
Sample records for hui-wen chen ying-hao

  1. H CHEN

    Indian Academy of Sciences (India)

    Home; Journals; Bulletin of Materials Science. H CHEN. Articles written in Bulletin of Materials Science. Volume 41 Issue 2 April 2018 pp 51. Effect of oxygen vacancies on Li-storage of anatase TiO 2 (001) facets: a first principles study · H CHEN Y H DING X Q TANG W ZHANG J R YIN P ZHANG Y JIANG · More Details ...

  2. Chen Hengzhe

    DEFF Research Database (Denmark)

    Gimpel, Denise

    been the first to write children’s literature. In 1914 she was among the first group of women to gain a Boxer Indemnity grant to study in America. The reiteration of these many “firsts” has led to a rather stereotypical portrait of Chen Hengzhe in Chinese sources and, as a result, in most Western...

  3. Chen Hengzhe

    DEFF Research Database (Denmark)

    Gimpel, Denise

    Chen Hengzhe has been celebrated as China’s first female professor, first professor of Western history, first person to publish a history of the West that was not a translation into Chinese. She is moreover celebrated as one of the first to write fiction and poetry in the vernacular and to have......; they speak to important questions in China today. This study, then, is not a biography of a person; it is an attempt to understand the way in which foreign influences (narratives of being, organizing, thinking, writing) seep into a person’s life and work and meld with the “home” influences (narratives...

  4. Chen's inversion formula

    International Nuclear Information System (INIS)

    Hughes, B.D.; Frankel, N.E.; Ninham, B.W.


    An alternative view is presented of the Chen's generalization of a formula of classic algebraic number theory, based on the Mellin transformation and Reimann's zeta function. The advantages of the Mellin transform, as a method with a primary role in asymptotic analysis, are outlined. 10 refs

  5. Horseshoes in modified Chen's attractors

    International Nuclear Information System (INIS)

    Huang Yan; Yang Xiaosong


    In this paper we study dynamics of a class of modified Chen's attractors, we show that these attractors are chaotic by giving a rigorous verification for existence of horseshoes in these systems. We prove that the Poincare maps derived from these modified Chen's attractors are semi-conjugate to the 2-shift map

  6. Mechanical analysis of Chen chaotic system

    International Nuclear Information System (INIS)

    Liang, Xiyin; Qi, Guoyuan


    The Chen chaotic system is transformed into Kolmogorov type system, which is decomposed into four types of torques: inertial torque, internal torque, dissipation and external torque. By the combinations of different torques, five cases are studied to discover key factors of chaos generation and the physical meaning. The conversion among Hamiltonian energy, kinetic energy and potential energy is investigated in these five cases. The relationship between the energies and the parameters is studied. It concludes that the combination of these four types of torques is necessary conditions to produce chaos, and any combination of three types of torques cannot produce chaos in Chen system.

  7. Immunogenicity of novel sulfadimethoxide conjugates | Chen ...

    African Journals Online (AJOL)

    Immunogenicity of novel sulfadimethoxide conjugates. L Chen, J Su, X Zhang, L Li, X He. Abstract. Sulfadimethoxine (SDM) is an antibiotic commonly added to animal feeds. Anti-SDM antibodies are useful for the detection of residual SDM in foods, feeds and biological fluids by ELISA. In this study, we show that SDM is ...

  8. Titanisierung von Implantatoberflächen (United States)

    Zimmermann, Hanngörg; Heinlein, Markus; Guldner, Norbert W.

    Titan gilt seit Jahrzehnten als einer der wichtigsten Implantatwerkstoffe in der Medizin. Neben den guten mechanischen Eigenschaften (Leichtigkeit, hohe Festigkeit etc.), besitzen Titanimplantate vor allem eine hervorragende Körperverträglichkeit, so dass die Implantate optimal in den humanen Organismus integriert werden [1]. Ist jedoch aufgrund der Anforderungen an das Implantat eine hohe Flexibilität und/ oder Elastizität gefragt, so scheidet der Werkstoff Titan aufgrund seiner spröden und unflexiblen Materialeigenschaften aus. Die Folge ist der Einsatz von Implantatmaterialien, sowohl künstlichen als auch biologischen Ursprungs, welche nicht selten eine unzureichende Biokompatibilität aufweisen und somit zu Fremdköper- und immunologischen Reaktionen und Einkapselung des Implantates führen können. Die Erhöhung der Körperverträglichkeit, eine Adaption an das biologische Umfeld und eine hohe Biokompatibilität sind demzufolge die wichtigsten Eigenschaften bei der bedarfsgerechten Herstellung von Implantaten und Implantatoberflächen. Zur Gestaltung von innovativen, biokompatiblen Oberflächen stehen unterschiedliche technische Lösungsansätze zur Verfügung. Zum einen besteht die Möglichkeit, geeignete Oberflächeneigenschaften aus dem Grundmaterial selbst zu optimieren. Dies geschieht unter anderem durch Modifikation der Werkstoffoberflächen in Form von Texturierungen und Oberflächenrauhigkeiten. Zum anderen können die Oberflächeneigenschaften unabhängig von denen des Trägermaterials gestaltet werden. Durch Funktionalisierung der Oberflächen mit geeigneten Beschichtungen oder der Zugabe von Medikamenten (Drug Eluting) werden die Kunststoffimplantate dahingehend verändert, dass eine Steigerung der Körperakzeptanz erreicht wird. Die Titanbeschichtung von Implantatoberflächen kombiniert die positiven Materialeigenschaften von Titan und Polymer.

  9. Chaos control of Chen chaotic dynamical system

    International Nuclear Information System (INIS)

    Yassen, M.T.


    This paper is devoted to study the problem of controlling chaos in Chen chaotic dynamical system. Two different methods of control, feedback and nonfeedback methods are used to suppress chaos to unstable equilibria or unstable periodic orbits (UPO). The Lyapunov direct method and Routh-Hurwitz criteria are used to study the conditions of the asymptotic stability of the steady states of the controlled system. Numerical simulations are presented to show these results

  10. Impulsive synchronization of Chen's hyperchaotic system

    International Nuclear Information System (INIS)

    Haeri, Mohammad; Dehghani, Mahsa


    In this Letter the impulsive synchronization of the Chen's hyperchaotic systems is discussed. Some new and sufficient conditions on varying impulsive distance are established in order to guarantee the synchronizabillity of the systems using the synchronization method. In particular, some simple conditions are derived in synchronizing the systems by equal impulsive distances. Two illustrative examples are provided to show the feasibility and the effectiveness of the proposed method. The boundaries of the stable regions are also estimated

  11. Stability analysis of distributed order fractional chen system. (United States)

    Aminikhah, H; Refahi Sheikhani, A; Rezazadeh, H


    We first investigate sufficient and necessary conditions of stability of nonlinear distributed order fractional system and then we generalize the integer-order Chen system into the distributed order fractional domain. Based on the asymptotic stability theory of nonlinear distributed order fractional systems, the stability of distributed order fractional Chen system is discussed. In addition, we have found that chaos exists in the double fractional order Chen system. Numerical solutions are used to verify the analytical results.

  12. Stability Analysis of Distributed Order Fractional Chen System (United States)

    Aminikhah, H.; Refahi Sheikhani, A.; Rezazadeh, H.


    We first investigate sufficient and necessary conditions of stability of nonlinear distributed order fractional system and then we generalize the integer-order Chen system into the distributed order fractional domain. Based on the asymptotic stability theory of nonlinear distributed order fractional systems, the stability of distributed order fractional Chen system is discussed. In addition, we have found that chaos exists in the double fractional order Chen system. Numerical solutions are used to verify the analytical results. PMID:24489508

  13. Adaptive synchronization of hyperchaotic Chen system with uncertain parameters

    International Nuclear Information System (INIS)

    Park, Ju H.


    This article addresses control for the chaos synchronization of hyperchaotic Chen system with five uncertain parameters. Based on the Lyapunov stability theory, an adaptive control law is derived to make the states of two identical hyperchaotic Chen systems asymptotically synchronized. Finally, a numerical simulations is presented to show the effectiveness of the proposed chaos synchronization scheme

  14. Chaos in the fractional order Chen system and its control

    International Nuclear Information System (INIS)

    Li Chunguang; Chen Guanrong


    In this letter, we study the chaotic behaviors in the fractional order Chen system. We found that chaos exists in the fractional order Chen system with order less than 3. The lowest order we found to have chaos in this system is 2.1. Linear feedback control of chaos in this system is also studied

  15. Complete synchronization of two Chen-Lee systems

    International Nuclear Information System (INIS)

    Sheu, L-J; Chen, J-H; Chen, H-K; Tam, L-M; Lao, S-K; Chen, W-C; Lin, K-T


    This study demonstrates that complete synchronization of two Chen-Lee chaotic systems can be easily achieved. The upper bound of the Chen-Lee chaotic system is estimated numerically. A controller is designed to synchronize two chaotic systems. Sufficient conditions for synchronization are obtained using Lyapunov's direct method. Two numerical examples are presented to verify the proposed synchronization approach

  16. A simple observer of the generalized Chen chaotic systems

    International Nuclear Information System (INIS)

    Sun, Y.-J.


    In this paper, the generalized Chen chaotic system is considered and the state observation problem of such a system is investigated. Based on the time-domain approach, a simple observer for the generalized Chen chaotic system is proposed to guarantee the global exponential stability of the resulting error system. Furthermore, the guaranteed exponential convergence rate can be correctly estimated. Finally, a numerical example is provided to illustrate the use of the main result.

  17. Comparing numerical methods for the solutions of the Chen system

    International Nuclear Information System (INIS)

    Noorani, M.S.M.; Hashim, I.; Ahmad, R.; Bakar, S.A.; Ismail, E.S.; Zakaria, A.M.


    In this paper, the Adomian decomposition method (ADM) is applied to the Chen system which is a three-dimensional system of ODEs with quadratic nonlinearities. The ADM yields an analytical solution in terms of a rapidly convergent infinite power series with easily computable terms. Comparisons between the decomposition solutions and the classical fourth-order Runge-Kutta (RK4) numerical solutions are made. In particular we look at the accuracy of the ADM as the Chen system changes from a non-chaotic system to a chaotic one. To highlight some computational difficulties due to a high Lyapunov exponent, a comparison with the Lorenz system is given

  18. The age grading and the Chen-Ruan cup product

    DEFF Research Database (Denmark)

    A. Hepworth, Richard


    We prove that the obstruction bundle used to define the cup-product in Chen-Ruan cohomology is determined by the so-called `age grading' or `degree-shifting numbers'. Indeed, the obstruction bundle can be directly computed using the age grading. We obtain a Kunneth Theorem for Chen-Ruan cohomology...... as a direct consequence of an elementary property of the age grading, and explain how several other results - including associativity of the cup-product - can be proved in a similar way....

  19. On a conjecture of Chen-Guo-Wang


    Ning, Bo; Zheng, Yu


    Towards confirming Sun's conjecture on the strict log-concavity of combinatorial sequence involving the n$th$ Bernoulli number, Chen, Guo and Wang proposed a conjecture about the log-concavity of the function $\\theta(x)=\\sqrt[x]{2\\zeta(x)\\Gamma(x+1)}$ for $x\\in (6,\\infty)$, where $\\zeta(x)$ is the Riemann zeta function and $\\Gamma(x)$ is the Gamma function. In this paper, we first prove this conjecture along the spirit of Zhu's previous work. Second, we extend Chen et al.'s conjecture in the ...

  20. An equilibrium point stabilization strategy for the Chen system

    International Nuclear Information System (INIS)

    Alvarez-Ramirez, Jose; Cevantes, Ilse; Femat, Ricardo


    The aim of this Letter is to address the equilibrium point stabilization problem of the Chen system by employing a simple linear feedback controller derived from time-scaling the dynamics of a single variable. The controller has the advantage of being easy to implement and a rigorous stability proof is provided based on singular perturbation arguments. Results are illustrated via numerical simulations

  1. Dynamics of fractional-ordered Chen system with delay

    Indian Academy of Sciences (India)

    Though this subject has a history of more than 300 years, utility and applicability of fractional calculus to various branches of science and engineering have been real- ... variants of Chen system and see the qualitative changes in attractor and ...

  2. Generalized projective synchronization between Lorenz system and Chen's system

    International Nuclear Information System (INIS)

    Li Guohui


    On the basis of active backstepping design, this paper presents the generalized projective synchronization between two different chaotic systems: Lorenz system and Chen's system. The proposed method combines backstepping methods and active control without having to calculate the Lyapunov exponents and the eigenvalues of the Jacobian matrix, which makes it simple and convenient. Numerical simulations show that this method works very well

  3. Alternative implementation of the chaotic Chen-Lee system

    International Nuclear Information System (INIS)

    Sheu, L.-J.; Tam, L.-M.; Chen, H.-K.; Lao, S.-K.


    The chaotic Chen-Lee system was developed with a formalism based on the Euler equations for the motion of a rigid body. It was proved that this system is the governing set of equations for gyro motion with feedback control. Recently, studies were conducted to explore the dynamic behavior of this system, including fractional order behavior, the generation of hyperchaos and perturbation analysis, control and anti-control of chaos, synchronization, etc. In this study, we further explore (1) the stability of the equilibrium points and (2) the implementation of an electronic circuit using the Chen-Lee system. It is shown that not only is this system related to gyro motion but can also be applied to electronic circuits for encryption purposes.

  4. Chaos synchronization between Chen system and Genesio system

    International Nuclear Information System (INIS)

    Wu Xianyong; Guan Zhihong; Wu Zhengping; Li Tao


    This Letter presents two synchronization schemes between two different chaotic systems. Active control synchronization and adaptive synchronization between Chen system and Genesio system are studied, different controllers are designed to synchronize the drive and response systems, active control synchronization is used when system parameters are known; adaptive synchronization is employed when system parameters are unknown or uncertain. Simulation results show the effectiveness of the proposed schemes

  5. [Professor CHEN Xiuhua's experience in the treatment of atopic dermatitis]. (United States)

    Quan, Xiaohong; Li, Shuqian; Li, Ying


    Professor CHEN Xiuhua 's clinical experiences were introduced in the intervention on atopic dermatitis with external therapies of TCM acupuncture. On the basis of the theory as cultivating the earth and clearing the heart from professor CHEN Dacan and in terms of the disease stages and skin lesion characteristics, as well as in consideration of syndrome differen-tiation, the acupoints for strengthening the spleen and clearing heart fire are selected, such as Zhongwan (CV 12), Daheng (SP 15), Shuifen (CV 9), Tianshu (ST 25), Neiguan (PC 6) and Quchi (LI 11). For the repair of skin lesion, the integration of Chinese and western medicine is used, with the internal application and external use of Chinese herbal medicines involved. The topical ointments are selected rationally. The self-blood therapy is used with acupuncture, bleeding therapy and acupoint injection applied in combination on the basis of the theory of TCM zangfu organs and modern immunological mechanism, which stimulates the nonspecific immune response in the body and strengthens acupoint stimulus effects. Medical thread therapy of Guangxi Zhuang medicine is used in moxibustion for skin damage, which effectively stops itching and promotes wound healing and skin repair.

  6. Eine praktische Anwendung von CMC-Flächen in der Bionik


    Apeltauer, Christian


    Die vorliegende Arbeit beschäftigt sich mit den theoretischen Grundlagen für die Entwicklung von Oberflächen, die unter Wasser möglichst lange eine Luftschicht an sich halten können. Ein natürliches Vorbild für solche Oberflächen ist die Pflanze Salvinia molesta; technisch interessieren solche Oberflächen zur Verringerung des Wasserwiderstandes von Schiffen und als Schutz vor Besiedlung durch Wasserorganismen. Wichtigste Gleichung bei der Entwicklung solcher Oberflächen ist...

  7. How Memory Is Tested Influences What Is Measured: Reply to Wyble and Chen (2017) (United States)

    Swallow, Khena M.; Jiang, Yuhong V.; Tan, Deborah H.


    In this response to Wyble and Chen's (2017) commentary on attribute amnesia, we hope to achieve several goals. First, we clarify how our view diverges from that described by Wyble and Chen. We argue that because the surprise memory test is disruptive, it is an insensitive tool for measuring the persistence of recently attended target attributes in…

  8. Forecasting Jakarta composite index (IHSG) based on chen fuzzy time series and firefly clustering algorithm (United States)

    Ningrum, R. W.; Surarso, B.; Farikhin; Safarudin, Y. M.


    This paper proposes the combination of Firefly Algorithm (FA) and Chen Fuzzy Time Series Forecasting. Most of the existing fuzzy forecasting methods based on fuzzy time series use the static length of intervals. Therefore, we apply an artificial intelligence, i.e., Firefly Algorithm (FA) to set non-stationary length of intervals for each cluster on Chen Method. The method is evaluated by applying on the Jakarta Composite Index (IHSG) and compare with classical Chen Fuzzy Time Series Forecasting. Its performance verified through simulation using Matlab.

  9. Review of the genus Neotetricodes Zhang et Chen (Hemiptera: Fulgoromorpha: Issidae) with description of two new species. (United States)

    Chang, Zhi-Min; Yang, Lin; Zhang, Zheng-Guang; Chen, Xiang-Sheng


    Two new species of the issid genus Neotetricodes Zhang et Chen (Hemiptera: Fulgoromorpha: Issidae): Neotetricodes longispinus Chang et Chen sp. nov. (China: Yunnan) and Neotetricodes xiphoideus Chang et Chen sp. nov. (China: Yunnan) are described and illustrated. The generic characteristic is redefined. A checklist and key to the species of the genus are provided. The female genitalia of the genus are firstly described.

  10. Methodische Anregungen zu Literarischen Gesprächen in der Sekundarstufe


    Spinner, Kaspar H.


    Methodische Anregungen zu Literarischen Gesprächen in der Sekundarstufe. - In: Standardorientierung im Lese- und Literaturunterricht der Sekundarstufe I / Cornelia Rosebrock ; Heike Wirthwein. - Baltmannsweiler : Schneider-Verl. Hohengehren, 2014. - S. 126-132

  11. Sociology in Times of Crisis: Chen Da, National Salvation and the Indigenization of Knowledge

    Directory of Open Access Journals (Sweden)

    Ana Maria Candela


    Full Text Available Chen Da was one of the foremost sociologists of China from the 1920s to the 1940s. His intellectual habitus took shape from the long crisis that defined Chinese intellectual life from the mid-19th to mid-20th centuries, a period of continuous imperial assault on Chinese sovereignty. As China integrated into the capitalist world-system, neo-Confucian structures of knowledge came into question. Intellectuals took up sociology to guide China’s transition from an empire to a nation-state. Through his studies on labor, migration, and population, Chen Da contributed to the institutionalization of sociology in China. Chen sought to craft a theory of Chinese development that followed universal trajectories of progress but was also attuned to the complexity of Chinese society on the ground. Through his efforts to indigenize sociology, Chen developed a non-Marxist historical materialism, a deterritorialized and pluralistic conceptualization of China as a nation, and a theory of eugenic transformation centered on the concept of “mode of living.” The questions which Chen Da confronted are emblematic of the predicament faced by Chinese social scientists today, who again struggle with the dynamics of a deterritorialzied “Greater China,” rising social fragmentation, and refigured eugenic discourses and policies that aim to craft the Chinese people into ideal national subjects fit for post-socialist development.

  12. Hopf bifurcation analysis of Chen circuit with direct time delay feedback

    International Nuclear Information System (INIS)

    Hai-Peng, Ren; Wen-Chao, Li; Ding, Liu


    Direct time delay feedback can make non-chaotic Chen circuit chaotic. The chaotic Chen circuit with direct time delay feedback possesses rich and complex dynamical behaviours. To reach a deep and clear understanding of the dynamics of such circuits described by delay differential equations, Hopf bifurcation in the circuit is analysed using the Hopf bifurcation theory and the central manifold theorem in this paper. Bifurcation points and bifurcation directions are derived in detail, which prove to be consistent with the previous bifurcation diagram. Numerical simulations and experimental results are given to verify the theoretical analysis. Hopf bifurcation analysis can explain and predict the periodical orbit (oscillation) in Chen circuit with direct time delay feedback. Bifurcation boundaries are derived using the Hopf bifurcation analysis, which will be helpful for determining the parameters in the stabilisation of the originally chaotic circuit

  13. Synchronization and anti-synchronization coexist in Chen-Lee chaotic systems

    International Nuclear Information System (INIS)

    Chen, J.-H.; Chen, H.-K.; Lin, Y.-K.


    This study demonstrates that synchronization and anti-synchronization can coexist in Chen-Lee chaotic systems by direct linear coupling. Based on Lyapunov's direct method, a linear controller was designed to assure that two different types of synchronization can simultaneously be achieved. Further, the hybrid projective synchronization of Chen-Lee chaotic systems was studied using a nonlinear control scheme. The nonlinear controller was designed according to the Lyapunov stability theory to guarantee the hybrid projective synchronization, including synchronization, anti-synchronization, and projective synchronization. Finally, numerical examples are presented in order to illustrate the proposed synchronization approach.

  14. His Excellency Professor Jiaer Chen President, National Natural Science Foundation, People's Republic of China

    CERN Multimedia

    Maximilien Brice


    L. to r.: Dr Diether Blechschmidt, Adviser for Non Member States Relations, Dr Peter Jenni, Spokesman, ATLAS Experiment, Prof. Chen, Mr Jean-Luc Baldy, Head of the LHC Civil Engineering Group and Dr John Ellis, Adviser for Non Member States Relations.


    Directory of Open Access Journals (Sweden)

    Denis Dolinar


    Full Text Available This paper empirically examines the well-known Chen-Roll-Ross model on the Croatian stock market. Modifications of definitions of the Chen-Roll-Ross model variables showed as necessary because of doubtful availability and quality of input data needed. Namely, some macroeconomic and market variables are not available in the originally defined form or do not exist. In that sense this paper gives some alternative definitions for some model variables. Also, in order to improve statistical analysis, in this paper we have modified Fama-MacBeth technique in the way that second-pass regression was substituted with panel regression analysis. Based on the two-pass regression analysis of returns of 34 Croatian stocks on 4 macroeconomic variables during the seven-and-half-year observation period the following conclusion is made. In contrast to the results of Chen, Roll and Ross (1986 for the U.S. stock market, their model is not successful when describing a risk-return relation of Croatian stocks. Nevertheless, one observed version of the Chen-RollRoss model showed certain statistical significance. Namely, two risk factors in that version of the model were statistically significant: default premium, measured as risk premium for the corporate short-term bank loan financing, and term structure premium, measured on short-run basis.

  16. 76 FR 71048 - Sixth Annual Philip S. Chen, Jr. Distinguished Lecture on Innovation and Technology Transfer (United States)


    ... present ``Treatment of Cancer with Recombinant Immunotoxins: From Technology Transfer to the Patient.'' Dr. Pastan is an NIH Distinguished Investigator and Chief, Laboratory of Molecular Biology, National Cancer Institute Center for Cancer Research. This annual series honors Dr. Philip S. Chen, Jr. for his almost 50...

  17. Self-Representation and Cultural Expectations: Yogi Chen and Religious Practices of Life-Writing

    Directory of Open Access Journals (Sweden)

    Richard K. Payne


    Full Text Available Explores the differences in self-representation as found in the autobiographical writings of Yogi Chen, Billy Graham, and the Dalai Lama. While the latter two are widely recognized in American popular religious culture, the former is virtually invisible outside the immigrant Chinese American community. This invisibility is consistent with fact that the religious praxes of immigrant communities remain largely under-studied. However, one additional factor appears to be the mismatch between the expectations of the dominant religious culture and the immigrant culture in terms of the ways in which religious leaders represent themselves. Both Billy Graham and the Dalai Lama present themselves in very humble terms, consistent with the expectations of the Pietist background to American popular religion. Yogi Chen on the contrary tends toward a self-aggrandizing style, which although consistent with the competitive nature of premodern Tibetan religious culture is not congruent with the expectations of American popular religion.

  18. Parametric study of the fractional-order Chen-Lee system

    Energy Technology Data Exchange (ETDEWEB)

    Tam, L.M. [Department of Electromechanical Engineering, Faculty of Science and Technology, University of Macau, Av. Padre Tomas Pereira S.J., Taipa, Macau (China)], E-mail:; Tou, W.M.S. [Department of Electromechanical Engineering, Faculty of Science and Technology, University of Macau, Av. Padre Tomas Pereira S.J., Taipa, Macau (China)


    The dynamics of fractional-order systems have attracted a great deal of attention in recent years. In this paper, the effects of parameter changes on the dynamics of the fractional-order Chen-Lee system were studied numerically. The parameter ranges used were relatively broad. The order used for the system was fixed at 2.7 (q{sub 1} = q{sub 2} = q{sub 3} = 0.9). The system displays rich dynamic behaviors, such as a fixed point, periodic motion (including period-3 motion), chaotic motion, and transient chaos. The chaotic motion identified was validated by the confirmation of a positive Lyapunov exponent. Period-doubling routes to chaos in the fractional-order Chen-Lee system were also found.

  19. Parametric study of the fractional-order Chen-Lee system

    International Nuclear Information System (INIS)

    Tam, L.M.; Tou, W.M.S.


    The dynamics of fractional-order systems have attracted a great deal of attention in recent years. In this paper, the effects of parameter changes on the dynamics of the fractional-order Chen-Lee system were studied numerically. The parameter ranges used were relatively broad. The order used for the system was fixed at 2.7 (q 1 = q 2 = q 3 = 0.9). The system displays rich dynamic behaviors, such as a fixed point, periodic motion (including period-3 motion), chaotic motion, and transient chaos. The chaotic motion identified was validated by the confirmation of a positive Lyapunov exponent. Period-doubling routes to chaos in the fractional-order Chen-Lee system were also found

  20. A numeric-analytic method for approximating the chaotic Chen system

    International Nuclear Information System (INIS)

    Mossa Al-sawalha, M.; Noorani, M.S.M.


    The epitome of this paper centers on the application of the differential transformation method (DTM) the renowned Chen system which is described as a three-dimensional system of ODEs with quadratic nonlinearities. Numerical comparisons are made between the DTM and the classical fourth-order Runge-Kutta method (RK4). Our work showcases the precision of the DTM as the Chen system transforms from a non-chaotic system to a chaotic one. Since the Lyapunov exponent for this system is much higher compared to other chaotic systems, we shall highlight the difficulties of the simulations with respect to its accuracy. We wrap up our investigations to reveal that this direct symbolic-numeric scheme is effective and accurate.

  1. Software-Lösungen in B2B-Verkaufsgesprächen wirkungsvoll einsetzen


    Thoma, Axel Michael


    Dieser Beitrag befasst sich mit dem Einsatz von Software-Lösungen in B2B-Verkaufsgesprächen (auf Englisch: Digital Sales Enablement). Anhand aktueller Beispiele aus der Geschäftswelt wird erklärt, wie solche Lösungen helfen (1) die Produktivität zu steigern, (2) Kunden zu aktivieren und (3) Neugeschäft zu entwickeln. Ebenfalls werden die Konzeption und Umsetzung solcher Lösungen behandelt.

  2. Self-Representation and Cultural Expectations: Yogi Chen and Religious Practices of Life-Writing


    Richard K. Payne


    Explores the differences in self-representation as found in the autobiographical writings of Yogi Chen, Billy Graham, and the Dalai Lama. While the latter two are widely recognized in American popular religious culture, the former is virtually invisible outside the immigrant Chinese American community. This invisibility is consistent with fact that the religious praxes of immigrant communities remain largely under-studied. However, one additional factor appears to be the mismatch between ...

  3. Tensioned Fabric Structures with Surface in the Form of Chen-Gackstatter

    Directory of Open Access Journals (Sweden)

    Yee Hooi Min


    Full Text Available Form-finding has to be carried out for tensioned fabric structure in order to determine the initial equilibrium shape under prescribed support condition and prestress pattern. Tensioned fabric structures are normally designed to be in the form of equal tensioned surface. Tensioned fabric structure is highly suited to be used for realizing surfaces of complex or new forms. However, research study on a new form as a tensioned fabric structure has not attracted much attention. Another source of inspiration minimal surface which could be adopted as form for tensioned fabric structure is very crucial. The aim of this study is to propose initial equilibrium shape of tensioned fabric structures in the form of Chen-Gackstatter. Computational form-finding using nonlinear analysis method is used to determine the Chen-Gackstatter form of uniformly stressed surfaces. A tensioned fabric structure must curve equally in opposite directions to give the resulting surface a three dimensional stability. In an anticlastic doubly curved surface, the sum of all positive and all negative curvatures is zero. This study provides an alternative choice for structural designer to consider the Chen-Gackstatter applied in tensioned fabric structures. The results on factors affecting initial equilibrium shape can serve as a reference for proper selection of surface parameter for achieving a structurally viable surface.

  4. Ronald Malt or Chen Zhongwei: Who performed the first surgical replantation? (United States)

    Fan, Ka-Wai


    This article discusses the contributions of the two pioneers of the surgical procedure of replantation-Ronald Malt in the US and Chen Zhongwei in China. Ronald Malt performed the reattachment surgery on a boy who had an accident in 1962, but he published his case report two years later in 1964. Chen Zhongwei performed a similar surgery on a worker who cut off his forearm in 1963, but he published his case report the same year. There is some debate about which one of these reputed surgeons should be given credit for being the first one to perform this breakthrough surgery, because although Malt was the first to perform the procedure, Zhongwei was the first to report it. To shed light on this controversy, criteria for scientific priority suggested by Ronald Vale and Anthony Hyman were applied. Although the criteria mainly favored Zhongwei as the pioneer of this procedure, he did not entirely fulfill one of the criteria. Therefore, the article could not present a definitive answer to the question, and it concludes by pointing out the highly commendable achievements and contributions of both Ronald Malt and Chen Zhongwei.

  5. Time budgets of Snow Geese Chen caerulescens and Ross's Geese Chen rossii in mixed flocks: Implications of body size, ambient temperature and family associations (United States)

    Jonsson, J.E.; Afton, A.D.


    Body size affects foraging and forage intake rates directly via energetic processes and indirectly through interactions with social status and social behaviour. Ambient temperature has a relatively greater effect on the energetics of smaller species, which also generally are more vulnerable to predator attacks than are larger species. We examined variability in an index of intake rates and an index of alertness in Lesser Snow Geese Chen caerulescens caerulescens and Ross's Geese Chen rossii wintering in southwest Louisiana. Specifically we examined variation in these response variables that could be attributed to species, age, family size and ambient temperature. We hypothesized that the smaller Ross's Geese would spend relatively more time feeding, exhibit relatively higher peck rates, spend more time alert or raise their heads up from feeding more frequently, and would respond to declining temperatures by increasing their proportion of time spent feeding. As predicted, we found that Ross's Geese spent more time feeding than did Snow Geese and had slightly higher peck rates than Snow Geese in one of two winters. Ross's Geese spent more time alert than did Snow Geese in one winter, but alert rates differed by family size, independent of species, in contrast to our prediction. In one winter, time spent foraging and walking was inversely related to average daily temperature, but both varied independently of species. Effects of age and family size on time budgets were generally independent of species and in accordance with previous studies. We conclude that body size is a key variable influencing time spent feeding in Ross's Geese, which may require a high time spent feeding at the expense of other activities. ?? 2008 The Authors.

  6. Generation of hyperchaos from the Chen-Lee system via sinusoidal perturbation

    Energy Technology Data Exchange (ETDEWEB)

    Tam, L.M. [Department of Electromechanical Engineering, Faculty of Science and Technology, University of Macau, Av. Padre Thomas Pereira S.J., Taipa, Macau (China)], E-mail:; Chen, J.H. [Department of Mechanical Engineering, Chung Hua University, Hsinchu, Taiwan (China); Chen, H.K. [Department of Mechanical Engineering, Hsiuping Institute of Technology, Taichung, Taiwan (China); Wai Meng Si Tou [Department of Electromechanical Engineering, Faculty of Science and Technology, University of Macau, Av. Padre Thomas Pereira S.J., Taipa, Macau (China)


    A system with more than one positive Lyapunov exponent can be classified as a hyperchaotic system. In this study, a sinusoidal perturbation was designed for generating hyperchaos from the Chen-Lee chaotic system. The hyperchaos was identified by the existence of two positive Lyapunov exponents and bifurcation diagrams. The system is hyperchaotic in several different regions of the parameters c, {epsilon}, and {omega}. It was found that this method not only can enhance or suppress chaotic behavior, but also induces chaos in non-chaotic parameter ranges. In addition, two interesting dynamical behaviors, Hopf bifurcation and intermittency, were also found in this study.

  7. Security problems for a pseudorandom sequence generator based on the Chen chaotic system (United States)

    Özkaynak, Fatih; Yavuz, Sırma


    Recently, a novel pseudorandom number generator scheme based on the Chen chaotic system was proposed. In this study, we analyze the security weaknesses of the proposed generator. By applying a brute force attack on a reduced key space, we show that 66% of the generated pseudorandom number sequences can be revealed. Executable C# code is given for the proposed attack. The computational complexity of this attack is O(n), where n is the sequence length. Both mathematical proofs and experimental results are presented to support the proposed attack.

  8. Generation of hyperchaos from the Chen-Lee system via sinusoidal perturbation

    International Nuclear Information System (INIS)

    Tam, L.M.; Chen, J.H.; Chen, H.K.; Wai Meng Si Tou


    A system with more than one positive Lyapunov exponent can be classified as a hyperchaotic system. In this study, a sinusoidal perturbation was designed for generating hyperchaos from the Chen-Lee chaotic system. The hyperchaos was identified by the existence of two positive Lyapunov exponents and bifurcation diagrams. The system is hyperchaotic in several different regions of the parameters c, ε, and ω. It was found that this method not only can enhance or suppress chaotic behavior, but also induces chaos in non-chaotic parameter ranges. In addition, two interesting dynamical behaviors, Hopf bifurcation and intermittency, were also found in this study

  9. Dark energy from cosmological fluids obeying a Shan-Chen non-ideal equation of state


    Bini, Donato; Geralico, Andrea; Gregoris, Daniele; Succi, Sauro


    We consider a Friedmann-Robertson-Walker universe with a fluid source obeying a nonideal equation of state with ‘‘asymptotic freedom,’’ namely ideal gas behavior (pressure changes directly proportional to density changes) both at low and high density regimes, following a fluid dynamical model due to Shan and Chen. It is shown that, starting from an ordinary energy density component, such fluids naturally evolve towards a universe with a substantial ‘‘dark energy’’ component at the present tim...

  10. Le jeu de la création : Le mangeur (2005 de Ying Chen

    Directory of Open Access Journals (Sweden)

    Nicole Dunham


    Full Text Available Le théoricien James Hans définit le jeu comme une déconstruction structurante, un processus de perpétuelle remise en question. Dans Le Mangeur (2005 de Ying Chen, la narratrice revit un épisode d’une de ses vies passées où elle meurt mangée, avalée, par son père, descendant dans le « tunnel » du ventre de ce dernier. Cependant, suite à cet événement, elle se retrouve dans un autre espace-temps où elle rencontre son mari, A.. Une équivalence s’établit dans le roman entre les éléments suivants : le ventre du père, les tableaux peints par ce dernier et l’espace-temps de A., et la fenêtre. Ces éléments deviennent des aires de jeu, remettant en question les concepts de l’intérieur et de l’extérieur et du créateur et de l’œuvre. En nous servant du texte « Le Tunnel » écrit par Ying Chen, nous démontrerons que cette notion du jeu s’applique également à l’ensemble de son œuvre.

  11. Theoretical and experimental study of Chen chaotic system with notch filter feedback control

    International Nuclear Information System (INIS)

    Ming, Zhang Xiao; Jian-Hua, Peng; Ju-Fang, Chen


    Since the past two decades, the time delay feedback control method has attracted more and more attention in chaos control studies because of its simplicity and efficiency compared with other chaos control schemes. Recently, it has been proposed to suppress low-dimensional chaos with the notch filter feedback control method, which can be implemented in a laser system. In this work, we have analytically determined the controllable conditions for notch filter feedback controlling of Chen chaotic system in terms of the Hopf bifurcation theory. The conditions for notch filter feedback controlled Chen chaoitc system having a stable limit cycle solution are given. Meanwhile, we also analysed the Hopf bifurcation direction, which is very important for parameter settings in notch filter feedback control applications. Finally, we apply the notch filter feedback control methods to the electronic circuit experiments and numerical simulations based on the theoretical analysis. The controlling results of notch filter feedback control method well prove the feasibility and reliability of the theoretical analysis. (general)

  12. Chen Jingrun, China's famous mathematician: devastated by brain injuries on the doorstep to solving a fundamental mathematical puzzle. (United States)

    Lei, Ting; Belykh, Evgenii; Dru, Alexander B; Yagmurlu, Kaan; Elhadi, Ali M; Nakaji, Peter; Preul, Mark C


    Chen Jingrun (1933-1996), perhaps the most prodigious mathematician of his time, focused on the field of analytical number theory. His work on Waring's problem, Legendre's conjecture, and Goldbach's conjecture led to progress in analytical number theory in the form of "Chen's Theorem," which he published in 1966 and 1973. His early life was ravaged by the Second Sino-Japanese War and the Chinese Cultural Revolution. On the verge of solving Goldbach's conjecture in 1984, Chen was struck by a bicyclist while also bicycling and suffered severe brain trauma. During his hospitalization, he was also found to have Parkinson's disease. Chen suffered another serious brain concussion after a fall only a few months after recovering from the bicycle crash. With significant deficits, he remained hospitalized for several years without making progress while receiving modern Western medical therapies. In 1988 traditional Chinese medicine experts were called in to assist with his treatment. After a year of acupuncture and oxygen therapy, Chen could control his basic bowel and bladder functions, he could walk slowly, and his swallowing and speech improved. When Chen was unable to produce complex work or finish his final work on Goldbach's conjecture, his mathematical pursuits were taken up vigorously by his dedicated students. He was able to publish Youth Math, a mathematics book that became an inspiration in Chinese education. Although he died in 1996 at the age of 63 after surviving brutal political repression, being deprived of neurological function at the very peak of his genius, and having to be supported by his wife, Chen ironically became a symbol of dedication, perseverance, and motivation to his students and associates, to Chinese youth, to a nation, and to mathematicians and scientists worldwide.

  13. Pitchfork bifurcation and circuit implementation of a novel Chen hyper-chaotic system

    International Nuclear Information System (INIS)

    Dong En-Zeng; Chen Zeng-Qiang; Chen Zai-Ping; Ni Jian-Yun


    In this paper, a novel four dimensional hyper-chaotic system is coined based on the Chen system, which contains two quadratic terms and five system parameters. The proposed system can generate a hyper-chaotic attractor in wide parameters regions. By using the center manifold theorem and the local bifurcation theory, a pitchfork bifurcation is demonstrated to arise at the zero equilibrium point. Numerical analysis demonstrates that the hyper-chaotic system can generate complex dynamical behaviors, e.g., a direct transition from quasi-periodic behavior to hyper-chaotic behavior. Finally, an electronic circuit is designed to implement the hyper-chaotic system, the experimental results are consist with the numerical simulations, which verifies the existence of the hyper-chaotic attractor. Due to the complex dynamic behaviors, this new hyper-chaotic system is useful in the secure communication. (general)

  14. Le jeu de la création : Le mangeur (2005) de Ying Chen


    Nicole Dunham


    Le théoricien James Hans définit le jeu comme une déconstruction structurante, un processus de perpétuelle remise en question. Dans Le Mangeur (2005) de Ying Chen, la narratrice revit un épisode d’une de ses vies passées où elle meurt mangée, avalée, par son père, descendant dans le « tunnel » du ventre de ce dernier. Cependant, suite à cet événement, elle se retrouve dans un autre espace-temps où elle rencontre son mari, A.. Une équivalence s’établit dans le roman entre les éléments suivants...

  15. Chen-Nester-Tung quasi-local energy and Wang-Yau quasi-local mass (United States)

    Liu, Jian-Liang; Yu, Chengjie


    In this paper, we show that the Chen-Nester-Tung (CNT) quasi-local energy with 4D isometric matching references is closely related to the Wang-Yau (WY) quasi-local energy. As a particular example, we compute the second variation of the CNT quasi-local energy for axially symmetric Kerr-like spacetimes with axially symmetric embeddings at the obvious critical point (0 , 0) and find that it is a saddle critical point in most of the cases. Also, as a byproduct, we generalize a previous result about the coincidence of the CNT quasi-local energy and Brown-York mass for axially symmetric Kerr-like spacetimes by Tam and the first author Liu and Tam (2016) to general spacetimes.

