi; Sueyoshi, Noriyuki; Kameshita, Isamu

    2013-07-15

    Cyclin-dependent kinase-like 5 (CDKL5) is a Ser/Thr protein kinase predominantly expressed in brain and mutations of its gene are known to be associated with neurodevelopmental disorders such as X-linked West syndrome and Rett syndrome. However, the physiological substrates of CDKL5 that are directly linked to these neurodevelopmental disorders are currently unknown. In this study, we explored endogenous substrates for CDKL5 in mouse brain extracts fractionated by a liquid-phase isoelectric focusing. In conjunction with CDKL5 phosphorylation assay, this approach detected a protein band with an apparent molecular mass of 120kDa that is remarkably phosphorylated by CDKL5. This 120-kDa protein was identified as amphiphysin 1 (Amph1) by LC-MS/MS analysis, and the site of phosphorylation by CDKL5 was determined to be Ser-293. The phosphorylation mimic mutants, Amph1(S293E) and Amph1(S293D), showed significantly reduced affinity for endophilin, a protein involved in synaptic vesicle endocytosis. Introduction of point mutations in the catalytic domain of CDKL5, which are disease-causing missense mutations found in Rett patients, resulted in the impairment of kinase activity toward Amph1. These results suggest that Amph1 is the cytoplasmic substrate for CDKL5 and that its phosphorylation may play crucial roles in the neuronal development. Copyright © 2013 Elsevier Inc. All rights reserved.

  18. Survivin knockdown increased anti-cancer effects of (-)-epigallocatechin-3-gallate in human malignant neuroblastoma SK-N-BE2 and SH-SY5Y cells.

    Science.gov (United States)

    Hossain, Md Motarab; Banik, Naren L; Ray, Swapan K

    2012-08-01

    Neuroblastoma is a solid tumor that mostly occurs in children. Malignant neuroblastomas have poor prognosis because conventional chemotherapeutic agents are hardly effective. Survivin, which is highly expressed in some malignant neuroblastomas, plays a significant role in inhibiting differentiation and apoptosis and promoting cell proliferation, invasion, and angiogenesis. We examined consequences of survivin knockdown by survivin short hairpin RNA (shRNA) plasmid and then treatment with (-)-epigallocatechin-3-gallate (EGCG), a green tea flavonoid, in malignant neuroblastoma cells. Our Western blotting and laser scanning confocal immunofluorescence microscopy showed that survivin was highly expressed in malignant neuroblastoma SK-N-BE2 and SH-SY5Y cell lines and slightly in SK-N-DZ cell line. Expression of survivin was very faint in malignant neuroblastoma IMR32 cell line. We transfected SK-N-BE2 and SH-SY-5Y cells with survivin shRNA, treated with EGCG, and confirmed knockdown of survivin at mRNA and protein levels. Survivin knockdown induced morphological features of neuronal differentiation, as we observed following in situ methylene blue staining. Combination of survivin shRNA and EGCG promoted neuronal differentiation biochemically by increases in the expression of NFP, NSE, and e-cadherin and also decreases in the expression of Notch-1, ID2, hTERT, and PCNA. Our in situ Wright staining and Annexin V-FITC/PI staining showed that combination therapy was highly effective in inducing, respectively, morphological and biochemical features of apoptosis. Apoptosis occurred with activation of caspase-8 and cleavage of Bid to tBid, increase in Bax:Bcl-2 ratio, mitochondrial release of cytochrome c, and increases in the expression and activity of calpain and caspase-3. Combination therapy decreased migration of cells through matrigel and inhibited proliferative (p-Akt and NF-κB), invasive (MMP-2 and MMP-9), and angiogenic (VEGF and b-FGF) factors. Also, in vitro

  19. Mitochondrial Effects of PGC-1alpha Silencing in MPP+ Treated Human SH-SY5Y Neuroblastoma Cells

    Directory of Open Access Journals (Sweden)

    Qinyong Ye

    2017-05-01

    Full Text Available The dopaminergic neuron degeneration and loss that occurs in Parkinson’s disease (PD has been tightly linked to mitochondrial dysfunction. Although the aged-related cause of the mitochondrial defect observed in PD patients remains unclear, nuclear genes are of potential importance to mitochondrial function. Human peroxisome proliferator-activated receptor γ coactivator-1alpha (PGC-1α is a multi-functional transcription factor that tightly regulates mitochondrial biogenesis and oxidative capacity. The goal of the present study was to explore the potential pathogenic effects of interference by the PGC-1α gene on N-methyl-4-phenylpyridinium ion (MPP+-induced SH-SY5Y cells. We utilized RNA interference (RNAi technology to probe the pathogenic consequences of inhibiting PGC-1α in the SH-SY5Y cell line. Remarkably, a reduction in PGC-1α resulted in the reduction of mitochondrial membrane potential, intracellular ATP content and intracellular H2O2 generation, leading to the translocation of cytochrome c (cyt c to the cytoplasm in the MPP+-induced PD cell model. The expression of related proteins in the signaling pathway (e.g., estrogen-related receptor α (ERRα, nuclear respiratory factor 1 (NRF-1, NRF-2 and Peroxisome proliferator-activated receptor γ (PPARγ also decreased. Our finding indicates that small interfering RNA (siRNA interference targeting the PGC-1α gene could inhibit the function of mitochondria in several capacities and that the PGC-1α gene may modulate mitochondrial function by regulating the expression of ERRα, NRF-1, NRF-2 and PPARγ. Thus, PGC-1α can be considered a potential therapeutic target for PD.

  20. Bayesian modeling of the yeast SH3 domain interactome predicts spatiotemporal dynamics of endocytosis proteins.

    Directory of Open Access Journals (Sweden)

    Raffi Tonikian

    2009-10-01

    Full Text Available SH3 domains are peptide recognition modules that mediate the assembly of diverse biological complexes. We scanned billions of phage-displayed peptides to map the binding specificities of the SH3 domain family in the budding yeast, Saccharomyces cerevisiae. Although most of the SH3 domains fall into the canonical classes I and II, each domain utilizes distinct features of its cognate ligands to achieve binding selectivity. Furthermore, we uncovered several SH3 domains with specificity profiles that clearly deviate from the two canonical classes. In conjunction with phage display, we used yeast two-hybrid and peptide array screening to independently identify SH3 domain binding partners. The results from the three complementary techniques were integrated using a Bayesian algorithm to generate a high-confidence yeast SH3 domain interaction map. The interaction map was enriched for proteins involved in endocytosis, revealing a set of SH3-mediated interactions that underlie formation of protein complexes essential to this biological pathway. We used the SH3 domain interaction network to predict the dynamic localization of several previously uncharacterized endocytic proteins, and our analysis suggests a novel role for the SH3 domains of Lsb3p and Lsb4p as hubs that recruit and assemble several endocytic complexes.

  1. Probing SH2-domains using Inhibitor Affinity Purification (IAP).

    Science.gov (United States)

    Höfener, Michael; Heinzlmeir, Stephanie; Kuster, Bernhard; Sewald, Norbert

    2014-01-01

    Many human diseases are correlated with the dysregulation of signal transduction processes. One of the most important protein interaction domains in the context of signal transduction is the Src homology 2 (SH2) domain that binds phosphotyrosine residues. Hence, appropriate methods for the investigation of SH2 proteins are indispensable in diagnostics and medicinal chemistry. Therefore, an affinity resin for the enrichment of all SH2 proteins in one experiment would be desirable. However, current methods are unable to address all SH2 proteins simultaneously with a single compound or a small array of compounds. In order to overcome these limitations for the investigation of this particular protein family in future experiments, a dipeptide-derived probe has been designed, synthesized and evaluated. This probe successfully enriched 22 SH2 proteins from mixed cell lysates which contained 50 SH2 proteins. Further characterization of the SH2 binding properties of the probe using depletion and competition experiments indicated its ability to enrich complexes consisting of SH2 domain bearing regulatory PI3K subunits and catalytic phosphoinositide 3-kinase (PI3K) subunits that have no SH2 domain. The results make this probe a promising starting point for the development of a mixed affinity resin with complete SH2 protein coverage. Moreover, the additional findings render it a valuable tool for the evaluation of PI3K complex interrupting inhibitors.

  2. Neurotoxicity of "ecstasy" and its metabolites in human dopaminergic differentiated SH-SY5Y cells.

    Science.gov (United States)

    Ferreira, Patrícia Silva; Nogueira, Tiago Bernandes; Costa, Vera Marisa; Branco, Paula Sério; Ferreira, Luísa Maria; Fernandes, Eduarda; Bastos, Maria Lourdes; Meisel, Andreas; Carvalho, Félix; Capela, João Paulo

    2013-02-04

    "Ecstasy" (3,4-methylenedioxymethamphetamine or MDMA) is a widely abused recreational drug, reported to produce neurotoxic effects, both in laboratory animals and in humans. MDMA metabolites can be major contributors for MDMA neurotoxicity. This work studied the neurotoxicity of MDMA and its catechol metabolites, α-methyldopamine (α-MeDA) and N-methyl-α-methyldopamine (N-Me-α-MeDA) in human dopaminergic SH-SY5Y cells differentiated with retinoic acid and 12-O-tetradecanoyl-phorbol-13-acetate. Differentiation led to SH-SY5Y neurons with higher ability to accumulate dopamine and higher resistance towards dopamine neurotoxicity. MDMA catechol metabolites were neurotoxic to SH-SY5Y neurons, leading to caspase 3-independent cell death in a concentration- and time-dependent manner. MDMA did not show a concentration- and time-dependent death. Pre-treatment with the antioxidant and glutathione precursor, N-acetylcysteine (NAC), resulted in strong protection against the MDMA metabolites' neurotoxicity. Neither the superoxide radical scavenger, tiron, nor the inhibitor of the dopamine (DA) transporter, GBR 12909, prevented the metabolites' toxicity. Cells exposed to α-MeDA showed an increase in intracellular glutathione (GSH) levels, which, at the 48 h time-point, was not dependent in the activity increase of γ-glutamylcysteine synthetase (γ-GCS), revealing a possible transient effect. Importantly, pre-treatment with buthionine sulfoximine (BSO), an inhibitor of γ-GCS, prevented α-MeDA induced increase in GSH levels, but did not augment this metabolite cytotoxicity. Even so, BSO pre-treatment abolished NAC protective effects against α-MeDA neurotoxicity, which were, at least partially, due to GSH de novo synthesis. Inversely, pre-treatment of cells with BSO augmented N-Me-α-MeDA-induced neurotoxicity, but only slightly affected NAC neuroprotection. In conclusion, MDMA catechol metabolites promote differential toxic effects to differentiated dopaminergic human SH

  3. Dibutyryl cyclic AMP induces differentiation of human neuroblastoma SH-SY5Y cells into a noradrenergic phenotype.

    Science.gov (United States)

    Kume, Toshiaki; Kawato, Yuka; Osakada, Fumitaka; Izumi, Yasuhiko; Katsuki, Hiroshi; Nakagawa, Takayuki; Kaneko, Shuji; Niidome, Tetsuhiro; Takada-Takatori, Yuki; Akaike, Akinori

    2008-10-10

    Dibutyryl cyclic AMP (dbcAMP) and retinoic acid (RA) have been demonstrated to be the inducers of morphological differentiation in SH-SY5Y cells, a human catecholaminergic neuroblastoma cell line. However, it remains unclear whether morphologically differentiated SH-SY5Y cells by these compounds acquire catecholaminergic properties. We focused on the alteration of tyrosine hydroxylase (TH) expression and intracellular content of noradrenaline (NA) as the indicators of functional differentiation. Three days treatment with dbcAMP (1mM) and RA (10microM) induced morphological changes and an increase of TH-positive cells using immunocytochemical analysis in SH-SY5Y cells. The percentage of TH-expressing cells in dbcAMP (1mM) treatment was larger than that in RA (10microM) treatment. In addition, dbcAMP increased intracellular NA content, whereas RA did not. The dbcAMP-induced increase in TH-expressing cells is partially inhibited by KT5720, a protein kinase A (PKA) inhibitor. We also investigated the effect of butyrate on SH-SY5Y cells, because dbcAMP is enzymatically degraded by intracellular esterase, thereby resulting in the formation of butyrate. Butyrate induced the increase of NA content at lower concentrations than dbcAMP, although the increase in TH-expressing cells by butyrate was smaller than that by dbcAMP. The dbcAMP (1mM)- and butyrate (0.3mM)-induced increase in NA content was completely suppressed by alpha-methyl-p-tyrosine (1mM), an inhibitor of TH. These results suggest that dbcAMP induces differentiation into the noradrenergic phenotype through both PKA activation and butyrate.

  4. Differentiation of the SH-SY5Y Human Neuroblastoma Cell Line.

    Science.gov (United States)

    Shipley, Mackenzie M; Mangold, Colleen A; Szpara, Moriah L

    2016-02-17

    Having appropriate in vivo and in vitro systems that provide translational models for human disease is an integral aspect of research in neurobiology and the neurosciences. Traditional in vitro experimental models used in neurobiology include primary neuronal cultures from rats and mice, neuroblastoma cell lines including rat B35 and mouse Neuro-2A cells, rat PC12 cells, and short-term slice cultures. While many researchers rely on these models, they lack a human component and observed experimental effects could be exclusive to the respective species and may not occur identically in humans. Additionally, although these cells are neurons, they may have unstable karyotypes, making their use problematic for studies of gene expression and reproducible studies of cell signaling. It is therefore important to develop more consistent models of human neurological disease. The following procedure describes an easy-to-follow, reproducible method to obtain homogenous and viable human neuronal cultures, by differentiating the chromosomally stable human neuroblastoma cell line, SH-SY5Y. This method integrates several previously described methods(1-4) and is based on sequential removal of serum from media. The timeline includes gradual serum-starvation, with introduction of extracellular matrix proteins and neurotrophic factors. This allows neurons to differentiate, while epithelial cells are selected against, resulting in a homogeneous neuronal culture. Representative results demonstrate the successful differentiation of SH-SY5Y neuroblastoma cells from an initial epithelial-like cell phenotype into a more expansive and branched neuronal phenotype. This protocol offers a reliable way to generate homogeneous populations of neuronal cultures that can be used for subsequent biochemical and molecular analyses, which provides researchers with a more accurate translational model of human infection and disease.

  5. Binding of influenza A virus NS1 protein to the inter-SH2 domain of p85 suggests a novel mechanism for phosphoinositide 3-kinase activation.

    Science.gov (United States)

    Hale, Benjamin G; Batty, Ian H; Downes, C Peter; Randall, Richard E

    2008-01-18

    Influenza A virus NS1 protein stimulates host-cell phosphoinositide 3-kinase (PI3K) signaling by binding to the p85beta regulatory subunit of PI3K. Here, in an attempt to establish a mechanism for this activation, we report further on the functional interaction between NS1 and p85beta. Complex formation was found to be independent of NS1 RNA binding activity and is mediated by the C-terminal effector domain of NS1. Intriguingly, the primary direct binding site for NS1 on p85beta is the inter-SH2 domain, a coiled-coil structure that acts as a scaffold for the p110 catalytic subunit of PI3K. In vitro kinase activity assays, together with protein binding competition studies, reveal that NS1 does not displace p110 from the inter-SH2 domain, and indicate that NS1 can form an active heterotrimeric complex with PI3K. In addition, it was established that residues at the C terminus of the inter-SH2 domain are essential for mediating the interaction between p85beta and NS1. Equivalent residues in p85alpha have previously been implicated in the basal inhibition of p110. However, such p85alpha residues were unable to substitute for those in p85beta with regards NS1 binding. Overall, these data suggest a model by which NS1 activates PI3K catalytic activity by masking a normal regulatory element specific to the p85beta inter-SH2 domain.

  6. Crystal Structure of the FERM-SH2 Module of Human Jak2.

    Science.gov (United States)

    McNally, Randall; Toms, Angela V; Eck, Michael J

    2016-01-01

    Jak-family tyrosine kinases mediate signaling from diverse cytokine receptors. Binding of Jaks to their cognate receptors is mediated by their N-terminal region, which contains FERM and SH2 domains. Here we describe the crystal structure of the FERM-SH2 region of Jak2 at 3.0Å resolution. The structure reveals that these domains and their flanking linker segments interact intimately to form an integrated structural module. The Jak2 FERM-SH2 structure closely resembles that recently described for Tyk2, another member of the Jak family. While the overall architecture and interdomain orientations are preserved between Jak2 and Tyk2, we identify residues in the putative receptor-binding groove that differ between the two and may contribute to the specificity of receptor recognition. Analysis of Jak mutations that are reported to disrupt receptor binding reveals that they lie in the hydrophobic core of the FERM domain, and are thus expected to compromise the structural integrity of the FERM-SH2 unit. Similarly, analysis of mutations in Jak3 that are associated with severe combined immunodeficiency suggests that they compromise Jak3 function by destabilizing the FERM-SH2 structure.

  7. SH2 domains of the p85 alpha subunit of phosphatidylinositol 3-kinase regulate binding to growth factor receptors.

    Science.gov (United States)

    McGlade, C J; Ellis, C; Reedijk, M; Anderson, D; Mbamalu, G; Reith, A D; Panayotou, G; End, P; Bernstein, A; Kazlauskas, A

    1992-01-01

    The binding of cytoplasmic signaling proteins such as phospholipase C-gamma 1 and Ras GTPase-activating protein to autophosphorylated growth factor receptors is directed by their noncatalytic Src homology region 2 (SH2) domains. The p85 alpha regulatory subunit of phosphatidylinositol (PI) 3-kinase, which associates with several receptor protein-tyrosine kinases, also contains two SH2 domains. Both p85 alpha SH2 domains, when expressed individually as fusion proteins in bacteria, bound stably to the activated beta receptor for platelet-derived growth factor (PDGF). Complex formation required PDGF stimulation and was dependent on receptor tyrosine kinase activity. The bacterial p85 alpha SH2 domains recognized activated beta PDGF receptor which had been immobilized on a filter, indicating that SH2 domains contact autophosphorylated receptors directly. Several receptor tyrosine kinases within the PDGF receptor subfamily, including the colony-stimulating factor 1 receptor and the Steel factor receptor (Kit), also associate with PI 3-kinase in vivo. Bacterially expressed SH2 domains derived from the p85 alpha subunit of PI 3-kinase bound in vitro to the activated colony-stimulating factor 1 receptor and to Kit. We infer that the SH2 domains of p85 alpha bind to high-affinity sites on these receptors, whose creation is dependent on receptor autophosphorylation. The SH2 domains of p85 are therefore primarily responsible for the binding of PI 3-kinase to activated growth factor receptors. Images PMID:1372092

  8. Changes in signal transducer and activator of transcription 3 (STAT3) dynamics induced by complexation with pharmacological inhibitors of Src homology 2 (SH2) domain dimerization.

    Science.gov (United States)

    Resetca, Diana; Haftchenary, Sina; Gunning, Patrick T; Wilson, Derek J

    2014-11-21

    The activity of the transcription factor signal transducer and activator of transcription 3 (STAT3) is dysregulated in a number of hematological and solid malignancies. Development of pharmacological STAT3 Src homology 2 (SH2) domain interaction inhibitors holds great promise for cancer therapy, and a novel class of salicylic acid-based STAT3 dimerization inhibitors that includes orally bioavailable drug candidates has been recently developed. The compounds SF-1-066 and BP-1-102 are predicted to bind to the STAT3 SH2 domain. However, given the highly unstructured and dynamic nature of the SH2 domain, experimental confirmation of this prediction was elusive. We have interrogated the protein-ligand interaction of STAT3 with these small molecule inhibitors by means of time-resolved electrospray ionization hydrogen-deuterium exchange mass spectrometry. Analysis of site-specific evolution of deuterium uptake induced by the complexation of STAT3 with SF-1-066 or BP-1-102 under physiological conditions enabled the mapping of the in silico predicted inhibitor binding site to the STAT3 SH2 domain. The binding of both inhibitors to the SH2 domain resulted in significant local decreases in dynamics, consistent with solvent exclusion at the inhibitor binding site and increased rigidity of the inhibitor-complexed SH2 domain. Interestingly, inhibitor binding induced hot spots of allosteric perturbations outside of the SH2 domain, manifesting mainly as increased deuterium uptake, in regions of STAT3 important for DNA binding and nuclear localization. © 2014 by The American Society for Biochemistry and Molecular Biology, Inc.

  9. Survivin knockdown increased anti-cancer effects of (−)-epigallocatechin-3-gallate in human malignant neuroblastoma SK-N- BE2 and SH-SY5Y cells

    Science.gov (United States)

    Hossain, Md. Motarab; Banik, Naren L.; Ray, Swapan K.

    2012-01-01

    Neuroblastoma is a solid tumor that mostly occurs in children. Malignant neuroblastomas have poor prognosis because conventional chemotherapeutic agents are hardly effective. Survivin, which is highly expressed in some malignant neuroblastomas, plays a significant role in inhibiting differentiation and apoptosis and promoting cell proliferation, invasion, and angiogenesis. We examined consequences of survivin knockdown by survivin short hairpin RNA (shRNA) plasmid and then treatment with (−)-epigallocatechin-3-gallate (EGCG), a green tea flavonoid, in malignant neuroblastoma cells. Our Western blotting and laser scanning confocal immunofluorescence microscopy showed that survivin was highly expressed in malignant neuroblastoma SK-N-BE2 and SH-SY5Y cell lines and slightly in SK-N-DZ cell line. Expression of survivin was very faint in malignant neuroblastoma IMR32 cell line. We transfected SK-N-BE2 and SH-SY-5Y cells with survivin shRNA, treated with EGCG, and confirmed knockdown of survivin at mRNA and protein levels. Survivin knockdown induced morphological features of neuronal differentiation, as we observed following in situ methylene blue staining. Combination of survivin shRNA and EGCG promoted neuronal differentiation biochemically by increases in expression of NFP, NSE, and e-cadherin and also decreases in expression of Notch-1, ID2, hTERT, and PCNA. Our in situ Wright staining and Annexin V-FITC/PI staining showed that combination therapy was highly effective in inducing, respectively, morphological and biochemical features of apoptosis. Apoptosis occurred with activation of caspase-8 and cleavage of Bid to tBid, increase in Bax:Bcl-2 ratio, mitochondrial release of cytochrome c, and increases in expression and activity of calpain and caspase-3. Combination therapy decreased migration of cells through matrigel and inhibited proliferative (p-Akt and NF-κB), invasive (MMP-2 and MMP-9), and angiogenic (VEGF and b-FGF) factors. Also, in vitro network

  10. FGF1 protects neuroblastoma SH-SY5Y cells from p53-dependent apoptosis through an intracrine pathway regulated by FGF1 phosphorylation

    Science.gov (United States)

    Pirou, Caroline; Montazer-Torbati, Fatemeh; Jah, Nadège; Delmas, Elisabeth; Lasbleiz, Christelle; Mignotte, Bernard; Renaud, Flore

    2017-01-01

    Neuroblastoma, a sympathetic nervous system tumor, accounts for 15% of cancer deaths in children. In contrast to most human tumors, p53 is rarely mutated in human primary neuroblastoma, suggesting impaired p53 activation in neuroblastoma. Various studies have shown correlations between fgf1 expression levels and both prognosis severity and tumor chemoresistance. As we previously showed that fibroblast growth factor 1 (FGF1) inhibited p53-dependent apoptosis in neuron-like PC12 cells, we initiated the study of the interaction between the FGF1 and p53 pathways in neuroblastoma. We focused on the activity of either extracellular FGF1 by adding recombinant rFGF1 in media, or of intracellular FGF1 by overexpression in human SH-SY5Y and mouse N2a neuroblastoma cell lines. In both cell lines, the genotoxic drug etoposide induced a classical mitochondrial p53-dependent apoptosis. FGF1 was able to inhibit p53-dependent apoptosis upstream of mitochondrial events in SH-SY5Y cells by both extracellular and intracellular pathways. Both rFGF1 addition and etoposide treatment increased fgf1 expression in SH-SY5Y cells. Conversely, rFGF1 or overexpressed FGF1 had no effect on p53-dependent apoptosis and fgf1 expression in neuroblastoma N2a cells. Using different FGF1 mutants (that is, FGF1K132E, FGF1S130A and FGF1S130D), we further showed that the C-terminal domain and phosphorylation of FGF1 regulate its intracrine anti-apoptotic activity in neuroblastoma SH-SY5Y cells. This study provides the first evidence for a role of an intracrine growth factor pathway on p53-dependent apoptosis in neuroblastoma, and could lead to the identification of key regulators involved in neuroblastoma tumor progression and chemoresistance. PMID:29048426

  11. Palmitic acid induces neurotoxicity and gliatoxicity in SH-SY5Y human neuroblastoma and T98G human glioblastoma cells

    Directory of Open Access Journals (Sweden)

    Yee-Wen Ng

    2018-04-01

    Full Text Available Background Obesity-related central nervous system (CNS pathologies like neuroinflammation and reactive gliosis are associated with high-fat diet (HFD related elevation of saturated fatty acids like palmitic acid (PA in neurons and astrocytes of the brain. Methods Human neuroblastoma cells SH-SY5Y (as a neuronal model and human glioblastoma cells T98G (as an astrocytic model, were treated with 100–500 µM PA, oleic acid (OA or lauric acid (LA for 24 h or 48 h, and their cell viability was assessed by 3-(4,5-dimetylthiazol-2-yl-2,5-diphenyltetrazolium bromide (MTT assay. The effects of stable overexpression of γ-synuclein (γ-syn, a neuronal protein recently recognized as a novel regulator of lipid handling in adipocytes, and transient overexpression of Parkinson’s disease (PD α-synuclein [α-syn; wild-type (wt and its pathogenic mutants A53T, A30P and E46K] in SH-SY5Y and T98G cells, were also evaluated. The effects of co-treatment of PA with paraquat (PQ, a Parkinsonian pesticide, and leptin, a hormone involved in the brain-adipose axis, were also assessed. Cell death mode and cell cycle were analyzed by Annexin V/PI flow cytometry. Reactive oxygen species (ROS level was determined using 2′,7′-dichlorofluorescien diacetate (DCFH-DA assay and lipid peroxidation level was determined using thiobarbituric acid reactive substances (TBARS assay. Results MTT assay revealed dose- and time-dependent PA cytotoxicity on SH-SY5Y and T98G cells, but not OA and LA. The cytotoxicity was significantly lower in SH-SY5Y-γ-syn cells, while transient overexpression of wt α-syn or its PD mutants (A30P and E46K, but not A53T modestly (but still significantly rescued the cytotoxicity of PA in SH-SY5Y and T98G cells. Co-treatment of increasing concentrations of PQ exacerbated PA’s neurotoxicity. Pre-treatment of leptin, an anti-apoptotic adipokine, did not successfully rescue SH-SY5Y cells from PA-induced cytotoxicity—suggesting a mechanism of PA

  12. SH3 Domains Differentially Stimulate Distinct Dynamin I Assembly Modes and G Domain Activity.

    Directory of Open Access Journals (Sweden)

    Sai Krishnan

    Full Text Available Dynamin I is a highly regulated GTPase enzyme enriched in nerve terminals which mediates vesicle fission during synaptic vesicle endocytosis. One regulatory mechanism involves its interactions with proteins containing Src homology 3 (SH3 domains. At least 30 SH3 domain-containing proteins bind dynamin at its proline-rich domain (PRD. Those that stimulate dynamin activity act by promoting its oligomerisation. We undertook a systematic parallel screening of 13 glutathione-S-transferase (GST-tagged endocytosis-related SH3 domains on dynamin binding, GTPase activity and oligomerisation. No correlation was found between dynamin binding and their potency to stimulate GTPase activity. There was limited correlation between the extent of their ability to stimulate dynamin activity and the level of oligomerisation, indicating an as yet uncharacterised allosteric coupling of the PRD and G domain. We examined the two variants, dynamin Iab and Ibb, which differ in the alternately splice middle domain α2 helix. They responded differently to the panel of SH3s, with the extent of stimulation between the splice variants varying greatly between the SH3s. This study reveals that SH3 binding can act as a heterotropic allosteric regulator of the G domain via the middle domain α2 helix, suggesting an involvement of this helix in communicating the PRD-mediated allostery. This indicates that SH3 binding both stabilises multiple conformations of the tetrameric building block of dynamin, and promotes assembly of dynamin-SH3 complexes with distinct rates of GTP hydrolysis.

  13. Novel multiplexed assay for identifying SH2 domain antagonists of STAT family proteins.

    Science.gov (United States)

    Takakuma, Kazuyuki; Ogo, Naohisa; Uehara, Yutaka; Takahashi, Susumu; Miyoshi, Nao; Asai, Akira

    2013-01-01

    Some of the signal transducer and activator of transcription (STAT) family members are constitutively activated in a wide variety of human tumors. The activity of STAT depends on their Src homology 2 (SH2) domain-mediated binding to sequences containing phosphorylated tyrosine. Thus, antagonizing this binding is a feasible approach to inhibiting STAT activation. We have developed a novel multiplexed assay for STAT3- and STAT5b-SH2 binding, based on amplified luminescent proximity homogeneous assay (Alpha) technology. AlphaLISA and AlphaScreen beads were combined in a single-well assay, which allowed the binding of STAT3- and STAT5b-SH2 to phosphotyrosine peptides to be simultaneously monitored. Biotin-labeled recombinant human STAT proteins were obtained as N- and C-terminal deletion mutants. The spacer length of the DIG-labeled peptide, the reaction time, and the concentration of sodium chloride were optimized to establish a HTS system with Z' values of greater than 0.6 for both STAT3- and STAT5b-SH2 binding. We performed a HTS campaign for chemical libraries using this multiplexed assay and identified hit compounds. A 2-chloro-1,4-naphthalenedione derivative, Compound 1, preferentially inhibited STAT3-SH2 binding in vitro, and the nuclear translocation of STAT3 in HeLa cells. Initial structure activity relationship (SAR) studies using the multiplexed assay showed the 3-substituent effect on both the activity and selectivity of STAT3 and STAT5b inhibition. Therefore, this multiplexed assay is useful for not only searching for potential lead compounds but also obtaining SAR data for developing new STAT3/STAT5b inhibitors.

  14. Cold Shock Induced Protein RBM3 but Not Mild Hypothermia Protects Human SH-SY5Y Neuroblastoma Cells From MPP+-Induced Neurotoxicity

    Directory of Open Access Journals (Sweden)

    Hai-Jie Yang

    2018-05-01

    Full Text Available The cold shock protein RBM3 can mediate mild hypothermia-related protection in neurodegeneration such as Alzheimer's disease. However, it remains unclear whether RBM3 and mild hypothermia provide same protection in model of Parkinson's disease (PD, the second most common neurodegenerative disorder. In this study, human SH-SY5Y neuroblastoma cells subjected to insult by 1-methyl-4-phenylpyridinium (MPP+ served as an in-vitro model of PD. Mild hypothermia (32°C aggravated MPP+-induced apoptosis, which was boosted when RBM3 was silenced by siRNA. In contrast, overexpression of RBM3 significantly reduced this apoptosis. MPP+ treatment downregulated the expression of RBM3 both endogenously and exogenously and suppressed its induction by mild hypothermia (32°C. In conclusion, our data suggest that cold shock protein RBM3 provides neuroprotection in a cell model of PD, suggesting that RBM3 induction may be a suitable strategy for PD therapy. However, mild hypothermia exacerbates MPP+-induced apoptosis even that RBM3 could be synthesized during mild hypothermia.

  15. Inhibition of STAT-3 results in radiosensitization of human squamous cell carcinoma

    International Nuclear Information System (INIS)

    Bonner, James A.; Trummell, Hoa Q.; Willey, Christopher D.; Plants, Brian A.; Raisch, Kevin P.

    2009-01-01

    Background: Signal transducer and activator of transcription-3 (STAT-3) is a downstream component of the Epidermal Growth Factor Receptor (EGFr) signaling process that may facilitate the resistance of tumor cells to conventional cancer treatments. Studies were performed to determine if inhibition of this downstream protein produces radiosensitization. Methods/Results: A431 cells (human squamous cell carcinoma cells with EGFr overexpression) were found to be sensitized to radiation after treatment with STAT-3 small interfering RNA (siRNA). Therefore, a short hairpin RNA (shRNA) against STAT-3 was designed and cloned into a pBABE vector system modified for shRNA expression. Following transfection, clone 2.1 was selected for further study as it showed a dramatic reduction of STAT-3 protein (and mRNA) when compared to A431 parental cells or a negative control shRNA cell line (transfected with STAT-3 shRNA with 2 base pairs mutated). A431 2.1 showed doubling times of 25-31 h as compared to 18-24 h for the parental cell line. The A431 shRNA knockdown STAT-3 cells A431 were more sensitive to radiation than A431 parental or negative STAT-3 control cells. Conclusion: A431 cells stably transfected with shRNA against STAT-3 resulted in enhanced radiosensitivity. Further work will be necessary to determine whether the inhibition of STAT-3 phosphorylation is a necessary step for the radiosensitization that is induced by the inhibition of EGFr.

  16. Preclinical Justification of pbi-shRNA EWS/FLI1 Lipoplex (LPX) Treatment for Ewing's Sarcoma.

    Science.gov (United States)

    Rao, Donald D; Jay, Christopher; Wang, Zhaohui; Luo, Xiuquan; Kumar, Padmasini; Eysenbach, Hilary; Ghisoli, Maurizio; Senzer, Neil; Nemunaitis, John

    2016-08-01

    The EWS/FLI1 fusion gene is well characterized as a driver of Ewing's sarcoma. Bi-shRNA EWS/FLI1 is a functional plasmid DNA construct that transcribes both siRNA and miRNA-like effectors each of which targets the identical type 1 translocation junction region of the EWS/FLI1 transcribed mRNA sequence. Previous preclinical and clinical studies confirm the safety of this RNA interference platform technology and consistently demonstrate designated mRNA and protein target knockdown at greater than 90% efficiency. We initiated development of pbi-shRNA EWS/FLI1 lipoplex (LPX) for the treatment of type 1 Ewing's sarcoma. Clinical-grade plasmid was manufactured and both sequence and activity verified. Target protein and RNA knockdown of 85-92% was demonstrated in vitro in type 1 human Ewing's sarcoma tumor cell lines with the optimal bi-shRNA EWS/FLI1 plasmid. This functional plasmid was placed in a clinically tested, liposomal (LP) delivery vehicle followed by in vivo verification of activity. Type 1 Ewing's sarcoma xenograft modeling confirmed dose related safety and tumor response to pbi-shRNA EWS/FLI1 LPX. Toxicology studies in mini-pigs with doses comparable to the demonstrated in vivo efficacy dose resulted in transient fever, occasional limited hypertension at low- and high-dose assessment and transient liver enzyme elevation at high dose. These results provide the justification to initiate clinical testing.

  17. Computational analysis and prediction of the binding motif and protein interacting partners of the Abl SH3 domain.

    Directory of Open Access Journals (Sweden)

    Tingjun Hou

    2006-01-01

    Full Text Available Protein-protein interactions, particularly weak and transient ones, are often mediated by peptide recognition domains, such as Src Homology 2 and 3 (SH2 and SH3 domains, which bind to specific sequence and structural motifs. It is important but challenging to determine the binding specificity of these domains accurately and to predict their physiological interacting partners. In this study, the interactions between 35 peptide ligands (15 binders and 20 non-binders and the Abl SH3 domain were analyzed using molecular dynamics simulation and the Molecular Mechanics/Poisson-Boltzmann Solvent Area method. The calculated binding free energies correlated well with the rank order of the binding peptides and clearly distinguished binders from non-binders. Free energy component analysis revealed that the van der Waals interactions dictate the binding strength of peptides, whereas the binding specificity is determined by the electrostatic interaction and the polar contribution of desolvation. The binding motif of the Abl SH3 domain was then determined by a virtual mutagenesis method, which mutates the residue at each position of the template peptide relative to all other 19 amino acids and calculates the binding free energy difference between the template and the mutated peptides using the Molecular Mechanics/Poisson-Boltzmann Solvent Area method. A single position mutation free energy profile was thus established and used as a scoring matrix to search peptides recognized by the Abl SH3 domain in the human genome. Our approach successfully picked ten out of 13 experimentally determined binding partners of the Abl SH3 domain among the top 600 candidates from the 218,540 decapeptides with the PXXP motif in the SWISS-PROT database. We expect that this physical-principle based method can be applied to other protein domains as well.

  18. Detection and characterization of partially unfolded oligomers of the SH3 domain of α-Spectrin

    NARCIS (Netherlands)

    Casares, S.; Sadqi, M.; López-Mayorga, O.; Conejero-Lara, F.; van Nuland, N.A.J.

    2004-01-01

    For the purpose of equilibrium and kinetic folding-unfolding studies, the SH3 domain of α-spectrin (spc-SH3) has long been considered a classic two-state folding protein. In this work we have indeed observed that the thermal unfolding curves of spc-SH3 measured at pH 3.0 by differential scanning

  19. Individual contributions of the human metapneumovirus F, G, and SH surface glycoproteins to the induction of neutralizing antibodies and protective immunity

    International Nuclear Information System (INIS)

    Skiadopoulos, Mario H.; Biacchesi, Stephane; Buchholz, Ursula J.; Amaro-Carambot, Emerito; Surman, Sonja R.; Collins, Peter L.; Murphy, Brian R.

    2006-01-01

    We evaluated the individual contributions of the three surface glycoproteins of human metapneumovirus (HMPV), namely the fusion F, attachment G, and small hydrophobic SH proteins, to the induction of serum HMPV-binding antibodies, serum HMPV-neutralizing antibodies, and protective immunity. Using reverse genetics, each HMPV protein was expressed individually from an added gene in recombinant human parainfluenza virus type 1 (rHPIV1) and used to infect hamsters once or twice by the intranasal route. The F protein was highly immunogenic and protective, whereas G and SH were only weakly or negligibly immunogenic and protective, respectively. Thus, in contrast to other paramyxoviruses, the HMPV attachment G protein is not a major neutralization or protective antigen. Also, although the SH protein of HMPV is a virion protein that is much larger than its counterparts in previously studied paramyxoviruses, it does not appear to be a significant neutralization or protective antigen

  20. Inhibition of WNT signaling reduces differentiation and induces sensitivity to doxorubicin in human malignant neuroblastoma SH-SY5Y cells.

    Science.gov (United States)

    Suebsoonthron, Junjira; Jaroonwitchawan, Thiranut; Yamabhai, Montarop; Noisa, Parinya

    2017-06-01

    Neuroblastoma is one of the most common cancers in infancy, arising from the neuroblasts during embryonic development. This cancer is difficult to treat and resistance to chemotherapy is often found; therefore, clinical trials of novel therapeutic approaches, such as targeted-cancer signaling, could be an alternative for a better treatment. WNT signaling plays significant roles in the survival, proliferation, and differentiation of human neuroblastoma. In this report, WNT signaling of a malignant human neuroblastoma cell line, SH-SY5Y cells, was inhibited by XAV939, a specific inhibitor of the Tankyrase enzyme. XAV939 treatment led to the reduction of β-catenin within the cells, confirming its inhibitory effect of WNT. The inhibition of WNT signaling by XAV939 did not affect cell morphology, survival, and proliferation; however, the differentiation and sensitivity to anticancer drugs of human neuroblastoma cells were altered. The treatment of XAV939 resulted in the downregulation of mature neuronal markers, including β-tubulin III, PHOX2A, and PHOX2B, whereas neural progenitor markers (PAX6, TFAP2α, and SLUG) were upregulated. In addition, the combination of XAV939 significantly enhanced the sensitivity of SH-SY5Y and IMR-32 cells to doxorubicin in both 2D and 3D culture systems. Microarray gene expression profiling suggested numbers of candidate target genes of WNT inhibition by XAV939, in particular, p21, p53, ubiquitin C, ZBED8, MDM2, CASP3, and FZD1, and this explained the enhanced sensitivity of SH-SY5Y cells to doxorubicin. Altogether, these results proposed that the altered differentiation of human malignant neuroblastoma cells by inhibiting WNT signaling sensitized the cells to anticancer drugs. This approach could thus serve as an effective treatment option for aggressive brain malignancy.

  1. Physical and functional interactions between SH2 and SH3 domains of the Src family protein tyrosine kinase p59fyn

    NARCIS (Netherlands)

    Panchamoorthy, G.; Fukazawa, T.; Stolz, L.; Payne, G.; Reedquist, K.; Shoelson, S.; Songyang, Z.; Cantley, L.; Walsh, C.; Band, H.

    1994-01-01

    The Src family protein tyrosine kinases participate in signalling through cell surface receptors that lack intrinsic tyrosine kinase domains. All nine members of this family possess adjacent Src homology (SH2 and SH3) domains, both of which are essential for repression of the enzymatic activity. The

  2. Effects and mechanism of integrin-β1 gene expression inhibited by shRNA in invasion of pancreatic carcinoma PANC-1 cells.

    Science.gov (United States)

    Yu, Feng; Li, Hua; Bu, Xuefeng; Zhang, Yongjun

    2012-01-01

    To investigate the effects of integrin-β1 gene expression inhibited by shRNA on invasion of pancreatic carcinoma PANC-1 cells in vitro. The eukaryotic expression plasmid of short hairpin RNA (shRNA) targeting integrin-β1 gene (integrin-β1-shRNA) was constructed and transfected into PANC-1 cells. The expressions of integrin-β1 mRNA and protein were detected by real-time quantitative polymerase chain reaction (PCR) and western blot assay, respectively. The invasive ability of PANC-1 cells was observed with a transwell cell culture chamber and the expressions of MMP-2 and MMP-9 were assayed. Compared to the untransfected group, recombinant expression plasmid integrin-β1-shRNA resulted in reduction of integrin-β1 mRNA and protein by 78.58%±7.24% and 92.88%±3.18%, respectively and the average number of invading PANC-1 cells were decreased from 52±5 to 21±4 (pPANC-1 cells in vitro significantly.

  3. The ShcA SH2 domain engages a 14-3-3/PI3'K signaling complex and promotes breast cancer cell survival.

    Science.gov (United States)

    Ursini-Siegel, J; Hardy, W R; Zheng, Y; Ling, C; Zuo, D; Zhang, C; Podmore, L; Pawson, T; Muller, W J

    2012-11-29

    The ShcA adapter protein transmits activating signals downstream of receptor and cytoplasmic tyrosine kinases through the establishment of phosphotyrosine-dependent complexes. In this regard, ShcA possesses both a phosphotyrosine-binding domain (PTB) and Src homology 2 domain (SH2), which bind phosphotyrosine residues in a sequence-specific manner. Although the majority of receptor tyrosine kinases expressed in breast cancer cells bind the PTB domain, very little is known regarding the biological importance of SH2-driven ShcA signaling during mammary tumorigenesis. To address this, we employed transgenic mice expressing a mutant ShcA allele harboring a non-functional SH2 domain (ShcR397K) under the transcriptional control of the endogenous ShcA promoter. Using transplantation approaches, we demonstrate that SH2-dependent ShcA signaling within the mammary epithelial compartment is essential for breast tumor outgrowth, survival and the development of lung metastases. We further show that the ShcA SH2 domain activates the AKT pathway, potentially through a novel SH2-mediated complex between ShcA, 14-3-3ζ and the p85 regulatory subunit of phosphatidylinositol 3 (PI3') kinase. This study is the first to demonstrate that the SH2 domain of ShcA is critical for tumor survival during mammary tumorigenesis.

  4. Photodissociation dynamics of CH3C(O)SH in argon matrix: A QM/MM nonadiabatic dynamics simulation

    Science.gov (United States)

    Xia, Shu-Hua; Liu, Xiang-Yang; Fang, Qiu; Cui, Ganglong

    2015-11-01

    In this work, we have first employed the combined quantum mechanics/molecular mechanics (QM/MM) method to study the photodissociation mechanism of thioacetic acid CH3C(O)SH in the S1, T1, and S0 states in argon matrix. CH3C(O)SH is treated quantum mechanically using the complete active space self-consistent field and complete active space second-order perturbation theory methods; argon matrix is described classically using Lennard-Jones potentials. We find that the C-S bond fission is predominant due to its small barriers of ca. 3.0 and 1.0 kcal/mol in the S1 and T1 states. It completely suppresses the nearby C—C bond fission. After the bond fission, the S1 radical pair of CH3CO and SH can decay to the S0 and T1 states via internal conversion and intersystem crossing, respectively. In the S0 state, the radical pair can either recombine to form CH3C(O)SH or proceed to form molecular products of CH2CO and H2S. We have further employed our recently developed QM/MM generalized trajectory-based surface-hopping method to simulate the photodissociation dynamics of CH3C(O)SH. In 1 ps dynamics simulation, 56% trajectories stay at the Franck-Condon region; the S1 C—S bond fission takes place in the remaining 44% trajectories. Among all nonadiabatic transitions, the S1 → S0 internal conversion is major (55%) but the S1 → T1 intersystem crossing is still comparable and cannot be ignored, which accounts for 28%. Finally, we have found a radical channel generating the molecular products of CH2CO and H2S, which is complementary to the concerted molecular channel. The present work sets the stage for simulating photodissociation dynamics of similar thio-carbonyl systems in matrix.

  5. Evaluation of the neurotoxic/neuroprotective role of organoselenides using differentiated human neuroblastoma SH-SY5Y cell line challenged with 6-hydroxydopamine.

    Science.gov (United States)

    Lopes, Fernanda Martins; Londero, Giovana Ferreira; de Medeiros, Liana Marengo; da Motta, Leonardo Lisbôa; Behr, Guilherme Antônio; de Oliveira, Valeska Aguiar; Ibrahim, Mohammad; Moreira, José Cláudio Fonseca; Porciúncula, Lisiane de Oliveira; da Rocha, João Batista Teixeira; Klamt, Fábio

    2012-08-01

    It is well established that oxidative stress plays a major role in several neurodegenerative conditions, like Parkinson disease (PD). Hence, there is an enormous effort for the development of new antioxidants compounds with therapeutic potential for the management of PD, such as synthetic organoselenides molecules. In this study, we selected between nine different synthetic organoselenides the most eligible ones for further neuroprotection assays, using the differentiated human neuroblastoma SH-SY5Y cell line as in vitro model. Neuronal differentiation of exponentially growing human neuroblastoma SH-SY5Y cells was triggered by cultivating cells with DMEM/F12 medium with 1% of fetal bovine serum (FBS) with the combination of 10 μM retinoic acid for 7 days. Differentiated cells were further incubated with different concentrations of nine organoselenides (0.1, 0.3, 3, 10, and 30 μM) for 24 h and cell viability, neurites densities and the immunocontent of neuronal markers were evaluated. Peroxyl radical scavenging potential of each compound was determined with TRAP assay. Three organoselenides tested presented low cytotoxicity and high antioxidant properties. Pre-treatment of cells with those compounds for 24 h lead to a significantly neuroprotection against 6-hydroxydopamine (6-OHDA) toxicity, which were directly related to their antioxidant properties. Neuroprotective activity of all three organoselenides was compared to diphenyl diselenide (PhSe)₂, the simplest of the diaryl diselenides tested. Our results demonstrate that differentiated human SH-SY5Y cells are suitable cellular model to evaluate neuroprotective/neurotoxic role of compounds, and support further evaluation of selected organoselenium molecules as potential pharmacological and therapeutic drugs in the treatment of PD.

  6. [Effect of ginsenoside Rg3 on Pim-3 and Bad proteins in human pancreatic cancer cell line PANC-1].

    Science.gov (United States)

    Jian, Jie; Hu, Zhi-Fang; Huang, Yuan

    2009-05-01

    Ginsenoside Rg3 is a traditional Chinese medicine monomer which possesses anticancer effects. This study was to investigate the effects of ginsenoside Rg3 on Pim-3 and phosphorylated Bad (pBad) proteins, pBad (Ser112) and pBad (Ser136) in human pancreatic cancer cell line PANC-1. PANC-1 cells were exposed to 10, 20, 40 and 80 micromol/L ginsenoside Rg3 for 24 h. A short hairpin RNA (shRNA) of Pim-3 was cloned and inserted into a eukaryotic expression vector pSilencer 3.1-H1 Neo to construct pSilencer 3.1-H1 Neo-Pim-3. pSilencer 3.1-H1 Neo-Pim-3 was then transfected into PANC-1 cells. Cell proliferation was measured by MTT assay; cell apoptosis was observed under an invert microscope and measured by flow cytometry with Annexin V/PI staining; protein expressions of Pim-3, Bad, pBad (Ser112) and pBad (Ser136) were measured by Western blot. The inhibitory rates of 10, 20, 40 and 80 micromol/L ginsenoside Rg3 on PANC-1 cells were 20.2%, 33.4%, 52.8% and 65.3%, respectively. Typical morphological changes in apoptosis were induced by ginsenoside Rg3. The apoptotic rate of PANC-1 cells was significantly higher in the ginsenoside Rg3 treatment group (80 micromol/L) than in the control group (12.2% vs. 3.3%, PPANC-1 cells. Compared with the control group, the percentages of early and total apoptotic cells were significantly increased in PANC-1 cells transfected with pim-3-shRNA [(11.5+/-3.7)% vs. (5.8+/-2.2)%,P<0.01;(20.8+/-2.6)% vs.(13.0+/-4.1)%,P<0.05], while the expressions of pim-3 and pBad (Ser112) were both decreased. The anti-tumor effect of ginsenoside Rg3 may be associated with the decrease of Pim-3 and pBad (Ser112).

  7. Neuroprotection via RNA-binding protein RBM3 expression is regulated by hypothermia but not by hypoxia in human SK-N-SH neurons

    Directory of Open Access Journals (Sweden)

    Rosenthal LM

    2017-05-01

    Full Text Available Lisa-Maria Rosenthal,1 Giang Tong,1 Christoph Walker,1 Sylvia J Wowro,1 Jana Krech,1 Constanze Pfitzer,1,2 Georgia Justus,1 Felix Berger,1,3 Katharina Rose Luise Schmitt1 1Department of Congenital Heart Disease/Pediatric Cardiology, German Heart Institute Berlin, 2Berlin Institute of Health (BIH, 3Department of Pediatric Cardiology, Charité – University Medical Center, Berlin, Germany Objective: Therapeutic hypothermia is an established treatment for perinatal asphyxia. Yet, many term infants continue to die or suffer from neurodevelopmental disability. Several experimental studies have demonstrated a beneficial effect of mild-to-moderate hypothermia after hypoxic injury, but the understanding of hypothermia-induced neuroprotection remains incomplete. In general, global protein synthesis is attenuated by hypothermia, but a small group of RNA-binding proteins including the RNA-binding motif 3 (RBM3 is upregulated in response to cooling. The aim of this study was to establish an in vitro model to investigate the effects of hypoxia and hypothermia on neuronal cell survival, as well as to examine the kinetics of concurrent cold-shock protein RBM3 gene expression. Methods: Experiments were performed by using human SK-N-SH neurons exposed to different oxygen concentrations (21%, 8%, or 0.2% O2 for 24 hours followed by moderate hypothermia (33.5°C or normothermia for 24, 48, or 72 hours. Cell death was determined by quantification of lactate dehydrogenase and neuron-specific enolase releases into the cell cultured medium, and cell morphology was assessed by using immunofluorescence staining. The regulation of RBM3 gene expression was assessed by reverse transcriptase-quantitative polymerase chain reaction and Western blot analysis.Results: Exposure to hypoxia (0.2% O2 for 24 hours resulted in significantly increased cell death in SK-N-SH neurons, whereas exposure to 8% O2 had no significant impact on cell viability. Post-hypoxia treatment with

  8. Evidence of site-specific fragmentation on thioacetic acid, CH3C(O)SH, irradiated with synchrotron radiation around the S 2p and O 1s regions.

    Science.gov (United States)

    Erben, Mauricio F; Geronés, Mariana; Romano, Rosana M; Della Védova, Carlos O

    2006-01-26

    Site-specific fragmentations following S 2p and O 1s photoexcitation of thioacetic acid, CH3C(O)SH, have been studied by means of synchrotron radiation. Total ion yield (TIY) spectra were measured and multicoincidence techniques, which include photoelectron-photoion coincidence (PEPICO) and photoelectron-photoion-photoion coincidence (PEPIPICO) time-of-flight mass spectrometry, were applied. The equivalent-core approximation was employed in order to estimate ionization transition values, and the observed peaks were tentatively assigned. A site-specific fragmentation is moderately observed by comparing the mass spectra collected at resonant energies around the inner and shallow inner shell S 2p and O 1s ionization edges. Beside H+ ion, the most abundant ions observed at the S 2p edge excitation were CH3CO+, SH+, S+, and CH3+. At the O 1s region the large CH3CO+ fragment was depressed, and small CHx+ (x = 0, 1, 2, 3), S+, and SH+ fragments were dominant. The dissociation dynamic for the main ion-pair production has been discussed. Two- and three-body dissociation channels have been observed in the PEPIPICO spectra, and the dissociation mechanisms were proposed.

  9. Preclinical Biodistribution and Safety Evaluation of a pbi-shRNA STMN1 Lipoplex after Subcutaneous Delivery.

    Science.gov (United States)

    Wang, Zhaohui; Jay, Christopher M; Evans, Courtney; Kumar, Padmasini; Phalon, Connor; Rao, Donald D; Senzer, Neil; Nemunaitis, John

    2017-02-01

    Stathmin-1 (STMN1) is a microtubule-destabilizing protein which is overexpressed in cancer. Its overexpression is associated with poor prognosis and also serves as a predictive marker to taxane therapy. We have developed a proprietary bi-functional shRNA (bi-shRNA) platform to execute RNA interference (RNAi)-mediated gene silencing and a liposome-carrier complex to systemically deliver the pbi-shRNA plasmids. In vitro and in vivo testing demonstrated efficacy and specificity of pbi-shRNA plasmid in targeting STMN1 (Phadke, A. P., Jay, C. M., Wang, Z., Chen, S., Liu, S., Haddock, C., Kumar, P., Pappen, B. O., Rao, D. D., Templeton, N. S., et al. (2011). In vivo safety and antitumor efficacy of bifunctional small hairpin RNAs specific for the human Stathmin 1 oncoprotein. DNA Cell Biol. 30, 715-726.). Biodistribution and toxicology studies in bio-relevant Sprague Dawley rats with pbi-shRNA STMN1 lipoplex revealed that the plasmid DNA was delivered to a broad distribution of organs after a single subcutaneous injection. Specifically, plasmid was detected within the first week using QPCR (threshold 50 copies plasmid/1 µg genomic DNA) at the injection site, lung, spleen, blood, skin, ovary (limited), lymph nodes, and liver. It was not detected in the heart, testis or bone marrow. No plasmid was detected from any organ 30 days after injection. Treatment was well tolerated. Minimal inflammation/erythema was observed at the injection site. Circulating cytokine response was also examined by ELISA. The IL-6 levels were induced within 6 h then declined to the vehicle control level 72 h after the injection. TNFα induction was transiently observed 4 days after the DNA lipoplex treatment. In summary, the pbi-shRNA STMN1 lipoplex was well tolerated and displayed broad distribution after a single subcutaneous injection. The pre-clinical data has been filed to FDA and the pbi-shRNA STMN1 lipoplex is being investigated in a phase I clinical study. © The Author 2016. Published

  10. SH2 domains: modulators of nonreceptor tyrosine kinase activity.

    Science.gov (United States)

    Filippakopoulos, Panagis; Müller, Susanne; Knapp, Stefan

    2009-12-01

    The Src homology 2 (SH2) domain is a sequence-specific phosphotyrosine-binding module present in many signaling molecules. In cytoplasmic tyrosine kinases, the SH2 domain is located N-terminally to the catalytic kinase domain (SH1) where it mediates cellular localization, substrate recruitment, and regulation of kinase activity. Initially, structural studies established a role of the SH2 domain stabilizing the inactive state of Src family members. However, biochemical characterization showed that the presence of the SH2 domain is frequently required for catalytic activity, suggesting a crucial function stabilizing the active state of many nonreceptor tyrosine kinases. Recently, the structure of the SH2-kinase domain of Fes revealed that the SH2 domain stabilizes the active kinase conformation by direct interactions with the regulatory helix alphaC. Stabilizing interactions between the SH2 and the kinase domains have also been observed in the structures of active Csk and Abl. Interestingly, mutations in the SH2 domain found in human disease can be explained by SH2 domain destabilization or incorrect positioning of the SH2. Here we summarize our understanding of mechanisms that lead to tyrosine kinase activation by direct interactions mediated by the SH2 domain and discuss how mutations in the SH2 domain trigger kinase inactivation.

  11. Understanding the role of BAR and SH3 domain-containing proteins in fungi

    NARCIS (Netherlands)

    Gkourtsa, A.

    2017-01-01

    This thesis addresses the role of SH3 and BAR domain-containing proteins in different fungal species. SH3 domains are small modules that mediate protein-protein interactions and BAR domains are dimerization domains with membrane binding and bending properties. It is known that the ScRvs167 protein

  12. Disruption of Fyn SH3 domain interaction with a proline-rich motif in liver kinase B1 results in activation of AMP-activated protein kinase.

    Directory of Open Access Journals (Sweden)

    Eijiro Yamada

    Full Text Available Fyn-deficient mice display increased AMP-activated Protein Kinase (AMPK activity as a result of Fyn-dependent regulation of Liver Kinase B1 (LKB1 in skeletal muscle. Mutation of Fyn-specific tyrosine sites in LKB1 results in LKB1 export into the cytoplasm and increased AMPK activation site phosphorylation. This study characterizes the structural elements responsible for the physical interaction between Fyn and LKB1. Effects of point mutations in the Fyn SH2/SH3 domains and in the LKB1 proline-rich motif on 1 Fyn and LKB1 binding, 2 LKB1 subcellular localization and 3 AMPK phosphorylation were investigated in C2C12 muscle cells. Additionally, novel LKB1 proline-rich motif mimicking cell permeable peptides were generated to disrupt Fyn/LKB1 binding and investigate the consequences on AMPK activity in both C2C12 cells and mouse skeletal muscle. Mutation of either Fyn SH3 domain or the proline-rich motif of LKB1 resulted in the disruption of Fyn/LKB1 binding, re-localization of 70% of LKB1 signal in the cytoplasm and a 2-fold increase in AMPK phosphorylation. In vivo disruption of the Fyn/LKB1 interaction using LKB1 proline-rich motif mimicking cell permeable peptides recapitulated Fyn pharmacological inhibition. We have pinpointed the structural elements within Fyn and LKB1 that are responsible for their binding, demonstrating the functionality of this interaction in regulating AMPK activity.

  13. Subclinical hyperthyroidism (Sh) in atomic-bomb survivors in Japan

    International Nuclear Information System (INIS)

    Ashizawa, K.; Imaizumi, M.; Usa, T.; Tominaga, T.; Hida, A.; Ejima, E.; Neriishi, K.; Soda, M.; Fujiwara, S.; Maeda, R.; Akahoshi, M.; Nagataki, S.; Eguchi, K.

    2005-01-01

    Full text: Purpose/Background Subclinical hyperthyroidism (Sh) is defined as a biochemical abnormality characterized by a subnormal level of TSH with otherwise normal thyroid tests (F T 3 , F T 4 ) and no clinical symptoms. There are only a small number of cross-sectional studies on the prevalence of Sh. With the improvement of the sensitivity of TSH assay, it has become possible to survey the clinical significance of Sh. With regard to both Sh and subclinical hypothyroidism, discussions are being focused on such as the necessity of treatment. In order to elucidate the clinical significance of Sh, examination data of A-bomb survivors in Hiroshima and Nagasaki were analyzed. Subjects and Method Between 2000 and 2003, of 4,090 A-bomb survivors (1,352 males and 2,738 females with average age of 70.7), 75 individuals (1.83%) with Sh were found who had normal Free T 4 (0.71∼1.51 ng/dL) and TSH<0.45 m U/L. Analysis was limited to those who had not taken antithyroid drugs or thyroxin, and the Sh group (n=35; 9 males and 26 females) was compared with a control group with TSH:0.45∼4.5 m U/L (Group C; N=3,243; 1,109 males and 2,134 females). Result: Nine individuals had TSH<0.1 m U/L. In the Sh group, six individuals were TPO antibody-positive (17%) and 14 were TG antibody-positive (40%); hence, TG antibody-positive was significantly greater in number (p=0.0096). Hematological biochemical tests showed no significant difference between the two groups. Electrocardiograms indicated that more individuals had atrial fibrillation [p=0.028; Odds ratio (OR)=3.98; 95% Confidential interval (CI)=1.2-13.7] or ventricular premature contraction [p=0.016; OR=3.29; 95% CI=1.3-8.6] in the Sh group. In terms of the presence or absence of diabetes, dyslipidemia, hypertension, and hyperuricemia, there was no difference between the two groups. One individual from the Sh group was confirmed to have Graves' disease two years later. Conclusion: Since more individuals in the Sh group were

  14. Protective effects of TRH and its analogues against various cytotoxic agents in retinoic acid (RA)-differentiated human neuroblastoma SH-SY5Y cells.

    Science.gov (United States)

    Jaworska-Feil, L; Jantas, D; Leskiewicz, M; Budziszewska, B; Kubera, M; Basta-Kaim, A; Lipkowski, A W; Lason, W

    2010-12-01

    TRH (thyroliberin) and its analogues were reported to possess neuroprotective effects in cellular and animal experimental models of acute and chronic neurodegenerative diseases. In the present study we evaluated effects of TRH and its three stable analogues, montirelin (CG-3703), RGH-2202 and Z-TRH (N-(carbobenzyloxy)-pGlutamyl-Histydyl-Proline) on the neuronally differentiated human neuroblastoma SH-SY5Y cell line, which is widely accepted for studying potential neuroprotectants. We found that TRH and all the tested analogues at concentrations 0.1-50 μM attenuated cell damage induced by MPP(+) (2 mM), 3-nitropropionate (10 mM), hydrogen peroxide (0.5 mM), homocysteine (250 μM) and beta-amyloid (20μM) in retinoic acid differentiated SH-SY5Y cells. Furthermore, we demonstrated that TRH and its analogues decreased the staurosporine (0.5 μM)-induced LDH release, caspase-3 activity and DNA fragmentation, which indicate the anti-apoptotic proprieties of these peptides. The neuroprotective effects of TRH (10 μM) and RGH-2202 (10 μM) on St-induced cell death was attenuated by inhibitors of PI3-K pathway (wortmannin and LY294002), but not MAPK/ERK1/2 (PD98059 and U0126). Moreover, TRH and its analogues at neuroprotective concentrations (1 and 10 μM) increased expression of Bcl-2 protein, as confirmed by Western blot analysis. All in all, these results extend data on neuroprotective properties of TRH and its analogues and provide evidence that mechanism of anti-apoptotic effects of these peptides in SH-SY5Y cell line involves induction of PI3K/Akt pathway and Bcl-2. Furthermore, the data obtained on human cell line with a dopaminergic phenotype suggest potential utility of TRH and its analogues in the treatment of some neurodegenerative diseases including Parkinson's disease. Copyright © 2010 Elsevier Ltd. All rights reserved.

  15. Specific phosphopeptide binding regulates a conformational change in the PI 3-kinase SH2 domain associated with enzyme activation.

    Science.gov (United States)

    Shoelson, S E; Sivaraja, M; Williams, K P; Hu, P; Schlessinger, J; Weiss, M A

    1993-01-01

    SH2 (src-homology 2) domains define a newly recognized binding motif that mediates the physical association of target phosphotyrosyl proteins with downstream effector enzymes. An example of such phosphoprotein-effector coupling is provided by the association of phosphatidylinositol 3-kinase (PI 3-kinase) with specific phosphorylation sites within the PDGF receptor, the c-Src/polyoma virus middle T antigen complex and the insulin receptor substrate IRS-1. Notably, phosphoprotein association with the SH2 domains of p85 also stimulates an increase in catalytic activity of the PI 3-kinase p110 subunit, which can be mimicked by phosphopeptides corresponding to targeted phosphoprotein phosphorylation sites. To investigate how phosphoprotein binding to the p85 SH2 domain stimulates p110 catalytic activation, we have examined the differential effects of phosphotyrosine and PDGF receptor-, IRS-1- and c-Src-derived phosphopeptides on the conformation of an isolated SH2 domain of PI 3-kinase. Although phosphotyrosine and both activating and non-activating phosphopeptides bind to the SH2 domain, activating phosphopeptides bind with higher affinity and induce a qualitatively distinct conformational change as monitored by CD and NMR spectroscopy. Amide proton exchange and protease protection assays further show that high affinity, specific phosphopeptide binding induces non-local dynamic SH2 domain stabilization. Based on these findings we propose that specific phosphoprotein binding to the p85 subunit induces a change in SH2 domain structure which is transmitted to the p110 subunit and regulates enzymatic activity by an allosteric mechanism. Images PMID:8382612

  16. Photodissociation dynamics of CH{sub 3}C(O)SH in argon matrix: A QM/MM nonadiabatic dynamics simulation

    Energy Technology Data Exchange (ETDEWEB)

    Xia, Shu-Hua; Liu, Xiang-Yang; Fang, Qiu; Cui, Ganglong, E-mail: ganglong.cui@bnu.edu.cn [Key Laboratory of Theoretical and Computational Photochemistry, Ministry of Education, College of Chemistry, Beijing Normal University, Beijing 100875 (China)

    2015-11-21

    In this work, we have first employed the combined quantum mechanics/molecular mechanics (QM/MM) method to study the photodissociation mechanism of thioacetic acid CH{sub 3}C(O)SH in the S{sub 1}, T{sub 1}, and S{sub 0} states in argon matrix. CH{sub 3}C(O)SH is treated quantum mechanically using the complete active space self-consistent field and complete active space second-order perturbation theory methods; argon matrix is described classically using Lennard-Jones potentials. We find that the C-S bond fission is predominant due to its small barriers of ca. 3.0 and 1.0 kcal/mol in the S{sub 1} and T{sub 1} states. It completely suppresses the nearby C—C bond fission. After the bond fission, the S{sub 1} radical pair of CH{sub 3}CO and SH can decay to the S{sub 0} and T{sub 1} states via internal conversion and intersystem crossing, respectively. In the S{sub 0} state, the radical pair can either recombine to form CH{sub 3}C(O)SH or proceed to form molecular products of CH{sub 2}CO and H{sub 2}S. We have further employed our recently developed QM/MM generalized trajectory-based surface-hopping method to simulate the photodissociation dynamics of CH{sub 3}C(O)SH. In 1 ps dynamics simulation, 56% trajectories stay at the Franck-Condon region; the S{sub 1} C—S bond fission takes place in the remaining 44% trajectories. Among all nonadiabatic transitions, the S{sub 1} → S{sub 0} internal conversion is major (55%) but the S{sub 1} → T{sub 1} intersystem crossing is still comparable and cannot be ignored, which accounts for 28%. Finally, we have found a radical channel generating the molecular products of CH{sub 2}CO and H{sub 2}S, which is complementary to the concerted molecular channel. The present work sets the stage for simulating photodissociation dynamics of similar thio-carbonyl systems in matrix.

  17. Identification and classification of genes regulated by phosphatidylinositol 3-kinase- and TRKB-mediated signalling pathways during neuronal differentiation in two subtypes of the human neuroblastoma cell line SH-SY5Y.

    Science.gov (United States)

    Nishida, Yuichiro; Adati, Naoki; Ozawa, Ritsuko; Maeda, Aasami; Sakaki, Yoshiyuki; Takeda, Tadayuki

    2008-10-28

    SH-SY5Y cells exhibit a neuronal phenotype when treated with all-trans retinoic acid (RA), but the molecular mechanism of activation in the signalling pathway mediated by phosphatidylinositol 3-kinase (PI3K) is unclear. To investigate this mechanism, we compared the gene expression profiles in SK-N-SH cells and two subtypes of SH-SY5Y cells (SH-SY5Y-A and SH-SY5Y-E), each of which show a different phenotype during RA-mediated differentiation. SH-SY5Y-A cells differentiated in the presence of RA, whereas RA-treated SH-SY5Y-E cells required additional treatment with brain-derived neurotrophic factor (BDNF) for full differentiation. After exposing cells to a PI3K inhibitor, LY294002, we identified 386 genes and categorised these genes into two clusters dependent on the PI3K signalling pathway during RA-mediated differentiation in SH-SY5Y-A cells. Transcriptional regulation of the gene cluster, including 158 neural genes, was greatly reduced in SK-N-SH cells and partially impaired in SH-SY5Y-E cells, which is consistent with a defect in the neuronal phenotype of these cells. Additional stimulation with BDNF induced a set of neural genes that were down-regulated in RA-treated SH-SY5Y-E cells but were abundant in differentiated SH-SY5Y-A cells. We identified gene clusters controlled by PI3K- and TRKB-mediated signalling pathways during the differentiation of two subtypes of SH-SY5Y cells. The TRKB-mediated bypass pathway compensates for impaired neural function generated by defects in several signalling pathways, including PI3K in SH-SY5Y-E cells. Our expression profiling data will be useful for further elucidation of the signal transduction-transcriptional network involving PI3K or TRKB.

  18. DFT study on oxidation of HS(CH2) m SH ( m = 1-8) in oxidative desulfurization

    Science.gov (United States)

    Song, Y. Z.; Song, J. J.; Zhao, T. T.; Chen, C. Y.; He, M.; Du, J.

    2016-06-01

    Density functional theory was employed for calculation of HS(CH2) m SH ( m = 1-8) and its derivatives at B3LYP method at 6-31++g ( d, p) level. Using eigenvalues of LUMO and HOMO for HS(CH2) m SH, the standard electrode potentials were estimated by a stepwise multiple regression techniques (MLR), and obtained as E° = 1.500 + 7.167 × 10-3 HOMO-0.229 LUMO with high correlation coefficients of 0.973 and F values of 43.973.

  19. Abl N-terminal Cap stabilization of SH3 domain dynamics†

    OpenAIRE

    Chen, Shugui; Dumitrescu, Teodora Pene; Smithgall, Thomas E.; Engen, John R.

    2008-01-01

    Crystal structures and other biochemical data indicate that the N-terminal cap (NCap) region of the Abelson tyrosine kinase (c-Abl) is important for maintaining the downregulated conformation of the kinase domain. The exact contributions that NCap makes in stabilizing the various intramolecular interactions within c-Abl are less clear. While the NCap appears important for locking the SH3/SH2 domains to the back of the kinase domain, there may be other more subtle elements of regulation. Hydro...

  20. Theoretical Insights Reveal Novel Motions in Csk's SH3 Domain That Control Kinase Activation.

    Directory of Open Access Journals (Sweden)

    Sulyman Barkho

    Full Text Available The Src family of tyrosine kinases (SFKs regulate numerous aspects of cell growth and differentiation and are under the principal control of the C-terminal Src Kinase (Csk. Although Csk and SFKs share conserved kinase, SH2 and SH3 domains, they differ considerably in three-dimensional structure, regulatory mechanism, and the intrinsic kinase activities. Although the SH2 and SH3 domains are known to up- or down-regulate tyrosine kinase function, little is known about the global motions in the full-length kinase that govern these catalytic variations. We use a combination of accelerated Molecular Dynamics (aMD simulations and experimental methods to provide a new view of functional motions in the Csk scaffold. These computational studies suggest that high frequency vibrations in the SH2 domain are coupled through the N-terminal lobe of the kinase domain to motions in the SH3 domain. The effects of these reflexive movements on the kinase domain can be viewed using both Deuterium Exchange Mass Spectrometry (DXMS and steady-state kinetic methods. Removal of several contacts, including a crystallographically unobserved N-terminal segment, between the SH3 and kinase domains short-circuit these coupled motions leading to reduced catalytic efficiency and stability of N-lobe motifs within the kinase domain. The data expands the model of Csk's activation whereby separate domains productively interact with two diametrically opposed surfaces of the kinase domain. Such reversible transitions may organize the active structure of the tyrosine kinase domain of Csk.

  1. The Neuroprotective Effects of Brazilian Green Propolis on Neurodegenerative Damage in Human Neuronal SH-SY5Y Cells

    Directory of Open Access Journals (Sweden)

    Junjun Ni

    2017-01-01

    Full Text Available Oxidative stress and synapse dysfunction are the major neurodegenerative damage correlated to cognitive impairment in Alzheimer’s disease (AD. We have found that Brazilian green propolis (propolis improves the cognitive functions of mild cognitive impairment patients living at high altitude; however, mechanism underlying the effects of propolis is unknown. In the present study, we investigated the effects of propolis on oxidative stress, expression of brain-derived neurotrophic factor (BDNF, and activity-regulated cytoskeleton-associated protein (Arc, the critical factors of synapse efficacy, using human neuroblastoma SH-SY5Y cells. Pretreatment with propolis significantly ameliorated the hydrogen peroxide- (H2O2- induced cytotoxicity in SH-SY5Y cells. Furthermore, propolis significantly reduced the H2O2-generated reactive oxygen species (ROS derived from mitochondria and 8-oxo-2′-deoxyguanosine (8-oxo-dG, the DNA oxidative damage marker but significantly reversed the fibrillar β-amyloid and IL-1β-impaired BDNF-induced Arc expression in SH-SY5Y cells. Furthermore, propolis significantly upregulated BDNF mRNA expression in time- and dose-dependent manners. In addition, propolis induced Arc mRNA and protein expression via phosphoinositide-3 kinase (PI3K. These observations strongly suggest that propolis protects from the neurodegenerative damage in neurons through the properties of various antioxidants. The present study provides a potential molecular mechanism of Brazilian green propolis in prevention of cognitive impairment in AD as well as aging.

  2. A Discovery Strategy for Selective Inhibitors of c-Src in Complex with the Focal Adhesion Kinase SH3/SH2-binding Region.

    Science.gov (United States)

    Moroco, Jamie A; Baumgartner, Matthew P; Rust, Heather L; Choi, Hwan Geun; Hur, Wooyoung; Gray, Nathanael S; Camacho, Carlos J; Smithgall, Thomas E

    2015-08-01

    The c-Src tyrosine kinase co-operates with the focal adhesion kinase to regulate cell adhesion and motility. Focal adhesion kinase engages the regulatory SH3 and SH2 domains of c-Src, resulting in localized kinase activation that contributes to tumor cell metastasis. Using assay conditions where c-Src kinase activity required binding to a tyrosine phosphopeptide based on the focal adhesion kinase SH3-SH2 docking sequence, we screened a kinase-biased library for selective inhibitors of the Src/focal adhesion kinase peptide complex versus c-Src alone. This approach identified an aminopyrimidinyl carbamate compound, WH-4-124-2, with nanomolar inhibitory potency and fivefold selectivity for c-Src when bound to the phospho-focal adhesion kinase peptide. Molecular docking studies indicate that WH-4-124-2 may preferentially inhibit the 'DFG-out' conformation of the kinase active site. These findings suggest that interaction of c-Src with focal adhesion kinase induces a unique kinase domain conformation amenable to selective inhibition. © 2014 John Wiley & Sons A/S.

  3. Solution structure of tensin2 SH2 domain and its phosphotyrosine-independent interaction with DLC-1.

    Directory of Open Access Journals (Sweden)

    Kun Dai

    Full Text Available Src homology 2 (SH2 domain is a conserved module involved in various biological processes. Tensin family member was reported to be involved in tumor suppression by interacting with DLC-1 (deleted-in-liver-cancer-1 via its SH2 domain. We explore here the important questions that what the structure of tensin2 SH2 domain is, and how it binds to DLC-1, which might reveal a novel binding mode.Tensin2 SH2 domain adopts a conserved SH2 fold that mainly consists of five β-strands flanked by two α-helices. Most SH2 domains recognize phosphorylated ligands specifically. However, tensin2 SH2 domain was identified to interact with nonphosphorylated ligand (DLC-1 as well as phosphorylated ligand.We determined the solution structure of tensin2 SH2 domain using NMR spectroscopy, and revealed the interactions between tensin2 SH2 domain and its ligands in a phosphotyrosine-independent manner.

  4. Functional analysis of SH3 domain containing ring finger 2 during the myogenic differentiation of quail myoblast cells

    Directory of Open Access Journals (Sweden)

    Si Won Kim

    2017-08-01

    Full Text Available Objective Owing to the public availability of complete genome sequences, including avian species, massive bioinformatics analyses may be conducted for computational gene prediction and the identification of gene regulatory networks through various informatics tools. However, to evaluate the biofunctional activity of a predicted target gene, in vivo and in vitro functional genomic analyses should be a prerequisite. Methods Due to a lack of quail genomic sequence information, we first identified the partial genomic structure and sequences of the quail SH3 domain containing ring finger 2 (SH3RF2 gene. Subsequently, SH3RF2 was knocked out using clustered regularly interspaced short palindromic repeat/Cas9 technology and single cell-derived SH3RF2 mutant sublines were established to study the biofunctional activity of SH3RF2 in quail myoblast (QM7 cells during muscle differentiation. Results Through a T7 endonuclease I assay and genotyping analysis, we established an SH3RF2 knockout (KO QM7#4 subline with 61 and 155 nucleotide deletion mutations in SH3RF2. After the induction of myotube differentiation, the expression profiles were analyzed and compared between regular QM7 and SH3RF2 KO QM7#4 cells by global RNA sequencing and bioinformatics analysis. Conclusion We did not detect any statistically significant role of SH3RF2 during myotube differentiation in QM7 myoblast cells. However, additional experiments are necessary to examine the biofunctional activity of SH3RF2 in cell proliferation and muscle growth.

  5. Identification and classification of genes regulated by phosphatidylinositol 3-kinase- and TRKB-mediated signalling pathways during neuronal differentiation in two subtypes of the human neuroblastoma cell line SH-SY5Y

    Directory of Open Access Journals (Sweden)

    Sakaki Yoshiyuki

    2008-10-01

    Full Text Available Abstract Background SH-SY5Y cells exhibit a neuronal phenotype when treated with all-trans retinoic acid (RA, but the molecular mechanism of activation in the signalling pathway mediated by phosphatidylinositol 3-kinase (PI3K is unclear. To investigate this mechanism, we compared the gene expression profiles in SK-N-SH cells and two subtypes of SH-SY5Y cells (SH-SY5Y-A and SH-SY5Y-E, each of which show a different phenotype during RA-mediated differentiation. Findings SH-SY5Y-A cells differentiated in the presence of RA, whereas RA-treated SH-SY5Y-E cells required additional treatment with brain-derived neurotrophic factor (BDNF for full differentiation. After exposing cells to a PI3K inhibitor, LY294002, we identified 386 genes and categorised these genes into two clusters dependent on the PI3K signalling pathway during RA-mediated differentiation in SH-SY5Y-A cells. Transcriptional regulation of the gene cluster, including 158 neural genes, was greatly reduced in SK-N-SH cells and partially impaired in SH-SY5Y-E cells, which is consistent with a defect in the neuronal phenotype of these cells. Additional stimulation with BDNF induced a set of neural genes that were down-regulated in RA-treated SH-SY5Y-E cells but were abundant in differentiated SH-SY5Y-A cells. Conclusion We identified gene clusters controlled by PI3K- and TRKB-mediated signalling pathways during the differentiation of two subtypes of SH-SY5Y cells. The TRKB-mediated bypass pathway compensates for impaired neural function generated by defects in several signalling pathways, including PI3K in SH-SY5Y-E cells. Our expression profiling data will be useful for further elucidation of the signal transduction-transcriptional network involving PI3K or TRKB.

