WorldWideScience

Sample records for host rho-family nucleotide

  1. Yersinia Virulence Depends on Mimicry of Host Rho-Family Nucleotide Dissociation Inhibitors

    Energy Technology Data Exchange (ETDEWEB)

    Prehna,G.; Ivanov, M.; Blisha, J.; Stebbins, C.

    2006-01-01

    Yersinia spp. cause gastroenteritis and the plague, representing historically devastating pathogens that are currently an important biodefense and antibiotic resistance concern. A critical virulence determinant is the Yersinia protein kinase A, or YpkA, a multidomain protein that disrupts the eukaryotic actin cytoskeleton. Here we solve the crystal structure of a YpkA-Rac1 complex and find that YpkA possesses a Rac1 binding domain that mimics host guanidine nucleotide dissociation inhibitors (GDIs) of the Rho GTPases. YpkA inhibits nucleotide exchange in Rac1 and RhoA, and mutations that disrupt the YpkA-GTPase interface abolish this activity in vitro and impair in vivo YpkA-induced cytoskeletal disruption. In cell culture experiments, the kinase and the GDI domains of YpkA act synergistically to promote cytoskeletal disruption, and a Y. pseudotuberculosis mutant lacking YpkA GDI activity shows attenuated virulence in a mouse infection assay. We conclude that virulence in Yersinia depends strongly upon mimicry of host GDI proteins by YpkA.

  2. Overexpression of GEFT, a Rho family guanine nucleotide exchange factor, predicts poor prognosis in patients with rhabdomyosarcoma.

    Science.gov (United States)

    Sun, Chao; Liu, Chunxia; Li, Shugang; Li, Hongan; Wang, Yuanyuan; Xie, Yuwen; Li, Bingcheng; Cui, Xiaobin; Chen, Yunzhao; Zhang, Wenjie; Li, Feng

    2014-01-01

    Rhabdomyosarcoma (RMS) is one of the most common soft-tissue sarcomas in children and adolescents with poor prognosis. Yet, there is lack of effective prognostic biomarkers for RMS. The present study, therefore, aimed to explore potential biomarkers for RMS based on our previous findings using array comparative genomic hybridization. We investigated guanine nucleotide exchange factor, GEFT, at expression level in 45 RMS patients and 36 normal striated muscle controls using immunohistochemistry using tissue microarrays. The expression rate of GEFT in RMS samples (42/45, 93.33%) was significantly higher (Prate of GEFT in RMS (31/45, 68.89%) was also significantly higher (P<0.05) than that in normal controls (0/36, 0.00%). Increased expression of GEFT correlated significantly with advanced disease stages (stages III/IV) (P=0.001), lymph node metastasis (P=0.019), and distant metastasis (P=0.004), respectively, in RMS patients. In addition, RMS patients having overexpressed GEFT experienced worse overall survival (OS) than those having low levels of GEFT (P=0.001). GEFT overexpression was determined to be an independent prognostic factor for poor OS in RMS patients (hazard ratio: 3.491, 95% confidence interval: 1.121-10.871, P=0.004). In conclusion, these observations provide the first evidence of GEFT overexpression in RMS and its correlations with disease aggressiveness and metastasis. These findings suggest that GEFT may serve as a promising biomarker predicting poor prognosis in RMS patients, thus implying its potential as a therapeutic target.

  3. Rickettsia parkeri invasion of diverse host cells involves an Arp2/3 complex, WAVE complex and Rho-family GTPase-dependent pathway.

    Science.gov (United States)

    Reed, Shawna C O; Serio, Alisa W; Welch, Matthew D

    2012-04-01

    Rickettsiae are obligate intracellular pathogens that are transmitted to humans by arthropod vectors and cause diseases such as spotted fever and typhus. Although rickettsiae require the host cell actin cytoskeleton for invasion, the cytoskeletal proteins that mediate this process have not been completely described. To identify the host factors important during cell invasion by Rickettsia parkeri, a member of the spotted fever group (SFG), we performed an RNAi screen targeting 105 proteins in Drosophila melanogaster S2R+ cells. The screen identified 21 core proteins important for invasion, including the GTPases Rac1 and Rac2, the WAVE nucleation-promoting factor complex and the Arp2/3 complex. In mammalian cells, including endothelial cells, the natural targets of R. parkeri, the Arp2/3 complex was also crucial for invasion, while requirements for WAVE2 as well as Rho GTPases depended on the particular cell type. We propose that R. parkeri invades S2R+ arthropod cells through a primary pathway leading to actin nucleation, whereas invasion of mammalian endothelial cells occurs via redundant pathways that converge on the host Arp2/3 complex. Our results reveal a key role for the WAVE and Arp2/3 complexes, as well as a higher degree of variation than previously appreciated in actin nucleation pathways activated during Rickettsia invasion. © 2011 Blackwell Publishing Ltd.

  4. Identification of potential small molecule binding pockets on Rho family GTPases.

    Directory of Open Access Journals (Sweden)

    Juan Manuel Ortiz-Sanchez

    Full Text Available Rho GTPases are conformational switches that control a wide variety of signaling pathways critical for eukaryotic cell development and proliferation. They represent attractive targets for drug design as their aberrant function and deregulated activity is associated with many human diseases including cancer. Extensive high-resolution structures (>100 and recent mutagenesis studies have laid the foundation for the design of new structure-based chemotherapeutic strategies. Although the inhibition of Rho signaling with drug-like compounds is an active area of current research, very little attention has been devoted to directly inhibiting Rho by targeting potential allosteric non-nucleotide binding sites. By avoiding the nucleotide binding site, compounds may minimize the potential for undesirable off-target interactions with other ubiquitous GTP and ATP binding proteins. Here we describe the application of molecular dynamics simulations, principal component analysis, sequence conservation analysis, and ensemble small-molecule fragment mapping to provide an extensive mapping of potential small-molecule binding pockets on Rho family members. Characterized sites include novel pockets in the vicinity of the conformationaly responsive switch regions as well as distal sites that appear to be related to the conformations of the nucleotide binding region. Furthermore the use of accelerated molecular dynamics simulation, an advanced sampling method that extends the accessible time-scale of conventional simulations, is found to enhance the characterization of novel binding sites when conformational changes are important for the protein mechanism.

  5. Nucleotide Sequence and Characterization of the Broad-Host-Range Lactococcal Plasmid pWVO1

    NARCIS (Netherlands)

    Leenhouts, Cornelis; Tolner, Berend; Bron, Sierd; Kok, Jan; Venema, Gerhardus; Seegers, Jozef

    The nucleotide sequence of the Lactococcus lactis broad-host-range plasmid pWVO1, replicating in both gram-positive and gram-negative bacteria, was determined. This analysis revealed four open reading frames (ORFs). ORF A appeared to encode a trans-acting 26.8-kDa protein (RepA), necessary for

  6. Involvement of the actin cytoskeleton and p21rho-family GTPases in the pathogenesis of the human protozoan parasite Entamoeba histolytica

    Directory of Open Access Journals (Sweden)

    G.D. Godbold

    1998-08-01

    Full Text Available It has been estimated that infection with the enteric protozoan parasite Entamoeba histolytica kills more than 50,000 people a year. Central to the pathogenesis of this organism is its ability to directly lyse host cells and cause tissue destruction. Amebic lesions show evidence of cell lysis, tissue necrosis, and damage to the extracellular matrix. The specific molecular mechanisms by which these events are initiated, transmitted, and effected are just beginning to be uncovered. In this article we review what is known about host cell adherence and contact-dependent cytolysis. We cover the involvement of the actin cytoskeleton and small GTP-binding proteins of the p21rho-family in the process of cell killing and phagocytosis, and also look at how amebic interactions with molecules of the extracellular matrix contribute to its cytopathic effects.

  7. Yersinia outer protein YopE affects the actin cytoskeleton in Dictyostelium discoideum through targeting of multiple Rho family GTPases

    LENUS (Irish Health Repository)

    Vlahou, Georgia

    2009-07-14

    Abstract Background All human pathogenic Yersinia species share a virulence-associated type III secretion system that translocates Yersinia effector proteins into host cells to counteract infection-induced signaling responses and prevent phagocytosis. Dictyostelium discoideum has been recently used to study the effects of bacterial virulence factors produced by internalized pathogens. In this study we explored the potential of Dictyostelium as model organism for analyzing the effects of ectopically expressed Yersinia outer proteins (Yops). Results The Yersinia pseudotuberculosis virulence factors YopE, YopH, YopM and YopJ were expressed de novo within Dictyostelium and their effects on growth in axenic medium and on bacterial lawns were analyzed. No severe effect was observed for YopH, YopJ and YopM, but expression of YopE, which is a GTPase activating protein for Rho GTPases, was found to be highly detrimental. GFP-tagged YopE expressing cells had less conspicuous cortical actin accumulation and decreased amounts of F-actin. The actin polymerization response upon cAMP stimulation was impaired, although chemotaxis was unaffected. YopE also caused reduced uptake of yeast particles. These alterations are probably due to impaired Rac1 activation. We also found that YopE predominantly associates with intracellular membranes including the Golgi apparatus and inhibits the function of moderately overexpressed RacH. Conclusion The phenotype elicited by YopE in Dictyostelium can be explained, at least in part, by inactivation of one or more Rho family GTPases. It further demonstrates that the social amoeba Dictyostelium discoideum can be used as an efficient and easy-to-handle model organism in order to analyze the function of a translocated GAP protein of a human pathogen.

  8. Plasma Membrane-Located Purine Nucleotide Transport Proteins Are Key Components for Host Exploitation by Microsporidian Intracellular Parasites

    Science.gov (United States)

    Heinz, Eva; Hacker, Christian; Dean, Paul; Mifsud, John; Goldberg, Alina V.; Williams, Tom A.; Nakjang, Sirintra; Gregory, Alison; Hirt, Robert P.; Lucocq, John M.; Kunji, Edmund R. S.; Embley, T. Martin

    2014-01-01

    Microsporidia are obligate intracellular parasites of most animal groups including humans, but despite their significant economic and medical importance there are major gaps in our understanding of how they exploit infected host cells. We have investigated the evolution, cellular locations and substrate specificities of a family of nucleotide transport (NTT) proteins from Trachipleistophora hominis, a microsporidian isolated from an HIV/AIDS patient. Transport proteins are critical to microsporidian success because they compensate for the dramatic loss of metabolic pathways that is a hallmark of the group. Our data demonstrate that the use of plasma membrane-located nucleotide transport proteins (NTT) is a key strategy adopted by microsporidians to exploit host cells. Acquisition of an ancestral transporter gene at the base of the microsporidian radiation was followed by lineage-specific events of gene duplication, which in the case of T. hominis has generated four paralogous NTT transporters. All four T. hominis NTT proteins are located predominantly to the plasma membrane of replicating intracellular cells where they can mediate transport at the host-parasite interface. In contrast to published data for Encephalitozoon cuniculi, we found no evidence for the location for any of the T. hominis NTT transporters to its minimal mitochondria (mitosomes), consistent with lineage-specific differences in transporter and mitosome evolution. All of the T. hominis NTTs transported radiolabelled purine nucleotides (ATP, ADP, GTP and GDP) when expressed in Escherichia coli, but did not transport radiolabelled pyrimidine nucleotides. Genome analysis suggests that imported purine nucleotides could be used by T. hominis to make all of the critical purine-based building-blocks for DNA and RNA biosynthesis during parasite intracellular replication, as well as providing essential energy for parasite cellular metabolism and protein synthesis. PMID:25474405

  9. Plasma membrane-located purine nucleotide transport proteins are key components for host exploitation by microsporidian intracellular parasites.

    Directory of Open Access Journals (Sweden)

    Eva Heinz

    2014-12-01

    Full Text Available Microsporidia are obligate intracellular parasites of most animal groups including humans, but despite their significant economic and medical importance there are major gaps in our understanding of how they exploit infected host cells. We have investigated the evolution, cellular locations and substrate specificities of a family of nucleotide transport (NTT proteins from Trachipleistophora hominis, a microsporidian isolated from an HIV/AIDS patient. Transport proteins are critical to microsporidian success because they compensate for the dramatic loss of metabolic pathways that is a hallmark of the group. Our data demonstrate that the use of plasma membrane-located nucleotide transport proteins (NTT is a key strategy adopted by microsporidians to exploit host cells. Acquisition of an ancestral transporter gene at the base of the microsporidian radiation was followed by lineage-specific events of gene duplication, which in the case of T. hominis has generated four paralogous NTT transporters. All four T. hominis NTT proteins are located predominantly to the plasma membrane of replicating intracellular cells where they can mediate transport at the host-parasite interface. In contrast to published data for Encephalitozoon cuniculi, we found no evidence for the location for any of the T. hominis NTT transporters to its minimal mitochondria (mitosomes, consistent with lineage-specific differences in transporter and mitosome evolution. All of the T. hominis NTTs transported radiolabelled purine nucleotides (ATP, ADP, GTP and GDP when expressed in Escherichia coli, but did not transport radiolabelled pyrimidine nucleotides. Genome analysis suggests that imported purine nucleotides could be used by T. hominis to make all of the critical purine-based building-blocks for DNA and RNA biosynthesis during parasite intracellular replication, as well as providing essential energy for parasite cellular metabolism and protein synthesis.

  10. Comparative transcriptomics reveal host-specific nucleotide variation in entomophthoralean fungi

    DEFF Research Database (Denmark)

    de Fine Licht, Henrik Hjarvard; Jensen, Annette Bruun; Eilenberg, Jørgen

    2017-01-01

    of toxins that interfere with the host immune response. Phylogenetic comparison with the nonobligate generalist insect-pathogenic fungus Conidiobolus coronatus revealed a gene-family expansion of trehalase enzymes in E. muscae. The main sugar in insect haemolymph is trehalose, and efficient sugar...

  11. Alteration of Pituitary Tumor Transforming Gene-1 Regulates Trophoblast Invasion via the Integrin/Rho-Family Signaling Pathway.

    Directory of Open Access Journals (Sweden)

    Seung Mook Lim

    Full Text Available Trophoblast invasion ability is an important factor in early implantation and placental development. Recently, pituitary tumor transforming gene 1 (PTTG1 was shown to be involved in invasion and proliferation of cancer. However, the role of PTTG1 in trophoblast invasion remains unknown. Thus, in this study we analyzed PTTG1 expression in trophoblasts and its effect on trophoblast invasion activity and determined the mechanism through which PTTG1 regulates trophoblast invasion. Trophoblast proliferation and invasion abilities, regardless of PTTG1 expression, were analyzed by quantitative real-time polymerase chain reaction, fluorescence-activated cell sorting analysis, invasion assay, western blot, and zymography after treatment with small interfering RNA against PTTG1 (siPTTG1. Additionally, integrin/Rho-family signaling in trophoblasts by PTTG1 alteration was analyzed. Furthermore, the effect of PTTG1 on trophoblast invasion was evaluated by microRNA (miRNA mimic and inhibitor treatment. Trophoblast invasion was significantly reduced through decreased matrix metalloproteinase (MMP-2 and MMP-9 expression when PTTG1 expression was inhibited by siPTTG1 (p < 0.05. Furthermore, knockdown of PTTG1 increased expression of integrin alpha 4 (ITGA4, ITGA5, and integrin beta 1 (ITGB1; otherwise, RhoA expression was significantly decreased (p < 0.05. Treatment of miRNA-186-5p mimic and inhibitor controlled trophoblast invasion ability by altering PTTG1 and MMP expression. PTTG1 can control trophoblast invasion ability via regulation of MMP expression through integrin/Rho-family signaling. In addition, PTTG1 expression and its function were regulated by miRNA-186-5p. These results help in understanding the mechanism through which PTTG1 regulates trophoblast invasion and thereby implantation and placental development.

  12. RhoGDI: multiple functions in the regulation of Rho family GTPase activities

    DEFF Research Database (Denmark)

    Dovas, Athanassios; Couchman, John R

    2005-01-01

    necessary for the correct targeting and regulation of Rho activities by conferring cues for spatial restriction, guidance and availability to effectors. These potential functions are discussed in the context of RhoGDI-associated multimolecular complexes, the newly emerged shuttling capability...... insight as to how RhoGDI exerts its effects on nucleotide binding, the membrane association-dissociation cycling of the GTPase and how these activities are controlled. Despite the initial negative roles attributed to RhoGDI, recent evidence has come to suggest that it may also act as a positive regulator...... of activities....

  13. Role of Nucleotide-Binding Oligomerization Domain-Containing (NOD 2 in Host Defense during Pneumococcal Pneumonia.

    Directory of Open Access Journals (Sweden)

    Tijmen J Hommes

    Full Text Available Streptococcus (S. pneumoniae is the most common causative pathogen in community-acquired pneumonia. Nucleotide-binding oligomerization domain-containing (NOD 2 is a pattern recognition receptor located in the cytosol of myeloid cells that is able to detect peptidoglycan fragments of S. pneumoniae. We here aimed to investigate the role of NOD2 in the host response during pneumococcal pneumonia. Phagocytosis of S. pneumoniae was studied in NOD2 deficient (Nod2-/- and wild-type (Wt alveolar macrophages and neutrophils in vitro. In subsequent in vivo experiments Nod2-/- and Wt mice were inoculated with serotype 2 S. pneumoniae (D39, an isogenic capsule locus deletion mutant (D39Δcps or serotype 3 S. pneumoniae (6303 via the airways, and bacterial growth and dissemination and the lung inflammatory response were evaluated. Nod2-/- alveolar macrophages and blood neutrophils displayed a reduced capacity to internalize pneumococci in vitro. During pneumonia caused by S. pneumoniae D39 Nod2-/- mice were indistinguishable from Wt mice with regard to bacterial loads in lungs and distant organs, lung pathology and neutrophil recruitment. While Nod2-/- and Wt mice also had similar bacterial loads after infection with the more virulent S. pneumoniae 6303 strain, Nod2-/- mice displayed a reduced bacterial clearance of the normally avirulent unencapsulated D39Δcps strain. These results suggest that NOD2 does not contribute to host defense during pneumococcal pneumonia and that the pneumococcal capsule impairs recognition of S. pneumoniae by NOD2.

  14. Cooperation of Rho family proteins Rac1 and Cdc42 in cartilage development and calcified tissue formation.

    Science.gov (United States)

    Ikehata, Mikiko; Yamada, Atsushi; Fujita, Koji; Yoshida, Yuko; Kato, Tadashi; Sakashita, Akiko; Ogata, Hiroaki; Iijima, Takehiko; Kuroda, Masahiko; Chikazu, Daichi; Kamijo, Ryutaro

    2018-04-20

    Rac1 and Cdc42, Rho family low molecular weight G proteins, are intracellular signaling factors that transmit various information from outside to inside cells. Primarily, they are known to control various biological activities mediated by actin cytoskeleton reorganization, such as cell proliferation, differentiation, and apoptosis. In order to investigate the functions of Rac1 and Cdc42 in bone formation, we prepared cartilage-specific double conditional knockout mice, Rac1 fl/fl ; Cdc42 fl/fl ; Col2-Cre (Rac1: Cdc42 dcKO mice), which died just after birth, similar to Cdc42 fl/fl ; Col2-Cre mice (Cdc42 cKO mice). Our findings showed that the long tubule bone in Rac1: Cdc42 dcKO mice was shorter than that in Rac1 fl/fl ; Col2-Cre mice (Rac1 cKO mice) and Cdc42 cKO mice. Abnormal skeleton formation was also observed and disordered columnar formation in the growth plate of the Rac1: Cdc42 dcKO mice was more severe as compared to the Rac1 cKO and Cdc42 cKO mice. Together, these results suggest that Rac1 and Cdc42 have cooperating roles in regulation of bone development. Copyright © 2018 Elsevier Inc. All rights reserved.

  15. Complete nucleotide sequence and analysis of two conjugative broad host range plasmids from a marine microbial biofilm.

    Directory of Open Access Journals (Sweden)

    Peter Norberg

    Full Text Available The complete nucleotide sequence of plasmids pMCBF1 and pMCBF6 was determined and analyzed. pMCBF1 and pMCBF6 form a novel clade within the IncP-1 plasmid family designated IncP-1 ς. The plasmids were exogenously isolated earlier from a marine biofilm. pMCBF1 (62 689 base pairs; bp and pMCBF6 (66 729 bp have identical backbones, but differ in their mercury resistance transposons. pMCBF1 carries Tn5053 and pMCBF6 carries Tn5058. Both are flanked by 5 bp direct repeats, typical of replicative transposition. Both insertions are in the vicinity of a resolvase gene in the backbone, supporting the idea that both transposons are "res-site hunters" that preferably insert close to and use external resolvase functions. The similarity of the backbones indicates recent insertion of the two transposons and the ongoing dynamics of plasmid evolution in marine biofilms. Both plasmids also carry the insertion sequence ISPst1, albeit without flanking repeats. ISPs1is located in an unusual site within the control region of the plasmid. In contrast to most known IncP-1 plasmids the pMCBF1/pMCBF6 backbone has no insert between the replication initiation gene (trfA and the vegetative replication origin (oriV. One pMCBF1/pMCBF6 block of about 2.5 kilo bases (kb has no similarity with known sequences in the databases. Furthermore, insertion of three genes with similarity to the multidrug efflux pump operon mexEF and a gene from the NodT family of the tripartite multi-drug resistance-nodulation-division (RND system in Pseudomonas aeruginosa was found. They do not seem to confer antibiotic resistance to the hosts of pMCBF1/pMCBF6, but the presence of RND on promiscuous plasmids may have serious implications for the spread of antibiotic multi-resistance.

  16. Scambio, a novel guanine nucleotide exchange factor for Rho

    Directory of Open Access Journals (Sweden)

    Groffen John

    2004-04-01

    Full Text Available Abstract Background Small GTPases of the Rho family are critical regulators of various cellular functions including actin cytoskeleton organization, activation of kinase cascades and mitogenesis. For this reason, a major objective has been to understand the mechanisms of Rho GTPase regulation. Here, we examine the function of a novel protein, Scambio, which shares homology with the DH-PH domains of several known guanine nucleotide exchange factors for Rho family members. Results Scambio is located on human chromosome 14q11.1, encodes a protein of around 181 kDa, and is highly expressed in both heart and skeletal muscle. In contrast to most DH-PH-domain containing proteins, it binds the activated, GTP-bound forms of Rac and Cdc42. However, it fails to associate with V14RhoA. Immunofluorescence studies indicate that Scambio and activated Rac3 colocalize in membrane ruffles at the cell periphery. In accordance with these findings, Scambio does not activate either Rac or Cdc42 but rather, stimulates guanine nucleotide exchange on RhoA and its close relative, RhoC. Conclusion Scambio associates with Rac in its activated conformation and functions as a guanine nucleotide exchange factor for Rho.

  17. [Effect of antepartum taurine supplementation in regulating the activity of Rho family factors and promoting the proliferation of neural stem cells in neonatal rats with fetal growth restriction].

    Science.gov (United States)

    Li, Xiang-Wen; Li, Fang; Liu, Jing; Wang, Yan; Fu, Wei

    2016-11-01

    To study the possible effect of antepartum taurine supplementation in regulating the activity of Rho family factors and promoting the proliferation of neural stem cells in neonatal rats with fetal growth restriction (FGR), and to provide a basis for antepartum taurine supplementation to promote brain development in children with FGR. A total of 24 pregnant Sprague-Dawley rats were randomly divided into three groups: control, FGR, and taurine (n=8 each ). A rat model of FGR was established by food restriction throughout pregnancy. RT-PCR, immunohistochemistry, and Western blot were used to measure the expression of the specific intracellular markers for neural stem cells fatty acid binding protein 7 (FABP7), Rho-associated coiled-coil containing protein kinase 2 (ROCK2), ras homolog gene family, member A (RhoA), and Ras-related C3 botulinum toxin substrate (Rac). The FGR group had significantly lower OD value of FABP7-positive cells and mRNA and protein expression of FABP7 than the control group, and the taurine group had significantly higher OD value of FABP7-positive cells and mRNA and protein expression of FABP7 than the FGR group (Ptaurine group had significantly higher mRNA expression of RhoA and ROCK2 than the control group and significantly lower expression than the FGR group (Ptaurine group had significantly higher mRNA expression of Rac than the FGR and control groups (Ptaurine group had significantly lower protein expression of RhoA and ROCK2 than the FGR group (Ptaurine supplementation can promote the proliferation of neural stem cells in rats with FGR, and its mechanism may be related to the regulation of the activity of Rho family factors.

  18. A 6-Nucleotide Regulatory Motif within the AbcR Small RNAs of Brucella abortus Mediates Host-Pathogen Interactions.

    Science.gov (United States)

    Sheehan, Lauren M; Caswell, Clayton C

    2017-06-06

    vitro and in vivo In the present study, we confirmed that the AbcR sRNAs have redundant regulatory functions and defined two six-nucleotide motifs, M1 and M2, that the AbcR sRNAs utilize to control gene expression. Importantly, only M2 was linked to B. abortus virulence. Further investigation of M2-regulated targets identified BAB2_0612 as critical for colonization of B. abortus in mice, highlighting the significance of AbcR M2-regulated transcripts for Brucella infection. Overall, our findings define the molecular mechanism of the virulence-associated AbcR system in the pathogenic bacterium B. abortus . Copyright © 2017 Sheehan and Caswell.

  19. Mutant RBL mast cells defective in Fc epsilon RI signaling and lipid raft biosynthesis are reconstituted by activated Rho-family GTPases.

    Science.gov (United States)

    Field, K A; Apgar, J R; Hong-Geller, E; Siraganian, R P; Baird, B; Holowka, D

    2000-10-01

    Characterization of defects in a variant subline of RBL mast cells has revealed a biochemical event proximal to IgE receptor (Fc epsilon RI)-stimulated tyrosine phosphorylation that is required for multiple functional responses. This cell line, designated B6A4C1, is deficient in both Fc epsilon RI-mediated degranulation and biosynthesis of several lipid raft components. Agents that bypass receptor-mediated Ca(2+) influx stimulate strong degranulation responses in these variant cells. Cross-linking of IgE-Fc epsilon RI on these cells stimulates robust tyrosine phosphorylation but fails to mobilize a sustained Ca(2+) response. Fc epsilon RI-mediated inositol phosphate production is not detectable in these cells, and failure of adenosine receptors to mobilize Ca(2+) suggests a general deficiency in stimulated phospholipase C activity. Antigen stimulation of phospholipases A(2) and D is also defective. Infection of B6A4C1 cells with vaccinia virus constructs expressing constitutively active Rho family members Cdc42 and Rac restores antigen-stimulated degranulation, and active Cdc42 (but not active Rac) restores ganglioside and GPI expression. The results support the hypothesis that activation of Cdc42 and/or Rac is critical for Fc epsilon RI-mediated signaling that leads to Ca(2+) mobilization and degranulation. Furthermore, they suggest that Cdc42 plays an important role in the biosynthesis and expression of certain components of lipid rafts.

  20. Small G proteins in insulin action: Rab and Rho families at the crossroads of signal transduction and GLUT4 vesicle traffic.

    Science.gov (United States)

    Ishikura, S; Koshkina, A; Klip, A

    2008-01-01

    Insulin stimulates glucose uptake into muscle and adipose tissues through glucose transporter 4 (GLUT4). GLUT4 cycles between the intracellular compartments and the plasma membrane. GLUT4 traffic-regulating insulin signals are largely within the insulin receptor-insulin receptor substrate-phosphatidylinositol 3-kinase (IR-IRS-PI3K) axis. In muscle cells, insulin signal bifurcates downstream of the PI3K into one arm leading to the activation of the Ser/Thr kinases Akt and atypical protein kinase C, and another leading to the activation of Rho family protein Rac1 leading to actin remodelling. Activated Akt inactivates AS160, a GTPase-activating protein for Rab family small G proteins. Here we review the roles of Rab and Rho proteins, particularly Rab substrates of AS160 and Rac1, in insulin-stimulated GLUT4 traffic. We discuss: (1) how distinct steps in GLUT4 traffic may be regulated by discrete Rab proteins, and (2) the importance of Rac1 activation in insulin-induced actin remodelling in muscle cells, a key element for the net gain in surface GLUT4.

  1. Guanine nucleotide exchange factor αPIX leads to activation of the Rac 1 GTPase/glycogen phosphorylase pathway in interleukin (IL)-2-stimulated T cells

    DEFF Research Database (Denmark)

    Llavero, Francisco; Urzelai, Bakarne; Osinalde, Nerea

    2015-01-01

    Recently, we have reported that the active form of Rac 1 GTPase binds to the glycogen phosphorylase muscle isoform (PYGM) and modulates its enzymatic activity leading to T cell proliferation. In the lymphoid system, Rac 1 and in general other small GTPases of the Rho family participate...... in the signaling cascades that are activated after engagement of the T cell antigen receptor. However, little is known about the IL-2-dependent Rac 1 activator molecules. For the first time, a signaling pathway leading to the activation of Rac 1/PYGM in response to IL-2-stimulated T cell proliferation is described....... More specifically, αPIX, a known guanine nucleotide exchange factor for the small GTPases of the Rho family, preferentially Rac 1, mediates PYGM activation in Kit 225 T cells stimulated with IL-2. Using directed mutagenesis, phosphorylation of αPIX Rho-GEF serines 225 and 488 is required for activation...

  2. Nucleotide Metabolism

    DEFF Research Database (Denmark)

    Martinussen, Jan; Willemoës, M.; Kilstrup, Mogens

    2011-01-01

    Metabolic pathways are connected through their utilization of nucleotides as supplier of energy, allosteric effectors, and their role in activation of intermediates. Therefore, any attempt to exploit a given living organism in a biotechnological process will have an impact on nucleotide metabolis...

  3. Single nucleotide polymorphism of CC chemokine ligand 5 promoter gene in recipients may predict the risk of chronic graft-versus-host disease and its severity after allogeneic transplantation.

    Science.gov (United States)

    Kim, Dong Hwan; Jung, Hee Du; Lee, Nan Young; Sohn, Sang Kyun

    2007-10-15

    Leukocyte trafficking, regulated by chemokine ligands and their receptors, involves in the pathogenesis of graft-versus-host disease (GVHD) including CC ligand 5 (CCL5) or CC receptor 5 (CCR5). The current study analyzed the association of acute or chronic GVHD (cGVHD) with the CCR5/CCL5 gene single nucleotide polymorphisms (SNPs) of recipients and donors. We evaluated the SNPs of CCL5 promoter gene at position -28 (rs1800825)/-403 (rs2107538) and CCR5 gene at 59029 (rs1799987) in 72 recipients and donors using polymerase chain reaction/RFLP (Restriction Fragment Length Polymorphism) methods. With a median follow up of 924 days for survivors (range 48-2,360 days), the CG genotype of CCL5 gene at position -28 in recipients was significantly associated with a higher incidence of cGVHD (P=0.004), extensive cGVHD (P=0.038 by Seattle's criteria), and severe grade of cGVHD at presentation (P=0.017 by prognostic grading by Apkek et al.) compared to CC genotype. In terms of haplotype analysis, the recipients with AG haplotype of CCL5 gene also showed a higher incidence of cGVHD (P=0.003), extensive cGVHD (P=0.023), and more severe grade of cGVHD (P=0.020). However, there was no association of CCL5/CCR5 SNPs with acute GVHD. The donors' genotype of CCL5/CCR5 was not associated with the risk of cGVHD. The CCL5 promoter gene polymorphism of recipients was associated with the risk of cGVHD and its severity. The current study suggested an involvement of CCL5 in leukocyte trafficking for the development of cGVHD.

  4. NUCLEOTIDES IN INFANT FEEDING

    Directory of Open Access Journals (Sweden)

    L.G. Mamonova

    2007-01-01

    Full Text Available The article reviews the application of nucleotides-metabolites, playing a key role in many biological processes, for the infant feeding. The researcher provides the date on the nucleotides in the women's milk according to the lactation stages. She also analyzes the foreign experience in feeding newborns with nucleotides-containing milk formulas. The article gives a comparison of nucleotides in the adapted formulas represented in the domestic market of the given products.Key words: children, feeding, nucleotides.

  5. Main: Nucleotide Analysis [KOME

    Lifescience Database Archive (English)

    Full Text Available Nucleotide Analysis Japonica genome blast search result Result of blastn search against jap...onica genome sequence kome_japonica_genome_blast_search_result.zip kome_japonica_genome_blast_search_result ...

  6. In vitro guanine nucleotide exchange activity of DHR-2/DOCKER/CZH2 domains.

    Science.gov (United States)

    Côté, Jean-François; Vuori, Kristiina

    2006-01-01

    Rho family GTPases regulate a large variety of biological processes, including the reorganization of the actin cytoskeleton. Like other members of the Ras superfamily of small GTP-binding proteins, Rho GTPases cycle between a GDP-bound (inactive) and a GTP-bound (active) state, and, when active, the GTPases relay extracellular signals to a large number of downstream effectors. Guanine nucleotide exchange factors (GEFs) promote the exchange of GDP for GTP on Rho GTPases, thereby activating them. Most Rho-GEFs mediate their effects through their signature domain known as the Dbl Homology-Pleckstrin Homology (DH-PH) module. Recently, we and others identified a family of evolutionarily conserved, DOCK180-related proteins that also display GEF activity toward Rho GTPases. The DOCK180-family of proteins lacks the canonical DH-PH module. Instead, they rely on a novel domain, termed DHR-2, DOCKER, or CZH2, to exchange GDP for GTP on Rho targets. In this chapter, the experimental approach that we used to uncover the exchange activity of the DHR-2 domain of DOCK180-related proteins will be described.

  7. Cyclic nucleotides and radioresistnace

    International Nuclear Information System (INIS)

    Kulinskij, V.I.; Mikheeva, G.A.; Zel'manovich, B.M.

    1982-01-01

    The addition of glucose to meat-peptone broth does not change the radiosensitizing effect (RSE) of cAMP at the logarithmic phase (LP) and the radioprotective effect (RPE) at the stationary phase (SP), but sensitization, characteristic of cGMP, disappears in SP and turns into RPE in LP. Introduction of glucose into the broth for 20 min eliminates all the effects of both cyclic nucleotides in the cya + strain while cya - mutant exhibits RSE. RSE of both cyclic nucleotides is only manifested on minimal media. These data brought confirmation of the dependence of the influence of cyclic media. These data brought confirmation of the dependence of the influence of cyclic nucleotides on radioresistance upon the metabolic status of the cell [ru

  8. Single Nucleotide Polymorphism

    DEFF Research Database (Denmark)

    Børsting, Claus; Pereira, Vania; Andersen, Jeppe Dyrberg

    2014-01-01

    Single nucleotide polymorphisms (SNPs) are the most frequent DNA sequence variations in the genome. They have been studied extensively in the last decade with various purposes in mind. In this chapter, we will discuss the advantages and disadvantages of using SNPs for human identification...... of SNPs. This will allow acquisition of more information from the sample materials and open up for new possibilities as well as new challenges....

  9. The arabidopsis cyclic nucleotide interactome

    KAUST Repository

    Donaldson, Lara Elizabeth; Meier, Stuart Kurt; Gehring, Christoph A

    2016-01-01

    Cyclic nucleotides have been shown to play important signaling roles in many physiological processes in plants including photosynthesis and defence. Despite this, little is known about cyclic nucleotide-dependent signaling mechanisms

  10. A Steric-inhibition model for regulation of nucleotide exchange via the Dock180 family of GEFs.

    Science.gov (United States)

    Lu, Mingjian; Kinchen, Jason M; Rossman, Kent L; Grimsley, Cynthia; Hall, Matthew; Sondek, John; Hengartner, Michael O; Yajnik, Vijay; Ravichandran, Kodi S

    2005-02-22

    CDM (CED-5, Dock180, Myoblast city) family members have been recently identified as novel, evolutionarily conserved guanine nucleotide exchange factors (GEFs) for Rho-family GTPases . They regulate multiple processes, including embryonic development, cell migration, apoptotic-cell engulfment, tumor invasion, and HIV-1 infection, in diverse model systems . However, the mechanism(s) of regulation of CDM proteins has not been well understood. Here, our studies on the prototype member Dock180 reveal a steric-inhibition model for regulating the Dock180 family of GEFs. At basal state, the N-terminal SH3 domain of Dock180 binds to the distant catalytic Docker domain and negatively regulates the function of Dock180. Further studies revealed that the SH3:Docker interaction sterically blocks Rac access to the Docker domain. Interestingly, ELMO binding to the SH3 domain of Dock180 disrupted the SH3:Docker interaction, facilitated Rac access to the Docker domain, and contributed to the GEF activity of the Dock180/ELMO complex. Additional genetic rescue studies in C. elegans suggested that the regulation of the Docker-domain-mediated GEF activity by the SH3 domain and its adjoining region is evolutionarily conserved. This steric-inhibition model may be a general mechanism for regulating multiple SH3-domain-containing Dock180 family members and may have implications for a variety of biological processes.

  11. A High-Throughput Assay for Rho Guanine Nucleotide Exchange Factors Based on the Transcreener GDP Assay.

    Science.gov (United States)

    Reichman, Melvin; Schabdach, Amanda; Kumar, Meera; Zielinski, Tom; Donover, Preston S; Laury-Kleintop, Lisa D; Lowery, Robert G

    2015-12-01

    Ras homologous (Rho) family GTPases act as molecular switches controlling cell growth, movement, and gene expression by cycling between inactive guanosine diphosphate (GDP)- and active guanosine triphosphate (GTP)-bound conformations. Guanine nucleotide exchange factors (GEFs) positively regulate Rho GTPases by accelerating GDP dissociation to allow formation of the active, GTP-bound complex. Rho proteins are directly involved in cancer pathways, especially cell migration and invasion, and inhibiting GEFs holds potential as a therapeutic strategy to diminish Rho-dependent oncogenesis. Methods for measuring GEF activity suitable for high-throughput screening (HTS) are limited. We developed a simple, generic biochemical assay method for measuring GEF activity based on the fact that GDP dissociation is generally the rate-limiting step in the Rho GTPase catalytic cycle, and thus addition of a GEF causes an increase in steady-state GTPase activity. We used the Transcreener GDP Assay, which relies on selective immunodetection of GDP, to measure the GEF-dependent stimulation of steady-state GTP hydrolysis by small GTPases using Dbs (Dbl's big sister) as a GEF for Cdc42, RhoA, and RhoB. The assay is well suited for HTS, with a homogenous format and far red fluorescence polarization (FP) readout, and it should be broadly applicable to diverse Rho GEF/GTPase pairs. © 2015 Society for Laboratory Automation and Screening.

  12. The arabidopsis cyclic nucleotide interactome

    KAUST Repository

    Donaldson, Lara Elizabeth

    2016-05-11

    Background Cyclic nucleotides have been shown to play important signaling roles in many physiological processes in plants including photosynthesis and defence. Despite this, little is known about cyclic nucleotide-dependent signaling mechanisms in plants since the downstream target proteins remain unknown. This is largely due to the fact that bioinformatics searches fail to identify plant homologs of protein kinases and phosphodiesterases that are the main targets of cyclic nucleotides in animals. Methods An affinity purification technique was used to identify cyclic nucleotide binding proteins in Arabidopsis thaliana. The identified proteins were subjected to a computational analysis that included a sequence, transcriptional co-expression and functional annotation analysis in order to assess their potential role in plant cyclic nucleotide signaling. Results A total of twelve cyclic nucleotide binding proteins were identified experimentally including key enzymes in the Calvin cycle and photorespiration pathway. Importantly, eight of the twelve proteins were shown to contain putative cyclic nucleotide binding domains. Moreover, the identified proteins are post-translationally modified by nitric oxide, transcriptionally co-expressed and annotated to function in hydrogen peroxide signaling and the defence response. The activity of one of these proteins, GLYGOLATE OXIDASE 1, a photorespiratory enzyme that produces hydrogen peroxide in response to Pseudomonas, was shown to be repressed by a combination of cGMP and nitric oxide treatment. Conclusions We propose that the identified proteins function together as points of cross-talk between cyclic nucleotide, nitric oxide and reactive oxygen species signaling during the defence response.

  13. Antinociceptive effect of purine nucleotides.

    Science.gov (United States)

    Mello, C F; Begnini, J; De-La-Vega, D D; Lopes, F P; Schwartz, C C; Jimenez-Bernal, R E; Bellot, R G; Frussa-Filho, R

    1996-10-01

    The antinociceptive effect of purine nucleotides administered systematically (sc) was determined using the formalin and writhing tests in adult male albino mice. The mechanisms underlying nucleotide-induced antinociception were investigated by preinjecting the animals (sc) with specific antagonists for opioid (naloxone, 1 mg/kg), purinergic P1 (caffeine, 5, 10, of 30 mg/kg); theophylline, 10 mg/kg) or purinergic P2 receptors (suramin, 100 mg/kg; Coomassie blue, 30-300 mg/kg; quinidine, 10 mg/kg). Adenosine, adenosine monophosphate (AMP), diphosphate (ADP) and triphosphate (ATP) caused a reduction in the number of writhes and in the time of licking the formalin-injected paw. Naloxone had no effect on adenosine- or adenine nucleotide-induced antinociception. Caffeine (30 mg/kg) and theophylline (10 mg/kg) reversed the antinociceptive action of adenosine and adenine nucleotide derivatives in both tests. P2 antagonists did not reverse adenine nucleotide-induced antinociception. These results suggest that antinociceptive effect of adenine nucleotides is mediated by adenosine.

  14. Cyclic nucleotide specific phosphodiesterases of Leishmania major

    Directory of Open Access Journals (Sweden)

    Linder Markus

    2006-03-01

    Full Text Available Abstract Background Leishmania represent a complex of important human pathogens that belong to the systematic order of the kinetoplastida. They are transmitted between their human and mammalian hosts by different bloodsucking sandfly vectors. In their hosts, the Leishmania undergo several differentiation steps, and their coordination and optimization crucially depend on numerous interactions between the parasites and the physiological environment presented by the fly and human hosts. Little is still known about the signalling networks involved in these functions. In an attempt to better understand the role of cyclic nucleotide signalling in Leishmania differentiation and host-parasite interaction, we here present an initial study on the cyclic nucleotide-specific phosphodiesterases of Leishmania major. Results This paper presents the identification of three class I cyclic-nucleotide-specific phosphodiesterases (PDEs from L. major, PDEs whose catalytic domains exhibit considerable sequence conservation with, among other, all eleven human PDE families. In contrast to other protozoa such as Dictyostelium, or fungi such as Saccharomyces cerevisiae, Candida ssp or Neurospora, no genes for class II PDEs were found in the Leishmania genomes. LmjPDEA contains a class I catalytic domain at the C-terminus of the polypeptide, with no other discernible functional domains elsewhere. LmjPDEB1 and LmjPDEB2 are coded for by closely related, tandemly linked genes on chromosome 15. Both PDEs contain two GAF domains in their N-terminal region, and their almost identical catalytic domains are located at the C-terminus of the polypeptide. LmjPDEA, LmjPDEB1 and LmjPDEB2 were further characterized by functional complementation in a PDE-deficient S. cerevisiae strain. All three enzymes conferred complementation, demonstrating that all three can hydrolyze cAMP. Recombinant LmjPDEB1 and LmjPDEB2 were shown to be cAMP-specific, with Km values in the low micromolar range

  15. Nucleotide excision repair in yeast

    NARCIS (Netherlands)

    Eijk, Patrick van

    2012-01-01

    Nucleotide Excision Repair (NER) is a conserved DNA repair pathway capable of removing a broad spectrum of DNA damage. In human cells a defect in NER leads to the disorder Xeroderma pigmentosum (XP). The yeast Saccharomyces cerevisiae is an excellent model organism to study the mechanism of NER. The

  16. Nucleotide Selectivity in Abiotic RNA Polymerization Reactions

    Science.gov (United States)

    Coari, Kristin M.; Martin, Rebecca C.; Jain, Kopal; McGown, Linda B.

    2017-09-01

    In order to establish an RNA world on early Earth, the nucleotides must form polymers through chemical rather than biochemical reactions. The polymerization products must be long enough to perform catalytic functions, including self-replication, and to preserve genetic information. These functions depend not only on the length of the polymers, but also on their sequences. To date, studies of abiotic RNA polymerization generally have focused on routes to polymerization of a single nucleotide and lengths of the homopolymer products. Less work has been done the selectivity of the reaction toward incorporation of some nucleotides over others in nucleotide mixtures. Such information is an essential step toward understanding the chemical evolution of RNA. To address this question, in the present work RNA polymerization reactions were performed in the presence of montmorillonite clay catalyst. The nucleotides included the monophosphates of adenosine, cytosine, guanosine, uridine and inosine. Experiments included reactions of mixtures of an imidazole-activated nucleotide (ImpX) with one or more unactivated nucleotides (XMP), of two or more ImpX, and of XMP that were activated in situ in the polymerization reaction itself. The reaction products were analyzed using matrix-assisted laser desorption/ionization time-of-flight mass spectrometry (MALDI-TOF MS) to identify the lengths and nucleotide compositions of the polymerization products. The results show that the extent of polymerization, the degree of heteropolymerization vs. homopolymerization, and the composition of the polymeric products all vary among the different nucleotides and depend upon which nucleotides and how many different nucleotides are present in the mixture.

  17. Nucleotide Selectivity in Abiotic RNA Polymerization Reactions.

    Science.gov (United States)

    Coari, Kristin M; Martin, Rebecca C; Jain, Kopal; McGown, Linda B

    2017-09-01

    In order to establish an RNA world on early Earth, the nucleotides must form polymers through chemical rather than biochemical reactions. The polymerization products must be long enough to perform catalytic functions, including self-replication, and to preserve genetic information. These functions depend not only on the length of the polymers, but also on their sequences. To date, studies of abiotic RNA polymerization generally have focused on routes to polymerization of a single nucleotide and lengths of the homopolymer products. Less work has been done the selectivity of the reaction toward incorporation of some nucleotides over others in nucleotide mixtures. Such information is an essential step toward understanding the chemical evolution of RNA. To address this question, in the present work RNA polymerization reactions were performed in the presence of montmorillonite clay catalyst. The nucleotides included the monophosphates of adenosine, cytosine, guanosine, uridine and inosine. Experiments included reactions of mixtures of an imidazole-activated nucleotide (ImpX) with one or more unactivated nucleotides (XMP), of two or more ImpX, and of XMP that were activated in situ in the polymerization reaction itself. The reaction products were analyzed using matrix-assisted laser desorption/ionization time-of-flight mass spectrometry (MALDI-TOF MS) to identify the lengths and nucleotide compositions of the polymerization products. The results show that the extent of polymerization, the degree of heteropolymerization vs. homopolymerization, and the composition of the polymeric products all vary among the different nucleotides and depend upon which nucleotides and how many different nucleotides are present in the mixture.

  18. Nucleotide sequence preservation of human mitochondrial DNA

    International Nuclear Information System (INIS)

    Monnat, R.J. Jr.; Loeb, L.A.

    1985-01-01

    Recombinant DNA techniques have been used to quantitate the amount of nucleotide sequence divergence in the mitochondrial DNA population of individual normal humans. Mitochondrial DNA was isolated from the peripheral blood lymphocytes of five normal humans and cloned in M13 mp11; 49 kilobases of nucleotide sequence information was obtained from 248 independently isolated clones from the five normal donors. Both between- and within-individual differences were identified. Between-individual differences were identified in approximately = to 1/200 nucleotides. In contrast, only one within-individual difference was identified in 49 kilobases of nucleotide sequence information. This high degree of mitochondrial nucleotide sequence homogeneity in human somatic cells is in marked contrast to the rapid evolutionary divergence of human mitochondrial DNA and suggests the existence of mechanisms for the concerted preservation of mammalian mitochondrial DNA sequences in single organisms

  19. Nucleotide diversity and phylogenetic relationships among ...

    Indian Academy of Sciences (India)

    2017-03-03

    Mar 3, 2017 ... 2Department of Botany, D. S. B. Campus, Kumaun University, Nainital 263 001, India ... Rana T. S. 2017 Nucleotide diversity and phylogenetic relationships ... Anderson and Park 1989). ..... Edgewood Press, Edgewood, USA.

  20. Nucleotide excision repair in the test tube.

    NARCIS (Netherlands)

    N.G.J. Jaspers (Nicolaas); J.H.J. Hoeijmakers (Jan)

    1995-01-01

    textabstractThe eukaryotic nucleotide excision-repair pathway has been reconstituted in vitro, an achievement that should hasten the full enzymological characterization of this highly complex DNA-repair pathway.

  1. A Nucleotide Phosphatase Activity in the Nucleotide Binding Domain of an Orphan Resistance Protein from Rice*

    Science.gov (United States)

    Fenyk, Stepan; de San Eustaquio Campillo, Alba; Pohl, Ehmke; Hussey, Patrick J.; Cann, Martin J.

    2012-01-01

    Plant resistance proteins (R-proteins) are key components of the plant immune system activated in response to a plethora of different pathogens. R-proteins are P-loop NTPase superfamily members, and current models describe their main function as ATPases in defense signaling pathways. Here we show that a subset of R-proteins have evolved a new function to combat pathogen infection. This subset of R-proteins possesses a nucleotide phosphatase activity in the nucleotide-binding domain. Related R-proteins that fall in the same phylogenetic clade all show the same nucleotide phosphatase activity indicating a conserved function within at least a subset of R-proteins. R-protein nucleotide phosphatases catalyze the production of nucleoside from nucleotide with the nucleotide monophosphate as the preferred substrate. Mutation of conserved catalytic residues substantially reduced activity consistent with the biochemistry of P-loop NTPases. Kinetic analysis, analytical gel filtration, and chemical cross-linking demonstrated that the nucleotide-binding domain was active as a multimer. Nuclear magnetic resonance and nucleotide analogues identified the terminal phosphate bond as the target of a reaction that utilized a metal-mediated nucleophilic attack by water on the phosphoester. In conclusion, we have identified a group of R-proteins with a unique function. This biochemical activity appears to have co-evolved with plants in signaling pathways designed to resist pathogen attack. PMID:22157756

  2. A nucleotide phosphatase activity in the nucleotide binding domain of an orphan resistance protein from rice.

    Science.gov (United States)

    Fenyk, Stepan; Campillo, Alba de San Eustaquio; Pohl, Ehmke; Hussey, Patrick J; Cann, Martin J

    2012-02-03

    Plant resistance proteins (R-proteins) are key components of the plant immune system activated in response to a plethora of different pathogens. R-proteins are P-loop NTPase superfamily members, and current models describe their main function as ATPases in defense signaling pathways. Here we show that a subset of R-proteins have evolved a new function to combat pathogen infection. This subset of R-proteins possesses a nucleotide phosphatase activity in the nucleotide-binding domain. Related R-proteins that fall in the same phylogenetic clade all show the same nucleotide phosphatase activity indicating a conserved function within at least a subset of R-proteins. R-protein nucleotide phosphatases catalyze the production of nucleoside from nucleotide with the nucleotide monophosphate as the preferred substrate. Mutation of conserved catalytic residues substantially reduced activity consistent with the biochemistry of P-loop NTPases. Kinetic analysis, analytical gel filtration, and chemical cross-linking demonstrated that the nucleotide-binding domain was active as a multimer. Nuclear magnetic resonance and nucleotide analogues identified the terminal phosphate bond as the target of a reaction that utilized a metal-mediated nucleophilic attack by water on the phosphoester. In conclusion, we have identified a group of R-proteins with a unique function. This biochemical activity appears to have co-evolved with plants in signaling pathways designed to resist pathogen attack.

  3. Bacterial Signaling Nucleotides Inhibit Yeast Cell Growth by Impacting Mitochondrial and Other Specifically Eukaryotic Functions.

    Science.gov (United States)

    Hesketh, Andy; Vergnano, Marta; Wan, Chris; Oliver, Stephen G

    2017-07-25

    We have engineered Saccharomyces cerevisiae to inducibly synthesize the prokaryotic signaling nucleotides cyclic di-GMP (cdiGMP), cdiAMP, and ppGpp in order to characterize the range of effects these nucleotides exert on eukaryotic cell function during bacterial pathogenesis. Synthetic genetic array (SGA) and transcriptome analyses indicated that, while these compounds elicit some common reactions in yeast, there are also complex and distinctive responses to each of the three nucleotides. All three are capable of inhibiting eukaryotic cell growth, with the guanine nucleotides exhibiting stronger effects than cdiAMP. Mutations compromising mitochondrial function and chromatin remodeling show negative epistatic interactions with all three nucleotides. In contrast, certain mutations that cause defects in chromatin modification and ribosomal protein function show positive epistasis, alleviating growth inhibition by at least two of the three nucleotides. Uniquely, cdiGMP is lethal both to cells growing by respiration on acetate and to obligately fermentative petite mutants. cdiGMP is also synthetically lethal with the ribonucleotide reductase (RNR) inhibitor hydroxyurea. Heterologous expression of the human ppGpp hydrolase Mesh1p prevented the accumulation of ppGpp in the engineered yeast and restored cell growth. Extensive in vivo interactions between bacterial signaling molecules and eukaryotic gene function occur, resulting in outcomes ranging from growth inhibition to death. cdiGMP functions through a mechanism that must be compensated by unhindered RNR activity or by functionally competent mitochondria. Mesh1p may be required for abrogating the damaging effects of ppGpp in human cells subjected to bacterial infection. IMPORTANCE During infections, pathogenic bacteria can release nucleotides into the cells of their eukaryotic hosts. These nucleotides are recognized as signals that contribute to the initiation of defensive immune responses that help the infected

  4. Complete nucleotide sequence of Alfalfa mosaic virus isolated from alfalfa (Medicago sativa L.) in Argentina.

    Science.gov (United States)

    Trucco, Verónica; de Breuil, Soledad; Bejerman, Nicolás; Lenardon, Sergio; Giolitti, Fabián

    2014-06-01

    The complete nucleotide sequence of an Alfalfa mosaic virus (AMV) isolate infecting alfalfa (Medicago sativa L.) in Argentina, AMV-Arg, was determined. The virus genome has the typical organization described for AMV, and comprises 3,643, 2,593, and 2,038 nucleotides for RNA1, 2 and 3, respectively. The whole genome sequence and each encoding region were compared with those of other four isolates that have been completely sequenced from China, Italy, Spain and USA. The nucleotide identity percentages ranged from 95.9 to 99.1 % for the three RNAs and from 93.7 to 99 % for the protein 1 (P1), protein 2 (P2), movement protein and coat protein (CP) encoding regions, whereas the amino acid identity percentages of these proteins ranged from 93.4 to 99.5 %, the lowest value corresponding to P2. CP sequences of AMV-Arg were compared with those of other 25 available isolates, and the phylogenetic analysis based on the CP gene was carried out. The highest percentage of nucleotide sequence identity of the CP gene was 98.3 % with a Chinese isolate and 98.6 % at the amino acid level with four isolates, two from Italy, one from Brazil and the remaining one from China. The phylogenetic analysis showed that AMV-Arg is closely related to subgroup I of AMV isolates. To our knowledge, this is the first report of a complete nucleotide sequence of AMV from South America and the first worldwide report of complete nucleotide sequence of AMV isolated from alfalfa as natural host.