  16. From Wang-Chen System with Only One Stable Equilibrium to a New Chaotic System Without Equilibrium (United States)

    Pham, Viet-Thanh; Wang, Xiong; Jafari, Sajad; Volos, Christos; Kapitaniak, Tomasz


    Wang-Chen system with only one stable equilibrium as well as the coexistence of hidden attractors has attracted increasing interest due to its striking features. In this work, the effect of state feedback on Wang-Chen system is investigated by introducing a further state variable. It is worth noting that a new chaotic system without equilibrium is obtained. We believe that the system is an interesting example to illustrate the conversion of hidden attractors with one stable equilibrium to hidden attractors without equilibrium.

  17. Modern process study on Chen Co and Ranwu Lake of Tibetan Plateau (United States)

    Ju, J.


    Lakes are important junctions of geospheres. There are many lakes distributed on the Tibetan Plateau (TP). Lake sediment is one of the important media for retrieving the past environmental changes. Because of the uniqueness of environment of the TP, sediment, water and ecological system in lakes has local characteristic inevitably. Modern process research on different lakes will benefit interpreting the proxies more accurately. The development of observation station makes the observation and sampling more convenient. Modern process of lakes can be fulfilled in two ways, spatial or seasonal variation study, with a same aim finding out the dominant factors controlling the variations. Chen Co is a closed lake locating at inland area of southern Tibet. Ranwu Lake is an open lake locating at outflow area of SE Tibet. In this study, I studied the spatial and (or) seasonal variation of lake water and sediment in the two distinct types of lakes to make clear the mechanism of modern process. Particular attention was given to the pattern and degree of influence of rivers supplied by glaciers on lakes. Preliminary conclusions are outlined as follow: (1) In the lakes with glacier melt supplying rivers, the patterns of supply of the rivers to the lake are different. In close lake Chen Co, the influence of glacier melt is mainly reflected in the south lake area. In the open lake Ranwu Lake, the influence is comprehensive and direct. This difference influencing patterns how the lake sediments reflected the glacier melt under the past environmental changes. (2) The supply of Kaluxiong Qu River, supplied mainly by glacier melt, to Chen co has North-South difference: more directly to south lake area, reflecting by lower value of conductivity and pH, finer grain size and west to east transporting trend, greater deposition rate, more allogenic fine sediments, not obvious biological and endogenic deposition there. This enlightens the site selection for lake cores and interpretation of

  18. The impact of systematic landscape conservation planning on ecosystem: Chen Youlan river watershed (United States)

    Chen, Chi-ju


    Heraclitus said that "no man ever steps in the same river twice." Everything continues to change. Land use change will keep redefine itself and subject the Earth and humankind to collateral changes. Humankind benefits from ecosystem in many ways. The ecosystem provides people with nutrients, enriches soil with sediment, and sustains all living organisms with water; these benefits are known as ecosystem services. In Taiwan, land use change has impacted ecosystem and biodiversity on various levels. Thus, we took six land use scenarios from 1999 to 2005 in Chen Youlan river watershed as our case study, intending to observe the course of ecosystem and biodiversity changes and the cause of it. Systematic Landscape conservation planning (SLCP) framework can be adopted when designing land use policy to safeguard human interests and ecosystem. This study use SLCP to develop ecosystem services and biodiversity protection strategies. Several strategies were designed by using 1999 to 2005 data as provision to protect the intactness of future ecosystem services and biodiversity. This research explores the potential and possible impacts of different land use protection strategies in the future. It is possible to identify the conservation priority of a certain region by using the Zonation meta-algorithm. This study selects the zonation critical protection area (Joint set of Yushan National Park) as strategy A, B and C. Strategy D takes Yushan National Park as a protected area; unstable hot spots in 1999/03 (Joint set of Yushan National Park) are selected as strategy E. Next, we used Kappa statistical method to find the minimal ecosystem services change and biodiversity hotspots change of the five aforementioned strategies and compared with those from 1999/03. By the Kappa statistical method, we further prioritized the important conservation areas by strategy A, B, C, E in the future. The results can not only serve as management reference for government agencies, but also develop

  19. Wormholes supported by phantom energy from Shan-Chen cosmological fluids

    Energy Technology Data Exchange (ETDEWEB)

    Wang, Deng [Nankai University, Theoretical Physics Division, Chern Institute of Mathematics, Tianjin (China); Meng, Xin-He [Nankai University, Department of Physics, Tianjin (China); Institute of Theoretical Physics, CAS, State key Lab of Theoretical Physics, Beijing (China)


    In the present paper, the exact solutions of spherically symmetrical Einstein field equations describing wormholes supported by phantom energy that violates the null energy condition from Shan-Chen background fluid are obtained. We have considered the important case of the model parameter ψ ∼ 1, which corresponds to the ''saturation effect'', and this regime corresponds to an effective form of ''asymptotic freedom'' for the fluids, but occurring at cosmological rather than subnuclear scales. Then we investigate the allowed range for the values of the model parameters g and ω when the spacetime metrics describe wormholes and discuss the possible singularities of the solutions, finding that the obtained spacetimes are geodesically complete. Furthermore, we construct two traversable wormholes through matching our obtained interior solutions to the exterior Schwarzschild solutions and analyze the traversabilities of the wormholes. Finally, we consider the case of anisotropic pressure and discover that the transverse pressure also crosses the phantom divide -1 with the growth of the wormhole dimension, and it tends to be the same as the radial pressure with the growth of the wormhole radius. (orig.)

  20. Psychometric properties of the Revised Chen Internet Addiction Scale (CIAS-R) in Chinese adolescents. (United States)

    Mak, Kwok-Kei; Lai, Ching-Man; Ko, Chih-Hung; Chou, Chien; Kim, Dong-Il; Watanabe, Hiroko; Ho, Roger C M


    The Revised Chen Internet Addiction Scale (CIAS-R) was developed to assess Internet addiction in Chinese populations, but its psychometric properties in adolescents have not been examined. This study aimed to evaluate the factor structure and psychometric properties of CIAS-R in Hong Kong Chinese adolescents. 860 Grade 7 to 13 students (38 % boys) completed the CIAS-R, the Young's Internet Addiction Test (IAT), and the Health of the Nation Outcome Scales for Children and Adolescents (HoNOSCA) in a survey. The prevalence of Internet addiction as assessed by CIAS-R was 18 %. High internal consistency and inter-item correlations were reported for the CIAS-R. Results from the confirmatory factor analysis suggested a four-factor structure of Compulsive Use and Withdrawal, Tolerance, Interpersonal and Health-related Problems, and Time Management Problems. Moreover, results of hierarchical multiple regression supported the incremental validity of the CIAS-R to predict mental health outcomes beyond the effects of demographic differences and self-reported time spent online. The CIAS is a reliable and valid measure of internet addiction problems in Hong Kong adolescents. Future study is warranted to validate the cutoffs of the CIAS-R for identification of adolescents with Internet use problems who may have mental health needs.

  1. Writing Beyond the Wall: Translation, Cross-cultural Exchange, and Chen Ran's 'A Private Life'

    Directory of Open Access Journals (Sweden)

    Kay Schaffer


    Full Text Available The past decade has witnessed an unprecedented rise in the global flow of knowledge, nowhere more apparent in the exchange of ideas between China and modern western democracies. Our interest concerns one aspect of this global flow— the translation of Chinese women’s autobiographical writing into English. Taking Chen Ran’s A Private Life (English edition, 2004 as a point of departure, the paper explores issues of translingual practice and cross-cultural exchange. It considers what escapes or is lost in translation as well as the additive potential of the host text. It is sometimes the case that the translation can deliberately make certain ambiguities visible—whether from pragmatic, market-driven motivations or from more complex political, historical and cultural considerations. These negotiations of meaning that occur in the translation process can reverberate on the critical reception of texts in both the ‘guest’ and ‘host’ languages (Liu 1995, with open-ended, incomplete and indeterminate effects. The paper examines the effects of the omission of a brief parenthetical section of three paragraphs from one chapter of the Chinese edition of A Private Life. Yet, even that small emendation changes the original text as a cultural object and alters potential modes of its reception. In this case, the translation results in a loss of ambiguity, irony, philosophic and rhetorical sophistication while also offering additive potentials that enhance the generation of new meanings in the translingual exchange, here with reference Tiananmen and contemporary feminism in China. The translation process provides new channels for readers, writers and theorists to dialogue and communicate across gaps of difference, despite inhibiting factors like the imposition of local restraints, the universalising pressures of western modernity, and asymmetrical relations of power between guest and host language contexts.

  2. Politics in the Western Maya Region (I: Ajawil/Ajawlel and Ch'e'n

    Directory of Open Access Journals (Sweden)

    Péter Bíró


    Full Text Available In a series of articles I reflect on the use of various expressions which are connected to what we call the political in the inscriptions of the Classic Maya Western Region. These words express concepts which help to understand the intricate details of the interactions between the political entities and their internal organisations in the Classic Maya Lowlands. Words such as 7ajawil, 7ajawlel, the kennings built on the base of ch'e7n (cave, pond, the emblem glyphs and titles will be examined in light of what they tell us about the functioning of the political organisation of the Classic Period in a constrained region.En una serie de artículos como éste investigo el uso de varias palabras en las inscripciones mayas de la época Clásica de la Región Occidental vinculadas con lo que nosotros llamamos "política". Estas palabras expresan conceptos que ayudan a entender los matices de las relaciones entre las entidades políticas de las Tierras Bajas Mayas y su organización interna. Términos como ajaw'ü I ajawlel, los difrasismos con base ch'e'n (cueva, pozo, los glifos emblemas y los títulos serán examinados tomando en cuenta la información que nos proporcionan sobre el funcionamiento de la organización política de la época Clásica en una región restringida.

  3. [Academic thoughts on Practice of acupuncture and moxibustion written by CHEN Jingwen, the acupuncture master in the Republic of China]. (United States)

    Huang, Weiping; Li, Naiqi


    Through the collection of Practice of acupuncture and moxibustion written by CHEN Jingwen, the acupuncture master in the Republic of China, the academic characteristics on acupuncture and moxibusiton were analyzed. The literature comparison method was adopted to compare the works of LUO Zhaoju, ZENG Tianzhi and LI Wenxian, etc. at the same period. It was discovered that CHEN Jingwen was the medical master who systematicly brought up the theory of acupoint properties earlier in the modern times. Classifying drugs based on acupoints was his academic feature. Additionally, the compatibility therapy of Chinese medicine was introduced to explain the essential ideas on the acupoints combination. The treatment was determined on the basis of zangxiang theory and the reinforcing and reducing therapy of acupuncture was emphasized in the determination of treatment and prescription. CHEN Jingwen's theory of acupoint property had been stressed and spread among the medical scholars in the Republic of China and he had made the beneficial exploration for the development of modern acupuncture and moxibustion therapy.

  4. Traditional uses, botany, phytochemistry, pharmacology and toxicology of Panax notoginseng (Burk.) F.H. Chen: A review. (United States)

    Wang, Ting; Guo, Rixin; Zhou, Guohong; Zhou, Xidan; Kou, Zhenzhen; Sui, Feng; Li, Chun; Tang, Liying; Wang, Zhuju


    Panax notoginseng (Burk.) F.H. Chen is a widely used traditional Chinese medicine known as Sanqi or Tianqi in China. This plant, which is distributed primarily in the southwest of China, has wide-ranging pharmacological effects and can be used to treat cardiovascular diseases, pain, inflammation and trauma as well as internal and external bleeding due to injury. This paper provides up-to-date information on investigations of this plant, including its botany, ethnopharmacology, phytochemistry, pharmacology and toxicology. The possible uses and perspectives for future investigation of this plant are also discussed. The relevant information on Panax notoginseng (Burk.) F.H. Chen was collected from numerous resources, including classic books about Chinese herbal medicine, and scientific databases, including Pubmed, SciFinder, ACS, Ebsco, Elsevier, Taylor, Wiley and CNKI. More than 200 chemical compounds have been isolated from Panax notoginseng (Burk.) F.H. Chen, including saponins, flavonoids and cyclopeptides. The plant has pharmacological effects on the cardiovascular system, immune system as well as anti-inflammatory, anti-atherosclerotic, haemostatic and anti-tumour activities, etc. Panax notoginseng is a valuable traditional Chinese medical herb with multiple pharmacological effects. This review summarizes the botany, ethnopharmacology, phytochemistry, pharmacology and toxicology of P. notoginseng, and presents the constituents and their corresponding chemical structures found in P. notoginseng comprehensively for the first time. Future research into its phytochemistry of bio-active components should be performed by using bioactivity-guided isolation strategies. Further work on elucidation of the structure-function relationship among saponins, understanding of multi-target network pharmacology of P. notoginseng, as well as developing its new clinical usage and comprehensive utilize will enhance the therapeutic potentials of P. notoginseng. Copyright © 2016

  5. Le fictif et le réel dans L’Empereur et l’assassin de Chen Kaige


    Giafferri, Xiaomin


    Comme tout texte historique littéraire refait l’Histoire en la manipulant, le récit filmique est doublement mensongère du fait de sa double représentation : le décor et les acteurs représentent une situation qui est la fiction, et le film lui-même représente sous forme d’images juxtaposées cette première représentation. Sans vouloir faire la part du réel et de l’imaginaire, le présent travail tente de montrer comment, dans le film L’empereur et l’assassin de Chen Kaige, l’illusion de l’authen...

  6. Activation energy and R. Chen frequency factor in the Randall and Wilkins original equation for second order kinetics. Emission curve simulated in Microsoft Excel algebra

    International Nuclear Information System (INIS)

    Moreno M, A.; Moreno B, A.


    In this work the incorporation of activation energy and frequency factor parameters proposed by R. Chen are presented in the original formulation of Randall and wilkins second order kinetics. The results concordance are compared between the calculus following the R. Chen methodology with those ones obtained by direct incorporation of the previously indicated in the Randall-Wilkins-Levy expression for a simulated thermoluminescent emission curve of two peaks with maximum peak temperature (tm): t m1=120 and t m2=190. (Author)

  7. New contributions to the knowledge of Chinese flea beetle fauna (III): Revision of Meishania Chen & Wang with description of five new species (Coleoptera: Chrysomelidae: Galerucinae) (United States)

    The flea beetle genus Meishania Chen & Wang is revised and five new species - M. cangshanensis sp. nov., M. flavipennis sp. nov., M. fulvotigera sp. nov., and M. sichuanica sp. nov. from China and M. bhutanensis sp. nov. from Bhutan - are described. All species of Meishania are illustrated and a key...

  8. Debris flow run off simulation and verification ‒ case study of Chen-You-Lan Watershed, Taiwan

    Directory of Open Access Journals (Sweden)

    M.-L. Lin


    Full Text Available In 1996 typhoon Herb struck the central Taiwan area, causing severe debris flow in many subwatersheds of the Chen-You-Lan river watershed. More severe cases of debris flow occurred following Chi-Chi earthquake, 1999. In order to identify the potentially affected area and its severity, the ability to simulate the flow route of debris is desirable. In this research numerical simulation of debris flow deposition process had been carried out using FLO-2D adopting Chui-Sue river watershed as the study area. Sensitivity study of parameters used in the numerical model was conducted and adjustments were made empirically. The micro-geomorphic database of Chui-Sue river watershed was generated and analyzed to understand the terrain variations caused by the debris flow. Based on the micro-geomorphic analysis, the debris deposition in the Chui-Sue river watershed in the downstream area, and the position and volume of debris deposition were determined. The simulated results appeared to agree fairly well with the results of micro-geomorphic study of the area when not affected by other inflow rivers, and the trends of debris distribution in the study area appeared to be fairly consistent.

  9. Satellite-derived land covers for runoff estimation using SCS-CN method in Chen-You-Lan Watershed, Taiwan (United States)

    Zhang, Wen-Yan; Lin, Chao-Yuan


    The Soil Conservation Service Curve Number (SCS-CN) method, which was originally developed by the USDA Natural Resources Conservation Service, is widely used to estimate direct runoff volume from rainfall. The runoff Curve Number (CN) parameter is based on the hydrologic soil group and land use factors. In Taiwan, the national land use maps were interpreted from aerial photos in 1995 and 2008. Rapid updating of post-disaster land use map is limited due to the high cost of production, so the classification of satellite images is the alternative method to obtain the land use map. In this study, Normalized Difference Vegetation Index (NDVI) in Chen-You-Lan Watershed was derived from dry and wet season of Landsat imageries during 2003 - 2008. Land covers were interpreted from mean value and standard deviation of NDVI and were categorized into 4 groups i.e. forest, grassland, agriculture and bare land. Then, the runoff volume of typhoon events during 2005 - 2009 were estimated using SCS-CN method and verified with the measured runoff data. The result showed that the model efficiency coefficient is 90.77%. Therefore, estimating runoff by using the land cover map classified from satellite images is practicable.

  10. Plasma biochemistry values in emperor geese (Chen canagica) in Alaska: comparisons among age, sex, incubation, and molt. (United States)

    Franson, J. Christian; Hoffman, D.J.; Schmutz, J.A.


    Reduced populations of emperor geese (Chen canagica), a Bering Sea endemic, provided the need to assess plasma biochemistry values as indicators of population health. A precursory step to such an investigation was to evaluate patterns of variability in plasma biochemistry values among age, sex, and reproductive period. Plasma from 63 emperor geese was collected on their breeding grounds on the Yukon-Kuskokwim Delta in western Alaska, USA. The geese sampled included 18 incubating adult females captured, in mid June, on their nests by using bow nets, and 30 adults and 15 goslings captured in corral traps in late July and early August, when the adults were molting their wing feathers and the goslings were 5-6 weeks old. Plasma was evaluated for 15 biochemical parameters, by comparing results among age, sex, and sampling period (incubation versus wing-feather molt). Ten of the 15 biochemical parameters assayed differed among adults during incubation, the adults during molt, and the goslings at molt, whereas sex differences were noted in few parameters.

  11. A variational numerical method based on finite elements for the nonlinear solution characteristics of the periodically forced Chen system (United States)

    Khan, Sabeel M.; Sunny, D. A.; Aqeel, M.


    Nonlinear dynamical systems and their solutions are very sensitive to initial conditions and therefore need to be approximated carefully. In this article, we present and analyze nonlinear solution characteristics of the periodically forced Chen system with the application of a variational method based on the concept of finite time-elements. Our approach is based on the discretization of physical time space into finite elements where each time-element is mapped to a natural time space. The solution of the system is then determined in natural time space using a set of suitable basis functions. The numerical algorithm is presented and implemented to compute and analyze nonlinear behavior at different time-step sizes. The obtained results show an excellent agreement with the classical RK-4 and RK-5 methods. The accuracy and convergence of the method is shown by comparing numerically computed results with the exact solution for a test problem. The presented method has shown a great potential in dealing with the solutions of nonlinear dynamical systems and thus can be utilized in delineating different features and characteristics of their solutions.

  12. Screening for Internet Addiction: An Empirical Study on Cut-off Points for the Chen Internet Addiction Scale

    Directory of Open Access Journals (Sweden)

    Chih-Hung Ko


    Full Text Available The aim of this study was to establish the optimal cut-off points of the Chen Internet Addiction Scale (CIAS, to screen for and diagnose Internet addiction among adolescents in the community by using the well- established diagnostic criteria of Internet addiction. This survey of 454 adolescents used screening (57/58 and diagnostic (63/64 cut-off points of the CIAS, a self-reported instrument, based on the results of systematic diagnostic interviews by psychiatrists. The area under the curve of the receiver operating characteristic curve revealed that CIAS has good diagnostic accuracy (89.6%. The screening cut-off point had high sensitivity (85.6% and the diagnostic cut-off point had the highest diagnostic accuracy, classifying 87.6% of participants correctly. Accordingly, the screening point of the CIAS could provide a screening function in two-stage diagnosis, and the diagnostic point could serve as a diagnostic criterion in one-stage massive epidemiologic research.

  13. Ground-state magnetization of the Ising spin glass: A recursive numerical method and Chen-Ma scaling (United States)

    Sepehrinia, Reza; Chalangari, Fartash


    The ground-state properties of quasi-one-dimensional (Q1D) Ising spin glass are investigated using an exact numerical approach and analytical arguments. A set of coupled recursive equations for the ground-state energy are introduced and solved numerically. For various types of coupling distribution, we obtain accurate results for magnetization, particularly in the presence of a weak external magnetic field. We show that in the weak magnetic field limit, similar to the 1D model, magnetization exhibits a singular power-law behavior with divergent susceptibility. Remarkably, the spectrum of magnetic exponents is markedly different from that of the 1D system even in the case of two coupled chains. The magnetic exponent makes a crossover from being dependent on a distribution function to a constant value independent of distribution. We provide an analytic theory for these observations by extending the Chen-Ma argument to the Q1D case. We derive an analytical formula for the exponent which is in perfect agreement with the numerical results.

  14. Serum Metabolomic Characterization of Liver Fibrosis in Rats and Anti-Fibrotic Effects of Yin-Chen-Hao-Tang

    Directory of Open Access Journals (Sweden)

    Hongyang Zhang


    Full Text Available Yin-Chen-Hao-Tang (YCHT is a famous Chinese medicine formula which has long been used in clinical practice for treating various liver diseases, such as liver fibrosis. However, to date, the mechanism for its anti-fibrotic effects remains unclear. In this paper, an ultra-performance liquid chromatography-time-of-flight mass spectrometry (UPLC-TOF-MS-based metabolomic study was performed to characterize dimethylnitrosamine (DMN-induced liver fibrosis in rats and evaluate the therapeutic effects of YCHT. Partial least squares-discriminant analysis (PLS-DA showed that the model group was well separated from the control group, whereas the YCHT-treated group exhibited a tendency to restore to the controls. Seven significantly changed fibrosis-related metabolites, including unsaturated fatty acids and lysophosphatidylcholines (Lyso-PCs, were identified. Moreover, statistical analysis demonstrated that YCHT treatment could reverse the levels of most metabolites close to the normal levels. These results, along with histological and biochemical examinations, indicate that YCHT has anti-fibrotic effects, which may be due to the suppression of oxidative stress and resulting lipid peroxidation involved in hepatic fibrogenesis. This study offers new opportunities to improve our understanding of liver fibrosis and the anti-fibrotic mechanisms of YCHT.

  15. Body mass of prefledging Emperor Geese Chen canagica: Large-scale effects of interspecific densities and food availability (United States)

    Lake, B.C.; Schmutz, J.A.; Lindberg, M.S.; Ely, Craig R.; Eldridge, W.D.; Broerman, F.J.


    We studied body mass of prefledging Emperor Geese Chen canagica at three locations across the Yukon-Kuskokwim Delta, Alaska, during 1990-2004 to investigate whether large-scale variation in body mass was related to interspecific competition for food. From 1990 to 2004, densities of Cackling Geese Branta hutchinsii minima more than doubled and were c. 2-5?? greater than densities of Emperor Geese, which were relatively constant over time. Body mass of prefledging Emperor Geese was strongly related (negatively) to interspecific densities of geese (combined density of Cackling and Emperor Geese) and positively related to measures of food availability (grazing lawn extent and net above-ground primary productivity (NAPP)). Grazing by geese resulted in consumption of ??? 90% of the NAPP that occurred in grazing lawns during the brood-rearing period, suggesting that density-dependent interspecific competition was from exploitation of common food resources. Efforts to increase the population size of Emperor Geese would benefit from considering competitive interactions among goose species and with forage plants. ?? 2008 The Authors.

  16. Le fictif et le réel dans L’Empereur et l’assassin de Chen Kaige

    Directory of Open Access Journals (Sweden)

    Xiaomin Giafferri


    Full Text Available Comme tout texte historique littéraire refait l’Histoire en la manipulant, le récit filmique est doublement mensongère du fait de sa double représentation : le décor et les acteurs représentent une situation qui est la fiction, et le film lui-même représente sous forme d’images juxtaposées cette première représentation. Sans vouloir faire la part du réel et de l’imaginaire, le présent travail tente de montrer comment, dans le film L’empereur et l’assassin de Chen Kaige, l’illusion de l’authenticité s’établit à travers les mécanismes de la fictionnalisation de l’Histoire. L’observation de leur manifestation est amenée à considérer deux axes principaux : l’organisation du récit et la mise en scène des personnages.

  17. Activation energy and R. Chen frequency factor in the Randall and Wilkins original equation for second order kinetics. Emission curve simulated in Microsoft Excel algebra; Energia de activacion y factor de frecuencia de R. Chen en la ecuacion original de Randall y Wilkins para cinetica de segundo orden. Curva de emision simulada en algebra de Microsoft Excel

    Energy Technology Data Exchange (ETDEWEB)

    Moreno M, A. [Departamento de Apoyo en Ciencias Aplicadas, Benemerita Universidad Autonoma de Puebla, 4 Sur 104, Centro Historico, 72000 Puebla (Mexico); Moreno B, A


    In this work the incorporation of activation energy and frequency factor parameters proposed by R. Chen are presented in the original formulation of Randall and wilkins second order kinetics. The results concordance are compared between the calculus following the R. Chen methodology with those ones obtained by direct incorporation of the previously indicated in the Randall-Wilkins-Levy expression for a simulated thermoluminescent emission curve of two peaks with maximum peak temperature (tm): t m1=120 and t m2=190. (Author)

  18. Variation in foraging behavior and body mass in broods of Emperor Geese (Chen canagica): Evidence for interspecific density dependence (United States)

    Schmutz, J.A.; Laing, K.K.


    Broods of geese spend time feeding according to availability and quality of food plants, subject to inherent foraging and digestive constraints. We studied behavioral patterns of broods of Emperor Geese (Chen canagica) on the Yukon–Kuskokwim Delta, Alaska, and examined how feeding and alert behavior varied in relation to habitat and goose density. During 1994–1996, time spent feeding by Emperor Goose goslings and adult females was positively related to multispecies goose densities near observation blinds, and not to just Emperor Goose density. Similarly, body mass of Emperor Goose goslings was more strongly related (negatively) to multispecies goose densities than intraspecific densities. A grazing experiment in 1995 indicated that most above ground primary production by Carex subspathacea, a preferred food plant, was consumed by grazing geese. Those results demonstrate that interspecific competition for food occurred, with greatest support for goslings whose behavioral repertoire is limited primarily to feeding, digesting, and resting. Although the more abundant Cackling Canada Geese (Branta canadensis minima) differed from Emperor Geese in their preferred use of habitats during brooding rearing (Schmutz 2001), the two species occurred in equal abundance in habitats preferred by Emperor Goose broods. Thus, Cackling Canada Geese were a numerically significant competitor with Emperor Geese. Comparing these results to an earlier study, time spent feeding by goslings, adult females, and adult males were greater during 1993–1996 than during 1985–1986. During the interval between those studies, densities of Cackling Canada Geese increased two to three times whereas Emperor Goose numbers remained approximately stable, which implies that interspecific competition affected foraging behavior over a long time period. These density-dependent changes in foraging behavior and body mass indicate that interspecific competition affects nutrient acquisition and gosling

  19. [Textual research on Chen Ye and his Jia cang jing yan fang (Family-preserved Empirical Recipes) of the Song Dynasty]. (United States)

    Zhang, Xuedan; Zhang, Ruqing; Chen, Dexing


    Chen Ye, an official of the Southern Song Dynasty, also known as Chen Rihua as his styled name, was born in Changle, Fuzhou in the reign of Shaoxing, and died during the reign of Duanping. He had been consecutively in the positions of Jiang shi lang (Court Gentleman for Ceremonial Service), Zhi zhou (Prefect) of Lingding, the Ti xing (Judicial Commissioner) of Guangdong, the Zong ling (Overseer-general) of Sichuan, Shan ding (Reviser), Shu lin and other positions in Tongzhou, Yuanzhou. His works included 1 volume of Gu ling xian sheng nian pu (Mr. Guling's Chronological Biography), 1 volume of Tan xie (On Humor), 1 volume of Shi hua (Poetry), 8 volumes of Jin yuan li shu (Jin Yuan's Smart Technique), 3 volumes of Yi jian zhi lei bian (Classified Compilation of Yijian's Annals), (Zeng guang) Suo sui lu (Augmented Records of Trivial Matters), 5 volumes of Jia cang jing yan fang (Family-preserved Empirical Recipes). He also compiled the 8-volume Yin jiang zhi (Yinjiang's Annals), published the 2-volume Jia cang ji yao fang (Collected Essential Recipes from Family Preservation), and other proses and poetry. Jia cang jing yan fang was a formulary compiled by Chen Ye, which was lost. Altogether 74 of its recipes were cited in Fu ren da quan liang fang (Complete Effective Prescriptions for Women's Diseases), Shou qin yang lao shu (A Book for Pursuing Seniors' Longevity and Healthcare), Pu ji fang (Prescriptions for Universal Relief) and Yong le da dian (Yongle Encyclopedia).

  20. Chinese Commission of Science Technology and Industry for National Defense Senior Vice Minister CHEN Qiufa exchanging gifts at luncheon and signing the Guest Book on 1st November 2007 with CERN Director-General R. Aymar.

    CERN Multimedia

    Maximilien Brice


    Chinese Commission of Science Technology and Industry for National Defense Senior Vice Minister CHEN Qiufa exchanging gifts at luncheon and signing the Guest Book on 1st November 2007 with CERN Director-General R. Aymar.

  1. 21 October 2008 - LHC Inauguration - IHEP Beijing representative Prof. Chen, People's Republic of China, welcomed by CERN Director-General R. Aymar, CERN Chief Scientific Officer J. Engelen and CERN Financial Officer S. Lettow.

    CERN Multimedia

    CERN Photo Service


    21 October 2008 - LHC Inauguration - IHEP Beijing representative Prof. Chen, People's Republic of China, welcomed by CERN Director-General R. Aymar, CERN Chief Scientific Officer J. Engelen and CERN Financial Officer S. Lettow.

  2. 6 June 2012 - Chinese Nanjing University President J.Chen in the ATLAS visitor centre with Member of the ATLAS Collaboration I. Wingerter and International Relations Office Adviser E. Tsesmelis. M. Qi, Nanjing University and ATLAS Collaboration, accompanies the delegation.

    CERN Multimedia

    Maximilien Brice


    6 June 2012 - Chinese Nanjing University President J.Chen in the ATLAS visitor centre with Member of the ATLAS Collaboration I. Wingerter and International Relations Office Adviser E. Tsesmelis. M. Qi, Nanjing University and ATLAS Collaboration, accompanies the delegation.

  3. Next-generation sequence detects ARAP3 as a novel oncogene in papillary thyroid carcinoma

    Directory of Open Access Journals (Sweden)

    Wang QX


    Full Text Available Qing-Xuan Wang, En-Dong Chen, Ye-Feng Cai, Yi-Li Zhou, Zhou-Ci Zheng, Ying-Hao Wang, Yi-Xiang Jin, Wen-Xu Jin, Xiao-Hua Zhang, Ou-Chen Wang Department of Oncology, The First Affiliated Hospital of Wenzhou Medical University, Wenzhou, Zhejiang Province, China Purpose: Thyroid cancer is the most frequent malignancies of the endocrine system, and it has became the fastest growing type of cancer worldwide. Much still remains unknown about the molecular mechanisms of thyroid cancer. Studies have found that some certain relationship between ARAP3 and human cancer. However, the role of ARAP3 in thyroid cancer has not been well explained. This study aimed to investigate the role of ARAP3 gene in papillary thyroid carcinoma. Methods: Whole exon sequence and whole genome sequence of primary papillary thyroid carcinoma (PTC samples and matched adjacent normal thyroid tissue samples were performed and then bioinformatics analysis was carried out. PTC cell lines (TPC1, BCPAP, and KTC-1 with transfection of small interfering RNA were used to investigate the functions of ARAP3 gene, including cell proliferation assay, colony formation assay, migration assay, and invasion assay. Results: Using next-generation sequence and bioinformatics analysis, we found ARAP3 genes may play an important role in thyroid cancer. Downregulation of ARAP3 significantly suppressed PTC cell lines (TPC1, BCPAP, and KTC-1, cell proliferation, colony formation, migration, and invasion. Conclusion: This study indicated that ARAP3 genes have important biological implications and may act as a potentially drugable target in PTC. Keywords: papillary thyroid carcinoma, next-generation sequence, ARAP3, oncogene

  4. The prevalence and pathogenicity of gizzard nematodes of the genera Amidostomum and Epomidiostomum (Trichostrongylidae) in the lesser snow goose (Chen caerulescens caerulescens) (United States)

    Tuggle, B.N.; Crites, John L.


    Three species of trichostrongylid nematodes were removed from the gizzards of 25 lesser snow geese, Chen caerulescens caerulescens, collected at Winisk, Ont. A 100% prevalence of infection was noted in the sampled population with each bird harboring two or more of the following species: Epomidiostomum crami (prevalence, 92%; mean intensity, 18.7 ± 13.3), Amidostomum anseris (prevalence, 84%; mean intensity, 9.6 ± 9.8), and Amidostomum spatulatum (prevalence, 84%; mean intensity, 11.2 ± 9.8). When large burdens (>30) of both A. anseris and A. spatulatum were present in the mucosal lining of the gizzard, progressive degeneration of the epithilium and koilin linings was noted in 16% of the geese examined. Severe necrotic granulomata observed in the gizzard muscle of 36% of the geese were associated with sizable burdens (>25) of E. crami which were found burrowed in the gizzard muscle.

  5. Chlorpromazine-induced perturbations of bile acids and free fatty acids in cholestatic liver injury prevented by the Chinese herbal compound Yin-Chen-Hao-Tang. (United States)

    Yang, Qiaoling; Yang, Fan; Tang, Xiaowen; Ding, Lili; Xu, Ying; Xiong, Yinhua; Wang, Zhengtao; Yang, Li


    Yin-Chen-Hao-Tang (YCHT), a commonly used as a traditional chinese medicine for liver disease. Several studies indicated that YCHT may improving hepatic triglyceride metabolism and anti-apoptotic response as well as decreasing oxidative stress .However, little is known about the role of YCHT in chlorpromazine (CPZ) -induced chlolestatic liver injury. Therefore, we aimed to facilitate the understanding of the pathogenesis of cholestatic liver injury and evaluate the effect of Yin-Chen-Hao-Tang (YCHT) on chlorpromazine (CPZ)-induced cholestatic liver injury in rats based on the change of bile acids (BAs) and free fatty acids (FFAs) alone with the biochemical indicators and histological examination. We conducted an experiment on CPZ-induced cholestatic liver injury in Wistar rats with and without YCHT for nine consecutive days. Serum levels of alanine aminotransferase (ALT), aspartate aminotransferase (AST), albumin (ALB), total bilirubin (TBIL), total cholesterol (TC), triglycerides (TG), low density lipoprotein-cholesterol (LDL-C) were measured to evaluate the protective effect of YCHT against chlorpromazine (CPZ)-induced cholestatic liver injury. Histopathology of the liver tissue showed that pathological injuries were relieved after YCHT pretreatment. In addition, ultra-performance lipid chromatography coupled with quadrupole mass spectrometry (UPLC-MS) and gas chromatography coupled with mass spectrometry (GC-MS) was applied to determine the content of bile acids, free fatty acids, respectively. Obtained data showed that YCHT attenuated the effect of CPZ-induced cholestatic liver injury, which was manifested by the serum biochemical parameters and histopathology of the liver tissue. YCHT regulated the lipid levels as indicated by the reversed serum levels of TC, TG, and LDL-C. YCHT also regulated the disorder of BA and FFA metabolism by CPZ induction. Results indicated that YCHT exerted a protective effect on CPZ-induced cholestasis liver injury. The variance of

  6. [Reiner Nürnberg, Ekkehard Höxtermann, Martina Voigt. Elisabeth Schiemann 1881-1972. Vom AußBruch der Genetik und der Frauen in den UmBrüchen des 20. Jahrhunderts] / Monika von Hirschheydt

    Index Scriptorium Estoniae

    Hirschheydt, Monika von


    Arvustus: Nürnberg, Reiner, Höxtermann, Ekkehard, Voigt, Martina. Elisabeth Schiemann 1881-1972. Vom AußBruch der Genetik und der Frauen in den UmBrüchen des 20. Jahrhunderts. Beiträge eines Symposiums zum 200. Gründungsjubiläum der Humboldt-Universität Berlin. Rangsdorf: Basilisken-Presse 2014

  7. "Is political behavior a viable coping strategy to perceived organizational politics? Unveiling the underlying resource dynamics": Correction to Sun and Chen (2017). (United States)


    Reports an error in "Is Political Behavior a Viable Coping Strategy to Perceived Organizational Politics? Unveiling the Underlying Resource Dynamics" by Shuhua Sun and Huaizhong Chen ( Journal of Applied Psychology , Advanced Online Publication, May 22, 2017, np). In the article, Table 1 contained a formatting error. Correlation coefficient values in the last four cells of column 6 were misplaced with correlation coefficient values in the last four cells of column 7. All versions of this article have been corrected. (The following abstract of the original article appeared in record 2017-22542-001.) We conduct a theory-driven empirical investigation on whether political behavior, as a coping strategy to perceived organizational politics, creates resource trade-offs in moderating the relationship between perceived organizational politics and task performance. Drawing on conservation of resources theory, we hypothesize that political behavior mitigates the adverse effect of perceived organizational politics on task performance via psychological empowerment, yet exacerbates its adverse effect on task performance via emotional exhaustion. Three-wave multisource data from a sample of 222 employees and their 75 supervisors were collected for hypothesis testing. Findings supported our hypotheses. Our study enhances understandings of the complex resource dynamics of using political behavior to cope with perceived organizational politics and highlights the need to move stress-coping research from a focus on the stress-buffering effect of coping on outcomes to a focus on the underlying competing resource dynamics. (PsycINFO Database Record (c) 2017 APA, all rights reserved).

  8. Novel strategy of stents in thyroid mass: a case series report of managing severely dyspneic patients

    Directory of Open Access Journals (Sweden)

    Bhandari A


    Full Text Available Adheesh Bhandari,* Ying-hao Wang,* Shi-xu Lv, Er-jie Xia, Ou-Chen Wang Department of Oncology, The First Affiliated Hospital of Wenzhou Medical University, Wenzhou, Zhejiang, People’s Republic of China *These authors contributed equally to this work Background: Tracheal and bronchial stenosis is a life-threatening condition causing difficulty in breathing and even severe respiratory distress. The silicone tracheobronchial stents were placed using the rigid bronchoscopy into the trachea of severe dyspneic patients and they exhibited symptomatic improvement as well as a rise in the saturation of oxygen. The bronchial stents were applicable to many extensive malignant airway stenosis patients, such as those with esophageal cancer, lung cancer, and laryngeal cancer. But the effectiveness of bronchial stents for thyroid cancer is not certain.Case presentation: Here, we report 3 emergency patients with a thyroid mass referred to our hospital because of grade 4 dyspnea according to the American Thoracic Society shortness of breath guidelines. The main clinical symptoms were severe dyspnea and stridor. The radiographic examination and tomographic examination showed the narrowing and displacement of the trachea. To the best of our knowledge, ideal airway management for the massive thyroid mass was considered to be temporary tracheobronchial stent placement pre-operation.Conclusion: In our study, we applied the tracheobronchial stent to massive thyroid mass patients with dyspnea and aimed to not only improve preoperative airway obstruction but also to protect the potential airway collapse from post-operative tracheomalacia following extubation. We found that application of tracheobronchial stents may provide a new strategy to dyspneic patients with huge thyroid mass. Keywords: tracheobronchial stents, airway management, tracheal stenosis, dyspnea

  9. Two phases of droplet evaporation during plasma arc spraying: reply to Chen's comment about the 'rocket' effect under conditions of thermal plasma spraying

    Energy Technology Data Exchange (ETDEWEB)

    Nemchinsky, V A [Key College, 225 Dania Beach Blvd, Dania Beach, FL 33040 (United States)


    The heating history of a droplet during its flight can be divided into two phases: (a) the initial phase when evaporation, although it occurs, does not change the heat balance of the droplet much (the case considered in our previous paper and (b) the final phase when the cooling due to evaporation balances the heat flux from the plasma. The later phase is considered in Chen's comment. In our reply, a very straightforward consideration demonstrates that even in the final phase of the droplet flight, the 'rocket' effect can be significant. (reply)

  10. Redescription of the Indo-West Pacific scorpionfish (Scorpaenidae), Neomerinthe erostris (Alcock 1896), a senior synonym of Scorpaena gibbifrons Fowler 1938, N. rotunda Chen 1981, and N. bathyperimensis Zajonz & Klausewitz 2002. (United States)

    Motomura, Hiroyuki; Causse, Romain; Béarez, Philippe; Mishra, Subhrendu Sekhar


    The Indo-West Pacific species, Neomerinthe erostris (Alcock 1896), originally described as Scorpaena erostris, is redescribed as a senior synonym of Scorpaena gibbifrons Fowler 1938, N. rotunda Chen 1981, and N. bathyperimensis Zajonz & Klausewitz 2002. Although the latter three nominal species have been regarded as valid species and N. erostris has not been reported since 1898, examinations of type specimens of the four nominal species revealed that they represent a single species. A lectotype of Scorpaena erostris is herein designated. Neomerinthe erostris is characterized by having a distinct longitudinal ridge on the lateral surface of the maxilla and a strongly rounded dorsal profile of the head.