  6. Subclinical hyperthyroidism (Sh) in atomic-bomb survivors in Japan

    Energy Technology Data Exchange (ETDEWEB)

    Ashizawa, K; Imaizumi, M; Usa, T; Tominaga, T; Hida, A; Ejima, E; Neriishi, K; Soda, M; Fujiwara, S; Maeda, R; Akahoshi, M; Nagataki, S; Eguchi, K [Radiation Effects Research Foundation, Nagasaki (Japan). Nagasaki Branch

    2005-07-01

    Full text: Purpose/Background Subclinical hyperthyroidism (Sh) is defined as a biochemical abnormality characterized by a subnormal level of TSH with otherwise normal thyroid tests (F T{sub 3}, F T{sub 4}) and no clinical symptoms. There are only a small number of cross-sectional studies on the prevalence of Sh. With the improvement of the sensitivity of TSH assay, it has become possible to survey the clinical significance of Sh. With regard to both Sh and subclinical hypothyroidism, discussions are being focused on such as the necessity of treatment. In order to elucidate the clinical significance of Sh, examination data of A-bomb survivors in Hiroshima and Nagasaki were analyzed. Subjects and Method Between 2000 and 2003, of 4,090 A-bomb survivors (1,352 males and 2,738 females with average age of 70.7), 75 individuals (1.83%) with Sh were found who had normal Free T{sub 4} (0.71{approx}1.51 ng/dL) and TSH<0.45 m U/L. Analysis was limited to those who had not taken antithyroid drugs or thyroxin, and the Sh group (n=35; 9 males and 26 females) was compared with a control group with TSH:0.45{approx}4.5 m U/L (Group C; N=3,243; 1,109 males and 2,134 females). Result: Nine individuals had TSH<0.1 m U/L. In the Sh group, six individuals were TPO antibody-positive (17%) and 14 were TG antibody-positive (40%); hence, TG antibody-positive was significantly greater in number (p=0.0096). Hematological biochemical tests showed no significant difference between the two groups. Electrocardiograms indicated that more individuals had atrial fibrillation [p=0.028; Odds ratio (OR)=3.98; 95% Confidential interval (CI)=1.2-13.7] or ventricular premature contraction [p=0.016; OR=3.29; 95% CI=1.3-8.6] in the Sh group. In terms of the presence or absence of diabetes, dyslipidemia, hypertension, and hyperuricemia, there was no difference between the two groups. One individual from the Sh group was confirmed to have Graves' disease two years later. Conclusion: Since more individuals in

  7. In vivo binding properties of SH2 domains from GTPase-activating protein and phosphatidylinositol 3-kinase.

    Science.gov (United States)

    Cooper, J A; Kashishian, A

    1993-01-01

    We have used a transient expression system and mutant platelet-derived growth factor (PDGF) receptors to study the binding specificities of the Src homology 2 (SH2) regions of the Ras GTPase-activator protein (GAP) and the p85 alpha subunit of phosphatidylinositol 3-kinase (PI3 kinase). A number of fusion proteins, each tagged with an epitope allowing recognition by a monoclonal antibody, were expressed at levels comparable to those of endogenous GAP. Fusion proteins containing the central SH2-SH3-SH2 region of GAP or the C-terminal region of p85 alpha, which includes two SH2 domains, bound to PDGF receptors in response to PDGF stimulation. Both fusion proteins showed the same requirements for tyrosine phosphorylation sites in the PDGF receptor as the full-length proteins from which they were derived, i.e., binding of the GAP fusion protein was reduced by mutation of Tyr-771, and binding of the p85 fusion protein was reduced by mutation of Tyr-740, Tyr-751, or both residues. Fusion proteins containing single SH2 domains from either GAP or p85 alpha did not bind detectably to PDGF receptors in this system, suggesting that two SH2 domains in a single polypeptide cooperate to raise the affinity of binding. The sequence specificities of individual SH2 domains were deduced from the binding properties of fusion proteins containing one SH2 domain from GAP and another from p85. The results suggest that the C-terminal GAP SH2 domain specifies binding to Tyr-771, the C-terminal p85 alpha SH2 domain binds to either Tyr-740 or Tyr-751, and each protein's N-terminal SH2 domain binds to unidentified phosphorylation sites.(ABSTRACT TRUNCATED AT 250 WORDS) Images PMID:8382774

  8. SH-SY5Y human neuroblastoma cell line: in vitro cell model of dopaminergic neurons in Parkinson's disease.

    Science.gov (United States)

    Xie, Hong-rong; Hu, Lin-sen; Li, Guo-yi

    2010-04-20

    To evaluate the human neuroblastoma SH-SY5Y cell line as an in vitro model of dopaminergic (DAergic) neurons for Parkinson's disease (PD) research and to determine the effect of differentiation on this cell model. The data of this review were selected from the original reports and reviews related to SH-SY5Y cells published in Chinese and foreign journals (Pubmed 1973 to 2009). After searching the literature, 60 articles were selected to address this review. The SH-SY5Y cell line has become a popular cell model for PD research because this cell line posses many characteristics of DAergic neurons. For example, these cells express tyrosine hydroxylase and dopamine-beta-hydroxylase, as well as the dopamine transporter. Moreover, this cell line can be differentiated into a functionally mature neuronal phenotype in the presence of various agents. Upon differentiation, SH-SY5Y cells stop proliferating and a constant cell number is subsequently maintained. However, different differentiating agents induce different neuronal phenotypes and biochemical changes. For example, retinoic acid induces differentiation toward a cholinergic neuronal phenotype and increases the susceptibility of SH-SY5Y cells to neurotoxins and neuroprotective agents, whereas treatment with retinoic acid followed by phorbol ester 12-O-tetradecanoylphorbol-13-acetate results in a DAergic neuronal phenotype and decreases the susceptibility of cells to neurotoxins and neuroprotective agents. Some differentiating agents also alter kinetics of 1-methyl-4-phenyl-pyridinium (MPP(+)) uptake, making SH-SY5Y cells more similar to primary mesencephalic neurons. Differentiated and undifferentiated SH-SY5Y cells have been widely used as a cell model of DAergic neurons for PD research. Some differentiating agents afford SH-SY5Y cells with more potential for studying neurotoxicity and neuroprotection and are thus more relevant to experimental PD research.

  9. [Knockdown of STAT3 inhibits proliferation and migration of HepG2 hepatoma cells induced by IFN1].

    Science.gov (United States)

    Li, Xiaofang; Wang, Yuqi; Yan, Ben; Fang, Peipei; Ma, Chao; Xu, Ning; Fu, Xiaoyan; Liang, Shujuan

    2018-02-01

    Objective To prepare lentiviruses expressing shRNA sequences targeting human signal transducer and activator of transcription 3 (STAT3) and detect the effect of STAT3 knockdown on type I interferon (IFN1)-induced proliferation and migration in HepG2 cells. Methods Four STAT3-targeting shRNA sequences (shRNA1-shRNA4) and one control sequence (Ctrl shRNA) were selected and cloned respectively into pLKO.1-sp6-pgk-GFP to construct shRNA-expressing vectors. Along with backbone psPAX2 and pMD2.G vectors, they were separately transfected into HEK293T cells to prepare lentiviruses. HepG2 cells were infected with the lentiviruses. Cytoplastic STAT3 level was detected by Western blotting to screen effective shRNA sequence(s) targeting STAT3. Proliferation and migration of HepG2 cells were analyzed by CCK-8 assay and Transwell TM migration and scratching assay, respectively. To detect the effect of IFN1 on cell proliferation and migration of HepG2 cells, the cells were treated with 2000 U/mL IFNα2b for indicated time and the activation of IFN-triggered STAT1 signal transduction was assayed by Western blotting. Results Two most effective STAT3-targeting shRNA sequences shRNA1 and shRNA2 were selected, and the expression of both STAT3 shRNA significantly decreased proliferation and migration of HepG2 cells. When treated with IFNα2b, 2000 U/mL of IFN1 showed more competent in attenuating growth and migration of HepG2 cells. Our data further proved that knockdown of STAT3 increased the phosphorylation of STAT1, and IFNα2b further enhanced the activation of STAT1 signaling in HepG2 cells. Conclusion Knockdown of STAT3 inhibits cell migration and growth, and rescues IFN response through up-regulating STAT1 signal transduction in HepG2 hepatoma cells.

  10. Palaeodemography of the Atapuerca-SH Middle Pleistocene hominid sample.

    Science.gov (United States)

    Bermúdez de Castro, J M; Nicolás, M E

    1997-01-01

    We report here on the palaeodemographic analysis of the hominid sample recovered to date from the Sima de los Huesos (SH) Middle Pleistocene cave site in the Sierra de Atapuerca (Burgos, Spain). The analysis of the mandibular, maxillary, and dental remains has made it possible to estimate that a minimum of 32 individuals, who probably belonged to the same biological population, are represented in the current SH human hypodigm. The remains of nine-individuals are assigned to males, and nine to females, suggesting that a 1:1 sex ratio characterizes this hominid sample. The survivorship curve shows a low representation of infants and children, a high mortality among the adolescents and prime-age adults, and a low older adult mortality. Longevity was probably no greater than 40 years. This mortality pattern (adolescents and adults); which in some aspects resembles that observed in Neandertals, is quite different from those reported for recent foraging human groups. The adult age-at-death distribution of the SH hominid sample appears to be neither the consequence of underaging the older adults, nor of differential preservation or of the recognition of skeletal remains. Thus if we accept that they had a life history pattern similar to that of modern humans there would appear to be a clear contradiction between the demographic distribution and the demographic viability of the population represented by the SH hominid fossils. The possible representational bias of the SH hominid sample, as well as some aspects of the reproductive biology of the Pleistocene populations are also discussed.

  11. Identification and classification of genes regulated by phosphatidylinositol 3-kinase- and TRKB-mediated signalling pathways during neuronal differentiation in two subtypes of the human neuroblastoma cell line SH-SY5Y

    OpenAIRE

    Nishida, Yuichiro; Adati, Naoki; Ozawa, Ritsuko; Maeda, Aasami; Sakaki, Yoshiyuki; Takeda, Tadayuki

    2008-01-01

    Abstract Background SH-SY5Y cells exhibit a neuronal phenotype when treated with all-trans retinoic acid (RA), but the molecular mechanism of activation in the signalling pathway mediated by phosphatidylinositol 3-kinase (PI3K) is unclear. To investigate this mechanism, we compared the gene expression profiles in SK-N-SH cells and two subtypes of SH-SY5Y cells (SH-SY5Y-A and SH-SY5Y-E), each of which show a different phenotype during RA-mediated differentiation. Findings SH-SY5Y-A cells diffe...

  12. Purification and molecular cloning of SH2- and SH3-containing inositol polyphosphate-5-phosphatase, which is involved in the signaling pathway of granulocyte-macrophage colony-stimulating factor, erythropoietin, and Bcr-Abl.

    Science.gov (United States)

    Odai, H; Sasaki, K; Iwamatsu, A; Nakamoto, T; Ueno, H; Yamagata, T; Mitani, K; Yazaki, Y; Hirai, H

    1997-04-15

    Grb2/Ash and Shc are the adapter proteins that link tyrosine-kinase receptors to Ras and make tyrosine-kinase functionally associated with receptors and Ras in fibroblasts and hematopoietic cells. Grb2/Ash and Shc have the SH3, SH2, or phosphotyrosine binding domains. These domains bind to proteins containing proline-rich regions or tyrosine-phosphorylated proteins and contribute to the association of Grb2/Ash and Shc with other signaling molecules. However, there could remain unidentified signaling molecules that physically and functionally interact with these adapter proteins and have biologically important roles in the signaling pathways. By using the GST fusion protein including the full length of Grb2/Ash, we have found that c-Cbl and an unidentified 135-kD protein (pp135) are associated with Grb2/Ash. We have also found that they become tyrosine-phosphorylated by treatment of a human leukemia cell line, UT-7, with granulocyte-macrophage colony-stimulating factor (GM-CSF). We have purified the pp135 by using GST-Grb2/Ash affinity column and have isolated the full-length complementary DNA (cDNA) encoding the pp135 using a cDNA probe, which was obtained by the degenerate polymerase chain reaction based on a peptide sequence of the purified pp135. The cloned cDNA has 3,958 nucleotides that contain a single long open reading frame of 3,567 nucleotides, encoding a 1,189 amino acid protein with a predicted molecular weight of approximately 133 kD. The deduced amino acid sequence reveals that pp135 is a protein that has one SH2, one SH3, and one proline-rich domain. The pp135, which contains two motifs conserved among the inositol polyphosphate-5-phosphatase proteins, was shown to have the inositol polyphosphate-5-phosphatase activity. The pp135 was revealed to associate constitutively with Grb2/Ash and inducibly with Shc using UT-7 cells stimulated with GM-CSF. In the cell lines derived from human chronic myelogenous leukemia, pp135 was constitutively tyrosine

  13. A relationship between SNR G109.1-1.0 and the molecular cloud of Sh2-152

    International Nuclear Information System (INIS)

    Heydari-Malayeri, M.; Kahane, C.; Lucas, R.

    1981-01-01

    The possible association of the supernova remnant SNR G109.1 - 1.0 and the x-ray source GF2259 + 586 with the molecular cloud of Sh2 - 152 has been investigated by observing the molecular line 13 CO (J = 1 → 0) of the complex Sh2 - 147/Sh2 - 153. The present results are compared with those of previous workers. It is shown that although the various estimates of distance for the SNR, the x-ray source, the H II region Sh2 - 152 and the molecular cloud are in relatively good agreement, because of the uncertainties of distance evaluation in the Perseus arm this cannot be regarded as conclusive proof of the association of these objects. (U.K.)

  14. Disruption of the podosome adaptor protein TKS4 (SH3PXD2B) causes the skeletal dysplasia, eye, and cardiac abnormalities of Frank-Ter Haar Syndrome.

    Science.gov (United States)

    Iqbal, Zafar; Cejudo-Martin, Pilar; de Brouwer, Arjan; van der Zwaag, Bert; Ruiz-Lozano, Pilar; Scimia, M Cecilia; Lindsey, James D; Weinreb, Robert; Albrecht, Beate; Megarbane, Andre; Alanay, Yasemin; Ben-Neriah, Ziva; Amenduni, Mariangela; Artuso, Rosangela; Veltman, Joris A; van Beusekom, Ellen; Oudakker, Astrid; Millán, José Luis; Hennekam, Raoul; Hamel, Ben; Courtneidge, Sara A; van Bokhoven, Hans

    2010-02-12

    Frank-Ter Haar syndrome (FTHS), also known as Ter Haar syndrome, is an autosomal-recessive disorder characterized by skeletal, cardiovascular, and eye abnormalities, such as increased intraocular pressure, prominent eyes, and hypertelorism. We have conducted homozygosity mapping on patients representing 12 FTHS families. A locus on chromosome 5q35.1 was identified for which patients from nine families shared homozygosity. For one family, a homozygous deletion mapped exactly to the smallest region of overlapping homozygosity, which contains a single gene, SH3PXD2B. This gene encodes the TKS4 protein, a phox homology (PX) and Src homology 3 (SH3) domain-containing adaptor protein and Src substrate. This protein was recently shown to be involved in the formation of actin-rich membrane protrusions called podosomes or invadopodia, which coordinate pericellular proteolysis with cell migration. Mice lacking Tks4 also showed pronounced skeletal, eye, and cardiac abnormalities and phenocopied the majority of the defects associated with FTHS. These findings establish a role for TKS4 in FTHS and embryonic development. Mutation analysis revealed five different homozygous mutations in SH3PXD2B in seven FTHS families. No SH3PXD2B mutations were detected in six other FTHS families, demonstrating the genetic heterogeneity of this condition. Interestingly however, dermal fibroblasts from one of the individuals without an SH3PXD2B mutation nevertheless expressed lower levels of the TKS4 protein, suggesting a common mechanism underlying disease causation. Copyright (c) 2010 The American Society of Human Genetics. Published by Elsevier Inc. All rights reserved.

  15. Neuroprotective Effects of Germinated Brown Rice against Hydrogen Peroxide Induced Cell Death in Human SH-SY5Y Cells

    Directory of Open Access Journals (Sweden)

    Shahid Iqbal

    2012-08-01

    Full Text Available The neuroprotective and antioxidative effects of germinated brown rice (GBR, brown rice (BR and commercially available γ-aminobutyric acid (GABA against cell death induced by hydrogen peroxide (H2O2 in human neuroblastoma SH-SY5Y cells have been investigated. Results show that GBR suppressed H2O2-mediated cytotoxicity and induced G0/G1 phase cell cycle arrest in SH-SY5Y cells. Moreover, GBR reduced mitochondrial membrane potential (MMP and prevented phosphatidylserine (PS translocation in SH-SY5Y cells, key features of apoptosis, and subsequent cell death. GBR exhibited better neuroprotective and antioxidative activities as compared to BR and GABA. These results indicate that GBR possesses high antioxidative activities and suppressed cell death in SH-SY5Y cells by blocking the cell cycle re-entry and apoptotic mechanisms. Therefore, GBR could be developed as a value added functional food to prevent neurodegenerative diseases caused by oxidative stress and apoptosis.

  16. Solution structure, dynamics and thermodynamics of the three SH3 domains of CD2AP

    Energy Technology Data Exchange (ETDEWEB)

    Roldan, Jose L. Ortega [Universidad de Granada, Departamento de Quimica Fisica e Instituto de Biotecnologia, Facultad de Ciencias (Spain); Blackledge, Martin [Institut de Biologie Structurale Jean-Pierre Ebel, CEA, CNRS, UJF UMR 5075, Protein Dynamics and Flexibility by NMR (France); Nuland, Nico A. J. van, E-mail: nvnuland@vub.ac.be [Vrije Universiteit Brussel, Structural Biology Brussels (Belgium); Azuaga, Ana I. [Universidad de Granada, Departamento de Quimica Fisica e Instituto de Biotecnologia, Facultad de Ciencias (Spain)

    2011-06-15

    CD2 associated protein (CD2AP) is an adaptor protein that plays an important role in cell to cell union needed for the kidney function. It contains three N-terminal SH3 domains that are able to interact among others with CD2, ALIX, c-Cbl and Ubiquitin. To understand the role of the individual SH3 domains of this adaptor protein we have performed a complete structural, thermodynamic and dynamic characterization of the separate domains using NMR and DSC. The energetic contributions to the stability and the backbone dynamics have been related to the structural features of each domain using the structure-based FoldX algorithm. We have found that the N-terminal SH3 domain of both adaptor proteins CD2AP and CIN85 are the most stable SH3 domains that have been studied until now. This high stability is driven by a more extensive network of intra-molecular interactions. We believe that this increased stabilization of N-terminal SH3 domains in adaptor proteins is crucial to maintain the necessary conformation to establish the proper interactions critical for the recruitment of their natural targets.

  17. Crystal structures of the human G3BP1 NTF2-like domain visualize FxFG Nup Repeat Specificity

    DEFF Research Database (Denmark)

    Vognsen, Tina Reinholdt; Möller, Ingvar Rúnar; Kristensen, Ole

    2013-01-01

    Ras GTPase Activating Protein SH3 Domain Binding Protein (G3BP) is a potential anti-cancer drug target implicated in several cellular functions. We have used protein crystallography to solve crystal structures of the human G3BP1 NTF2-like domain both alone and in complex with an FxFG Nup repeat...... peptide. Despite high structural similarity, the FxFG binding site is located between two alpha helices in the G3BP1 NTF2-like domain and not at the dimer interface as observed for nuclear transport factor 2. ITC studies showed specificity towards the FxFG motif but not FG and GLFG motifs. The unliganded...

  18. Insights into Substrate Specificity of NlpC/P60 Cell Wall Hydrolases Containing Bacterial SH3 Domains

    Energy Technology Data Exchange (ETDEWEB)

    Xu, Qingping; Mengin-Lecreulx, Dominique; Liu, Xueqian W.; Patin, Delphine; Farr, Carol L.; Grant, Joanna C.; Chiu, Hsiu-Ju; Jaroszewski, Lukasz; Knuth, Mark W.; Godzik, Adam; Lesley, Scott A.; Elsliger, Marc-André; Deacon, Ashley M.; Wilson, Ian A.

    2015-09-15

    ABSTRACT

    Bacterial SH3 (SH3b) domains are commonly fused with papain-like Nlp/P60 cell wall hydrolase domains. To understand how the modular architecture of SH3b and NlpC/P60 affects the activity of the catalytic domain, three putative NlpC/P60 cell wall hydrolases were biochemically and structurally characterized. These enzymes all have γ-d-Glu-A2pm (A2pm is diaminopimelic acid) cysteine amidase (ordl-endopeptidase) activities but with different substrate specificities. One enzyme is a cell wall lysin that cleaves peptidoglycan (PG), while the other two are cell wall recycling enzymes that only cleave stem peptides with an N-terminall-Ala. Their crystal structures revealed a highly conserved structure consisting of two SH3b domains and a C-terminal NlpC/P60 catalytic domain, despite very low sequence identity. Interestingly, loops from the first SH3b domain dock into the ends of the active site groove of the catalytic domain, remodel the substrate binding site, and modulate substrate specificity. Two amino acid differences at the domain interface alter the substrate binding specificity in favor of stem peptides in recycling enzymes, whereas the SH3b domain may extend the peptidoglycan binding surface in the cell wall lysins. Remarkably, the cell wall lysin can be converted into a recycling enzyme with a single mutation.

    IMPORTANCEPeptidoglycan is a meshlike polymer that envelops the bacterial plasma membrane and bestows structural integrity. Cell wall lysins and recycling enzymes are part of a set of lytic enzymes that target covalent bonds connecting the amino acid and amino sugar building blocks of the PG network. These hydrolases are involved in processes such as cell growth and division, autolysis, invasion, and PG turnover and recycling. To avoid cleavage of unintended substrates, these enzymes have very selective substrate specificities. Our biochemical and structural

  19. Inhibitory effects of recombinant plasmid pshuttle-Egr1-shTRAIL transfection in combination with X-irradiation on growth of liver cancer cells SMMC7721

    International Nuclear Information System (INIS)

    Chen Zhiyong; Liu Min; Dong Lihua; Gong Shouliang

    2011-01-01

    Objective: To investigate the effect of recombinant plasmid pshuttle-Egr1-shTRAIL stable transfection in combination with X-ray irradiation on the TRAIL protein expression and the apoptosis in human SMMC7721 hepatoma cells. Methods: The pshuttle-Egr1-shTRAIL packaged with liposome was stably transfected into SMMC7721 cells in vitro. The shTRAIL protein expression were measured with ELISA assay, Annexin V-FITC kit was adopted to measure the apoptosis of pshuttle-Egr1-shTRAIL cells, and the changes in survival rate of SMMC7721 cells measured with cell cloning assay. Results: The TRAIL protein expressions in pshuttle-Egr1-shTRAIL plus different doses of irradiation groups were significantly increased compared with 0 Gy group (P<0.001). The percentage of apoptotic cells was significantly higher than that in 0 Gy group (P<0.05 or P<0.001), and the survival rate of SMMC7721 cells was decreased significantly (P<0.05 or P<0.001). Conclusion: The pshuttle-Egr1-shTRAIL stable transfection in combination with irradiation can significantly induce the apoptosis of SMMC7721 tumor cells and inhibit the cell proliferation. (authors)

  20. Global transformation of erythrocyte properties via engagement of an SH2-like sequence in band 3.

    Science.gov (United States)

    Puchulu-Campanella, Estela; Turrini, Francesco M; Li, Yen-Hsing; Low, Philip S

    2016-11-29

    Src homology 2 (SH2) domains are composed of weakly conserved sequences of ∼100 aa that bind phosphotyrosines in signaling proteins and thereby mediate intra- and intermolecular protein-protein interactions. In exploring the mechanism whereby tyrosine phosphorylation of the erythrocyte anion transporter, band 3, triggers membrane destabilization, vesiculation, and fragmentation, we discovered a SH2 signature motif positioned between membrane-spanning helices 4 and 5. Evidence that this exposed cytoplasmic sequence contributes to a functional SH2-like domain is provided by observations that: (i) it contains the most conserved sequence of SH2 domains, GSFLVR; (ii) it binds the tyrosine phosphorylated cytoplasmic domain of band 3 (cdb3-PO 4 ) with K d = 14 nM; (iii) binding of cdb3-PO 4 to erythrocyte membranes is inhibited both by antibodies against the SH2 signature sequence and dephosphorylation of cdb3-PO 4 ; (iv) label transfer experiments demonstrate the covalent transfer of photoactivatable biotin from isolated cdb3-PO 4 (but not cdb3) to band 3 in erythrocyte membranes; and (v) phosphorylation-induced binding of cdb3-PO 4 to the membrane-spanning domain of band 3 in intact cells causes global changes in membrane properties, including (i) displacement of a glycolytic enzyme complex from the membrane, (ii) inhibition of anion transport, and (iii) rupture of the band 3-ankyrin bridge connecting the spectrin-based cytoskeleton to the membrane. Because SH2-like motifs are not retrieved by normal homology searches for SH2 domains, but can be found in many tyrosine kinase-regulated transport proteins using modified search programs, we suggest that related cases of membrane transport proteins containing similar motifs are widespread in nature where they participate in regulation of cell properties.

  1. SH1 leaf rust and bacterial halo blight coffee resistances are genetically independent

    Directory of Open Access Journals (Sweden)

    Lucas Mateus Rivero Rodrigues

    Full Text Available ABSTRACT Coffee resistance to Pseudomonas syringae pv. garcae has been associated to pleiotropic effect of SH1 allele, present in coffee plants resistant to certain races of Hemileia vastatrix, the causal agent of leaf rust, or genetic linkage between resistance alleles to both pathogens. To validate this hypothesis, 63 coffee plants in F2 generation were evaluated for resistance to 2 isolates of H. vastatrix carriers of alleles, respectively, v2, v5 (isolate I/2015 and v1; v2; v5 (isolate II/2015 with the objective to confirm presence of SH1 allele in resistant plants to isolate I/2015. The same coffee plants were evaluated for resistance to a mixture of P. syringae pv. garcae strains highly pathogenic to coffee. Results showed that, among F2 coffee allele SH1 carriers, resistant to isolate I/2015, resistant and susceptible plants to bacterial halo blight were found; the same segregation occurs between F2 homozygous for SH1 allele, susceptible to the same isolate (I/2015 of H. vastatrix. Results also indicate that there is no pleiotropic effect of gene or allele SH1 connection between genes conferring resistance to leaf rust caused by H. vastatrix and bacterial halo blight caused by P. syringae pv. garcae.

  2. Effects of all-trans-retinoic acid on human SH-SY5Y neuroblastoma as in vitro model in neurotoxicity research.

    Science.gov (United States)

    Cheung, Yuen-Ting; Lau, Way Kwok-Wai; Yu, Man-Shan; Lai, Cora Sau-Wan; Yeung, Sze-Chun; So, Kwok-Fai; Chang, Raymond Chuen-Chung

    2009-01-01

    Human neuroblastoma SH-SY5Y is a dopaminergic neuronal cell line which has been used as an in vitro model for neurotoxicity experiments. Although the neuroblastoma is usually differentiated by all-trans-retinoic acid (RA), both RA-differentiated and undifferentiated SH-SY5Y cells have been used in neuroscience research. However, the changes in neuronal properties triggered by RA as well as the subsequent responsiveness to neurotoxins have not been comprehensively studied. Therefore, we aim to re-evaluate the differentiation property of RA on this cell line. We hypothesize that modulation of signaling pathways and neuronal properties during RA-mediated differentiation in SH-SY5Y cells can affect their susceptibility to neurotoxins. The differentiation property of RA was confirmed by showing an extensive outgrowth of neurites, increased expressions of neuronal nuclei, neuron specific enolase, synaptophysin and synaptic associated protein-97, and decreased expression of inhibitor of differentiation-1. While undifferentiated SH-SY5Y cells were susceptible to 6-OHDA and MPP+, RA-differentiation conferred SH-SY5Y cells higher tolerance, potentially by up-regulating survival signaling, including Akt pathway as inhibition of Akt removed RA-induced neuroprotection against 6-OHDA. As a result, the real toxicity cannot be revealed in RA-differentiated cells. Therefore, undifferentiated SH-SY5Y is more appropriate for studying neurotoxicity or neuroprotection in experimental Parkinson's disease research.

  3. Arabidopsis SH3P2 is an ubiquitin-binding protein that functions together with ESCRT-I and the deubiquitylating enzyme AMSH3.

    Science.gov (United States)

    Nagel, Marie-Kristin; Kalinowska, Kamila; Vogel, Karin; Reynolds, Gregory D; Wu, Zhixiang; Anzenberger, Franziska; Ichikawa, Mie; Tsutsumi, Chie; Sato, Masa H; Kuster, Bernhard; Bednarek, Sebastian Y; Isono, Erika

    2017-08-22

    Clathrin-mediated endocytosis of plasma membrane proteins is an essential regulatory process that controls plasma membrane protein abundance and is therefore important for many signaling pathways, such as hormone signaling and biotic and abiotic stress responses. On endosomal sorting, plasma membrane proteins maybe recycled or targeted for vacuolar degradation, which is dependent on ubiquitin modification of the cargos and is driven by the endosomal sorting complexes required for transport (ESCRTs). Components of the ESCRT machinery are highly conserved among eukaryotes, but homologs of ESCRT-0 that are responsible for recognition and concentration of ubiquitylated proteins are absent in plants. Recently several ubiquitin-binding proteins have been identified that serve in place of ESCRT-0; however, their function in ubiquitin recognition and endosomal trafficking is not well understood yet. In this study, we identified Src homology-3 (SH3) domain-containing protein 2 (SH3P2) as a ubiquitin- and ESCRT-I-binding protein that functions in intracellular trafficking. SH3P2 colocalized with clathrin light chain-labeled punctate structures and interacted with clathrin heavy chain in planta , indicating a role for SH3P2 in clathrin-mediated endocytosis. Furthermore, SH3P2 cofractionates with clathrin-coated vesicles (CCVs), suggesting that it associates with CCVs in planta Mutants of SH3P2 and VPS23 genetically interact, suggesting that they could function in the same pathway. Based on these results, we suggest a role of SH3P2 as an ubiquitin-binding protein that binds and transfers ubiquitylated proteins to the ESCRT machinery.

  4. The Arabidopsis homolog of human G3BP1 is a key regulator of stomatal and apoplastic immunity

    KAUST Repository

    Abulfaraj, Aala A.; Mariappan, Kiruthiga; Bigeard, Jean; Manickam, Prabhu; Blilou, Ikram; Guo, Xiujie; Al-Babili, Salim; Pflieger, Delphine; Hirt, Heribert; Rayapuram, Naganand

    2018-01-01

    Mammalian Ras-GTPase–activating protein SH3-domain–binding proteins (G3BPs) are a highly conserved family of RNA-binding proteins that link kinase receptor-mediated signaling to RNA metabolism. Mammalian G3BP1 is a multifunctional protein that functions in viral immunity. Here, we show that the Arabidopsis thaliana homolog of human G3BP1 negatively regulates plant immunity. Arabidopsis g3bp1 mutants showed enhanced resistance to the virulent bacterial pathogen Pseudomonas syringae pv. tomato. Pathogen resistance was mediated in Atg3bp1 mutants by altered stomatal and apoplastic immunity. Atg3bp1 mutants restricted pathogen entry into stomates showing insensitivity to bacterial coronatine–mediated stomatal reopening. AtG3BP1 was identified as a negative regulator of defense responses, which correlated with moderate up-regulation of salicylic acid biosynthesis and signaling without growth penalty.

  5. The Arabidopsis homolog of human G3BP1 is a key regulator of stomatal and apoplastic immunity

    KAUST Repository

    Abulfaraj, Aala Abdulaziz Hussien

    2018-05-31

    Mammalian Ras-GTPase–activating protein SH3-domain–binding proteins (G3BPs) are a highly conserved family of RNA-binding proteins that link kinase receptor-mediated signaling to RNA metabolism. Mammalian G3BP1 is a multifunctional protein that functions in viral immunity. Here, we show that the Arabidopsis thaliana homolog of human G3BP1 negatively regulates plant immunity. Arabidopsis g3bp1 mutants showed enhanced resistance to the virulent bacterial pathogen Pseudomonas syringae pv. tomato. Pathogen resistance was mediated in Atg3bp1 mutants by altered stomatal and apoplastic immunity. Atg3bp1 mutants restricted pathogen entry into stomates showing insensitivity to bacterial coronatine–mediated stomatal reopening. AtG3BP1 was identified as a negative regulator of defense responses, which correlated with moderate up-regulation of salicylic acid biosynthesis and signaling without growth penalty.

  6. The SH2 Domain Interaction Landscape

    Directory of Open Access Journals (Sweden)

    Michele Tinti

    2013-04-01

    Full Text Available Members of the SH2 domain family modulate signal transduction by binding to short peptides containing phosphorylated tyrosines. Each domain displays a distinct preference for the sequence context of the phosphorylated residue. We have developed a high-density peptide chip technology that allows for probing of the affinity of most SH2 domains for a large fraction of the entire complement of tyrosine phosphopeptides in the human proteome. Using this technique, we have experimentally identified thousands of putative SH2-peptide interactions for more than 70 different SH2 domains. By integrating this rich data set with orthogonal context-specific information, we have assembled an SH2-mediated probabilistic interaction network, which we make available as a community resource in the PepspotDB database. A predicted dynamic interaction between the SH2 domains of the tyrosine phosphatase SHP2 and the phosphorylated tyrosine in the extracellular signal-regulated kinase activation loop was validated by experiments in living cells.

  7. Time-resolved multimodal analysis of Src Homology 2 (SH2) domain binding in signaling by receptor tyrosine kinases.

    Science.gov (United States)

    Jadwin, Joshua A; Oh, Dongmyung; Curran, Timothy G; Ogiue-Ikeda, Mari; Jia, Lin; White, Forest M; Machida, Kazuya; Yu, Ji; Mayer, Bruce J

    2016-04-12

    While the affinities and specificities of SH2 domain-phosphotyrosine interactions have been well characterized, spatio-temporal changes in phosphosite availability in response to signals, and their impact on recruitment of SH2-containing proteins in vivo, are not well understood. To address this issue, we used three complementary experimental approaches to monitor phosphorylation and SH2 binding in human A431 cells stimulated with epidermal growth factor (EGF): 1) phospho-specific mass spectrometry; 2) far-Western blotting; and 3) live cell single-molecule imaging of SH2 membrane recruitment. Far-Western and MS analyses identified both well-established and previously undocumented EGF-dependent tyrosine phosphorylation and binding events, as well as dynamic changes in binding patterns over time. In comparing SH2 binding site phosphorylation with SH2 domain membrane recruitment in living cells, we found in vivo binding to be much slower. Delayed SH2 domain recruitment correlated with clustering of SH2 domain binding sites on the membrane, consistent with membrane retention via SH2 rebinding.

  8. An Involvement of PI3-K/Akt Activation and Inhibition of AIF Translocation in Neuroprotective Effects of Undecylenic Acid (UDA) Against Pro-Apoptotic Factors-Induced Cell Death in Human Neuroblastoma SH-SY5Y Cells.

    Science.gov (United States)

    Jantas, Danuta; Piotrowski, Marek; Lason, Wladyslaw

    2015-12-01

    Undecylenic acid (UDA), a naturally occurring 11-carbon unsaturated fatty acid, has been used for several years as an economical antifungal agent and a nutritional supplement. Recently, the potential usefulness of UDA as a neuroprotective drug has been suggested based on the ability of this agent to inhibit μ-calpain activity. In order to verify neuroprotective potential of UDA, we tested protective efficacy of this compound against cell damage evoked by pro-apoptotic factors (staurosporine and doxorubicin) and oxidative stress (hydrogen peroxide) in human neuroblastoma SH-SY5Y cells. We showed that UDA partially protected SH-SY5Y cells against the staurosporine- and doxorubicin-evoked cell death; however, this effect was not connected with its influence on caspase-3 activity. UDA decreased the St-induced changes in mitochondrial and cytosolic AIF level, whereas in Dox-model it affected only the cytosolic AIF content. Moreover, UDA (1-40 μM) decreased the hydrogen peroxide-induced cell damage which was connected with attenuation of hydrogen peroxide-mediated necrotic (PI staining, ADP/ATP ratio) and apoptotic (mitochondrial membrane potential, caspase-3 activation, AIF translocation) changes. Finally, we demonstrated that an inhibitor of PI3-K/Akt (LY294002) but not MAPK/ERK1/2 (U0126) pathway blocked the protection mediated by UDA in all tested models of SH-SY5Y cell injury. These in vitro data point to UDA as potentially effective neuroprotectant the utility of which should be further validated in animal studies. © 2015 Wiley Periodicals, Inc.

  9. Simian Immunodeficiency Virus and Human Immunodeficiency Virus Type 1 Nef Proteins Show Distinct Patterns and Mechanisms of Src Kinase Activation

    Science.gov (United States)

    Greenway, Alison L.; Dutartre, Hélène; Allen, Kelly; McPhee, Dale A.; Olive, Daniel; Collette, Yves

    1999-01-01

    The nef gene from human and simian immunodeficiency viruses (HIV and SIV) regulates cell function and viral replication, possibly through binding of the nef product to cellular proteins, including Src family tyrosine kinases. We show here that the Nef protein encoded by SIVmac239 interacts with and also activates the human Src kinases Lck and Hck. This is in direct contrast to the inhibitory effect of HIV type 1 (HIV-1) Nef on Lck catalytic activity. Unexpectedly, however, the interaction of SIV Nef with human Lck or Hck is not mediated via its consensus proline motif, which is known to mediate HIV-1 Nef binding to Src homology 3 (SH3) domains, and various experimental analyses failed to show significant interaction of SIV Nef with the SH3 domain of either kinase. Instead, SIV Nef can bind Lck and Hck SH2 domains, and its N-terminal 50 amino acid residues are sufficient for Src kinase binding and activation. Our results provide evidence for multiple mechanisms by which Nef binds to and regulates Src kinases. PMID:10364375

  10. MERTK interactions with SH2-domain proteins in the retinal pigment epithelium.

    Science.gov (United States)

    Shelby, Shameka J; Colwill, Karen; Dhe-Paganon, Sirano; Pawson, Tony; Thompson, Debra A

    2013-01-01

    The receptor tyrosine kinase MERTK plays an essential role in the phagocytic uptake of shed photoreceptor membranes by the retinal pigment epithelium (RPE). A fundamental aspect of signal transduction by receptor tyrosine kinases involves autophosphorylation of tyrosine residues that recruit Src-homology 2 (SH2)-domain proteins to the receptor intracellular domain. The goal of the current study was to evaluate the interactions of human MERTK with SH2-domain proteins present in the RPE. The MERTK intracellular domain was expressed as a 6xHis-fusion protein (6xHis-rMERTK(571-999)), purified and phosphorylated. Ni(2+)-NTA pull downs were performed using 6xHis-rMERTK(571-999) in incubations with recombinant phosphotyrosine-recognition sequences expressed as GST-fusion proteins. In addition, pull downs of native SH2-domain proteins were performed using 6xHis-rMERTK(571-999) and protein homogenates from rat RPE/choroid. For both recombinant and native proteins, western analysis detected MERTK interactions with GRB2, PIK3R1 (P85α), VAV3, and SRC. Immunohistochemical analysis localized each protein to mouse RPE. In cultured RPE-J cells incubated with rod outer segments (OS), siRNA knockdown of Grb2 had no effect on OS binding, but significantly reduced OS uptake. Pik3r1 localized to early phagosomes along with Rab5 and Eea1. Phosphorylation and activation of Src was detected downstream of phagocytosis and Mertk activation. These findings suggest that MERTK signaling in the RPE involves a cohort of SH2-domain proteins with the potential to regulate both cytoskeletal rearrangement and membrane movement. Identification of the SH2-domain signaling partners of MERTK is an important step toward further defining the mechanism of RPE phagocytosis that is central to the function and survival of the retina.

  11. MERTK interactions with SH2-domain proteins in the retinal pigment epithelium.

    Directory of Open Access Journals (Sweden)

    Shameka J Shelby

    Full Text Available The receptor tyrosine kinase MERTK plays an essential role in the phagocytic uptake of shed photoreceptor membranes by the retinal pigment epithelium (RPE. A fundamental aspect of signal transduction by receptor tyrosine kinases involves autophosphorylation of tyrosine residues that recruit Src-homology 2 (SH2-domain proteins to the receptor intracellular domain. The goal of the current study was to evaluate the interactions of human MERTK with SH2-domain proteins present in the RPE. The MERTK intracellular domain was expressed as a 6xHis-fusion protein (6xHis-rMERTK(571-999, purified and phosphorylated. Ni(2+-NTA pull downs were performed using 6xHis-rMERTK(571-999 in incubations with recombinant phosphotyrosine-recognition sequences expressed as GST-fusion proteins. In addition, pull downs of native SH2-domain proteins were performed using 6xHis-rMERTK(571-999 and protein homogenates from rat RPE/choroid. For both recombinant and native proteins, western analysis detected MERTK interactions with GRB2, PIK3R1 (P85α, VAV3, and SRC. Immunohistochemical analysis localized each protein to mouse RPE. In cultured RPE-J cells incubated with rod outer segments (OS, siRNA knockdown of Grb2 had no effect on OS binding, but significantly reduced OS uptake. Pik3r1 localized to early phagosomes along with Rab5 and Eea1. Phosphorylation and activation of Src was detected downstream of phagocytosis and Mertk activation. These findings suggest that MERTK signaling in the RPE involves a cohort of SH2-domain proteins with the potential to regulate both cytoskeletal rearrangement and membrane movement. Identification of the SH2-domain signaling partners of MERTK is an important step toward further defining the mechanism of RPE phagocytosis that is central to the function and survival of the retina.

  12. Association of 3BP2 with SHP-1 regulates SHP-1-mediated production of TNF-α in RBL-2H3 cells.

    Science.gov (United States)

    Chihara, Kazuyasu; Nakashima, Kenji; Takeuchi, Kenji; Sada, Kiyonao

    2011-12-01

    Adaptor protein 3BP2, a c-Abl Src homology 3 (SH3) domain-binding protein, is tyrosine phosphorylated and positively regulates mast cell signal transduction after the aggregation of the high affinity IgE receptor (FcεRI). Overexpression of the Src homology 2 (SH2) domain of 3BP2 results in the dramatic suppression of antigen-induced degranulation in rat basophilic leukemia RBL-2H3 cells. Previously, a linker for activation of T cells (LAT) was identified as one of the 3BP2 SH2 domain-binding protein. In this report, to further understand the functions of 3BP2 in FcεRI-mediated activation of mast cell, we explored the protein that associates with the SH2 domain of 3BP2 and found that SH2 domain-containing phosphatase-1 (SHP-1) inducibly interacts with the SH2 domain of 3BP2 after the aggregation of FcεRI. The phosphorylation of Tyr(564) in the carboxy (C)-terminal tail region of SHP-1 is required for the direct interaction of SHP-1 to the SH2 domain of 3BP2. The expression of the mutant form of SHP-1 which was unable to interact with 3BP2 resulted in the significant reduction in SHP-1-mediated tumor necrosis factor-α (TNF-α) production without any effects on the degranulation in antigen-stimulated RBL-2H3 cells. These findings suggest that 3BP2 directly interacts with Tyr(564) -phosphorylated form of SHP-1 and positively regulates the function of SHP-1 in FcεRI-mediated signaling in mast cells. © 2011 The Authors. Journal compilation © 2011 by the Molecular Biology Society of Japan/Blackwell Publishing Ltd.

  13. Association between receptor protein-tyrosine phosphatase RPTPalpha and the Grb2 adaptor. Dual Src homology (SH) 2/SH3 domain requirement and functional consequences

    DEFF Research Database (Denmark)

    Su, J; Yang, L T; Sap, J

    1996-01-01

    domain in Grb2 (, ). We show here that association of Grb2 with RPTPalpha also involves a critical function for the C-terminal SH3 domain of Grb2. Furthermore, Grb2 SH3 binding peptides interfere with RPTPalpha-Grb2 association in vitro, and the RPTPalpha protein can dissociate the Grb2-Sos complex...... in vivo. These observations constitute a novel mode of Grb2 association and suggest a model in which association with a tyrosine-phosphorylated protein restricts the repertoire of SH3 binding proteins with which Grb2 can simultaneously interact. The function of the Tyr798 tyrosine phosphorylation/Grb2...... binding site in RPTPalpha was studied further by expression of wild type or mutant RPTPalpha proteins in PC12 cells. In these cells, wild type RPTPalpha interferes with acidic fibroblast growth factor-induced neurite outgrowth; this effect requires both the catalytic activity and the Grb2 binding Tyr798...

  14. Roles for SH2 and SH3 domains in Lyn kinase association with activated FcepsilonRI in RBL mast cells revealed by patterned surface analysis.

    Science.gov (United States)

    Hammond, Stephanie; Wagenknecht-Wiesner, Alice; Veatch, Sarah L; Holowka, David; Baird, Barbara

    2009-10-01

    In mast cells, antigen-mediated cross-linking of IgE bound to its high-affinity surface receptor, FcepsilonRI, initiates a signaling cascade that culminates in degranulation and release of allergic mediators. Antigen-patterned surfaces, in which the antigen is deposited in micron-sized features on a silicon substrate, were used to examine the spatial relationship between clustered IgE-FcepsilonRI complexes and Lyn, the signal-initiating tyrosine kinase. RBL mast cells expressing wild-type Lyn-EGFP showed co-redistribution of this protein with clustered IgE receptors on antigen-patterned surfaces, whereas Lyn-EGFP containing an inhibitory point mutation in its SH2 domain did not significantly accumulate with the patterned antigen, and Lyn-EGFP with an inhibitory point mutation in its SH3 domain exhibited reduced interactions. Our results using antigen-patterned surfaces and quantitative cross-correlation image analysis reveal that both the SH2 and SH3 domains contribute to interactions between Lyn kinase and cross-linked IgE receptors in stimulated mast cells.

  15. The SH2 domain interaction landscape.

    Science.gov (United States)

    Tinti, Michele; Kiemer, Lars; Costa, Stefano; Miller, Martin L; Sacco, Francesca; Olsen, Jesper V; Carducci, Martina; Paoluzi, Serena; Langone, Francesca; Workman, Christopher T; Blom, Nikolaj; Machida, Kazuya; Thompson, Christopher M; Schutkowski, Mike; Brunak, Søren; Mann, Matthias; Mayer, Bruce J; Castagnoli, Luisa; Cesareni, Gianni

    2013-04-25

    Members of the SH2 domain family modulate signal transduction by binding to short peptides containing phosphorylated tyrosines. Each domain displays a distinct preference for the sequence context of the phosphorylated residue. We have developed a high-density peptide chip technology that allows for probing of the affinity of most SH2 domains for a large fraction of the entire complement of tyrosine phosphopeptides in the human proteome. Using this technique, we have experimentally identified thousands of putative SH2-peptide interactions for more than 70 different SH2 domains. By integrating this rich data set with orthogonal context-specific information, we have assembled an SH2-mediated probabilistic interaction network, which we make available as a community resource in the PepspotDB database. A predicted dynamic interaction between the SH2 domains of the tyrosine phosphatase SHP2 and the phosphorylated tyrosine in the extracellular signal-regulated kinase activation loop was validated by experiments in living cells. Copyright © 2013 The Authors. Published by Elsevier Inc. All rights reserved.

  16. Pomegranate inhibits neuroinflammation and amyloidogenesis in IL-1β-stimulated SK-N-SH cells.

    Science.gov (United States)

    Velagapudi, Ravikanth; Baco, Gina; Khela, Sunjeet; Okorji, Uchechukwu; Olajide, Olumayokun

    2016-06-01

    Pomegranate fruit, Punica granatum L. (Punicaceae), and its constituents have been shown to inhibit inflammation. In this study, we aimed to assess the effects of freeze-dried pomegranate (PWE) on PGE2 production in IL-1β-stimulated SK-N-SH cells. An enzyme immunoassay (EIA) was used to measure prostaglandin E2 (PGE2) production from supernatants of IL-1β-stimulated SK-N-SH cells. Expression of COX-2, phospho-IκB, and phospho-IKK proteins was evaluated, while NF-κB reporter gene assay was carried out in TNFα-stimulated HEK293 cells to determine the effect of PWE on NF-κB transactivation. Levels of BACE-1 and Aβ in SK-N-SH cells stimulated with IL-1β were measured with an in cell ELISA. PWE (25-200 μg/ml) dose dependently reduced COX-2-dependent PGE2 production in SK-N-SH cells stimulated with IL-1β. Phosphorylation of IκB and IKK was significantly (p pomegranate inhibits inflammation, as well as amyloidogenesis in IL-1β-stimulated SK-N-SH cells. We propose that pomegranate is a potential nutritional strategy in slowing the progression of neurodegenerative disorders such as Alzheimer's disease.

  17. Suppression of LIM and SH3 Domain Protein 1 (LASP1) Negatively Regulated by Androgen Receptor Delays Castration Resistant Prostate Cancer Progression.

    Science.gov (United States)

    Dejima, Takashi; Imada, Kenjiro; Takeuchi, Ario; Shiota, Masaki; Leong, Jeffrey; Tombe, Tabitha; Tam, Kevin; Fazli, Ladan; Naito, Seiji; Gleave, Martin E; Ong, Christopher J

    2017-02-01

    LIM and SH3 domain protein 1 (LASP1) has been implicated in several human malignancies and has been shown to predict PSA recurrence in prostate cancer. However, the anti-tumor effect of LASP1 knockdown and the association between LASP1 and the androgen receptor (AR) remains unclear. The aim of this study is to clarify the significance of LASP1 as a target for prostate cancer, and to test the effect of silencing LASP1 in vivo using antisense oligonucleotides (ASO). A tissue microarray (TMA) was performed to characterize the differences in LASP1 expression in prostate cancer treated after hormone deprivation therapy. Flow cytometry was used to analyze cell cycle. We designed LASP1 ASO for knockdown of LASP1 in vivo studies. The expression of LASP1 in TMA was increased after androgen ablation and persisted in castration resistant prostate cancer (CRPC). Also in TMA, compared with LNCaP cell, LASP1 expression is elevated in CRPC cell lines (C4-2 and VehA cells). Interestingly, suppression of AR elevated LASP1 expression conversely, AR activation decreased LASP1 expression. Silencing of LASP1 reduced cell growth through G1 arrest which was accompanied by a decrease of cyclin D1. Forced overexpression of LASP1 promoted cell cycle and induced cell growth which was accompanied by an increase of cyclin D1. Systemic administration of LASP1 ASO with athymic mice significantly inhibited tumor growth in CRPC xenografts. These results indicate that LASP1 is negatively regulated by AR at the transcriptional level and promotes tumor growth through induction of cell cycle, ultimately suggesting that LASP1 may be a potential target in prostate cancer treatment. Prostate 77:309-320, 2017. © 2016 Wiley Periodicals, Inc. © 2016 Wiley Periodicals, Inc.

  18. Dental size variation in the Atapuerca-SH Middle Pleistocene hominids.

    Science.gov (United States)

    Bermúdez de Castro, J M; Sarmiento, S; Cunha, E; Rosas, A; Bastir, M

    2001-09-01

    The Middle Pleistocene Atapuerca-Sima de los Huesos (SH) site in Spain has yielded the largest sample of fossil hominids so far found from a single site and belonging to the same biological population. The SH dental sample includes a total of 452 permanent and deciduous teeth, representing a minimum of 27 individuals. We present a study of the dental size variation in these hominids, based on the analysis of the mandibular permanent dentition: lateral incisors, n=29; canines, n=27; third premolars, n=30; fourth premolars, n=34; first molars, n=38; second molars, n=38. We have obtained the buccolingual diameter and the crown area (measured on occlusal photographs) of these teeth, and used the bootstrap method to assess the amount of variation in the SH sample compared with the variation of a modern human sample from the Museu Antropologico of the Universidade of Coimbra (Portugal). The SH hominids have, in general terms, a dental size variation higher than that of the modern human sample. The analysis is especially conclusive for the canines. Furthermore, we have estimated the degree of sexual dimorphism of the SH sample by obtaining male and female dental subsamples by means of sexing the large sample of SH mandibular specimens. We obtained the index of sexual dimorphism (ISD=male mean/female mean) and the values were compared with those obtained from the sexed modern human sample from Coimbra, and with data found in the literature concerning several recent human populations. In all tooth classes the ISD of the SH hominids was higher than that of modern humans, but the differences were generally modest, except for the canines, thus suggesting that canine size sexual dimorphism in Homo heidelbergensis was probably greater than that of modern humans. Since the approach of sexing fossil specimens has some obvious limitations, these results should be assessed with caution. Additional data from SH and other European Middle Pleistocene sites would be necessary to test

  19. Codelivery of SH-aspirin and curcumin by mPEG-PLGA nanoparticles enhanced antitumor activity by inducing mitochondrial apoptosis

    Directory of Open Access Journals (Sweden)

    Zhou L

    2015-08-01

    Full Text Available Lin Zhou,1,2,* Xingmei Duan,1,2,* Shi Zeng,1 Ke Men,1 Xueyan Zhang,1 Li Yang,1 Xiang Li1 1State Key Laboratory of Biotherapy, Cancer Center and Department of Urology, West China Hospital, Sichuan University, Chengdu, People’s Republic of China; 2Sichuan Food and Drug Safety Monitoring and Review of Certification, Adverse Reaction Monitoring Center, Drug Abuse Monitoring Center, Chengdu, People’s Republic of China *These authors contributed equally to this work Abstract: Natural product curcumin (Cur and H2S-releasing prodrug SH-aspirin (SH-ASA are potential anticancer agents with diverse mechanisms, but their clinical application prospects are restricted by hydrophobicity and limited efficiency. In this work, we coencapsulated SH-ASA and Cur into methoxy poly(ethylene glycol-poly (lactide-coglycolide (mPEG-PLGA nanoparticles through a modified oil-in-water single-emulsion solvent evaporation process. The prepared SH-ASA/Cur-coloaded mPEG-PLGA nanoparticles had a mean particle size of 122.3±6.8 nm and were monodispersed (polydispersity index =0.179±0.016 in water, with high drug-loading capacity and stability. Intriguingly, by treating with SH-ASA/Cur-coloaded mPEG-PLGA nanoparticles, obvious synergistic anticancer effects on ES-2 and SKOV3 human ovarian carcinoma cells were observed in vitro, and activation of the mitochondrial apoptosis pathway was indicated. Our results demonstrated that SH-ASA/Cur-coloaded mPEG-PLGA nanoparticles could have potential clinical advantages for the treatment of ovarian cancer. Keywords: drug delivery, cancer therapy, ovarian cancer, synergistic effect

  20. Interactions of polyomavirus middle T with the SH2 domains of the pp85 subunit of phosphatidylinositol-3-kinase.

    Science.gov (United States)

    Yoakim, M; Hou, W; Liu, Y; Carpenter, C L; Kapeller, R; Schaffhausen, B S

    1992-01-01

    The binding of phosphatidylinositol-3-kinase to the polyomavirus middle T antigen is facilitated by tyrosine phosphorylation of middle T on residue 315. The pp85 subunit of phosphatidylinositol-3-kinase contains two SH2 domains, one in the middle of the molecule and one at the C terminus. When assayed by blotting with phosphorylated middle T, the more N-terminal SH2 domain is responsible for binding to middle T. When assayed in solution with glutathione S transferase fusions, both SH2s are capable of binding phosphorylated middle T. While both SH2 fusions can compete with intact pp85 for binding to middle T, the C-terminal SH2 is the more efficient of the two. Interaction between pp85 or its SH2 domains and middle T can be blocked by a synthetic peptide comprising the tyrosine phosphorylation sequence around middle T residue 315. Despite the fact that middle T can interact with both SH2s, these domains are not equivalent. Only the C-terminal SH2-middle T interaction was blocked by anti-SH2 antibody; the two SH2 fusions also interact with different cellular proteins. Images PMID:1380095

  1. Downregulation of mouse CCR3 by lentiviral shRNA inhibits proliferation and induces apoptosis of mouse eosinophils.

    Science.gov (United States)

    Zhu, Xin-Hua; Liao, Bing; Xu, Yi; Liu, Ke; Huang, Yun; Huang, Quan-Long; Liu, Yue-Hui

    2017-02-01

    RNA interference has been considered as an effective gene silencing method in basic and preclinical investigations. The aims of the present study were to construct a lentiviral vector expressing a short hairpin RNA (shRNA) targeting the murine CC chemokine receptor 3 (mCCR3), and to investigate its effects on the proliferation and apoptosis of mouse eosinophils. A recombinant lentiviral vector expressing four fragments of mouse CCR3 shRNA (pLVX‑mCCR31+2+3+4‑shRNA) was constructed using subcloning techniques. This novel lentivirus was then packaged into 293T cells by co‑transduction with plasmids, including Baculo p35, pCMV R8.2 and VSV. The interference effects of the vector were verified using polymerase chain reaction (PCR) and western blot analyses. The effects of the interference on the proliferation and apoptosis of mouse eosinophils were investigated using 3‑(4,5‑dimethylthiazol‑2‑yl)‑5‑(3‑carboxymethoxyphenyl)‑2‑(4‑sulfophenyl)‑2H‑tetrazolium and terminal deoxynucleotidyl transferase dUTP nick end labeling methods, respectively. The results of the PCR and western blot analyses confirmed that the novel recombinant vector, pLVX‑mCCR31+2+3+4‑shRNA, had high efficiency in inhibiting the mRNA and protein expression levels of mCCR3 in mouse eosinophils. The downregulation of mCCR3 significantly inhibited proliferation of the eosinophils. Furthermore, the present study found that the downregulation of mCCR3 significantly promoted apoptosis of the eosinophils. Therefore, the downregulation of mCCR3 led to the inhibition of proliferation and induction of apoptosis in mouse eosinophils. The predominant characteristics of allergic rhinitis are eosinophil infiltration and release of inflammatory mediators, which appear in a variety of clinical manifestations. The results of the present study indicate that mCCR3 silencing may serve as a putative approach for the treatment of allergic rhinitis.

  2. A novel mutation in the SH3BP2 gene causes cherubism: case report

    Directory of Open Access Journals (Sweden)

    Yu Shi-Feng

    2006-12-01

    Full Text Available Abstract Background Cherubism is a rare hereditary multi-cystic disease of the jaws, characterized by its typical appearance in early childhood, and stabilization and remission after puberty. It is genetically transmitted in an autosomal dominant fashion and the gene coding for SH3-binding protein 2 (SH3BP2 may be involved. Case presentation We investigated a family consisting of 21 members with 3 female affected individuals with cherubism from Northern China. Of these 21 family members, 17 were recruited for the genetic analysis. We conducted the direct sequence analysis of the SH3BP2 gene among these 17 family members. A disease-causing mutation was identified in exon 9 of the gene. It was an A1517G base change, which leads to a D419G amino acid substitution. Conclusion To our knowledge, the A1517G mutation has not been reported previously in cherubism. This finding is novel.

  3. Deciphering of ADP-induced, phosphotyrosine-dependent signaling networks in human platelets by Src-homology 2 region (SH2)-profiling.

    Science.gov (United States)

    Schweigel, Hardy; Geiger, Jörg; Beck, Florian; Buhs, Sophia; Gerull, Helwe; Walter, Ulrich; Sickmann, Albert; Nollau, Peter

    2013-03-01

    Tyrosine phosphorylation plays a central role in signal transduction controlling many important biological processes. In platelets, the activity of several signaling proteins is controlled by tyrosine phosphorylation ensuring proper platelet activation and aggregation essential for regulation of the delicate balance between bleeding and hemostasis. Here, we applied Src-homology 2 region (SH2)-profiling for deciphering of the phosphotyrosine state of human platelets activated by adenosine diphosphate (ADP). Applying a panel of 31 SH2-domains, rapid and complex regulation of the phosphotyrosine state of platelets was observed after ADP stimulation. Specific inhibition of platelet P2Y receptors by synthetic drugs revealed a major role for the P2Y1 receptor in tyrosine phosphorylation. Concomitant activation of protein kinase A (PKA) abolished ADP-induced tyrosine phosphorylation in a time and concentration-dependent manner. Given the fact that PKA activity is negatively regulated by the P2Y12 receptor, our data provide evidence for a novel link of synergistic control of the state of tyrosine phosphorylation by both P2Y receptors. By SH2 domain pull down and MS/MS analysis, we identified distinct tyrosine phosphorylation sites in cell adhesion molecules, intracellular adapter proteins and phosphatases suggesting a major, functional role of tyrosine phosphorylation of theses candidate proteins in ADP-dependent signaling in human platelets. © 2013 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  4. Highly Efficient Performance and Conversion Pathway of Photocatalytic CH3SH Oxidation on Self-Stabilized Indirect Z-scheme g-C3N4/I3-BiOI.

    Science.gov (United States)

    Hu, Lingling; He, Huanjunwa; Xia, Dehua; Huang, Yajing; Xu, Jiarong; Li, Haoyue; He, Chun; Yang, Wenjing; Shu, Dong; Wong, Po Keung

    2018-05-07

    A self-stabilized Z-scheme porous g-C3N4/I3--containing BiOI ultrathin nanosheets (g-C3N4/I3--BiOI) heterojunction photocatalyst with I3-/I- redox mediator was successfully synthesized by a facile solvothermal method coupling with light illumination. The structure and optical properties of g-C3N4/I3--BiOI composites were systematically characterized by means of XRD, SEM, TEM, FT-IR, XPS, N2 adsorption/desorption, UV-vis DRS, PL. The g-C3N4/I3--BiOI composites, with heterojunction between porous g-C3N4 and BiOI ultrathin nanosheets, were firstly applied for the photocatalytic elimination of ppm-leveled CH3SH under LED visible light illumination. The g-C3N4/I3--BiOI heterojunction with 10% g-C3N4 showed a dramatically enhanced photocatalytic activity in removal of CH3SH compared with pure BiOI and g-C3N4, due to its effective interfacial charge transfer and separation. The adsorption and photocatalytic oxidation of CH3SH over g-C3N4/I3--BiOI were deeply explored by in situ DRIFTS, and the intermediates and conversion pathways were elucidated and compared. Furthermore, on the basis of reactive species trapping, ESR and Mott-Schottky experiments, it was revealed that the responsible reactive species for catalytic CH3SH composotion were h+, ·O2- and 1O2, thus, the g-C3N4/I3--BiOI heterojunction followed an indirect all-solid state Z-scheme charge transfer mode with self-stabilized I3-/I- pairs as redox mediator, which could accelerate the separation of photo-generated charge and enhance the redox reaction power of charged carriers simultaneously.

  5. Expression, refolding and crystallizations of the Grb2-like (GADS) C-terminal SH3 domain complexed with a SLP-76 motif peptide

    International Nuclear Information System (INIS)

    Faravelli, Alessandro; Dimasi, Nazzareno

    2005-01-01

    Several crystals of the Grb2-like C-terminal SH3 domain in complex with a motif peptide from the SLP-76 protein were obtained and characterized. The Grb2-like adaptor protein GADS is composed of an N-terminal SH3 domain, an SH2 domain, a proline-rich region and a C-terminal SH3 domain. GADS interacts through its C-terminal SH3 domain with the adaptor protein SLP-76, thus recruiting this protein and other associated molecules to the linker for activation of T-cell (LAT) protein. The DNA encoding the C-terminal SH3 domain of GADS (GADS-cSH3) was assembled synthetically using a recursive PCR technique and the protein was overexpressed in Escherichia coli, refolded and purified. Several crystals of this domain in complex with the SLP-76 peptide were obtained and characterized

  6. The biologic role of ganglioside in neuronal differentiation--effects of GM1 ganglioside on human neuroblastoma SH-SY5Y cells.

    OpenAIRE

    Lee, M. C.; Lee, W. S.; Park, C. S.; Juhng, S. W.

    1994-01-01

    Human neuroblastoma SH-SY5Y cell is a cloned cell line which has many attractive features for the study of neuronal proliferation and neurite outgrowth, because it has receptors for insulin, IGF-I and PDGF. Gangliosides are sialic acid containing glycosphingolipids which form an integral part of the plasma membrane of many mammalian cells. They inhibit cell growth mediated by tyrosine kinase receptors and ligand-stimulated tyrosine kinase activity, and autophosphorylation of EGF(epidermal gro...

  7. A fluorescence assay for measuring acetylcholinesterase activity in rat blood and a human neuroblastoma cell line (SH-SY5Y).

    Science.gov (United States)

    Santillo, Michael F; Liu, Yitong

    2015-01-01

    Acetylcholinesterase (AChE) is an enzyme responsible for metabolism of the neurotransmitter acetylcholine, and inhibition of AChE can have therapeutic applications (e.g., drugs for Alzheimer's disease) or neurotoxic consequences (e.g., pesticides). A common absorbance-based AChE activity assay that uses 5,5'-dithiobis(2-nitrobenzoic acid) (DTNB) can have limited sensitivity and be prone to interference. Therefore, an alternative assay was developed, in which AChE activity was determined by measuring fluorescence of resorufin produced from coupled enzyme reactions involving acetylcholine and Amplex Red (10-acetyl-3,7-dihydroxyphenoxazine). The Amplex Red assay was used for two separate applications. First, AChE activity was measured in rat whole blood, which is a biomarker for exposure to AChE inhibitor pesticides. Activity was quantified from a 10(5)-fold dilution of whole blood, and there was a linear correlation between Amplex Red and DTNB assays. For the second application, Amplex Red assay was used to measure AChE inhibition potency in a human neuroblastoma cell line (SH-SY5Y), which is important for assessing pharmacological and toxicological potential of AChE inhibitors including drugs, phytochemicals, and pesticides. Five known reversible inhibitors were evaluated (IC50, 7-225 nM), along with irreversible inhibitors chlorpyrifos-oxon (ki=1.01 nM(-1)h(-1)) and paraoxon (ki=0.16 nM(-1)h(-1)). Lastly, in addition to inhibition, AChE reactivation was measured in SH-SY5Y cells incubated with pralidoxime chloride (2-PAM). The Amplex Red assay is a sensitive, specific, and reliable fluorescence method for measuring AChE activity in both rat whole blood and cultured SH-SY5Y cells. Published by Elsevier Inc.

  8. Biomarkers of environmental genotoxicity: comparison of genetic damage induced in Trad-SH cells and human lymphocytes

    International Nuclear Information System (INIS)

    Cebulska-Wasilewska, A.

    1999-01-01

    The report presents some of the results of genotoxicity of the environmental agents studied in somatic cells of Tradescantia and show similarity between responses of the Tradescantia stamen hair cells (Trad-SH) and human blood cells to the physical and chemical mutagens. In the studies in vitro chromosome aberrations (CA) and sister chromatid exchanges (SCE) were applied to evaluate genotoxicity of pesticides. For comparison of genotoxic effectiveness of agrochemicals with other chemicals, there are also presented results of the genotoxicity of well-known mutagens (EMS, X-rays). The results confirm that in the environment a chemical pollution might cause higher genetic risk than radiation. Trad-SH assay was applied for in situ monitoring of the ambient air mutagenicity caused by benzene and petroleum associated compounds. The studies showed that gene mutation frequencies were slightly dependent on the distance from the petroleum work center. Results of measures of the cell cycle factor have shown also that the chemical pollutants in the air played also an important role in physiological cellular processes. The similarity of the Trad-SH and human blood cells responses to the physical and chemical mutagens showed that the gene mutations in Tradescantia present a simple and sensitive model, which can be very useful in biological monitoring

  9. Expression and Production of SH2 Domain Proteins.

    Science.gov (United States)

    Liu, Bernard A; Ogiue-Ikeda, Mari; Machida, Kazuya

    2017-01-01

    The Src Homology 2 (SH2) domain lies at the heart of phosphotyrosine signaling, coordinating signaling events downstream of receptor tyrosine kinases (RTKs), adaptors, and scaffolds. Over a hundred SH2 domains are present in mammals, each having a unique specificity which determines its interactions with multiple binding partners. One of the essential tools necessary for studying and determining the role of SH2 domains in phosphotyrosine signaling is a set of soluble recombinant SH2 proteins. Here we describe methods, based on a broad experience with purification of all SH2 domains, for the production of SH2 domain proteins needed for proteomic and biochemical-based studies such as peptide arrays, mass-spectrometry, protein microarrays, reverse-phase microarrays, and high-throughput fluorescence polarization (HTP-FP). We describe stepwise protocols for expression and purification of SH2 domains using GST or poly His-tags, two widely adopted affinity tags. In addition, we address alternative approaches, challenges, and validation studies for assessing protein quality and provide general characteristics of purified human SH2 domains.

  10. Itk tyrosine kinase substrate docking is mediated by a nonclassical SH2 domain surface of PLCgamma1.

    Science.gov (United States)

    Min, Lie; Joseph, Raji E; Fulton, D Bruce; Andreotti, Amy H

    2009-12-15

    Interleukin-2 tyrosine kinase (Itk) is a Tec family tyrosine kinase that mediates signaling processes after T cell receptor engagement. Activation of Itk requires recruitment to the membrane via its pleckstrin homology domain, phosphorylation of Itk by the Src kinase, Lck, and binding of Itk to the SLP-76/LAT adapter complex. After activation, Itk phosphorylates and activates phospholipase C-gamma1 (PLC-gamma1), leading to production of two second messengers, DAG and IP(3). We have previously shown that phosphorylation of PLC-gamma1 by Itk requires a direct, phosphotyrosine-independent interaction between the Src homology 2 (SH2) domain of PLC-gamma1 and the kinase domain of Itk. We now define this docking interface using a combination of mutagenesis and NMR spectroscopy and show that disruption of the Itk/PLCgamma1 docking interaction attenuates T cell signaling. The binding surface on PLCgamma1 that mediates recognition by Itk highlights a nonclassical binding activity of the well-studied SH2 domain providing further evidence that SH2 domains participate in important signaling interactions beyond recognition of phosphotyrosine.

  11. Flexibility of the myosin heavy chain: direct evidence that the region containing SH/sub 1/ and SH/sub 2/ can move 10 /Angstrom/ under the influence of nucleotide binding

    Energy Technology Data Exchange (ETDEWEB)

    Huston, E.E.; Grammer, J.C.; Yount, R.G.

    1988-12-13

    Previous experiments demonstrated that two thiols of skeletal myosin subfragment 1 (SF/sub 1/) could be oxidized to a disulfide bond by treatment with a 2-fold excess of 5,5'-dithiobis (2-nitrobenzoic acid) (DTNB) in the presence of MgADP. The resulting characteristic changes in the ATPase activities of SF/sub 1/ and the fact that MgADP was stably trapped at the active site, suggested that the two thiols cross-linked were SH/sub 1/ (Cys-707) and SH/sub 2/ (Cys-697) from the myosin heavy chain. To verify this suggestion, SF/sub 1/, after DTNB treatment as above, was treated with an excess of N-ethylmaleimide to block all accessible thiols. The single protein disulfide produced by DTNB oxidation was reduced with dithioerythritol and the modified SF/sub 1/ internally cross-linked with equimolar (/sup 14/C)p-phenylenedimaleimide (pPDM) in the presence of MgADP. After extensive trypsinization, the major /sup 14/C-labeled peptide was isolated, characterized, and shown to be Cys-Asn-Gly-Val-Leu-Gly-Ile-Arg-Ile-Cys-Arg, in which the two cysteines were cross-linked by pPDM. This peptide is known to contain SH/sub 2/ and SH/sub 1/ in this order and to come from residues 697-708 in the rabbit skeletal myosin heavy chain. Parallel experiments with (/sup 14/C)pPDM and unmodified SF/sub 1/ similar to those above gave an identical SH/sub 1/, SH/sub 2/ tryptic peptide, verifying earlier labeling results. These combined results demonstrate that SH/sub 1/ and SH/sub 2/ cross-linked by pPDM (12-13 /Angstrom/, S to S) or by oxidation with DTNB (2 /Angstrom/, S to S) can move a minimum of 10 /Angstrom/ under the influence of nucleotide binding. Because these residues are separated by only nine amino acids in the primary sequence, this small section of the heavy chain must possess extraordinary flexibility.

  12. Ras-MAPK signaling in differentiating SH-SY5Y human neuroblastoma cells

    OpenAIRE

    Olsson, Anna-Karin

    2000-01-01

    Neuroblastoma is a malignant childhood cancer, originating from sympathetic neuroblasts of the peripheral nervous system. Neuroblastoma is a heterogenous group of tumours, while some are highly malignant others can spontaneosly mature into a more benign form or regress. Less than half of the patients survive and this statistics has improved only modestly over the past 20 years. SH-SY5Y is a human neuroblastoma cell line established from a highly malignant tumour. The cells have retained a ca...

  13. Screening for coding variants in FTO and SH2B1 genes in Chinese patients with obesity.

    Directory of Open Access Journals (Sweden)

    Zhaojing Zheng

    Full Text Available To investigate potential functional variants in FTO and SH2B1 genes among Chinese children with obesity.Sanger sequencing of PCR products of all FTO and SH2B1 exons and their flanking regions were performed in 338 Chinese Han children with obesity and 221 age- and sex-matched lean controls.A total of seven and five rare non-synonymous variants were identified in FTO and SH2B1, respectively. The overall frequencies of FTO and SH2B1 rare non-synonymous variants were similar in obese and lean children (2.37% and 0.90% vs. 1.81% and 1.36%, P>0.05. However, four out of the seven variants in FTO were novel and all were unique to obese children (p>0.05. None of the novel variants was consistently being predicted to be deleterious. Four out of five variants in SH2B1 were novel and one was unique to obese children (p>0.05. One variant (L293R that was consistently being predicted as deleterious in SH2B1 gene was unique to lean control. While rare missense mutations were more frequently detected in girls from obesity as well as lean control than boys, the difference was not statistically significant. In addition, it's shown that the prevalence of rare missense mutations of FTO as well as SH2B1 was similar across different ethnic groups.The rare missense mutations of FTO and SH2B1 did not confer risks of obesity in Chinese Han children in our cohort.

  14. Postneonatal Mortality and Liver Changes in Cloned Pigs Associated with Human Tumor Necrosis Factor Receptor I-Fc and Human Heme Oxygenase-1 Overexpression.

    Science.gov (United States)

    Kim, Geon A; Jin, Jun-Xue; Lee, Sanghoon; Taweechaipaisankul, Anukul; Oh, Hyun Ju; Hwang, Joing-Ik; Ahn, Curie; Saadeldin, Islam M; Lee, Byeong Chun

    2017-01-01

    Soluble human tumor necrosis factor (shTNFRI-Fc) and human heme oxygenase 1 (hHO-1) are key regulators for protection against oxidative and inflammatory injury for xenotransplantation. Somatic cells with more than 10 copy numbers of shTNFRI-Fc and hHO-1 were employed in somatic cell nuclear transfer to generate cloned pigs, thereby resulting in seven cloned piglets. However, produced piglets were all dead within 24 hours after birth. Obviously, postnatal death with liver apoptosis was reported in the higher copy number of shTNFRI-Fc and hHO-1 piglets. In liver, the transcript levels of ferritin heavy chain, light chain, transferrin, and inducible nitric oxide synthase were significantly highly expressed compared to those of lower copy number of shTNFRI-Fc and hHO-1 piglets ( P hHO-1 piglets ( P hHO-1 overexpression may apparently induce free iron in the liver and exert oxidative stress by enhancing reactive oxygen species production and block normal postneonatal liver metabolism.

  15. Mechanisms of CDDO-imidazolide-mediated cytoprotection against acrolein-induced neurocytotoxicity in SH-SY5Y cells and primary human astrocytes.

    Science.gov (United States)

    Speen, Adam; Jones, Colton; Patel, Ruby; Shah, Halley; Nallasamy, Palanisamy; Brooke, Elizabeth A S; Zhu, Hong; Li, Y Robert; Jia, Zhenquan

    2015-10-01

    Acrolein is a ubiquitous unsaturated aldehyde has been implicated in the pathogenesis of various neurological disorders. However, limited study has been conducted into potential therapeutic protection and underlying mechanism against acrolein-induced cytotoxicity via upregulation of cellular aldehyde-detoxification defenses. In this study we have utilized RA-differentiated human SH-SY5Y cells and primary human astrocytes to investigate the induction of glutathione (GSH) by the synthetic triterpenoid 2-cyano-3,12-dixooleana-1,9-dien-28-imidazolide (CDDO-Im) and the protective effects CDDO-Im-mediated antioxidant defenses on acrolein toxicity. Acrolein exposure to RA-differentiated SH-SY5Y cells resulted in a significant time dependent depletion of cellular GSH preceding a reduction in cell viability and LDH release. Further, we demonstrated the predominance of cellular GSH in protection against acrolein-induced cytotoxicity. Buthionine sulfoximine (BSO) at 25μM dramatically depleted GSH and significantly potentiated acrolein-induced cytotoxicity. Pretreatment of the cells with 100nM CDDO-Im afforded a dramatic protection against acrolein-induced cytotoxicity. Pretreatment of BSO and CDDO was found to prevent the CDDO-Im-mediated GSH induction and partially reversed the cytoprotective effects of CDDO-Im against acrolein cytotoxicity. Overall, this study represents for the first time the CDDO-Im mediated upregulation of GSH is a predominant mechanism against acrolein-induced neurotoxicity. Copyright © 2015 Elsevier Ireland Ltd. All rights reserved.