  5. The International Nucleotide Sequence Database Collaboration.

    Science.gov (United States)

    Cochrane, Guy; Karsch-Mizrachi, Ilene; Nakamura, Yasukazu

    2011-01-01

    Under the International Nucleotide Sequence Database Collaboration (INSDC; http://www.insdc.org), globally comprehensive public domain nucleotide sequence is captured, preserved and presented. The partners of this long-standing collaboration work closely together to provide data formats and conventions that enable consistent data submission to their databases and support regular data exchange around the globe. Clearly defined policy and governance in relation to free access to data and relationships with journal publishers have positioned INSDC databases as a key provider of the scientific record and a core foundation for the global bioinformatics data infrastructure. While growth in sequence data volumes comes no longer as a surprise to INSDC partners, the uptake of next-generation sequencing technology by mainstream science that we have witnessed in recent years brings a step-change to growth, necessarily making a clear mark on INSDC strategy. In this article, we introduce the INSDC, outline data growth patterns and comment on the challenges of increased growth.

  6. Bacterial nucleotide-based second messengers.

    Science.gov (United States)

    Pesavento, Christina; Hengge, Regine

    2009-04-01

    In all domains of life nucleotide-based second messengers transduce signals originating from changes in the environment or in intracellular conditions into appropriate cellular responses. In prokaryotes cyclic di-GMP has emerged as an important and ubiquitous second messenger regulating bacterial life-style transitions relevant for biofilm formation, virulence, and many other bacterial functions. This review describes similarities and differences in the architecture of the cAMP, (p)ppGpp, and c-di-GMP signaling systems and their underlying signaling principles. Moreover, recent advances in c-di-GMP-mediated signaling will be presented and the integration of c-di-GMP signaling with other nucleotide-based signaling systems will be discussed.

  7. Nucleotide Manipulatives to Illustrate the Central Dogma

    OpenAIRE

    Sonja B. Yung; Todd P. Primm

    2015-01-01

    The central dogma is a core concept that is critical for introductory biology and microbiology students to master. However, students often struggle to conceptualize the processes involved, and fail to move beyond simply memorizing the basic facts. To encourage critical thinking, we have designed a set of magnetic nucleotide manipulatives that allow students to model DNA structure, along with the processes of replication, transcription, and translation.

  8. Nucleotide Manipulatives to Illustrate the Central Dogma

    Directory of Open Access Journals (Sweden)

    Sonja B. Yung

    2015-08-01

    Full Text Available The central dogma is a core concept that is critical for introductory biology and microbiology students to master. However, students often struggle to conceptualize the processes involved, and fail to move beyond simply memorizing the basic facts. To encourage critical thinking, we have designed a set of magnetic nucleotide manipulatives that allow students to model DNA structure, along with the processes of replication, transcription, and translation.

  9. Histone displacement during nucleotide excision repair

    DEFF Research Database (Denmark)

    Dinant, C.; Bartek, J.; Bekker-Jensen, S.

    2012-01-01

    Nucleotide excision repair (NER) is an important DNA repair mechanism required for cellular resistance against UV light and toxic chemicals such as those found in tobacco smoke. In living cells, NER efficiently detects and removes DNA lesions within the large nuclear macromolecular complex called...... of histone variants and histone displacement (including nucleosome sliding). Here we review current knowledge, and speculate about current unknowns, regarding those chromatin remodeling activities that physically displace histones before, during and after NER....

  10. Pyrrolidine nucleotide analogs with a tunable conformation

    Czech Academy of Sciences Publication Activity Database

    Poštová Slavětínská, Lenka; Rejman, Dominik; Pohl, Radek

    2014-01-01

    Roč. 10, Aug 22 (2014), s. 1967-1980 ISSN 1860-5397 R&D Projects: GA ČR GA13-24880S Institutional support: RVO:61388963 Keywords : conformation * NMR * nucleic acids * nucleotide analog * phosphonic acid * pseudorotation * pyrrolidine Subject RIV: CC - Organic Chemistry Impact factor: 2.762, year: 2014 http://www.beilstein-journals.org/bjoc/single/articleFullText.htm?publicId=1860-5397-10-205

  11. Vacuum ultraviolet photoionization of carbohydrates and nucleotides

    Energy Technology Data Exchange (ETDEWEB)

    Shin, Joong-Won, E-mail: jshin@govst.edu [Division of Science, Governors State University, University Park, Illinois 60484-0975 (United States); Department of Chemistry, Colorado State University, Fort Collins, Colorado 80523-1872 (United States); Bernstein, Elliot R., E-mail: erb@lamar.colostate.edu [Department of Chemistry, Colorado State University, Fort Collins, Colorado 80523-1872 (United States)

    2014-01-28

    Carbohydrates (2-deoxyribose, ribose, and xylose) and nucleotides (adenosine-, cytidine-, guanosine-, and uridine-5{sup ′}-monophosphate) are generated in the gas phase, and ionized with vacuum ultraviolet photons (VUV, 118.2 nm). The observed time of flight mass spectra of the carbohydrate fragmentation are similar to those observed [J.-W. Shin, F. Dong, M. Grisham, J. J. Rocca, and E. R. Bernstein, Chem. Phys. Lett. 506, 161 (2011)] for 46.9 nm photon ionization, but with more intensity in higher mass fragment ions. The tendency of carbohydrate ions to fragment extensively following ionization seemingly suggests that nucleic acids might undergo radiation damage as a result of carbohydrate, rather than nucleobase fragmentation. VUV photoionization of nucleotides (monophosphate-carbohydrate-nucleobase), however, shows that the carbohydrate-nucleobase bond is the primary fragmentation site for these species. Density functional theory (DFT) calculations indicate that the removed carbohydrate electrons by the 118.2 nm photons are associated with endocyclic C–C and C–O ring centered orbitals: loss of electron density in the ring bonds of the nascent ion can thus account for the observed fragmentation patterns following carbohydrate ionization. DFT calculations also indicate that electrons removed from nucleotides under these same conditions are associated with orbitals involved with the nucleobase-saccharide linkage electron density. The calculations give a general mechanism and explanation of the experimental results.

  12. Vacuum ultraviolet photoionization of carbohydrates and nucleotides

    International Nuclear Information System (INIS)

    Shin, Joong-Won; Bernstein, Elliot R.

    2014-01-01

    Carbohydrates (2-deoxyribose, ribose, and xylose) and nucleotides (adenosine-, cytidine-, guanosine-, and uridine-5 ′ -monophosphate) are generated in the gas phase, and ionized with vacuum ultraviolet photons (VUV, 118.2 nm). The observed time of flight mass spectra of the carbohydrate fragmentation are similar to those observed [J.-W. Shin, F. Dong, M. Grisham, J. J. Rocca, and E. R. Bernstein, Chem. Phys. Lett. 506, 161 (2011)] for 46.9 nm photon ionization, but with more intensity in higher mass fragment ions. The tendency of carbohydrate ions to fragment extensively following ionization seemingly suggests that nucleic acids might undergo radiation damage as a result of carbohydrate, rather than nucleobase fragmentation. VUV photoionization of nucleotides (monophosphate-carbohydrate-nucleobase), however, shows that the carbohydrate-nucleobase bond is the primary fragmentation site for these species. Density functional theory (DFT) calculations indicate that the removed carbohydrate electrons by the 118.2 nm photons are associated with endocyclic C–C and C–O ring centered orbitals: loss of electron density in the ring bonds of the nascent ion can thus account for the observed fragmentation patterns following carbohydrate ionization. DFT calculations also indicate that electrons removed from nucleotides under these same conditions are associated with orbitals involved with the nucleobase-saccharide linkage electron density. The calculations give a general mechanism and explanation of the experimental results

  13. Identification of cyclic nucleotide gated channels using regular expressions

    KAUST Repository

    Zelman, Alice K.; Dawe, Adam Sean; Berkowitz, Gerald A.

    2013-01-01

    Cyclic nucleotide-gated channels (CNGCs) are nonselective cation channels found in plants, animals, and some bacteria. They have a six-transmembrane/one- pore structure, a cytosolic cyclic nucleotide-binding domain, and a cytosolic calmodulin

  14. Effects of hypokinesia on cyclic nucleotides and hormonal regulation ...

    African Journals Online (AJOL)

    PTH), calcitonin (CT), cyclic nucleotides (cAMP, cGMP) and calcium in the blood of rats, while in urine - phosphate, calcium and cyclic nucleotides. Design: Laboratory based experiment. Setting: Laboratory in the Department of Biochemistry, ...

  15. Nucleotide diversity analysis of three major bacterial blight resistance genes in rice.

    Directory of Open Access Journals (Sweden)

    Waikhom Bimolata

    Full Text Available Nucleotide sequence polymorphisms among R gene alleles influence the process of co-evolutionary interaction between host and pathogen by shaping the response of host plants towards invading pathogens. Here, we present the DNA sequence polymorphisms and diversities present among natural alleles of three rice bacterial blight resistance genes, Xa21, Xa26 and xa5. The diversity was examined across different wild relatives and cultivars of Oryza species. Functional significance of selected alleles was evaluated through semi-quantitative reverse transcription polymerase chain reaction and real time PCR. The greatest nucleotide diversity and singleton variable sites (SVS were present in Xa26 (π = 0.01958; SVS = 182 followed by xa5 and Xa21 alleles. The highest frequency of single nucleotide polymorphisms were observed in Xa21 alleles and least in xa5. Transition bias was observed in all the genes and 'G' to 'A' transitions were more favored than other form of transitions. Neutrality tests failed to show the presence of selection at these loci, though negative Tajima's D values indicate the presence of a rare form of polymorphisms. At the interspecies level, O. nivara exhibited more diversity than O. sativa. We have also identified two nearly identical resistant alleles of xa5 and two sequentially identical alleles of Xa21. The alleles of xa5 showed basal levels of expression while Xa21 alleles were functionally not expressed.

  16. Chlamydial entry involves TARP binding of guanine nucleotide exchange factors.

    Directory of Open Access Journals (Sweden)

    B Josh Lane

    2008-03-01

    Full Text Available Chlamydia trachomatis attachment to cells induces the secretion of the elementary body-associated protein TARP (Translocated Actin Recruiting Protein. TARP crosses the plasma membrane where it is immediately phosphorylated at tyrosine residues by unknown host kinases. The Rac GTPase is also activated, resulting in WAVE2 and Arp2/3-dependent recruitment of actin to the sites of chlamydia attachment. We show that TARP participates directly in chlamydial invasion activating the Rac-dependent signaling cascade to recruit actin. TARP functions by binding two distinct Rac guanine nucleotide exchange factors (GEFs, Sos1 and Vav2, in a phosphotyrosine-dependent manner. The tyrosine phosphorylation profile of the sequence YEPISTENIYESI within TARP, as well as the transient activation of the phosphatidylinositol 3-kinase (PI3-K, appears to determine which GEF is utilized to activate Rac. The first and second tyrosine residues, when phosphorylated, are utilized by the Sos1/Abi1/Eps8 and Vav2, respectively, with the latter requiring the lipid phosphatidylinositol 3,4,5-triphosphate. Depletion of these critical signaling molecules by siRNA resulted in inhibition of chlamydial invasion to varying degrees, owing to a possible functional redundancy of the two pathways. Collectively, these data implicate TARP in signaling to the actin cytoskeleton remodeling machinery, demonstrating a mechanism by which C.trachomatis invades non-phagocytic cells.

  17. Host organisms: Bacillus subtilis

    NARCIS (Netherlands)

    Hohman, Hans-Peter; van Dijl, Jan; Krishnappa, Laxmi; Pragai, Zoltan

    2016-01-01

    Bacillus subtilis and its close Bacillus relatives are important bacterial platforms for industrial production of enzymes and fine chemicals such as vitamin B2 and nucleotides. B. subtilis is an attractive bacterial organism for industrial use mainly because of its straightforward genetic

  18. Classifying Coding DNA with Nucleotide Statistics

    Directory of Open Access Journals (Sweden)

    Nicolas Carels

    2009-10-01

    Full Text Available In this report, we compared the success rate of classification of coding sequences (CDS vs. introns by Codon Structure Factor (CSF and by a method that we called Universal Feature Method (UFM. UFM is based on the scoring of purine bias (Rrr and stop codon frequency. We show that the success rate of CDS/intron classification by UFM is higher than by CSF. UFM classifies ORFs as coding or non-coding through a score based on (i the stop codon distribution, (ii the product of purine probabilities in the three positions of nucleotide triplets, (iii the product of Cytosine (C, Guanine (G, and Adenine (A probabilities in the 1st, 2nd, and 3rd positions of triplets, respectively, (iv the probabilities of G in 1st and 2nd position of triplets and (v the distance of their GC3 vs. GC2 levels to the regression line of the universal correlation. More than 80% of CDSs (true positives of Homo sapiens (>250 bp, Drosophila melanogaster (>250 bp and Arabidopsis thaliana (>200 bp are successfully classified with a false positive rate lower or equal to 5%. The method releases coding sequences in their coding strand and coding frame, which allows their automatic translation into protein sequences with 95% confidence. The method is a natural consequence of the compositional bias of nucleotides in coding sequences.

  19. The Rho-family GTPase Rac1 regulates integrin localization in Drosophila immunosurveillance cells.

    Directory of Open Access Journals (Sweden)

    Miguel J Xavier

    Full Text Available BACKGROUND: When the parasitoid wasp Leptopilina boulardi lays an egg in a Drosophila larva, phagocytic cells called plasmatocytes and specialized cells known as lamellocytes encapsulate the egg. The Drosophila β-integrin Myospheroid (Mys is necessary for lamellocytes to adhere to the cellular capsule surrounding L. boulardi eggs. Integrins are heterodimeric adhesion receptors consisting of α and β subunits, and similar to other plasma membrane receptors undergo ligand-dependent endocytosis. In mammalian cells it is known that integrin binding to the extracellular matrix induces the activation of Rac GTPases, and we have previously shown that Rac1 and Rac2 are necessary for a proper encapsulation response in Drosophila larvae. We wanted to test the possibility that Myospheroid and Rac GTPases interact during the Drosophila anti-parasitoid immune response. RESULTS: In the current study we demonstrate that Rac1 is required for the proper localization of Myospheroid to the cell periphery of haemocytes after parasitization. Interestingly, the mislocalization of Myospheroid in Rac1 mutants is rescued by hyperthermia, involving the heat shock protein Hsp83. From these results we conclude that Rac1 and Hsp83 are required for the proper localization of Mys after parasitization. SIGNIFICANCE: We show for the first time that the small GTPase Rac1 is required for Mysopheroid localization. Interestingly, the necessity of Rac1 in Mys localization was negated by hyperthermia. This presents a problem, in Drosophila we quite often raise larvae at 29°C when using the GAL4/UAS misexpression system. If hyperthermia rescues receptor endosomal recycling defects, raising larvae in hyperthermic conditions may mask potentially interesting phenotypes.

  20. Rho-family GTPase Cdc42 controls migration of Langerhans cells in vivo

    DEFF Research Database (Denmark)

    Luckashenak, Nancy; Wähe, Anna; Breit, Katharina

    2013-01-01

    Epidermal Langerhans cells (LCs) of the skin represent the prototype migratory dendritic cell (DC) subtype. In the skin, they take up Ag, migrate to the draining lymph nodes, and contribute to Ag transport and immunity. Different depletion models for LCs have revealed contrasting roles and contri...

  1. Horizontal gene transfer and nucleotide compositional anomaly in large DNA viruses

    Directory of Open Access Journals (Sweden)

    Ogata Hiroyuki

    2007-12-01

    Full Text Available Abstract Background DNA viruses have a wide range of genome sizes (5 kb up to 1.2 Mb, compared to 0.16 Mb to 1.5 Mb for obligate parasitic bacteria that do not correlate with their virulence or the taxonomic distribution of their hosts. The reasons for such large variation are unclear. According to the traditional view of viruses as gifted "gene pickpockets", large viral genome sizes could originate from numerous gene acquisitions from their hosts. We investigated this hypothesis by studying 67 large DNA viruses with genome sizes larger than 150 kb, including the recently characterized giant mimivirus. Given that horizontally transferred DNA often have anomalous nucleotide compositions differing from the rest of the genome, we conducted a detailed analysis of the inter- and intra-genome compositional properties of these viruses. We then interpreted their compositional heterogeneity in terms of possible causes, including strand asymmetry, gene function/expression, and horizontal transfer. Results We first show that the global nucleotide composition and nucleotide word usage of viral genomes are species-specific and distinct from those of their hosts. Next, we identified compositionally anomalous (cA genes in viral genomes, using a method based on Bayesian inference. The proportion of cA genes is highly variable across viruses and does not exhibit a significant correlation with genome size. The vast majority of the cA genes were of unknown function, lacking homologs in the databases. For genes with known homologs, we found a substantial enrichment of cA genes in specific functional classes for some of the viruses. No significant association was found between cA genes and compositional strand asymmetry. A possible exogenous origin for a small fraction of the cA genes could be confirmed by phylogenetic reconstruction. Conclusion At odds with the traditional dogma, our results argue against frequent genetic transfers to large DNA viruses from their

  2. Regulation of nucleotide excision repair through ubiquitination

    Institute of Scientific and Technical Information of China (English)

    Jia Li; Audesh Bhat; Wei Xiao

    2011-01-01

    Nucleotide excision repair (NER) is the most versatile DNA-repair pathway in all organisms.While bacteria require only three proteins to complete the incision step of NER,eukaryotes employ about 30 proteins to complete the same step.Here we summarize recent studies demonstrating that ubiquitination,a post-translational modification,plays critical roles in regulating the NER activity either dependent on or independent of ubiquitin-proteolysis.Several NER components have been shown as targets of ubiquitination while others are actively involved in the ubiquitination process.We argue through this analysis that ubiquitination serves to coordinate various steps of NER and meanwhile connect NER with other related pathways to achieve the efficient global DNA-damage response.

  3. Palindromic nucleotide analysis in human T cell receptor rearrangements.

    Directory of Open Access Journals (Sweden)

    Santosh K Srivastava

    Full Text Available Diversity of T cell receptor (TCR genes is primarily generated by nucleotide insertions upon rearrangement from their germ line-encoded V, D and J segments. Nucleotide insertions at V-D and D-J junctions are random, but some small subsets of these insertions are exceptional, in that one to three base pairs inversely repeat the sequence of the germline DNA. These short complementary palindromic sequences are called P nucleotides. We apply the ImmunoSeq deep-sequencing assay to the third complementarity determining region (CDR3 of the β chain of T cell receptors, and use the resulting data to study P nucleotides in the repertoire of naïve and memory CD8(+ and CD4(+ T cells. We estimate P nucleotide distributions in a cross section of healthy adults and different T cell subtypes. We show that P nucleotide frequency in all T cell subtypes ranges from 1% to 2%, and that the distribution is highly biased with respect to the coding end of the gene segment. Classification of observed palindromic sequences into P nucleotides using a maximum conditional probability model shows that single base P nucleotides are very rare in VDJ recombination; P nucleotides are primarily two bases long. To explore the role of P nucleotides in thymic selection, we compare P nucleotides in productive and non-productive sequences of CD8(+ naïve T cells. The naïve CD8(+ T cell clones with P nucleotides are more highly expanded.

  4. Rasp21 sequences opposite the nucleotide binding pocket are required for GRF-mediated nucleotide release

    DEFF Research Database (Denmark)

    Leonardsen, L; DeClue, J E; Lybaek, H

    1996-01-01

    The substrate requirements for the catalytic activity of the mouse Cdc25 homolog Guanine nucleotide Release Factor, GRF, were determined using the catalytic domain of GRF expressed in insect cells and E. coli expressed H-Ras mutants. We found a requirement for the loop 7 residues in Ras (amino ac...... and the human Ras like proteins RhoA, Rap1A, Rac1 and G25K revealed a strict Ras specificity; of these only S. pombe Ras was GRF sensitive....

  5. Influence of the host contact sequence on the outcome of competition among aspergillus flavus isolates during host tissue invasion.

    Science.gov (United States)

    Mehl, H L; Cotty, P J

    2011-03-01

    Biological control of aflatoxin contamination by Aspergillus flavus is achieved through competitive exclusion of aflatoxin producers by atoxigenic strains. Factors dictating the extent to which competitive displacement occurs during host infection are unknown. The role of initial host contact in competition between pairs of A. flavus isolates coinfecting maize kernels was examined. Isolate success during tissue invasion and reproduction was assessed by quantification of isolate-specific single nucleotide polymorphisms using pyrosequencing. Isolates were inoculated either simultaneously or 1 h apart. Increased success during competition was conferred to the first isolate to contact the host independent of that isolate's innate competitive ability. The first-isolate advantage decreased with the conidial concentration, suggesting capture of limited resources on kernel surfaces contributes to competitive exclusion. Attempts to modify access to putative attachment sites by either coating kernels with dead conidia or washing kernels with solvents did not influence the success of the first isolate, suggesting competition for limited attachment sites on kernel surfaces does not mediate first-isolate advantage. The current study is the first to demonstrate an immediate competitive advantage conferred to A. flavus isolates upon host contact and prior to either germ tube emergence or host colonization. This suggests the timing of host contact is as important to competition during disease cycles as innate competitive ability. Early dispersal to susceptible crop components may allow maintenance within A. flavus populations of genetic types with low competitive ability during host tissue invasion.

  6. Inferring epidemiological dynamics of infectious diseases using Tajima's D statistic on nucleotide sequences of pathogens.

    Science.gov (United States)

    Kim, Kiyeon; Omori, Ryosuke; Ito, Kimihito

    2017-12-01

    The estimation of the basic reproduction number is essential to understand epidemic dynamics, and time series data of infected individuals are usually used for the estimation. However, such data are not always available. Methods to estimate the basic reproduction number using genealogy constructed from nucleotide sequences of pathogens have been proposed so far. Here, we propose a new method to estimate epidemiological parameters of outbreaks using the time series change of Tajima's D statistic on the nucleotide sequences of pathogens. To relate the time evolution of Tajima's D to the number of infected individuals, we constructed a parsimonious mathematical model describing both the transmission process of pathogens among hosts and the evolutionary process of the pathogens. As a case study we applied this method to the field data of nucleotide sequences of pandemic influenza A (H1N1) 2009 viruses collected in Argentina. The Tajima's D-based method estimated basic reproduction number to be 1.55 with 95% highest posterior density (HPD) between 1.31 and 2.05, and the date of epidemic peak to be 10th July with 95% HPD between 22nd June and 9th August. The estimated basic reproduction number was consistent with estimation by birth-death skyline plot and estimation using the time series of the number of infected individuals. These results suggested that Tajima's D statistic on nucleotide sequences of pathogens could be useful to estimate epidemiological parameters of outbreaks. Copyright © 2017 The Authors. Published by Elsevier B.V. All rights reserved.

  7. Exploiting nucleotide composition to engineer promoters.

    Directory of Open Access Journals (Sweden)

    Manfred G Grabherr

    Full Text Available The choice of promoter is a critical step in optimizing the efficiency and stability of recombinant protein production in mammalian cell lines. Artificial promoters that provide stable expression across cell lines and can be designed to the desired strength constitute an alternative to the use of viral promoters. Here, we show how the nucleotide characteristics of highly active human promoters can be modelled via the genome-wide frequency distribution of short motifs: by overlapping motifs that occur infrequently in the genome, we constructed contiguous sequence that is rich in GC and CpGs, both features of known promoters, but lacking homology to real promoters. We show that snippets from this sequence, at 100 base pairs or longer, drive gene expression in vitro in a number of mammalian cells, and are thus candidates for use in protein production. We further show that expression is driven by the general transcription factors TFIIB and TFIID, both being ubiquitously present across cell types, which results in less tissue- and species-specific regulation compared to the viral promoter SV40. We lastly found that the strength of a promoter can be tuned up and down by modulating the counts of GC and CpGs in localized regions. These results constitute a "proof-of-concept" for custom-designing promoters that are suitable for biotechnological and medical applications.

  8. Supplementary Material for: The arabidopsis cyclic nucleotide interactome

    KAUST Repository

    Donaldson, Lara; Meier, Stuart; Gehring, Christoph A

    2016-01-01

    Abstract Background Cyclic nucleotides have been shown to play important signaling roles in many physiological processes in plants including photosynthesis and defence. Despite this, little is known about cyclic nucleotide-dependent signaling mechanisms in plants since the downstream target proteins remain unknown. This is largely due to the fact that bioinformatics searches fail to identify plant homologs of protein kinases and phosphodiesterases that are the main targets of cyclic nucleotides in animals. Methods An affinity purification technique was used to identify cyclic nucleotide binding proteins in Arabidopsis thaliana. The identified proteins were subjected to a computational analysis that included a sequence, transcriptional co-expression and functional annotation analysis in order to assess their potential role in plant cyclic nucleotide signaling. Results A total of twelve cyclic nucleotide binding proteins were identified experimentally including key enzymes in the Calvin cycle and photorespiration pathway. Importantly, eight of the twelve proteins were shown to contain putative cyclic nucleotide binding domains. Moreover, the identified proteins are post-translationally modified by nitric oxide, transcriptionally co-expressed and annotated to function in hydrogen peroxide signaling and the defence response. The activity of one of these proteins, GLYGOLATE OXIDASE 1, a photorespiratory enzyme that produces hydrogen peroxide in response to Pseudomonas, was shown to be repressed by a combination of cGMP and nitric oxide treatment. Conclusions We propose that the identified proteins function together as points of cross-talk between cyclic nucleotide, nitric oxide and reactive oxygen species signaling during the defence response.

  9. In-silico single nucleotide polymorphisms (SNP) mining of Sorghum ...

    African Journals Online (AJOL)

    Single nucleotide polymorphisms (SNPs) may be considered the ultimate genetic markers as they represent the finest resolution of a DNA sequence (a single nucleotide), and are generally abundant in populations with a low mutation rate. SNPs are important tools in studying complex genetic traits and genome evolution.

  10. Condensing the information in DNA with double-headed nucleotides

    DEFF Research Database (Denmark)

    Hornum, Mick; Sharma, Pawan K; Reslow-Jacobsen, Charlotte

    2017-01-01

    A normal duplex holds as many Watson-Crick base pairs as the number of nucleotides in its constituent strands. Here we establish that single nucleotides can be designed to functionally imitate dinucleotides without compromising binding affinity. This effectively allows sequence information...

  11. Adenine nucleotide depletion from endothelial cells exposed to xanthine oxidase

    International Nuclear Information System (INIS)

    Aalto, T.K.; Raivio, K.O.

    1990-01-01

    Hypoxia causes breakdown of cellular nucleotides, accumulation of hypoxanthine (HX), and conversion of xanthine dehydrogenase into xanthine oxidase (XO). Upon reoxygenation, the HX-XO reaction generates free radicals, one potential mechanism of tissue damage. Because endothelial cells contain XO and are exposed to circulating HX, they are a likely target for damage. We studied the effect of XO and/or HX at physiologically relevant concentrations on nucleotide metabolism of cultured endothelial cells from human umbilical veins. Cells were labeled with [14C]adenine and incubated for up to 6 h with HX, XO, or both, in the absence or presence of serum. Adenine nucleotides from cell extracts and nucleotide breakdown products (HX, xanthine, and urate) from the medium were separated and counted. HX alone had no effect. XO (80 mU/ml) alone caused a 70% (no serum) or 40% (with serum) fall in adenine nucleotides and an equivalent increase of xanthine and urate. The combination of HX and XO caused a 90% (no serum) or 70% (with serum) decrease in nucleotides, decrease in energy charge, and detachment of cells from the culture plate. Nucleotide depletion was not accounted for by proteolytic activity in the XO preparation. Albumin was only half as effective as serum in preventing nucleotide loss. Thus exogenous XO, in the presence of endogenous HX, triggers adenine nucleotide catabolism, but endogenous XO activity is too low to influence nucleotide levels even at high exogenous HX concentrations. Serum limits the catabolic effect of XO and thus protects cells from free radical damage

  12. Nucleotide excision repair in differentiated cells

    Energy Technology Data Exchange (ETDEWEB)

    Wees, Caroline van der [Department of Toxicogenetics, Leiden University Medical Center, Leiden (Netherlands); Department of Cardiology, Leiden University Medical Center, Leiden (Netherlands); Jansen, Jacob [Department of Toxicogenetics, Leiden University Medical Center, Leiden (Netherlands); Vrieling, Harry [Department of Toxicogenetics, Leiden University Medical Center, Leiden (Netherlands); Laarse, Arnoud van der [Department of Cardiology, Leiden University Medical Center, Leiden (Netherlands); Zeeland, Albert van [Department of Toxicogenetics, Leiden University Medical Center, Leiden (Netherlands); Mullenders, Leon [Department of Toxicogenetics, Leiden University Medical Center, Leiden (Netherlands)]. E-mail: l.mullenders@lumc.nl

    2007-01-03

    Nucleotide excision repair (NER) is the principal pathway for the removal of a wide range of DNA helix-distorting lesions and operates via two NER subpathways, i.e. global genome repair (GGR) and transcription-coupled repair (TCR). Although detailed information is available on expression and efficiency of NER in established mammalian cell lines, little is known about the expression of NER pathways in (terminally) differentiated cells. The majority of studies in differentiated cells have focused on repair of UV-induced cyclobutane pyrimidine dimers (CPD) and 6-4-photoproducts (6-4PP) because of the high frequency of photolesions at low level of toxicity and availability of sensitive technologies to determine photolesions in defined regions of the genome. The picture that emerges from these studies is blurred and rather complex. Fibroblasts and terminally differentiated myocytes of the rat heart display equally efficient GGR of 6-4PP but poor repair of CPD due to the absence of p48 expression. This repair phenotype is clearly different from human terminal differentiated neurons. Furthermore, both cell types were found to carry out TCR of CPD, thus mimicking the repair phenotype of established rodent cell lines. In contrast, in intact rat spermatogenic cells repair was very inefficient at the genome overall level and in transcriptionally active genes indicating that GGR and TCR are non-functional. Also, non-differentiated mouse embryonic stem (ES) cells exhibit low levels of NER after UV irradiation. However, the mechanisms that lead to low NER activity are clearly different: in differentiated spermatogenic cells differences in chromatin compaction and sequestering of NER proteins may underlie the lack of NER activity in pre-meiotic cells, whereas in non-differentiated ES cells NER is impaired by a strong apoptotic response.

  13. Host age modulates within-host parasite competition.

    Science.gov (United States)

    Izhar, Rony; Routtu, Jarkko; Ben-Ami, Frida

    2015-05-01

    In many host populations, one of the most striking differences among hosts is their age. While parasite prevalence differences in relation to host age are well known, little is known on how host age impacts ecological and evolutionary dynamics of diseases. Using two clones of the water flea Daphnia magna and two clones of its bacterial parasite Pasteuria ramosa, we examined how host age at exposure influences within-host parasite competition and virulence. We found that multiply-exposed hosts were more susceptible to infection and suffered higher mortality than singly-exposed hosts. Hosts oldest at exposure were least often infected and vice versa. Furthermore, we found that in young multiply-exposed hosts competition was weak, allowing coexistence and transmission of both parasite clones, whereas in older multiply-exposed hosts competitive exclusion was observed. Thus, age-dependent parasite exposure and host demography (age structure) could together play an important role in mediating parasite evolution. At the individual level, our results demonstrate a previously unnoticed interaction of the host's immune system with host age, suggesting that the specificity of immune function changes as hosts mature. Therefore, evolutionary models of parasite virulence might benefit from incorporating age-dependent epidemiological parameters. © 2015 The Author(s) Published by the Royal Society. All rights reserved.

  14. Nucleotide Excision Repair in Cellular Chromatin: Studies with Yeast from Nucleotide to Gene to Genome

    Directory of Open Access Journals (Sweden)

    Simon Reed

    2012-09-01

    Full Text Available Here we review our development of, and results with, high resolution studies on global genome nucleotide excision repair (GGNER in Saccharomyces cerevisiae. We have focused on how GGNER relates to histone acetylation for its functioning and we have identified the histone acetyl tranferase Gcn5 and acetylation at lysines 9/14 of histone H3 as a major factor in enabling efficient repair. We consider results employing primarily MFA2 as a model gene, but also those with URA3 located at subtelomeric sequences. In the latter case we also see a role for acetylation at histone H4. We then go on to outline the development of a high resolution genome-wide approach that enables one to examine correlations between histone modifications and the nucleotide excision repair (NER of UV-induced cyclobutane pyrimidine dimers throughout entire genomes. This is an approach that will enable rapid advances in understanding the complexities of how compacted chromatin in chromosomes is processed to access DNA damage and then returned to its pre-damaged status to maintain epigenetic codes.

  15. The possible role of human milk nucleotides as sleep inducers.

    Science.gov (United States)

    Sánchez, Cristina L; Cubero, Javier; Sánchez, Javier; Chanclón, Belén; Rivero, Montserrat; Rodríguez, Ana B; Barriga, Carmen

    2009-02-01

    Breast-milk contains a potent mixture of diverse components, such as the non-protein nitrogen fraction which includes nucleotides, whose variation in levels is evident throughout lactation. In addition, these substances play an important role in sleep homeostasis. In the present study, human milk samples were analyzed using a capillary electrophoresis system. The rhythmicity of each nucleotide was studied by cosinor analysis. It was found that the nucleotides 5'AMP, 5'GMP, 5'CMP, and 5'IMP have significant (P inducing the 'hypnotic' action of breast-milk at night in the infant.

  16. Nucleotide sequence of Hungarian grapevine chrome mosaic nepovirus RNA1.

    OpenAIRE

    Le Gall, O; Candresse, T; Brault, V; Dunez, J

    1989-01-01

    The nucleotide sequence of the RNA1 of hungarian grapevine chrome mosaic virus, a nepovirus very closely related to tomato black ring virus, has been determined from cDNA clones. It is 7212 nucleotides in length excluding the 3' terminal poly(A) tail and contains a large open reading frame extending from nucleotides 216 to 6971. The presumably encoded polyprotein is 2252 amino acids in length with a molecular weight of 250 kDa. The primary structure of the polyprotein was compared with that o...

  17. Host phylogeny determines viral persistence and replication in novel hosts.

    Directory of Open Access Journals (Sweden)

    Ben Longdon

    2011-09-01

    Full Text Available Pathogens switching to new hosts can result in the emergence of new infectious diseases, and determining which species are likely to be sources of such host shifts is essential to understanding disease threats to both humans and wildlife. However, the factors that determine whether a pathogen can infect a novel host are poorly understood. We have examined the ability of three host-specific RNA-viruses (Drosophila sigma viruses from the family Rhabdoviridae to persist and replicate in 51 different species of Drosophilidae. Using a novel analytical approach we found that the host phylogeny could explain most of the variation in viral replication and persistence between different host species. This effect is partly driven by viruses reaching a higher titre in those novel hosts most closely related to the original host. However, there is also a strong effect of host phylogeny that is independent of the distance from the original host, with viral titres being similar in groups of related hosts. Most of this effect could be explained by variation in general susceptibility to all three sigma viruses, as there is a strong phylogenetic correlation in the titres of the three viruses. These results suggest that the source of new emerging diseases may often be predictable from the host phylogeny, but that the effect may be more complex than simply causing most host shifts to occur between closely related hosts.

  18. Host Phylogeny Determines Viral Persistence and Replication in Novel Hosts

    Science.gov (United States)

    Longdon, Ben; Hadfield, Jarrod D.; Webster, Claire L.

    2011-01-01

    Pathogens switching to new hosts can result in the emergence of new infectious diseases, and determining which species are likely to be sources of such host shifts is essential to understanding disease threats to both humans and wildlife. However, the factors that determine whether a pathogen can infect a novel host are poorly understood. We have examined the ability of three host-specific RNA-viruses (Drosophila sigma viruses from the family Rhabdoviridae) to persist and replicate in 51 different species of Drosophilidae. Using a novel analytical approach we found that the host phylogeny could explain most of the variation in viral replication and persistence between different host species. This effect is partly driven by viruses reaching a higher titre in those novel hosts most closely related to the original host. However, there is also a strong effect of host phylogeny that is independent of the distance from the original host, with viral titres being similar in groups of related hosts. Most of this effect could be explained by variation in general susceptibility to all three sigma viruses, as there is a strong phylogenetic correlation in the titres of the three viruses. These results suggest that the source of new emerging diseases may often be predictable from the host phylogeny, but that the effect may be more complex than simply causing most host shifts to occur between closely related hosts. PMID:21966271

  19. Classification of pseudo pairs between nucleotide bases and amino acids by analysis of nucleotide-protein complexes.

    Science.gov (United States)

    Kondo, Jiro; Westhof, Eric

    2011-10-01

    Nucleotide bases are recognized by amino acid residues in a variety of DNA/RNA binding and nucleotide binding proteins. In this study, a total of 446 crystal structures of nucleotide-protein complexes are analyzed manually and pseudo pairs together with single and bifurcated hydrogen bonds observed between bases and amino acids are classified and annotated. Only 5 of the 20 usual amino acid residues, Asn, Gln, Asp, Glu and Arg, are able to orient in a coplanar fashion in order to form pseudo pairs with nucleotide bases through two hydrogen bonds. The peptide backbone can also form pseudo pairs with nucleotide bases and presents a strong bias for binding to the adenine base. The Watson-Crick side of the nucleotide bases is the major interaction edge participating in such pseudo pairs. Pseudo pairs between the Watson-Crick edge of guanine and Asp are frequently observed. The Hoogsteen edge of the purine bases is a good discriminatory element in recognition of nucleotide bases by protein side chains through the pseudo pairing: the Hoogsteen edge of adenine is recognized by various amino acids while the Hoogsteen edge of guanine is only recognized by Arg. The sugar edge is rarely recognized by either the side-chain or peptide backbone of amino acid residues.

  20. Computational identification of candidate nucleotide cyclases in higher plants

    KAUST Repository

    Wong, Aloysius Tze; Gehring, Christoph A

    2013-01-01

    In higher plants guanylyl cyclases (GCs) and adenylyl cyclases (ACs) cannot be identified using BLAST homology searches based on annotated cyclic nucleotide cyclases (CNCs) of prokaryotes, lower eukaryotes, or animals. The reason is that CNCs

  1. A single nucleotide polymorphism (SNP) assay for population ...

    African Journals Online (AJOL)

    A single nucleotide polymorphism (SNP) assay for population stratification test ... phenotypes and unlinked candidate loci in case-control and cohort studies of ... Key words: Chinese, Japanese, population stratification, ancestry informative ...

  2. Mitochondrial DNA analysis reveals a low nucleotide diversity of ...

    African Journals Online (AJOL)

    STORAGESEVER

    2009-06-17

    Jun 17, 2009 ... gene sequences of C. japonica in China to assess nucleotide sequence diversity (GenBank ... provide a scientific basis for the regional control of forestry .... population (AB015869) was downloaded from GenBank database.

  3. Extracellular nucleotide derivatives protect cardiomyctes against hypoxic stress

    DEFF Research Database (Denmark)

    Golan, O; Issan, Y; Isak, A

    2011-01-01

    assures cardioprotection. Treatment with extracellular nucleotides, or with tri/di-phosphate, administered under normoxic conditions or during hypoxic conditions, led to a decrease in reactive oxygen species production. CONCLUSIONS: Extracellular tri/di-phosphates are apparently the molecule responsible...

  4. Enzymatic Incorporation of Modified Purine Nucleotides in DNA.

    Science.gov (United States)

    Abu El Asrar, Rania; Margamuljana, Lia; Abramov, Mikhail; Bande, Omprakash; Agnello, Stefano; Jang, Miyeon; Herdewijn, Piet

    2017-12-14

    A series of nucleotide analogues, with a hypoxanthine base moiety (8-aminohypoxanthine, 1-methyl-8-aminohypoxanthine, and 8-oxohypoxanthine), together with 5-methylisocytosine were tested as potential pairing partners of N 8 -glycosylated nucleotides with an 8-azaguanine or 8-aza-9-deazaguanine base moiety by using DNA polymerases (incorporation studies). The best results were obtained with the 5-methylisocytosine nucleotide followed by the 1-methyl-8-aminohypoxanthine nucleotide. The experiments demonstrated that small differences in the structure (8-azaguanine versus 8-aza-9-deazaguanine) might lead to significant differences in recognition efficiency and selectivity, base pairing by Hoogsteen recognition at the polymerase level is possible, 8-aza-9-deazaguanine represents a self-complementary base pair, and a correlation exists between in vitro incorporation studies and in vivo recognition by natural bases in Escherichia coli, but this recognition is not absolute (exceptions were observed). © 2017 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.

  5. Detection of DNA nucleotides on pretreated boron doped diamond electrodes

    Energy Technology Data Exchange (ETDEWEB)

    Garbellini, Gustavo S.; Uliana, Carolina V.; Yamanaka, Hideko [UNESP, Araraquara, SP (Brazil). Inst. de Quimica

    2011-07-01

    The individual detection and equimolar mixture of DNA nucleotides guanosine monophosphate (GMP), adenosine monophosphate (AMP), thymidine (TMP) and cytidine (CMP) 5'-monophosphate using square wave voltammetry was performed on boron doped diamond (BDD) electrodes cathodically (Red-DDB) and anodically (Oxi-DDB) pretreated. The oxidation of individual DNA nucleotides was more sensitive on Oxi-BDD electrode. In a simultaneous detection of nucleotides, the responses of GMP, AMP, TMP and CMP were very adequate on both treated electrodes. Particularly, more sensitive and separate peaks for TMP and CMP on Oxi-BDD and Red-BDD electrodes, respectively, were observed after deconvolution procedure. The detection of nucleotides in aqueous solutions will certainly contribute for genotoxic evaluation of substances and hybridization reactions by immobilizing ss or ds-DNA on BDD surface. (author)

  6. Nucleotide Metabolism and its Control in Lactic Acid Bacteria

    DEFF Research Database (Denmark)

    Kilstrup, Mogens; Hammer, Karin; Jensen, Peter Ruhdal

    2005-01-01

    Most metabolic reactions are connected through either their utilization of nucleotides or their utilization of nucleotides or their regulation by these metabolites. In this review the biosynthetic pathways for pyrimidine and purine metabolism in lactic acid bacteria are described including...... the interconversion pathways, the formation of deoxyribonucleotides and the salvage pathways for use of exogenous precursors. The data for the enzymatic and the genetic regulation of these pathways are reviewed, as well as the gene organizations in different lactic acid bacteria. Mutant phenotypes and methods...... for manipulation of nucleotide pools are also discussed. Our aim is to provide an overview of the physiology and genetics of nucleotide metabolism and its regulation that will facilitate the interpretation of data arising from genetics, metabolomics, proteomics, and transcriptomics in lactic acid bacteria....

  7. Free amino acids and 5'-nucleotides in Finnish forest mushrooms.

    Science.gov (United States)

    Manninen, Hanna; Rotola-Pukkila, Minna; Aisala, Heikki; Hopia, Anu; Laaksonen, Timo

    2018-05-01

    Edible mushrooms are valued because of their umami taste and good nutritional values. Free amino acids, 5'-nucleotides and nucleosides were analyzed from four Nordic forest mushroom species (Lactarius camphoratus, Boletus edulis, Cantharellus cibarius, Craterellus tubaeformis) using high precision liquid chromatography analysis. To our knowledge, these taste components were studied for the first time from Craterellus tubaeformis and Lactarius camphoratus. The focus was on the umami amino acids and 5'-nucleotides. The free amino acid and 5'-nucleotide/nucleoside contents of studied species differed from each other. In all studied samples, umami amino acids were among five major free amino acids. The highest concentration of umami amino acids was on L. camphoratus whereas B. edulis had the highest content of sweet amino acids and C. cibarius had the highest content of bitter amino acids. The content of umami enhancing 5'-nucleotides were low in all studied species. Copyright © 2017 Elsevier Ltd. All rights reserved.

  8. Structural basis for solute transport, nucleotide regulation, and immunological recognition of Neisseria meningitidis PorB

    Energy Technology Data Exchange (ETDEWEB)

    Tanabe, Mikio; Nimigean, Crina M.; Iverson, T.M. (Weill-Med); (Vanderbilt)

    2010-06-25

    PorB is the second most prevalent outer membrane protein in Neisseria meningitidis. PorB is required for neisserial pathogenesis and can elicit a Toll-like receptor mediated host immune response. Here, the x-ray crystal structure of PorB has been determined to 2.3 {angstrom} resolution. Structural analysis and cocrystallization studies identify three putative solute translocation pathways through the channel pore: One pathway transports anions nonselectively, one transports cations nonselectively, and one facilitates the specific uptake of sugars. During infection, PorB likely binds host mitochondrial ATP, and cocrystallization with the ATP analog AMP-PNP suggests that binding of nucleotides regulates these translocation pathways both by partial occlusion of the pore and by restricting the motion of a putative voltage gating loop. PorB is located on the surface of N. meningitidis and can be recognized by receptors of the host innate immune system. Features of PorB suggest that Toll-like receptor mediated recognition outer membrane proteins may be initiated with a nonspecific electrostatic attraction.

  9. Comparison of the nucleotide sequence of wild-type hepatitis - A virus and its attenuated candidate vaccine derivative

    International Nuclear Information System (INIS)

    Cohen, J.I.; Rosenblum, B.; Ticehurst, J.R.; Daemer, R.; Feinstone, S.; Purcell, R.H.

    1987-01-01

    Development of attenuated mutants for use as vaccines is in progress for other viruses, including influenza, rotavirus, varicella-zoster, cytomegalovirus, and hepatitis-A virus (HAV). Attenuated viruses may be derived from naturally occurring mutants that infect human or nonhuman hosts. Alternatively, attenuated mutants may be generated by passage of wild-type virus in cell culture. Production of attenuated viruses in cell culture is a laborious and empiric process. Despite previous empiric successes, understanding the molecular basis for attenuation of vaccine viruses could facilitate future development and use of live-virus vaccines. Comparison of the complete nucleotide sequences of wild-type (virulent) and vaccine (attenuated) viruses has been reported for polioviruses and yellow fever virus. Here, the authors compare the nucleotide sequence of wild-type HAV HM-175 with that of a candidate vaccine derivative

  10. Statistical properties and fractals of nucleotide clusters in DNA sequences

    International Nuclear Information System (INIS)

    Sun Tingting; Zhang Linxi; Chen Jin; Jiang Zhouting

    2004-01-01

    Statistical properties of nucleotide clusters in DNA sequences and their fractals are investigated in this paper. The average size of nucleotide clusters in non-coding sequence is larger than that in coding sequence. We investigate the cluster-size distribution P(S) for human chromosomes 21 and 22, and the results are different from previous works. The cluster-size distribution P(S 1 +S 2 ) with the total size of sequential Pu-cluster and Py-cluster S 1 +S 2 is studied. We observe that P(S 1 +S 2 ) follows an exponential decay both in coding and non-coding sequences. However, we get different results for human chromosomes 21 and 22. The probability distribution P(S 1 ,S 2 ) of nucleotide clusters with the size of sequential Pu-cluster and Py-cluster S 1 and S 2 respectively, is also examined. In the meantime, some of the linear correlations are obtained in the double logarithmic plots of the fluctuation F(l) versus nucleotide cluster distance l along the DNA chain. The power spectrums of nucleotide clusters are also discussed, and it is concluded that the curves are flat and hardly changed and the 1/3 frequency is neither observed in coding sequence nor in non-coding sequence. These investigations can provide some insights into the nucleotide clusters of DNA sequences

  11. Fatty acid-producing hosts

    Science.gov (United States)

    Pfleger, Brian F; Lennen, Rebecca M

    2013-12-31

    Described are hosts for overproducing a fatty acid product such as a fatty acid. The hosts include an exogenous nucleic acid encoding a thioesterase and, optionally, an exogenous nucleic acid encoding an acetyl-CoA carboxylase, wherein an acyl-CoA synthetase in the hosts are functionally delected. The hosts prefereably include the nucleic acid encoding the thioesterase at an intermediate copy number. The hosts are preferably recominantly stable and growth-competent at 37.degree. C. Methods of producing a fatty acid product comprising culturing such hosts at 37.degree. C. are also described.

  12. Analysis of nucleotide sequence variations in herpes simplex virus types 1 and 2, and varicella-zoster virus

    International Nuclear Information System (INIS)

    Chiba, A.; Suzutani, T.; Koyano, S.; Azuma, M.; Saijo, M.

    1998-01-01

    To analyze the difference in the degree of divergence between genes from identical herpes virus species, we examined the nucleotide sequence of genes from the herpes simplex virus type 1 (HSV-l ) strains VR-3 and 17 encoding thymidine kinase (TK), deoxyribonuclease (DNase), protein kinase (PK; UL13) and virion-associated host shut off (vhs) protein (UL41). The frequency of nucleotide substitutions per 1 kb in TK gene was 2.5 to 4.3 times higher than those in the other three genes. To prove that the polymorphism of HSV-1 TK gene is common characteristic of herpes virus TK genes, we compared the diversity of TK genes among eight HSV-l , six herpes simplex virus type 2 (HSV-2) and seven varicella-zoster virus (VZV) strains. The average frequency of nucleotide substitutions per 1 kb in the TK gene of HSV-l strains was 4-fold higher than that in the TK gene of HSV-2 strains. The VZV TK gene was highly conserved and only two nucleotide changes were evident in VZV strains. However, the rate of non-synonymous substitutions in total nucleotide substitutions was similar among the TK genes of the three viruses. This result indicated that the mutational rates differed, but there were no significant differences in selective pressure. We conclude that HSV-l TK gene is highly diverged and analysis of variations in the gene is a useful approach for understanding the molecular evolution of HSV-l in a short period. (authors)

  13. Guidelines for Hosted Payload Integration

    Science.gov (United States)

    2014-06-06

    reduces risk. Need to consider mass simulator to protect host launch window. Average Payload Power Both BOL and EOL . Host must consider orbit...acceptance testing. Peak Payload Power Both BOL and EOL . Host must consider orbit constraints. Typically driven by Payload operations but must...post-retirement failure might cause damage to the Spacecraft Host or its payloads. Safe conditions at EOL should consider thermal and radiation

  14. HostPhinder: A Phage Host Prediction Tool

    Directory of Open Access Journals (Sweden)

    Julia Villarroel

    2016-05-01

    Full Text Available The current dramatic increase of antibiotic resistant bacteria has revitalised the interest in bacteriophages as alternative antibacterial treatment. Meanwhile, the development of bioinformatics methods for analysing genomic data places high-throughput approaches for phage characterization within reach. Here, we present HostPhinder, a tool aimed at predicting the bacterial host of phages by examining the phage genome sequence. Using a reference database of 2196 phages with known hosts, HostPhinder predicts the host species of a query phage as the host of the most genomically similar reference phages. As a measure of genomic similarity the number of co-occurring k-mers (DNA sequences of length k is used. Using an independent evaluation set, HostPhinder was able to correctly predict host genus and species for 81% and 74% of the phages respectively, giving predictions for more phages than BLAST and significantly outperforming BLAST on phages for which both had predictions. HostPhinder predictions on phage draft genomes from the INTESTI phage cocktail corresponded well with the advertised targets of the cocktail. Our study indicates that for most phages genomic similarity correlates well with related bacterial hosts. HostPhinder is available as an interactive web service [1] and as a stand alone download from the Docker registry [2].

  15. The Drosophila melanogaster host model

    Science.gov (United States)

    Igboin, Christina O.; Griffen, Ann L.; Leys, Eugene J.

    2012-01-01

    The deleterious and sometimes fatal outcomes of bacterial infectious diseases are the net result of the interactions between the pathogen and the host, and the genetically tractable fruit fly, Drosophila melanogaster, has emerged as a valuable tool for modeling the pathogen–host interactions of a wide variety of bacteria. These studies have revealed that there is a remarkable conservation of bacterial pathogenesis and host defence mechanisms between higher host organisms and Drosophila. This review presents an in-depth discussion of the Drosophila immune response, the Drosophila killing model, and the use of the model to examine bacterial–host interactions. The recent introduction of the Drosophila model into the oral microbiology field is discussed, specifically the use of the model to examine Porphyromonas gingivalis–host interactions, and finally the potential uses of this powerful model system to further elucidate oral bacterial-host interactions are addressed. PMID:22368770

  16. The Drosophila melanogaster host model

    Directory of Open Access Journals (Sweden)

    Christina O. Igboin

    2012-02-01

    Full Text Available The deleterious and sometimes fatal outcomes of bacterial infectious diseases are the net result of the interactions between the pathogen and the host, and the genetically tractable fruit fly, Drosophila melanogaster, has emerged as a valuable tool for modeling the pathogen–host interactions of a wide variety of bacteria. These studies have revealed that there is a remarkable conservation of bacterial pathogenesis and host defence mechanisms between higher host organisms and Drosophila. This review presents an in-depth discussion of the Drosophila immune response, the Drosophila killing model, and the use of the model to examine bacterial–host interactions. The recent introduction of the Drosophila model into the oral microbiology field is discussed, specifically the use of the model to examine Porphyromonas gingivalis–host interactions, and finally the potential uses of this powerful model system to further elucidate oral bacterial-host interactions are addressed.

  17. The Drosophila melanogaster host model.

    Science.gov (United States)

    Igboin, Christina O; Griffen, Ann L; Leys, Eugene J

    2012-01-01

    The deleterious and sometimes fatal outcomes of bacterial infectious diseases are the net result of the interactions between the pathogen and the host, and the genetically tractable fruit fly, Drosophila melanogaster, has emerged as a valuable tool for modeling the pathogen-host interactions of a wide variety of bacteria. These studies have revealed that there is a remarkable conservation of bacterial pathogenesis and host defence mechanisms between higher host organisms and Drosophila. This review presents an in-depth discussion of the Drosophila immune response, the Drosophila killing model, and the use of the model to examine bacterial-host interactions. The recent introduction of the Drosophila model into the oral microbiology field is discussed, specifically the use of the model to examine Porphyromonas gingivalis-host interactions, and finally the potential uses of this powerful model system to further elucidate oral bacterial-host interactions are addressed.