  11. Chinese Commission of Science Technology and Industry for National Defense Senior Vice Minister CHEN Qiufa visiting ALICE experiment on 1st November 2007 with CERN Director-General R. Aymar and Adviser J.-P. Revol. Thursday, 1st and Friday, 2nd November 2007

    CERN Multimedia

    Maximilien Brice


    Chinese Commission of Science Technology and Industry for National Defense Senior Vice Minister CHEN Qiufa visiting ALICE experiment on 1st November 2007 with CERN Director-General R. Aymar and Adviser J.-P. Revol. Thursday, 1st and Friday, 2nd November 2007

  12. Blazar Sequence in Fermi Era Liang Chen

    Indian Academy of Sciences (India)

    Abstract. In this paper, we review the latest research results on the topic of blazar sequence. It seems that the blazar sequence is phenomenally ruled out, while the theoretical blazar sequence still holds. We point out that black hole mass is a dominated parameter accounting for high-power- high-synchrotron-peaked and ...

  13. MARGA_Chen et al_2016 (United States)

    U.S. Environmental Protection Agency — These data describe the chromatography characteristics of the MARGA instrument software as compared to an alternative, independent technique for chromatogram...

  14. 古今中西之間--陳垣與20世紀中國史學%Between the Ancient and the Present and between China and the West:Prof. Chen Yuan and Chinese Historiography in the 20 th Century

    Institute of Scientific and Technical Information of China (English)



    Every historian should answer two questions related to each other, i. e. what is the relationship between history and reality and what is that between historiography and reality. Moreover, Chinese historians should answer other two questions also re-lated to each other, namely what is the relationship between China and the West and what is that between Chinese culture and Western culture. Based on their own outlook on the ancient and the present as well as on China and the West, every conscious Chinese historian of the 20 th century was bound to cherish a definite sense of responsi-bility and determined what role they played and what way they chose when taking on this responsibility. The present paper expounds Prof. Chen Yuan’ s answers to the above questions andhis practice concerned with them in the four stages of his lifetime.

  15. Effect of Contract Compliance Rate to a Fourth-Generation Telehealth Program on the Risk of Hospitalization in Patients With Chronic Kidney Disease: Retrospective Cohort Study. (United States)

    Hung, Chi-Sheng; Lee, Jenkuang; Chen, Ying-Hsien; Huang, Ching-Chang; Wu, Vin-Cent; Wu, Hui-Wen; Chuang, Pao-Yu; Ho, Yi-Lwun


    telehealth program and risk of hospitalization. Renal function status was associated with risk of hospitalization among these patients, and there was a significant interaction with contract compliance rate. ©Chi-Sheng Hung, Jenkuang Lee, Ying-Hsien Chen, Ching-Chang Huang, Vin-Cent Wu, Hui-Wen Wu, Pao-Yu Chuang, Yi-Lwun Ho. Originally published in the Journal of Medical Internet Research (, 24.01.2018.

  16. Ökodisainist futuristlike tudengite silmade läbi

    Index Scriptorium Estoniae


    Electroluxi Design Lab'i 2007. a. ülemaailsel disainivõistlusel Pariisis kujundasid tootedisaini üliõpilased keskkonnasõbralikke kodumasinaid aastaks 2020. Tutvustatakse finaliste: pesumasin E-wash (I koht - Levente Szabo), päikeseenergial töötav toiduvalmistaja Pebble (II - Laura Pandelle), kärjekujulistest sahtlitest koosnev külmik Go Fresh (III - He Cheng Fei), õhupuhastaja Nature Wind (Bae Won-Ho), plastikut kodustes tingimustes lagundav seade Return Pot (Juan Ying-Hao), nõudepesumasin Pure Washer (Tatjana Voronova), ududushsh Fog Shower (Joao Diego Schimansky), kompostiseade Circompo (Thanat Tengamnuay)

  17. Food Fortification to Prevent and Control Iron Deficiency | Chen ...

    African Journals Online (AJOL)

    It is essential to prevent the fortification iron from reacting with the absorption inhibitors. To ensure adequate absorption therefore, various factors must be considered before initiating a fortification programme. These include cost effectiveness of fortification in increasing absorbable iron, palatability of the fortified food and the ...

  18. Lateral strukturierte Oberflächen zur THz-Strahlmanipulation


    Jahn, David; Koch, Martin (Prof. Dr.)


    Die Terahertz-Zeitbereichsspektroskopie ist mittlerweile eine etablierte spektroskopische Methode im Frequenzbereich von 0;2 THz bis etwa 5 THz. Mit der stetigen Verbesserung von Zeitbereichs-Spektrometern, in den letzten Jahren hauptsächlich vorangetrieben durch die Verbesserung der Materialsysteme sowohl im photoleitenden Emitter als auch im Detektor sind heute Systeme mit bis zu 90 dB SNR und 4;5 THz Brandbreite verfügbar. Auch der Einfluss anderer Systemkomponenten, deren Beitrag zum...

  19. Massive Star Formation: Accreting from Companion X. Chen1 ...

    Indian Academy of Sciences (India)

    Abstract. We report the possible accretion from companion in the mas- sive star forming region (G350.69–0.49). This region seems to be a binary system composed of a diffuse object (possible nebulae or UC HII region) and a Massive Young Stellar Object (MYSO) seen in Spitzer IRAC image. The diffuse object and MYSO ...

  20. Initiation and Propagation of Coronal Mass Ejections P. F. Chen

    Indian Academy of Sciences (India)

    Introduction. Coronal mass ejections (CMEs) have been observed for over 30 years. They keep being an intriguing research topic, not only because they are now realized to be the major driver for space weather disturbances, which are intimately connected to human activities, but also because they themselves are full of ...

  1. Mitochondrial genome of Taiwan pig ( Sus Scrofa ) | Chen | African ...

    African Journals Online (AJOL)

    The purpose of this study is to investigate the complete nucleotide sequence of the mitochondrial genome of the Taiwan Lanyu pig (Sus scrofa) and its phylogenetic relationships with other pig breeds. Thirty-four forward and reverse primers were designed. Sequencing was performed in both directions. The results showed ...

  2. Chemische Reaktionen auf Oberflächen - eine SFG Studie


    Kirsch, Harald


    This thesis focused on the investigation of chemical reactions on surfaces by usage of Sum Frequency Generation (SFG) spectroscopy and Thermal Desorption Spectroscopy (TDS). Understanding of chemical reactions on surfaces is of critical importance for modification and optimization of a variety of environmental and industrial processes, but the complexity of the ongoing reactions under "realistic" conditions often hinders an understanding on a molecular level. The aim of this work was to get i...

  3. C. Huang , G. Zhao , HW Zhang & YQ Chen

    Indian Academy of Sciences (India)

    the host stars' birth cloud with higher abundance of Si will make the cloud ... with the metallicity distribution of nearby field F, G, or K stars which are known to .... In the early stage of planetesimal accumulation, the rate of growth of planetesimal.

  4. Chaos synchronization of the fractional-order Chen's system

    International Nuclear Information System (INIS)

    Zhu Hao; Zhou Shangbo; He Zhongshi


    In this paper, based on the stability theorem of linear fractional systems, a necessary condition is given to check the chaos synchronization of fractional systems with incommensurate order. Chaos synchronization is studied by utilizing the Pecora-Carroll (PC) method and the coupling method. The necessary condition can also be used as a tool to confirm results of a numerical simulation. Numerical simulation results show the effectiveness of the necessary condition.

  5. Relación heterófilo/linfocito, frecuencia espontánea de eritrocitos micronucleados y prolongaciones nucleares en el ganso nevado (Chen caerulescens: Una propuesta como posible biomonitor de estrés y genotóxicos ambientales

    Directory of Open Access Journals (Sweden)

    Martha C. Martínez Quintanilla


    Full Text Available Existen organismos silvestres que son altamente vulnerables ante estresores antropogénicos y naturales, estos organismos pueden ser de utilidad para evaluar la salud ambiental mediante diferentes indicadores confiables, sencillos, rápidos, económicos para determinar y si es posible reducir estos efectos negativos. En este estudio proponemos al ganso nevado (Chen caerulescens como posible biomonitor de estrés y genotóxicos ambientales mediante la relación heterófilo/linfocito (H/L, la prueba de micronúcleos (EMN, prolongaciones nucleares en eritrocitos (EPN y eritrocitos policromáticos (EPC. Durante la temporada de caza (2012-2013 en el humedal de Málaga, Durango, México, colectamos 18 organismos. Los eritrocitos fueron las células más abundantes, de núcleo y morfología elípticos, de tamaño 12.68 ± 0.89 µm. Observamos heterófilos (11.07±1.32 µm, eosinófilos (9.67±1.26 µm, basófilos (5.75 ± 0.78 µm, monocitos (10.49±1.36 µm y linfocitos (6.53±1.0 µm. No identificamos alteración en las proporciones ni en la morfología de leucocitos, sin embargo, es necesario un mayor número de organismos para establecer los parámetros sanguíneos de base normal para esta especie. La relación h/l fue de 0.41 ± 0.11 este valor es similar a lo reportado para esta y otras especies de aves consideradas como sanas. Establecimos la frecuencia basal de EMN (2.6±1.45, epn (249.2 ± 89.74 y EPC (156.5 ± 50. El ganso nevado es un organismo que se perfila como buen candidato a biomonitor ambiental debido a la frecuencia basal de su relación H/L, EMN, EPN y EPC, pero debe probarse en condiciones estandarizadas y a través de estudios en zonas con y sin contaminación.

  6. Chen et al., Afr J Tradit Complement Altern Med. (2012) 9(2):234 ...

    African Journals Online (AJOL)


    E-mail: .... under an inverted microscope. ... Stars image analyzing equipment (Shanghai, P.R. China) was used to analyze the image ... Inverted microscope: The cultured neurons in the control group grew well and ...

  7. Critical node lifetimes in random networks via the Chen-Stein method

    NARCIS (Netherlands)

    Franceschetti, M.; Meester, R.W.J.


    This correspondence considers networks where nodes are connected randomly and can fail at random times. It provides scaling laws that allow to find the critical time at which isolated nodes begin to appear in the system as its size tends to infinity. Applications are in the areas of sensor and

  8. Chen et al., Afr J Tradit Complement Altern Med. (2016) 13(1):25-32 ...

    African Journals Online (AJOL)


    The phosphorylation of PKA substrate was not activated after 48 hours of treatment with ephedrine and anisodamine. Conclusion: Ephedrine and anisodamine inhibit the proliferation of SKBR3 cells via a significantly change of intracellular cAMP concentration. Key words: anisodamine, breast cancer, cyclic adenosine ...

  9. Q. Shen1, X. Chen1, Jiyune Yi2, DR Jiang1 & YJ Yun3

    Indian Academy of Sciences (India)

    imately six months to cover the 2-yr pulsation cycle of VX Sgr. We used a special phase referencing ... but the υ = 2 line has relatively few maser features, most of which reside in the. Southern and Northern parts. ... stronger masers of both the lines appear, among which the main features reside in the inner shell and show ...

  10. Chen and Xiaodong Afr J Tradit Complement Altern Med. (2013) 10 ...

    African Journals Online (AJOL)


    As an ancient medicine, Solanum nigrum Linne has been playing an important role in the treatment of cancer in China since ancient times. It is reported in the literatures that Solanum nigrum Linne can inhibit tumour cell growth and promote apoptosis of tumour cells, and has immunomodulatory and cytotoxic effects (Son et ...

  11. In search of low cost titanium: the Fray Farthing Chen (FFC) Cambridge process

    CSIR Research Space (South Africa)

    Oosthuizen, SJ


    Full Text Available delivering a sponge product, aimed at replacing Kroll sponge alone, does not have potential for large reduction in overall titanium cost. Significant cost savings can only be achieved by also reducing the large number of process steps required to process... the sponge to mill product, including sponge purification, comminution, electrode forming, Vacuum Arc Re-melting, Hot and cold rolling. Presently, economy of scale in the production of titanium dictates that it is most cost effective to cast the largest...

  12. In search of low cost titanium: the fray farthing chen (FFC) cambridge process

    CSIR Research Space (South Africa)

    Oosthuizen, SJ


    Full Text Available delivering a sponge product, aimed at replacing Kroll sponge alone, does not have potential for large reduction in overall titanium cost. Significant cost savings can be achieved only by also reducing the large number of process steps required... to process the sponge to mill product, including sponge purification, comminution, electrode forming, vacuum arc re-melting, and hot and cold rolling. Presently, economy of scale in the production of titanium dictates that it is most cost...

  13. Chen et al., Afr J Tradit Complement Altern Med. (2014) 11(1):15-22

    African Journals Online (AJOL)


    x300mm,Japan ) column. The columns were eluted with 0.1M nitric acid and calibrated with ..... Mushiake, H, Tsunoda, T, Nukatsuka,M, Shimao K, Fukushima M, Tahara H. (2005). Dendritic cells might be one of key factors for eliciting antitumor ...

  14. Calibrating the Shan-Chen lattice Boltzmann model for immiscible displacement in porous media

    DEFF Research Database (Denmark)

    Christensen, Britt Stenhøj Baun; Schaap, M.G.; Wildenschild, D.


    The lattice Boltzmann (LB) modeling technique is increasingly being applied in a variety of fields where computational fluid dynamics are investigated. In our field of interest, environmentally related flow processes in porous media, the use of the LB method is still not common. For the LB...

  15. Beiträge zur Beugungstheorie elektromagnetischer Wellen an Kanten vollkommen leitender Flächen


    Zinal, Sherko


    Den Kern der vorliegenden Arbeit bilden die Untersuchung sowie die Formulierung von Lösungsansätzen für ein elementares, elektromagnetisches Beugungsproblem; einer undendlich langen Schlitzleitung mit einseitig begrenzter etallisierungsplatte (Abschnitt 1.2). Motiviert wird dieses Beugungsproblem im Hinblick auf die Beugungsproblematik planarer Strahler (Antennen) mit endlich ausgedehnter Grundmetallisierung (Abschnitt 1.1). In Kapitel 2 wird ein Stromlinien-Modell zur Formulierung des Beugun...

  16. VizieR Online Data Catalog: IRS spectra with features of crystalline silicates (Chen+, 2016) (United States)

    Chen, R.; Luo, A.; Liu, J.; Jiang, B.


    Spectra taken by the IRS (Houck et al. 2004ApJS..154...18H) on the Spitzer space telescope (Werner et al. 2004ApJS..154....1W) are now publicly available. These spectra are produced using the bksub.tbl products from SL and LL modules of final SSC pipeline, version 18.18. From the IRS data archive, we found a collection of 16986 low-resolution spectra. The spectra are merged by four slits: SL2 (5.21-7.56 μm), SL1 (7.57-14.28 μm), LL2 (14.29-20.66 μm), and LL1 (20.67-38.00 μm). As crystalline silicates have no features in the SL2 band, we choose the spectra that include all the other three bands: SL1, LL2, and LL1 so that the object has a continuous spectrum from about 7.5-38 μm. In this way, five of the seven infrared complexes of crystalline silicates are covered, i.e., the 10, 18, 23, 28, and 33 μm complexes. (5 data files).

  17. Die Beifuß-Ambrosie auf Ackerflächen - ein Problem?

    Directory of Open Access Journals (Sweden)

    Verschwele, Arnd


    Full Text Available Common ragweed (Ambrosia artemisiifolia is spreading on agricultural fields in Germany, mainly in Brandenburg and Bayern. Competitive crops like winter cereals and oilseed-rape can reduce growth of this plant better than spring crops. In maize or cereals a chemical control is possible, but problems may arise because of the late emergence of ragweed and its high ability to regrowth. In crops like sunflower or lupines herbicide choice is limited and thus preventive control measures are crucial. An integrated approach is needed in order to avoid yield losses and to stop the spreading of ragweed in Germany.

  18. Effects of different cleaning treatments on heavy metal removal of Panax notoginseng (Burk) F. H. Chen. (United States)

    Dahui, Liu; Na, Xu; Li, Wang; Xiuming, Cui; Lanping, Guo; Zhihui, Zhang; Jiajin, Wang; Ye, Yang


    The quality and safety of Panax notoginseng products has become a focus of concern in recent years. Contamination with heavy metals is one of the important factors as to P. notoginseng safety. Cleaning treatments can remove dust, soil, impurities or even heavy metals and pesticide residues on agricultural products. But effects of cleaning treatments on the heavy metal content of P. notoginseng roots have still not been studied. In order to elucidate this issue, the effects of five different cleaning treatments (CK, no treatment; T1, warm water (50°C) washing; T2, tap water (10°C) washing; T3, drying followed by polishing; and T4, drying followed by tap water (10°C) washing) on P. notoginseng roots' heavy metal (Cu, Pb, Cd, As and Hg) contents were studied. The results showed that heavy metal (all five) content in the three parts all followed the order of hair root > rhizome > root tuber under the same treatment. Heavy metal removals were in the order of Hg > As > Pb > Cu > Cd. Removal efficiencies of the four treatments were in the order of T2 > T1 > T3 > T4. Treatments (T1-T4) could decrease the contents of heavy metal in P. notoginseng root significantly. Compared with the requirements of WM/T2-2004, P. notoginseng roots' heavy metal contents of Cu, Pb, As and Hg were safe under treatments T1 and T2. In conclusion, the cleaning process after production was necessary and could reduce the content of heavy metals significantly. Fresh P. notoginseng root washed with warm water (T2) was the most efficient treatment to remove heavy metal and should be applied in production.

  19. Chen et al., Afr J Tradit Complement Altern Med. (2011) 8(4):467-476

    African Journals Online (AJOL)


    Keywords: Shen-qi-di-huang decoction, proteinuria, nephrin, adriamycin nephropathy. Introduction. Proteinuria is a clinical signature of podocyte injury resulting in many renal diseases. The slit diaphragm (SD) which connects neighboring foot processes of podocytes represents a critical structure of protein filtration (Tarabra ...

  20. AtCCX1 transports Na + and K + in Pitch pastoris | Chen | African ...

    African Journals Online (AJOL)

    Compartmentation of Na+ into vacuoles is an important way for cells to avoid the toxic effects of salt. Here, Arabidopsis AtCCX1 was studied in Pitch pastoris GS115. Yeast expressing AtCCX1 grew better in high H+ concentration medium and high salt medium than original strain and increased Na+ accumulation and ...

  1. First record of molluscs naturally infected with Angiostrongylus cantonensis (Chen, 1935 (Nematoda: Metastrongylidae in Brazil

    Directory of Open Access Journals (Sweden)

    Roberta Lima Caldeira


    Full Text Available Seeking the identification of Angiostrongylus cantonensis as a potential etiological agent of three clinical cases of eosinophilic meningitis, mollusc specimens were collected in the state of Espírito Santo, Brazil. The snails were identified as Sarasinula marginata (45 specimens, Subulina octona (157, Achatina fulica (45 and Bradybaena similaris (23. Larvae obtained were submitted to polymerase chain reaction and restriction fragment length polymorphism diagnosis. Their genetic profile were corresponded to A. cantonensis. Rattus norvegicus experimentally infected with third-stage larvae, developed menigoencephalitis, and parasites became sexually mature in the lungs. Additionally, larvae obtained from A. fulica snails, from São Vicente, state of São Paulo, also showed genetic profiles of this nematode. This is the first record of Brazilian molluscs infected with this nematode species.

  2. VizieR Online Data Catalog: YSO candidates in the Magellanic Bridge (Chen+, 2014) (United States)

    Chen, C.-H. R.; Indebetouw, R.; Muller, E.; Kawamura, A.; Gordon, K. D.; Sewilo, M.; Whitney, B. A.; Fukui, Y.; Madden, S. C.; Meade, M. R.; Meixner, M.; Oliveira, J. M.; Robitaille, T. P.; Seale, J. P.; Shiao, B.; van Loon, J. Th.


    The Spitzer observations of the Bridge were obtained as part of the Legacy Program "Surveying the Agents of Galaxy Evolution in the Tidally-Stripped, Low-Metallicity Small Magellanic Cloud" (SAGE-SMC; Gordon et al. 2011AJ....142..102G). These observations included images taken at 3.6, 4.5, 5.8, and 8.0 um bands with the InfraRed Array Camera (IRAC) and at 24, 70, and 160 um bands with the Multiband Imaging Photometer for Spitzer (MIPS). The details of data processing are given in Gordon et al. (2011AJ....142..102G). To construct multi-wavelength SEDs for sources in the Spitzer catalog, we have expanded it by adding photometry from optical and NIR surveys covering the Bridge, i.e., BRI photometry from the Super COSMOS Sky Surveys (SSS; Hambly et al. 2001MNRAS.326.1279H) and JHKs photometry from the Two Micron All Sky Survey (2MASS; Skrutskie et al. 2006AJ....131.1163S, Cat. VII/233). (5 data files).

  3. Was kommt nach dem Handel? Umnutzung von Einzelhandelsflächen und deren Beitrag zur Stadtentwicklung


    Sperle, Tilman


    In der Stadt europäischen Typs sind Stadt und Handel eng miteinander verwoben. Die Bedeutung des Handels geht weit über dessen originäre Versorgungsfunktion hinaus. Für die städtischen Zentren und Nebenzentren übernimmt er sowohl gestaltende als auch soziale Funktionen und trägt mit seiner belebenden Wirkung maßgeblich zum urbanen Leben bei. Mit dem tief greifenden Strukturwandel im Einzelhandel verändert sich diese Beziehung zwischen Stadt und Handel dramatisch, Trading-down-Prozesse geh...

  4. VizieR Online Data Catalog: Sample of Fermi Blazars (Chen+, 2016) (United States)

    Chen, Y.-Y.; Zhang, X.; Xiong, D.-R.; Wang, S.-J.; Yu, X.-L.


    We tried to select a large number of blazars with reliable redshift, radio core and extended radio luminosity at 1.4GHz. Firstly, we considered the following samples of blazars to get the radio core luminosity and extended luminosity at 1.4GHz: Kharb et al. (2010, J/ApJ/710/764), Antonucci & Ulvestad (1985ApJ...294..158A), Cassaro et al. (1999A&AS..139..601C), Murphy et al. (1993MNRAS.264..298M), Landt & Bignall (2008MNRAS.391..967L), Caccianiga & Marcha (2004, Cat. J/MNRAS/348/973), Giroletti et al. (2004). We cross-correlated these samples with the Fermi LAT Third Source Catalog (3FGL), and we acquired the 3FGL spectral index and energy flux at 0.1-100GeV from clean sources in 3FGL (Fermi-LAT Collaboration 2015, J/ApJS/218/23) Using these catalogs, we compiled 201 Fermi blazars. (1 data file).

  5. Diskrepanz: Die EU-Frauenpolitik zwischen Deregulierung und Gleichheitsansprüchen

    Directory of Open Access Journals (Sweden)

    Ingrid Biermann


    Full Text Available In von neun Autorinnen verfassten Beiträgen gibt der Band Einblicke in zentrale Felder der EU-Politik: die europäische Wirtschafts- und Währungsunion (EWWU, die Strukturpolitik, die Gleichstellungspolitik und das Gender Mainstreaming, die Osterweiterung sowie die Ausarbeitung einer europäischen Verfassung. Damit werden wesentliche Teile des Maastricht-Vertrags (1992, des Amsterdamer Vertrags (1997 und des Nizza-Vertrags (2000 behandelt. Hierdurch bildet dieser Band eine wichtige Grundlage für die Diskussion über die Frauenpolitik der EU.

  6. VizieR Online Data Catalog: Quasars narrow absorption lines from SDSS (Chen+, 2015) (United States)

    Chen, Z.-F.; Gu, Q.-S.; Chen, Y.-M.; Cao, Y.


    The Baryon Oscillation Spectroscopic Survey (BOSS: Eisenstein et al. 2011AJ....142...72E; Paris et al. 2012, Cat. VII/269) is the main dark-time legacy survey of the third stage of the SDSS, which used the same 2.5-m telescope (Gunn et al. 2006AJ....131.2332G; Ross et al. 2012, J/ApJS/199/3) as the first and second stages of the SDSS (hereafter SDSS-I/II). SDSS-I/II spectra have a wavelength coverage from 3800-9200Å with a spectral resolution of 1800-2200 (e.g. York et al. 2000AJ....120.1579Y). BOSS spectra span a range from 3600-10500Å at a resolution of 1300-2500 (Paris et al. 2012, Cat. VII/269). During the first two years, BOSS detected 87822 quasars over an area of 3275 deg2, including 7932 quasars that were observed by SDSS-I/II as well. Quasars observed by both SDSS-I/II and BOSS provide a remarkable chance to study the variabilities of absorption lines in a large population. Throughout this work, we take the quasar emission redshifts provided by Hewett & Wild (2010, J/MNRAS/405/2302, directly. (2 data files).

  7. REVIEW: LOVE IN LHASA Lhasa hong chen 拉萨红尘

    Directory of Open Access Journals (Sweden)

    Reviewed by Wu Jing 吴晶


    Full Text Available Published in 2002, Love in Lhasa is Baima's first novel. The background is the 1980s at a time when China was engaging in fast-paced development of industrialization and commercialization as part of the Reform and Opening Up that began in the late 1970s. Most of the novel's episodes are set on the Tibetan Plateau where local Tibetans are affected by the trend of modernization. Young people in particular have increased opportunities to go out and see the world and also experience more challenges in dealing with issues of self-identity, and exploring the meaning of their existence. Against such a fast-changing social background, Tibetan women are faced with poignant life choices, especially as compared to traditional women. The novel's plot unfolds with the parallel life trajectories of the two female characters, Langsa and Yama, who are classmates and close friends at Tibet Military College. After graduation, the two young women leave the army and work in non-military areas as nurses. Langsa, the narrator, falls in love with a pilgrim, Varma, who comes from an isolated part of Tibet where Tibetan, Hui, and Han nationalities live together. They enjoy their otherworldly, extremely romantic relationship, and in the end, choose to live a reclusive life in the unknown hinterlands of Tibet. In contrast, Yama, the heroine, undergoes more complicated love experiences. Yama is the focus of this novel, embodying qualities of a "lost girl," such as beauty, rebelliousness, freedom-loving, desire, dreamer, degradation, and despair. After a pre-marriage affair with Di, a young Han man, she marries Zedan, a Tibetan, and her first real love. Disappointed by domestic life, she succumbs to temptation and has an extra-marital affair with Xu Nan in Shanghai. ...

  8. Die Erfassung von städtischen Oberflächen mittels EDV-gestützter Luftbildauswertung : ein Beitrag zur klimatologischen und luftklimatischen Bewertung von städtischen Teilflächen

    Directory of Open Access Journals (Sweden)

    M. Sandtner

    Full Text Available The article shows that the computer-aided, analogous-visual, stereometric interpretation of large-scale colour-infrared (CIR aerial photographs and subsequent data processing in a Geographical Information System (GIS can provide fundamental data necessary to describe aspects of urban ecology in a scale relevant for city-planning. This is exemplified by an evaluation of urban areas concerning their climates and airpollution using maps of urban surfaces (scale1:2500. An argumentation relying on such detailed and current basic data can stress the importance of environmental aspects in contrast to competing public and private interests in the process of city planning.

  9. Erste Erfahrungen mit RDA an wissenschaftlichen Universalbibliotheken in Deutschland - Ergebnisse aus Fokusgruppengesprächen mit Katalogisierenden

    Directory of Open Access Journals (Sweden)

    Heidrun Wiesenmüller


    Full Text Available Einige Monate nach dem Umstieg auf das neue Regelwerk "Resource Description and Access" (RDA wurden an 18 großen deutschen wissenschaftlichen Universalbibliotheken Fokusgruppengespräche mit Katalogisierererinnen und Katalogisierern durchgeführt. Die Katalogisierenden wurden u.a. befragt, wie sicher sie sich bei der Anwendung von RDA fühlen, was sie am neuen Regelwerk gut oder schlecht finden, wie sie den Aufwand im Vergleich zum früheren Regelwerk RAK einschätzen, welche Informations- und Hilfsmittel sie verwenden und wie sie zu den regelmäßigen Änderungen im Standard stehen. Der vorliegende Aufsatz dokumentiert die Ergebnisse der Gespräche.   Several months after the introduction of the new cataloging standard "Resource Description and Access" (RDA, focus-group interviews with catalogers were conducted at 18 large academic and state libraries in Germany. Among other things, the catalogers were asked how confident they feel in applying RDA, which aspects of the new cataloging code they like or do not like, how they estimate the expenditure of time in comparison to the former cataloging code RAK, which sources they use to get help or information, and what they think about the frequent changes to the new standard. The paper presents the results of these interviews.

  10. Organisation der Lektoratsarbeit in Öffentlichen Bibliotheken, ihre Stärken und Schwächen


    Umlauf, Konrad


    Die Praxis der Lektoratsarbeit an Öffentlichen Bibliotheken wurde 2010 mit einer Online-Befragung unter Biblothekspersonal erhoben. Die Fragen richten sich auf die Aufbauorganisation (Anteil der Lektoren unter dem Personal, den am Bestandsaufbau beteiligten Personalgruppen, die Lektoratsaufgaben im Einzelnen, typische Aufgaben der Lektoren neben den Lektoratsaufgaben, insbes. Verbindung von Lektoratsaufgaben mit Auskunftsdienst), die Ablauforganisation (Entscheidungsablauf und Kaufsitzungen, ...

  11. Chem TV: Choices I, v. 1.5.1 (by B. A. Luceigh, P. Ngo, and J. Chen) (United States)

    Kraig Steffen, L.


    CHEM TV: Sunland, CA, 1998. 24.95, students; 59.95, faculty. This CD-ROM presents a series of interactive overviews and drills for students of organic chemistry. The material covered is generally taught in the first semester. This suite is much more than a simple presentation of material and, for students sufficiently motivated to take the time and work with the problems, will provide valuable review. Five interactive spaces are provided: concentration drills that emphasize recall of related structures/names, reagents/reactions, and stereochemistry; a structural review based on epinephrine; interactive synthesis projects; arcade game reagent review; and a set of timed self-tests. The CD-ROM installed and ran without problem on a Power PC Mac and on a Pentium running Windows 95. The program did fail to run when a student reviewing it switched to a very new version of Windows Quick Time. Most of the drills ran without a problem, although at times it was unclear how to respond to queries. I turned off the music, which would be much less annoying if the loops were simply longer. Publishers are flooding the market with add-on computer-based materials for the various levels of chemistry. Many constitute little more than a stack of overheads. This is one that may be of sufficient value to warrant the extra cost. A large number of examples are provided for many of the areas covered. Most of the graphical interfaces are clear and easy to manipulate, with the exception of a couple of mechanistic screens that had hard-to-figure-out arrows. Two sections, or modules, are of special note. The first of these is the synthesis challenges, where students must choose reactants, reagents, and reaction conditions for a particular reaction. These synthesis problems are well thought out and can be challenging. It is unfortunate that there are only five of them. The Self-Tests module is also of great practical value, forcing students to work through a variety of topics (200 problems) with limited time allotted per test. The structures are clear and easy to view and include a large number of three-dimensional molecular models that help make the connection between simple line drawings and actual molecules. More feedback information on incorrect answers would be nice, although it is obvious that this can balloon into an unworkable situation if every possible "wrong" answer is considered. The structure summary, which uses a single complicated molecule to review a large range of structural topics, is a good integrated look at bonding, stereochemistry, and conformational analysis. The concentration game is informative, albeit a bit obtuse on a few of the answers! The selection drills, a shooting gallery game with various chemical targets, seems a bit silly, but then if one can learn to recognize all the major reducing agents by snagging butterflies with faux nets than this could be helpful! With its varying levels of difficulty, this set of modules should be accessible even to weaker students and yet will provide a challenge for the more advanced. A great future addition would be an interactive module builder that allows faculty to modify existing questions and add their own. How can one effectively use this program? The relatively low cost does make it accessible for individual students to purchase, perhaps as a "recommended" item for the class. Another very practical option is to purchase 5-10 copies (assuming a class size of around 30-40) and make them available through a common computer laboratory (or an appropriate network site-license arrangement) or for check-out to small groups of students. One drawback is that only about 1/3 of the major topics that fill the year in organic are covered. I have used some of the drills as in-class interactive examples with a projector and laptop. This type of interactive tutorial-quiz-based program is a welcome change from the simple textbook on a CD-ROM approach. Given easy access to computers and an environment that encourages individual and small-group interactions, I believe this program can be a worthwhile aid for students of organic chemistry.

  12. Helical Magnetic Fields in AGN Jets Y. J. Chen1,2,∗ , G.-Y. Zhao1,2 ...

    Indian Academy of Sciences (India)

    Abstract. We establish a simple model to describe the helical mag- netic fields in AGN jets projected on the sky plane and the line-of-sight. This kind of profile has been detected in the polarimetric VLBI observa- tion of many blazar objects, suggesting the existence of helical magnetic fields in these sources. Key words.

  13. VizieR Online Data Catalog: New IR photometric study of Ap and Am stars (Chen+, 2017) (United States)

    Chen, P. S.; Liu, J. Y.; Shan, H. G.


    In the General Catalog of Ap and Am stars (Renson & Manfroid 2009, Cat. III/260) 8265 stars are included in which, as Renson & Manfroid (2009, Cat. III/260) described, only 426 stars are of the "well known confirmed sample". We take these 426 stars as our working sample. The cross-identifications of 2MASS/WISE counterparts for all Ap, Am, and HgMn stars listed in this paper are made from Cutri et al. (2012, Cat. II/311) by using the radius of 2 arcsec. All 426 Ap, Am, and HgMn stars have 2MASS and/or WISE counterparts, which are listed in Table 3. The cross-identifications of IRAS counterparts are made according to the positional error ellipse of the source, because it has a 95% confidence level (IRAS Explanatory Supplement, Beichman et al. 1988, Cat. II/274). Finally, 202 stars are found to have the IRAS counterparts from IRAS PSC/FSC, which is listed in Table 4. (5 data files).

  14. J. Chen1, Z.-Q. Shen1, H. Sudou3, S. Iguchi4, Y. Murata5

    Indian Academy of Sciences (India)

    4National Astronomical Observatory of Japan, Tokyo 181-8588, Japan. 5The Institute of Space and Astronautical Science, JAXA, Kanagawa 229-8510, Japan. 6Research Center for Space and Cosmic Evolution, Ehime University,. Matsuyama 790-8577, Japan. ∗ e-mail: Abstract. It was argued that 3C ...

  15. X-ray Time Lags in TeV Blazars X. Chen1,∗ , G. Fossati1, E. Liang1 ...

    Indian Academy of Sciences (India)

    Abstract. We use Monte Carlo/Fokker–Planck simulations to study the. X-ray time lags. Our results show that soft lags will be observed as long as the decay of the flare is dominated by radiative cooling, even when acceleration and cooling time scales are similar. Hard lags can be pro- duced in the presence of a competitive ...

  16. Trichodina nobilis Chen, 1963 and Trichodina reticulata Hirschmann et Partsch, 1955 from ornamental freshwater fishes in Brazil

    Directory of Open Access Journals (Sweden)

    ML Martins

    Full Text Available In the present work Trichodina reticulata and T. nobilis (Ciliophora: Trichodinidae are morphologically characterised from ornamental freshwater fish culture in the State of Santa Catarina, Brazil. The prevalence of infection and a list of comparative measurements are discussed. We examined "southern platyfish" Xiphophorus maculatus (n = 35, "goldfish" Carassius auratus (n = 31, "guppy" Poecilia reticulata (n = 20, "sailfin molly" Poecilia latipinna (n = 6, "beta" Betta splendens (n = 2 and "spotted headstander" Chilodus punctatus (n = 1. After being anesthetised in a benzocaine solution, fishes were examined for parasitological evaluation. A total of 51.57% fishes were parasitised by Trichodina spp. Carassius auratus was the most parasitised species, followed by X. maculatus and P. reticulata. Beta splendens, C. punctatus and P. latipinna were not parasitised by any trichodinid species. Two species of Trichodina were collected from the skin of fish: T. nobilis was found in C. auratus, P. reticulata and X. maculatus and T. reticulata was only observed in C. auratus. The importance of adequate handling in ornamental fish culture are also discussed.

  17. On Meng Chen-shun's Romance Theory and His Opera and Drama Greation%孟称舜"传情"理论及其戏曲创作

    Institute of Scientific and Technical Information of China (English)




  18. 论陈亮事功主义伦理思想的基本特征%On Chen Liang's Essential Features of Utilitarian Ethics

    Institute of Scientific and Technical Information of China (English)




  19. Diskrepanz: Die EU-Frauenpolitik zwischen Deregulierung und Gleichheitsansprüchen Internal Discrepancies: EU Women’s Policies between Deregulation and Claims to Equality

    Directory of Open Access Journals (Sweden)

    Ingrid Biermann


    Full Text Available In von neun Autorinnen verfassten Beiträgen gibt der Band Einblicke in zentrale Felder der EU-Politik: die europäische Wirtschafts- und Währungsunion (EWWU, die Strukturpolitik, die Gleichstellungspolitik und das Gender Mainstreaming, die Osterweiterung sowie die Ausarbeitung einer europäischen Verfassung. Damit werden wesentliche Teile des Maastricht-Vertrags (1992, des Amsterdamer Vertrags (1997 und des Nizza-Vertrags (2000 behandelt. Hierdurch bildet dieser Band eine wichtige Grundlage für die Diskussion über die Frauenpolitik der EU.This anthology, consisting of nine essays written by women authors, offers insights into central areas of EU politics: the European Economic and Currency Union, structural policies, policies dealing with gender equality, the expansion of the EU, as well as the creation of a new European constitution. These policies include relevant parts of the 1992 Maastricht Treaty, the 1997 Treaty of Amsterdam, and the 2000 Treaty of Nizza. The information and insights presented here make this book an important basis for any discussions about EU women’s policies.

  20. Bya rog prog zhu, The raven crest : the life and teachings of bDe chen 'od gsal rdo rje treasure revealer of contemporary Tibet

    NARCIS (Netherlands)

    Terrone, Antonio


    This research starts from the historical assertion that notwithstanding their claim of increased religious tolerance, the dramatic post-Mao political campaigns have continued to weaken the pervasive force of religious faith, traditional monastery-centered religious power, religious leadership, and

  1. Discussion of “Nanoscale Fluid Mechanics and Energy Conversion” (Chen, X., Xu, B., and Liu, L., 2014, ASME Appl. Mech. Rev., 66(5), p. 050803)

    NARCIS (Netherlands)

    Eijkel, Jan C.T.


    The authors of the paper “Nanoscale Fluid Mechanics and Energy Conversion” have presented an overview of recent applications of nanofluidic phenomena for energy conversion and storage. The discussion given here aims to place this paper in a broader context of literature and theory.

  2. Redescription of Paragaleus tengi (Chen, 1963) (Carcharhiniformes: Hemigaleidae) and first record of Paragaleus randalli Compagno, Krupp & Carpenter, 1996 from the western North Pacific. (United States)

    White, William T; Harris, Mark


    Paragaleus tengi was previously considered to be the only member of this genus occurring in the Western Pacific, with Paragaleus randalli occurring in the Indian Ocean and allopatric in distribution. Recent molecular and morphological studies showed that P. randalli also occurs in the Western Pacific with records from Thailand, Malaysia and Indonesia previously mostly incorrectly attributed to P. tengi. This paper provides a redescription of P. tengi and confirms the presence of P. randalli from off Taiwan in the western North Pacific. These two species are morphologically very similar in appearance but differ in meristics, dentition, some coloration attributes and minor morphological characters. The conservation status of these two species needs to be reassessed based on this new information.