  16. F-BAR family proteins, emerging regulators for cell membrane dynamic changes-from structure to human diseases.

    Science.gov (United States)

    Liu, Suxuan; Xiong, Xinyu; Zhao, Xianxian; Yang, Xiaofeng; Wang, Hong

    2015-05-09

    Eukaryotic cell membrane dynamics change in curvature during physiological and pathological processes. In the past ten years, a novel protein family, Fes/CIP4 homology-Bin/Amphiphysin/Rvs (F-BAR) domain proteins, has been identified to be the most important coordinators in membrane curvature regulation. The F-BAR domain family is a member of the Bin/Amphiphysin/Rvs (BAR) domain superfamily that is associated with dynamic changes in cell membrane. However, the molecular basis in membrane structure regulation and the biological functions of F-BAR protein are unclear. The pathophysiological role of F-BAR protein is unknown. This review summarizes the current understanding of structure and function in the BAR domain superfamily, classifies F-BAR family proteins into nine subfamilies based on domain structure, and characterizes F-BAR protein structure, domain interaction, and functional relevance. In general, F-BAR protein binds to cell membrane via F-BAR domain association with membrane phospholipids and initiates membrane curvature and scission via Src homology-3 (SH3) domain interaction with its partner proteins. This process causes membrane dynamic changes and leads to seven important cellular biological functions, which include endocytosis, phagocytosis, filopodium, lamellipodium, cytokinesis, adhesion, and podosome formation, via distinct signaling pathways determined by specific domain-binding partners. These cellular functions play important roles in many physiological and pathophysiological processes. We further summarize F-BAR protein expression and mutation changes observed in various diseases and developmental disorders. Considering the structure feature and functional implication of F-BAR proteins, we anticipate that F-BAR proteins modulate physiological and pathophysiological processes via transferring extracellular materials, regulating cell trafficking and mobility, presenting antigens, mediating extracellular matrix degradation, and transmitting

  17. Optical and millimeter wavelength study of the complex Sh2-147/Sh2-153

    International Nuclear Information System (INIS)

    Heydari-Malayeri, M.; Testor, G.; Kahane, C.; Lucas, R.

    1982-01-01

    Sh2-147/Sh2-153 is a vast HII region-molecular cloud complex of dimension 1 0 .5 located in the Perseus arm at l approximately 109 0 . This cloud embodies the HII regions Sh2-147, 148, 149, 152 and 153. In this direction were detected several H 2 O and OH masers, a number of infrared sources, and a supernova remnant. The authors present the 13 CO map and also optical results on two of the HII regions: Sh2-152 and 148. (Auth.)

  18. BDNF and the maturation of posttranscriptional regulatory networks in human SH-SY5Y neuroblast differentiation

    Directory of Open Access Journals (Sweden)

    Belinda J Goldie

    2014-10-01

    Full Text Available The SH-SY5Y culture system is a convenient neuronal model with the potential to elaborate human/primate-specific transcription networks and pathways related to human cognitive disorders. While this system allows for the exploration of specialised features in the human genome, there is still significant debate about how this model should be implemented, and its appropriateness for answering complex functional questions related to human neural architecture. In view of these questions we sought to characterise the posttranscriptional regulatory structure of the two-stage ATRA differentiation, BDNF maturation protocol proposed by Encinas and colleagues (2010 using integrative whole-genome gene and microRNA (miRNA expression analysis. We report that ATRA-BDNF induced significant increases in expression of key synaptic genes, brain-specific miRNA and miRNA biogenesis machinery, and in AChE activity, compared with ATRA alone. Functional annotation clustering associated BDNF more significantly with neuronal terms, and with synaptic terms not found in ATRA-only clusters. While our results support use of SH-SY5Y as a neuronal model, we advocate considered selection of the differentiation agent/s relative to the system being modelled.

  19. BDNF and the maturation of posttranscriptional regulatory networks in human SH-SY5Y neuroblast differentiation.

    Science.gov (United States)

    Goldie, Belinda J; Barnett, Michelle M; Cairns, Murray J

    2014-01-01

    The SH-SY5Y culture system is a convenient neuronal model with the potential to elaborate human/primate-specific transcription networks and pathways related to human cognitive disorders. While this system allows for the exploration of specialized features in the human genome, there is still significant debate about how this model should be implemented, and its appropriateness for answering complex functional questions related to human neural architecture. In view of these questions we sought to characterize the posttranscriptional regulatory structure of the two-stage ATRA differentiation, BDNF maturation protocol proposed by Encinas et al. (2000) using integrative whole-genome gene and microRNA (miRNA) expression analysis. We report that ATRA-BDNF induced significant increases in expression of key synaptic genes, brain-specific miRNA and miRNA biogenesis machinery, and in AChE activity, compared with ATRA alone. Functional annotation clustering associated BDNF more significantly with neuronal terms, and with synaptic terms not found in ATRA-only clusters. While our results support use of SH-SY5Y as a neuronal model, we advocate considered selection of the differentiation agent/s relative to the system being modeled.

  20. Application of shRNA-containing herpes simplex virus type 1 (HSV-1)-based gene therapy for HSV-2-induced genital herpes.

    Science.gov (United States)

    Liu, Zhihong; Xiang, Yang; Wei, Zhun; Yu, Bo; Shao, Yong; Zhang, Jie; Yang, Hong; Li, Manmei; Guan, Ming; Wan, Jun; Zhang, Wei

    2013-11-01

    HSV-1-based vectors have been widely used to achieve targeted delivery of genes into the nervous system. In the current study, we aim to use shRNA-containing HSV-1-based gene delivery system for the therapy of HSV-2 infection. Guinea pigs were infected intravaginally with HSV-2 and scored daily for 100 days for the severity of vaginal disease. HSV-2 shRNA-containing HSV-1 was applied intravaginally daily between 8 and 14 days after HSV-2 challenge. Delivery of HSV-2 shRNA-containing HSV-1 had no effect on the onset of disease and acute virus shedding in animals, but resulted in a significant reduction in both the cumulative recurrent lesion days and the number of days with recurrent disease. Around half of the animals in the HSV-2 shRNA group did not develop recurrent disease 100 days post HSV-2 infection. In conclusion, HSV-2 shRNA-containing HSV-1 particles are effective in reducing the recurrence of genital herpes caused by HSV-2. Copyright © 2013 Elsevier B.V. All rights reserved.

  1. Adaptor proteins intersectin 1 and 2 bind similar proline-rich ligands but are differentially recognized by SH2 domain-containing proteins.

    Directory of Open Access Journals (Sweden)

    Olga Novokhatska

    Full Text Available BACKGROUND: Scaffolding proteins of the intersectin (ITSN family, ITSN1 and ITSN2, are crucial for the initiation stage of clathrin-mediated endocytosis. These proteins are closely related but have implications in distinct pathologies. To determine how these proteins could be separated in certain cell pathways we performed a comparative study of ITSNs. METHODOLOGY/PRINCIPAL FINDINGS: We have shown that endogenous ITSN1 and ITSN2 colocalize and form a complex in cells. A structural comparison of five SH3 domains, which mediated most ITSNs protein-protein interactions, demonstrated a similarity of their ligand-binding sites. We showed that the SH3 domains of ITSN2 bound well-established interactors of ITSN1 as well as newly identified ITSNs protein partners. A search for a novel interacting interface revealed multiple tyrosines that could be phosphorylated in ITSN2. Phosphorylation of ITSN2 isoforms but not ITSN1 short isoform was observed in various cell lines. EGF stimulation of HeLa cells enhanced tyrosine phosphorylation of ITSN2 isoforms and enabled their recognition by the SH2 domains of the Fyn, Fgr and Abl1 kinases, the regulatory subunit of PI3K, the adaptor proteins Grb2 and Crk, and phospholipase C gamma. The SH2 domains mentioned were unable to bind ITSN1 short isoform. CONCLUSIONS/SIGNIFICANCE: Our results indicate that during evolution of vertebrates ITSN2 acquired a novel protein-interaction interface that allows its specific recognition by the SH2 domains of signaling proteins. We propose that these data could be important to understand the functional diversity of paralogous ITSN proteins.

  2. Lipopolysaccharide induces VCAM-1 expression and neutrophil adhesion to human tracheal smooth muscle cells: Involvement of Src/EGFR/PI3-K/Akt pathway

    International Nuclear Information System (INIS)

    Lin, W.-N.; Luo, S.-F.; Wu, C.-B.; Lin, C.-C.; Yang, C.-M.

    2008-01-01

    In our previous study, LPS has been shown to induce vascular cell adhesion molecule-1(VCAM-1) expression through MAPKs and NF-κB in human tracheal smooth muscle cells (HTSMCs). In addition to these pathways, the non-receptor tyrosine kinases (Src), EGF receptor (EGFR), and phosphatidylinositol 3-kinase (PI3K) have been shown to be implicated in the expression of several inflammatory target proteins. Here, we reported that LPS-induced up-regulation of VCAM-1 enhanced the adhesion of neutrophils onto HTSMC monolayer, which was inhibited by LY294002 and wortmannin. LPS stimulated phosphorylation of protein tyrosine kinases including Src, PYK2, and EGFR, which were further confirmed using specific anti-phospho-Src, PYK2, or EGFR Ab, respectively, revealed by Western blotting. LPS-stimulated Src, PYK2, EGFR, and Akt phosphorylation and VCAM-1 expression were attenuated by the inhibitors of Src (PP1), EGFR (AG1478), PI3-K (LY294002 and wortmannin), and Akt (SH-5), respectively, or transfection with siRNAs of Src or Akt and shRNA of p110. LPS-induced VCAM-1 expression was also blocked by pretreatment with curcumin (a p300 inhibitor) or transfection with p300 siRNA. LPS-stimulated Akt activation translocated into nucleus and associated with p300 and VCAM-1 promoter region was further confirmed by immunofluorescence, immunoprecipitation, and chromatin immunoprecipitation assays. This association of Akt and p300 to VCAM-1 promoter was inhibited by pretreatment with PP1, AG1478, wortmannin, and SH-5. LPS-induced p300 activation enhanced VCAM-1 promoter activity and VCAM-1 mRNA expression. These results suggested that in HTSMCs, Akt phosphorylation mediated through transactivation of Src/PYK2/EGFR promoted the transcriptional p300 activity and eventually led to VCAM-1 expression induced by LPS

  3. Polymorphisms in sh2b1 and spns1 loci are associated with ...

    Indian Academy of Sciences (India)

    SH2B1, which encodes a signal transduction adaptor protein ... Here, we studied the associa- tion of eight single ... Health Study (NSPHS) cohort, consisting of 719 individuals ... mate can lower triglyceride levels, and elevate high-density.

  4. The Cish SH2 domain is essential for PLC-γ1 regulation in TCR stimulated CD8+ T cells.

    Science.gov (United States)

    Guittard, Geoffrey; Dios-Esponera, Ana; Palmer, Douglas C; Akpan, Itoro; Barr, Valarie A; Manna, Asit; Restifo, Nicholas P; Samelson, Lawrence E

    2018-03-28

    Cish, participates within a multi-molecular E3 ubiquitin ligase complex, which ubiquitinates target proteins. It has an inhibitory effect on T cell activation mediated by PLC-γ1 regulation, and it functions as a potent checkpoint in CD8 + T cell tumor immunotherapy. To study the structural and functional relationships between Cish and PLC-γ1 during CD8 + T cell activation, we tested mutants of the Cish-SH2 (R107K) and D/BC (L222Q, C226Q) domains. We confirmed that Cish-SH2-specific binding was essential for PLC-γ1 ubiquitination and degradation. This domain was essential for the Cish-mediated inhibition of Ca 2+ release upon TCR stimulation. No effect on inhibition of cytokine release was observed with SH2 or D/BC mutants, although the absence of Cish led to an increased release of IFN-γ and TNF-α. Using imaging we showed that Cish was expressed mostly in the cytoplasm and we did not see any Cish clustering at the plasma membrane upon stimulation. We conclude that the Cish-SH2 domain is essential for PLC-γ1 regulation in TCR-stimulated CD8 + T cells.

  5. Cisplatin induces protective autophagy through activation of BECN1 in human bladder cancer cells

    Directory of Open Access Journals (Sweden)

    Lin JF

    2017-05-01

    Full Text Available Ji-Fan Lin,1 Yi-Chia Lin,2 Te-Fu Tsai,2,3 Hung-En Chen,2 Kuang-Yu Chou,2,3 Thomas I-Sheng Hwang2–4 1Central Laboratory, Shin Kong Wu Ho-Su Memorial Hospital, Taipei, 2Division of Urology, School of Medicine, Fu-Jen Catholic University, New Taipei, 3Division of Urology, Department of Surgery, Shin Kong Wu Ho-Su Memorial Hospital, 4Department of Urology, Taipei Medical University, Taipei, Taiwan Purpose: Cisplatin-based chemotherapy is the first line treatment for several cancers including bladder cancer (BC. Autophagy induction has been implied to contribute to cisplatin resistance in ovarian cancer; and a high basal level of autophagy has been demonstrated in human bladder tumors. Therefore, it is reasonable to speculate that autophagy may account for the failure of cisplatin single treatment in BC. This study investigated whether cisplatin induces autophagy and the mechanism involved using human BC cell lines.Materials and methods: Human BC cells (5637 and T24 were used in this study. Cell viability was detected using water soluble tetrazolium-8 reagents. Autophagy induction was detected by monitoring the levels of light chain 3 (LC3-II and p62 by Western blot, LC3-positive puncta formation by immunofluorescence, and direct observation of the autophagolysosome (AL formation by transmission electron microscopy. Inhibitors including bafilomycin A1 (Baf A1, chloroquine (CQ, and shRNA-based lentivirus against autophagy-related genes (ATG7 and ATG12 were utilized. Apoptosis level was detected by caspase 3/7 activity and DNA fragmentation.Results: Cisplatin decreased cell viability and induced apoptosis of 5637 and T24 cells in a dose- and time-dependent manner. The increased LC3-II accumulation, p62 clearance, the number of LC3-positive puncta, and ALs in cisplatin-treated cells suggested that cisplatin indeed induces autophagy. Inhibition of cisplatin-induced autophagy using Baf A1, CQ, or ATG7/ATG12 shRNAs significantly enhanced cytotoxicity of

  6. Cisplatin induces protective autophagy through activation of BECN1 in human bladder cancer cells.

    Science.gov (United States)

    Lin, Ji-Fan; Lin, Yi-Chia; Tsai, Te-Fu; Chen, Hung-En; Chou, Kuang-Yu; Hwang, Thomas I-Sheng

    2017-01-01

    Cisplatin-based chemotherapy is the first line treatment for several cancers including bladder cancer (BC). Autophagy induction has been implied to contribute to cisplatin resistance in ovarian cancer; and a high basal level of autophagy has been demonstrated in human bladder tumors. Therefore, it is reasonable to speculate that autophagy may account for the failure of cisplatin single treatment in BC. This study investigated whether cisplatin induces autophagy and the mechanism involved using human BC cell lines. Human BC cells (5637 and T24) were used in this study. Cell viability was detected using water soluble tetrazolium-8 reagents. Autophagy induction was detected by monitoring the levels of light chain 3 (LC3)-II and p62 by Western blot, LC3-positive puncta formation by immunofluorescence, and direct observation of the autophagolysosome (AL) formation by transmission electron microscopy. Inhibitors including bafilomycin A1 (Baf A1), chloroquine (CQ), and shRNA-based lentivirus against autophagy-related genes (ATG7 and ATG12) were utilized. Apoptosis level was detected by caspase 3/7 activity and DNA fragmentation. Cisplatin decreased cell viability and induced apoptosis of 5637 and T24 cells in a dose-and time-dependent manner. The increased LC3-II accumulation, p62 clearance, the number of LC3-positive puncta, and ALs in cisplatin-treated cells suggested that cisplatin indeed induces autophagy. Inhibition of cisplatin-induced autophagy using Baf A1, CQ, or ATG7/ATG12 shRNAs significantly enhanced cytotoxicity of cisplatin toward BC cells. These results indicated that cisplatin induced protective autophagy which may contribute to the development of cisplatin resistance and resulted in treatment failure. Mechanistically, upregulation of beclin-1 (BECN1) was detected in cisplatin-treated cells, and knockdown of BECN1 using shRNA attenuated cisplatin-induced autophagy and subsequently enhanced cisplatin-induced apoptosis. Collectively, the study results

  7. MgADP-induced changes in the structure of myosin S1 near the ATPase-related thiol SH1 probed by cross-linking

    International Nuclear Information System (INIS)

    Rajasekharan, K.N.; Mayadevi, M.; Agarwal, R.; Burke, M.

    1990-01-01

    The structural consequence of MgADP binding at the vicinity of the ATPase-related thiol SH1 (Cys-707) have been examined by subjecting myosin subfragment 1, premodified at SH2 (Cys-697) with N-ethylmaleimide (NEM), to reaction with the bifunctional reagent p-phenylenedimaleimide (pPDM) in the presence and absence of MgADP. By monitoring the changes in the Ca 2+ -ATPase activity as a function of reaction time, it appears that the reagent rapidly modifies SH1 irrespective of whether MgADP is present or not. In the absence of nucleotide, only extremely low levels of cross-linking to the 50-kDa middle segment of S1 can be detected, while in the presence of MgADP substantial cross-linking to this segment is observed. A similar cross-link is also formed if MgADP is added subsequent to the reaction of the SH2-NEM-premodified S1 with pPDM in the absence of nucleotide. Isolation of the labeled tryptic peptide from the cross-linked adduct formed with [ 14 C]pPDM, and subsequent partial sequence analyses, indicates that the cross-link is made from SH1 to Cys-522. Moreover, it appears that this cross-link results in the trapping of MgADP in this S1 species. These data suggest that the binding of MgADP results in a change in the structure of S1 in the vicinity of the SH1 thiol relative to the 50-kDa domain which enables Cys-522 to adopt the appropriate configuration to enable it to be cross-linked to SH1 by pPDM

  8. Progress towards the development of SH2 domain inhibitors.

    Science.gov (United States)

    Kraskouskaya, Dziyana; Duodu, Eugenia; Arpin, Carolynn C; Gunning, Patrick T

    2013-04-21

    Src homology 2 (SH2) domains are 100 amino acid modular units, which recognize and bind to tyrosyl-phosphorylated peptide sequences on their target proteins, and thereby mediate intracellular protein-protein interactions. This review summarizes the progress towards the development of synthetic agents that disrupt the function of the SH2 domains in different proteins as well as the clinical relevance of targeting a specific SH2 domain. Since 1986, SH2 domains have been identified in over 110 human proteins, including kinases, transcription factors, and adaptor proteins. A number of these proteins are over-activated in many diseases, including cancer, and their function is highly dependent on their SH2 domain. Thus, inhibition of a protein's function through disrupting that of its SH2 domain has emerged as a promising approach towards the development of novel therapeutic modalities. Although targeting the SH2 domain is a challenging task in molecular recognition, the progress reported here demonstrates the feasibility of such an approach.

  9. Phosphorylation of the adaptor protein SH2B1β regulates its ability to enhance growth hormone-dependent macrophage motility

    OpenAIRE

    Su, Hsiao-Wen; Lanning, Nathan J.; Morris, David L.; Argetsinger, Lawrence S.; Lumeng, Carey N.; Carter-Su, Christin

    2013-01-01

    Previous studies have shown that growth hormone (GH) recruits the adapter protein SH2B1β to the GH-activated, GH receptor-associated tyrosine kinase JAK2, implicating SH2B1β in GH-dependent actin cytoskeleton remodeling, and suggesting that phosphorylation at serines 161 and 165 in SH2B1β releases SH2B1β from the plasma membrane. Here, we examined the role of SH2B1β in GH regulation of macrophage migration. We show that GH stimulates migration of cultured RAW264.7 macrophages, and primary cul...

  10. Postneonatal Mortality and Liver Changes in Cloned Pigs Associated with Human Tumor Necrosis Factor Receptor I-Fc and Human Heme Oxygenase-1 Overexpression

    Directory of Open Access Journals (Sweden)

    Geon A. Kim

    2017-01-01

    Full Text Available Soluble human tumor necrosis factor (shTNFRI-Fc and human heme oxygenase 1 (hHO-1 are key regulators for protection against oxidative and inflammatory injury for xenotransplantation. Somatic cells with more than 10 copy numbers of shTNFRI-Fc and hHO-1 were employed in somatic cell nuclear transfer to generate cloned pigs, thereby resulting in seven cloned piglets. However, produced piglets were all dead within 24 hours after birth. Obviously, postnatal death with liver apoptosis was reported in the higher copy number of shTNFRI-Fc and hHO-1 piglets. In liver, the transcript levels of ferritin heavy chain, light chain, transferrin, and inducible nitric oxide synthase were significantly highly expressed compared to those of lower copy number of shTNFRI-Fc and hHO-1 piglets (P<0.05. Also, H2O2 contents were increased, and superoxide dismutase was significantly lower in the higher copy number of shTNFRI-Fc and hHO-1 piglets (P<0.05. These results indicate that TNFRI-Fc and hHO-1 overexpression may apparently induce free iron in the liver and exert oxidative stress by enhancing reactive oxygen species production and block normal postneonatal liver metabolism.

  11. Identification of STAT1 and STAT3 specific inhibitors using comparative virtual screening and docking validation.

    Directory of Open Access Journals (Sweden)

    Malgorzata Szelag

    Full Text Available Signal transducers and activators of transcription (STATs facilitate action of cytokines, growth factors and pathogens. STAT activation is mediated by a highly conserved SH2 domain, which interacts with phosphotyrosine motifs for specific STAT-receptor contacts and STAT dimerization. The active dimers induce gene transcription in the nucleus by binding to a specific DNA-response element in the promoter of target genes. Abnormal activation of STAT signaling pathways is implicated in many human diseases, like cancer, inflammation and auto-immunity. Searches for STAT-targeting compounds, exploring the phosphotyrosine (pTyr-SH2 interaction site, yielded many small molecules for STAT3 but sparsely for other STATs. However, many of these inhibitors seem not STAT3-specific, thereby questioning the present modeling and selection strategies of SH2 domain-based STAT inhibitors. We generated new 3D structure models for all human (hSTATs and developed a comparative in silico docking strategy to obtain further insight into STAT-SH2 cross-binding specificity of a selection of previously identified STAT3 inhibitors. Indeed, by primarily targeting the highly conserved pTyr-SH2 binding pocket the majority of these compounds exhibited similar binding affinity and tendency scores for all STATs. By comparative screening of a natural product library we provided initial proof for the possibility to identify STAT1 as well as STAT3-specific inhibitors, introducing the 'STAT-comparative binding affinity value' and 'ligand binding pose variation' as selection criteria. In silico screening of a multi-million clean leads (CL compound library for binding of all STATs, likewise identified potential specific inhibitors for STAT1 and STAT3 after docking validation. Based on comparative virtual screening and docking validation, we developed a novel STAT inhibitor screening tool that allows identification of specific STAT1 and STAT3 inhibitory compounds. This could increase our

  12. SH003 suppresses breast cancer growth by accumulating p62 in autolysosomes.

    Science.gov (United States)

    Choi, Youn Kyung; Cho, Sung-Gook; Choi, Yu-Jeong; Yun, Yee Jin; Lee, Kang Min; Lee, Kangwook; Yoo, Hye-Hyun; Shin, Yong Cheol; Ko, Seong-Gyu

    2017-10-24

    Drug markets revisits herbal medicines, as historical usages address their therapeutic efficacies with less adverse effects. Moreover, herbal medicines save both cost and time in development. SH003, a modified version of traditional herbal medicine extracted from Astragalus membranaceus (Am), Angelica gigas (Ag), and Trichosanthes Kirilowii Maximowicz (Tk) with 1:1:1 ratio (w/w) has been revealed to inhibit tumor growth and metastasis on highly metastatic breast cancer cells, both in vivo and in vitro with no toxicity. Meanwhile, autophagy is imperative for maintenance cellular homeostasis, thereby playing critical roles in cancer progression. Inhibition of autophagy by pharmacological agents induces apoptotic cell death in cancer cells, resulting in cancer treatment. In this study, we demonstrate that SH003-induced autophagy via inhibiting STAT3 and mTOR results in an induction of lysosomal p62/SQSTM1 accumulation-mediated reactive oxygen species (ROS) generation and attenuates tumor growth. SH003 induced autophagosome and autolysosome formation by inhibiting activation of STAT3- and mTOR-mediated signaling pathways. However, SH003 blocked autophagy-mediated p62/SQSTM1 degradation through reducing of lysosomal proteases, Cathepsins, resulting in accumulation of p62/SQSTM1 in the lysosome. The accumulation of p62/SQSTM1 caused the increase of ROS, which resulted in the induction of apoptotic cell death. Therefore, we conclude that SH003 suppresses breast cancer growth by inducing autophagy. In addition, SH003-induced p62/SQSTM1 could function as an important mediator for ROS generation-dependent cell death suggesting that SH003 may be useful for treating breast cancer.

  13. Salicin from Willow Bark can Modulate Neurite Outgrowth in Human Neuroblastoma SH-SY5Y Cells.

    Science.gov (United States)

    Wölfle, Ute; Haarhaus, Birgit; Kersten, Astrid; Fiebich, Bernd; Hug, Martin J; Schempp, Christoph M

    2015-10-01

    Salicin from willow bark has been used throughout centuries in China and Europe for the treatment of pain, headache, and inflammatory conditions. Recently, it could be demonstrated that salicin binds and activates the bitter taste receptor TAS2R16. Studies on rodent tissues showed the general expression of bitter taste receptors (TAS2Rs) in rodent brain. Here, we demonstrate the expression of hTAS2R16 in human neuronal tissues and the neuroblastoma cell line SH-SY5Y. The functionality was analyzed in the neuroblastoma cell line SH-SY5Y after stimulation with salicin, a known TAS2R16 agonist. In this setting salicin induced in SH-SY5Y cells phosphorylation of ERK and CREB, the key transcription factor of neuronal differentiation. PD98059, an inhibitor of the ERK pathway, as well as probenecid, a TAS2R16 antagonist, inhibited receptor phosphorylation as well as neurite outgrowth. These data show that salicin might modulate neurite outgrowth by bitter taste receptor activation. Copyright © 2015 John Wiley & Sons, Ltd.

  14. The influence of Bauhinia forficata Link subsp. pruinosa tea on lipid peroxidation and non-protein SH groups in human erythrocytes exposed to high glucose concentrations.

    Science.gov (United States)

    Salgueiro, Andréia C F; Leal, Carina Q; Bianchini, Matheus C; Prado, Ianeli O; Mendez, Andreas S L; Puntel, Robson L; Folmer, Vanderlei; Soares, Félix A; Avila, Daiana S; Puntel, Gustavo O

    2013-06-21

    Bauhinia forficata (BF) has been traditionally used as tea in folk medicine of Brazil for treatment of Diabetes mellitus (DM). To evaluate the effects of BF leaf tea on markers of oxidative damage and antioxidant levels in an experimental model of hyperglycemia in human erythrocytes in vitro. Human erythrocytes were incubated with high glucose concentrations or glucose and BF tea for 24h and 48h. After incubation lipid peroxidation and non-protein SH levels were analyzed. Moreover, quantification of polyphenols and flavonoids, iron chelating property, scavenging of DPPH, and prevention of lipid peroxidation in isolated lipids were also assessed. A significant amount of polyphenols and flavonoids was observed. The main components found by LC-MS analysis were quercetin-3-O-(2-rhamnosyl) rutinoside, kaempferol-3-O-(2-rhamnosyl) rutinoside, quercetin-3-O-rutinoside and kaempferol-3-O-rutinoside. BF tea presents important antioxidant and chelating properties. Moreover, BF tea was effective to increase non-protein SH levels and reduce lipid peroxidation induced by high glucose concentrations in human erythrocytes. The antioxidant effects of BF tea could be related to the presence of different phenolic and flavonoids components. We believe that these components can be responsible to protect human erythrocytes exposed to high glucose concentrations against oxidative damage. Copyright © 2013 Elsevier Ireland Ltd. All rights reserved.

  15. Analysis of the Catecholaminergic Phenotype in Human SH-SY5Y and BE(2-M17 Neuroblastoma Cell Lines upon Differentiation.

    Directory of Open Access Journals (Sweden)

    Roberta Filograna

    Full Text Available Human cell lines are often used to investigate cellular pathways relevant for physiological or pathological processes or to evaluate cell toxicity or protection induced by different compounds, including potential drugs. In this study, we analyzed and compared the differentiating activities of three agents (retinoic acid, staurosporine and 12-O-tetradecanoylphorbol-13-acetate on the human neuroblastoma SH-SY5Y and BE(2-M17 cell lines; the first cell line is largely used in the field of neuroscience, while the second is still poorly characterized. After evaluating their effects in terms of cell proliferation and morphology, we investigated their catecholaminergic properties by assessing the expression profiles of the major genes involved in catecholamine synthesis and storage and the cellular concentrations of the neurotransmitters dopamine and noradrenaline. Our results demonstrate that the two cell lines possess similar abilities to differentiate and acquire a neuron-like morphology. The most evident effects in SH-SY5Y cells were observed in the presence of staurosporine, while in BE(2-M17 cells, retinoic acid induced the strongest effects. Undifferentiated SH-SY5Y and BE(2-M17 cells are characterized by the production of both NA and DA, but their levels are considerably higher in BE(2-M17 cells. Moreover, the NAergic phenotype appears to be more pronounced in SH-SY5Y cells, while BE(2-M17 cells have a more prominent DAergic phenotype. Finally, the catecholamine concentration strongly increases upon differentiation induced by staurosporine in both cell lines. In conclusion, in this work the catecholaminergic phenotype of the human BE(2-M17 cell line upon differentiation was characterized for the first time. Our data suggest that SH-SY5Y and BE(2-M17 represent two alternative cell models for the neuroscience field.

  16. Analysis of the Catecholaminergic Phenotype in Human SH-SY5Y and BE(2)-M17 Neuroblastoma Cell Lines upon Differentiation.

    Science.gov (United States)

    Filograna, Roberta; Civiero, Laura; Ferrari, Vanni; Codolo, Gaia; Greggio, Elisa; Bubacco, Luigi; Beltramini, Mariano; Bisaglia, Marco

    2015-01-01

    Human cell lines are often used to investigate cellular pathways relevant for physiological or pathological processes or to evaluate cell toxicity or protection induced by different compounds, including potential drugs. In this study, we analyzed and compared the differentiating activities of three agents (retinoic acid, staurosporine and 12-O-tetradecanoylphorbol-13-acetate) on the human neuroblastoma SH-SY5Y and BE(2)-M17 cell lines; the first cell line is largely used in the field of neuroscience, while the second is still poorly characterized. After evaluating their effects in terms of cell proliferation and morphology, we investigated their catecholaminergic properties by assessing the expression profiles of the major genes involved in catecholamine synthesis and storage and the cellular concentrations of the neurotransmitters dopamine and noradrenaline. Our results demonstrate that the two cell lines possess similar abilities to differentiate and acquire a neuron-like morphology. The most evident effects in SH-SY5Y cells were observed in the presence of staurosporine, while in BE(2)-M17 cells, retinoic acid induced the strongest effects. Undifferentiated SH-SY5Y and BE(2)-M17 cells are characterized by the production of both NA and DA, but their levels are considerably higher in BE(2)-M17 cells. Moreover, the NAergic phenotype appears to be more pronounced in SH-SY5Y cells, while BE(2)-M17 cells have a more prominent DAergic phenotype. Finally, the catecholamine concentration strongly increases upon differentiation induced by staurosporine in both cell lines. In conclusion, in this work the catecholaminergic phenotype of the human BE(2)-M17 cell line upon differentiation was characterized for the first time. Our data suggest that SH-SY5Y and BE(2)-M17 represent two alternative cell models for the neuroscience field.

  17. Human neuroblastoma SH-SY5Y cells show increased resistance to hyperthermic stress after differentiation, associated with elevated levels of Hsp72.

    Science.gov (United States)

    Cheng, Lesley; Smith, Danielle J; Anderson, Robin L; Nagley, Phillip

    2011-01-01

    Terminally differentiated neurones in the central nervous system need to be protected from stress. We ask here whether differentiation of progenitor cells to neurones is accompanied by up-regulation of Hsp72, with acquisition of enhanced thermotolerance. Human neuroblastoma SH-SY5Y cells were propagated in an undifferentiated form and subsequently differentiated into neurone-like cells. Thermotolerance tests were carried out by exposure of cells to various temperatures, monitoring nuclear morphology as index of cell death. Abundance of Hsp72 was measured in cell lysates by western immunoblotting. The differentiation of SH-SY5Y cells was accompanied by increased expression of Hsp72. Further, in both cell states, exposure to mild hyperthermic stress (43°C for 30 min) increased Hsp72 expression. After differentiation, SH-SY5Y cells were more resistant to hyperthermic stress compared to their undifferentiated state, correlating with levels of Hsp72. Stable exogenous expression of Hsp72 in SH-SY5Y cells (transfected line 5YHSP72.1, containing mildly elevated levels of Hsp72), led to enhanced resistance to hyperthermic stress. Hsp72 was found to be inducible in undifferentiated 5YHSP72.1 cells; such heat-treated cells displayed enhanced thermotolerance. Treatment of cells with KNK437, a suppressor of Hsp72 induction, resulted in acute thermosensitisation of all cell types tested here. Hsp72 has a major role in the enhanced hyperthermic resistance acquired during neuronal differentiation of SH-SY5Y cells. These findings model the requirement in intact organisms for highly differentiated neurones to be specially protected against thermal stress.

  18. A Biochemical/Biophysical Assay Dyad for HTS-Compatible Triaging of Inhibitors of the HIV-1 Nef/Hck SH3 Interaction

    KAUST Repository

    Breuer, Sebastian

    2013-07-26

    The current treatment regimens for HIV include over 20 anti-retrovirals. However, adverse drug effects and the emergence of drug resistance necessitates the continued improvement of the existing drug classes as well as the development of novel drugs that target as yet therapeutically unexploited viral and cellular pathways. Here we demonstrate a strategy for the discovery of protein-protein interaction inhibitors of the viral pathogenicity factor HIV-1 Nef and its interaction with the host factor SH3. A combination of a time-resolved fluorescence resonance energy resonance energy transfer-based assay and a label-free resonant waveguide grating-based assay was optimized for high-throughput screening formats.

  19. A Biochemical/Biophysical Assay Dyad for HTS-Compatible Triaging of Inhibitors of the HIV-1 Nef/Hck SH3 Interaction

    KAUST Repository

    Breuer, Sebastian; Espinola, Sheryll; Morelli, Xavier; Torbett, Bruce E; Arold, Stefan T.; Engels, Ingo H

    2013-01-01

    The current treatment regimens for HIV include over 20 anti-retrovirals. However, adverse drug effects and the emergence of drug resistance necessitates the continued improvement of the existing drug classes as well as the development of novel drugs that target as yet therapeutically unexploited viral and cellular pathways. Here we demonstrate a strategy for the discovery of protein-protein interaction inhibitors of the viral pathogenicity factor HIV-1 Nef and its interaction with the host factor SH3. A combination of a time-resolved fluorescence resonance energy resonance energy transfer-based assay and a label-free resonant waveguide grating-based assay was optimized for high-throughput screening formats.

  20. MeSH key terms for validation and annotation of gene expression clusters

    Energy Technology Data Exchange (ETDEWEB)

    Rechtsteiner, A. (Andreas); Rocha, L. M. (Luis Mateus)

    2004-01-01

    associated with MeSH terms. MeSH terms can be associated with genes through co-occurrence of these in MEDLINE citations, i.e. the genes occur in titles or abstracts and the MeSH terms are assigned by experts. To identify MeSH terms associated with a group of genes we used the tool MESHGENE developed at the Information Dynamics Lab at HP Labs (http://www-idl.hpl.hp.com/meshgene/). When presented with a list of human genes, MESHGENE uses some sophisticated techniques to search for these gene symbols in the titles and abstracts of all MEDLINE citations. MeSH terms and the number of co-occurrences can be retrieved. Gene symbols that are aliases of each other are pooled from several databases. This addresses the problem of synonymy, the fact that several symbols can refer to the same gene. MESHGENE employs some sophisticated algorithms that disregards symbols that are likely to be acronyms for other concepts than a gene. This addresses the problem of polysemy, i.e. possible multiple meanings of a gene symbol. We applied our approach to gene expression data from herpes virus infected human fibroblast cells. The data contains 12 time-points, between 1/2 hrs and 48 hrs after infection. Singular Value Decomposition was used to identify the dominant modes of expression. 75% of the variance in the expression data was captured by the first two modes, the first exhibiting a monotonly increasing expression pattern and the second a more transient pattern. Projection of the gene expression vectors onto this first two modes identified 3 statistically significant clusters of co-expressed genes. 500 genes from cluster 1 and 300 genes from clusters 2 and 3 each were uploaded to MESHGENE and the MeSH terms and co-occurrence values were retrieved. MeSH terms were also obtained for 5 groups of randomly selected genes with similar numbers of genes. The log was taken of the co-occurrence values and for each MeSH term these log co-occurrence values were summed for each group over the genes in that

  1. Roles for NHERF1 and NHERF2 on the regulation of C3a receptor signaling in human mast cells.

    Directory of Open Access Journals (Sweden)

    Hariharan Subramanian

    Full Text Available BACKGROUND: The anaphylatoxin C3a binds to the G protein coupled receptor (GPCR, C3aR and activates divergent signaling pathways to induce degranulation and cytokine production in human mast cells. Adapter proteins such as the Na(+/H(+ exchange regulatory factor (NHERF1 and NHERF2 have been implicated in regulating functions of certain GPCRs by binding to the class I PDZ (PSD-95/Dlg/Zo1 motifs present on their cytoplasmic tails. Although C3aR possesses a class I PDZ motif, the possibility that it interacts with NHERF proteins to modulate signaling in human mast cells has not been determined. METHODOLOGY/PRINCIPAL FINDINGS: Using reverse transcription PCR and Western blotting, we found that NHERF1 and NHERF2 are expressed in human mast cell lines (HMC-1, LAD2 and CD34(+-derived primary human mast cells. Surprisingly, however, C3aR did not associate with these adapter proteins. To assess the roles of NHERFs on signaling downstream of C3aR, we used lentiviral shRNA to stably knockdown the expression of these proteins in human mast cells. Silencing the expression of NHERF1 and NHERF2 had no effect on C3aR desensitization, agonist-induced receptor internalization, ERK/Akt phosphorylation or chemotaxis. However, loss of NHERF1 and NHERF2 resulted in significant inhibition of C3a-induced mast cell degranulation, NF-κB activation and chemokine production. CONCLUSION/SIGNIFICANCE: This study demonstrates that although C3aR possesses a class I PDZ motif, it does not associate with NHERF1 and NHERF2. Surprisingly, these proteins provide stimulatory signals for C3a-induced degranulation, NF-κB activation and chemokine generation in human mast cells. These findings reveal a new level of complexity for the functional regulation of C3aR by NHERFs in human mast cells.

  2. Interactions of polyomavirus middle T with the SH2 domains of the pp85 subunit of phosphatidylinositol-3-kinase.

    OpenAIRE

    Yoakim, M; Hou, W; Liu, Y; Carpenter, C L; Kapeller, R; Schaffhausen, B S

    1992-01-01

    The binding of phosphatidylinositol-3-kinase to the polyomavirus middle T antigen is facilitated by tyrosine phosphorylation of middle T on residue 315. The pp85 subunit of phosphatidylinositol-3-kinase contains two SH2 domains, one in the middle of the molecule and one at the C terminus. When assayed by blotting with phosphorylated middle T, the more N-terminal SH2 domain is responsible for binding to middle T. When assayed in solution with glutathione S transferase fusions, both SH2s are ca...

  3. Interleukin-18 alters protein expressions of neurodegenerative diseases-linked proteins in human SH-SY5Y neuron-like cells

    Directory of Open Access Journals (Sweden)

    Elina M Sutinen

    2014-08-01

    Full Text Available Chronic inflammation and oxidative stress (OS are present in Alzheimer´s disease (AD brains in addition to neuronal loss, Amyloid-β (Aβ plaques and hyperphosphorylated tau-protein neurofibrillary tangles. Previously we showed that levels of the pro-inflammatory cytokine, interleukin-18 (IL-18, are elevated in post-mortem AD brains. IL-18 can modulate the tau kinases, Cdk5 and GSK3β, as well as Aβ-production. IL-18 levels are also increased in AD risk diseases, including type-2 diabetes and obesity. Here, we explored other IL-18 regulated proteins in neuron-like SH-SY5Y cells. Differentiated SH-SY5Y cells, incubated with IL-18 for 24, 48 or 72h, were analyzed by two-dimensional gel electrophoresis (2D-DIGE. Specific altered protein spots were chosen and identified with mass spectrometry and verified by western immunoblotting. IL-18 had time-dependent effects on the SH-SY5Y proteome, modulating numerous protein levels/modifications. We concentrated on those related to OS (DDAH2, peroxiredoxins 2, 3 and 6, DJ-1, BLVRA, Aβ-degradation (MMP14, TIMP2, Aβ-aggregation (Septin-2 and modifications of axon growth and guidance associated, collapsing response mediator protein 2 (CRMP2. IL-18 significantly increased antioxidative enzymes, indicative of OS, and altered levels of glycolytic α- and γ-enolase and multifunctional 14-3-3γ and -ε, commonly affected in neurodegenerative diseases. MMP14, TIMP2, α-enolase and 14-3-3ε, indirectly involved in Aβ metabolism, as well as Septin-2 showed changes that increase Aβ levels. Increased 14-3-3γ may contribute to GSK3β driven tau hyperphosphorylation and CRMP2 Thr514 and Ser522 phosphorylation with the Thr555-site, a target for Rho kinase, showing time-dependent changes. IL-18 also increased caspase-1 levels and vacuolization of the cells. Although our SH-SY5Y cells were not aged, as neurons in AD, our work suggests that heightened or prolonged IL-18 levels can drive protein changes of known

  4. Analysis of the thermodynamics of binding of an SH3 domain to proline-rich peptides using a chimeric fusion protein.

    Science.gov (United States)

    Candel, Adela M; van Nuland, Nico A J; Martin-Sierra, Francisco M; Martinez, Jose C; Conejero-Lara, Francisco

    2008-03-14

    A complete understanding of the thermodynamic determinants of binding between SH3 domains and proline-rich peptides is crucial to the development of rational strategies for designing ligands for these important domains. Recently we engineered a single-chain chimeric protein by fusing the alpha-spectrin Src homology region 3 (SH3) domain to the decapeptide APSYSPPPPP (p41). This chimera mimics the structural and energetic features of the interaction between SH3 domains and proline-rich peptides. Here we show that analysing the unfolding thermodynamics of single-point mutants of this chimeric fusion protein constitutes a very useful approach to deciphering the thermodynamics of SH3-ligand interactions. To this end, we investigated the contribution of each proline residue of the ligand sequence to the SH3-peptide interaction by producing six single Pro-Ala mutants of the chimeric protein and analysing their unfolding thermodynamics by differential scanning calorimetry (DSC). Structural analyses of the mutant chimeras by circular dichroism, fluorescence and NMR together with NMR-relaxation measurements indicate conformational flexibility at the binding interface, which is strongly affected by the different Pro-Ala mutations. An analysis of the DSC thermograms on the basis of a three-state unfolding model has allowed us to distinguish and separate the thermodynamic magnitudes of the interaction at the binding interface. The model assumes equilibrium between the "unbound" and "bound" states at the SH3-peptide binding interface. The resulting thermodynamic magnitudes classify the different proline residues according to their importance in the interaction as P2 approximately P7 approximately P10>P9 approximately P6>P8, which agrees well with Lim's model for the interaction between SH3 domains and proline-rich peptides. In addition, the thermodynamic signature of the interaction is the same as that usually found for this type of binding, with a strong enthalpy

  5. SH3 domain-mediated binding of the Drk protein to Dos is an important step in signaling of Drosophila receptor tyrosine kinases.

    Science.gov (United States)

    Feller, Stephan M; Wecklein, Heike; Lewitzky, Marc; Kibler, Eike; Raabe, Thomas

    2002-08-01

    Activation of the Sevenless (Sev) receptor tyrosine kinase (RTK) in the developing Drosophila eye is required for the specification of the R7 photoreceptor cell fate. Daughter of Sevenless (Dos), a putative multi-site adaptor protein, is a substrate of the Sev kinase and is known to associate with the tyrosine phosphatase Corkscrew (Csw). Binding of Csw to Dos depends on the Csw Src homology 2 (SH2) domains and is an essential step for signaling by the Sev RTK. Dos, however, lacks a recognizable phosphotyrosine interaction domain and it was previously unclear how it is recruited to the Sev receptor. Here it is shown that the SH2/SH3 domain adaptor protein Drk can provide this link. Drk binds with its SH2 domain to the autophosphorylated Sev receptor while the C-terminal SH3 domain is able to associate with Dos. The Drk SH3 domain binding motifs on Dos were mapped to two sites which do not conform the known Drk SH3 domain binding motif (PxxPxR) but instead have the consensus PxxxRxxKP. Mutational analysis in vitro and in vivo provided evidence that both Drk binding sites fulfil an important function in the context of Sev and Drosophila epidermal growth factor receptor mediated signaling processes.

  6. Genetic disruption of the sh3pxd2a gene reveals an essential role in mouse development and the existence of a novel isoform of tks5.

    Science.gov (United States)

    Cejudo-Martin, Pilar; Yuen, Angela; Vlahovich, Nicole; Lock, Peter; Courtneidge, Sara A; Díaz, Begoña

    2014-01-01

    Tks5 is a scaffold protein and Src substrate involved in cell migration and matrix degradation through its essential role in invadosome formation and function. We have previously described that Tks5 is fundamental for zebrafish neural crest cell migration in vivo. In the present study, we sought to investigate the function of Tks5 in mammalian development by analyzing mice mutant for sh3pxd2a, the gene encoding Tks5. Homozygous disruption of the sh3pxd2a gene by gene-trapping in mouse resulted in neonatal death and the presence of a complete cleft of the secondary palate. Interestingly, embryonic fibroblasts from homozygous gene-trap sh3pxd2a mice lacked only the highest molecular weight band of the characteristic Tks5 triplet observed in protein extracts, leaving the lower molecular weight bands unaffected. This finding, together with the existence of two human Expressed Sequence Tags lacking the first 5 exons of SH3PXD2A, made us hypothesize about the presence of a second alternative transcription start site located in intron V. We performed 5'RACE on mouse fibroblasts and isolated a new transcript of the sh3pxd2a gene encoding a novel Tks5 isoform, that we named Tks5β. This novel isoform diverges from the long form of Tks5 in that it lacks the PX-domain, which confers affinity for phosphatidylinositol-3,4-bisphosphate. Instead, Tks5β has a short unique amino terminal sequence encoded by the newly discovered exon 6β; this exon includes a start codon located 29 bp from the 5'-end of exon 6. Tks5β mRNA is expressed in MEFs and all mouse adult tissues analyzed. Tks5β is a substrate for the Src tyrosine kinase and its expression is regulated through the proteasome degradation pathway. Together, these findings indicate the essentiality of the larger Tks5 isoform for correct mammalian development and the transcriptional complexity of the sh3pxd2a gene.

  7. Genetic disruption of the sh3pxd2a gene reveals an essential role in mouse development and the existence of a novel isoform of tks5.

    Directory of Open Access Journals (Sweden)

    Pilar Cejudo-Martin

    Full Text Available Tks5 is a scaffold protein and Src substrate involved in cell migration and matrix degradation through its essential role in invadosome formation and function. We have previously described that Tks5 is fundamental for zebrafish neural crest cell migration in vivo. In the present study, we sought to investigate the function of Tks5 in mammalian development by analyzing mice mutant for sh3pxd2a, the gene encoding Tks5. Homozygous disruption of the sh3pxd2a gene by gene-trapping in mouse resulted in neonatal death and the presence of a complete cleft of the secondary palate. Interestingly, embryonic fibroblasts from homozygous gene-trap sh3pxd2a mice lacked only the highest molecular weight band of the characteristic Tks5 triplet observed in protein extracts, leaving the lower molecular weight bands unaffected. This finding, together with the existence of two human Expressed Sequence Tags lacking the first 5 exons of SH3PXD2A, made us hypothesize about the presence of a second alternative transcription start site located in intron V. We performed 5'RACE on mouse fibroblasts and isolated a new transcript of the sh3pxd2a gene encoding a novel Tks5 isoform, that we named Tks5β. This novel isoform diverges from the long form of Tks5 in that it lacks the PX-domain, which confers affinity for phosphatidylinositol-3,4-bisphosphate. Instead, Tks5β has a short unique amino terminal sequence encoded by the newly discovered exon 6β; this exon includes a start codon located 29 bp from the 5'-end of exon 6. Tks5β mRNA is expressed in MEFs and all mouse adult tissues analyzed. Tks5β is a substrate for the Src tyrosine kinase and its expression is regulated through the proteasome degradation pathway. Together, these findings indicate the essentiality of the larger Tks5 isoform for correct mammalian development and the transcriptional complexity of the sh3pxd2a gene.

  8. [Lentivirus-mediated shRNA silencing of LAMP2A inhibits the proliferation of multiple myeloma cells].

    Science.gov (United States)

    Li, Lixuan; Li, Jia

    2015-05-01

    To study the effects of lentivirus-mediated short hairpin RNA (shRNA) silencing of lysosome-associated membrane protein type 2A (LAMP2A) expression on the proliferation of multiple myeloma cells. The constructed shRNA lentiviral vector was applied to infect human multiple myeloma cell line MM.1S, and stable expression cell line was obtained by puromycin screening. Western blotting was used to verify the inhibitory effect on LAMP2A protein expression. MTT assay was conducted to detect the effect of knocked-down LAMP2A on MM.1S cell proliferation, and the anti-tumor potency of suberoylanilide hydroxamic acid (SAHA) against the obtained MM.1S LAMP2A(shRNA) stable cell line. Lactate assay was performed to observe the impact of low LAMP2A expression on cell glycolysis. The stable cell line with low LAMP2A expression were obtained with the constructed human LAMP2A-shRNA lentiviral vector. Down-regulation of LAMP2A expression significantly inhibited MM.1S cell proliferation and enhanced the anti-tumor activity of SAHA. Interestingly, decreased LAMP2A expression also inhibited MM.1S cell lactic acid secretion. Down-regulation of LAMP2A expression could inhibit cell proliferation in multiple myeloma cells.

  9. Electrostatic effects in the folding of the SH3 domain of the c-Src tyrosine kinase: pH-dependence in 3D-domain swapping and amyloid formation.

    Directory of Open Access Journals (Sweden)

    Julio Bacarizo

    Full Text Available The SH3 domain of the c-Src tyrosine kinase (c-Src-SH3 aggregates to form intertwined dimers and amyloid fibrils at mild acid pHs. In this work, we show that a single mutation of residue Gln128 of this SH3 domain has a significant effect on: (i its thermal stability; and (ii its propensity to form amyloid fibrils. The Gln128Glu mutant forms amyloid fibrils at neutral pH but not at mild acid pH, while Gln128Lys and Gln128Arg mutants do not form these aggregates under any of the conditions assayed. We have also solved the crystallographic structures of the wild-type (WT and Gln128Glu, Gln128Lys and Gln128Arg mutants from crystals obtained at different pHs. At pH 5.0, crystals belong to the hexagonal space group P6₅22 and the asymmetric unit is formed by one chain of the protomer of the c-Src-SH3 domain in an open conformation. At pH 7.0, crystals belong to the orthorhombic space group P2₁2₁2₁, with two molecules at the asymmetric unit showing the characteristic fold of the SH3 domain. Analysis of these crystallographic structures shows that the residue at position 128 is connected to Glu106 at the diverging β-turn through a cluster of water molecules. Changes in this hydrogen-bond network lead to the displacement of the c-Src-SH3 distal loop, resulting also in conformational changes of Leu100 that might be related to the binding of proline rich motifs. Our findings show that electrostatic interactions and solvation of residues close to the folding nucleation site of the c-Src-SH3 domain might play an important role during the folding reaction and the amyloid fibril formation.

  10. TP53inp1 Gene Is Implicated in Early Radiation Response in Human Fibroblast Cells

    Directory of Open Access Journals (Sweden)

    Nikolett Sándor

    2015-10-01

    Full Text Available Tumor protein 53-induced nuclear protein-1 (TP53inp1 is expressed by activation via p53 and p73. The purpose of our study was to investigate the role of TP53inp1 in response of fibroblasts to ionizing radiation. γ-Ray radiation dose-dependently induces the expression of TP53inp1 in human immortalized fibroblast (F11hT cells. Stable silencing of TP53inp1 was done via lentiviral transfection of shRNA in F11hT cells. After irradiation the clonogenic survival of TP53inp1 knockdown (F11hT-shTP cells was compared to cells transfected with non-targeting (NT shRNA. Radiation-induced senescence was measured by SA-β-Gal staining and autophagy was detected by Acridine Orange dye and microtubule-associated protein-1 light chain 3 (LC3B immunostaining. The expression of TP53inp1, GDF-15, and CDKN1A and alterations in radiation induced mitochondrial DNA deletions were evaluated by qPCR. TP53inp1 was required for radiation (IR induced maximal elevation of CDKN1A and GDF-15 expressions. Mitochondrial DNA deletions were increased and autophagy was deregulated following irradiation in the absence of TP53inp1. Finally, we showed that silencing of TP53inp1 enhances the radiation sensitivity of fibroblast cells. These data suggest functional roles for TP53inp1 in radiation-induced autophagy and survival. Taken together, we suppose that silencing of TP53inp1 leads radiation induced autophagy impairment and induces accumulation of damaged mitochondria in primary human fibroblasts.

  11. SH2-dependent autophosphorylation within the Tec family kinase Itk.

    Science.gov (United States)

    Joseph, Raji E; Severin, Andrew; Min, Lie; Fulton, D Bruce; Andreotti, Amy H

    2009-08-07

    The Tec family kinase, Itk (interleukin-2 tyrosine kinase), undergoes an in cis autophosphorylation on Y180 within its Src homology 3 (SH3) domain. Autophosphorylation of the Itk SH3 domain by the Itk kinase domain is strictly dependent on the presence of the intervening Src homology 2 (SH2) domain. A direct docking interaction between the Itk kinase and SH2 domains brings the Itk SH3 domain into the active site where Y180 is then phosphorylated. We now identify the residues on the surface of the Itk SH2 domain responsible for substrate docking and show that this SH2 surface mediates autophosphorylation in the full-length Itk molecule. The canonical phospholigand binding site on the SH2 domain is not involved in substrate docking, instead the docking site consists of side chains from three loop regions (AB, EF and BG) and part of the betaD strand. These results are extended into Btk (Bruton's tyrosine kinase), a Tec family kinase linked to the B-cell deficiency X-linked agammaglobulinemia (XLA). Our results suggest that some XLA-causing mutations might impair Btk phosphorylation.

  12. Hydrophobic interaction between the SH2 domain and the kinase domain is required for the activation of Csk.

    Science.gov (United States)

    Mikkola, Esa T; Gahmberg, Carl G

    2010-06-18

    The protein tyrosine kinase C-terminal Src kinase (Csk) is activated by the engagement of its Src homology (SH) 2 domain. However, the molecular mechanism required for this is not completely understood. The crystal structure of the active Csk indicates that Csk could be activated by contact between the SH2 domain and the beta3-alphaC loop in the N-terminal lobe of the kinase domain. To study the importance of this interaction for the SH2-domain-mediated activation of Csk, we mutated the amino acid residues forming the contacts between the SH2 domain and the beta3-alphaC loop. The mutation of the beta3-alphaC loop Ala228 to glycine and of the SH2 domain Tyr116, Tyr133, Leu138, and Leu149 to alanine resulted in the inability of the SH2 domain ligand to activate Csk. Furthermore, the overexpressed Csk mutants A228G, Y133A/Y116A, L138A, and L149A were unable to efficiently inactivate endogenous Src in human embryonic kidney 293 cells. The results suggest that the SH2-domain-mediated activation of Csk is dependent on the binding of the beta3-alphaC loop Ala228 to the hydrophobic pocket formed by the side chains of Tyr116, Tyr133, Leu138, and Leu149 on the surface of the SH2 domain. Copyright (c) 2010 Elsevier Ltd. All rights reserved.

  13. SH2 dependent autophosphorylation within the Tec family kinase Itk

    Science.gov (United States)

    Joseph, Raji E.; Severin, Andrew; Min, Lie; Fulton, D. Bruce; Andreotti, Amy H.

    2009-01-01

    The Tec family kinase, Itk, undergoes an in cis autophosphorylation on Y180 within its SH3 domain. Autophosphorylation of the Itk SH3 domain by the Itk kinase domain is strictly dependent on the presence of the intervening SH2 domain. A direct docking interaction between the Itk kinase and SH2 domains brings the Itk SH3 domain into the active site where Y180 is then phosphorylated. We now identify the residues on the surface of the Itk SH2 domain responsible for substrate docking and show that this SH2 surface mediates autophosphorylation in the full length Itk molecule. The canonical phospholigand binding site on the SH2 domain is not involved in substrate docking, instead the docking site consists of side chains from three loop regions (AB, EF and BG) and part of the βD strand. These results are extended into Btk, a Tec family kinase linked to the B cell deficiency X-linked agammaglobulinemia (XLA). Our results suggest that some XLA causing mutations might impair Btk phosphorylation. PMID:19523959

  14. Effect of whole body X-irradiation on the NP-SH level of blood in rabbits

    International Nuclear Information System (INIS)

    Suh, Soo Jhi; Woo, Won Hyung

    1972-01-01

    In hope to elucidate possible changes in blood NP-SH levels when X-irradiation is made in single or fractionate dose, a whole body X-irradiation was done to rabbits either in single dose of 900 r or in fractionated dose of 300 r per day for three days. The NP-SH was measured at 1, 3, 5, 24 and 48 post-irradiation hours, and the results were compared with the normal value of the blood NP-SH. The results obtained are as follows: 1. The normal value of blood NP-SH in the rabbit was 2.11 ± 0.40 μmol/ml. 2. In the single X-irradiation group, the blood NP-SH decreased most prominently at five hours after-irradiation, and a tendency of recovery to the normal level was observed thereafter. 3. In the fractionated group, the blood NP-SH levels were higher, than in the single irradiation group throughout the experiment, and the levels were also higher than the normal in general

  15. Characterizing tyrosine phosphorylation signaling in lung cancer using SH2 profiling.

    Directory of Open Access Journals (Sweden)

    Kazuya Machida

    2010-10-01

    Full Text Available Tyrosine kinases drive the proliferation and survival of many human cancers. Thus profiling the global state of tyrosine phosphorylation of a tumor is likely to provide a wealth of information that can be used to classify tumors for prognosis and prediction. However, the comprehensive analysis of tyrosine phosphorylation of large numbers of human cancer specimens is technically challenging using current methods.We used a phosphoproteomic method termed SH2 profiling to characterize the global state of phosphotyrosine (pTyr signaling in human lung cancer cell lines. This method quantifies the phosphorylated binding sites for SH2 domains, which are used by cells to respond to changes in pTyr during signaling. Cells could be grouped based on SH2 binding patterns, with some clusters correlated with EGF receptor (EGFR or K-RAS mutation status. Binding of specific SH2 domains, most prominently RAS pathway activators Grb2 and ShcA, correlated with EGFR mutation and sensitivity to the EGFR inhibitor erlotinib. SH2 binding patterns also reflected MET activation and could identify cells driven by multiple kinases. The pTyr responses of cells treated with kinase inhibitors provided evidence of distinct mechanisms of inhibition.This study illustrates the potential of modular protein domains and their proteomic binding profiles as powerful molecular diagnostic tools for tumor classification and biomarker identification.

  16. Pandemic H1N1 influenza A directly induces a robust and acute inflammatory gene signature in primary human bronchial epithelial cells downstream of membrane fusion

    Energy Technology Data Exchange (ETDEWEB)

    Paquette, Stéphane G. [Division of Experimental Therapeutics, Toronto General Hospital Research Institute, University Health Network, Toronto, Ontario (Canada); Institute of Medical Science, Faculty of Medicine, University of Toronto, Toronto, Ontario (Canada); Banner, David [Division of Experimental Therapeutics, Toronto General Hospital Research Institute, University Health Network, Toronto, Ontario (Canada); Chi, Le Thi Bao [Department of Microbiology, Hue University of Medicine and Pharmacy, Thua Thien Hue (Viet Nam); Carlo Urbani Centre, Hue University of Medicine and Pharmacy, Thua Thien Hue (Viet Nam); Leon, Alberto J. [Division of Experimental Therapeutics, Toronto General Hospital Research Institute, University Health Network, Toronto, Ontario (Canada); International Institute of Infection and Immunity, Shantou University Medical College, Shantou, Guangdong (China); Xu, Luoling; Ran, Longsi [Division of Experimental Therapeutics, Toronto General Hospital Research Institute, University Health Network, Toronto, Ontario (Canada); Huang, Stephen S.H. [Division of Experimental Therapeutics, Toronto General Hospital Research Institute, University Health Network, Toronto, Ontario (Canada); Department of Immunology, Faculty of Medicine, University of Toronto, Toronto, Ontario (Canada); Farooqui, Amber [Division of Experimental Therapeutics, Toronto General Hospital Research Institute, University Health Network, Toronto, Ontario (Canada); International Institute of Infection and Immunity, Shantou University Medical College, Shantou, Guangdong (China); and others

    2014-01-05

    Pandemic H1N1 influenza A (H1N1pdm) elicits stronger pulmonary inflammation than previously circulating seasonal H1N1 influenza A (sH1N1), yet mechanisms of inflammatory activation in respiratory epithelial cells during H1N1pdm infection are unclear. We investigated host responses to H1N1pdm/sH1N1 infection and virus entry mechanisms in primary human bronchial epithelial cells in vitro. H1N1pdm infection rapidly initiated a robust inflammatory gene signature (3 h post-infection) not elicited by sH1N1 infection. Protein secretion inhibition had no effect on gene induction. Infection with membrane fusion deficient H1N1pdm failed to induce robust inflammatory gene expression which was rescued with restoration of fusion ability, suggesting H1N1pdm directly triggered the inflammatory signature downstream of membrane fusion. Investigation of intra-virion components revealed H1N1pdm viral RNA (vRNA) triggered a stronger inflammatory phenotype than sH1N1 vRNA. Thus, our study is first to report H1N1pdm induces greater inflammatory gene expression than sH1N1 in vitro due to direct virus–epithelial cell interaction. - Highlights: • We investigated H1N1pdm/sH1N1 infection in primary epithelial cells. • H1N1pdm directly initiated a robust inflammatory gene signature, sH1N1 did not. • H1N1pdm viral RNA triggered a stronger response than sH1N1. • H1N1pdm induces greater response due to direct virus–cell interaction. • These results have potential to impact vaccine and therapeutic development.

  17. Pandemic H1N1 influenza A directly induces a robust and acute inflammatory gene signature in primary human bronchial epithelial cells downstream of membrane fusion

    International Nuclear Information System (INIS)

    Paquette, Stéphane G.; Banner, David; Chi, Le Thi Bao; Leon, Alberto J.; Xu, Luoling; Ran, Longsi; Huang, Stephen S.H.; Farooqui, Amber

    2014-01-01

    Pandemic H1N1 influenza A (H1N1pdm) elicits stronger pulmonary inflammation than previously circulating seasonal H1N1 influenza A (sH1N1), yet mechanisms of inflammatory activation in respiratory epithelial cells during H1N1pdm infection are unclear. We investigated host responses to H1N1pdm/sH1N1 infection and virus entry mechanisms in primary human bronchial epithelial cells in vitro. H1N1pdm infection rapidly initiated a robust inflammatory gene signature (3 h post-infection) not elicited by sH1N1 infection. Protein secretion inhibition had no effect on gene induction. Infection with membrane fusion deficient H1N1pdm failed to induce robust inflammatory gene expression which was rescued with restoration of fusion ability, suggesting H1N1pdm directly triggered the inflammatory signature downstream of membrane fusion. Investigation of intra-virion components revealed H1N1pdm viral RNA (vRNA) triggered a stronger inflammatory phenotype than sH1N1 vRNA. Thus, our study is first to report H1N1pdm induces greater inflammatory gene expression than sH1N1 in vitro due to direct virus–epithelial cell interaction. - Highlights: • We investigated H1N1pdm/sH1N1 infection in primary epithelial cells. • H1N1pdm directly initiated a robust inflammatory gene signature, sH1N1 did not. • H1N1pdm viral RNA triggered a stronger response than sH1N1. • H1N1pdm induces greater response due to direct virus–cell interaction. • These results have potential to impact vaccine and therapeutic development

  18. Wind rotor power station BONI-ShHV

    International Nuclear Information System (INIS)

    Bolotov, A.V.

    1999-01-01

    Wind rotor power station (WRPS) BONI-ShHV has following advantages : the increase of installation stability by rise of wind velocity and rotation speed of rotor due to gyroscopic effect; the absence noise and vibration; the safety for birds and animals; ability of compact installation and creation of series of wind power dams with higher capacity; the simplicity and fast assembling and putting into operation. The price of 1 k W of installing capacity is lower about 2.5-3 times compare to usual WRPS due to simple kinematic scheme. WRPS has high specific output of electrical energy due to use of low and long existing wind velocity and due to short storms, giving greater power. It has ability to be replayed when average annual wind velocity is above 5.5 m/s in comparison with propeller WRPS, which are never repaying. WRPS BONI-ShHV are made on the plants of Republic of Kazakhstan, and tested in wind velocity range up 45 m/s, have experience of 3 years of operation, showing their reliability and effectiveness. The repayment period of individual WRPS BONI-0.5/6 ShHV is from 10 month to 1 year depending on average annual velocity

  19. Interproximal grooving in the Atapuerca-SH hominid dentitions.

    Science.gov (United States)

    Bermúdez de Castro, J M; Arsuaga, J L; Pérez, P J

    1997-03-01

    The dental sample recovered from the Sima de los Huesos (SH) Middle Pleistocene cave site of the Sierra de Atapuerca (Spain) includes 296 specimens. Interproximal wear grooves have been observed in 20 maxillary and mandibular posterior teeth belonging to at least five of the 32 individuals identified so far in the SH hypodigm. Interproximal grooving affected only the adults, and at an age between 25 and 40 years. The appearance, morphology, and location pattern of the SH wear grooves are similar to those reported in other fossil hominids and in more recent human populations. Two alternative proposals, the toothpicking and the fiber or sinew processing hypotheses, compete for explaining the formation of this anomalous wear. The characteristics observed in the wear grooves of the SH teeth are compatible only with the habitual probing of interdental spaces by means of hard and inflexible objects. Dietary grit may also have contributed to the abrasion of the root walls during the motion of the dental probes.

  20. JNK signaling pathway regulates sorbitol-induced Tau proteolysis and apoptosis in SH-SY5Y cells by targeting caspase-3.

    Science.gov (United States)

    Olivera Santa-Catalina, Marta; Caballero Bermejo, Montaña; Argent, Ricardo; Alonso, Juan C; Centeno, Francisco; Lorenzo, María J

    2017-12-15

    Growing evidence suggests that Diabetes Mellitus increases the risk of developing Alzheimer's disease. It is well known that hyperglycemia, a key feature of Diabetes Mellitus, may induce plasma osmolarity disturbances. Both hyperglycemia and hyperosmolarity promote the altered post-translational regulation of microtubule-associated protein Tau. Interestingly, abnormal hyperphosphorylation and cleavage of Tau have been proven to lead to the genesis of filamentous structures referred to as neurofibrillary tangles, the main pathological hallmark of Alzheimer's disease. We have previously described that hyperosmotic stress induced by sorbitol promotes Tau proteolysis and apoptosis in SH-SY5Y cells via caspase-3 activation. In order to gain insights into the regulatory mechanisms of such processes, in this work we explored the intracellular signaling pathways that regulate these events. We found that sorbitol treatment significantly enhanced the activation of conventional families of MAPK in SH-SY5Y cells. Tau proteolysis was completely prevented by JNK inhibition but not affected by either ERK1/2 or p38 MAPK blockade. Moreover, inhibition of JNK, but not ERK1/2 or p38 MAPK, efficiently prevented sorbitol-induced apoptosis and caspase-3 activation. In summary, we provide evidence that JNK signaling pathway is an upstream regulator of hyperosmotic stress-induced Tau cleavage and apoptosis in SH-SY5Y through the control of caspase-3 activation. Copyright © 2017 Elsevier Inc. All rights reserved.

  1. Human Freud-2/CC2D1B: a novel repressor of postsynaptic serotonin-1A receptor expression.

    Science.gov (United States)

    Hadjighassem, Mahmoud R; Austin, Mark C; Szewczyk, Bernadeta; Daigle, Mireille; Stockmeier, Craig A; Albert, Paul R

    2009-08-01

    Altered expression of serotonin-1A (5-HT1A) receptors, both presynaptic in the raphe nuclei and post-synaptic in limbic and cortical target areas, has been implicated in mood disorders such as major depression and anxiety. Within the 5-HT1A receptor gene, a powerful dual repressor element (DRE) is regulated by two protein complexes: Freud-1/CC2D1A and a second, unknown repressor. Here we identify human Freud-2/CC2D1B, a Freud-1 homologue, as the second repressor. Freud-2 distribution was examined with Northern and Western blot, reverse transcriptase polymerase chain reaction, and immunohistochemistry/immunofluorescence; Freud-2 function was examined by electrophoretic mobility shift, reporter assay, and Western blot. Freud-2 RNA was widely distributed in brain and peripheral tissues. Freud-2 protein was enriched in the nuclear fraction of human prefrontal cortex and hippocampus but was weakly expressed in the dorsal raphe nucleus. Freud-2 immunostaining was co-localized with 5-HT1A receptors, neuronal and glial markers. In prefrontal cortex, Freud-2 was expressed at similar levels in control and depressed male subjects. Recombinant hFreud-2 protein bound specifically to 5' or 3' human DRE adjacent to the Freud-1 site. Human Freud-2 showed strong repressor activity at the human 5-HT1A or heterologous promoter in human HEK-293 5-HT1A-negative cells and neuronal SK-N-SH cells, a model of postsynaptic 5-HT1A receptor-positive cells. Furthermore, small interfering RNA knockdown of endogenous hFreud-2 expression de-repressed 5-HT1A promoter activity and increased levels of 5-HT1A receptor protein in SK-N-SH cells. Human Freud-2 binds to the 5-HT1A DRE and represses the human 5-HT1A receptor gene to regulate its expression in non-serotonergic cells and neurons.

  2. Rhodium(II) metallopeptide catalyst design enables fine control in selective functionalization of natural SH3 domains.

    Science.gov (United States)

    Vohidov, Farrukh; Coughlin, Jane M; Ball, Zachary T

    2015-04-07

    Chemically modified proteins are increasingly important for use in fundamental biophysical studies, chemical biology, therapeutic protein development, and biomaterials. However, chemical methods typically produce heterogeneous labeling and cannot approach the exquisite selectivity of enzymatic reactions. While bioengineered methods are sometimes an option, selective reactions of natural proteins remain an unsolved problem. Here we show that rhodium(II) metallopeptides combine molecular recognition with promiscuous catalytic activity to allow covalent decoration of natural SH3 domains, depending on choice of catalyst but independent of the specific residue present. A metallopeptide catalyst succeeds in modifying a single SH3-containing kinase at endogenous concentrations in prostate cancer (PC-3) cell lysate. © 2015 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  3. RNA interference-based therapeutics for human immunodeficiency virus HIV-1 treatment: synthetic siRNA or vector-based shRNA?

    Science.gov (United States)

    Subramanya, Sandesh; Kim, Sang-Soo; Manjunath, N; Shankar, Premlata

    2010-02-01

    Despite the clinical benefits of highly active antiretroviral therapy (HAART), the prospect of life-long antiretroviral treatment poses significant problems, which has spurred interest in developing new drugs and strategies to treat HIV infection and eliminate persistent viral reservoirs. RNAi has emerged as a therapeutic possibility for HIV. We discuss progress in overcoming hurdles to translating transient and stable RNAi enabling technologies to clinical application for HIV; covering the past 2 - 3 years. HIV inhibition can be achieved by transfection of chemically or enzymatically synthesized siRNAs or by DNA-based vector systems expressing short hairpin RNAs (shRNAs) that are processed intracellularly into siRNA. We compare these approaches, focusing on technical and safety issues that will guide the choice of strategy for clinical use. Introduction of synthetic siRNA into cells or its stable endogenous production using vector-driven shRNA have been shown to suppress HIV replication in vitro and, in some instances, in vivo. Each method has advantages and limitations in terms of ease of delivery, duration of silencing, emergence of escape mutants and potential toxicity. Both appear to have potential as future therapeutics for HIV, once the technical and safety issues of each approach are overcome.

  4. Semi-supervised prediction of SH2-peptide interactions from imbalanced high-throughput data.

    Science.gov (United States)

    Kundu, Kousik; Costa, Fabrizio; Huber, Michael; Reth, Michael; Backofen, Rolf

    2013-01-01

    Src homology 2 (SH2) domains are the largest family of the peptide-recognition modules (PRMs) that bind to phosphotyrosine containing peptides. Knowledge about binding partners of SH2-domains is key for a deeper understanding of different cellular processes. Given the high binding specificity of SH2, in-silico ligand peptide prediction is of great interest. Currently however, only a few approaches have been published for the prediction of SH2-peptide interactions. Their main shortcomings range from limited coverage, to restrictive modeling assumptions (they are mainly based on position specific scoring matrices and do not take into consideration complex amino acids inter-dependencies) and high computational complexity. We propose a simple yet effective machine learning approach for a large set of known human SH2 domains. We used comprehensive data from micro-array and peptide-array experiments on 51 human SH2 domains. In order to deal with the high data imbalance problem and the high signal-to-noise ration, we casted the problem in a semi-supervised setting. We report competitive predictive performance w.r.t. state-of-the-art. Specifically we obtain 0.83 AUC ROC and 0.93 AUC PR in comparison to 0.71 AUC ROC and 0.87 AUC PR previously achieved by the position specific scoring matrices (PSSMs) based SMALI approach. Our work provides three main contributions. First, we showed that better models can be obtained when the information on the non-interacting peptides (negative examples) is also used. Second, we improve performance when considering high order correlations between the ligand positions employing regularization techniques to effectively avoid overfitting issues. Third, we developed an approach to tackle the data imbalance problem using a semi-supervised strategy. Finally, we performed a genome-wide prediction of human SH2-peptide binding, uncovering several findings of biological relevance. We make our models and genome-wide predictions, for all the 51 SH2

  5. A genome-wide shRNA screen identifies GAS1 as a novel melanoma metastasis suppressor gene.

    Science.gov (United States)

    Gobeil, Stephane; Zhu, Xiaochun; Doillon, Charles J; Green, Michael R

    2008-11-01

    Metastasis suppressor genes inhibit one or more steps required for metastasis without affecting primary tumor formation. Due to the complexity of the metastatic process, the development of experimental approaches for identifying genes involved in metastasis prevention has been challenging. Here we describe a genome-wide RNAi screening strategy to identify candidate metastasis suppressor genes. Following expression in weakly metastatic B16-F0 mouse melanoma cells, shRNAs were selected based upon enhanced satellite colony formation in a three-dimensional cell culture system and confirmed in a mouse experimental metastasis assay. Using this approach we discovered 22 genes whose knockdown increased metastasis without affecting primary tumor growth. We focused on one of these genes, Gas1 (Growth arrest-specific 1), because we found that it was substantially down-regulated in highly metastatic B16-F10 melanoma cells, which contributed to the high metastatic potential of this mouse cell line. We further demonstrated that Gas1 has all the expected properties of a melanoma tumor suppressor including: suppression of metastasis in a spontaneous metastasis assay, promotion of apoptosis following dissemination of cells to secondary sites, and frequent down-regulation in human melanoma metastasis-derived cell lines and metastatic tumor samples. Thus, we developed a genome-wide shRNA screening strategy that enables the discovery of new metastasis suppressor genes.

  6. Construction and expression of secreting type human TRAIL gene vector mediated by hypoxia/radiation double sensitive promoter

    International Nuclear Information System (INIS)

    Yang Yanming; Jia Xiaojing; Qu Yaqin; Li Yanbo

    2009-01-01

    Objective: To construct secreting type human TRAIL (shTRAIL) gene vector pcDNA3.1-HRE/Egr1-shTRAIL mediated by hypoxia/radiation double sensitive promoter, and observe the effect of hypoxia and radiation on shTRAIL. Methods: HRE upper and lower strands were gotten by chemical synthesis, double strands HRE was gotten by PCR; pMD19T-Egr1 was digested by Sac I and Hind III, then Egr1 was obtained, pshuttle-shTRAIL was digested by Kpn I and BamH I, then shTRAIL was obtained; HRE/Egr1 double sensitive promoter mediated shTRAIL expression vector pcDNA3.1-HRE/Egr1-shTRAIL was constructed by gene recombination technique, it was identified correctly by enzyme digestion, PCR and sequencing. A549 cells were divided into normal, hypoxia (0.1%), irradiation (6 Gy) and hypoxia + irradiation groups. Results: After enzyme digestion by BamH I and Sma I, the fragments which lengths were 1284 bp and 4 998 bp, 2 292 bp and 3 990 bp were obtained; the vector was amplified by PCR with Egr1 and shTRAIL primer, the products which lengthens were 469 bp and 820 bp were obtained; pcDNA3.1-HRE/Egr1-shTRAIL was sequenced, the result was same to designed, this demonstrated that the construction was right. The vectors were transfected into A549 cells of adenocarcinoma of lung, the expression levels of shTRAIL mRNA and protein were increased after treated with hypoxia and radiation, it had statistically significant differences compared with normal group (P<0.05), and when they were combinated, the effect was more obvious. Conclusion: Secreting type human TRAIL gene vector pcDNA3.1-HRE/Egr1-shTRAIL mediated by hypoxia/radiation double sensitive promoter is constructed successfully, and hypoxia and radiation could increase the expression of TRAIL, and they have synergetic effect. (authors)

  7. Ischemic preconditioning negatively regulates plenty of SH3s-mixed lineage kinase 3-Rac1 complex and c-Jun N-terminal kinase 3 signaling via activation of Akt.