  18. Host genetics affect microbial ecosystems via host immunity.

    Science.gov (United States)

    El Kafsi, Hela; Gorochov, Guy; Larsen, Martin

    2016-10-01

    Genetic evolution of multicellular organisms has occurred in response to environmental challenges, including competition for nutrients, climate change, physical and chemical stressors, and pathogens. However, fitness of an organism is dependent not only on defense efficacy, but also on the ability to take advantage of symbiotic organisms. Indeed, microbes not only encompass pathogenicity, but also enable efficient nutrient uptake from diets nondegradable by the host itself. Moreover, microbes play important roles in the development of host immunity. Here we review associations between specific host genes and variance in microbiota composition and compare with interactions between microbes and host immunity. Recent genome-wide association studies reveal that symbiosis between host and microbiota is the exquisite result of genetic coevolution. Moreover, a subset of microbes from human and mouse microbiota have been identified to interact with humoral and cellular immunity. Interestingly, microbes associated with both host genetics and host immunity are taxonomically related. Most involved are Bifidobacterium, Lactobacillus, and Akkermansia, which are dually associated with both host immunity and host genetics. We conclude that future therapeutics targeting microbiota in the context of chronic inflammatory diseases need to consider both immune and genetic host features associated with microbiota homeostasis.

  19. Nucleotide sequence of Hungarian grapevine chrome mosaic nepovirus RNA1.

    Science.gov (United States)

    Le Gall, O; Candresse, T; Brault, V; Dunez, J

    1989-10-11

    The nucleotide sequence of the RNA1 of hungarian grapevine chrome mosaic virus, a nepovirus very closely related to tomato black ring virus, has been determined from cDNA clones. It is 7212 nucleotides in length excluding the 3' terminal poly(A) tail and contains a large open reading frame extending from nucleotides 216 to 6971. The presumably encoded polyprotein is 2252 amino acids in length with a molecular weight of 250 kDa. The primary structure of the polyprotein was compared with that of other viral polyproteins, revealing the same general genetic organization as that of other picorna-like viruses (comoviruses, potyviruses and picornaviruses), except that an additional protein is suspected to occupy the N-terminus of the polyprotein.

  20. DNA Nucleotide Sequence Restricted by the RI Endonuclease

    Science.gov (United States)

    Hedgpeth, Joe; Goodman, Howard M.; Boyer, Herbert W.

    1972-01-01

    The sequence of DNA base pairs adjacent to the phosphodiester bonds cleaved by the RI restriction endonuclease in unmodified DNA from coliphage λ has been determined. The 5′-terminal nucleotide labeled with 32P and oligonucleotides up to the heptamer were analyzed from a pancreatic DNase digest. The following sequence of nucleotides adjacent to the RI break made in λ DNA was deduced from these data and from the 3′-dinucleotide sequence and nearest-neighbor analysis obtained from repair synthesis with the DNA polymerase of Rous sarcoma virus [Formula: see text] The RI endonuclease cleavage of the phosphodiester bonds (indicated by arrows) generates 5′-phosphoryls and short cohesive termini of four nucleotides, pApApTpT. The most striking feature of the sequence is its symmetry. PMID:4343974

  1. Dinucleotide Composition in Animal RNA Viruses Is Shaped More by Virus Family than by Host Species.

    Science.gov (United States)

    Di Giallonardo, Francesca; Schlub, Timothy E; Shi, Mang; Holmes, Edward C

    2017-04-15

    Viruses use the cellular machinery of their hosts for replication. It has therefore been proposed that the nucleotide and dinucleotide compositions of viruses should match those of their host species. If this is upheld, it may then be possible to use dinucleotide composition to predict the true host species of viruses sampled in metagenomic surveys. However, it is also clear that different taxonomic groups of viruses tend to have distinctive patterns of dinucleotide composition that may be independent of host species. To determine the relative strength of the effect of host versus virus family in shaping dinucleotide composition, we performed a comparative analysis of 20 RNA virus families from 15 host groupings, spanning two animal phyla and more than 900 virus species. In particular, we determined the odds ratios for the 16 possible dinucleotides and performed a discriminant analysis to evaluate the capability of virus dinucleotide composition to predict the correct virus family or host taxon from which it was isolated. Notably, while 81% of the data analyzed here were predicted to the correct virus family, only 62% of these data were predicted to their correct subphylum/class host and a mere 32% to their correct mammalian order. Similarly, dinucleotide composition has a weak predictive power for different hosts within individual virus families. We therefore conclude that dinucleotide composition is generally uniform within a virus family but less well reflects that of its host species. This has obvious implications for attempts to accurately predict host species from virus genome sequences alone. IMPORTANCE Determining the processes that shape virus genomes is central to understanding virus evolution and emergence. One question of particular importance is why nucleotide and dinucleotide frequencies differ so markedly between viruses. In particular, it is currently unclear whether host species or virus family has the biggest impact on dinucleotide frequencies and

  2. Tye7 regulates yeast Ty1 retrotransposon sense and antisense transcription in response to adenylic nucleotides stress.

    Science.gov (United States)

    Servant, Géraldine; Pinson, Benoit; Tchalikian-Cosson, Aurélie; Coulpier, Fanny; Lemoine, Sophie; Pennetier, Carole; Bridier-Nahmias, Antoine; Todeschini, Anne Laure; Fayol, Hélène; Daignan-Fornier, Bertrand; Lesage, Pascale

    2012-07-01

    Transposable elements play a fundamental role in genome evolution. It is proposed that their mobility, activated under stress, induces mutations that could confer advantages to the host organism. Transcription of the Ty1 LTR-retrotransposon of Saccharomyces cerevisiae is activated in response to a severe deficiency in adenylic nucleotides. Here, we show that Ty2 and Ty3 are also stimulated under these stress conditions, revealing the simultaneous activation of three active Ty retrotransposon families. We demonstrate that Ty1 activation in response to adenylic nucleotide depletion requires the DNA-binding transcription factor Tye7. Ty1 is transcribed in both sense and antisense directions. We identify three Tye7 potential binding sites in the region of Ty1 DNA sequence where antisense transcription starts. We show that Tye7 binds to Ty1 DNA and regulates Ty1 antisense transcription. Altogether, our data suggest that, in response to adenylic nucleotide reduction, TYE7 is induced and activates Ty1 mRNA transcription, possibly by controlling Ty1 antisense transcription. We also provide the first evidence that Ty1 antisense transcription can be regulated by environmental stress conditions, pointing to a new level of control of Ty1 activity by stress, as Ty1 antisense RNAs play an important role in regulating Ty1 mobility at both the transcriptional and post-transcriptional stages.

  3. Coevolution of a Persistent Plant Virus and Its Pepper Hosts.

    Science.gov (United States)

    Safari, Maliheh; Roossinck, Marilyn J

    2018-05-30

    There are many nonpathogenic viruses that are maintained in a persistent lifestyle in plants. Plant persistent viruses are widespread, replicating in their hosts for many generations. So far, Endornaviridae is the only family of plant persistent viruses with a single-stranded RNA genome, containing one large open reading frame. Bell pepper endornavirus (BPEV), Hot pepper endornavirus, Capsicum frutescens endornavirus 1 (CFEV 1) have been identified from peppers. Peppers are native to Central and South America and, as domesticated plants, human selection accelerated their evolution. We investigated the evolution of these endornaviruses in different peppers including Capsicum annuum, C. chacoense, C.chinense, C. frutescens, C.bacccutum, and C. pubescens using two fragments from the viral helicase (Hel) and RNA dependent RNA polymerase (RdRp) domains. In addition, using single nucleotide polymorphisms, we analyzed the pepper host populations and phylogenies. The endornaviruses phylogeny was correlated with its Capsicum species host. In this study, BPEV was limited to C. annuum species, and the RdRp and Hel phylogenies identified two clades that correlated with the host pungency. No C. annuum infected with CFEV 1 was found in this study, but the CFEV 1 RdRp fragment was recovered from C. chinense, C. frutescens, C. bacccutum, and C. pubescens. Hence, during pepper speciation, the ancestor of CFEV 1 may have evolved as a new endornavirus, BPEV, in C. annuum peppers.

  4. Development of a single nucleotide polymorphism (SNP) marker for ...

    African Journals Online (AJOL)

    The nature of the single nucleotide polymorphism (SNP) marker was validated by DNA sequencing of the parental PCR products. Using high resolution melt (HRM) profiles and normalised difference plots, we successfully differentiated the homozygous dominant (wild type), homozygous recessive (LPA) and heterozygous ...

  5. Four new single nucleotide polymorphisms (SNPs) of toll-like ...

    African Journals Online (AJOL)

    In order to reveal the single nucleotide polymorphisms (SNPs), genotypes and allelic frequencies of each mutation site of TLR7 gene in Chinese native duck breeds, SNPs of duck TLR7 gene were detected by DNA sequencing. The genotypes of 465 native ducks from eight key protected duck breeds were determined by ...

  6. Detection of new single nucleotide polymorphisms by means of real ...

    Indian Academy of Sciences (India)

    Unknown

    amplified millions to billions of times by means of a PCR before the PCR product ... Keywords. Single nucleotide polymorphism; real time PCR; DNA melting curve analysis. ... VAL158MET SNP and alcoholism and to test for interac- tions between the .... indicate a heterozygote sample (VAL/MET genotype). The curve with ...

  7. Involvement of cyclic nucleotides in locust flight muscle metabolism

    NARCIS (Netherlands)

    Worm, R.A.A.

    1980-01-01

    1. Flight had no significant effect on the levels of c-AMP of c-GMP in the flight muscles of Locusta migratoria. 2. Injections of 0.01 or 0.1 corpus cardiacum equivalents into the abdominal cavity did not elicit any effect on cyclic nucleotide levels either. 3. Injection of A23187 resulted in

  8. Analysis of single nucleotide polymorphisms in case-control studies.

    Science.gov (United States)

    Li, Yonghong; Shiffman, Dov; Oberbauer, Rainer

    2011-01-01

    Single nucleotide polymorphisms (SNPs) are the most common type of genetic variants in the human genome. SNPs are known to modify susceptibility to complex diseases. We describe and discuss methods used to identify SNPs associated with disease in case-control studies. An outline on study population selection, sample collection and genotyping platforms is presented, complemented by SNP selection, data preprocessing and analysis.

  9. Subpicosecond Dynamics in Nucleotides Measured by Spontaneous Raman Spectroscopy

    NARCIS (Netherlands)

    Terpstra, P.A.; Terpstra, P.A.; Otto, Cornelis; Greve, Jan

    1997-01-01

    The band widths in Raman spectra are sensitive to dynamics active on a time scale from 0.1 to 10 ps. The band widths of nucleotide vibrations and their dependence on temperature, concentration, and structure are reported. From the experimental band widths and second moments, it is derived that the

  10. Nucleotide excision repair II: From yeast to mammals

    NARCIS (Netherlands)

    J.H.J. Hoeijmakers (Jan)

    1993-01-01

    textabstractAn intricate network of repair systems safeguards the integrity of genetic material, by eliminating DNA lesions induced by numerous environmental and endogenous genotoxic agents. Nucleotide excision repair (NER) is one of the most versatile DNA repair systems. Deficiencies in this

  11. Nucleotide excision repair I: from E.coli to yeast.

    NARCIS (Netherlands)

    J.H.J. Hoeijmakers (Jan)

    1993-01-01

    textabstractGenetic information is constantly deteriorating, mainly as a consequence of the action of numerous genotoxic agents. In order to cope with this fundamental problem, all living organisms have acquired a complex network of DNA repair systems to safeguard their genetic integrity. Nucleotide

  12. Characterization of single nucleotide polymorphism markers for eelgrass (Zostera marina)

    NARCIS (Netherlands)

    Ferber, Steven; Reusch, Thorsten B. H.; Stam, Wytze T.; Olsen, Jeanine L.

    We characterized 37 single nucleotide polymorphism (SNP) makers for eelgrass Zostera marina. SNP markers were developed using existing EST (expressed sequence tag)-libraries to locate polymorphic loci and develop primers from the functional expressed genes that are deposited in The ZOSTERA database

  13. DNA Nucleotides Detection via capacitance properties of Graphene

    Science.gov (United States)

    Khadempar, Nahid; Berahman, Masoud; Yazdanpanah, Arash

    2016-05-01

    In the present paper a new method is suggested to detect the DNA nucleotides on a first-principles calculation of the electronic features of DNA bases which chemisorbed to a graphene sheet placed between two gold electrodes in a contact-channel-contact system. The capacitance properties of graphene in the channel are surveyed using non-equilibrium Green's function coupled with the Density Functional Theory. Thus, the capacitance properties of graphene are theoretically investigated in a biological environment, and, using a novel method, the effect of the chemisorbed DNA nucleotides on electrical charges on the surface of graphene is deciphered. Several parameters in this method are also extracted including Electrostatic energy, Induced density, induced electrostatic potential, Electron difference potential and Electron difference density. The qualitative and quantitative differences among these parameters can be used to identify DNA nucleotides. Some of the advantages of this approach include its ease and high accuracy. What distinguishes the current research is that it is the first experiment to investigate the capacitance properties of gaphene changes in the biological environment and the effect of chemisorbed DNA nucleotides on the surface of graphene on the charge.

  14. Effects of Dietary Nucleotides on Growth Rate and Disease ...

    African Journals Online (AJOL)

    Effects of dietary nucleotides on growth and disease resistance of crustaceans were evaluated using axenic Artemia culture tests. Higher Artemia growth in xenic culture (15.6 ± 2.9 mm) than in axenic culture (9.2 ± 1.9 mm) reaffirmed the need to eliminate microbial populations known to influence growth and disease ...

  15. Adiponectin Single Nucleotide Polymorphism (+276G/T) and Its ...

    African Journals Online (AJOL)

    The present study was investigating the association between the single nucleotide polymorphism +276 G/T of the adiponectin gene with serum adiponectin level in patients with coronary artery disease (CAD). In this study 100 healthy controls and 100 Egyptian patients with coronary artery disease of both genders ...

  16. The nucleotide sequences of two leghemoglobin genes from soybean

    DEFF Research Database (Denmark)

    Wiborg, O; Hyldig-Nielsen, J J; Jensen, E O

    1982-01-01

    We present the complete nucleotide sequences of two leghemoglobin genes isolated from soybean DNA. Both genes contain three intervening sequences in identical positions. Comparison of the coding sequences with known amino-acid sequences of soybean leghemoglobins suggest that the two genes...

  17. Single nucleotide polymorphisms in the 5'-flanking region of the ...

    African Journals Online (AJOL)

    Prolactin (PRL), a polypeptide hormone synthesized and secreted by the animal's anterior pituitary gland, plays an important role in the regulation of mammalian lactation and avian reproduction. Considering the significant association between single nucleotide polymorphisms (SNPs) in the 5'-flanking region of PRL and ...

  18. Effects of Dietary Nucleotides on Growth Rate and Disease ...

    African Journals Online (AJOL)

    Nucleotides are low molecular weight biological compounds, which are ... nutrition and disease aspects of crustaceans (Overton and Bland 1981 .... additives on growth and disease resistance. Effects of ... metabolically active cells during stressful conditions ... in humans supplemented with Uracyl, which resulted in optimal ...

  19. Molecular identification of Trichuris vulpis and Trichuris suis isolated from different hosts.

    Science.gov (United States)

    Cutillas, Cristina; de Rojas, Manuel; Ariza, Concepción; Ubeda, José Manuel; Guevara, Diego

    2007-01-01

    Trichuris suis was isolated from the cecum of two different hosts (Sus scrofa domestica -- swine and Sus scrofa scrofa -- wild boar) and Trichuris vulpis from dogs in Sevilla, Spain. Genomic DNA was isolated and internal transcribed spacers (ITS)1-5.8S-ITS2 segment from the ribosomal DNA (rDNA) was amplified and sequenced using polymerase chain reaction techniques. The sequence of T. suis from both hosts was 1,396 bp in length while that of T. vulpis was 1,044 bp. ITS1 of both populations isolated of T. suis was 661 nucleotides in length, while the ITS2 was 534 nucleotides in length. Furthermore, the ITS1 of T. vulpis was 410 nucleotides in length, while the ITS2 was 433 nucleotides in length. One hundred fifty-four nucleotides were observed along the 5.8S gene of T. suis and T. vulpis. Intraindividual and intraspecific variations were detected in the rDNA of both species. The presence of microsatellites was observed in all the individuals assayed. Sequence analysis of the ITSs and the 5.8S gene has demonstrated no sequence differences between T. suis isolated from both hosts (S. scrofa domestica -- swine and S. scrofa scrofa -- wild boar). Nevertheless, clear differences were detected between the ITS1 and ITS2 of T. suis and T. vulpis. Furthermore, a comparative molecular analysis between both species and the previously published ITS1-5.8S-ITS2 sequence data of Trichuris ovis, Trichuris leporis, Trichuris muris, Trichuris arvicolae, and Trichuris skrjabini was carried out. A common homology zone was detected in the ITS1 sequence of all species of trichurids.

  20. Host Factors in Ebola Infection.

    Science.gov (United States)

    Rasmussen, Angela L

    2016-08-31

    Ebola virus (EBOV) emerged in West Africa in 2014 to devastating effect, and demonstrated that infection can cause a broad range of severe disease manifestations. As the virus itself was genetically similar to other Zaire ebolaviruses, the spectrum of pathology likely resulted from variable responses to infection in a large and genetically diverse population. This review comprehensively summarizes current knowledge of the host response to EBOV infection, including pathways hijacked by the virus to facilitate replication, host processes that contribute directly to pathogenesis, and host-pathogen interactions involved in subverting or antagonizing host antiviral immunity.

  1. HostPhinder: A Phage Host Prediction Tool

    DEFF Research Database (Denmark)

    Villarroel, Julia; Kleinheinz, Kortine Annina; Jurtz, Vanessa Isabell

    2016-01-01

    The current dramatic increase of antibiotic resistant bacteria has revitalised the interest in bacteriophages as alternative antibacterial treatment. Meanwhile, the development of bioinformatics methods for analysing genomic data places high-throughput approaches for phage characterization within...... bacterial hosts. HostPhinder is available as an interactive web service [1] and as a stand alone download from the Docker registry [2]....

  2. Phenolic Amides Are Potent Inhibitors of De Novo Nucleotide Biosynthesis.

    Science.gov (United States)

    Pisithkul, Tippapha; Jacobson, Tyler B; O'Brien, Thomas J; Stevenson, David M; Amador-Noguez, Daniel

    2015-09-01

    An outstanding challenge toward efficient production of biofuels and value-added chemicals from plant biomass is the impact that lignocellulose-derived inhibitors have on microbial fermentations. Elucidating the mechanisms that underlie their toxicity is critical for developing strategies to overcome them. Here, using Escherichia coli as a model system, we investigated the metabolic effects and toxicity mechanisms of feruloyl amide and coumaroyl amide, the predominant phenolic compounds in ammonia-pretreated biomass hydrolysates. Using metabolomics, isotope tracers, and biochemical assays, we showed that these two phenolic amides act as potent and fast-acting inhibitors of purine and pyrimidine biosynthetic pathways. Feruloyl or coumaroyl amide exposure leads to (i) a rapid buildup of 5-phosphoribosyl-1-pyrophosphate (PRPP), a key precursor in nucleotide biosynthesis, (ii) a rapid decrease in the levels of pyrimidine biosynthetic intermediates, and (iii) a long-term generalized decrease in nucleotide and deoxynucleotide levels. Tracer experiments using (13)C-labeled sugars and [(15)N]ammonia demonstrated that carbon and nitrogen fluxes into nucleotides and deoxynucleotides are inhibited by these phenolic amides. We found that these effects are mediated via direct inhibition of glutamine amidotransferases that participate in nucleotide biosynthetic pathways. In particular, feruloyl amide is a competitive inhibitor of glutamine PRPP amidotransferase (PurF), which catalyzes the first committed step in de novo purine biosynthesis. Finally, external nucleoside supplementation prevents phenolic amide-mediated growth inhibition by allowing nucleotide biosynthesis via salvage pathways. The results presented here will help in the development of strategies to overcome toxicity of phenolic compounds and facilitate engineering of more efficient microbial producers of biofuels and chemicals. Copyright © 2015, Pisithkul et al.

  3. Phenolic Amides Are Potent Inhibitors of De Novo Nucleotide Biosynthesis

    Science.gov (United States)

    Pisithkul, Tippapha; Jacobson, Tyler B.; O'Brien, Thomas J.; Stevenson, David M.

    2015-01-01

    An outstanding challenge toward efficient production of biofuels and value-added chemicals from plant biomass is the impact that lignocellulose-derived inhibitors have on microbial fermentations. Elucidating the mechanisms that underlie their toxicity is critical for developing strategies to overcome them. Here, using Escherichia coli as a model system, we investigated the metabolic effects and toxicity mechanisms of feruloyl amide and coumaroyl amide, the predominant phenolic compounds in ammonia-pretreated biomass hydrolysates. Using metabolomics, isotope tracers, and biochemical assays, we showed that these two phenolic amides act as potent and fast-acting inhibitors of purine and pyrimidine biosynthetic pathways. Feruloyl or coumaroyl amide exposure leads to (i) a rapid buildup of 5-phosphoribosyl-1-pyrophosphate (PRPP), a key precursor in nucleotide biosynthesis, (ii) a rapid decrease in the levels of pyrimidine biosynthetic intermediates, and (iii) a long-term generalized decrease in nucleotide and deoxynucleotide levels. Tracer experiments using 13C-labeled sugars and [15N]ammonia demonstrated that carbon and nitrogen fluxes into nucleotides and deoxynucleotides are inhibited by these phenolic amides. We found that these effects are mediated via direct inhibition of glutamine amidotransferases that participate in nucleotide biosynthetic pathways. In particular, feruloyl amide is a competitive inhibitor of glutamine PRPP amidotransferase (PurF), which catalyzes the first committed step in de novo purine biosynthesis. Finally, external nucleoside supplementation prevents phenolic amide-mediated growth inhibition by allowing nucleotide biosynthesis via salvage pathways. The results presented here will help in the development of strategies to overcome toxicity of phenolic compounds and facilitate engineering of more efficient microbial producers of biofuels and chemicals. PMID:26070680

  4. HOST liner cyclic facilities

    Science.gov (United States)

    Schultz, D.

    1983-01-01

    The HOST Liner Cyclic Program is utilizing two types of test apparatus, rectangular box rigs and a full annular rig. To date two quartz lamp cyclic box rigs have been tested and a third is to begin testing in late October 1983. The box rigs are used to evaluate 5x8 inch rectangular linear samples. A 21 inch diameter outer liner simulator is also being built up for testing beginning in April 1984. All rigs are atmospheric rigs. The first box rig, a three 6-kVA lamp installation, was operated under adverse conditions to determine feasibility of using quartz lamps for cyclic testing. This work was done in December 1981 and looked promising. The second box rig, again using three 6-kVA lamps, was operated to obtain instrumentation durability information and initial data input to a Finite Element Model. This limited test program was conducted in August 1983. Five test plates were run. Instrumentation consisted of strain gages, thermocouples and thermal paint. The strain gages were found to fail at 1200 F as expected though plates were heated to 1700 F. The third box rig, containing four 6-kVA lamps, is in build up for testing to begin in late October 1983. In addition to 33 percent greater power input, this rig has provision for 400 F backside line cooling air and a viewing port suitable for IR camera viewing. The casing is also water cooled for extended durability.

  5. [Tuberculosis in compromised hosts].

    Science.gov (United States)

    2003-11-01

    Recent development of tuberculosis in Japan tends to converge on a specific high risk group. The proportion of tuberculosis developing particularly from the compromised hosts in the high risk group is especially high. At this symposium, therefore, we took up diabetes mellitus, gastrectomy, dialysis, AIDS and the elderly for discussion. Many new findings and useful reports for practical medical treatment are submitted; why these compromised hosts are predisposed to tuberculosis, tuberculosis diagnostic and remedial notes of those compromised hosts etc. It is an important question for the future to study how to prevent tuberculosis from these compromised hosts. 1. Tuberculosis in diabetes mellitus: aggravation and its immunological mechanism: Kazuyoshi KAWAKAMI (Department of Internal Medicine, Division of Infectious Diseases, Graduate School and Faculty of Medicine, University of the Ryukyus). It has been well documented that diabetes mellitus (DM) is a major aggravating factor in tuberculosis. The onset of this disease is more frequent in DM patients than in individuals with any underlying diseases. However, the precise mechanism of this finding remains to be fully understood. Earlier studies reported that the migration, phagocytosis and bactericidal activity of neutrophils are all impaired in DM patients, which is related to their reduced host defense to infection with extracellular bacteria, such as S. aureus and E. colli. Host defense to mycobacterial infection is largely mediated by cellular immunity, and Th1-related cytokines, such as IFN-gamma and IL-12, play a central role in this response. It is reported that serum level of these cytokines and their production by peripheral blood mononuclear cells (PBMC) are reduced in tuberculosis patients with DM, and this is supposed to be involved in the high incidence of tuberculosis in DM. Our study observed similar findings and furthermore indicated that IFN-gamma and IL-12 production by BCG-stimulated PBMC was lower

  6. Host factors in nidovirus replication

    NARCIS (Netherlands)

    Wilde, Adriaan Hugo de

    2013-01-01

    The interplay between nidoviruses and the infected host cell was investigated. Arterivirus RNA-synthesising activity was shown to depend on intact membranes and on a cytosolic host protein which does not cosediment with the RTC. Furthermore, the immunosuppressant drug cyclosporin A (CsA) blocks

  7. Larval helminths in intermediate hosts

    DEFF Research Database (Denmark)

    Fredensborg, Brian Lund; Poulin, R

    2005-01-01

    Density-dependent effects on parasite fitness have been documented from adult helminths in their definitive hosts. There have, however, been no studies on the cost of sharing an intermediate host with other parasites in terms of reduced adult parasite fecundity. Even if larval parasites suffer a ...

  8. Host Adaptation of Staphylococcal Leukocidins

    NARCIS (Netherlands)

    Vrieling, M

    2016-01-01

    Staphylococcus aureus is a human and animal pathogen of global importance and has the capacity to cause disease in distinct host populations, using a large arsenal of secreted proteins to evade the host immune response. Amongst the immune evasion proteins of S. aureus, secreted cytotoxins play a

  9. Germline single nucleotide polymorphisms associated with response of urothelial carcinoma to platinum-based therapy: the role of the host.

    LENUS (Irish Health Repository)

    Gallagher, D J

    2013-09-01

    Variations in urothelial carcinoma (UC) response to platinum chemotherapy are common and frequently attributed to genetic and epigenetic variations of somatic DNA. We hypothesized that variations in germline DNA may contribute to UC chemosensitivity.

  10. Preparation of protected nucleotides usable in oligonucleotide synthesis

    International Nuclear Information System (INIS)

    Debiard, Jean-Pascal

    1983-01-01

    After having presented the components of DNA, the author of this research thesis outlines that, when dealing the chemical synthesis, the respect of the sequence of these components is the main problem as each nucleotide possesses several functions which may react with each other. In order to solve this problem, functional protection is used to protect functions which may react in an undesirable way and to let free those which participate to the desired reaction. But a selective protector group must be used and this group must remain stable during the operations it is not involved in. Therefore, its elimination will be easy and without any risk of deterioration of the synthesised molecule. This research thesis first addresses the various available techniques to perform these steps, and then reports the study of possible applications of synthetic nucleotides in the field of genetic engineering [fr

  11. Identification of cyclic nucleotide gated channels using regular expressions

    KAUST Repository

    Zelman, Alice K.

    2013-09-03

    Cyclic nucleotide-gated channels (CNGCs) are nonselective cation channels found in plants, animals, and some bacteria. They have a six-transmembrane/one- pore structure, a cytosolic cyclic nucleotide-binding domain, and a cytosolic calmodulin-binding domain. Despite their functional similarities, the plant CNGC family members appear to have different conserved amino acid motifs within corresponding functional domains than animal and bacterial CNGCs do. Here we describe the development and application of methods employing plant CNGC-specific sequence motifs as diagnostic tools to identify novel candidate channels in different plants. These methods are used to evaluate the validity of annotations of putative orthologs of CNGCs from plant genomes. The methods detail how to employ regular expressions of conserved amino acids in functional domains of annotated CNGCs and together with Web tools such as PHI-BLAST and ScanProsite to identify novel candidate CNGCs in species including Physcomitrella patens. © Springer Science+Business Media New York 2013.

  12. Nucleotide sequence composition and method for detection of neisseria gonorrhoeae

    International Nuclear Information System (INIS)

    Lo, A.; Yang, H.L.

    1990-01-01

    This patent describes a composition of matter that is specific for Neisseria gonorrhoeae. It comprises: at least one nucleotide sequence for which the ratio of the amount of the sequence which hybridizes to chromosomal DNA of Neisseria gonorrhoeae to the amount of the sequence which hybridizes to chromosomal DNA of Neisseria meningitidis is greater than about five. The ratio being obtained by a method described

  13. Nucleotide sequence composition and method for detection of neisseria gonorrhoeae

    Energy Technology Data Exchange (ETDEWEB)

    Lo, A.; Yang, H.L.

    1990-02-13

    This patent describes a composition of matter that is specific for {ital Neisseria gonorrhoeae}. It comprises: at least one nucleotide sequence for which the ratio of the amount of the sequence which hybridizes to chromosomal DNA of {ital Neisseria gonorrhoeae} to the amount of the sequence which hybridizes to chromosomal DNA of {ital Neisseria meningitidis} is greater than about five. The ratio being obtained by a method described.

  14. Statistical properties of nucleotides in human chromosomes 21 and 22

    International Nuclear Information System (INIS)

    Zhang Linxi; Sun Tingting

    2005-01-01

    In this paper the statistical properties of nucleotides in human chromosomes 21 and 22 are investigated. The n-tuple Zipf analysis with n = 3, 4, 5, 6, and 7 is used in our investigation. It is found that the most common n-tuples are those which consist only of adenine (A) and thymine (T), and the rarest n-tuples are those in which GC or CG pattern appears twice. With the n-tuples become more and more frequent, the double GC or CG pattern becomes a single GC or CG pattern. The percentage of four nucleotides in the rarest ten and the most common ten n-tuples are also considered in human chromosomes 21 and 22, and different behaviors are found in the percentage of four nucleotides. Frequency of appearance of n-tuple f(r) as a function of rank r is also examined. We find the n-tuple Zipf plot shows a power-law behavior for r n-1 and a rapid decrease for r > 4 n-1 . In order to explore the interior statistical properties of human chromosomes 21 and 22 in detail, we divide the chromosome sequence into some moving windows and we discuss the percentage of ξη (ξ, η = A, C, G, T) pair in those moving windows. In some particular regions, there are some obvious changes in the percentage of ξη pair, and there maybe exist functional differences. The normalized number of repeats N 0 (l) can be described by a power law: N 0 (l) ∼ l -μ . The distance distributions P 0 (S) between two nucleotides in human chromosomes 21 and 22 are also discussed. A two-order polynomial fit exists in those distance distributions: log P 0 (S) = a + bS + cS 2 , and it is quite different from the random sequence

  15. Mitochondria as determinant of nucleotide pools and chromosomal stability

    DEFF Research Database (Denmark)

    Madsen, Claus Desler; Munch-Petersen, Birgitte; Stevnsner, Tinna

    2007-01-01

    Mitochondrial function plays an important role in multiple human diseases and mutations in the mitochondrial genome have been detected in nearly every type of cancer investigated to date. However, the mechanism underlying the interrelation is unknown. We used human cell lines depleted of mitochon...... mitochondrial activity. Our results suggest that mitochondria are central players in maintaining genomic stability and in controlling essential nuclear processes such as upholding a balanced supply of nucleotides....

  16. Ebola virus host cell entry.

    Science.gov (United States)

    Sakurai, Yasuteru

    2015-01-01

    Ebola virus is an enveloped virus with filamentous structure and causes a severe hemorrhagic fever in human and nonhuman primates. Host cell entry is the first essential step in the viral life cycle, which has been extensively studied as one of the therapeutic targets. A virus factor of cell entry is a surface glycoprotein (GP), which is an only essential viral protein in the step, as well as the unique particle structure. The virus also interacts with a lot of host factors to successfully enter host cells. Ebola virus at first binds to cell surface proteins and internalizes into cells, followed by trafficking through endosomal vesicles to intracellular acidic compartments. There, host proteases process GPs, which can interact with an intracellular receptor. Then, under an appropriate circumstance, viral and endosomal membranes are fused, which is enhanced by major structural changes of GPs, to complete host cell entry. Recently the basic research of Ebola virus infection mechanism has markedly progressed, largely contributed by identification of host factors and detailed structural analyses of GPs. This article highlights the mechanism of Ebola virus host cell entry, including recent findings.

  17. Prediction of Nucleotide Binding Peptides Using Star Graph Topological Indices.

    Science.gov (United States)

    Liu, Yong; Munteanu, Cristian R; Fernández Blanco, Enrique; Tan, Zhiliang; Santos Del Riego, Antonino; Pazos, Alejandro

    2015-11-01

    The nucleotide binding proteins are involved in many important cellular processes, such as transmission of genetic information or energy transfer and storage. Therefore, the screening of new peptides for this biological function is an important research topic. The current study proposes a mixed methodology to obtain the first classification model that is able to predict new nucleotide binding peptides, using only the amino acid sequence. Thus, the methodology uses a Star graph molecular descriptor of the peptide sequences and the Machine Learning technique for the best classifier. The best model represents a Random Forest classifier based on two features of the embedded and non-embedded graphs. The performance of the model is excellent, considering similar models in the field, with an Area Under the Receiver Operating Characteristic Curve (AUROC) value of 0.938 and true positive rate (TPR) of 0.886 (test subset). The prediction of new nucleotide binding peptides with this model could be useful for drug target studies in drug development. © 2015 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  18. Nucleotide sequence of tomato ringspot virus RNA-2.

    Science.gov (United States)

    Rott, M E; Tremaine, J H; Rochon, D M

    1991-07-01

    The sequence of tomato ringspot virus (TomRSV) RNA-2 has been determined. It is 7273 nucleotides in length excluding the 3' poly(A) tail and contains a single long open reading frame (ORF) of 5646 nucleotides in the positive sense beginning at position 78 and terminating at position 5723. A second in-frame AUG at position 441 is in a more favourable context for initiation of translation and may act as a site for initiation of translation. The TomRSV RNA-2 3' noncoding region is 1550 nucleotides in length. The coat protein is located in the C-terminal region of the large polypeptide and shows significant but limited amino acid sequence similarity to the putative coat proteins of the nepoviruses tomato black ring (TBRV), Hungarian grapevine chrome mosaic (GCMV) and grapevine fanleaf (GFLV). Comparisons of the coding and non-coding regions of TomRSV RNA-2 and the RNA components of TBRV, GCMV, GFLV and the comovirus cowpea mosaic virus revealed significant similarity for over 300 amino acids between the coding region immediately to the N-terminal side of the putative coat proteins of TomRSV and GFLV; very little similarity could be detected among the non-coding regions of TomRSV and any of these viruses.

  19. Within-Host Variations of Human Papillomavirus Reveal APOBEC-Signature Mutagenesis in the Viral Genome.

    Science.gov (United States)

    Hirose, Yusuke; Onuki, Mamiko; Tenjimbayashi, Yuri; Mori, Seiichiro; Ishii, Yoshiyuki; Takeuchi, Takamasa; Tasaka, Nobutaka; Satoh, Toyomi; Morisada, Tohru; Iwata, Takashi; Miyamoto, Shingo; Matsumoto, Koji; Sekizawa, Akihiko; Kukimoto, Iwao

    2018-03-28

    Persistent infection with oncogenic human papillomaviruses (HPVs) causes cervical cancer, accompanied with the accumulation of somatic mutations into the host genome. There are concomitant genetic changes in the HPV genome during viral infection; however, their relevance to cervical carcinogenesis is poorly understood. Here we explored within-host genetic diversity of HPV by performing deep sequencing analyses of viral whole-genome sequences in clinical specimens. The whole genomes of HPV types 16, 52 and 58 were amplified by type-specific PCR from total cellular DNA of cervical exfoliated cells collected from patients with cervical intraepithelial neoplasia (CIN) and invasive cervical cancer (ICC), and were deep-sequenced. After constructing a reference vial genome sequence for each specimen, nucleotide positions showing changes with > 0.5% frequencies compared to the reference sequence were determined for individual samples. In total, 1,052 positions of nucleotide variations were detected in HPV genomes from 151 samples (CIN1, n = 56; CIN2/3, n = 68; ICC, n = 27), with varying numbers per sample. Overall, C-to-T and C-to-A substitutions were the dominant changes observed across all histological grades. While C-to-T transitions were predominantly detected in CIN1, their prevalence was decreased in CIN2/3 and fell below that of C-to-A transversions in ICC. Analysis of the tri-nucleotides context encompassing substituted bases revealed that Tp C pN, a preferred target sequence for cellular APOBEC cytosine deaminases, was a primary site for C-to-T substitutions in the HPV genome. These results strongly imply that the APOBEC proteins are drivers of HPV genome mutation, particularly in CIN1 lesions. IMPORTANCE HPVs exhibit surprisingly high levels of genetic diversity, including a large repertoire of minor genomic variants in each viral genotype. Here, by conducting deep sequencing analyses, we show for the first time a comprehensive snapshot of the "within-host

  20. The Role of Cyclic Nucleotide Signaling Pathways in Cancer: Targets for Prevention and Treatment

    Energy Technology Data Exchange (ETDEWEB)

    Fajardo, Alexandra M.; Piazza, Gary A. [Drug Discovery Research Center, Mitchell Cancer Institute, University of South Alabama, 1660 Springhill Ave, Suite 3029, Mobile, AL 36604 (United States); Tinsley, Heather N., E-mail: htinsley@montevallo.edu [Department of Biology, Chemistry, and Mathematics, University of Montevallo, Station 6480, Montevallo, AL 35115 (United States)

    2014-02-26

    For more than four decades, the cyclic nucleotides cyclic AMP (cAMP) and cyclic GMP (cGMP) have been recognized as important signaling molecules within cells. Under normal physiological conditions, cyclic nucleotides regulate a myriad of biological processes such as cell growth and adhesion, energy homeostasis, neuronal signaling, and muscle relaxation. In addition, altered cyclic nucleotide signaling has been observed in a number of pathophysiological conditions, including cancer. While the distinct molecular alterations responsible for these effects vary depending on the specific cancer type, several studies have demonstrated that activation of cyclic nucleotide signaling through one of three mechanisms—induction of cyclic nucleotide synthesis, inhibition of cyclic nucleotide degradation, or activation of cyclic nucleotide receptors—is sufficient to inhibit proliferation and activate apoptosis in many types of cancer cells. These findings suggest that targeting cyclic nucleotide signaling can provide a strategy for the discovery of novel agents for the prevention and/or treatment of selected cancers.

  1. Rho family GTP binding proteins are involved in the regulatory volume decrease process in NIH3T3 mouse fibroblasts

    DEFF Research Database (Denmark)

    Pedersen, Stine F; Beisner, Kristine H; Willumsen, Berthe M

    2002-01-01

    The role of Rho GTPases in the regulatory volume decrease (RVD) process following osmotic cell swelling is controversial and has so far only been investigated for the swelling-activated Cl- efflux. We investigated the involvement of RhoA in the RVD process in NIH3T3 mouse fibroblasts, using wild......-type cells and three clones expressing constitutively active RhoA (RhoAV14). RhoAV14 expression resulted in an up to fourfold increase in the rate of RVD, measured by large-angle light scattering. The increase in RVD rate correlated with RhoAV14 expression. RVD in wild-type cells was unaffected by the Rho...

  2. Digbeth hosts the Big Bang

    CERN Multimedia

    2002-01-01

    Birminham museum of science and discovery, Thinktank, is hosting 'Building The Universe', a free exhibition about the work undertaken at the European Laboratory for Particle Physics, in Geneva (3 paragraphs).

  3. Complexes of Escherichia coli adenylate kinase and nucleotides: 1H NMR studies of the nucleotide sites in solution

    International Nuclear Information System (INIS)

    Vetter, I.R.; Reinstein, J.; Roesch, P.

    1990-01-01

    One- and two-dimensional nuclear magnetic resonance (NMR) studies, in particular substrate-protein nuclear Overhauser effect (NOESY) measurements, as well as nucleotide and P 1 ,P 5 -bis-(5'-adenosyl) pentaphosphate (AP 5 A) titrations and studies of the temperature-dependent unfolding of the tertiary structure of Escherichia coli adenylate kinase (AK EC ) were performed. These experiments and comparison with the same type of experiments performed with the porcine enzyme led them to the following conclusions: (1) at pH 8 and concentrations of approximately 2.5-3 mM, AK EC is partially unfolded at 318 K; (2) ATP·Mg 2+ binds to the ATP site with a dissociation constant of approximately 40 μM under the assumption that ATP binds to one nucleotide site only; (3) AP 5 A·Mg 2+ binds to both nucleotide sites and thus simulates the active complex; (4) the ATP·Mg 2+ adenine in the AK EC ·AP 5 A·Mg 2+ complex is located close to His 134 and Phe 19 ; (5) the AK EC G-loop with bound ATP·Mg 2+ is structurally highly homologous to the loop region in the oncogene product p21 with bound GTP·Mg 2+

  4. AVP-stimulated nucleotide secretion in perfused mouse medullary thick ascending limb and cortical collecting duct

    DEFF Research Database (Denmark)

    Odgaard, Elvin V. P.; Prætorius, Helle; Leipziger, Jens Georg

    2009-01-01

    is stimulated remain elusive. Here, we investigate the phenomenon of nucleotide secretion in intact, perfused mouse medullary thick ascending limb (mTAL) and cortical collecting duct (CCD). The nucleotide secretion was monitored by a biosensor adapted to register nucleotides in the tubular outflow...

  5. The Tomato Nucleotide-binding Leucine-rich Repeat Immune Receptor I-2 Couples DNA-binding to Nucleotide-binding Domain Nucleotide Exchange*

    Science.gov (United States)

    Fenyk, Stepan; Dixon, Christopher H.; Gittens, William H.; Townsend, Philip D.; Sharples, Gary J.; Pålsson, Lars-Olof; Takken, Frank L. W.; Cann, Martin J.

    2016-01-01

    Plant nucleotide-binding leucine-rich repeat (NLR) proteins enable plants to recognize and respond to pathogen attack. Previously, we demonstrated that the Rx1 NLR of potato is able to bind and bend DNA in vitro. DNA binding in situ requires its genuine activation following pathogen perception. However, it is unknown whether other NLR proteins are also able to bind DNA. Nor is it known how DNA binding relates to the ATPase activity intrinsic to NLR switch function required to immune activation. Here we investigate these issues using a recombinant protein corresponding to the N-terminal coiled-coil and nucleotide-binding domain regions of the I-2 NLR of tomato. Wild type I-2 protein bound nucleic acids with a preference of ssDNA ≈ dsDNA > ssRNA, which is distinct from Rx1. I-2 induced bending and melting of DNA. Notably, ATP enhanced DNA binding relative to ADP in the wild type protein, the null P-loop mutant K207R, and the autoactive mutant S233F. DNA binding was found to activate the intrinsic ATPase activity of I-2. Because DNA binding by I-2 was decreased in the presence of ADP when compared with ATP, a cyclic mechanism emerges; activated ATP-associated I-2 binds to DNA, which enhances ATP hydrolysis, releasing ADP-bound I-2 from the DNA. Thus DNA binding is a general property of at least a subset of NLR proteins, and NLR activation is directly linked to its activity at DNA. PMID:26601946

  6. The Tomato Nucleotide-binding Leucine-rich Repeat Immune Receptor I-2 Couples DNA-binding to Nucleotide-binding Domain Nucleotide Exchange.

    Science.gov (United States)

    Fenyk, Stepan; Dixon, Christopher H; Gittens, William H; Townsend, Philip D; Sharples, Gary J; Pålsson, Lars-Olof; Takken, Frank L W; Cann, Martin J

    2016-01-15

    Plant nucleotide-binding leucine-rich repeat (NLR) proteins enable plants to recognize and respond to pathogen attack. Previously, we demonstrated that the Rx1 NLR of potato is able to bind and bend DNA in vitro. DNA binding in situ requires its genuine activation following pathogen perception. However, it is unknown whether other NLR proteins are also able to bind DNA. Nor is it known how DNA binding relates to the ATPase activity intrinsic to NLR switch function required to immune activation. Here we investigate these issues using a recombinant protein corresponding to the N-terminal coiled-coil and nucleotide-binding domain regions of the I-2 NLR of tomato. Wild type I-2 protein bound nucleic acids with a preference of ssDNA ≈ dsDNA > ssRNA, which is distinct from Rx1. I-2 induced bending and melting of DNA. Notably, ATP enhanced DNA binding relative to ADP in the wild type protein, the null P-loop mutant K207R, and the autoactive mutant S233F. DNA binding was found to activate the intrinsic ATPase activity of I-2. Because DNA binding by I-2 was decreased in the presence of ADP when compared with ATP, a cyclic mechanism emerges; activated ATP-associated I-2 binds to DNA, which enhances ATP hydrolysis, releasing ADP-bound I-2 from the DNA. Thus DNA binding is a general property of at least a subset of NLR proteins, and NLR activation is directly linked to its activity at DNA. © 2016 by The American Society for Biochemistry and Molecular Biology, Inc.

  7. Association of Nucleotide-binding Oligomerization Domain Receptors with Peptic Ulcer and Gastric Cancer.

    Science.gov (United States)

    Mohammadian Amiri, Rajeeh; Tehrani, Mohsen; Taghizadeh, Shirin; Shokri-Shirvani, Javad; Fakheri, Hafez; Ajami, Abolghasem

    2016-10-01

    Host innate immunity can affect the clinical outcomes of Helicobacter pylori infection, including gastritis, gastric ulcer, gastric adenocarcinoma, and MALT lymphoma. Nucleotide binding oligomerization domain (NOD)-1 and -2 are two molecules of innate immunity which are involved in the host defense against H. pylori. This study aimed to evaluate the effect of the expression level of NOD1 and NOD2 on the susceptibility to gastric cancer as well as peptic ulcer in individuals with H. pylori infection. The gene expression levels of these molecules were compared in three groups of non-ulcer dyspepsia (NUD) as a control group (n=52); peptic ulcer disease (PUD), (n=53); and gastric cancer (GC), (n=39). Relative expression levels of NOD1 in patients with GC were higher than those of NUD and PUD (p<0.001 and P<0.001, respectively). Similarly in case of NOD1, PUD group showed higher level of expression than NUD group (p<0.01). However, there was no significant difference between H. pylori -positive and -negative patients in NUD, PUD, or GC groups. Moreover, the expression levels of NOD2 showed no significant difference among NUD, PUD, or GC groups, while among H. pylori-positive patients, it was higher in GC group than NUD  and PUD groups (p<0.05 and p<0.01, respectively). In addition, positive correlation coefficients were attained between NOD1 and NOD2 expressions in patients with NUD (R2 Linear=0.349, p<0.001), PUD (R2 Linear=0.695, p<0.001), and GC (R2 Linear=0.385, p<0.001). Collectively, the results suggest that the chronic activation of NOD1 and NOD2 receptors might play a role in the development of gastric cancer.

  8. MicroRNAs from the parasitic plant Cuscuta campestris target host messenger RNAs.

    Science.gov (United States)

    Shahid, Saima; Kim, Gunjune; Johnson, Nathan R; Wafula, Eric; Wang, Feng; Coruh, Ceyda; Bernal-Galeano, Vivian; Phifer, Tamia; dePamphilis, Claude W; Westwood, James H; Axtell, Michael J

    2018-01-03

    Dodders (Cuscuta spp.) are obligate parasitic plants that obtain water and nutrients from the stems of host plants via specialized feeding structures called haustoria. Dodder haustoria facilitate bidirectional movement of viruses, proteins and mRNAs between host and parasite, but the functional effects of these movements are not known. Here we show that Cuscuta campestris haustoria accumulate high levels of many novel microRNAs (miRNAs) while parasitizing Arabidopsis thaliana. Many of these miRNAs are 22 nucleotides in length. Plant miRNAs of this length are uncommon, and are associated with amplification of target silencing through secondary short interfering RNA (siRNA) production. Several A. thaliana mRNAs are targeted by 22-nucleotide C. campestris miRNAs during parasitism, resulting in mRNA cleavage, secondary siRNA production, and decreased mRNA accumulation. Hosts with mutations in two of the loci that encode target mRNAs supported significantly higher growth of C. campestris. The same miRNAs that are expressed and active when C. campestris parasitizes A. thaliana are also expressed and active when it infects Nicotiana benthamiana. Homologues of target mRNAs from many other plant species also contain the predicted target sites for the induced C. campestris miRNAs. These data show that C. campestris miRNAs act as trans-species regulators of host-gene expression, and suggest that they may act as virulence factors during parasitism.

  9. Identification of a chemical that inhibits the mycobacterial UvrABC complex in nucleotide excision repair.

    Science.gov (United States)

    Mazloum, Nayef; Stegman, Melanie A; Croteau, Deborah L; Van Houten, Bennett; Kwon, Nyoun Soo; Ling, Yan; Dickinson, Caitlyn; Venugopal, Aditya; Towheed, Mohammad Atif; Nathan, Carl

    2011-03-01

    Bacterial DNA can be damaged by reactive nitrogen and oxygen intermediates (RNI and ROI) generated by host immunity, as well as by antibiotics that trigger bacterial production of ROI. Thus a pathogen's ability to repair its DNA may be important for persistent infection. A prominent role for nucleotide excision repair (NER) in disease caused by Mycobacterium tuberculosis (Mtb) was suggested by attenuation of uvrB-deficient Mtb in mice. However, it was unknown if Mtb's Uvr proteins could execute NER. Here we report that recombinant UvrA, UvrB, and UvrC from Mtb collectively bound and cleaved plasmid DNA exposed to ultraviolet (UV) irradiation or peroxynitrite. We used the DNA incision assay to test the mechanism of action of compounds identified in a high-throughput screen for their ability to delay recovery of M. smegmatis from UV irradiation. 2-(5-Amino-1,3,4-thiadiazol-2-ylbenzo[f]chromen-3-one) (ATBC) but not several closely related compounds inhibited cleavage of damaged DNA by UvrA, UvrB, and UvrC without intercalating in DNA and impaired recovery of M. smegmatis from UV irradiation. ATBC did not affect bacterial growth in the absence of UV exposure, nor did it exacerbate the growth defect of UV-irradiated mycobacteria that lacked uvrB. Thus, ATBC appears to be a cell-penetrant, selective inhibitor of mycobacterial NER. Chemical inhibitors of NER may facilitate studies of the role of NER in prokaryotic pathobiology.

  10. The anti-Trichomonas vaginalis phloroglucinol derivative isoaustrobrasilol B modulates extracellular nucleotide hydrolysis.

    Science.gov (United States)

    Menezes, Camila Braz; Rigo, Graziela Vargas; Bridi, Henrique; Trentin, Danielle da Silva; Macedo, Alexandre José; von Poser, Gilsane Lino; Tasca, Tiana

    2017-11-01

    Trichomonas vaginalis causes trichomoniasis, a neglected sexually transmitted disease. Due to severe health consequences and treatment failure, new therapeutic alternatives are crucial. Phloroglucinols from southern Brazilian Hypericum species demonstrated anti-T. vaginalis and anti-Leishmania amazonensis activities. The modulation of biochemical pathways involved in the control of inflammatory response by ectonucleotidases, NTPDase, and ecto-5'-nucleotidase represents new targets for combating protozoa. This study investigated the activity of phloroglucinol derivatives of Hypericum species from southern Brazil against T. vaginalis as well as its ability on modulating parasite ectonucleotidases and, consequently, immune parameters through ATP and adenosine effects. Phloroglucinol derivatives screening revealed activity for isoaustrobrasilol B (IC 50 38 μm) with no hemolytic activity. Although the most active compound induced cytotoxicity against a mammalian cell lineage, the in vivo model evidenced absence of toxicity. Isoaustrobrasilol B significantly inhibited NTPDase and ecto-5'-nucleotidase activities, and the immune modulation attributed to extracellular nucleotide accumulation was evaluated. The production of ROS and IL-6 by T. vaginalis-stimulated neutrophils was not affected by the treatment. Conversely, IL-8 levels were significantly enhanced. The associative mechanism of trophozoites death and ectonucleotidases modulation by isoaustrobrasilol B may increase the susceptibility of T. vaginalis to host innate immune cell like neutrophils consequently, contributing to parasite clearance. © 2017 John Wiley & Sons A/S.

  11. A Single Nucleotide Polymorphism in Human APOBEC3C Enhances Restriction of Lentiviruses.

    Directory of Open Access Journals (Sweden)

    Cristina J Wittkopp

    2016-10-01

    Full Text Available Humans express seven human APOBEC3 proteins, which can inhibit viruses and endogenous retroelements through cytidine deaminase activity. The seven paralogs differ in the potency of their antiviral effects, as well as in their antiviral targets. One APOBEC3, APOBEC3C, is exceptional as it has been found to only weakly block viruses and endogenous retroelements compared to other APOBEC3s. However, our positive selection analyses suggest that APOBEC3C has played a role in pathogen defense during primate evolution. Here, we describe a single nucleotide polymorphism in human APOBEC3C, a change from serine to isoleucine at position 188 (I188 that confers potent antiviral activity against HIV-1. The gain-of-function APOBEC3C SNP results in increased enzymatic activity and hypermutation of target sequences when tested in vitro, and correlates with increased dimerization of the protein. The I188 is widely distributed in human African populations, and is the ancestral primate allele, but is not found in chimpanzees or gorillas. Thus, while other hominids have lost activity of this antiviral gene, it has been maintained, or re-acquired, as a more active antiviral gene in a subset of humans. Taken together, our results suggest that APOBEC3C is in fact involved in protecting hosts from lentiviruses.

  12. HIV-1 Promoter Single Nucleotide Polymorphisms Are Associated with Clinical Disease Severity.

    Directory of Open Access Journals (Sweden)

    Michael R Nonnemacher

    Full Text Available The large majority of human immunodeficiency virus type 1 (HIV-1 markers of disease progression/severity previously identified have been associated with alterations in host genetic and immune responses, with few studies focused on viral genetic markers correlate with changes in disease severity. This study presents a cross-sectional/longitudinal study of HIV-1 single nucleotide polymorphisms (SNPs contained within the viral promoter or long terminal repeat (LTR in patients within the Drexel Medicine CNS AIDS Research and Eradication Study (CARES Cohort. HIV-1 LTR SNPs were found to associate with the classical clinical disease parameters CD4+ T-cell count and log viral load. They were found in both defined and undefined transcription factor binding sites of the LTR. A novel SNP identified at position 108 in a known COUP (chicken ovalbumin upstream promoter/AP1 transcription factor binding site was significantly correlated with binding phenotypes that are potentially the underlying cause of the associated clinical outcome (increase in viral load and decrease in CD4+ T-cell count.