  3. How Structural Deficiencies Hamper Estonia’s Catching-up Process. Strukturschwächen als Hemmnis für Estlands Aufholprozess

    Directory of Open Access Journals (Sweden)

    Klaus Schrader


    Full Text Available Estonia is widely regarded as a paramount example for a successful transformation of a socialist economic system to a functioning market economy. Against the backdrop of this positive image which contrasts strongly with the crisis scenarios in Southern Europe the remaining problems of Estonia are often ignored. Estonia has hardly succeeded in catching-up economically with the richer countries of the EU. In this paper the authors raise the question why the catching-up process of Estonia is not as successful as it could have been expected from the policy performance during the last decades. It turns out that Estonia faces a serious productivity problem, particularly in the manufacturing sector producing tradable goods which is normally the driving engine behind economic and technological catching-up. The Estonian economy has failed to undergo the necessary structural change towards technologically more advanced employment structures and export patterns. Accordingly, Estonian economic policy needs to create a suitable business environment to support this kind of structural change.

  4. New World species of the genus Calliscelio Ashmead (Hymenoptera, Platygastridae, Scelioninae

    Directory of Open Access Journals (Sweden)

    Hua-yan Chen


    Full Text Available The genus Calliscelio Ashmead is presumed to be a diverse group of parasitoids of the eggs of crickets (Orthoptera: Gryllidae. A least one species has been found to be an important factor in depressing cricket pest populations. The New World species of Calliscelio are revised. Forty-two species are recognized, 3 are redescribed: C. bisulcatus (Kieffer, C. laticinctus Ashmead, C. rubriclavus (Ashmead, comb. n.; and 38 are described as new: C. absconditum Chen & Johnson, sp. n., C. absum Chen & Johnson, sp. n., C. alcoa Chen & Masner, sp. n., C. amadoi Chen & Johnson, sp. n., C. armila Chen & Masner, sp. n., C. bidens Chen & Masner, sp. n., C. brachys Chen & Johnson, sp. n., C. brevinotaulus Chen & Johnson, sp. n., C. brevitas Chen & Johnson, sp. n., C. carinigena Chen & Johnson, sp. n., C. crater Chen & Johnson, sp. n., C. crena Chen & Johnson, sp. n., C. eboris Chen & Johnson, sp. n., C. extenuatus Chen & Johnson, sp. n., C. flavicauda Chen & Johnson, sp. n., C. foveolatus Chen & Johnson, sp. n., C. gatineau Chen & Johnson, sp. n., C. glaber Chen & Masner, sp. n., C. granulatus Chen & Masner, sp. n., C. latifrons Chen & Johnson, sp. n., C. levis Chen & Johnson, sp. n., C. longius Chen & Johnson, sp. n., C. magnificus Chen & Masner, sp. n., C. migma Chen & Johnson, sp. n., C. minutia Chen & Johnson, sp. n., C. paraglaber Chen & Johnson, sp. n., C. pararemigio Chen & Masner, sp. n., C. prolixus Chen & Johnson, sp. n., C. punctatifrons Chen & Johnson, sp. n., C. remigio Chen & Masner, sp. n., C. ruga Chen & Johnson, sp. n., C. rugicoxa Chen & Masner, sp. n., C. sfina Chen & Johnson, sp. n., C. storea Chen & Johnson, sp. n., C. suni Chen & Johnson, sp. n., C. telum Chen & Johnson, sp. n., C. torqueo Chen & Johnson, sp. n., C. virga Chen & Johnson, sp. n. Four species are treated as junior synonyms of Calliscelio rubriclavus (Ashmead: Anteris nigriceps Ashmead, syn. n., Caloteleia marlattii Ashmead, syn. n., Caloteleia grenadensis Ashmead, syn. n

  5. Commentary on: "An integrated metabolic atlas of clear cell renal cell carcinoma." Hakimi AA, Reznik E, Lee CH, Creighton CJ, Brannon AR, Luna A, Aksoy BA, Liu EM, Shen R, Lee W, Chen Y, Stirdivant SM, Russo P, Chen YB, Tickoo SK, Reuter VE, Cheng EH, Sander C, Hsieh JJ.: Cancer Cell. 2016 Jan 11;29(1):104-16. (United States)

    Lee, Byron H


    Dysregulated metabolism is a hallmark of cancer, manifested through alterations in metabolites. We performed metabolomic profiling on 138 matched clear cell renal cell carcinoma (ccRCC)/normal tissue pairs and found that ccRCC is characterized by broad shifts in central carbon metabolism, one-carbon metabolism, and antioxidant response. Tumor progression and metastasis were associated with metabolite increases in glutathione and cysteine/methionine metabolism pathways. We develop an analytic pipeline and visualization tool (metabolograms) to bridge the gap between TCGA transcriptomic profiling and our metabolomic data, which enables us to assemble an integrated pathway-level metabolic atlas and to demonstrate discordance between transcriptome and metabolome. Lastly, expression profiling was performed on a high-glutathione cluster, which corresponds to a poor-survival subgroup in the ccRCC TCGA cohort. Copyright © 2017 Elsevier Inc. All rights reserved.

  6. Uso de plâncton silvestre, fermento fresco e levedura desidratada na alimentação de larvas do cascudo chinelo, Loricariichthys platymetopon (Isbrüchen & Nijssen, 1979 (Osteichthyes, Loricariidae Natural plankton, fresh ferment and dehydrated yeast utilization at Loricariichthys platymetopon (Isbrüchen & Nijssen, 1979 (Osteichthyes, Loricariidae, cascudo chinelo, fry feeding

    Directory of Open Access Journals (Sweden)

    Claudemir Martins Soares


    Full Text Available Objetivando avaliar a utilização de diferentes alimentos para larvas do cascudo chinelo Loricariichthys platymetopon (Osteichthyes, Loricariidae, 240 larvas com cinco dias pós-eclosão foram distribuídas em 20 aquários (12 L. Foram utilizados cinco tratamentos com quatro repetições cada, os quais consistiram do emprego de diferentes tipos de alimentos como: plâncton (P, fermento (F, levedura desidratada (LD e as combinações P+F e P+LD por 15 dias consecutivos. O F e a LD foram fornecidos à vontade três vezes ao dia, enquanto o P foi fornecido pela manhã, após os aquários serem sifonados. Os valores da temperatura, pH, condutividade elétrica e oxigênio dissolvido se mantiveram dentro de níveis aceitáveis para a aquicultura. Os valores de biomassa/aquário das larvas alimentadas com P+LD foram superiores aos dos alimentados com P, F e P+F, entretanto não diferiram daqueles com o uso de LD. As larvas alimentadas com P+LD apresentaram valores de peso final médio superiores às dos demais tratamentos, sendo que F levou a valores de peso final médio inferiores em comparação ao uso de P, LD e P+F. Observou-se menor sobrevivência com o uso de P em comparação a LD e P+LD. Conclui-se que se pode utilizar P+LD na criação do cascudo chinelo em suas fases iniciais de desenvolvimento.Aiming to evaluate different foods effects in the rearing of Loricariichthys platymetopon (Osteichthyes, Loricariidae fry, 240 5-day-after-hatch specimens were distributed in 20 aquarium glasses (12 L. Five treatments, with four repetitions each, were tested, consisting in: plankton (P, fresh ferment (F, dehydrated yeast (DY and the combinations P+F and P+DY, for 15 days. F and DY were given ad libitum three times a day, and P only in the morning, after the aquariums siphoning. Temperature, pH, electric conductivity and dissolved oxygen were in levels acceptable for fish. The fry biomass per aquarium values were higher for the P + DY treatment, when compared to P, F and P+F, but equal to DY. Also, P +DY-fed fry showed higher mean final weight than all the other treatments. F-treated fry showed mean final weight lower than the ones treated with P, DY and P+F. The P treatment showed lower survival rate than DY and P+DY. The results indicate that P + DY can be used for Loricariichthys platymetopon fry rearing during their initial development phases.

  7. 研究/電子資源使用統計標準與規範之探討/陳雪華;許嘉珍;朱雅琦 | Study of the Electronic Resources Usage Statistics Standards and Guidelines/ Hsueh-Hua Chen;Chia-Chen Hsu;Ya-Chi Chu

    Directory of Open Access Journals (Sweden)



    Full Text Available

    近年來,由於資訊科技的進步,圖書館中的電子資源數量快速增加,所佔預算金額比例也大幅增長。圖書館希望能夠透過評鑑電子資源的使用,以便能夠在電 子資源館藏發展等方面做出正確的決策。由於體認到電子資源使用統計之重要性,圖書館界與相關組織紛紛發展或修訂圖書館統計標準,增列電子資源使用統計的項 目以充分反映圖書館電子資源使用之狀況。本文主要採用文獻分析法以及內容分析法,收集探討並比較近軍來國內外電子資源使用統計之相關規範及標準,包含 ISO 2789、 ICOLC Guidelines、州ANSI/NISO Z39.7、CNS13151、ARL E-Metrlcs、E-Measures Project、以及Project COUNTER等。

    Recently, due to the advances of information technology, electronic resources are gradually replacing print resources as the largest consumer of library acquisition budgets. Logically, libraries want to evaluate the usage of electronic resources and incorporate the results into their decision making regarding electronic resource acquisition. Over these years, there is a general awareness among libraries to develop statistics standards and guidelines for library electronic resources usage. In this paper, literature review and content analysis methods are used to compare several library statistics standards, including: ISO 2789 、ICOLC Guidelines、ANSI/NISO Z39.7、CNS13151、ARL E-Metrics、E-Measures Project、and Project COUNTER etc.


  8. Bestimmung des Bodenreibungsbeiwertes und der Oberflächenreibung eisbedeckter Wasserflächen im Meiningenstrom der Darß-Zingster Boddenkette und Anwendung auf vertikal integrierte hydronumerische Modelle


    Schönfeldt, Hans-Jürgen; Raabe, Armin; Baudler, Henning


    In einem hydronumerischen Modell zur Prognose des Strömungs- und Wasserstandsfeldes flacher Gewässer wird eine auf der Turbulenztheorie basierende Tiefenkorrektur für den Bodenreibungsbeiwertwert eingeführt und auf der Basis von Berechnungen für die DarßZingster Boddenkette überprüft. Für einen ausgewählten Meßpunkt der Darß-Zingster Boddenkette wurde der Reibungsbeiwert sowohl am Boden als auch unter einer Eisschicht experimentell bestimmt. Die Auswirkungen einer Tiefenkorrektur des Reibungs...

  9. Das Usutu-Virus als Ursache von Massensterben bei Amseln Turdus merula und anderen Vogelarten in Europa: Erfahrungen aus fünf Ausbrüchen zwischen 2001 und 2011


    Bosch, Stefan; Schmidt-Chanasit, Jonas; Fiedler, Wolfgang


    Das Usutu-Virus (USUV) ist ein durch Stechmücken der Gattung Culex übertragenes Flavivirus. Es wurde wahrscheinlich durch Zugvögel oder Stechmücken nach Europa eingeschleppt und hat sich inzwischen dauerhaft in der einheimischen Stechmücken-und Vogelfauna etabliert. Seit seinem Erstnachweis 2001 in Österreich hat das USUV fünf größere Ausbrüche mit USUV-assoziierten Vogelsterben, vor allem unter Amseln und in Volieren gehaltenen Eulen, sowie vermutlich kleinere Ausbrüche ohne augenfälliges Vo...

  10. Monitoring Protein Conformation Changes as an Activating Step for Protein Interactions with Cross-linking/MS Analysis. / Chen, Zhuo; Rasmussen, Morten; Tahir, Salman; Clark, C.A.C; Barlow, Paul; Rappsilber, Juri

    DEFF Research Database (Denmark)

    Rasmussen, Morten

    of C3 to its active form C3b. C3 (187kDa) is a twelve domain protein (ANA, CUB, TED and MG1 to MG9). During the conversion of C3 to C3b, one domain, ANA (99 residues), is proteolytically removed and a number of domains change their position. This exposes protein-binding sites for downstream...... interactions in the complement response.   Methods 250 pmol of C3 and C3b were both cross-linked with a 1000X excess of cross-linkers. BS2G, BS3, and sulfo-EGS were applied respectively. The cross-linking products were separated with 1D-PAGE gel. Monomer bands were sliced and digested with trypsin. Cross......-terminus. The TED domain relocates as is revealed by three cross-links to the ANA domain in C3 and four cross-links to the MG1 domain in C3b, a domain that is remote in C3. In C3b case, a cross-link within the CUB domain suggests a folded structure of this domain, a matter of dispute in the competing crystal...

  11. JPRS Report, China

    National Research Council Canada - National Science Library


    ...; AGRICULTURE - Further Reform of Grain Circulation, Prices Advocated, Chen Yaobang on Market Challenges Facing Agriculture, Chen Yaobang on Restructuring of Crop Planting, MILITARY, PUBLIC SECURITY...

  12. Relationship between resistant hypertension and arterial stiffness assessed by brachial-ankle pulse wave velocity in the older patient

    Directory of Open Access Journals (Sweden)

    Chung CM


    Full Text Available Chang-Min Chung,1,2 Hui-Wen Cheng,2 Jung-Jung Chang,2 Yu-Sheng Lin,2 Ju-Feng Hsiao,2 Shih-Tai Chang,1 Jen-Te Hsu2,31School of Traditional Chinese Medicine, College of Medicine, Chang Gung University, 2Division of Cardiology, Chang Gung Memorial Hospital, Chiayi, 3Department of Medicine, College of Medicine, Chang Gung University, Taoyuan County, TaiwanBackground: Resistant hypertension (RH is a common clinical condition associated with increased cardiovascular mortality and morbidity in older patients. Several factors and conditions interfering with blood pressure (BP control, such as excess sodium intake, obesity, diabetes, older age, kidney disease, and certain identifiable causes of hypertension are common in patients resistant to antihypertensive treatment. Arterial stiffness, measured by brachial-ankle pulse wave velocity (baPWV, is increasingly recognized as an important prognostic index and potential therapeutic target in hypertensive patients. The aim of this study was to determine whether there is an association between RH and arterial stiffness. Methods: This study included 1,620 patients aged ≥65 years who were referred or self-referred to the outpatient hypertension unit located at a single cardiovascular center. They were separated into normotensive, controlled BP, and resistant hypertension groups. Home BP, blood laboratory parameters, echocardiographic studies and baPWV all were measured. Results: The likelihood of diabetes mellitus was significantly greater in the RH group than in the group with controlled BP (odds ratio 2.114, 95% confidence interval [CI] 1.194–3.744, P=0.010. Systolic BP was correlated in the RH group significantly more than in the group with controlled BP (odds ratio 1.032, 95% CI 1.012–1.053, P=0.001. baPWV (odds ratio 1.084, 95% CI 1.016–1.156, P=0.015 was significantly correlated with the presence of RH. The other factors were negatively correlated with the existence of RH.Conclusion: In

  13. Nomenclatural corrections to the taxonomic revision of The Old World species of Boehmeria (Urticaceae, tribus Boehmeriae) by Wilmot-Dear and Friis (2013)

    DEFF Research Database (Denmark)

    Wilmot-Dear, Christine Melanie; Friis, Ib; Govaerts, R. H. A.


    (H. Lév.) C.J. Chen in Chen et al. as the correct name for the variety named in the revision as B. zollingeriana Wedd. var. podocarpa (W.T. Wang) W.T. Wang & C.J. Chen in Chen et al., (3) that the combination B. spicata (Thunb.) Thunb., based on Urtica spicata Thunb., is not illegitimate, as stated...

  14. 專論/台灣圖書館史數位圖書館建構之研究/王梅玲;蔡明月;陳志銘;柯雲娥;蔡佳縈;陳勇汀;林怡甄 | A Digital Library Pilot Study on Taiwan Libraries' History / Mei-Ling Wang; Ming-Yueh Tsay; Chih-Ming Chen; Yun-Er Ke; Chia-Ying Tsai; Yong-Ting Chen; Yi-Jen Lin

    Directory of Open Access Journals (Sweden)



    Full Text Available

    圖書館是保存與詮釋人類文化重要的機構,1990 年代開始,網際網路的進步,促成數位圖書館蓬勃發展,有人預測它就是未來的圖書館,因此,圖書館界與教育界積極參與相關研究。台灣地區歷經日據時期、重建 時期、成長時期及茁壯時期四階段,建設許多圖書館,有其豐富的主題與素材值得發展成為數位圖書館。政治大學圖書資訊與檔案學研究所有鑑於此,提出「『台灣 百無圖書館史』數位圖書館」的構想,並獲得政大「發展國際一流大學及頂尖研究中心計畫」經費支持。本研究計畫目的包括:(1探索以台彎圖書館事業史為主 題的數位圖書館建構模式;(2建構數位圖書館以支援圖書資訊學教育與研究;(3研訂圖書館事業史料文獻的Metadata與數位資料格式;(4將圖 書文獻與文物數位化以建構數位館藏;(5發展數位圖書館系統與技術;(6研發數位圖書館網站的瀏覽與檢索功能;(7探討數位圖書館支援數位學習的模 式。計畫成果共研訂六種 Metadata標準:建置746筆數位化資料;以Dspace系統平台,依據需求設計台灣百年圖書館史系統架構與網站,最後提出結論與建議。

    Libraries are important social institutions that preserve and communicate human culture and knowledge. From the beginning of 1990s, the digital library has grown up rapidly based on the progress of the Internet. Libraries and educational institutions should be actively involved in digital library research and development. The Taiwan libraries’ history can be divided into four stages: Japanese occupation period, reconstruction period, growth period and strong period. In these processes, many events and libraries with rich materials that can be developed into a digital library. Graduate Institute of Library, Information and Archival Studies, National Chengchi University, planned the Digital Library Pilot Study on Taiwan Libraries’ History and got the university support. The pilot study objectives include: (1 exploring the digital library model on Taiwan libraries' history; (2 constructing digital library to support education and research in information and library science; (3 developing Metadata standards of library documents and heritage; (4 digitalizing documents and heritage to build digital collections (5 developing digital library systems and technology; (6 researching browsing and search functions of the digital library; (7 exploring the model of the digital library supports e-learning. In this pilot study, we developed six Metadata standards, built 746 digital resources, constructed a digital library system and web site, and proposed the conclusions and suggestions finally.


  15. China Report, Political, Sociological and Military Affairs, No. 445. (United States)


    2052 0981], Chen Dingming [7115 7844 6900], Jin Xiulan [6855 4423 5695] (F, Mongolian), Zhao Nanqi [6392 0589 6386] Korean), Suo Jingxian [4792...Pen Center and the Guangzhou Pen Center will be headed by Chen Huangmei, another vice-president of the China center and a noted critic. The...1728 4426 6311], Zhang Tengxiao [1728 7506 7197], Chen Dingmou [7115 0002 5399], Chen Lunfen [7115 0243 5358] (F), Chen Xitong [7115 1585 0681

  16. Technical Digest of the 1998 Summer Topical Meeting on Organic Optics and Optoelectronics (United States)


    Larry Dalton, University of Southern California, Los Angeles, CA Harold Fetterman , University of California, Los Angeles, CA Steve Forrest...OPTIC MODULATORS H. Fetterman , D. Chen, A. Udupa. D. Bhattachaya, B. Tsap University of Califonia, Los Angeles 90024 S. Lee, A. Chen, J. Chen, W...Chen, H.R. Fetterman , A. Chen, W.H. Steier, and L. R. Dalton, Appl. Phys. Lett. 70, (1997). 2. T.A. Tumolillo and P.R. Ashley, Appl. Phys. Lett. 62

  17. Use of epoxidized natural rubber as a compatibilizer in silica-filled natural rubber tire tread compounds ; Verwendung von epoxydiertem Naturkautschuk als Verträglichkeitsvermittler in Zusammensetzungen aus kieselsäuregefülltem Naturkautschuk für Reifenlaufflächen

    NARCIS (Netherlands)

    Sengloyluan, K.; Sahakaro, Kannika; Noordermeer, Jacobus W.M.


    Silica-reinforced natural rubber (NR) tire tread compounds with epoxidized natural rubber (ENR) as a compatibilizer are investigated. ENR contents of 2.5-15.0 phr, with epoxide levels of 10, 38 and 51 mol%, are used. The addition of ENRs, especially ENR-38 and ENR-51, as compatibilizers decreases


    Institute of Scientific and Technical Information of China (English)



    东方叶肢介(Eosestheria)是著名热河生物群中最为常见的一类甲壳动物,关于它的形态、壳瓣结构及微细纹饰特征的研究已相当详尽,但一直没有关于其软体构造的报道。本文描述的凌源东方叶肢介(Eosestheria lingyuanensis)采自辽宁北票市尖山沟村,产于下白垩统义县组的尖山沟夹层。这些软体构造包括:头部形态、眼、闭壳肌痕、雄性执握肢、体节、消化道及尾节等。通过与现生叶肢介软体形态构造比较,显示其与刺尾亚目的蚌壳虫科的代表最为亲近。从而为探讨化石与现生叶肢介之间的演化关系及建立高一级的统一分类,提供了有价值的依据。%The clam shrimp Eosestheria is an extraordinarily abundant and important member of the con-chostracan fauna from the famous Jehol Biota. Here the occurrence of partial soft body preservation in E. Lingyuanensis is reported for the first time, occurring as impressions, inside the valve, of the head, eye, adductor muscle scar, male claspers, digestive tube, and telson.The exceptionally preserved specimens were found in the Lower Cretaceous Yixian Formation at Jianshangou village, near Beipiao, in Liaoning Province of NE China. The preservation of soft parts in conchostracans is significant partly because its occurrence is very rare-known previously only from about 16 species . Worldwide and several of which are actually much less complete than the present material. Soft body characteristics are also important for accurate taxonomic determination and assessment of relationships. For example, all conchostracan males have the first pair of trunk limbs modified to form so called 'claspers', which hold to the female during mating. Some modification of the second pair of trunk limbs is seen in lae-vicaudatan conchostracans, two species of which are also known as fossils with soft body parts, butthe second pair appears not to be clasper-like in form. Eosestheria lingyuanensis on the other hand has two pairs of clearly defined claspers as in spini-caudatan conchostracans. Furthermore in its more distinct growth lines and acute rostrum as well as its two pairs of claspers it clearly belongs to the suborder Spinicaudata. Within that group, although it is similar to the Cyzicidae in its rostrum lacking an apical spine and in its short stout telson, it differs in its less developed occipital notch and larger palp with a row of pores.Although the name Conchostraca is commonly used in fossil and extant literature, recent molecular and morphological analyses show that the 'Conchostraca' appears not to be a monophyletic group. As such it has no taxonomic meaning. It has therefore been abandoned as a taxonomic unit by many authors. However, Shen et al. (2006) retain use of the 'Conchostraca', which include five suborders. Laevicaudata, Spinicaudata, Cycles-therida, Leaiina and Estheriellina. The two latter are distinct extinct groups and their soft bodies were found recently in several specimens. Leaiina with 1-5 radial carina on the carapace valve ranges from the Devonian to Permian and Estheriellina with 3-16 radial costae on the carapace valve appears in the Triassic to Cretaceous interval.

  19. Comments on X. Yin, A. Wen, Y. Chen, and T. Wang, `Studies in an optical millimeter-wave generation scheme via two parallel dual-parallel Mach-Zehnder modulators', Journal of Modern Optics, 58(8), 2011, pp. 665-673 (United States)

    Hasan, Mehedi; Maldonado-Basilio, Ramón; Hall, Trevor J.


    Yin et al. have described an innovative filter-less optical millimeter-wave generation scheme for octotupling of a 10 GHz RF oscillator, or sedecimtupling of a 5 GHz RF oscillator using two parallel dual-parallel Mach-Zehnder modulators (DP-MZMs). The great merit of their design is the suppression of all harmonics except those of order ? (octotupling) or all harmonics except those of order ? (sedecimtupling), where ? is an integer. A demerit of their scheme is the requirement to set a precise RF signal modulation index in order to suppress the zeroth order optical carrier. The purpose of this comment is to show that, in the case of the octotupling function, all harmonics may be suppressed except those of order ?, where ? is an odd integer, by the simple addition of an optical ? phase shift between the two DP-MZMs and an adjustment of the RF drive phases. Since the carrier is suppressed in the modified architecture, the octotupling circuit is thereby released of the strict requirement to set the drive level to a precise value without any significant increase in circuit complexity.

  20. 專論/以關鍵詞網絡探討動態性知識管理議題/陳良駒;張正宏 | Exploring Dynamic Knowledge Management Research Issues: A Keyword Network Analysis / Liang-Chu Chen; Jeng-Horng Chang

    Directory of Open Access Journals (Sweden)



    Full Text Available

    知識管理是企業邁向知識經濟時代的實務顯學,也是學術界近年來持續探討的重要研究議題。然而知識管理的面向是一種多維度的呈現,如何快速而正確的瞭 解知識管理議題的發展,是許多組織知識工作者及學術研究學者努力的目標。許多學者提出知識管理內容的架構及分類,但卻都是屬於一種由上而下的靜態設計。社 會網絡分析是呈現及量測網絡實體成員互動的技術,適合建構關係網絡的動態性。本文嘗試以關鍵詞網絡來分析國內資訊相關系所從事知識管理研究的主題及脈絡, 並透過關鍵詞的連結來建構一套動態性的知識管理研究範疇。研究成果除驗證知識管理學域中的研究重點,更透過網絡關係來連結多樣性的研究構想,進而提供產官 學界更宏觀且動態的知識管理研究建議。

    Knowledge management (KM is an important practice in a corporation and an essential issue that academic scholars intend to explore continuously in the era of knowledge economy. However, KM presents a variety of perspectives that are still undefined for many knowledge workers and academic researchers. Many scholars propose a few categories and frameworks about KM, but a static outcome. Social network analysis (SNA is a method to present and measure the interaction among network entities and it is suitable to construct the dynamic relationship networks. The purpose of this study is to acquire the research issues and contexts of KM within information-related graduate schools based on a keyword network analysis. Moreover, we build a dynamic KM research network through these linkages with keywords. The results of this study confirm the essential research perspectives in a KM domain and suggest a variety of KM research ideas which provide the industries, governments, and academic communities with a macro and dynamic KM research viewpoint.


  1. Response to the comment by C. Kisielowski, H.A. Calderon, F.R. Chen, S. Helveg, J.R. Jinschek, P. Specht, D. Van Dyck on the article "On the influence of the electron dose-rate on the HRTEM image contrast" by J. Barthel, M. Lentzen, A. Thust, Ultramicroscopy 176 (2017) 37-45. (United States)

    Barthel, Juri; Lentzen, Markus; Thust, Andreas


    In a recent article [1] we examined the influence of the applied electron dose rate on the magnitude of the image contrast in high-resolution transmission electron microscopy (HRTEM). We concluded that the magnitude of the image contrast is not substantially affected by the applied electron dose rate. This result is in obvious contradiction to numerous earlier publications by Kisielowski and coworkers [2-7], who commented our recent article due to this contradiction. The present short communication is a response to the comment of Kisielowski and coworkers on our recent article, where we provide additional arguments supporting our initial findings and conclusions on the magnitude of the image contrast in HRTEM. Copyright © 2017 Elsevier B.V. All rights reserved.

  2. 實徵研究/國小教師以CREATER模式推動資訊素養創新課程之歷程/謝佩紋;林菁|The Process of Elementary School Teachers Implementing an Innovation Curriculum of Information Literacy with CREATER Model/Pei-Wen Hsieh; Lin Ching Chen

    Directory of Open Access Journals (Sweden)

    謝佩紋、林菁 Pei-Wen Hsieh; Lin Ching Chen


    Full Text Available 本研究旨在探究國小教師推動資訊素養創新課程的歷程,並以CREATER革新模式的七個階段為架構,深入瞭解教師作為創新推動者在每個階段的經歷及結果,以提供有意推動資訊素養理念或其它創新的教育工作者參考。本研究採個案研究,以南部一所國小為研究個案,研究時間歷時一年半,透過觀察、訪談、文件分析等方法進行資料的蒐集。研究結果發現,國小教師推動資訊素養課程的歷程大致與CREATER模式的七個階段相符,但「關心」、「連結」與「檢視」階段並無明顯次序,教師以組織內成員的角色推動創新,能有效地將創新理念化為行動,但行動能否持續及發揮效果,還有賴團隊組成的完整性、教師的持續更新力及組織內掌握實權者的支持與參與。The purpose of this study was to explore the change process of implementing an information literacy curriculum by elementary school teachers. Based on the CREATER model, this study investigated the teachers’ experiences as change agents in each stage of the process. The research results could provide guidelines for educators who are devoted to promote the information literacy or other innovations. The method of case study was used to design this study. The subjects of this study were the teachers who voluntarily implemented the information literacy curriculum in an elementary school in the southern part of Taiwan. The methods for collecting research data were observations, interviews, and document analyses. The research results showed that the change process of implementing the information literacy curriculum corresponded to the seven stages of the CREATER model. However, the stages of “care,” “relate,” and “examine,” did not obviously happen in sequence. As members of the organization, the teachers could transform effectively the innovative concept into an action, but whether the innovation could be persistent depended on team relationships, teachers’ self-renewal capacity, and approvals and participation of the leaders who really managed the organization.頁次:70-89

  3. Fortschritt als Fraktur im frühen Science Fiction Film. Metaphorologische Überlegungen zu Auf- und Einbrüchen in LE VOYAGE DANS LA LUNE und LE VOYAGE À TRAVERS L`IMPOSSIBLE von G. Méliès

    Directory of Open Access Journals (Sweden)

    Hartmann, Jörg


    Full Text Available Fantasies of man travelling into space form a main part of the popular movie genre ‘Science Fiction’. These celluloid visions are not only fantasies of improving transport, they also convey a meaning in a figurative sense. They can be seen as a modern adoption of one of humanities oldest metaphors, ‘life as a sea fare voyage’: the meaning, which was once expressed by this ‘nautical metaphor’, has been transferred and can nowadays be found in films, which show astro-nauts crossing the frontier from known space into the unknown space. In order to conclude on their attitude towards technological progress in the early 20th century, the two oldest space travel movies, Le Voyage dans la Lune (F 1902 and Le Voyage a Travers L’Impossible (F 1904 will be analyzed.

  4. Web Usability Policies/Standards/Guidelines Do Not Influence Practices at ARL Academic Libraries. A Review of: Chen, Yu‐Hui, Carol Anne Germain and Huahai Yang. “An Exploration into the Practices of Library Web Usability in ARL Academic Libraries.” Journal of the American Society for Information Science and Technology 60.5 (2009: 953‐68.

    Directory of Open Access Journals (Sweden)

    Shandra Protzko


    Full Text Available Objective – To survey the current status of Web usability Policies/Standards/Guidelines (PSGs found in academic libraries of the Association of Research Libraries (ARL. Researchers sought to investigate whether PSGs are in place, the levels of difficulty surrounding implementation, the impact of PSGs on design, testing, and resource allocation, and the relationship between ARL ranking and usability practice or PSGs.Design – Survey.Setting – North America.Subjects – Academic libraries of the ARL.Methods – An 18‐question survey consisting of multiple choice, Likert scale, and open‐ended questions was sent to all 113 ARL libraries in November 2007. Survey recipients were selected as the person in charge of Web site usability by visiting library Web sites and phone inquiry. The survey was concluded in January 2008 with a response rate of 74% (84 institutions. The researchers used t‐test to detect any difference in ARL library ranking between libraries with and without PSGs. Pair‐wise t‐tests were conducted to identify gaps in difficulty implementing PSGs. In addition, they used Pearson’s Correlation to investigate any significant correlations between variables such as ARL rank and resource allocation.Main Results – Of the 84 respondents, 34 (40% have general library Web PSGs and 25 (30% have specific usability PSGs; 41 (49% have at least one type of in‐library PSG. Of the 43 (51% libraries that do not have PSGs, 30 (36% are at universities with institutional Web usability PSGs; 26 (87% follow those guidelines. There was no statistically significant relationship between ARL ranking and PSG status (see Table 1. The authors asked about difficulty in implementing PSGs. Of the 32 libraries responding to a question about general library Web PSGs, most had slight or moderate difficulty. Twenty‐three libraries with specific usability PSGs identified difficulty levels; some had no difficulty, but a majority had moderate difficulty. For the 26 libraries using institutional Web usability PSGs, most had no or slight difficulty. Pair‐wise t‐tests showed that library Web usability PSGs were significantly more difficult to implement than university Web usability PSGs. Enforcement/agreement issues were reported as the primary difficulty in implementing in‐library PSGs. Technical issues and ambiguity were obstacles at the institutional level. More than half of the 84 libraries have Web advisory committees and about one third have usability committees or Web usability subcommittees. Several libraries answered that they have none of these committees, but indicated that they have some sort of ad hoc committee or user study group to address usability issues. Of the 84 respondents, 71 (85% have conducted usability testing. Sixty‐two libraries (73.8% rated usability testing as important, very important, or extremely important: the rate given for the importance of usability testing did not correlate with ARL ranking. Cited most often in open ended questioningwere the importance of iterative testing, library wide buy‐in, and staff and resource availability. Main web pages were tested most frequently. Fifty‐three libraries (74.6% tested their lower level pages at least once. OPACs were tested the least often. The amount of testing was impacted neither by the existence of library Web PSGs nor usability PSGs. The top two testing methods were in‐person observation and think aloud protocol.Of the 84 libraries, 24 (28% reported having staff dedicated to Web usability issues; twenty full‐time staff and four part‐time staff. There was a weak association between ARL ranking and hours worked by dedicated staff; no association existed for regular staff who take on Web responsibilities. Fifty‐one (60% of libraries had regular staff whose duties included Web usability; forty‐six full‐time and five part‐time. Training did not correlate to amount of testing methods used. There was a weak link between ALR ranking and availability of resources and, the authors showed, more testing was done as resources increased. In response to a query about future Web usability plans, the focus was on usability testing and site redesign, with only three libraries planning to refine or establish usability PSGs.Conclusion – The authors hypothesized that “web usability PSGs would influence usability practice within libraries and other institutions” (953. The data show that PSGs do not influence practices. The authors conclude that there is no significant relationship between PSGs and testing practices or PSGs and the availability of resources. Likewise, ARL ranking had no effect on the establishment of usability PSGs. Most libraries are conducting usability testing, and there was a weak link between ARL ranking and availability of testing resources. Highlighted in the open‐ended questions is the lack of usability expertise among stakeholders. Workload, inadequate human resources, and lack of organizational cohesion are also cited as barriers to the adoption of Web usability PSGs. The authors speculate that Web professionals likely use their own working knowledge and internalized guidelines without having formal documentation. The authors further speculate that the difficulty related to creating mental models that adequately represent library tasks may hinder the use of formal usability PSGs. Additionally, libraries may not regard the lack of usability PSGs as a liability, especially in light of the lack of government mandates or standards. The authors recommend educational efforts for key players on the value of Web usability, support for hiring dedicated staff, and formal documentation to guide design practice. The authors plan to compare the collected PSGs in an upcoming project. Future research could focus on non‐ARL libraries, the relationship between PSGs and user experience, and Content Management System (CMS usability characteristics.

  5. Effects of water stress and seed mass on germination and ...

    African Journals Online (AJOL)



    Mar 1, 2012 ... polyvinylpyrrolidone; TCA, trichloroacetic acid; NBT, nitroblue tetrazolium; TBA ..... seeds had weaker resistances to moderate stress (-0.6. MPa) compared with .... Chen YN,Chen YP,Li WH,Zhang HF (2003). Response of ...

  6. How Many Women Are Affected by or at Risk of Preeclampsia? (United States)

    ... pregnancy outcomes: Differences among 4 racial/ethnic groups. American Journal of Public Health, 95 (9), 1545–1551. Lin, H. C., Chen, S. F., Lin, H. C., & Chen, Y. H. (2010). Increased risk of adverse pregnancy outcomes ...

  7. Proceedings – Mathematical Sciences | Indian Academy of Sciences

    Indian Academy of Sciences (India)

    Author Affiliations. Yanheng Chen1 2 Guiyun Chen1. School of Mathematics and Statistics, Southwest University, Chongqing 400715, People's Republic of China; School of Mathematics and Statistics, Chongqing Three Gorges University, Chongqing 404100, People's Republic of China ...

  8. Kinetic investigation on enantioselective hydrolytic resolution of ...

    African Journals Online (AJOL)

    Kinetic investigation on enantioselective hydrolytic resolution of epichlorohydrin by crude epoxide hydrolase from domestic duck liver. X Ling, D Lu, J Wang, J Chen, L Ding, J Chen, H Chai, P Ouyang ...

  9. 77 FR 11620 - Notice of Request for the Extension of a Currently Approved Information Collection (United States)


    ... Reduction Act of 1995, this notice announces the intention of the Federal Transit Administration (FTA) to... INFORMATION CONTACT: Roy Chen, FTA Office of Technology, (202) 366-0462, or email:

  10. Reference: 291 [Arabidopsis Phenome Database[Archive

    Lifescience Database Archive (English)

    Full Text Available 291 Chai Mao-Feng...d chloroplast protection. 4 553-64 16244906 2005 Nov Plant molecular biology An Rui|Chai Mao-Feng|Chen Jia|Chen Qi-Jun|Chen Ye-Miao|Wang Xue-Chen

  11. Journal of Genetics | Indian Academy of Sciences

    Indian Academy of Sciences (India)

    Author Affiliations. Chen Bin1 Zeng Zhirong1 Wu Xiaoqin1 Chen Minhu1 Li Mei1 Gao Xiang1 Chen Baili1 Hu Pinjin1. Department of Gastroenterology, the First Affiliated Hospital, Sun Yat-sen University, 58 Zhongshan II Road, Guangzhou 510080, People's Republic of China ...

  12. Tropical Journal of Pharmaceutical Research - Vol 15, No 3 (2016)

    African Journals Online (AJOL)

    Wan Wu, Wei Chen, Qiong Jin, 447-451 ... Chung-Shih Chen, Mei-Lin Wang, Rosa Huang Liu, Shih-Pin Chen, Tsong-Ming Lu, Wei-Yu Tsai, Chien-Fu Huang, ... Yan-Qiong Li, Rui Hu, Li-Hui Zhong, Qian Sun, You-Ping Yan, 527-533.

  13. Untitled

    Indian Academy of Sciences (India)

    Beak P and Chen C W 1985 Tetrahedron Lett. 4979. Boatman R J, Whitlock B J and Whitlock H W 1977 J. An. Chen. Soc. 99 4822. Diamond S E, Szalkiewicz A and Mares F 1979 J. Ann. Chen. Soc. 101 490. Ellefson C R 1979 J. Org. Chem. 44 1533. Gschwend H W and Rodriguez H R 1979 Organic reactions 26 Chapter I.

  14. Untitled

    Indian Academy of Sciences (India)

    Smith and Carson ... Z. Physikal. Chenn., 1908, 6, 200. 13. Ephraim ... Z. anord. Chen., 190S, 58, 33S. 14. Wright ... J. Chen. Soc, 1915, 107, 1527. 15. Amadori ... Gazetta, 1922, 1, 52, 387. 16. Mori ... J. Chen. Soc., Japa), 1923, 44, 730. 17. Waradachari and Subra- Proc. Ind. Acad, Sci., 1936, 3 A, 428. Ilala. 18. Hervey and ...

  15. Three new species of the genus Gnamptogenys (Hymenoptera, Formicidae from southern China with a key to the known Chinese species

    Directory of Open Access Journals (Sweden)

    Zhilin Chen


    Full Text Available Three new species of the genus Gnamptogenys Roger, 1863 are described from southern China: Gnamptogenys dentihumera Chen, Lattke & Zhou, sp. n., Gnamptogenys nanlingensis Chen, Lattke & Zhou, sp. n. and Gnamptogenys quadrutinodules Chen, Lattke & Zhou, sp. n. A distribution map and an identification key to workers for the known species of China are provided.

  16. Sadhana | Indian Academy of Sciences

    Indian Academy of Sciences (India)

    Influence of free water content on the compressive mechanical behaviour of cement mortar under high strain rate · Jikai Zhou Xudong Chen Longqiang Wu Xiaowei Kan ... pp 111-117. Mechanical properties of concrete to cyclic uniaxial tensile loading using variable waveforms · YUZHI CHEN XUDONG CHEN JINGWU BU.

  17. Calycosin regulates glucocorticoid-induced apoptosis via Nrf2/ARE ...

    African Journals Online (AJOL)

    Lifeng Fu1, WeiLiang Wu2, Jian Zhu2, Shu Qiang2, Jansong Chen2* ... Results: CA reduced the apoptosis and accumulation of ROS in DEX-treated cells. ..... its downstream effectors (Figure 5 A-C). However .... Cao J, Chen Z, Zhu Y, Li Y, Guo C, Gao K, Chen L, Shi ... Hong W. Experimental study on the effect of Calycosin.