    Science.gov (United States)

    Zhang, Q-G; Han, D; Xu, J; Lv, Q; Wang, R; Yin, X-H; Xu, T-L; Zhang, G-Y

    2006-12-01

    Activation of Akt/protein kinase B has been recently reported to play an important role in ischemic tolerance. We here demonstrate that the decreased protein expression and phosphorylation of phosphatase and tensin homolog deleted from chromosome 10 (PTEN) underlie the increased Akt-Ser-473 phosphorylation in the hippocampal CA1 subfield in ischemic preconditioning (IPC). Co-immunoprecipitation analysis reveals that Akt physically interacts with Rac1, a small Rho family GTPase required for mixed lineage kinase 3 (MLK3) autophosphorylation, and both this interaction and Rac1-Ser-71 phosphorylation induced by Akt are promoted in preconditioned rats. In addition, we show that Akt activation results in the disassembly of the plenty of SH3s (POSH)-MLK3-Rac1 signaling complex and down-regulation of the activation of MLK3/c-Jun N-terminal kinase (JNK) pathway. Akt activation results in decreased serine phosphorylation of 14-3-3, a cytoplasmic anchor of Bax, and prevents ischemia-induced mitochondrial translocation of Bax, release of cytochrome c, and activation of caspase-3. The expression of Fas ligand is also decreased in the CA1 region. Akt activation protects against apoptotic neuronal death as shown in TUNEL staining following IPC. Intracerebral infusion of LY294002 before IPC reverses the increase in Akt phosphorylation and the decrease in JNK signaling activation, as well as the neuroprotective action of IPC. Our results suggest that activation of pro-apoptotic MLK3/JNK3 cascade can be suppressed through activating anti-apoptotic phosphoinositide 3-kinase/Akt pathway induced by a sublethal ischemic insult, which provides a functional link between Akt and the JNK family of stress-activated kinases in ischemic tolerance.

  8. Molecular dynamics simulations from putative transition states of alpha-spectrin SH3 domain

    NARCIS (Netherlands)

    Periole, Xavier; Vendruscolo, Michele; Mark, Alan E.

    2007-01-01

    A series of molecular dynamics simulations in explicit solvent were started from nine structural models of the transition state of the SH3 domain of alpha-spectrin, which were generated by Lindorff Larsen et al. (Nat Struct Mol Biol 2004;11:443-449) using molecular dynamics simulations in which

  9. SH2 Binding Site Protection Assay: A Method for Identification of SH2 Domain Interaction Partners by Exploiting SH2 Mediated Phosphosite Protection.

    Science.gov (United States)

    Jadwin, Joshua A

    2017-01-01

    Over the last two decades there has been a significant effort in the field to characterize the phosphosite binding specificities of SH2 domains with the goal of deciphering the pY signaling code. Although high throughput studies in various formats using most SH2 domains have collectively provided a rich resource of in vitro SH2-pTyr site specificity maps, this data can only be used approximate what is happening in the cell where protein concentrations and localization are not homogenous, as they are for in vitro experiments. Here we describe an in vivo approach, SH2 site protection assay, which can capture the pTyr binding specificity of SH2 domains in the cell. The basis of this approach is SH2-pY site protection, the ability of SH2 domains to prevent the PTP-dependent dephosphorylation of their pY site binding partners. We overexpress a tracer SH2 domain in cells and quantify the change in abundance of tyrosine phosphorylated sites using MS. Since the method is performed in vivo, it has the advantage of identifying SH2-pY interactions as they occur within in the cell.

  10. Chromosome locations of genes encoding human signal transduction adapter proteins, Nck (NCK), Shc (SHC1), and Grb2 (GRB2)

    DEFF Research Database (Denmark)

    Huebner, K; Kastury, K; Druck, T

    1994-01-01

    "adapter" proteins, which are involved in transducing signals from receptor tyrosine kinases to downstream signal recipients such as ras, because adaptor protein genes could also, logically, serve as targets of mutation, rearrangement, or other aberration in disease. Therefore, DNAs from panels of rodent-human......Abnormalities due to chromosomal aberration or point mutation in gene products of growth factor receptors or in ras gene products, which lie on the same signaling pathway, can cause disease in animals and humans. Thus, it can be important to determine chromosomal map positions of genes encoding...... hybrids carrying defined complements of human chromosomes were assayed for the presence of the cognate genes for NCK, SHC, and GRB2, three SH2 or SH2/SH3 (Src homology 2 and 3) domain-containing adapter proteins. Additionally, NCK and SHC genes were more narrowly localized by chromosomal in situ...

  11. Transferência de fatores genéticos de resistência a Hemileia vastatrix para o cultivar mundo novo Transference of the genes SH2 and SH3 for resistance to Hemileia vastatrix to the mundo novo cultivar of C. arabica

    Directory of Open Access Journals (Sweden)

    A. Carvalho

    1977-01-01

    Full Text Available Cafeeiros portadores dos fatores genéticos SH2 ou SH2 e SH3, simultaneamente, que conferem resistência a várias raças de Hemileia vastatrix, foram cruzados com plantas selecionadas do cultivar mundo novo de Coffea arabica a fim de se obter, em F2, recombinações com resistência a esse patógeno e elevada produtividade. Analisaram-se 14 populações F2 segregando apenas para o fator SH2, oito para os fatores SH2 e HS3, e três populações que dão, em sua descendência, plantas do grupo A, resistentes a todas as raças do patógeno até agora conhecidas. De 22.356 cafeeiros originalmente plantados em ensaio, a duas mudas por cova, em parcelas casualizadas, fez-se uma primeira seleção deixando apenas um cafeeiro por cova, reduzindo-se para 11.178 as plantas em estudo. Com base no aspecto vegetativo, na produtividade, na ausência de defeitos nos frutos e na reação de resistência ao agente causal da ferrugem, realizaram-se sucessivas seleções escolhendo-se finalmente, apenas 100 cafeeiros do tipo mundo novo e resistentes a H. vastatrix para derivação das populações F2 e prosseguimento da seleção.Coffee trees homozygous for the alleles SH2 or SH2 and SH3 which confer resistance to several physiological races of Hemileia vastatrix, were crossed to selected plants of Mundo Novo cultivar of Coffea arabica and the F2 generations were studied aiming to develop new high yielding and resistant coffee recombinations. A complete randomized field trial was stablished including 14 F2 populations segregating for SH2, eight populations segregating for SH2 and SH3 genes, and three populations segregating for plants of the A group of reaction to the H. vastatrix attack. A total of 22,356 F2 plants were analysed. Based on the plant vigor, yield capacity, percentage of normal developed seeds and resistance reaction to H. vastatrix, three successive series of selection were undertaken leaving only 100 coffee trees for development of F3 populations

  12. Assessment of intravenous pbi-shRNA PDX1 nanoparticle (OFHIRNA-PDX1) in yucatan swine.

    Science.gov (United States)

    Jay, C M; Ruoff, C; Kumar, P; Maass, H; Spanhel, B; Miller, M; Arrington, A; Montalvo, N; Gresham, V; Rao, D D; Evans, C; Wang, Z; Brunicardi, F C; Liu, S-H; Zhou, G; Senzer, N; Nemunaitis, J; King, L; Weeks, B; Clubb, F J; Fossum, T W; Maples, P B

    2013-12-01

    PDX1 (pancreatic and duodenal homeobox 1) is overexpressed in pancreatic cancer, and its reduction results in tumor regression. Bi-functional pbi-shRNA PDX1 nanoparticle (OFHIRNA-PDX1) utilizes the endogenous micro-RNA biogenesis pathway to effect cleavage- and non-cleavage-dependent degradation of PDX1 mRNA. We have shown that OFHIRNA-PDX1 reduces pancreatic tumor volume in xenograft models. Thus, we are now exploring biorelevant large animal safety of OFHIRNA-PDX1. Mini pigs were chosen as the biorelevant species based on the similarity of human and pig PDX1 target sequence. In the initial study, animals developed fever, lethargy, hyporexia and cutaneous hyperemia following administration of OFHIRNA-PDX1. Twenty-one days later, the same animals demonstrated less toxicity with a second OFHIRNA-PDX1 infusion in conjunction with a prophylactic regimen involving dexamethasone, diphenhydramine, Indocin and ranitidine. In a new group of animals, PDX1 protein (31 kDa) expression in the pancreas was significantly repressed at 48 and 72 h (85%, P=0.018 and 88%, P=0.013; respectively) following a single infusion of OFHIRNA-PDX1 but recovered to normal state within 7 days. In conclusion, a single intravenous infusion of OFHIRNA-PDX1 in conjunction with premedication in pigs was well tolerated and demonstrated significant PDX1 knockdown.

  13. A photoaffinity scan maps regions of the p85 SH2 domain involved in phosphoprotein binding.

    Science.gov (United States)

    Williams, K P; Shoelson, S E

    1993-03-15

    Src homology 2 (SH2) domains are modular phosphotyrosine binding pockets found within a wide variety of cytoplasmic signaling molecules. Here we develop a new approach to analyzing protein-protein interfaces termed photoaffinity scanning, and apply the method to map regions of the phosphatidylinositol 3-kinase p85 SH2 domain that participate in phospho-protein binding. Each residue except phosphotyrosine (pY) within a tightly binding, IRS-1-derived phosphopeptide (GNGDpYMPMSPKS) was substituted with the photoactive amino acid, benzoylphenylalanine (Bpa). Whereas most substitutions had little effect on binding affinity, Bpa substitution of either Met (+1 and +3 with respect to pY) reduced affinity 50-100-fold to confirm their importance in the pYMXM recognition motif. In three cases photolysis of SH2 domain/Bpa phosphopeptide complexes led to cross-linking of > 50% of the SH2 domain; cross-link positions were identified by microsequence, amino acid composition, and electrospray mass spectrometric analyses. Bpa-1 cross-links within alpha-helix I, whereas Bpa+1 and Bpa+4 cross-link the SH2 domain within the flexible loop C-terminal to alpha-helix II. Moreover, cross-linking at any position prevents SH2 domain cleavage at a trypsin-sensitive site within the flexible loop between beta-strands 1 and 2. Therefore, at least three distinct SH2 regions in addition to the beta-sheet participate in phosphoprotein binding; the loop cross-linked by phosphopeptide residues C-terminal to pY appears to confer specificity to the phosphoprotein/SH2 domain interaction.

  14. Adsorption of Pb2+ on Thiol-functionalized Mesoporous Silica, SH-MCM-48

    Science.gov (United States)

    Taba, P.; Mustafa, R. D. P.; Ramang, L. M.; Kasim, A. H.

    2018-03-01

    Modification of mesoporous silica, MCM-48, by using 3- mercaptopropyltrimethoxysilane has been successfully conducted. MCM-48 and SH-MCM-48 were characterized using XRD and FTIR. SH-MCM-48 was used as an adsorbent of Pb2+ ions from solution. A number of Pb2+ ions adsorbed were studied as the function of time, pH, and concentration. The concentration of the ions after adsorption was determined by an Atomic Absorption Spectrophotometer. The removal of the adsorbed ions from the SH-MCM-48 was also studied using several desorbing agents. The result showed that the optimum time was 20 minutes and optimum pH was 4. The adsorption of Pb(II) ion followed the pseudo-second-order with the rate constant of 0,2632 g•mg-1•min-1. Adsorption of Pb(II) ion fitted the Langmuir isotherm with the adsorption capacity of 0,1088 mmol/g. The best desorbing agent to remove the adsorbed ion from SH-MCM-48 was 0.3 M HCl solution with the desorption percentage of 58.6%.

  15. Herbal Extract SH003 Suppresses Tumor Growth and Metastasis of MDA-MB-231 Breast Cancer Cells by Inhibiting STAT3-IL-6 Signaling

    Directory of Open Access Journals (Sweden)

    Youn Kyung Choi

    2014-01-01

    Full Text Available Cancer inflammation promotes cancer progression, resulting in a high risk of cancer. Here, we demonstrate that our new herbal extract, SH003, suppresses both tumor growth and metastasis of MDA-MB-231 breast cancer cells via inhibiting STAT3-IL-6 signaling path. Our new herbal formula, SH003, mixed extract from Astragalus membranaceus, Angelica gigas, and Trichosanthes kirilowii Maximowicz, suppressed MDA-MB-231 tumor growth and lung metastasis in vivo and reduced the viability and metastatic abilities of MDA-MB-231 cells in vitro. Furthermore, SH003 inhibited STAT3 activation, which resulted in a reduction of IL-6 production. Therefore, we conclude that SH003 suppresses highly metastatic breast cancer growth and metastasis by inhibiting STAT3-IL-6 signaling path.

  16. Characterizing SH2 Domain Specificity and Network Interactions Using SPOT Peptide Arrays.

    Science.gov (United States)

    Liu, Bernard A

    2017-01-01

    Src Homology 2 (SH2) domains are protein interaction modules that recognize and bind tyrosine phosphorylated ligands. Their ability to distinguish binding to over thousands of potential phosphotyrosine (pTyr) ligands within the cell is critical for the fidelity of receptor tyrosine kinase (RTK) signaling. Within humans there are over a hundred SH2 domains with more than several thousand potential ligands across many cell types and cell states. Therefore, defining the specificity of individual SH2 domains is critical for predicting and identifying their physiological ligands. Here, in this chapter, I describe the broad use of SPOT peptide arrays for examining SH2 domain specificity. An orientated peptide array library (OPAL) approach can uncover both favorable and non-favorable residues, thus providing an in-depth analysis to SH2 specificity. Moreover, I discuss the application of SPOT arrays for paneling SH2 ligand binding with physiological peptides.

  17. Regulation of nicotinic receptor subtypes following chronic nicotinic agonist exposure in M10 and SH-SY5Y neuroblastoma cells

    DEFF Research Database (Denmark)

    Warpman, U; Friberg, L; Gillespie, A

    1998-01-01

    investigated in human neuroblastoma SH-SY5Y cells (expressing alpha3, alpha5, beta2, and beta4 nAChR subunits). Nicotine exhibited a 14 times lower affinity for the nAChRs in SH-SY5Y cells as compared with M10 cells, whereas epibatidine showed similar affinities for the nAChRs expressed in the two cell lines...

  18. Fundamental modes of new dispersive SH-waves in ...

    Indian Academy of Sciences (India)

    [3] M Fiebig, V V Pavlov and R V Pisarev, J. Opt. Soc. Am. B 22(1), 96 (2005). [4] T Kimura, Ann. Rev. Condens. Matter Phys. 3(1), 93 (2012). [5] Ch-S Park and Sh Priya, Advances in condensed matter physics (Hindawi Publishing. Corporation, 2012) Vol. 2012, 12 pages. [6] R C Pullar, Prog. Mater. Sci. 57(7), 1191 (2012).

  19. Purification, crystallization and preliminary X-ray diffraction analysis of the Fyn SH2 domain and its complex with a phosphotyrosine peptide

    International Nuclear Information System (INIS)

    Huculeci, Radu; Buts, Lieven; Lenaerts, Tom; Nuland, Nico A. J. van; Garcia-Pino, Abel

    2012-01-01

    The SH2 domain of the human protein tyrosine kinase Fyn has been expressed, purified and crystallized in the unbound state and in complex with a high-affinity phosphotyrosine peptide. SH2 domains are widespread protein-binding modules that recognize phosphotyrosines and play central roles in intracellular signalling pathways. The SH2 domain of the human protein tyrosine kinase Fyn has been expressed, purified and crystallized in the unbound state and in complex with a high-affinity phosphotyrosine peptide. X-ray data were collected to a resolution of 2.00 Å for the unbound form and 1.40 Å for the protein in complex with the phosphotyrosine peptide

  20. Identification and Functional Characterization of Sugarcane Invertase Inhibitor (ShINH1: A Potential Candidate for Reducing Pre- and Post-harvest Loss of Sucrose in Sugarcane

    Directory of Open Access Journals (Sweden)

    Suresha G. Shivalingamurthy

    2018-05-01

    Full Text Available In sugarcane, invertase enzymes play a key role in sucrose accumulation and are also involved in futile reactions where sucrose is continuously degraded during the pre- and post-harvest period, thereby reducing sugar yield and recovery. Invertase inhibitor (INVINH proteins play a key role in post-translation regulation of plant invertases through which sucrose hydrolysis is controlled. INVINH proteins are small (18 kDa members of the pectin methylesterase inhibitor superfamily and they are moderately conserved across plants. In the present study, we identified two INVINH genes from sugarcane, ShINH1 and ShINH2. In silico characterization of the encoded proteins revealed 43% sequence identity at the amino acid level, confirming the non-allelic nature of the proteins. The presence of putative signal peptide and subcellular targeting sequences revealed that ShINH1 and ShINH2 likely have apoplasmic and vacuolar localization, respectively. Experimental visualization of ShINH1–GFP revealed that ShINHI is indeed exported to the apoplast. Differential tissue-specific and developmental expression of ShINH1 between leaf, stalk, flower and root suggest that it plays a role in controlling source-sink metabolic regulation during sucrose accumulation in sugarcane. ShINH1 is expressed at relatively high levels in leaves and stalk compared to flowers and roots, and expression decreases significantly toward internodal maturity during stalk development. ShINH1 is expressed at variable levels in flowers with no specific association to floral maturity. Production of recombinant ShINH1 enabled experimental validation of protein function under in vitro conditions. Recombinant ShINH1 potently inhibited acid invertase (IC50 22.5 nM, making it a candidate for controlling pre- and post-harvest deterioration of sucrose in sugarcane. Our results indicate that ShINH1 and ShINH2 are likely to play a regulatory role in sucrose accumulation and contribute to the improvement

  1. Multiscale molecular dynamics simulations of membrane remodeling by Bin/Amphiphysin/Rvs family proteins

    Science.gov (United States)

    Chun, Chan; Haohua, Wen; Lanyuan, Lu; Jun, Fan

    2016-01-01

    Membrane curvature is no longer thought of as a passive property of the membrane; rather, it is considered as an active, regulated state that serves various purposes in the cell such as between cells and organelle definition. While transport is usually mediated by tiny membrane bubbles known as vesicles or membrane tubules, such communication requires complex interplay between the lipid bilayers and cytosolic proteins such as members of the Bin/Amphiphysin/Rvs (BAR) superfamily of proteins. With rapid developments in novel experimental techniques, membrane remodeling has become a rapidly emerging new field in recent years. Molecular dynamics (MD) simulations are important tools for obtaining atomistic information regarding the structural and dynamic aspects of biological systems and for understanding the physics-related aspects. The availability of more sophisticated experimental data poses challenges to the theoretical community for developing novel theoretical and computational techniques that can be used to better interpret the experimental results to obtain further functional insights. In this review, we summarize the general mechanisms underlying membrane remodeling controlled or mediated by proteins. While studies combining experiments and molecular dynamics simulations recall existing mechanistic models, concurrently, they extend the role of different BAR domain proteins during membrane remodeling processes. We review these recent findings, focusing on how multiscale molecular dynamics simulations aid in understanding the physical basis of BAR domain proteins, as a representative of membrane-remodeling proteins. Project supported by the National Natural Science Foundation of China (Grant No. 21403182) and the Research Grants Council of Hong Kong, China (Grant No. CityU 21300014).

  2. Quality of pharmacy-specific Medical Subject Headings (MeSH) assignment in pharmacy journals indexed in MEDLINE.

    Science.gov (United States)

    Minguet, Fernando; Salgado, Teresa M; van den Boogerd, Lucienne; Fernandez-Llimos, Fernando

    2015-01-01

    The Medical Subject Headings (MeSH) is the National Library of Medicine (NLM) controlled vocabulary for indexing articles. Inaccuracies in the MeSH thesaurus have been reported for several areas including pharmacy. To assess the quality of pharmacy-specific MeSH assignment to articles indexed in pharmacy journals. The 10 journals containing the highest number of articles published in 2012 indexed under the MeSH 'Pharmacists' were identified. All articles published over a 5-year period (2008-2012) in the 10 previously selected journals were retrieved from PubMed. MeSH terms used to index these articles were extracted and pharmacy-specific MeSH terms were identified. The frequency of use of pharmacy-specific MeSH terms was calculated across journals. A total of 6989 articles were retrieved from the 10 pharmacy journals, of which 328 (4.7%) were articles not fully indexed and therefore did not contain any MeSH terms assigned. Among the 6661 articles fully indexed, the mean number of MeSH terms was 10.1 (SD = 4.0), being 1.0 (SD = 1.3) considered as Major MeSH. Both values significantly varied across journals. The mean number of pharmacy-specific MeSH terms per article was 0.9 (SD = 1.2). A total of 3490 (52.4%) of the 6661 articles were indexed in pharmacy journals without a single pharmacy-specific MeSH. Of the total 67193 MeSH terms assigned to articles, on average 10.5% (SD = 13.9) were pharmacy-specific MeSH. A statistically significant different pattern of pharmacy-specific MeSH assignment was identified across journals (Kruskal-Wallis P journals can be improved to further enhance evidence gathering in pharmacy. Over half of the articles published in the top-10 journals publishing pharmacy literature were indexed without a single pharmacy-specific MeSH. Copyright © 2015 Elsevier Inc. All rights reserved.

  3. Mobility of TOAC spin-labelled peptides binding to the Src SH3 domain studied by paramagnetic NMR

    Energy Technology Data Exchange (ETDEWEB)

    Lindfors, Hanna E. [Leiden University, Leiden Institute of Chemistry, Gorlaeus Laboratories (Netherlands); Koning, Peter E. de; Wouter Drijfhout, Jan [Leiden University Medical Centre, Department of Immunohematology and Blood Transfusion (Netherlands); Venezia, Brigida; Ubbink, Marcellus [Leiden University, Leiden Institute of Chemistry, Gorlaeus Laboratories (Netherlands)], E-mail: m.ubbink@chem.leidenuniv.nl

    2008-07-15

    Paramagnetic relaxation enhancement provides a tool for studying the dynamics as well as the structure of macromolecular complexes. The application of side-chain coupled spin-labels is limited by the mobility of the free radical. The cyclic, rigid amino acid spin-label TOAC (2,2,6,6-Tetramethylpiperidine-1-oxyl-4-amino-4-carboxylic acid), which can be incorporated straightforwardly by peptide synthesis, provides an attractive alternative. In this study, TOAC was incorporated into a peptide derived from focal adhesion kinase (FAK), and the interaction of the peptide with the Src homology 3 (SH3) domain of Src kinase was studied, using paramagnetic NMR. Placing TOAC within the binding motif of the peptide has a considerable effect on the peptide-protein binding, lowering the affinity substantially. When the TOAC is positioned just outside the binding motif, the binding constant remains nearly unaffected. Although the SH3 domain binds weakly and transiently to proline-rich peptides from FAK, the interaction is not very dynamic and the relative position of the spin-label to the protein is well-defined. It is concluded that TOAC can be used to generate reliable paramagnetic NMR restraints.

  4. Mobility of TOAC spin-labelled peptides binding to the Src SH3 domain studied by paramagnetic NMR

    International Nuclear Information System (INIS)

    Lindfors, Hanna E.; Koning, Peter E. de; Wouter Drijfhout, Jan; Venezia, Brigida; Ubbink, Marcellus

    2008-01-01

    Paramagnetic relaxation enhancement provides a tool for studying the dynamics as well as the structure of macromolecular complexes. The application of side-chain coupled spin-labels is limited by the mobility of the free radical. The cyclic, rigid amino acid spin-label TOAC (2,2,6,6-Tetramethylpiperidine-1-oxyl-4-amino-4-carboxylic acid), which can be incorporated straightforwardly by peptide synthesis, provides an attractive alternative. In this study, TOAC was incorporated into a peptide derived from focal adhesion kinase (FAK), and the interaction of the peptide with the Src homology 3 (SH3) domain of Src kinase was studied, using paramagnetic NMR. Placing TOAC within the binding motif of the peptide has a considerable effect on the peptide-protein binding, lowering the affinity substantially. When the TOAC is positioned just outside the binding motif, the binding constant remains nearly unaffected. Although the SH3 domain binds weakly and transiently to proline-rich peptides from FAK, the interaction is not very dynamic and the relative position of the spin-label to the protein is well-defined. It is concluded that TOAC can be used to generate reliable paramagnetic NMR restraints

  5. Avaliação e seleção de progênies F3 de cafeeiros de porte baixo com o gene SH3 de resistência a Hemileia vastatrix Berk. et Br. Evaluation and selection of Coffea arabica F3 progenies with low height and the leaf-rust SH3 resistence gene

    Directory of Open Access Journals (Sweden)

    Albano Silva da Conceição

    2005-01-01

    Full Text Available Com o objetivo de avaliar e selecionar progênies F3 de cafeeiros de porte baixo com o gene SH3 de resistência à ferrugem, foram estudadas 36 progênies de cafeeiros tipo arábica (Coffea arabica L. , em geração F3, resultantes dos cruzamentos dirigidos entre as cultivares Catuaí Vermelho IAC 46 e Catuaí Vermelho IAC 81 com o acesso IAC 1110 (BA-10. Esse último, originário da Índia, é fonte dos genes SH2SH3 que conferem resistência a Hemileia vastatrix. O experimento, estabelecido em 1988 no Centro Experimental do Instituto Agronômico, em Campinas (SP, no delineamento experimental em blocos ao acaso com seis repetições, duas plantas por parcela e no espaçamento 3,0 x 1,8 m, utilizou como testemunha a cultivar Catuaí Vermelho IAC 81, totalizando 37 tratamentos. Avaliaram-se no campo, a produção de café (média de sete colheitas, vigor vegetativo, resistência à ferrugem, porte da planta, coloração das folhas novas e maturação dos frutos. Os frutos das plantas mais produtivas foram analisados em laboratório quanto ao rendimento, tipos de sementes, peneira média e massa de 1000 grãos. A análise da variância dos dados de produção das progênies evidenciou que houve diferenças significativas entre as progênies, ao nível de 1% de probabilidade, pelo teste F. Foram selecionadas 11 progênies com média superior à testemunha e dentro dessas, 39 cafeeiros. Das 25 progênies restantes foram selecionados mais 15 cafeeiros produtivos e resistentes ao agente da ferrugem. Desses 54 cafeeiros, foram selecionados os 18 que apresentaram peneira média acima de 15,5 e maior freqüência de grãos normais do tipo chato. As progênies dessas plantas selecionadas foram avaliadas na geração F4, em fase de mudas, quando se verificou que dez delas estavam em homozigoze para porte baixo. Com as 18 plantas, o Programa de Melhoramento do Café, no IAC, terá continuidade como progênies F4, visando à obtenção de nova cultivar de

  6. Crystal structure of an SH2-kinase construct of c-Abl and effect of the SH2 domain on kinase activity.

    Science.gov (United States)

    Lorenz, Sonja; Deng, Patricia; Hantschel, Oliver; Superti-Furga, Giulio; Kuriyan, John

    2015-06-01

    Constitutive activation of the non-receptor tyrosine kinase c-Abl (cellular Abelson tyrosine protein kinase 1, Abl1) in the Bcr (breakpoint cluster region)-Abl1 fusion oncoprotein is the molecular cause of chronic myeloid leukaemia (CML). Recent studies have indicated that an interaction between the SH2 (Src-homology 2) domain and the N-lobe (N-terminal lobe) of the c-Abl kinase domain (KD) has a critical role in leukaemogenesis [Grebien et al. (2011) Cell 147, 306-319; Sherbenou et al. (2010) Blood 116, 3278-3285]. To dissect the structural basis of this phenomenon, we studied c-Abl constructs comprising the SH2 and KDs in vitro. We present a crystal structure of an SH2-KD construct bound to dasatinib, which contains the relevant interface between the SH2 domain and the N-lobe of the KD. We show that the presence of the SH2 domain enhances kinase activity moderately and that this effect depends on contacts in the SH2/N-lobe interface and is abrogated by specific mutations. Consistently, formation of the interface decreases slightly the association rate of imatinib with the KD. That the effects are small compared with the dramatic in vivo consequences suggests an important function of the SH2-N-lobe interaction might be to help disassemble the auto-inhibited conformation of c-Abl and promote processive phosphorylation, rather than substantially stimulate kinase activity.

  7. Cyclophilin B protects SH-SY5Y human neuroblastoma cells against MPP(+)-induced neurotoxicity via JNK pathway.

    Science.gov (United States)

    Oh, Yoojung; Jeong, Kwon; Kim, Kiyoon; Lee, Young-Seok; Jeong, Suyun; Kim, Sung Soo; Yoon, Kyung-Sik; Ha, Joohun; Kang, Insug; Choe, Wonchae

    2016-09-23

    Parkinson's disease (PD) is the second most common neurodegenerative disorder of aging. PD involves a progressive loss of dopaminergic neurons in the substantia nigra pars compacta. 1-Methyl-4-phenyl-1, 2, 3, 6-tetrahydropyidine (MPTP) and its toxic metabolite 1-methyl-4-phenylpyridinium ion (MPP+) inhibit the complex I of the mitochondrial electron transport chain, and have been widely used to construct PD models. Cyclophilin B (CypB) is an endoplasmic reticulum protein that binds to cyclosporine A as a cyclophilin family member. CypB has peptidyl-prolyl cis-trans isomerase (PPIase) activity. We investigated the protective effects of overexpressed CypB on MPP+-induced neurocytotoxicity in SH-SY5Y human neuroblastoma cells. Overexpressed CypB decreased MPP(+)-induced oxidative stress through the modulation of antioxidant enzymes including manganese superoxide dismutase and catalase, and prevented neurocytotoxicity via mitogen-activated protein kinase, especially the c-Jun N-terminal kinase pathway. In addition, CypB inhibited the activation of MPP(+)-induced the pro-apoptotic molecules poly (ADP-ribose) polymerase, Bax, and Bcl-2, and attenuated MPP(+)-induced mitochondrial dysfunction. The data suggest that overexpressed CypB protects neuronal cells from MPP+-induced dopaminergic neuronal cell death. Copyright © 2016 Elsevier Inc. All rights reserved.

  8. A novel small molecule inhibits STAT3 phosphorylation and DNA binding activity and exhibits potent growth suppressive activity in human cancer cells

    Directory of Open Access Journals (Sweden)

    Lin Li

    2010-08-01

    Full Text Available Abstract Background Targeting Signal Transducer and Activator of Transcription 3 (STAT3 signaling is an attractive therapeutic approach for most types of human cancers with constitutively activated STAT3. A novel small molecular STAT3 inhibitor, FLLL32 was specifically designed from dietary agent, curcumin to inhibit constitutive STAT3 signaling in multiple myeloma, glioblastoma, liver cancer, and colorectal cancer cells. Results FLLL32 was found to be a potent inhibitor of STAT3 phosphorylation, STAT3 DNA binding activity, and the expression of STAT3 downstream target genes in vitro, leading to the inhibition of cell proliferation as well as the induction of Caspase-3 and PARP cleavages in human multiple myeloma, glioblastoma, liver cancer, and colorectal cancer cell lines. However, FLLL32 exhibited little inhibition on some tyrosine kinases containing SH2 or both SH2 and SH3 domains, and other protein and lipid kinases using a kinase profile assay. FLLL32 was also more potent than four previously reported JAK2 and STAT3 inhibitors as well as curcumin to inhibit cell viability in these cancer cells. Furthermore, FLLL32 selectively inhibited the induction of STAT3 phosphorylation by Interleukin-6 but not STAT1 phosphorylation by IFN-γ. Conclusion Our findings indicate that FLLL32 exhibits potent inhibitory activity to STAT3 and has potential for targeting multiple myeloma, glioblastoma, liver cancer, and colorectal cancer cells expressing constitutive STAT3 signaling.

  9. Meshable: searching PubMed abstracts by utilizing MeSH and MeSH-derived topical terms.

    Science.gov (United States)

    Kim, Sun; Yeganova, Lana; Wilbur, W John

    2016-10-01

    Medical Subject Headings (MeSH(®)) is a controlled vocabulary for indexing and searching biomedical literature. MeSH terms and subheadings are organized in a hierarchical structure and are used to indicate the topics of an article. Biologists can use either MeSH terms as queries or the MeSH interface provided in PubMed(®) for searching PubMed abstracts. However, these are rarely used, and there is no convenient way to link standardized MeSH terms to user queries. Here, we introduce a web interface which allows users to enter queries to find MeSH terms closely related to the queries. Our method relies on co-occurrence of text words and MeSH terms to find keywords that are related to each MeSH term. A query is then matched with the keywords for MeSH terms, and candidate MeSH terms are ranked based on their relatedness to the query. The experimental results show that our method achieves the best performance among several term extraction approaches in terms of topic coherence. Moreover, the interface can be effectively used to find full names of abbreviations and to disambiguate user queries. https://www.ncbi.nlm.nih.gov/IRET/MESHABLE/ CONTACT: sun.kim@nih.gov Supplementary data are available at Bioinformatics online. © The Author 2016. Published by Oxford University Press.

  10. The adaptor Lnk (SH2B3): an emerging regulator in vascular cells and a link between immune and inflammatory signaling.

    Science.gov (United States)

    Devallière, Julie; Charreau, Béatrice

    2011-11-15

    A better knowledge of the process by which inflammatory extracellular signals are relayed from the plasma membrane to specific intracellular sites is a key step to understand how inflammation develops and how it is regulated. This review focuses on Lnk (SH2B3) a member, with SH2B1 and SH2B2, of the SH2B family of adaptor proteins that influences a variety of signaling pathways mediated by Janus kinase and receptor tyrosine kinases. SH2B adaptor proteins contain conserved dimerization, pleckstrin homology, and SH2 domains. Initially described as a regulator of hematopoiesis and lymphocyte differentiation, Lnk now emerges as a key regulator in hematopoeitic and non hematopoeitic cells such as endothelial cells (EC) moderating growth factor and cytokine receptor-mediated signaling. In EC, Lnk is a negative regulator of TNF signaling that reduce proinflammatory phenotype and prevent EC from apoptosis. Lnk is a modulator in integrin signaling and actin cytoskeleton organization in both platelets and EC with an impact on cell adhesion, migration and thrombosis. In this review, we discuss some recent insights proposing Lnk as a key regulator of bone marrow-endothelial progenitor cell kinetics, including the ability to cell growth, endothelial commitment, mobilization, and recruitment for vascular regeneration. Finally, novel findings also provided evidences that mutations in Lnk gene are strongly linked to myeloproliferative disorders but also autoimmune and inflammatory syndromes where both immune and vascular cells display a role. Overall, these studies emphasize the importance of the Lnk adaptor molecule not only as prognostic marker but also as potential therapeutic target. Copyright © 2011 Elsevier Inc. All rights reserved.

  11. Examining transition metal hydrosulfides: The pure rotational spectrum of ZnSH (X̃2A').

    Science.gov (United States)

    Bucchino, M P; Adande, G R; Halfen, D T; Ziurys, L M

    2017-10-21

    The pure rotational spectrum of the ZnSH (X̃ 2 A') radical has been measured using millimeter-wave direct absorption and Fourier transform microwave (FTMW) methods across the frequency range 18-468 GHz. This work is the first gas-phase detection of ZnSH by any spectroscopic technique. Spectra of the 66 ZnSH, 68 ZnSH, and 64 ZnSD isotopologues were also recorded. In the mm-wave study, ZnSH was synthesized in a DC discharge by the reaction of zinc vapor, generated by a Broida-type oven, with H 2 S; for FTMW measurements, the radical was made in a supersonic jet expansion by the same reactants but utilizing a discharge-assisted laser ablation source. Between 7 and 9 rotational transitions were recorded for each isotopologue. Asymmetry components with K a = 0 through 6 were typically measured in the mm-wave region, each split into spin-rotation doublets. In the FTMW spectra, hyperfine interactions were also resolved, arising from the hydrogen or deuterium nuclear spins of I = 1/2 or I = 1, respectively. The data were analyzed using an asymmetric top Hamiltonian, and rotational, spin-rotation, and magnetic hyperfine parameters were determined for ZnSH, as well as the quadrupole coupling constant for ZnSD. The observed spectra clearly indicate that ZnSH has a bent geometry. The r m (1) structure was determined to be r Zn-S = 2.213(5) Å, r S-H = 1.351(3) Å, and θ Zn-S-H = 90.6(1)°, suggesting that the bonding occurs primarily through sulfur p orbitals, analogous to H 2 S. The hyperfine constants indicate that the unpaired electron in ZnSH primarily resides on the zinc nucleus.

  12. SH2 domains: modulators of nonreceptor tyrosine kinase activity

    OpenAIRE

    Filippakopoulos, Panagis; Müller, Susanne; Knapp, Stefan

    2009-01-01

    The Src homology 2 (SH2) domain is a sequence-specific phosphotyrosine-binding module present in many signaling molecules. In cytoplasmic tyrosine kinases, the SH2 domain is located N-terminally to the catalytic kinase domain (SH1) where it mediates cellular localization, substrate recruitment, and regulation of kinase activity. Initially, structural studies established a role of the SH2 domain stabilizing the inactive state of Src family members. However, biochemical characterization showed ...

  13. Cloning and expression of sheep renal K-CI cotransporter-1.

    Science.gov (United States)

    Zhang, Jin J; Misri, Sandeep; Adragna, Norma C; Gagnon, Kenneth B E; Fyffe, Robert E W; Lauf, Peter K

    2005-01-01

    Sheep K-Cl cotransporter-1(shKCC1) cDNA was cloned from kidney by RT-PCR with an open reading frame of 3258 base pairs exhibiting 92%, 90%, 88% and 87% identity with pig, rabbit and human, rat and mouse KCC1 cDNAs, respectively, encoding an approximately 122 kDa polypeptide of 1086-amino acids. Hydropathy analysis reveals the familiar KCC1 topology with 12 transmembrane domains (TMDs) and the hydrophilic NH2-terminal (NTD) and COOH-terminal (CTD) domains both at the cytoplasmic membrane face. However, shKCC1 has two rather than one large extracellular loops (ECL): ECL3 between TMDs 5 and 6, and ECL6, between TMDs 11 and 12. The translated shKCC1 protein differs in 12 amino acid residues from other KCC1s, mainly within the NTD, ECL3, ICL4, ECL6, and CTD. Notably, a tyrosine residue at position 996 replaces aspartic acid conserved in all other species. Human embryonic kidney (HEK293) cells and mouse NIH/3T3 fibroblasts, transiently transfected with shKCCI-cDNA, revealed the glycosylated approximately 150 kDa proteins by Western blots and positive immunofluorescence-staining with polyclonal rabbit anti-ratKCC1 antibodies. ShKCC1 was functionally expressed in NIH/3T3 cells by an elevated basal Cl-dependent K influx measured with Rb as K-congener that was stimulated three-fold by the KCC-activator N-ethylmaleimide. Copyright (c) 2005 S. Karger AG, Basel.

  14. Kit W-sh Mutation Prevents Cancellous Bone Loss during Calcium Deprivation.

    Science.gov (United States)

    Lotinun, Sutada; Suwanwela, Jaijam; Poolthong, Suchit; Baron, Roland

    2018-01-01

    Calcium is essential for normal bone growth and development. Inadequate calcium intake increases the risk of osteoporosis and fractures. Kit ligand/c-Kit signaling plays an important role in regulating bone homeostasis. Mice with c-Kit mutations are osteopenic. The present study aimed to investigate whether impairment of or reduction in c-Kit signaling affects bone turnover during calcium deprivation. Three-week-old male WBB6F1/J-Kit W /Kit W-v /J (W/W v ) mice with c-Kit point mutation, Kit W-sh /HNihrJaeBsmJ (W sh /W sh ) mice with an inversion mutation in the regulatory elements upstream of the c-Kit promoter region, and their wild-type controls (WT) were fed either a normal (0.6% calcium) or a low calcium diet (0.02% calcium) for 3 weeks. μCT analysis indicated that both mutants fed normal calcium diet had significantly decreased cortical thickness and cancellous bone volume compared to WT. The low calcium diet resulted in a comparable reduction in cortical bone volume and cortical thickness in the W/W v and W sh /W sh mice, and their corresponding controls. As expected, the low calcium diet induced cancellous bone loss in the W/W v mice. In contrast, W sh /W sh cancellous bone did not respond to this diet. This c-Kit mutation prevented cancellous bone loss by antagonizing the low calcium diet-induced increase in osteoblast and osteoclast numbers in the W sh /W sh mice. Gene expression profiling showed that calcium deficiency increased Osx, Ocn, Alp, type I collagen, c-Fms, M-CSF, and RANKL/OPG mRNA expression in controls; however, the W sh mutation suppressed these effects. Our findings indicate that although calcium restriction increased bone turnover, leading to osteopenia, the decreased c-Kit expression levels in the W sh /W sh mice prevented the low calcium diet-induced increase in cancellous bone turnover and bone loss but not the cortical bone loss.

  15. Adaptor protein SH2-B linking receptor-tyrosine kinase and Akt promotes adipocyte differentiation by regulating peroxisome proliferator-activated receptor gamma messenger ribonucleic acid levels.

    Science.gov (United States)

    Yoshiga, Daigo; Sato, Naoichi; Torisu, Takehiro; Mori, Hiroyuki; Yoshida, Ryoko; Nakamura, Seiji; Takaesu, Giichi; Kobayashi, Takashi; Yoshimura, Akihiko

    2007-05-01

    Adipocyte differentiation is regulated by insulin and IGF-I, which transmit signals by activating their receptor tyrosine kinase. SH2-B is an adaptor protein containing pleckstrin homology and Src homology 2 (SH2) domains that have been implicated in insulin and IGF-I receptor signaling. In this study, we found a strong link between SH2-B levels and adipogenesis. The fat mass and expression of adipogenic genes including peroxisome proliferator-activated receptor gamma (PPARgamma) were reduced in white adipose tissue of SH2-B-/- mice. Reduced adipocyte differentiation of SH2-B-deficient mouse embryonic fibroblasts (MEFs) was observed in response to insulin and dexamethasone, whereas retroviral SH2-B overexpression enhanced differentiation of 3T3-L1 preadipocytes to adipocytes. SH2-B overexpression enhanced mRNA level of PPARgamma in 3T3-L1 cells, whereas PPARgamma levels were reduced in SH2-B-deficient MEFs in response to insulin. SH2-B-mediated up-regulation of PPARgamma mRNA was blocked by a phosphatidylinositol 3-kinase inhibitor, but not by a MAPK kinase inhibitor. Insulin-induced Akt activation and the phosphorylation of forkhead transcription factor (FKHR/Foxo1), a negative regulator of PPARgamma transcription, were up-regulated by SH2-B overexpression, but reduced in SH2-B-deficient MEFs. These data indicate that SH2-B is a key regulator of adipogenesis both in vivo and in vitro by regulating the insulin/IGF-I receptor-Akt-Foxo1-PPARgamma pathway.

  16. Investigation of phosphotyrosine recognition by the SH2 domain of the Src kinase.

    Science.gov (United States)

    Bradshaw, J M; Mitaxov, V; Waksman, G

    1999-11-05

    The binding of tyrosine phosphorylated targets by SH2 domains is required for propagation of many cellular signals in higher eukaryotes; however, the determinants of phosphotyrosine (pTyr) recognition by SH2 domains are not well understood. In order to identify the attributes of pTyr required for high affinity interaction with SH2 domains, the binding of the SH2 domain of the Src kinase (Src SH2 domain) to a dephosphorylated peptide, a phosphoserine-containing peptide, and the amino acid pTyr was studied using titration calorimetry and compared with the binding of a high affinity tyrosyl phosphopeptide. The dephosphorylated peptide and the phosphoserine containing peptide both bind extremely weakly to the Src SH2 domain (DeltaGo (dephosphorylated)=-3.6 kcal/mol, DeltaGo (phosphoserine) >-3.7 kcal/mol); however, the DeltaGo value of pTyr binding is more favorable (-4.7 kcal/mol, or 50 % of the entire binding free energy of a high affinity tyrosyl phosphopeptide). These results indicate that both the phosphate and the tyrosine ring of the pTyr are critical determinants of high affinity binding. Alanine mutagenesis was also used to evaluate the energetic contribution to binding of ten residues located in the pTyr-binding site. Mutation of the strictly conserved Arg betaB5 resulted in a large increase in DeltaGo (DeltaDeltaGo=3.2 kcal/mol) while elimination of the other examined residues each resulted in a significantly smaller (DeltaDeltaGoSH2 domain, surprisingly increased affinity by eightfold (DeltaDeltaGo=-1.1 kcal/mol). Using a double mutant cycle analysis, it was revealed that residues of the pTyr-binding pocket are not coupled to the peptide residues C-terminal to the pTyr. In addition, comparison of each residue's DeltaDeltaGo value upon mutation with that residue's sequence conservation among SH2 domains revealed only a modest correlation between a residue's energetic contribution to pTyr recognition and its conservation throughout evolution. The results of

  17. Presenilin expression during induced differentiation of the human neuroblastoma SH-SY5Y cell line.

    Science.gov (United States)

    Flood, Fiona; Sundström, Erik; Samuelsson, Eva-Britt; Wiehager, Birgitta; Seiger, Ake; Johnston, Janet A; Cowburn, Richard F

    2004-06-01

    Human neuroblastoma SH-SY5Y cells stably transfected with both wild-type and exon-9 deleted (deltaE9) presenilin constructs were used to study the role of the presenilin proteins during differentiation. Cells transfected with either wild-type or deltaE9 PS1, of which the latter abolishes normal endoproteolytic cleavage of the protein, showed no obvious differences in their ability to differentiate to a neuronal-like phenotype upon treatment with retinoic acid (RA). A defined pattern of PS1 expression was observed during differentiation with both RA and the phorbol ester TPA. Full-length PS1 was shown to increase dramatically within 5-24 h of RA treatment. TPA gave an earlier and longer lasting increase in full-length PS1 levels. The intracellular distribution pattern of PS1 was markedly altered following RA treatment. Within 24h PS1 was highly up-regulated throughout the cell body around the nucleus. Between 2 and 4 weeks PS1 staining appeared punctate and also localised to the nucleus. Increases in PS1 expression upon treatment with RA and TPA were blocked by treatment with cycloheximide, indicating a role of de-novo protein synthesis in this effect. PS2 expression remained unchanged during differentiation. Levels of full-length PS1 were also seen to increase during neurogenesis and neuronal differentiation in the forebrain of first trimester human foetuses between 6.5 and 11 weeks. These combined observations support the idea that PS1 is involved in neuronal differentiation by a mechanism likely independent of endoproteolysis of the protein.

  18. Artificial proteins as allosteric modulators of PDZ3 and SH3 in two-domain constructs: A computational characterization of novel chimeric proteins

    Czech Academy of Sciences Publication Activity Database

    Palani, Kirubakaran; Pfeiferová, Lucie; Boušová, Kristýna; Bednárová, Lucie; Obšilová, V.; Vondrášek, Jiří

    2016-01-01

    Roč. 84, č. 10 (2016), s. 1358-1374 ISSN 0887-3585 Institutional support: RVO:61388963 Keywords : protein design * fusion proteins * PDZ3 * SH3 * Trp-cage * two domain proteins Subject RIV: CE - Biochemistry Impact factor: 2.289, year: 2016

  19. Protection against 1-methyl-4-phenyl pyridinium-induced neurotoxicity in human neuroblastoma SH-SY5Y cells by Soyasaponin I by the activation of the phosphoinositide 3-kinase/AKT/GSK3β pathway.

    Science.gov (United States)

    Guo, Zheng; Cao, Wei; Zhao, Shifeng; Han, Zengtai; Han, Boxiang

    2016-07-06

    Parkinson's disease (PD) can be ascribed to the progressive and selective loss of dopaminergic neurons in the substantia nigra pars compacta, and thus molecules with neuroprotective ability may have therapeutic value against PD. In the current study, the neuroprotective effects and underlying mechanisms of Soyasaponin I (Soya-I), a naturally occurring triterpene extracted from a widely used ingredient in many foods, such as Glycine max (soybean), were evaluated in a widely used cellular PD model in which neurotoxicity was induced by 1-methyl-4-phenyl pyridinium (MPP) in cultured SH-SY5Y cells. We found that Soya-I at 10-40 μM considerably protected against MPP-induced neurotoxicity as evidenced by an increase in cell viability, a decrease in lactate dehydrogenase release, and a reduction in apoptotic nuclei. Moreover, Soya-I effectively inhibited the elevated intracellular accumulation of reactive oxygen species as well as the Bax/Bcl-2 ratio caused by MPP. Most importantly, Soya-I markedly reversed the inhibition of protein expression of phosphorylated AKT and phosphorylated GSK3β caused by MPP. LY294002, the specific inhibitor of phosphoinositide 3-kinase, significantly abrogated the upregulated phosphorylated AKT and phosphorylated GSK3β offered by Soya-I, suggesting that the neuroprotection of Soya-I was mainly dependent on the activation of the phosphoinositide 3-kinase/AKT/GSK3β signaling pathway. The results taken together indicate that Soya-I may be a potential candidate for further preclinical study aimed at the prevention and treatment of PD.

  20. Chronic ethanol exposure induces SK-N-SH cell apoptosis by increasing N-methyl-D-aspartic acid receptor expression and intracellular calcium.

    Science.gov (United States)

    Wang, Hongbo; Wang, Xiaolong; Li, Yan; Yu, Hao; Wang, Changliang; Feng, Chunmei; Xu, Guohui; Chen, Jiajun; You, Jiabin; Wang, Pengfei; Wu, Xu; Zhao, Rui; Zhang, Guohua

    2018-04-01

    It has been identified that chronic ethanol exposure damages the nervous system, particularly neurons. There is scientific evidence suggesting that neuronal loss caused by chronic ethanol exposure has an association with neuron apoptosis and intracellular calcium oscillation is one of the primary inducers of apoptosis. Therefore, the present study aimed to investigate the inductive effects of intracellular calcium oscillation on apoptosis in SK-N-SH human neuroblastoma cells and the protective effects of the N-methyl-D-aspartic acid receptor (NMDAR) antagonist, memantine, on SK-N-SH cell apoptosis caused by chronic ethanol exposure. SK-N-SH cells were treated with 100 mM ethanol and memantine (4 µM) for 2 days. Protein expression of NR1 was downregulated by RNA interference (RNAi). Apoptosis was detected by Annexin V/propidium iodide (PI) double-staining and flow cytometry and cell viability was detected using an MTS kit. Fluorescence dual wavelength spectrophotometry was used to determine the intracellular calcium concentration and the levels of NR1 and caspase-3 were detected using western blotting. NR1 mRNA levels were also detected using qPCR. It was found that chronic ethanol exposure reduced neuronal cell viability and caused apoptosis of SK-N-SH cells, and the extent of damage in SK-N-SH cells was associated with ethanol exposure concentration and time. In addition, chronic ethanol exposure increased the concentration of intracellular calcium in SK-N-SH cells by inducing the expression of NMDAR, resulting in apoptosis, and memantine treatment reduced ethanol-induced cell apoptosis. The results of the present study indicate that the application of memantine may provide a novel strategy for the treatment of alcoholic dementia.

  1. Antibody fragments directed against different portions of the human neural cell adhesion molecule L1 act as inhibitors or activators of L1 function.

    Directory of Open Access Journals (Sweden)

    Yan Wang

    Full Text Available The neural cell adhesion molecule L1 plays important roles in neuronal migration and survival, neuritogenesis and synaptogenesis. L1 has also been found in tumors of different origins, with levels of L1 expression correlating positively with the metastatic potential of tumors. To select antibodies targeting the varied functions of L1, we screened the Tomlinson library of recombinant human antibody fragments to identify antibodies binding to recombinant human L1 protein comprising the entire extracellular domain of human L1. We obtained four L1 binding single-chain variable fragment antibodies (scFvs, named I4, I6, I13, and I27 and showed by enzyme-linked immunosorbent assay (ELISA that scFvs I4 and I6 have high affinity to the immunoglobulin-like (Ig domains 1-4 of L1, while scFvs I13 and I27 bind strongly to the fibronectin type III homologous (Fn domains 1-3 of L1. Application of scFvs I4 and I6 to human SK-N-SH neuroblastoma cells reduced proliferation and transmigration of these cells. Treatment of SK-N-SH cells with scFvs I13 and I27 enhanced cell proliferation and migration, neurite outgrowth, and protected against the toxic effects of H(2O(2 by increasing the ratio of Bcl-2/Bax. In addition, scFvs I4 and I6 inhibited and scFvs I13 and I27 promoted phosphorylation of src and Erk. Our findings indicate that scFvs reacting with the immunoglobulin-like domains 1-4 inhibit L1 functions, whereas scFvs interacting with the fibronectin type III domains 1-3 trigger L1 functions of cultured neuroblastoma cells.

  2. Effect of ellagic acid on proliferation, cell adhesion and apoptosis in SH-SY5Y human neuroblastoma cells.

    Science.gov (United States)

    Fjaeraa, Christina; Nånberg, Eewa

    2009-05-01

    Ellagic acid, a polyphenolic compound found in berries, fruits and nuts, has been shown to possess growth-inhibiting and apoptosis promoting activities in cancer cell lines in vitro. The objective of this study was to investigate the effect of ellagic acid in human neuroblastoma SH-SY5Y cells. In cultures of SH-SY5Y cells incubated with ellagic acid, time- and concentration-dependent inhibitory effects on cell number were demonstrated. Ellagic acid induced cell detachment, decreased cell viability and induced apoptosis as measured by DNA strand breaks. Ellagic acid-induced alterations in cell cycle were also observed. Simultaneous treatment with all-trans retinoic acid did not rescue the cells from ellagic acid effects. Furthermore, the results suggested that pre-treatment with all-trans retinoic acid to induce differentiation and cell cycle arrest did not rescue the cells from ellagic acid-induced cell death.

  3. NuSTAR Search for Hard X-ray Emission from the Star Formation Regions in Sh2-104

    Science.gov (United States)

    Gotthelf, Eric V.

    2016-04-01

    We present NuSTAR hard X-ray observations of Sh2-104, a compact Hii region containing several young massive stellar clusters (YMSCs). We have detected distinct hard X-ray sources coincident with localized VERITAS TeV emission recently resolved from the giant gamma-ray complex MGRO J2019+37 in the Cygnus region. Faint, diffuse X-ray emission coincident with the eastern YMSC in Sh2-104 is likely the result of colliding winds of component stars. Just outside the radio shell of Sh2-104 lies 3XMM J201744.7+365045 and nearby nebula NuSTAR J201744.3+364812, whose properties are most consistent with extragalactic objects. The combined XMM-Newton and NuSTAR spectrum of 3XMM J201744.7+365045 is well-fit to an absorbed power-law model with NH = (3.1+/-1.0)E22 1/cm^2 and photon index Gamma = 2.1+/-0.1. Based on possible long-term flux variation and lack of detected pulsations (Sh2-104 will help identify the nature of the X-ray sources and their relation to MGRO J2019+37.

  4. The Arizona Radio Observatory CO Mapping Survey of Galactic Molecular Clouds. V. The Sh2-235 Cloud in CO J=2-1, 13CO J=2-1, and CO J=3-2

    Science.gov (United States)

    Bieging, John H.; Patel, Saahil; Peters, William L.; Toth, L. Viktor; Marton, Gábor; Zahorecz, Sarolta

    2016-09-01

    We present the results of a program to map the Sh2-235 molecular cloud complex in the CO and 13CO J = 2 - 1 transitions using the Heinrich Hertz Submillimeter Telescope. The map resolution is 38″ (FWHM), with an rms noise of 0.12 K brightness temperature, for a velocity resolution of 0.34 km s-1. With the same telescope, we also mapped the CO J = 3 - 2 line at a frequency of 345 GHz, using a 64 beam focal plane array of heterodyne mixers, achieving a typical rms noise of 0.5 K brightness temperature with a velocity resolution of 0.23 km s-1. The three spectral line data cubes are available for download. Much of the cloud appears to be slightly sub-thermally excited in the J = 3 level, except for in the vicinity of the warmest and highest column density areas, which are currently forming stars. Using the CO and 13CO J = 2 - 1 lines, we employ an LTE model to derive the gas column density over the entire mapped region. Examining a 125 pc2 region centered on the most active star formation in the vicinity of Sh2-235, we find that the young stellar object surface density scales as approximately the 1.6-power of the gas column density. The area distribution function of the gas is a steeply declining exponential function of gas column density. Comparison of the morphology of ionized and molecular gas suggests that the cloud is being substantially disrupted by expansion of the H II regions, which may be triggering current star formation.

  5. Kalopanacis Cortex extract-capped gold nanoparticles activate NRF2 signaling and ameliorate damage in human neuronal SH-SY5Y cells exposed to oxygen–glucose deprivation and reoxygenation

    Directory of Open Access Journals (Sweden)

    Park SY

    2017-06-01

    Full Text Available Sun Young Park,1 Seon Yeong Chae,1,2 Jin Oh Park,2 Kyu Jin Lee,2 Geuntae Park1,2 1Bio-IT Fusion Technology Research Institute, 2Department of Nanofusion Technology, Graduate School, Pusan National University, Busan, Republic of Korea Abstract: Recently, environment-friendly synthesis of gold nanoparticles (GNPs has been extensively explored by biologists and chemists. However, significant research is still required to determine whether “eco-friendly” GNPs are beneficial to human health and to elucidate the molecular mechanisms of their effects on human cells. We used human neuronal SH-SY5Y cells to show that treatment with Kalopanacis Cortex extract-capped GNPs (KC-GNs, prepared via an eco-friendly, fast, one-pot synthetic route, protected neuronal cells against oxygen–glucose deprivation/reoxygenation (OGD/R-induced damage. To prepare GNPs, Kalopanacis Cortex was used without any chemical reducing and stabilizing agents. Ultraviolet–visible spectroscopy showed maximum absorbance at 526 nm owing to KC-GN surface plasmon resonance. Hydrodynamic size (54.02±2.19 nm and zeta potential (-20.3±0.04 mV were determined by dynamic light scattering. The average diameter (41.07±3.05 nm was determined by high-resolution transmission electron microscopy. Energy-dispersive X-ray diffraction spectroscopy and X-ray diffraction confirmed the presence of assembled GNPs. Fourier transform infrared analysis suggested that functional groups such as O–H, C–C, and C–N participated in KC-GN formation. Cell viability assays indicated that KC-GNs restored the viability of OGD/R-treated SH-SY5Y cells. Flow cytometry demonstrated that KC-GNs inhibited the OGD/R-induced reactive oxygen species production and mitochondrial membrane potential disruption. KC-GNs also inhibited the apoptosis of OGD/R-exposed cells. Western blot analysis indicated that the OGD/R-induced cellular apoptosis and simultaneous increases in the expression of cleaved caspase-3, p

  6. SH2B Regulation of Growth, Metabolism, and Longevity in Both Insects and Mammals

    OpenAIRE

    Song, Wei; Ren, Decheng; Li, Wenjun; Jiang, Lin; Cho, Kae Won; Huang, Ping; Fan, Chen; Song, Yiyun; Liu, Yong; Rui, Liangyou

    2010-01-01

    SH2B1 is a key regulator of body weight in mammals. Here we identified dSH2B as the Drosophila homolog of SH2B1. dSH2B bound to Chico and directly promoted insulin-like signaling. Disruption of dSH2B decreased insulin-like signaling and somatic growth in flies. dSH2B deficiency also increased hemolymph carbohydrate levels, whole body lipid levels, lifespan, and resistance to starvation and oxidative stress. Systemic overexpression of dSH2B resulted in opposite phenotypes. dSH2B overexpression...

  7. Preparation of crystals for characterizing the Grb7 SH2 domain before and after complex formation with a bicyclic peptide antagonist.

    Science.gov (United States)

    Ambaye, Nigus D; Gunzburg, Menachem J; Traore, Daouda A K; Del Borgo, Mark P; Perlmutter, Patrick; Wilce, Matthew C J; Wilce, Jacqueline A

    2014-02-01

    Human growth factor receptor-bound protein 7 (Grb7) is an adapter protein involved in cell growth, migration and proliferation. It is now recognized that Grb7 is an emerging therapeutic target in specific cancer subtypes. Recently, the discovery of a bicyclic peptide inhibitor that targets the Grb7 SH2 domain, named G7-B1, was reported. In an attempt to probe the foundation of its interaction with Grb7, the crystallization and preliminary data collection of both the apo and G7-B1-bound forms of the Grb7 SH2 domain are reported here. Diffraction-quality crystals were obtained using the hanging-drop vapour-diffusion method. After several rounds of microseeding, crystals of the apo Grb7 SH2 domain were obtained that diffracted to 1.8 Å resolution, while those of the G7-B1-Grb7 SH2 domain complex diffracted to 2.2 Å resolution. The apo Grb7 SH2 domain crystallized in the trigonal space group P63, whereas the G7-B1-Grb7 SH2 domain complex crystallized in the monoclinic space group P21. The experimental aspects of crystallization, crystal optimization and data collection and the preliminary data are reported.

  8. Investigating MUC1/ICAM-1 Binding Induced Signaling in Breast Cancer Metastasis

    Science.gov (United States)

    2011-05-01

    at the molecular weight expected for a CD8/MUC1 dimer (Fig 4.9C). MUC1-CD contains SH2 and SH3 binding domains which act to recruit Src kinase To...recruitment of Src kinase , we assayed dimerization in MUC1-CFP-Fv cells with SH2 and/or SH3 domains mutated (Fig 4.11). As described below, MUC1-CFP-Fv...contains SH2 and SH3 binding domains for Src kinase . MUCI-CFP-Fv cells with mutations of the SH2 (Y46F; b.SH2) and/ or the putative Src SH3 binding

  9. Artificial proteins as allosteric modulators of PDZ3 and SH3 in two-domain constructs: A computational characterization of novel chimeric proteins

    Czech Academy of Sciences Publication Activity Database

    Palani, K.; Pfeiferová, L.; Boušová, Kristýna; Bednárová, L.; Obšilová, Veronika; Vondrášek, J.

    2016-01-01

    Roč. 84, č. 10 (2016), s. 1358-1374 ISSN 0887-3585 Institutional support: RVO:67985823 Keywords : protein design * fusion proteins * PDZ3 * SH3 * Trp-cage * two domain proteins * molecular dynamics simulation * circular dichroism Subject RIV: BO - Biophysics Impact factor: 2.289, year: 2016

  10. Lost P1 allele in sh2 sweet corn: quantitative effects of p1 and a1 genes on concentrations of maysin, apimaysin, methoxymaysin, and chlorogenic acid in maize silk.

    Science.gov (United States)

    Guo, B Z; Zhang, Z J; Butrón, A; Widstrom, N W; Snook, M E; Lynch, R E; Plaisted, D

    2004-12-01

    In the United States, insecticide is used extensively in the production of sweet corn due to consumer demand for zero damage to ears and to a sweet corn genetic base with little or no resistance to ear-feeding insects. Growers in the southern United States depend on scheduled pesticide applications to control ear-feeding insects. In a study of quantitative genetic control over silk maysin, AM-maysin (apimaysin and methoxymaysin), and chlorogenic acid contents in an F2 population derived from GE37 (dent corn, P1A1) and 565 (sh2 sweet corn, p1a1), we demonstrate that the P1 allele from field corn, which was selected against in the development of sweet corn, has a strong epistatic interaction with the a1 allele in sh2 sweet corn. We detected that the p1 gene has significant effects (P silk maysin concentrations but also on AM-maysin, and chlorogenic acid concentrations. The a1 gene also has significant (P silk antibiotic chemicals. Successful selection from the fourth and fifth selfed backcrosses for high-maysin individuals of sweet corn homozygous for the recessive a1 allele (tightly linked to sh2) and the dominant P1 allele has been demonstrated. These selected lines have much higher (2 to 3 times) concentrations of silk maysin and other chemicals (AM-maysin and chlorogenic acid) than the donor parent GE37 and could enhance sweet corn resistance to corn earworm and reduce the number of applications of insecticide required to produce sweet corn.

  11. Andrographolide inhibits TNFα-induced ICAM-1 expression via suppression of NADPH oxidase activation and induction of HO-1 and GCLM expression through the PI3K/Akt/Nrf2 and PI3K/Akt/AP-1 pathways in human endothelial cells.

    Science.gov (United States)

    Lu, Chia-Yang; Yang, Ya-Chen; Li, Chien-Chun; Liu, Kai-Li; Lii, Chong-Kuei; Chen, Haw-Wen

    2014-09-01

    Andrographolide, the major bioactive component of Andrographis paniculata, has been demonstrated to have various biological properties including anti-inflammation, antioxidation, and anti-hepatotoxicity. Oxidative stress is considered a major risk factor in aging, inflammation, cancer, atherosclerosis, and diabetes mellitus. NADPH oxidase is a major source of endogenous reactive oxygen species (ROS). In this study, we used EA.hy926 endothelial-like cells to explore the anti-inflammatory activity of andrographolide. Andrographolide attenuated TNFα-induced ROS generation, Src phosphorylation, membrane translocation of the NADPH oxidase subunits p47(phox) and p67(phox), and ICAM-1 gene expression. In the small hairpin RNA interference assay, shp47(phox) abolished TNFα-induced p65 nuclear translocation, ICAM-1 gene expression, and adhesion of HL-60 cells. Andrographolide induced the gene expression of heme oxygenase 1 (HO-1) and glutamate cysteine ligase modifier subunit (GCLM) in a time-dependent manner. Cellular glutathione (GSH) content was increased by andrographolide. shGCLM attenuated the andrographolide-induced increase in GSH content and reversed the andrographolide inhibition of HL-60 adhesion. shHO-1 showed a similar effect on andrographolide inhibition of HL-60 adhesion to shGCLM. The mechanism underlying the up-regulation of HO-1 and GCLM by andrographolide was dependent on the PI3K/Akt pathway, and both the Nrf2 and AP-1 transcriptional factors were involved. Our results suggest that andrographolide attenuates TNFα-induced ICAM-1 expression at least partially through suppression of NADPH oxidase activation and induction of HO-1 and GCLM expression, which is PI3K/Akt pathway-dependent. Copyright © 2014. Published by Elsevier Inc.

  12. Engineering HIV-1-resistant T-cells from short-hairpin RNA-expressing hematopoietic stem/progenitor cells in humanized BLT mice.

    Directory of Open Access Journals (Sweden)

    Gene-Errol E Ringpis

    Full Text Available Down-regulation of the HIV-1 coreceptor CCR5 holds significant potential for long-term protection against HIV-1 in patients. Using the humanized bone marrow/liver/thymus (hu-BLT mouse model which allows investigation of human hematopoietic stem/progenitor cell (HSPC transplant and immune system reconstitution as well as HIV-1 infection, we previously demonstrated stable inhibition of CCR5 expression in systemic lymphoid tissues via transplantation of HSPCs genetically modified by lentiviral vector transduction to express short hairpin RNA (shRNA. However, CCR5 down-regulation will not be effective against existing CXCR4-tropic HIV-1 and emergence of resistant viral strains. As such, combination approaches targeting additional steps in the virus lifecycle are required. We screened a panel of previously published shRNAs targeting highly conserved regions and identified a potent shRNA targeting the R-region of the HIV-1 long terminal repeat (LTR. Here, we report that human CD4(+ T-cells derived from transplanted HSPC engineered to co-express shRNAs targeting CCR5 and HIV-1 LTR are resistant to CCR5- and CXCR4- tropic HIV-1-mediated depletion in vivo. Transduction with the combination vector suppressed CXCR4- and CCR5- tropic viral replication in cell lines and peripheral blood mononuclear cells in vitro. No obvious cytotoxicity or interferon response was observed. Transplantation of combination vector-transduced HSPC into hu-BLT mice resulted in efficient engraftment and subsequent stable gene marking and CCR5 down-regulation in human CD4(+ T-cells within peripheral blood and systemic lymphoid tissues, including gut-associated lymphoid tissue, a major site of robust viral replication, for over twelve weeks. CXCR4- and CCR5- tropic HIV-1 infection was effectively inhibited in hu-BLT mouse spleen-derived human CD4(+ T-cells ex vivo. Furthermore, levels of gene-marked CD4(+ T-cells in peripheral blood increased despite systemic infection with either

  13. Opioid receptors in human neuroblastoma SH-SY5Y cells: evidence for distinct morphine (. mu. ) and enkephalin (delta) binding sites

    Energy Technology Data Exchange (ETDEWEB)

    Kazmi, S.M.I.; Mishra, R.K.

    1986-06-13

    Human neuroblastoma SH-SY5Y cells exhibited a heterogeneous population of ..mu.. and delta types of opioid binding sites. These specific binding sites displayed the characteristic saturability, stereospecificity and reversibility, expected of a receptor. Scatchard analysis of (/sup 3/H)-D-Ala/sup 2/-D-Leu/sup 5/-enkephalin (DADLE) in the presence of 10/sup -5/M D-Pro/sup 4/-morphiceptin (to block the ..mu.. receptors) and the competitive displacement by various highly selective ligands yielded the binding parameters of delta sites which closely resemble those of the delta receptors in brain and mouse neuroblastoma clones. Similarly, the high affinity binding of (/sup 3/H)-dihydromorphine, together with the higher potency of morphine analogues to displace (/sup 3/H)-naloxone binding established the presence of ..mu.. sites. Guanine nucleotides and NaCl significantly inhibited the association and increased the dissociation of (/sup 3/H)-DADLE binding.

  14. Pre-exposure to 50 Hz magnetic fields modifies menadione-induced genotoxic effects in human SH-SY5Y neuroblastoma cells.

    Directory of Open Access Journals (Sweden)

    Jukka Luukkonen

    Full Text Available BACKGROUND: Extremely low frequency (ELF magnetic fields (MF are generated by power lines and various electric appliances. They have been classified as possibly carcinogenic by the International Agency for Research on Cancer, but a mechanistic explanation for carcinogenic effects is lacking. A previous study in our laboratory showed that pre-exposure to ELF MF altered cancer-relevant cellular responses (cell cycle arrest, apoptosis to menadione-induced DNA damage, but it did not include endpoints measuring actual genetic damage. In the present study, we examined whether pre-exposure to ELF MF affects chemically induced DNA damage level, DNA repair rate, or micronucleus frequency in human SH-SY5Y neuroblastoma cells. METHODOLOGY/PRINCIPAL FINDINGS: Exposure to 50 Hz MF was conducted at 100 µT for 24 hours, followed by chemical exposure for 3 hours. The chemicals used for inducing DNA damage and subsequent micronucleus formation were menadione and methyl methanesulphonate (MMS. Pre-treatment with MF enhanced menadione-induced DNA damage, DNA repair rate, and micronucleus formation in human SH-SY5Y neuroblastoma cells. Although the results with MMS indicated similar effects, the differences were not statistically significant. No effects were observed after MF exposure alone. CONCLUSIONS: The results confirm our previous findings showing that pre-exposure to MFs as low as 100 µT alters cellular responses to menadione, and show that increased genotoxicity results from such interaction. The present findings also indicate that complementary data at several chronological points may be critical for understanding the MF effects on DNA damage, repair, and post-repair integrity of the genome.

  15. Pre-exposure to 50 Hz magnetic fields modifies menadione-induced genotoxic effects in human SH-SY5Y neuroblastoma cells.

    Science.gov (United States)

    Luukkonen, Jukka; Liimatainen, Anu; Höytö, Anne; Juutilainen, Jukka; Naarala, Jonne

    2011-03-23

    Extremely low frequency (ELF) magnetic fields (MF) are generated by power lines and various electric appliances. They have been classified as possibly carcinogenic by the International Agency for Research on Cancer, but a mechanistic explanation for carcinogenic effects is lacking. A previous study in our laboratory showed that pre-exposure to ELF MF altered cancer-relevant cellular responses (cell cycle arrest, apoptosis) to menadione-induced DNA damage, but it did not include endpoints measuring actual genetic damage. In the present study, we examined whether pre-exposure to ELF MF affects chemically induced DNA damage level, DNA repair rate, or micronucleus frequency in human SH-SY5Y neuroblastoma cells. Exposure to 50 Hz MF was conducted at 100 µT for 24 hours, followed by chemical exposure for 3 hours. The chemicals used for inducing DNA damage and subsequent micronucleus formation were menadione and methyl methanesulphonate (MMS). Pre-treatment with MF enhanced menadione-induced DNA damage, DNA repair rate, and micronucleus formation in human SH-SY5Y neuroblastoma cells. Although the results with MMS indicated similar effects, the differences were not statistically significant. No effects were observed after MF exposure alone. The results confirm our previous findings showing that pre-exposure to MFs as low as 100 µT alters cellular responses to menadione, and show that increased genotoxicity results from such interaction. The present findings also indicate that complementary data at several chronological points may be critical for understanding the MF effects on DNA damage, repair, and post-repair integrity of the genome.

  16. An Efficient Semi-supervised Learning Approach to Predict SH2 Domain Mediated Interactions.

    Science.gov (United States)

    Kundu, Kousik; Backofen, Rolf

    2017-01-01

    Src homology 2 (SH2) domain is an important subclass of modular protein domains that plays an indispensable role in several biological processes in eukaryotes. SH2 domains specifically bind to the phosphotyrosine residue of their binding peptides to facilitate various molecular functions. For determining the subtle binding specificities of SH2 domains, it is very important to understand the intriguing mechanisms by which these domains recognize their target peptides in a complex cellular environment. There are several attempts have been made to predict SH2-peptide interactions using high-throughput data. However, these high-throughput data are often affected by a low signal to noise ratio. Furthermore, the prediction methods have several additional shortcomings, such as linearity problem, high computational complexity, etc. Thus, computational identification of SH2-peptide interactions using high-throughput data remains challenging. Here, we propose a machine learning approach based on an efficient semi-supervised learning technique for the prediction of 51 SH2 domain mediated interactions in the human proteome. In our study, we have successfully employed several strategies to tackle the major problems in computational identification of SH2-peptide interactions.

  17. SH2 Domain Histochemistry.

    Science.gov (United States)

    Buhs, Sophia; Nollau, Peter

    2017-01-01

    Among posttranslational modifications, the phosphorylation of tyrosine residues is a key modification in cell signaling. Because of its biological importance, characterization of the cellular state of tyrosine phosphorylation is of great interest. Based on the unique properties of endogenously expressed SH2 domains recognizing tyrosine phosphorylated signaling proteins with high specificity we have developed an alternative approach, coined SH2 profiling, enabling us to decipher complex patterns of tyrosine phosphorylation in various normal and cancerous tissues. So far, SH2 profiling has largely been applied for the analysis of protein extracts with the limitation that information on spatial distribution and intensity of tyrosine phosphorylation within a tissue is lost. Here, we describe a novel SH2 domain based strategy for differential characterization of the state of tyrosine phosphorylation in formaldehyde-fixed and paraffin-embedded tissues. This approach demonstrates that SH2 domains may serve as very valuable tools for the analysis of the differential state of tyrosine phosphorylation in primary tissues fixed and processed under conditions frequently applied by routine pathology laboratories.

  18. New investigation on THz spectra of OH and SH radicals (X∏)

    Science.gov (United States)

    Martin-Drumel, M. A.; Eliet, S.; Pirali, O.; Guinet, M.; Hindle, F.; Mouret, G.; Cuisset, A.

    2012-10-01

    Pure rotational transitions of OH and SH radicals have been recorded in the THz spectral range using cw-THz and synchrotron-based FT-FIR techniques. Line lists on these radicals have been completed in the three and two lowest vibrational states for OH and SH, respectively. Furthermore, the hyperfine structure of OH and SH has been observed for the first time using infrared IR FT-spectroscopy, and at frequencies higher than 1 THz, respectively. A combined fit has been made for each of these radicals including v = 0, 1 and 2 for OH and v = 0 and 1 for SH.

  19. Coffee induces vascular endothelial growth factor (VEGF) expression in human neuroblastama SH-SY5Y cells.

    Science.gov (United States)

    Kakio, Shota; Funakoshi-Tago, Megumi; Kobata, Kenji; Tamura, Hiroomi

    2017-07-01

    Recent evidence indicates that hypoxia-inducible vascular endothelial growth factor (VEGF) has neurotrophic and neuroprotective effects on neuronal and glial cells. On the other hand, recent epidemiological studies showed that daily coffee consumption has been associated with a lower risk of several neuronal disorders. Therefore, we investigated the effect of coffee on VEGF expression in human neuroblastoma SH-SY5Y cells. We found that even low concentration of coffee (coffee was attributed to the coffee-dependent inhibition of prolyl hydroxylation of HIF1α, which is essential for proteolytic degradation of HIF-1α. However, no inhibition was observed at the catalytic activity in vitro. Coffee component(s) responsible for the activation of HIF-1α was not major constituents such as caffeine, caffeic acid, chlorogenic acid, and trigonelline, but was found to emerge during roasting process. The active component(s) was extractable with ethyl acetate. Our results suggest that daily consumption of coffee may induce VEGF expression in neuronal cells. This might be related to protective effect of coffee on neural disorders such as Alzheimer's disease and Parkinson's disease.

  20. Structural coupling of SH2-kinase domains links Fes and Abl substrate recognition and kinase activation.

    Science.gov (United States)

    Filippakopoulos, Panagis; Kofler, Michael; Hantschel, Oliver; Gish, Gerald D; Grebien, Florian; Salah, Eidarus; Neudecker, Philipp; Kay, Lewis E; Turk, Benjamin E; Superti-Furga, Giulio; Pawson, Tony; Knapp, Stefan

    2008-09-05

    The SH2 domain of cytoplasmic tyrosine kinases can enhance catalytic activity and substrate recognition, but the molecular mechanisms by which this is achieved are poorly understood. We have solved the structure of the prototypic SH2-kinase unit of the human Fes tyrosine kinase, which appears specialized for positive signaling. In its active conformation, the SH2 domain tightly interacts with the kinase N-terminal lobe and positions the kinase alphaC helix in an active configuration through essential packing and electrostatic interactions. This interaction is stabilized by ligand binding to the SH2 domain. Our data indicate that Fes kinase activation is closely coupled to substrate recognition through cooperative SH2-kinase-substrate interactions. Similarly, we find that the SH2 domain of the active Abl kinase stimulates catalytic activity and substrate phosphorylation through a distinct SH2-kinase interface. Thus, the SH2 and catalytic domains of active Fes and Abl pro-oncogenic kinases form integrated structures essential for effective tyrosine kinase signaling.