  13. Two different strategies of host manipulation allow parasites to persist in intermediate-definitive host systems

    NARCIS (Netherlands)

    Vries, de L.J.; Langevelde, van F.

    2018-01-01

    Trophically transmitted parasites start their development in an intermediate host, before they finish the development in their definitive host when the definitive host preys on the intermediate host. In intermediate-definitive host systems, two strategies of host manipulation have been evolved:

  14. Microarray Beads for Identifying Blood Group Single Nucleotide Polymorphisms

    OpenAIRE

    Drago, Francesca; Karpasitou, Katerina; Poli, Francesca

    2009-01-01

    We have developed a high-throughput system for single nucleotide polymorphism (SNP) genotyping of alleles of diverse blood group systems exploiting Luminex technology. The method uses specific oligonucleotide probes coupled to a specific array of fluorescent microspheres and is designed for typing Jka/Jkb, Fya/Fyb, S/s, K/k, Kpa/Kpb, Jsa/Jsb, Coa/Cob and Lua/Lub alleles. Briefly, two multiplex PCR reactions (PCR I and PCR II) according to the laboratory specific needs are set up. PCR I amplif...

  15. Nucleotide sequence of the triosephosphate isomerase gene from Macaca mulatta

    Energy Technology Data Exchange (ETDEWEB)

    Old, S.E.; Mohrenweiser, H.W. (Univ. of Michigan, Ann Arbor (USA))

    1988-09-26

    The triosephosphate isomerase gene from a rhesus monkey, Macaca mulatta, charon 34 library was sequenced. The human and chimpanzee enzymes differ from the rhesus enzyme at ASN 20 and GLU 198. The nucleotide sequence identity between rhesus and human is 97% in the coding region and >94% in the flanking regions. Comparison of the rhesus and chimp genes, including the intron and flanking sequences, does not suggest a mechanism for generating the two TPI peptides of proliferating cells from hominoids and a single peptide from the rhesus gene.

  16. Single nucleotide polymorphism (SNP) detection on a magnetoresistive sensor

    DEFF Research Database (Denmark)

    Rizzi, Giovanni; Østerberg, Frederik Westergaard; Dufva, Martin

    2013-01-01

    We present a magnetoresistive sensor platform for hybridization assays and demonstrate its applicability on single nucleotide polymorphism (SNP) genotyping. The sensor relies on anisotropic magnetoresistance in a new geometry with a local negative reference and uses the magnetic field from...... the sensor bias current to magnetize magnetic beads in the vicinity of the sensor. The method allows for real-time measurements of the specific bead binding to the sensor surface during DNA hybridization and washing. Compared to other magnetic biosensing platforms, our approach eliminates the need...... for external electromagnets and thus allows for miniaturization of the sensor platform....

  17. Identification of a single-nucleotide insertion in the promoter region affecting the sodC promoter activity in Brucella neotomae.

    Directory of Open Access Journals (Sweden)

    Dina A Moustafa

    Full Text Available Brucella neotomae is not known to be associated with clinical disease in any host species. Previous research suggested that B. neotomae might not express detectable levels of Cu/Zn superoxide dismutase (SOD, a periplasmic enzyme known to be involved in protecting Brucella from oxidative bactericidal effects of host phagocytes. This study was undertaken to investigate the genetic basis for the disparity in SOD expression in B. neotomae. Our Western blot and SOD enzyme assay analyses indicated that B. neotomae does express SOD, but at a substantially reduced level. Nucleotide sequence analysis of region upstream to the sodC gene identified a single-nucleotide insertion in the potential promoter region. The same single-nucleotide insertion was also detected in the sodC promoter of B. suis strain Thomsen, belonging to biovar 2 in which SOD expression was undetectable previously. Examination of the sodC promoter activities using translational fusion constructs with E. coli β-galactosidase demonstrated that the B. neotomae and B. suis biovar 2 promoters were very weak in driving gene expression. Site-directed mutation studies indicated that the insertion of A in the B. neotomae sodC promoter reduced the promoter activity. Increasing the level of SOD expression in B. neotomae through complementation with B. abortus sodC gene did not alter the bacterial survival in J774A.1 macrophage-like cells and in tissues of BALB/c and C57BL/6 mice. These results for the first time demonstrate the occurrence of a single-nucleotide polymorphism affecting promoter function and gene expression in Brucella.

  18. Nucleotide Selectivity at a Preinsertion Checkpoint of T7 RNA Polymerase Transcription Elongation.

    Science.gov (United States)

    E, Chao; Duan, Baogen; Yu, Jin

    2017-04-20

    Nucleotide selection is crucial for transcription fidelity control, in particular, for viral T7 RNA polymerase (RNAP) lack of proofreading activity. It has been recognized that multiple kinetic checkpoints exist prior to full nucleotide incorporation. In this work, we implemented intensive atomistic molecular dynamics (MD) simulations to quantify how strong the nucleotide selection is at the initial checkpoint of an elongation cycle of T7 RNAP. The incoming nucleotides bind into a preinsertion site where a critical tyrosine residue locates nearby to assist the nucleotide selection. We calculated the relative binding free energy between a noncognate nucleotide and a cognate one at a preinsertion configuration via alchemical simulations, showing that a small selection free energy or the binding free energy difference (∼3 k B T) exists between the two nucleotides. Indeed, another preinsertion configuration favored by the noncognate nucleotides was identified, which appears to be off path for further nucleotide insertion and additionally assists the nucleotide selection. By chemical master equation (CME) approach, we show that the small selection free energy at the preinsertion site along with the off-path noncognate nucleotide filtering can help substantially to reduce the error rate and to maintain the elongation rate high in the T7 RNAP transcription.

  19. Salmonella Disrupts Host Endocytic Trafficking by SopD2-Mediated Inhibition of Rab7

    Directory of Open Access Journals (Sweden)

    Vanessa M. D’Costa

    2015-09-01

    Full Text Available Intracellular bacterial pathogens of a diverse nature share the ability to evade host immunity by impairing trafficking of endocytic cargo to lysosomes for degradation, a process that is poorly understood. Here, we show that the Salmonella enterica type 3 secreted effector SopD2 mediates this process by binding the host regulatory GTPase Rab7 and inhibiting its nucleotide exchange. Consequently, this limits Rab7 interaction with its dynein- and kinesin-binding effectors RILP and FYCO1 and thereby disrupts host-driven regulation of microtubule motors. Our study identifies a bacterial effector capable of directly binding and thereby modulating Rab7 activity and a mechanism of endocytic trafficking disruption that may provide insight into the pathogenesis of other bacteria. Additionally, we provide a powerful tool for the study of Rab7 function, and a potential therapeutic target.

  20. Pre-Steady State Kinetic Investigation of the Incorporation of Anti-Hepatitis B Nucleotide Analogs Catalyzed by Non-Canonical Human DNA Polymerases

    Science.gov (United States)

    Brown, Jessica A.; Pack, Lindsey R.; Fowler, Jason D.; Suo, Zucai

    2011-01-01

    Antiviral nucleoside analogs have been developed to inhibit the enzymatic activities of the hepatitis B virus (HBV) polymerase, thereby preventing the replication and production of HBV. However, the usage of these analogs can be limited by drug toxicity because the 5′-triphosphates of these nucleoside analogs (nucleotide analogs) are potential substrates for human DNA polymerases to incorporate into host DNA. Although they are poor substrates for human replicative DNA polymerases, it remains to be established whether these nucleotide analogs are substrates for the recently discovered human X- and Y-family DNA polymerases. Using pre-steady state kinetic techniques, we have measured the substrate specificity values for human DNA polymerases β, λ, η, ι, κ, and Rev1 incorporating the active forms of the following anti-HBV nucleoside analogs approved for clinical use: adefovir, tenofovir, lamivudine, telbivudine, and entecavir. Compared to the incorporation of a natural nucleotide, most of the nucleotide analogs were incorporated less efficiently (2 to >122,000) by the six human DNA polymerases. In addition, the potential for entecavir and telbivudine, two drugs which possess a 3′-hydroxyl, to become embedded into human DNA was examined by primer extension and DNA ligation assays. These results suggested that telbivudine functions as a chain terminator while entecavir was efficiently extended by the six enzymes and was a substrate for human DNA ligase I. Our findings suggested that incorporation of anti-HBV nucleotide analogs catalyzed by human X- and Y-family polymerases may contribute to clinical toxicity. PMID:22132702

  1. Kinetic mechanism and nucleotide specificity of NADH peroxidase

    International Nuclear Information System (INIS)

    Stoll, V.S.; Blanchard, J.S.

    1988-01-01

    NADH peroxidase is a flavoprotein isolated from Streptococcus faecalis which catalyzes the pyridine nucleotide-dependent reduction of hydrogen peroxide to water. Initial velocity, product, and dead-end inhibition studies have been performed at pH 7.5 and support a ping-pong kinetic mechanism. In the absence of hydrogen peroxide, both transhydrogenation between NADH and thioNAD, and isotope exchange between [ 14 C]NADH and NAD, have been demonstrated, although in both these experiments, the maximal velocity of nucleotide exchange was less than 1.5% the maximal velocity of the peroxidatic reaction. We propose that NADH binds tightly to both oxidized and two-electron reduced enzyme. NADH oxidation proceeds stereospecifically with the transfer of the 4S hydrogen to enzyme, and then, via exchange, to water. No primary tritium kinetic isotope effect was observed, and no statistically significant primary deuterium kinetic isotope effects on V/K were determined, although primary deuterium kinetic isotope effects on V were observed in the presence and absence of sodium acetate. NADH peroxidase thus shares with other flavoprotein reductases striking kinetic, spectroscopic, and stereochemical similarities. On this basis, we propose a chemical mechanism for the peroxide cleaving reaction catalyzed by NADH peroxidase which involves the obligate formation of a flavinperoxide, and peroxo bond cleavage by nucleophilic attack by enzymatic dithiols

  2. Single Nucleotide Polymorphism Analysis of Protamine Genes in Infertile Men

    Directory of Open Access Journals (Sweden)

    Ahamad Salamian

    2008-01-01

    Full Text Available Background: Single nucleotide polymorphism (SNPs are considered as one of the underlyingcauses of male infertility. Proper sperm chromatin packaging which involves replacement ofhistones with protamines has profound effect on male fertility. Over 20 SNPs have been reportedfor the protamine 1 and 2.Materials and Methods: The aim of this study was to evaluate the frequency of two previouslyreported SNPs using polymerase chain reaction (PCR-restriction fragment length polymorphism(RFLP approach in 35, 96 and 177 normal, oligozoospermic and azoospermic individuals. TheseSNPs are: 1. A base pair substitution (G at position 197 instead of T in protamine type 1 Openreading frame (ORF including untranslated region, which causes an Arg residue change to Serresidue in a highly conserved region. 2. cytidine nucleotide change to thymidine in position of 248of protamine type 2 ORF which caused a nonsense point mutation.Results: The two mentioned SNPs were not present in the studied population, thus concluding thatthese SNPs can not serves as molecular markers for male infertility diagnosis.Conclusion: The results of our study reveal that in a selected Iranian population, the SNP G197Tand C248T are completely absent and are not associated with male infertility and therefore theseSNPs may not represent a molecular marker for genetic diagnosis of male infertility.

  3. Retinal Cyclic Nucleotide-Gated Channels: From Pathophysiology to Therapy

    Directory of Open Access Journals (Sweden)

    Stylianos Michalakis

    2018-03-01

    Full Text Available The first step in vision is the absorption of photons by the photopigments in cone and rod photoreceptors. After initial amplification within the phototransduction cascade the signal is translated into an electrical signal by the action of cyclic nucleotide-gated (CNG channels. CNG channels are ligand-gated ion channels that are activated by the binding of cyclic guanosine monophosphate (cGMP or cyclic adenosine monophosphate (cAMP. Retinal CNG channels transduce changes in intracellular concentrations of cGMP into changes of the membrane potential and the Ca2+ concentration. Structurally, the CNG channels belong to the superfamily of pore-loop cation channels and share a common gross structure with hyperpolarization-activated cyclic nucleotide-gated (HCN channels and voltage-gated potassium channels (KCN. In this review, we provide an overview on the molecular properties of CNG channels and describe their physiological role in the phototransduction pathways. We also discuss insights into the pathophysiological role of CNG channel proteins that have emerged from the analysis of CNG channel-deficient animal models and human CNG channelopathies. Finally, we summarize recent gene therapy activities and provide an outlook for future clinical application.

  4. Cyclic Nucleotide Monophosphates and Their Cyclases in Plant Signaling

    KAUST Repository

    Gehring, Christoph A.

    2017-10-04

    The cyclic nucleotide monophosphates (cNMPs), and notably 3′,5′-cyclic guanosine monophosphate (cGMP) and 3′,5′-cyclic adenosine monophosphate (cAMP) are now accepted as key signaling molecules in many processes in plants including growth and differentiation, photosynthesis, and biotic and abiotic defense. At the single molecule level, we are now beginning to understand how cNMPs modify specific target molecules such as cyclic nucleotide-gated channels, while at the systems level, a recent study of the Arabidopsis cNMP interactome has identified novel target molecules with specific cNMP-binding domains. A major advance came with the discovery and characterization of a steadily increasing number of guanylate cyclases (GCs) and adenylate cyclases (ACs). Several of the GCs are receptor kinases and include the brassinosteroid receptor, the phytosulfokine receptor, the Pep receptor, the plant natriuretic peptide receptor as well as a nitric oxide sensor. We foresee that in the near future many more molecular mechanisms and biological roles of GCs and ACs and their catalytic products will be discovered and further establish cNMPs as a key component of plant responses to the environment.

  5. Cyclic Nucleotide Monophosphates and Their Cyclases in Plant Signaling

    KAUST Repository

    Gehring, Christoph A; Turek, Ilona S.

    2017-01-01

    The cyclic nucleotide monophosphates (cNMPs), and notably 3′,5′-cyclic guanosine monophosphate (cGMP) and 3′,5′-cyclic adenosine monophosphate (cAMP) are now accepted as key signaling molecules in many processes in plants including growth and differentiation, photosynthesis, and biotic and abiotic defense. At the single molecule level, we are now beginning to understand how cNMPs modify specific target molecules such as cyclic nucleotide-gated channels, while at the systems level, a recent study of the Arabidopsis cNMP interactome has identified novel target molecules with specific cNMP-binding domains. A major advance came with the discovery and characterization of a steadily increasing number of guanylate cyclases (GCs) and adenylate cyclases (ACs). Several of the GCs are receptor kinases and include the brassinosteroid receptor, the phytosulfokine receptor, the Pep receptor, the plant natriuretic peptide receptor as well as a nitric oxide sensor. We foresee that in the near future many more molecular mechanisms and biological roles of GCs and ACs and their catalytic products will be discovered and further establish cNMPs as a key component of plant responses to the environment.

  6. Modification of synthesis nucleotides [γ-32P] ATP

    International Nuclear Information System (INIS)

    Wira Y Rahman; Endang Sarmini; Herlina; Triyanto; Hambali; Abdul Mutalib; Santi Nurbaiti

    2013-01-01

    In molecular biology, radionuclides in the form of radiolabeled compounds have been widely used as deoxyribonucleic acid (DNA) / ribonucleic acid (RNA) tracer in order to explore a wide range of physiological and pathological processes. One of such compounds is [γ- 32 P]-adenosine triphosphate {[γ- 32 P]-ATP} [γ- 32 P]-ATP which has been widely used in the biotechnology research. In order to support the biotechnology research in Indonesia in this project, [γ- 32 P]- ATP had been synthesized by enzymatic reactions with modifying the method of synthesis using the precursor DL-glyceraldehyde 3-phosphate, nucleotides Adenosine Diphosphate (ADP) and H 3 32 PO 4 and enzymes glyceraldehyde 3-phosphate dehydrogenase, 3-phosphoroglyceric phosphokinase and lactate dehydrogenase. The purification of the synthesized [γ- 32 P]-ATP, by using DEAE Sephadex column chromatography. The synthesis and purification process that had been performed were able in producing of [γ- 32 P]-ATP with radioactivity of 1,175 mCi and radiochemical purity of 99,49%.. Having successfully prepared the [γ- 32 P]-ATP and application, in the near future the Radioisotopes and Radiopharmaceuticals Centre is expected to be able in providing the above-mentioned radiolabeled nucleotide for biotechnology research in Indonesia. (author)

  7. Nucleobases, nucleosides, and nucleotides: versatile biomolecules for generating functional nanomaterials.

    Science.gov (United States)

    Pu, Fang; Ren, Jinsong; Qu, Xiaogang

    2018-02-21

    The incorporation of biomolecules into nanomaterials generates functional nanosystems with novel and advanced properties, presenting great potential for applications in various fields. Nucleobases, nucleosides and nucleotides, as building blocks of nucleic acids and biological coenzymes, constitute necessary components of the foundation of life. In recent years, as versatile biomolecules for the construction or regulation of functional nanomaterials, they have stimulated interest in researchers, due to their unique properties such as structural diversity, multiplex binding sites, self-assembly ability, stability, biocompatibility, and chirality. In this review, strategies for the synthesis of nanomaterials and the regulation of their morphologies and functions using nucleobases, nucleosides, and nucleotides as building blocks, templates or modulators are summarized alongside selected applications. The diverse applications range from sensing, bioimaging, and drug delivery to mimicking light-harvesting antenna, the construction of logic gates, and beyond. Furthermore, some perspectives and challenges in this emerging field are proposed. This review is directed toward the broader scientific community interested in biomolecule-based functional nanomaterials.

  8. Assay of cyclic nucleotide phosphodiesterase using radiolabeled and fluorescent substrates

    International Nuclear Information System (INIS)

    Kincaid, R.L.; Manganiello, V.C.

    1988-01-01

    There are four major classes of phosphodiesterase with different specificities for cAMP and cGMP and different allosteric regulators. Type I phosphodiesterase is activated by calmodulin plus Ca/sup 2+/ and has a higher affinity for cGMP than cAMP. Type II phosphodiesterase likewise has a higher affinity for cGMP than cAMP, but the activity toward one substrate is markedly stimulated by low (micromolar) concentrations of the other nucleotide. Type III phosphodiesterase has a higher affinity for cAMP than cGMP; its activity is increased in responsive cells by certain hormones, e.g., insulin, isoproterenol. Type IV phosphodiesterase is the cGMP-specific enzyme, which also has an allosteric binding site for cGMP. An example of this class of enzyme is the one from retinal rod outer segments, which is activated by light via rhodopsin and the guanine nucleotide-binding protein transducin. There appears to be little structural relatedness among these enzymes based on immunologic analysis, consistent with the possibility that divergent forms evolved from an ancestral enzyme. Determination of the amount of a specific form of phosphodiesterase in crude material is often difficult. Modification of assay conditions by judicious choice of substrate and/or inhibitor concentrations may selectively favor (or reduce) the activity of a particular form; in many instances, however, some fractionation of enzymes may be necessary. This is discussed more fully in the final section of this chapter

  9. Complete nucleotide sequences of avian metapneumovirus subtype B genome.

    Science.gov (United States)

    Sugiyama, Miki; Ito, Hiroshi; Hata, Yusuke; Ono, Eriko; Ito, Toshihiro

    2010-12-01

    Complete nucleotide sequences were determined for subtype B avian metapneumovirus (aMPV), the attenuated vaccine strain VCO3/50 and its parental pathogenic strain VCO3/60616. The genomes of both strains comprised 13,508 nucleotides (nt), with a 42-nt leader at the 3'-end and a 46-nt trailer at the 5'-end. The genome contains eight genes in the order 3'-N-P-M-F-M2-SH-G-L-5', which is the same order shown in the other metapneumoviruses. The genes are flanked on either side by conserved transcriptional start and stop signals and have intergenic sequences varying in length from 1 to 88 nt. Comparison of nt and predicted amino acid (aa) sequences of VCO3/60616 with those of other metapneumoviruses revealed higher homology with aMPV subtype A virus than with other metapneumoviruses. A total of 18 nt and 10 deduced aa differences were seen between the strains, and one or a combination of several differences could be associated with attenuation of VCO3/50.

  10. Thoroughbred Horse Single Nucleotide Polymorphism and Expression Database: HSDB

    Directory of Open Access Journals (Sweden)

    Joon-Ho Lee

    2014-09-01

    Full Text Available Genetics is important for breeding and selection of horses but there is a lack of well-established horse-related browsers or databases. In order to better understand horses, more variants and other integrated information are needed. Thus, we construct a horse genomic variants database including expression and other information. Horse Single Nucleotide Polymorphism and Expression Database (HSDB (http://snugenome2.snu.ac.kr/HSDB provides the number of unexplored genomic variants still remaining to be identified in the horse genome including rare variants by using population genome sequences of eighteen horses and RNA-seq of four horses. The identified single nucleotide polymorphisms (SNPs were confirmed by comparing them with SNP chip data and variants of RNA-seq, which showed a concordance level of 99.02% and 96.6%, respectively. Moreover, the database provides the genomic variants with their corresponding transcriptional profiles from the same individuals to help understand the functional aspects of these variants. The database will contribute to genetic improvement and breeding strategies of Thoroughbreds.

  11. The Inflammasome in Host Defense

    Directory of Open Access Journals (Sweden)

    Gang Chen

    2009-12-01

    Full Text Available Nod-like receptors have emerged as an important family of sensors in host defense. These receptors are expressed in macrophages, dendritic cells and monocytes and play an important role in microbial immunity. Some Nod-like receptors form the inflammasome, a protein complex that activates caspase-1 in response to several stimuli. Caspase-1 activation leads to processing and secretion of pro-inflammatory cytokines such as interleukin (IL-1β and IL-18. Here, we discuss recent advances in the inflammasome field with an emphasis on host defense. We also compare differential requirements for inflammasome activation in dendritic cells, macrophages and monocytes.

  12. Host factors influencing viral persistence

    DEFF Research Database (Denmark)

    Thomsen, Allan Randrup; Nansen, A; Ørding Andreasen, Susanne

    2000-01-01

    host were used. Our results reveal that very different outcomes may be observed depending on virus strain and immunocompetence of the host. Thus while CD4+ cells are not critical during the initial phase of virus control, infectious virus reappear in mice lacking CD4+ cells, B cells or CD40 ligand...... replication, mice lacking the ability to produce interferon-gamma may develop either a severe, mostly fatal, T-cell mediated wasting syndrome or a chronic infection characterized by long-term coexistence of antiviral cytotoxic T lymphocytes and infectious virus. Mathematical modelling indicates...

  13. Genetic diversity and distribution patterns of host insects of Caterpillar Fungus Ophiocordyceps sinensis in the Qinghai-Tibet Plateau.

    Directory of Open Access Journals (Sweden)

    Qing-Mei Quan

    Full Text Available The caterpillar fungus Ophiocordyceps sinensis is one of the most valuable medicinal fungi in the world, and it requires host insects in family Hepialidae (Lepidoptera to complete its life cycle. However, the genetic diversity and phylogeographic structures of the host insects remain to be explored. We analyzed the genetic diversity and temporal and spatial distribution patterns of genetic variation of the host insects throughout the O. sinensis distribution. Abundant haplotype and nucleotide diversity mainly existed in the areas of Nyingchi, ShangriLa, and around the edge of the Qinghai-Tibet Plateau, where are considered as the diversity center or micro-refuges of the host insects of O. sinensis. However, there was little genetic variation among host insects from 72.1% of all populations, indicating that the host species composition might be relatively simple in large-scale O. sinensis populations. All host insects are monophyletic except for those from four O. sinensis populations around Qinghai Lake. Significant phylogeographic structure (NST>GST, P<0.05 was revealed for the monophyletic host insects, and the three major phylogenetic groups corresponded with specific geographical areas. The divergence of most host insects was estimated to have occurred at ca. 3.7 Ma, shortly before the rapid uplift of the QTP. The geographical distribution and star-like network of the haplotypes implied that most host insects were derived from the relicts of a once-widespread host that subsequently became fragmented. Neutrality tests, mismatch distribution analysis, and expansion time estimation confirmed that most host insects presented recent demographic expansions that began ca. 0.118 Ma in the late Pleistocene. Therefore, the genetic diversity and distribution of the present-day insects should be attributed to effects of the Qinghai-Tibet Plateau uplift and glacial advance/retreat cycles during the Quaternary ice age. These results provide valuable

  14. Schistosome tegumental ecto-apyrase (SmATPDase1 degrades exogenous pro-inflammatory and pro-thrombotic nucleotides

    Directory of Open Access Journals (Sweden)

    Akram A. Da’dara

    2014-03-01

    Full Text Available Schistosomes are parasitic worms that can survive in the hostile environment of the human bloodstream where they appear refractory to both immune elimination and thrombus formation. We hypothesize that parasite migration in the bloodstream can stress the vascular endothelium causing this tissue to release chemicals alerting responsive host cells to the stress. Such chemicals are called damage associated molecular patterns (DAMPs and among the most potent is the proinflammatory mediator, adenosine triphosphate (ATP. Furthermore, the ATP derivative ADP is a pro-thrombotic molecule that acts as a strong activator of platelets. Schistosomes are reported to possess at their host interactive tegumental surface a series of enzymes that could, like their homologs in mammals, degrade extracellular ATP and ADP. These are alkaline phosphatase (SmAP, phosphodiesterase (SmNPP-5 and ATP diphosphohydrolase (SmATPDase1. In this work we employ RNAi to knock down expression of the genes encoding these enzymes in the intravascular life stages of the parasite. We then compare the abilities of these parasites to degrade exogenously added ATP and ADP. We find that only SmATPDase1-suppressed parasites are significantly impaired in their ability to degrade these nucleotides. Suppression of SmAP or SmNPP-5 does not appreciably affect the worms’ ability to catabolize ATP or ADP. These findings are confirmed by the functional characterization of the enzymatically active, full-length recombinant SmATPDase1 expressed in CHO-S cells. The enzyme is a true apyrase; SmATPDase1 degrades ATP and ADP in a cation dependent manner. Optimal activity is seen at alkaline pH. The Km of SmATPDase1 for ATP is 0.4 ± 0.02 mM and for ADP, 0.252 ± 0.02 mM. The results confirm the role of tegumental SmATPDase1 in the degradation of the exogenous pro-inflammatory and pro-thrombotic nucleotides ATP and ADP by live intravascular stages of the parasite. By degrading host inflammatory signals

  15. Tracking Dengue Virus Intra-host Genetic Diversity during Human-to-Mosquito Transmission.

    Directory of Open Access Journals (Sweden)

    Shuzhen Sim

    Full Text Available Dengue virus (DENV infection of an individual human or mosquito host produces a dynamic population of closely-related sequences. This intra-host genetic diversity is thought to offer an advantage for arboviruses to adapt as they cycle between two very different host species, but it remains poorly characterized. To track changes in viral intra-host genetic diversity during horizontal transmission, we infected Aedes aegypti mosquitoes by allowing them to feed on DENV2-infected patients. We then performed whole-genome deep-sequencing of human- and matched mosquito-derived DENV samples on the Illumina platform and used a sensitive variant-caller to detect single nucleotide variants (SNVs within each sample. >90% of SNVs were lost upon transition from human to mosquito, as well as from mosquito abdomen to salivary glands. Levels of viral diversity were maintained, however, by the regeneration of new SNVs at each stage of transmission. We further show that SNVs maintained across transmission stages were transmitted as a unit of two at maximum, suggesting the presence of numerous variant genomes carrying only one or two SNVs each. We also present evidence for differences in selection pressures between human and mosquito hosts, particularly on the structural and NS1 genes. This analysis provides insights into how population drops during transmission shape RNA virus genetic diversity, has direct implications for virus evolution, and illustrates the value of high-coverage, whole-genome next-generation sequencing for understanding viral intra-host genetic diversity.

  16. Deep-Sea Hydrothermal Vent Viruses Compensate for Microbial Metabolism in Virus-Host Interactions.

    Science.gov (United States)

    He, Tianliang; Li, Hongyun; Zhang, Xiaobo

    2017-07-11

    Viruses are believed to be responsible for the mortality of host organisms. However, some recent investigations reveal that viruses may be essential for host survival. To date, it remains unclear whether viruses are beneficial or harmful to their hosts. To reveal the roles of viruses in the virus-host interactions, viromes and microbiomes of sediment samples from three deep-sea hydrothermal vents were explored in this study. To exclude the influence of exogenous DNAs on viromes, the virus particles were purified with nuclease (DNase I and RNase A) treatments and cesium chloride density gradient centrifugation. The metagenomic analysis of viromes without exogenous DNA contamination and microbiomes of vent samples indicated that viruses had compensation effects on the metabolisms of their host microorganisms. Viral genes not only participated in most of the microbial metabolic pathways but also formed branched pathways in microbial metabolisms, including pyrimidine metabolism; alanine, aspartate, and glutamate metabolism; nitrogen metabolism and assimilation pathways of the two-component system; selenocompound metabolism; aminoacyl-tRNA biosynthesis; and amino sugar and nucleotide sugar metabolism. As is well known, deep-sea hydrothermal vent ecosystems exist in relatively isolated environments which are barely influenced by other ecosystems. The metabolic compensation of hosts mediated by viruses might represent a very important aspect of virus-host interactions. IMPORTANCE Viruses are the most abundant biological entities in the oceans and have very important roles in regulating microbial community structure and biogeochemical cycles. The relationship between virus and host microbes is broadly thought to be that of predator and prey. Viruses can lyse host cells to control microbial population sizes and affect community structures of hosts by killing specific microbes. However, viruses also influence their hosts through manipulation of bacterial metabolism. We found

  17. Host Defence to Pulmonary Mycosis

    Directory of Open Access Journals (Sweden)

    Christopher H Mody

    1999-01-01

    Full Text Available OBJECTIVE: To provide a basic understanding of the mechanisms of host defense to pathogenic fungi. This will help physicians understand why some patients are predisposed to fungal infections and update basic scientists on how microbial immunology applies to fungal disease.

  18. Intercultural Competence in Host Students?

    DEFF Research Database (Denmark)

    Egekvist, Ulla Egidiussen; Lyngdorf, Niels Erik; Du, Xiangyun

    2016-01-01

    Although substantial work in intercultural education has been done on the intercultural competences of mobile students engaging in international study visits, there is a need to explore intercultural competences in host students. This chapter seeks to answer questions about the challenges...

  19. Host Event Based Network Monitoring

    Energy Technology Data Exchange (ETDEWEB)

    Jonathan Chugg

    2013-01-01

    The purpose of INL’s research on this project is to demonstrate the feasibility of a host event based network monitoring tool and the effects on host performance. Current host based network monitoring tools work on polling which can miss activity if it occurs between polls. Instead of polling, a tool could be developed that makes use of event APIs in the operating system to receive asynchronous notifications of network activity. Analysis and logging of these events will allow the tool to construct the complete real-time and historical network configuration of the host while the tool is running. This research focused on three major operating systems commonly used by SCADA systems: Linux, WindowsXP, and Windows7. Windows 7 offers two paths that have minimal impact on the system and should be seriously considered. First is the new Windows Event Logging API, and, second, Windows 7 offers the ALE API within WFP. Any future work should focus on these methods.

  20. The Rac-RhoGDI complex and the structural basis for the regulation of Rho proteins by RhoGDI

    DEFF Research Database (Denmark)

    Scheffzek, K; Stephan, I; Jensen, Ole Nørregaard

    2000-01-01

    Rho family-specific guanine nucleotide dissociation inhibitors (RhoGDIs) decrease the rate of nucleotide dissociation and release Rho proteins such as RhoA, Rac and Cdc42 from membranes, forming tight complexes that shuttle between cytosol and membrane compartments. We have solved the crystal...

  1. Effect of oligonucleotide primers in determining viral variability within hosts

    Directory of Open Access Journals (Sweden)

    Moya Andrés

    2004-12-01

    Full Text Available Abstract Background Genetic variability in viral populations is usually estimated by means of polymerase chain reaction (PCR based methods in which the relative abundance of each amplicon is assumed to be proportional to the frequency of the corresponding template in the initial sample. Although bias in template-to-product ratios has been described before, its relevance in describing viral genetic variability at the intrapatient level has not been fully assessed yet. Results To investigate the role of oligonucleotide design in estimating viral variability within hosts, genetic diversity in hepatitis C virus (HCV populations from eight infected patients was characterised by two parallel PCR amplifications performed with two slightly different sets of primers, followed by cloning and sequencing (mean = 89 cloned sequences per patient. Population genetics analyses of viral populations recovered by pairs of amplifications revealed that in seven patients statistically significant differences were detected between populations sampled with different set of primers. Conclusions Genetic variability analyses demonstrates that PCR selection due to the choice of primers, differing in their degeneracy degree at some nucleotide positions, can eclipse totally or partially viral variants, hence yielding significant different estimates of viral variability within a single patient and therefore eventually producing quite different qualitative and quantitative descriptions of viral populations within each host.

  2. Effect of oligonucleotide primers in determining viral variability within hosts.

    Science.gov (United States)

    Bracho, Maria Alma; García-Robles, Inmaculada; Jiménez, Nuria; Torres-Puente, Manuela; Moya, Andrés; González-Candelas, Fernando

    2004-12-09

    Genetic variability in viral populations is usually estimated by means of polymerase chain reaction (PCR) based methods in which the relative abundance of each amplicon is assumed to be proportional to the frequency of the corresponding template in the initial sample. Although bias in template-to-product ratios has been described before, its relevance in describing viral genetic variability at the intrapatient level has not been fully assessed yet. To investigate the role of oligonucleotide design in estimating viral variability within hosts, genetic diversity in hepatitis C virus (HCV) populations from eight infected patients was characterised by two parallel PCR amplifications performed with two slightly different sets of primers, followed by cloning and sequencing (mean = 89 cloned sequences per patient). Population genetics analyses of viral populations recovered by pairs of amplifications revealed that in seven patients statistically significant differences were detected between populations sampled with different set of primers. Genetic variability analyses demonstrates that PCR selection due to the choice of primers, differing in their degeneracy degree at some nucleotide positions, can eclipse totally or partially viral variants, hence yielding significant different estimates of viral variability within a single patient and therefore eventually producing quite different qualitative and quantitative descriptions of viral populations within each host.

  3. Variation in RNA virus mutation rates across host cells.

    Directory of Open Access Journals (Sweden)

    Marine Combe

    2014-01-01

    Full Text Available It is well established that RNA viruses exhibit higher rates of spontaneous mutation than DNA viruses and microorganisms. However, their mutation rates vary amply, from 10(-6 to 10(-4 substitutions per nucleotide per round of copying (s/n/r and the causes of this variability remain poorly understood. In addition to differences in intrinsic fidelity or error correction capability, viral mutation rates may be dependent on host factors. Here, we assessed the effect of the cellular environment on the rate of spontaneous mutation of the vesicular stomatitis virus (VSV, which has a broad host range and cell tropism. Luria-Delbrück fluctuation tests and sequencing showed that VSV mutated similarly in baby hamster kidney, murine embryonic fibroblasts, colon cancer, and neuroblastoma cells (approx. 10(-5 s/n/r. Cell immortalization through p53 inactivation and oxygen levels (1-21% did not have a significant impact on viral replication fidelity. This shows that previously published mutation rates can be considered reliable despite being based on a narrow and artificial set of laboratory conditions. Interestingly, we also found that VSV mutated approximately four times more slowly in various insect cells compared with mammalian cells. This may contribute to explaining the relatively slow evolution of VSV and other arthropod-borne viruses in nature.

  4. Computational learning on specificity-determining residue-nucleotide interactions

    KAUST Repository

    Wong, Ka-Chun; Li, Yue; Peng, Chengbin; Moses, Alan M.; Zhang, Zhaolei

    2015-01-01

    The protein–DNA interactions between transcription factors and transcription factor binding sites are essential activities in gene regulation. To decipher the binding codes, it is a long-standing challenge to understand the binding mechanism across different transcription factor DNA binding families. Past computational learning studies usually focus on learning and predicting the DNA binding residues on protein side. Taking into account both sides (protein and DNA), we propose and describe a computational study for learning the specificity-determining residue-nucleotide interactions of different known DNA-binding domain families. The proposed learning models are compared to state-of-the-art models comprehensively, demonstrating its competitive learning performance. In addition, we describe and propose two applications which demonstrate how the learnt models can provide meaningful insights into protein–DNA interactions across different DNA binding families.

  5. Radicals of DNA and DNA nucleotides generated by ionising radiation

    International Nuclear Information System (INIS)

    Przybytniak, G.

    2004-01-01

    A first stage of cell processes leading to DNA damage of initiated by radical reactions. In a model system such transformations were generated by ionising radiation which involves production of electron loss and electron gain centers of the substrate and radical formation. Using cryogenic ESR spectroscopy it was found that the DNA nucleotides, which convert to radical anions upon electron capture undergo the separation of unpaired spin and charge due to protonation. Circular and linear dichroism studies enabled to conclude that iron ions(III) induce strong changes in the DNA helical structure indicating their coordination with nitrogen bases. The repair of DNA radicals produced via radiolytic oxidation, i.e. the guanine radical cation and the allyl type radical of thymine, is possible at elevated temperatures due to the involvement of sulphydryl groups. The influence of the thiol charge is then limited

  6. Nucleic acid and nucleotide-mediated synthesis of inorganic nanoparticles

    Science.gov (United States)

    Berti, Lorenzo; Burley, Glenn A.

    2008-02-01

    Since the advent of practical methods for achieving DNA metallization, the use of nucleic acids as templates for the synthesis of inorganic nanoparticles (NPs) has become an active area of study. It is now widely recognized that nucleic acids have the ability to control the growth and morphology of inorganic NPs. These biopolymers are particularly appealing as templating agents as their ease of synthesis in conjunction with the possibility of screening nucleotide composition, sequence and length, provides the means to modulate the physico-chemical properties of the resulting NPs. Several synthetic procedures leading to NPs with interesting photophysical properties as well as studies aimed at rationalizing the mechanism of nucleic acid-templated NP synthesis are now being reported. This progress article will outline the current understanding of the nucleic acid-templated process and provides an up to date reference in this nascent field.

  7. Environmental heat stress, hyperammonemia and nucleotide metabolism during intermittent exercise

    DEFF Research Database (Denmark)

    Mohr, Magni; Rasmussen, Peter; Drust, Barry

    2006-01-01

    ) followed by five 15 s all-out sprints. Control trials were conducted in a 20°C environment while heat stress trials were performed at an ambient temperature of 40°C. Muscle biopsies and venous blood samples were obtained at rest, after 40 min of exercise and following the maximal sprints. Following......Abstract  This study investigated the influence of environmental heat stress on ammonia (NH3) accumulation in relation to nucleotide metabolism and fatigue during intermittent exercise. Eight males performed 40 min of intermittent exercise (15 s at 306±22 W alternating with 15 s of unloaded cycling...... exercise with heat stress, the core and muscle temperatures peaked at 39.5±0.2 and 40.2±0.2°C to be ~ 1°C higher (Pheat stress trial (P

  8. Computational learning on specificity-determining residue-nucleotide interactions

    KAUST Repository

    Wong, Ka-Chun

    2015-11-02

    The protein–DNA interactions between transcription factors and transcription factor binding sites are essential activities in gene regulation. To decipher the binding codes, it is a long-standing challenge to understand the binding mechanism across different transcription factor DNA binding families. Past computational learning studies usually focus on learning and predicting the DNA binding residues on protein side. Taking into account both sides (protein and DNA), we propose and describe a computational study for learning the specificity-determining residue-nucleotide interactions of different known DNA-binding domain families. The proposed learning models are compared to state-of-the-art models comprehensively, demonstrating its competitive learning performance. In addition, we describe and propose two applications which demonstrate how the learnt models can provide meaningful insights into protein–DNA interactions across different DNA binding families.

  9. Genome-wide patterns of nucleotide polymorphism in domesticated rice

    DEFF Research Database (Denmark)

    Caicedo, Ana L; Williamson, Scott H; Hernandez, Ryan D

    2007-01-01

    Domesticated Asian rice (Oryza sativa) is one of the oldest domesticated crop species in the world, having fed more people than any other plant in human history. We report the patterns of DNA sequence variation in rice and its wild ancestor, O. rufipogon, across 111 randomly chosen gene fragments......, and use these to infer the evolutionary dynamics that led to the origins of rice. There is a genome-wide excess of high-frequency derived single nucleotide polymorphisms (SNPs) in O. sativa varieties, a pattern that has not been reported for other crop species. We developed several alternative models...... to explain contemporary patterns of polymorphisms in rice, including a (i) selectively neutral population bottleneck model, (ii) bottleneck plus migration model, (iii) multiple selective sweeps model, and (iv) bottleneck plus selective sweeps model. We find that a simple bottleneck model, which has been...

  10. Computational identification of candidate nucleotide cyclases in higher plants

    KAUST Repository

    Wong, Aloysius Tze

    2013-09-03

    In higher plants guanylyl cyclases (GCs) and adenylyl cyclases (ACs) cannot be identified using BLAST homology searches based on annotated cyclic nucleotide cyclases (CNCs) of prokaryotes, lower eukaryotes, or animals. The reason is that CNCs are often part of complex multifunctional proteins with different domain organizations and biological functions that are not conserved in higher plants. For this reason, we have developed CNC search strategies based on functionally conserved amino acids in the catalytic center of annotated and/or experimentally confirmed CNCs. Here we detail this method which has led to the identification of >25 novel candidate CNCs in Arabidopsis thaliana, several of which have been experimentally confirmed in vitro and in vivo. We foresee that the application of this method can be used to identify many more members of the growing family of CNCs in higher plants. © Springer Science+Business Media New York 2013.

  11. High pressure {sup 31}P NMR spectroscopy on guanine nucleotides

    Energy Technology Data Exchange (ETDEWEB)

    Spoerner, Michael; Karl, Matthias; Lopes, Pedro; Hoering, Marcus; Loeffel, Karoline; Nuehs, Andrea; Adelsberger, Joseph; Kremer, Werner; Kalbitzer, Hans Robert, E-mail: hans-robert.kalbitzer@ur.de [University of Regensburg, Centre of Magnetic Resonance in Chemistry and Biomedicine, Institute of Biophysics and Physical Biochemistry (Germany)

    2017-01-15

    The {sup 31}P NMR pressure response of guanine nucleotides bound to proteins has been studied in the past for characterizing the pressure perturbation of conformational equilibria. The pressure response of the {sup 31}P NMR chemical shifts of the phosphate groups of GMP, GDP, and GTP as well as the commonly used GTP analogs GppNHp, GppCH{sub 2}p and GTPγS was measured in the absence and presence of Mg{sup 2+}-ions within a pressure range up to 200 MPa. The pressure dependence of chemical shifts is clearly non-linear. For all nucleotides a negative first order pressure coefficient B{sub 1} was determined indicating an upfield shift of the resonances with pressure. With exception of the α-phosphate group of Mg{sup 2+}·GMP and Mg{sup 2+}·GppNHp the second order pressure coefficients are positive. To describe the data of Mg{sup 2+}·GppCH{sub 2}p and GTPγS a Taylor expansion of 3rd order is required. For distinguishing pH effects from pressure effects a complete pH titration set is presented for GMP, as well as GDP and GTP in absence and presence of Mg{sup 2+} ions using indirect referencing to DSS under identical experimental conditions. By a comparison between high pressure {sup 31}P NMR data on free Mg{sup 2+}-GDP and Mg{sup 2+}-GDP in complex with the proto-oncogene Ras we demonstrate that pressure induced changes in chemical shift are clearly different between both forms.

  12. Location of Host and Host Habitat by Fruit Fly Parasitoids

    Directory of Open Access Journals (Sweden)

    Pascal Rousse

    2012-11-01

    Full Text Available Augmentative releases of parasitoids may be a useful tool for the area-wide management of tephritid pests. The latter are parasitized by many wasp species, though only a few of them are relevant for augmentative biocontrol purposes. To date, nearly all the actual or potential biocontrol agents for such programs are egg or larval Opiinae parasitoids (Hymenoptera: Braconidae. Here, we review the literature published on their habitat and host location behavior, as well as the factors that modulate this behavior, which is assumed to be sequential; parasitoids forage first for the host habitat and then for the host itself. Parasitoids rely on chemical, visual, and mechanical stimuli, often strongly related to their ecology. Behavioral modulation factors include biotic and abiotic factors including learning, climatic conditions and physiological state of the insect. Finally, conclusions and perspectives for future research are briefly highlighted. A detailed knowledge of this behavior may be very useful for selecting the release sites for both inundative/augmentative releases of mass-reared parasitoids and inoculative releases for classical biocontrol.

  13. Electrical detection and quantification of single and mixed DNA nucleotides in suspension

    Science.gov (United States)

    Ahmad, Mahmoud Al; Panicker, Neena G.; Rizvi, Tahir A.; Mustafa, Farah

    2016-09-01

    High speed sequential identification of the building blocks of DNA, (deoxyribonucleotides or nucleotides for short) without labeling or processing in long reads of DNA is the need of the hour. This can be accomplished through exploiting their unique electrical properties. In this study, the four different types of nucleotides that constitute a DNA molecule were suspended in a buffer followed by performing several types of electrical measurements. These electrical parameters were then used to quantify the suspended DNA nucleotides. Thus, we present a purely electrical counting scheme based on the semiconductor theory that allows one to determine the number of nucleotides in a solution by measuring their capacitance-voltage dependency. The nucleotide count was observed to be similar to the multiplication of the corresponding dopant concentration and debye volume after de-embedding the buffer contribution. The presented approach allows for a fast and label-free quantification of single and mixed nucleotides in a solution.

  14. Microarray analysis of gene expression profiles of Schistosoma japonicum derived from less-susceptible host water buffalo and susceptible host goat.

    Directory of Open Access Journals (Sweden)

    Jianmei Yang

    Full Text Available BACKGROUND: Water buffalo and goats are natural hosts for S. japonicum in endemic areas of China. The susceptibility of these two hosts to schistosome infection is different, as water buffalo are less conducive to S. japonicum growth and development. To identify genes that may affect schistosome development and survival, we compared gene expression profiles of schistosomes derived from these two natural hosts using high-throughput microarray technology. RESULTS: The worm recovery rate was lower and the length and width of worms from water buffalo were smaller compared to those from goats following S. japonicum infection for 7 weeks. Besides obvious morphological difference between the schistosomes derived from the two hosts, differences were also observed by scanning and transmission electron microscopy. Microarray analysis showed differentially expressed gene patterns for parasites from the two hosts, which revealed that genes related to lipid and nucleotide metabolism, as well as protein folding, sorting, and degradation were upregulated, while others associated with signal transduction, endocrine function, development, immune function, endocytosis, and amino acid/carbohydrate/glycan metabolism were downregulated in schistosomes from water buffalo. KEGG pathway analysis deduced that the differentially expressed genes mainly involved lipid metabolism, the MAPK and ErbB signaling pathways, progesterone-mediated oocyte maturation, dorso-ventral axis formation, reproduction, and endocytosis, etc. CONCLUSION: The microarray gene analysis in schistosomes derived from water buffalo and goats provide a useful platform to disclose differences determining S. japonicum host compatibility to better understand the interplay between natural hosts and parasites, and identify schistosome target genes associated with susceptibility to screen vaccine candidates.

  15. Genetic diversity and distribution patterns of host insects of Caterpillar Fungus Ophiocordyceps sinensis in the Qinghai-Tibet Plateau.

    Science.gov (United States)

    Quan, Qing-Mei; Chen, Ling-Ling; Wang, Xi; Li, Shan; Yang, Xiao-Ling; Zhu, Yun-Guo; Wang, Mu; Cheng, Zhou

    2014-01-01

    The caterpillar fungus Ophiocordyceps sinensis is one of the most valuable medicinal fungi in the world, and it requires host insects in family Hepialidae (Lepidoptera) to complete its life cycle. However, the genetic diversity and phylogeographic structures of the host insects remain to be explored. We analyzed the genetic diversity and temporal and spatial distribution patterns of genetic variation of the host insects throughout the O. sinensis distribution. Abundant haplotype and nucleotide diversity mainly existed in the areas of Nyingchi, ShangriLa, and around the edge of the Qinghai-Tibet Plateau, where are considered as the diversity center or micro-refuges of the host insects of O. sinensis. However, there was little genetic variation among host insects from 72.1% of all populations, indicating that the host species composition might be relatively simple in large-scale O. sinensis populations. All host insects are monophyletic except for those from four O. sinensis populations around Qinghai Lake. Significant phylogeographic structure (NST>GST, Pinsects, and the three major phylogenetic groups corresponded with specific geographical areas. The divergence of most host insects was estimated to have occurred at ca. 3.7 Ma, shortly before the rapid uplift of the QTP. The geographical distribution and star-like network of the haplotypes implied that most host insects were derived from the relicts of a once-widespread host that subsequently became fragmented. Neutrality tests, mismatch distribution analysis, and expansion time estimation confirmed that most host insects presented recent demographic expansions that began ca. 0.118 Ma in the late Pleistocene. Therefore, the genetic diversity and distribution of the present-day insects should be attributed to effects of the Qinghai-Tibet Plateau uplift and glacial advance/retreat cycles during the Quaternary ice age. These results provide valuable information to guide the protection and sustainable use of these host

  16. The Coding of Biological Information: From Nucleotide Sequence to Protein Recognition

    Science.gov (United States)

    Štambuk, Nikola

    The paper reviews the classic results of Swanson, Dayhoff, Grantham, Blalock and Root-Bernstein, which link genetic code nucleotide patterns to the protein structure, evolution and molecular recognition. Symbolic representation of the binary addresses defining particular nucleotide and amino acid properties is discussed, with consideration of: structure and metric of the code, direct correspondence between amino acid and nucleotide information, and molecular recognition of the interacting protein motifs coded by the complementary DNA and RNA strands.

  17. Comparative Genomics of Rhodococcus equi Virulence Plasmids Indicates Host-Driven Evolution of the vap Pathogenicity Island.

    Science.gov (United States)

    MacArthur, Iain; Anastasi, Elisa; Alvarez, Sonsiray; Scortti, Mariela; Vázquez-Boland, José A

    2017-05-01

    The conjugative virulence plasmid is a key component of the Rhodococcus equi accessory genome essential for pathogenesis. Three host-associated virulence plasmid types have been identified the equine pVAPA and porcine pVAPB circular variants, and the linear pVAPN found in bovine (ruminant) isolates. We recently characterized the R. equi pangenome (Anastasi E, et al. 2016. Pangenome and phylogenomic analysis of the pathogenic actinobacterium Rhodococcus equi. Genome Biol Evol. 8:3140-3148.) and we report here the comparative analysis of the virulence plasmid genomes. Plasmids within each host-associated type were highly similar despite their diverse origins. Variation was accounted for by scattered single nucleotide polymorphisms and short nucleotide indels, while larger indels-mostly in the plasticity region near the vap pathogencity island (PAI)-defined plasmid genomic subtypes. Only one of the plasmids analyzed, of pVAPN type, was exceptionally divergent due to accumulation of indels in the housekeeping backbone. Each host-associated plasmid type carried a unique PAI differing in vap gene complement, suggesting animal host-specific evolution of the vap multigene family. Complete conservation of the vap PAI was observed within each host-associated plasmid type. Both diversity of host-associated plasmid types and clonality of specific chromosomal-plasmid genomic type combinations were observed within the same R. equi phylogenomic subclade. Our data indicate that the overall strong conservation of the R. equi host-associated virulence plasmids is the combined result of host-driven selection, lateral transfer between strains, and geographical spread due to international livestock exchanges. © The Author(s) 2017. Published by Oxford University Press on behalf of the Society for Molecular Biology and Evolution.

  18. The immediate nucleotide precursor, guanosine triphosphate, in the riboflavin biosynthetic pathway

    International Nuclear Information System (INIS)

    Mitsuda, Hisateru; Nakajima, Kenji; Nadamoto, Tomonori

    1977-01-01

    In the present paper, the nucleotide precursor of riboflavin was investigated by experiments with labeled purines using non-growing cells of Eremothecium ashbyii. The added purines, at 10 -4 M, were effectively incorporated into riboflavin at an early stage of riboflavin biosynthesis under the experimental conditions. In particular, both labeled xanthine and labeled guanine were specifically transported to guanosine nucleotides, GMP, GDP, GDP-Mannose and GTP, in the course of the riboflavin biosynthesis. A comparison of specific activities of labeled guanosine nucleotides and labeled riboflavin indicated that the nucleotide precursor of riboflavin is guanosine triphosphate. From the results obtained, a biosynthetic pathway of riboflavin is proposed. (auth.)

  19. Nucleos: a web server for the identification of nucleotide-binding sites in protein structures.

    Science.gov (United States)

    Parca, Luca; Ferré, Fabrizio; Ausiello, Gabriele; Helmer-Citterich, Manuela

    2013-07-01

    Nucleos is a web server for the identification of nucleotide-binding sites in protein structures. Nucleos compares the structure of a query protein against a set of known template 3D binding sites representing nucleotide modules, namely the nucleobase, carbohydrate and phosphate. Structural features, clustering and conservation are used to filter and score the predictions. The predicted nucleotide modules are then joined to build whole nucleotide-binding sites, which are ranked by their score. The server takes as input either the PDB code of the query protein structure or a user-submitted structure in PDB format. The output of Nucleos is composed of ranked lists of predicted nucleotide-binding sites divided by nucleotide type (e.g. ATP-like). For each ranked prediction, Nucleos provides detailed information about the score, the template structure and the structural match for each nucleotide module composing the nucleotide-binding site. The predictions on the query structure and the template-binding sites can be viewed directly on the web through a graphical applet. In 98% of the cases, the modules composing correct predictions belong to proteins with no homology relationship between each other, meaning that the identification of brand-new nucleotide-binding sites is possible using information from non-homologous proteins. Nucleos is available at http://nucleos.bio.uniroma2.it/nucleos/.

  20. Hosting the first EDRS payload

    Science.gov (United States)

    Poncet, D.; Glynn, S.; Heine, F.