  18. Construction of full-length cDNA library of white flower Salvia ...

    African Journals Online (AJOL)



    May 18, 2009 ... of S. miltiorrhiza bge (Yuan et al., 1990; Wang et al.,. 1998; Huang et al., 2000). Hairy roots and ... or A. tumefaciens strains (Chen et al., 1997; Song et al.,. 1997). ..... Chen H, Yuan JP, Chen F, Zhang YL, Song JY (1997).

  19. Two new genera and three new species of Epipaschiinae Meyrick from China (Lepidoptera, Pyralidae

    Directory of Open Access Journals (Sweden)

    Mingqiang Wang


    Full Text Available Two new genera of Epipaschiinae are described. The genus Arcanusa Wang, Chen & Wu, gen. n. is established for Ar. apexiarcanusa Wang, Chen & Wu, sp. n. and Ar. sinuosa (Moore, 1888, comb. n., described in Scopocera Moore, 1888 (junior synonym of Stericta Lederer, 1863. The female genitalia of Ar. sinuosa (Moore, 1888, comb. n. are described for the first time. Androconia Wang, Chen & Wu, gen. n. is erected, including two new species, An. rallusa Wang, Chen & Wu, sp. n. and An. morulusa Wang, Chen & Wu, sp. n. Illustrations of all adults and their genitalia, and a key to the two new genera are provided.

  20. Revision of the subfamily Opiinae (Hymenoptera, Braconidae from Hunan (China, including thirty-six new species and two new genera

    Directory of Open Access Journals (Sweden)

    Li Xi-Ying


    postpectalis sp. n. are described. All species are illustrated and keyed. In total 30 species of Opiinae are sequenced and the cladograms are presented. Neopius Gahan, 1917, Opiognathus Fischer, 1972, Opiostomus Fischer, 1972, and Rhogadopsis Brèthes, 1913, are treated as a valid genera based on molecular and morphological differences. Opius vittata Chen & Weng, 2005 (not Opius vittatus Ruschka, 1915, O. ambiguus Weng & Chen, 2005 (not Wesmael, 1835 and O. mitis Chen & Weng, 2005 (not Fischer, 1963 are primary homonyms and are renamed into Phaedrotoma depressa Li & van Achterberg, nom. n., Opius cheni Li & van Achterberg, nom. n. and O. wengi Li & van Achterberg, nom. n., respectively. Phaedrotoma terga (Chen & Weng, 2005 comb. n., Diachasmimorpha longicaudata (Ashmead, 1905 and Biosteres pavitita Chen & Weng, 2005, are reported new for Hunan, Opiostomus aureliae (Fischer, 1957 comb. n. is new for China and Hunan; Xynobius maculipennis (Enderlein, 1912 comb. n. is new for Hunan and continental China and Rhogadopsis longuria (Chen & Weng, 2005 comb. n. is new for Hunan. The following new combinations are given: Apodesmia puncta (Weng & Chen, 2005 comb. n., A. tracta (Weng & Chen, 2005 comb. n., Areotetes laevigatus (Weng & Chen, 2005 comb. n., Phaedrotoma dimidia (Chen & Weng, 2005 comb. n., P. improcera (Weng & Chen, 2005 comb. n., P. amputata (Weng & Chen, 2005 comb. n., P. larga (Weng & Chen, 2005 comb. n., P. osculas (Weng & Chen, 2005 comb. n., P. postuma (Chen & Weng, 2005 comb. n., P. rugulosa (Chen & Weng, 2005 comb. n., P. tabularis (Weng & Chen, 2005 comb. n., Rhogadopsis apii (Chen & Weng, 2005 comb. n., R. dimidia (Chen & Weng, 2005 comb. n., R. diutia (Chen & Weng, 2005 comb. n., R. longuria (Chen & Weng, 2005 comb. n., R. pratellae (Weng & Chen, 2005 comb. n., R. pratensis (Weng & Chen, 2005 comb. n., R. sculpta (Chen & Weng, 2005 comb. n., R. sulcifer (Fischer, 1975 comb. n., R. tabidula (Weng & Chen, 2005 comb. n., Xynobius complexus (Weng & Chen, 2005 comb. n

  1. Browse Title Index

    African Journals Online (AJOL)

    Items 51 - 100 of 1309 ... Li-Long Liu, Kai Xu, Lu-Mei Kang, Shu-Ping Jiang, Qing-Hua Wang, ... CR Sewani-Rusike, JE Iputo, EJ Ndebia, M Gondwe, DR Kamadyaapa ... K-M Man, W-C Chen, H-M Wang, H-Y Chen, J-L Shen, L-D Chen, F-J Tsai, ...

  2. Soil Behavior Under Blast Loading (United States)


    in detail (Lade 2005, Prevost and Popescu 1996, Chen and Baladi 1985). Models that are appropriate to be implemented into finite element programs...Chen and Baladi 1985). As the soil strain hardens, both the cone and the end cap expand. This concept of cap envelope was a major step forward...hardening cap model (Chen and Baladi 1985) 17 The modified Cam-clay model was developed at Cambridge University by Roscoe et al. (1963). This

  3. Reference: 418 [Arabidopsis Phenome Database[Archive

    Lifescience Database Archive (English)

    Full Text Available 418 Chai Mao-Feng...cid responses in Arabidopsis. 5 665-74 16856986 2006 Sep The Plant journal An Rui|Chai Mao-Feng|Chen Jia|Chen Qi-Jun|Wang Xue-Chen|Wei Peng-Cheng|Yang Shuhua

  4. Taiwan in 2004: Elections, Referenda, and Other Democratic Challenges

    National Research Council Canada - National Science Library

    Dumbaugh, Kerry


    .... In both the presidential and legislative election campaigns, Chen emphasized gaining a separate international identity for Taiwan -- an emphasis to which Beijing strenuously objected as dangerously...

  5. 77 FR 28880 - Ocean Transportation Intermediary License Applicants (United States)


    ... (NVO & OFF), 332 Hindry Avenue, Inglewood, CA 90301, Officers: Edison Chen, Manager (Qualifying..., Schiller Park, IL 60176, Officers: Scott A. Case, Vice President (Qualifying Individual), Thomas C. Case...

  6. Journal of Biosciences | Indian Academy of Sciences

    Indian Academy of Sciences (India)

    Home; Journals; Journal of Biosciences. Chen Fang. Articles written in Journal of Biosciences. Volume 30 Issue 3 June 2005 pp 351-357 Articles. Expression of a ribosome inactivating protein (curcin 2) in Jatropha curcas is induced by stress · Wei Qin Huang Ming-Xing Xu Ying Zhang Xin-Shen Chen Fang · More Details ...

  7. Evaluation of effectiveness in a novel wound healing ointment ...

    African Journals Online (AJOL)

    Evaluation of effectiveness in a novel wound healing ointment-crocodile oil burn ointment. Hua-Liang Li, Yi-Tao Deng, Zi-Ran Zhang, Qi-Rui Fu, Ya-Hui Zheng, Xing-Mei Cao, Jing Nie, Li-Wen Fu, Li-Ping Chen, You-Xiong Xiong, Dong-Yan Shen, Qing-Xi Chen ...

  8. Enhanced Thermal Transport of Surfaces with Superhydrophobic Coatings (United States)


    resistance conferred by superhydrophobic fluorinated polyacrylate-silica composite coatings on cold-rolled steel. Journal of Applied Polymer Science... thiolates on metals as a form of nanotechnology. ChemInform. 2005:36. doi: 10.1002/chin.200532281. 9. Chen C-H, Cai Q, Tsai C, Chen C-L, Xiong G

  9. Advances in SCA and RF-DNA Fingerprinting Through Enhanced Linear Regression Attacks and Application of Random Forest Classifiers (United States)


    22:477– 505 , 2007. [21] Bushnell, Michael L. and Vishwani Agrawal. Essentials of Electronic Testing for Digital, Memory, and Mixed-Signal VLSI...Investigation”. Knowledge and information systems, 10(4):453–472, 2006. [68] Liang, Nia -Chiang, Ping-Chieh Chen, Tony Sun, Guang Yang, Ling-Jyh Chen

  10. A comparative study assessing a new tool for occluding ...

    African Journals Online (AJOL)

    0.630, p=0.068 and p=0.047, respectively) (Table 2). A comparative study assessing a new tool for occluding parenchymal blood flow during liver resection for hepatocellular carcinoma. S Zhou, X-J Xue, R-R Li, D-F Chen, W-Y Chen, G-X Liu, ...

  11. (DEPSCOR FY 09) Obfuscation and Deobfuscation of Intent of Computer Programs (United States)


    increased as the malware distribution mechanism has moved to the web through infected sites. In this use a site is hacked so as to distribute malware to...Simpósio Brasileiro em Segurança da Informaçao e de Sistemas Computacionais (2009). (Chen et al., 2012) Jundong Chen, Matthias R. Brust, Vir V. Phoha

  12. The roles of electronic books in the transformation of learning and instruction

    NARCIS (Netherlands)

    Huang, Ronghuai; Chen, Nian-Shing; Kang, Myunghee; McKenney, Susan; Churchill, Daniel


    Huang, R., Chen, N., Kang, M. McKenney, S. & Churchill, D. (2013). The roles of electronic books in the transformation of learning and instruction. In N. Chen, R. Huang, Kinshuk, Y. Li, D. G. Sampson (Eds.) Proceedings of the IEEE 13th International Conference on Advanced Learning Technologies

  13. African Journal of Biotechnology - Vol 10, No 60 (2011)

    African Journals Online (AJOL)

    Microsatellite variability reveals significant genetic differentiation of giant pandas (Ailuropoda melanoleuca) in the Minshan A habitat · EMAIL FREE FULL TEXT EMAIL FREE FULL TEXT DOWNLOAD FULL TEXT DOWNLOAD FULL TEXT. J Yang, R Hou, F Shen, X Yang, L Zhang, L Chen, W Chen, W Zhang, Q Zhu, Z Zhang ...

  14. Trend analysis and change point detection of annual and seasonal ...

    Indian Academy of Sciences (India)

    elevation ranges from 0 m in the coastal areas of the. Persian Gulf to over ... been explained by Kang and Yusof (2012); Dhorde ...... J L 2004 Detection of statistically significant trends in ... Sun H, Chen Y, Li W, Li F, Chen Y, Hao X and Yang Y.

  15. The effects of growth time on the quality of graphene synthesized by ...

    Indian Academy of Sciences (India)

    by LPCVD. A JAFARI, R ALIPOUR∗ and M GHORANNEVISS ..... Li T, Hass J, Marchenkoy A N, Conrad E H, First P N and de ... Ni Z H, Chen W, Fan X F, Kuo J L, Yu T, Wee A T S ... Chen S, Cai W, Piner R D, Suk J W, Wu Y, Ren Y, Kang Y.

  16. Genome-Wide Chromosomal Targets of Oncogenic Transcription Factors (United States)


    Altman, W.E., Attiya, S., Bader, J.S., Bemben, L.A., Berka , J., Braverman, M.S., Chen, Y.J., Chen, Z., et al. 2005. Genome sequencing in after filtering to exclude bad spots. qPCR validation. Primer pairs used in Figure 1 were designed to cover three peaks and three troughs in

  17. The Response of Small Scale Rigid Targets to Shallow Buried Explosive Detonations (United States)


    properties as applied in this work was based on some of the standard defini- tions of soil constitutive properties as found in, e.g., Chen and Baladi [18...Technology Corporation; 2007. [18] Chen WF, Baladi GY. Soil plasticity: theory and implementation. New York: Elsevier Science; 1985. [19] Zimmerman

  18. Application of an Arbitrary Lagrangian Eulerian Method to Describe High Velocity Gas-Particle Flow Behavior (United States)


    applied in this work was based on some of the standard definitions of soil constitutive properties as found in, e.g., Chen and Baladi [20], and...Livermore, CA. [20] Chen, W. F., and Baladi , G. Y., 1985. Soil Plasticity: Theory and Implementation. Elsevier Science, New York. [21] Zimmerman, H.D

  19. Untitled

    Indian Academy of Sciences (India)

    20. Nevill GA and Cook D 1969 Can. J. Chen. 47 743. 21. Glasel GA 1969 Org. Magn. Reson. 1481. 22. Soundarajan S 1958 Trans. Faraday Soc. 54147. 23. Rein R 1971 Int. J. Quant. Chem., Symp, 4341. 24. Woet D 1972.J. Am. Chen, Soc. 94.8213. 25. Bideau.JP, Huong PV and Toure S 1976 Acta Crystallogr. B32481.

  20. Mechanisms of all-trans retinoic acid-induced differentiation of acute ...

    Indian Academy of Sciences (India)

    Author Affiliations. Ji-Wang Zhang1 Jian Gu1 Zhen-Yi Wang1 Sai-Juan Chen1 Zhu Chen1. Shanghai Institute of Hematology, Ruijin Hospital Affiliated to Shanghai Second Medical University, 197 Ruijin Road II, Shanghai 200025, People's Republic of China ...

  1. A novel contiguous deletion involving NDP, MAOB and EFHC2 gene ...

    Indian Academy of Sciences (India)

    Home; Journals; Journal of Genetics; Volume 96; Issue 6. A novel contiguous deletion involving NDP, MAOBand EFHC2gene in a patient with familial Norrie disease: bilateral blindness and leucocoria without other deficits. BEI JIA LIPING HUANG YAOYU CHEN SIPING LIU CUIHUA CHEN KE XIONG LANLIN SONG YULAI ...

  2. WAIS-IV and WISC-IV Structural Validity: Alternate Methods, Alternate Results. Commentary on Weiss et al. (2013a) and Weiss et al. (2013b) (United States)

    Canivez, Gary L.; Kush, Joseph C.


    Weiss, Keith, Zhu, and Chen (2013a) and Weiss, Keith, Zhu, and Chen (2013b), this issue, report examinations of the factor structure of the Wechsler Adult Intelligence Scale-Fourth Edition (WAIS-IV) and Wechsler Intelligence Scale for Children-Fourth Edition (WISC-IV), respectively; comparing Wechsler Hierarchical Model (W-HM) and…

  3. A reviewof the pharmacologicalmechanism of traditional Chinese ...

    African Journals Online (AJOL)

    A reviewof the pharmacologicalmechanism of traditional Chinese medicine in the intervention of coronary heart disease and stroke. W Zhang, K Gao, K Gao, J Liu, J Liu, H Zhao, H Zhao, J Wang, J Wang, Y Li, Y Li, G Murtaza, G Murtaza, J Chen, J Chen, W Wang, W Wang ...

  4. African Journal of Traditional, Complementary and Alternative ...

    African Journals Online (AJOL)

    Anti-tumour effects of polysaccharides isolated from Artemisia Annua L by inducing cell apoptosis and immunomodulatory anti-hepatoma effects of polysaccharides · EMAIL FREE FULL TEXT EMAIL FREE FULL TEXT · DOWNLOAD FULL TEXT DOWNLOAD FULL TEXT. J Chen, J Chen, X Wang, C Liu, 15-22.

  5. Journal of Genetics | Indian Academy of Sciences

    Indian Academy of Sciences (India)

    ... Refresher Courses · Symposia · Live Streaming. Home; Journals; Journal of Genetics; Volume 95; Issue 1. Novel NPHS1 gene mutations in a Chinese family with congenital nephrotic syndrome. Fengjie Yang Yaxian Chen Yu Zhang Liru Qiu Yu Chen Jianhua Zhou. Research Note Volume 95 Issue 1 March 2016 pp 161- ...

  6. Impacts of DNAPL Source Treatment: Experimental and Modeling Assessment of the Benefits of Partial DNAPL Source Removal (United States)


    this project: A. Noman M. Ahsanuzzaman, Steve Acree, Nandita Basu, Sten Berglund, Carol Bratt, Gordon Brown, Xaisong Chen, Jaehyun Cho, Pat Clark...A.S.C. Chen (eds). Chapelle, F.H., J.S. Widdowson, J.S. Bruner, E. Mendez , and C.C. Casey (2003). Methodology for Estimating Times of Remediation

  7. Enhancement of Radiation Therapy in Prostate Cancer by DNA-PKcs Inhibitor (United States)


    Center, Urology Habib , Amyn; UTSouthwestern Medical Center, Neurology & Neurotherapeutics Chen, Benjamin; UTSouthwestern Medical Center, Radiation...Tsong Hsieh 3,5,7 , Amyn A. Habib 4,5,6 , Benjamin Chen 1,4 and Debabrata Saha 1,4 1 Department of Radiation Oncology, 3 Department of Urology, 4

  8. A novel contiguous deletion involving NDP, MAOB and EFHC2 gene ...

    Indian Academy of Sciences (India)

    Home; Journals; Journal of Genetics; Volume 96; Issue 6. A novel contiguous deletion involving NDP, MAOBitalic> and EFHC2italic> gene in a patient with familial Norrie disease: bilateral blindness and leucocoria without other deficits. BEI JIA LIPING HUANG YAOYU CHEN SIPING LIU CUIHUA CHEN KE XIONG LANLIN ...

  9. Browse Title Index

    African Journals Online (AJOL)

    Vol 9, No 1 (2006), Splenectomy in a rural surgical practice, Abstract PDF. E Alufohai, OO Odusanya. Vol 20, No 9 (2017), Spontaneous Retropharyngeal Emphysema: A Case Report, Abstract PDF. T-H Chi, C-C Hung, R-F Chen, C-H Yuan, J-C Chen. Vol 5, No 2 (2002), Spontaneous Rupture Of A Massive Hydrocephalus ...

  10. 75 FR 7358 - Addition of Certain Persons to the Entity List: Addition of Persons Acting Contrary to the... (United States)


    ... Company Ltd., 13/F, Number 181, Sec 1, Datong Rd., Sijhih City, Taipei, Taiwan; and (4) Yi-Lan Chen, a.k.a., Kevin Chen, 13/F, Number 181, Sec 1, Datong Rd., Sijhih City, Taipei, Taiwan, and 7th Floor, Number 17... the requirements of the Paperwork Reduction Act of 1995 (44 U.S.C. 3501 et seq.) (PRA), unless that...

  11. 75 FR 4509 - Uniform Criteria for State Observational Surveys of Seat Belt Use (United States)


    ... statistical issues: Ms. Chou-Lin Chen, Chief, Mathematical Analysis Division, National Center for Statistics..., Washington, DC 20590. Telephone number: 202-366-1048; E- mail: . For legal issues: Ms..., and reduce burden. E. Paperwork Reduction Act Under the Paperwork Reduction Act of 1995, a person is...

  12. The effects of reciprocal cross on inheritance of DNA methylation in ...

    African Journals Online (AJOL)



    Mar 20, 2012 ... DNA methylation plays an important role for regulation of gene expression. To study ... genes, and newly acquired epigenetic states of trans- ... GACTGCGTACCAATTCAGA(E6). ATCATGAGTCCTGCTCGGTAC(H6). GACTGCGTACCAATTCAGT(E7) ..... Chen XQ, Ma Y, Chen F, Song WQ, Zhang L (2009).

  13. Sadhana | Indian Academy of Sciences

    Indian Academy of Sciences (India)

    YUZHI CHEN1 2 XUDONG CHEN2 JINGWU BU3. Architectural Engineering Institute, Jinling Institute of Technology, Nanjing 211169, China; College of Civil and Transportation Engineering, Hobai University, Nanjing 210098, China; College of Water Conservancy and Hydropower Engineering, Hohai University, Nanjing ...

  14. Journal of Chemical Sciences | Indian Academy of Sciences

    Indian Academy of Sciences (India)

    Home; Journals; Journal of Chemical Sciences. Chen Chai. Articles written in Journal of Chemical Sciences. Volume 126 Issue 3 May 2014 pp 813-820 Regular Articles. First total synthesis of Boehmenan · Yamu Xia Xiaoli Dai Haixin Liu Chen Chai · More Details Abstract Fulltext PDF. The first total synthesis of dilignan ...

  15. Three novel antioxidants from Cinnamomum plants | Cheng | African ...

    African Journals Online (AJOL)

    Three novel antioxidants from Cinnamomum plants. K-C Cheng, H-A Chen, P-F Wu, W-L Yang, H-M Wang, C-Y Chen. Abstract. In this study, we identified three novel antioxidants, subamolide C (1), subamolide E (2) and isokotomolide A (3) from the constitutes of Cinnamomum subavenium and Cinnamomum kotoense.

  16. The validity and accuracy in foot-to-foot bioelectrical impedance ...

    African Journals Online (AJOL)

    The validity and accuracy in foot-to-foot bioelectrical impedance analysis measuring models referenced by dual-energy X-ray absorptiometry in body composition in standing position. KC Hsieh, HK Lu, CH Chen, TR Jang, YY Chen, MF Kao ...

  17. High School Students' Topic Preferences and Oral Development in an English-Only Short-Term Intensive Language Program (United States)

    Hsieh, Hui-Chen


    Developing the ability to speak English is a daunting task that has long been omitted in a test-driven pedagogy context (Chang, 2011; Li, 2012a, 2012b; Chen & Tsai, 2012; Katchen, 1989, 1995). Since speaking is not tested for school admissions, most students are not motivated to learn it (Chang, 2011; Chen & Tsai, 2012). Now, globalization…

  18. Sadhana | Indian Academy of Sciences

    Indian Academy of Sciences (India)

    Home; Journals; Sadhana. B Chen. Articles written in Sadhana. Volume 38 Issue 4 August 2013 pp 557-569. Flexibility-based structural damage identification using Gauss–Newton method · B Chen S Nagarajaiah · More Details Abstract Fulltext PDF. Structural damage will change the dynamic characteristics, including ...

  19. New St-chromosome-specific molecular markers for identifying ...

    Indian Academy of Sciences (India)

    et al. 1994) or JJsSt (Chen et al. 1998) was widely used in wheat breeding programme (Chen .... Japan). Table 1. The features of primers used in this study. Homologous ..... Redinbaugh M. G., Jones T. A. and Zhang Y. T. 2000 Ubiquity of.

  20. Revision of the subfamily Opiinae (Hymenoptera, Braconidae) from Hunan (China), including thirty-six new species and two new genera (United States)

    Li, Xi-Ying; van Achterberg, Cornelis; Tan, Ji-Cai


    van Achterberg & Li, gen. n. (type species: Areotetes carinuliferus sp. n.) and Coleopioides van Achterberg & Li, gen. n. (type species: Coleopioides postpectalis sp. n. are described. All species are illustrated and keyed. In total 30 species of Opiinae are sequenced and the cladograms are presented. Neopius Gahan, 1917, Opiognathus Fischer, 1972, Opiostomus Fischer, 1972, and Rhogadopsis Brèthes, 1913, are treated as a valid genera based on molecular and morphological differences. Opius vittata Chen & Weng, 2005 (not Opius vittatus Ruschka, 1915), Opius ambiguus Weng & Chen, 2005 (not Wesmael, 1835) and Opius mitis Chen & Weng, 2005 (not Fischer, 1963) are primary homonymsandarerenamed into Phaedrotoma depressa Li & van Achterberg, nom. n., Opius cheni Li & van Achterberg, nom. n. andOpius wengi Li & van Achterberg, nom. n., respectively. Phaedrotoma terga (Chen & Weng, 2005) comb. n.,Diachasmimorpha longicaudata (Ashmead, 1905) and Biosteres pavitita Chen & Weng, 2005, are reported new for Hunan, Opiostomus aureliae (Fischer, 1957) comb. n. is new for China and Hunan; Xynobius maculipennis(Enderlein, 1912) comb. n. is new for Hunan and continental China and Rhogadopsis longuria (Chen & Weng, 2005) comb. n. is new for Hunan. The following new combinations are given: Apodesmia puncta (Weng & Chen, 2005) comb. n., Apodesmia tracta (Weng & Chen, 2005) comb. n., Areotetes laevigatus (Weng & Chen, 2005) comb. n., Phaedrotoma dimidia (Chen & Weng, 2005) comb. n., Phaedrotoma improcera (Weng & Chen, 2005) comb. n., Phaedrotoma amputata (Weng & Chen, 2005) comb. n., Phaedrotoma larga (Weng & Chen, 2005) comb. n., Phaedrotoma osculas (Weng & Chen, 2005) comb. n., Phaedrotoma postuma (Chen & Weng, 2005) comb. n., Phaedrotoma rugulosa (Chen & Weng, 2005) comb. n., Phaedrotoma tabularis (Weng & Chen, 2005) comb. n., Rhogadopsis apii (Chen & Weng, 2005) comb. n., Rhogadopsis dimidia (Chen & Weng, 2005) comb. n., Rhogadopsis diutia (Chen & Weng, 2005) comb. n., Rhogadopsis

  1. Seven new species of Begonia (Begoniaceae) in Northern Vietnam and Southern China (United States)

    Chen, Wen-Hong; Radbouchoom, Sirilak; Nguyen, Hieu Quang; Nguyen, Hiep Tien; Nguyen4, Khang Sinh; Shui, Yu-Min


    Abstract Since 2016, KIB (Kunming Institute of Botany) and CPC (Centre for Plant Conservation of Vietnam) have conducted several surveys in the transboundary karst regions in Northern Vietnam and Southern China and seven new species in the genus Begonia Linn. (Begoniaceae) are firstly described. Amongst them, two species, Begonia albopunctata Y.M. Shui, W.H. Chen & H.Q. Nguyen and B. erectocarpa H.Q. Nguyen, Y.M. Shui & W.H. Chen, respectively belong to section Sphenanthera with berry fruits and section Leprosae with clavate berry fruits; four species, B. gulongshanensis Y.M. Shui & W. H. Chen, B. minissima H.Q. Nguyen, Y.M. Shui & W.H. Chen, B. mollissima Y.M. Shui, H.Q. Nguyen & W.H. Chen, B. rhytidophylla Y.M. Shui & W.H. Chen, belong to section Coelocentrum with parietal placentation; one species, Begonia bambusetorum H.Q. Nguyen, Y.M. Shui & W.H. Chen, belongs to section Diploclinium with 3-loculed ovary and capsules. The diagnostic characters of these species are described and illustrated in the text and photographs. PMID:29416422

  2. Wide Band Gap Semiconductors Symposium Held in Boston, Massachusetts on 2-6 December 1991. Materials Research Society Symposium Proceedings. Volume 242 (United States)


    AND PROPERTIES OF WIDE BAND-GAP Il-VI STRAINED- LAYER SUPERLATTICE 227 Hailong Wang. Jie Cui. Aidong Shen. Liang Xu, Yunliang Chen. and Yuhua Shen IN...WANG JIE CUI AIDONG SHEN LIANG XU YUNLIANG CHEN AND YUHUA SHEN Shanghai Institute of Optics and Fine Mechanics, Academia Sinica P.O.Box 800-216 Shanghai...He Zujou, Cao Huazhe, Su Wuda, Chen Zhongcai, Zhon Feng and Wang Erguang, Thin Solid Films, 139,261(1986). 22) Xin Li and T.L.Tansley, J.AppI.Phys

  3. Pitfalls in VAR based return decompositions: A clarification

    DEFF Research Database (Denmark)

    Engsted, Tom; Pedersen, Thomas Quistgaard; Tanggaard, Carsten

    in their analysis is not "cashflow news" but "inter- est rate news" which should not be zero. Consequently, in contrast to what Chen and Zhao claim, their decomposition does not serve as a valid caution against VAR based decompositions. Second, we point out that in order for VAR based decompositions to be valid......Based on Chen and Zhao's (2009) criticism of VAR based return de- compositions, we explain in detail the various limitations and pitfalls involved in such decompositions. First, we show that Chen and Zhao's interpretation of their excess bond return decomposition is wrong: the residual component...


    Institute of Scientific and Technical Information of China (English)

    CHENTie-mei; SONGShi-mei; YUANDe-cheng


    Three new species of Crambinae from China, Eschata truncata Song & Chen, sp. nov., Eschata tricornia Song & Chen, sp. nov., Pseudargyria acuta Song & Chen, sp. nov. and the female of Girdharia tau-romma Kapur are described, with figures and illustrations of genitalia provided. E. truncata resembles E.smithi Bleszynski, but valva with one short truncated process in costa; E. tricornia differed from all recorded species by valva with a triangular process on dorsum; P. acuta resembles P. marginepunctalis (Hampson), but with cucullus rapidly pointed and aedeagus with one group of cornuti. E. bleszynskiella Minet is proposed as a junior synonym of E. shanghaiensis Wang & Sung.

  5. The genus Bryoerythrophyllum (Musci, Pottiaceae in Antarctica

    Directory of Open Access Journals (Sweden)

    Sollman Philip


    Full Text Available Antarctic material of the genus Bryoerythrophyllum P. C. Chen was studied from all specimens present in KRAM. Bryoerythrophyllum recurvirostrum (Hedw. P. C. Chen var. antarcticum L. I. Savicz & Smirnova is treated as a distinct species: B. antarcticum (L. I. Savicz & Smirnova P. Sollman, stat. nov. Three species are now known in the Antarctic region: B. antarcticum, B. recurvirostrum and B. rubrum (Jur. ex Geh. P. C. Chen. Bryoerythrophyllum rubrum is reported for the first time from the Antarctic. It is a bipolar species. A key to the taxa is given. These species are described and briefly discussed, with notes on illustrations, reproduction, habitat, world range, distribution and elevation in Antarctica.

  6. LDL Particle Testing (United States)

    ... P. Caulfield, Jay Wohlgemuth, Zhizong Chen, Robert Superko, Charles M. Rowland, Robert J. Glynn, Paul M. Ridker, ... See Less Ask a Laboratory Scientist Your questions will be answered by a laboratory scientist as part ...

  7. 77 FR 52311 - Wooden Bedroom Furniture From the People's Republic of China: Partial Rescission of Antidumping... (United States)


    ... Furniture Co., Ltd. Zhangjiagang Zheng Yan Decoration Co., Ltd. Zhangjiang Sunwin Arts & Crafts Co., Ltd.... Trendex Industries Limited Wan Bao Chen Group Hong Kong Co., Ltd. World Design International Co., Ltd...

  8. On synchronization of three chaotic systems

    International Nuclear Information System (INIS)

    Yan Jianping; Li Changpin


    In this paper, a simple but efficient method is applied to the synchronization of three chaotic systems, i.e., the chaotic Lorenz, Chua, and Chen systems. Numerical simulations show this method works very well


    African Journals Online (AJOL)



    Apr 24, 2012 ... Key words: Grey mullet, growth, foreign DNA, genetically modified. INTRODUCTION ... ration, food quality and preservation (Shears et al., 1991;. Chen et al. ... fish eggs (Khoo et al., 1992) and 4) direct injection of foreign DNA ...

  10. Hybrid Chaos Synchronization of Four-Scroll Systems via Active Control (United States)

    Karthikeyan, Rajagopal; Sundarapandian, Vaidyanathan


    This paper investigates the hybrid chaos synchronization of identical Wang four-scroll systems (Wang, 2009), identical Liu-Chen four-scroll systems (Liu and Chen, 2004) and non-identical Wang and Liu-Chen four-scroll systems. Active control method is the method adopted to achieve the hybrid chaos synchronization of the four-scroll chaotic systems addressed in this paper and our synchronization results are established using Lyapunov stability theory. Since the Lyapunov exponents are not required for these calculations, the active control method is effective and convenient to hybrid synchronize identical and different Wang and Liu-Chen four-scroll chaotic systems. Numerical simulations are also shown to illustrate and validate the hybrid synchronization results derived in this paper.

  11. Fulltext PDF

    Indian Academy of Sciences (India)

    Journal of Earth System Science wishes to place on record the valuable ... Chen Xun-Hong, University of Nebraska-Lincoln, Nebraska, United States ... Dasgupta Somnath, Indian Institute of Science Education and Research, Kolkata.

  12. The Application of First‑Trimester Volumetry in Predicting Pregnancy ...

    African Journals Online (AJOL)

    Rawal MY, Malhotra N. Ultrasonography in Early Intrauterine pregnancy. ... Leung KY, Ma Teresa, Lau BY, Chen M. First trimester ultrasound volumetry: .... Ghosh A, Tang MH, Lam YH, Fung E, Chan V. Ultrasound measurement of placental ...

  13. Appiah-Adjei et al

    African Journals Online (AJOL)


    ing, sale of automobile spare parts, and metal fabrication. Some of these activities generate huge ... Keywords: Groundwater quality, pollution, waste disposal, Suame, Ghana ... of fertilizers (Chen et al., 2007; Parris, 2011;. Shen et al., 2011), ...

  14. Genetics Home Reference: isobutyryl-CoA dehydrogenase deficiency (United States)

    ... An Y, Weavil SD, Chaing SH, Bali D, McDonald MT, Kishnani PS, Chen YT, Millington DS. Rare ... 10 All Bulletins Features What is direct-to-consumer genetic testing? What are genome editing and CRISPR- ...

  15. Genetics Home Reference: short-chain acyl-CoA dehydrogenase deficiency (United States)

    ... An Y, Weavil SD, Chaing SH, Bali D, McDonald MT, Kishnani PS, Chen YT, Millington DS. Rare ... 10 All Bulletins Features What is direct-to-consumer genetic testing? What are genome editing and CRISPR- ...

  16. Spinal Cord Injury 101

    Medline Plus

    Full Text Available ... Counseling Blog About Media Donate Spinal Cord Injury Medical Expert Videos Topics menu Topics Spinal Cord Injury ... Jennifer Piatt, PhD David Chen, MD Read Bio Medical Director, Spinal Cord Injury Rehabilitation Program, Rehabilitation Institute ...

  17. Journal of Chemical Sciences | Indian Academy of Sciences

    Indian Academy of Sciences (India)

    Author Affiliations. Fang Dong1 Jiang Chenning1 Zhu Ting1 Yang Jinming1. Department of Pharmaceutical Engineering, School of Chemistry and Chemical Engineering, Yancheng Teachers University, 50 Kai Fang Da Dao, Yancheng 224002, Jiangsu, P. R. China ...

  18. Probability to produce animal vaccines in insect baculovirus ...

    African Journals Online (AJOL)



    Sep 7, 2011 ... The insect baculovirus expression system is a valuable tool for the production of vaccine. .... vaccine expression/delivery vehicle (Yu-Chen et al., ... baculoviruses are applied in cell-based assays for drug ... Intramuscular.

  19. Extraction and Purification of Flavonoids from Radix Puerariae

    African Journals Online (AJOL)

    and preparations are now on sale. ... significant for optimization of extraction, resin selection and ... and flavonoids as indexes, optimize the proper density. ..... system. Sep Purif Technol. 2008; 62: 590-595. 12. Chen JH, Liau BC, Jong TT.


    Indian Academy of Sciences (India)

    Chen Xingyuan Lorraine, University of California, Berkeley, United States ... Das Kaushik, Bengal Engineering and Science University, Kolkata de Boyer ..... Samborska Katarzyna, Institute for Ecology of Industrial Areas, Katowice, Poland.

  1. 1,6-Diaminoperylene bisimide with a highly twisted perylene core

    Indian Academy of Sciences (India)

    ... KEW-YU CHEN. ∗. Department of Chemical Engineering, Feng Chia University, 40724 Taichung, Taiwan, Republic of China ... chromic materials,6 and organic field-effect transis- ..... Wasielewski M R 2012 Competition between singlet fis-.

  2. Phenotype-gene: 396 [Arabidopsis Phenome Database[Archive

    Lifescience Database Archive (English)

    Full Text Available ciency in organ named stomatal complex during process named stomatal movement for AT5G13680 Chen Zhizhong et...943431i increased efficiency in organ named stomatal complex during process named stomatal movement

  3. Screening a heterogeneous elderly South African population for ...

    African Journals Online (AJOL)

    Age and race influenced performance on the MMSE, SIS and SMRS. Conclusion: Different types .... Depression Scale (GDS)34 employing a cut-off score of >11. ...... Society for Academic Emergency Medicine 2008;15(7):613-6. 42. Chen MR ...

  4. Preventing Pressure Sores

    Medline Plus

    Full Text Available ... Injury Medical Expert Videos Topics menu Topics Preventing Pressure Sores Adult Injuries Spinal Cord Injury 101 David Chen, MD Preventing Pressure Sores Mary Zeigler, MS Transition from Hospital to Home ...

  5. Afrika Statistika ISSN 2316-090X Network estimation in State Space ...

    African Journals Online (AJOL)

    continuous, stochastic differential equation model (Chen et al., 2005; ... a large number of model parameters and are not well suited to deal with noisy data ... and selection in regression analysis that incorporates an L1 regularization constraint.

  6. Isolation and identification of two galangin metabolites from rat urine ...

    African Journals Online (AJOL)

    Isolation and identification of two galangin metabolites from rat urine and determination of their in vitro hypolipidemic activity. Xuguang Zhang, Shouqian Cheng, Hailong Li, Xiaopo Zhang, Feng Chen, Youbin Li, Junqing Zhang, Yinfeng Tan ...

  7. Fulltext PDF

    Indian Academy of Sciences (India)

    The newly synthesized molecules were characterized by spectral analysis and subjected to antioxidant and ... membered heterocyclic compounds with oxygen and nitrogen atoms. ...... Yen G C and Chen H Y 1995 J. Agric. Food Chem. 43. 27.

  8. Proceedings – Mathematical Sciences | Indian Academy of Sciences

    Indian Academy of Sciences (India)

    dimensional stochastic Navier–Stokes equations in the presence of delays. The results extend some of the existing results. Author Affiliations. Huabin Chen1. Department of Mathematics, School of Science, Nanchang University, Nanchang 330031, ...

  9. Genetics Home Reference: type 2 diabetes (United States)

    ... Chen H, Huyghe JR, van de Bunt M, Pearson RD, Kumar A, Müller-Nurasyid M, Grarup N, ... Accessibility FOIA Viewers & Players U.S. Department of Health & Human Services National Institutes of Health National Library of ...

  10. hispidulin and other constituents of scoparia dulcis linn

    African Journals Online (AJOL)


    HIV. INTRODUCTION. Scoparia dulcis Linn. (Scrophulariaceae) has been extensively studied for its flavone and terpene constituents (Ahmed et al., 1990, Ah- san et al., 2003, Chen et al., 1976, Hayashi et al., 1987, 1987b, 1988, 1990, 1991, ...

  11. Wahab et al (14)

    African Journals Online (AJOL)


    food chain via cereals, vegetables, fishes and meat. (Abdulqawi, 2011). ... different functional groups which are involved in metal binding, and .... Penicillium species. A phylogenetic tree was ..... Chemistry and Ecology, 29(4),. 320–328. Chen ...

  12. Synthesis, characterization and photocatalytic reactions of ...

    Indian Academy of Sciences (India)

    The methods used usually include various surface modifi- cations. Several ... In recent years, innovative solid catalysts have been prepared ... post-treatment with phosphoric acid (Clesla et al 1996; Chen .... The ammonia adsorption was ca-.

  13. Hong et al., Afr J Tradit Complement Altern Med. (2013) 10(4):66-69 ...

    African Journals Online (AJOL)


    inflammation, annex inflammation, uterine prolapse, and neurasthenia. .... Research progress on pharmacological effects of Bidens bipinnata L. China Pharmacy. ... Clinic. 24 (3): 147-149. 8. Wang, Q., Zhang Y.N., Chen F.H. (2009). Research ...

  14. Sex and Fertility After SCI

    Medline Plus

    Full Text Available ... Topic Resources Peer Counseling Blog About Media Donate Spinal Cord Injury Medical Expert Videos Topics menu Topics Sex and Fertility After Spinal Cord Injury Adult Injuries Spinal Cord Injury 101 David Chen, ...


    African Journals Online (AJOL)

    teaching, research and practice since C C Chen's impressive efforts at the ... HSDU tended to emphasise human resource development, for example ... innovative subdistrict and health centre programmes could be ... Agincourt Study Area. Fig.

  16. “Use salt and foods high in salt sparingly”: a food-based dietary ...

    African Journals Online (AJOL)


    Apr 12, 2013 ... effect on blood pressure, a high sodium intake has also been associated with ... promotion of healthy eating habits from an early age is important. Chen and ..... help consumers make informed purchasing decisions. However ...