  1. SH2 Domains Serve as Lipid-Binding Modules for pTyr-Signaling Proteins.

    Science.gov (United States)

    Park, Mi-Jeong; Sheng, Ren; Silkov, Antonina; Jung, Da-Jung; Wang, Zhi-Gang; Xin, Yao; Kim, Hyunjin; Thiagarajan-Rosenkranz, Pallavi; Song, Seohyeon; Yoon, Youngdae; Nam, Wonhee; Kim, Ilshin; Kim, Eui; Lee, Dong-Gyu; Chen, Yong; Singaram, Indira; Wang, Li; Jang, Myoung Ho; Hwang, Cheol-Sang; Honig, Barry; Ryu, Sungho; Lorieau, Justin; Kim, You-Me; Cho, Wonhwa

    2016-04-07

    The Src-homology 2 (SH2) domain is a protein interaction domain that directs myriad phosphotyrosine (pY)-signaling pathways. Genome-wide screening of human SH2 domains reveals that ∼90% of SH2 domains bind plasma membrane lipids and many have high phosphoinositide specificity. They bind lipids using surface cationic patches separate from pY-binding pockets, thus binding lipids and the pY motif independently. The patches form grooves for specific lipid headgroup recognition or flat surfaces for non-specific membrane binding and both types of interaction are important for cellular function and regulation of SH2 domain-containing proteins. Cellular studies with ZAP70 showed that multiple lipids bind its C-terminal SH2 domain in a spatiotemporally specific manner and thereby exert exquisite spatiotemporal control over its protein binding and signaling activities in T cells. Collectively, this study reveals how lipids control SH2 domain-mediated cellular protein-protein interaction networks and suggest a new strategy for therapeutic modulation of pY-signaling pathways. Copyright © 2016 Elsevier Inc. All rights reserved.

  2. The C-terminal SH2 domain of p85 accounts for the high affinity and specificity of the binding of phosphatidylinositol 3-kinase to phosphorylated platelet-derived growth factor beta receptor.

    Science.gov (United States)

    Klippel, A; Escobedo, J A; Fantl, W J; Williams, L T

    1992-01-01

    Upon stimulation by its ligand, the platelet-derived growth factor (PDGF) receptor associates with the 85-kDa subunit of phosphatidylinositol (PI) 3-kinase. The 85-kDa protein (p85) contains two Src homology 2 (SH2) domains and one SH3 domain. To define the part of p85 that interacts with the PDGF receptor, a series of truncated p85 mutants was analyzed for association with immobilized PDGF receptor in vitro. We found that a fragment of p85 that contains a single Src homology domain, the C-terminal SH2 domain (SH2-C), was sufficient for directing the high-affinity interaction with the receptor. Half-maximal binding of SH2-C to the receptor was observed at an SH2-C concentration of 0.06 nM. SH2-C, like full-length p85, was able to distinguish between wild-type PDGF receptor and a mutant receptor lacking the PI 3-kinase binding site. An excess of SH2-C blocked binding of full-length p85 and PI 3-kinase to the receptor but did not interfere with the binding of two other SH2-containing proteins, phospholipase C-gamma and GTPase-activating protein. These results demonstrate that a region of p85 containing a single SH2 domain accounts both for the high affinity and specificity of binding of PI 3-kinase to the PDGF receptor. Images PMID:1312663

  3. SH2-inositol phosphatase 1 negatively influences early megakaryocyte progenitors.

    Directory of Open Access Journals (Sweden)

    Lia E Perez

    Full Text Available The SH2-containing-5'inositol phosphatase-1 (SHIP influences signals downstream of cytokine/chemokine receptors that play a role in megakaryocytopoiesis, including thrombopoietin, stromal-cell-derived-Factor-1/CXCL-12 and interleukin-3. We hypothesize that SHIP might control megakaryocytopoiesis through effects on proliferation of megakaryocyte progenitors (MKP and megakaryocytes (MK.Herein, we report the megakaryocytic phenotype and MK functional assays of hematopoietic organs of two strains of SHIP deficient mice with deletion of the SHIP promoter/first exon or the inositol phosphatase domain. Both SHIP deficient strains exhibit a profound increase in MKP numbers in bone marrow (BM, spleen and blood as analyzed by flow cytometry (Lin(-c-Kit+CD41+ and functional assays (CFU-MK. SHIP deficient MKP display increased phosphorylation of Signal Transducers and Activators of Transcription 3 (STAT-3, protein kinase B (PKB/AKT and extracellular signal-regulated kinases (ERKs. Despite increased MKP content, total body number of mature MK (Lin(-c-kit(-CD41+ are not significantly changed as SHIP deficient BM contains reduced MK while spleen MK numbers are increased. Reduction of CXCR-4 expression in SHIP deficient MK may influence MK localization to the spleen instead of the BM. Endomitosis, process involved in MK maturation, was preserved in SHIP deficient MK. Circulating platelets and red blood cells are also reduced in SHIP deficient mice.SHIP may play an important role in regulation of essential signaling pathways that control early megakaryocytopoiesis in vivo.

  4. Influence of combined use of selenious acid and SH compounds in parenteral preparations

    Energy Technology Data Exchange (ETDEWEB)

    Terada, A. [St. Marianna University School of Medicine, Kawasaki (Japan). Dept. of Public Health]|[St. Marianna University School of Medicine, Kawasaki (Japan). Dept. of Pharmacy; Yoshida, M. [St. Marianna University School of Medicine, Kawasaki (Japan). Dept. of Chemistry; Nakada, M.; Nakada, K.; Yamate, N. [St. Marianna University School of Medicine, Kawasaki (Japan). Dept. of Surgery; Kobayashi, T. [St. Marianna University School of Medicine, Kawasaki (Japan). Dept. of Pharmacy; Yoshida, K. [St. Marianna University School of Medicine, Kawasaki (Japan). Dept. of Public Health

    1997-12-31

    The influence of the combined use of selenious acid and SH compounds (glutathione (GSH) and cysteine (Cys), or ascorbic acid (Asc)) on cultured venous vascular endothelial cells was investigated experimentally. When cultured human umbilical venous vascular endothelial cells were exposed to 10 {mu}M of selenious acid combined with 0.5 mM-GSH or 0.5 mM-Cys, the release rates of [{sup 3}H]-adenine and lactate dehydrogenase (LDH) from cells into the medium increased significantly as compared with after exposure to selenious acid alone, and damage to the vascular endothelial cells was found to be intensified. Addition of 1 {mu}M of selenious acid simultaneously with 0.5 mM-GSH or 0.5 mM-Cys showed no differences in toxicity for the vascular endothelial cells as compared with the addition of selenious acid alone. On the other hand, simultaneous exposure to 10 {mu}M of selenious acid and 1 mM-Asc induced no significant differences in the release rates of [{sup 3}H]-adenine and LDH, and no damage was observed to the vascular endothelial cells. These results suggest that simultaneous addition of selenious acid together with GSH or Cys, which have the SH-group, may cause damage to the vascular endothelial cells. Therefore careful attention is warranted in total parenteral nutrition. (orig.)

  5. Filaggrin silencing by shRNA directly impairs the skin barrier function of normal human epidermal keratinocytes and then induces an immune response

    Energy Technology Data Exchange (ETDEWEB)

    Dang, N.N. [Department of Dermatology, Jinan Central Hospital Affiliated to Shandong University, Jinan, Shandong Province (China); College of Life Science, Shandong Normal University, Jinan, Shandong Province (China); Pang, S.G. [Department of Endocrinology, Jinan Central Hospital Affiliated to Shandong University, Jinan, Shandong Province (China); Song, H.Y. [Department of Dermatology, Jinan Central Hospital Affiliated to Shandong University, Jinan, Shandong Province (China); An, L.G. [College of Life Science, Shandong Normal University, Jinan, Shandong Province (China); Ma, X.L. [Central Laboratory, Jinan Central Hospital Affiliated to Shandong University, Jinan, Shandong Province (China)

    2014-11-14

    The objective of this study was to investigate whether a single defect in skin barrier function simulated by filaggrin silencing could induce Th2-predominant inflammation. Filaggrin gene expression was silenced in cultured normal human epidermal keratinocytes (NHEKs) using small hairpin RNA (shRNA, GTTGGCTCAAGCATATTATTT). The efficacy of silencing was confirmed by polymerase chain reaction (PCR) and Western blotting. Filaggrin-silenced cells (LV group), shRNA control cells (NC group), and noninfected cells (Blank group) were evaluated. The expression of cornified cell envelope-related proteins, including cytokeratin (CK)-5, -10, -14, loricrin, involucrin, and transglutaminase (TGM)-1, was detected by Western blotting. Interleukins (IL)-2, IL-4, IL-5, IL-12p70, IL-13, and interferon-gamma (IFN-γ) were detected by enzyme-linked immunosorbent assay (ELISA). After filaggrin was successfully silenced by shRNA, the expressions of CK-5, -10, -14, involucrin, and TGM-1 in NHEKs were significantly downregulated compared to the Blank and NC groups (P<0.05 or P<0.01); only loricrin expression was markedly upregulated (P<0.01). Filaggrin silencing also resulted in significant increases of IL-2, IL-4, IL-5, and IL-13 (P<0.05 or P<0.01), and significant decreases of IL-12p70 and IFN-γ (P<0.01) compared with cells in the Blank and NC groups. Filaggrin silencing impaired normal skin barrier function mainly by targeting the cornified cell envelope. The immune response after filaggrin silencing was characterized by Th2 cells, mainly because of the inhibition of IFN-γ expression. Lack of filaggrin may directly impair skin barrier function and then further induce the immune response.

  6. shRNA-mediated EMMPRIN silencing inhibits human leukemic monocyte lymphoma U937 cell proliferation and increases chemosensitivity to adriamycin.

    Science.gov (United States)

    Gao, Hui; Jiang, Qixiao; Han, Yantao; Peng, Jianjun; Wang, Chunbo

    2015-03-01

    EMMPRIN is a widely distributed cell surface glycoprotein, which plays an important role in tumor progression and confers resistance to some chemotherapeutic drugs. Recent studies have shown that EMMPRIN overexpression indicates poor prognosis in acute myeloid leukemia (AML). However, little was known on the role of EMMPRIN in leukemia. Human leukemia cell line U937 was stably transfected with a EMMPRIN-targeted shRNA-containing vector to investigate the effect of EMMPRIN on cellular functions. EMMPRIN expression was monitored by qRT-PCR and Western blotting. Cell viability and proliferation were determined by trypan blue exclusion and BrdU labeling, respectively. Cell cycle and apoptosis were analyzed by flow cytometry. Cytotoxicity of chemotherapeutic agent adriamycin on cells was assessed by MTT assay. Knockdown of EMMPRIN gene significantly inhibited cell viability and decreased cell proliferation. Fluorescence-activated cell-sorting analysis revealed that the reduced EMMPRIN expression resulted in cell cycle arrest at G1 phase and induced apoptosis. Meanwhile, western blotting analysis showed that EMMPRIN knockdown was associated with downregulation of cell cycle- and apoptosis-related molecules including cyclin D1, cyclin E, as well as increase in cleavage of caspase-3 and PARP. This study also showed that silencing of EMMPRIN sensitized U937 cells to Adriamycin. EMMPRIN is involved in proliferation, growth, and chemosensitivity of human AML line U937, indicating that EMMPRIN may be a promising therapeutic target for AML.

  7. Paralog-Specific Patterns of Structural Disorder and Phosphorylation in the Vertebrate SH3-SH2-Tyrosine Kinase Protein Family.

    Science.gov (United States)

    Dos Santos, Helena G; Siltberg-Liberles, Jessica

    2016-09-19

    One of the largest multigene families in Metazoa are the tyrosine kinases (TKs). These are important multifunctional proteins that have evolved as dynamic switches that perform tyrosine phosphorylation and other noncatalytic activities regulated by various allosteric mechanisms. TKs interact with each other and with other molecules, ultimately activating and inhibiting different signaling pathways. TKs are implicated in cancer and almost 30 FDA-approved TK inhibitors are available. However, specific binding is a challenge when targeting an active site that has been conserved in multiple protein paralogs for millions of years. A cassette domain (CD) containing SH3-SH2-Tyrosine Kinase domains reoccurs in vertebrate nonreceptor TKs. Although part of the CD function is shared between TKs, it also presents TK specific features. Here, the evolutionary dynamics of sequence, structure, and phosphorylation across the CD in 17 TK paralogs have been investigated in a large-scale study. We establish that TKs often have ortholog-specific structural disorder and phosphorylation patterns, while secondary structure elements, as expected, are highly conserved. Further, domain-specific differences are at play. Notably, we found the catalytic domain to fluctuate more in certain secondary structure elements than the regulatory domains. By elucidating how different properties evolve after gene duplications and which properties are specifically conserved within orthologs, the mechanistic understanding of protein evolution is enriched and regions supposedly critical for functional divergence across paralogs are highlighted. © The Author 2016. Published by Oxford University Press on behalf of the Society for Molecular Biology and Evolution.

  8. SH2 Ligand-Like Effects of Second Cytosolic Domain of Na/K-ATPase α1 Subunit on Src Kinase.

    Science.gov (United States)

    Banerjee, Moumita; Duan, Qiming; Xie, Zijian

    2015-01-01

    Our previous studies have suggested that the α1 Na/K-ATPase interacts with Src to form a receptor complex. In vitro binding assays indicate an interaction between second cytosolic domain (CD2) of Na/K-ATPase α1 subunit and Src SH2 domain. Since SH2 domain targets Src to specific signaling complexes, we expressed CD2 as a cytosolic protein and studied whether it could act as a Src SH2 ligand in LLC-PK1 cells. Co-immunoprecipitation analyses indicated a direct binding of CD2 to Src, consistent with the in vitro binding data. Functionally, CD2 expression increased basal Src activity, suggesting a Src SH2 ligand-like property of CD2. Consistently, we found that CD2 expression attenuated several signaling pathways where Src plays an important role. For instance, although it increased surface expression of Na/K-ATPase, it decreased ouabain-induced activation of Src and ERK by blocking the formation of Na/K-ATPase/Src complex. Moreover, it also attenuated cell attachment-induced activation of Src/FAK. Consequently, CD2 delayed cell spreading, and inhibited cell proliferation. Furthermore, these effects appear to be Src-specific because CD2 expression had no effect on EGF-induced activation of EGF receptor and ERK. Hence, the new findings indicate the importance of Na/K-ATPase/Src interaction in ouabain-induced signal transduction, and support the proposition that the CD2 peptide may be utilized as a Src SH2 ligand capable of blocking Src-dependent signaling pathways via a different mechanism from a general Src kinase inhibitor.

  9. Temporality in Manyōshū

    Directory of Open Access Journals (Sweden)

    Yamaguchi Toshiko

    2016-12-01

    Full Text Available Using the Manyōshū corpus, the paper argues that conceptual metaphor theory imposes limitations on the diversity of linguistic facts, particularly those concerning the speaker or the poet who is communicating. The paper offers explanations of the nature of time by drawing upon the inference operating within “basic sign structure”, specifically, indexicality and iconicity, both of which are at the heart of human semiotic activity.

  10. Comparison of the frequency of functional SH3 domains with different limited sets of amino acids using mRNA display.

    Directory of Open Access Journals (Sweden)

    Junko Tanaka

    Full Text Available Although modern proteins consist of 20 different amino acids, it has been proposed that primordial proteins consisted of a small set of amino acids, and additional amino acids have gradually been recruited into the genetic code. This hypothesis has recently been supported by comparative genome sequence analysis, but no direct experimental approach has been reported. Here, we utilized a novel experimental approach to test a hypothesis that native-like globular proteins might be easily simplified by a set of putative primitive amino acids with retention of its structure and function than by a set of putative new amino acids. We performed in vitro selection of a functional SH3 domain as a model from partially randomized libraries with different sets of amino acids using mRNA display. Consequently, a library rich in putative primitive amino acids included a larger number of functional SH3 sequences than a library rich in putative new amino acids. Further, the functional SH3 sequences were enriched from the primitive library slightly earlier than from a randomized library with the full set of amino acids, while the function and structure of the selected SH3 proteins with the primitive alphabet were comparable with those from the 20 amino acid alphabet. Application of this approach to various combinations of codons in protein sequences may be useful not only for clarifying the precise order of the amino acid expansion in the early stages of protein evolution but also for efficiently creating novel functional proteins in the laboratory.

  11. Astronomical Pacing of Relative Sea Level through OAE2 from the Expanded SH#1 Core, Southern Utah

    Science.gov (United States)

    Jones, M. M.; Sageman, B. B.; Oakes, R. L.; Bralower, T. J.; Parker, A. L.; Leckie, R. M.

    2017-12-01

    Proximal marine strata of the North American Western Interior Basin (WIB) preserve a rich record of faunal turnover linked to Oceanic Anoxic Event 2 (OAE2 - 94 Ma), a pronounced Late Cretaceous carbon cycle perturbation interpreted to reflect global warming and possible ocean acidification. To develop a more robust synthesis of paleobiologic and geochemical datasets spanning this major Earth-life transition, we drilled a 131-meter core (SH#1) on the Kaiparowits Plateau of southern Utah, recovering the Cenomanian-Turonian Boundary (CTB) interval of the Tropic Shale. A 17.5-meter positive excursion in high-resolution bulk carbon isotope chemostratigraphy (δ13Corg) of SH#1 characterizes the most expanded and detailed record of OAE2 recovered from the WIB. Additionally, we detect statistically significant evidence for astronomical cycles in a companion δ13Ccarb dataset, using advanced spectral techniques (evolutive average spectral misfit). Bandpass filtering and tracing of the short eccentricity cycle (97 ka) permit development of a floating astronomical time scale (ATS) for the CTB interval. The presence of radioisotopic dates within the time series provides an independent check on astrochronologic interpretations. We attribute some depleted δ13Ccarb values in SH#1, which cyclically punctuate the OAE2 excursion, to preferential carbonate diagenesis driven by periodic sea level oscillations. Accordingly, major flooding surfaces in SH#1 correlate well to an existing sequence stratigraphic framework from shoreface facies of the Markagunt Plateau ( 100 km west). Comparing the ATS and sequence stratigraphic surfaces in SH#1, we observe that stable eccentricity cycles (405 ka) pace stratigraphic sequences and associated saw-toothed trends in sedimentation rate estimates through OAE2. Furthermore, short eccentricity cycles pace nested parasequences. These results confirm astronomical and, therefore, climatic pacing of relative sea level trends during OAE2 in the WIB. The

  12. Enhanced Prediction of Src Homology 2 (SH2) Domain Binding Potentials Using a Fluorescence Polarization-derived c-Met, c-Kit, ErbB, and Androgen Receptor Interactome*

    Science.gov (United States)

    Leung, Kin K.; Hause, Ronald J.; Barkinge, John L.; Ciaccio, Mark F.; Chuu, Chih-Pin; Jones, Richard B.

    2014-01-01

    Many human diseases are associated with aberrant regulation of phosphoprotein signaling networks. Src homology 2 (SH2) domains represent the major class of protein domains in metazoans that interact with proteins phosphorylated on the amino acid residue tyrosine. Although current SH2 domain prediction algorithms perform well at predicting the sequences of phosphorylated peptides that are likely to result in the highest possible interaction affinity in the context of random peptide library screens, these algorithms do poorly at predicting the interaction potential of SH2 domains with physiologically derived protein sequences. We employed a high throughput interaction assay system to empirically determine the affinity between 93 human SH2 domains and phosphopeptides abstracted from several receptor tyrosine kinases and signaling proteins. The resulting interaction experiments revealed over 1000 novel peptide-protein interactions and provided a glimpse into the common and specific interaction potentials of c-Met, c-Kit, GAB1, and the human androgen receptor. We used these data to build a permutation-based logistic regression classifier that performed considerably better than existing algorithms for predicting the interaction potential of several SH2 domains. PMID:24728074

  13. Autophagy influences the low-dose hyper-radiosensitivity of human lung adenocarcinoma cells by regulating MLH1.

    Science.gov (United States)

    Wang, Qiong; Xiao, Zhuya; Lin, Zhenyu; Zhou, Jie; Chen, Weihong; Jie, Wuyun; Cao, Xing; Yin, Zhongyuan; Cheng, Jing

    2017-06-01

    To investigate the impact of autophagy on the low-dose hyper-radiosensitivity (HRS) of human lung adenocarcinoma cells via MLH1 regulation. Immunofluorescent staining, Western blotting, and electron microscopy were utilized to detect autophagy in A549 and H460 cells. shRNA was used to silence MLH1 expression. The levels of MLH1, mTOR, p-mTOR, BNIP3, and Beclin-1 were measured by real-time polymerase chain reaction (PCR) and Western blotting. A549 cells, which have low levels of MLH1 expression, displayed HRS/induced radioresistance (IRR). Conversely, the radiosensitivity of H460 cells, which express high levels of MLH1, conformed to the linear-quadratic (LQ) model. After down-regulating MLH1 expression, A549 cells showed increased HRS and inhibition of autophagy, whereas H460 cells exhibited HRS/IRR. The levels of mTOR, p-mTOR, and BNIP3 were reduced in cells harboring MLH1 shRNA, and the changes in the mTOR/p-mTOR ratio mirrored those in MLH1 expression. Low MLH1-expressing A549 cells may exhibit HRS. Both the mTOR/p-mTOR and BNIP3/Beclin-1 signaling pathways were found to be related to HRS, but only mTOR/p-mTOR is involved in the regulation of HRS via MLH1 and autophagy.

  14. Hydrogen Peroxide Toxicity Induces Ras Signaling in Human Neuroblastoma SH-SY5Y Cultured Cells

    Directory of Open Access Journals (Sweden)

    Jirapa Chetsawang

    2010-01-01

    Full Text Available It has been reported that overproduction of reactive oxygen species occurs after brain injury and mediates neuronal cells degeneration. In the present study, we examined the role of Ras signaling on hydrogen peroxide-induced neuronal cells degeneration in dopaminergic neuroblastoma SH-SY5Y cells. Hydrogen peroxide significantly reduced cell viability in SH-SY5Y cultured cells. An inhibitor of the enzyme that catalyzes the farnesylation of Ras proteins, FTI-277, and a competitive inhibitor of GTP-binding proteins, GDP-beta-S significantly decreased hydrogen peroxide-induced reduction in cell viability in SH-SY5Y cultured cells. The results of this study might indicate that a Ras-dependent signaling pathway plays a role in hydrogen peroxide-induced toxicity in neuronal cells.

  15. Neuroprotective effects of metabotropic glutamate receptor group II and III activators against MPP(+)-induced cell death in human neuroblastoma SH-SY5Y cells: the impact of cell differentiation state.

    Science.gov (United States)

    Jantas, D; Greda, A; Golda, S; Korostynski, M; Grygier, B; Roman, A; Pilc, A; Lason, W

    2014-08-01

    Recent studies have documented that metabotropic glutamate receptors from group II and III (mGluR II/III) are a potential target in the symptomatic treatment of Parkinson's disease (PD), however, the neuroprotective effects of particular mGluR II/III subtypes in relation to PD pathology are recognized only partially. In the present study, we investigated the effect of various mGluR II/III activators in the in vitro model of PD using human neuroblastoma SH-SY5Y cell line and mitochondrial neurotoxin MPP(+). We demonstrated that all tested mGluR ligands: mGluR II agonist - LY354740, mGluR III agonist - ACPT-I, mGluR4 PAM - VU0361737, mGluR8 agonist - (S)-3,4-DCPG, mGluR8 PAM - AZ12216052 and mGluR7 allosteric agonist - AMN082 were protective against MPP(+)-evoked cell damage in undifferentiated (UN-) SH-SY5Y cells with the highest neuroprotection mediated by mGluR8-specific agents. However, in retinoic acid- differentiated (RA-) SH-SY5Y cells we found protection mediated only by mGluR8 activators. We also demonstrated the cell proliferation stimulating effect for mGluR4 and mGluR8 PAMs. Next, we showed that the protection mediated by mGluR II/III activators in UN-SH-SY5Y was not accompanied by the modulation of caspase-3 activity, however, a decrease in the number of apoptotic nuclei was found. Finally, we showed that the inhibitor of necroptosis, necrostatin-1 blocked the mGluR III-mediated protection. Altogether our comparative in vitro data add a further proof to neuroprotective effects of mGluR agonists or PAMs and point to mGluR8 as a promising target for neuroprotective interventions in PD. The results also suggest the participation of necroptosis-related molecular pathways in neuroprotective effects of mGluR III activation. Copyright © 2014 Elsevier Ltd. All rights reserved.

  16. Distinct mechanisms of a phosphotyrosyl peptide binding to two SH2 domains.

    Science.gov (United States)

    Pang, Xiaodong; Zhou, Huan-Xiang

    2014-05-01

    Protein phosphorylation is very common post-translational modification, catalyzed by kinases, for signaling and regulation. Phosphotyrosines frequently target SH2 domains. The spleen tyrosine kinase (Syk) is critical for tyrosine phosphorylation of multiple proteins and for regulation of important pathways. Phosphorylation of both Y342 and Y346 in Syk linker B is required for optimal signaling. The SH2 domains of Vav1 and PLC-γ both bind this doubly phosphorylated motif. Here we used a recently developed method to calculate the effects of Y342 and Y346 phosphorylation on the rate constants of a peptide from Syk linker B binding to the SH2 domains of Vav1 and PLC-γ. The predicted effects agree well with experimental observations. Moreover, we found that the same doubly phosphorylated peptide binds the two SH2 domains via distinct mechanisms, with apparent rigid docking for Vav1 SH2 and dock-and-coalesce for PLC-γ SH2.

  17. Thermodynamic dissection of the binding energetics of proline-rich peptides to the Abl-SH3 domain: implications for rational ligand design.

    Science.gov (United States)

    Palencia, Andrés; Cobos, Eva S; Mateo, Pedro L; Martínez, Jose C; Luque, Irene

    2004-02-13

    The inhibition of the interactions between SH3 domains and their targets is emerging as a promising therapeutic strategy. To date, rational design of potent ligands for these domains has been hindered by the lack of understanding of the origins of the binding energy. We present here a complete thermodynamic analysis of the binding energetics of the p41 proline-rich decapeptide (APSYSPPPPP) to the SH3 domain of the c-Abl oncogene. Isothermal titration calorimetry experiments have revealed a thermodynamic signature for this interaction (very favourable enthalpic contributions opposed by an unfavourable binding entropy) inconsistent with the highly hydrophobic nature of the p41 ligand and the Abl-SH3 binding site. Our structural and thermodynamic analyses have led us to the conclusion, having once ruled out any possible ionization events or conformational changes coupled to the association, that the establishment of a complex hydrogen-bond network mediated by water molecules buried at the binding interface is responsible for the observed thermodynamic behaviour. The origin of the binding energetics for proline-rich ligands to the Abl-SH3 domain is further investigated by a comparative calorimetric analysis of a set of p41-related ligands. The striking effects upon the enthalpic and entropic contributions provoked by conservative substitutions at solvent-exposed positions in the ligand confirm the complexity of the interaction. The implications of these results for rational ligand design are discussed.

  18. Performance Improvement of CH3NH3PbI3 Perovskite Solar Cell by CH3SH Doping

    Directory of Open Access Journals (Sweden)

    Hong Li

    2016-03-01

    Full Text Available Organometal halide perovskites have recently emerged as an appealing candidate in photovoltaic devices due to their excellent properties. Therefore, intense efforts have been devoted to find the ideal organics for perovskite solar cells. In response, we investigate the doping effect of CH3SH organic on the structure and related performance of a CH3NH3PbI3 perovskite solar cell, via in situ synchrotron- based grazing incidence X-ray diffraction (GIXRD, together with scanning electron microscopy (SEM. In situ GIXRD investigations clearly illustrated the transformation and modification of the perovskite structure induced by the organic dopant, which subsequently led to the enhance‐ ment of the power conversion efficiency of fabricated solar cells. Notably, nanoporous morphology and nanocrystal‐ line structures were discovered in the perovskite film by SEM; they were also confirmed by the increase in broad‐ ening peaks/features in the GIXRD measurements. Overall, our study may ultimately result in an attractive strategy for the fabrication of high performance perovskite solar cells.

  19. SH2 Ligand-Like Effects of Second Cytosolic Domain of Na/K-ATPase α1 Subunit on Src Kinase.

    Directory of Open Access Journals (Sweden)

    Moumita Banerjee

    Full Text Available Our previous studies have suggested that the α1 Na/K-ATPase interacts with Src to form a receptor complex. In vitro binding assays indicate an interaction between second cytosolic domain (CD2 of Na/K-ATPase α1 subunit and Src SH2 domain. Since SH2 domain targets Src to specific signaling complexes, we expressed CD2 as a cytosolic protein and studied whether it could act as a Src SH2 ligand in LLC-PK1 cells. Co-immunoprecipitation analyses indicated a direct binding of CD2 to Src, consistent with the in vitro binding data. Functionally, CD2 expression increased basal Src activity, suggesting a Src SH2 ligand-like property of CD2. Consistently, we found that CD2 expression attenuated several signaling pathways where Src plays an important role. For instance, although it increased surface expression of Na/K-ATPase, it decreased ouabain-induced activation of Src and ERK by blocking the formation of Na/K-ATPase/Src complex. Moreover, it also attenuated cell attachment-induced activation of Src/FAK. Consequently, CD2 delayed cell spreading, and inhibited cell proliferation. Furthermore, these effects appear to be Src-specific because CD2 expression had no effect on EGF-induced activation of EGF receptor and ERK. Hence, the new findings indicate the importance of Na/K-ATPase/Src interaction in ouabain-induced signal transduction, and support the proposition that the CD2 peptide may be utilized as a Src SH2 ligand capable of blocking Src-dependent signaling pathways via a different mechanism from a general Src kinase inhibitor.

  20. Molecular mechanism of action of opioids in human neuroblastoma cells

    International Nuclear Information System (INIS)

    Yu, V.C.K.

    1987-01-01

    A series of human neuroblastoma cell lines was screened for the presence of opioid receptor sites. Of these cell lines, SK-N-SH was found to express approximately 50,000 μ and 10,000 δ opioid receptor sites/cell. In vitro characterization revealed that the binding properties of these receptor sites closely resembled those of human and rodent brain. Phosphatidylinositol turnover as a potential second messenger system for the μ receptor was examined in SK-N-SH cells. Neurotransmitter receptor systems were determined in the three sub-clones of SK-N-SH cells. Cells of the SH-SY5Y line, a phenotypically stable subclone of SK-N-SH cells, were induced to differentiate by treatment with various inducing agents, and changes of several neurotransmitter receptor systems were determined. Nerve growth factor (NGF) and retinoic acid (RA) up-regulated, while dBcAMP down-regulated opioid receptor sites. [ 3 H]Dopamine uptake was slightly enhanced only in RA-treated cells. Strikingly, the efficacy of PGE 1 -stimulated accumulation of cAMP was enhanced by 15- to 30-fold upon RA treatment

  1. High resolution crystal structure of the Grb2 SH2 domain with a phosphopeptide derived from CD28.

    Directory of Open Access Journals (Sweden)

    Kunitake Higo

    Full Text Available Src homology 2 (SH2 domains play a critical role in cellular signal transduction. They bind to peptides containing phosphotyrosine (pY with various specificities that depend on the flanking amino-acid residues. The SH2 domain of growth-factor receptor-bound protein 2 (Grb2 specifically recognizes pY-X-N-X, whereas the SH2 domains in phosphatidylinositol 3-kinase (PI3K recognize pY-X-X-M. Binding of the pY site in CD28 (pY-M-N-M by PI3K and Grb2 through their SH2 domains is a key step that triggers the CD28 signal transduction for T cell activation and differentiation. In this study, we determined the crystal structure of the Grb2 SH2 domain in complex with a pY-containing peptide derived from CD28 at 1.35 Å resolution. The peptide was found to adopt a twisted U-type conformation, similar to, but distinct from type-I β-turn. In all previously reported crystal structures, the peptide bound to the Grb2 SH2 domains adopts a type-I β-turn conformation, except those with a proline residue at the pY+3 position. Molecular modeling also suggests that the same peptide bound to PI3K might adopt a very different conformation.

  2. High resolution crystal structure of the Grb2 SH2 domain with a phosphopeptide derived from CD28.

    Science.gov (United States)

    Higo, Kunitake; Ikura, Teikichi; Oda, Masayuki; Morii, Hisayuki; Takahashi, Jun; Abe, Ryo; Ito, Nobutoshi

    2013-01-01

    Src homology 2 (SH2) domains play a critical role in cellular signal transduction. They bind to peptides containing phosphotyrosine (pY) with various specificities that depend on the flanking amino-acid residues. The SH2 domain of growth-factor receptor-bound protein 2 (Grb2) specifically recognizes pY-X-N-X, whereas the SH2 domains in phosphatidylinositol 3-kinase (PI3K) recognize pY-X-X-M. Binding of the pY site in CD28 (pY-M-N-M) by PI3K and Grb2 through their SH2 domains is a key step that triggers the CD28 signal transduction for T cell activation and differentiation. In this study, we determined the crystal structure of the Grb2 SH2 domain in complex with a pY-containing peptide derived from CD28 at 1.35 Å resolution. The peptide was found to adopt a twisted U-type conformation, similar to, but distinct from type-I β-turn. In all previously reported crystal structures, the peptide bound to the Grb2 SH2 domains adopts a type-I β-turn conformation, except those with a proline residue at the pY+3 position. Molecular modeling also suggests that the same peptide bound to PI3K might adopt a very different conformation.

  3. PSM/SH2-B distributes selected mitogenic receptor signals to distinct components in the PI3-kinase and MAP kinase signaling pathways.

    Science.gov (United States)

    Deng, Youping; Xu, Hu; Riedel, Heimo

    2007-02-15

    The Pro-rich, PH, and SH2 domain containing mitogenic signaling adapter PSM/SH2-B has been implicated as a cellular partner of various mitogenic receptor tyrosine kinases and related signaling mechanisms. Here, we report in a direct comparison of three peptide hormones, that PSM participates in the assembly of distinct mitogenic signaling complexes in response to insulin or IGF-I when compared to PDGF in cultured normal fibroblasts. The complex formed in response to insulin or IGF-I involves the respective peptide hormone receptor and presumably the established components leading to MAP kinase activation. However, our data suggest an alternative link from the PDGF receptor via PSM directly to MEK1/2 and consequently also to p44/42 activation, possibly through a scaffold protein. At least two PSM domains participate, the SH2 domain anticipated to link PSM to the respective receptor and the Pro-rich region in an association with an unidentified downstream component resulting in direct MEK1/2 and p44/42 regulation. The PDGF receptor signaling complex formed in response to PDGF involves PI 3-kinase in addition to the same components and interactions as described for insulin or IGF-I. PSM associates with PI 3-kinase via p85 and in addition the PSM PH domain participates in the regulation of PI 3-kinase activity, presumably through membrane interaction. In contrast, the PSM Pro-rich region appears to participate only in the MAP kinase signal. Both pathways contribute to the mitogenic response as shown by cell proliferation, survival, and focus formation. PSM regulates p38 MAP kinase activity in a pathway unrelated to the mitogenic response.

  4. Problem Definition Study on 1,3-Dinitrobenzene, 1,3,5-Trinitrobenzene and Di-n-Propyl Adipate

    Science.gov (United States)

    1979-11-01

    are significantly higher than the levels observed for * 1,3,5-tr it~be-zeve. 9Both corounds hav teen sh...r to exhibit c e-re:,onse mutagenicity in the...returned to work. However, cyanosis, general malaise and anorexia *0 appeared within two days after returning to work and she was admitted to the hospital...secondary anemia, anorexia , weight loss, insomnia, moderate cvanosis and yellow-brown discoloration of the skin. After removal from 1,3-dinitro- benzene

  5. Intramolecular dynamics within the N-Cap-SH3-SH2 regulatory unit of the c-Abl tyrosine kinase reveal targeting to the cellular membrane.

    Science.gov (United States)

    de Oliveira, Guilherme A P; Pereira, Elen G; Ferretti, Giulia D S; Valente, Ana Paula; Cordeiro, Yraima; Silva, Jerson L

    2013-09-27

    c-Abl is a key regulator of cell signaling and is under strict control via intramolecular interactions. In this study, we address changes in the intramolecular dynamics coupling within the c-Abl regulatory unit by presenting its N-terminal segment (N-Cap) with an alternative function in the cell as c-Abl becomes activated. Using small angle x-ray scattering, nuclear magnetic resonance, and confocal microscopy, we demonstrate that the N-Cap and the Src homology (SH) 3 domain acquire μs-ms motions upon N-Cap association with the SH2-L domain, revealing a stabilizing synergy between these segments. The N-Cap-myristoyl tether likely triggers the protein to anchor to the membrane because of these flip-flop dynamics, which occur in the μs-ms time range. This segment not only presents the myristate during c-Abl inhibition but may also trigger protein localization inside the cell in a functional and stability-dependent mechanism that is lost in Bcr-Abl(+) cells, which underlie chronic myeloid leukemia. This loss of intramolecular dynamics and binding to the cellular membrane is a potential therapeutic target.

  6. Selective Targeting of SH2 Domain–Phosphotyrosine Interactions of Src Family Tyrosine Kinases with Monobodies

    Energy Technology Data Exchange (ETDEWEB)

    Kükenshöner, Tim; Schmit, Nadine Eliane; Bouda, Emilie; Sha, Fern; Pojer, Florence; Koide, Akiko; Seeliger, Markus; Koide, Shohei; Hantschel, Oliver

    2017-05-01

    The binding of Src-homology 2 (SH2) domains to phosphotyrosine (pY) sites is critical for the autoinhibition and substrate recognition of the eight Src family kinases (SFKs). The high sequence conservation of the 120 human SH2 domains poses a significant challenge to selectively perturb the interactions of even the SFK SH2 family against the rest of the SH2 domains. We have developed synthetic binding proteins, termed monobodies, for six of the SFK SH2 domains with nanomolar affinity. Most of these monobodies competed with pY ligand binding and showed strong selectivity for either the SrcA (Yes, Src, Fyn, Fgr) or SrcB subgroup (Lck, Lyn, Blk, Hck). Interactome analysis of intracellularly expressed monobodies revealed that they bind SFKs but no other SH2-containing proteins. Three crystal structures of monobody–SH2 complexes unveiled different and only partly overlapping binding modes, which rationalized the observed selectivity and enabled structure-based mutagenesis to modulate inhibition mode and selectivity. In line with the critical roles of SFK SH2 domains in kinase autoinhibition and T-cell receptor signaling, monobodies binding the Src and Hck SH2 domains selectively activated respective recombinant kinases, whereas an Lck SH2-binding monobody inhibited proximal signaling events downstream of the T-cell receptor complex. Our results show that SFK SH2 domains can be targeted with unprecedented potency and selectivity using monobodies. They are excellent tools for dissecting SFK functions in normal development and signaling and to interfere with aberrant SFK signaling networks in cancer cells.

  7. Overexpression of tissue-nonspecific alkaline phosphatase increases the expression of neurogenic differentiation markers in the human SH-SY5Y neuroblastoma cell line.

    Science.gov (United States)

    Graser, Stephanie; Mentrup, Birgit; Schneider, Doris; Klein-Hitpass, Ludger; Jakob, Franz; Hofmann, Christine

    2015-10-01

    Patients suffering from the rare hereditary disease hypophosphatasia (HPP), which is based on mutations in the ALPL gene, tend to develop central nervous system (CNS) related issues like epileptic seizures and neuropsychiatric illnesses such as anxiety and depression, in addition to well-known problems with the mineralization of bones and teeth. Analyses of the molecular role of tissue-nonspecific alkaline phosphatase (TNAP) in transgenic SH-SY5Y(TNAPhigh) neuroblastoma cells compared to SH-SY5Y(TNAPlow) cells indicate that the enzyme influences the expression levels of neuronal marker genes like RNA-binding protein, fox-1 homolog 3 (NEUN) and enolase 2, gamma neuronal (NSE) as well as microtubule-binding proteins like microtubule-associated protein 2 (MAP2) and microtubule-associated protein tau (TAU) during neurogenic differentiation. Fluorescence staining of SH-SY5Y(TNAPhigh) cells reveals TNAP localization throughout the whole length of the developed projection network and even synapsin Ι co-localization with strong TNAP signals at some spots at least at the early time points of differentiation. Additional immunocytochemical staining shows higher MAP2 expression in SH-SY5Y(TNAPhigh) cells and further a distinct up-regulation of tau and MAP2 in the course of neurogenic differentiation. Interestingly, transgenic SH-SY5Y(TNAPhigh) cells are able to develop longer cellular processes compared to control cells after stimulation with all-trans retinoic acid (RA). Current therapies for HPP prioritize improvement of the bone phenotype. Unraveling the molecular role of TNAP in extraosseous tissues, like in the CNS, will help to improve treatment strategies for HPP patients. Taking this rare disease as a model may also help to dissect TNAP's role in neurodegenerative diseases and even improve future treatment of common pathologies. Copyright © 2015 Elsevier Inc. All rights reserved.

  8. Resveratrol Modulates Interleukin-1β-induced Phosphatidylinositol 3-Kinase and Nuclear Factor κB Signaling Pathways in Human Tenocytes

    Science.gov (United States)

    Busch, Franziska; Mobasheri, Ali; Shayan, Parviz; Lueders, Cora; Stahlmann, Ralf; Shakibaei, Mehdi

    2012-01-01

    Resveratrol, an activator of histone deacetylase Sirt-1, has been proposed to have beneficial health effects due to its antioxidant and anti-inflammatory properties. However, the mechanisms underlying the anti-inflammatory effects of resveratrol and the intracellular signaling pathways involved are poorly understood. An in vitro model of human tenocytes was used to examine the mechanism of resveratrol action on IL-1β-mediated inflammatory signaling. Resveratrol suppressed IL-1β-induced activation of NF-κB and PI3K in a dose- and time-dependent manner. Treatment with resveratrol enhanced the production of matrix components collagen types I and III, tenomodulin, and tenogenic transcription factor scleraxis, whereas it inhibited gene products involved in inflammation and apoptosis. IL-1β-induced NF-κB and PI3K activation was inhibited by resveratrol or the inhibitors of PI3K (wortmannin), c-Src (PP1), and Akt (SH-5) through inhibition of IκB kinase, IκBα phosphorylation, and inhibition of nuclear translocation of NF-κB, suggesting that PI3K signaling pathway may be one of the signaling pathways inhibited by resveratrol to abrogate NF-κB activation. Inhibition of PI3K by wortmannin attenuated IL-1β-induced Akt and p65 acetylation, suggesting that p65 is a downstream component of PI3K/Akt in these responses. The modulatory effects of resveratrol on IL-1β-induced activation of NF-κB and PI3K were found to be mediated at least in part by the association between Sirt-1 and scleraxis and deacetylation of NF-κB and PI3K. Overall, these results demonstrate that activated Sirt-1 plays an essential role in the anti-inflammatory effects of resveratrol and this may be mediated at least in part through inhibition/deacetylation of PI3K and NF-κB. PMID:22936809

  9. Adventitial delivery of lentivirus-shRNA-ADAMTS-1 reduces venous stenosis formation in arteriovenous fistula.

    Science.gov (United States)

    Nieves Torres, Evelyn C; Yang, Binxia; Roy, Bhaskar; Janardhanan, Rajiv; Brahmbhatt, Akshaar; Leof, Ed; Mukhopadhyay, Debabrata; Misra, Sanjay

    2014-01-01

    Hemodialysis vascular access can develop venous neointimal hyperplasia (VNH) causing stenosis. Recent clinical and experimental data has demonstrated that there is increased expression of a disintegrin and metalloproteinase thrombospondin motifs-1 (ADAMTS-1) at site of VNH. The experiments outlined in the present paper were designed to test the hypothesis that targeting of the adventitia of the outflow vein of murine arteriovenous fistula (AVF) using a small hairpin RNA that inhibits ADAMTS-1 expression (LV-shRNA-ADAMTS-1) at the time of fistula creation will decrease VNH. At early time points, ADAMTS-1 expression was significantly decreased associated with a reduction in vascular endothelial growth factor-A (VEGF-A) and matrix metalloproteinase-9 (MMP-9) (LV-shRNA-ADAMTS-1 transduced vessels vs. controls). These changes in gene and protein expression resulted in favorable vascular remodeling with a significant increase in mean lumen vessel area, decrease in media/adventitia area, with a significant increase in TUNEL staining accompanied with a decrease in cellular proliferation accompanied with a reduction in CD68 staining. Collectively, these results demonstrate that ADAMTS-1 transduced vessels of the outflow vein of AVF have positive vascular remodeling.

  10. Adventitial delivery of lentivirus-shRNA-ADAMTS-1 reduces venous stenosis formation in arteriovenous fistula.

    Directory of Open Access Journals (Sweden)

    Evelyn C Nieves Torres

    Full Text Available Hemodialysis vascular access can develop venous neointimal hyperplasia (VNH causing stenosis. Recent clinical and experimental data has demonstrated that there is increased expression of a disintegrin and metalloproteinase thrombospondin motifs-1 (ADAMTS-1 at site of VNH. The experiments outlined in the present paper were designed to test the hypothesis that targeting of the adventitia of the outflow vein of murine arteriovenous fistula (AVF using a small hairpin RNA that inhibits ADAMTS-1 expression (LV-shRNA-ADAMTS-1 at the time of fistula creation will decrease VNH. At early time points, ADAMTS-1 expression was significantly decreased associated with a reduction in vascular endothelial growth factor-A (VEGF-A and matrix metalloproteinase-9 (MMP-9 (LV-shRNA-ADAMTS-1 transduced vessels vs. controls. These changes in gene and protein expression resulted in favorable vascular remodeling with a significant increase in mean lumen vessel area, decrease in media/adventitia area, with a significant increase in TUNEL staining accompanied with a decrease in cellular proliferation accompanied with a reduction in CD68 staining. Collectively, these results demonstrate that ADAMTS-1 transduced vessels of the outflow vein of AVF have positive vascular remodeling.

  11. Protein-phosphotyrosine proteome profiling by superbinder-SH2 domain affinity purification mass spectrometry, sSH2-AP-MS.

    Science.gov (United States)

    Tong, Jiefei; Cao, Biyin; Martyn, Gregory D; Krieger, Jonathan R; Taylor, Paul; Yates, Bradley; Sidhu, Sachdev S; Li, Shawn S C; Mao, Xinliang; Moran, Michael F

    2017-03-01

    Recently, "superbinder" SH2 domain variants with three amino acid substitutions (sSH2) were reported to have 100-fold or greater affinity for protein-phosphotyrosine (pY) than natural SH2 domains. Here we report a protocol in which His-tagged Src sSH2 efficiently captures pY-peptides from protease-digested HeLa cell total protein extracts. Affinity purification of pY-peptides by this method shows little bias for pY-proximal amino acid sequences, comparable to that achieved by using antibodies to pY, but with equal or higher yield. Superbinder-SH2 affinity purification mass spectrometry (sSH2-AP-MS) therefore provides an efficient and economical approach for unbiased pY-directed phospho-proteome profiling without the use of antibodies. © 2016 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  12. Rosiglitazone protects human neuroblastoma SH-SY5Y cells against acetaldehyde-induced cytotoxicity

    International Nuclear Information System (INIS)

    Jung, Tae Woo; Lee, Ji Young; Shim, Wan Sub; Kang, Eun Seok; Kim, Soo Kyung; Ahn, Chul Woo; Lee, Hyun Chul; Cha, Bong Soo

    2006-01-01

    Acetaldehyde, an inhibitor of mitochondrial function, has been widely used as a neurotoxin because it elicits a severe Parkinson's disease-like syndrome with elevation of the intracellular reactive oxygen species level and apoptosis. Rosiglitazone, a peroxisome proliferator-activated receptor-γ agonist, has been known to show various non-hypoglycemic effects, including anti-inflammatory, anti-atherogenic, and anti-apoptotic. In this study, we investigated the protective effects of rosiglitazone on acetaldehyde-induced apoptosis in human neuroblastoma SH-SY5Y cells and attempted to examine its mechanism. Acetaldehyde-induced apoptosis was moderately reversed by rosiglitazone treatment. Our results suggest that the protective effects of rosiglitazone on acetaldehyde-induced apoptosis may be ascribed to ability to induce the expression of anti-oxidant enzymes and to regulate Bcl-2 and Bax expression. These data indicate that rosiglitazone may provide a useful therapeutic strategy for the prevention of progressive neurodegenerative disease such as Parkinson's disease

  13. Dichloroacetate stimulates changes in the mitochondrial network morphology via partial mitophagy in human SH-SY5Y neuroblastoma cells

    Czech Academy of Sciences Publication Activity Database

    Pajuelo-Reguera, David; Alán, Lukáš; Olejár, Tomáš; Ježek, Petr

    2015-01-01

    Roč. 46, č. 6 (2015), s. 2409-2418 ISSN 1019-6439 R&D Projects: GA MŠk(CZ) EE2.3.30.0025 Institutional support: RVO:67985823 Keywords : dichloroacetate * mitochondria * mitophagy * neuroblastoma SH-SY5Y cells * mitochondrial network Subject RIV: EI - Biotechnology ; Bionics Impact factor: 3.018, year: 2015

  14. Membrane localization is critical for activation of the PICK1 BAR domain

    DEFF Research Database (Denmark)

    Madsen, Kenneth L; Eriksen, Jacob; Milan-Lobo, Laura

    2008-01-01

    The PSD-95/Discs-large/ZO-1 homology (PDZ) domain protein, protein interacting with C kinase 1 (PICK1) contains a C-terminal Bin/amphiphysin/Rvs (BAR) domain mediating recognition of curved membranes; however, the molecular mechanisms controlling the activity of this domain are poorly understood....

  15. Protective effect of Pycnogenol in human neuroblastoma SH-SY5Y cells following acrolein-induced cytotoxicity.

    Science.gov (United States)

    Ansari, Mubeen A; Keller, Jeffrey N; Scheff, Stephen W

    2008-12-01

    Oxidative stress is one of the hypotheses involved in the etiology of Alzheimer's disease (AD). Considerable attention has been focused on increasing the intracellular glutathione (GSH) levels in many neurodegenerative diseases, including AD. Pycnogenol (PYC) has antioxidant properties and stabilizes intracellular antioxidant defense systems including glutathione levels. The present study investigated the protective effects of PYC on acrolein-induced oxidative cell toxicity in cultured SH-SY5Y neuroblastoma cells. Decreased cell survival in SH-SY5Y cultures treated with acrolein correlated with oxidative stress, increased NADPH oxidase activity, free radical production, protein oxidation/nitration (protein carbonyl, 3-nitrotyrosine), and lipid peroxidation (4-hydroxy-2-nonenal). Pretreatment with PYC significantly attenuated acrolein-induced cytotoxicity, protein damage, lipid peroxidation, and cell death. A dose-response study suggested that PYC showed protective effects against acrolein toxicity by modulating oxidative stress and increasing GSH. These findings provide support that PYC may provide a promising approach for the treatment of oxidative stress-related neurodegenerative diseases such as AD.

  16. Grb7 SH2 domain structure and interactions with a cyclic peptide inhibitor of cancer cell migration and proliferation

    Directory of Open Access Journals (Sweden)

    Pero Stephanie C

    2007-09-01

    Full Text Available Abstract Background Human growth factor receptor bound protein 7 (Grb7 is an adapter protein that mediates the coupling of tyrosine kinases with their downstream signaling pathways. Grb7 is frequently overexpressed in invasive and metastatic human cancers and is implicated in cancer progression via its interaction with the ErbB2 receptor and focal adhesion kinase (FAK that play critical roles in cell proliferation and migration. It is thus a prime target for the development of novel anti-cancer therapies. Recently, an inhibitory peptide (G7-18NATE has been developed which binds specifically to the Grb7 SH2 domain and is able to attenuate cancer cell proliferation and migration in various cancer cell lines. Results As a first step towards understanding how Grb7 may be inhibited by G7-18NATE, we solved the crystal structure of the Grb7 SH2 domain to 2.1 Å resolution. We describe the details of the peptide binding site underlying target specificity, as well as the dimer interface of Grb 7 SH2. Dimer formation of Grb7 was determined to be in the μM range using analytical ultracentrifugation for both full-length Grb7 and the SH2 domain alone, suggesting the SH2 domain forms the basis of a physiological dimer. ITC measurements of the interaction of the G7-18NATE peptide with the Grb7 SH2 domain revealed that it binds with a binding affinity of Kd = ~35.7 μM and NMR spectroscopy titration experiments revealed that peptide binding causes perturbations to both the ligand binding surface of the Grb7 SH2 domain as well as to the dimer interface, suggesting that dimerisation of Grb7 is impacted on by peptide binding. Conclusion Together the data allow us to propose a model of the Grb7 SH2 domain/G7-18NATE interaction and to rationalize the basis for the observed binding specificity and affinity. We propose that the current study will assist with the development of second generation Grb7 SH2 domain inhibitors, potentially leading to novel inhibitors of

  17. The M1 muscarinic receptor and its second messenger coupling in human neuroblastoma cells and transfected murine fibroblast cells

    International Nuclear Information System (INIS)

    Mei, Lin.

    1989-01-01

    The data of this study indicate that pirenzepine (PZ)-high affinity muscarinic receptors (mAChRs) are coupled to the hydrolysis of inositol lipids and not to the adenylate cyclase system in human neuroblastoma SH-SY5Y cells. The maximal carbachol(CCh)-stimulated [ 3 H]IP 1 accumulation in the SH-SY5Y cells was decreased in the presence of 1μg/ml pertussis toxin, suggesting that a pertussis toxin sensitive G-protein may be involved in the coupling. Several cell clones which express only M 1 mAChR were generated by transfecting the murine fibroblast B82 cells with the cloned rat genomic m 1 gene. The transfected B82 cells (cTB10) showed specific [ 3 H](-)QNB binding activity. The mAChRs in these cells are of the M 1 type defined by their high affinity for PZ and low affinity for AF-DX 116 and coupled to hydrolysis of inositol lipids, possibly via a pertussis toxin sensitive G protein. The relationship between the M 1 mAChR density and the receptor-mediated hydrolysis of inositol lipids was studied in 7 clones. The M 1 mAChR densities in these cells characterized by [ 3 H](-)MQNB binding ranged from 12 fmol/10 6 cells in LK3-1 cells to 260 fmol/10 6 cells in the LK3-8 cells

  18. The C1 domain-targeted isophthalate derivative HMI-1b11 promotes neurite outgrowth and GAP-43 expression through PKCα activation in SH-SY5Y cells.

    Science.gov (United States)

    Talman, Virpi; Amadio, Marialaura; Osera, Cecilia; Sorvari, Salla; Boije Af Gennäs, Gustav; Yli-Kauhaluoma, Jari; Rossi, Daniela; Govoni, Stefano; Collina, Simona; Ekokoski, Elina; Tuominen, Raimo K; Pascale, Alessia

    2013-07-01

    Protein kinase C (PKC) is a family of serine/threonine phosphotransferases ubiquitously expressed and involved in multiple cellular functions, such as proliferation, apoptosis and differentiation. The C1 domain of PKC represents an attractive drug target, especially for developing PKC activators. Dialkyl 5-(hydroxymethyl)isophthalates are a novel group of synthetic C1 domain ligands that exhibit antiproliferative effect in HeLa cervical carcinoma cells. Here we selected two isophthalates, HMI-1a3 and HMI-1b11, and characterized their effects in the human neuroblastoma cell line SH-SY5Y. Both of the active isophthalates exhibited significant antiproliferative and differentiation-inducing effects. Since HMI-1b11 did not impair cell survival even at the highest concentration tested (20μM), and supported neurite growth and differentiation of SH-SY5Y cells, we focused on studying its downstream signaling cascades and effects on gene expression. Consistently, genome-wide gene expression microarray and gene set enrichment analysis indicated that HMI-1b11 (10μM) induced changes in genes mainly related to cell differentiation. In particular, further studies revealed that HMI-1b11 exposure induced up-regulation of GAP-43, a marker for neurite sprouting and neuronal differentiation. These effects were induced by a 7-min HMI-1b11 treatment and specifically depended on PKCα activation, since pretreatment with the selective inhibitor Gö6976 abolished the up-regulation of GAP-43 protein observed at 12h. In parallel, we found that a 7-min exposure to HMI-1b11 induced PKCα accumulation to the cytoskeleton, an effect that was again prevented by pretreatment with Gö6976. Despite similar binding affinities to PKC, the isophthalates had different effects on PKC-dependent ERK1/2 signaling: HMI-1a3-induced ERK1/2 phosphorylation was transient, while HMI-1b11 induced a rapid but prolonged ERK1/2 phosphorylation. Overall our data are in accordance with previous studies showing that

  19. Selective Targeting of SH2 Domain-Phosphotyrosine Interactions of Src Family Tyrosine Kinases with Monobodies.

    Science.gov (United States)

    Kükenshöner, Tim; Schmit, Nadine Eliane; Bouda, Emilie; Sha, Fern; Pojer, Florence; Koide, Akiko; Seeliger, Markus; Koide, Shohei; Hantschel, Oliver

    2017-05-05

    The binding of Src-homology 2 (SH2) domains to phosphotyrosine (pY) sites is critical for the autoinhibition and substrate recognition of the eight Src family kinases (SFKs). The high sequence conservation of the 120 human SH2 domains poses a significant challenge to selectively perturb the interactions of even the SFK SH2 family against the rest of the SH2 domains. We have developed synthetic binding proteins, termed monobodies, for six of the SFK SH2 domains with nanomolar affinity. Most of these monobodies competed with pY ligand binding and showed strong selectivity for either the SrcA (Yes, Src, Fyn, Fgr) or SrcB subgroup (Lck, Lyn, Blk, Hck). Interactome analysis of intracellularly expressed monobodies revealed that they bind SFKs but no other SH2-containing proteins. Three crystal structures of monobody-SH2 complexes unveiled different and only partly overlapping binding modes, which rationalized the observed selectivity and enabled structure-based mutagenesis to modulate inhibition mode and selectivity. In line with the critical roles of SFK SH2 domains in kinase autoinhibition and T-cell receptor signaling, monobodies binding the Src and Hck SH2 domains selectively activated respective recombinant kinases, whereas an Lck SH2-binding monobody inhibited proximal signaling events downstream of the T-cell receptor complex. Our results show that SFK SH2 domains can be targeted with unprecedented potency and selectivity using monobodies. They are excellent tools for dissecting SFK functions in normal development and signaling and to interfere with aberrant SFK signaling networks in cancer cells. Copyright © 2017 The Author(s). Published by Elsevier Ltd.. All rights reserved.

  20. Knock-down of ABCE1 gene induces G1/S arrest in human oral cancer cells

    OpenAIRE

    Wang, Lei; Zhang, Mei; Liu, Dong-Xu

    2014-01-01

    Purpose: This study aims to explore the clinical characteristics of ATP binding cassette E1 (ABCE1) in oral squamous cell carcinomas (OSCC) and its roles in the proliferation, invasiveness, migration and apoptosis of the human oral squamous cell carcinoma cells CAL-27. Methods: The expression of ABCE1 and its target protein-RNase L, were first studied in tumor tissues of OSCC and adjacent non-tumor tissues. Moreover, CAL-27cells were transfected by ABCE1-specific shRNA, then MTT assay, the tr...

  1. Cold collisions of SH- with He: Potential energy surface and rate coefficients

    Science.gov (United States)

    Bop, C. T.; Trabelsi, T.; Hammami, K.; Mogren Al Mogren, M.; Lique, F.; Hochlaf, M.

    2017-09-01

    Collisional energy transfer under cold conditions is of great importance from the fundamental and applicative point of view. Here, we investigate low temperature collisions of the SH- anion with He. We have generated a three-dimensional potential energy surface (PES) for the SH-(X1Σ+)-He(1S) van der Waals complex. The ab initio multi-dimensional interaction PES was computed using the explicitly correlated coupled cluster approach with simple, double, and perturbative triple excitation in conjunction with the augmented-correlation consistent-polarized valence triple zeta Gaussian basis set. The PES presents two minima located at linear geometries. Then, the PES was averaged over the ground vibrational wave function of the SH- molecule and the resulting two-dimensional PES was incorporated into exact quantum mechanical close coupling calculations to study the collisional excitation of SH- by He. We have computed inelastic cross sections among the 11 first rotational levels of SH- for energies up to 2500 cm-1. (De-)excitation rate coefficients were deduced for temperatures ranging from 1 to 300 K by thermally averaging the cross sections. We also performed calculations using the new PES for a fixed internuclear SH- distance. Both sets of results were found to be in reasonable agreement despite differences existing at low temperatures confirming that accurate predictions require the consideration of all internal degrees of freedom in the case of molecular hydrides. The rate coefficients presented here may be useful in interpreting future experimental work on the SH- negative ion colliding with He as those recently done for the OH--He collisional system as well as for possible astrophysical applications in case SH- would be detected in the interstellar medium.

  2. The SH3 domain-binding T cell tyrosyl phosphoprotein p120. Demonstration of its identity with the c-cbl protooncogene product and in vivo complexes with Fyn, Grb2, and phosphatidylinositol 3-kinase

    NARCIS (Netherlands)

    Fukazawa, T.; Reedquist, K. A.; Trub, T.; Soltoff, S.; Panchamoorthy, G.; Druker, B.; Cantley, L.; Shoelson, S. E.; Band, H.

    1995-01-01

    Previously, we have identified p120 as a Fyn/Lck SH3 and SH2 domain-binding protein that is tyrosine phosphorylated rapidly after T cell receptor triggering. Here, we used direct protein purification, amino acid sequence analysis, reactivity with antibodies, and two-dimensional gel analyses to

  3. Fusion protein based on Grb2-SH2 domain for cancer therapy

    International Nuclear Information System (INIS)

    Saito, Yuriko; Furukawa, Takako; Arano, Yasushi; Fujibayashi, Yasuhisa; Saga, Tsuneo

    2010-01-01

    Research highlights: → Grb2 mediates EGFR signaling through binding to phosphorylate EGFR with SH2 domain. → We generated fusion proteins containing 1 or 2 SH2 domains of Grb2 added with TAT. → The one with 2 SH2 domains (TSSF) interfered ERK phosphorylation. → TSSF significantly delayed the growth of EGFR overexpressing tumor in a mouse model. -- Abstract: Epidermal growth factor receptor (EGFR) is one of the very attractive targets for cancer therapy. In this study, we generated fusion proteins containing one or two Src-homology 2 (SH2) domains of growth factor receptor bound protein 2 (Grb2), which bind to phosphorylated EGFR, added with HIV-1 transactivating transcription for cell membrane penetration (termed TSF and TSSF, respectively). We examined if they can interfere Grb2-mediated signaling pathway and suppress tumor growth as expected from the lack of SH3 domain, which is necessary to intermediate EGFR-Grb2 cell signaling, in the fusion proteins. The transduction efficiency of TSSF was similar to that of TSF, but the binding activity of TSSF to EGFR was higher than that of TSF. Treatment of EGFR-overexpressing cells showed that TSSF decreased p42-ERK phosphorylation, while TSF did not. Both the proteins delayed cell growth but did not induce cell death in culture. TSSF also significantly suppressed tumor growth in vivo under consecutive administration. In conclusion, TSSF showed an ability to inhibit EGFR-Grb2 signaling and could have a potential to treat EGFR-activated cancer.

  4. IGF-1R and ErbB3/HER3 contribute to enhanced proliferation and carcinogenesis in trastuzumab-resistant ovarian cancer model

    International Nuclear Information System (INIS)

    Jia, Yanhan; Zhang, Yan; Qiao, Chunxia; Liu, Guijun; Zhao, Qing; Zhou, Tingting; Chen, Guojiang; Li, Yali; Feng, Jiannan; Li, Yan; Zhang, Qiuping; Peng, Hui

    2013-01-01

    Highlights: •We established trastuzumab-resistant cell line SKOV3/T. •SKOV3/T enhances proliferation and in vivo carcinogenesis. •IGF-1R and HER3 genes were up-regulated in SKOV3/T based on microarray analysis. •Targeting IGF-1R and/or HER3 inhibited the proliferation of SKOV3/T. •Therapies targeting IGF-1R and HER3 might be effective in ovarian cancer. -- Abstract: Trastuzumab (Herceptin®) has demonstrated clinical potential in several types of HER2-overexpressing human cancers. However, primary and acquired resistance occurs in many HER2-positive patients with regimens. To investigate the possible mechanism of acquired therapeutic resistance to trastuzumab, we have developed a preclinical model of human ovarian cancer cells, SKOV3/T, with the distinctive feature of stronger carcinogenesis. The differences in gene expression between parental and the resistant cells were explored by microarray analysis, of which IGF-1R and HER3 were detected to be key molecules in action. Their correctness was validated by follow-up experiments of RT-PCR, shRNA-mediated knockdown, downstream signal activation, cell cycle distribution and survival. These results suggest that IGF-1R and HER3 differentially regulate trastuzumab resistance and could be promising targets for trastuzumab therapy in ovarian cancer

  5. IGF-1R and ErbB3/HER3 contribute to enhanced proliferation and carcinogenesis in trastuzumab-resistant ovarian cancer model

    Energy Technology Data Exchange (ETDEWEB)

    Jia, Yanhan [Department of Immunology, School of Basic Medical Sciences, Wuhan University, Wuhan, Hubei 430071 (China); Department of Immunology, Institute of Basic Medical Sciences, Beijing 100850 (China); Zhang, Yan [Department of Gynaecology and Obstetrics, PLA General Hospital, Beijing 100853 (China); Qiao, Chunxia; Liu, Guijun [Department of Immunology, Institute of Basic Medical Sciences, Beijing 100850 (China); Zhao, Qing [Department of Immunology, Institute of Basic Medical Sciences, Beijing 100850 (China); Department of Gynaecology and Obstetrics, PLA General Hospital, Beijing 100853 (China); Zhou, Tingting; Chen, Guojiang [Department of Immunology, Institute of Basic Medical Sciences, Beijing 100850 (China); Li, Yali [Department of Gynaecology and Obstetrics, PLA General Hospital, Beijing 100853 (China); Feng, Jiannan; Li, Yan [Department of Immunology, Institute of Basic Medical Sciences, Beijing 100850 (China); Zhang, Qiuping, E-mail: qpzhang@whu.edu.cn [Department of Immunology, School of Basic Medical Sciences, Wuhan University, Wuhan, Hubei 430071 (China); Peng, Hui, E-mail: p_h2002@hotmail.com [Department of Immunology, Institute of Basic Medical Sciences, Beijing 100850 (China); Cardiovascular Drug Research Center, Institute of Health and Environmental Medicine, Beijing 100850 (China)

    2013-07-12

    Highlights: •We established trastuzumab-resistant cell line SKOV3/T. •SKOV3/T enhances proliferation and in vivo carcinogenesis. •IGF-1R and HER3 genes were up-regulated in SKOV3/T based on microarray analysis. •Targeting IGF-1R and/or HER3 inhibited the proliferation of SKOV3/T. •Therapies targeting IGF-1R and HER3 might be effective in ovarian cancer. -- Abstract: Trastuzumab (Herceptin®) has demonstrated clinical potential in several types of HER2-overexpressing human cancers. However, primary and acquired resistance occurs in many HER2-positive patients with regimens. To investigate the possible mechanism of acquired therapeutic resistance to trastuzumab, we have developed a preclinical model of human ovarian cancer cells, SKOV3/T, with the distinctive feature of stronger carcinogenesis. The differences in gene expression between parental and the resistant cells were explored by microarray analysis, of which IGF-1R and HER3 were detected to be key molecules in action. Their correctness was validated by follow-up experiments of RT-PCR, shRNA-mediated knockdown, downstream signal activation, cell cycle distribution and survival. These results suggest that IGF-1R and HER3 differentially regulate trastuzumab resistance and could be promising targets for trastuzumab therapy in ovarian cancer.

  6. TODS BioCast User Manual, Forecasting 3D Satellite Derived Optical Properties Using Eulerian Advection Procedure, Version 1.0

    Science.gov (United States)

    2015-06-17

    Example 2: OpCast_cron.sh #!/bin/sh # # # # # Cron helper script This script may be called with the appropriate arguments to reproduce what the...testing. Example 3: OpCast.sh #!/bin/sh # # helper script to set up environment for call to make_merged_product.sh # # This script can be called stand...ecosystem model skill assessment, Journal of Marine Systems, 76(1-2), 64-82, doi:10.1016/j.jmarsys.2008.05.014. Jolliff, J. K., S. Ladner, R. Crout, P

  7. Specific pesticide-dependent increases in α-synuclein levels in human neuroblastoma (SH-SY5Y) and melanoma (SK-MEL-2) cell lines.

    Science.gov (United States)

    Chorfa, Areski; Bétemps, Dominique; Morignat, Eric; Lazizzera, Corinne; Hogeveen, Kevin; Andrieu, Thibault; Baron, Thierry

    2013-06-01

    Epidemiological studies indicate a role of genetic and environmental factors in Parkinson's disease involving alterations of the neuronal α-synuclein (α-syn) protein. In particular, a relationship between Parkinson's disease and occupational exposure to pesticides has been repeatedly suggested. Our objective was to precisely assess changes in α-syn levels in human neuroblastoma (SH-SY5Y) and melanoma (SK-MEL-2) cell lines following acute exposure to pesticides (rotenone, paraquat, maneb, and glyphosate) using Western blot and flow cytometry. These human cell lines express α-syn endogenously, and overexpression of α-syn (wild type or mutated A53T) can be obtained following recombinant adenoviral transduction. We found that endogenous α-syn levels in the SH-SY5Y neuroblastoma cell line were markedly increased by paraquat, and to a lesser extent by rotenone and maneb, but not by glyphosate. Rotenone also clearly increased endogenous α-syn levels in the SK-MEL-2 melanoma cell line. In the SH-SY5Y cell line, similar differences were observed in the α-syn adenovirus-transduced cells, with a higher increase of the A53T mutated protein. Paraquat markedly increased α-syn in the SK-MEL-2 adenovirus-transduced cell line, similarly for the wild-type or A53T proteins. The observed differences in the propensities of pesticides to increase α-syn levels are in agreement with numerous reports that indicate a potential role of exposure to certain pesticides in the development of Parkinson's disease. Our data support the hypothesis that pesticides can trigger some molecular events involved in this disease and also in malignant melanoma that consistently shows a significant but still unexplained association with Parkinson's disease.

  8. The development and application of a quantitative peptide microarray platform to SH2 domain specificity space

    Science.gov (United States)

    Engelmann, Brett Warren

    The Src homology 2 (SH2) domains evolved alongside protein tyrosine kinases (PTKs) and phosphatases (PTPs) in metazoans to recognize the phosphotyrosine (pY) post-translational modification. The human genome encodes 121 SH2 domains within 111 SH2 domain containing proteins that represent the primary mechanism for cellular signal transduction immediately downstream of PTKs. Despite pY recognition contributing to roughly half of the binding energy, SH2 domains possess substantial binding specificity, or affinity discrimination between phosphopeptide ligands. This specificity is largely imparted by amino acids (AAs) adjacent to the pY, typically from positions +1 to +4 C-terminal to the pY. Much experimental effort has been undertaken to construct preferred binding motifs for many SH2 domains. However, due to limitations in previous experimental methodologies these motifs do not account for the interplay between AAs. It was therefore not known how AAs within the context of individual peptides function to impart SH2 domain specificity. In this work we identified the critical role context plays in defining SH2 domain specificity for physiological ligands. We also constructed a high quality interactome using 50 SH2 domains and 192 physiological ligands. We next developed a quantitative high-throughput (Q-HTP) peptide microarray platform to assess the affinities four SH2 domains have for 124 physiological ligands. We demonstrated the superior characteristics of our platform relative to preceding approaches and validated our results using established biophysical techniques, literature corroboration, and predictive algorithms. The quantitative information provided by the arrays was leveraged to investigate SH2 domain binding distributions and identify points of binding overlap. Our microarray derived affinity estimates were integrated to produce quantitative interaction motifs capable of predicting interactions. Furthermore, our microarrays proved capable of resolving

  9. Fentanyl activates hypoxia-inducible factor 1 in neuronal SH-SY5Y cells and mice under non-hypoxic conditions in a μ-opioid receptor-dependent manner.

    Science.gov (United States)

    Daijo, Hiroki; Kai, Shinichi; Tanaka, Tomoharu; Wakamatsu, Takuhiko; Kishimoto, Shun; Suzuki, Kengo; Harada, Hiroshi; Takabuchi, Satoshi; Adachi, Takehiko; Fukuda, Kazuhiko; Hirota, Kiichi

    2011-09-30

    Hypoxia-inducible factor 1 (HIF-1) is the main transcription factor responsible for hypoxia-induced gene expression. Perioperative drugs including anesthetics have been reported to affect HIF-1 activity. However, the effect of fentanyl on HIF-1 activity is not well documented. In this study, we investigated the effect of fentanyl and other opioids on HIF-1 activity in human SH-SY5Y neuroblastoma cells, hepatoma Hep3B cells, lung adenocarcinoma A549 cells and mice. Cells were exposed to fentanyl, and HIF-1 protein expression was examined by Western blot analysis using anti-HIF-1α and β antibodies. HIF-1-dependent gene expression was investigated by semi-quantitative real-time reverse transcriptase (RT)-PCR (qRT-PCR) and luciferase assay. Furthermore, fentanyl was administered intraperitoneally and HIF-1-dependent gene expression was investigated by qRT-PCR in the brains and kidneys of mice. A 10-μM concentration of fentanyl and other opioids, including 1 μM morphine and 4 μM remifentanil, induced HIF-1α protein expression and HIF-1 target gene expression in an opioid receptor-dependent manner in SH-SY5Y cells with activity peaking at 24h. Fentanyl did not augment HIF-1α expression during hypoxia-induced induction. HIF-1α stabilization assays and experiments with cycloheximide revealed that fentanyl increased translation from HIF-1α mRNA but did not stabilize the HIF-1α protein. Furthermore, fentanyl induced HIF-1 target gene expression in the brains of mice but not in their kidneys in a naloxone-sensitive manner. In this report, we describe for the first time that fentanyl, both in vitro and in vivo, induces HIF-1 activation under non-hypoxic conditions, leading to increases in expression of genes associated with adaptation to hypoxia. Copyright © 2011 Elsevier B.V. All rights reserved.

  10. AHR prevents human IL-1R1hi ILC3 differentiation to natural killer cells

    Science.gov (United States)

    Hughes, Tiffany; Briercheck, Edward L.; Freud, Aharon G.; Trotta, Rossana; McClory, Susan; Scoville, Steven D.; Keller, Karen; Deng, Youcai; Cole, Jordan; Harrison, Nicholas; Mao, Charlene; Zhang, Jianying; Benson, Don M.; Yu, Jianhua; Caligiuri, Michael A.

    2014-01-01

    SUMMARY Accumulating evidence indicates that human natural killer (NK) cells develop in secondary lymphoid tissue (SLT) through a so-called “stage 3” developmental intermediate minimally characterized by a CD34-CD117+CD94- immunophenotype that lacks mature NK cell function. This stage 3 population is heterogeneous, potentially composed of functionally distinct innate lymphoid cell (ILC) types that includes interleukin-1 receptor (IL-1R1) positive, IL-22-producing ILC3s. Whether human ILC3s are developmentally related to NK cells is a subject of ongoing investigation. Here we show that antagonism of the aryl hydrocarbon receptor (AHR) or silencing of AHR gene expression promotes differentiation of tonsillar IL-22-producing IL-1R1hi human ILC3s to CD56brightCD94+ IFN-gamma-producing cytolytic mature NK cells expressing eomesodermin (EOMES) and T-Box Protein 21 (TBX21 or TBET). Hence, AHR is a transcription factor that prevents human IL-1R1hi ILC3s from differentiating into NK cells. PMID:24953655

  11. NEAR-INFRARED IMAGING OF THE STAR-FORMING REGIONS SH2-157 AND SH2-152

    International Nuclear Information System (INIS)

    Chen Yafeng; Yang Ji; Zeng Qin; Yao Yongqiang; Sato, Shuji

    2009-01-01

    Near-infrared JHK' and H 2 v = 1-0 S (1) imaging observations of the star-forming regions Sh2-157 and Sh2-152 are presented. The data reveal a cluster of young stars associated with H 2 line emission in each region. Additionally, many IR point sources are found in the dense core of each molecular cloud. Most of these sources exhibit infrared color excesses typical of T Tauri stars, Herbig Ae/Be stars, and protostars. Several display the characteristics of massive stars. We calculate histograms of the K'-magnitude and [H - K'] color for all sources, as well as two-color and color-magnitude diagrams. The stellar populations inside and outside the clusters are similar, suggesting that these systems are rather evolved. Shock-driven H 2 emission knots are also detected, which may be related to evident subclusters in an earlier evolutionary stage.

  12. The Secretome of Bone Marrow and Wharton Jelly Derived Mesenchymal Stem Cells Induces Differentiation and Neurite Outgrowth in SH-SY5Y Cells

    Directory of Open Access Journals (Sweden)

    Ana O. Pires

    2014-01-01

    Full Text Available The goal of this study was to determine and compare the effects of the secretome of mesenchymal stem cells (MSCs isolated from human bone-marrow (BMSCs and the Wharton jelly surrounding the vein and arteries of the umbilical cord (human umbilical cord perivascular cells (HUCPVCs on the survival and differentiation of a human neuroblastoma cell line (SH-SY5Y. For this purpose, SH-SY5Y cells were differentiated with conditioned media (CM from the MSCs populations referred above. Retinoic acid cultured cells were used as control for neuronal differentiated SH-SY5Y cells. SH-SY5Y cells viability assessment revealed that the secretome of BMSCs and HUCPVCs, in the form of CM, was able to induce their survival. Moreover, immunocytochemical experiments showed that CM from both MSCs was capable of inducing neuronal differentiation of SH-SY5Y cells. Finally, neurite lengths assessment and quantitative real-time reverse-transcription polymerase chain reaction (RT-PCR analysis demonstrated that CM from BMSCs and HUCPVCs differently induced neurite outgrowth and mRNA levels of neuronal markers exhibited by SH-SY5Y cells. Overall, our results show that the secretome of both BMSCs and HUCPVCs was capable of supporting SH-SY5Y cells survival and promoting their differentiation towards a neuronal phenotype.

  13. Neuroprotective effects of glyceryl nonivamide against microglia-like cells and 6-hydroxydopamine-induced neurotoxicity in SH-SY5Y human dopaminergic neuroblastoma cells.