    2017-11-01

    The European Data Relay System (EDRS) will provide optical and microwave data relay services between Low Earth Orbit (LEO) satellites at altitudes up to 2000 km and the ground through geostationary (GEO) satellite nodes. Currently, two such nodes have been procured as part of a Public Private Partnership (PPP) between Astrium (now Airbus Defence and Space) and ESA. The first node (EDRS-A) is a hosted payload embarked upon the Eutelsat 9B satellite and scheduled for launch in early 2015.

  1. Host thin films incorporating nanoparticles

    Science.gov (United States)

    Qureshi, Uzma

    The focus of this research project was the investigation of the functional properties of thin films that incorporate a secondary nanoparticulate phase. In particular to assess if the secondary nanoparticulate material enhanced a functional property of the coating on glass. In order to achieve this, new thin film deposition methods were developed, namely use of nanopowder precursors, an aerosol assisted transport technique and an aerosol into atmospheric pressure chemical vapour deposition system. Aerosol assisted chemical vapour deposition (AACVD) was used to deposit 8 series of thin films on glass. Five different nanoparticles silver, gold, ceria, tungsten oxide and zinc oxide were tested and shown to successfully deposit thin films incorporating nanoparticles within a host matrix. Silver nanoparticles were synthesised and doped within a titania film by AACVD. This improved solar control properties. A unique aerosol assisted chemical vapour deposition (AACVD) into atmospheric pressure chemical vapour deposition (APCVD) system was used to deposit films of Au nanoparticles and thin films of gold nanoparticles incorporated within a host titania matrix. Incorporation of high refractive index contrast metal oxide particles within a host film altered the film colour. The key goal was to test the potential of nanopowder forms and transfer the suspended nanopowder via an aerosol to a substrate in order to deposit a thin film. Discrete tungsten oxide nanoparticles or ceria nanoparticles within a titanium dioxide thin film enhanced the self-cleaning and photo-induced super-hydrophilicity. The nanopowder precursor study was extended by deposition of zinc oxide thin films incorporating Au nanoparticles and also ZnO films deposited from a ZnO nanopowder precursor. Incorporation of Au nanoparticles within a VO: host matrix improved the thermochromic response, optical and colour properties. Composite VC/TiC and Au nanoparticle/V02/Ti02 thin films displayed three useful

  2. Evolutionary interpretations of mycobacteriophage biodiversity and host-range through the analysis of codon usage bias.

    Science.gov (United States)

    Esposito, Lauren A; Gupta, Swati; Streiter, Fraida; Prasad, Ashley; Dennehy, John J

    2016-10-01

    In an genomics course sponsored by the Howard Hughes Medical Institute (HHMI), undergraduate students have isolated and sequenced the genomes of more than 1,150 mycobacteriophages, creating the largest database of sequenced bacteriophages able to infect a single host, Mycobacterium smegmatis , a soil bacterium. Genomic analysis indicates that these mycobacteriophages can be grouped into 26 clusters based on genetic similarity. These clusters span a continuum of genetic diversity, with extensive genomic mosaicism among phages in different clusters. However, little is known regarding the primary hosts of these mycobacteriophages in their natural habitats, nor of their broader host ranges. As such, it is possible that the primary host of many newly isolated mycobacteriophages is not M. smegmatis , but instead a range of closely related bacterial species. However, determining mycobacteriophage host range presents difficulties associated with mycobacterial cultivability, pathogenicity and growth. Another way to gain insight into mycobacteriophage host range and ecology is through bioinformatic analysis of their genomic sequences. To this end, we examined the correlations between the codon usage biases of 199 different mycobacteriophages and those of several fully sequenced mycobacterial species in order to gain insight into the natural host range of these mycobacteriophages. We find that UPGMA clustering tends to match, but not consistently, clustering by shared nucleotide sequence identify. In addition, analysis of GC content, tRNA usage and correlations between mycobacteriophage and mycobacterial codon usage bias suggests that the preferred host of many clustered mycobacteriophages is not M. smegmatis but other, as yet unknown, members of the mycobacteria complex or closely allied bacterial species.

  3. Supramolecular Properties of Triazole-containing Two Armed Peptidomimetics: From Organogelators to Nucleotide-binding Tweezers

    Science.gov (United States)

    Chui, Tin Ki

    obtain a clearer picture on the mode of association of these two series of branched peptidomimetics, the length of the tripeptidomimetic arms was truncated to a dipeptide, and the amino acid, valine, was used for further studies. Both the two new candidates, 88-K-V2 and 89-B-V2, were shown to dimerize in chloroform as shown from vapor pressure osmometry (VPO) studies. 1H NMR titration experiments indicated a better dimerization strength for the latter candidate due to the intermolecular pi-pi interactions offered by its benzene ring in addition to the intermolecular hydrogen bonding by the amides and triazole units. H/D exchange and 2D NMR experiments, and molecular modeling revealed that 88-K-V2 dimerized through the formation of antiparallel beta-strands whereas formation of parallel beta-strands took place in 89-B-V2. Compound 88-K-V2 was found to form 1:1 complexes with chloride (Ka 640 M-1) and monobasic diethyl phosphate (DEP) ion (Ka 810 M-1) in chloroform. Interestingly, 89-B-V 2 was shown to form the usual 1:1 complex with the former ion (Ka 970 M-1) while forming an unexpected 2:1 complex with the latter with positive cooperativity. It was observed that both the amides and triazole protons were involved in anion-binding. In the 88-K-V2-DEP complex, the host formed a helix-like structure that wrapped around the anion located at the center of the complex as determined by 2D NMR and molecular modeling studies. Finally, further structural modification of 88-K-V2 gave a water-soluble nucleotide-binding tweezer 93-K-R2·4TFA . This tweezer consisted of four arginines (R), two triazole units, two pyrene probes and a small hydrophilic ethanolamine tail. Fluorescence study showed that this tweezer was able to form 1:1 complexes with different nucleotides in water with similar binding strength regardless of the number of phosphate groups present in the nucleotides. Moleular modeling suggested that such a charge-independent binding behavior was due to the similar number

  4. Biosynthesis of GDP-fucose and other sugar nucleotides in the blood stages of Plasmodium falciparum.

    Science.gov (United States)

    Sanz, Sílvia; Bandini, Giulia; Ospina, Diego; Bernabeu, Maria; Mariño, Karina; Fernández-Becerra, Carmen; Izquierdo, Luis

    2013-06-07

    Carbohydrate structures play important roles in many biological processes, including cell adhesion, cell-cell communication, and host-pathogen interactions. Sugar nucleotides are activated forms of sugars used by the cell as donors for most glycosylation reactions. Using a liquid chromatography-tandem mass spectrometry-based method, we identified and quantified the pools of UDP-glucose, UDP-galactose, UDP-N-acetylglucosamine, GDP-mannose, and GDP-fucose in Plasmodium falciparum intraerythrocytic life stages. We assembled these data with the in silico functional reconstruction of the parasite metabolic pathways obtained from the P. falciparum annotated genome, exposing new active biosynthetic routes crucial for further glycosylation reactions. Fucose is a sugar present in glycoconjugates often associated with recognition and adhesion events. Thus, the GDP-fucose precursor is essential in a wide variety of organisms. P. falciparum presents homologues of GDP-mannose 4,6-dehydratase and GDP-L-fucose synthase enzymes that are active in vitro, indicating that most GDP-fucose is formed by a de novo pathway that involves the bioconversion of GDP-mannose. Homologues for enzymes involved in a fucose salvage pathway are apparently absent in the P. falciparum genome. This is in agreement with in vivo metabolic labeling experiments showing that fucose is not significantly incorporated by the parasite. Fluorescence microscopy of epitope-tagged versions of P. falciparum GDP-mannose 4,6-dehydratase and GDP-L-fucose synthase expressed in transgenic 3D7 parasites shows that these enzymes localize in the cytoplasm of P. falciparum during the intraerythrocytic developmental cycle. Although the function of fucose in the parasite is not known, the presence of GDP-fucose suggests that the metabolite may be used for further fucosylation reactions.

  5. Biosynthesis of GDP-fucose and Other Sugar Nucleotides in the Blood Stages of Plasmodium falciparum*

    Science.gov (United States)

    Sanz, Sílvia; Bandini, Giulia; Ospina, Diego; Bernabeu, Maria; Mariño, Karina; Fernández-Becerra, Carmen; Izquierdo, Luis

    2013-01-01

    Carbohydrate structures play important roles in many biological processes, including cell adhesion, cell-cell communication, and host-pathogen interactions. Sugar nucleotides are activated forms of sugars used by the cell as donors for most glycosylation reactions. Using a liquid chromatography-tandem mass spectrometry-based method, we identified and quantified the pools of UDP-glucose, UDP-galactose, UDP-N-acetylglucosamine, GDP-mannose, and GDP-fucose in Plasmodium falciparum intraerythrocytic life stages. We assembled these data with the in silico functional reconstruction of the parasite metabolic pathways obtained from the P. falciparum annotated genome, exposing new active biosynthetic routes crucial for further glycosylation reactions. Fucose is a sugar present in glycoconjugates often associated with recognition and adhesion events. Thus, the GDP-fucose precursor is essential in a wide variety of organisms. P. falciparum presents homologues of GDP-mannose 4,6-dehydratase and GDP-l-fucose synthase enzymes that are active in vitro, indicating that most GDP-fucose is formed by a de novo pathway that involves the bioconversion of GDP-mannose. Homologues for enzymes involved in a fucose salvage pathway are apparently absent in the P. falciparum genome. This is in agreement with in vivo metabolic labeling experiments showing that fucose is not significantly incorporated by the parasite. Fluorescence microscopy of epitope-tagged versions of P. falciparum GDP-mannose 4,6-dehydratase and GDP-l-fucose synthase expressed in transgenic 3D7 parasites shows that these enzymes localize in the cytoplasm of P. falciparum during the intraerythrocytic developmental cycle. Although the function of fucose in the parasite is not known, the presence of GDP-fucose suggests that the metabolite may be used for further fucosylation reactions. PMID:23615908

  6. Carp erythrodermatitis : host defense-pathogen interaction

    OpenAIRE

    Pourreau, C.N.

    1990-01-01

    The outcome of a bacterial infection depends on the interaction between pathogen and host. The ability of the microbe to survive in the host depends on its invasive potential (i.e. spreading and multiplication), and its ability to obtain essential nutrients and to resist the host's defense system. On the other hand, the host's resistance to a bacterial attack depends on its physiological state, the intensity of the bacterial attack and the efficacy of the defense system to ...

  7. Microarray Beads for Identifying Blood Group Single Nucleotide Polymorphisms.

    Science.gov (United States)

    Drago, Francesca; Karpasitou, Katerina; Poli, Francesca

    2009-01-01

    We have developed a high-throughput system for single nucleotide polymorphism (SNP) genotyping of alleles of diverse blood group systems exploiting Luminex technology. The method uses specific oligonucleotide probes coupled to a specific array of fluorescent microspheres and is designed for typing Jk(a)/Jk(b), Fy(a)/Fy(b), S/s, K/k, Kp(a)/Kp(b), Js(a)/Js(b), Co(a)/Co(b) and Lu(a)/Lu(b) alleles. Briefly, two multiplex PCR reactions (PCR I and PCR II) according to the laboratory specific needs are set up. PCR I amplifies the alleles tested routinely, namely Jk(a)/Jk(b), Fy(a)/Fy(b), S/s, and K/k. PCR II amplifies those alleles that are typed less frequently. Biotinylated PCR products are hybridized in a single multiplex assay with the corresponding probe mixture. After incubation with R-phycoerythrin-conjugated streptavidin, the emitted fluorescence is analyzed with Luminex 100. So far, we have typed more than 2,000 subjects, 493 of whom with multiplex assay, and there have been no discrepancies with the serology results other than null and/or weak phenotypes. The cost of consumables and reagents for typing a single biallelic pair per sample is less than EUR 3.-, not including DNA extraction costs. The capability to perform multiplexed reactions makes the method markedly suitable for mass screening of red blood cell alleles. This genotyping approach represents an important tool in transfusion medicine.

  8. Implication of SUMO E3 ligases in nucleotide excision repair.

    Science.gov (United States)

    Tsuge, Maasa; Kaneoka, Hidenori; Masuda, Yusuke; Ito, Hiroki; Miyake, Katsuhide; Iijima, Shinji

    2015-08-01

    Post-translational modifications alter protein function to mediate complex hierarchical regulatory processes that are crucial to eukaryotic cellular function. The small ubiquitin-like modifier (SUMO) is an important post-translational modification that affects transcriptional regulation, nuclear localization, and the maintenance of genome stability. Nucleotide excision repair (NER) is a very versatile DNA repair system that is essential for protection against ultraviolet (UV) irradiation. The deficiencies in NER function remarkably increase the risk of skin cancer. Recent studies have shown that several NER factors are SUMOylated, which influences repair efficiency. However, how SUMOylation modulates NER has not yet been elucidated. In the present study, we performed RNAi knockdown of SUMO E3 ligases and found that, in addition to PIASy, the polycomb protein Pc2 affected the repair of cyclobutane pyrimidine dimers. PIAS1 affected both the removal of 6-4 pyrimidine pyrimidone photoproducts and cyclobutane pyrimidine dimers, whereas other SUMO E3 ligases did not affect the removal of either UV lesion.

  9. Base Sequence Context Effects on Nucleotide Excision Repair

    Directory of Open Access Journals (Sweden)

    Yuqin Cai

    2010-01-01

    Full Text Available Nucleotide excision repair (NER plays a critical role in maintaining the integrity of the genome when damaged by bulky DNA lesions, since inefficient repair can cause mutations and human diseases notably cancer. The structural properties of DNA lesions that determine their relative susceptibilities to NER are therefore of great interest. As a model system, we have investigated the major mutagenic lesion derived from the environmental carcinogen benzo[a]pyrene (B[a]P, 10S (+-trans-anti-B[a]P-2-dG in six different sequence contexts that differ in how the lesion is positioned in relation to nearby guanine amino groups. We have obtained molecular structural data by NMR and MD simulations, bending properties from gel electrophoresis studies, and NER data obtained from human HeLa cell extracts for our six investigated sequence contexts. This model system suggests that disturbed Watson-Crick base pairing is a better recognition signal than a flexible bend, and that these can act in concert to provide an enhanced signal. Steric hinderance between the minor groove-aligned lesion and nearby guanine amino groups determines the exact nature of the disturbances. Both nearest neighbor and more distant neighbor sequence contexts have an impact. Regardless of the exact distortions, we hypothesize that they provide a local thermodynamic destabilization signal for repair.

  10. Myristoylated α subunits of guanine nucleotide-binding regulatory proteins

    International Nuclear Information System (INIS)

    Buss, J.E.; Mumby, S.M.; Casey, P.J.; Gilman, A.G.; Sefton, B.M.

    1987-01-01

    Antisera directed against specific subunits of guanine nucleotide-binding regulatory proteins (G proteins) were used to immunoprecipitate these polypeptides from metabolically labeled cells. This technique detects, in extracts of a human astrocytoma cell line, the α subunits of G/sub s/ (stimulatory) (α 45 and α 52 ), a 41-kDa subunit of G/sub i/ (inhibitory) (α 41 ), a 40-kDa protein (α 40 ), and the 36-kDa β subunit. No protein that comigrated with the α subunit of G 0 (unknown function) (α 39 ) was detected. In cells grown in the presence of [ 3 H]myristic acid, α 41 and α 40 contained 3 H label, while the β subunit did not. Chemical analysis of lipids attached covalently to purified α 41 and α 39 from bovine brain also revealed myristic acid. Similar analysis of brain G protein β and γ subunits and of G/sub t/ (Transducin) subunits (α, β, and γ) failed to reveal fatty acids. The fatty acid associated with α 41 , α 40 , and α 39 was stable to treatment with base, suggesting that the lipid is linked to the polypeptide via an amide bond. These GTP binding proteins are thus identified as members of a select group of proteins that contains myristic acid covalently attached to the peptide backbone. Myristate may play an important role in stabilizing interactions of G proteins with phospholipid or with membrane-bound proteins

  11. Nucleotide sequence of the human N-myc gene

    International Nuclear Information System (INIS)

    Stanton, L.W.; Schwab, M.; Bishop, J.M.

    1986-01-01

    Human neuroblastomas frequently display amplification and augmented expression of a gene known as N-myc because of its similarity to the protooncogene c-myc. It has therefore been proposed that N-myc is itself a protooncogene, and subsequent tests have shown that N-myc and c-myc have similar biological activities in cell culture. The authors have now detailed the kinship between N-myc and c-myc by determining the nucleotide sequence of human N-myc and deducing the amino acid sequence of the protein encoded by the gene. The topography of N-myc is strikingly similar to that of c-myc: both genes contain three exons of similar lengths; the coding elements of both genes are located in the second and third exons; and both genes have unusually long 5' untranslated regions in their mRNAs, with features that raise the possibility that expression of the genes may be subject to similar controls of translation. The resemblance between the proteins encoded by N-myc and c-myc sustains previous suspicions that the genes encode related functions

  12. Expression of Vesicular Nucleotide Transporter in Rat Odontoblasts

    International Nuclear Information System (INIS)

    Ikeda, Erina; Goto, Tetsuya; Gunjigake, Kaori; Kuroishi, Kayoko; Ueda, Masae; Kataoka, Shinji; Toyono, Takashi; Nakatomi, Mitsushiro; Seta, Yuji; Kitamura, Chiaki; Nishihara, Tatsuji; Kawamoto, Tatsuo

    2016-01-01

    Several theories have been proposed regarding pain transmission mechanisms in tooth. However, the exact signaling mechanism from odontoblasts to pulp nerves remains to be clarified. Recently, ATP-associated pain transmission has been reported, but it is unclear whether ATP is involved in tooth pain transmission. In the present study, we focused on the vesicular nucleotide transporter (VNUT), a transporter of ATP into vesicles, and examined whether VNUT was involved in ATP release from odontoblasts. We examined the expression of VNUT in rat pulp by RT-PCR and immunostaining. ATP release from cultured odontoblast-like cells with heat stimulation was evaluated using ATP luciferase methods. VNUT was expressed in pulp tissue, and the distribution of VNUT-immunopositive vesicles was confirmed in odontoblasts. In odontoblasts, some VNUT-immunopositive vesicles were colocalized with membrane fusion proteins. Additionally P2X 3 , an ATP receptor, immunopositive axons were distributed between odontoblasts. The ATP release by thermal stimulation from odontoblast-like cells was inhibited by the addition of siRNA for VNUT. These findings suggest that cytosolic ATP is transported by VNUT and that the ATP in the vesicles is then released from odontoblasts to ATP receptors on axons. ATP vesicle transport in odontoblasts seems to be a key mechanism for signal transduction from odontoblasts to axons in the pulp

  13. Implication of Posttranslational Histone Modifications in Nucleotide Excision Repair

    Directory of Open Access Journals (Sweden)

    Shisheng Li

    2012-09-01

    Full Text Available Histones are highly alkaline proteins that package and order the DNA into chromatin in eukaryotic cells. Nucleotide excision repair (NER is a conserved multistep reaction that removes a wide range of generally bulky and/or helix-distorting DNA lesions. Although the core biochemical mechanism of NER is relatively well known, how cells detect and repair lesions in diverse chromatin environments is still under intensive research. As with all DNA-related processes, the NER machinery must deal with the presence of organized chromatin and the physical obstacles it presents. A huge catalogue of posttranslational histone modifications has been documented. Although a comprehensive understanding of most of these modifications is still lacking, they are believed to be important regulatory elements for many biological processes, including DNA replication and repair, transcription and cell cycle control. Some of these modifications, including acetylation, methylation, phosphorylation and ubiquitination on the four core histones (H2A, H2B, H3 and H4 or the histone H2A variant H2AX, have been found to be implicated in different stages of the NER process. This review will summarize our recent understanding in this area.

  14. Adenine nucleotide translocator transports haem precursors into mitochondria.

    Directory of Open Access Journals (Sweden)

    Motoki Azuma

    2008-08-01

    Full Text Available Haem is a prosthetic group for haem proteins, which play an essential role in oxygen transport, respiration, signal transduction, and detoxification. In haem biosynthesis, the haem precursor protoporphyrin IX (PP IX must be accumulated into the mitochondrial matrix across the inner membrane, but its mechanism is largely unclear. Here we show that adenine nucleotide translocator (ANT, the inner membrane transporter, contributes to haem biosynthesis by facilitating mitochondrial accumulation of its precursors. We identified that haem and PP IX specifically bind to ANT. Mitochondrial uptake of PP IX was inhibited by ADP, a known substrate of ANT. Conversely, ADP uptake into mitochondria was competitively inhibited by haem and its precursors, suggesting that haem-related porphyrins are accumulated into mitochondria via ANT. Furthermore, disruption of the ANT genes in yeast resulted in a reduction of haem biosynthesis by blocking the translocation of haem precursors into the matrix. Our results represent a new model that ANT plays a crucial role in haem biosynthesis by facilitating accumulation of its precursors into the mitochondrial matrix.

  15. Single Nucleotide Polymorphism Identification, Characterization, and Linkage Mapping in Quinoa

    Directory of Open Access Journals (Sweden)

    P. J. Maughan

    2012-11-01

    Full Text Available Quinoa ( Willd. is an important seed crop throughout the Andean region of South America. It is important as a regional food security crop for millions of impoverished rural inhabitants of the Andean Altiplano (high plains. Efforts to improve the crop have led to an increased focus on genetic research. We report the identification of 14,178 putative single nucleotide polymorphisms (SNPs using a genomic reduction protocol as well as the development of 511 functional SNP assays. The SNP assays are based on KASPar genotyping chemistry and were detected using the Fluidigm dynamic array platform. A diversity screen of 113 quinoa accessions showed that the minor allele frequency (MAF of the SNPs ranged from 0.02 to 0.50, with an average MAF of 0.28. Structure analysis of the quinoa diversity panel uncovered the two major subgroups corresponding to the Andean and coastal quinoa ecotypes. Linkage mapping of the SNPs in two recombinant inbred line populations produced an integrated linkage map consisting of 29 linkage groups with 20 large linkage groups, spanning 1404 cM with a marker density of 3.1 cM per SNP marker. The SNPs identified here represent important genomic tools needed in emerging plant breeding programs for advanced genetic analysis of agronomic traits in quinoa.

  16. Domestication rewired gene expression and nucleotide diversity patterns in tomato.

    Science.gov (United States)

    Sauvage, Christopher; Rau, Andrea; Aichholz, Charlotte; Chadoeuf, Joël; Sarah, Gautier; Ruiz, Manuel; Santoni, Sylvain; Causse, Mathilde; David, Jacques; Glémin, Sylvain

    2017-08-01

    Plant domestication has led to considerable phenotypic modifications from wild species to modern varieties. However, although changes in key traits have been well documented, less is known about the underlying molecular mechanisms, such as the reduction of molecular diversity or global gene co-expression patterns. In this study, we used a combination of gene expression and population genetics in wild and crop tomato to decipher the footprints of domestication. We found a set of 1729 differentially expressed genes (DEG) between the two genetic groups, belonging to 17 clusters of co-expressed DEG, suggesting that domestication affected not only individual genes but also regulatory networks. Five co-expression clusters were enriched in functional terms involving carbohydrate metabolism or epigenetic regulation of gene expression. We detected differences in nucleotide diversity between the crop and wild groups specific to DEG. Our study provides an extensive profiling of the rewiring of gene co-expression induced by the domestication syndrome in one of the main crop species. © 2017 The Authors The Plant Journal © 2017 John Wiley & Sons Ltd.

  17. Nucleotide diversity and linkage disequilibrium in five Lolium perenne genes with putative role in shoot branching

    DEFF Research Database (Denmark)

    Brazauskas, Gintaras; Pašakinskienė, Izolda; Asp, Torben

    2010-01-01

    Knowledge on nucleotide diversity and linkage disequilibrium (LD) patterns is prerequisite for association analyses. However, little is known about the nucleotide diversity in the evolutionary important ryegrass shoot morphology genes. Five candidate genes, LpIAA1, LpRUB1, LpBRI1, LpSHOOT1 and Lp...

  18. Direct detection of single-nucleotide polymorphisms in bacterial DNA by SNPtrap

    DEFF Research Database (Denmark)

    Grønlund, Hugo Ahlm; Moen, Birgitte; Hoorfar, Jeffrey

    2011-01-01

    A major challenge with single-nucleotide polymorphism (SNP) fingerprinting of bacteria and higher organisms is the combination of genome-wide screenings with the potential of multiplexing and accurate SNP detection. Single-nucleotide extension by the minisequencing principle represents a technolo...

  19. A novel Y-xylosidase, nucleotide sequence encoding it and use thereof.

    NARCIS (Netherlands)

    Graaff, de L.H.; Peij, van N.N.M.E.; Broeck, van den H.C.; Visser, J.

    1996-01-01

    A nucleotide sequence is provided which encodes a peptide having beta-xylosidase activity and exhibits at least 30mino acid identity with the amino acid sequence shown in SEQ ID NO. 1 or hybridises under stringent conditions with a nucleotide sequence shown in SEQ ID NO. 1, or a part thereof having

  20. The nucleotide sequence of satellite RNA in grapevine fanleaf virus, strain F13.

    Science.gov (United States)

    Fuchs, M; Pinck, M; Serghini, M A; Ravelonandro, M; Walter, B; Pinck, L

    1989-04-01

    The nucleotide sequence of cDNA copies of grapevine fanleaf virus (strain F13) satellite RNA has been determined. The primary structure obtained was 1114 nucleotides in length, excluding the poly(A) tail, and contained only one long open reading frame encoding a 341 residue, highly hydrophilic polypeptide of Mr37275. The coding sequence was bordered by a leader of 14 nucleotides and a 3'-terminal non-coding region of 74 nucleotides. No homology has been found with small satellite RNAs associated with other nepoviruses. Two limited homologies of eight nucleotides have been detected between the satellite RNA in grapevine fanleaf virus and those in tomato black ring virus, and a consensus sequence U.G/UGAAAAU/AU/AU/A at the 5' end of nepovirus RNAs is reported. A less extended consensus exists in this region in comovirus and picornavirus RNA.

  1. Polarisation of Major Histocompatibility Complex II Host Genotype with Pathogenesis of European Brown Hare Syndrome Virus

    DEFF Research Database (Denmark)

    Iacovakis, Christos; Mamuris, Zissis; Moutou, Katerina A

    2013-01-01

    A study was conducted in order to determine the occurrence of European Brown Hare Syndrome virus (EBHSV) in Denmark and possible relation between disease pathogenesis and Major Histocompatibility Complex (MHC) host genotype. Liver samples were examined from 170 brown hares (hunted, found sick...... were found to be EBHSV-positive (RT-PCR, VP60 gene). In order to investigate associations between viral pathogenesis and host genotype, variation within the exon 2 DQA gene of MHC was assessed. DQA exon 2 analysis revealed the occurrence of seven different alleles in Denmark. Consistent with other...... populations examined so far in Europe, observed heterozygosity of DQA (H o = 0.1180) was lower than expected (H e = 0.5835). The overall variation for both nucleotide and amino acid differences (2.9% and 14.9%, respectively) were lower in Denmark than those assessed in other European countries (8.3% and 16...

  2. Phylogenetic relationships and host range of Rhizobium spp. that nodulate Phaseolus vulgaris L.

    Science.gov (United States)

    Hernandez-Lucas, I; Segovia, L; Martinez-Romero, E; Pueppke, S G

    1995-07-01

    We determined the nucleotide sequences of 16S rRNA gene segments from five Rhizobium strains that have been isolated from tropical legume species. All share the capacity to nodulate Phaseolus vulgaris L., the common bean. Phylogenetic analysis confirmed that these strains are of two different chromosomal lineages. We defined the host ranges of two strains of Rhizobium etli and three strains of R. tropici, comparing them with those of the two most divergently related new strains. Twenty-two of the 43 tested legume species were nodulated by three or more of these strains. All seven strains have broad host ranges that include woody species such as Albizia lebbeck, Gliricidia maculata, and Leucaena leucocephala.

  3. Host evasion by Burkholderia cenocepacia

    Directory of Open Access Journals (Sweden)

    Shyamala eGanesan

    2012-01-01

    Full Text Available Burkholderia cenocepacia is an opportunistic respiratory pathogen of individuals with cystic fibrosis (CF. It is one of the highly transmissible species of Burkholderia cepacia complex and very resistant to almost all the antibiotics. Approximately 1/3rd of B. cenocepacia infected CF patients go on to develop fatal ‘cepacia syndrome’. During the last two decades, substantial progress has been made with regards to evasion of host innate defense mechanisms by B. cenocepacia. Almost all strains of B. cenocepacia has capacity to survive and replicate intracellularly in both airway epithelial cells and macrophages, which are primary centennials of the lung and play a pivotal role in clearance of infecting bacteria. Some strains of B. cenocepaica, which express cable pili and the associated 22kDa adhesin are also capable of transmigrating across airway epithelium and persist in mouse models of infection. In this review, we will discuss how this type of interaction between B. cenocepacia and host may lead to persistence of bacteria and contribute to lung inflammation in CF patients.

  4. R3D Align web server for global nucleotide to nucleotide alignments of RNA 3D structures.

    Science.gov (United States)

    Rahrig, Ryan R; Petrov, Anton I; Leontis, Neocles B; Zirbel, Craig L

    2013-07-01

    The R3D Align web server provides online access to 'RNA 3D Align' (R3D Align), a method for producing accurate nucleotide-level structural alignments of RNA 3D structures. The web server provides a streamlined and intuitive interface, input data validation and output that is more extensive and easier to read and interpret than related servers. The R3D Align web server offers a unique Gallery of Featured Alignments, providing immediate access to pre-computed alignments of large RNA 3D structures, including all ribosomal RNAs, as well as guidance on effective use of the server and interpretation of the output. By accessing the non-redundant lists of RNA 3D structures provided by the Bowling Green State University RNA group, R3D Align connects users to structure files in the same equivalence class and the best-modeled representative structure from each group. The R3D Align web server is freely accessible at http://rna.bgsu.edu/r3dalign/.

  5. Characterization of joining sites of a viral histone H4 on host insect chromosomes.

    Directory of Open Access Journals (Sweden)

    Sunil Kumar

    Full Text Available A viral histone H4 (CpBV-H4 is encoded in a polydnavirus, Cotesia plutellae bracovirus (CpBV. It plays a crucial role in parasitism of an endoparasitoid wasp, C. plutellae, against diamondback moth, Plutella xylostella, by altering host gene expression in an epigenetic mode by its N-terminal tail after joining host nucleosomes. Comparative transcriptomic analysis between parasitized and nonparasitized P. xylostella by RNA-Seq indicated that 1,858 genes were altered at more than two folds in expression levels at late parasitic stage, including 877 up-regulated genes and 981 down-regulated genes. Among parasitic factors altering host gene expression, CpBV-H4 alone explained 16.3% of these expressional changes. To characterize the joining sites of CpBV-H4 on host chromosomes, ChIP-Seq (chromatin immunoprecipitation followed by deep sequencing was applied to chromatins extracted from parasitized larvae. It identified specific 538 ChIP targets. Joining sites were rich (60.2% in AT sequence. Almost 40% of ChIP targets included short nucleotide repeat sequences presumably recognizable by transcriptional factors and chromatin remodeling factors. To further validate these CpBV-H4 targets, CpBV-H4 was transiently expressed in nonparasitized host at late larval stage and subjected to ChIP-Seq. Two kinds of ChIP-Seqs shared 51 core joining sites. Common targets were close (within 1 kb to genes regulated at expression levels by CpBV-H4. However, other host genes not close to CpBV-H4 joining sites were also regulated by CpBV-H4. These results indicate that CpBV-H4 joins specific chromatin regions of P. xylostella and controls about one sixth of the total host genes that were regulated by C. plutellae parasitism in an epigenetic mode.

  6. Host feeding in insect parasitoids: why destructively feed upon a host that excretes an alternative?

    NARCIS (Netherlands)

    Burger, J.S.M.; Reijnen, T.M.; Van Lenteren, J.C.; Vet, L.E.M.

    2004-01-01

    Host feeding is the consumption of host tissue by the adult female parasitoid. We studied the function of destructive host feeding and its advantage over non-destructive feeding on host-derived honeydew in the whitefly parasitoid Encarsia formosa Gahan (Hymenoptera: Aphelinidae). We allowed

  7. Patterns of evolution and host gene mimicry in influenza and other RNA viruses.

    Directory of Open Access Journals (Sweden)

    Benjamin D Greenbaum

    2008-06-01

    adapted to its human host and exhibits an extremely low CpG dinucleotide content. We believe that these observations directly show that the evolution of RNA viral genomes can be shaped by pressures observed in the host genome. As a possible explanation, we suggest that the strong selection pressures acting on these RNA viruses are most likely related to the innate immune response and to nucleotide motifs in the host DNA and RNAs.

  8. Actinides and rare earths complexation with adenosine phosphate nucleotides

    International Nuclear Information System (INIS)

    Mostapha, Sarah

    2013-01-01

    Organophosphorus compounds are important molecules in both nuclear industry and living systems fields. Indeed, several extractants of organophosphorus compounds (such as TBP, HDEHP) are used in the nuclear fuel cycle reprocessing and in the biological field. For instance, the nucleotides are organophosphates which play a very important role in various metabolic processes. Although the literature on the interactions of actinides with inorganic phosphate is abundant, published studies with organophosphate compounds are generally limited to macroscopic and / or physiological approaches. The objective of this thesis is to study the structure of several organophosphorus compounds with actinides to reach a better understanding and develop new specific buildings blocks. The family of the chosen molecules for this procedure consists of three adenine nucleotides mono, bi and triphosphate (AMP, adenosine monophosphate - ADP, adenosine diphosphate - ATP, adenosine triphosphate) and an amino-alkylphosphate (AEP O-phosphoryl-ethanolamine). Complexes synthesis was conducted in aqueous and weakly acidic medium (2.8-4) for several lanthanides (III) (Lu, Yb, Eu) and actinides (U (VI), Th (IV) and Am (III)). Several analytical and spectroscopic techniques have been used to describe the organization of the synthesized complexes: spectrometric analysis performed by FTIR and NMR were used to identify the functional groups involved in the complexation, analysis by ESI-MS and pH-metric titration were used to determine the solution speciation and EXAFS analyzes were performed on Mars beamline of the SOLEIL synchrotron, have described the local cation environment, for both solution and solid compounds. Some theoretical approaches of DFT were conducted to identify stable structures in purpose of completing the experimental studies. All solid complexes (AMP, ADP, ATP and AEP) have polynuclear structures, while soluble ATP complexes are mononuclear. For all synthesized complexes, it has been

  9. Sequencing genes in silico using single nucleotide polymorphisms

    Directory of Open Access Journals (Sweden)

    Zhang Xinyi

    2012-01-01

    Full Text Available Abstract Background The advent of high throughput sequencing technology has enabled the 1000 Genomes Project Pilot 3 to generate complete sequence data for more than 906 genes and 8,140 exons representing 697 subjects. The 1000 Genomes database provides a critical opportunity for further interpreting disease associations with single nucleotide polymorphisms (SNPs discovered from genetic association studies. Currently, direct sequencing of candidate genes or regions on a large number of subjects remains both cost- and time-prohibitive. Results To accelerate the translation from discovery to functional studies, we propose an in silico gene sequencing method (ISS, which predicts phased sequences of intragenic regions, using SNPs. The key underlying idea of our method is to infer diploid sequences (a pair of phased sequences/alleles at every functional locus utilizing the deep sequencing data from the 1000 Genomes Project and SNP data from the HapMap Project, and to build prediction models using flanking SNPs. Using this method, we have developed a database of prediction models for 611 known genes. Sequence prediction accuracy for these genes is 96.26% on average (ranges 79%-100%. This database of prediction models can be enhanced and scaled up to include new genes as the 1000 Genomes Project sequences additional genes on additional individuals. Applying our predictive model for the KCNJ11 gene to the Wellcome Trust Case Control Consortium (WTCCC Type 2 diabetes cohort, we demonstrate how the prediction of phased sequences inferred from GWAS SNP genotype data can be used to facilitate interpretation and identify a probable functional mechanism such as protein changes. Conclusions Prior to the general availability of routine sequencing of all subjects, the ISS method proposed here provides a time- and cost-effective approach to broadening the characterization of disease associated SNPs and regions, and facilitating the prioritization of candidate

  10. Association of single nucleotide polymorphisms with radiation-induced esophagitis

    International Nuclear Information System (INIS)

    Zhang Li; Wang Lvhua; Yang Ming; Ji Wei; Zhao Lujun; Yang Weizhi; Zhou Zongmei; Ou Guangfei; Lin Dongxin

    2008-01-01

    Objective: To evaluate the relationship between single nucleotide polymorphism(SNP) of candidate genes and radiation-induced esophagitis (RIE) in patients with lung cancer. Methods: Between Jan. 2004 and Aug. 2006, 170 patients with pathologically diagnosed lung cancer were enrolled in this study. The total target dose was 45-70 Gy (median 60 Gy). One hundred and thirty-two patients were treated with three-dimensional conformal radiotherapy(3DCRT) and 38 with two-dimensional radiotherapy(2DRT). Forty-one patients received radiotherapy alone, 78 received sequential chemoradiotherapy and 51 received concurrent chemoradiotherapy. Thirty-seven SNPs in 20 DNA repair genes were analyzed by using PCR- based restricted fragment length polymorphism (RFLP). These genes were apoptosis and inflammatory cytokine genes including ATM, ERCC1, XRCC3, XRCCI, XPD, XPC, XPG, NBS1, STK15, ZNF350, ADPRT, TP53, FAS, FASL, CYP2D6*4, CASPASE8, COX2,TGF-β, CD14 and ACE. The endpoint was grade ≥2 R I E. Results: Forty of the 170 patients developed grade ≥2 R I E, including 36 in grade 2 and 4 in grade 3. Univariate analysis revealed that radiation technique and concurrent chemoradiotherapy were statistically significant relatives to the incidence of R I E (P=0.032, 0.049), and both of them had the trend associating with the esophagitis (P=0.072, 0.094). An increased incidence of esophagitis was observed associating with the TGF-β 1 -509T and XPD 751Lys/Lys genotypes (χ 2 =5.65, P=0.017; χ 2 =3.84, P=0.048) in multivariate analysis. Conclusions: Genetic polymorphisms in TGF-β 1 gene and XPD gene have a significant association with radiation-induced esophagitis. (authors)

  11. Association of prediabetes-associated single nucleotide polymorphisms with microalbuminuria.

    Science.gov (United States)

    Choi, Jong Wook; Moon, Shinje; Jang, Eun Jung; Lee, Chang Hwa; Park, Joon-Sung

    2017-01-01

    Increased glycemic exposure, even below the diagnostic criteria for diabetes mellitus, is crucial in the pathogenesis of diabetic microvascular complications represented by microalbuminuria. Nonetheless, there is limited evidence regarding which single nucleotide polymorphisms (SNPs) are associated with prediabetes and whether genetic predisposition to prediabetes is related to microalbuminuria, especially in the general population. Our objective was to answer these questions. We conducted a genomewide association study (GWAS) separately on two population-based cohorts, Ansung and Ansan, in the Korean Genome and Epidemiology Study (KoGES). The initial GWAS was carried out on the Ansung cohort, followed by a replication study on the Ansan cohort. A total of 5682 native Korean participants without a significant medical illness were classified into either control group (n = 3153) or prediabetic group (n = 2529). In the GWAS, we identified two susceptibility loci associated with prediabetes, one at 17p15.3-p15.1 in the GCK gene and another at 7p15.1 in YKT6. When variations in GCK and YKT6 were used as a model of prediabetes, this genetically determined prediabetes increased microalbuminuria. Multiple logistic regression analyses revealed that fasting glucose concentration in plasma and SNP rs2908289 in GCK were associated with microalbuminuria, and adjustment for age, gender, smoking history, systolic blood pressure, waist circumference, and serum triglyceride levels did not attenuate this association. Our results suggest that prediabetes and the associated SNPs may predispose to microalbuminuria before the diagnosis of diabetes mellitus. Further studies are needed to explore the details of the physiological and molecular mechanisms underlying this genetic association.

  12. Association of prediabetes-associated single nucleotide polymorphisms with microalbuminuria

    Science.gov (United States)

    Choi, Jong Wook; Moon, Shinje; Jang, Eun Jung; Lee, Chang Hwa; Park, Joon-Sung

    2017-01-01

    Increased glycemic exposure, even below the diagnostic criteria for diabetes mellitus, is crucial in the pathogenesis of diabetic microvascular complications represented by microalbuminuria. Nonetheless, there is limited evidence regarding which single nucleotide polymorphisms (SNPs) are associated with prediabetes and whether genetic predisposition to prediabetes is related to microalbuminuria, especially in the general population. Our objective was to answer these questions. We conducted a genomewide association study (GWAS) separately on two population-based cohorts, Ansung and Ansan, in the Korean Genome and Epidemiology Study (KoGES). The initial GWAS was carried out on the Ansung cohort, followed by a replication study on the Ansan cohort. A total of 5682 native Korean participants without a significant medical illness were classified into either control group (n = 3153) or prediabetic group (n = 2529). In the GWAS, we identified two susceptibility loci associated with prediabetes, one at 17p15.3-p15.1 in the GCK gene and another at 7p15.1 in YKT6. When variations in GCK and YKT6 were used as a model of prediabetes, this genetically determined prediabetes increased microalbuminuria. Multiple logistic regression analyses revealed that fasting glucose concentration in plasma and SNP rs2908289 in GCK were associated with microalbuminuria, and adjustment for age, gender, smoking history, systolic blood pressure, waist circumference, and serum triglyceride levels did not attenuate this association. Our results suggest that prediabetes and the associated SNPs may predispose to microalbuminuria before the diagnosis of diabetes mellitus. Further studies are needed to explore the details of the physiological and molecular mechanisms underlying this genetic association. PMID:28158221

  13. Deregulation of ocular nucleotide homeostasis in patients with diabetic retinopathy.

    Science.gov (United States)

    Loukovaara, Sirpa; Sandholm, Jouko; Aalto, Kristiina; Liukkonen, Janne; Jalkanen, Sirpa; Yegutkin, Gennady G

    2017-02-01

    Clear signaling roles for ATP and adenosine have been established in all tissues, including the eye. The magnitude of signaling responses is governed by networks of enzymes; however, little is known about the regulatory mechanisms of purinergic signaling in the eye. By employing thin-layer chromatographic assays with 3 H-labeled substrates, this study aimed to evaluate the role of nucleotide homeostasis in the pathogenesis of vitreoretinal diseases in humans. We have identified soluble enzymes ecto-5'-nucleotidase/CD73, adenylate kinase-1, and nucleoside diphosphate kinase in the vitreous fluid that control active cycling between pro-inflammatory ATP and anti-inflammatory adenosine. Strikingly, patients with proliferative form of diabetic retinopathy (DR) had higher adenylate kinase activity and ATP concentration, when compared to non-proliferative DR eyes and non-diabetic controls operated for rhegmatogenous retinal detachment, macular hole, and pucker. The non-parametric correlation analysis revealed positive correlations between intravitreal adenylate kinase and concentrations of ATP, ADP, and other angiogenic (angiopoietins-1 and -2), profibrotic (transforming growth factor-β1), and proteolytic (matrix metalloproteinase-9) factors but not erythropoietin and VEGF. Immunohistochemical staining of postmortem human retina additionally revealed selective expression of ecto-5'-nucleotidase/CD73 on the rod-and-cone-containing photoreceptor cells. Collectively, these findings provide novel insights into the regulatory mechanisms that influence purinergic signaling in diseased eye and open up new possibilities in the development of enzyme-targeted therapeutic approaches for prevention and treatment of DR. Ecto-5'-nucleotidase/CD73 and adenylate kinase-1 circulate in human vitreous fluid. Adenylate kinase activity is high in diabetic eyes with proliferative retinopathy. Diabetic eyes display higher intravitreal ATP/ADP ratio than non-diabetic controls. Soluble adenylate

  14. Ability of a Generalist Seed Beetle to Colonize an Exotic Host: Effects of Host Plant Origin and Oviposition Host.

    Science.gov (United States)

    Amarillo-Suárez, A; Repizo, A; Robles, J; Diaz, J; Bustamante, S

    2017-08-01

    The colonization of an exotic species by native herbivores is more likely to occur if that herbivore is a generalist. There is little information on the life-history mechanisms used by native generalist insects to colonize exotic hosts and how these mechanisms are affected by host properties. We examined the ability of the generalist seed beetle Stator limbatus Horn to colonize an exotic species. We compared its host preference, acceptability, performance, and egg size when ovipositing and developing on two native (Pithecellobium dulce (Roxb.) Benth and Senegalia riparia (Kunth)) and one exotic legume species (Leucaena leucocephala (Lam.)). We also analyzed the seed chemistry. We found that females recognize the exotic species as an unfavorable host for larval development and that they delayed oviposition and laid fewer and larger eggs on the exotic species than on the native species. Survivorship on the exotic host was 0%. Additionally, seeds of the native species contain five chemical compounds that are absent in the exotic species, and the exotic species contains three sterols, which are absent in the native legumes. Genetically based differences between beetles adapted to different hosts, plastic responses toward new hosts, and chemical differences among seeds are important in host colonization and recognition of the exotic host. In conclusion, the generalist nature of S. limbatus does not influence its ability to colonize L. leucocephala. Explanations for the colonization of exotic hosts by generalist native species and for the success of invasive species must be complemented with studies measuring local adaptation and plasticity.

  15. Degradation of brown adipocyte purine nucleotides regulates uncoupling protein 1 activity

    Directory of Open Access Journals (Sweden)

    Tobias Fromme

    2018-02-01

    Full Text Available Objective: Non-shivering thermogenesis in mammalian brown adipose tissue depends on thermogenic uncoupling protein 1. Its activity is triggered by free fatty acids while purine nucleotides mediate inhibition. During activation, it is thought that free fatty acids overcome purine-mediated inhibition. We measured the cellular concentration and the release of purine nucleotide metabolites to uncover a possible role of purine nucleotide degradation in uncoupling protein 1 activation. Methods: With mass spectrometry, purine nucleotide metabolites were quantified in cellular homogenates and supernatants of cultured primary brown adipocytes. We also determined oxygen consumption in response to a β-adrenergic agonist. Results: Upon adrenergic activation, brown adipocytes decreased the intracellular concentration of inhibitory nucleotides (ATP, ADP, GTP and GDP and released the respective degradation products. At the same time, an increase in cellular calcium occurred. None of these phenomena occurred in white adipocytes or myotubes. The brown adipocyte expression of enzymes implicated in purine metabolic remodeling is altered upon cold exposure. Pharmacological and genetic interference of purine metabolism altered uncoupling protein 1 mediated uncoupled respiration. Conclusion: Adrenergic stimulation of brown adipocytes lowers the intracellular concentration of purine nucleotides, thereby contributing to uncoupling protein 1 activation. Keywords: Purine nucleotides, Uncoupling protein 1, Brown adipose tissue, Non-shivering thermogenesis, HILIC-MS/MS, Guanosine monophosphate reductase

  16. SV40 host-substituted variants: a new look at the monkey DNA inserts and recombinant junctions.

    Science.gov (United States)

    Singer, Maxine; Winocour, Ernest

    2011-04-10

    The available monkey genomic data banks were examined in order to determine the chromosomal locations of the host DNA inserts in 8 host-substituted SV40 variant DNAs. Five of the 8 variants contained more than one linked monkey DNA insert per tandem repeat unit and in all cases but one, the 19 monkey DNA inserts in the 8 variants mapped to different locations in the monkey genome. The 50 parental DNAs (32 monkey and 18 SV40 DNA segments) which spanned the crossover and flanking regions that participated in monkey/monkey and monkey/SV40 recombinations were characterized by substantial levels of microhomology of up to 8 nucleotides in length; the parental DNAs also exhibited direct and inverted repeats at or adjacent to the crossover sequences. We discuss how the host-substituted SV40 variants arose and the nature of the recombination mechanisms involved. Copyright © 2011 Elsevier Inc. All rights reserved.

  17. Quantum Point Contact Single-Nucleotide Conductance for DNA and RNA Sequence Identification.

    Science.gov (United States)

    Afsari, Sepideh; Korshoj, Lee E; Abel, Gary R; Khan, Sajida; Chatterjee, Anushree; Nagpal, Prashant

    2017-11-28

    Several nanoscale electronic methods have been proposed for high-throughput single-molecule nucleic acid sequence identification. While many studies display a large ensemble of measurements as "electronic fingerprints" with some promise for distinguishing the DNA and RNA nucleobases (adenine, guanine, cytosine, thymine, and uracil), important metrics such as accuracy and confidence of base calling fall well below the current genomic methods. Issues such as unreliable metal-molecule junction formation, variation of nucleotide conformations, insufficient differences between the molecular orbitals responsible for single-nucleotide conduction, and lack of rigorous base calling algorithms lead to overlapping nanoelectronic measurements and poor nucleotide discrimination, especially at low coverage on single molecules. Here, we demonstrate a technique for reproducible conductance measurements on conformation-constrained single nucleotides and an advanced algorithmic approach for distinguishing the nucleobases. Our quantum point contact single-nucleotide conductance sequencing (QPICS) method uses combed and electrostatically bound single DNA and RNA nucleotides on a self-assembled monolayer of cysteamine molecules. We demonstrate that by varying the applied bias and pH conditions, molecular conductance can be switched ON and OFF, leading to reversible nucleotide perturbation for electronic recognition (NPER). We utilize NPER as a method to achieve >99.7% accuracy for DNA and RNA base calling at low molecular coverage (∼12×) using unbiased single measurements on DNA/RNA nucleotides, which represents a significant advance compared to existing sequencing methods. These results demonstrate the potential for utilizing simple surface modifications and existing biochemical moieties in individual nucleobases for a reliable, direct, single-molecule, nanoelectronic DNA and RNA nucleotide identification method for sequencing.

  18. Molecular recognition of nucleotides in micelles and the development and expansion of a chemistry outreach program

    Science.gov (United States)

    Schechinger, Linda Sue

    I. To investigate the delivery of nucleotide-based drugs, we are studying molecular recognition of nucleotide derivatives in environments that are similar to cell membranes. The Nowick group previously discovered that membrane-like surfactant micelles tetradecyltrimethylammonium bromide (TTAB) micelle facilitate molecular of adenosine monophosphate (AMP) recognition. The micelles bind nucleotides by means of electrostatic interactions and hydrogen bonding. We observed binding by following 1H NMR chemical shift changes of unique hexylthymine protons upon addition of AMP. Cationic micelles are required for binding. In surfactant-free or sodium dodecylsulfate solutions, no hydrogen bonding is observed. These observations suggest that the cationic surfactant headgroups bind the nucleotide phosphate group, while the intramicellar base binds the nucleotide base. The micellar system was optimized to enhance binding and selectivity for adenosine nucleotides. The selectivity for adenosine and the number of phosphate groups attached to the adenosine were both investigated. Addition of cytidine, guanidine, or uridine monophosphates, results in no significant downfield shifting of the NH resonance. Selectivity for the phosphate is limited, since adenosine mono-, di-, and triphosphates all have similar binding constants. We successfully achieved molecular recognition of adenosine nucleotides in micellar environments. There is significant difference in the binding interactions between the adenosine nucleotides and three other natural nucleotides. II. The UCI Chemistry Outreach Program (UCICOP) addresses the declining interest of the nations youth for science. UCICOP brings fun and exciting chemistry experiments to local high schools, to remind students that science is fun and has many practical uses. Volunteer students and alumni of UCI perform the demonstrations using scripts and material provided by UCICOP. The preparation of scripts and materials is done by two coordinators

  19. Sequence Variation in Toxoplasma gondii rop17 Gene among Strains from Different Hosts and Geographical Locations

    Directory of Open Access Journals (Sweden)

    Nian-Zhang Zhang

    2014-01-01

    Full Text Available Genetic diversity of T. gondii is a concern of many studies, due to the biological and epidemiological diversity of this parasite. The present study examined sequence variation in rhoptry protein 17 (ROP17 gene among T. gondii isolates from different hosts and geographical regions. The rop17 gene was amplified and sequenced from 10 T. gondii strains, and phylogenetic relationship among these T. gondii strains was reconstructed using maximum parsimony (MP, neighbor-joining (NJ, and maximum likelihood (ML analyses. The partial rop17 gene sequences were 1375 bp in length and A+T contents varied from 49.45% to 50.11% among all examined T. gondii strains. Sequence analysis identified 33 variable nucleotide positions (2.1%, 16 of which were identified as transitions. Phylogeny reconstruction based on rop17 gene data revealed two major clusters which could readily distinguish Type I and Type II strains. Analyses of sequence variations in nucleotides and amino acids among these strains revealed high ratio of nonsynonymous to synonymous polymorphisms (>1, indicating that rop17 shows signs of positive selection. This study demonstrated the existence of slightly high sequence variability in the rop17 gene sequences among T. gondii strains from different hosts and geographical regions, suggesting that rop17 gene may represent a new genetic marker for population genetic studies of T. gondii isolates.

  20. The Role of NLR-related Protein 3 Inflammasome in Host Defense and Inflammatory Diseases

    Directory of Open Access Journals (Sweden)

    Chul-Su Yang

    2012-03-01

    Full Text Available Among a number of innate receptors, the nucleotide-binding domain leucine-rich repeat containing (NLR nucleotide oligomerization domain (NOD-like receptor families are involved in the recognition of cytosolic pathogen- or danger-associated molecules. Activation of these specific sets of receptors leads to the assembly of a multiprotein complex, the inflammasome, leading to the activation of caspase-1 and maturation of the cytokines interleukin (IL-1β, IL-18, and IL-33. Among NLRs, NLR-related protein 3 (NLRP3 is one of the best-characterized receptors that activates the inflammasome. There is no doubt that NLRP3 inflammasome activation is important for host defense and effective pathogen clearance against fungal, bacterial, and viral infection. In addition, mounting evidence indicates that the NLRP3 inflammasome plays a role in a variety of inflammatory diseases, including gout, atherosclerosis, and type II diabetes, as well as under conditions of cellular stress or injury. Here, we review recent advances in our understanding of the role of the NLRP3 inflammasome in host defense and various inflammatory diseases.

  1. Subnanomole detection and quantitation of high specific activity 32P-nucleotides

    International Nuclear Information System (INIS)

    Coniglio, C.; Pappas, G.; Gill, W.J.; Kashdan, M.; Maniscalco, M.