  17. Moskva kunstibiennaal reaktsiooni teenistuses? / Johannes Saar

    Index Scriptorium Estoniae

    Saar, Johannes, 1965-


    Moskva II rahvusvahelisest nüüdiskunsti biennaalist. Näitustest "Sotsart. Poliitiline kunst Venemaal" (kuraator Andrei Jerofejev), "Sotsart. Poliitiline kunst Hiinas" (kuraator Xin Don Chen), "Mõtlev realism" (kuraator Jekaterina Djegot) ja "Mina usun" (kuraator Oleg Kulik)

  18. Online Resources Microsatellites development, cross-amplification ...

    Indian Academy of Sciences (India)


    1Guangdong Provincial Key Laboratory of Applied Botany, South China ... In south China, urban development is another threat to A. sinensis. ..... Chen G., Liu C. and Sun W. 2016 Pollination and seed dispersal of Aquilaria sinensis (Lour.) ...

  19. A lanthanum pyromellitate coordination polymer with three ...

    Indian Academy of Sciences (India)

    Framework Solids Laboratory, Chemistry and Physics of Materials Unit, Jawaharlal Nehru Centre for. Advanced Scientific ... bases, though the quality of the single crystals ob- tained using ..... Chen J S and Wang S N 2003 Inorg. Chem. 42 944.

  20. Nanocomposite Membrane via Magnetite Nanoparticle Assembly

    KAUST Repository

    Xie, Yihui


    discussions and suggestions. I also want to extend my gratitude to the staff from the KAUST Core Lab for Advanced Nanofabrication, Imaging and Characterization, especially Dr. Ali Reza Behzad, Dr. Rachid Sougrat, and Dr. Long Chen, for their assistance

  1. Bulletin of Materials Science | Indian Academy of Sciences

    Indian Academy of Sciences (India)

    Author Affiliations. Xiaoming Liao1 Hongyang Zhu1 Guangfu Yin1 Zhongbing Huang1 Yadong Yao1 Xianchun Chen1. College of Materials Science and Engineering, Sichuan University, Chengdu 610064, P.R. of China ...

  2. ocular findings in children with cerebral palsy attending a tertiary

    African Journals Online (AJOL)

    ocular abnormalities among children with cerebral palsy that attended the neurology clinic of University of. Ilorin Teaching ... recognize faces or hand-held toys (Chen, Weinberg and Catalano ... palsy that is also blind/visually impaired pose a.

  3. Spinal Cord Injury 101

    Medline Plus

    Full Text Available ... RN Pediatric Injuries Pediatric Spinal Cord Injury 101 Lawrence Vogel, MD The Basics of Pediatric SCI Rehabilitation ... Rogers, PT Recreational Therapy after Spinal Cord Injury Jennifer Piatt, PhD David Chen, MD Read Bio Medical ...

  4. Effect of demographic variables on public attitudes towards ...

    African Journals Online (AJOL)



    Sep 30, 2011 ... 5Faculty of Social Sciences and Humanities, Universiti Kebangsaan Malaysia, 43600 UKM, Bangi, ..... race formulates a cultural/social network. .... Macer D, Chen Ng MA (2000). Changing Attitudes to Biotechnology in. Japan.

  5. Galactosemia (United States)

    ... and Rector's The Kidney. 10th ed. Philadelphia, PA: Elsevier; 2016:chap 45. Broomfield A, Brain C, Grunewald S. ... Neurology in Clinical Practice. 7th ed. Philadelphia, PA: Elsevier; 2016:chap 91. Kishnani PS, Chen Y-T. ...

  6. Spinal Cord Injury 101

    Medline Plus

    Full Text Available ... Medical Experts People Living with SCI Personal Experiences by Topic Resources Peer ... Injuries Spinal Cord Injury 101 David Chen, MD Preventing Pressure Sores Mary Zeigler, MS Transition from Hospital to ...

  7. Basics of SCI Rehabilitation

    Medline Plus

    Full Text Available ... Medical Experts People Living with SCI Personal Experiences by Topic Resources Peer ... Injuries Spinal Cord Injury 101 David Chen, MD Preventing Pressure Sores Mary Zeigler, MS Transition from Hospital to ...

  8. Sex and Fertility After SCI

    Medline Plus

    Full Text Available ... Medical Experts People Living with SCI Personal Experiences by Topic Resources Peer ... Injuries Spinal Cord Injury 101 David Chen, MD Preventing Pressure Sores Mary Zeigler, MS Transition from Hospital to ...

  9. TMX magnet system, present and future

    International Nuclear Information System (INIS)

    Wong, R.L.; Pedrotti, L.R.; Leavitt, G.A.; Waugh, A.F.; Chargin, A.K.; Calderon, M.O.


    The magnetic field design and the mechanical design of the TMX magnet system were previously reported by Chen and Hinkle. This paper is a summary of the work that has been accomplished in the two years since then

  10. On bounds in Poisson approximation for distributions of independent negative-binomial distributed random variables. (United States)

    Hung, Tran Loc; Giang, Le Truong


    Using the Stein-Chen method some upper bounds in Poisson approximation for distributions of row-wise triangular arrays of independent negative-binomial distributed random variables are established in this note.

  11. Download this PDF file

    African Journals Online (AJOL)

    Andries du Toit

    11 Chen, et al Mainstreaming informal Employment and Gender (2004). 12 Svendsen Work (2008) at 3. ...... In the workplace, other than changes in ..... Philip K Second economy strategy: addressing inequality and economic marginalisation.

  12. Novel alleles of 31-bp VNTR polymorphism in the human ...

    Indian Academy of Sciences (India)

    Author Affiliations. Yik-Yuen Gan1 Chuan-Fei Chen1. Natural Sciences and Science Education, National Institute of Education, Nanyang Technological University, 1 Nanyang Walk, Singapore 637616, Republic of Singapore ...

  13. Tourism and microcredit for sustainable community development in Sub-Saharan Africa

    NARCIS (Netherlands)

    Hoeve ten, Marieke


    Poverty reduction is one of the main Millennium Development Goals (United Nations, 2000). Sub-Saharan Africa is the region with the highest prevalence of poverty. Almost half the population lives in extreme poverty (Chen & Ravillion, 2004; UN, 2005). Pove

  14. Recognition of Pitman shorthand text using tangent feature values at ...

    Indian Academy of Sciences (India)

    R. Narasimhan (Krishtel eMaging) 1461 1996 Oct 15 13:05:22

    a prerequisite for directional code measurement (Chen & Lee 1992). The handwritten PSL ... shows the directional code and an example to illustrate the coding method for a word formed by the concatenation .... Primitive selection. 5.1 Corner ...

  15. Sex and Fertility After SCI

    Medline Plus

    Full Text Available ... Adult Injuries Spinal Cord Injury 101 David Chen, MD Preventing Pressure Sores Mary Zeigler, MS Transition from ... Rosenberg, PsyD Understanding SCI Rehabilitation Donald Peck Leslie, MD Adjusting to Social Life in a Wheelchair Lisa ...

  16. Basics of SCI Rehabilitation

    Medline Plus

    Full Text Available ... Adult Injuries Spinal Cord Injury 101 David Chen, MD Preventing Pressure Sores Mary Zeigler, MS Transition from ... Rosenberg, PsyD Understanding SCI Rehabilitation Donald Peck Leslie, MD Adjusting to Social Life in a Wheelchair Lisa ...

  17. Preventing Pressure Sores

    Medline Plus

    Full Text Available ... Adult Injuries Spinal Cord Injury 101 David Chen, MD Preventing Pressure Sores Mary Zeigler, MS Transition from ... Rosenberg, PsyD Understanding SCI Rehabilitation Donald Peck Leslie, MD Adjusting to Social Life in a Wheelchair Lisa ...

  18. 76 FR 72850 - Adjustment of Monetary Threshold for Reporting Rail Equipment Accidents/Incidents for Calendar... (United States)


    ... 2010. DATES: This regulation is effective January 1, 2012. FOR FURTHER INFORMATION CONTACT: Kebo Chen... of 1995 Pursuant to Section 201 of the Unfunded Mandates Reform Act of 1995 (Pub. L. 104-4, 2 U.S.C...

  19. 77 FR 13393 - Endangered and Threatened Wildlife and Plants; Revised Endangered Status, Revised Critical... (United States)


    ..., 1995). Chance or stochastic events have occurred in the range of M. viminea, and may continue to make M.... 2010; Chen et al. 2011). Scientists are projecting possible impacts and responses of ecological systems...

  20. 77 FR 71354 - Adjustment of Monetary Threshold for Reporting Rail Equipment Accidents/Incidents for Calendar... (United States)


    ... 2011. DATES: This regulation is effective January 1, 2013. FOR FURTHER INFORMATION CONTACT: Kebo Chen... of 1995 Pursuant to Section 201 of the Unfunded Mandates Reform Act of 1995 (Pub. L. 104-4, 2 U.S.C...

  1. T'ai Chi (United States)

    ... are different styles of t'ai chi, including: Chen style Hao (or Wu Shi) style Hu Lei ... medical advice, diagnoses, and treatment, consult your doctor. © 1995- The Nemours Foundation. All rights reserved. Images provided ...

  2. LDRD 2013 Annual Report: Laboratory Directed Research and Development Program Activities

    Energy Technology Data Exchange (ETDEWEB)

    Bookless, W. [Brookhaven National Lab. (BNL), Upton, NY (United States)


    This LDRD project establishes a research program led by Jingguang Chen, who has started a new position as a Joint Appointee between BNL and Columbia University as of FY2013. Under this project, Dr. Chen will establish a new program in catalysis science at BNL and Columbia University. The LDRD program will provide initial research funding to start research at both BNL and Columbia. At BNL, Dr. Chen will initiate laboratory research, including hiring research staff, and will collaborate with the existing BNL catalysis and electrocatalysis research groups. At Columbia, a subcontract to Dr. Chen will provide startup funding for his laboratory research, including initial graduate student costs. The research efforts will be linked under a common Catalysis Program in Sustainable Fuels. The overall impact of this project will be to strengthen the BNL catalysis science program through new linked research thrusts and the addition of an internationally distinguished catalysis scientist.

  3. Comparative mapping reveals similar linkage of functional genes to ...

    Indian Academy of Sciences (India)

    related traits between Brassica napus and Oryza sativa. Fupeng Li, Chaozhi Ma, Qingfang Chen, Touming Liu, Jinxiong Shen, Jinxing Tu, Yongzhong Xing and Tingdong Fu. J. Genet. 91, 163–170. Length of. Position of. Position of. Expect.

  4. Treatment responses in adult depressive patients treated with ...

    African Journals Online (AJOL)

    with dexamethasone/corticotrophin-releasing hormone. Lina Zhang1*, Yanbo Chen2, ... Keywords: stress, depressive patients, hormonal response, hormonal dysregulation, sertraline, ..... interactions in depression: will cause inform cure. Mol.

  5. Growth assessments of Nicotianatabaccumcv.Xanthitransformed ...

    African Journals Online (AJOL)



    Aug 10, 2011 ... transgenic plants were grown; T1 and the succeeding T2 transgenic plants were obtained. Subsequently, ..... evaluation of T2 plants for salt tolerance, seeds from .... Chen C, Wanduragala S, Becker DF, Dickman MB (2006).

  6. Spinal Cord Injury 101

    Medline Plus

    Full Text Available ... Living with SCI Personal Experiences by Topic Resources Peer ... Adult Injuries Spinal Cord Injury 101 David Chen, MD Preventing Pressure Sores Mary Zeigler, MS Transition from Hospital to ...

  7. Sex and Fertility After SCI

    Medline Plus

    Full Text Available ... Living with SCI Personal Experiences by Topic Resources Peer ... Injuries Spinal Cord Injury 101 David Chen, MD Preventing Pressure Sores Mary Zeigler, MS Transition from Hospital to ...

  8. Basics of SCI Rehabilitation

    Medline Plus

    Full Text Available ... Living with SCI Personal Experiences by Topic Resources Peer ... Injuries Spinal Cord Injury 101 David Chen, MD Preventing Pressure Sores Mary Zeigler, MS Transition from Hospital to ...

  9. Spinal Cord Injury 101

    Medline Plus

    Full Text Available ... Spinal Cord Injury 101 David Chen, MD Preventing Pressure Sores Mary Zeigler, MS Transition from Hospital to ... a spinal cord injury? play_arrow Why are high-dose steroids often used right after an injury? ...

  10. Truncus arteriosus (United States)

    ... through the middle Truncus arteriosus References Fraser CD, Kane LC. Congenital heart disease. In: Townsend CM Jr, ... 62. Review Date 10/17/2017 Updated by: Michael A. Chen, MD, PhD, Associate Professor of Medicine, ...

  11. Total anomalous pulmonary venous return (United States)

    ... pulmonary venous return, x-ray References Fraser CD, Kane LC. Congenital heart disease. In: Townsend CM Jr, ... 62. Review Date 10/17/2017 Updated by: Michael A. Chen, MD, PhD, Associate Professor of Medicine, ...

  12. OGG1, MYH and MTH1 gene variants identified in gastric cancer ...

    Indian Academy of Sciences (India)

    Handayama, Hamamatsu, Shizuoka 431-3192, Japan. 2Department ... 1997; Farinati et al. 1998), induce inflammation in the stomach tissue. A con- ..... 1999; Chen et al. 2003 .... R., Nohmi T. and Yokota J. 2000 Adenine excisional repair func-.

  13. A graph-clustering approach to search important molecular markers ...

    African Journals Online (AJOL)



    Nov 7, 2011 ... inclusions and a movement disorder (Chen and Feany,. 2005). LRRK2 ... The gene ontology (Ashburner et al., 2000) project is a major bioinformatics initiative ... et al. 15657 particular organisms (

  14. Cloning and expression analysis of a new anther-specific gene ...

    Indian Academy of Sciences (India)

    sequencing gene differential expression analysis (Chen et al. ... DNase digestion (Takara, Shiga, Japan), so that any remain- ..... ing the early moments of pollen germination (Guyon et al. 2000). The steady-state transcript level of PGPS/D3 ...

  15. Statistical analysis of thermal conductivity of nanofluid containing ...

    Indian Academy of Sciences (India)


    four temperatures for thermal conductivity of pristine. MWCNTs ... MWCNTs. In other words, the augmentation of the ... TiO2 nanofluid, means with different letters are significantly different .... Chen L and Xie H 2010 Thermochim Acta 497 67.

  16. The 1-hydroxy-2-methyl-butenyl 4-diphosphate reductase gene from ...

    African Journals Online (AJOL)

    The 1-hydroxy-2-methyl-butenyl 4-diphosphate reductase gene from Taxus media: Cloning, characterization and functional identification. Y Sun, M Chen, J Tang, W Liu, C Yang, Y Yang, X Lan, M Hsieh, Z Liao ...

  17. Laser Enhanced System for Ultra-Fine Microstructure Formation

    National Research Council Canada - National Science Library

    Chen, Ray T


    .... High-speed polymer-based EO modulator arrays and polymer-based optical true-time delay modules have been built through the existing programs involving UT Austin (Chen), USC (Steier), UCLA (Fetterman) and Univ. of Washington (Dalton...

  18. Von Gierke disease (United States)

    ... sugar test Genetic testing Lactic acid blood test Triglyceride level Uric acid blood test If a person ... 45. Kishnani PS, Chen Y-T. Defects in metabolism of carbohydrates. In: Kliegman RM, Stanton BF, St. ...

  19. Physikalische Grundlagen von chemischen Raman-Sensoren mit Schwerpunkt auf faseroptischen SERS-Sonden


    Viets, Carmen


    Faseroptische SERS-Sensoren wurden durch die Beschichtung der Endflächen von optischen Fasern mit rauhen Metallfilmen erzeugt. Zu den verschiedenen Präparationstechniken, die angewendet und verglichen wurden, gehörten das langsame Aufdampfen von Metall-Inselfilmen und das Bedampfen von Nanopartikeln, aufgerauhten oder elektronenlithographisch strukturierten Oberflächen mit Metallfilmen. Der Einfluß der Laserleistung auf die Messungen mit SERS-Sensoren wurde untersucht, und es wurden maximale ...

  20. JPRS Report, China (United States)


    brand , which symbolizes feudal autocracy, in that the new form has been posited in the hopes that reform can forcefully be implemented so as to...ucts; name- brand and high-quality products; products of energy, communications, transportation, and raw mate- rial industries; aid agriculture...1986 election. Chen Weiye fought a skillful battle although he had been seen as an underdog . The smashing victory of Chen Weiye and Huang Wentai plus

  1. Development and characterization of a gastroretentive dosage form composed of chitosan and hydroxyethyl cellulose for alendronate


    Chen YC; Ho HO; Chiu CC; Sheu MT


    Ying-Chen Chen,1,* Hsiu-O Ho,1,* Chiao-Chi Chiu,1 Ming-Thau Sheu1,2 1School of Pharmacy, College of Pharmacy, Taipei Medical University, 2Clinical Research Center and Traditional Herbal Medicine Research Center, Taipei Medical University Hospital, Taipei, Taiwan*These authors contributed equally to this workAbstract: In this study, alendronate, the most commonly used biphosphonate for treating osteoporosis, was formulated as gastroretentive dosage form (GRDF) tablets to enhance its oral bioav...

  2. On integral equation methods for electromagnetic scattering by biperiodic structures


    Bugert, Beatrice


    In der vorliegenden Arbeit verwenden wir Integralgleichungsmethoden, um die Streuung von zeitharmonischen elektromagnetischen ebenen Wellen an biperiodischen mehrschichtigen Strukturen zu untersuchen. Solche Strukturen modellieren wir durch die vertikale Anordnung einer endlichen Anzahl an sich nicht schneidenden, polyedrisch Lipschitz regulären Grenzflächen. Wir unterscheiden Streuobjekte bestehend aus einer Oberfläche und solche bestehend aus mindestens zwei Oberflächen. Das elektromagnetis...

  3. Magnetic resonance-guided regional gene delivery strategy using a tumor stroma-permeable nanocarrier for pancreatic cancer


    Wang, Xiaolin; Wang,Qingbing; Li,Jianfeng; An,Sai; Chen,Yi; Jiang,Chen


    Qingbing Wang,1,2 Jianfeng Li,3 Sai An,3 Yi Chen,1 Chen Jiang,3 Xiaolin Wang1,2 1Department of Interventional Radiology, Zhongshan Hospital, Fudan University, 2Shanghai Institute of Medical Imaging, 3Key Laboratory of Smart Drug Delivery, Ministry of Education, Department of Pharmaceutics, School of Pharmacy, Fudan University, Shanghai, People’s Republic of China Background: Gene therapy is a very promising technology for treatment of pancreatic ductal adenocarci...

  4. Quasi-Static Evolution, Catastrophe, and Failed Eruption of Solar Flux Ropes (United States)


    Ropes James Chen Beam Physics Branch Plasma Physics Division December 30, 2016 Approved for public release; distribution is unlimited. i REPORT...pressure gradient force combine to balance the major radial hoop force. The macroscopic forces on the flux ropes and onset conditions are quantified...Solar physics theory 67-4989-07 Quasi-Static Evolution, Catastrophe, and “Failed” Eruption of Solar Flux Ropes James Chen1 Plasma Physics Division

  5. Transparent and Stretchable High-Performance Supercapacitors Based on Wrinkled Graphene Electrodes (United States)


    2, 870–875. 38. Chen, T.; Dai, L. Carbon Nanomaterials for High- Performance Supercapacitors . Mater. Today 2013, 16, 272–280. 39. Stoller, M. D...High-Performance Supercapacitors Based onWrinkledGraphene Electrodes Tao Chen,† Yuhua Xue,† Ajit K. Roy,‡ and Liming Dai†,* †Center of Advanced Science...electrodes and the associated supercapacitor cells cannot be both trans- parent and stretchable.1318 It is highly desirable to integrate the

  6. Vehicle/Guideway Interaction in Maglev Systems (United States)


    Technology Division Materials and Components in Maglev Systems Technology Division Materials and Components Technology Division byY. Cai, S. S. Chen, and D. M...Transportation Systems Reports (UC-330, Vehicle/Guideway Interaction in Maglev Systems by Y. Cai and S. S. Chen Materials and Components Technology Division D. M...Surface Irregularities ...................................... 32 4 Vehicle/Guideway Interaction in Transrapid Maglev System .................. 34 4.1

  7. On the Unsteady-Motion Theory of Magnetic Forces for Maglev (United States)


    DivisionEnergy Technology Division Forces for Maglev Energy Technology DivisionEnergy Technology Division by S. S. Chen, S. Zhu, and Y. Cai APQ 4 袲...On the Unsteady-Motion Theory of Magnetic Forces for Maglev by S. S. Chen, S. Zhu, and Y. Cai Energy Technology Division November 1993 Work On The Unsteady-Motion Theory of Magnetic Forces for Maglev by S. S

  8. Comparison of cumulative dissipated energy between the Infiniti and Centurion phacoemulsification systems


    Chen, Ming; Anderson, Erik; Hill, Geoffrey; Chen, John J; Patrianakos, Thomas


    Ming Chen,1 Erik Anderson,2 Geoffrey Hill,3 John J Chen,4 Thomas Patrianakos2 1Department of Surgery, University of Hawaii, Honolulu, HI, 2Department of Ophthalmology, John H Stroger, Jr Hospital of Cook County, Chicago, IL, 3Department of Ophthalmology, UT Southwestern Medical Center, Dallas, TX, 4Biostatistics Core, John A Burns School of Medicine, University of Hawaii, Honolulu, HI, USA Purpose: To compare cumulative dissipated energy between two phacoemulsification mac...

  9. A retrospective randomized study to compare the energy delivered using CDE with different techniques and OZil? settings by different surgeons in phacoemulsification


    Chen, Ming; Sweeney, Henry W; Luke, Becky; Chen, Mindy; Brown, Mathew


    Ming Chen1, Henry W Sweeney2, Becky Luke3, Mindy Chen4, Mathew Brown51University of Hawaii, Honolulu, Hawaii, USA; 2Research Support Services, the Queens Medical Center, Honolulu, Hawaii, USA; 3Surgical Suite, Honolulu, Hawaii, USA; 4University of California, Irvine, CA, USA; 5University of California, San Diego, CA, USAAbstract: Cumulative dissipated energy (CDE) was used with Infiniti® Vision System (Alcon Labs) as an energy delivery guide to compare four different phaco techniques ...

  10. A retrospective randomized study to compare the energy delivered using CDE with different techniques and OZil settings by different surgeons in phacoemulsification


    Chen, Ming


    Ming Chen1, Henry W Sweeney2, Becky Luke3, Mindy Chen4, Mathew Brown51University of Hawaii, Honolulu, Hawaii, USA; 2Research Support Services, the Queens Medical Center, Honolulu, Hawaii, USA; 3Surgical Suite, Honolulu, Hawaii, USA; 4University of California, Irvine, CA, USA; 5University of California, San Diego, CA, USAAbstract: Cumulative dissipated energy (CDE) was used with Infiniti® Vision System (Alcon Labs) as an energy delivery guide to compare four different phaco techniques ...

  11. Unconventional Density Wave and Superfluidity in Cold Atom Systems (United States)


    Tsai, Chairperson Professor Kirill Shtengel Professor Vivek Aji 3 Copyright by Chen-Yen Lai 2014 4 The Dissertation of Chen-Yen Lai is approved...thank my dissertation committee members, Professor Vivek Aji and Pro- fessor Kirill Shtengel, for their help, kindness, insightful comments and...near balance to a stripe-CDW ( red ) as the imbalance increases. The insert shows the strong imbalance region, where single species p-wave majority

  12. Development of liposomal pemetrexed for enhanced therapy against multidrug resistance mediated by ABCC5 in breast cancer


    Bai,Fang; Yin,You; Chen,Ting; Chen,Jihui; Ge,Meixin; Lu,Yunshu; Xie,Fangyuan; Zhang,Jian; Wu,Kejin; Liu,Yan


    Fang Bai,1–3,* You Yin,4,* Ting Chen,1,* Jihui Chen,1 Meixin Ge,2 Yunshu Lu,2 Fangyuan Xie,5 Jian Zhang,1 Kejin Wu,3 Yan Liu1,6 1Department of Pharmacy, Xinhua Hospital, Shanghai Jiao Tong University School of Medicine, Shanghai, 2Department of General Surgery, Xinhua Hospital, Affiliated to Shanghai Jiao Tong University, School of Medicine, Shanghai, 3Department of Breast Surgery, Obstetrics and Gynaecology Hospital, Fudan University, Shanghai, 4Department of Neurology, Changzheng...

  13. Astragalus polysaccharides protect cardiac stem and progenitor cells by the inhibition of oxidative stress-mediated apoptosis in diabetic hearts


    Chen,Wei; Ju,Jing; Yang,Yehong; Wang,Hao; Chen,Wenjie; Zhao,Xuelan; Ye,Hongying; Zhang,Yu


    Wei Chen,1 Jing Ju,1 Yehong Yang,2 Hao Wang,3 Wenjie Chen,1 Xuelan Zhao,1 Hongying Ye,2 Yu Zhang1 1Department of Geriatrics, Huashan Hospital, Fudan University, Shanghai, China; 2Department of Endocrinology, Huashan Hospital, Fudan University, Shanghai, China; 3Core Center of Animal Facility, School of Medicine, Fudan University, Shanghai, China Introduction: Diabetic cardiomyopathy is characterized by an imbalance between myocyte death and regeneration mediated by the progressive loss of c...

  14. Aerial Logistics Management for Carrier Onboard Delivery (United States)



  15. Ühinemise ja iseolemise vastuseis. Ideaalid ja reaalsus / Rein Tootmaa

    Index Scriptorium Estoniae

    Tootmaa, Rein


    Mängufilmid "Keiser ja palgamõrtsukas" ("Jing ke ci qin wang") : režissöör Chen Kaige : Jaapan-Hiina-Prantsusmaa 1999 ja "Tiiger ja draakon" ("Wo hu chang long") : režissöör Ang Lee : Hiina-Hongkong-Ameerika Ühendriigid 2000. Lisa : Aare Ermeli koostatud Chen Kaige ja Ang Lee loomingu lühikokkuvõtted. Kokkuvõte inglise keeles lk. 128

  16. The Role of Protein Elongation Factor eEF1A2 in Breast Cancer (United States)


    apoptosis . A summary of common EMT markers is listed in Table I. Importantly, these developmental regulators can induce EMT in a nondevelopmental...1978; Chen et al., 1997), apoptosis (Chen et al., 1997), and metabolic regulation (Bissell et al., 1977) has been known for decades, the molecular...marks the Spemann organizer in vertebrate gastrulation and is one of the fi rst identifi ed regulators of embryological patterning (De Robertis et al

  17. CLEAR: Cross-Layer Exploration for Architecting Resilience (United States)


    unavailable, or in an economy mode (low resilience, low power mode) when ABFT is available. However, the overheads outweigh benefits (details in [Cheng 16b...layer r Design, Automation , & Test in Europe, 2010. [Chen 05] Chen, Z. and J. Dong table real number codes based on random m Lecture Notes in...tolerate soft errors in processor c ACM/EDAC/IEEE Design Automation Conf., 2016. [Cheng 16b] Cheng, E., et al. -layer exploration for architecting

  18. Agent Reasoning Transparency: The Influence of Information Level on Automation-Induced Complacency (United States)


    automation performance using working memory capacity. Ergonomics . 2014;57(3):295–318. Barber D, Davis L, Nicholson D, Finkelstein N, Chen JYC. The...ELEMENT NUMBER 6. AUTHOR(S) Julia L Wright, Jessie YC Chen, Michael J Barnes, and Peter A Hancock 5d. PROJECT NUMBER 5e. TASK NUMBER 5f. WORK ...Appendix C. Cube Comparisons Test 131 Appendix D. Spatial Orientation Test 135 Appendix E. National Aeronautics and Space Administration-Task Load Index

  19. Activation of Hh Signaling: A Critical Biological Consequence of ETS Gene Anomalies in Prostate Cancer (United States)


    Mian BM. Hedgehog Signaling Pathway Activation in Bladder Transitional Cell Carcinoma (TCC). J Urol., 2010, 184(1):344-351. PMID: 20488474 3...Tanner MJ, Welliver RC Jr, Chen M, Shtutman M, Godoy A, Smith G, Mian BM, Buttyan R. Effects of Androgen Receptor and Androgen on Gene Expression in...activities. Proc. Natl. Acad. Sci. USA, 2012, 109(34):13799-804. PMID: 22869755 Manuscripts in Preparation 1. Chen M* (co-first author), Li N*, Carkner

  20. Phase relation of LaFe11· 6Si1· 4 compounds annealed at different ...

    Indian Academy of Sciences (India)

    Home; Journals; Bulletin of Materials Science; Volume 35; Issue 2. Phase relation of LaFe11.6Si1.4 compounds annealed at different high-temperature and the magnetic property of LaFe11.6−CoSi1.4 compounds. Xiang Chen Yungui Chen Yongbai Tang. Volume 35 Issue 2 April 2012 pp 175-182 ...

  1. New Jurassic tettigarctid cicadas from China with a novel example of disruptive coloration

    Directory of Open Access Journals (Sweden)

    Jun Chen


    Full Text Available Tettigarctidae is the most primitive family of Cicadoidea, with only two relict species. Although they are relatively well known from Eurasia, Australia, Africa, and South America, their Mesozoic examples are typically preserved only as isolated forewings. Herein, a new genus Sanmai Chen, Zhang, and B. Wang with three new species (Sanmai kongi Chen, Zhang, and B. Wang, S. mengi Chen, Zhang, and B. Wang, and S. xuni Chen, Zhang, and B. Wang are described based on fossil specimens from the Middle–Upper Jurassic of northeastern China, with well-preserved body structures, forewing and hindwing venations, making it the hitherto best known extinct tettigarctid taxon. The new genus, provisionally assigned to the tribe Turutanoviini, provides some new information about the evolution and palaeobiogeography of Mesozoic Tettigarctidae. The genus Paraprosbole is synonymized with Shuraboprosbole. In addition, the coloration pattern of forewing, prominent on some specimens of Sanmai kongi Chen, Zhang, and B. Wang sp. nov. and Sanmai xuni Chen, Zhang, and B. Wang sp. nov., represents a novel example of disruptive coloration in Tettigarctidae, which can effectively break up the body outline as well as surface, and so likely enabled these cicadas to reduce the detectability of potential predators.

  2. Lanthanide metal-organic frameworks

    International Nuclear Information System (INIS)

    Cheng, Peng


    This book contains the following nine chapters: lanthanide metal-organic frameworks: syntheses, properties, and potential applications (Stephen Fordham, Xuan Wang, Mathieu Bosch, Hong-Cai Zhou); 2. chiral lanthanide metal-organic frameworks (Weisheng Liu, Xiaoliang Tang); 3. Porous lanthanide metal-organic frameworks for gas storage and separation (Bin Li, Banglin Chen); 4. Luminescent lanthanide metal-organic frameworks (Xue-Zhi Song, Shu-Yan Song, Hong-Jie Zhang); 5. Metal-organic frameworks based on lanthanide clusters (Lian Chen, Feilong Jiang, Kang Zhou, Mingyan Wu, Maochun Hong); 6. metal-organic frameworks with d-f cyanide bridges: structural diversity, bonding regime, and magnetism (Marilena Ferbinteanu, Fanica Cimpoesu, Stefania Tanase); 7. transition-lanthanide heterometal-organic frameworks: synthesis, structures, and properties (Wei Shi, Ke Liu, Peng Cheng); 8: MOFs of uranium and the actinides (Juan Su, Jiesheng Chen); 9. Nanostructured and/or nanoscale lanthanide metal-organic frameworks (Zhonghao Zhang, Zhiping Zheng).

  3. Robust anonymous authentication scheme for telecare medical information systems. (United States)

    Xie, Qi; Zhang, Jun; Dong, Na


    Patient can obtain sorts of health-care delivery services via Telecare Medical Information Systems (TMIS). Authentication, security, patient's privacy protection and data confidentiality are important for patient or doctor accessing to Electronic Medical Records (EMR). In 2012, Chen et al. showed that Khan et al.'s dynamic ID-based authentication scheme has some weaknesses and proposed an improved scheme, and they claimed that their scheme is more suitable for TMIS. However, we show that Chen et al.'s scheme also has some weaknesses. In particular, Chen et al.'s scheme does not provide user's privacy protection and perfect forward secrecy, is vulnerable to off-line password guessing attack and impersonation attack once user's smart card is compromised. Further, we propose a secure anonymity authentication scheme to overcome their weaknesses even an adversary can know all information stored in smart card.

  4. Existence of positive periodic solution of mutualism system with several delays

    International Nuclear Information System (INIS)

    Wu Haihui; Xia Yonghui; Lin Muren


    In this paper, by using Mawhin coincidence degree, some sufficient conditions are obtained for the global existence of positive periodic solutions of a mutualism systems with bounded and unbounded delays. Our results generalize significantly improve those of Gopalsamy and He [Gopalsamy K, He XZ. Persistence, attractivity, and delay in facultative mutualism. J Math Anal Appl 1997;215:154-73], Yang et al. [Yang F, Jiang D, Ying A. Existence of positive solution of multidelays facultative mutualism system. J Eng Math 2002;3:64-8], Chen et al. [Chen FD, Shi JL, Chen XX. Periodicity in Lotka-Volterra facultative mutualism system with several delays. J Eng Math 2004;21(3)] and Xia and Lin [Xia YH, Lin M, Existence of positive periodic solution of mutualism system with infinite delays. Ann Diff Eqs 2005;21(3):448-53

  5. Lanthanide metal-organic frameworks

    Energy Technology Data Exchange (ETDEWEB)

    Cheng, Peng (ed.) [Nankai Univ., Tianjin (China). Dept. of Chemistry


    This book contains the following nine chapters: lanthanide metal-organic frameworks: syntheses, properties, and potential applications (Stephen Fordham, Xuan Wang, Mathieu Bosch, Hong-Cai Zhou); 2. chiral lanthanide metal-organic frameworks (Weisheng Liu, Xiaoliang Tang); 3. Porous lanthanide metal-organic frameworks for gas storage and separation (Bin Li, Banglin Chen); 4. Luminescent lanthanide metal-organic frameworks (Xue-Zhi Song, Shu-Yan Song, Hong-Jie Zhang); 5. Metal-organic frameworks based on lanthanide clusters (Lian Chen, Feilong Jiang, Kang Zhou, Mingyan Wu, Maochun Hong); 6. metal-organic frameworks with d-f cyanide bridges: structural diversity, bonding regime, and magnetism (Marilena Ferbinteanu, Fanica Cimpoesu, Stefania Tanase); 7. transition-lanthanide heterometal-organic frameworks: synthesis, structures, and properties (Wei Shi, Ke Liu, Peng Cheng); 8: MOFs of uranium and the actinides (Juan Su, Jiesheng Chen); 9. Nanostructured and/or nanoscale lanthanide metal-organic frameworks (Zhonghao Zhang, Zhiping Zheng).

  6. Virtual Trackballs Revisited

    DEFF Research Database (Denmark)

    Henriksen, Knud; Sporring, Jon; Hornbæk, Kasper


    reviews and provides a mathematical foundation for virtual trackballs. The first, but still popular, virtual trackball was described by Chen et al. [CHECK END OF SENTENCE]. We show that the virtual trackball by Chen et al. does not rotate the object along the intended great circular arc on the virtual...... trackball and we give a correction. Another popular virtual trackball is Shoemake's quaternion implementation [CHECK END OF SENTENCE], which we show to be a special case of the virtual trackball by Chen et al.. Shoemake extends the scope of the virtual trackball to the full screen. Unfortunately, Shoemake......'s virtual trackball is inhomogeneous and discontinuous with consequences for usability. Finally, we review Bell's virtual trackball [CHECK END OF SENTENCE] and discuss studies of the usability of virtual trackballs....

  7. A Brief Introduction of Air Traffic Management

    Institute of Scientific and Technical Information of China (English)


    Air Traffic Management (ATM) started publication in 1995 by Air Traffic Management Bureau of CAAC. It is the first magazine about ATM field in CAAC. The chairman of Editorial Board of ATM is Mr. Bao Peide, Vice Minister of CAAC. Mr. Chen Ziye, Vice President of the 1st Research Institute of CAAC and Chen Xuhua, General Director of Air Traffic Management Bureau are vice chairmen of the editorial board, and six general directors of local air traffic management bureau and some professors and experts are members of the editorial board.

  8. Computationally Efficient Modeling of Hydrocarbon Oxidation Chemistry and Flames Using Constituents and Species (United States)


    Cremer , J-Y Chen, C.K. Westbrook, L.Q. Maurice, J. Propul. Power 18 (1) (2002) 192–198. K. Harstad, J. Bellan / Combustion and Flame 157 (2010) 1594... Cremer , J.-Y. Chen, C.K. Westbrook, L.Q. Maurice, J. Propuls. Power 18 (1) (2002) 192–198. a 10-9 10-7 10-5 10-3 10-1 101 N oh (m ol /m 3 ) T0 = 800...Caltech by the Army Research Office under the direction of Drs. David Mann, Kevin McNesby and Ralph Anthenien. References 1U. C. Müeller, N. Peters, A

  9. Adaptive feedback synchronization of Lue system

    International Nuclear Information System (INIS)

    Han, X.; Lu, J.-A.; Wu, X.


    This letter further improves and extends the works of Chen and Lue [Chaos, Solitons and Fractals 14 (2002) 643] and Wang et al. [Phys. Lett. A 312 (2003) 34]. In detail, the linear feedback synchronization and adaptive feedback synchronization for Lue system are discussed. And the lower bound of the feedback gain in linear feedback synchronization is presented. The adaptive feedback synchronization with only one controller is designed, which improves the proof in the work by Wang et al. The adaptive synchronization with two controllers for completely uncertain Lue system is also discussed, which extends the work of Chen and Lue. Also, numerical simulations show the effectiveness of these methods

  10. Scattering of plane waves by rough surfaces in the sense of Born approximation


    Arnold, Thomas


    Das Thema dieser Arbeit ist die Streuung elektromagnetischer ebener Wellen an rauen Oberflächen, also an ebenen Oberflächen mit glatten und beschränkten Störungen. Darüber hinaus wird ein kleiner Kontrast der Materialkonstanten zwischen dem Deckmaterial und dem Material unter der rauen Oberfläche angenommen. Unter diesen Voraussetzungen wird ein Fernfeld-Formel für das gestreute Feld mit Hilfe von Born-Approximation und Fourier-Techniken hergeleitet. Dieser Ansatz basiert auf einer Modifikati...

  11. Hybrid dislocated control and general hybrid projective dislocated synchronization for the modified Lue chaotic system

    International Nuclear Information System (INIS)

    Xu Yuhua; Zhou Wuneng; Fang Jianan


    This paper introduces a modified Lue chaotic system, and some basic dynamical properties are studied. Based on these properties, we present hybrid dislocated control method for stabilizing chaos to unstable equilibrium and limit cycle. In addition, based on the Lyapunov stability theorem, general hybrid projective dislocated synchronization (GHPDS) is proposed, which includes complete dislocated synchronization, dislocated anti-synchronization and projective dislocated synchronization as its special item. The drive and response systems discussed in this paper can be strictly different dynamical systems (including different dimensional systems). As examples, the modified Lue chaotic system, Chen chaotic system and hyperchaotic Chen system are discussed. Numerical simulations are given to show the effectiveness of these methods.

  12. Parameters identification and adaptive full state hybrid projective synchronization of chaotic (hyper-chaotic) systems

    International Nuclear Information System (INIS)

    Hu Manfeng; Xu Zhenyuan; Zhang Rong; Hu Aihua


    Based on the active control idea and the invariance principle of differential equations, a general scheme of adaptive full state hybrid projective synchronization (FSHPS) and parameters identification of a class of chaotic (hyper-chaotic) systems with linearly dependent uncertain parameters is proposed in this Letter. With this effective scheme parameters identification and FSHPS of chaotic and hyper-chaotic systems can be realized simultaneously. Numerical simulations on the chaotic Chen system and the hyper-chaotic Chen system are presented to verify the effectiveness of the proposed scheme

  13. Pollen Flora of Yuenyang Lake Nature Preserve, Taiwan (IV

    Directory of Open Access Journals (Sweden)

    Yu-Fa Wang


    Full Text Available Yuenyang Lake is an acidic lake situated within a nature preserve in northern Taiwan. The pollen of nineteen taxa, belonging to five families, was collected from this nature preserve and investigated with light and scanning electron microscopy. The results of this investigation are supplementary work to the previous publications in this journal (Chen and Wang, 1999, 2001; Wang and Chen, 2001. A total of 4 pollen classes were identified on the basis of the aperture on the pollen wall: 3-colpate, 6-colpate, 3-colporate, and 4-7-colporate pollen. These results could be useful in the reconstruction of vegetation history around the Yuenyang Lake.