    Science.gov (United States)

    Lin, Yi-Chin; Uang, Hao-Wei; Lin, Rong-Jyh; Chen, Ing-Jun; Lo, Yi-Ching

    2007-12-01

    Glyceryl nonivamide (GLNVA), a vanilloid receptor (VR) agonist, has been reported to have calcitonin gene-related peptide-associated vasodilatation and to prevent subarachnoid hemorrhage-induced cerebral vasospasm. In this study, we investigated the neuroprotective effects of GLNVA on activated microglia-like cell mediated- and proparkinsonian neurotoxin 6-hydroxydopamine (6-OHDA)-induced neurotoxicity in human dopaminergic neuroblastoma SH-SY5Y cells. In coculture conditions, we used lipopolysaccharide (LPS)-stimulated BV-2 cells as a model of activated microglia. LPS-induced neuronal death was significantly inhibited by diphenylene iodonium (DPI), an inhibitor of NADPH oxidase. However, capsazepine, the selective VR1 antagonist, did not block the neuroprotective effects of GLNVA. GLNVA reduced LPS-activated microglia-mediated neuronal death, but it lacked protection in DPI-pretreated cultures. GLNVA also decreased LPS activated microglia induced overexpression of neuronal nitric-oxide synthase (nNOS) and glycoprotein 91 phagocyte oxidase (gp91(phox)) on SH-SY5Y cells. Pretreatment of BV-2 cells with GLNVA diminished LPS-induced nitric oxide production, overexpression of inducible nitric-oxide synthase (iNOS), and gp91(phox) and intracellular reactive oxygen species (iROS). GLNVA also reduced cyclooxygenase (COX)-2 expression, inhibitor of nuclear factor (NF)-kappaB (IkappaB)alpha/IkappaBbeta degradation, NF-kappaB activation, and the overproduction of tumor necrosis factor-alpha, interleukin (IL)-1beta, and prostaglandin E2 in BV-2 cells. However, GLNVA augmented anti-inflammatory cytokine IL-10 production on LPS-stimulated BV-2 cells. Furthermore, in 6-OHDA-treated SH-SY5Y cells, GLNVA rescued the changes in condensed nuclear and apoptotic bodies, prevented the decrease in mitochondrial membrane potential, and reduced cells death. GLNVA also suppressed accumulation of iROS and up-regulated heme oxygenase-1 expression. 6-OHDA-induced overexpression of nNOS, i

  14. Comprehensive analysis of interactions between the Src-associated protein in mitosis of 68 kDa and the human Src-homology 3 proteome.

    Directory of Open Access Journals (Sweden)

    Benedikt Asbach

    Full Text Available The protein Sam68 is involved in many cellular processes such as cell-cycle regulation, RNA metabolism, or signal transduction. Sam68 comprises a central RNA-binding domain flanked by unstructured tails containing docking sites for signalling proteins including seven proline-rich sequences (denoted P0 to P6 as potential SH3-domain binding motifs. To comprehensively assess Sam68-SH3-interactions, we applied a phage-display screening of a library containing all approx. 300 human SH3 domains. Thereby we identified five new (from intersectin 2, the osteoclast stimulating factor OSF, nephrocystin, sorting nexin 9, and CIN85 and seven already known high-confidence Sam68-ligands (mainly from the Src-kinase family, as well as several lower-affinity binders. Interaction of the high-affinity Sam68-binders was confirmed in independent assays in vitro (phage-ELISA, GST-pull-down and in vivo (FACS-based FRET-analysis with CFP- and YFP-tagged proteins. Fine-mapping analyses with peptides established P0, P3, P4, and P5 as exclusive docking-sites for SH3 domains, which showed varying preferences for these motifs. Mutational analyses identified individual residues within the proline-rich motifs being crucial for the interactions. Based on these data, we generated a Sam68-mutant incapable of interacting with SH3 domains any more, as subsequently demonstrated by FRET-analyses. In conclusion, we present a thorough characterization of Sam68's interplay with the SH3 proteome. The observed interaction between Sam68 and OSF complements the known Sam68-Src and OSF-Src interactions. Thus, we propose, that Sam68 functions as a classical scaffold protein in this context, assembling components of an osteoclast-specific signalling pathway.

  15. Ursodeoxycholic acid suppresses mitochondria-dependent programmed cell death induced by sodium nitroprusside in SH-SY5Y cells

    International Nuclear Information System (INIS)

    Chun, Hong Sung; Low, Walter C.

    2012-01-01

    Although ursodeoxycholic acid (UDCA) and its highly water-soluble formula (Yoo's solution; YS) have been shown to prevent neuronal damage, the effects of UDCA or YS against Parkinson's disease (PD)-related dopaminergic cell death has not been studied. This study investigated the protective effects of UDCA and YS on sodium nitroprusside (SNP)-induced cytotoxicity in human dopaminergic SH-SY5Y cells. Both UDCA (50–200 μM) and YS (100–200 μM) dose-dependently prevented SNP (1 mM)-induced cell death. Results showed that both UDCA and YS effectively attenuated the production of total reactive oxygen species (ROS), peroxynitrite (ONOO − ) and nitric oxide (NO), and markedly inhibited the mitochondrial membrane potential (MMP) loss and intracellular reduced glutathione (GSH) depletion. SNP-induced programmed cell death events, such as nuclear fragmentation, caspase-3/7 and -9 activation, Bcl-2/Bax ratio decrease, and cytochrome c release, were significantly attenuated by both UDCA and YS. Furthermore, selective inhibitor of phosphatidylinositiol-3-kinase (PI3K), LY294002, and Akt/PKB inhibitor, triciribine, reversed the preventive effects of UDCA on the SNP-induced cytotoxicity and Bax translocation. These results suggest that UDCA can protect SH-SY5Y cells under programmed cell death process by regulating PI3K-Akt/PKB pathways.

  16. Synthesis and in vitro cytotoxicity of mPEG-SH modified gold nanorods

    Science.gov (United States)

    Didychuk, Candice L.; Ephrat, Pinhas; Belton, Michelle; Carson, Jeffrey J. L.

    2008-02-01

    Plasmon-resonant gold nanorods show great potential as an agent for contrast-enhanced biomedical imaging or for phototherapeutics. This is primarily due to the high molar extinction coefficient at the absorption maximum and the dependence of the wavelength of the absorption maximum on the aspect ratio, which is tunable in the near-infrared (NIR) during synthesis. Although gold nanorods can be produced in high-yield through the seed-mediated growth technique, the presence of residual cetyltrimethylammonium bromide (CTAB), a stabilizing surfactant required for nanorod growth, interferes with cell function and causes cytotoxicity. To overcome this potential obstacle to in vivo use, we synthesized gold nanorods and conjugated them to a methoxy (polyethylene glycol)-thiol (mPEG (5000)-SH). This approach yielded mPEG-SH modified gold nanorods with optical and morphometric properties that were similar to raw (CTAB) nanorods. Both the CTAB and mPEG-SH nanorods were tested for cytotoxicity against the HL-60 human leukemia cell line by trypan blue exclusion, and the mPEG-SH modified gold nanorods were also tested against a rat insulinoma (RIN-38) and squamous cell carcinoma (SCCVII) cell line. Cells incubated for 24 h with the mPEG-SH modified nanorods had little change in cell viability compared to cells incubated with vehicle alone. This was in contrast to cytotoxicity of CTAB nanorods on HL-60 cells. These results suggest that mPEG-SH modified gold nanorods are better suited for cell loading protocols and injection into animals and facilitate their use for imaging and phototherapeutic purposes.

  17. Dovitinib Acts As a Novel Radiosensitizer in Hepatocellular Carcinoma by Targeting SHP-1/STAT3 Signaling

    Energy Technology Data Exchange (ETDEWEB)

    Huang, Chao-Yuan [Department of Oncology, National Taiwan University Hospital and National Taiwan University College of Medicine, Taipei, Taiwan (China); Department of Radiological Technology, Yuanpei University, Hsinchu, Taiwan (China); Tai, Wei-Tien [Department of Medical Research, National Taiwan University Hospital, Taipei, Taiwan (China); National Center of Excellence for Clinical Trial and Research, National Taiwan University Hospital, Taipei, Taiwan (China); Wu, Szu-Yuan [Institute of Toxicology, College of Medicine, National Taiwan University, Taipei, Taiwan (China); Department of Radiation Oncology, Wan Fang Hospital, Taipei Medical University, Taipei, Taiwan (China); Department of Internal Medicine, School of Medicine, College of Medicine, Taipei Medical University, Taipei, Taiwan (China); Department of Biotechnology, Hungkuang University, Taichung, Taiwan (China); Shih, Chih-Ting; Chen, Min-Hsuan; Tsai, Ming-Hsien [Department of Medical Research, National Taiwan University Hospital, Taipei, Taiwan (China); Kuo, Chiung-Wen [Department of Medical Imaging and Radiological Technology, Yuanpei University of Medical Technology, Hsinchu, Taiwan (China); Shiau, Chung-Wai [Institute of Biopharmaceutical Sciences, National Yang-Ming University, Taipei, Taiwan (China); Hung, Man-Hsin, E-mail: cindybeaty@gmail.com [Division of Medical Oncology, Department of Oncology, Taipei Veterans General Hospital, Taipei, Taiwan (China); Division of Hematology and Oncology, Department of Medicine, Taipei Veterans General Hospital, Taipei, Taiwan (China); Program in Molecular Medicine, School of Life Science, National Yang-Ming University, Taipei, Taiwan (China); School of Medicine, National Yang-Ming University, Taipei, Taiwan (China); Chen, Kuen-Feng, E-mail: kfchen1970@ntu.edu.tw [Department of Medical Research, National Taiwan University Hospital, Taipei, Taiwan (China); National Center of Excellence for Clinical Trial and Research, National Taiwan University Hospital, Taipei, Taiwan (China)

    2016-06-01

    Purpose: Hepatocellular carcinoma (HCC) is among the most lethal human malignancies, and curative therapy is not an option for most patients. There is growing interest in the potential benefit of combining targeted therapies with radiation therapy (RT). This study aimed to characterize the efficacy and mechanism of an investigational drug, dovitinib, used in combination with RT. Methods and Materials: HCC cell lines (PLC5, Hep3B, SK-Hep1, HA59T, and Huh-7) were treated with dovitinib, RT, or both, and apoptosis and signal transduction were analyzed. Results: Dovitinib treatment resulted in Src homology region 2 (SH2) domain-containing phosphatase 1 (SHP-1)-mediated downregulation of p-STAT3 and promoted potent apoptosis of HCC cells. Ectopic expression of STAT3, or inhibition of SHP-1, diminished the effects of dovitinib on HCC cells. By ectopic expression and purified recombinant proteins of various mutant forms of SHP-1, the N-SH2 domain of SHP-1 was found to be required for dovitinib treatment. Overexpression of STAT3 or catalytic-dead mutant SHP-1 restored RT-induced reduction of HCC cell survival. Conversely, ectopic expression of SHP-1 or activation of SHP-1 by dovitinib enhanced the effects of RT against HCC in vitro and in vivo. Conclusions: SHP-1/STAT3 signaling is critically associated with the radiosensitivity of HCC cells. Combination therapy with RT and the SHP-1 agonist, such as dovitinib, resulted in enhanced in vitro and in vivo anti-HCC effects.

  18. Dovitinib Acts As a Novel Radiosensitizer in Hepatocellular Carcinoma by Targeting SHP-1/STAT3 Signaling

    International Nuclear Information System (INIS)

    Huang, Chao-Yuan; Tai, Wei-Tien; Wu, Szu-Yuan; Shih, Chih-Ting; Chen, Min-Hsuan; Tsai, Ming-Hsien; Kuo, Chiung-Wen; Shiau, Chung-Wai; Hung, Man-Hsin; Chen, Kuen-Feng

    2016-01-01

    Purpose: Hepatocellular carcinoma (HCC) is among the most lethal human malignancies, and curative therapy is not an option for most patients. There is growing interest in the potential benefit of combining targeted therapies with radiation therapy (RT). This study aimed to characterize the efficacy and mechanism of an investigational drug, dovitinib, used in combination with RT. Methods and Materials: HCC cell lines (PLC5, Hep3B, SK-Hep1, HA59T, and Huh-7) were treated with dovitinib, RT, or both, and apoptosis and signal transduction were analyzed. Results: Dovitinib treatment resulted in Src homology region 2 (SH2) domain-containing phosphatase 1 (SHP-1)-mediated downregulation of p-STAT3 and promoted potent apoptosis of HCC cells. Ectopic expression of STAT3, or inhibition of SHP-1, diminished the effects of dovitinib on HCC cells. By ectopic expression and purified recombinant proteins of various mutant forms of SHP-1, the N-SH2 domain of SHP-1 was found to be required for dovitinib treatment. Overexpression of STAT3 or catalytic-dead mutant SHP-1 restored RT-induced reduction of HCC cell survival. Conversely, ectopic expression of SHP-1 or activation of SHP-1 by dovitinib enhanced the effects of RT against HCC in vitro and in vivo. Conclusions: SHP-1/STAT3 signaling is critically associated with the radiosensitivity of HCC cells. Combination therapy with RT and the SHP-1 agonist, such as dovitinib, resulted in enhanced in vitro and in vivo anti-HCC effects.

  19. Morphological Differentiation Towards Neuronal Phenotype of SH-SY5Y Neuroblastoma Cells by Estradiol, Retinoic Acid and Cholesterol

    OpenAIRE

    Teppola, Heidi; Sarkanen, Jertta-Riina; Jalonen, Tuula O.; Linne, Marja-Leena

    2015-01-01

    Human SH-SY5Y neuroblastoma cells maintain their potential for differentiation and regression in culture conditions. The induction of differentiation could serve as a strategy to inhibit cell proliferation and tumor growth. Previous studies have shown that differentiation of SH-SY5Y cells can be induced by all-trans-retinoic-acid (RA) and cholesterol (CHOL). However, signaling pathways that lead to terminal differentiation of SH-SY5Y cells are still largely unknown. The goal of this study was...

  20. Morphological Differentiation Towards Neuronal Phenotype of SH-SY5Y Neuroblastoma Cells by Estradiol, Retinoic Acid and Cholesterol

    OpenAIRE

    Teppola, Heidi; Sarkanen, Jertta-Riina; Jalonen, Tuula; Linne, Marja-Leena

    2016-01-01

    Human SH-SY5Y neuroblastoma cells maintain their potential for differentiation and regression in culture conditions. The induction of differentiation could serve as a strategy to inhibit cell proliferation and tumor growth. Previous studies have shown that differentiation of SH-SY5Y cells can be induced by all-trans-retinoic-acid (RA) and cholesterol (CHOL). However, signaling pathways that lead to terminal differentiation of SH-SY5Y cells are still largely unknown. The goal of this study was...

  1. Modeling and validating HL7 FHIR profiles using semantic web Shape Expressions (ShEx).

    Science.gov (United States)

    Solbrig, Harold R; Prud'hommeaux, Eric; Grieve, Grahame; McKenzie, Lloyd; Mandel, Joshua C; Sharma, Deepak K; Jiang, Guoqian

    2017-03-01

    HL7 Fast Healthcare Interoperability Resources (FHIR) is an emerging open standard for the exchange of electronic healthcare information. FHIR resources are defined in a specialized modeling language. FHIR instances can currently be represented in either XML or JSON. The FHIR and Semantic Web communities are developing a third FHIR instance representation format in Resource Description Framework (RDF). Shape Expressions (ShEx), a formal RDF data constraint language, is a candidate for describing and validating the FHIR RDF representation. Create a FHIR to ShEx model transformation and assess its ability to describe and validate FHIR RDF data. We created the methods and tools that generate the ShEx schemas modeling the FHIR to RDF specification being developed by HL7 ITS/W3C RDF Task Force, and evaluated the applicability of ShEx in the description and validation of FHIR to RDF transformations. The ShEx models contributed significantly to workgroup consensus. Algorithmic transformations from the FHIR model to ShEx schemas and FHIR example data to RDF transformations were incorporated into the FHIR build process. ShEx schemas representing 109 FHIR resources were used to validate 511 FHIR RDF data examples from the Standards for Trial Use (STU 3) Ballot version. We were able to uncover unresolved issues in the FHIR to RDF specification and detect 10 types of errors and root causes in the actual implementation. The FHIR ShEx representations have been included in the official FHIR web pages for the STU 3 Ballot version since September 2016. ShEx can be used to define and validate the syntax of a FHIR resource, which is complementary to the use of RDF Schema (RDFS) and Web Ontology Language (OWL) for semantic validation. ShEx proved useful for describing a standard model of FHIR RDF data. The combination of a formal model and a succinct format enabled comprehensive review and automated validation. Copyright © 2017 Elsevier Inc. All rights reserved.

  2. Human kidney anion exchanger 1 interacts with kinesin family member 3B (KIF3B)

    Energy Technology Data Exchange (ETDEWEB)

    Duangtum, Natapol [Medical Molecular Biology Unit, Office for Research and Development Faculty of Medicine Siriraj Hospital, Mahidol University, Bangkok 10700 (Thailand); Department of Anatomy, Faculty of Medicine Siriraj Hospital, Mahidol University, Bangkok 10700 (Thailand); Junking, Mutita; Sawasdee, Nunghathai [Medical Molecular Biology Unit, Office for Research and Development Faculty of Medicine Siriraj Hospital, Mahidol University, Bangkok 10700 (Thailand); Cheunsuchon, Boonyarit [Department of Pathology, Faculty of Medicine Siriraj Hospital, Mahidol University, Bangkok 10700 (Thailand); Limjindaporn, Thawornchai, E-mail: limjindaporn@yahoo.com [Department of Anatomy, Faculty of Medicine Siriraj Hospital, Mahidol University, Bangkok 10700 (Thailand); Yenchitsomanus, Pa-thai, E-mail: grpye@mahidol.ac.th [Medical Molecular Biology Unit, Office for Research and Development Faculty of Medicine Siriraj Hospital, Mahidol University, Bangkok 10700 (Thailand)

    2011-09-16

    Highlights: {yields} Impaired trafficking of kAE1 causes distal renal tubular acidosis (dRTA). {yields} The interaction between kAE1 and kinesin family member 3B (KIF3B) is reported. {yields} The co-localization between kAE and KIF3B was detected in human kidney tissues. {yields} A marked reduction of kAE1 on the cell membrane was observed when KIF3B was knockdown. {yields} KFI3B plays an important role in trafficking of kAE1 to the plasma membrane. -- Abstract: Impaired trafficking of human kidney anion exchanger 1 (kAE1) to the basolateral membrane of {alpha}-intercalated cells of the kidney collecting duct leads to the defect of the Cl{sup -}/HCO{sub 3}{sup -} exchange and the failure of proton (H{sup +}) secretion at the apical membrane of these cells, causing distal renal tubular acidosis (dRTA). In the sorting process, kAE1 interacts with AP-1 mu1A, a subunit of AP-1A adaptor complex. However, it is not known whether kAE1 interacts with motor proteins in its trafficking process to the plasma membrane or not. We report here that kAE1 interacts with kinesin family member 3B (KIF3B) in kidney cells and a dileucine motif at the carboxyl terminus of kAE1 contributes to this interaction. We have also demonstrated that kAE1 co-localizes with KIF3B in human kidney tissues and the suppression of endogenous KIF3B in HEK293T cells by small interfering RNA (siRNA) decreases membrane localization of kAE1 but increases its intracellular accumulation. All results suggest that KIF3B is involved in the trafficking of kAE1 to the plasma membrane of human kidney {alpha}-intercalated cells.

  3. Human kidney anion exchanger 1 interacts with kinesin family member 3B (KIF3B)

    International Nuclear Information System (INIS)

    Duangtum, Natapol; Junking, Mutita; Sawasdee, Nunghathai; Cheunsuchon, Boonyarit; Limjindaporn, Thawornchai; Yenchitsomanus, Pa-thai

    2011-01-01

    Highlights: → Impaired trafficking of kAE1 causes distal renal tubular acidosis (dRTA). → The interaction between kAE1 and kinesin family member 3B (KIF3B) is reported. → The co-localization between kAE and KIF3B was detected in human kidney tissues. → A marked reduction of kAE1 on the cell membrane was observed when KIF3B was knockdown. → KFI3B plays an important role in trafficking of kAE1 to the plasma membrane. -- Abstract: Impaired trafficking of human kidney anion exchanger 1 (kAE1) to the basolateral membrane of α-intercalated cells of the kidney collecting duct leads to the defect of the Cl - /HCO 3 - exchange and the failure of proton (H + ) secretion at the apical membrane of these cells, causing distal renal tubular acidosis (dRTA). In the sorting process, kAE1 interacts with AP-1 mu1A, a subunit of AP-1A adaptor complex. However, it is not known whether kAE1 interacts with motor proteins in its trafficking process to the plasma membrane or not. We report here that kAE1 interacts with kinesin family member 3B (KIF3B) in kidney cells and a dileucine motif at the carboxyl terminus of kAE1 contributes to this interaction. We have also demonstrated that kAE1 co-localizes with KIF3B in human kidney tissues and the suppression of endogenous KIF3B in HEK293T cells by small interfering RNA (siRNA) decreases membrane localization of kAE1 but increases its intracellular accumulation. All results suggest that KIF3B is involved in the trafficking of kAE1 to the plasma membrane of human kidney α-intercalated cells.

  4. Presence of an SH2 domain in the actin-binding protein tensin.

    Science.gov (United States)

    Davis, S; Lu, M L; Lo, S H; Lin, S; Butler, J A; Druker, B J; Roberts, T M; An, Q; Chen, L B

    1991-05-03

    The molecular cloning of the complementary DNA coding for a 90-kilodalton fragment of tensin, an actin-binding component of focal contacts and other submembraneous cytoskeletal structures, is reported. The derived amino acid sequence revealed the presence of a Src homology 2 (SH2) domain. This domain is shared by a number of signal transduction proteins including nonreceptor tyrosine kinases such as Abl, Fps, Src, and Src family members, the transforming protein Crk, phospholipase C-gamma 1, PI-3 (phosphatidylinositol) kinase, and guanosine triphosphatase-activating protein (GAP). Like the SH2 domain found in Src, Crk, and Abl, the SH2 domain of tensin bound specifically to a number of phosphotyrosine-containing proteins from v-src-transformed cells. Tensin was also found to be phosphorylated on tyrosine residues. These findings suggest that by possessing both actin-binding and phosphotyrosine-binding activities and being itself a target for tyrosine kinases, tensin may link signal transduction pathways with the cytoskeleton.

  5. Evolution of Src Homology 2 (SH2) Domain to Recognize Sulfotyrosine.

    Science.gov (United States)

    Ju, Tong; Niu, Wei; Guo, Jiantao

    2016-09-16

    Protein tyrosine O-sulfation is considered as the most common type of post-translational tyrosine modification in nature and plays important roles in extracellular biomolecular interactions. To facilitate the mapping, biological study, and medicinal application of this type of post-translational modification, we seek to evolve a small protein scaffold that recognizes sulfotyrosine with high affinity. We focused our efforts on the engineering of the Src Homology 2 (SH2) domain, which represents the largest class of known phosphotyrosine-recognition domain in nature and has a highly evolvable binding pocket. By using phage display, we successfully engineered the SH2 domain to recognize sulfotyrosine with high affinity. The best mutant, SH2-60.1, displayed more than 1700 fold higher sulfotyrosine-binding affinity than that of the wild-type SH2 domain. We also demonstrated that the evolved SH2 domain mutants could be used to detect sulfoprotein levels on the cell surface. These evolved SH2 domain mutants can be potentially applied to the study of protein tyrosine O-sulfation with proper experimental designs.

  6. Effect of graphene oxide on undifferentiated and retinoic acid-differentiated SH-SY5Y cells line

    Science.gov (United States)

    Lv, Min; Zhang, Yujie; Liang, Le; Wei, Min; Hu, Wenbing; Li, Xiaoming; Huang, Qing

    2012-06-01

    Graphene oxide (GO), has created an unprecedented opportunity for development and application in biology, due to its abundant functional groups and well water solubility. Recently, the potential toxicity of GO in the environment and in humans has garnered more and more attention. In this paper, we systematically studied the cytotoxicity of GO nanosheets via examining the effect of GO on the morphology, viability and differentiation of a human neuroblastoma SH-SY5Y cell line, which was an ideal model used to study neuronal disease in vitro. The results suggested that GO had no obvious cytotoxicity at low concentration (cells exhibited dose- and time-dependent decreases at high concentration (>=80 μg mL-1). Moreover, GO did not induce apoptosis. Very interestingly, GO significantly enhanced the differentiation of SH-SY5Y induced-retinoic acid (RA) by evaluating neurite length and the expression of neuronal marker MAP2. These data provide a promising application for neurodegenerative diseases.

  7. Inhibition and Promotion of Pyrolysis by Hydrogen Sulfide (H2S) and Sulfanyl Radical (SH)

    DEFF Research Database (Denmark)

    Zeng, Zhe; Altarawneh, Mohammednoor; Oluwoye, Ibukun

    2016-01-01

    processes. For the three groups of hydrocarbon, Evans–Polanyi plots display linear correlations between the bond dissociation enthalpies of the abstracted hydrogens and the relevant activation energies. In the case of methane, we demonstrated that the reactivity of SH radicals toward abstracting H atoms......This study resolves the interaction of sulfanyl radical (SH) with aliphatic (C1–C4) hydrocarbons, using CBS-QB3 based calculations. We obtained the C–H dissociation enthalpies and located the weakest link in each hydrocarbon. Subsequent computations revealed that, H abstraction by SH from...... the weakest C–H sites in alkenes and alkynes, except for ethylene, appears noticeably exothermic. Furthermore, abstraction of H from propene, 1-butene, and iso-butene displays pronounced spontaneity (i.e., ΔrG° bond. However...

  8. ExoMol molecular line lists - XXVI: spectra of SH and NS

    Science.gov (United States)

    Yurchenko, Sergei N.; Bond, Wesley; Gorman, Maire N.; Lodi, Lorenzo; McKemmish, Laura K.; Nunn, William; Shah, Rohan; Tennyson, Jonathan

    2018-07-01

    Line lists for the sulphur-containing molecules SH (the mercapto radical) and NS are computed as part of the ExoMol project. These line lists consider transitions within the X2Π ground state for 32SH, 33SH, 34SH,36SH and, 32SD, and 14N32S, 14N33S, 14N34S, 14N36S, and 15N32S. Ab initio potential energy (PEC) and spin-orbit coupling (SOC) curves are computed and then improved by fitting to experimentally observed transitions. Fully ab initio dipole moment curves (DMCs) computed at high level of theory are used to produce the final line lists. For SH, our fit gives a root-mean-square (rms) error of 0.03 cm-1 between the observed (vmax = 4, Jmax = 34.5) and calculated transitions wavenumbers; this is extrapolated such that all X2Π rotational-vibrational-electronic (rovibronic) bound states are considered. For 32SH the resulting line list contains about 81 000 transitions and 2300 rovibronic states, considering levels up to vmax = 14 and Jmax = 60.5. For NS the refinement used a combination of experimentally determined frequencies and energy levels and led to an rms-fitting error of 0.002 cm-1. Each NS-calculated line list includes around 2.8 million transitions and 31 000 rovibronic states with a vibrational range up to v = 53 and rotational range up to J = 235.5, which covers up to 23 000 cm-1. Both line lists should be complete for temperatures up to 5000 K. Example spectra simulated using this line list are shown and comparisons made to the existing data in the CDMS data base. The line lists are available from the CDS (http://cdsarc.u-strasbg.fr) and ExoMol (www.exomol.com) data bases.

  9. TNF-α and IL-1β Dependent Induction of CCL3 Expression by Nucleus Pulposus Cells Promotes Macrophage Migration through CCR1

    Science.gov (United States)

    Wang, Jianru; Tian, Ye; Phillips, Kate L.E.; Chiverton, Neil; Haddock, Gail; Bunning, Rowena A.; Cross, Alison K.; Shapiro, Irving M.; LeMaitre, Christine L.; Risbud, Makarand V.

    2012-01-01

    Objective To investigate TNF-α and IL-1β regulation of CCL3 expression in nucleus pulposus (NP) cells and in macrophage migration. Methods qRT-PCR and immunohistochemistry were used to measure CCL3 expression in NP cells. Transfections were used to determine the role of NF-κB, C/EBP-β and MAPK on cytokine mediated CCL3 promoter activity. Effect of NP-conditioned medium on macrophage migration was measured using a transwell system. Results An increase in CCL3 expression and promoter activity was observed in NP cells after TNF-α or IL-1β treatment. Treatment of cells with NF-κB and MAPK inhibitors abolished the effect of the cytokines on CCL3 expression. The inductive effect of p65 and C/EBP-β on CCL3 promoter was confirmed through gain- and loss-of-function studies. Noteworthy, co-transfection of p50 completely blocked cytokine and p65 dependent induction. In contrast, c-Rel and RelB had little effect on promoter activity. Lentiviral transduction with Sh-p65 and Sh-Ikkβ significantly decreased TNF-α dependent increase in CCL3 expression. Analysis of degenerate human NP tissues showed that CCL3, but not CCL4 expression correlated positively with the grade of tissue degeneration. Importantly, treatment of macrophages with conditioned medium of NP cells treated with TNF-α or IL-1β promoted their migration; pretreatment of macrophages with antagonist to CCR1, primary receptor for CCL3 and CCL4, blocked cytokine mediated migration. Conclusions By controlling the activation of MAPK, NF-κB and C/EBPβ signaling, TNF-α and IL-1β modulate the expression of CCL3 in NP cells. The CCL3-CCR1 axis may play an important role in promoting macrophage infiltration in degenerate, herniated discs. PMID:23233369

  10. Caspase Activation of p21-Activated Kinase 2 Occurs During Cisplatin-Induced Apoptosis of SH-SY5Y Neuroblastoma Cells and in SH-SY5Y Cell Culture Models of Alzheimer’s and Parkinson’s Disease

    Directory of Open Access Journals (Sweden)

    Jerry W. Marlin

    2010-04-01

    Full Text Available p21-activated kinase 2 (PAK-2 appears to have a dual function in the regulation of cell survival and cell death. Activation of full-length PAK-2 by the p21 G-proteins Rac or Cdc42 stimulates cell survival. However, PAK-2 is unique among the PAK family because it is also activated through proteolytic cleavage by caspase 3 or similar caspases to generate the constitutively active PAK-2p34 fragment. Caspase activation of PAK-2 correlates with the induction of apoptosis in response to many stimuli and recombinant expression of PAK-2p34 has been shown to stimulate apoptosis in several human cell lines. Here, we show that caspase activation of PAK-2 also occurs during cisplatin-induced apoptosis of SH-SY5Y neuroblastoma cells as well as in SH-SY5Y cell culture models for Alzheimer’s and Parkinson’s disease. Inhibition of mitochondrial complex I or of ubiquitin/proteasome-mediated protein degradation, which both appear to be involved in Parkinson’s disease, induce apoptosis and caspase activation of PAK-2 in SH-SY5Y cells. Overexpression of the amyloid precursor protein, which results in accumulation and aggregation of β-amyloid peptide, the main component of β-amyloid plaques in Alzheimer’s disease, also induces apoptosis and caspase activation of PAK-2 in SH-SY5Y cells. Expression of the PAK-2 regulatory domain inhibits caspase-activated PAK-2p34 and prevents apoptosis in 293T human embryonic kidney cells, indicating that caspase activation of PAK-2 is directly involved in the apoptotic response. This is the first evidence that caspase activation of PAK-2 correlates with apoptosis in cell culture models of Alzheimer’s and Parkinson’s disease and that selective inhibition of caspase-activated PAK-2p34 could prevent apoptosis.

  11. Differential expression profiling of membrane proteins by quantitative proteomics in a human mesenchymal stem cell line undergoing osteoblast differentiation

    DEFF Research Database (Denmark)

    Foster, Leonard J; Zeemann, Patricia A; Li, Chen

    2005-01-01

    in a cell model of hMSCs established by overexpression of human telomerase reverse-transcriptase gene. We identified 463 unique proteins with extremely high confidence, including all known markers of hMSCs (e.g., SH3 [CD71], SH2 [CD105], CD166, CD44, Thy1, CD29, and HOP26 [CD63]) among 148 integral membrane...

  12. Paracrine Maturation and Migration of SH-SY5Y Cells by Dental Pulp Stem Cells.

    Science.gov (United States)

    Gervois, P; Wolfs, E; Dillen, Y; Hilkens, P; Ratajczak, J; Driesen, R B; Vangansewinkel, T; Bronckaers, A; Brône, B; Struys, T; Lambrichts, I

    2017-06-01

    Neurological disorders are characterized by neurodegeneration and/or loss of neuronal function, which cannot be adequately repaired by the host. Therefore, there is need for novel treatment options such as cell-based therapies that aim to salvage or reconstitute the lost tissue or that stimulate host repair. The present study aimed to evaluate the paracrine effects of human dental pulp stem cells (hDPSCs) on the migration and neural maturation of human SH-SY5Y neuroblastoma cells. The hDPSC secretome had a significant chemoattractive effect on SH-SY5Y cells as shown by a transwell assay. To evaluate neural maturation, SH-SY5Y cells were first induced toward neuronal cells, after which they were exposed to the hDPSC secretome. In addition, SH-SY5Y cells subjected to the hDPSC secretome showed increased neuritogenesis compared with nonexposed cells. Maturated cells were shown to increase immune reactivity for neuronal markers compared with controls. Ultrastructurally, retinoic acid (RA) signaling and subsequent exposure to the hDPSC secretome induced a gradual rise in metabolic activity and neuronal features such as multivesicular bodies and cytoskeletal elements associated with cellular communication. In addition, electrophysiological recordings of differentiating cells demonstrated a transition toward a neuronal electrophysiological profile based on the maximum tetrodotoxin (TTX)-sensitive, Na + current. Moreover, conditioned medium (CM)-hDPSC-maturated SH-SY5Y cells developed distinct features including, Cd 2+ -sensitive currents, which suggests that CM-hDPSC-maturated SH-SY5Y acquired voltage-gated Ca 2+ channels. The results reported in this study demonstrate the potential of hDPSCs to support differentiation and recruitment of cells with neuronal precursor characteristics in a paracrine manner. Moreover, this in vitro experimental design showed that the widely used SH-SY5Y cell line can improve and simplify the preclinical in vitro research on the molecular

  13. The lipid fraction of human milk initiates adipocyte differentiation in 3T3-L1 cells.

    Science.gov (United States)

    Fujisawa, Yasuko; Yamaguchi, Rie; Nagata, Eiko; Satake, Eiichiro; Sano, Shinichiro; Matsushita, Rie; Kitsuta, Kazunobu; Nakashima, Shinichi; Nakanishi, Toshiki; Nakagawa, Yuichi; Ogata, Tsutomu

    2013-09-01

    The prevalence of childhood obesity has increased worldwide over the past decade. Despite evidence that human milk lowers the risk of childhood obesity, the mechanism is not fully understood. We investigated the direct effect of human milk on differentiation of 3T3-L1 preadipocytes. 3T3-L1 preadipocytes were treated with donated human milk only or the combination of the standard hormone mixture; insulin, dexamethasone (DEX), and 3-isobututyl-1-methylxanthine (IBMX). Furthermore, the induction of preadipocyte differentiation by extracted lipids from human milk was tested in comparison to the cells treated with lipid extracts from infant formula. Adipocyte differentiation, specific genes as well as formation of lipid droplets were examined. We clearly show that lipids present in human milk initiate 3T3-L1 preadipocyte differentiation. In contrast, this effect was not observed in response to lipids present in infant formula. The initiation of preadipocyte differentiation by human milk was enhanced by adding the adipogenic hormone, DEX or insulin. The expression of late adipocyte markers in Day 7 adipocytes that have been induced into differentiation with human milk lipid extracts was comparable to those in control cells initiated by a standard adipogenic hormone cocktail. These results demonstrate that human milk contains bioactive lipids that can initiate preadipocyte differentiation in the absence of the standard adipogenic compounds via a unique pathway. Copyright © 2013 Elsevier Ltd. All rights reserved.

  14. Suppression of human breast tumors in NOD/SCID mice by CD44 shRNA gene therapy combined with doxorubicin treatment

    Directory of Open Access Journals (Sweden)

    Pham PV

    2012-05-01

    Full Text Available Phuc Van Pham1, Ngoc Bich Vu1, Thuy Thanh Duong1, Tam Thanh Nguyen1, Nhung Hai Truong1, Nhan Lu Chinh Phan1, Tue Gia Vuong1, Viet Quoc Pham1, Hoang Minh Nguyen1, Kha The Nguyen1, Nhung Thi Nguyen1, Khue Gia Nguyen1, Lam Tan Khat1, Dong Van Le2, Kiet Dinh Truong1, Ngoc Kim Phan11Laboratory of Stem Cell Research and Application, University of Science, Vietnam National University, HCM City, 2Military Medical University, Ha Noi, VietnamBackground: Breast cancer stem cells with a CD44+CD24- phenotype are the origin of breast tumors. Strong CD44 expression in this population indicates its important role in maintaining the stem cell phenotype. Previous studies show that CD44 down-regulation causes CD44+CD24- breast cancer stem cells to differentiate into non-stem cells that are sensitive to antitumor drugs and lose many characteristics of the original cells. In this study, we determined tumor suppression in non-obese severe combined immunodeficiency mice using CD44 shRNA therapy combined with doxorubicin treatment.Methods: Tumor-bearing non-obese severe combined immunodeficiency mice were established by injection of CD44+CD24- cells. To track CD44+CD24- cells, green fluorescence protein was stably transduced using a lentiviral vector prior to injection into mice. The amount of CD44 shRNA lentiviral vector used for transduction was based on CD44 down-regulation by in vitro CD44 shRNA transduction. Mice were treated with direct injection of CD44 shRNA lentiviral vector into tumors followed by doxorubicin administration after 48 hours. The effect was evaluated by changes in the size and weight of tumors compared with that of the control.Results: The combination of CD44 down-regulation and doxorubicin strongly suppressed tumor growth with significant differences in tumor sizes and weights compared with that of CD44 down-regulation or doxorubicin treatment alone. In the combination of CD44 down-regulation and doxorubicin group, the tumor weight was

  15. Vasoactive intestinal peptide-induced neurite remodeling in human neuroblastoma SH-SY5Y cells implicates the Cdc42 GTPase and is independent of Ras-ERK pathway

    International Nuclear Information System (INIS)

    Alleaume, Celine; Eychene, Alain; Harnois, Thomas; Bourmeyster, Nicolas; Constantin, Bruno; Caigneaux, Evelyne; Muller, Jean-Marc; Philippe, Michel

    2004-01-01

    Vasoactive intestinal peptide (VIP) is known to regulate proliferation or differentiation in normal and tumoral cells. SH-SY5Y is a differentiated cell subclone derived from the SK-N-SH human neuroblastoma cell line and possess all the components for an autocrine action of VIP. In the present study, we investigated the morphological changes and intracellular signaling pathways occurring upon VIP treatment of SH-SY5Y cells. VIP induced an early remodeling of cell projections: a branched neurite network spread out and prominent varicosities developed along neurites. Although activated by VIP, the Ras/ERK pathway was not required for the remodeling process. In contrast, pull-down experiments revealed a strong Cdc42 activation by VIP while expression of a dominant-negative Cdc42 prevented the VIP-induced neurite changes, suggesting an important role for this small GTPase in the process. These data provide the first evidence for a regulation of the activity of Rho family GTPases by VIP and bring new insights in the signaling pathways implicated in neurite remodeling process induced by VIP in neuroblastoma cells

  16. Introduction: History of SH2 Domains and Their Applications.

    Science.gov (United States)

    Liu, Bernard A; Machida, Kazuya

    2017-01-01

    The Src Homology 2 (SH2) domain is the prototypical protein interaction module that lies at the heart of phosphotyrosine signaling. Since its serendipitous discovery, there has been a tremendous advancement in technologies and an array of techniques available for studying SH2 domains and phosphotyrosine signaling. In this chapter, we provide a glimpse of the history of SH2 domains and describe many of the tools and techniques that have been developed along the way and discuss future directions for SH2 domain studies. We highlight the gist of each chapter in this volume in the context of: the structural biology and phosphotyrosine binding; characterizing SH2 specificity and generating prediction models; systems biology and proteomics; SH2 domains in signal transduction; and SH2 domains in disease, diagnostics, and therapeutics. Many of the individual chapters provide an in-depth approach that will allow scientists to interrogate the function and role of SH2 domains.

  17. Pinocembrin Suppresses H2O2-Induced Mitochondrial Dysfunction by a Mechanism Dependent on the Nrf2/HO-1 Axis in SH-SY5Y Cells.

    Science.gov (United States)

    de Oliveira, Marcos Roberto; da Costa Ferreira, Gustavo; Brasil, Flávia Bittencourt; Peres, Alessandra

    2018-02-01

    Mitochondria are susceptible to redox impairment, which has been associated with neurodegeneration. These organelles are both a source and target of reactive species. In that context, there is increasing interest in finding natural compounds that modulate mitochondrial function and mitochondria-related signaling in order to prevent or to treat diseases involving mitochondrial impairment. Herein, we investigated whether and how pinocembrin (PB) would prevent mitochondrial dysfunction elicited by the exposure of human neuroblastoma SH-SY5Y cells to hydrogen peroxide (H 2 O 2 ). PB (25 μM) was administrated for 4 h before H 2 O 2 treatment (300 μM for 24 h). PB prevented H 2 O 2 -induced loss of cell viability mitochondrial depolarization in SH-SY5Y cells. PB also attenuated redox impairment in mitochondrial membranes. The production of superoxide anion radical (O 2 -• ) and nitric oxide (NO • ) was alleviated by PB in cells exposed to H 2 O 2 . PB suppressed the H 2 O 2 -induced inhibition of the tricarboxylic acid (TCA) cycle enzymes aconitase, α-ketoglutarate dehydrogenase, and succinate dehydrogenase. Furthermore, PB induced anti-inflammatory effects by abolishing the H 2 O 2 -dependent activation of the nuclear factor-κB (NF-κB) and upregulation of interleukin-1β (IL-1β) and tumor necrosis factor-α (TNF-α). The PB-induced antioxidant and anti-inflammatory effects are dependent on the heme oxygenate-1 (HO-1) enzyme and on the activation of the transcription factor nuclear factor erythroid 2-related factor 2 (Nrf2), since HO-1 inhibition (with 0.5 μM ZnPP IX) or Nrf2 silencing (with small interfering RNA (siRNA)) abolished the effects of PB. Overall, PB afforded cytoprotection by the Nrf2/HO-1 axis in H 2 O 2 -treated SH-SY5Y cells.

  18. Distinctive functions of Syk N-terminal and C-terminal SH2 domains in the signaling cascade elicited by oxidative stress in B cells.

    Science.gov (United States)

    Ding, J; Takano, T; Hermann, P; Gao, S; Han, W; Noda, C; Yanagi, S; Yamamura, H

    2000-05-01

    Syk plays a crucial role in the transduction of oxidative stress signaling. In this paper, we investigated the roles of Src homology 2 (SH2) domains of Syk in oxidative stress signaling, using Syk-negative DT40 cells expressing the N- or C-terminal SH2 domain mutant [mSH2(N) or mSH2(C)] of Syk. Tyrosine phosphorylation of Syk in cells expressing mSH2(N) Syk after H(2)O(2) treatment was higher than that in cells expressing wild-type Syk or mSH2(C) Syk. The tyrosine phosphorylation of wild-type Syk and mSH2(C) Syk, but not that of mSH2(N), was sensitive to PP2, a specific inhibitor of Src-family protein-tyrosine kinase. In oxidative stress, the C-terminal SH2 domain of Syk was demonstrated to be required for induction of tyrosine phosphorylation of cellular proteins, phospholipase C (PLC)-gamma2 phosphorylation, inositol 1,4, 5-triphosphate (IP(3)) generation, Ca(2)(+) release from intracellular stores, and c-Jun N-terminal kinase activation. In contrast, in mSH2(N) Syk-expressing cells, tyrosine phosphorylation of intracellular proteins including PLC-gamma2 was markedly induced in oxidative stress. The enhanced phosphorylation of mSH2(N) Syk and PLC-gamma2, however, did not link to Ca(2)(+) mobilization from intracellular pools and IP(3) generation. Thus, the N- and C-terminal SH2 domains of Syk possess distinctive functions in oxidative stress signaling.

  19. 70Z/3 Cbl induces PLC gamma 1 activation in T lymphocytes via an alternate Lat- and Slp-76-independent signaling mechanism.

    Science.gov (United States)

    Graham, Laurie J; Verí, Maria-Concetta; DeBell, Karen E; Noviello, Cristiana; Rawat, Rashmi; Jen, Sandy; Bonvini, Ezio; Rellahan, Barbara

    2003-04-24

    The oncoprotein 70Z/3 Cbl signals in an autonomous fashion or through blockade of endogenous c-Cbl, a negative regulator of signaling. The mechanism of 70Z/3 Cbl-induced signaling was investigated by comparing the molecular requirements for 70Z/3 Cbl- and TCR-induced phospholipase C gamma 1 (PLC gamma 1) activation. 70Z/3 Cbl-induced PLC gamma 1 tyrosine phosphorylation required, in addition to the PLC gamma 1 N-terminal SH2 domain, the C-terminal SH2 and SH3 domains that were dispensable for TCR-induced phosphorylation. Deletion of the leucine zipper of 70Z/3 Cbl did not eliminate 70Z/3 Cbl-induced PLC gamma 1 phosphorylation, suggesting that blockage of c-Cbl via dimerization with 70Z/3 Cbl cannot fully explain 70Z/3 Cbl activating characteristics. The complete elimination of PLC gamma 1 phosphorylation required deleting the SH3 domain-binding region of 70Z/3 Cbl, consistent with 70Z/3 Cbl binding the PLC gamma 1 SH3 domain. 70Z/3 Cbl-induced PLC gamma 1 phosphorylation required Zap-70, as for the TCR, and the tyrosine kinase binding domain of 70Z/3 Cbl, which binds Zap-70, but did not require PLC gamma 1 binding to Lat, a crucial interaction in TCR-induced PLC gamma 1 phosphorylation. Furthermore, 70Z/3 Cbl-induced activation of NFAT, a PLC gamma 1/Ca(2+)-dependent transcriptional event, required Zap-70, but was independent of Slp-76, an adapter required for TCR-induced NFAT activation. These results suggest that 70Z/3 Cbl and PLC gamma 1 form a TCR-, Lat- and Slp-76-independent complex that leads to PLC gamma 1 phosphorylation and activation.

  20. Molecular epidemiology of the SH (small hydrophobic) gene of human respiratory syncytial virus (HRSV), over 2 consecutive years.

    Science.gov (United States)

    Lima, Hildenêr Nogueira; Botosso, Viviane Fongaro; Oliveira, Danielle Bruna Leal; Campos, Angélica Cristine de Almeida; Leal, Andrea Lima; Silva, Tereza Souza; Bosso, Patrícia Alves Ramos; Moraes, Claudia Trigo Pedroso; Filho, Claudionor Gomes da Silva; Vieira, Sandra Elisabete; Gilio, Alfredo Elias; Stewien, Klaus Eberhard; Durigon, Edison Luiz

    2012-01-01

    Human respiratory syncytial virus (HRSV) strains were isolated from nasopharyngeal aspirates collected from 965 children between 2004 and 2005, yielding 424 positive samples. We sequenced the small hydrophobic protein (SH) gene of 117 strains and compared them with other viruses identified worldwide. Phylogenetic analysis showed a low genetic variability among the isolates but allowed us to classify the viruses into different genotypes for both groups, HRSVA and HRSVB. It is also shown that the novel BA-like genotype was well segregated from the others, indicating that the mutations are not limited to the G gene. Copyright © 2011 Elsevier B.V. All rights reserved.

  1. Distinct human and mouse membrane trafficking systems for sweet taste receptors T1r2 and T1r3.

    Science.gov (United States)

    Shimizu, Madoka; Goto, Masao; Kawai, Takayuki; Yamashita, Atsuko; Kusakabe, Yuko

    2014-01-01

    The sweet taste receptors T1r2 and T1r3 are included in the T1r taste receptor family that belongs to class C of the G protein-coupled receptors. Heterodimerization of T1r2 and T1r3 is required for the perception of sweet substances, but little is known about the mechanisms underlying this heterodimerization, including membrane trafficking. We developed tagged mouse T1r2 and T1r3, and human T1R2 and T1R3 and evaluated membrane trafficking in human embryonic kidney 293 (HEK293) cells. We found that human T1R3 surface expression was only observed when human T1R3 was coexpressed with human T1R2, whereas mouse T1r3 was expressed without mouse T1r2 expression. A domain-swapped chimera and truncated human T1R3 mutant showed that the Venus flytrap module and cysteine-rich domain (CRD) of human T1R3 contain a region related to the inhibition of human T1R3 membrane trafficking and coordinated regulation of human T1R3 membrane trafficking. We also found that the Venus flytrap module of both human T1R2 and T1R3 are needed for membrane trafficking, suggesting that the coexpression of human T1R2 and T1R3 is required for this event. These results suggest that the Venus flytrap module and CRD receive taste substances and play roles in membrane trafficking of human T1R2 and T1R3. These features are different from those of mouse receptors, indicating that human T1R2 and T1R3 are likely to have a novel membrane trafficking system.

  2. Compartmentalized self-replication (CSR) selection of Thermococcus litoralis Sh1B DNA polymerase for diminished uracil binding.

    Science.gov (United States)

    Tubeleviciute, Agne; Skirgaila, Remigijus

    2010-08-01

    The thermostable archaeal DNA polymerase Sh1B from Thermococcus litoralis has a typical uracil-binding pocket, which in nature plays an essential role in preventing the accumulation of mutations caused by cytosine deamination to uracil and subsequent G-C base pair transition to A-T during the genomic DNA replication. The uracil-binding pocket recognizes and binds uracil base in a template strand trapping the polymerase. Since DNA replication stops, the repair systems have a chance to correct the promutagenic event. Archaeal family B DNA polymerases are employed in various PCR applications. Contrary to nature, in PCR the uracil-binding property of archaeal polymerases is disadvantageous and results in decreased DNA amplification yields and lowered sensitivity. Furthermore, in diagnostics qPCR, RT-qPCR and end-point PCR are performed using dNTP mixtures, where dTTP is partially or fully replaced by dUTP. Uracil-DNA glycosylase treatment and subsequent heating of the samples is used to degrade the DNA containing uracil and prevent carryover contamination, which is the main concern in diagnostic laboratories. A thermostable archaeal DNA polymerase with the abolished uracil binding would be a highly desirable and commercially interesting product. An attempt to disable uracil binding in DNA polymerase Sh1B from T. litoralis by generating site-specific mutants did not yield satisfactory results. However, a combination of random mutagenesis of the whole polymerase gene and compartmentalized self-replication was successfully used to select variants of thermostable Sh1B polymerase capable of performing PCR with dUTP instead of dTTP.

  3. Sinomenine Hydrochloride Inhibits the Metastasis of Human Glioblastoma Cells by Suppressing the Expression of Matrix Metalloproteinase-2/-9 and Reversing the Endogenous and Exogenous Epithelial-Mesenchymal Transition.

    Science.gov (United States)

    Jiang, Yumao; Jiao, Yue; Liu, Yang; Zhang, Meiyu; Wang, Zhiguo; Li, Yujuan; Li, Tao; Zhao, Xiaoliang; Wang, Danqiao

    2018-03-14

    As shown in our previous study, sinomenine hydrochloride (SH), the major bioactive alkaloid isolated from Sinomenium acutum Rehd. et Wils. (Fam. Menispermaceae ), initiates the autophagy-mediated death of human glioblastoma cells by generating reactive oxygen species and activating the autophagy-lysosome pathway. However, its effects on the migration and invasion of human glioblastoma cells have not yet been elucidated. Therefore, human glioblastoma U87 and SF767 cells were treated with SH (0.125 and 0.25 mM) for 24 h, and cell migration and invasion were assessed using scratch wound healing, migration and invasion assays. SH promoted G0/G1 phase arrest, inhibited the migration and invasion of the two cell lines, suppressed the activation of nuclear factor kappa B (NFκB) and the expression of matrix metalloproteinase (MMP)-2/-9, triggered endoplasmic reticulum (ER) stress, reversed the exogenous epithelial-mesenchymal transition (EMT) induced by the inflammatory microenvironment and the endogenous EMT. Additionally, NFκB p65 overexpression blocked the SH-mediated inhibitory effects on MMP-2/-9 expression and cell invasion. SH-induced autophagy was reduced in CCAAT/enhancer binding protein (C/EBP) homologous protein (CHOP) or autophagy-related 5 (ATG5)-silenced human glioblastoma cells and cells treated with 4-phenylbutyric acid (4-PBA) or 3-methyladenine (3-MA), as shown by the decreased levels of the microtubule-associated protein light chain 3B (LC3B)-II and autophagic vacuoles (AVs) stained with monodansylcadaverine (MDC), respectively. Moreover, knockdown of CHOP or ATG5 and treatment with 4-PBA or 3-MA abolished the SH-mediated inhibition of mesenchymal markers (vimentin, Snail and Slug) expression and cell invasion, respectively. Importantly, SH also regulated the above related pathways in nude mice. Based on these findings, SH inhibited cell proliferation by inducing cell cycle arrest, and attenuated the metastasis of U87 and SF767 cells by suppressing MMP

  4. Sinomenine Hydrochloride Inhibits the Metastasis of Human Glioblastoma Cells by Suppressing the Expression of Matrix Metalloproteinase-2/-9 and Reversing the Endogenous and Exogenous Epithelial-Mesenchymal Transition

    Directory of Open Access Journals (Sweden)

    Yumao Jiang

    2018-03-01

    Full Text Available As shown in our previous study, sinomenine hydrochloride (SH, the major bioactive alkaloid isolated from Sinomenium acutum Rehd. et Wils. (Fam. Menispermaceae, initiates the autophagy-mediated death of human glioblastoma cells by generating reactive oxygen species and activating the autophagy-lysosome pathway. However, its effects on the migration and invasion of human glioblastoma cells have not yet been elucidated. Therefore, human glioblastoma U87 and SF767 cells were treated with SH (0.125 and 0.25 mM for 24 h, and cell migration and invasion were assessed using scratch wound healing, migration and invasion assays. SH promoted G0/G1 phase arrest, inhibited the migration and invasion of the two cell lines, suppressed the activation of nuclear factor kappa B (NFκB and the expression of matrix metalloproteinase (MMP-2/-9, triggered endoplasmic reticulum (ER stress, reversed the exogenous epithelial-mesenchymal transition (EMT induced by the inflammatory microenvironment and the endogenous EMT. Additionally, NFκB p65 overexpression blocked the SH-mediated inhibitory effects on MMP-2/-9 expression and cell invasion. SH-induced autophagy was reduced in CCAAT/enhancer binding protein (C/EBP homologous protein (CHOP or autophagy-related 5 (ATG5-silenced human glioblastoma cells and cells treated with 4-phenylbutyric acid (4-PBA or 3-methyladenine (3-MA, as shown by the decreased levels of the microtubule-associated protein light chain 3B (LC3B-II and autophagic vacuoles (AVs stained with monodansylcadaverine (MDC, respectively. Moreover, knockdown of CHOP or ATG5 and treatment with 4-PBA or 3-MA abolished the SH-mediated inhibition of mesenchymal markers (vimentin, Snail and Slug expression and cell invasion, respectively. Importantly, SH also regulated the above related pathways in nude mice. Based on these findings, SH inhibited cell proliferation by inducing cell cycle arrest, and attenuated the metastasis of U87 and SF767 cells by suppressing

  5. SH2-PLA: a sensitive in-solution approach for quantification of modular domain binding by proximity ligation and real-time PCR.

    Science.gov (United States)

    Thompson, Christopher M; Bloom, Lee R; Ogiue-Ikeda, Mari; Machida, Kazuya

    2015-06-26

    There is a great interest in studying phosphotyrosine dependent protein-protein interactions in tyrosine kinase pathways that play a critical role in many aspects of cellular function. We previously established SH2 profiling, a phosphoproteomic approach based on membrane binding assays that utilizes purified Src Homology 2 (SH2) domains as a molecular tool to profile the global tyrosine phosphorylation state of cells. However, in order to use this method to investigate SH2 binding sites on a specific target in cell lysate, additional procedures such as pull-down or immunoprecipitation which consume large amounts of sample are required. We have developed PLA-SH2, an alternative in-solution modular domain binding assay that takes advantage of Proximity Ligation Assay and real-time PCR. The SH2-PLA assay utilizes oligonucleotide-conjugated anti-GST and anti-EGFR antibodies recognizing a GST-SH2 probe and cellular EGFR, respectively. If the GST-SH2 and EGFR are in close proximity as a result of SH2-phosphotyrosine interactions, the two oligonucleotides are brought within a suitable distance for ligation to occur, allowing for efficient complex amplification via real-time PCR. The assay detected signal across at least 3 orders of magnitude of lysate input with a linear range spanning 1-2 orders and a low femtomole limit of detection for EGFR phosphotyrosine. SH2 binding kinetics determined by PLA-SH2 showed good agreement with established far-Western analyses for A431 and Cos1 cells stimulated with EGF at various times and doses. Further, we showed that PLA-SH2 can survey lung cancer tissues using 1 μl lysate without requiring phospho-enrichment. We showed for the first time that interactions between SH2 domain probes and EGFR in cell lysate can be determined in a microliter-scale assay using SH2-PLA. The obvious benefit of this method is that the low sample requirement allows detection of SH2 binding in samples which are difficult to analyze using traditional protein

  6. Genomic analysis of the aconidial and high-performance protein producer, industrially relevant Aspergillus niger SH2 strain.

    Science.gov (United States)

    Yin, Chao; Wang, Bin; He, Pan; Lin, Ying; Pan, Li

    2014-05-15

    Aspergillus niger is usually regarded as a beneficial species widely used in biotechnological industry. Obtaining the genome sequence of the widely used aconidial A. niger SH2 strain is of great importance to understand its unusual production capability. In this study we assembled a high-quality genome sequence of A. niger SH2 with approximately 11,517 ORFs. Relatively high proportion of genes enriched for protein expression related FunCat items verify its efficient capacity in protein production. Furthermore, genome-wide comparative analysis between A. niger SH2 and CBS513.88 reveals insights into unique properties of A. niger SH2. A. niger SH2 lacks the gene related with the initiation of asexual sporulation (PrpA), leading to its distinct aconidial phenotype. Frame shift mutations and non-synonymous SNPs in genes of cell wall integrity signaling, β-1,3-glucan synthesis and chitin synthesis influence its cell wall development which is important for its hyphal fragmentation during industrial high-efficiency protein production. Copyright © 2014 Elsevier B.V. All rights reserved.

  7. [Mechanism Study of the Smectite-OR-SH Compound for Reducing Cadmium Uptake by Plants in Contaminated Soils].

    Science.gov (United States)

    Zeng, Yan-jun; Zhou, Zhi-jun; Zhao, Qiu-xiang

    2015-06-01

    Adsorption and desorption experiments, pot experiments and characterization test were performed to investigate the immobilization effect and mechanism of the smectite-OR-SH compound for reducing cadmium uptake by plants in contaminated soils. The results showed that the saturated adsorption capacity for the adsorption of Cd2+ on smectite raised distinctly after functionalized. The adsorption of Cd2+ on smectite-OR-SH compound was very stable and it was difficult for Cd2+ to be desorbed from it. Crop yields promoted differently in original soil, Cd 3 mg x kg(-1) soil and Cd 10 mg x kg(-1) soil after adding the smectite-OR-SH compound. And the cadmium content of the cabbage reduced 61.00%, 62.10% and 83.73% respectively compare with the control. Characterization test analysis showed that Cd was adsorbed by the compound successfully and ligand interaction occurred between Cd and the thiol group. Floc amount on the compound surface increased correspondingly. In addition to electrostatic adsorption, ion exchange and hydroxyl ligand adsorption, the reaction mechanism of smectite-OR-SH compound with Cd was mainly sulfhydryl ligand adsorption.

  8. Partial Correction of Psoriasis upon Genetic Knock-Down of Human TNF-α by Lentivirus-Encoded shRNAs in a Xenograft Mouse Model

    DEFF Research Database (Denmark)

    Jakobsen, Maria; Stenderup, Karin; Rosada, Cecilia

    samples treated with irrelevant shRNAs, were selected and cloned into lentiviral vectors. The lentiviral vectors expressing TNF- shRNAs were used to transduce HEK-293 cells and verify vector-derived knock-down of stable TNF- expression in vitro. The most efficient TNF- -directed shRNA, which in cell lines...

  9. Residue-specific description of non-native transient structures in the ensemble of acid-denatured structures of the all-beta protein c-src SH3

    DEFF Research Database (Denmark)

    Rösner, Heike I; Poulsen, Flemming Martin

    2010-01-01

    -src loop to the third beta-strand, exhibited an apparent helicity of nearly 45%. Furthermore, the RT loop and the diverging turn appeared to adopt non-native-like helical conformations. Interestingly, none of the residues found in transient helical conformations exhibited significant varphi-values [Riddle......Secondary chemical shift analysis has been used to characterize the unfolded state of acid-denatured c-src SH3. Even though native c-src SH3 adopts an all-beta fold, we found evidence of transient helicity in regions corresponding to native loops. In particular, residues 40-46, connecting the n...

  10. The SH-SY5Y cell line in Parkinson's disease research: a systematic review.

    Science.gov (United States)

    Xicoy, Helena; Wieringa, Bé; Martens, Gerard J M

    2017-01-24

    Parkinson's disease (PD) is a devastating and highly prevalent neurodegenerative disease for which only symptomatic treatment is available. In order to develop a truly effective disease-modifying therapy, improvement of our current understanding of the molecular and cellular mechanisms underlying PD pathogenesis and progression is crucial. For this purpose, standardization of research protocols and disease models is necessary. As human dopaminergic neurons, the cells mainly affected in PD, are difficult to obtain and maintain as primary cells, current PD research is mostly performed with permanently established neuronal cell models, in particular the neuroblastoma SH-SY5Y lineage. This cell line is frequently chosen because of its human origin, catecholaminergic (though not strictly dopaminergic) neuronal properties, and ease of maintenance. However, there is no consensus on many fundamental aspects that are associated with its use, such as the effects of culture media composition and of variations in differentiation protocols. Here we present the outcome of a systematic review of scientific articles that have used SH-SY5Y cells to explore PD. We describe the cell source, culture conditions, differentiation protocols, methods/approaches used to mimic PD and the preclinical validation of the SH-SY5Y findings by employing alternative cellular and animal models. Thus, this overview may help to standardize the use of the SH-SY5Y cell line in PD research and serve as a future user's guide.

  11. Neurotoxicity induced by dexamethasone in the human neuroblastoma SH-SY5Y cell line can be prevented by folic acid.

    Science.gov (United States)

    Budni, J; Romero, A; Molz, S; Martín-de-Saavedra, M D; Egea, J; Del Barrio, L; Tasca, C I; Rodrigues, A L S; López, M G

    2011-09-08

    Folic acid (folate) is a vitamin of the B-complex group that is essential for cell replication. Folate is a major determinant of one-carbon metabolism, in which S-adenosylmethionine donates methyl groups that are crucial for neurological function. Many roles for folic acid have been reported, including neuroprotective and antidepressant properties. On the other hand, increased concentrations of corticoids have proven neurotoxic effects and hypersecretion of glucocorticoids has been linked to different mood disorders. The purpose of this study was to investigate the potential protective effect of folic acid on dexamethasone-induced cellular death in SH-SY5Y neuroblastoma cell line and the possible intracellular signaling pathway involved in such effect. Exposure to 1 mM dexamethasone for 48 h caused a significant reduction of cell viability measured as 3-[4,5 dimethylthiazol-2-yl]-2,5-diphenyl-tetrazolium bromide (MTT) reduction. Exposure of SH-SY5Y cells for 72 h to increasing concentrations of folate (1-300 μM) was not cytotoxic. However, pretreatment with folate (10-300 μM) reduced dexamethasone-induced toxicity in a significant manner. To explore the putative intracellular signaling pathways implicated in the protective effect of folate we used different protein kinase inhibitors. The protective effect of folic acid on dexamethasone-induced neurotoxicity was reversed by the phosphatidylinositol-3 kinase/Akt (PI3K/Akt, LY294002), Ca²⁺/Calmodulin-dependent protein kinase II (CaMKII, KN-93), and protein kinase A (PKA, H-89) inhibitors, but not the mitogen-activated protein/extracellular signal-regulated kinase (MEK1/2, PD98059) and protein kinase C (PKC, chelerythrine) inhibitors. In conclusion, the results of this study show that folic acid can protect against dexamethasone-induced neurotoxicity and its protective mechanism is related to a signaling pathway that involves PI3K/Akt, CaMKII, and PKA. Copyright © 2011. Published by Elsevier Ltd.

  12. Classification and Lineage Tracing of SH2 Domains Throughout Eukaryotes.

    Science.gov (United States)

    Liu, Bernard A

    2017-01-01

    Today there exists a rapidly expanding number of sequenced genomes. Cataloging protein interaction domains such as the Src Homology 2 (SH2) domain across these various genomes can be accomplished with ease due to existing algorithms and predictions models. An evolutionary analysis of SH2 domains provides a step towards understanding how SH2 proteins integrated with existing signaling networks to position phosphotyrosine signaling as a crucial driver of robust cellular communication networks in metazoans. However organizing and tracing SH2 domain across organisms and understanding their evolutionary trajectory remains a challenge. This chapter describes several methodologies towards analyzing the evolutionary trajectory of SH2 domains including a global SH2 domain classification system, which facilitates annotation of new SH2 sequences essential for tracing the lineage of SH2 domains throughout eukaryote evolution. This classification utilizes a combination of sequence homology, protein domain architecture and the boundary positions between introns and exons within the SH2 domain or genes encoding these domains. Discrete SH2 families can then be traced across various genomes to provide insight into its origins. Furthermore, additional methods for examining potential mechanisms for divergence of SH2 domains from structural changes to alterations in the protein domain content and genome duplication will be discussed. Therefore a better understanding of SH2 domain evolution may enhance our insight into the emergence of phosphotyrosine signaling and the expansion of protein interaction domains.

  13. Neuronal differentiation and long-term culture of the human neuroblastoma line SH-SY5Y.

    Science.gov (United States)

    Constantinescu, R; Constantinescu, A T; Reichmann, H; Janetzky, B

    2007-01-01

    Parkinson's disease (PD) is the second most prevalent neurodegenerative disorder in industrialized countries. Present cell culture models for PD rely on either primary cells or immortal cell lines, neither of which allow for long-term experiments on a constant population, a crucial requisite for a realistic model of slowly progressing neurodegenerative diseases. We differentiated SH-SY5Y human dopaminergic neuroblastoma cells to a neuronal-like state in a perfusion culture system using a combination of retinoic acid and mitotic inhibitors. The cells could be cultivated for two months without the need for passage. We show, by various means, that the differentiated cells exhibit, at the molecular level, many neuronal properties not characteristic to the starting line. This approach opens the possibility to develop chronic models, in which the effect of perturbations and putative counteracting strategies can be monitored over long periods of time in a quasi-stable cell population.

  14. Creating Transgenic shRNA Mice by Recombinase-Mediated Cassette Exchange

    Science.gov (United States)

    Premsrirut, Prem K.; Dow, Lukas E.; Park, Youngkyu; Hannon, Gregory J.; Lowe, Scott W.

    2014-01-01

    RNA interference (RNAi) enables sequence-specific, experimentally induced silencing of virtually any gene by tapping into innate regulatory mechanisms that are conserved among most eukaryotes. The principles that enable transgenic RNAi in cell lines can also be used to create transgenic animals, which express short-hairpin RNAs (shRNAs) in a regulated or tissue-specific fashion. However, RNAi in transgenic animals is somewhat more challenging than RNAi in cultured cells. The activities of promoters that are commonly used for shRNA expression in cell culture can vary enormously in different tissues, and founder lines also typically vary in transgene expression due to the effects of their single integration sites. There are many ways to produce mice carrying shRNA transgenes and the method described here uses recombinase-mediated cassette exchange (RMCE). RMCE permits insertion of the shRNA transgene into a well-characterized locus that gives reproducible and predictable expression in each founder and enhances the probability of potent expression in many cell types. This procedure is more involved and complex than simple pronuclear injection, but if even a few shRNA mice are envisioned, for example, to probe the functions of several genes, the effort of setting up the processes outlined below are well worthwhile. Note that when creating a transgenic mouse, one should take care to use the most potent shRNA possible. As a rule of thumb, the sequence chosen should provide >90% knockdown when introduced into cultured cells at single copy (e.g., on retroviral infection at a multiplicity of ≤0.3). PMID:24003198

  15. El medio interestelar en los alrededores de la region HII Sh2-183

    Science.gov (United States)

    Cichowolski, S.; Cappa, C. E.; Blanco, A.; Eppens, L.; Ertini, K.; Leiva, M. M.

    2017-10-01

    We present a multiwavelength study of the HII region Sh2-183, located at (,) = (123.3,+3.0) at a distance of 7.0 1.5 kpc from the Sun. Based on the radio continuum data we estimated the amount of ionized gas, the electronic density, and the number of ionizing photons needed to keep the region ionized, which is important since the star/s responsible of the region was/were not detected yet. On the other hand, based on IRAS data we have analyzed the dust temperature and distribution. The Hi line data allowed the detection of a shell-like structure surrounding the ionized gas and the CO data revealed the presence of 6 molecular clouds probably related to Sh2-183, which harbor several young stellar object candidates.

  16. Tyrosine phosphorylation of 3BP2 is indispensable for the interaction with VAV3 in chicken DT40 cells

    Energy Technology Data Exchange (ETDEWEB)

    Chihara, Kazuyasu [Division of Genome Science and Microbiology, Department of Pathological Sciences, Faculty of Medical Sciences, Fukui 910-1193 (Japan); Organization for Life Science Advancement Programs, University of Fukui, Fukui 910-1193 (Japan); Kimura, Yukihiro [Division of Genome Science and Microbiology, Department of Pathological Sciences, Faculty of Medical Sciences, Fukui 910-1193 (Japan); Division of Otorhinolaryngology Head and Neck Surgery, Department of Sensory and Locomotor Medicine, Faculty of Medical Sciences, Fukui 910-1193 (Japan); Honjoh, Chisato [Division of Genome Science and Microbiology, Department of Pathological Sciences, Faculty of Medical Sciences, Fukui 910-1193 (Japan); Third Department of Internal Medicine, Faculty of Medical Sciences, Fukui 910-1193 (Japan); Yamauchi, Shota; Takeuchi, Kenji [Division of Genome Science and Microbiology, Department of Pathological Sciences, Faculty of Medical Sciences, Fukui 910-1193 (Japan); Organization for Life Science Advancement Programs, University of Fukui, Fukui 910-1193 (Japan); Sada, Kiyonao, E-mail: ksada@u-fukui.ac.jp [Division of Genome Science and Microbiology, Department of Pathological Sciences, Faculty of Medical Sciences, Fukui 910-1193 (Japan); Organization for Life Science Advancement Programs, University of Fukui, Fukui 910-1193 (Japan)

    2014-03-10

    Adaptor protein c-Abl SH3 domain-binding protein-2 (3BP2) is known to play regulatory roles in immunoreceptor-mediated signal transduction. We have previously demonstrated that Tyr{sup 174}, Tyr{sup 183} and Tyr{sup 446} in mouse 3BP2 are predominantly phosphorylated by Syk, and the phosphorylation of Tyr{sup 183} and the Src homology 2 (SH2) domain of mouse 3BP2 are critical for B cell receptor (BCR)-induced activation of nuclear factor of activated T cells (NFAT) in human B cells. In this report, we have shown that Syk, but not Abl family protein-tyrosine kinases, is critical for BCR-mediated tyrosine phosphorylation of 3BP2 in chicken DT40 cells. Mutational analysis showed that Tyr{sup 174}, Tyr{sup 183} and Tyr{sup 426} of chicken 3BP2 are the major phosphorylation sites by Syk and the SH2 domain of 3BP2 is critical for tyrosine phosphorylation. In addition, phosphorylation of Tyr{sup 426} is required for the inducible interaction with the SH2 domain of Vav3. Moreover, the expression of the mutant form of 3BP2 in which Tyr{sup 426} was substituted to Phe resulted in the reduction in BCR-mediated Rac1 activation, when compared with the case of wild-type. Altogether, these data suggest that 3BP2 is involved in the activation of Rac1 through the regulation of Vav3 by Syk-dependent phosphorylation of Tyr{sup 426} following BCR stimulation. - Highlights: • 3BP2 is phosphorylated by Syk, but not Abl family kinases in BCR signaling. • Tyr183 and Tyr426 in chicken 3BP2 are the major phosphorylation sites by Syk. • The SH2 domain of 3BP2 is critical for tyrosine phosphorylation of 3BP2. • Phosphorylation of Tyr426 in 3BP2 is required for the inducible binding with Vav3. • 3BP2 is involved in the regulation of BCR-mediated Rac1 activation.

  17. Tyrosine phosphorylation of 3BP2 is indispensable for the interaction with VAV3 in chicken DT40 cells

    International Nuclear Information System (INIS)

    Chihara, Kazuyasu; Kimura, Yukihiro; Honjoh, Chisato; Yamauchi, Shota; Takeuchi, Kenji; Sada, Kiyonao

    2014-01-01

    Adaptor protein c-Abl SH3 domain-binding protein-2 (3BP2) is known to play regulatory roles in immunoreceptor-mediated signal transduction. We have previously demonstrated that Tyr 174 , Tyr 183 and Tyr 446 in mouse 3BP2 are predominantly phosphorylated by Syk, and the phosphorylation of Tyr 183 and the Src homology 2 (SH2) domain of mouse 3BP2 are critical for B cell receptor (BCR)-induced activation of nuclear factor of activated T cells (NFAT) in human B cells. In this report, we have shown that Syk, but not Abl family protein-tyrosine kinases, is critical for BCR-mediated tyrosine phosphorylation of 3BP2 in chicken DT40 cells. Mutational analysis showed that Tyr 174 , Tyr 183 and Tyr 426 of chicken 3BP2 are the major phosphorylation sites by Syk and the SH2 domain of 3BP2 is critical for tyrosine phosphorylation. In addition, phosphorylation of Tyr 426 is required for the inducible interaction with the SH2 domain of Vav3. Moreover, the expression of the mutant form of 3BP2 in which Tyr 426 was substituted to Phe resulted in the reduction in BCR-mediated Rac1 activation, when compared with the case of wild-type. Altogether, these data suggest that 3BP2 is involved in the activation of Rac1 through the regulation of Vav3 by Syk-dependent phosphorylation of Tyr 426 following BCR stimulation. - Highlights: • 3BP2 is phosphorylated by Syk, but not Abl family kinases in BCR signaling. • Tyr183 and Tyr426 in chicken 3BP2 are the major phosphorylation sites by Syk. • The SH2 domain of 3BP2 is critical for tyrosine phosphorylation of 3BP2. • Phosphorylation of Tyr426 in 3BP2 is required for the inducible binding with Vav3. • 3BP2 is involved in the regulation of BCR-mediated Rac1 activation

  18. Structure of lipid kinase p110β/p85β elucidates an unusual SH2-domain-mediated inhibitory mechanism.

    Science.gov (United States)

    Zhang, Xuxiao; Vadas, Oscar; Perisic, Olga; Anderson, Karen E; Clark, Jonathan; Hawkins, Phillip T; Stephens, Len R; Williams, Roger L

    2011-03-04

    Phosphoinositide 3-kinases (PI3Ks) are essential for cell growth, migration, and survival. The structure of a p110β/p85β complex identifies an inhibitory function for the C-terminal SH2 domain (cSH2) of the p85 regulatory subunit. Mutagenesis of a cSH2 contact residue activates downstream signaling in cells. This inhibitory contact ties up the C-terminal region of the p110β catalytic subunit, which is essential for lipid kinase activity. In vitro, p110β basal activity is tightly restrained by contacts with three p85 domains: the cSH2, nSH2, and iSH2. RTK phosphopeptides relieve inhibition by nSH2 and cSH2 using completely different mechanisms. The binding site for the RTK's pYXXM motif is exposed on the cSH2, requiring an extended RTK motif to reach and disrupt the inhibitory contact with p110β. This contrasts with the nSH2 where the pY-binding site itself forms the inhibitory contact. This establishes an unusual mechanism by which p85 SH2 domains contribute to RTK signaling specificities. Copyright © 2011 Elsevier Inc. All rights reserved.

  19. Resistance to Inhibitors of Cholinesterase 3 (Ric-3 Expression Promotes Selective Protein Associations with the Human α7-Nicotinic Acetylcholine Receptor Interactome.

    Directory of Open Access Journals (Sweden)

    Matthew J Mulcahy

    Full Text Available The α7-nicotinic acetylcholine receptor (α7-nAChR is a ligand-gated ion channel widely expressed in vertebrates and is associated with numerous physiological functions. As transmembrane ion channels, α7-nAChRs need to be expressed on the surface of the plasma membrane to function. The receptor has been reported to associate with proteins involved with receptor biogenesis, modulation of receptor properties, as well as intracellular signaling cascades and some of these associated proteins may affect surface expression of α7-nAChRs. The putative chaperone resistance to inhibitors of cholinesterase 3 (Ric-3 has been reported to interact with, and enhance the surface expression of, α7-nAChRs. In this study, we identified proteins that associate with α7-nAChRs when Ric-3 is expressed. Using α-bungarotoxin (α-bgtx, we isolated and compared α7-nAChR-associated proteins from two stably transfected, human tumor-derived cell lines: SH-EP1-hα7 expressing human α7-nAChRs and the same cell line further transfected to express Ric-3, SH-EP1-hα7-Ric-3. Mass spectrometric analysis of peptides identified thirty-nine proteins that are associated with α7-nAChRs only when Ric-3 was expressed. Significantly, and consistent with reports of Ric-3 function in the literature, several of the identified proteins are involved in biological processes that may affect nAChR surface expression such as post-translational processing of proteins, protein trafficking, and protein transport. Additionally, proteins affecting the cell cycle, the cytoskeleton, stress responses, as well as cyclic AMP- and inositol triphosphate-dependent signaling cascades were identified. These results illuminate how α-bgtx may be used to isolate and identify α7-nAChRs as well as how the expression of chaperones such as Ric-3 can influence proteins associating with α7-nAChRs. These associating proteins may alter activities of α7-nAChRs to expand their functionally-relevant repertoire as

  20. Towards Antiviral shRNAs Based on the AgoshRNA Design.

    Directory of Open Access Journals (Sweden)

    Ying Poi Liu

    Full Text Available RNA interference (RNAi can be induced by intracellular expression of a short hairpin RNA (shRNA. Processing of the shRNA requires the RNaseIII-like Dicer enzyme to remove the loop and to release the biologically active small interfering RNA (siRNA. Dicer is also involved in microRNA (miRNA processing to liberate the mature miRNA duplex, but recent studies indicate that miR-451 is not processed by Dicer. Instead, this miRNA is processed by the Argonaute 2 (Ago2 protein, which also executes the subsequent cleavage of a complementary mRNA target. Interestingly, shRNAs that structurally resemble miR-451 can also be processed by Ago2 instead of Dicer. The key determinant of these "AgoshRNA" molecules is a relatively short basepaired stem, which avoids Dicer recognition and consequently allows alternative processing by Ago2. AgoshRNA processing yields a single active RNA strand, whereas standard shRNAs produce a duplex with guide and passenger strands and the latter may cause adverse off-target effects. In this study, we converted previously tested active anti-HIV-1 shRNA molecules into AgoshRNA. We tested several designs that could potentially improve AgoshRNA activity, including extension of the complementarity between the guide strand and the mRNA target and reduction of the thermodynamic stability of the hairpins. We demonstrate that active AgoshRNAs can be generated. However, the RNAi activity is reduced compared to the matching shRNAs. Despite reduced RNAi activity, comparison of an active AgoshRNA and the matching shRNA in a sensitive cell toxicity assay revealed that the AgoshRNA is much less toxic.