    1991-01-01

    Microbore liquid chromatography utilizes conventional HPLC and ultraviolet detection principles to determine subnanomole mass quantities of biologically significant molecules. This system takes advantage of specifically designed microflow equipment to analyze ultraviolet absorbing species at the picomole range. 32P-labeled nucleotides are examples of compounds routinely used at picomole quantities that are extremely difficult to accurately quantify using standard mass measurement techniques. The procedure described in this paper has the capability of measuring nucleotides down to 10 pmol using commercially available microbore ultraviolet detection equipment. The technique can be used to accurately measure the specific activity of as little as 10 microCi of an aqueous 32P-nucleotide solution

  2. A novel genome signature based on inter-nucleotide distances profiles for visualization of metagenomic data

    Science.gov (United States)

    Xie, Xian-Hua; Yu, Zu-Guo; Ma, Yuan-Lin; Han, Guo-Sheng; Anh, Vo

    2017-09-01

    There has been a growing interest in visualization of metagenomic data. The present study focuses on the visualization of metagenomic data using inter-nucleotide distances profile. We first convert the fragment sequences into inter-nucleotide distances profiles. Then we analyze these profiles by principal component analysis. Finally the principal components are used to obtain the 2-D scattered plot according to their source of species. We name our method as inter-nucleotide distances profiles (INP) method. Our method is evaluated on three benchmark data sets used in previous published papers. Our results demonstrate that the INP method is good, alternative and efficient for visualization of metagenomic data.

  3. Pro-inflammatory cytokine single nucleotide polymorphisms in Kawasaki disease.

    Science.gov (United States)

    Assari, Raheleh; Aghighi, Yahya; Ziaee, Vahid; Sadr, Maryam; Rahmani, Farzaneh; Rezaei, Arezou; Sadr, Zeinab; Moradinejad, Mohammad Hassan; Raeeskarami, Seyed Reza; Rezaei, Nima

    2016-07-25

    Kawasaki disease (KD) is a systemic vasculitis of children associated with cardiovascular sequelae. Proinflammatory cytokines play a major role in KD pathogenesis. However, their role is both influenced and modified by regulatory T-cells. IL-1 gene cluster, IL-6 and TNF-α polymorphisms have shown significant associations with some vasculitides. Herein we investigated their role in KD. Fifty-five patients with KD who were randomly selected from referrals to the main pediatric hospital were enrolled in this case-control study. Single nucleotide polymorphisms (SNPs) of the following genes were assessed in patients and 140 healthy subjects as control group: IL-1α at -889 (rs1800587), IL-1β at -511 (rs16944), IL-1β at +3962 (rs1143634), IL-1R at Pst-I 1970 (rs2234650), IL-1RN/A at Mspa-I 11100 (rs315952), TNF-α at -308 (rs1800629), TNF-α at -238, IL-6 at -174 (rs1800795) and IL-6 at +565. Twenty-one percent of the control group had A allele at TNF-α -238 while only 8% of KD patients had A allele at this position (P = 0.003, OR [95%CI] = 0.32 [0.14-0.71]). Consistently, TNF-α genotype GG at -238 had significant association with KD (OR [95% CI] = 4.31 [1.79-10.73]). Most controls carried the CG genotype at IL-6 -174 (n = 93 [66.9%]) while GG genotype was the most common genotype (n = 27 [49%]) among patients. Carriers of the GG haplotype at TNF-α (-308, -238) were significantly more prevalent among the KD group. No association was found between IL-1 gene cluster, allelic or haplotypic variants and KD. TNF-α GG genotype at -238 and GG haplotype at positions -308 and -238 were associated with KD in an Iranian population. © 2016 Asia Pacific League of Associations for Rheumatology and John Wiley & Sons Australia, Ltd.

  4. Host-to-host variation of ecological interactions in polymicrobial infections

    Science.gov (United States)

    Mukherjee, Sayak; Weimer, Kristin E.; Seok, Sang-Cheol; Ray, Will C.; Jayaprakash, C.; Vieland, Veronica J.; Swords, W. Edward; Das, Jayajit

    2015-02-01

    Host-to-host variability with respect to interactions between microorganisms and multicellular hosts are commonly observed in infection and in homeostasis. However, the majority of mechanistic models used to analyze host-microorganism relationships, as well as most of the ecological theories proposed to explain coevolution of hosts and microbes, are based on averages across a host population. By assuming that observed variations are random and independent, these models overlook the role of differences between hosts. Here, we analyze mechanisms underlying host-to-host variations of bacterial infection kinetics, using the well characterized experimental infection model of polymicrobial otitis media (OM) in chinchillas, in combination with population dynamic models and a maximum entropy (MaxEnt) based inference scheme. We find that the nature of the interactions between bacterial species critically regulates host-to-host variations in these interactions. Surprisingly, seemingly unrelated phenomena, such as the efficiency of individual bacterial species in utilizing nutrients for growth, and the microbe-specific host immune response, can become interdependent in a host population. The latter finding suggests a potential mechanism that could lead to selection of specific strains of bacterial species during the coevolution of the host immune response and the bacterial species.

  5. Host-to-host variation of ecological interactions in polymicrobial infections.

    Science.gov (United States)

    Mukherjee, Sayak; Weimer, Kristin E; Seok, Sang-Cheol; Ray, Will C; Jayaprakash, C; Vieland, Veronica J; Swords, W Edward; Das, Jayajit

    2014-12-04

    Host-to-host variability with respect to interactions between microorganisms and multicellular hosts are commonly observed in infection and in homeostasis. However, the majority of mechanistic models used to analyze host-microorganism relationships, as well as most of the ecological theories proposed to explain coevolution of hosts and microbes, are based on averages across a host population. By assuming that observed variations are random and independent, these models overlook the role of differences between hosts. Here, we analyze mechanisms underlying host-to-host variations of bacterial infection kinetics, using the well characterized experimental infection model of polymicrobial otitis media (OM) in chinchillas, in combination with population dynamic models and a maximum entropy (MaxEnt) based inference scheme. We find that the nature of the interactions between bacterial species critically regulates host-to-host variations in these interactions. Surprisingly, seemingly unrelated phenomena, such as the efficiency of individual bacterial species in utilizing nutrients for growth, and the microbe-specific host immune response, can become interdependent in a host population. The latter finding suggests a potential mechanism that could lead to selection of specific strains of bacterial species during the coevolution of the host immune response and the bacterial species.

  6. Local host specialization, host-switching, and dispersal shape the regional distributions of avian haemosporidian parasites.

    Science.gov (United States)

    Ellis, Vincenzo A; Collins, Michael D; Medeiros, Matthew C I; Sari, Eloisa H R; Coffey, Elyse D; Dickerson, Rebecca C; Lugarini, Camile; Stratford, Jeffrey A; Henry, Donata R; Merrill, Loren; Matthews, Alix E; Hanson, Alison A; Roberts, Jackson R; Joyce, Michael; Kunkel, Melanie R; Ricklefs, Robert E

    2015-09-08

    The drivers of regional parasite distributions are poorly understood, especially in comparison with those of free-living species. For vector-transmitted parasites, in particular, distributions might be influenced by host-switching and by parasite dispersal with primary hosts and vectors. We surveyed haemosporidian blood parasites (Plasmodium and Haemoproteus) of small land birds in eastern North America to characterize a regional parasite community. Distributions of parasite populations generally reflected distributions of their hosts across the region. However, when the interdependence between hosts and parasites was controlled statistically, local host assemblages were related to regional climatic gradients, but parasite assemblages were not. Moreover, because parasite assemblage similarity does not decrease with distance when controlling for host assemblages and climate, parasites evidently disperse readily within the distributions of their hosts. The degree of specialization on hosts varied in some parasite lineages over short periods and small geographic distances independently of the diversity of available hosts and potentially competing parasite lineages. Nonrandom spatial turnover was apparent in parasite lineages infecting one host species that was well-sampled within a single year across its range, plausibly reflecting localized adaptations of hosts and parasites. Overall, populations of avian hosts generally determine the geographic distributions of haemosporidian parasites. However, parasites are not dispersal-limited within their host distributions, and they may switch hosts readily.

  7. Bacterial pathogen manipulation of host membrane trafficking.

    Science.gov (United States)

    Asrat, Seblewongel; de Jesús, Dennise A; Hempstead, Andrew D; Ramabhadran, Vinay; Isberg, Ralph R

    2014-01-01

    Pathogens use a vast number of strategies to alter host membrane dynamics. Targeting the host membrane machinery is important for the survival and pathogenesis of several extracellular, vacuolar, and cytosolic bacteria. Membrane manipulation promotes bacterial replication while suppressing host responses, allowing the bacterium to thrive in a hostile environment. This review provides a comprehensive summary of various strategies used by both extracellular and intracellular bacteria to hijack host membrane trafficking machinery. We start with mechanisms used by bacteria to alter the plasma membrane, delve into the hijacking of various vesicle trafficking pathways, and conclude by summarizing bacterial adaptation to host immune responses. Understanding bacterial manipulation of host membrane trafficking provides insights into bacterial pathogenesis and uncovers the molecular mechanisms behind various processes within a eukaryotic cell.

  8. Road MAPs to engineer host microbiomes.

    Science.gov (United States)

    Oyserman, Ben O; Medema, Marnix H; Raaijmakers, Jos M

    2017-12-02

    Microbiomes contribute directly or indirectly to host health and fitness. Thus far, investigations into these emergent traits, referred to here as microbiome-associated phenotypes (MAPs), have been primarily qualitative and taxonomy-driven rather than quantitative and trait-based. We present the MAPs-first approach, a theoretical and experimental roadmap that involves quantitative profiling of MAPs across genetically variable hosts and subsequent identification of the underlying mechanisms. We outline strategies for developing 'modular microbiomes'-synthetic microbial consortia that are engineered in concert with the host genotype to confer different but mutually compatible MAPs to a single host or host population. By integrating host and microbial traits, these strategies will facilitate targeted engineering of microbiomes to the benefit of agriculture, human/animal health and biotechnology. Copyright © 2017. Published by Elsevier Ltd.

  9. Plasticity in host utilization by two host-associated populations of Aphis gossypii Glover.

    Science.gov (United States)

    Barman, A K; Gadhave, K R; Dutta, B; Srinivasan, R

    2018-06-01

    Biological and morphological plasticity in polyphagous insect herbivores allow them to exploit diverse host plant species. Geographical differences in resource availability can lead to preferential host exploitation and result in inconsistent host specialization. Biological and molecular data provide insights into specialization and plasticity of such herbivore populations. In agricultural landscapes, Aphis gossypii encounters several crop and non-crop hosts, which exist in temporal and spatial proximity. We investigated the host-specialization of two A. gossypii host-associated populations (HAPs), which were field collected from cotton and squash (cotton-associated population and melon-associated population), and later maintained separately in the greenhouse. The two aphid populations were exposed to seven plant species (cotton, okra, watermelon, squash, cucumber, pigweed, and morning glory), and evaluated for their host utilization plasticity by estimating aphid's fitness parameters (nymphal period, adult period, fecundity, and intrinsic rate of increase). Four phenotypical characters (body length, head capsule width, hind tibia length and cornicle length) were also measured from the resulting 14 different HAP × host plant combinations. Phylogenetic analysis of mitochondrial COI sequences showed no genetic variation between the two HAPs. Fitness parameters indicated a significant variation between the two aphid populations, and the variation was influenced by host plants. The performance of melon-aphids was poor (up to 89% reduction in fecundity) on malvaceous hosts, cotton and okra. However, cotton-aphids performed better on cucurbitaceous hosts, squash and watermelon (up to 66% increased fecundity) compared with the natal host, cotton. Both HAPs were able to reproduce on two weed hosts. Cotton-aphids were smaller than melon-aphids irrespective of their host plants. Results from this study suggest that the two HAPs in the study area do not have strict host

  10. Functional analysis of virion host shutoff protein of pseudorabies virus

    International Nuclear Information System (INIS)

    Lin, H.-W.; Chang, Y.-Y.; Wong, M.-L.; Lin, J.-W.; Chang, T.-J.

    2004-01-01

    During lytic infection, the virion host shutoff (vhs) protein of alphaherpesviruses causes the degradation of mRNAs nonspecifically. In this work, we cloned the vhs gene (UL41 open reading frame) of pseudorabies virus (PRV; TNL strain) by PCR, and its nucleotide sequences were determined. The PCR product of vhs gene was subcloned into the prokaryotic pET32b expression vector, and production of the recombinant vhs protein was examined by SDS-PAGE. Result of Western blotting demonstrated that our recombinant vhs protein reacted with antiserum against a synthetic peptide of 17 amino acids of the vhs protein. After purification with nickel-chelate affinity chromatography, the purified recombinant vhs protein exhibited in vitro ribonuclease activity as expected. We further cloned the vhs gene into eukaryotic expression vectors and investigated the intracellular function of vhs protein by DNA transfection. By transient trasfection and CAT assay, we found the CAT activity was reduced in the presence of vhs, indicating that degradation of mRNA of the CAT gene was caused by the vhs. Furthermore, our results showed that the plaque formation of pseudorabies virus was blocked by exogenous vhs. Taken together, we have cloned the vhs gene of pseudorabies virus (TNL strain) and conducted functional analysis of the recombinant vhs protein in vitro as well as in vivo

  11. A novel pathogenic aviadenovirus from red-bellied parrots (Poicephalus rufiventris) unveils deep recombination events among avian host lineages

    International Nuclear Information System (INIS)

    Das, Shubhagata; Fearnside, Kathleen; Sarker, Subir; Forwood, Jade K.; Raidal, Shane R.

    2017-01-01

    Competing roles of coevolution, selective pressure and recombination are an emerging interest in virus evolution. We report a novel aviadenovirus from captive red-bellied parrots (Poicephalus rufiventris) that uncovers evidence of deep recombination among aviadenoviruses. The sequence identity of the virus was most closely related to Turkey adenovirus D (42% similarity) and other adenoviruses in chickens, turkeys and pigeons. Sequencing and comparative analysis showed that the genome comprised 40,930 nucleotides containing 42 predicted open reading frames (ORFs) 19 of which had strong similarity with genes from other adenovirus species. The new genome unveiled a lineage that likely participated in deep recombination events across the genus Aviadenovirus accounting for an ancient evolutionary relationship. We hypothesize frequent host switch events and recombination among adenovirus progenitors in Galloanserae hosts caused the radiation of extant aviadenoviruses and the newly assembled Poicephalus adenovirus genome points to a potentially broader host range of these viruses among birds. - Highlights: •Shows how a single new genome can change overall phylogeny. •Reveals host switch events among adenovirus progenitors in Galloanserae hosts. •Points to a potentially broader host range of adenoviruses among birds and wildlife .

  12. A novel pathogenic aviadenovirus from red-bellied parrots (Poicephalus rufiventris) unveils deep recombination events among avian host lineages

    Energy Technology Data Exchange (ETDEWEB)

    Das, Shubhagata, E-mail: sdas@csu.edu.au [School of Animal and Veterinary Sciences, Faculty of Science, Charles Sturt University, New South Wales 2678 (Australia); Fearnside, Kathleen, E-mail: kathyfearnside@exemail.com.au [Hills District Veterinary Hospital, Unit 1, 276 New Line Road, Dural, NSW 2158 (Australia); Sarker, Subir, E-mail: S.Sarker@latrobe.edu.au [Department of Physiology, Anatomy and Microbiology, School of Life Sciences, La Trobe University, Melbourne, VIC 3086 (Australia); Forwood, Jade K., E-mail: jforwood@csu.edu.au [School of Biomedical Sciences, Faculty of Science, Charles Sturt University, Wagga Wagga, NSW 2650 (Australia); Raidal, Shane R., E-mail: shraidal@csu.edu.au [School of Animal and Veterinary Sciences, Faculty of Science, Charles Sturt University, New South Wales 2678 (Australia)

    2017-02-15

    Competing roles of coevolution, selective pressure and recombination are an emerging interest in virus evolution. We report a novel aviadenovirus from captive red-bellied parrots (Poicephalus rufiventris) that uncovers evidence of deep recombination among aviadenoviruses. The sequence identity of the virus was most closely related to Turkey adenovirus D (42% similarity) and other adenoviruses in chickens, turkeys and pigeons. Sequencing and comparative analysis showed that the genome comprised 40,930 nucleotides containing 42 predicted open reading frames (ORFs) 19 of which had strong similarity with genes from other adenovirus species. The new genome unveiled a lineage that likely participated in deep recombination events across the genus Aviadenovirus accounting for an ancient evolutionary relationship. We hypothesize frequent host switch events and recombination among adenovirus progenitors in Galloanserae hosts caused the radiation of extant aviadenoviruses and the newly assembled Poicephalus adenovirus genome points to a potentially broader host range of these viruses among birds. - Highlights: •Shows how a single new genome can change overall phylogeny. •Reveals host switch events among adenovirus progenitors in Galloanserae hosts. •Points to a potentially broader host range of adenoviruses among birds and wildlife .

  13. HOST GALAXY IDENTIFICATION FOR SUPERNOVA SURVEYS

    Energy Technology Data Exchange (ETDEWEB)

    Gupta, Ravi R.; Kuhlmann, Steve; Kovacs, Eve; Spinka, Harold; Kessler, Richard; Goldstein, Daniel A.; Liotine, Camille; Pomian, Katarzyna; D’Andrea, Chris B.; Sullivan, Mark; Carretero, Jorge; Castander, Francisco J.; Nichol, Robert C.; Finley, David A.; Fischer, John A.; Foley, Ryan J.; Kim, Alex G.; Papadopoulos, Andreas; Sako, Masao; Scolnic, Daniel M.; Smith, Mathew; Tucker, Brad E.; Uddin, Syed; Wolf, Rachel C.; Yuan, Fang; Abbott, Tim M. C.; Abdalla, Filipe B.; Benoit-Lévy, Aurélien; Bertin, Emmanuel; Brooks, David; Rosell, Aurelio Carnero; Kind, Matias Carrasco; Cunha, Carlos E.; Costa, Luiz N. da; Desai, Shantanu; Doel, Peter; Eifler, Tim F.; Evrard, August E.; Flaugher, Brenna; Fosalba, Pablo; Gaztañaga, Enrique; Gruen, Daniel; Gruendl, Robert; James, David J.; Kuehn, Kyler; Kuropatkin, Nikolay; Maia, Marcio A. G.; Marshall, Jennifer L.; Miquel, Ramon; Plazas, Andrés A.; Romer, A. Kathy; Sánchez, Eusebio; Schubnell, Michael; Sevilla-Noarbe, Ignacio; Sobreira, Flávia; Suchyta, Eric; Swanson, Molly E. C.; Tarle, Gregory; Walker, Alistair R.; Wester, William

    2016-11-08

    Host galaxy identification is a crucial step for modern supernova (SN) surveys such as the Dark Energy Survey and the Large Synoptic Survey Telescope, which will discover SNe by the thousands. Spectroscopic resources are limited, and so in the absence of real-time SN spectra these surveys must rely on host galaxy spectra to obtain accurate redshifts for the Hubble diagram and to improve photometric classification of SNe. In addition, SN luminosities are known to correlate with host-galaxy properties. Therefore, reliable identification of host galaxies is essential for cosmology and SN science. We simulate SN events and their locations within their host galaxies to develop and test methods for matching SNe to their hosts. We use both real and simulated galaxy catalog data from the Advanced Camera for Surveys General Catalog and MICECATv2.0, respectively. We also incorporate "hostless" SNe residing in undetected faint hosts into our analysis, with an assumed hostless rate of 5%. Our fully automated algorithm is run on catalog data and matches SNe to their hosts with 91% accuracy. We find that including a machine learning component, run after the initial matching algorithm, improves the accuracy (purity) of the matching to 97% with a 2% cost in efficiency (true positive rate). Although the exact results are dependent on the details of the survey and the galaxy catalogs used, the method of identifying host galaxies we outline here can be applied to any transient survey.

  14. Host plant adaptation in Drosophila mettleri populations.

    Directory of Open Access Journals (Sweden)

    Sergio Castrezana

    Full Text Available The process of local adaptation creates diversity among allopatric populations, and may eventually lead to speciation. Plant-feeding insect populations that specialize on different host species provide an excellent opportunity to evaluate the causes of ecological specialization and the subsequent consequences for diversity. In this study, we used geographically separated Drosophila mettleri populations that specialize on different host cacti to examine oviposition preference for and larval performance on an array of natural and non-natural hosts (eight total. We found evidence of local adaptation in performance on saguaro cactus (Carnegiea gigantea for populations that are typically associated with this host, and to chemically divergent prickly pear species (Opuntia spp. in a genetically isolated population on Santa Catalina Island. Moreover, each population exhibited reduced performance on the alternative host. This finding is consistent with trade-offs associated with adaptation to these chemically divergent hosts, although we also discuss alternative explanations for this pattern. For oviposition preference, Santa Catalina Island flies were more likely to oviposit on some prickly pear species, but all populations readily laid eggs on saguaro. Experiments with non-natural hosts suggest that factors such as ecological opportunity may play a more important role than host plant chemistry in explaining the lack of natural associations with some hosts.

  15. HOST GALAXY IDENTIFICATION FOR SUPERNOVA SURVEYS

    Energy Technology Data Exchange (ETDEWEB)

    Gupta, Ravi R.; Kuhlmann, Steve; Kovacs, Eve; Spinka, Harold; Liotine, Camille; Pomian, Katarzyna [Argonne National Laboratory, 9700 South Cass Avenue, Lemont, IL 60439 (United States); Kessler, Richard; Scolnic, Daniel M. [Kavli Institute for Cosmological Physics, University of Chicago, Chicago, IL 60637 (United States); Goldstein, Daniel A. [Department of Astronomy, University of California, Berkeley, 501 Campbell Hall #3411, Berkeley, CA 94720 (United States); D’Andrea, Chris B.; Nichol, Robert C.; Papadopoulos, Andreas [Institute of Cosmology and Gravitation, University of Portsmouth, Portsmouth, PO1 3FX (United Kingdom); Sullivan, Mark [Department of Physics and Astronomy, University of Southampton, Southampton, SO17 1BJ (United Kingdom); Carretero, Jorge; Castander, Francisco J. [Institut de Ciències de l’Espai, IEEC-CSIC, Campus UAB, Carrer de Can Magrans, s/n, E-08193 Bellaterra, Barcelona (Spain); Finley, David A. [Fermi National Accelerator Laboratory, P.O. Box 500, Batavia, IL 60510 (United States); Fischer, John A.; Sako, Masao [Department of Physics and Astronomy, University of Pennsylvania, 209 South 33rd Street, Philadelphia, PA 19104 (United States); Foley, Ryan J. [Department of Astronomy, University of Illinois, 1002 W. Green Street, Urbana, IL 61801 (United States); Kim, Alex G., E-mail: raviryan@gmail.com [Physics Division, Lawrence Berkeley National Laboratory, 1 Cyclotron Road, Berkeley, CA 94720 (United States); and others

    2016-12-01

    Host galaxy identification is a crucial step for modern supernova (SN) surveys such as the Dark Energy Survey and the Large Synoptic Survey Telescope, which will discover SNe by the thousands. Spectroscopic resources are limited, and so in the absence of real-time SN spectra these surveys must rely on host galaxy spectra to obtain accurate redshifts for the Hubble diagram and to improve photometric classification of SNe. In addition, SN luminosities are known to correlate with host-galaxy properties. Therefore, reliable identification of host galaxies is essential for cosmology and SN science. We simulate SN events and their locations within their host galaxies to develop and test methods for matching SNe to their hosts. We use both real and simulated galaxy catalog data from the Advanced Camera for Surveys General Catalog and MICECATv2.0, respectively. We also incorporate “hostless” SNe residing in undetected faint hosts into our analysis, with an assumed hostless rate of 5%. Our fully automated algorithm is run on catalog data and matches SNe to their hosts with 91% accuracy. We find that including a machine learning component, run after the initial matching algorithm, improves the accuracy (purity) of the matching to 97% with a 2% cost in efficiency (true positive rate). Although the exact results are dependent on the details of the survey and the galaxy catalogs used, the method of identifying host galaxies we outline here can be applied to any transient survey.

  16. Adaptation to human populations is revealed by within-host polymorphisms in HIV-1 and hepatitis C virus.

    Directory of Open Access Journals (Sweden)

    Art F Y Poon

    2007-03-01

    Full Text Available CD8(+ cytotoxic T-lymphocytes (CTLs perform a critical role in the immune control of viral infections, including those caused by human immunodeficiency virus type 1 (HIV-1 and hepatitis C virus (HCV. As a result, genetic variation at CTL epitopes is strongly influenced by host-specific selection for either escape from the immune response, or reversion due to the replicative costs of escape mutations in the absence of CTL recognition. Under strong CTL-mediated selection, codon positions within epitopes may immediately "toggle" in response to each host, such that genetic variation in the circulating virus population is shaped by rapid adaptation to immune variation in the host population. However, this hypothesis neglects the substantial genetic variation that accumulates in virus populations within hosts. Here, we evaluate this quantity for a large number of HIV-1- (n > or = 3,000 and HCV-infected patients (n > or = 2,600 by screening bulk RT-PCR sequences for sequencing "mixtures" (i.e., ambiguous nucleotides, which act as site-specific markers of genetic variation within each host. We find that nonsynonymous mixtures are abundant and significantly associated with codon positions under host-specific CTL selection, which should deplete within-host variation by driving the fixation of the favored variant. Using a simple model, we demonstrate that this apparently contradictory outcome can be explained by the transmission of unfavorable variants to new hosts before they are removed by selection, which occurs more frequently when selection and transmission occur on similar time scales. Consequently, the circulating virus population is shaped by the transmission rate and the disparity in selection intensities for escape or reversion as much as it is shaped by the immune diversity of the host population, with potentially serious implications for vaccine design.

  17. Unraveling the cellular context of cyclic nucleotide signaling proteins by chemical proteomics

    NARCIS (Netherlands)

    Corradini, E.

    2015-01-01

    Understanding the molecular mechanisms which regulate signal transduction is fundamental to the development of therapeutic molecules for the treatment of several diseases. In particular, signaling proteins, such as cyclic nucleotide dependent enzymes are the orchestrators of many tissue functions.

  18. WEB-server for search of a periodicity in amino acid and nucleotide sequences

    Science.gov (United States)

    E Frenkel, F.; Skryabin, K. G.; Korotkov, E. V.

    2017-12-01

    A new web server (http://victoria.biengi.ac.ru/splinter/login.php) was designed and developed to search for periodicity in nucleotide and amino acid sequences. The web server operation is based upon a new mathematical method of searching for multiple alignments, which is founded on the position weight matrices optimization, as well as on implementation of the two-dimensional dynamic programming. This approach allows the construction of multiple alignments of the indistinctly similar amino acid and nucleotide sequences that accumulated more than 1.5 substitutions per a single amino acid or a nucleotide without performing the sequences paired comparisons. The article examines the principles of the web server operation and two examples of studying amino acid and nucleotide sequences, as well as information that could be obtained using the web server.

  19. Study on the change of cyclic nucleotide in mice with yang vacuity disease

    International Nuclear Information System (INIS)

    Zhu Xinhua; Shen Ling; Wang Shuguang

    2002-01-01

    To study the relation between Yang Vacuity disease happening, development and cyclic nucleotide response, and prove curative effects of some assisting Yang drug, the plasma cAMP, cGMP and cAMP/cGMP levels were detected by radioimmunoassay in the Yang Vacuity group and curing group. Results: showed: (1) Yang Vacuity group: the symptoms were clear, death rate was high, the plasma cAMP and cAMP/cGMP increased obviously, it suggests that cyclic nucleotide was imbalance. (2) Curing group: the symptoms of Yang Vacuity disease were improved obviously, death rate dropped, cAMP declined, cGMP increased, while cAMP/cGMP reached the normal level, it showed that cyclic nucleotide of the body had altered greatly. (3) It is a reference target for Yang Vacuity. (4) Assisting yang drug (Sini Decoction) had a close relation with correcting imbalance of cyclic nucleotide

  20. Efficient reverse transcription using locked nucleic acid nucleotides towards the evolution of nuclease resistant RNA aptamers

    DEFF Research Database (Denmark)

    Crouzier, Lucile; Dubois, Camille; Edwards, Stacey L

    2012-01-01

    We found that SuperScript® III Reverse Transcriptase is an efficient enzyme for the recognition of LNA nucleotides, making it a prime candidate to be used in de novo selection of LNA containing RNA aptamers....

  1. Multiple-strand displacement and identification of single nucleotide polymorphisms as markers of genotypic variation of Pasteuria penetrans biotypes infecting root-knot nematodes.

    Science.gov (United States)

    Nong, Guang; Chow, Virginia; Schmidt, Liesbeth M; Dickson, Don W; Preston, James F

    2007-08-01

    Pasteuria species are endospore-forming obligate bacterial parasites of soil-inhabiting nematodes and water-inhabiting cladocerans, e.g. water fleas, and are closely related to Bacillus spp. by 16S rRNA gene sequence. As naturally occurring bacteria, biotypes of Pasteuria penetrans are attractive candidates for the biocontrol of various Meloidogyne spp. (root-knot nematodes). Failure to culture these bacteria outside their hosts has prevented isolation of genomic DNA in quantities sufficient for identification of genes associated with host recognition and virulence. We have applied multiple-strand displacement amplification (MDA) to generate DNA for comparative genomics of biotypes exhibiting different host preferences. Using the genome of Bacillus subtilis as a paradigm, MDA allowed quantitative detection and sequencing of 12 marker genes from 2000 cells. Meloidogyne spp. infected with P. penetrans P20 or B4 contained single nucleotide polymorphisms (SNPs) in the spoIIAB gene that did not change the amino acid sequence, or that substituted amino acids with similar chemical properties. Individual nematodes infected with P. penetrans P20 or B4 contained SNPs in the spoIIAB gene sequenced in MDA-generated products. Detection of SNPs in the spoIIAB gene in a nematode indicates infection by more than one genotype, supporting the need to sequence genomes of Pasteuria spp. derived from single spore isolates.

  2. Single nucleotide polymorphism in toll-like receptor 6 is associated with a decreased risk for ureaplasma respiratory tract colonization and bronchopulmonary dysplasia in preterm infants.

    Science.gov (United States)

    Winters, Alexandra H; Levan, Tricia D; Vogel, Stefanie N; Chesko, Kirsty L; Pollin, Toni I; Viscardi, Rose M

    2013-08-01

    Ureaplasma spp. respiratory tract colonization is a risk factor for bronchopulmonary dysplasia (BPD) in preterm infants, but differences in host susceptibility have not been elucidated. We hypothesized that variants in genes regulating the innate immune response are associated with altered risk for Ureaplasma spp. respiratory colonization and BPD in preterm infants. Twenty-four tag single nucleotide polymorphisms (SNPs) from Toll-like receptor (TLR)1, TLR2, TLR4 and TLR6 were assayed in 298 infants Ureaplasma spp. and were evaluated for BPD. The majority of subjects (N = 205 [70%]) were African-American. One hundred ten (37%) were Ureaplasma positive. Four SNPs in TLR2 and TLR6 were significantly associated with Ureaplasma respiratory tract colonization. Single SNPs in TLR2, TLR4 and TLR6 were associated with BPD. TLR6 SNP rs5743827 was associated with both a decreased risk for Ureaplasma respiratory tract colonization and decreased risk for BPD (odds ratio: 0.54 [0.34-0.86] and odds ratio: 0.54 [0.31-0.95], respectively). There was a significant additive interaction between Ureaplasma colonization and genotype at TLR6 SNP rs5743827 (Padditive = 0.023), with an attributable proportion due to interaction of 0.542. Polymorphisms in host defense genes may alter susceptibility to Ureaplasma infection and severity of the inflammatory response contributing to BPD. These observations implicate host genetic susceptibility as a major factor in BPD pathogenesis in Ureaplasma-infected preterms.

  3. The effect of exhaustive exercise on the concentration of purine nucleotides and their metabolites in erythrocytes

    OpenAIRE

    E Skotnicka; I Baranowska-Bosiacka; W Dudzińska; M Suska; R Nowak; K Krupecki; AJ Hłyńczak

    2008-01-01

    In this study we tried to obtain a complete overview of purine nucleotide metabolism in erythrocytes before and during an incremental, intermittent exhaustive exercise bout protocol for sportsmen (high-performance rowers) and untrained, healthy, active volunteers. Erythrocyte levels of the main nucleotides (ATP, ADP, AMP, GTP, GDP, GMP, IMP, NAD and NADP ), nucleosides (Ado, Guo, Ino) and the base Hyp were measured using the HPLC method. The parameters that can be deducted from their concent...

  4. Guanine nucleotides stimulate hydrolysis of phosphatidyl inositol bis phosphate in human myelin membranes

    International Nuclear Information System (INIS)

    Boulias, C.; Moscarello, M.A.

    1989-01-01

    Phosphodiesterase activity was stimulated in myelin membranes in the presence of guanine nucleotide analogues. This activity was reduced in myelin membranes which had been adenosine diphosphate ribosylated in the presence of cholera toxin which ADP-ribosylated three proteins of Mr 46,000, 43,000 and 18,500. Aluminum fluoride treatment of myelin had the same stimulatory effects on phosphodiesterase activity as did the guanine nucleotides

  5. Host-to-host variation of ecological interactions in polymicrobial infections

    International Nuclear Information System (INIS)

    Mukherjee, Sayak; Seok, Sang-Cheol; Ray, Will C; Jayaprakash, C; Vieland, Veronica J; Das, Jayajit; Weimer, Kristin E; Swords, W Edward

    2015-01-01

    Host-to-host variability with respect to interactions between microorganisms and multicellular hosts are commonly observed in infection and in homeostasis. However, the majority of mechanistic models used to analyze host–microorganism relationships, as well as most of the ecological theories proposed to explain coevolution of hosts and microbes, are based on averages across a host population. By assuming that observed variations are random and independent, these models overlook the role of differences between hosts. Here, we analyze mechanisms underlying host-to-host variations of bacterial infection kinetics, using the well characterized experimental infection model of polymicrobial otitis media (OM) in chinchillas, in combination with population dynamic models and a maximum entropy (MaxEnt) based inference scheme. We find that the nature of the interactions between bacterial species critically regulates host-to-host variations in these interactions. Surprisingly, seemingly unrelated phenomena, such as the efficiency of individual bacterial species in utilizing nutrients for growth, and the microbe-specific host immune response, can become interdependent in a host population. The latter finding suggests a potential mechanism that could lead to selection of specific strains of bacterial species during the coevolution of the host immune response and the bacterial species. (paper)

  6. Critical role of DNA intercalation in enzyme-catalyzed nucleotide flipping

    Science.gov (United States)

    Hendershot, Jenna M.; O'Brien, Patrick J.

    2014-01-01

    Nucleotide flipping is a common feature of DNA-modifying enzymes that allows access to target sites within duplex DNA. Structural studies have identified many intercalating amino acid side chains in a wide variety of enzymes, but the functional contribution of these intercalating residues is poorly understood. We used site-directed mutagenesis and transient kinetic approaches to dissect the energetic contribution of intercalation for human alkyladenine DNA glycosylase, an enzyme that initiates repair of alkylation damage. When AAG flips out a damaged nucleotide, the void in the duplex is filled by a conserved tyrosine (Y162). We find that tyrosine intercalation confers 140-fold stabilization of the extrahelical specific recognition complex, and that Y162 functions as a plug to slow the rate of unflipping by 6000-fold relative to the Y162A mutant. Surprisingly, mutation to the smaller alanine side chain increases the rate of nucleotide flipping by 50-fold relative to the wild-type enzyme. This provides evidence against the popular model that DNA intercalation accelerates nucleotide flipping. In the case of AAG, DNA intercalation contributes to the specific binding of a damaged nucleotide, but this enhanced specificity comes at the cost of reduced speed of nucleotide flipping. PMID:25324304

  7. Biochemistry of an olfactory purinergic system: dephosphorylation of excitatory nucleotides and uptake of adenosine

    Energy Technology Data Exchange (ETDEWEB)

    Trapido-Rosenthal, H G; Carr, W E; Gleeson, R A

    1987-10-01

    The olfactory organ of the spiny lobster, Panulirus argus, is composed of chemosensory sensilla containing the dendrites of primary chemosensory neurons. Receptors on these dendrites are activated by the nucleotides AMP, ADP, and ATP but not by the nucleoside adenosine. It is shown here that the lobster chemosensory sensilla contain enzymes that dephosphorylate excitatory nucleotides and an uptake system that internalizes the nonexcitatory dephosphorylated product adenosine. The uptake of (/sup 3/H)-adenosine is saturable with increasing concentration, linear with time for up to 3 h, sodium dependent, insensitive to moderate pH changes and has a Km of 7.1 microM and a Vmax of 5.2 fmol/sensillum/min (573 fmol/micrograms of protein/min). Double-label experiments show that sensilla dephosphorylate nucleotides extracellularly; /sup 3/H from adenine-labeled AMP or ATP is internalized, whereas 32P from phosphate-labeled nucleotides is not. The dephosphorylation of AMP is very rapid; /sup 3/H from AMP is internalized at the same rate as /sup 3/H from adenosine. Sensillar 5'-ectonucleotidase activity is inhibited by ADP and the ADP analog alpha, beta-methylene ADP. Collectively, these results indicate that the enzymes and the uptake system whereby chemosensory sensilla of the lobster inactivate excitatory nucleotides and clear adenosine from extracellular spaces are very similar to those present in the internal tissues of vertebrates, where nucleotides have many neuroactive effects.

  8. Regulation of Ca2+ release from mitochondria by the oxidation-reduction state of pyridine nucleotides

    Science.gov (United States)

    Lehninger, Albert L.; Vercesi, Anibal; Bababunmi, Enitan A.

    1978-01-01

    Mitochondria from normal rat liver and heart, and also Ehrlich tumor cells, respiring on succinate as energy source in the presence of rotenone (to prevent net electron flow to oxygen from the endogenous pyridine nucleotides), rapidly take up Ca2+ and retain it so long as the pyridine nucleotides are kept in the reduced state. When acetoacetate is added to bring the pyridine nucleotides into a more oxidized state, Ca2+ is released to the medium. A subsequent addition of a reductant of the pyridine nucleotides such as β-hydroxybutyrate, glutamate, or isocitrate causes reuptake of the released Ca2+. Successive cycles of Ca2+ release and uptake can be induced by shifting the redox state of the pyridine nucleotides to more oxidized and more reduced states, respectively. Similar observations were made when succinate oxidation was replaced as energy source by ascorbate oxidation or by the hydrolysis of ATP. These and other observations form the basis of a hypothesis for feedback regulation of Ca2+-dependent substrate- or energy-mobilizing enzymatic reactions by the uptake or release of mitochondrial Ca2+, mediated by the cytosolic phosphate potential and the ATP-dependent reduction of mitochondrial pyridine nucleotides by reversal of electron transport. Images PMID:25436

  9. GDP-bound and nucleotide-free intermediates of the guanine nucleotide exchange in the Rab5·Vps9 system.

    Science.gov (United States)

    Uejima, Tamami; Ihara, Kentaro; Goh, Tatsuaki; Ito, Emi; Sunada, Mariko; Ueda, Takashi; Nakano, Akihiko; Wakatsuki, Soichi

    2010-11-19

    Many GTPases regulate intracellular transport and signaling in eukaryotes. Guanine nucleotide exchange factors (GEFs) activate GTPases by catalyzing the exchange of their GDP for GTP. Here we present crystallographic and biochemical studies of a GEF reaction with four crystal structures of Arabidopsis thaliana ARA7, a plant homolog of Rab5 GTPase, in complex with its GEF, VPS9a, in the nucleotide-free and GDP-bound forms, as well as a complex with aminophosphonic acid-guanylate ester and ARA7·VPS9a(D185N) with GDP. Upon complex formation with ARA7, VPS9 wedges into the interswitch region of ARA7, inhibiting the coordination of Mg(2+) and decreasing the stability of GDP binding. The aspartate finger of VPS9a recognizes GDP β-phosphate directly and pulls the P-loop lysine of ARA7 away from GDP β-phosphate toward switch II to further destabilize GDP for its release during the transition from the GDP-bound to nucleotide-free intermediates in the nucleotide exchange reaction.

  10. Nucleotide-Binding Oligomerization Domain-1 and -2 Play No Role in Controlling Brucella abortus Infection in Mice

    Directory of Open Access Journals (Sweden)

    Fernanda S. Oliveira

    2012-01-01

    Full Text Available Nucleotide-binding oligomerization domain proteins (NODs are modular cytoplasmic proteins implicated in the recognition of peptidoglycan-derived molecules. Further, several in vivo studies have demonstrated a role for Nod1 and Nod2 in host defense against bacterial pathogens. Here, we demonstrated that macrophages from NOD1-, NOD2-, and Rip2-deficient mice produced lower levels of TNF-α following infection with live Brucella abortus compared to wild-type mice. Similar reduction on cytokine synthesis was not observed for IL-12 and IL-6. However, NOD1, NOD2, and Rip2 knockout mice were no more susceptible to infection with virulent B. abortus than wild-type mice. Additionally, spleen cells from NOD1-, NOD2-, and Rip2-deficient mice showed unaltered production of IFN-γ compared to C57BL/6 mice. Taken together, this study demonstrates that NOD1, NOD2 and Rip2 are dispensable for the control of B. abortus during in vivo infection.

  11. Complete nucleotide sequences of a new bipartite begomovirus from Malvastrum sp. plants with bright yellow mosaic symptoms in South Texas.

    Science.gov (United States)

    Alabi, Olufemi J; Villegas, Cecilia; Gregg, Lori; Murray, K Daniel

    2016-06-01

    Two isolates of a novel bipartite begomovirus, tentatively named malvastrum bright yellow mosaic virus (MaBYMV), were molecularly characterized from naturally infected plants of the genus Malvastrum showing bright yellow mosaic disease symptoms in South Texas. Six complete DNA-A and five DNA-B genome sequences of MaBYMV obtained from the isolates ranged in length from 2,608 to 2,609 nucleotides (nt) and 2,578 to 2,605 nt, respectively. Both genome segments shared a 178- to 180-nt common region. In pairwise comparisons, the complete DNA-A and DNA-B sequences of MaBYMV were most similar (87-88 % and 79-81 % identity, respectively) and phylogenetically related to the corresponding sequences of sida mosaic Sinaloa virus-[MX-Gua-06]. Further analysis revealed that MaBYMV is a putative recombinant virus, thus supporting the notion that malvaceous hosts may be influencing the evolution of several begomoviruses. The design of new diagnostic primers enabled the detection of MaBYMV in cohorts of Bemisia tabaci collected from symptomatic Malvastrum sp. plants, thus implicating whiteflies as potential vectors of the virus.

  12. Where the bugs are: analyzing distributions of bacterial phyla by descriptor keyword search in the nucleotide database.

    Science.gov (United States)

    Squartini, Andrea

    2011-07-26

    The associations between bacteria and environment underlie their preferential interactions with given physical or chemical conditions. Microbial ecology aims at extracting conserved patterns of occurrence of bacterial taxa in relation to defined habitats and contexts. In the present report the NCBI nucleotide sequence database is used as dataset to extract information relative to the distribution of each of the 24 phyla of the bacteria superkingdom and of the Archaea. Over two and a half million records are filtered in their cross-association with each of 48 sets of keywords, defined to cover natural or artificial habitats, interactions with plant, animal or human hosts, and physical-chemical conditions. The results are processed showing: (a) how the different descriptors enrich or deplete the proportions at which the phyla occur in the total database; (b) in which order of abundance do the different keywords score for each phylum (preferred habitats or conditions), and to which extent are phyla clustered to few descriptors (specific) or spread across many (cosmopolitan); (c) which keywords individuate the communities ranking highest for diversity and evenness. A number of cues emerge from the results, contributing to sharpen the picture on the functional systematic diversity of prokaryotes. Suggestions are given for a future automated service dedicated to refining and updating such kind of analyses via public bioinformatic engines.

  13. Chosen single nucleotide polymorphisms (SNPs) of enamel formation genes and dental caries in a population of Polish children.

    Science.gov (United States)

    Gerreth, Karolina; Zaorska, Katarzyna; Zabel, Maciej; Borysewicz-Lewicka, Maria; Nowicki, Michał

    2017-09-01

    It is increasingly emphasized that the influence of a host's factors in the etiology of dental caries are of most interest, particularly those concerned with genetic aspect. The aim of the study was to analyze the genotype and allele frequencies of single nucleotide polymorphisms (SNPs) in AMELX, AMBN, TUFT1, TFIP11, MMP20 and KLK4 genes and to prove their association with dental caries occurrence in a population of Polish children. The study was performed in 96 children (48 individuals with caries - "cases" and 48 free of this disease - "controls"), aged 20-42 months, chosen out of 262 individuals who had dental examination performed and attended 4 day nurseries located in Poznań (Poland). From both groups oral swab was collected for molecular evaluation. Eleven selected SNPs markers were genotyped by Sanger sequencing. Genotype and allele frequencies were calculated and a standard χ2 analysis was used to test for deviation from Hardy-Weinberg equilibrium. The association of genetic variations with caries susceptibility or resistance was assessed by the Fisher's exact test and p ≤ 0.05 was considered statistically significant. Five markers were significantly associated with caries incidence in children in the study: rs17878486 in AMELX (p caries occurrence in Polish children.

  14. Data from: Two different strategies of host manipulation allow parasites to persist in intermediate-definitive host systems

    NARCIS (Netherlands)

    Vries, de Lana; Langevelde, van F.

    2017-01-01

    Trophically-transmitted parasites start their development in an intermediate host, before they finish the development in their definitive host when the definitive host preys on the intermediate host. In intermediate-definitive host systems, two strategies of host manipulation have been evolved:

  15. Schizosaccharomyces pombe MutSα and MutLα Maintain Stability of Tetra-Nucleotide Repeats and Msh3 of Hepta-Nucleotide Repeats

    Directory of Open Access Journals (Sweden)

    Desirée Villahermosa

    2017-05-01

    Full Text Available Defective mismatch repair (MMR in humans is associated with colon cancer and instability of microsatellites, that is, DNA sequences with one or several nucleotides repeated. Key factors of eukaryotic MMR are the heterodimers MutSα (Msh2-Msh6, which recognizes base-base mismatches and unpaired nucleotides in DNA, and MutLα (Mlh1-Pms1, which facilitates downstream steps. In addition, MutSβ (Msh2-Msh3 recognizes DNA loops of various sizes, although our previous data and the data presented here suggest that Msh3 of Schizosaccharomyces pombe does not play a role in MMR. To test microsatellite stability in S. pombe and hence DNA loop repair, we have inserted tetra-, penta-, and hepta-nucleotide repeats in the ade6 gene and determined their Ade+ reversion rates and spectra in wild type and various mutants. Our data indicate that loops with four unpaired nucleotides in the nascent and the template strand are the upper limit of MutSα- and MutLα-mediated MMR in S. pombe. Stability of hepta-nucleotide repeats requires Msh3 and Exo1 in MMR-independent processes as well as the DNA repair proteins Rad50, Rad51, and Rad2FEN1. Most strikingly, mutation rates in the double mutants msh3 exo1 and msh3 rad51 were decreased when compared to respective single mutants, indicating that Msh3 prevents error prone processes carried out by Exo1 and Rad51. We conclude that Msh3 has no obvious function in MMR in S. pombe, but contributes to DNA repeat stability in MMR-independent processes.

  16. Nestedness of ectoparasite-vertebrate host networks.

    Directory of Open Access Journals (Sweden)

    Sean P Graham

    2009-11-01

    Full Text Available Determining the structure of ectoparasite-host networks will enable disease ecologists to better understand and predict the spread of vector-borne diseases. If these networks have consistent properties, then studying the structure of well-understood networks could lead to extrapolation of these properties to others, including those that support emerging pathogens. Borrowing a quantitative measure of network structure from studies of mutualistic relationships between plants and their pollinators, we analyzed 29 ectoparasite-vertebrate host networks--including three derived from molecular bloodmeal analysis of mosquito feeding patterns--using measures of nestedness to identify non-random interactions among species. We found significant nestedness in ectoparasite-vertebrate host lists for habitats ranging from tropical rainforests to polar environments. These networks showed non-random patterns of nesting, and did not differ significantly from published estimates of nestedness from mutualistic networks. Mutualistic and antagonistic networks appear to be organized similarly, with generalized ectoparasites interacting with hosts that attract many ectoparasites and more specialized ectoparasites usually interacting with these same "generalized" hosts. This finding has implications for understanding the network dynamics of vector-born pathogens. We suggest that nestedness (rather than random ectoparasite-host associations can allow rapid transfer of pathogens throughout a network, and expand upon such concepts as the dilution effect, bridge vectors, and host switching in the context of nested ectoparasite-vertebrate host networks.

  17. Host selection by the shiny cowbird

    Science.gov (United States)

    Wiley, J.W.

    1988-01-01

    Factors important in Shiny Cowbird (Molothrus bonariensis) host selection were examined within the mangrove community in Puerto Rico. Cowbirds did not parasitize birds in proportion to their abundance. The cowbird breeding season coincided with those of its major hosts, which were 'high-quality' foster species (i.e., species that fledge .gtoreq. 55% of cowbirds hatched: Yellow Warbler, Dendroica petechia; Yellow-shouldered Blackbird, Agelaius xanthomus; Black-whiskered Vireo, Vireo altiloquus; Black-cowled Oriole, Icterus dominicensis; Peurto Rican Flycatcher, Myiarchus antillarum; Troupial, Icterus icterus), and did not extend into other periods even though nests of 'low-quality: species (i.e., species that fledge < 55% of cowbird chicks that hatched: Bronze Mannikin, Lonchura cucullata; Greater Antillean Grackle, Quiscalus niger; Gray Kingbird, Tyrannus dominicensis; Northern Mockingbird, Mimus polyglottos; Red-legged Thrush, Turdus plumbeus) were available. Shiny Cowbird food habits and egg size were similar to those of their hosts, suggesting that cowbirds choose hosts partly on the basis of this combination. Cowbirds located host nests primarily by cryptically watching activities of birds in likely habitats. Other nest locating strategies were active searching of suitable habitat and 'flushing' of hosts by the cowbird's noisy approach. Cowbirds closely monitored nest status with frequent visits that peaked on the host's first day of egg laying. Hosts using covered nests (e.g., cavities, domed nests) were as vulnerable to cowbird parasitism as those building open nests.

  18. Biofilms and host response - helpful or harmful

    DEFF Research Database (Denmark)

    Moser, Claus; Pedersen, Hannah Trøstrup; Lerche, Christian Johann

    2017-01-01

    infections can present in numerous ways, one common feature is involvement of the host response with significant impact on the course. A special characteristic is the synergy of the innate and the acquired immune responses for the induced pathology. Here, we review the impact of the host response...

  19. Social Host Ordinances and Policies. Prevention Update

    Science.gov (United States)

    Higher Education Center for Alcohol, Drug Abuse, and Violence Prevention, 2011

    2011-01-01

    Social host liability laws (also known as teen party ordinances, loud or unruly gathering ordinances, or response costs ordinances) target the location in which underage drinking takes place. Social host liability laws hold noncommercial individuals responsible for underage drinking events on property they own, lease, or otherwise control. They…

  20. Host tree resistance against the polyphagous

    Science.gov (United States)

    W. D. Morewood; K. Hoover; P. R. Neiner; J.R. McNeil; J. C. Sellmer

    2004-01-01

    Anoplophora glabripennis (Motschulsky) (Coleoptera: Cerambycidae: Lamiini) is an invasive wood-boring beetle with an unusually broad host range and a proven ability to increase its host range as it colonizes new areas and encounters new tree species. The beetle is native to eastern Asia and has become an invasive pest in North America and Europe,...

  1. Carp erythrodermatitis : host defense-pathogen interaction

    NARCIS (Netherlands)

    Pourreau, C.N.

    1990-01-01

    The outcome of a bacterial infection depends on the interaction between pathogen and host. The ability of the microbe to survive in the host depends on its invasive potential (i.e. spreading and multiplication), and its ability to obtain essential nutrients and to resist the

  2. Host genetics and dengue fever.

    Science.gov (United States)

    Xavier-Carvalho, Caroline; Cardoso, Cynthia Chester; de Souza Kehdy, Fernanda; Pacheco, Antonio Guilherme; Moraes, Milton Ozório

    2017-12-01

    Dengue is a major worldwide problem in tropical and subtropical areas; it is caused by four different viral serotypes, and it can manifest as asymptomatic, mild, or severe. Many factors interact to determine the severity of the disease, including the genetic profile of the infected patient. However, the mechanisms that lead to severe disease and eventually death have not been determined, and a great challenge is the early identification of patients who are more likely to progress to a worse health condition. Studies performed in regions with cyclic outbreaks such as Cuba, Brazil, and Colombia have demonstrated that African ancestry confers protection against severe dengue. Highlighting the host genetics as an important factor in infectious diseases, a large number of association studies between genetic polymorphisms and dengue outcomes have been published in the last two decades. The most widely used approach involves case-control studies with candidate genes, such as the HLA locus and genes for receptors, cytokines, and other immune mediators. Additionally, a Genome-Wide Association Study (GWAS) identified SNPs associated with African ethnicity that had not previously been identified in case-control studies. Despite the increasing number of publications in America, Africa, and Asia, the results are quite controversial, and a meta-analysis is needed to assess the consensus among the studies. SNPs in the MICB, TNF, CD209, FcγRIIA, TPSAB1, CLEC5A, IL10 and PLCE1 genes are associated with the risk or protection of severe dengue, and the findings have been replicated in different populations. A thorough understanding of the viral, human genetic, and immunological mechanisms of dengue and how they interact is essential for effectively preventing dengue, but also managing and treating patients. Copyright © 2017 Elsevier B.V. All rights reserved.

  3. Importance of host feeding for parasitoids that attack honeydew-producing hosts

    NARCIS (Netherlands)

    Burger, J.M.S.; Komany, A.; Lenteren, van J.C.; Vet, L.E.M.

    2005-01-01

    Insect parasitoids lay their eggs in arthropods. Some parasitoid species not only use their arthropod host for oviposition but also for feeding. Host feeding provides nutrients to the adult female parasitoid. However, in many species, host feeding destroys an opportunity to oviposit. For parasitoids

  4. Whole genome-based phylogeny of reptile-associated Helicobacter indicates independent niche adaptation followed by diversification in a poikilothermic host.