  14. Distributed mechatronics controller for modular wall climbing robot

    CSIR Research Space (South Africa)

    Tlale, NS


    Full Text Available - climbing robot for inspection in nuclear power plants.”, Proc. IEEE Int. Conf. on Robotics and Automation, pp. 409-1414. (Chen 2001) Chen, D-. J., 2001, “Architecture for Systematic Development of Mechatronics Software Systems”, Licentiate Thesis... provide a more cost effective solution to the problem (Luk et al 1991). Such robots are termed service robots by the International Service Robot Association (ISRA) (Pransky 1996). They are defined as machines that sense, think, and act to benefit (or...

  15. Size-controlled fabrication of zein nano/microparticles by modified anti-solvent precipitation with/without sodium caseinate


    Li, Feng; Chen, Yan; Liu, Shubo; Qi, Jian; Wang, Weiying; Wang, Chenhua; Zhong, Ruiyue; Chen, Zhijun; Li, Xiaoming; Guan, Yuanzhou; Kong, Wei; Zhang, Yong


    Feng Li,1 Yan Chen,1,2 Shubo Liu,1 Jian Qi,1 Weiying Wang,1 Chenhua Wang,1 Ruiyue Zhong,1 Zhijun Chen,1 Xiaoming Li,1 Yuanzhou Guan,1 Wei Kong,1,2 Yong Zhang1,2 1National Engineering Laboratory for AIDS Vaccine, School of Life Sciences, Jilin University, Changchun, 2Key Laboratory for Molecular Enzymology and Engineering, the Ministry of Education, School of Life Sciences, Jilin University, Changchun, China Abstract: Zein-based nano/microparticles have been demonstrated to be promising carr...

  16. A glimpse into the littoral nutrient dynamics of a lake system connected to the sea

    CSIR Research Space (South Africa)

    Taljaard, Susan


    Full Text Available -situ sources are those situated in the floodplains of water bodies such as septic tank systems from low-lying developments (e.g. Chen, 1988; Fraterrigo and Downing, 2008). The smaller, dynamic and more linear nature of over 80% of South Africa’s estuaries... of agricultural watersheds in central Navarre (Spain). Agric. Water Manage. 95 1111–1128. CHEN M (1988) Pollution of ground water by nutrients and fecal coliforms from lakeshore septic tank systems. Water Air Soil...

  17. miR-139-5p regulates proliferation, apoptosis, and cell cycle of uterine leiomyoma cells by targeting TPD52


    Chen,Hong; Xu,Hong; Meng,Yugang; Zhang,Yun; Chen,Junying; Wei,Xiaoning


    Hong Chen,1 Hong Xu,1 Yu-gang Meng,1 Yun Zhang,2 Jun-ying Chen,1 Xiao-ning Wei1 1Department of Gynaecology, The First Affiliated Hospital of Guangxi Medical University, Nanning, Guangxi, 2Department of Gynaecology, The People’s Hospital of Suzhou High Tech District, Suzhou, Jiangsu, People’s Republic of China Background: Uterine leiomyoma is one of the most common benign tumors in women. It dramatically decreases the quality of life in the affected women. However, there ...

  18. New Techniques for Thermo-electrochemical Analysis of Lithium-ion Batteries for Space Applications (United States)

    Walker, William; Ardebili, H.


    The overall goal of this study was achieved: Replicated the numerical assessment performed by Chen et. al. (2005). Displayed the ability of Thermal Desktop to be coupled with thermo-electrochemical analysis techniques. such that the local heat generated on the cells is a function of the model itself using logic blocks and arrays. Differences in the TD temperature vs. depth of discharge profiles and Chen's was most likely due to differences in two primary areas: Contact regions and conductance values. Differences in density and specific heat values. center dot The model results are highly dependent on the accuracy of the material properties with respect to the multiple layers of an individual cell.

  19. A multislice theory of electron scattering in crystals including backscattering and inelastic effects. (United States)

    Spiegelberg, Jakob; Rusz, Ján


    In the framework of the slice transition operator technique, a general multislice theory for electron scattering in crystals is developed. To achieve this generalization, we combine the approaches for inelastic scattering derived by Yoshioka [J. Phys. Soc. Jpn. 12, 6 (1957)] and backscattering based on the formalism of Chen and Van Dyck [Ultramicroscopy 70, 29-44 (1997)]. A computational realization of the obtained equations is suggested. The proposed computational scheme is tested on elastic backscattering of electrons, where we consider single backscattering in analogy to the computational scheme proposed by Chen and Van Dyck. Copyright © 2015 Elsevier B.V. All rights reserved.

  20. The Role of Retinal Determination Gene Network (RDGN) in Hormone Signaling Transduction and Prostate Tumorigenesis (United States)


    Wu K, Wang L, Jiao X, Ju X, Li Z, Ertel A, Addya S, McCue P, Lisanti MP, Wang C, Davis RJ, Mardon G, Pestell RG. Androgen therapy resistant...Li Z, Hu J, Chen K, Wu J, Pestell RG. DACH1 inhibited prostate cancer cellular proliferation and Interleukon-6 signaling. AACR 103rd Annual Meeting...March 31 – April 4, 2012, Chicago, IL.  Wang J, Cai S, Chen K, Sun Y, Li S, Pestell RG, Wu K. Regulation of AR transcriptional activity and

  1. Reforming China’s Criminal Procedure Law


    Winckler, Hugo


    Sources:- Wang Jianxun, “The provisions of the reform of criminal procedural law legalising secret investigations are a step backwards,” Caijing wang, 5 September 2011.- Chen Youxi, “The legalisation of secret investigations is an important violation of political integrity,” Zhongguo wangluo dianshitai – CNTV web site, Opinion section, 27 November 2011.- Wu Zhehua, “Chen Weidong discusses reform of the criminal procedure law: Behind each article there is a story,” Zhongguoguangbo wang, 8 Marc...

  2. Qingryllus jiguanshanensis sp. n. from Sichuan, China, the second species of Qingryllus (Orthoptera, Gryllidae

    Directory of Open Access Journals (Sweden)

    Haoyu Liu


    Full Text Available A second species of Qingryllus Chen & Zheng is described and illustrated, Q. jiguanshanensis sp. n., from Sichuan, China. This new species is similar to Q. striofemorus Chen & Zheng, 1995, but differs from the latter by the posterior margin of pronotum being distinctly widened, the veins of tegmina yellowish-white only on lateral side of dorsal area, and the epiphallus distinctly widened posteriorly. A distribution map of the species of this genus and habitus photographs of the new species are presented.

  3. 清末民初における『レ・ミゼラブル』の移入と日本 : 陳景韓訳「哀史之一節逸犯」を例として


    梁, 艶; Liang, Yan


    Victor Hugo was introduced into China through his Japanese translations. However, the route of the reception of his masterpiece Les Misérables in China has not yet been explained clearly. In this paper, I will take Ai Shi Zhi Yi Jie Yi Fan, a Chinese translation by Chen Jinghan of a part of Les Misérables, as an example to see how Les Misérables was introduced into China. By examining Japanese translations of Les Misérables, I come to the conclusion that Chen was influenced by Kuroiwa Ruikô's...

  4. Hybrid dislocated control and general hybrid projective dislocated synchronization for the modified Lue chaotic system

    Energy Technology Data Exchange (ETDEWEB)

    Xu Yuhua [College of Information Science and Technology, Donghua University, Shanghai 201620 (China) and Department of Maths, Yunyang Teacher' s College, Hubei 442000 (China)], E-mail:; Zhou Wuneng [College of Information Science and Technology, Donghua University, Shanghai 201620 (China)], E-mail:; Fang Jianan [College of Information Science and Technology, Donghua University, Shanghai 201620 (China)


    This paper introduces a modified Lue chaotic system, and some basic dynamical properties are studied. Based on these properties, we present hybrid dislocated control method for stabilizing chaos to unstable equilibrium and limit cycle. In addition, based on the Lyapunov stability theorem, general hybrid projective dislocated synchronization (GHPDS) is proposed, which includes complete dislocated synchronization, dislocated anti-synchronization and projective dislocated synchronization as its special item. The drive and response systems discussed in this paper can be strictly different dynamical systems (including different dimensional systems). As examples, the modified Lue chaotic system, Chen chaotic system and hyperchaotic Chen system are discussed. Numerical simulations are given to show the effectiveness of these methods.

  5. The Secret of Guided Missile Re-Entry, (United States)


    I RD-PAI169 598 THE SECRET OF GUIDED MISSILE RE-ENTRY(U) FOREIGN / I TECHNOLOGY DIV NRIGHT-PATTERSON RFB OH J CHEN ET AL. I 25 JUN 96 FTD-ID(RS)T...TECHNOLOGY DIVISION THE SECRET OF GUIDED MISSILE RE-ENTRY by Chen Jingzhong, An Sehua J L 0 7 ’:;85’ ’ 0 *Approved for public release; Distribution...unlimite t d. :. 86 7 034.. FTD- ID(RS)T-0459-86 HUMAN TRANSLATION FTD-ID(RS)T-0459-86 25 June 1986 MICROFICHE NR: F - - 0Q 9? THE SECRET OF GUIDED

  6. Support from the Army Research Office to be Used Towards Student Travel Fellowships for the National Radio Science Meetings in January 2010, 2011, and 2012 (United States)


    K2-2 COMPUTATIONAL STUDY OF EXTERNAL FIXATION DEVICES SURFACE HEATING IN 1.5T AND 3T MRI SYSTEMS Yan Liu*1, Jianxiang Shen1, Ji Chen1, Wolfgang...communications have been ex- panding rapidly with the proliferation of consumer wireless devices such as smart phones, tablet PCs, handheld gaming devices, and...Computational Study of External Fixation Devices Surface Heating in 1.5T and 3T MRI Systems Yan Liu* (1) , Jianxiang Shen (1) , Ji Chen (1) , and

  7. Sensory integration dysfunction affects efficacy of speech therapy on children with functional articulation disorders


    Tung, Li-Chen; Lin, Chin-Kai; Hsieh, Ching-Lin; Chen, Ching-Chi; Huang, Chin-Tsan; Wang, Chun-Hou


    Li-Chen Tung,1,# Chin-Kai Lin,2,# Ching-Lin Hsieh,3,4 Ching-Chi Chen,1 Chin-Tsan Huang,1 Chun-Hou Wang5,6 1Department of Physical Medicine and Rehabilitation, Chi Mei Medical Center, Tainan, 2Program of Early Intervention, Department of Early Childhood Education, National Taichung University of Education, Taichung, 3School of Occupational Therapy, College of Medicine, National Taiwan University, Taipei, 4Department of Physical Medicine and Rehabilitation, National Taiwan University Hospital, ...

  8. Earthworms of the 'acaecate' Pheretima group in Vietnam (Oligochaeta: Megascolecidae), with description of a new species from the Mekong delta. (United States)

    Nguyen, Tung T; Tran, Binh T T; Nguyen, Anh D


    The 'acaecate' Pheretima group from Vietnam is revised, with description of a new species, Polypheretima mekongmontis sp. nov. A total of 18 species of three genera, Metapheretima Michaelsen, 1928, Planapheretima Michaelsen, 1934, and Polypheretima Michaelsen, 1934 has been recorded from Vietnam. Caecate species of Planapheretima are included here as well. Planapheretima arboricola (Rosa, 1890), Pl. lacertina (Chen, 1946), Pl. tenebrica (Chen, 1946), Polypheretima elongata (Perrier, 1872), and Po. taprobanae (Beddard, 1892) are originally recorded from other countries; all remaining species are native to Vietnam. The species Polypheretima tani (Thai, 1996) and Po. tiencanhensis (Pham, 1995) are transferred to the genus Metapheretima. A key to species and distribution maps are also presented.

  9. Is the Chinese Army the Real Winner in PLA Reforms (United States)


    44 Commentary / The Chinese Army and PLA Reforms JFQ 83, 4th Quarter 2016 Is the Chinese Army the Real Winner in PLA Reforms? By Phillip C. Saunders...and John Chen G round force officers run China’s military, the People’s Liberation Army ( PLA ). About 70 percent of PLA soldiers serve in the PLA ...Saunders and Chen 45 services and arms of the PLA ” has meant reductions in “technologically backward” PLAA units and personnel increases for the other

  10. Why Should You Use a Clear Pattern of Organization? Because it Works (United States)

    Slagell, Amy


    Decades of research in psychology, education, and communication stand behind the claim that chunking information and providing connections among those chunks helps students learn (Bodiea, Powers, & Fitch-Hauser, 2006; Cowan, Chen, & Rouder, 2004; Gabriel & Mayzner, 1963; Miller, 1956). Informative speakers, who aim to help audiences…

  11. Power-Scalable Blue-Green Bessel Beams (United States)


    building system to achieve emission at the desired blue colours , was, however, abandoned due to lack of funds relative to the original anticipated award...Chen, P. Steinvurzel, K. Rottwitt, S. Ramachandran, “High-energy Fiber Lasers at Non-traditional Colours , via Intermodal Nonlinearities,” CTu3M.6

  12. Zhang et al., Afr J Tradit Complement Altern Med. (2014) 11(6):66-76

    African Journals Online (AJOL)


    So DNA barcodes for identifying herbal materials should have great usability and variation. Previous data suggested that ITS2 represented the most suitable region for DNA barcoding applications so it was proposed as a novel universal barcode for herbal materials (Chen et al.,. 2010, 2013; Yao et al., 2010). Until now, the ...

  13. Thirty-seven transcription factor genes differentially respond to a ...

    Indian Academy of Sciences (India)

    Plant transcription factors and insect defence si. Thirty-seven transcription factor genes differentially respond to a harpin protein and affect resistance to the green peach aphid in Arabidopsis. HUNLIN. PIN. RUOXUE LIŲ, BEIBEI LÜ, XIAOMENG WANG, CHUNLING ZHANG, SHUPING ZHANG, JUN QIAN, LEI CHEN,.

  14. Integrated Eye Tracking and Neural Monitoring for Enhanced Assessment of Mild TBI (United States)


    working memory load effects after mild traumatic brain injury. Neuroimage, 2001. 14(5): p. 1004-12. 2. Chen, J.K., et al., Functional abnormalities 10 Supporting Data None. Integrated Eye Tracking and Neural Monitoring for Enhanced Assessment of Mild TBI Psychological Health

  15. Enhancing the Breadth and Efficacy of Therapeutic Vaccines for Breast Cancer (United States)


    REPORTABLE OUTCOMES: None OTHER ACHIEVEMENTS: No other achievements to report. REFERENCES: 1. Wolfl M, Kuball J, Ho WY, Nguyen H, Manley TJ...Valiante NM, Chen L, Lee C, Gumperz JE, Phillips JH, Lanier LL , Bigge JC, Parekh RB, Parham P. The inter-locus recombinant HLA-B*4601 has high

  16. Comparing rat and rabbit embryo-fetal developmental toxicity data for 379 pharmaceuticals: on systemic dose and developmental effects

    NARCIS (Netherlands)

    Peter T. Theunissen; Bruce Beyer; Sonia Beken


    And co-authors William J. Breslin, Gregg D. Cappon, Connie L. Chen, Gary Chmielewski, Luc de Schaepdrijver, Brian Enright, Jennifer E. Foreman, Wafa Harrouk, Kok-Wah Hew, Alan M. Hoberman, Julia Y. Hui, Thomas B. Knudsen, Susan B. Laffan, Susan L. Makris, Matthew Martin, Mary Ellen McNerney,

  17. The role of the yeast as probiotic in protection against liver injury

    African Journals Online (AJOL)


    cancer treatment (Chen et al., 2009). In this study, we ... animal food. The final yeast amount eaten by each rat/day was 500 mg/kg/day. Animals. Adult male Wistar albino rats, ageing approximately three months ..... collection of inflammatory cells and loss of hepatic tissue structural pattern; (d) treated with only yeast. CV,.

  18. Journal of Genetics | Indian Academy of Sciences

    Indian Academy of Sciences (India)

    Home; Journals; Journal of Genetics. BINLONG CHEN. Articles written in Journal of Genetics. Volume 95 Issue 3 September 2016 pp 675-681 RESEARCH ARTICLE. Genetic diversity of bitter taste receptor gene family in Sichuan domestic and Tibetan chicken populations · YUAN SU DIYAN LI UMA GAUR YAN WANG ...

  19. Isolation of Stilbenoids and Lignans from Dendrobium hongdie

    African Journals Online (AJOL)

    Chen YG, Xu JJ, Yu H, Qing C, Zhang YL, Wang LQ, Liu. Y, Wang JH. Cytotoxic phenolics from Bulbophyllum odoratissimum. Food Chem, 2008; 107: 169–173. 17. Hernández-Romero Y, Acevedo L, Sánchez MLÁ, Shier. WT, Abbas HK, Mata R. Phytotoxic activity of bibenzyl derivatives from the Orchid Epidendrum rigidum.

  20. Bulletin of Materials Science | Indian Academy of Sciences

    Indian Academy of Sciences (India)

    Ping Chen1 2 Qing-Sheng Wu1 Ya-Ping Ding3 Pin-Shi Yuan1. Department of Chemistry, Tongji University, 1239 Siping Road, Shanghai 200092, P.R. China; Department of Chemistry, Chizhou College, Chizhou, Anhui 247000, P.R. China; Department of Chemistry, Shanghai University, Shanghai 200436, P.R. China ...

  1. Two genera Foersteria Szépligeti, 1896 and Polydegmon Foerster, 1862 (Hymenoptera, Braconidae, Brachistinae) from China, with description of a new species. (United States)

    Yan, Cheng-Jin; He, Jun-Hua; Chen, Xue-Xin


    The genera Foersteria Szépligeti, 1896 and Polydegmon Foerster, 1862 (Hymenoptera, Braconidae, Brachistinae) are recorded for the first time from China. A new species, Foersteria xinjiangensis Yan & Chen, sp. nov., is described and illustrated. A key to the Palaearctic species of Foersteria is given. In addition, Polydegmon sinuatus Foerster, 1862 is illustrated in detail for the first time.

  2. Chaos Q-S synchronization between Rossler system and the new unified chaotic system

    International Nuclear Information System (INIS)

    Yan Zhenya


    In this Letter, we investigate the Q-S synchronization between two different chaotic systems: the Rossler system and the new unified Lorenz-Chen-Lu system based on the backstepping design method and Lyapunov stability theory. Moreover numerical simulations are used to verify the effectiveness of the proposed controller

  3. Journal of Genetics | Indian Academy of Sciences

    Indian Academy of Sciences (India)

    Yu-Song Guo Zhong-Duo Wang Cheng-Zhong Yan Yu-Lan Zhang Jin-Nan Zheng Yuan-Min Xu Tao Du Chu-Wu Liu · More Details Fulltext PDF ... Aifu Yang Dapeng Sun Shikai Liu Ying Dong Zhong Chen Zunchun Zhou · More Details Fulltext ...

  4. Biomarkers of Exposure to Toxic Substances. Volume 2: Genomics: Unique Patterns of Differential Gene Expression and Pathway Perturbation Resulting from Exposure to Nephrotoxins with Regional Specific Toxicity (United States)


    producing cells in TGF-beta 1-induced renal interstitial fibrosis,” Histochemistry and Cell Biology., 119, 4, Apr 2003 pp. 267-80. Chen X, Abair TD ...protein l53 (predicted) 1367559_at ferritin light chain 1 1367589_at aconitase 2, mitochondrial 1367591_at peroxiredoxin 3 1367609_at macrophage

  5. Effects of Leak Detection/Location on Underground Heat Distribution System (UHDS) Life Cycle Costs: A Probabilistic Model (United States)


    ADA167556 (USACERL, March 1986). E. Segan and C. Chen ’K. Cooper et a]. 9 spots associated with leaks are detected with either a digital temperature...HSHG.DEX ATTN: NAPEN-FL Walte Road AMC 20307 Norto APB. CA 92409 ATTN: Faciliion Ensgime ATIN: APRC-MX4DB US Ary Roagr Diviaiur AWlN: Libary (13

  6. Journal of Astrophysics and Astronomy | Indian Academy of Sciences

    Indian Academy of Sciences (India)

    Home; Journals; Journal of Astrophysics and Astronomy; Volume 37; Issue 2. Issue front cover thumbnail. Volume 37, Issue 2. June 2016. Article ID 8. Stochastic Oscillations of General Relativistic Disks Described by a Fractional Langevin Equation with Fractional Gaussian Noise · Wang Zhi-Yun Chen Pei-Jie · More Details ...

  7. Creativity and Control : A Paradox-Evidence from the Levers of Control Framework

    NARCIS (Netherlands)

    Speklé, R.F.; van Elten, Hilco; Widener, Sally


    Both control and creativity are important drivers of organizational success (Gilson, Mathieu, Shally, and Ruddy 2005; Hirst, Van Knippenberg, Chen, and Sacramento 2011). However, they are often regarded as conflicting. We use the Levers of Control (LoC) framework to examine the relationships between

  8. Some determinantal inequalities for Hadamard and Fan products of matrices

    Directory of Open Access Journals (Sweden)

    Xiaohui Fu


    Full Text Available Abstract In this note, we generalize some determinantal inequalities which are due to Lynn (Proc. Camb. Philos. 60:425-431, 1964, Chen (Linear Algebra Appl. 368:99-106, 2003 and Ando (Linear Multilinear Algebra 8:291-316, 1980.

  9. Nanotechnology Enabled Hybrid Power System Suitable for Portable Telecommunications and Sensor Applications (United States)


    Similar nanostructures have been used to improve electrostatic capacitors. For example, metal- insulator - metal capacitor arrays fabricated in anodic...Materials, vol. 25, pp. 285-290 (2010). [11] X. Li, C. Han, X. Chen, C. Shi, Microporous and Mesoporous Materials, vol. 131, pp. 303- 309 (2010). [12] D

  10. Knowledge Production with Asia-Centric Research Methodology (United States)

    Park, Jae


    Taiwanese cultural critic Kuan-Hsing Chen has elaborated and promoted an "Asia and the rest" worldview for over a decade. His "opus magnum" "Asia as Method" argues for a paradigm shift to observe Asian reality with a de-imperialized, de-colonized, and de-Cold War mentality. The work has produced academic discussions…

  11. Fast simulation of non-steady state emission problems in energy conversion

    NARCIS (Netherlands)

    Mees, P.A.J.; Wolff, E.H.P.; Verheijen, P.J.T.; Van den Bleek, C.M.


    Application of the Fast Fourier Transform (FFT) to the inversion of Laplace transforms is a recent development in the solution of the equations describing the behavior of chemical reactors. Chen and Hsu (1987) used the Fast Fourier Transform for the prediction of breakthrough curves of an isothermal

  12. Tanshinones as Effective Therapeutic Agents for Prostate Cancer (United States)


    Y. Tian, T.-F. Chen, W. Ye, L. Li, F. Ni, J.-R. Zhou: Construction and screening of fractional library of Salvia Miltiorrhiza for the rapid...glutathione perturbation. Food Chem Toxicol 2008;46: 328–38. 19. Singh AV, Franke AA, Blackburn GL, Zhou JR. Soy phytochemicals prevent orthotopic growth and

  13. Journal of Astrophysics and Astronomy | Indian Academy of Sciences

    Indian Academy of Sciences (India)


    Jan 27, 2016 ... Author Affiliations. J. B. Su1 Z.-Q. Shen1 X. Chen1 Jiyune Yi2 D. R. Jiang1 Y. J. Yun3. Shanghai Astronomical Observatory, Chinese Academy of Sciences, Shanghai 200030, China. Korea Astronomy and Space Science Institute, Daejeon 305-348, South Korea. Department of Physics and Astronomy, ...

  14. The genetic background affects the vascular response in T-type calcium channels 3.2 deficient mice

    DEFF Research Database (Denmark)

    Svenningsen, Per; Hansen, Pernille B L


    -type channels are the dominant Ca(2+) entry pathway in vascular smooth muscle cells, however, T-type calcium channels are also expressed in the cardiovascular system where they play a functional role in the regulation of both contraction and vasodilation in (Chen et al. 2003; Hansen et al. 2001). This article...... is protected by copyright. All rights reserved....

  15. In vitro induction of multiple buds from cotyledonary nodes of ...

    African Journals Online (AJOL)

    reading 6


    Feb 1, 2012 ... Balsam pear (Momordica charantia L.) is a weak climbing annual vine ... acids, reducing sugars and fixed oil (Dhalla et al., 1961). Ambasta et ..... Lee-Huang S, Huang PL, Bourinbaiar AS, Chen HC, Kung HF (1995). Inhibition ...

  16. Photoluminescence quenching and enhanced optical conductivity of P3HT derived Ho3+-doped ZnO nanostructures

    CSIR Research Space (South Africa)

    Kabongo, GL


    Full Text Available , Swart HC (2016) Eu3 + doped down shifting TiO2 layer for efficient dye-sensitized solar cells. J Colloid Interface Sci 484:24–32 70. Tung-Ming P, Li-Chen Y, Xin-Chang W (2010) A comparative study on the structural properties and electrical...


    African Journals Online (AJOL)


    Nov 13, 2017 ... The large and sudden rise in maize cultivation in some African ... Maize is grown globally from 50oN–40oS, and from sea level up to ...... Chen, M.; Ma, L.Q. Comparison of three aqua-regia digestion methods for twenty Florida.

  18. Download this PDF file

    African Journals Online (AJOL)


    1,3, Wen-Chi Chen*4. 1Department of Urology, Chang Bing Show Chwan Memorial Hospital, 2Department of Life ..... with WLS was first recorded in the book written by Ken-Tang Wang entitled “Zheng Zhi Zhun Sheng” (standards of patterns and treatment) during the Ming Dynasty (late sixteenth century). Since that time, the ...

  19. Characterization and photocatalytic activity of boron-doped TiO2 thin ...

    Indian Academy of Sciences (India)


    Chen Daimai, Wang Dong Yang and Jiang Zhongyi 2006 Ind. Eng. Chem. 45 4110. Cheng Jen-hao 2003 A study on photocatalytic oxidation of aque- ous chlorobenzene solution by nanostructured film of TiO2,. Master Thesis, National Sun Yat-Sen University, Taiwan. Deki S, Henin Yu Yu Ko, Fujita T, Akamatsu K, Mizuhata ...

  20. Lattice Boltzmann method to study the contraction of a viscous ligament

    NARCIS (Netherlands)

    Srivastava, S.; Driessen, T.W.; Jeurissen, R.J.M.; Wijshoff, H.M.A.; Toschi, F.


    We employ a recently formulated axisymmetric version of the multiphase Shan–Chen (SC) lattice Boltzmann method (LBM) [S. Srivastava et al., Phys. Rev. E88, 013309 (2013)] to simulate the contraction of a liquid ligament. We compare the axisymmetric LBM simulation against the slender jet (SJ)

  1. Growth of Tungsten Bronze Family Crystals (United States)


    the other weighs the crucible (Technical Specialties and Services (TSS)). Both systems are adequate for our needs, but the TSS system is designed for...507. 47. L.H. Lin, Proc. IEEE 57 (1969), 210. 48. F.S. Chen, J. AppI. Phys. 38 (1967), 3148. 49. E. Okoniata. H-. Ikea and K. Muto, Appi. Opt. 14

  2. Accessing the capability of TRMM 3B42 V7 to simulate streamflow ...

    Indian Academy of Sciences (India)

    Brijesh Kumar


    Mar 6, 2018 ... The curve number. (CN) is an index to divide the precipitated water into runoff and infiltration after subtracting the initial losses, which depends on the slope, land use and soil data. For this study, we have used global land cover information from GlobeLand30. (Chen et al. 2015) (http://www.globallandcover.

  3. Biology and life history of Argopistes tsekooni (Coleoptera: Chrysomelidae) in China, a promising biological control agent of Chinese privet. (United States)

    Y-Z Zhang; J. Sun; J.L. Hanula


    The biology and life history of Argopistes tsekooni Chen (Coleoptera: Chrysomelidae), a potential biological control agent of Chinese privet, Ligustrum sinense Lour., was studied under laboratory and outdoor conditions in Huangshan City of Anhui Province, China, in 2006. A. tsekooni larvae are leafminers that...

  4. Mitochondrial Damage: A Diagnostic and Metabolic Approach in Traumatic Brain Injury and Post-Traumatic Disorder (United States)


    Global mapping of the yeast genetic interaction network. Science 2004;303:808-13. 28. Chen S, Wang C, Eberly LE, Caffo BS, Schwartz BS. Adaptive control...of the false discovery rate in voxel-based morphometry. Hum Brain Mapp 2009;30:2304-11. 29. Parihar MS, Brewer GJ. Mitoenergetic failure in

  5. Co-catalyst free Titanate Nanorods for improved Hydrogen ...

    Indian Academy of Sciences (India)

    Herein, we report a simplified method for the preparation of photo-active titanate nanorods catalyst .... The TEM images were taken with Philips Technai G2 FEI F12 trans- mission electron microscope operating at 80-100 kV. Optical properties were measured in DRS ..... Chen X, Shen S, Guo L and Mao S S 2010 Chem. Rev ...

  6. Statistical Properties of Gamma-Ray Burst Host Galaxies Jie-Min ...

    Indian Academy of Sciences (India)

    Statistical Properties of Gamma-Ray Burst Host Galaxies. Jie-Min Chen1, Jin Zhang2,3, ... of GRB host galaxies and explore possible correlations between these properties. We also investigate possible cosmic ... hydrogen column density for the GRB host galaxies in our sample. 6.295. The stellar masses are mainly in the ...

  7. Efficacy of carvedilol in pediatric heart failure

    DEFF Research Database (Denmark)

    Christensen, Alex Hørby; Fatkin, Diane


    Evaluation of: Huang M, Zhang X, Chen S et al. The effect of carvedilol treatment on chronic heart failure in pediatric patients with dilated cardiomyopathy: a prospective, randomized-controlled study. Pediatr. Cardiol. 34, 680-685 (2013). A role for β-blockers in children with heart failure has...

  8. A View from Within: A Case Study of Chinese Heritage Community Language Schools in the United States. (United States)

    Wang, Xueying, Ed.

    A collection of essays on Chinese heritage community language schools in the United States addresses these topics: the schools, their curricula, and organization (Theresa Hsu Chao); school administration and management (Chao, Lydia Chen, Edward Chang); academic curriculum (Pay-Fen Serena Wang); non-heritage Chinese learners: practices and…

  9. Horseshoes in a Chaotic System with Only One Stable Equilibrium (United States)

    Huan, Songmei; Li, Qingdu; Yang, Xiao-Song

    To confirm the numerically demonstrated chaotic behavior in a chaotic system with only one stable equilibrium reported by Wang and Chen, we resort to Poincaré map technique and present a rigorous computer-assisted verification of horseshoe chaos by virtue of topological horseshoes theory.

  10. The impact of anode design on fuel crossover of direct ethanol fuel cell

    Indian Academy of Sciences (India)

    than methanol due to the higher molecular weight of ethanol compared with methanol .... converted in the cathode side, hydrogen ions were then sent from the cathode to .... retard the ethanol crossover and possibly improve the dura- bility. ... [4] Wan C-H and Chen C-L 2009 Int. J. Hydrogen Energy 34. 9515. [5] Pethaiah ...

  11. 75 FR 59290 - In the Matter of Certain Game Controllers; Notice of Commission Determination Not To Review an... (United States)


    ... CONTACT: Jia Chen, Office of the General Counsel, U.S. International Trade Commission, 500 E Street, SW....m. to 5:15 p.m.) in the Office of the Secretary, U.S. International Trade Commission, 500 E Street... investigation on May 9, 2010, based on a complaint filed by Microsoft Corporation (``Microsoft'') of Redmond...

  12. Journal of Genetics | Indian Academy of Sciences

    Indian Academy of Sciences (India)

    Three duplication events and variable molecular evolution characteristics involved in multiple GGPS genes of six Solanaceae species. FENG LI CHUNYANG WEI CHAN QIAO ZHENXI CHEN PENG WANG PAN WEI RAN WANG LIFENG JIN JUN YANG FUCHENG LIN ZHAOPENG LUO. RESEARCH NOTE Volume 95 Issue ...

  13. Pramana – Journal of Physics | Indian Academy of Sciences

    Indian Academy of Sciences (India)

    dimensional coupled double-distribution-function lattice Boltzmann models for compressible Navier–Stokes equations. RUO-FAN QIU YAN-CHENG YOU CHENG-XIANG ZHU RONG-QIAN CHEN JIAN-FENG ZHU. Research Article Volume 89 Issue ...

  14. Dissecting the Role of IGFBP-2 in Development of Acute Myeloid Leukemia (United States)


    IGF- binding protein-2 protects against the develop- ment of obesity and insulin resistance. Diabetes . 2007;56(2):285-294. 47. Oh IH, Kwon KR...Y. Christen, editors. Springer. 21-42. 18. Lou Z, Zhang CC, Tirado CA, Slone T, Zheng J, Zaremba CM, Oliver D, Chen W. 2010. infantile mixed

  15. Separation of Armchair SWNTs by Using Polymer Conformation Guided Assembly (United States)


    Chan-Park, M. B. Diameter- and Metallicity-Selective Enrichment of Single-Walled Carbon Nanotubes Using Polymethacrylates with Pendant Aromatic...Emitting PPE-PPV Hybrid Polymers: Efficient Energy Transfer across the m-Phenylene Bridge . Macromolecules 2003, 36, 3848-3853. 34. Yao, J.; Chen, Y

  16. QTL mapping for combining ability in different population-based ...

    Indian Academy of Sciences (India)

    based NCII designs: a simulation study. Lanzhi Li, Congwei Sun, Yuan Chen, Zhijun Dai, Zhen Qu, Xingfei Zheng, Sibin Yu,. Tongmin Mou, Chenwu Xu and Zhongli Hu. J. Genet. 92, 529–543. Journal of Genetics, Vol. 92, No. 3, December 2013 ...

  17. A Framework for Interaction and Cognitive Engagement in Connectivist Learning Contexts (United States)

    Wang, Zhijun; Chen, Li; Anderson, Terry


    Interaction has always been highly valued in education, especially in distance education (Moore, 1989; Anderson, 2003; Chen, 2004a; Woo & Reeves, 2007; Wang, 2013; Conrad, in press). It has been associated with motivation (Mahle, 2011; Wen-chi, et al., 2011), persistence (Tello, 2007; Joo, Lim, & Kim, 2011), deep learning (Offir, et al.,…

  18. Georgetown Institute for Cognitive and Computational Sciences (United States)


    Nature 403, 98-103. release to the point of mitochondrial depolar- 104. Bitko V. and Barik S. (2001) An endoplasmic ization. J. Cell Biol. 150, 131-143...V, Barik S. An endoplasmic reticulum-specific stress-acti- 102. Zhang X, Chen J, Graham SH, Du L, Kochanek PM, Draviam R vated caspase (caspase-12

  19. Effects of various forms of lipopolysaccharide on the expression of ...

    African Journals Online (AJOL)



    Oct 5, 2011 ... Lan-jun Bai1, Wings TY Loo2,3,4*, Yiding Dou4, Min Wang5, Hao Liang5, Mary NB Cheung3,4,6 ... The levels of lactate dehydrogenase (LDH), N-terminal pro ...... Li G-R, Sun H-Y, Chen J-B, Zhou Y, Tse H-F, Lau C-P (2009).

  20. Browse Title Index

    African Journals Online (AJOL)

    Items 7351 - 7400 of 11090 ... Vol 10, No 65 (2011), Molecular cloning and sequence analysis of VP6 gene of giant panda rotavirus strain CH-1, Abstract PDF. Y Lie, S Chen, CD Wang, Z Zhang, CD Wang, W Guo, X Wang, L Guo, Q Yan. Vol 11, No 23 (2012), Molecular cloning, characterization and expression analysis of heat ...

  1. Instructional Experiment of Practical Competencies-Oriented Teaching Materials in Technical Universities (United States)

    Chen, Su-Chang


    This study aims to conduct experimental instruction on the human resource management unit of business management in practical competencies-oriented business program developed by Chen (2005). This study is based on the quasi-experiment method and the subjects are two classes of students in a four-year technical university who have completed the…

  2. Maryam Moslemi, Sharghi, Mehdi Zahravi, Gholamreza Bakhshi ...

    African Journals Online (AJOL)



    Aug 21, 2013 ... Briefly, Young leaves (100 mg) were ground to a fine powder in liquid nitrogen and ..... Yuan Z, Chen X, He T, Feng J, Feng T, Zhang C (2007b). Population genetic structure in apricot (Prunus armeniaca L.) cultivars revealed.

  3. Multifunctional CNTs nanohybrids decorated with magnetic and ...

    Indian Academy of Sciences (India)

    seen that the crystal structure of ZnS has changed slightly because of the extended .... sion of fine metal or metal–oxide nanoparticles, is used to control the ..... Chen B D, Zhang H, Zhai C X, Du N, Sun C and Xue J W 2010. J. Mater. Chem.

  4. Hydrogenation of Cinnamaldehyde over an Ionic Cobalt Promoted ...

    African Journals Online (AJOL)


    useful transformation in organic synthesis to produce fine chemicals.1 To .... crystal structure of this compound is reported elsewhere.17. 2.2.2. Incipient Wet ..... 12 M. H. Chen, W. Chu, X. Y. Dai and X. W. Zhang, Catal. Today, 2004, 89,.

  5. Morphology and anatomical structure of the larval salt gland of ...

    African Journals Online (AJOL)

    Ezedom Theresa


    Oct 9, 2013 ... the morphology and fine structure of the ion transporting epithelium ... The general structure of the salt gland of nauplii cultured at 180 g/L disappeared. ...... Wu G, Zhang H, Sun J, Liu F, Ge X, Chen WH, Yu, J, Wang W (2011).

  6. Brauchen die Universitäten in Deutschland ein neues Paradigma der Nachwuchsausbildung?

    NARCIS (Netherlands)

    Enders, Jürgen


    Der Beitrag gibt einen neuen Überblick zum Stand der Forschungen über die Doktorandenausbildung in Deutschland und die weiteren beruflichen Werdegänge von Promovierten. Vor diesem Hintergrund werden Stärken und Schwächen der Nachwuchsförderung an den Hochschulen diskutiert. Die Analyse unterstreicht

  7. Sequence variants of the LCORL gene and its association with ...

    Indian Academy of Sciences (India)

    Y. J. HAN

    [Han Y. J., Chen Y., Liu Y. and Liu X. L. 2017 Sequence variants of the LCORL gene and its association with growth and carcass traits in. Qinchuan cattle in China. J. Genet. 96, xx–xx]. Introduction. Genetically selecting is a better way to satisfy the growing customer requirement with the development of beef cattle industry ...

  8. Browse Title Index

    African Journals Online (AJOL)

    Items 1 - 50 of 138 ... Vol 2, No 2 (2013), Dental pulp-derived stem cells (DPSC) differentiation in vitro into odontoblast and neuronal progenitors during cell passaging is associated with alterations in cell survival and viability, Abstract PDF. M Alleman, E Low, K Truong, E Huang, CK Hill, TY Chen, M Deaton, K Kingsley.

  9. Efficacy of biofeedback-assisted pelvic floor muscle training in ...

    African Journals Online (AJOL)

    Ibrahim Khalil Ibrahim


    Jul 18, 2014 ... ized life advice leaflet sheet with instructions.20,21 Standardized proper PFMT instruction .... Unexpectedly, female age and duration of complaint were not predictive factors of .... Chen Gin-Den. Conservative management of ... muscle: comparison of a digital and a manometric techniques. Physiotherapy ...

  10. Polyploidy levels of Chinese large-flower chrysanthemum ...

    African Journals Online (AJOL)



    Apr 17, 2012 ... color, and is regarded as one of two flower spectacle in the world (Chen, 2001). However, their genetic backgrounds as well as genetic relationships are lack of knowledge. Large-flower chrysanthemum has been cultivated for more than 1, 600 years (Zhao et al., 2009). It experienced long-term arti-.

  11. Inheritance of DNA methylation in DH and its backcrossed lines of ...

    African Journals Online (AJOL)



    Aug 1, 2011 ... (Chen and Li, 2004). Salmon et al. .... M primer. MSAP bands. CTGCAG. Figure 2. A flowchart showing the MSAP method. ..... Doyle JJ, Doyle JL (1990). .... Yoon DB, Kang KH, Kim HJ, Ju HG, Kwon SJ, Suh JP, Jeong OY, Ahn.