  1. ExoMol molecular line lists - XXVI: spectra of SH and NS

    Science.gov (United States)

    Yurchenko, Sergei N.; Bond, Wesley; Gorman, Maire N.; Lodi, Lorenzo; McKemmish, Laura K.; Nunn, William; Shah, Rohan; Tennyson, Jonathan

    2018-04-01

    Line lists for the sulphur-containing molecules SH (the mercapto radical) and NS are computed as part of the ExoMol project. These line lists consider transitions within the X 2Π ground state for 32SH, 33SH, 34SH and 32SD, and 14N32S, 14N33S, 14N34S, 14N36S and 15N32S. Ab initio potential energy (PEC) and spin-orbit coupling (SOC) curves are computed and then improved by fitting to experimentally observed transitions. Fully ab initio dipole moment curves (DMCs) computed at high level of theory are used to produce the final line lists. For SH, our fit gives a root-mean-square (rms) error of 0.03 cm-1 between the observed (vmax = 4, Jmax = 34.5) and calculated transitions wavenumbers; this is extrapolated such that all X 2Π rotational-vibrational-electronic (rovibronic) bound states are considered. For 32SH the resulting line list contains about 81 000 transitions and 2 300 rovibronic states, considering levels up to vmax = 14 and Jmax = 60.5. For NS the refinement used a combination of experimentally determined frequencies and energy levels and led to an rms fitting error of 0.002 cm-1. Each NS calculated line list includes around 2.8 million transitions and 31 000 rovibronic states with a vibrational range up to v = 53 and rotational range to J = 235.5, which covers up to 23 000 cm-1. Both line lists should be complete for temperatures up to 5000 K. Example spectra simulated using this line list are shown and comparisons made to the existing data in the CDMS database. The line lists are available from the CDS (http://cdsarc.u-strasbg.fr) and ExoMol (www.exomol.com) data bases.

  2. Clinical, in silico, and experimental evidence for pathogenicity of two novel splice site mutations in the SH3TC2 gene

    Czech Academy of Sciences Publication Activity Database

    Laššuthová, P.; Gregor, Martin; Sarnová, Lenka; Machalová, Eliška; Sedláček, Radislav; Seeman, P.

    2012-01-01

    Roč. 26, 3-4 (2012), s. 413-420 ISSN 0167-7063 R&D Projects: GA ČR GAP303/10/2044 Institutional support: RVO:68378050 Keywords : exon trapping * peripheral neuropathy * SH3TC2 gene * splice site mutation Subject RIV: EB - Genetics ; Molecular Biology Impact factor: 2.159, year: 2012

  3. Structural and biophysical investigation of the interaction of a mutant Grb2 SH2 domain (W121G) with its cognate phosphopeptide.

    Science.gov (United States)

    Papaioannou, Danai; Geibel, Sebastian; Kunze, Micha B A; Kay, Christopher W M; Waksman, Gabriel

    2016-03-01

    The adaptor protein Grb2 is a key element of mitogenetically important signaling pathways. With its SH2 domain it binds to upstream targets while its SH3 domains bind to downstream proteins thereby relaying signals from the cell membranes to the nucleus. The Grb2 SH2 domain binds to its targets by recognizing a phosphotyrosine (pY) in a pYxNx peptide motif, requiring an Asn at the +2 position C-terminal to the pY with the residue either side of this Asn being hydrophobic. Structural analysis of the Grb2 SH2 domain in complex with its cognate peptide has shown that the peptide adopts a unique β-turn conformation, unlike the extended conformation that phosphopeptides adopt when bound to other SH2 domains. TrpEF1 (W121) is believed to force the peptide into this unusual conformation conferring this unique specificity to the Grb2 SH2 domain. Using X-ray crystallography, electron paramagnetic resonance (EPR) spectroscopy, and isothermal titration calorimetry (ITC), we describe here a series of experiments that explore the role of TrpEF1 in determining the specificity of the Grb2 SH2 domain. Our results demonstrate that the ligand does not adopt a pre-organized structure before binding to the SH2 domain, rather it is the interaction between the two that imposes the hairpin loop to the peptide. Furthermore, we find that the peptide adopts a similar structure when bound to both the wild-type Grb2 SH2 domain and a TrpEF1Gly mutant. This suggests that TrpEF1 is not the determining factor for the conformation of the phosphopeptide. © 2015 The Protein Society.

  4. MSH3-deficiency initiates EMAST without oncogenic transformation of human colon epithelial cells.

    Directory of Open Access Journals (Sweden)

    Christoph Campregher

    Full Text Available BACKGROUND/AIM: Elevated microsatellite instability at selected tetranucleotide repeats (EMAST is a genetic signature in certain cases of sporadic colorectal cancer and has been linked to MSH3-deficiency. It is currently controversial whether EMAST is associated with oncogenic properties in humans, specifically as cancer development in Msh3-deficient mice is not enhanced. However, a mutator phenotype is different between species as the genetic positions of repetitive sequences are not conserved. Here we studied the molecular effects of human MSH3-deficiency. METHODS: HCT116 and HCT116+chr3 (both MSH3-deficient and primary human colon epithelial cells (HCEC, MSH3-wildtype were stably transfected with an EGFP-based reporter plasmid for the detection of frameshift mutations within an [AAAG]17 repeat. MSH3 was silenced by shRNA and changes in protein expression were analyzed by shotgun proteomics. Colony forming assay was used to determine oncogenic transformation and double strand breaks (DSBs were assessed by Comet assay. RESULTS: Despite differential MLH1 expression, both HCT116 and HCT116+chr3 cells displayed comparable high mutation rates (about 4×10(-4 at [AAAG]17 repeats. Silencing of MSH3 in HCECs leads to a remarkable increased frameshift mutations in [AAAG]17 repeats whereas [CA]13 repeats were less affected. Upon MSH3-silencing, significant changes in the expression of 202 proteins were detected. Pathway analysis revealed overexpression of proteins involved in double strand break repair (MRE11 and RAD50, apoptosis, L1 recycling, and repression of proteins involved in metabolism, tRNA aminoacylation, and gene expression. MSH3-silencing did not induce oncogenic transformation and DSBs increased 2-fold. CONCLUSIONS: MSH3-deficiency in human colon epithelial cells results in EMAST, formation of DSBs and significant changes of the proteome but lacks oncogenic transformation. Thus, MSH3-deficiency alone is unlikely to drive human colon

  5. Autophagy regulates chlorpyrifos-induced apoptosis in SH-SY5Y cells

    International Nuclear Information System (INIS)

    Park, Jae Hyeon; Lee, Jeong Eun; Shin, In Chul; Koh, Hyun Chul

    2013-01-01

    Recent studies have shown that up-regulation of autophagy may be a tractable therapeutic intervention for clearing disease-causing proteins, including α-synuclein, ubiquitin, and other misfolded or aggregated proteins in pesticide-induced neurodegeneration. In a previous study, we reported that chlorpyrifos (CPF)-induced mitochondria-dependent apoptosis is mediated through reactive oxygen species in SH-SY5Y cells. In this study, we explored a novel pharmacotherapeutic approach to prevent CPF neurotoxicity involving the regulation of autophagy. We investigated the modulation of CPF-induced apoptosis according to autophagy regulation. We found that CPF induced apoptosis in SH-SY5Y cells, as demonstrated by the activation of caspase-3 and nuclear condensation. In addition, we observed that cells treated with CPF underwent autophagic cell death by monitoring the expression of LC3-II and p62. Pretreatment with the autophagy inducer rapamycin significantly enhanced the cell viability of CPF-exposed cells, and the enhancement of cell viability was partially due to alleviation of CPF-induced apoptosis via a decrease in levels of cleaved caspase-3. Specifically, rapamycin pretreatment decreased Bax and increased Bcl-2 expression in mitochondria. In addition, rapamycin significantly decreased cytochrome c release in from mitochondria into the cytosol. However, pretreatment of cells with the autophagy inhibitor, 3-methyladenine (3MA), remarkably increased CPF toxicity in these cells; this with correlated with increased expression of Bax and decreased expression of Bcl-2 in mitochondria. Our results suggest that CPF-induced cytotoxicity is modified by autophagy regulation and that rapamycin protects against CPF-induced apoptosis by enhancing autophagy. Pharmacologic induction of autophagy by rapamycin may be a useful treatment strategy in neurodegenerative disorders. - Highlights: ► Chlorpyrifos (CPF) is cytotoxic to SH-SY5Y cells ► CPF-induced cytotoxicity is mediated by

  6. Autophagy regulates chlorpyrifos-induced apoptosis in SH-SY5Y cells

    Energy Technology Data Exchange (ETDEWEB)

    Park, Jae Hyeon [Department of Pharmacology, College of Medicine, Hanyang University (Korea, Republic of); Hanyang Biomedical Research Institute, Seoul (Korea, Republic of); Graduate School of Biomedical Science and Engineering, Hanyang University, Seoul (Korea, Republic of); Lee, Jeong Eun [Department of Pharmacology, College of Medicine, Hanyang University (Korea, Republic of); Hanyang Biomedical Research Institute, Seoul (Korea, Republic of); Shin, In Chul [Department of Pharmacology, College of Medicine, Hanyang University (Korea, Republic of); Koh, Hyun Chul, E-mail: hckoh@hanyang.ac.kr [Department of Pharmacology, College of Medicine, Hanyang University (Korea, Republic of); Hanyang Biomedical Research Institute, Seoul (Korea, Republic of); Graduate School of Biomedical Science and Engineering, Hanyang University, Seoul (Korea, Republic of)

    2013-04-01

    Recent studies have shown that up-regulation of autophagy may be a tractable therapeutic intervention for clearing disease-causing proteins, including α-synuclein, ubiquitin, and other misfolded or aggregated proteins in pesticide-induced neurodegeneration. In a previous study, we reported that chlorpyrifos (CPF)-induced mitochondria-dependent apoptosis is mediated through reactive oxygen species in SH-SY5Y cells. In this study, we explored a novel pharmacotherapeutic approach to prevent CPF neurotoxicity involving the regulation of autophagy. We investigated the modulation of CPF-induced apoptosis according to autophagy regulation. We found that CPF induced apoptosis in SH-SY5Y cells, as demonstrated by the activation of caspase-3 and nuclear condensation. In addition, we observed that cells treated with CPF underwent autophagic cell death by monitoring the expression of LC3-II and p62. Pretreatment with the autophagy inducer rapamycin significantly enhanced the cell viability of CPF-exposed cells, and the enhancement of cell viability was partially due to alleviation of CPF-induced apoptosis via a decrease in levels of cleaved caspase-3. Specifically, rapamycin pretreatment decreased Bax and increased Bcl-2 expression in mitochondria. In addition, rapamycin significantly decreased cytochrome c release in from mitochondria into the cytosol. However, pretreatment of cells with the autophagy inhibitor, 3-methyladenine (3MA), remarkably increased CPF toxicity in these cells; this with correlated with increased expression of Bax and decreased expression of Bcl-2 in mitochondria. Our results suggest that CPF-induced cytotoxicity is modified by autophagy regulation and that rapamycin protects against CPF-induced apoptosis by enhancing autophagy. Pharmacologic induction of autophagy by rapamycin may be a useful treatment strategy in neurodegenerative disorders. - Highlights: ► Chlorpyrifos (CPF) is cytotoxic to SH-SY5Y cells ► CPF-induced cytotoxicity is mediated by

  7. Tyrosine phosphorylation of 3BP2 is indispensable for the interaction with VAV3 in chicken DT40 cells.

    Science.gov (United States)

    Chihara, Kazuyasu; Kimura, Yukihiro; Honjoh, Chisato; Yamauchi, Shota; Takeuchi, Kenji; Sada, Kiyonao

    2014-03-10

    Adaptor protein c-Abl SH3 domain-binding protein-2 (3BP2) is known to play regulatory roles in immunoreceptor-mediated signal transduction. We have previously demonstrated that Tyr(174), Tyr(183) and Tyr(446) in mouse 3BP2 are predominantly phosphorylated by Syk, and the phosphorylation of Tyr(183) and the Src homology 2 (SH2) domain of mouse 3BP2 are critical for B cell receptor (BCR)-induced activation of nuclear factor of activated T cells (NFAT) in human B cells. In this report, we have shown that Syk, but not Abl family protein-tyrosine kinases, is critical for BCR-mediated tyrosine phosphorylation of 3BP2 in chicken DT40 cells. Mutational analysis showed that Tyr(174), Tyr(183) and Tyr(426) of chicken 3BP2 are the major phosphorylation sites by Syk and the SH2 domain of 3BP2 is critical for tyrosine phosphorylation. In addition, phosphorylation of Tyr(426) is required for the inducible interaction with the SH2 domain of Vav3. Moreover, the expression of the mutant form of 3BP2 in which Tyr(426) was substituted to Phe resulted in the reduction in BCR-mediated Rac1 activation, when compared with the case of wild-type. Altogether, these data suggest that 3BP2 is involved in the activation of Rac1 through the regulation of Vav3 by Syk-dependent phosphorylation of Tyr(426) following BCR stimulation. Copyright © 2014 Elsevier Inc. All rights reserved.

  8. Theoretical study and rate constant calculation for the reactions of SH (SD) with Cl2, Br2, and BrCl.

    Science.gov (United States)

    Wang, Li; Liu, Jing-Yao; Li, Ze-Sheng; Sun, Chia-Chung

    2005-01-30

    The mechanisms of the SH (SD) radicals with Cl2 (R1), Br2 (R2), and BrCl (R3) are investigated theoretically, and the rate constants are calculated using a dual-level direct dynamics method. The optimized geometries and frequencies of the stationary points are calculated at the MP2/6-311G(d,p) and MPW1K/6-311G(d,p) levels. Higher-level energies are obtained at the approximate QCISD(T)/6-311++G(3df, 2pd) level using the MP2 geometries as well as by the multicoefficient correlation method based on QCISD (MC-QCISD) using the MPW1K geometries. Complexes with energies less than those of the reactants or products are located at the entrance or the exit channels of these reactions, which indicate that the reactions may proceed via an indirect mechanism. The enthalpies of formation for the species XSH/XSD (X = Cl and Br) are evaluated using hydrogenation working reactions method. By canonical variational transition-state theory (CVT), the rate constants of SH and SD radicals with Cl2, Br2, and BrCl are calculated over a wide temperature range of 200-2000 K at the a-QCISD(T)/6-311++G(3df, 2pd)//MP2/6-311G(d, p) level. Good agreement between the calculated and experimental rate constants is obtained in the measured temperature range. Our calculations show that for SH (SD) + BrCl reaction bromine abstraction (R3a or R3a') leading to the formation of BrSH (BrSD) + Cl in a barrierless process dominants the reaction with the branching ratios for channels 3a and 3a' of 99% at 298 K, which is quite different from the experimental result of k3a'/k3' = 54 +/- 10%. Negative activation energies are found at the higher level for the SH + Br2 and SH + BrCl (Br-abstraction) reactions; as a result, the rate constants show a slightly negative temperature dependence, which is consistent with the determination in the literature. The kinetic isotope effects for the three reactions are "inverse". The values of kH/kD are 0.88, 0.91, and 0.69 at room temperature, respectively, and they increase

  9. Comparison of the neurotoxicities between volatile organic compounds and fragrant organic compounds on human neuroblastoma SK-N-SH cells and primary cultured rat neurons

    Directory of Open Access Journals (Sweden)

    Yasue Yamada

    2015-01-01

    Full Text Available These are many volatile organic compounds (VOCs that are synthesized, produced from petroleum or derived from natural compounds, mostly plants. Fragrant and volatile organic compounds from plants have been used as food additives, medicines and aromatherapy. Several clinical and pathological studies have shown that chronic abuse of VOCs, mainly toluene, causes several neuropsychiatric disorders. Little is known about the mechanisms of neurotoxicity of the solvents. n-Octanal, nonanal, and 2-ethyl-1-hexanol, which are used catalyzers or intermediates of chemical reactions, are released into the environment. Essential oils have the functions of self-defense, sterilization, and antibiosis in plants. When volatile organic compounds enter the body, there is the possibility that they will pass through the blood–brain barrier (BBB and affect the central nervous system (CNS. However, the direct effects of volatile organic compounds on neural function and their toxicities are still unclear. We compared the toxicities of n-octanal, nonanal and 2-ethyl-1-hexanol with those of five naturally derived fragrant organic compounds (FOCs, linalool, cis-3-hexen-1-ol, isoamyl alcohol, n-propyl alcohol and n-phenethyl alcohol. MTT assay of human neuroblastoma SK-N-SH cells showed that the IC50 values of linalool, cis-3-hexen-1-ol, isoamyl alcohol, n-propyl alcohol and phenethyl alcohol were 1.33, 2.3, >5, >5, and 2.39 mM, respectively, and the IC50 values of toluene, n-octanal, nonanal and 2-ethyl-1-hexanol were 850, 37.2, 8.31 and 15.1 μM, respectively. FOCs showed lower toxicities than those of VOCs. These results indicate that FOCs are safer than other compounds.

  10. Purification of SOCS (Suppressor of Cytokine Signaling) SH2 Domains for Structural and Functional Studies.

    Science.gov (United States)

    Liau, Nicholas P D; Laktyushin, Artem; Babon, Jeffrey J

    2017-01-01

    Src Homology 2 (SH2) domains are protein domains which have a high binding affinity for specific amino acid sequences containing a phosphorylated tyrosine residue. The Suppressors of Cytokine Signaling (SOCS) proteins use an SH2 domain to bind to components of certain cytokine signaling pathways to downregulate the signaling cascade. The recombinantly produced SH2 domains of various SOCS proteins have been used to undertake structural and functional studies elucidating the method of how such targeting occurs. Here, we describe the protocol for the recombinant production and purification of SOCS SH2 domains, with an emphasis on SOCS3.

  11. The Secretome of Bone Marrow and Wharton Jelly Derived Mesenchymal Stem Cells Induces Differentiation and Neurite Outgrowth in SH-SY5Y Cells

    OpenAIRE

    Ana O. Pires; Andreia Neves-Carvalho; Nuno Sousa; António J. Salgado

    2014-01-01

    The goal of this study was to determine and compare the effects of the secretome of mesenchymal stem cells (MSCs) isolated from human bone-marrow (BMSCs) and the Wharton jelly surrounding the vein and arteries of the umbilical cord (human umbilical cord perivascular cells (HUCPVCs)) on the survival and differentiation of a human neuroblastoma cell line (SH-SY5Y). For this purpose, SH-SY5Y cells were differentiated with conditioned media (CM) from the MSCs populations referred above. Retinoic ...

  12. Blocking hepatic metastases of colon cancer cells using an shRNA against Rac1 delivered by activatable cell-penetrating peptide.

    Science.gov (United States)

    Bao, Ying; Guo, Huihui; Lu, Yongliang; Feng, Wenming; Sun, Xinrong; Tang, Chengwu; Wang, Xiang; Shen, Mo

    2016-11-22

    Hepatic metastasis is one of the critical progressions of colon cancer. Blocking this process is key to prolonging survival time in cancer patients. Studies on activatable cell-penetrating peptides (dtACPPs) have demonstrated their potential as gene carriers. It showed high tumor cell-targeting specificity and transfection efficiency and low cytotoxicity in the in vitro settings of drug delivery. However, using this system to silence target genes to inhibit metastasis in colorectal cancer cells has not been widely reported and requires further investigation. In this study, we observed that expression of Rac1, a key molecule for cytoskeletal reorganization, was higher in hepatic metastatic tumor tissue compared with prime colon cancer tissue and that patients with high Rac1-expressing colon cancer showed shorter survival time. Base on these findings, we created dtACPP-PEG-DGL (dtACPPD)/shRac1 nanoparticles and demonstrated that they downregulated Rac1 expression in colon cancer cells. Moreover, we observed inhibitory effects on migration, invasion and adhesion in HCT116 colorectal cancer cells in vitro, and our results showed that Rac1 regulated colon cancer cell matrix adhesion through the regulation of cytofilament dynamics. Moreover, mechanically, repression of Rac1 inhibiting cells migration and invasion by enhancing cell to cell adhesion and reducing cell to extracellular matrix adhesion. Furthermore, when atCDPPD/shRac1 nanoparticles were administered intravenously to a HCT116 xenograft model, significant tumor metastasis to the liver was inhibited. Our results suggest that atCDPP/shRac1 nanoparticles may enable the blockade of hepatic metastasis in colon cancer.

  13. Is TNF-a-targeted short hairpin RNA (shRNA) a novel potential therapeutic tool in psoriasis treatment?

    DEFF Research Database (Denmark)

    Stenderup, Karin; Jakobsen, Maria; Rosada, Cecilia

    2008-01-01

      TNF-α is a well known target in psoriasis treatment and biological treatments targeting TNF-a are already clinically used against psoriasis and psoriasis arthritis. Attention is however given to a novel therapeutic tool: RNA interference that controls gene silencing. This study investigates...... the efficiency of targeting TNF-a with specific short hairpin RNA (shRNA) and explores its potential in treating psoriasis. ShRNAs targeting human TNF-α mRNA were generated. Their efficiency in down-regulating TNF-a protein expression was evaluated using a Renilla luciferase screening-assay and a transient co...... TNF-a shRNA was used to transduce HEK293 cells and verify vector-derived TNF-a knockdown in vitro. In vivo, psoriasis skin was exposed to lentiviral TNF-a shRNAs by a single intra-dermal injection. Psoriasis skin for the in vivo study was obtained from psoriatic plaque skin biopsies that were...

  14. FBAR syndapin 1 recognizes and stabilizes highly curved tubular membranes in a concentration dependent manner

    DEFF Research Database (Denmark)

    Ramesh, Pradeep; Baroji, Younes F.; Seyyed Reihani, Seyyed Nader

    2013-01-01

    Syndapin 1 FBAR, a member of the Bin-amphiphysin-Rvs (BAR) domain protein family, is known to induce membrane curvature and is an essential component in biological processes like endocytosis and formation and growth of neurites. We quantify the curvature sensing of FBAR on reconstituted porcine b...

  15. Tyrosine Phosphorylation of the Lyn Src Homology 2 (SH2) Domain Modulates Its Binding Affinity and Specificity*

    Science.gov (United States)

    Jin, Lily L.; Wybenga-Groot, Leanne E.; Tong, Jiefei; Taylor, Paul; Minden, Mark D.; Trudel, Suzanne; McGlade, C. Jane; Moran, Michael F.

    2015-01-01

    Src homology 2 (SH2) domains are modular protein structures that bind phosphotyrosine (pY)-containing polypeptides and regulate cellular functions through protein-protein interactions. Proteomics analysis showed that the SH2 domains of Src family kinases are themselves tyrosine phosphorylated in blood system cancers, including acute myeloid leukemia, chronic lymphocytic leukemia, and multiple myeloma. Using the Src family kinase Lyn SH2 domain as a model, we found that phosphorylation at the conserved SH2 domain residue Y194 impacts the affinity and specificity of SH2 domain binding to pY-containing peptides and proteins. Analysis of the Lyn SH2 domain crystal structure supports a model wherein phosphorylation of Y194 on the EF loop modulates the binding pocket that engages amino acid side chains at the pY+2/+3 position. These data indicate another level of regulation wherein SH2-mediated protein-protein interactions are modulated by SH2 kinases and phosphatases. PMID:25587033

  16. CX3CR1 is expressed by human B lymphocytes and mediates [corrected] CX3CL1 driven chemotaxis of tonsil centrocytes.

    Directory of Open Access Journals (Sweden)

    Anna Corcione

    Full Text Available BACKGROUND: Fractalkine/CX(3CL1, a surface chemokine, binds to CX(3CR1 expressed by different lymphocyte subsets. Since CX(3CL1 has been detected in the germinal centres of secondary lymphoid tissue, in this study we have investigated CX(3CR1 expression and function in human naïve, germinal centre and memory B cells isolated from tonsil or peripheral blood. METHODOLOGY/PRINCIPAL FINDINGS: We demonstrate unambiguously that highly purified human B cells from tonsil and peripheral blood expressed CX(3CR1 at mRNA and protein levels as assessed by quantitative PCR, flow cytometry and competition binding assays. In particular, naïve, germinal centre and memory B cells expressed CX(3CR1 but only germinal centre B cells were attracted by soluble CX(3CL1 in a transwell assay. CX(3CL1 signalling in germinal centre B cells involved PI3K, Erk1/2, p38, and Src phosphorylation, as assessed by Western blot experiments. CX(3CR1(+ germinal centre B cells were devoid of centroblasts and enriched for centrocytes that migrated to soluble CX(3CL1. ELISA assay showed that soluble CX(3CL1 was secreted constitutively by follicular dendritic cells and T follicular helper cells, two cell populations homing in the germinal centre light zone as centrocytes. At variance with that observed in humans, soluble CX(3CL1 did not attract spleen B cells from wild type mice. OVA immunized CX(3CR1(-/- or CX(3CL1(-/- mice showed significantly decreased specific IgG production compared to wild type mice. CONCLUSION/SIGNIFICANCE: We propose a model whereby human follicular dendritic cells and T follicular helper cells release in the light zone of germinal centre soluble CX(3CL1 that attracts centrocytes. The functional implications of these results warrant further investigation.

  17. Grb-IR: A SH2-Domain-Containing Protein that Binds to the Insulin Receptor and Inhibits Its Function

    Science.gov (United States)

    Liu, Feng; Roth, Richard A.

    1995-10-01

    To identify potential signaling molecules involved in mediating insulin-induced biological responses, a yeast two-hybrid screen was performed with the cytoplasmic domain of the human insulin receptor (IR) as bait to trap high-affinity interacting proteins encoded by human liver or HeLa cDNA libraries. A SH2-domain-containing protein was identified that binds with high affinity in vitro to the autophosphorylated IR. The mRNA for this protein was found by Northern blot analyses to be highest in skeletal muscle and was also detected in fat by PCR. To study the role of this protein in insulin signaling, a full-length cDNA encoding this protein (called Grb-IR) was isolated and stably expressed in Chinese hamster ovary cells overexpressing the human IR. Insulin treatment of these cells resulted in the in situ formation of a complex of the IR and the 60-kDa Grb-IR. Although almost 75% of the Grb-IR protein was bound to the IR, it was only weakly tyrosine-phosphorylated. The formation of this complex appeared to inhibit the insulin-induced increase in tyrosine phosphorylation of two endogenous substrates, a 60-kDa GTPase-activating-protein-associated protein and, to a lesser extent, IR substrate 1. The subsequent association of this latter protein with phosphatidylinositol 3-kinase also appeared to be inhibited. These findings raise the possibility that Grb-IR is a SH2-domain-containing protein that directly complexes with the IR and serves to inhibit signaling or redirect the IR signaling pathway.

  18. Isolation and characterization of an isoproturon mineralizing Sphingomonas sp. strain SH from a French agricultural soil.

    Science.gov (United States)

    Hussain, Sabir; Devers-Lamrani, Marion; El Azhari, Najoi; Martin-Laurent, Fabrice

    2011-06-01

    The phenylurea herbicide isoproturon, 3-(4-isopropylphenyl)-1,1-dimethylurea (IPU), was found to be rapidly mineralized in an agricultural soil in France that had been periodically exposed to IPU. Enrichment cultures from samples of this soil isolated a bacterial strain able to mineralize IPU. 16S rRNA sequence analysis showed that this strain belonged to the phylogeny of the genus Sphingomonas (96% similarity with Sphingomonas sp. JEM-14, AB219361) and was designated Sphingomonas sp. strain SH. From this strain, a partial sequence of a 1,2-dioxygenase (catA) gene coding for an enzyme degrading catechol putatively formed during IPU mineralization was amplified. Phylogenetic analysis revealed that the catA sequence was related to Sphingomonas spp. and showed a lack of congruence between the catA and 16S rRNA based phylogenies, implying horizontal gene transfer of the catA gene cluster between soil microbiota. The IPU degrading ability of strain SH was strongly influenced by pH with maximum degradation taking place at pH 7.5. SH was only able to mineralize IPU and its known metabolites including 4-isopropylaniline and it could not degrade other structurally related phenylurea herbicides such as diuron, linuron, monolinuron and chlorotoluron or their aniline derivatives. These observations suggest that the catabolic abilities of the strain SH are highly specific to the metabolism of IPU.

  19. A simple and robust vector-based shRNA expression system used for RNA interference.

    Science.gov (United States)

    Wang, Xue-jun; Li, Ying; Huang, Hai; Zhang, Xiu-juan; Xie, Pei-wen; Hu, Wei; Li, Dan-dan; Wang, Sheng-qi

    2013-01-01

    RNA interference (RNAi) mediated by small interfering RNAs (siRNAs) or short hairpin RNAs (shRNAs) has become a powerful genetic tool for conducting functional studies. Previously, vector-based shRNA-expression strategies capable of inducing RNAi in viable cells have been developed, however, these vector systems have some disadvantages, either because they were error-prone or cost prohibitive. In this report we described the development of a simple, robust shRNA expression system utilizing 1 long oligonucleotide or 2 short oligonucleotides for half the cost of conventional shRNA construction methods and with a >95% cloning success rate. The shRNA loop sequence and stem structure were also compared and carefully selected for better RNAi efficiency. Furthermore, an easier strategy was developed based on isocaudomers which permit rapid combination of the most efficient promoter-shRNA cassettes. Finally, using this method, the conservative target sites for hepatitis B virus (HBV) knockdown were systemically screened and HBV antigen expression shown to be successfully suppressed in the presence of connected multiple shRNAs both in vitro and in vivo. This novel design describes an inexpensive and effective way to clone and express single or multiple shRNAs from the same vector with the capacity for potent and effective silencing of target genes.

  20. Conformation of an Shc-derived phosphotyrosine-containing peptide complexed with the Grb2 SH2 domain

    International Nuclear Information System (INIS)

    Ogura, Kenji; Tsuchiya, Shigeo; Terasawa, Hiroaki; Yuzawa, Satoru; Hatanaka, Hideki; Mandiyan, Valsan; Schlessinger, Joseph; Inagaki, Fuyuhiko

    1997-01-01

    We have determined the structure of an Shc-derived phosphotyrosine-containing peptide complexed with Grb2 SH2 based on intra-and intermolecular NOE correlations observed by a series of isotope-filtered NMR experiments using a PFG z-filter. In contrast to an extended conformation of phosphotyrosine-containing peptides bound to Src, Syp and PLC γ SH2s, the Shc-derived peptide formed a turn at the +1 and +2 positions next to the phosphotyrosine residue. Trp 121 , located at the EF1 site of Grb2 SH2, blocked the peptide binding in an extended conformation. The present study confirms that each phosphotyrosine-containing peptide binds to the cognate SH2 with a specific conformation, which gives the structural basis for the binding specificity between SH2s and target proteins

  1. Antibody-mediated platelet phagocytosis by human macrophages is inhibited by siRNA specific for sequences in the SH2 tyrosine kinase, Syk.

    Science.gov (United States)

    Lu, Ying; Wang, Weiming; Mao, Huiming; Hu, Hai; Wu, Yanling; Chen, Bing-Guan; Liu, Zhongmin

    2011-01-01

    Immune thrombocytopenia depends upon Fc receptor-mediated phagocytosis that involves signaling through the SH2 tyrosine kinase, Syk. We designed small interfering (siRNA) sequences complementary to Syk coding regions to decrease the expression of Syk in the human macrophage cell line, THP-1. To evaluate the functional effect of siRNA on phagocytosis, we developed a new in vitro assay for antibody-mediated platelet ingestion by THP-1 cells. Incubation of THP-1 cells at 37°C with fluorescence-labeled platelets and anti-platelet antibody promoted ingestion of platelets that could be quantitated by flow cytometry. Transfection of THP-1 cells with Syk-specific siRNA resulted in a reduction in the amount of FcγRII-associated Syk protein. Coincident with decreased Syk expression, we observed inhibition of antibody-mediated platelet ingestion. These results confirm a key role for Syk in antibody-mediated phagocytosis and suggest Syk-specific siRNA as a possible therapeutic candidate for immune thrombocytopenia. Copyright © 2011 Elsevier Inc. All rights reserved.

  2. Dissection of the BCR-ABL signaling network using highly specific monobody inhibitors to the SHP2 SH2 domains.

    Science.gov (United States)

    Sha, Fern; Gencer, Emel Basak; Georgeon, Sandrine; Koide, Akiko; Yasui, Norihisa; Koide, Shohei; Hantschel, Oliver

    2013-09-10

    The dysregulated tyrosine kinase BCR-ABL causes chronic myelogenous leukemia in humans and forms a large multiprotein complex that includes the Src-homology 2 (SH2) domain-containing phosphatase 2 (SHP2). The expression of SHP2 is necessary for BCR-ABL-dependent oncogenic transformation, but the precise signaling mechanisms of SHP2 are not well understood. We have developed binding proteins, termed monobodies, for the N- and C-terminal SH2 domains of SHP2. Intracellular expression followed by interactome analysis showed that the monobodies are essentially monospecific to SHP2. Two crystal structures revealed that the monobodies occupy the phosphopeptide-binding sites of the SH2 domains and thus can serve as competitors of SH2-phosphotyrosine interactions. Surprisingly, the segments of both monobodies that bind to the peptide-binding grooves run in the opposite direction to that of canonical phosphotyrosine peptides, which may contribute to their exquisite specificity. When expressed in cells, monobodies targeting the N-SH2 domain disrupted the interaction of SHP2 with its upstream activator, the Grb2-associated binder 2 adaptor protein, suggesting decoupling of SHP2 from the BCR-ABL protein complex. Inhibition of either N-SH2 or C-SH2 was sufficient to inhibit two tyrosine phosphorylation events that are critical for SHP2 catalytic activity and to block ERK activation. In contrast, targeting the N-SH2 or C-SH2 revealed distinct roles of the two SH2 domains in downstream signaling, such as the phosphorylation of paxillin and signal transducer and activator of transcription 5. Our results delineate a hierarchy of function for the SH2 domains of SHP2 and validate monobodies as potent and specific antagonists of protein-protein interactions in cancer cells.

  3. Genetic Disruption of the Sh3pxd2a Gene Reveals an Essential Role in Mouse Development and the Existence of a Novel Isoform of Tks5

    OpenAIRE

    Cejudo-Martin, Pilar; Yuen, Angela; Vlahovich, Nicole; Lock, Peter; Courtneidge, Sara A.; Díaz, Begoña

    2014-01-01

    Tks5 is a scaffold protein and Src substrate involved in cell migration and matrix degradation through its essential role in invadosome formation and function. We have previously described that Tks5 is fundamental for zebrafish neural crest cell migration in vivo. In the present study, we sought to investigate the function of Tks5 in mammalian development by analyzing mice mutant for sh3pxd2a, the gene encoding Tks5. Homozygous disruption of the sh3pxd2a gene by gene-trapping in mouse resulte...

  4. MeSH: a window into full text for document summarization.

    Science.gov (United States)

    Bhattacharya, Sanmitra; Ha-Thuc, Viet; Srinivasan, Padmini

    2011-07-01

    Previous research in the biomedical text-mining domain has historically been limited to titles, abstracts and metadata available in MEDLINE records. Recent research initiatives such as TREC Genomics and BioCreAtIvE strongly point to the merits of moving beyond abstracts and into the realm of full texts. Full texts are, however, more expensive to process not only in terms of resources needed but also in terms of accuracy. Since full texts contain embellishments that elaborate, contextualize, contrast, supplement, etc., there is greater risk for false positives. Motivated by this, we explore an approach that offers a compromise between the extremes of abstracts and full texts. Specifically, we create reduced versions of full text documents that contain only important portions. In the long-term, our goal is to explore the use of such summaries for functions such as document retrieval and information extraction. Here, we focus on designing summarization strategies. In particular, we explore the use of MeSH terms, manually assigned to documents by trained annotators, as clues to select important text segments from the full text documents. Our experiments confirm the ability of our approach to pick the important text portions. Using the ROUGE measures for evaluation, we were able to achieve maximum ROUGE-1, ROUGE-2 and ROUGE-SU4 F-scores of 0.4150, 0.1435 and 0.1782, respectively, for our MeSH term-based method versus the maximum baseline scores of 0.3815, 0.1353 and 0.1428, respectively. Using a MeSH profile-based strategy, we were able to achieve maximum ROUGE F-scores of 0.4320, 0.1497 and 0.1887, respectively. Human evaluation of the baselines and our proposed strategies further corroborates the ability of our method to select important sentences from the full texts. sanmitra-bhattacharya@uiowa.edu; padmini-srinivasan@uiowa.edu.

  5. Construction of lentiviral shRNA expression vector targeting ...

    African Journals Online (AJOL)

    ajl yemi

    2011-10-26

    Oct 26, 2011 ... was then selected, while the titer of lentiviral packing PLD2-shRNA was 3.47 × 104 TU/ml and the virus was successfully ... MATERIALS AND METHODS .... such as: transfecting cells not only in mitotic active phase but also in ...

  6. Expression and Purification of Soluble STAT5b/STAT3 Proteins for SH2 Domain Binding Assay.

    Science.gov (United States)

    Asai, Akira; Takakuma, Kazuyuki

    2017-01-01

    When a large hydrophobic full-length protein is expressed in bacteria, it is often challenging to obtain recombinant proteins in the soluble fraction. One way to overcome this challenge is expression of deletion mutants that have improved solubility while maintaining biological activity. In this chapter, we describe a protocol for expression of truncated forms of STAT5b and STAT3 proteins that are soluble and retain SH2-mediated activity for phospho-Tyr peptide recognition.

  7. Tyrosine phosphorylation of the Lyn Src homology 2 (SH2) domain modulates its binding affinity and specificity.

    Science.gov (United States)

    Jin, Lily L; Wybenga-Groot, Leanne E; Tong, Jiefei; Taylor, Paul; Minden, Mark D; Trudel, Suzanne; McGlade, C Jane; Moran, Michael F

    2015-03-01

    Src homology 2 (SH2) domains are modular protein structures that bind phosphotyrosine (pY)-containing polypeptides and regulate cellular functions through protein-protein interactions. Proteomics analysis showed that the SH2 domains of Src family kinases are themselves tyrosine phosphorylated in blood system cancers, including acute myeloid leukemia, chronic lymphocytic leukemia, and multiple myeloma. Using the Src family kinase Lyn SH2 domain as a model, we found that phosphorylation at the conserved SH2 domain residue Y(194) impacts the affinity and specificity of SH2 domain binding to pY-containing peptides and proteins. Analysis of the Lyn SH2 domain crystal structure supports a model wherein phosphorylation of Y(194) on the EF loop modulates the binding pocket that engages amino acid side chains at the pY+2/+3 position. These data indicate another level of regulation wherein SH2-mediated protein-protein interactions are modulated by SH2 kinases and phosphatases. © 2015 by The American Society for Biochemistry and Molecular Biology, Inc.

  8. Comprehensive Binary Interaction Mapping of SH2 Domains via Fluorescence Polarization Reveals Novel Functional Diversification of ErbB Receptors

    Science.gov (United States)

    Ciaccio, Mark F.; Chuu, Chih-pin; Jones, Richard B.

    2012-01-01

    First-generation interaction maps of Src homology 2 (SH2) domains with receptor tyrosine kinase (RTK) phosphosites have previously been generated using protein microarray (PM) technologies. Here, we developed a large-scale fluorescence polarization (FP) methodology that was able to characterize interactions between SH2 domains and ErbB receptor phosphosites with higher fidelity and sensitivity than was previously achieved with PMs. We used the FP assay to query the interaction of synthetic phosphopeptides corresponding to 89 ErbB receptor intracellular tyrosine sites against 93 human SH2 domains and 2 phosphotyrosine binding (PTB) domains. From 358,944 polarization measurements, the affinities for 1,405 unique biological interactions were determined, 83% of which are novel. In contrast to data from previous reports, our analyses suggested that ErbB2 was not more promiscuous than the other ErbB receptors. Our results showed that each receptor displays unique preferences in the affinity and location of recruited SH2 domains that may contribute to differences in downstream signaling potential. ErbB1 was enriched versus the other receptors for recruitment of domains from RAS GEFs whereas ErbB2 was enriched for recruitment of domains from tyrosine and phosphatidyl inositol phosphatases. ErbB3, the kinase inactive ErbB receptor family member, was predictably enriched for recruitment of domains from phosphatidyl inositol kinases and surprisingly, was enriched for recruitment of domains from tyrosine kinases, cytoskeletal regulatory proteins, and RHO GEFs but depleted for recruitment of domains from phosphatidyl inositol phosphatases. Many novel interactions were also observed with phosphopeptides corresponding to ErbB receptor tyrosines not previously reported to be phosphorylated by mass spectrometry, suggesting the existence of many biologically relevant RTK sites that may be phosphorylated but below the detection threshold of standard mass spectrometry procedures. This

  9. Comprehensive binary interaction mapping of SH2 domains via fluorescence polarization reveals novel functional diversification of ErbB receptors.

    Directory of Open Access Journals (Sweden)

    Ronald J Hause

    Full Text Available First-generation interaction maps of Src homology 2 (SH2 domains with receptor tyrosine kinase (RTK phosphosites have previously been generated using protein microarray (PM technologies. Here, we developed a large-scale fluorescence polarization (FP methodology that was able to characterize interactions between SH2 domains and ErbB receptor phosphosites with higher fidelity and sensitivity than was previously achieved with PMs. We used the FP assay to query the interaction of synthetic phosphopeptides corresponding to 89 ErbB receptor intracellular tyrosine sites against 93 human SH2 domains and 2 phosphotyrosine binding (PTB domains. From 358,944 polarization measurements, the affinities for 1,405 unique biological interactions were determined, 83% of which are novel. In contrast to data from previous reports, our analyses suggested that ErbB2 was not more promiscuous than the other ErbB receptors. Our results showed that each receptor displays unique preferences in the affinity and location of recruited SH2 domains that may contribute to differences in downstream signaling potential. ErbB1 was enriched versus the other receptors for recruitment of domains from RAS GEFs whereas ErbB2 was enriched for recruitment of domains from tyrosine and phosphatidyl inositol phosphatases. ErbB3, the kinase inactive ErbB receptor family member, was predictably enriched for recruitment of domains from phosphatidyl inositol kinases and surprisingly, was enriched for recruitment of domains from tyrosine kinases, cytoskeletal regulatory proteins, and RHO GEFs but depleted for recruitment of domains from phosphatidyl inositol phosphatases. Many novel interactions were also observed with phosphopeptides corresponding to ErbB receptor tyrosines not previously reported to be phosphorylated by mass spectrometry, suggesting the existence of many biologically relevant RTK sites that may be phosphorylated but below the detection threshold of standard mass spectrometry

  10. In-Solution SH2 Domain Binding Assay Based on Proximity Ligation.

    Science.gov (United States)

    Machida, Kazuya

    2017-01-01

    Protein-protein interactions mediated by SH2 domains confer specificity in tyrosine kinase pathways. Traditional assays for assessing interactions between an SH2 domain and its interacting protein such as far-Western and pull-down are inherently low throughput. We developed SH2-PLA, an in-solution SH2 domain binding assay, that takes advantage of the speed and sensitivity of proximity ligation and real-time PCR. SH2-PLA allows for rapid assessment of SH2 domain binding to a target protein using only a few microliters of cell lysate, thereby making it an attractive new tool to study tyrosine kinase signaling.

  11. Two-dimensional Molecular Gas and Ongoing Star Formation around H II Region Sh2-104

    Science.gov (United States)

    Xu, Jin-Long; Xu, Ye; Yu, Naiping; Zhang, Chuan-peng; Liu, Xiao-Lan; Wang, Jun-Jie; Ning, Chang-chun; Ju, Bing-Gang; Zhang, Guo-Yin

    2017-11-01

    We performed a multi-wavelength study toward H II region Sh2-104. New maps of 12CO J = 1 - 0 and 13CO J = 1 - 0 were obtained from the Purple Mountain Observatory 13.7 m radio telescope. Sh2-104 displays a double-ring structure. The outer ring with a radius of 4.4 pc is dominated by 12, 500 μm, 12CO J = 1 - 0, and 13CO J = 1 - 0 emission, while the inner ring with a radius of 2.9 pc is dominated by 22 μm and 21 cm emission. We did not detect CO emission inside the outer ring. The north-east portion of the outer ring is blueshifted, while the south-west portion is redshifted. The present observations have provided evidence that the collected outer ring around Sh2-104 is a two-dimensional structure. From the column density map constructed by the Hi-GAL survey data, we extract 21 clumps. About 90% of all the clumps will form low-mass stars. A power-law fit to the clumps yields M=281 {M}⊙ {(r/{pc})}1.31+/- 0.08. The selected YSOs are associated with the collected material on the edge of Sh2-104. The derived dynamical age of Sh2-104 is 1.6× {10}6 yr. Comparing the Sh2-104 dynamical age with the YSO timescale and the fragmentation time of the molecular ring, we further confirm that the collect-and-collapse process operates in this region, indicating positive feedback from a massive star for surrounding gas.

  12. Differential Effects of Methyl-4-Phenylpyridinium Ion, Rotenone, and Paraquat on Differentiated SH-SY5Y Cells

    Directory of Open Access Journals (Sweden)

    João Barbosa Martins

    2013-01-01

    Full Text Available Paraquat (PQ, a cationic nonselective bipyridyl herbicide, has been used as neurotoxicant to modulate Parkinson’s disease in laboratory settings. Other compounds like rotenone (ROT, a pesticide, and 1-methyl-4-phenylpyridinium ion (MPP+ have been widely used as neurotoxicants. We compared the toxicity of these three neurotoxicants using differentiated dopaminergic SH-SY5Y human cells, aiming to elucidate their differential effects. PQ-induced neurotoxicity was shown to be concentration and time dependent, being mitochondrial dysfunction followed by neuronal death. On the other hand, cells exposure to MPP+ induced mitochondrial dysfunction, but not cellular lyses. Meanwhile, ROT promoted both mitochondrial dysfunction and neuronal death, revealing a biphasic pattern. To further elucidate PQ neurotoxic mechanism, several protective agents were used. SH-SY5Y cells pretreatment with tiron (TIR and 2-hydroxybenzoic acid sodium salt (NaSAL, both antioxidants, and Nω-nitro-L-arginine methyl ester hydrochloride (L-NAME, a nitric oxide synthase inhibitor, partially protected against PQ-induced cell injury. Additionally, 1-(2-[bis(4-fluorophenylmethoxy]ethyl-4-(3-phenyl-propylpiperazine (GBR 12909, a dopamine transporter inhibitor, and cycloheximide (CHX, a protein synthesis inhibitor, also partially protected against PQ-induced cell injury. In conclusion, we demonstrated that PQ, MPP+, and ROT exerted differential toxic effects on dopaminergic cells. PQ neurotoxicity occurred through exacerbated oxidative stress, with involvement of uptake through the dopamine transporter and protein synthesis.

  13. J-GLOBAL MeSH Dictionary: Gallidヘルペスウイルス3 [MeCab user dictionary for science technology term[Archive

    Lifescience Database Archive (English)

    Full Text Available MeCab user dictionary for science technology term Gallidヘルペスウイルス3 名詞 一般 * * * * Gallidヘルペスウイルス...3 ... MeSH D025961 200906074137167123 C LS07 UNKNOWN_2 Gallid ヘルペスウイルス 3

  14. A simple and robust vector-based shRNA expression system used for RNA interference.

    Directory of Open Access Journals (Sweden)

    Xue-jun Wang

    Full Text Available BACKGROUND: RNA interference (RNAi mediated by small interfering RNAs (siRNAs or short hairpin RNAs (shRNAs has become a powerful genetic tool for conducting functional studies. Previously, vector-based shRNA-expression strategies capable of inducing RNAi in viable cells have been developed, however, these vector systems have some disadvantages, either because they were error-prone or cost prohibitive. RESULTS: In this report we described the development of a simple, robust shRNA expression system utilizing 1 long oligonucleotide or 2 short oligonucleotides for half the cost of conventional shRNA construction methods and with a >95% cloning success rate. The shRNA loop sequence and stem structure were also compared and carefully selected for better RNAi efficiency. Furthermore, an easier strategy was developed based on isocaudomers which permit rapid combination of the most efficient promoter-shRNA cassettes. Finally, using this method, the conservative target sites for hepatitis B virus (HBV knockdown were systemically screened and HBV antigen expression shown to be successfully suppressed in the presence of connected multiple shRNAs both in vitro and in vivo. CONCLUSION: This novel design describes an inexpensive and effective way to clone and express single or multiple shRNAs from the same vector with the capacity for potent and effective silencing of target genes.

  15. Structure of Stenotrophomonas maltophilia FeoA complexed with zinc: a unique prokaryotic SH3-domain protein that possibly acts as a bacterial ferrous iron-transport activating factor

    International Nuclear Information System (INIS)

    Su, Yi-Che; Chin, Ko-Hsin; Hung, Hui-Chih; Shen, Gwan-Han; Wang, Andrew H.-J.; Chou, Shan-Ho

    2010-01-01

    The crystal structure of FeoA from Stenotrophomonas maltophilia has been determined to a resolution of 1.7 Å using an Se single-wavelength anomalous dispersion (Se-SAD) approach and revealed a unique dimer cross-linked by two zinc ions and six chloride ions. Iron is vital to the majority of prokaryotes, with ferrous iron believed to be the preferred form for iron uptake owing to its much better solubility. The major route for bacterial ferrous iron uptake is found to be via an Feo (ferrous iron-transport) system comprising the three proteins FeoA, FeoB and FeoC. Although the structure and function of FeoB have received much attention recently, the roles played by FeoA and FeoC have been little investigated to date. Here, the tertiary structure of FeoA from Stenotrophomonas maltophilia (Sm), a vital opportunistic pathogen in immunodepressed hosts, is reported. The crystal structure of SmFeoA has been determined to a resolution of 1.7 Å using an Se single-wavelength anomalous dispersion (Se-SAD) approach. Although SmFeoA bears low sequence identity to eukaryotic proteins, its structure is found to adopt a eukaryotic SH3-domain-like fold. It also bears weak similarity to the C-terminal SH3 domain of bacterial DtxR (diphtheria toxin regulator), with some unique characteristics. Intriguingly, SmFeoA is found to adopt a unique dimer cross-linked by two zinc ions and six anions (chloride ions). Since FeoB has been found to contain a G-protein-like domain with low GTPase activity, FeoA may interact with FeoB through the SH3–G-protein domain interaction to act as a ferrous iron-transport activating factor

  16. Conditions required for the appearance of double responses in hippocampal field CA1 to application of single stimuli to Shäffer collaterals in freely moving rats.

    Science.gov (United States)

    Zosimovskii, V A; Korshunov, V A; Markevich, V A

    2008-03-01

    Stimulation of Shäffer collaterals with single current impulses could evoke double responses in hippocampal field CA1 in freely moving rats. The late response - the population excitatory postsynaptic potential with a preceding transient potential, often biphasic - occurred only after an early population spike and was time-locked to it. The shape characteristics of the late response, its polarity, and its latent period relative to the early population spike suggest that stimulation of Shäffer collaterals gives rise, in CA1, to a wave of excitation which passes through the entorhinal cortex and returns to CA1 directly via fibers of the perforant path. In conscious rats, medium-strength stimulation of Shäffer collaterals, sufficient to evoke a quite early population spike in CA1, did not usually lead to the appearance of a late response; the same stimulation became effective after tetanization of Shäffer collaterals in conditions of long-term potentiation of the early population spike. Furthermore, the appearance of the late response was facilitated in rats falling asleep on the background of high-amplitude, low-frequency EEG oscillations in CA1 characteristic of slow-wave sleep, as well as in sleeping rats, regardless of the EEG pattern.

  17. Application of the biosurfactants produced by Bacillus spp. (SH 20 ...

    African Journals Online (AJOL)

    Application of the biosurfactants produced by Bacillus spp. (SH 20 and SH 26) and P. aeruginosa SH 29 isolated from the rhizosphere soil of an Egyptian salt marsh plant for the cleaning of oil - contaminataed vessels and enhancing the biodegradat.

  18. Inhibition of Rac1 activity induces G1/S phase arrest through the GSK3/cyclin D1 pathway in human cancer cells.

    Science.gov (United States)

    Liu, Linna; Zhang, Hongmei; Shi, Lei; Zhang, Wenjuan; Yuan, Juanli; Chen, Xiang; Liu, Juanjuan; Zhang, Yan; Wang, Zhipeng

    2014-10-01

    Rac1 has been shown to regulate the cell cycle in cancer cells. Yet, the related mechanism remains unclear. Thus, the present study aimed to investigate the mechanism involved in the regulation of G1/S phase transition by Rac1 in cancer cells. Inhibition of Rac1 by inhibitor NSC23766 induced G1/S phase arrest and inhibited the proliferation of A431, SW480 and U2-OS cells. Suppression of GSK3 by shRNA partially rescued G1/S phase arrest and inhibition of proliferation. Incubation of cells with NSC23766 reduced p-AKT and inactivated p-GSK3α and p-GSK3β, increased p-cyclin D1 expression and decreased the level of cyclin D1 protein. Consequently, cyclin D1 targeting transcriptional factor E2F1 expression, which promotes G1 to S phase transition, was also reduced. In contrast, constitutive active Rac1 resulted in increased p-AKT and inactivated p-GSK3α and p-GSK3β, decreased p-cyclin D1 expression and enhanced levels of cyclin D1 and E2F1 expression. Moreover, suppression of GSK3 did not alter p-AKT or Rac1 activity, but decreased p-cyclin D1 and increased total cyclin D1 protein. However, neither Rac1 nor GSK3 inhibition altered cyclin D1 at the RNA level. Moreover, after inhibition of Rac1 or GSK3 following proteasome inhibitor MG132 treatment, cyclin D1 expression at the protein level remained constant, indicating that Rac1 and GSK3 may regulate cyclin D1 turnover through phosphorylation and degradation. Therefore, our findings suggest that inhibition of Rac1 induces cell cycle G1/S arrest in cancer cells by regulation of the GSK3/cyclin D1 pathway.

  19. Identification of two novel SH3PXD2B gene mutations in Frank-Ter Haar syndrome by exome sequencing: Case report and review of the literature.

    Science.gov (United States)

    Zrhidri, Abdelali; Jaouad, Imane Cherkaoui; Lyahyai, Jaber; Raymond, Laure; Egéa, Grégory; Taoudi, Mohamed; El Mouatassim, Said; Sefiani, Abdelaziz

    2017-09-10

    Frank-Ter Haar syndrome (FTHS) is an autosomal-recessive disorder characterized by skeletal, cardio-vascular, and eye abnormalities, such as increased intraocular pressure, prominent eyes, and hypertelorism. The most common underlying genetic defect in Frank-Ter Haar syndrome appears to be due to mutations in the SH3PXD2B gene on chromosome 5q35.1. Until now, only six mutations in SH3PXD2B gene have been identified. A genetic heterogeneity of FTHS was suggested in previous studies. FTHS was suspected clinically in a girl of 2years old, born from non-consanguineous Moroccan healthy parents. The patient had been referred to a medical genetics outpatient clinic for dysmorphic facial features. Whole Exome Sequencing (WES) was performed in the patient and her parents, in addition to Sanger sequencing that was carried out to confirm the results. We report the first description of a Moroccan FTHS patient with two novel compound heterozygous mutations c.806G>A; p.Trp269* (maternal allele) and c.892delC; p.Asp299Thrfs*44 (paternal allele) in the SH3PXD2B gene. Sanger sequencing confirmed this mutation in the affected girl and demonstrated that her parents carry this mutation in heterozygous state. Our results confirm the clinical diagnosis of FTHS in this reported family and contribute to expand the mutational spectrum of this rare disease. Our study shows also, that exome sequencing is a powerful and a cost-effective tool for the diagnosis of a supposed genetically heterogeneous disorder such FTHS. Copyright © 2017 Elsevier B.V. All rights reserved.

  20. Impact of haloperidol and quetiapine on the expression of genes encoding antioxidant enzymes in human neuroblastoma SH-SY5Y cells.

    Science.gov (United States)

    Schmidt, Andreas Johannes; Hemmeter, Ulrich Michael; Krieg, Jürgen-Christian; Vedder, Helmut; Heiser, Philip

    2009-05-01

    Antipsychotics are known to alter antioxidant activities in vivo. Therefore, the aim of the present study was to examine in the human neuroblastoma SH-SY5Y cell line the impact of a typical (haloperidol) and an atypical (quetiapine) antipsychotic on the expression of genes encoding the key enzymes of the antioxidant metabolism (Cu, Zn superoxide dismutase; Mn superoxide dismutase; glutathione peroxidase; catalase) and enzymes of the glutathione metabolism (gamma-glutamyl cysteine synthetase, glutathione-S-transferase, gamma-glutamyltranspeptidase, glutathione reductase). The cells were incubated for 24h with 0.3, 3, 30 and 300microM haloperidol and quetiapine, respectively; mRNA levels were measured by polymerase chain reaction. In the present study, we observed mostly significant decreases of mRNA contents. With respect to the key pathways, we detected mainly effects on the mRNA levels of the hydrogen peroxide detoxifying enzymes. Among the enzymes of the glutathione metabolism, glutathione-S-transferase- and gamma-glutamyltranspeptidase-mRNA levels showed the most prominent effects. Taken together, our results demonstrate a significantly reduced expression of genes encoding for antioxidant enzymes after treatment with the antipsychotics, haloperidol and quetiapine.

  1. Baicalein antagonizes rotenone-induced apoptosis in dopaminergic SH-SY5Y cells related to Parkinsonism.

    Science.gov (United States)

    Song, Ju-Xian; Choi, Mandy Yuen-Man; Wong, Kavin Chun-Kit; Chung, Winkie Wing-Yan; Sze, Stephen Cho-Wing; Ng, Tzi-Bun; Zhang, Kalin Yan-Bo

    2012-01-21

    Two active compounds, baicalein and its glycoside baicalin were found in the dried root of Scutellaria baicalensis Georgi, and reported to be neuroprotective in vitro and in vivo. This study aims to evaluate the protective effects of baicalein on the rotenone-induced apoptosis in dopaminergic SH-SY5Y cells related to parkinsonism. Cell viability and cytotoxicity were determined by MTT assay. The degree of nuclear apoptosis was evaluated with a fluorescent DNA-binding probe Hoechst 33258. The production of reactive oxidative species (ROS) and loss of mitochondrial membrane potential (ΔΨm) were determined by fluorescent staining with DCFH-DA and Rhodanmine 123, respectively. The expression of Bax, Bcl-2, cleaved caspase-3 and phosphorylated ERK1/2 was determined by the Western blots. Baicalein significantly increased viability and decreased rotenone-induced death of SH-SY5Y cells in a dose-dependent manner. Pre- and subsequent co-treatment with baicalein preserved the cell morphology and attenuated the nuclear apoptotic characteristics triggered by rotenone. Baicalein antagonized rotenone-induced overproduction of ROS, loss of ΔΨm, the increased expression of Bax, cleaved caspase-3 and phosphorylated ERK1/2 and the decreased expression of Bcl-2. The antioxidative effect, mitochondrial protection and modulation of anti-and pro-apoptotic proteins are related to the neuroprotective effects of baicalein against rotenone induced cell death in SH-SY5Y cells.

  2. Silencing Intersectin 1 Slows Orthotopic Neuroblastoma Growth in Mice.

    Science.gov (United States)

    Harris, Jamie; Herrero-Garcia, Erika; Russo, Angela; Kajdacsy-Balla, Andre; O'Bryan, John P; Chiu, Bill

    2017-11-01

    Neuroblastoma accounts for 15% of all pediatric cancer deaths. Intersectin 1 (ITSN1), a scaffold protein involved in phosphoinositide 3-kinase (PI3K) signaling, regulates neuroblastoma cells independent of MYCN status. We hypothesize that by silencing ITSN1 in neuroblastoma cells, tumor growth will be decreased in an orthotopic mouse tumor model. SK-N-AS neuroblastoma cells transfected with empty vector (pSR), vectors expressing scrambled shRNA (pSCR), or shRNAs targeting ITSN1 (sh#1 and sh#2) were used to create orthotopic neuroblastoma tumors in mice. Volume was monitored weekly with ultrasound. End-point was tumor volume >1000 mm. Tumor cell lysates were analyzed with anti-ITSN1 antibody by Western blot. Orthotopic tumors were created in all cell lines. Twenty-five days post injection, pSR tumor size was 917.6±247.7 mm, pSCR was 1180±159.9 mm, sh#1 was 526.3±212.8 mm, and sh#2 was 589.2±74.91 mm. sh#1-tumors and sh#2-tumors were smaller than pSCR (P=0.02), no difference between sh#1 and sh#2. Survival was superior in sh#2-tumors (P=0.02), trended towards improved survival in sh#1-tumors (P=0.09), compared with pSCR-tumors, no difference in pSR tumors. Western blot showed decreased ITSN1 expression in sh#1 and sh#2 compared with pSR and pSCR. Silencing ITSN1 in neuroblastoma cells led to decreased tumor growth in an orthotopic mouse model. Orthotopic animal models can provide insight into the role of ITSN1 pathways in neuroblastoma tumorigenesis.

  3. 3-(Fur-2-yl)-10-(2-phenylethyl)-[1,2,4]triazino[4,3-a]benzimidazol-4(10H)-one, a novel adenosine receptor antagonist with A(2A)-mediated neuroprotective effects.

    Science.gov (United States)

    Scatena, Alessia; Fornai, Francesco; Trincavelli, Maria Letizia; Taliani, Sabrina; Daniele, Simona; Pugliesi, Isabella; Cosconati, Sandro; Martini, Claudia; Da Settimo, Federico

    2011-09-21

    In this study, compound FTBI (3-(2-furyl)-10-(2-phenylethyl)[1,2,4]triazino[4,3-a]benzimidazol-4(10H)-one) was selected from a small library of triazinobenzimidazole derivatives as a potent A(2A) adenosine receptor (AR) antagonist and tested for its neuroprotective effects against two different kinds of dopaminergic neurotoxins, 1-methyl-4-phenylpyridinium (MPP+) and methamphetamine (METH), in rat PC12 and in human neuroblastoma SH-SY5Y cell lines. FTBI, in a concentration range corresponding to its affinity for A(2A) AR subtype, significantly increased the number of viable PC12 cells after their exposure to METH and, to a similar extent, to MPP+, as demonstrated in both trypan blue exclusion assay and in cytological staining. These neuroprotective effects were also observed with a classical A(2A) AR antagonist, ZM241385, and appeared to be completely counteracted by the AR agonist, NECA, supporting A(2A) ARs are directly involved in FTBI-mediated effects. Similarly, in human SH-SY5Y cells, FTBI was able to prevent cell toxicity induced by MPP+ and METH, showing that this A(2A) AR antagonist has a neuroprotective effect independently by the specific cell model. Altogether these results demonstrate that the A(2A) AR blockade mediates cell protection against neurotoxicity induced by dopaminergic neurotoxins in dopamine containing cells, supporting the potential use of A(2A) AR antagonists in dopaminergic degenerative diseases including Parkinson's disease.

  4. Morphological Differentiation Towards Neuronal Phenotype of SH-SY5Y Neuroblastoma Cells by Estradiol, Retinoic Acid and Cholesterol.

    Science.gov (United States)

    Teppola, Heidi; Sarkanen, Jertta-Riina; Jalonen, Tuula O; Linne, Marja-Leena

    2016-04-01

    Human SH-SY5Y neuroblastoma cells maintain their potential for differentiation and regression in culture conditions. The induction of differentiation could serve as a strategy to inhibit cell proliferation and tumor growth. Previous studies have shown that differentiation of SH-SY5Y cells can be induced by all-trans-retinoic-acid (RA) and cholesterol (CHOL). However, signaling pathways that lead to terminal differentiation of SH-SY5Y cells are still largely unknown. The goal of this study was to examine in the RA and CHOL treated SH-SY5Y cells the additive impacts of estradiol (E2) and brain-derived neurotrophic factor (BDNF) on cell morphology, cell population growth, synaptic vesicle recycling and presence of neurofilaments. The above features indicate a higher level of neuronal differentiation. Our data show that treatment for 10 days in vitro (DIV) with RA alone or when combined with E2 (RE) or CHOL (RC), but not when combined with BDNF (RB), significantly (p differentiation.

  5. AAV-based shRNA silencing of NF-κB ameliorates muscle pathologies in mdx mice.

    Science.gov (United States)

    Yang, Q; Tang, Y; Imbrogno, K; Lu, A; Proto, J D; Chen, A; Guo, F; Fu, F H; Huard, J; Wang, B

    2012-12-01

    Chronic inflammation, promoted by an upregulated NF-kappa B (NF-κB) pathway, has a key role in Duchenne muscular dystrophy (DMD) patients' pathogenesis. Blocking the NF-κB pathway has been shown to be a viable approach to diminish chronic inflammation and necrosis in the dystrophin-defective mdx mouse, a murine DMD model. In this study, we used the recombinant adeno-associated virus serotype 9 (AAV9) carrying an short hairpin RNA (shRNA) specifically targeting the messenger RNA of NF-κB/p65 (p65-shRNA), the major subunit of NF-κB associated with chronic inflammation in mdx mice. We examined whether i.m. AAV9-mediated delivery of p65-shRNA could decrease NF-κB activation, allowing for amelioration of muscle pathologies in 1- and 4-month-old mdx mice. At 1 month after treatment, NF-κB/p65 levels were significantly decreased by AAV gene transfer of p65-shRNA in the two ages of treatment groups, with necrosis significantly decreased compared with controls. Quantitative analysis revealed that central nucleation (CN) of the myofibers of p65-shRNA-treated 1-month-old mdx muscles was reduced from 67 to 34%, but the level of CN was not significantly decreased in treated 4-month-old mdx mice. Moreover, delivery of the p65-shRNA enhanced the capacity of myofiber regeneration in old mdx mice treated at 4 months of age when the dystrophic myofibers were most exhausted; however, such p65 silencing diminished the myofiber regeneration in young mdx mice treated at 1 month of age. Taken together, these findings demonstrate that the AAV-mediated delivery of p65-shRNA has the capacity to ameliorate muscle pathologies in mdx mice by selectively reducing NF-κB/p65 activity.

  6. Differential induction of Toll-like receptors & type 1 interferons by Sabin attenuated & wild type 1 polioviruses in human neuronal cells.

    Science.gov (United States)

    Mohanty, Madhu C; Deshpande, Jagadish M

    2013-01-01

    Polioviruses are the causative agent of paralytic poliomyelitis. Attenuated polioviruses (Sabin oral poliovirus vaccine strains) do not replicate efficiently in neurons as compared to the wild type polioviruses and therefore do not cause disease. This study was aimed to investigate the differential host immune response to wild type 1 poliovirus (wild PV) and Sabin attenuated type 1 poliovirus (Sabin PV) in cultured human neuronal cells. By using flow cytometry and real time PCR methods we examined host innate immune responses and compared the role of toll like receptors (TLRs) and cytoplasmic RNA helicases in cultured human neuronal cells (SK-N-SH) infected with Sabin PV and wild PV. Human neuronal cells expressed very low levels of TLRs constitutively. Sabin PV infection induced significantly higher expression of TLR3, TLR7 and melanoma differentiation-associated protein-5 (MDA-5) m-RNA in neuronal cells at the beginning of infection (up to 4 h) as compared to wild PV. Further, Sabin PV also induced the expression of interferon α/β at early time point of infection. The induced expression of IFN α/β gene by Sabin PV in neuronal cells could be suppressed by inhibiting TLR7. Neuronal cell innate immune response to Sabin and wild polioviruses differ significantly for TLR3, TLR7, MDA5 and type 1 interferons. Effects of TLR7 activation and interferon production and Sabin virus replication in neuronal cells need to be actively investigated in future studies.

  7. Enhanced 3-sulfanylhexan-1-ol production in sequential mixed fermentation with Torulaspora delbrueckii/Saccharomyces cerevisiae reveals a situation of synergistic interaction between two industrial strains

    Directory of Open Access Journals (Sweden)

    Philippe eRenault

    2016-03-01

    Full Text Available The aim of this work was to study the volatile thiol productions of 2 industrial strains of Torulaspora delbrueckii and Saccharomyces cerevisiae during alcoholic fermentation (AF of Sauvignon Blanc must. In order to evaluate the influence of the inoculation procedure, sequential and simultaneous mixed cultures were carried out and compared to pure cultures of T. delbrueckii and S. cerevisiae. The results confirmed the inability of T. delbrueckii to release 4-methyl-4-sulfanylpentan-2-one (4MSP and its low capacity to produce 3-sulfanylhexyl acetate (3SHA, as already reported in previous studies. A synergistic interaction was observed between the two species, resulting in higher levels of 3SH (3-sulfanylhexan-1-ol and its acetate when S. cerevisiae was inoculated 24 hours after T. delbrueckii, compared to the pure cultures. To elucidate the nature of the interactions between these 2 species, the yeast population kinetics were examined and monitored, as well as the production of 3SH, its acetate and their related non-odorous precursors: Glut-3SH (glutathionylated conjugate precursor and Cys-3SH (cysteinylated conjugate precursor. For the first time, it was suggested that, unlike, S. cerevisiae, which is able to metabolize the two precursor forms, T. delbrueckii was only able to metabolize the glutathionylated precursor. Consequently, the presence of T. delbrueckii during mixed fermentation led to an increase in Glut-3SH degradation and Cys-3SH production. This overproduction was dependent on the T. delbrueckii biomass. In sequential culture, thus favouring T. delbrueckii development, the higher availability of Cys-3SH throughout AF (alcoholic fermentation resulted in more abundant 3SH and 3SHA production by S. cerevisiae

  8. Enhanced 3-Sulfanylhexan-1-ol Production in Sequential Mixed Fermentation with Torulaspora delbrueckii/Saccharomyces cerevisiae Reveals a Situation of Synergistic Interaction between Two Industrial Strains.

    Science.gov (United States)

    Renault, Philippe; Coulon, Joana; Moine, Virginie; Thibon, Cécile; Bely, Marina

    2016-01-01

    The aim of this work was to study the volatile thiol productions of two industrial strains of Torulaspora delbrueckii and Saccharomyces cerevisiae during alcoholic fermentation (AF) of Sauvignon Blanc must. In order to evaluate the influence of the inoculation procedure, sequential and simultaneous mixed cultures were carried out and compared to pure cultures of T. delbrueckii and S. cerevisiae. The results confirmed the inability of T. delbrueckii to release 4-methyl-4-sulfanylpentan-2-one (4MSP) and its low capacity to produce 3-sulfanylhexyl acetate (3SHA), as already reported in previous studies. A synergistic interaction was observed between the two species, resulting in higher levels of 3SH (3-sulfanylhexan-1-ol) and its acetate when S. cerevisiae was inoculated 24 h after T. delbrueckii, compared to the pure cultures. To elucidate the nature of the interactions between these two species, the yeast population kinetics were examined and monitored, as well as the production of 3SH, its acetate and their related non-odorous precursors: Glut-3SH (glutathionylated conjugate precursor) and Cys-3SH (cysteinylated conjugate precursor). For the first time, it was suggested that, unlike S. cerevisiae, which is able to metabolize the two precursor forms, T. delbrueckii was only able to metabolize the glutathionylated precursor. Consequently, the presence of T. delbrueckii during mixed fermentation led to an increase in Glut-3SH degradation and Cys-3SH production. This overproduction was dependent on the T. delbrueckii biomass. In sequential culture, thus favoring T. delbrueckii development, the higher availability of Cys-3SH throughout AF resulted in more abundant 3SH and 3SHA production by S. cerevisiae.

  9. SH2 Ligand Prediction-Guidance for In-Silico Screening.

    Science.gov (United States)

    Li, Shawn S C; Li, Lei

    2017-01-01

    Systematic identification of binding partners for SH2 domains is important for understanding the biological function of the corresponding SH2 domain-containing proteins. Here, we describe two different web-accessible computer programs, SMALI and DomPep, for predicting binding ligands for SH2 domains. The former was developed using a Scoring Matrix method and the latter based on the Support Vector Machine model.

  10. Giant-Planet Chemistry: Ammonium Hydrosulfide (NH4SH), Its IR Spectra and Thermal and Radiolytic Stabilities

    Science.gov (United States)

    Loeffler, Mark J.; Hudson, Reggie L.; Chanover, Nancy J.; Simon, Amy A.

    2015-01-01

    Here we present our recent studies of proton-irradiated and unirradiated ammonium hydrosulfide, NH4SH, a compound predicted to be an important tropospheric cloud component of Jupiter and other giant planets. We irradiated both crystalline and amorphous NH4SH at 10-160 K and used IR spectroscopy to observe and identify reaction products in the ice, specifically NH3 and long-chained sulfur-containing ions. Crystalline NH4SH was amorphized during irradiation at all temperatures studied with the rate being the fastest at the lowest temperatures. Irradiation of amorphous NH4SH at approximately 10-75 K showed that 60-80% of the NH4 + remained when equilibrium was reached, and that NH4SH destruction rates were relatively constant within this temperature range. Irradiations at higher temperatures produced different dose dependence and were accompanied by pressure outbursts that, in some cases, fractured the ice. The thermal stability of irradiated NH4SH was found to be greater than that of unirradiated NH4SH, suggesting that an irradiated giant-planet cloud precipitate can exist at temperatures and altitudes not previously considered.

  11. Pharmacological Targeting SHP-1-STAT3 Signaling Is a Promising Therapeutic Approach for the Treatment of Colorectal Cancer

    Directory of Open Access Journals (Sweden)

    Li-Ching Fan

    2015-09-01

    Full Text Available STAT3 activation is associated with poor prognosis in human colorectal cancer (CRC. Our previous data demonstrated that regorafenib (Stivarga is a pharmacological agonist of SH2 domain-containing phosphatase 1 (SHP-1 that enhances SHP-1 activity and induces apoptosis by targeting STAT3 signals in CRC. This study aimed to find a therapeutic drug that is more effective than regorafenib for CRC treatment. Here, we showed that SC-43 was more effective than regorafenib at inducing apoptosis in vitro and suppressing tumorigenesis in vivo. SC-43 significantly increased SHP-1 activity, downregulated p-STAT3Tyr705 level, and induced apoptosis in CRC cells. An SHP-1 inhibitor or knockdown of SHP-1 by siRNA both significantly rescued the SC-43–induced apoptosis and decreased p-STAT3Tyr705 level. Conversely, SHP-1 overexpression increased the effects of SC-43 on apoptosis and p-STAT3Tyr705 level. These data suggest that SC-43–induced apoptosis mediated through the loss of p-STAT3Tyr705 was dependent on SHP-1 function. Importantly, SC-43–enhanced SHP-1 activity was because of the docking potential of SC-43, which relieved the autoinhibited N-SH2 domain of SHP-1 and inhibited p-STAT3Tyr705 signals. Importantly, we observed that a significant negative correlation existed between SHP-1 and p-STAT3Tyr705expression in CRC patients (P = .038. Patients with strong SHP-1 and weak p-STAT3Tyr705 expression had significantly higher overall survival compared with patients with weak SHP-1 and strong p-STAT3Tyr705 expression (P = .029. In conclusion, SHP-1 is suitable to be a useful prognostic marker and a pharmacological target for CRC treatment. Targeting SHP-1-STAT3 signaling by SC-43 may serve as a promising pharmacotherapy for CRC.

  12. The selectivity of receptor tyrosine kinase signaling is controlled by a secondary SH2 domain binding site.

    Science.gov (United States)

    Bae, Jae Hyun; Lew, Erin Denise; Yuzawa, Satoru; Tomé, Francisco; Lax, Irit; Schlessinger, Joseph

    2009-08-07

    SH2 domain-mediated interactions represent a crucial step in transmembrane signaling by receptor tyrosine kinases. SH2 domains recognize phosphotyrosine (pY) in the context of particular sequence motifs in receptor phosphorylation sites. However, the modest binding affinity of SH2 domains to pY containing peptides may not account for and likely represents an oversimplified mechanism for regulation of selectivity of signaling pathways in living cells. Here we describe the crystal structure of the activated tyrosine kinase domain of FGFR1 in complex with a phospholipase Cgamma fragment. The structural and biochemical data and experiments with cultured cells show that the selectivity of phospholipase Cgamma binding and signaling via activated FGFR1 are determined by interactions between a secondary binding site on an SH2 domain and a region in FGFR1 kinase domain in a phosphorylation independent manner. These experiments reveal a mechanism for how SH2 domain selectivity is regulated in vivo to mediate a specific cellular process.

  13. Molecular determinants of the interaction between Doa1 and Hse1 involved in endosomal sorting.

    Science.gov (United States)

    Han, Seungsu; Shin, Donghyuk; Choi, Hoon; Lee, Sangho

    2014-03-28

    Yeast Doa1/Ufd3 is an adaptor protein for Cdc48 (p97 in mammal), an AAA type ATPase associated with endoplasmic reticulum-associated protein degradation pathway and endosomal sorting into multivesicular bodies. Doa1 functions in the endosomal sorting by its association with Hse1, a component of endosomal sorting complex required for transport (ESCRT) system. The association of Doa1 with Hse1 was previously reported to be mediated between PFU domain of Doa1 and SH3 of Hse1. However, it remains unclear which residues are specifically involved in the interaction. Here we report that Doa1/PFU interacts with Hse1/SH3 with a moderate affinity of 5 μM. Asn-438 of Doa1/PFU and Trp-254 of Hse1/SH3 are found to be critical in the interaction while Phe-434, implicated in ubiquitin binding via a hydrophobic interaction, is not. Small-angle X-ray scattering measurements combined with molecular docking and biochemical analysis yield the solution structure of the Doa1/PFU:Hse1/SH3 complex. Taken together, our results suggest that hydrogen bonding is a major determinant in the interaction of Doa1/PFU with Hse1/SH3. Copyright © 2014 Elsevier Inc. All rights reserved.