    Science.gov (United States)

    Gilbert, Maarten J; Duim, Birgitta; Timmerman, Arjen J; Zomer, Aldert L; Wagenaar, Jaap A

    2017-08-21

    Reptiles have been shown to host a significant Helicobacter diversity. In order to survive, reptile-associated Helicobacter lineages need to be adapted to the thermally dynamic environment encountered in a poikilothermic host. The whole genomes of reptile-associated Helicobacter lineages can provide insights in Helicobacter host adaptation and coevolution. These aspects were explored by comparing the genomes of reptile-, bird-, and mammal-associated Helicobacter lineages. Based on average nucleotide identity, all reptile-associated Helicobacter lineages in this study could be considered distinct species. A whole genome-based phylogeny showed two distinct clades, one associated with chelonians and one associated with lizards. The phylogeny indicates initial adaptation to an anatomical niche, which is followed by an ancient host jump and subsequent diversification. Furthermore, the ability to grow at low temperatures, which might reflect thermal adaptation to a reptilian host, originated at least twice in Helicobacter evolution. A putative tricarballylate catabolism locus was specifically present in Campylobacter and Helicobacter isolates from reptiles. The phylogeny of reptile-associated Helicobacter parallels host association, indicating a high level of host specificity. The high diversity and deep branching within these clades supports long-term coevolution with, and extensive radiation within the respective reptilian host type.

  5. Nucleotide sequence and genetic organization of barley stripe mosaic virus RNA gamma.

    Science.gov (United States)

    Gustafson, G; Hunter, B; Hanau, R; Armour, S L; Jackson, A O

    1987-06-01

    The complete nucleotide sequences of RNA gamma from the Type and ND18 strains of barley stripe mosaic virus (BSMV) have been determined. The sequences are 3164 (Type) and 2791 (ND18) nucleotides in length. Both sequences contain a 5'-noncoding region (87 or 88 nucleotides) which is followed by a long open reading frame (ORF1). A 42-nucleotide intercistronic region separates ORF1 from a second, shorter open reading frame (ORF2) located near the 3'-end of the RNA. There is a high degree of homology between the Type and ND18 strains in the nucleotide sequence of ORF1. However, the Type strain contains a 366 nucleotide direct tandem repeat within ORF1 which is absent in the ND18 strain. Consequently, the predicted translation product of Type RNA gamma ORF1 (mol wt 87,312) is significantly larger than that of ND18 RNA gamma ORF1 (mol wt 74,011). The amino acid sequence of the ORF1 polypeptide contains homologies with putative RNA polymerases from other RNA viruses, suggesting that this protein may function in replication of the BSMV genome. The nucleotide sequence of RNA gamma ORF2 is nearly identical in the Type and ND18 strains. ORF2 codes for a polypeptide with a predicted molecular weight of 17,209 (Type) or 17,074 (ND18) which is known to be translated from a subgenomic (sg) RNA. The initiation point of this sgRNA has been mapped to a location 27 nucleotides upstream of the ORF2 initiation codon in the intercistronic region between ORF1 and ORF2. The sgRNA is not coterminal with the 3'-end of the genomic RNA, but instead contains heterogeneous poly(A) termini up to 150 nucleotides long (J. Stanley, R. Hanau, and A. O. Jackson, 1984, Virology 139, 375-383). In the genomic RNA gamma, ORF2 is followed by a short poly(A) tract and a 238-nucleotide tRNA-like structure.

  6. Codivergence of mycoviruses with their hosts.

    Directory of Open Access Journals (Sweden)

    Markus Göker

    Full Text Available BACKGROUND: The associations between pathogens and their hosts are complex and can result from any combination of evolutionary events such as codivergence, switching, and duplication of the pathogen. Mycoviruses are RNA viruses which infect fungi and for which natural vectors are so far unknown. Thus, lateral transfer might be improbable and codivergence their dominant mode of evolution. Accordingly, mycoviruses are a suitable target for statistical tests of virus-host codivergence, but inference of mycovirus phylogenies might be difficult because of low sequence similarity even within families. METHODOLOGY: We analyzed here the evolutionary dynamics of all mycovirus families by comparing virus and host phylogenies. Additionally, we assessed the sensitivity of the co-phylogenetic tests to the settings for inferring virus trees from their genome sequences and approximate, taxonomy-based host trees. CONCLUSIONS: While sequence alignment filtering modes affected branch support, the overall results of the co-phylogenetic tests were significantly influenced only by the number of viruses sampled per family. The trees of the two largest families, Partitiviridae and Totiviridae, were significantly more similar to those of their hosts than expected by chance, and most individual host-virus links had a significant positive impact on the global fit, indicating that codivergence is the dominant mode of virus diversification. However, in this regard mycoviruses did not differ from closely related viruses sampled from non-fungus hosts. The remaining virus families were either dominated by other evolutionary modes or lacked an apparent overall pattern. As this negative result might be caused by insufficient taxon sampling, the most parsimonious hypothesis still is that host-parasite evolution is basically the same in all mycovirus families. This is the first study of mycovirus-host codivergence, and the results shed light not only on how mycovirus biology

  7. Effect of Intermediate Hosts on Emerging Zoonoses.

    Science.gov (United States)

    Cui, Jing-An; Chen, Fangyuan; Fan, Shengjie

    2017-08-01

    Most emerging zoonotic pathogens originate from animals. They can directly infect humans through natural reservoirs or indirectly through intermediate hosts. As a bridge, an intermediate host plays different roles in the transmission of zoonotic pathogens. In this study, we present three types of pathogen transmission to evaluate the effect of intermediate hosts on emerging zoonotic diseases in human epidemics. These types are identified as follows: TYPE 1, pathogen transmission without an intermediate host for comparison; TYPE 2, pathogen transmission with an intermediate host as an amplifier; and TYPE 3, pathogen transmission with an intermediate host as a vessel for genetic variation. In addition, we established three mathematical models to elucidate the mechanisms underlying zoonotic disease transmission according to these three types. Stability analysis indicated that the existence of intermediate hosts increased the difficulty of controlling zoonotic diseases because of more difficult conditions to satisfy for the disease to die out. The human epidemic would die out under the following conditions: TYPE 1: [Formula: see text] and [Formula: see text]; TYPE 2: [Formula: see text], [Formula: see text], and [Formula: see text]; and TYPE 3: [Formula: see text], [Formula: see text], [Formula: see text], and [Formula: see text] Simulation with similar parameters demonstrated that intermediate hosts could change the peak time and number of infected humans during a human epidemic; intermediate hosts also exerted different effects on controlling the prevalence of a human epidemic with natural reservoirs in different periods, which is important in addressing problems in public health. Monitoring and controlling the number of natural reservoirs and intermediate hosts at the right time would successfully manage and prevent the prevalence of emerging zoonoses in humans.

  8. Important role of the nucleotide excision repair pathway in Mycobacterium smegmatis in conferring protection against commonly encountered DNA-damaging agents.

    Science.gov (United States)

    Kurthkoti, Krishna; Kumar, Pradeep; Jain, Ruchi; Varshney, Umesh

    2008-09-01

    Mycobacteria are an important group of human pathogens. Although the DNA repair mechanisms in mycobacteria are not well understood, these are vital for the pathogen's persistence in the host macrophages. In this study, we generated a null mutation in the uvrB gene of Mycobacterium smegmatis to allow us to compare the significance of the nucleotide excision repair (NER) pathway with two important base excision repair pathways, initiated by uracil DNA glycosylase (Ung) and formamidopyrimidine DNA glycosylase (Fpg or MutM), in an isogenic strain background. The strain deficient in NER was the most sensitive to commonly encountered DNA-damaging agents such as UV, low pH, reactive oxygen species, hypoxia, and was also sensitive to acidified nitrite. Taken together with previous observations on NER-deficient M. tuberculosis, these results suggest that NER is an important DNA repair pathway in mycobacteria.

  9. Molecular characterization and phylogenetic analysis of Explanatum explanatum in India based on nucleotide sequences of ribosomal ITS2 and the mitochondrial gene nad1.

    Science.gov (United States)

    Hayashi, Kei; Mohanta, Uday K; Ohari, Yuma; Neeraja, Tambireddy; Singh, T Shantikumar; Sugiyama, Hiromu; Itagaki, Tadashi

    2016-12-01

    The aim of this study was to analyze the phylogenetic relationship between Explanatum explanatum populations in India and other countries of the Indian subcontinent. Seventy liver amphistomes collected from four localities in India were identified as E. explanatum based on the nucleotide sequences of ribosomal ITS2. The flukes were then analyzed phylogenetically based on the nucleotide sequence of the mitochondrial gene nad1 in comparison with flukes from Bangladesh and Nepal. In the resulting phylogenetic tree, the nad1 haplotypes from India were divided into four clades, and the flukes showing the haplotypes of clades A and C were predominant in India. The haplotypes of the clades A and C have also been detected in Bangladesh and Nepal, and therefore, it seems they occur commonly throughout the Indian subcontinent. The results of AMOVA suggested that gene flow was likely to occur between E. explanatum populations in these countries. These countries are geographically close and have been historically and culturally connected to each other, and therefore, the movements of host ruminants among these countries might have been involved in the migration of the flukes and their gene flow.

  10. THE LOCAL HOSTS OF TYPE Ia SUPERNOVAE

    International Nuclear Information System (INIS)

    Neill, James D.; Martin, D. Christopher; Barlow, Tom A.; Foster, Karl; Friedman, Peter G.; Morrissey, Patrick; Wyder, Ted K.; Sullivan, Mark; Howell, D. Andrew; Conley, Alex; Seibert, Mark; Madore, Barry F.; Neff, Susan G.; Schiminovich, David; Bianchi, Luciana; Donas, Jose; Milliard, Bruno; Heckman, Timothy M.; Lee, Young-Wook; Rich, R. Michael

    2009-01-01

    We use multi-wavelength, matched aperture, integrated photometry from the Galaxy Evolution Explorer (GALEX), the Sloan Digital Sky Survey, and the RC3 to estimate the physical properties of 166 nearby galaxies hosting 168 well-observed Type Ia supernovae (SNe Ia). The ultraviolet (UV) imaging of local SN Ia hosts from GALEX allows a direct comparison with higher-redshift hosts measured at optical wavelengths that correspond to the rest-frame UV. Our data corroborate well-known features that have been seen in other SN Ia samples. Specifically, hosts with active star formation produce brighter and slower SNe Ia on average, and hosts with luminosity-weighted ages older than 1 Gyr produce on average more faint, fast, and fewer bright, slow SNe Ia than younger hosts. New results include that in our sample, the faintest and fastest SNe Ia occur only in galaxies exceeding a stellar mass threshold of ∼10 10 M sun , leading us to conclude that their progenitors must arise in populations that are older and/or more metal rich than the general SN Ia population. A low host extinction subsample hints at a residual trend in peak luminosity with host age, after correcting for light-curve shape, giving the appearance that older hosts produce less-extincted SNe Ia on average. This has implications for cosmological fitting of SNe Ia, and suggests that host age could be useful as a parameter in the fitting. Converting host mass to metallicity and computing 56 Ni mass from the supernova light curves, we find that our local sample is consistent with a model that predicts a shallow trend between stellar metallicity and the 56 Ni mass that powers the explosion, but we cannot rule out the absence of a trend. We measure a correlation between 56 Ni mass and host age in the local universe that is shallower and not as significant as that seen at higher redshifts. The details of the age- 56 Ni mass correlations at low and higher redshift imply a luminosity-weighted age threshold of ∼3 Gyr

  11. Multifactor dimensionality reduction analysis identifies specific nucleotide patterns promoting genetic polymorphisms

    Directory of Open Access Journals (Sweden)

    Arehart Eric

    2009-03-01

    Full Text Available Abstract Background The fidelity of DNA replication serves as the nidus for both genetic evolution and genomic instability fostering disease. Single nucleotide polymorphisms (SNPs constitute greater than 80% of the genetic variation between individuals. A new theory regarding DNA replication fidelity has emerged in which selectivity is governed by base-pair geometry through interactions between the selected nucleotide, the complementary strand, and the polymerase active site. We hypothesize that specific nucleotide combinations in the flanking regions of SNP fragments are associated with mutation. Results We modeled the relationship between DNA sequence and observed polymorphisms using the novel multifactor dimensionality reduction (MDR approach. MDR was originally developed to detect synergistic interactions between multiple SNPs that are predictive of disease susceptibility. We initially assembled data from the Broad Institute as a pilot test for the hypothesis that flanking region patterns associate with mutagenesis (n = 2194. We then confirmed and expanded our inquiry with human SNPs within coding regions and their flanking sequences collected from the National Center for Biotechnology Information (NCBI database (n = 29967 and a control set of sequences (coding region not associated with SNP sites randomly selected from the NCBI database (n = 29967. We discovered seven flanking region pattern associations in the Broad dataset which reached a minimum significance level of p ≤ 0.05. Significant models (p Conclusion The present study represents the first use of this computational methodology for modeling nonlinear patterns in molecular genetics. MDR was able to identify distinct nucleotide patterning around sites of mutations dependent upon the observed nucleotide change. We discovered one flanking region set that included five nucleotides clustered around a specific type of SNP site. Based on the strongly associated patterns identified in

  12. Vγ9Vδ2 T cell activation by strongly agonistic nucleotidic phosphoantigens.

    Science.gov (United States)

    Moulin, Morgane; Alguacil, Javier; Gu, Siyi; Mehtougui, Asmaa; Adams, Erin J; Peyrottes, Suzanne; Champagne, Eric

    2017-12-01

    Human Vγ9Vδ2 T cells can sense through their TCR tumor cells producing the weak endogenous phosphorylated antigen isopentenyl pyrophosphate (IPP), or bacterially infected cells producing the strong agonist hydroxyl dimethylallyl pyrophosphate (HDMAPP). The recognition of the phosphoantigen is dependent on its binding to the intracellular B30.2 domain of butyrophilin BTN3A1. Most studies have focused on pyrophosphate phosphoantigens. As triphosphate nucleotide derivatives are naturally co-produced with IPP and HDMAPP, we analyzed their specific properties using synthetic nucleotides derived from HDMAPP. The adenylated, thymidylated and uridylated triphosphate derivatives were found to activate directly Vγ9Vδ2 cell lines as efficiently as HDMAPP in the absence of accessory cells. These antigens were inherently resistant to terminal phosphatases, but apyrase, when added during a direct stimulation of Vγ9Vδ2 cells, abrogated their stimulating activity, indicating that their activity required transformation into strong pyrophosphate agonists by a nucleotide pyrophosphatase activity which is present in serum. Tumor cells can be sensitized with nucleotide phosphoantigens in the presence of apyrase to become stimulatory, showing that this can occur before their hydrolysis into pyrophosphates. Whereas tumors sensitized with HDMAPP rapidly lost their stimulatory activity, sensitization with nucleotide derivatives, in particular with the thymidine derivative, induced long-lasting stimulating ability. Using isothermal titration calorimetry, binding of some nucleotide derivatives to BTN3A1 intracellular domain was found to occur with an affinity similar to that of IPP, but much lower than that of HDMAPP. Thus, nucleotide phosphoantigens are precursors of pyrophosphate antigens which can deliver strong agonists intracellularly resulting in prolonged and strengthened activity.

  13. Host response to biomaterials the impact of host response on biomaterial selection

    CERN Document Server

    Badylak, Stephen F

    2015-01-01

    Host Response to Biomaterials: The Impact of Host Response on Biomaterial Selection explains the various categories of biomaterials and their significance for clinical applications, focusing on the host response to each biomaterial. It is one of the first books to connect immunology and biomaterials with regard to host response. The text also explores the role of the immune system in host response, and covers the regulatory environment for biomaterials, along with the benefits of synthetic versus natural biomaterials, and the transition from simple to complex biomaterial solutions. Fiel

  14. Molecular Identification of Weed hosts of Tomato yellow leaf curl virus in southeast of Kerman Province

    Directory of Open Access Journals (Sweden)

    Kh. Salari

    2016-02-01

    55 oC for 60s, and extension at 72 oC for 1 min followed by 1 cycle at 72 oC for 10 min. Electrophoresis of polymerase chain reaction products on 1% agarose gel was performed and stained with DNA safe stain (sinaclon-IRAN. The polymerase chain reaction product were sequenced using automatic sequencer AB13730XL (Macrogen, Korea. The resulting sequences were looking similarity and after obtaining a degree of homology, 550 bp fragment of the coat protein gene of four isolates were ordinated by Bio Edit software. Looking for similar sequences were obtained and then achieved the 550 bp fragments of the coat protein gene homology four software isolates Bio edit (21 were ordination. To study the phylogenetic relationship of study strains, the phylogenetic tree was drawn with maximum likelihood way in the MEGA 5 software. Then percentage of similarity at the nucleotide and amino acid sequence with a genetic distance matrix was determined by using the software CLC Main work bench. Results and Discussion: The results showed that four weeds including Chrozophora tinctoria, Heliotropium annum, Malva neglecta and Chenopodium murale were infected with TYLCV. To compare the TYLCV isolates in infected weeds, 550 bp fragment of the coat protein gene in four different strains of the virus was sequenced. Assessment of the genetic similarity between study isolates and strains in the Gene Bank revealed that study isolates with isolates from Gene Bank have similarity in the range of 93/24-99/98% at the nucleotide level and in the range of 87/42-98/15% at the amino acid level. Sixty-six mutations at the nucleotide level in compared sequences in this study was also found. Drawn Phylogenetic tree was confirmed the results of the genetic distance matrix. The results showed that the virus has a wide host range, and identification of weed hosts to remove the maintenance of virus plays an important role in the epidemiology of the disease. and also it’s the management of this disease. This is

  15. Mechanisms of host seeking by parasitic nematodes.

    Science.gov (United States)

    Gang, Spencer S; Hallem, Elissa A

    2016-07-01

    The phylum Nematoda comprises a diverse group of roundworms that includes parasites of vertebrates, invertebrates, and plants. Human-parasitic nematodes infect more than one billion people worldwide and cause some of the most common neglected tropical diseases, particularly in low-resource countries [1]. Parasitic nematodes of livestock and crops result in billions of dollars in losses each year [1]. Many nematode infections are treatable with low-cost anthelmintic drugs, but repeated infections are common in endemic areas and drug resistance is a growing concern with increasing therapeutic and agricultural administration [1]. Many parasitic nematodes have an environmental infective larval stage that engages in host seeking, a process whereby the infective larvae use sensory cues to search for hosts. Host seeking is a complex behavior that involves multiple sensory modalities, including olfaction, gustation, thermosensation, and humidity sensation. As the initial step of the parasite-host interaction, host seeking could be a powerful target for preventative intervention. However, host-seeking behavior remains poorly understood. Here we review what is currently known about the host-seeking behaviors of different parasitic nematodes, including insect-parasitic nematodes, mammalian-parasitic nematodes, and plant-parasitic nematodes. We also discuss the neural bases of these behaviors. Copyright © 2016 Elsevier B.V. All rights reserved.

  16. Bartonella entry mechanisms into mammalian host cells.

    Science.gov (United States)

    Eicher, Simone C; Dehio, Christoph

    2012-08-01

    The Gram-negative genus Bartonella comprises arthropod-borne pathogens that typically infect mammals in a host-specific manner. Bartonella bacilliformis and Bartonella quintana are human-specific pathogens, while several zoonotic bartonellae specific for diverse animal hosts infect humans as an incidental host. Clinical manifestations of Bartonella infections range from mild symptoms to life-threatening disease. Following transmission by blood-sucking arthropods or traumatic contact with infected animals, bartonellae display sequential tropisms towards endothelial and possibly other nucleated cells and erythrocytes, the latter in a host-specific manner. Attachment to the extracellular matrix (ECM) and to nucleated cells is mediated by surface-exposed bacterial adhesins, in particular trimeric autotransporter adhesins (TAAs). The subsequent engulfment of the pathogen into a vacuolar structure follows a unique series of events whereby the pathogen avoids the endolysosomal compartments. For Bartonella henselae and assumingly most other species, the infection process is aided at different steps by Bartonella effector proteins (Beps). They are injected into host cells through the type IV secretion system (T4SS) VirB/D4 and subvert host cellular functions to favour pathogen uptake. Bacterial binding to erythrocytes is mediated by Trw, another T4SS, in a strictly host-specific manner, followed by pathogen-forced uptake involving the IalB invasin and subsequent replication and persistence within a membrane-bound intra-erythrocytic compartment. © 2012 Blackwell Publishing Ltd.

  17. Associate host in single-layer co-host polymer electrophosphorescent devices

    International Nuclear Information System (INIS)

    Wang Yuanmin; Teng Feng; Feng Bin; Wang Yongsheng; Xu Xurong

    2006-01-01

    The definition and role of 'host' in polymer LED materials are studied in the present work. 'Primary host' and 'associate host' have been proposed and the rules of how to select an associate host are reported. Based on our experiments and the analysis of the energy scheme of the devices, we suggest that the values of the lowest unoccupied molecular orbital (LUMO) and highest occupied molecular orbital (HOMO) are critical determinant in selecting a suitable associate host. On one hand, the associate host should be a hole-blocking material. This can confine the excitons in the active layer. On the other hand, the associate host should have a suitable LUMO that is convenient for electrons to transport

  18. The role of viral population diversity in adaptation of bovine coronavirus to new host environments.

    Directory of Open Access Journals (Sweden)

    Monica K Borucki

    Full Text Available The high mutation rate of RNA viruses enables a diverse genetic population of viral genotypes to exist within a single infected host. In-host genetic diversity could better position the virus population to respond and adapt to a diverse array of selective pressures such as host-switching events. Multiple new coronaviruses, including SARS, have been identified in human samples just within the last ten years, demonstrating the potential of coronaviruses as emergent human pathogens. Deep sequencing was used to characterize genomic changes in coronavirus quasispecies during simulated host-switching. Three bovine nasal samples infected with bovine coronavirus were used to infect human and bovine macrophage and lung cell lines. The virus reproduced relatively well in macrophages, but the lung cell lines were not infected efficiently enough to allow passage of non lab-adapted samples. Approximately 12 kb of the genome was amplified before and after passage and sequenced at average coverages of nearly 950×(454 sequencing and 38,000×(Illumina. The consensus sequence of many of the passaged samples had a 12 nucleotide insert in the consensus sequence of the spike gene, and multiple point mutations were associated with the presence of the insert. Deep sequencing revealed that the insert was present but very rare in the unpassaged samples and could quickly shift to dominate the population when placed in a different environment. The insert coded for three arginine residues, occurred in a region associated with fusion entry into host cells, and may allow infection of new cell types via heparin sulfate binding. Analysis of the deep sequencing data indicated that two distinct genotypes circulated at different frequency levels in each sample, and support the hypothesis that the mutations present in passaged strains were "selected" from a pre-existing pool rather than through de novo mutation and subsequent population fixation.

  19. Host conservatism or host specialization? Patterns of fungal diversification are influenced by host specificity in Ophiognomonia (Gnomoniaceae, Diaporthales)

    Science.gov (United States)

    Species of Ophiognomonia (Gnomoniaceae) are perithecial fungi that occur as endophytes, pathogens, and latent saprobes on leaf and stem tissue of plants in the Betulaceae, Fagaceae, Juglandaceae, Lauraceae, Malvaceae, Platanaceae, Rosaceae, Salicaceae, and Sapindaceae. In this study host plant patte...

  20. Mesoscale spatiotemporal variability in a complex host-parasite system influenced by intermediate host body size.

    Science.gov (United States)

    Rodríguez, Sara M; Valdivia, Nelson

    2017-01-01

    Parasites are essential components of natural communities, but the factors that generate skewed distributions of parasite occurrences and abundances across host populations are not well understood. Here, we analyse at a seascape scale the spatiotemporal relationships of parasite exposure and host body-size with the proportion of infected hosts (i.e., prevalence) and aggregation of parasite burden across ca. 150 km of the coast and over 22 months. We predicted that the effects of parasite exposure on prevalence and aggregation are dependent on host body-sizes. We used an indirect host-parasite interaction in which migratory seagulls, sandy-shore molecrabs, and an acanthocephalan worm constitute the definitive hosts, intermediate hosts, and endoparasite, respectively. In such complex systems, increments in the abundance of definitive hosts imply increments in intermediate hosts' exposure to the parasite's dispersive stages. Linear mixed-effects models showed a significant, albeit highly variable, positive relationship between seagull density and prevalence. This relationship was stronger for small (cephalothorax length >15 mm) than large molecrabs (analysis of the variance-to-mean ratio of per capita parasite burden showed no relationship between seagull density and mean parasite aggregation across host populations. However, the amount of unexplained variability in aggregation was strikingly higher in larger than smaller intermediate hosts. This unexplained variability was driven by a decrease in the mean-variance scaling in heavily infected large molecrabs. These results show complex interdependencies between extrinsic and intrinsic population attributes on the structure of host-parasite interactions. We suggest that parasite accumulation-a characteristic of indirect host-parasite interactions-and subsequent increasing mortality rates over ontogeny underpin size-dependent host-parasite dynamics.

  1. Reversal of Proximal Renal Tubular Dysfunction after Nucleotide Analogue Withdrawal in Chronic Hepatitis B

    Directory of Open Access Journals (Sweden)

    Abhasnee Sobhonslidsuk

    2017-01-01

    Full Text Available Aims. Proximal renal tubular dysfunction (PRTD is an infrequent complication after nucleotide analogue therapy. We evaluated the outcomes of PRTD and nephrotoxicity after nucleotide analogue withdrawal in chronic hepatitis B (CHB. Methods. A longitudinal follow-up study was performed in patients with PRTD after nucleotide analogue discontinuation. Serum and urine were collected at baseline and every 3 months for one year. The fractional excretion of phosphate (PO4, uric acid (UA, and potassium and tubular maximal reabsorption rate of PO4 to glomerular filtration rate (TmPO4/GFR were calculated. Renal losses were defined based on the criteria of substance losses. Subclinical PRTD and overt PRTD were diagnosed when 2 and ≥3 criteria were identified. Results. Eight subclinical and eight overt PRTD patients were enrolled. After nucleotide analogue withdrawal, there were overall improvements in GFR, serum PO4, and UA. Renal loss of PO4, UA, protein, and β2-microglobulin reduced over time. At one year, complete reversal of PRTD was seen in 13 patients (81.2%. Improvements in PRTD were seen in all but one patient. Conclusion. One year after nucleotide analogue withdrawal, PRTD was resolved in most patients. Changes in TmPO4/GFR, urinary protein, and β2-microglobulin indicate that urinary biomarkers may represent an early sign of PRTD recovery.

  2. Enhanced NMR signal detection of imino protons in RNA molecules containing 3' dangling nucleotides

    International Nuclear Information System (INIS)

    Amborski, Andrew N.; Johnson, Philip E.

    2008-01-01

    We present a method for improving the quality of nuclear magnetic resonance (NMR) spectra involving exchangeable protons near the base of the stem of RNA hairpin molecules. NMR spectra of five different RNA hairpins were compared. These hairpins consisted of a native RNA structure and four molecules each having different unpaired, or dangling, nucleotides at the 3' end. NMR experiments were acquired in water for each construct and the quality of the imino proton spectral regions were examined. The imino resonances near the base of the stem of the wild type RNA structure were not observed due to breathing motions. However, a significant increase in spectral quality for molecules with dangling 3' adenosine or guanosine nucleotides was observed, with imino protons detected in these constructs that were not observed in the wild type construct. A modest improvement in spectral quality was seen for the construct with a 3' unpaired uridine, whereas no significant improvement was observed for a 3' unpaired cytidine. This improvement in NMR spectral quality mirrors the increased thermodynamic stability observed for 3' unpaired nucleotides which is dependant on the stacking interactions of these nucleotides against the base of the stem. The use of a dangling 3' adenosine nucleotide represents an easy method to significantly improve the quality of NMR spectra of RNA molecules

  3. Multifunctional roles of leader protein of foot-and-mouth disease viruses in suppressing host antiviral responses.

    Science.gov (United States)

    Liu, Yingqi; Zhu, Zixiang; Zhang, Miaotao; Zheng, Haixue

    2015-10-28

    Foot-and-mouth disease virus (FMDV) leader protein (L(pro)) is a papain-like proteinase, which plays an important role in FMDV pathogenesis. L(pro) exists as two forms, Lab and Lb, due to translation being initiated from two different start codons separated by 84 nucleotides. L(pro) self-cleaves from the nascent viral polyprotein precursor as the first mature viral protein. In addition to its role as a viral proteinase, L(pro) also has the ability to antagonize host antiviral effects. To promote FMDV replication, L(pro) can suppress host antiviral responses by three different mechanisms: (1) cleavage of eukaryotic translation initiation factor 4 γ (eIF4G) to shut off host protein synthesis; (2) inhibition of host innate immune responses through restriction of interferon-α/β production; and (3) L(pro) can also act as a deubiquitinase and catalyze deubiquitination of innate immune signaling molecules. In the light of recent functional and biochemical findings regarding L(pro), this review introduces the basic properties of L(pro) and the mechanisms by which it antagonizes host antiviral responses.

  4. Chemical similarity between historical and novel host plants promotes range and host expansion of the mountain pine beetle in a naïve host ecosystem.

    Science.gov (United States)

    Erbilgin, Nadir; Ma, Cary; Whitehouse, Caroline; Shan, Bin; Najar, Ahmed; Evenden, Maya

    2014-02-01

    Host plant secondary chemistry can have cascading impacts on host and range expansion of herbivorous insect populations. We investigated the role of host secondary compounds on pheromone production by the mountain pine beetle (Dendroctonus ponderosae) (MPB) and beetle attraction in response to a historical (lodgepole pine, Pinus contorta var. latifolia) and a novel (jack pine, Pinus banksiana) hosts, as pheromones regulate the host colonization process. Beetles emit the same pheromones from both hosts, but more trans-verbenol, the primary aggregation pheromone, was emitted by female beetles on the novel host. The phloem of the novel host contains more α-pinene, a secondary compound that is the precursor for trans-verbenol production in beetle, than the historical host. Beetle-induced emission of 3-carene, another secondary compound found in both hosts, was also higher from the novel host. Field tests showed that the addition of 3-carene to the pheromone mixture mimicking the aggregation pheromones produced from the two host species increased beetle capture. We conclude that chemical similarity between historical and novel hosts has facilitated host expansion of MPB in jack pine forests through the exploitation of common host secondary compounds for pheromone production and aggregation on the hosts. Furthermore, broods emerging from the novel host were larger in terms of body size. © 2013 The Authors. New Phytologist © 2013 New Phytologist Trust.

  5. MicroRNAs in the host response to viral infections of veterinary importance

    Directory of Open Access Journals (Sweden)

    Mohamed Samir Ahmed

    2016-10-01

    Full Text Available The discovery of small regulatory non-coding RNAs has been an exciting advance in the field of genomics. MicroRNAs (miRNAs are endogenous RNA molecules, approximately 22 nucleotides in length that regulate gene expression, mostly at the post-transcriptional level. MiRNA profiling technologies have made it possible to identify and quantify novel miRNAs and to study their regulation and potential roles in disease pathogenesis. Although miRNAs have been extensively investigated in viral infections of humans, their implications in viral diseases affecting animals of veterinary importance are much less understood. The number of annotated miRNAs in different animal species is growing continuously, and novel roles in regulating host-pathogen interactions are being discovered, for instance miRNA-mediated augmentation of viral transcription and replication. In this review, we present an overview of synthesis and function of miRNAs and an update on the current state of research on host-encoded miRNAs in the genesis of viral infectious diseases in their natural animal host as well as in selected in vivo and in vitro laboratory models.

  6. Properties of alternative microbial hosts used in synthetic biology: towards the design of a modular chassis

    Science.gov (United States)

    Kim, Juhyun; Salvador, Manuel; Saunders, Elizabeth; González, Jaime; Avignone-Rossa, Claudio

    2016-01-01

    The chassis is the cellular host used as a recipient of engineered biological systems in synthetic biology. They are required to propagate the genetic information and to express the genes encoded in it. Despite being an essential element for the appropriate function of genetic circuits, the chassis is rarely considered in their design phase. Consequently, the circuits are transferred to model organisms commonly used in the laboratory, such as Escherichia coli, that may be suboptimal for a required function. In this review, we discuss some of the properties desirable in a versatile chassis and summarize some examples of alternative hosts for synthetic biology amenable for engineering. These properties include a suitable life style, a robust cell wall, good knowledge of its regulatory network as well as of the interplay of the host components with the exogenous circuits, and the possibility of developing whole-cell models and tuneable metabolic fluxes that could allow a better distribution of cellular resources (metabolites, ATP, nucleotides, amino acids, transcriptional and translational machinery). We highlight Pseudomonas putida, widely used in many different biotechnological applications as a prominent organism for synthetic biology due to its metabolic diversity, robustness and ease of manipulation. PMID:27903818

  7. Towards host-directed therapies for tuberculosis.

    Science.gov (United States)

    Zumla, Alimuddin; Maeurer, Markus; Chakaya, Jeremiah; Hoelscher, Michael; Ntoumi, Francine; Rustomjee, Roxana; Vilaplana, Cristina; Yeboah-Manu, Dorothy; Rasolof, Voahangy; Munderi, Paula; Singh, Nalini; Aklillu, Eleni; Padayatchi, Nesri; Macete, Eusebio; Kapata, Nathan; Mulenga, Modest; Kibiki, Gibson; Mfinanga, Sayoki; Nyirenda, Thomas; Maboko, Leonard; Garcia-Basteiro, Alberto; Rakotosamimanana, Niaina; Bates, Matthew; Mwaba, Peter; Reither, Klaus; Gagneux, Sebastien; Edwards, Sarah; Mfinanga, Elirehema; Abdulla, Salim; Cardona, Pere-Joan; Russell, James B W; Gant, Vanya; Noursadeghi, Mahdad; Elkington, Paul; Bonnet, Maryline; Menendez, Clara; Dieye, Tandakha N; Diarra, Bassirou; Maiga, Almoustapha; Aseffa, Abraham; Parida, Shreemanta; Wejse, Christian; Petersen, Eskild; Kaleebu, Pontiano; Oliver, Matt; Craig, Gill; Corrah, Tumena; Tientcheu, Leopold; Antonio, Martin; Rao, Martin; McHugh, Timothy D; Sheikh, Aziz; Ippolito, Giuseppe; Ramjee, Gita; Kaufmann, Stefan H E; Churchyard, Gavin; Steyn, Andrie; Grobusch, Martin; Sanne, Ian; Martinson, Neil; Madansein, Rajhmun; Wilkinson, Robert J; Mayosi, Bongani; Schito, Marco; Wallis, Robert S

    2015-08-01

    The treatment of tuberculosis is based on combinations of drugs that directly target Mycobacterium tuberculosis. A new global initiative is now focusing on a complementary approach of developing adjunct host-directed therapies.

  8. Hologenomics: Systems-Level Host Biology.

    Science.gov (United States)

    Theis, Kevin R

    2018-01-01

    The hologenome concept of evolution is a hypothesis explaining host evolution in the context of the host microbiomes. As a hypothesis, it needs to be evaluated, especially with respect to the extent of fidelity of transgenerational coassociation of host and microbial lineages and the relative fitness consequences of repeated associations within natural holobiont populations. Behavioral ecologists are in a prime position to test these predictions because they typically focus on animal phenotypes that are quantifiable, conduct studies over multiple generations within natural animal populations, and collect metadata on genetic relatedness and relative reproductive success within these populations. Regardless of the conclusion on the hologenome concept as an evolutionary hypothesis, a hologenomic perspective has applied value as a systems-level framework for host biology, including in medicine. Specifically, it emphasizes investigating the multivarious and dynamic interactions between patient genomes and the genomes of their diverse microbiota when attempting to elucidate etiologies of complex, noninfectious diseases.

  9. Host Plants of Xylosandrus mutilatus in Mississippi

    International Nuclear Information System (INIS)

    Stone, W.D.; Nebeker, T.E.; Gerard, P.D.

    2007-01-01

    Host range of Xylosandrus mutilatus (Blandford) in North America is reported here for the first time. Descriptive data such as number of attacks per host, size of stems at point of attacks, and height of attacks above ground are presented. Hosts observed in Mississippi were Acer rubrum L., Acer saccharum Marsh., Acer palmatum Thunb., Ostrya virginiana (Mill.) K. Koch., Cornus florida L., Fagus grandifolia Ehrh., Liquidamber styraciflua L., Carya spp., Liriodendron tulipifera L., Melia azedarach L., Pinus taeda L., Prunus serotina Ehrh., Prunus americana Marsh., Ulmus alata Michaux, and Vitus rotundifolia Michaux. Liquidamber styraciflua had significantly more successful attacks, significantly higher probability of attacks, and significantly higher number of adult beetles per host tree than did Carya spp., A. rubrum, and L. tulipifera. This information is relevant in determining the impact this exotic beetle may have in nurseries, urban areas, and other forestry systems where this beetle becomes established. (author) [es

  10. CERN to host conference on information society

    CERN Multimedia

    CERN will host a conference on the Role of Science in the Information Society (RSIS) in December. This conference will focus on ensuring that the information society benefits people to the greatest extent possible, especially in developing regions.

  11. Host-bacterial interplay in periodontal disease

    Directory of Open Access Journals (Sweden)

    Rudrakshi Chickanna

    2015-01-01

    Full Text Available A literature search was performed using MEDLINE (PubMed and other electronic basis from 1991 to 2014. Search included books and journals based on the systematic and critical reviews, in vitro and in vivo clinical studies on molecular basis of host microbial interactions. Clearly, an understanding of the host susceptibility factor in addition to microbial factors by elucidating the molecular basis offers opportunity for therapeutic manipulation of advancing periodontal destruction. One of the hallmarks of pathogenesis is the ability of pathogenic organisms to invade surrounding tissues and to evade the host defence. This paper focuses the general overview of molecular mechanisms involved in the microbiota and host response to bacterial inimical behavior in periodontics.

  12. Directional Selection from Host Plants Is a Major Force Driving Host Specificity in Magnaporthe Species.

    Science.gov (United States)

    Zhong, Zhenhui; Norvienyeku, Justice; Chen, Meilian; Bao, Jiandong; Lin, Lianyu; Chen, Liqiong; Lin, Yahong; Wu, Xiaoxian; Cai, Zena; Zhang, Qi; Lin, Xiaoye; Hong, Yonghe; Huang, Jun; Xu, Linghong; Zhang, Honghong; Chen, Long; Tang, Wei; Zheng, Huakun; Chen, Xiaofeng; Wang, Yanli; Lian, Bi; Zhang, Liangsheng; Tang, Haibao; Lu, Guodong; Ebbole, Daniel J; Wang, Baohua; Wang, Zonghua

    2016-05-06

    One major threat to global food security that requires immediate attention, is the increasing incidence of host shift and host expansion in growing number of pathogenic fungi and emergence of new pathogens. The threat is more alarming because, yield quality and quantity improvement efforts are encouraging the cultivation of uniform plants with low genetic diversity that are increasingly susceptible to emerging pathogens. However, the influence of host genome differentiation on pathogen genome differentiation and its contribution to emergence and adaptability is still obscure. Here, we compared genome sequence of 6 isolates of Magnaporthe species obtained from three different host plants. We demonstrated the evolutionary relationship between Magnaporthe species and the influence of host differentiation on pathogens. Phylogenetic analysis showed that evolution of pathogen directly corresponds with host divergence, suggesting that host-pathogen interaction has led to co-evolution. Furthermore, we identified an asymmetric selection pressure on Magnaporthe species. Oryza sativa-infecting isolates showed higher directional selection from host and subsequently tends to lower the genetic diversity in its genome. We concluded that, frequent gene loss or gain, new transposon acquisition and sequence divergence are host adaptability mechanisms for Magnaporthe species, and this coevolution processes is greatly driven by directional selection from host plants.

  13. Mesoscale spatiotemporal variability in a complex host-parasite system influenced by intermediate host body size

    Directory of Open Access Journals (Sweden)

    Sara M. Rodríguez

    2017-08-01

    Full Text Available Background Parasites are essential components of natural communities, but the factors that generate skewed distributions of parasite occurrences and abundances across host populations are not well understood. Methods Here, we analyse at a seascape scale the spatiotemporal relationships of parasite exposure and host body-size with the proportion of infected hosts (i.e., prevalence and aggregation of parasite burden across ca. 150 km of the coast and over 22 months. We predicted that the effects of parasite exposure on prevalence and aggregation are dependent on host body-sizes. We used an indirect host-parasite interaction in which migratory seagulls, sandy-shore molecrabs, and an acanthocephalan worm constitute the definitive hosts, intermediate hosts, and endoparasite, respectively. In such complex systems, increments in the abundance of definitive hosts imply increments in intermediate hosts’ exposure to the parasite’s dispersive stages. Results Linear mixed-effects models showed a significant, albeit highly variable, positive relationship between seagull density and prevalence. This relationship was stronger for small (cephalothorax length >15 mm than large molecrabs (<15 mm. Independently of seagull density, large molecrabs carried significantly more parasites than small molecrabs. The analysis of the variance-to-mean ratio of per capita parasite burden showed no relationship between seagull density and mean parasite aggregation across host populations. However, the amount of unexplained variability in aggregation was strikingly higher in larger than smaller intermediate hosts. This unexplained variability was driven by a decrease in the mean-variance scaling in heavily infected large molecrabs. Conclusions These results show complex interdependencies between extrinsic and intrinsic population attributes on the structure of host-parasite interactions. We suggest that parasite accumulation—a characteristic of indirect host

  14. Poxvirus Host Range Genes and Virus–Host Spectrum: A Critical Review

    Science.gov (United States)

    Oliveira, Graziele Pereira; Rodrigues, Rodrigo Araújo Lima; Lima, Maurício Teixeira; Drumond, Betânia Paiva; Abrahão, Jônatas Santos

    2017-01-01

    The Poxviridae family is comprised of double-stranded DNA viruses belonging to nucleocytoplasmic large DNA viruses (NCLDV). Among the NCLDV, poxviruses exhibit the widest known host range, which is likely observed because this viral family has been more heavily investigated. However, relative to each member of the Poxviridae family, the spectrum of the host is variable, where certain viruses can infect a large range of hosts, while others are restricted to only one host species. It has been suggested that the variability in host spectrum among poxviruses is linked with the presence or absence of some host range genes. Would it be possible to extrapolate the restriction of viral replication in a specific cell lineage to an animal, a far more complex organism? In this study, we compare and discuss the relationship between the host range of poxvirus species and the abundance/diversity of host range genes. We analyzed the sequences of 38 previously identified and putative homologs of poxvirus host range genes, and updated these data with deposited sequences of new poxvirus genomes. Overall, the term host range genes might not be the most appropriate for these genes, since no correlation between them and the viruses’ host spectrum was observed, and a change in nomenclature should be considered. Finally, we analyzed the evolutionary history of these genes, and reaffirmed the occurrence of horizontal gene transfer (HGT) for certain elements, as previously suggested. Considering the data presented in this study, it is not possible to associate the diversity of host range factors with the amount of hosts of known poxviruses, and this traditional nomenclature creates misunderstandings. PMID:29112165

  15. Poxvirus Host Range Genes and Virus-Host Spectrum: A Critical Review.

    Science.gov (United States)

    Oliveira, Graziele Pereira; Rodrigues, Rodrigo Araújo Lima; Lima, Maurício Teixeira; Drumond, Betânia Paiva; Abrahão, Jônatas Santos

    2017-11-07

    The Poxviridae family is comprised of double-stranded DNA viruses belonging to nucleocytoplasmic large DNA viruses (NCLDV). Among the NCLDV, poxviruses exhibit the widest known host range, which is likely observed because this viral family has been more heavily investigated. However, relative to each member of the Poxviridae family, the spectrum of the host is variable, where certain viruses can infect a large range of hosts, while others are restricted to only one host species. It has been suggested that the variability in host spectrum among poxviruses is linked with the presence or absence of some host range genes. Would it be possible to extrapolate the restriction of viral replication in a specific cell lineage to an animal, a far more complex organism? In this study, we compare and discuss the relationship between the host range of poxvirus species and the abundance/diversity of host range genes. We analyzed the sequences of 38 previously identified and putative homologs of poxvirus host range genes, and updated these data with deposited sequences of new poxvirus genomes. Overall, the term host range genes might not be the most appropriate for these genes, since no correlation between them and the viruses' host spectrum was observed, and a change in nomenclature should be considered. Finally, we analyzed the evolutionary history of these genes, and reaffirmed the occurrence of horizontal gene transfer (HGT) for certain elements, as previously suggested. Considering the data presented in this study, it is not possible to associate the diversity of host range factors with the amount of hosts of known poxviruses, and this traditional nomenclature creates misunderstandings.

  16. Host density and competency determine the effects of host diversity on trematode parasite infection.

    Directory of Open Access Journals (Sweden)

    Jeremy M Wojdak

    Full Text Available Variation in host species composition can dramatically alter parasite transmission in natural communities. Whether diverse host communities dilute or amplify parasite transmission is thought to depend critically on species traits, particularly on how hosts affect each other's densities, and their relative competency as hosts. Here we studied a community of potential hosts and/or decoys (i.e. non-competent hosts for two trematode parasite species, Echinostoma trivolvis and Ribeiroia ondatrae, which commonly infect wildlife across North America. We manipulated the density of a focal host (green frog tadpoles, Rana clamitans, in concert with manipulating the diversity of alternative species, to simulate communities where alternative species either (1 replace the focal host species so that the total number of individuals remains constant (substitution or (2 add to total host density (addition. For E. trivolvis, we found that total parasite transmission remained roughly equal (or perhaps decreased slightly when alternative species replaced focal host individuals, but parasite transmission was higher when alternative species were added to a community without replacing focal host individuals. Given the alternative species were roughly equal in competency, these results are consistent with current theory. Remarkably, both total tadpole and per-capita tadpole infection intensity by E. trivolvis increased with increasing intraspecific host density. For R. ondatrae, alternative species did not function as effective decoys or hosts for parasite infective stages, and the diversity and density treatments did not produce clear changes in parasite transmission, although high tank to tank variation in R. ondatrae infection could have obscured patterns.

  17. Host reproductive phenology drives seasonal patterns of host use in mosquitoes.

    Directory of Open Access Journals (Sweden)

    Nathan D Burkett-Cadena

    2011-03-01

    Full Text Available Seasonal shifts in host use by mosquitoes from birds to mammals drive the timing and intensity of annual epidemics of mosquito-borne viruses, such as West Nile virus, in North America. The biological mechanism underlying these shifts has been a matter of debate, with hypotheses falling into two camps: (1 the shift is driven by changes in host abundance, or (2 the shift is driven by seasonal changes in the foraging behavior of mosquitoes. Here we explored the idea that seasonal changes in host use by mosquitoes are driven by temporal patterns of host reproduction. We investigated the relationship between seasonal patterns of host use by mosquitoes and host reproductive phenology by examining a seven-year dataset of blood meal identifications from a site in Tuskegee National Forest, Alabama USA and data on reproduction from the most commonly utilized endothermic (white-tailed deer, great blue heron, yellow-crowned night heron and ectothermic (frogs hosts. Our analysis revealed that feeding on each host peaked during periods of reproductive activity. Specifically, mosquitoes utilized herons in the spring and early summer, during periods of peak nest occupancy, whereas deer were fed upon most during the late summer and fall, the period corresponding to the peak in births for deer. For frogs, however, feeding on early- and late-season breeders paralleled peaks in male vocalization. We demonstrate for the first time that seasonal patterns of host use by mosquitoes track the reproductive phenology of the hosts. Peaks in relative mosquito feeding on each host during reproductive phases are likely the result of increased tolerance and decreased vigilance to attacking mosquitoes by nestlings and brooding adults (avian hosts, quiescent young (avian and mammalian hosts, and mate-seeking males (frogs.

  18. Guanine nucleotide binding to the Bateman domain mediates the allosteric inhibition of eukaryotic IMP dehydrogenases

    Science.gov (United States)

    Buey, Rubén M.; Ledesma-Amaro, Rodrigo; Velázquez-Campoy, Adrián; Balsera, Mónica; Chagoyen, Mónica; de Pereda, José M.; Revuelta, José L.

    2015-11-01

    Inosine-5'-monophosphate dehydrogenase (IMPDH) plays key roles in purine nucleotide metabolism and cell proliferation. Although IMPDH is a widely studied therapeutic target, there is limited information about its physiological regulation. Using Ashbya gossypii as a model, we describe the molecular mechanism and the structural basis for the allosteric regulation of IMPDH by guanine nucleotides. We report that GTP and GDP bind to the regulatory Bateman domain, inducing octamers with compromised catalytic activity. Our data suggest that eukaryotic and prokaryotic IMPDHs might have developed different regulatory mechanisms, with GTP/GDP inhibiting only eukaryotic IMPDHs. Interestingly, mutations associated with human retinopathies map into the guanine nucleotide-binding sites including a previously undescribed non-canonical site and disrupt allosteric inhibition. Together, our results shed light on the mechanisms of the allosteric regulation of enzymes mediated by Bateman domains and provide a molecular basis for certain retinopathies, opening the door to new therapeutic approaches.

  19. Optimization time synthesis of nucleotide labelled [γ-32P]-ATP

    International Nuclear Information System (INIS)

    Rahman, Wira Y; Sarmini, Endang; Herlina; Lubis, Hotman; Triyanto; Hambali

    2013-01-01

    Adenosine triphosphate-labelled with γ- 32 P([γ- 32 p]-ATP) has been widely used in the biotechnology research, usually as a tracer to study aspects of physiological and pathological processes. In order to support biotechnology research in Indonesia, a process for production of [γ- 32 P]-ATP with enzymatic reaction was used as precursors DL-glyceraldehydde 3-phosphate, Adenosine Diphosphate (ADP) and H 3 32 PO 4 , and enzyme glyceraldehid 3-phosphate dehydrogenase, 3-phosphoglyceryc phosphokinase and lactate dehydrogenase. Optimization of incubation time labeled nucleotide synthesis process is performed to find the optimum conditions, in terms of the most advantageous time in the synthesis process. With the success of the synthesis and optimization is done incubation time of synthesis labeled nucleotide, the result suggested can be used for producing [γ- 32 P] -ATP to support the provision of radiolabeled nucleotide for biotechnology research in Indonesia. (author)

  20. Heated oligonucleotide ligation assay (HOLA): an affordable single nucleotide polymorphism assay.

    Science.gov (United States)

    Black, W C; Gorrochotegui-Escalante, N; Duteau, N M

    2006-03-01

    Most single nucleotide polymorphism (SNP) detection requires expensive equipment and reagents. The oligonucleotide ligation assay (OLA) is an inexpensive SNP assay that detects ligation between a biotinylated "allele-specific detector" and a 3' fluorescein-labeled "reporter" oligonucleotide. No ligation occurs unless the 3' detector nucleotide is complementary to the SNP nucleotide. The original OLA used chemical denaturation and neutralization. Heated OLA (HOLA) instead uses a thermal stable ligase and cycles of denaturing and hybridization for ligation and SNP detection. The cost per genotype is approximately US$1.25 with two-allele SNPs or approximately US$1.75 with three-allele SNPs. We illustrate the development of HOLA for SNP detection in the Early Trypsin and Abundant Trypsin loci in the mosquito Aedes aegypti (L.) and at the a-glycerophosphate dehydrogenase locus in the mosquito Anopheles gambiae s.s.

  1. The Fanconi anaemia components UBE2T and FANCM are functionally linked to nucleotide excision repair.

    Directory of Open Access Journals (Sweden)

    Ian R Kelsall

    Full Text Available The many proteins that function in the Fanconi anaemia (FA monoubiquitylation pathway initiate replicative DNA crosslink repair. However, it is not clear whether individual FA genes participate in DNA repair pathways other than homologous recombination and translesion bypass. Here we show that avian DT40 cell knockouts of two integral FA genes--UBE2T and FANCM are unexpectedly sensitive to UV-induced DNA damage. Comprehensive genetic dissection experiments indicate that both of these FA genes collaborate to promote nucleotide excision repair rather than translesion bypass to protect cells form UV genotoxicity. Furthermore, UBE2T deficiency impacts on the efficient removal of the UV-induced photolesion cyclobutane pyrimidine dimer. Therefore, this work reveals that the FA pathway shares two components with nucleotide excision repair, intimating not only crosstalk between the two major repair pathways, but also potentially identifying a UBE2T-mediated ubiquitin-signalling response pathway that contributes to nucleotide excision repair.

  2. De novo synthesis of purine nucleotides in different fiber types of rat skeletal muscle

    International Nuclear Information System (INIS)

    Tullson, P.C.; John-Alder, H.; Hood, D.A.; Terjung, R.L.

    1986-01-01

    The contribution of de novo purine nucleotide synthesis to nucleotide metabolism in skeletal muscles is not known. The authors have determined rates of de novo synthesis in soleus (slow-twitch red), red gastrocnemius (fast-twitch red), and white gastrocnemius (fast-twitch white) using the perfused rat hindquarter. 14 C glycine incorporation into ATP was linear after 1 and 2 hours of perfusion with 0.2 mM added glycine. The intracellular (I) and extracellular (E) specific activity of 14 C glycine was determined by HPLC of phenylisothiocyanate derivatives of neutralized PCA extracts. The rates of de novo synthesis when expressed relative to muscle ATP content show slow and fast-twitch red muscles to be similar and about twice as great as fast-twitch white muscles. This could represent a greater turnover of the adenine nucleotide pool in more oxidative red muscle types

  3. Nucleotide Sequence Diversity and Linkage Disequilibrium of Four Nuclear Loci in Foxtail Millet (Setaria italica.

    Directory of Open Access Journals (Sweden)

    Shui-Lian He

    Full Text Available Foxtail millet (Setaria italica (L. Beauv is one of the earliest domesticated grains, which has been cultivated in northern China by 8,700 years before present (YBP and across Eurasia by 4,000 YBP. Owing to a small genome and diploid nature, foxtail millet is a tractable model crop for studying functional genomics of millets and bioenergy grasses. In this study, we examined nucleotide sequence diversity, geographic structure, and levels of linkage disequilibrium at four nuclear loci (ADH1, G3PDH, IGS1 and TPI1 in representative samples of 311 landrace accessions across its cultivated range. Higher levels of nucleotide sequence and haplotype diversity were observed in samples from China relative to other sampled regions. Genetic assignment analysis classified the accessions into seven clusters based on nucleotide sequence polymorphisms. Intralocus LD decayed rapidly to half the initial value within ~1.2 kb or less.