  12. Download this PDF file

    African Journals Online (AJOL)

    Dr Olaleye

    Panel k: relative testicular weight, panel L: testicular cell count, panel M: relative epididymal weight, panel N: relative prostate gland weight ..... 66:375-377. Chen J.L., Longo F.J. (1996). .... Jung, E.Y., Lee, B.J., Yun, Y.W., Kang, J.K., Baek, I.J.,.

  13. Anti-inflammatory Effects of Magnolia sieboldii Extract in ...

    African Journals Online (AJOL)

    Hao Li4 and Kang-Duk Choi1*. 1Genomic ... Methods: The whole plant of M. sieboldii was extracted with methanol at room temperature. The in vitro ... action of M. sieboldii in inflammation. Magnolia ..... Shih HC, Hwang TL, Chen HC, Kuo PC, Lee EJ, Lee. KH, Wu TS. ... Fu JY, Masferrer JL, Seibert K, Raz A, Needleman P.

  14. Browse Title Index

    African Journals Online (AJOL)

    Items 501 - 550 of 1309 ... HH Tamboura, B Bayala, M Lompo, IP Guissou, L Sawadogo ... X Wang, Y-G Chen, L Ma, Z-H Li, J-Y Li, X-G Liu, J-L Zou, J-H Wu. Vol 11, No 2 ... Zhi-Jiang Wang, Wei Xu, Jian-Wen Liang, Cai-Sheng Wang, Yani Kang.

  15. Fulltext PDF

    Indian Academy of Sciences (India)

    [7] Mahdhi H, Ben Ayadi Z, Gauffier J L, Djessas K and Alaya S. 2015 Opt. Mater. ... [23] Wu D W, Yang M, Huang Z B, Yin G F, Liao X M, Kang Y. Q, Chen X F and ... [42] Lee P A, Said G, Davis R and Lim T H 1969 J. Phys. Chem. Solids 30 ...

  16. Protective effect of (-)-epigallocatechin gallate on ultraviolet b ...

    African Journals Online (AJOL)

    Chang Liu1, Xin-Qiang Zheng1, Li-Ping Xiang2, Jian-Liang Lu1, Curt ..... Fukunagam M, Tsuru K, Horikawa T. UV-induced skin ... Liang YR, Kang SY, Deng L, Xiang LP, Zheng XQ. ... Lee XZ, Liang YR, Chen H, Lu JL, Liang HL, Huang FP,.


    African Journals Online (AJOL)


    UHCC (Chen, 2009; Tong, 2010; Zhang et al., 2006; Zhu and Li, 2006). .... 2006; Yu and Kang, 2009) were identified for further study (726 patients), but without a .... inhibit its transition from G2 phase to M phase in vitro. .... Venook, A. P., Stagg, R. J., Lewis, B. J., Chase, J. L., Ring, E. J., Maroney, T. P., Hohn, D. C., (1990).

  18. Cloning and characterization of peptidylprolyl isomerase B in the ...

    African Journals Online (AJOL)



    Dec 15, 2009 ... 1Institute of Life Sciences, Jiangsu University, 301 Xuefu Road, Zhenjiang 212013, P. R. China. 2Beijing ... 6 Tianshuiyuan Street, Chaoyang District, Beijing 100026, P. R. China. ... Kang et al., 2008). Cyclophilins were ..... Xu YX, Manley JL (2007). ... Yao Q, Li M, Yang H, Chai H, Fisher W, Chen C (2005).

  19. Evaluation on the resistance to aphids of wheat germplasm ...

    African Journals Online (AJOL)



    Oct 17, 2011 ... Agricultural Sciences, Beijing, 100193, Peoples Republic of China. ... 3College of Plant Protection, Shandong Agricultural University, Taian, ... varieties in Henan Province, China (Li et al., 1998). ... (m a.s.l.), represents the warm temperate continental monsoon ..... Ma R, Chen JL, Cheng DF, Sun JR (2010).

  20. Molecular cloning, characterization and expression of WAG-2 ...

    Indian Academy of Sciences (India)

    China West Normal University, Nanchong, Sichuan 637009, People's Republic of China. Abstract. WAG-2 is a ... tially be extended to rice (Kang et al. 1998 .... Biotechnology (Beijing, China). WAG-2 ... and WAG-2g in M, I and C domains was typically striking, .... Cheng Y., Kato N., Wang W., Li J. and Chen X. 2003 Two RNA.

  1. Identification and characterization of eighteen polymorphic ...

    Indian Academy of Sciences (India)

    Author Affiliations. Fei Xiong1 Hong-Yan Liu1 Xin-Bin Duan2 Da-Qing Chen2. College of Life Sciences, Jianghan University, Wuhan 430056, People's Republic of China; Yangtze River Fisheries Research Institute, Chinese Academy of Fishery Sciences, Wuhan 430223, People's Republic of China ...

  2. Stability and Hopf bifurcation analysis of a new system

    International Nuclear Information System (INIS)

    Huang Kuifei; Yang Qigui


    In this paper, a new chaotic system is introduced. The system contains special cases as the modified Lorenz system and conjugate Chen system. Some subtle characteristics of stability and Hopf bifurcation of the new chaotic system are thoroughly investigated by rigorous mathematical analysis and symbolic computations. Meanwhile, some numerical simulations for justifying the theoretical analysis are also presented.

  3. Synthesis and influence of alkaline concentration on α-FeOOH ...

    Indian Academy of Sciences (India)


    pH values of solution play an important role in the process of transformation of ... largely dependent on their size, shape and surface chemistry. (Tang et al 2006; ... (Lemaire et al 2002), sensors (Chen et al 2005) and min- eral liquid crystals ...

  4. Kommunikationsprobleme zwischen deutschen Expatriates und Chinesen in der wirtschaftlichen Zusammenarbeit -- Empirische Erfahrungen und Analyse der Einflußfaktoren


    Shi, Hongxia


    Die vorliegende Arbeit untersucht die empirischen Erfahrungen und die Einflußfaktoren der Kommunikationsprobleme der deutschen Expatriates und Chinesen in der wirtschaftlichen Zusammenarbeit. Die Untersuchung basiert auf einem Datenmaterial, das aus 86 Interviewgesprächen mit Betroffenen besteht. Zentrale Fragestellungen der vorliegenden Arbeit sind: 1. Mit welchen Kommunikationsproblemen werden die befragten deutschen Expatriates und Chinesen in ihrer interkulturellen Kommunikation miteinand...

  5. A remarkable new species of winter stonefly (Plecoptera: Capniidae) from Southeastern China. (United States)

    Du, Yu-Zhou; Chen, Zhi-Teng


    A new species of the genus Capnia s.l., C. zijinshana Du & Chen, sp. nov. is described and illustrated from Jiangsu Province, of southeastern China. The new species is distinguished from other known Chinese capniid species by the unique thoracic sclerites and genitalic characters.


    Indian Academy of Sciences (India)

    Uniqueness of solutions to Schrödinger equations on complex semi-simple Lie groups. 325. Chen Lili. On the compactly locally uniformly rotund points of Orlicz spaces. 471. Chu Jifeng. Positive solutions and eigenvalue intervals for nonlinear systems. 85. Clozel L. Equivariant embeddings of Hermitian sym- metric spaces.

  7. Stretching and Exploiting Thresholds for High-Order War: How Russia, China, and Iran are Eroding American Influence Using Time-Tested Measures Short of War (United States)


    core of realist treatises on international relations, including those of Thucydides, Thomas Hobbes, Niccolò Machiavelli , and, more recently, Chinese History, Princeton, N.J.: Prince - ton University Press, 1995a; Dingding Chen, Xiaoyu Pu, and Alastair Iain Johnston, “Correspondence

  8. 77 FR 14341 - Certain Hot-Rolled Carbon Steel Flat Products From Taiwan: Notice of Rescission of Antidumping... (United States)


    ... to separate requests from United States Steel Corporation and Nucor Corporation, interested parties... States Steel Corporation and Nucor Corporation, we are now rescinding this administrative review. DATES... Iron & Steel Corp.; Shang Chen Steel Co., Ltd.; and Yieh Phui Enterprise Co., Ltd. Nucor Corporation...

  9. Ausbreitung des parasitischen Unkrauts Phelipanche ramosa in der deutschen Landwirtschaft

    DEFF Research Database (Denmark)

    Kohlschmid, Eva; Müller-Stöver, Dorette Sophie; Sauerborn, J.


    Petersilie auf ihren Flächen anzubauen. Dies hatte zur Folge, dass diese nun mit P. ramosa befallen wurde. Noch vor 10 Jahren als Fallenpflanze eingesetzt, hatte die Petersilie eine eher geringe Wirkung auf die verzweigte Sommerwurz. Dieses Gefährdungspotential vor allem durch weitere potentielle...

  10. HEP meets ML award talk : XGBoost

    CERN Multimedia

    CERN. Geneva; CHEN, Tianqi


    Tianqi Chen and Tong He (team crowwork) have provided very early in the challenge to all participants XGBoost (for eXtreme Gradient Boosted). It is a parallelised software to train boost decision trees, which has been effectively used by many participants to the challenge. For this, they have won the "HEP meets ML" award which is the invitation to CERN happening today.

  11. Reply to Comment on "Fringe projection profilometry with nonparallel illumination: a least-squares approach" (United States)

    Chen, Lujie; Quan, Chenggen


    We have confirmed that a mathematical expression in our previous Letter [Chen and Quan, Opt. Lett.30, 2101 (2005)] should be modified. The modification, however, does not affect the validity of the method reported, the results obtained and the subsequent conclusions made.

  12. Application of Taguchi approach on investigation of formability for ...

    African Journals Online (AJOL)


    plastic behavior of perforated sheets (Chen, 1993; Baik et al., 1995; Baik et ... Reminder. 1.290. 0.603. 0.024. 0.153. 0.014. 0.075. Figure 1. Straight pattern of perforations ... this, it contains very little amount of manganese, which increases the ...

  13. 75 FR 52398 - Migratory Bird Hunting; Proposed Frameworks for Late-Season Migratory Bird Hunting Regulations (United States)


    ... productivity of North American Canada geese (Branta canadensis), brant (B. bernicla), snow geese (Chen... of the hunting public which, in part, provided the motivation for this recommendation. Furthermore... relationship of harvest regulations, and specifically zones and splits, to hunter recruitment, retention, and...

  14. Synthesis, photophysical and preliminary investigation of the dye-sensitized solar cells properties of functionalized anthracenyl-based bipyridyl and phenanthrolyl Ru(II) complexes

    CSIR Research Space (South Africa)

    Adeloye, AO


    Full Text Available .Ali S, Arta S, Sina H, Siguang C, Pierre G P and Sylvie M 2008 J. New Mat. Electrochem. Systems 11 281 39.Ruhle S, Greenshtein M, Chen S G, Merson A, Pizen H, Sukenik S, Cahen D and Zaban A 2005 J. Phys. Chem. B 109 18907 40.Hoshikawa T, Kikuchi R...

  15. Journal of Chemical Sciences | Indian Academy of Sciences

    Indian Academy of Sciences (India)

    Home; Journals; Journal of Chemical Sciences; Volume 119; Issue 1. Issue front cover thumbnail. Volume 119, Issue 1. January 2007, pages 3-51. pp 3-9. Synthesis, structure, redox and spectra of green iridium complexes of tridentate azo-aromatic ligands · Manashi Panda Chayan Das Chen-Hsiung Hung Sreebrata ...

  16. de zekerheid van het geloof — bucer's antwoord aan pighius 1 ...

    African Journals Online (AJOL)

    Das Rechtfertigungsverständnis in den Religionsgesprächen von Hagenau, Worms und. Regensburg 1540/41, Göttingen 1996 (FKDG 64). 15 Pfeilschifter, Acta reformationis catholicae, p. 53: Fides ergo viva ea est, quae et apprehendit misericordiam in Christo ac credit iustitiam, quae est in Christo, sibi gratis imputari et ...

  17. Genetic diversity of bitter taste receptor gene family in Sichuan

    Indian Academy of Sciences (India)

    Genetic diversity of bitter taste receptor gene family in Sichuan domestic and Tibetan chicken populations. YUAN SU DIYAN LI UMA GAUR YAN WANG NAN WU BINLONG CHEN HONGXIAN XU HUADONG YIN YAODONG HU QING ZHU. RESEARCH ARTICLE Volume 95 Issue 3 September 2016 pp 675-681 ...

  18. A Note on Quantum Entropy

    International Nuclear Information System (INIS)

    Hansen, Frank


    Incremental information, as measured by the quantum entropy, is increasing when two ensembles are united. This result was proved by Lieb and Ruskai, and it is the foundation for the proof of strong subadditivity of quantum entropy. We present a truly elementary proof of this fact in the context of the broader family of matrix entropies introduced by Chen and Tropp.

  19. Amendment of crude oil contaminated soil with sawdust and ...

    African Journals Online (AJOL)



    May 2, 2006 ... Akonye LA, Onwudiwe IO (2004). Potential for Sawdust and. Chromolaena leaves as soil amendments for plants growth in an oil polluted soil. Niger Delta Biologia 4: 50-60. Chen ZS Lee DY (1997). Evaluation of remediation technique on two. Cadmiun polluted soil contaminated with metals. North word.

  20. Utility Assessment Methods. (United States)


    Raiffa (831, LaValle [891, and other books on decision analysis. 4.2 Risk Attitudes Much recent research has focused on the investigation of various risk...Issacs, G.L., Hamer, R., Chen, J., Chuang, D., Woodworth, G., Molenaar , I., Lewis C., and Libby, D., Manual for the Computer-Assisted Data Analysis (CADA

  1. Experimental Studies of CADA-Based Utility Assessment Procedures. (United States)


    Trabajos de Estadistica, in press, 1981. Novick, M. R., Isaacs, G. L., Hamer, R., Chen, J., Chuang, D., Woodworth, G., Molenaar , I., Lewis, C., & Libby...Hill Book Co., Inc., 1959. Slovic, P. From Shakespeare to Simo: Spoculatie - and sm evidence - about man’s ability to process Imfotmatiea. Or&&n

  2. Genetic enrichment of cardiomyocytes derived from mouse ...

    African Journals Online (AJOL)

    Genetic enrichment of cardiomyocytes derived from mouse embryonic stem cells. WJ He, SC Li, LL Ye, H Liu, QW Wang, WD Han, XB Fu, ZL Chen. Abstract. Pluripotent embryonic stem cells (ESC) have the ability to differentiate into a variety of cell lineages in vitro, including cardiomyocytes. Successful applications of ...

  3. Bulletin of Materials Science | Indian Academy of Sciences

    Indian Academy of Sciences (India)

    ... Refresher Courses · Symposia · Live Streaming. Home; Journals; Bulletin of Materials Science; Volume 36; Issue 4. Enhanced high temperature performance of LiMn2O4 coated with Li3BO3 solid electrolyte. Liu Jinlian Wu Xianming Chen Shang Liu Jianben He Zeqiang. Volume 36 Issue 4 August 2013 pp 687-691 ...

  4. Identification and Classification of Player Types in Massive Multiplayer Online Games Using Avatar Behavior (United States)


    Kuan-Ta, Jhih-Wei Jiang, Polly Huang, Hao-Hua Chu, Chin-Laung Lei, and Wen-Chin Chen, “Identifying MMORPG Bots: A Traffic Analysis Approach”, MMORPGs ”, Proceedings of DiGRA 2005 Conference: Changing Views – Worlds in Play Loeffelholz, Bernard, Earl Bednar, Kenneth W. Bauer, “Predicting

  5. A combinatorial enumeration problem of RNA secondary structures

    African Journals Online (AJOL)



    Dec 21, 2011 ... connection between Discrete Mathematics and Compu- tational Molecular Biology (Chen et al, 2005; Hofacker et ... in Computational Molecular Biology. An RNA molecule is described by its sequences of bases ... Here, a mathematical definition of secondary structure is given (Stein and Waterman 1978).

  6. Journal of Chemical Sciences | Indian Academy of Sciences

    Indian Academy of Sciences (India)

    CHEN AI-HUA1 MENG SU-CI2 ZHOU KAI1 WANG CONG-CONG1 ZHAO WEI2 WANG AI-JIAN2 QIAN JUN2. School of Chemistry & Chemical Engineering, Yancheng Institute of Technology, Yancheng 224051, People's Republic of China; School of Chemistry and Chemical Engineering, Jiangsu University, Zhenjiang ...

  7. Water quality and bacteriology in an aquaculture facility equipped with a new aeration system

    Digital Repository Service at National Institute of Oceanography (India)

    Fernandes, S.O.; Kulkarni, S.S.; Shirodkar, R.R.; Karekar, S.V.; PraveenKumar, R.; Sreepada, R.A.; Vogelsang, C.; LokaBharathi, P.A.

    .J., & Reyes F L. de los. (2005). Effects of Aeration Cycles on Nitrifying Bacterial Populations and Nitrogen Removal in Intermittently Aerated Reactors. Applied and Environmental Microbiology, 71(12), 8565-8572. Li, Q., Chen, B., Qu, k., Yuan, Y., Li, J...

  8. Microwave assisted template synthesis of silver nanoparticles

    Indian Academy of Sciences (India)


    employed on the size and shape of the nanoparticles has been compared. 2. ... nanoparticles prepared by direct heating at 80°C for various durations. Figure 2 .... References. Aoki K, Chen J, Yang N and Nagasava H 2003 Langmuir 19. 9904.

  9. Synthesis and characterization of CuO nanoparticles using strong ...

    Indian Academy of Sciences (India)

    classified into three types on the basis of their dimension, i.e., one-, two- and ... dependent on the shape, size, composition and structures of the nanocrystals. ..... [43] Liu J, Jin J, Deng Z, Huang S-Z, Hu Z-Y, Wang L, Wang C,. Chen L-H, Li Y, ...

  10. (nanoclay and CaSiO3)-reinforced E-glass-reinforced epoxy

    Indian Academy of Sciences (India)

    For instance, Zhang et al. [6] have prepared 30 types of epoxy matrix reinforced with ... the resin in a high-speed metal blade rotation medium. The .... Tests were run for .... Figure 2. Mean effect plots showing the influence of load, nanoclay content and speed on ..... [8] Wang K, Chen L, Wu J, Toh M L, He C and Yee A F 2005.

  11. Case Studies of Predictive Analysis Applications in Law Enforcement (United States)


    Management, December 2, 2006, 12– 15; Whiting, “Predict the Future-Or Try, Anyway.” 59 Hsinchun Chen, Roger HL Chiang, and Veda C. Storey, “Business...Roger HL Chiang, and Veda C. Storey. “Business Intelligence and Analytics: From Big Data to Big Impact.” MIS Quarterly 36, no. 4 (2012). http

  12. Social Media Analytics: A New Approach for Cyberspace Enabled Understanding of Operational Environments (United States)


    analytics, Hsinchun Chen, Roger HL Chiang, and Veda C. Storey, “Business intelligence and analytics: from big data to big impact,” MIS Quarterly 36...Roger H. L. Chiang, and Veda C. Storey. “Business Intelligence and Analytics: From Big Data to Big Impact.” MIS Quarterly 36, no. 4 (December 2012

  13. Turbulence in a cusp Q device

    DEFF Research Database (Denmark)

    D'Angelo, N.; Pécseli, Hans; Petersen, P. I.


    Spectral measurements are reported of plasma turbulence in the Cs plasma of a Q device, modified to a magnetic cusp geometry. The excitation mechanism for the fluctuations appears to be the centrifugal instability discussed by Chen. A transition from an f−5 to an f−3 power spectrum is observed...

  14. Reference: 438 [Arabidopsis Phenome Database[Archive

    Lifescience Database Archive (English)

    Full Text Available ity and drought tolerance in Arabidopsis thaliana. 18 6902-12 16943431 2006 Sep Molecular and cellular bio...logy Chen Zhizhong|Gong Zhizhong|Hong Xuhui|Jablonowski Daniel|Ren Xiaozhi|Schaffrath Raffael|Zhang Hairong|Zhou Xiaofeng|Zhu Jian-Kang

  15. Describing one- and two-neutron halos in effective field theory

    Indian Academy of Sciences (India)


    Nov 1, 2014 ... values for Rcore, this means that we are restricted to systems with ... its relation to a key process in the chain of solar neutrino production reactions, 7Be + ..... enjoyable and productive collaborations, and to Chen and Ken in ...

  16. Proteomic analysis of cell lines to identify the irinotecan resistance ...

    Indian Academy of Sciences (India)


    was selected from the wild-type LoVo cell line by chronic exposure to irinotecan ... dose–effect curves of anticancer drugs were drawn on semilogarithm .... alcohol metabolites daunorubicinol (Forrest and Gonzalez. 2000; Mordente et al. ..... Chen L, Huang C and Wei Y 2007 Proteomic analysis of liver cancer cells treated ...

  17. Starting small: Revisiting young children's perceptions of social withdrawal in China. (United States)

    Ding, Xuechen; Coplan, Robert J; Sang, Biao; Liu, Junsheng; Pan, Tingting; Cheng, Chen


    In this reply to the commentaries by Xinyin Chen, Charissa Cheah, Yiyuan Xu, and Dawn Watling, we further discuss the conceptual and methodological challenges that arise when attempting to study beliefs about social withdrawal (1) in the unique cultural context of China and (2) in the unique developmental age period of early childhood. © 2015 The British Psychological Society.

  18. Research Article Special Issue

    African Journals Online (AJOL)



    Mar 7, 2018 ... [32] Ren Y, Tang W. A service integrity assurance framework for .... [66] Liu C, Ranjan R, Zhang X, Yang C, Georgakopoulos D, Chen J. Public auditing for big ... [70] Berman J. J. Principles of big data: Preparing, sharing, and ...

  19. Synthesis of γ-Al2O3 nanowires through a boehmite precursor route

    Indian Academy of Sciences (India)

    has applications in absorbent, catalyst carrier and reinforce- ment of ceramic .... nia into the transparent solution, Al(OH)3 with colloidal form generates .... 99 1823. Zhou J, Deng S Z, Chen J, She J C and Xu N S 2002 Chem. Phys. Lett. 365 505.

  20. Multiparticipant Chat Analysis: A Survey (United States)


    by local search achieved the best performance for their study. Elsner and Charniak [35] used a voting schema for correlation clustering. They processed...Yener, Modeling and multiway analysis of chatroom tensors , in: P. Kantor, G. Muresan, F. Roberts, D.D. Zeng, F.-Y. Wang, H. Chen, R.C. Merkle (Eds

  1. African Journal of Biotechnology - Vol 11, No 14 (2012)

    African Journals Online (AJOL)

    DOWNLOAD FULL TEXT DOWNLOAD FULL TEXT. HD Ding, HJ Zhang, XH Zhu, H Liu, JS Liang, B Lu, 3259-3269 ... DOWNLOAD FULL TEXT DOWNLOAD FULL TEXT. Y Hanying, X Wei, G Xingxi, 3370-3378 ... FULL TEXT DOWNLOAD FULL TEXT. J Zhang, YC Huang, Q Zhang, ZP Hong, YC Zhou, WL Chen, 3388-3393 ...

  2. Journal of Genetics | Indian Academy of Sciences

    Indian Academy of Sciences (India)

    Identification and validation of reference genes for gene expression studies in sweet osmanthus (Osmanthus fragrans) based on transcriptomic sequence data. HONGNA MU TAOZE SUN CHEN XU LIANGGUI WANG YUANZHENG YUE HUOGEN LI XIULIAN YANG. RESEARCH ARTICLE Volume 96 Issue 2 June 2017 pp ...

  3. Photosynthesis and photoprotective systems of plants in response to ...

    African Journals Online (AJOL)



    Dec 27, 2010 ... al., 2008), photoprotective systems (Xiao et al., 2003a;. Chen et al., 2005a; Ali et al., .... et al., 1988) and soybean (Ying and Liu, 2005) and unaffected in beech ...... Goulding KW, Vitousek PM, Zhang FS (2010). Significant.

  4. The Effects of Prohibiting Gestures on Children's Lexical Retrieval Ability (United States)

    Pine, Karen J.; Bird, Hannah; Kirk, Elizabeth


    Two alternative accounts have been proposed to explain the role of gestures in thinking and speaking. The Information Packaging Hypothesis (Kita, 2000) claims that gestures are important for the conceptual packaging of information before it is coded into a linguistic form for speech. The Lexical Retrieval Hypothesis (Rauscher, Krauss & Chen, 1996)…

  5. Theoretical Criteria for Scattering Dark States in Nanostructured Particles (United States)


    64, 023805. (39) Suh, W.; Wang, Z.; Fan, S. IEEE J. Quantum Electron. 2004, 40, 1511–1518. (40) Smith, D. D.; Chang, H.; Fuller, K. A.; Rosenberger...Mukherjee, S.; Mirin, N. A.; Levit , S. D.; Nordlander, P.; Halas, N. J. J. Phys. Chem. C 2010, 114, 7378–7383. 16 (60) Wang, M.; Cao, M.; Chen, X.; Gu

  6. 77 FR 66084 - Quarterly Publication of Individuals, Who Have Chosen To Expatriate, as Required by Section 6039G (United States)



  7. Flowers with Yeast α-Glucosidase Inhibitory Activity

    African Journals Online (AJOL)

    Cholesterol in Hamsters Fed High-Fat Diets. Supplemented with Blueberry Peels and Peel. Extract. J Agric Food Chem 2010; 58: 3984-3991. 7. Xie C, Kang J, Chen JR, Nagarajan S, Badger TM, Wu X. Phenolic Acids Are in Vivo Atheroprotective. Compounds Appearing in the Serum of Rats after. Blueberry Consumption.

  8. Sadhana | Indian Academy of Sciences

    Indian Academy of Sciences (India)

    Home; Journals; Sadhana. Kang Ma. Articles written in Sadhana. Volume 34 Issue 5 October 2009 pp 851-864. Profit rate performance optimization for a generalized irreversible combined refrigeration cycle · Kang Ma Lingen Chen Fengrui Sun · More Details Abstract Fulltext PDF. Finite-time exergoeconomic performance ...

  9. Sierra Leone Journal of Biomedical Research Vol. 2 (1) pp. 32-37 ...

    African Journals Online (AJOL)

    Carlos III Institute of Health (Instituto de Salud. Carlos III) Madrid. Pp: 1-6. Ni YH, Chang MH, Huang LM, Chen HL, Hsu HY and Chiu TY (2001). Hepatitis B virus Infection in. Children and Adolescents in a Hyperendemic. Area:15 years after Mass Hepatitis B Vaccination. Ann Intern Med. 135: 796-800. Ngui SL, O'Connell S ...

  10. Estimation of genetic and genotypic parameters for growth and ...

    African Journals Online (AJOL)



    Dec 18, 2013 ... These included 50 Dongan chickens (DA) from Dongan county, 50 ..... Chang, G.B., Chang, H., Liu, X.P., Wang, H.Y., Xu, W., Zhao, W.M. & Wang, Q.H., 2005. ... Su, Y., Chen, G.H., Long, R.J., Bao, W.B. & Wan, J.H., 2006.

  11. Prevention of Post-Radiotherapy Failure in Prostate Cancer by Vitamin D (United States)


    cur- 55. Mitchell MF, Hittelman WN, Hong WK et al. The natural history cumin , a chemo preventive agent, in patients with high-risk or of cervical...chromosomal DNA loops during oxidative stress . Genes & Dev 13:1553-1560. 16 1999 Chen AY, Choy H and Rothenberg ML. DNA topoisomerase I-targeting drugs as

  12. Untitled

    Indian Academy of Sciences (India)

    Frein, M. L., and Fisher, C. H. ... Ind. and Eng. Chen, 1948, 40, 534. 2. Kosolapoff, G. M. ... J. Amer. Chem. Soc., 1947, 69, 1651. 3. Fornet, R, ... Seifensieder-2tg., 1938, 65, 658 and 687. 4. Dusart, L, and Bardy, Ch. ... Compt, rend, 73, 1276. 5. Gal, H., and Etard, A. ... Ibid., 82, 457. 6. Demole, E. ... Deut. Chem. Ges, Ber, 1877 ...

  13. Untitled

    Indian Academy of Sciences (India)

    Proc. of ICEM-1992, Budapest, pp 550-553. 23) A R Millner 1994 Multi-hundred horsepower permanent magnet brushless disk motors. Proc. of APEC Conf, pp 351-355 w. (24 C C Chen, KT Chau, J ZJiang, W Xia, M. Zhu, R. Zhang 1996 Novel permanent magnet motor drives for electric vehicles. IEEE Trans. Ind. Electron.

  14. IPDO-2007: Inverse Problems, Design and Optimization Symposium (United States)


    Grebenniko v J. Luna Tomas Perez Manuel Enriquez 025 Alexande r Grebenniko v 026 Tsung- Chien Chen Shou- Jen Hsu Pan-Chio Tuan 028...Dulikravich 086 Helmut Sobieczky Monika Hannemann 087 Anssi Lehikoinen Arto Voutilainen Jari Kaipio Stefan Finsterle Mike Kowalsky 088

  15. Fibrinolysis and anticoagulant potential of a metallo protease ...

    Indian Academy of Sciences (India)

    In this study, a potent fibrinolytic enzyme-producing bacterium was isolated .... Time courses of growth and enzyme production in a culture of B. subtilis K42: ..... on a large scale in industry,would make thisoperation rapid .... Process. Biochem. 41 1545–1552. Wang SL, Kao TY, Wang CL, Yen YH, Chern MK and Chen YH.

  16. Content Analysis of the 20 Most Influential Articles in "PIQ" (United States)

    Cho, Yonjoo; Park, Sunyoung


    The purpose of this study is to examine key research themes in human performance technology (HPT) through content analysis of the 20 most influential articles identified in Cho, Jo, Park, Kang, and Chen (2011). Three questions guiding this inquiry are: (1) What are the key themes of the 20 most influential articles in "PIQ", (2) What information…

  17. Music Instruction for Elementary Students with Moderate to Severe Cognitive Impairments: A Case Study (United States)

    Salvador, Karen


    Although elementary general music specialists teach students with a variety of exceptionalities every day (Chen, 2007; Hahn, 2010; Hoffman, 2011), many music teacher preparation programs do not adequately address exceptionality (Salvador, 2010). Articles regarding "strategies that work" appear perennially in the professional literature…

  18. Eight Nobel prizewinners at CERN in 1962

    CERN Multimedia


    In 1962, CERN hosted the 11th International Conference on High Energy Physics. Among the distinguished visitors were eight Nobel prizewinners. Left to right: Cecil F Powell, Isidor I Rabi, Werner Heisenberg, Edwin M McMillan, Emile Segre, Tsung Dao Lee, Chen Ning Yang and Robert Hofstadter.

  19. Biologische Angriffe auf Mauerwerke

    NARCIS (Netherlands)

    Schober, G.; Kort, H.S.M.; Balen, van K.; Bronswijk, van J.E.M.H.


    Zusammenfassung: Biologische Angriffe durch Mauerwerkbewuchs führen zu Schadensbildern, die durch Festigkeitsverlust, Formveränderungen oder Farbveränderungen auf den Oberflächen charakterisiert sind. Allerdings sind nur einige spezialisierte Pflanzen an die extremen Bedingungen dieser Lebensräume

  20. Author Affiliation Index: A New Approach to Marketing Journal Ranking (United States)

    Pan, Yue; Chen, Carl R.


    Previous research has adopted various methods to assess the relative quality of academic marketing journals. This study, as a replication and extension of Chen and Huang (2007), introduces the Author Affiliation Index (AAI) as an alternative approach to assessing marketing journal quality. The AAI is defined as the ratio of articles authored by…

  1. The Function of Neuroendocrine Cells in Prostate Cancer (United States)


    University of Rochester Medical Center School of Medicine and Dentistry , Rochester, NY. Corresponding Authors: Jiaoti Huang, UCLA David Geffen School of...facilities, etc.): Z. Li, Y. Sun, X. Chen, J. Squires Analysis and interpretation of data (e.g., statistical analysis, biostatistics , computational

  2. X-ray structure, hydrogen bonding and lattice energy analysis of (2E ...

    Indian Academy of Sciences (India)

    tion data for both the compounds were collected on an X'Calibur CCD area detector diffractometer (Oxford Diffrac- tion) using MoKa .... (Oxford Diffraction make, U.K.) ..... [4] Wang L, Chen G, Lu X, Wang S, Han S, Li Y, Ping G, Jiang. X, Li H ...

  3. Effects of atorvastatin and rosuvastatin on blood lipids, platelet ...

    African Journals Online (AJOL)

    Conclusion: Atorvastatin and rosuvastatin have no significant effect on the antiplatelet .... J20120006; Astra Zeneca UK limited) 10 mg, .... by Johansen et al [29] and Wang et al [30] .... Pan Y, Chen W, Xu Y, Yi X, Han Y, Yang Q, Li X, Huang.

  4. Chiral and achiral helical coordination polymers of zinc and ...

    Indian Academy of Sciences (India)

    rality depends on formation of cis coordination geom- etry around the ..... lographic Data Centre via .... 324; (b) Han L and Hong M 2005 Inorg. Chem. Com ... Kang Y, Chen S, Wang F, Zhang J and Bu X 2011 Chem.

  5. Synthesis and characterization of silicon-doped polycrystalline GaN ...

    Indian Academy of Sciences (India)


    300 to 623 K on fused silica and silicon substrates by radio frequency (r.f.) magnetron sputtering at a system pressure of ~ 5 ..... Yu H B, Chen H, Li D, Han Y J, Zheng X H, Huang Q and ... Hong J-II, Chang Y, Ding Y, Wang Z L and Snyder R L.

  6. Rogue waves in the multicomponent Mel'nikov system and ...

    Indian Academy of Sciences (India)

    Baonan Sun


    Jan 10, 2018 ... articles [42,43] have provided a good review on the ...... [20] J S He, H R Zhang, L H Wang, K Porsezian and A S. Fokas ... [55] Z Han and Y Chen, Bright–dark mixed N-soliton ... bridge University Press, Cambridge, UK, 2004).

  7. Molecular cytogenetic identification of a novel dwarf wheat line with ...

    Indian Academy of Sciences (India)


    Jan 8, 2012 ... of a pAs1 hybridization band on 2DL chromosome of 31505-1. Two SSR ... [Chen G, Zheng Q, Bao Y, Liu S, Wang H and Li X 2012 Molecular cytogenetic identification of a novel dwarf wheat line with ..... translocations (Fedak and Han 2005; Li et al. ... growth (Cambridge, UK: Cambridge University Press).

  8. Methoden der Kommunikations- und Mediengeschichte: die Wechselwirkung unterschiedlicher Verfahren als Spezifikum der Kommunikations- und Mediengeschichte

    NARCIS (Netherlands)

    Hemels, J.; Averbeck-Lietz, S.; Klein, P.; Meyen, M.


    Dieser Beitrag verfolgt zwei Ziele: Einerseits wird beabsichtigt, nicht his-torisch geschulte Kommunikationswissenschaftler mit Grundlagen und Praxis kommunikationswissenschaftlicher Forschung vertraut zu ma-chen. Andererseits wird für ein Zusammenspiel zwischen führenden For-schungsansätzen und

  9. Reference: 612 [Arabidopsis Phenome Database[Archive

    Lifescience Database Archive (English)

    Full Text Available 612 Feng Haizh...1531-45 17513484 2007 Jul Plant physiology Chen Qingguo|Feng Haizhong|Feng Jian|Yang Xiaohui|Zhang Jian|Zuo Jianru

  10. African Journal of Traditional, Complementary and Alternative ...

    African Journals Online (AJOL)

    Li-Long Liu, Kai Xu, Lu-Mei Kang, Shu-Ping Jiang, Qing-Hua Wang, Lei Zhang, Shao-Gui Wan, Hong-Ping Chen, 113-121 ... Cytological effects of pulsed electromagnetic fields and static magnetic fields induced by a therapeutic device on in vivo exposed rats · EMAIL FREE FULL TEXT EMAIL FREE FULL TEXT

  11. Relationship between deficits of verbal short-term memory and auditory impairment among Cantonese speakers with aphasia

    Directory of Open Access Journals (Sweden)

    Diana W.L. Ho


    Our results suggested that Cantonese speakers demonstrated more difficulties in non-words and lexical decision tasks, potentially due to the additional linguistic factor of lexical tone (Cutler & Chen, 1997.The importance of lexical tone in phonological processing of tonal languages, which warrants further investigation, should be highlighted for clinical assessment as well as intervention.

  12. Experimental and Theoretical Studies of Hydrogenated Amorphous Semiconductor Alloys and Superlattices (United States)


    case may be expected ’G. Mao, H. Fritzsche. K. Chen, and D. Feng, Bull . Am. Phys. Soc. 35, in very thin films of a-Si:H where the high defect density" 7...coupling and do is the touching distance 2b. The a - 5 nm for difftrent gnglv of orientation of the sphehids with respect to the v+ tipo (s. The

  13. Profit rate performance optimization for a generalized irreversible ...

    Indian Academy of Sciences (India)

    fer law system generalized irreversible combined refrigeration cycle model with finite-rate heat ...... Chen L, Sun F, Wu C 2004b Optimum allocation of heat exchanger area for refrigeration and air conditioning plants. Appl. Energy 77(3): 339– ...

  14. Karyotype analysis of three Solanum plants using combined PI-DAPI ...

    African Journals Online (AJOL)

    ajl yemi


    Dec 19, 2011 ... OLYMPUS epifluorescence microscope, and their images were captured with a CoolSNAP-CCD video camera using Meta Imaging. Series software. In this study, Adobe Photoshop software was used to take photos of the chromosomes, and karyotype analysis was studied by Li and. Chen (1985) methods.

  15. Genetic variation of indigenous chicken breeds in China and a ...

    African Journals Online (AJOL)


    Genetic variation of indigenous chicken breeds in China and a Recessive White breed using AFLP fingerprinting. Yushi Gao. 1,2#. , Yunjie Tu. 1,2. , Haibin Tong. 1. , Kehua Wang. 1. , Xiujun Tang. 1 and Kuanwei Chen. 1. 1 Institute of Poultry, Academy of Agricultural Sciences in China, Yangzhou, 225003, Jiangsu, China.

  16. China’s War by Other Means: Unveiling China’s Quest for Information Dominance (United States)


    of the U.S. Persian Gulf War – delivering the message the “PLA’s capabilities during a crisis would deter any enemy.” In 1995, relations were...Chen, King C. “China’s War Against Vietnam, 1979: A Military Analysis.” Journal of East Asian Affairs 3, no. 1 (Spring/Summer 1983). Accessed May 8

  17. Symposium LL: Nanowires--Synthesis Properties Assembly and Application (United States)


    J. C. Wang, Y. C. Chang, H. C. Hsu, Tzer-En Nee, L. J. Chen, and J. H. He, 2008 J. Nanosci. Nanotechnol, 8, 3363-3368. [2] Y. Ishikawa , M. Okamoto...Silicon Nanowires. Kaoru Kaiiwara1, Masato Ara2 and Hirokazu Tada1; 1 Division of Materials Physics, Graduate school of Engineering Science, Toyonaka

  18. Monitoring of uncultured Dunaliella sp. in an Egyptian solar saltern ...

    African Journals Online (AJOL)



    Aug 21, 2013 ... salinity, pH, light intensity and temperature. The characterization of economically important algae in solar salterns has become a key focus for many research groups all over the world (Chen and Jiang, 2009). Dunaliella species that are living in these fields, have an economic importance due to its highly ...

  19. An equi-biased k-prototypes algorithm for clustering mixed-type data

    Indian Academy of Sciences (India)

    Ravi Sankar Sangam


    Mar 14, 2018 ... nition [2], medical diagnosis [3], data streams [4], data compression [5] ...... Artificial Intelligence in Medicine 16(2): 129–147. [4] Chen L, Zou L J, .... [35] Ng M K, Li M J, Huang J Z and He Z 2007 On the impact of dissimilarity ...

  20. Developing Novel Therapeutics Targeting Undifferentiated and Castration-Resistant Prostate Cancer Stem Cells (United States)


    2009;106:268-73. 41. Carver BS, Chapinski C, Wongvipat J, Hieronymus H, Chen Y, Chandarlapaty S, Arora VK, Le C, Koutcher J, Scher H, Scardino PT... Rosen N, Sawyers CL. Reciprocal feedback regulation of PI3K and androgen receptor signaling in PTEN- deficient prostate cancer. Cancer Cell. 2011;19