  14. Neuroprotective effects of Salvia aristata Aucher ex Benth. on hydrogen peroxide induced apoptosis in SH-SY5Y neuroblastoma cells

    Directory of Open Access Journals (Sweden)

    M. A. Esmaeili

    2015-08-01

    Full Text Available Background and objectives: Oxidative stress is implicated in the neuronal damage associated with Alzheimer’s disease, Parkinson’s disease, Huntington’s disease, amyotropic lateral sclerosis and cerebral ischemic stroke. The present work was designed to establish the neuroprotective effects of Salvia aristata extract on H2O2-induced apoptosis in human dopaminergic SH-SY5Y cells. Methods: The total phenol and flavonoids contents of the plant extracts were quantified by colorimetric methods. The antioxidant activity was assessed using DPPH free radicals scavenging activity assay, and the neuroprotective effect on H2O2-induced oxidative stress was also investigated using human dopaminergic SH-SY5Y cells by MTT assay and western blotting techniques. Results: The highest scavenging activity was found for methanol extract of S. aristata roots (85.28 ± 2.61 μg/mL, with the highest total phenolic and flavonoids content (90.28 mg total phenols as gallic acid and 250.12 mg total flavonoids as rutin, respectively. Our results also, showed that H2O2-induced cytotoxicity in SH-SY5Y cells was suppressed by treatment with S. aristata. Moreover, S. aristata root extract was effective in attenuating the disruption of mitochondrial membrane potential and apoptotic cell death has induced by H2O2.  S. aristata suppressed the down-regulation of Bcl-2, upregulation of Bax, and the release of mitochondrial cytochrome c to cytosol. In addition, S. aristata attenuated caspase-3, and -9 activation, and eventually protected the cells against H2O2-induced apoptosis. Conclusion: Theresults of the present study suggest that treatment of SH-SY5Y cells with S. aristata could block H2O2-induced apoptosis by regulating Bcl-2 family members and by suppressing caspase cascade activation.

  15. Structural insights into the intertwined dimer of fyn SH2.

    Science.gov (United States)

    Huculeci, Radu; Garcia-Pino, Abel; Buts, Lieven; Lenaerts, Tom; van Nuland, Nico

    2015-12-01

    Src homology 2 domains are interaction modules dedicated to the recognition of phosphotyrosine sites incorporated in numerous proteins found in intracellular signaling pathways. Here we provide for the first time structural insight into the dimerization of Fyn SH2 both in solution and in crystalline conditions, providing novel crystal structures of both the dimer and peptide-bound structures of Fyn SH2. Using nuclear magnetic resonance chemical shift analysis, we show how the peptide is able to eradicate the dimerization, leading to monomeric SH2 in its bound state. Furthermore, we show that Fyn SH2's dimer form differs from other SH2 dimers reported earlier. Interestingly, the Fyn dimer can be used to construct a completed dimer model of Fyn without any steric clashes. Together these results extend our understanding of SH2 dimerization, giving structural details, on one hand, and suggesting a possible physiological relevance of such behavior, on the other hand. © 2015 The Protein Society.

  16. Characterization of AKT independent effects of the synthetic AKT inhibitors SH-5 and SH-6 using an integrated approach combining transcriptomic profiling and signaling pathway perturbations

    Directory of Open Access Journals (Sweden)

    Schäfer Reinhold

    2010-06-01

    Full Text Available Abstract Background Signal transduction processes mediated by phosphatidyl inositol phosphates affect a broad range of cellular processes such as cell cycle progression, migration and cell survival. The protein kinase AKT is one of the major effectors in this signaling network. Chronic AKT activation contributes to oncogenic transformation and tumor development. Therefore, analogs of phosphatidyl inositol phosphates (PIAs were designed as new small drugs to block AKT activity for cancer treatment. Here we characterize the biological effects of the PIAs SH-5 and SH-6 in colorectal cancer cell lines. Methods Serum-starved or serum-supplemented human colorectal cancer cell lines SW480, HT29 and HCT116 were exposed to SH-5 and SH-6. AKT activation was determined by western blotting. Cell viability was assessed using a colorimetric XTT-based assay, apoptosis and cell cycle changes were monitored by FACS analysis. The dynamics of cell morphology alterations was evaluated by confocal and time-lapse microscopy. Transcriptional changes due to inhibitor treatment were analyzed using Affymetrix HG-U133A microarrays and RT-PCR. Results While the PIAs clearly reduce AKT phosphorylation in serum starved cells, we did not observe a significant reduction under serum supplemented conditions, giving us the opportunity to analyze AKT independent effects of these compounds. Both inhibitors induce broadly the same morphological alterations, in particular changes in cell shape and formation of intracellular vesicles. Moreover, we observed the induction of binucleated cells specifically in the SW480 cell line. Gene expression analysis revealed transcriptional alterations, which are mostly cell line specific. In accordance to the phenotype we found a gene group associated with mitosis and spindle organization down regulated in SW480 cells, but not in the other cell lines. A bioinformatics analysis using the Connectivity Map linked the gene expression pattern of the

  17. Characterization of AKT independent effects of the synthetic AKT inhibitors SH-5 and SH-6 using an integrated approach combining transcriptomic profiling and signaling pathway perturbations

    International Nuclear Information System (INIS)

    Krech, Till; Thiede, Margarethe; Hilgenberg, Ellen; Schäfer, Reinhold; Jürchott, Karsten

    2010-01-01

    Signal transduction processes mediated by phosphatidyl inositol phosphates affect a broad range of cellular processes such as cell cycle progression, migration and cell survival. The protein kinase AKT is one of the major effectors in this signaling network. Chronic AKT activation contributes to oncogenic transformation and tumor development. Therefore, analogs of phosphatidyl inositol phosphates (PIAs) were designed as new small drugs to block AKT activity for cancer treatment. Here we characterize the biological effects of the PIAs SH-5 and SH-6 in colorectal cancer cell lines. Serum-starved or serum-supplemented human colorectal cancer cell lines SW480, HT29 and HCT116 were exposed to SH-5 and SH-6. AKT activation was determined by western blotting. Cell viability was assessed using a colorimetric XTT-based assay, apoptosis and cell cycle changes were monitored by FACS analysis. The dynamics of cell morphology alterations was evaluated by confocal and time-lapse microscopy. Transcriptional changes due to inhibitor treatment were analyzed using Affymetrix HG-U133A microarrays and RT-PCR. While the PIAs clearly reduce AKT phosphorylation in serum starved cells, we did not observe a significant reduction under serum supplemented conditions, giving us the opportunity to analyze AKT independent effects of these compounds. Both inhibitors induce broadly the same morphological alterations, in particular changes in cell shape and formation of intracellular vesicles. Moreover, we observed the induction of binucleated cells specifically in the SW480 cell line. Gene expression analysis revealed transcriptional alterations, which are mostly cell line specific. In accordance to the phenotype we found a gene group associated with mitosis and spindle organization down regulated in SW480 cells, but not in the other cell lines. A bioinformatics analysis using the Connectivity Map linked the gene expression pattern of the inhibitor treated SW480 cells to PKC signaling. Using

  18. Construction of global ab initio potential energy surfaces for the HNS system and quantum dynamics calculations for the S({sup 3}P) + NH(X{sup 3}Σ) → NS(X{sup 2}Π) + H({sup 2}S) and N({sup 4}S) + SH(X{sup 2}Π) → NS(X{sup 2}Π) + H({sup 2}S) reactions

    Energy Technology Data Exchange (ETDEWEB)

    Sato, Kazuma; Takayanagi, Toshiyuki, E-mail: tako@mail.saitama-u.ac.jp

    2014-08-17

    Highlights: • Low-lying three potential energy surfaces for the HNS/HSN system are developed. • Quantum scattering calculations are performed for S + NH and N + SH reactions. • NS production mechanisms from S + NH and N + SH reactions are discussed. - Abstract: The lowest three adiabatic potential energy surfaces (1{sup 1}A′, 1{sup 1}A″ and 1{sup 3}A″) of the HNS molecular system have been developed using ab initio MRCI + Q-level electronic structure calculations with a complete-basis-set approach in order to understand the NS production mechanisms from the S({sup 3}P) + NH(X{sup 3}Σ) → NS(X{sup 2}Π) + H({sup 2}S) and N({sup 4}S) + SH(X{sup 2}Π) → NS(X{sup 2}Π) + H({sup 2}S) reactions. The results of time-independent quantum reactive scattering calculations show that the reactions proceed with the contribution of both direct and HNS/HSN complex-forming mechanisms on all the three potential energy surfaces. It is found that the reaction dynamics is not entirely statistical and cannot be described with a simple capture theory despite that the reactions are barrierless with large exoergicity.

  19. Structural/surface characterization and catalytic evaluation of rare-earth (Y, Sm and La) doped ceria composite oxides for CH{sub 3}SH catalytic decomposition

    Energy Technology Data Exchange (ETDEWEB)

    He, Dedong; Chen, Dingkai; Hao, Husheng; Yu, Jie; Liu, Jiangping; Lu, Jichang; Liu, Feng [Faculty of Environmental Science and Engineering, Kunming University of Science and Technology, Kunming, 650500 (China); Wan, Gengping [Faculty of Environmental Science and Engineering, Kunming University of Science and Technology, Kunming, 650500 (China); Research Center for Analysis and Measurement, Hainan University, Haikou, 570228 (China); He, Sufang [Research Center for Analysis and Measurement, Kunming University of Science and Technology, Kunming, 650093 (China); Luo, Yongming, E-mail: environcatalysis222@yahoo.com [Faculty of Environmental Science and Engineering, Kunming University of Science and Technology, Kunming, 650500 (China)

    2016-12-30

    Highlights: • Ce{sub 0.75}RE{sub 0.25}O{sub 2-δ} (RE = Y, Sm and La) were synthesized by citrate complexation method. • Ce{sub 0.75}Y{sub 0.25}O{sub 2-δ} exhibited the best stability for the decomposition of CH{sub 3}SH. • Cation radius played a key role in determining structure and surface characteristics. • Catalytic behavior depended on synergistic role of oxygen vacancies and basic sites. • Ce{sub 2}S{sub 3} accumulation on the surface was responsible for the deactivation of catalyst. - Abstract: A series of rare earth (Y, Sm and La) doped ceria composite oxides and pure CeO{sub 2} were synthesized and evaluated by conducting CH{sub 3}SH catalytic decomposition test. Several characterization studies, including XRD, BET, Raman, H{sub 2}-TPR, XPS, FT-IR, CO{sub 2}-TPD and CH{sub 3}SH-TPD, were undertaken to correlate structural and surface properties of the obtained ceria-based catalysts with their catalytic performance for CH{sub 3}SH decomposition. More oxygen vacancies and increased basic sites exhibited in the rare earth doped ceria catalysts. Y doped ceria sample (Ce{sub 0.75}Y{sub 0.25}O{sub 2-δ}), with a moderate increase in basic sites, contained more oxygen vacancies. More structural defects and active sites could be provided, and a relatively small amount of sulfur would accumulate, which resulted in better catalytic performance. The developed catalyst presented good catalytic behavior with stability very similar to that of typical zeolite-based catalysts reported previously. However, La doped ceria catalyst (Ce{sub 0.75}La{sub 0.25}O{sub 2-δ}) with the highest alkalinity was not the most active one. More sulfur species would be adsorbed and a large amount of cerium sulfide species (Ce{sub 2}S{sub 3}) would accumulate, which caused deactivation of the catalysts. The combined effect of increased oxygen vacancies and alkalinity led to the catalytic stability of Ce{sub 0.75}Sm{sub 0.25}O{sub 2-δ} sample was comparable to that of pure Ce

  20. Expression of caspase-3 gene in apoptotic HL-60 cell and different human tumor cell lines

    International Nuclear Information System (INIS)

    Li Xiaoming; Song Tianbao

    1999-01-01

    Objective: To research the expression of caspase-3 gene in the apoptotic and the control HL-60 cells and in the different human tumor cell lines. Methods: Caspase-3 mRNA in the control and γ-radiation-induced apoptotic HL-60 cells, and in the 6 types of human tumor cell lines, was analysed by Northern blot. Results: The caspase-3 gene transcript was more highly expressed in leukemia cells HL-60, CEM, K562 and neuroblastoma SH-SY5Y than in cervical adenocarcinoma HeLa and breast carcinoma MCF7, and more highly in the radiation-induced apoptotic HL-60 than in the control HL-60 cells. Conclusion: The high level of expression of caspase-3 may aid the efforts to understand the tumor cell sensitivity to radiation, apoptosis and its inherent ability to survive

  1. SH2 modified STAT1 induces HLA-I expression and improves IFN-γ signaling in IFN-α resistant HCV replicon cells.

    Directory of Open Access Journals (Sweden)

    Bret Poat

    2010-09-01

    Full Text Available We have developed multiple stable cell lines containing subgenomic HCV RNA that are resistant to treatment with interferon alpha (IFN-α. Characterization of these IFN-α resistant replicon cells showed defects in the phosphorylation and nuclear translocation of STAT1 and STAT2 proteins due to a defective Jak-STAT pathway.In this study, we have developed an alternative strategy to overcome interferon resistance in a cell culture model by improving intracellular STAT1 signaling. An engineered STAT1-CC molecule with double cysteine substitutions in the Src-homology 2 (SH2 domains of STAT1 (at Ala-656 and Asn-658 efficiently phosphorylates and translocates to the nucleus of IFN-resistant cells in an IFN-γ dependent manner. Transfection of a plasmid clone containing STAT1-CC significantly activated the GAS promoter compared to wild type STAT1 and STAT3. The activity of the engineered STAT1-CC is dependent upon the phosphorylation of tyrosine residue 701, since the construct with a substituted phenylalanine residue at position 701 (STAT1-CC-Y701F failed to activate GAS promoter in the replicon cells. Intracellular expression of STAT1-CC protein showed phosphorylation and nuclear translocation in the resistant cell line after IFN-γ treatment. Transient transfection of STAT1-CC plasmid clone into an interferon resistant cell line resulted in inhibition of viral replication and viral clearance in an IFN-γ dependent manner. Furthermore, the resistant replicon cells transfected with STAT1-CC constructs significantly up regulated surface HLA-1 expression when compared to the wild type and Y to F mutant controls.These results suggest that modification of the SH2 domain of the STAT1 molecule allows for improved IFN-γ signaling through increased STAT1 phosphorylation, nuclear translocation, HLA-1 surface expression, and prolonged interferon antiviral gene activation.

  2. Insulin-like Growth Factor-I Mediates Neuroprotection in Proteasome Inhibition-Induced Cytotoxicity in SH-SY5Y Cells

    Science.gov (United States)

    Cheng, Benxu; Maffi, Shivani Kaushal; Martinez, Alex Anthony; Acosta, Yolanda P Villarreal; Morales, Liza D; Roberts, James L

    2011-01-01

    The proteasome is an enzyme complex responsible for targeted intracellular proteolysis. Alterations in proteasome-mediated protein clearance have been implicated in the pathogenesis of aging, Alzheimer's disease (AD) and Parkinson's disease (PD). In such diseases, proteasome inhibition may contribute to formation of abnormal protein aggregates, which in turn activate intracellular unfolded protein responses that cause oxidative stress and apoptosis. In this study, we investigated the protective effect of Insulin-like Growth Factor-I (IGF-1) for neural SH-SY5Y cells treated with the proteasomal inhibitor, Epoxomicin, In SH-SY5Y cells, Epoxomicin treatment results in accumulation of intracellular ubiquitinated proteins and cytochrome c release from damaged mitochondria, leading to cell death, in Epoxomicin time- and dose-dependent manner. In cells treated with small amounts of IGF-1, the same dosages of Epoxomicin reduced both mitochondrial damage (cytochrome c release) and reduced caspase-3 activation and PARP cleavage, both of which are markers of apoptosis. Notably, however, IGF-1-treated SH-SY5Y cells still contained ubiquitinated protein aggregates. This result indicates that IGF-1 blocks the downstream apoptotic consequences of Epoxomicin treatment leading to decreased proteasome function. Clues as to the mechanism for this protective effect come from (a) increased AKT phosphorylation observed in IGF-1-protected cells, vs. cells exposed to Epoxomicin without IGF-1, and (b) reduction of IGF-1 protection by pretreatment of the cells with LY294002 (an inhibitor of PI3-kinase). Together these findings suggest that activation of PI3/AKT pathways by IGF-1 is involved in IGF-1 neuroprotection against apoptosis following proteasome inhibition. PMID:21545837

  3. Inhibition of UBE2D3 expression attenuates radiosensitivity of MCF-7 human breast cancer cells by increasing hTERT expression and activity.

    Directory of Open Access Journals (Sweden)

    Wenbo Wang

    Full Text Available The known functions of telomerase in tumor cells include replenishing telomeric DNA and maintaining cell immortality. We have previously shown the existence of a negative correlation between human telomerase reverse transcriptase (hTERT and radiosensitivity in tumor cells. Here we set out to elucidate the molecular mechanisms underlying regulation by telomerase of radiosensitivity in MCF-7 cells. Toward this aim, yeast two-hybrid (Y2H screening of a human laryngeal squamous cell carcinoma radioresistant (Hep2R cDNA library was first performed to search for potential hTERT interacting proteins. We identified ubiquitin-conjugating enzyme E2D3 (UBE2D3 as a principle hTERT-interacting protein and validated this association biochemically. ShRNA-mediated inhibition of UBE2D3 expression attenuated MCF-7 radiosensitivity, and induced the accumulation of hTERT and cyclin D1 in these cells. Moreover, down-regulation of UBE2D3 increased hTERT activity and cell proliferation, accelerating G1 to S phase transition in MCF-7 cells. Collectively these findings suggest that UBE2D3 participates in the process of hTERT-mediated radiosensitivity in human breast cancer MCF-7 cells by regulating hTERT and cyclin D1.

  4. Binding of Candida albicans to Human CEACAM1 and CEACAM6 Modulates the Inflammatory Response of Intestinal Epithelial Cells

    Directory of Open Access Journals (Sweden)

    Esther Klaile

    2017-03-01

    Full Text Available Candida albicans colonizes human mucosa, including the gastrointestinal tract, as a commensal. In immunocompromised patients, C. albicans can breach the intestinal epithelial barrier and cause fatal invasive infections. Carcinoembryonic antigen-related cell adhesion molecule 1 (CEACAM1; CD66a, CEACAM5 (CEA, and CEACAM6 (CD66c are immunomodulatory receptors expressed on human mucosa and are recruited by bacterial and viral pathogens. Here we show for the first time that a fungal pathogen (i.e., C. albicans also binds directly to the extracellular domain of human CEACAM1, CEACAM3, CEACAM5, and CEACAM6. Binding was specific for human CEACAMs and mediated by the N-terminal IgV-like domain. In enterocytic C2BBe1 cells, C. albicans caused a transient tyrosine phosphorylation of CEACAM1 and induced higher expression of membrane-bound CEACAM1 and soluble CEACAM6. Lack of the CEACAM1 receptor after short hairpin RNA (shRNA knockdown abolished CXCL8 (interleukin-8 secretion by C2BBe1 cells in response to C. albicans. In CEACAM1-competent cells, the addition of recombinant soluble CEACAM6 reduced the C. albicans-induced CXCL8 secretion.

  5. Modulators of the human CCR5 receptor. Part 1: Discovery and initial SAR of 1-(3,3-diphenylpropyl)-piperidinyl amides and ureas.

    Science.gov (United States)

    Burrows, Jeremy N; Cumming, John G; Fillery, Shaun M; Hamlin, Gordon A; Hudson, Julian A; Jackson, Ruth J; McLaughlin, Sharon; Shaw, John S

    2005-01-03

    Investigation of weak screening hits led to the identification of N-alkyl-N-[1-(3,3-diphenylpropyl)piperidin-4-yl]-2-phenylacetamides and N-alkyl-N-[1-(3,3-diphenylpropyl)piperidin-4-yl]-N'-benzylureas as potent, selective ligands for the human CCR5 chemokine receptor.

  6. Insect peptide CopA3-induced protein degradation of p27Kip1 stimulates proliferation and protects neuronal cells from apoptosis

    International Nuclear Information System (INIS)

    Nam, Seung Taek; Kim, Dae Hong; Lee, Min Bum; Nam, Hyo Jung; Kang, Jin Ku; Park, Mi Jung; Lee, Ik Hwan; Seok, Heon; Lee, Dong Gun; Hwang, Jae Sam; Kim, Ho

    2013-01-01

    Highlights: •CopA3 peptide isolated from the Korean dung beetle has antimicrobial activity. •Our study reported that CopA3 has anticancer and immunosuppressive effects. •We here demonstrated that CopA3 has neurotropic and neuroprotective effects. •CopA3 degrades p27Kip1 protein and this mediates effects of CopA3 on neuronal cells. -- Abstract: We recently demonstrated that the antibacterial peptide, CopA3 (a D-type disulfide dimer peptide, LLCIALRKK), inhibits LPS-induced macrophage activation and also has anticancer activity in leukemia cells. Here, we examined whether CopA3 could affect neuronal cell proliferation. We found that CopA3 time-dependently increased cell proliferation by up to 31 ± 2% in human neuroblastoma SH-SY5Y cells, and up to 29 ± 2% in neural stem cells isolated from neonatal mouse brains. In both cell types, CopA3 also significantly inhibited the apoptosis and viability losses caused by 6-hydroxy dopamine (a Parkinson disease-mimicking agent) and okadaic acid (an Alzheimer’s disease-mimicking agent). Immunoblotting revealed that the p27Kip1 protein (a negative regulator of cell cycle progression) was markedly degraded in CopA3-treated SH-SY5Y cells. Conversely, an adenovirus expressing p27Kip1 significantly inhibited the antiapoptotic effects of CopA3 against 6-hydroxy dopamine- and okadaic acid-induced apoptosis, and decreased the neurotropic effects of CopA3. These results collectively suggest that CopA3-mediated protein degradation of p27Kip1 may be the main mechanism through which CopA3 exerts neuroprotective and neurotropic effects

  7. Insect peptide CopA3-induced protein degradation of p27Kip1 stimulates proliferation and protects neuronal cells from apoptosis

    Energy Technology Data Exchange (ETDEWEB)

    Nam, Seung Taek; Kim, Dae Hong; Lee, Min Bum; Nam, Hyo Jung; Kang, Jin Ku; Park, Mi Jung; Lee, Ik Hwan [Department of Life Science, College of Natural Science, Daejin University, Pocheon, Gyeonggido 487-711 (Korea, Republic of); Seok, Heon [Department of Biomedical Science, Jungwon University, Goesan, Chungcheongbukdo 367-700 (Korea, Republic of); Lee, Dong Gun [School of Life Sciences and Biotechnology, College of Natural Sciences, Kyungpook National University, Daegu 702-701 (Korea, Republic of); Hwang, Jae Sam [Department of Agricultural Biology, National Academy of Agricultural Science, RDA, Suwon 441-707 (Korea, Republic of); Kim, Ho, E-mail: hokim@daejin.ac.kr [Department of Life Science, College of Natural Science, Daejin University, Pocheon, Gyeonggido 487-711 (Korea, Republic of)

    2013-07-19

    Highlights: •CopA3 peptide isolated from the Korean dung beetle has antimicrobial activity. •Our study reported that CopA3 has anticancer and immunosuppressive effects. •We here demonstrated that CopA3 has neurotropic and neuroprotective effects. •CopA3 degrades p27Kip1 protein and this mediates effects of CopA3 on neuronal cells. -- Abstract: We recently demonstrated that the antibacterial peptide, CopA3 (a D-type disulfide dimer peptide, LLCIALRKK), inhibits LPS-induced macrophage activation and also has anticancer activity in leukemia cells. Here, we examined whether CopA3 could affect neuronal cell proliferation. We found that CopA3 time-dependently increased cell proliferation by up to 31 ± 2% in human neuroblastoma SH-SY5Y cells, and up to 29 ± 2% in neural stem cells isolated from neonatal mouse brains. In both cell types, CopA3 also significantly inhibited the apoptosis and viability losses caused by 6-hydroxy dopamine (a Parkinson disease-mimicking agent) and okadaic acid (an Alzheimer’s disease-mimicking agent). Immunoblotting revealed that the p27Kip1 protein (a negative regulator of cell cycle progression) was markedly degraded in CopA3-treated SH-SY5Y cells. Conversely, an adenovirus expressing p27Kip1 significantly inhibited the antiapoptotic effects of CopA3 against 6-hydroxy dopamine- and okadaic acid-induced apoptosis, and decreased the neurotropic effects of CopA3. These results collectively suggest that CopA3-mediated protein degradation of p27Kip1 may be the main mechanism through which CopA3 exerts neuroprotective and neurotropic effects.

  8. Characterization of breakpoint cluster region kinase and SH2-binding activities.

    Science.gov (United States)

    Afar, D E; Witte, O N

    1995-01-01

    BCR is an interesting signaling protein, whose cellular function is currently unknown. Its biochemical properties include serine kinase activity, SH2-binding activity, and a GTPase-activating activity. The SH2-binding activity is particularly interesting because it may link BCR to signaling pathways involving SH2-containing molecules. Since tyrosine phosphorylation of BCR has been detected in CML-derived cell lines and since tyrosine-phosphorylated BCR shows increased affinity toward certain SH2 domains, it seems particularly important to further characterize this activity. This chapter described a simple purification scheme for partial purification of BCR, which can be used to assess in vitro kinase and SH2-binding activities.

  9. [Effect of DOT1L gene silence on proliferation of acute monocytic leukemia cell line THP-1].

    Science.gov (United States)

    Zhang, Yu-Juan; Li, Hua-Wen; Chang, Guo-Qiang; Zhang, Hong-Ju; Wang, Jian; Lin, Ya-Ni; Zhou, Jia-Xi; Li, Qing-Hua; Pang, Tian-Xiang

    2013-08-01

    This study was aimed to investigate the influence of short hairpin RNA (shRNA) on proliferation of human leukemia cell line THP-1. The shRNA targeting the site 732-752 of DOT1L mRNA was designed and chemically synthesized, then a single-vector lentiviral, tet-inducible shRNA-DOT1L system (Plko-Tet-On) was generated. Thereafter, the THP-1 cells with lentivirus were infected to create stable cell line with regulatable shRNA expression. The expression of DOT1L in the THP-1 cell line was assayed by RT-PCR. Effect of shRNA-DOT1L on the proliferation of THP-1 cells was detected with MTT method,and the change of colony forming potential of THP-1 cells was analyzed by colony forming unit test. Cell cycle distribution was tested by flow cytometry. The results indicated that the expression of DOT1L was statistically lower than that in the control groups. The proliferation and colony forming capacity of THP-1 cells were significantly inhibited. The percentage of cells at G0/G1 phase increased in THP-1/shRNA cells treated with Dox while the percentage of cells at S phase significantly decreased as compared with that in the control group. It is concluded that the shRNA targeting DOT1L can effectively inhibit the proliferation of acute monocytic leukemia cell line THP-1.

  10. Postcranial morphology of the middle Pleistocene humans from Sima de los Huesos, Spain.

    Science.gov (United States)

    Arsuaga, Juan Luis; Carretero, José-Miguel; Lorenzo, Carlos; Gómez-Olivencia, Asier; Pablos, Adrián; Rodríguez, Laura; García-González, Rebeca; Bonmatí, Alejandro; Quam, Rolf M; Pantoja-Pérez, Ana; Martínez, Ignacio; Aranburu, Arantza; Gracia-Téllez, Ana; Poza-Rey, Eva; Sala, Nohemi; García, Nuria; Alcázar de Velasco, Almudena; Cuenca-Bescós, Gloria; Bermúdez de Castro, José María; Carbonell, Eudald

    2015-09-15

    Current knowledge of the evolution of the postcranial skeleton in the genus Homo is hampered by a geographically and chronologically scattered fossil record. Here we present a complete characterization of the postcranium of the middle Pleistocene paleodeme from the Sima de los Huesos (SH) and its paleobiological implications. The SH hominins show the following: (i) wide bodies, a plesiomorphic character in the genus Homo inherited from their early hominin ancestors; (ii) statures that can be found in modern human middle-latitude populations that first appeared 1.6-1.5 Mya; and (iii) large femoral heads in some individuals, a trait that first appeared during the middle Pleistocene in Africa and Europe. The intrapopulational size variation in SH shows that the level of dimorphism was similar to modern humans (MH), but the SH hominins were less encephalized than Neandertals. SH shares many postcranial anatomical features with Neandertals. Although most of these features appear to be either plesiomorphic retentions or are of uncertain phylogenetic polarity, a few represent Neandertal apomorphies. Nevertheless, the full suite of Neandertal-derived features is not yet present in the SH population. The postcranial evidence is consistent with the hypothesis based on the cranial morphology that the SH hominins are a sister group to the later Neandertals. Comparison of the SH postcranial skeleton to other hominins suggests that the evolution of the postcranium occurred in a mosaic mode, both at a general and at a detailed level.

  11. A recombined fusion protein PTD-Grb2-SH2 inhibits the proliferation of breast cancer cells in vitro.

    Science.gov (United States)

    Yin, Jikai; Cai, Zhongliang; Zhang, Li; Zhang, Jian; He, Xianli; Du, Xilin; Wang, Qing; Lu, Jianguo

    2013-03-01

    The growth factor receptor bound protein 2 (Grb2) is one of the affirmative targets for cancer therapy, especially for breast cancer. In this study, we hypothesized the Src-homology 2 (SH2) domain in Grb2 may serve as a competitive protein-binding agent to interfere with the proliferation of breast cancer cells in vitro. We designed, constructed, expressed and purified a novel fusion protein containing the protein transduction domain (PTD) and Grb2-SH2 domain (we named it after PTD-Grb2-SH2). An immunofluorescence assay was used to investigate the location of PTD-Grb2-SH2 in cells. MTT assay and EdU experiments were applied to detect the proliferation of breast cancer cells. The ultra-structure was observed using transmission electron microscopy. Flow cytometry was used to determine the cytotoxicity of PTD-Grb2-SH2 on cell proliferation. We successfully obtained the PTD-Grb2-SH2 fusion protein in soluble form using a prokaryotic expression system. The new fusion protein successfully passed through both the cellular and nuclear membranes of breast cancer cells. The MTT assay showed that PTD-Grb2-SH2 exhibited significant toxicity to breast cancer cells in a dose- and time-dependent manner in vitro. EdU identified the decreased proliferation rates in treated MDA-MB-231 and SK-BR-3 cells. Observation by transmission electron microscopy and flow cytometry further confirmed the cytotoxicity as apoptosis. Our results show that the HIV1-TAT domain is a useful tool for transporting a low molecular weight protein across the cell membrane in vitro. The PTD-Grb2-SH2 may be a novel agent for breast cancer therapy.

  12. Klotho down-regulates Egr-1 by inhibiting TGF-β1/Smad3 signaling in high glucose treated human mesangial cells

    International Nuclear Information System (INIS)

    Li, Yang; Hu, Fang; Xue, Meng; Jia, Yi-Jie; Zheng, Zong-Ji; Wang, Ling; Guan, Mei-Ping; Xue, Yao-Ming

    2017-01-01

    Diabetic kidney disease (DKD) has become the leading cause of end-stage renal disease worldwide and is associated with glomerular mesangial cell (MC) proliferation and excessive extracellular matrix (ECM) production. Klotho can attenuate renal fibrosis in part by inhibiting TGF-β1/Smad3 signaling in DKD. Early growth response factor 1 (Egr-1) has been shown to play a key role in renal fibrosis in part by facilitating the formation of a positive feedback loop involving TGF-β1. However, whether Klotho down-regulates Egr-1 by inhibiting TGF-β1/Smad3 signaling in DKD is unclear. In the present study, we assessed human MCs that were incubated under high-glucose conditions to mimic diabetes. Then, we transfected the cells with Klotho plasmid or siRNA to overexpress or knock down Klotho gene and protein expression. Klotho, Egr-1, fibronectin (FN), collagen type I (Col I), Smad3 and phosphorylated Smad3 (p-Smad3) gene and protein expression levels were determined by RT-qPCR and western blotting respectively. High glucose time-dependently down-regulated Klotho mRNA and protein expression in cultured human MCs. pcDNA3.1-Klotho transfection-mediated Klotho overexpression down-regulated Egr-1, FN and Col I expression and the p-Smad3/Smad3 ratio in human MCs. Conversely, siRNA-mediated Klotho silencing up-regulated Egr-1, FN, and Col I expression and the p-Smad3/Smad3 ratio. Moreover, the effects of si-Klotho on Egr-1 expression were abolished by the TGF-β1 inhibitor SB-431542. Klotho overexpression can prevent mesangial ECM production in high-glucose-treated human MCs, an effect that has been partially attributed to Egr-1 down-regulation facilitated by TGF-β1/Smad3 signaling inhibition. - Highlights: • High glucose time-dependently down-regulated Klotho mRNA and protein expression in cultured human MCs. • Klotho overexpression down-regulated Egr-1 and prevented mesangial ECM production in high-glucose-treated human MCs. • Klotho down-regulated Egr-1 by inhibiting

  13. The signaling cascades of Ganoderma lucidum extracts in stimulating non-amyloidogenic protein secretion in human neuroblastoma SH-SY5Y cell lines.

    Science.gov (United States)

    Pinweha, Sirinthorn; Wanikiat, Payong; Sanvarinda, Yupin; Supavilai, Porntip

    2008-12-19

    Ganoderma lucidum (GL) is a medicinal mushroom that possesses various pharmacological properties which are also documented in the ancient reports where GL is praised for its effects on the promotion of health and longevity. In this study, we have investigated the effect of GL mycelia extracts on the non-amyloidogenic protein secretion (sAPPalpha) and the amyloid precursor protein (APP) expression in SH-SY5Y neuroblastoma cells. In order to characterize the signaling pathway which mediates GL-enhanced sAPPalpha secretion, we used inhibitors of nerve growth factor (NGF) signaling pathways, phosphatidylinositol 3 kinase (PI3K), phospholipase Cgamma1 (PLCgamma1), protein kinase C (PKC) and extracellular signal-regulated kinase (ERK1/2), to block GL-mediated sAPPalpha secretion as well as ERK1/2 and PKC activation by using Western blot analysis. Our results provided for the first time evidence that GL mycelia extracts increased APP expression and promoted sAPPalpha secretion. In addition, GL extracts activated ERK1/2 and PKC phosphorylation. The complex signaling cascades of PI3K and ERK may be responsible for GL-mediated sAPPalpha secretion.

  14. Membrane Localization is Critical for Activation of the PICK1 BAR Domain

    OpenAIRE

    Madsen, Kenneth L.; Eriksen, Jacob; Milan-Lobo, Laura; Han, Daniel S.; Niv, Masha Y.; Ammendrup-Johnsen, Ina; Henriksen, Ulla; Bhatia, Vikram K.; Stamou, Dimitrios; Sitte, Harald H.; McMahon, Harvey T.; Weinstein, Harel; Gether, Ulrik

    2008-01-01

    The PSD-95/Discs-large/ZO-1 homology (PDZ) domain protein, protein interacting with C kinase 1 (PICK1) contains a C-terminal Bin/amphiphysin/Rvs (BAR) domain mediating recognition of curved membranes; however, the molecular mechanisms controlling the activity of this domain are poorly understood. In agreement with negative regulation of the BAR domain by the N-terminal PDZ domain, PICK1 distributed evenly in the cytoplasm, whereas truncation of the PDZ domain caused BAR domain-dependent redis...

  15. Neurotoxicity Induced by Bupivacaine via T-Type Calcium Channels in SH-SY5Y Cells

    Science.gov (United States)

    Wen, Xianjie; Xu, Shiyuan; Liu, Hongzhen; Zhang, Quinguo; Liang, Hua; Yang, Chenxiang; Wang, Hanbing

    2013-01-01

    There is concern regarding neurotoxicity induced by the use of local anesthetics. A previous study showed that an overload of intracellular calcium is involved in the neurotoxic effect of some anesthetics. T-type calcium channels, which lower the threshold of action potentials, can regulate the influx of calcium ions. We hypothesized that T-type calcium channels are involved in bupivacaine-induced neurotoxicity. In this study, we first investigated the effects of different concentrations of bupivacaine on SH-SY5Y cell viability, and established a cell injury model with 1 mM bupivacaine. The cell viability of SH-SY5Y cells was measured following treatment with 1 mM bupivacaine and/or different dosages (10, 50, or 100 µM) of NNC 55-0396 dihydrochloride, an antagonist of T-type calcium channels for 24 h. In addition, we monitored the release of lactate dehydrogenase, cytosolic Ca2+ ([Ca2+]i), cell apoptosis and caspase-3 expression. SH-SY5Y cells pretreated with different dosages (10, 50, or 100 µM) of NNC 55-0396 dihydrochloride improved cell viability, reduced lactate dehydrogenase release, inhibited apoptosis, and reduced caspase-3 expression following bupivacaine exposure. However, the protective effect of NNC 55-0396 dihydrochloride plateaued. Overall, our results suggest that T-type calcium channels may be involved in bupivacaine neurotoxicity. However, identification of the specific subtype of T calcium channels involved requires further investigation. PMID:23658789

  16. Baicalein antagonizes rotenone-induced apoptosis in dopaminergic SH-SY5Y cells related to Parkinsonism

    Directory of Open Access Journals (Sweden)

    Song Ju-Xian

    2012-01-01

    Full Text Available Abstract Background Two active compounds, baicalein and its glycoside baicalin were found in the dried root of Scutellaria baicalensis Georgi, and reported to be neuroprotective in vitro and in vivo. This study aims to evaluate the protective effects of baicalein on the rotenone-induced apoptosis in dopaminergic SH-SY5Y cells related to parkinsonism. Methods Cell viability and cytotoxicity were determined by MTT assay. The degree of nuclear apoptosis was evaluated with a fluorescent DNA-binding probe Hoechst 33258. The production of reactive oxidative species (ROS and loss of mitochondrial membrane potential (ΔΨm were determined by fluorescent staining with DCFH-DA and Rhodanmine 123, respectively. The expression of Bax, Bcl-2, cleaved caspase-3 and phosphorylated ERK1/2 was determined by the Western blots. Results Baicalein significantly increased viability and decreased rotenone-induced death of SH-SY5Y cells in a dose-dependent manner. Pre- and subsequent co-treatment with baicalein preserved the cell morphology and attenuated the nuclear apoptotic characteristics triggered by rotenone. Baicalein antagonized rotenone-induced overproduction of ROS, loss of ΔΨm, the increased expression of Bax, cleaved caspase-3 and phosphorylated ERK1/2 and the decreased expression of Bcl-2. Conclusion The antioxidative effect, mitochondrial protection and modulation of anti-and pro-apoptotic proteins are related to the neuroprotective effects of baicalein against rotenone induced cell death in SH-SY5Y cells.

  17. Neurotoxicity induced by bupivacaine via T-type calcium channels in SH-SY5Y cells.

    Directory of Open Access Journals (Sweden)

    Xianjie Wen

    Full Text Available There is concern regarding neurotoxicity induced by the use of local anesthetics. A previous study showed that an overload of intracellular calcium is involved in the neurotoxic effect of some anesthetics. T-type calcium channels, which lower the threshold of action potentials, can regulate the influx of calcium ions. We hypothesized that T-type calcium channels are involved in bupivacaine-induced neurotoxicity. In this study, we first investigated the effects of different concentrations of bupivacaine on SH-SY5Y cell viability, and established a cell injury model with 1 mM bupivacaine. The cell viability of SH-SY5Y cells was measured following treatment with 1 mM bupivacaine and/or different dosages (10, 50, or 100 µM of NNC 55-0396 dihydrochloride, an antagonist of T-type calcium channels for 24 h. In addition, we monitored the release of lactate dehydrogenase, cytosolic Ca(2+ ([Ca2+]i, cell apoptosis and caspase-3 expression. SH-SY5Y cells pretreated with different dosages (10, 50, or 100 µM of NNC 55-0396 dihydrochloride improved cell viability, reduced lactate dehydrogenase release, inhibited apoptosis, and reduced caspase-3 expression following bupivacaine exposure. However, the protective effect of NNC 55-0396 dihydrochloride plateaued. Overall, our results suggest that T-type calcium channels may be involved in bupivacaine neurotoxicity. However, identification of the specific subtype of T calcium channels involved requires further investigation.

  18. Evolution of SH2 domains and phosphotyrosine signalling networks

    Science.gov (United States)

    Liu, Bernard A.; Nash, Piers D.

    2012-01-01

    Src homology 2 (SH2) domains mediate selective protein–protein interactions with tyrosine phosphorylated proteins, and in doing so define specificity of phosphotyrosine (pTyr) signalling networks. SH2 domains and protein-tyrosine phosphatases expand alongside protein-tyrosine kinases (PTKs) to coordinate cellular and organismal complexity in the evolution of the unikont branch of the eukaryotes. Examination of conserved families of PTKs and SH2 domain proteins provides fiduciary marks that trace the evolutionary landscape for the development of complex cellular systems in the proto-metazoan and metazoan lineages. The evolutionary provenance of conserved SH2 and PTK families reveals the mechanisms by which diversity is achieved through adaptations in tissue-specific gene transcription, altered ligand binding, insertions of linear motifs and the gain or loss of domains following gene duplication. We discuss mechanisms by which pTyr-mediated signalling networks evolve through the development of novel and expanded families of SH2 domain proteins and the elaboration of connections between pTyr-signalling proteins. These changes underlie the variety of general and specific signalling networks that give rise to tissue-specific functions and increasingly complex developmental programmes. Examination of SH2 domains from an evolutionary perspective provides insight into the process by which evolutionary expansion and modification of molecular protein interaction domain proteins permits the development of novel protein-interaction networks and accommodates adaptation of signalling networks. PMID:22889907

  19. Neuronal uptake and neuroprotective effect of curcumin-loaded PLGA nanoparticles on the human SK-N-SH cell line.

    Science.gov (United States)

    Doggui, Sihem; Sahni, Jasjeet Kaur; Arseneault, Madeleine; Dao, Lé; Ramassamy, Charles

    2012-01-01

    Curcumin, a natural polyphenolic pigment present in the spice turmeric (Curcuma longa), is known to possess a pleiotropic activity such as antioxidant, anti-inflammatory, and anti-amyloid-β activities. However, these benefits of curcumin are limited by its poor aqueous solubility and oral bioavailability. In the present study, a polymer-based nanoparticle approach has been utilized to deliver drugs to neuronal cells. Curcumin was encapsulated in biodegradable poly (lactide-co-glycolide) (PLGA) based-nanoparticulate formulation (Nps-Cur). Dynamic laser light scattering and transmission electronic microscopy analysis indicated a particle diameter ranging from 80 to 120 nm. The entrapment efficiency was 31% with 15% drug-loading. In vitro release kinetics of curcumin from Nps-Cur revealed a biphasic pattern with an initial exponential phase followed by a slow release phase. Cellular internalization of Nps-Cur was confirmed by fluorescence and confocal microscopy with a wide distribution of the fluorescence in the cytoplasm and within the nucleus. The prepared nanoformulation was characterized for cellular toxicity and biological activity. Cytotoxicity assays showed that void PLGA-nanoparticles (Nps) and curcumin-loaded PLGA nanoparticles (Nps-Cur) were nontoxic to human neuroblastoma SK-N-SH cells. Moreover, Nps-Cur was able to protect SK-N-SH cells against H2O2 and prevent the elevation of reactive oxygen species and the consumption of glutathione induced by H2O2. Interestingly, Nps-Cur was also able to prevent the induction of the redox-sensitive transcription factor Nrf2 in the presence of H2O2. Taken together, these results suggest that Nps-Cur could be a promising drug delivery strategy to protect neurons against oxidative damage as observed in Alzheimer's disease.

  20. Knockdown of MAGEA6 Activates AMP-Activated Protein Kinase (AMPK) Signaling to Inhibit Human Renal Cell Carcinoma Cells.

    Science.gov (United States)

    Ye, Xueting; Xie, Jing; Huang, Hang; Deng, Zhexian

    2018-01-01

    Melanoma antigen A6 (MAGEA6) is a cancer-specific ubiquitin ligase of AMP-activated protein kinase (AMPK). The current study tested MAGEA6 expression and potential function in renal cell carcinoma (RCC). MAGEA6 and AMPK expression in human RCC tissues and RCC cells were tested by Western blotting assay and qRT-PCR assay. shRNA method was applied to knockdown MAGEA6 in human RCC cells. Cell survival and proliferation were tested by MTT assay and BrdU ELISA assay, respectively. Cell apoptosis was tested by the TUNEL assay and single strand DNA ELISA assay. The 786-O xenograft in nude mouse model was established to test RCC cell growth in vivo. MAGEA6 is specifically expressed in RCC tissues as well as in the established (786-O and A498) and primary human RCC cells. MAGEA6 expression is correlated with AMPKα1 downregulation in RCC tissues and cells. It is not detected in normal renal tissues nor in the HK-2 renal epithelial cells. MAGEA6 knockdown by targeted-shRNA induced AMPK stabilization and activation, which led to mTOR complex 1 (mTORC1) in-activation and RCC cell death/apoptosis. AMPK inhibition, by AMPKα1 shRNA or the dominant negative AMPKα1 (T172A), almost reversed MAGEA6 knockdown-induced RCC cell apoptosis. Conversely, expression of the constitutive-active AMPKα1 (T172D) mimicked the actions by MAGEA6 shRNA. In vivo, MAGEA6 shRNA-bearing 786-O tumors grew significantly slower in nude mice than the control tumors. AMPKα1 stabilization and activation as well as mTORC1 in-activation were detected in MAGEA6 shRNA tumor tissues. MAGEA6 knockdown inhibits human RCC cells via activating AMPK signaling. © 2018 The Author(s). Published by S. Karger AG, Basel.

  1. 15NH/D-SOLEXSY experiment for accurate measurement of amide solvent exchange rates: application to denatured drkN SH3

    International Nuclear Information System (INIS)

    Chevelkov, Veniamin; Xue, Yi; Krishna Rao, D.; Forman-Kay, Julie D.; Skrynnikov, Nikolai R.

    2010-01-01

    Amide solvent exchange rates are regarded as a valuable source of information on structure/dynamics of unfolded (disordered) proteins. Proton-based saturation transfer experiments, normally used to measure solvent exchange, are known to meet some serious difficulties. The problems mainly arise from the need to (1) manipulate water magnetization and (2) discriminate between multiple magnetization transfer pathways that occur within the proton pool. Some of these issues are specific to unfolded proteins. For example, the compensation scheme used to cancel the Overhauser effect in the popular CLEANEX experiment is not designed for use with unfolded proteins. In this report we describe an alternative experimental strategy, where amide 15 N is used as a probe of solvent exchange. The experiment is performed in 50% H 2 O-50% D 2 O solvent and is based on the (HACACO)NH pulse sequence. The resulting spectral map is fully equivalent to the conventional HSQC. To fulfill its purpose, the experiment monitors the conversion of deuterated species, 15 N D , into protonated species, 15 N H , as effected by the solvent exchange. Conceptually, this experiment is similar to EXSY which prompted the name of 15 N H/D -SOLEXSY (SOLvent EXchange SpectroscopY). Of note, our experimental scheme, which relies on nitrogen rather than proton to monitor solvent exchange, is free of the complications described above. The developed pulse sequence was used to measure solvent exchange rates in the chemically denatured state of the drkN SH3 domain. The results were found to correlate well with the CLEANEX-PM data, r = 0.97, thus providing a measure of validation for both techniques. When the experimentally measured exchange rates are converted into protection factors, most of the values fall in the range 0.5-2, consistent with random-coil behavior. However, elevated values, ca. 5, are obtained for residues R38 and A39, as well as the side-chain indole of W36. This is surprising, given that high

  2. Retinoic acid reduces human neuroblastoma cell migration and invasiveness: effects on DCX, LIS1, neurofilaments-68 and vimentin expression

    International Nuclear Information System (INIS)

    Messi, Elio; Florian, Maria C; Caccia, Claudio; Zanisi, Mariarosa; Maggi, Roberto

    2008-01-01

    Neuroblastoma is a severe pediatric tumor, histologically characterised by a variety of cellular phenotypes. One of the pharmacological approaches to neuroblastoma is the treatment with retinoic acid. The mechanism of action of retinoic acid is still unclear, and the development of resistance to this differentiating agent is a great therapy problem. Doublecortin, a microtubule-associated protein involved in neuronal migration, has recently been proposed as a molecular marker for the detection of minimal residual disease in human neuroblastoma. Nevertheless, no information is available on the expression of doublecortin in the different cell-types composing human neuroblastoma, its correlation with neuroblastoma cell motility and invasiveness, and the possible modulations exerted by retinoic acid treatment. We analysed by immunofluorescence and by Western blot analysis the presence of doublecortin, lissencephaly-1 (another protein involved in neuronal migration) and of two intermediate filaments proteins, vimentin and neurofilament-68, in SK-N-SH human neuroblastoma cell line both in control conditions and under retinoic acid treatment. Migration and cell invasiveness studies were performed by wound scratch test and a modified microchemotaxis assay, respectively. Doublecortin is expressed in two cell subtypes considered to be the more aggressive and that show high migration capability and invasiveness. Vimentin expression is excluded by these cells, while lissencephaly-1 and neurofilaments-68 are immunodetected in all the cell subtypes of the SK-N-SH cell line. Treatment with retinoic acid reduces cell migration and invasiveness, down regulates doublecortin and lissencephaly-1 expression and up regulates neurofilament-68 expression. However, some cells that escape from retinoic acid action maintain migration capability and invasiveness and express doublecortin. a) Doublecortin is expressed in human neuroblastoma cells that show high motility and invasiveness; b

  3. The 1-Tosylpentan-3-one Protects against 6-Hydroxydopamine-Induced Neurotoxicity

    Directory of Open Access Journals (Sweden)

    Chien-Jen Kao

    2017-05-01

    Full Text Available Previous studies have demonstrated that the marine compound austrasulfone, isolated from the soft coral Cladiella australis, exerts a neuroprotective effect. The intermediate product in the synthesis of austrasulfone, dihydroaustrasulfone alcohol, attenuates several inflammatory responses. The present study uses in vitro and in vivo methods to investigate the neuroprotective effect of dihydroaustrasulfone alcohol-modified 1-tosylpentan-3-one (1T3O. Results from in vitro experiments show that 1T3O effectively inhibits 6-hydroxydopamine-induced (6-OHDA-induced activation of both p38 mitogen-activated protein kinase (MAPK and caspase-3 in SH-SY5Y cells; and enhances nuclear factor erythroid 2–related factor 2 (Nrf2 and heme oxygenase-1 (HO-1 expression via phosphoinositide 3-kinase (PI3K/protein kinase B (Akt signaling. Hoechst staining and Terminal deoxynucleotidyl transferase dUTP nick end labeling (TUNEL staining results reveal that 1T3O significantly inhibits 6-OHDA-induced apoptosis. In addition, the addition of an Akt or HO-1 inhibitor decreases the protective effect of 1T3O. Thus, we hypothesize that the anti-apoptotic activity of 1T3O in neuronal cells is mediated through the regulation of the Akt and HO-1 signaling pathways. In vivo experiments show that 1T3O can reverse 6-OHDA-induced reduction in locomotor behavior ability in zebrafish larvae, and inhibit 6-OHDA-induced tumor necrosis factor-alpha (TNF-α increase at the same time. According to our in vitro and in vivo results, we consider that 1T3O exerts its anti-apoptotic activities at SH-SY5Y cells after 6-OHDA challenges, probably via the regulation of anti-oxidative signaling pathways. Therefore, this compound may be a promising therapeutic agent for neurodegenerations.

  4. Solution structure of the human Grb7-SH2 domain/erbB2 peptide complex and structural basis for Grb7 binding to ErbB2

    International Nuclear Information System (INIS)

    Ivancic, Monika; Daly, Roger J.; Lyons, Barbara A.

    2003-01-01

    The solution structure of the hGrb7-SH2 domain in complex with a ten amino acid phosphorylated peptide ligand representative of the erbB2 receptor tyrosine kinase (pY1139) is presented as determined by nuclear magnetic resonance methods. The hGrb7-SH2 domain structure reveals the Src homology 2 domain topology consisting of a central β-sheet capped at each end by an α-helix. The presence of a four residue insertion in the region between β-strand E and the EF loop and resulting influences on the SH2 domain/peptide complex structure are discussed. The binding conformation of the erbB2 peptide is in a β-turn similar to that found in phosphorylated tyrosine peptides bound to the Grb2-SH2 domain. To our knowledge this is only the second example of an SH2 domain binding its naturally occurring ligands in a turn, instead of extended, conformation. Close contacts between residues responsible for binding specificity in hGrb7-SH2 and the erbB2 peptide are characterized and the potential effect of mutation of these residues on the hGrb7-SH2 domain structure is discussed

  5. The human VGF-derived bioactive peptide TLQP-21 binds heat shock 71 kDa protein 8 (HSPA8on the surface of SH-SY5Y cells.

    Directory of Open Access Journals (Sweden)

    Shamim Akhter

    Full Text Available VGF (non-acronymicis a secreted chromogranin/secretogranin that gives rise to a number of bioactive peptides by a complex proteolysis mechanism. VGF-derived peptides exert an extensive array of biological effects in energy metabolism, mood regulation, pain, gastric secretion function, reproduction and, perhaps, cancer. It is therefore surprising that very little is known about receptors and binding partners of VGF-derived peptides and their downstream molecular mechanisms of action. Here, using affinity chromatography and mass spectrometry-based protein identification, we have identified the heat shock cognate 71 kDa protein A8 (HSPA8as a binding partner of human TLQP-21 on the surface of human neuroblastomaSH-SY5Y cells. Binding of TLQP-21 to membrane associated HSPA8 in live SH-SY5Y cells was further supported by cross-linking to live cells. Interaction between HSPA8 and TLQP-21 was confirmed in vitro by label-free Dynamic Mass Redistribution (DMR studies. Furthermore, molecular modeling studies show that TLQP-21 can be docked into the HSPA8 peptide binding pocket. Identification of HSPA8 as a cell surface binding partner of TLQP-21 opens new avenues to explore the molecular mechanisms of its physiological actions, and of pharmacological modulation thereof.

  6. Heat shock protein 70 modulates neural progenitor cells dynamics in human neuroblastoma SH-SY5Y cells exposed to high glucose content.

    Science.gov (United States)

    Salimi, Leila; Rahbarghazi, Reza; Jafarian, Vahab; Biray Avci, Çıgır; Goker Bagca, Bakiye; Pinar Ozates, Neslihan; Khaksar, Majid; Nourazarian, Alireza

    2018-01-18

    In the current experiment, detrimental effects of high glucose condition were investigated on human neuroblastoma cells. Human neuroblastoma cell line SH-SY5Y were exposed to 5, 40, and 70 mM glucose over a period of 72 h. Survival rate and the proliferation of cells were analyzed by MTT and BrdU incorporation assays. Apoptosis was studied by the assays of flow cytometry and PCR array. In order to investigate the trans-differentiation capacity of the cell into mature neurons, we used immunofluorescence imaging to follow NeuN protein level. The transcription level of HSP70 was shown by real-time PCR analysis. MMP-2 and -9 activities were shown by gelatin Zymography. According to data from MTT and BrdU incorporation assay, 70 mM glucose reduced cell viability and proliferation rate as compared to control (5 mM glucose) and cells treated with 40 mM glucose (P Cell exposure to 70 mM glucose had potential to induced apoptosis after 72 h (P SH-SY5Y cells to detrimental effects of high glucose condition during trans-differentiation into mature neuron-like cells. Real-time PCR analysis confirmed the expression of HSP70 in cells under high content glucose levels, demonstrating the possible cell compensatory response to an insulting condition (p control vs 70 mM group  cells being exposed to 70 mM glucose. High glucose condition could abrogate the dynamics of neural progenitor cells. The intracellular level of HSP70 was proportional to cell damage in high glucose condition. © 2018 Wiley Periodicals, Inc.

  7. Expression of Ras-related C3 botulinum toxin substrate 1 (RAC1) in human cholesteatoma.

    Science.gov (United States)

    Lee, No Hee; Chang, Ji-Won; Choi, June; Jung, Hak Hyun; Im, Gi Jung

    2013-02-01

    Ras-related C3 botulinum toxin substrate 1 (RAC1) is a 21-kDa signaling G protein that functions as a pleiotropic regulator of many cellular processes including epithelial differentiation. RAC1 activates the nicotinamide adenine dinucleotide phosphate oxidase complex which promotes formation of reactive oxygen species and degradation enzymes. RAC1 has been associated with rapid epithelial differentiation and invasive properties in human cholesteatoma. This study aimed to identify the presence of RAC1 in human cholesteatoma and analyze its functional role as a regulator of proteolysis and overgrowth. Tissue samples from human cholesteatoma and normal postaural skin were obtained from patients during otologic surgery for cholesteatoma. The expression of RAC1 mRNA was quantified by real-time RT-PCR, and localization of RAC1 expression was confirmed using immunohistochemical staining. Expression of RAC1 mRNA in the epithelium of cholesteatoma was significantly elevated 2.94 fold on average, compared with normal control skin. RAC1 expression in the suprabasal and basal layer of cholesteatoma epithelium was stronger than normal control skin. Our results suggest that RAC1 can be associated with rapid epithelial differentiation and invasive properties of human cholesteatoma.

  8. Gadd153 and NF-κB crosstalk regulates 27-hydroxycholesterol-induced increase in BACE1 and β-amyloid production in human neuroblastoma SH-SY5Y cells.

    Directory of Open Access Journals (Sweden)

    Gurdeep Marwarha

    Full Text Available β-amyloid (Aβ peptide, accumulation of which is a culprit for Alzheimer's disease (AD, is derived from the initial cleavage of amyloid precursor protein by the aspartyl protease BACE1. Identification of cellular mechanisms that regulate BACE1 production is of high relevance to the search for potential disease-modifying therapies that inhibit BACE1 to reduce Aβ accumulation and AD progression. In the present study, we show that the cholesterol oxidation product 27-hydroxycholesterol (27-OHC increases BACE1 and Aβ levels in human neuroblastoma SH-SY5Y cells. This increase in BACE1 involves a crosstalk between the two transcription factors NF-κB and the endoplasmic reticulum stress marker, the growth arrest and DNA damage induced gene-153 (gadd153, also called CHOP. We specifically show that 27-OHC induces a substantial increase in NF-κB binding to the BACE1 promoter and subsequent increase in BACE1 transcription and Aβ production. The NF-κB inhibitor, sc514, significantly attenuated the 27-OHC-induced increase in NF-κB-mediated BACE1 expression and Aβ genesis. We further show that the 27-OHC-induced NF-κB activation and increased NF-κB-mediated BACE1 expression is contingent on the increased activation of gadd153. Silencing gadd153 expression with siRNA alleviated the 27-OHC-induced increase in NF-κB activation, NF-κB binding to the BACE1 promoter, and subsequent increase in BACE1 transcription and Aβ production. We also show that increased levels of BACE1 in the triple transgenic mouse model for AD is preceded by gadd153 and NF-κB activation. In summary, our study demonstrates that gadd153 and NF-κB work in concert to regulate BACE1 expression. Agents that inhibit gadd153 activation and subsequent interaction with NF-κB might be promising targets to reduce BACE1 and Aβ overproduction and may ultimately serve as disease-modifying treatments for AD.

  9. Extreme sensitivity of gene expression in human SH-SY5Y neurocytes to ultra-low doses of Gelsemium sempervirens

    Science.gov (United States)

    2014-01-01

    Background Gelsemium sempervirens L. (Gelsemium s.) is a traditional medicinal plant, employed as an anxiolytic at ultra-low doses and animal models recently confirmed this activity. However the mechanisms by which it might operate on the nervous system are largely unknown. This work investigates the gene expression of a human neurocyte cell line treated with increasing dilutions of Gelsemium s. extract. Methods Starting from the crude extract, six 100 × (centesimal, c) dilutions of Gelsemium s. (2c, 3c, 4c, 5c, 9c and 30c) were prepared according to the French homeopathic pharmacopoeia. Human SH-SY5Y neuroblastoma cells were exposed for 24 h to test dilutions, and their transcriptome compared by microarray to that of cells treated with control vehicle solutions. Results Exposure to the Gelsemium s. 2c dilution (the highest dose employed, corresponding to a gelsemine concentration of 6.5 × 10-9 M) significantly changed the expression of 56 genes, of which 49 were down-regulated and 7 were overexpressed. Several of the down-regulated genes belonged to G-protein coupled receptor signaling pathways, calcium homeostasis, inflammatory response and neuropeptide receptors. Fisher exact test, applied to the group of 49 genes down-regulated by Gelsemium s. 2c, showed that the direction of effects was significantly maintained across the treatment with high homeopathic dilutions, even though the size of the differences was distributed in a small range. Conclusions The study shows that Gelsemium s., a medicinal plant used in traditional remedies and homeopathy, modulates a series of genes involved in neuronal function. A small, but statistically significant, response was detected even to very low doses/high dilutions (up to 30c), indicating that the human neurocyte genome is extremely sensitive to this regulation. PMID:24642002

  10. Differential induction of Toll-like receptors & type 1 interferons by Sabin attenuated & wild type 1 polioviruses in human neuronal cells

    Directory of Open Access Journals (Sweden)

    Madhu C Mohanty

    2013-01-01

    Full Text Available Background & objectives: Polioviruses are the causative agent of paralytic poliomyelitis. Attenuated polioviruses (Sabin oral poliovirus vaccine strains do not replicate efficiently in neurons as compared to the wild type polioviruses and therefore do not cause disease. This study was aimed to investigate the differential host immune response to wild type 1 poliovirus (wild PV and Sabin attenuated type 1 poliovirus (Sabin PV in cultured human neuronal cells. Methods: By using flow cytometry and real time PCR methods we examined host innate immune responses and compared the role of toll like receptors (TLRs and cytoplasmic RNA helicases in cultured human neuronal cells (SK-N-SH infected with Sabin PV and wild PV. Results: Human neuronal cells expressed very low levels of TLRs constitutively. Sabin PV infection induced significantly higher expression of TLR3, TLR7 and melanoma differentiation-associated protein-5 (MDA-5 m-RNA in neuronal cells at the beginning of infection (up to 4 h as compared to wild PV. Further, Sabin PV also induced the expression of interferon α/β at early time point of infection. The induced expression of IFN α/β gene by Sabin PV in neuronal cells could be suppressed by inhibiting TLR7. Interpretation & conclusions: Neuronal cell innate immune response to Sabin and wild polioviruses differ significantly for TLR3, TLR7, MDA5 and type 1 interferons. Effects of TLR7 activation and interferon production and Sabin virus replication in neuronal cells need to be actively investigated in future studies.

  11. Designing a dataflow processor using CλaSH

    NARCIS (Netherlands)

    Niedermeier, A.; Wester, Rinse; Wester, Rinse; Rovers, K.C.; Baaij, C.P.R.; Kuper, Jan; Smit, Gerardus Johannes Maria

    2010-01-01

    In this paper we show how a simple dataflow processor can be fully implemented using CλaSH, a high level HDL based on the functional programming language Haskell. The processor was described using Haskell, the CλaSH compiler was then used to translate the design into a fully synthesisable VHDL code.

  12. Study on expression of SH2 domain-containing protein tyrosine phosphatase SHP-1 and SHP-2 in γ-ray irradiation-induced thymus lymphoma in mice

    International Nuclear Information System (INIS)

    Huang Dingde; Chen Qi; Han Ling; Cai Jianming; Li Bailong; Huang Yuecheng; Gao Jianguo; Sun Suping

    2003-01-01

    Objective: To investigate the expression of SH2 domain containing-protein tyrosine phosphatase SHP-1 and SHP-2 in γ-ray irradiation-induced thymus lymphoma in mice. Methods: Altogether 338 BALB/c mice were randomly divided into irradiation groups and controls. Irradiation groups which were irradiated with γ-rays included canceration groups confirmed with histology and uncanceration groups. The controls were fed synchronistically with irradiation groups. The expression of SHP-1 and SHP-2 was detected with Western blot in thymus cells. Results: The expression of SHP-1 in canceration groups was much higher than that in uncanceration groups and controls significantly, while the expression of SHP-2 in canceration groups was higher than that in uncanceration groups and controls. When authors detected the expression of SHP-2 with Western blot, the authors found another protein with a molecular weight of 55x10 3 , which expression in canceration groups was higher than that in uncanceration groups and controls. Conclusion: The expression of SH2 domain-containing protein tyrosine phosphatase SHP-1 and SHP-2 is significantly increased in canceration groups, suggesting that SHP-1 and SHP-2 may be related with γ-ray induced thymus lymphoma in mice. Further research is expected on the relationship between development of cancer and SHP-1 and SHP-2

  13. Tissue localization of human trefoil factors 1, 2, and 3

    DEFF Research Database (Denmark)

    Madsen, Jens; Nielsen, Ole; Tornøe, Ida

    2007-01-01

    Trefoil factors (TTFs) are small, compact proteins coexpressed with mucins in the gastrointestinal tract. Three trefoil factors are known in mammals: TFF1, TFF2, and TFF3. They are implicated to play diverse roles in maintenance and repair of the gastrointestinal channel. We compared the expression...... pattern of the three trefoil factors analyzing mRNA from a panel of 20 human tissues by conventional reverse transcriptase (RT) PCR and, in addition, by real-time PCR. These findings were supported by immunohistochemical analysis of paraffin-embedded human tissues using rabbit polyclonal antibodies raised...... against these factors. TFF1 showed highest expression in the stomach and colon, whereas TFF2 and TFF3 showed highest expression in stomach and colon, respectively. All three TFFs were found in the ducts of pancreas. Whereas TFF2 was found to be restricted to these two tissues, the structurally more...

  14. The human LIS1 is downregulated in hepatocellular carcinoma and plays a tumor suppressor function

    International Nuclear Information System (INIS)

    Xing, Zhen; Tang, Xin; Gao, Yuan; Da, Liang; Song, Hai; Wang, Suiquan; Tiollais, Pierre; Li, Tsaiping; Zhao, Mujun

    2011-01-01

    Highlights: → LIS1 mRNA and protein levels are decreased in 70% HCC tissues. → Downregulation of LIS1 expression induces oncogenic transformation of QSG7701 and NIH3T3 cells in vitro and in vivo. → LIS1 downregulation leads to mitotic errors including spindle and chromosome defects. → Ectopic expression of LIS1 could significantly inhibit HCC cell proliferation and colony formation. → Our results suggest that LIS1 plays a potential tumor suppressor role in the development and progression of HCC. -- Abstract: The human lissencephaly-1 gene (LIS1) is a disease gene responsible for Miller-Dieker lissencephaly syndrome (MDL). LIS1 gene is located in the region of chromosome 17p13.3 that is frequency deleted in MDL patients and in human liver cancer cells. However, the expression and significance of LIS1 in liver cancer remain unknown. Here, we investigated the expression of LIS1 in hepatocellular carcinoma (HCC) tissues by real-time PCR, Western blot, and immunohistochemistry. The results indicated that the mRNA and protein levels of LIS1 were downregulated in about 70% of HCC tissues, and this downregulation was significantly associated with tumor progression. Functional studies showed that the reduction of LIS1 expression in the normal human liver cell line QSG7701 or the mouse fibroblast cell line NIH3T3 by shRNA resulted in colony formation in soft agar and xenograft tumor formation in nude mice, demonstrating that a decrease in the LIS1 level can promote the oncogenic transformation of cells. We also observed that the phenotypes of LIS1-knockdown cells displayed various defective mitotic structures, suggesting that the mechanism by which reduced LIS1 levels results in tumorigenesis is associated with its role in mitosis. Furthermore, we demonstrated that ectopic expression of LIS1 could significantly inhibit HCC cell proliferation and colony formation. Our results suggest that LIS1 plays a potential tumor suppressor role in the development and

  15. The human LIS1 is downregulated in hepatocellular carcinoma and plays a tumor suppressor function

    Energy Technology Data Exchange (ETDEWEB)

    Xing, Zhen; Tang, Xin; Gao, Yuan; Da, Liang; Song, Hai; Wang, Suiquan [State Key Laboratory of Molecular Biology, Institute of Biochemistry and Cell Biology, Shanghai Institutes for Biological Sciences, Chinese Academy of Sciences, Shanghai (China); Tiollais, Pierre [Unite' d' Organisation Nucleaire et Oncogenese, INSERM U.579, Institut Pasteur, Paris (France); Li, Tsaiping [State Key Laboratory of Molecular Biology, Institute of Biochemistry and Cell Biology, Shanghai Institutes for Biological Sciences, Chinese Academy of Sciences, Shanghai (China); Zhao, Mujun, E-mail: mjzhao@sibs.ac.cn [State Key Laboratory of Molecular Biology, Institute of Biochemistry and Cell Biology, Shanghai Institutes for Biological Sciences, Chinese Academy of Sciences, Shanghai (China)

    2011-06-03

    Highlights: {yields} LIS1 mRNA and protein levels are decreased in 70% HCC tissues. {yields} Downregulation of LIS1 expression induces oncogenic transformation of QSG7701 and NIH3T3 cells in vitro and in vivo. {yields} LIS1 downregulation leads to mitotic errors including spindle and chromosome defects. {yields} Ectopic expression of LIS1 could significantly inhibit HCC cell proliferation and colony formation. {yields} Our results suggest that LIS1 plays a potential tumor suppressor role in the development and progression of HCC. -- Abstract: The human lissencephaly-1 gene (LIS1) is a disease gene responsible for Miller-Dieker lissencephaly syndrome (MDL). LIS1 gene is located in the region of chromosome 17p13.3 that is frequency deleted in MDL patients and in human liver cancer cells. However, the expression and significance of LIS1 in liver cancer remain unknown. Here, we investigated the expression of LIS1 in hepatocellular carcinoma (HCC) tissues by real-time PCR, Western blot, and immunohistochemistry. The results indicated that the mRNA and protein levels of LIS1 were downregulated in about 70% of HCC tissues, and this downregulation was significantly associated with tumor progression. Functional studies showed that the reduction of LIS1 expression in the normal human liver cell line QSG7701 or the mouse fibroblast cell line NIH3T3 by shRNA resulted in colony formation in soft agar and xenograft tumor formation in nude mice, demonstrating that a decrease in the LIS1 level can promote the oncogenic transformation of cells. We also observed that the phenotypes of LIS1-knockdown cells displayed various defective mitotic structures, suggesting that the mechanism by which reduced LIS1 levels results in tumorigenesis is associated with its role in mitosis. Furthermore, we demonstrated that ectopic expression of LIS1 could significantly inhibit HCC cell proliferation and colony formation. Our results suggest that LIS1 plays a potential tumor suppressor role in the

  16. FOXP3 renders activated human regulatory T cells resistant to restimulation-induced cell death by suppressing SAP expression.

    Science.gov (United States)

    Katz, Gil; Voss, Kelsey; Yan, Toria F; Kim, Yong Chan; Kortum, Robert L; Scott, David W; Snow, Andrew L

    2018-05-01

    Restimulation-induced cell death (RICD) is an apoptotic program that regulates effector T cell expansion, triggered by repeated stimulation through the T cell receptor (TCR) in the presence of interleukin-2 (IL-2). Although CD4 + regulatory T cells (Tregs) consume IL-2 and experience frequent TCR stimulation, they are highly resistant to RICD. Resistance in Tregs is dependent on the forkhead box P3 (FOXP3) transcription factor, although the mechanism remains unclear. T cells from patients with X-linked lymphoproliferative disease (XLP-1), that lack the adaptor molecule SLAM-associated protein (SAP), are also resistant to RICD. Here we demonstrate that normal Tregs express very low levels of SAP compared to conventional T cells. FOXP3 reduces SAP expression by directly binding to and repressing the SH2D1A (SAP) promoter. Indeed, ectopic SAP expression restores RICD sensitivity in human FOXP3 + Tregs. Our findings illuminate the mechanism behind FOXP3-mediated RICD resistance in Tregs, providing new insight into their long-term persistence. Published by Elsevier Inc.

  17. Interstellar Extinction in the Direction of NGC 7380 (Sh2-142)

    Science.gov (United States)

    Topasna, Gregory A.

    2016-01-01

    Multi-wavelength polarization measurements of stars in NGC 7380, centered on the emission nebula Sh2-142 are presented. The polarization is found to be in the direction of the magnetic field of the galaxy for this region with the degree of polarization ranging from 1.8% to 3.3%. The wavelength of maximum polarization ranges from 0.413 μm to 0.661 μm. Using the dependence of the ratio of total to selective extinction R = (5.6 ±0.3)λmax an average value of R = 3.05 ± 0.09 results. The wavelength of maximum polarization is also shown to be strongly correlated to E(B - V) color excess.

  18. SiRNA-mediated IGF-1R inhibition sensitizes human colon cancer SW480 cells to radiation

    International Nuclear Information System (INIS)

    Yavari, Kamal; Taghikhani, Mohammad; Mesbah-Namin, Seyed A.; Maragheh, Mohammad Ghannadi; Babaei, Mohammad Hosein; Arfaee, Ali Jabbary; Madani, Hossein; Mirzaei, Hamid Reza

    2010-01-01

    Purpose. Insulin like growth factor receptor 1 (IGF-1R) is well-documented to play a key role in radiation response and tumor radiosensitivity, thus offering an attractive clinic drug target to enhance tumor sensitivity to anti-cancer radiotherapy. Material and methods. Human colon carcinoma SW480 cells were transfected with the specific small interference RNA (siRNA) expression vector (pkD-shRNA-IGF-1R-V2) designed to target IGF-1R mRNA. The expression of IGF-1R mRNA and its protein among the transfected and untransfected cells were detected by semi-quantitative RT-PCR and ELISA assay. The changes in cell radiosensitivity were examined by MTT assay. Results. Transfection of mammalian expression vector pkD containing IGF-1R siRNA was shown to reduce IGF-1R mRNA levels by up to 95%. ELISA assay detected a similar inhibition of IGF-1R protein levels in cells transfected with IGF-1R siRNA. SW480 cells transfected with the expression vector for siRNA significantly rendered cells more sensitive to radiation and the highest radiation enhancement ratio was 2.02 ± 0.08. Conclusion. These data provide the first evidence that specific siRNA fragment (pkD-shRNA-IGF-1R-V2) targeting human IGF-1R mRNA is able to enhance colon cancer radiosensitivity. Also results indicated that, combining IGF-1R siRNA and radiation significantly enhances antitumor efficacy compared with either modality alone

  19. Modeling cometary photopolarimetric characteristics with Sh-matrix method

    Science.gov (United States)

    Kolokolova, L.; Petrov, D.

    2017-12-01

    Cometary dust is dominated by particles of complex shape and structure, which are often considered as fractal aggregates. Rigorous modeling of light scattering by such particles, even using parallelized codes and NASA supercomputer resources, is very computer time and memory consuming. We are presenting a new approach to modeling cometary dust that is based on the Sh-matrix technique (e.g., Petrov et al., JQSRT, 112, 2012). This method is based on the T-matrix technique (e.g., Mishchenko et al., JQSRT, 55, 1996) and was developed after it had been found that the shape-dependent factors could be separated from the size- and refractive-index-dependent factors and presented as a shape matrix, or Sh-matrix. Size and refractive index dependences are incorporated through analytical operations on the Sh-matrix to produce the elements of T-matrix. Sh-matrix method keeps all advantages of the T-matrix method, including analytical averaging over particle orientation. Moreover, the surface integrals describing the Sh-matrix elements themselves can be solvable analytically for particles of any shape. This makes Sh-matrix approach an effective technique to simulate light scattering by particles of complex shape and surface structure. In this paper, we present cometary dust as an ensemble of Gaussian random particles. The shape of these particles is described by a log-normal distribution of their radius length and direction (Muinonen, EMP, 72, 1996). Changing one of the parameters of this distribution, the correlation angle, from 0 to 90 deg., we can model a variety of particles from spheres to particles of a random complex shape. We survey the angular and spectral dependencies of intensity and polarization resulted from light scattering by such particles, studying how they depend on the particle shape, size, and composition (including porous particles to simulate aggregates) to find the best fit to the cometary observations.

  20. Effect of 1,24R-dihydroxyvitamin D3 on the growth of human keratinocytes.

    LENUS (Irish Health Repository)

    Matsumoto, K

    1990-02-01

    The effect of 1,24R-dihydroxyvitamin D3 (1,24R(OH)2D3), a synthetic analogue of a biologically active form of vitamin D3 (1,25-dihydroxyvitamin D3, 1,25(OH)2D3), on the growth of human keratinocytes cultured in serum-free medium was investigated. The growth of cultured normal human keratinocytes was inhibited by 65% by 10(-8)M 1,24R(OH)2D3 and by 90% by 10(-7)M 1,24(OH)2D3. It inhibited cell growth almost completely at 10(-6)M. The DNA synthesis of keratinocytes was also inhibited with 1,24R(OH)2D3 by 27% at 10(-8)M, 59% at 10(-7)M, and 92% at 10(-6)M. The inhibition of cell growth and DNA synthesis were more remarkable by 1,24R(OH)2D3 than by 1,25(OH)2D3. 1,24R(OH)2D3 also inhibited the growth of keratinocytes derived from patients with psoriasis vulgaris; the growth inhibitory effect was again more remarkable with 1,24R(OH)2D3 than with 1,25(OH)2D3. The viability and protein synthesis of keratinocytes were not affected by 1,24R(OH)2D3, suggesting that the growth inhibitory effect is due to its biological activity, not to cytotoxicity. The binding of [3H]-labeled 1,25(OH)2D3 to its receptor in the cytosolic fraction of cultured keratinocytes was competitively substituted by unlabeled 1,24R(OH)2D3 as well as 1,25(OH)2D3, suggesting that 1,24R(OH)2D3 binds to the 1,25(OH)2D3 receptor. It was found that the affinity of 1,24R(OH)2D3 for the receptor was slightly higher than that of 1,25(OH)2D3. These results demonstrate that 1,24R(OH)2D3 functions as a potent growth inhibitor in vitro in human keratinocytes from both normal and psoriatic epidermis, and it possesses a higher affinity for the 1,25(OH)2D3 receptor in cultured human keratinocytes. The difference in affinity of 1,24R(OH)2D3 for the 1,25(OH)2D3 receptor correlates with its greater inhibition of keratinocyte growth than 1,25(OH)2D3. 1,24R(OH)2D3 may be useful in the treatment of psoriasis.