  4. Nucleotide Sequence Diversity and Linkage Disequilibrium of Four Nuclear Loci in Foxtail Millet (Setaria italica).

    Science.gov (United States)

    He, Shui-Lian; Yang, Yang; Morrell, Peter L; Yi, Ting-Shuang

    2015-01-01

    Foxtail millet (Setaria italica (L.) Beauv) is one of the earliest domesticated grains, which has been cultivated in northern China by 8,700 years before present (YBP) and across Eurasia by 4,000 YBP. Owing to a small genome and diploid nature, foxtail millet is a tractable model crop for studying functional genomics of millets and bioenergy grasses. In this study, we examined nucleotide sequence diversity, geographic structure, and levels of linkage disequilibrium at four nuclear loci (ADH1, G3PDH, IGS1 and TPI1) in representative samples of 311 landrace accessions across its cultivated range. Higher levels of nucleotide sequence and haplotype diversity were observed in samples from China relative to other sampled regions. Genetic assignment analysis classified the accessions into seven clusters based on nucleotide sequence polymorphisms. Intralocus LD decayed rapidly to half the initial value within ~1.2 kb or less.

  5. Nucleotide sequence and genetic organization of Hungarian grapevine chrome mosaic nepovirus RNA2.

    Science.gov (United States)

    Brault, V; Hibrand, L; Candresse, T; Le Gall, O; Dunez, J

    1989-10-11

    The complete nucleotide sequence of hungarian grapevine chrome mosaic nepovirus (GCMV) RNA2 has been determined. The RNA sequence is 4441 nucleotides in length, excluding the poly(A) tail. A polyprotein of 1324 amino acids with a calculated molecular weight of 146 kDa is encoded in a single long open reading frame extending from nucleotides 218 to 4190. This polyprotein is homologous with the protein encoded by the S strain of tomato black ring virus (TBRV) RNA2, the only other nepovirus sequenced so far. Direct sequencing of the viral coat protein and in vitro translation of transcripts derived from cDNA sequences demonstrate that, as for comoviruses, the coat protein is located at the carboxy terminus of the polyprotein. A model for the expression of GCMV RNA2 is presented.

  6. [Replication of Streptomyces plasmids: the DNA nucleotide sequence of plasmid pSB 24.2].

    Science.gov (United States)

    Bolotin, A P; Sorokin, A V; Aleksandrov, N N; Danilenko, V N; Kozlov, Iu I

    1985-11-01

    The nucleotide sequence of DNA in plasmid pSB 24.2, a natural deletion derivative of plasmid pSB 24.1 isolated from S. cyanogenus was studied. The plasmid amounted by its size to 3706 nucleotide pairs. The G-C composition was equal to 73 per cent. The analysis of the DNA structure in plasmid pSB 24.2 revealed the protein-encoding sequence of DNA, the continuity of which was significant for replication of the plasmid containing more than 1300 nucleotide pairs. The analysis also revealed two A-T-rich areas of DNA, the G-C composition of which was less than 55 per cent and a DNA area with a branched pin structure. The results may be of value in investigation of plasmid replication in actinomycetes and experimental cloning of DNA with this plasmid as a vector.

  7. Data hosting infrastructure for primary biodiversity data

    Science.gov (United States)

    2011-01-01

    Background Today, an unprecedented volume of primary biodiversity data are being generated worldwide, yet significant amounts of these data have been and will continue to be lost after the conclusion of the projects tasked with collecting them. To get the most value out of these data it is imperative to seek a solution whereby these data are rescued, archived and made available to the biodiversity community. To this end, the biodiversity informatics community requires investment in processes and infrastructure to mitigate data loss and provide solutions for long-term hosting and sharing of biodiversity data. Discussion We review the current state of biodiversity data hosting and investigate the technological and sociological barriers to proper data management. We further explore the rescuing and re-hosting of legacy data, the state of existing toolsets and propose a future direction for the development of new discovery tools. We also explore the role of data standards and licensing in the context of data hosting and preservation. We provide five recommendations for the biodiversity community that will foster better data preservation and access: (1) encourage the community's use of data standards, (2) promote the public domain licensing of data, (3) establish a community of those involved in data hosting and archival, (4) establish hosting centers for biodiversity data, and (5) develop tools for data discovery. Conclusion The community's adoption of standards and development of tools to enable data discovery is essential to sustainable data preservation. Furthermore, the increased adoption of open content licensing, the establishment of data hosting infrastructure and the creation of a data hosting and archiving community are all necessary steps towards the community ensuring that data archival policies become standardized. PMID:22373257

  8. Interaction of pathogens with host cholesterol metabolism.

    Science.gov (United States)

    Sviridov, Dmitri; Bukrinsky, Michael

    2014-10-01

    Pathogens of different taxa, from prions to protozoa, target cellular cholesterol metabolism to advance their own development and to impair host immune responses, but also causing metabolic complications, for example, atherosclerosis. This review describes recent findings of how pathogens do it. A common theme in interaction between pathogens and host cholesterol metabolism is pathogens targeting lipid rafts of the host plasma membrane. Many intracellular pathogens use rafts as an entry gate, taking advantage of the endocytic machinery and high abundance of outward-looking molecules that can be used as receptors. At the same time, disruption of the rafts' functional capacity, achieved by the pathogens through a number of various means, impairs the ability of the host to generate immune response, thus helping pathogen to thrive. Pathogens cannot synthesize cholesterol, and salvaging host cholesterol helps pathogens build advanced cholesterol-containing membranes and assembly platforms. Impact on cholesterol metabolism is not limited to the infected cells; proteins and microRNAs secreted by infected cells affect lipid metabolism systemically. Given an essential role that host cholesterol metabolism plays in pathogen development, targeting this interaction may be a viable strategy to fight infections, as well as metabolic complications of the infections.

  9. Different characteristics and nucleotide binding properties of inosine monophosphate dehydrogenase (IMPDH isoforms.

    Directory of Open Access Journals (Sweden)

    Elaine C Thomas

    Full Text Available We recently reported that Inosine Monophosphate Dehydrogenase (IMPDH, a rate-limiting enzyme in de novo guanine nucleotide biosynthesis, clustered into macrostructures in response to decreased nucleotide levels and that there were differences between the IMPDH isoforms, IMPDH1 and IMPDH2. We hypothesised that the Bateman domains, which are present in both isoforms and serve as energy-sensing/allosteric modules in unrelated proteins, would contribute to isoform-specific differences and that mutations situated in and around this domain in IMPDH1 which give rise to retinitis pigmentosa (RP would compromise regulation. We employed immuno-electron microscopy to investigate the ultrastructure of IMPDH macrostructures and live-cell imaging to follow clustering of an IMPDH2-GFP chimera in real-time. Using a series of IMPDH1/IMPDH2 chimera we demonstrated that the propensity to cluster was conferred by the N-terminal 244 amino acids, which includes the Bateman domain. A protease protection assay suggested isoform-specific purine nucleotide binding characteristics, with ATP protecting IMPDH1 and AMP protecting IMPDH2, via a mechanism involving conformational changes upon nucleotide binding to the Bateman domain without affecting IMPDH catalytic activity. ATP binding to IMPDH1 was confirmed in a nucleotide binding assay. The RP-causing mutation, R224P, abolished ATP binding and nucleotide protection and this correlated with an altered propensity to cluster. Collectively these data demonstrate that (i the isoforms are differentially regulated by AMP and ATP by a mechanism involving the Bateman domain, (ii communication occurs between the Bateman and catalytic domains and (iii the RP-causing mutations compromise such regulation. These findings support the idea that the IMPDH isoforms are subject to distinct regulation and that regulatory defects contribute to human disease.

  10. Guanine nucleotide regulation of α1-adrenergic receptors of muscle and kidney eptihelial cells

    International Nuclear Information System (INIS)

    Terman, B.I.; Hughes, R.J.; Slivka, S.R.; Insel, P.A.

    1986-01-01

    The authors have examined the effect of guanine nucleotides on the interaction of adrenergic agents with α 1 -adrenergic receptors of two cell lines, the Madin-Darby Canine Kidney (MDCK) and BC3H-1 muscle cells. While gaunylylimidodiphosphoate (Gpp(NH)p) had no effect on the affinity or the total number of [ -3 H]prazosin binding sites in membranes prepared from these cells, the nucleotide decreased the apparent affinity of the agonist epinephrine in competing for [ 3 H]prazosin binding sites in both cell types. The EC 50 of Gpp(NH)p was ∼100 μM, and a maximal effect was seen at 500 μM. In contrast, 100 μM Gpp(NH)p yielding maximal shifts in binding of epinephrine to β-adrenergic receptors in BC3H-1 cell membranes. Guanine nucleotides were significantly more effective than adenine nucleotides in shifting agonist affinity for the α 1 -receptor and Mg ++ was required to observe a maximal effect. α 1 -receptor agonists activated phosphatidylinositol (PI) hydrolysis in both cell types, but have no direct effect on membrane adenylate cyclase activity. In intact BC3H-1 cells, α 1 -agonists inhibited β-adrenergic cAMP production, an effect which appears in preliminary studies not to result from enhanced phosphodieterase activity. These results show that agonist binding to α 1 -adrenergic receptors in mammalian kidney and muscle cells is regulated by guanine nucleotides. This regulation and inturn transmembrane signalling (PI hydrolysis) by these receptors appear to involve a guanine nucleotide binding (G) protein, which may be different than G/sub s/ and G/sub i/

  11. Plastid: nucleotide-resolution analysis of next-generation sequencing and genomics data.

    Science.gov (United States)

    Dunn, Joshua G; Weissman, Jonathan S

    2016-11-22

    Next-generation sequencing (NGS) informs many biological questions with unprecedented depth and nucleotide resolution. These assays have created a need for analytical tools that enable users to manipulate data nucleotide-by-nucleotide robustly and easily. Furthermore, because many NGS assays encode information jointly within multiple properties of read alignments - for example, in ribosome profiling, the locations of ribosomes are jointly encoded in alignment coordinates and length - analytical tools are often required to extract the biological meaning from the alignments before analysis. Many assay-specific pipelines exist for this purpose, but there remains a need for user-friendly, generalized, nucleotide-resolution tools that are not limited to specific experimental regimes or analytical workflows. Plastid is a Python library designed specifically for nucleotide-resolution analysis of genomics and NGS data. As such, Plastid is designed to extract assay-specific information from read alignments while retaining generality and extensibility to novel NGS assays. Plastid represents NGS and other biological data as arrays of values associated with genomic or transcriptomic positions, and contains configurable tools to convert data from a variety of sources to such arrays. Plastid also includes numerous tools to manipulate even discontinuous genomic features, such as spliced transcripts, with nucleotide precision. Plastid automatically handles conversion between genomic and feature-centric coordinates, accounting for splicing and strand, freeing users of burdensome accounting. Finally, Plastid's data models use consistent and familiar biological idioms, enabling even beginners to develop sophisticated analytical workflows with minimal effort. Plastid is a versatile toolkit that has been used to analyze data from multiple NGS assays, including RNA-seq, ribosome profiling, and DMS-seq. It forms the genomic engine of our ORF annotation tool, ORF-RATER, and is readily

  12. Purine nucleotide synthesis from exogenous adenine and guanine in rodent small intestine

    International Nuclear Information System (INIS)

    Gross, C.J.; Karlberg, P.K.; Savaiano, D.A.

    1986-01-01

    14 C-Adenine and 14 C-guanine uptake was studied in isolated guinea pig enterocytes. Cells were incubated in Hank's buffer and separated from the medium by centrifugation through silicone oil into 1M PCA. Uptake was temperature and concentration dependent. Both compounds were incorporated into nucleotides as measured by HPLC and HVE. Adenine was more extensively incorporated into nucleotides than was guanine. Adenine nucleotides accounted for about 70% of the intracellular label after 30 min with a majority being ADP and ATP (medium concentration = 10 μM). Guanine nucleotides accounted for only 30% of the intracellular label after 30 min. Labeled intracellular free adenine or guanine were not detected. Significantly more guanine vs. adenine was converted to uric acid. After 30 min, 11.5 +/- 3.9% (n=3) and 83.0 +/- 8.4% (n=4) of the label was present as uric acid in the medium when adenine and guanine, respectively, were the substrate. After 1 min, 34.8 +/- 3.4% (n=4) of the label in the medium was present as uric acid when guanine was the substrate. Decreasing the concentration of adenine resulted in an increase in the percent of uric acid in the medium. 14 C-adenine (75 nmol) was injected into 1 gm segments of rat jejunum. After 5 min., segments were quickly flushed and the tissue homogenized in 1M PCA. Only uric acid was present after 5 min (n=6). In contrast, in animals fasted 3 to 5 days, less conversion to uric acid was observed in the intestinal content (50-80% of the same dose was still present as adenine after 5 min) and nucleotide formation was observed in the tissue. The results indicate that uric acid and nucleotide synthesis from exogenous adenine and guanine are concentration dependent and affected by nutritional state

  13. De novo synthesis of adenine nucleotides in different skeletal muscle fiber types

    International Nuclear Information System (INIS)

    Tullson, P.C.; John-Alder, H.B.; Hood, D.A.; Terjung, R.L.

    1988-01-01

    Management of adenine nucleotide catabolism differs among skeletal muscle fiber types. This study evaluated whether there are corresponding differences in the rates of de novo synthesis of adenine nucleotide among fiber type sections of skeletal muscle using an isolated perfused rat hindquarter preparation. Label incorporation into adenine nucleotides from the [1-14C]glycine precursor was determined and used to calculate synthesis rates based on the intracellular glycine specific radioactivity. Results show that intracellular glycine is closely related to the direct precursor pool. Rates of de novo synthesis were highest in fast-twitch red muscle (57.0 +/- 4.0, 58.2 +/- 4.4 nmol.h-1.g-1; deep red gastrocnemius and vastus lateralis), relatively high in slow-twitch red muscle (47.0 +/- 3.1; soleus), and low in fast-twitch white muscle (26.1 +/- 2.0 and 21.6 +/- 2.3; superficial white gastrocnemius and vastus lateralis). Rates for four mixed muscles were intermediate, ranging between 32.3 and 37.3. Specific de novo synthesis rates exhibited a strong correlation (r = 0.986) with muscle section citrate synthase activity. Turnover rates (de novo synthesis rate/adenine nucleotide pool size) were highest in high oxidative muscle (0.82-1.06%/h), lowest in low oxidative muscle (0.30-0.35%/h), and intermediate in mixed muscle (0.44-0.55%/h). Our results demonstrate that differences in adenine nucleotide management among fiber types extends to the process of de novo adenine nucleotide synthesis

  14. Bacterial Signaling Nucleotides Inhibit Yeast Cell Growth by Impacting Mitochondrial and Other Specifically Eukaryotic Functions

    Directory of Open Access Journals (Sweden)

    Andy Hesketh

    2017-07-01

    Full Text Available We have engineered Saccharomyces cerevisiae to inducibly synthesize the prokaryotic signaling nucleotides cyclic di-GMP (cdiGMP, cdiAMP, and ppGpp in order to characterize the range of effects these nucleotides exert on eukaryotic cell function during bacterial pathogenesis. Synthetic genetic array (SGA and transcriptome analyses indicated that, while these compounds elicit some common reactions in yeast, there are also complex and distinctive responses to each of the three nucleotides. All three are capable of inhibiting eukaryotic cell growth, with the guanine nucleotides exhibiting stronger effects than cdiAMP. Mutations compromising mitochondrial function and chromatin remodeling show negative epistatic interactions with all three nucleotides. In contrast, certain mutations that cause defects in chromatin modification and ribosomal protein function show positive epistasis, alleviating growth inhibition by at least two of the three nucleotides. Uniquely, cdiGMP is lethal both to cells growing by respiration on acetate and to obligately fermentative petite mutants. cdiGMP is also synthetically lethal with the ribonucleotide reductase (RNR inhibitor hydroxyurea. Heterologous expression of the human ppGpp hydrolase Mesh1p prevented the accumulation of ppGpp in the engineered yeast and restored cell growth. Extensive in vivo interactions between bacterial signaling molecules and eukaryotic gene function occur, resulting in outcomes ranging from growth inhibition to death. cdiGMP functions through a mechanism that must be compensated by unhindered RNR activity or by functionally competent mitochondria. Mesh1p may be required for abrogating the damaging effects of ppGpp in human cells subjected to bacterial infection.

  15. Nucleotide Interdependency in Transcription Factor Binding Sites in the Drosophila Genome.

    Science.gov (United States)

    Dresch, Jacqueline M; Zellers, Rowan G; Bork, Daniel K; Drewell, Robert A

    2016-01-01

    A long-standing objective in modern biology is to characterize the molecular components that drive the development of an organism. At the heart of eukaryotic development lies gene regulation. On the molecular level, much of the research in this field has focused on the binding of transcription factors (TFs) to regulatory regions in the genome known as cis-regulatory modules (CRMs). However, relatively little is known about the sequence-specific binding preferences of many TFs, especially with respect to the possible interdependencies between the nucleotides that make up binding sites. A particular limitation of many existing algorithms that aim to predict binding site sequences is that they do not allow for dependencies between nonadjacent nucleotides. In this study, we use a recently developed computational algorithm, MARZ, to compare binding site sequences using 32 distinct models in a systematic and unbiased approach to explore nucleotide dependencies within binding sites for 15 distinct TFs known to be critical to Drosophila development. Our results indicate that many of these proteins have varying levels of nucleotide interdependencies within their DNA recognition sequences, and that, in some cases, models that account for these dependencies greatly outperform traditional models that are used to predict binding sites. We also directly compare the ability of different models to identify the known KRUPPEL TF binding sites in CRMs and demonstrate that a more complex model that accounts for nucleotide interdependencies performs better when compared with simple models. This ability to identify TFs with critical nucleotide interdependencies in their binding sites will lead to a deeper understanding of how these molecular characteristics contribute to the architecture of CRMs and the precise regulation of transcription during organismal development.

  16. Cytosolic nucleotides block and regulate the Arabidopsis vacuolar anion channel AtALMT9.

    Science.gov (United States)

    Zhang, Jingbo; Martinoia, Enrico; De Angeli, Alexis

    2014-09-12

    The aluminum-activated malate transporters (ALMTs) form a membrane protein family exhibiting different physiological roles in plants, varying from conferring tolerance to environmental Al(3+) to the regulation of stomatal movement. The regulation of the anion channels of the ALMT family is largely unknown. Identifying intracellular modulators of the activity of anion channels is fundamental to understanding their physiological functions. In this study we investigated the role of cytosolic nucleotides in regulating the activity of the vacuolar anion channel AtALMT9. We found that cytosolic nucleotides modulate the transport activity of AtALMT9. This modulation was based on a direct block of the pore of the channel at negative membrane potentials (open channel block) by the nucleotide and not by a phosphorylation mechanism. The block by nucleotides of AtALMT9-mediated currents was voltage dependent. The blocking efficiency of intracellular nucleotides increased with the number of phosphate groups and ATP was the most effective cellular blocker. Interestingly, the ATP block induced a marked modification of the current-voltage characteristic of AtALMT9. In addition, increased concentrations of vacuolar anions were able to shift the ATP block threshold to a more negative membrane potential. The block of AtALMT9-mediated anion currents by ATP at negative membrane potentials acts as a gate of the channel and vacuolar anion tune this gating mechanism. Our results suggest that anion transport across the vacuolar membrane in plant cells is controlled by cytosolic nucleotides and the energetic status of the cell. © 2014 by The American Society for Biochemistry and Molecular Biology, Inc.

  17. Cytosolic Nucleotides Block and Regulate the Arabidopsis Vacuolar Anion Channel AtALMT9*

    Science.gov (United States)

    Zhang, Jingbo; Martinoia, Enrico; De Angeli, Alexis

    2014-01-01

    The aluminum-activated malate transporters (ALMTs) form a membrane protein family exhibiting different physiological roles in plants, varying from conferring tolerance to environmental Al3+ to the regulation of stomatal movement. The regulation of the anion channels of the ALMT family is largely unknown. Identifying intracellular modulators of the activity of anion channels is fundamental to understanding their physiological functions. In this study we investigated the role of cytosolic nucleotides in regulating the activity of the vacuolar anion channel AtALMT9. We found that cytosolic nucleotides modulate the transport activity of AtALMT9. This modulation was based on a direct block of the pore of the channel at negative membrane potentials (open channel block) by the nucleotide and not by a phosphorylation mechanism. The block by nucleotides of AtALMT9-mediated currents was voltage dependent. The blocking efficiency of intracellular nucleotides increased with the number of phosphate groups and ATP was the most effective cellular blocker. Interestingly, the ATP block induced a marked modification of the current-voltage characteristic of AtALMT9. In addition, increased concentrations of vacuolar anions were able to shift the ATP block threshold to a more negative membrane potential. The block of AtALMT9-mediated anion currents by ATP at negative membrane potentials acts as a gate of the channel and vacuolar anion tune this gating mechanism. Our results suggest that anion transport across the vacuolar membrane in plant cells is controlled by cytosolic nucleotides and the energetic status of the cell. PMID:25028514

  18. Adenylate Nucleotides and 2,3-Biphosphoglycerate Concentration in Erythrocytes of Growing Wielkopolska Stallions

    OpenAIRE

    M. Suska; E. Skotnicka; W. Dudzińska; W. Orowicz; M. Brzezinska

    2006-01-01

    The aim of this study was to examine the relationships between the concentrations of adenylate nucleotides (ATP, ADP, AMP), total nucleotide pool (TAN), adenylate energy charge (AEC) and 2,3-biphosphoglycerate (2,3-BPG) in the erythrocytes of young horses in the period of their rapid growth and development. The studies were conducted on 10 young Wielkopolska breed stallions for two years; Group A: 1-month-old, Group B: 3-month-old, Group C: 6-month-old, Group D: 1-year-old, and Group E: 2-yea...

  19. NUCLEOTIDE COMPARISON OF GDF9 GENE IN INDIAN YAK AND GADDI GOAT: HIGH ALTITUDE LIVESTOCK ANIMALS

    Directory of Open Access Journals (Sweden)

    Lakshya Veer Singh

    2013-06-01

    Full Text Available The present study was undertaken to characterize exon 1 and exon 2 sequence of one of fecundity genes: GDF9 (Growth differentiation factor 9, in high altitude livestock animal (Yak and Gaddi goat. Six nucleotide differences were identified between sheep (AF078545 and goats (EF446168 in exon 1 and exon 2. Sequencing revealed nine novel single nucleotide mutations in exon 1 and exon 2 of Indian yak that compared with Bos taurus (GQ922451. These results preliminarily showed that the GDF9 gene might be a major gene that influences prolificacy of Gaddi goats and Indian yak.

  20. Hydrolytic and alcoholytic dephosphorylation of nucleotides by acid phosphatase in the presence of ethanol.

    Science.gov (United States)

    Tomaszewski, M; Buchowicz, J

    1971-08-01

    The effect of ethanol on the activity of acid phosphatase from wheat germ was studied, by using ribonucleoside monophosphates as the enzyme substrates. The nucleotides were effectively degraded to the corresponding nucleosides in the presence of ethanol at all concentrations tested, including a 96% (v/v) solution. However, the nucleotide dephosphorylation was accompanied by the liberation of orthophosphate only when the concentration of ethanol in the assay mixture did not exceed 15%. No inorganic phosphate was liberated when ethanol was present at higher concentrations. Instead, monoethyl phosphate was formed in quantities expected for orthophosphate. The results are explained in terms of phosphatase-catalysed alcoholysis.

  1. Detecting Single-Nucleotides by Tunneling Current Measurements at Sub-MHz Temporal Resolution.

    Science.gov (United States)

    Morikawa, Takanori; Yokota, Kazumichi; Tanimoto, Sachie; Tsutsui, Makusu; Taniguchi, Masateru

    2017-04-18

    Label-free detection of single-nucleotides was performed by fast tunneling current measurements in a polar solvent at 1 MHz sampling rate using SiO₂-protected Au nanoprobes. Short current spikes were observed, suggestive of trapping/detrapping of individual nucleotides between the nanoelectrodes. The fall and rise features of the electrical signatures indicated signal retardation by capacitance effects with a time constant of about 10 microseconds. The high temporal resolution revealed current fluctuations, reflecting the molecular conformation degrees of freedom in the electrode gap. The method presented in this work may enable direct characterizations of dynamic changes in single-molecule conformations in an electrode gap in liquid.

  2. Emerging prion disease drives host selection in a wildlife population

    Science.gov (United States)

    Robinson, Stacie J.; Samuel, Michael D.; Johnson, Chad J.; Adams, Marie; McKenzie, Debbie I.

    2012-01-01

    Infectious diseases are increasingly recognized as an important force driving population dynamics, conservation biology, and natural selection in wildlife populations. Infectious agents have been implicated in the decline of small or endangered populations and may act to constrain population size, distribution, growth rates, or migration patterns. Further, diseases may provide selective pressures that shape the genetic diversity of populations or species. Thus, understanding disease dynamics and selective pressures from pathogens is crucial to understanding population processes, managing wildlife diseases, and conserving biological diversity. There is ample evidence that variation in the prion protein gene (PRNP) impacts host susceptibility to prion diseases. Still, little is known about how genetic differences might influence natural selection within wildlife populations. Here we link genetic variation with differential susceptibility of white-tailed deer to chronic wasting disease (CWD), with implications for fitness and disease-driven genetic selection. We developed a single nucleotide polymorphism (SNP) assay to efficiently genotype deer at the locus of interest (in the 96th codon of the PRNP gene). Then, using a Bayesian modeling approach, we found that the more susceptible genotype had over four times greater risk of CWD infection; and, once infected, deer with the resistant genotype survived 49% longer (8.25 more months). We used these epidemiological parameters in a multi-stage population matrix model to evaluate relative fitness based on genotype-specific population growth rates. The differences in disease infection and mortality rates allowed genetically resistant deer to achieve higher population growth and obtain a long-term fitness advantage, which translated into a selection coefficient of over 1% favoring the CWD-resistant genotype. This selective pressure suggests that the resistant allele could become dominant in the population within an

  3. Host location by ichneumonid parasitoids is associated with nest dimensions of the host bee species.

    Science.gov (United States)

    Flores-Prado, L; Niemeyer, H M

    2012-08-01

    Parasitoid fitness depends on the ability of females to locate a host. In some species of Ichneumonoidea, female parasitoids detect potential hosts through vibratory cues emanating from them or through vibrational sounding produced by antennal tapping on the substrate. In this study, we (1) describe host location behaviors in Grotea gayi Spinola (Hymenoptera: Ichneumonidae) and Labena sp. on nests of Manuelia postica Spinola (Hymenoptera: Apidae), (2) compare nest dimensions between parasitized and unparasitized nests, (3) correlate the length of M. postica nests with the number of immature individuals developing, and (4) establish the relative proportion of parasitized nests along the breeding period of M. postica. Based on our results, we propose that these parasitoids use vibrational sounding as a host location mechanism and that they are able to assess host nest dimensions and choose those which may provide them with a higher fitness. Finally, we discuss an ancestral host-parasitoid relationship between Manuelia and ichneumonid species.

  4. The Potential for Hosted Payloads at NASA

    Science.gov (United States)

    Andraschko, Mark; Antol, Jeffrey; Baize, Rosemary; Horan, Stephen; Neil, Doreen; Rinsland, Pamela; Zaiceva, Rita

    2012-01-01

    The 2010 National Space Policy encourages federal agencies to actively explore the use of inventive, nontraditional arrangements for acquiring commercial space goods and services to meet United States Government requirements, including...hosting government capabilities on commercial spacecraft. NASA's Science Mission Directorate has taken an important step towards this goal by adding an option for hosted payload responses to its recent Announcement of Opportunity (AO) for Earth Venture-2 missions. Since NASA selects a significant portion of its science missions through a competitive process, it is useful to understand the implications that this process has on the feasibility of successfully proposing a commercially hosted payload mission. This paper describes some of the impediments associated with proposing a hosted payload mission to NASA, and offers suggestions on how these impediments might be addressed. Commercially hosted payloads provide a novel way to serve the needs of the science and technology demonstration communities at a fraction of the cost of a traditional Geostationary Earth Orbit (GEO) mission. The commercial communications industry launches over 20 satellites to GEO each year. By exercising this repeatable commercial paradigm of privately financed access to space with proven vendors, NASA can achieve science goals at a significantly lower cost than the current dedicated spacecraft and launch vehicle approach affords. Commercial hosting could open up a new realm of opportunities for NASA science missions to make measurements from GEO. This paper also briefly describes two GEO missions recommended by the National Academies of Science Earth Science Decadal Survey, the Geostationary Coastal and Air Pollution Events (GEO-CAPE) mission and the Precipitation and All-weather Temperature and Humidity (PATH) mission. Hosted payload missions recently selected for implementation by the Office of the Chief Technologist are also discussed. Finally, there are

  5. Local host adaptation and use of a novel host in the seed beetle Megacerus eulophus.

    Directory of Open Access Journals (Sweden)

    Gisela C Stotz

    Full Text Available Spatial variation in host plant availability may lead to specialization in host use and local host adaptation in herbivorous insects, which may involve a cost in performance on other hosts. We studied two geographically separated populations of the seed beetle Megacerus eulophus (Coleoptera: Bruchidae in central Chile: a population from the host Convolvulus chilensis (in Aucó and a population from C. bonariensis (in Algarrobo. In Aucó C. chilensis is the only host plant, while in Algarrobo both C. bonariensis and C. chilensis are available. We tested local adaptation to these native host plants and its influence on the use of another, exotic host plant. We hypothesized that local adaptation would be verified, particularly for the one-host population (Aucó, and that the Aucó population would be less able to use an alternative, high-quality host. We found evidence of local adaptation in the population from C. chilensis. Thus, when reared on C. chilensis, adults from the C. chilensis population were larger and lived longer than individuals from the C. bonariensis population, while bruchids from the two populations had the same body size and longevity when reared on C. bonariensis. Overall, bruchids from the C. chilensis population showed greater performance traits than those from the C. bonariensis population. There were no differences between the bruchid populations in their ability to use the alternative, exotic host Calystegia sepium, as shown by body size and longevity patterns. Results suggest that differences in local adaptation might be explained by differential host availability in the study populations.

  6. Coevolution in host-parasite systems: behavioural strategies of slave-making ants and their hosts.

    OpenAIRE

    Foitzik, S.; DeHeer, C. J.; Hunjan, D. N.; Herbers, J. M.

    2001-01-01

    Recently, avian brood parasites and their hosts have emerged as model systems for the study of host-parasite coevolution. However, empirical studies of the highly analogous social parasites, which use the workers of another eusocial species to raise their own young, have never explicitly examined the dynamics of these systems from a coevolutionary perspective. Here, we demonstrate interpopulational variation in behavioural interactions between a socially parasitic slave-maker ant and its host...

  7. The complete nucleotide sequence and environmental distribution of the cryptic, conjugative, broad-host-range plasmid pIPO2 islated from bacteria of the wheat rhizosphere

    OpenAIRE

    Tauch, A.; Schneiker, S.; Selbitschka, W.; PÜhler, A.; Overbeek, van, L.S.; Smalla, K.; Thomas, C.M.; Bailey, M.J.; Forney, L.J.; Weightman, A.; Ceglowski, P.; Pembroke, T.; Tietze, E.; Schröder, G.; Lanka, E.

    2002-01-01

    The flood of sequence data resulting from the large number of current genome projects has increased the need for a flexible, open source genome annotation system, which so far has not existed. To account for the individual needs of different projects, such a system should be modular and easily extensible. We present a genome annotation system for prokaryote genomes, which is well tested and readily adaptable to different tasks. The modular system was developed using an object-oriented approac...

  8. The complete nucleotide sequence and environmental distribution of the cryptic, conjugative, broad-host-range plasmid pIPO2 islated from bacteria of the wheat rhizosphere

    NARCIS (Netherlands)

    Tauch, A.; Schneiker, S.; Selbitschka, W.; PÜhler, A.; Overbeek, van L.S.; Smalla, K.; Thomas, C.M.; Bailey, M.J.; Forney, L.J.; Weightman, A.; Ceglowski, P.; Pembroke, T.; Tietze, E.; Schröder, G.; Lanka, E.; Elsas, van J.D.

    2002-01-01

    The flood of sequence data resulting from the large number of current genome projects has increased the need for a flexible, open source genome annotation system, which so far has not existed. To account for the individual needs of different projects, such a system should be modular and easily

  9. Effect of the nucleotides surrounding the start codon on the translation of foot-and-mouth disease virus RNA.

    Science.gov (United States)

    Ma, X X; Feng, Y P; Gu, Y X; Zhou, J H; Ma, Z R

    2016-06-01

    As for the alternative AUGs in foot-and-mouth disease virus (FMDV), nucleotide bias of the context flanking the AUG(2nd) could be used as a strong signal to initiate translation. To determine the role of the specific nucleotide context, dicistronic reporter constructs were engineered to contain different versions of nucleotide context linking between internal ribosome entry site (IRES) and downstream gene. The results indicate that under FMDV IRES-dependent mechanism, the nucleotide contexts flanking start codon can influence the translation initiation efficiencies. The most optimal sequences for both start codons have proved to be UUU AUG(1st) AAC and AAG AUG(2nd) GAA.

  10. Co-extinction in a host-parasite network: identifying key hosts for network stability.

    Science.gov (United States)

    Dallas, Tad; Cornelius, Emily

    2015-08-17

    Parasites comprise a substantial portion of total biodiversity. Ultimately, this means that host extinction could result in many secondary extinctions of obligate parasites and potentially alter host-parasite network structure. Here, we examined a highly resolved fish-parasite network to determine key hosts responsible for maintaining parasite diversity and network structure (quantified here as nestedness and modularity). We evaluated four possible host extinction orders and compared the resulting co-extinction dynamics to random extinction simulations; including host removal based on estimated extinction risk, parasite species richness and host level contributions to nestedness and modularity. We found that all extinction orders, except the one based on realistic extinction risk, resulted in faster declines in parasite diversity and network structure relative to random biodiversity loss. Further, we determined species-level contributions to network structure were best predicted by parasite species richness and host family. Taken together, we demonstrate that a small proportion of hosts contribute substantially to network structure and that removal of these hosts results in rapid declines in parasite diversity and network structure. As network stability can potentially be inferred through measures of network structure, our findings may provide insight into species traits that confer stability.

  11. Fungal-host diversity among mycoheterotrophic plants increases proportionally to their fungal-host overlap.

    Science.gov (United States)

    Gomes, Sofia I F; Merckx, Vincent S F T; Saavedra, Serguei

    2017-05-01

    The vast majority of plants obtain an important proportion of vital resources from soil through mycorrhizal fungi. Generally, this happens in exchange of photosynthetically fixed carbon, but occasionally the interaction is mycoheterotrophic, and plants obtain carbon from mycorrhizal fungi. This process results in an antagonistic interaction between mycoheterotrophic plants and their fungal hosts. Importantly, the fungal-host diversity available for plants is restricted as mycoheterotrophic interactions often involve narrow lineages of fungal hosts. Unfortunately, little is known whether fungal-host diversity may be additionally modulated by plant-plant interactions through shared hosts. Yet, this may have important implications for plant competition and coexistence. Here, we use DNA sequencing data to investigate the interaction patterns between mycoheterotrophic plants and arbuscular mycorrhizal fungi. We find no phylogenetic signal on the number of fungal hosts nor on the fungal hosts shared among mycoheterotrophic plants. However, we observe a potential trend toward increased phylogenetic diversity of fungal hosts among mycoheterotrophic plants with increasing overlap in their fungal hosts. While these patterns remain for groups of plants regardless of location, we do find higher levels of overlap and diversity among plants from the same location. These findings suggest that species coexistence cannot be fully understood without attention to the two sides of ecological interactions.

  12. Animal salmonelloses: a brief review of “host adaptation and host specificity” of Salmonella spp.

    Directory of Open Access Journals (Sweden)

    Grammato Evangelopoulou

    2013-07-01

    Full Text Available Salmonella enterica, the most pathogenic species of the genusSalmonella, includes more than 2,500 serovars, many of which are of great veterinary and medical significance. The emergence of food-borne pathogens, such as Salmonella spp., has increased knowledge about the mechanisms helping microorganisms to persist and spread within new host populations. It has also increased information about the properties they acquire for adapting in the biological environment of a new host. Thedifferences observed between serovars in their host preference and clinical manifestations are referred to as “serovar-host specificity” or “serovar-host adaptation”. The genus Salmonella, highly adaptive to vertebrate hosts, has many pathogenic serovars showing host specificity. Serovar Salmonella Typhi, causing disease to man and higher primates, is a good example of host specificity. Thus, understanding the mechanisms that Salmonella serovars use to overcome animal species' barriers or adapt to new hosts is also important for understanding the origins of any other infectious diseases or the emergence of new pathogens. In addition, molecular methods used to study the virulence determinants of Salmonella serovars, could also be used to model ways of studying the virulence determinants used by bacteria in general, when causing disease to a specific animal species

  13. Host and parasite morphology influence congruence between host and parasite phylogenies.

    Science.gov (United States)

    Sweet, Andrew D; Bush, Sarah E; Gustafsson, Daniel R; Allen, Julie M; DiBlasi, Emily; Skeen, Heather R; Weckstein, Jason D; Johnson, Kevin P

    2018-03-23

    Comparisons of host and parasite phylogenies often show varying degrees of phylogenetic congruence. However, few studies have rigorously explored the factors driving this variation. Multiple factors such as host or parasite morphology may govern the degree of phylogenetic congruence. An ideal analysis for understanding the factors correlated with congruence would focus on a diverse host-parasite system for increased variation and statistical power. In this study, we focused on the Brueelia-complex, a diverse and widespread group of feather lice that primarily parasitise songbirds. We generated a molecular phylogeny of the lice and compared this tree with a phylogeny of their avian hosts. We also tested for the contribution of each host-parasite association to the overall congruence. The two trees overall were significantly congruent, but the contribution of individual associations to this congruence varied. To understand this variation, we developed a novel approach to test whether host, parasite or biogeographic factors were statistically associated with patterns of congruence. Both host plumage dimorphism and parasite ecomorphology were associated with patterns of congruence, whereas host body size, other plumage traits and biogeography were not. Our results lay the framework for future studies to further elucidate how these factors influence the process of host-parasite coevolution. Copyright © 2018 Australian Society for Parasitology. Published by Elsevier Ltd. All rights reserved.

  14. HOST PLANT UTILIZATION, HOST RANGE OSCILLATIONS AND DIVERSIFICATION IN NYMPHALID BUTTERFLIES: A PHYLOGENETIC INVESTIGATION

    Science.gov (United States)

    Nylin, Sören; Slove, Jessica; Janz, Niklas

    2014-01-01

    It has been suggested that phenotypic plasticity is a major factor in the diversification of life, and that variation in host range in phytophagous insects is a good model for investigating this claim. We explore the use of angiosperm plants as hosts for nymphalid butterflies, and in particular the evidence for past oscillations in host range and how they are linked to host shifts and to diversification. At the level of orders of plants, a relatively simple pattern of host use and host shifts emerges, despite the 100 million years of history of the family Nymphalidae. We review the evidence that these host shifts and the accompanying diversifications were associated with transient polyphagous stages, as suggested by the “oscillation hypothesis.” In addition, we investigate all currently polyphagous nymphalid species and demonstrate that the state of polyphagy is rare, has a weak phylogenetic signal, and a very apical distribution in the phylogeny; we argue that these are signs of its transient nature. We contrast our results with data from the bark beetles Dendroctonus, in which a more specialized host use is instead the apical state. We conclude that plasticity in host use is likely to have contributed to diversification in nymphalid butterflies. PMID:24372598

  15. Essential multimeric enzymes in kinetoplastid parasites: A host of potentially druggable protein-protein interactions.

    Science.gov (United States)

    Wachsmuth, Leah M; Johnson, Meredith G; Gavenonis, Jason

    2017-06-01

    Parasitic diseases caused by kinetoplastid parasites of the genera Trypanosoma and Leishmania are an urgent public health crisis in the developing world. These closely related species possess a number of multimeric enzymes in highly conserved pathways involved in vital functions, such as redox homeostasis and nucleotide synthesis. Computational alanine scanning of these protein-protein interfaces has revealed a host of potentially ligandable sites on several established and emerging anti-parasitic drug targets. Analysis of interfaces with multiple clustered hotspots has suggested several potentially inhibitable protein-protein interactions that may have been overlooked by previous large-scale analyses focusing solely on secondary structure. These protein-protein interactions provide a promising lead for the development of new peptide and macrocycle inhibitors of these enzymes.

  16. Genomic analysis of codon usage shows influence of mutation pressure, natural selection, and host features on Marburg virus evolution.

    Science.gov (United States)

    Nasrullah, Izza; Butt, Azeem M; Tahir, Shifa; Idrees, Muhammad; Tong, Yigang

    2015-08-26

    The Marburg virus (MARV) has a negative-sense single-stranded RNA genome, belongs to the family Filoviridae, and is responsible for several outbreaks of highly fatal hemorrhagic fever. Codon usage patterns of viruses reflect a series of evolutionary changes that enable viruses to shape their survival rates and fitness toward the external environment and, most importantly, their hosts. To understand the evolution of MARV at the codon level, we report a comprehensive analysis of synonymous codon usage patterns in MARV genomes. Multiple codon analysis approaches and statistical methods were performed to determine overall codon usage patterns, biases in codon usage, and influence of various factors, including mutation pressure, natural selection, and its two hosts, Homo sapiens and Rousettus aegyptiacus. Nucleotide composition and relative synonymous codon usage (RSCU) analysis revealed that MARV shows mutation bias and prefers U- and A-ended codons to code amino acids. Effective number of codons analysis indicated that overall codon usage among MARV genomes is slightly biased. The Parity Rule 2 plot analysis showed that GC and AU nucleotides were not used proportionally which accounts for the presence of natural selection. Codon usage patterns of MARV were also found to be influenced by its hosts. This indicates that MARV have evolved codon usage patterns that are specific to both of its hosts. Moreover, selection pressure from R. aegyptiacus on the MARV RSCU patterns was found to be dominant compared with that from H. sapiens. Overall, mutation pressure was found to be the most important and dominant force that shapes codon usage patterns in MARV. To our knowledge, this is the first detailed codon usage analysis of MARV and extends our understanding of the mechanisms that contribute to codon usage and evolution of MARV.

  17. The Host RNAs in Retroviral Particles

    Directory of Open Access Journals (Sweden)

    Alice Telesnitsky

    2016-08-01

    Full Text Available As they assemble, retroviruses encapsidate both their genomic RNAs and several types of host RNA. Whereas limited amounts of messenger RNA (mRNA are detectable within virion populations, the predominant classes of encapsidated host RNAs do not encode proteins, but instead include endogenous retroelements and several classes of non-coding RNA (ncRNA, some of which are packaged in significant molar excess to the viral genome. Surprisingly, although the most abundant host RNAs in retroviruses are also abundant in cells, unusual forms of these RNAs are packaged preferentially, suggesting that these RNAs are recruited early in their biogenesis: before associating with their cognate protein partners, and/or from transient or rare RNA populations. These RNAs’ packaging determinants differ from the viral genome’s, and several of the abundantly packaged host ncRNAs serve cells as the scaffolds of ribonucleoprotein particles. Because virion assembly is equally efficient whether or not genomic RNA is available, yet RNA appears critical to the structural integrity of retroviral particles, it seems possible that the selectively encapsidated host ncRNAs might play roles in assembly. Indeed, some host ncRNAs appear to act during replication, as some transfer RNA (tRNA species may contribute to nuclear import of human immunodeficiency virus 1 (HIV-1 reverse transcription complexes, and other tRNA interactions with the viral Gag protein aid correct trafficking to plasma membrane assembly sites. However, despite high conservation of packaging for certain host RNAs, replication roles for most of these selectively encapsidated RNAs—if any—have remained elusive.

  18. The Case for GEO Hosted SSA Payloads

    Science.gov (United States)

    Welsch, C.; Armand, B.; Repp, M.; Robinson, A.

    2014-09-01

    Space situational awareness (SSA) in the geosynchronous earth orbit (GEO) belt presents unique challenges, and given the national importance and high value of GEO satellites, is increasingly critical as space becomes more congested and contested. Space situational awareness capabilities can serve as an effective deterrent against potential adversaries if they provide accurate, timely, and persistent information and are resilient to the threat environment. This paper will demonstrate how simple optical SSA payloads hosted on GEO commercial and government satellites can complement the SSA mission and data provided by Space-Based Space Surveillance (SBSS) and the Geosynchronous Space Situational Awareness Program (GSSAP). GSSAP is built by Orbital Sciences Corporation and launched on July 28, 2014. Analysis performed for this paper will show how GEO hosted SSA payloads, working in combination with SBSS and GSSAP, can increase persistence and timely coverage of high value assets in the GEO belt. The potential to further increase GEO object identification and tracking accuracy by integrating SSA data from multiple sources across different viewing angles including GEO hosted SSA sources will be addressed. Hosting SSA payloads on GEO platforms also increases SSA mission architecture resiliency as the sensors are by distributed across multiple platforms including commercial platforms. This distributed architecture presents a challenging target for an adversary to attempt to degrade or disable. We will present a viable concept of operations to show how data from hosted SSA sensors could be integrated with SBSS and GSSAP data to present a comprehensive and more accurate data set to users. Lastly, we will present an acquisition approach using commercial practices and building on lessons learned from the Commercially Hosted Infra Red Payload CHIRP to demonstrate the affordability of GEO hosted SSA payloads.

  19. Brood parasitic cowbird nestlings use host young to procure resources.

    Science.gov (United States)

    Kilner, Rebecca M; Madden, Joah R; Hauber, Mark E

    2004-08-06

    Young brood parasites that tolerate the company of host offspring challenge the existing evolutionary view of family life. In theory, all parasitic nestlings should be ruthlessly self-interested and should kill host offspring soon after hatching. Yet many species allow host young to live, even though they are rivals for host resources. Here we show that the tolerance of host nestlings by the parasitic brown-headed cowbird Molothrus ater is adaptive. Host young procure the cowbird a higher provisioning rate, so it grows more rapidly. The cowbird's unexpected altruism toward host offspring simply promotes its selfish interests in exploiting host parents.

  20. Complete nucleotide sequence of Bacillus subtilis (natto) bacteriophage PM1, a phage associated with disruption of food production.

    Science.gov (United States)

    Umene, Kenichi; Shiraishi, Atsushi

    2013-06-01

    "Natto", considered a traditional food, is made by fermenting boiled soybeans with Bacillus subtilis (natto), which is a natto-producing strain related to B. subtilis. The production of natto is disrupted by phage infections of B. subtilis (natto); hence, it is necessary to control phage infections. PM1, a phage of B. subtilis (natto), was isolated during interrupted natto production in a factory. In a previous study, PM1 was classified morphologically into the family Siphoviridae, and its genome, comprising approximately 50 kbp of linear double-stranded DNA, was assumed to be circularly permuted. In the present study, the complete nucleotide sequence of the PM1 genomic DNA of 50,861 bp (41.3 %G+C) was determined, and 86 open reading frames (ORFs) were deduced. Forty-one ORFs of PM1 shared similarities with proteins deduced from the genome of phages reported so far. Twenty-three ORFs of PM1 were associated with functions related to the phage multiplication process of gene control, DNA replication/modification, DNA packaging, morphogenesis, and cell lysis. Bacillus subtilis (natto) produces a capsular polypeptide of glutamate with a γ-linkage (called poly-γ-glutamate), which appears to serve as a physical barrier to phage adsorption. One ORF of PM1 had similarity with a poly-γ-glutamate hydrolase, which is assumed to degrade the capsular barrier to allow phage progenies to infect encapsulated host cells. The genome analysis of PM1 revealed the characteristics of the phage that are consistent as Bacillus subtilis (natto)-infecting phage.

  1. Single nucleotide polymorphisms in the PRDX3 and RPS19 and risk of HPV persistence and cervical precancer/cancer.

    Directory of Open Access Journals (Sweden)

    Mahboobeh Safaeian

    Full Text Available Host genetic factors might affect the risk of progression from infection with carcinogenic human papillomavirus (HPV, the etiologic agent for cervical cancer, to persistent HPV infection, and hence to cervical precancer and cancer.We assessed 18,310 tag single nucleotide polymorphisms (SNPs from 1113 genes in 416 cervical intraepithelial neoplasia 3 (CIN3/cancer cases, 356 women with persistent carcinogenic HPV infection (median persistence of 25 months and 425 randomly selected women (non-cases and non-HPV persistent from the 10,049 women from the Guanacaste, Costa Rica HPV natural history cohort. For gene and SNP associations, we computed age-adjusted odds ratio and p-trend. Three comparisons were made: 1 association with CIN3/cancer (compared CIN3/cancer cases to random controls, 2 association with persistence (compared HPV persistence to random controls, and 3 progression (compared CIN3/cancers with HPV-persistent group. Regions statistically significantly associated with CIN3/cancer included genes for peroxiredoxin 3 PRDX3, and ribosomal protein S19 RPS19. The single most significant SNPs from each gene associated with CIN3/cancer were PRDX3 rs7082598 (P(trend<0.0001, and RPS19 rs2305809 (P(trend=0.0007, respectively. Both SNPs were also associated with progression.These data suggest involvement of two genes, RSP19 and PRDX3, or other SNPs in linkage disequilibrium, with cervical cancer risk. Further investigation showed that they may be involved in both the persistence and progression transition stages. Our results require replication but, if true, suggest a role for ribosomal dysfunction, mitochondrial processes, and/or oxidative stress, or other unknown function of these genes in cervical carcinogenesis.

  2. Activation of nucleotide oligomerization domain 2 (NOD2 by human cytomegalovirus initiates innate immune responses and restricts virus replication.

    Directory of Open Access Journals (Sweden)

    Arun Kapoor

    Full Text Available Nucleotide-binding oligomerization domain 2 (NOD2 is an important innate immune sensor of bacterial pathogens. Its induction results in activation of the classic NF-κB pathway and alternative pathways including type I IFN and autophagy. Although the importance of NOD2 in recognizing RNA viruses has recently been identified, its role in sensing DNA viruses has not been studied. We report that infection with human cytomegalovirus (HCMV results in significant induction of NOD2 expression, beginning as early as 2 hours post infection and increasing steadily 24 hours post infection and afterwards. Infection with human herpesvirus 1 and 2 does not induce NOD2 expression. While the HCMV-encoded glycoprotein B is not required for NOD2 induction, a replication competent virion is necessary. Lentivirus-based NOD2 knockdown in human foreskin fibroblasts (HFFs and U373 glioma cells leads to enhanced HCMV replication along with decreased levels of interferon beta (IFN-β and the pro-inflammatory cytokine, IL8. NOD2 induction in HCMV-infected cells activates downstream NF-κB and interferon pathways supported by reduced nuclear localization of NF-κB and pIRF3 in NOD2 knockdown HFFs. Stable overexpression of NOD2 in HFFs restricts HCMV replication in association with increased levels of IFN-β and IL8. Similarly, transient overexpression of NOD2 in U373 cells or its downstream kinase, RIPK2, results in decreased HCMV replication and enhanced cytokine responses. However, overexpression of a mutant NOD2, 3020insC, associated with severe Crohn's disease, results in enhanced HCMV replication and decreased levels of IFN-β in U373 cells. These results show for the first time that NOD2 plays a significant role in HCMV replication and may provide a model for studies of HCMV recognition by the host cell and HCMV colitis in Crohn's disease.

  3. Shifts in diversification rates and host jump frequencies shaped the diversity of host range among Sclerotiniaceae fungal plant pathogens

    OpenAIRE

    Taylor, Andrew; Clarkson, John; Raffaele, Sylvain; Navaud, Olivier; Barbacci, Adelin

    2017-01-01

    The range of hosts that a parasite can infect in nature is a trait determined by its own evolutionary history and that of its potential hosts. However, knowledge on host range diversity and evolution at the family level is often lacking. Here, we investigate host range variation and diversification trends within the Sclerotiniaceae , a family of Ascomycete fungi. Using a phylogenetic framework, we associate diversification rates, the frequency of host jump events, and host range variation dur...

  4. Proteinaceous molecules mediating Bifidobacterium-host interactions

    Directory of Open Access Journals (Sweden)

    Lorena Ruiz

    2016-08-01

    Full Text Available Bifidobacteria are commensal microoganisms found in the gastrointestinal tract.Several strains have been attributed beneficial traits at local and systemic levels, through pathogen exclusion or immune modulation, among other benefits. This has promoted a growing industrial and scientific interest in bifidobacteria as probiotic supplements. However, the molecular mechanisms mediating this cross-talk with the human host remain unknown. High-throughput technologies, from functional genomics to transcriptomics, proteomics and interactomics coupled to the development of both in vitro and in vivo models to study the dynamics of the intestinal microbiota and their effects on host cells, have eased the identification of key molecules in these interactions. Numerous secreted or surface-associated proteins or peptides have been identified as potential mediators of bifidobacteria-host interactions and molecular cross-talk, directly participating in sensing environmental factors, promoting intestinal colonization or mediating a dialogue with mucosa-associated immune cells. On the other hand, bifidobacteria induce the production of proteins in the intestine, by epithelial or immune cells, and other gut bacteria, which are key elements in orchestrating interactions among bifidobacteria, gut microbiota and host cells. This review aims to give a comprehensive overview on proteinaceous molecules described and characterized to date, as mediators of the dynamic interplay between bifidobacteria and the human host, providing a framework to identify knowledge gaps and future research needs.

  5. Deconstructing host-pathogen interactions in Drosophila

    Directory of Open Access Journals (Sweden)

    Ethan Bier

    2012-01-01

    Full Text Available Many of the cellular mechanisms underlying host responses to pathogens have been well conserved during evolution. As a result, Drosophila can be used to deconstruct many of the key events in host-pathogen interactions by using a wealth of well-developed molecular and genetic tools. In this review, we aim to emphasize the great leverage provided by the suite of genomic and classical genetic approaches available in flies for decoding details of host-pathogen interactions; these findings can then be applied to studies in higher organisms. We first briefly summarize the general strategies by which Drosophila resists and responds to pathogens. We then focus on how recently developed genome-wide RNA interference (RNAi screens conducted in cells and flies, combined with classical genetic methods, have provided molecular insight into host-pathogen interactions, covering examples of bacteria, fungi and viruses. Finally, we discuss novel strategies for how flies can be used as a tool to examine how specific isolated virulence factors act on an intact host.

  6. The host galaxy of GRB 990712

    DEFF Research Database (Denmark)

    Christensen, L.; Hjorth, J.; Gorosabel, J.

    2004-01-01

    We present a comprehensive study of the z = 0.43 host galaxy of GRB 990712, involving ground-based photometry, spectroscopy, and HST imaging. The broad-band UBVRIJHKs photometry is used to determine the global spectral energy distribution (SED) of the host galaxy. Comparison with that of known...... galaxy types shows that the host is similar to a moderately kreddened starburst galaxy with a young stellar population. The estimated internal extinction in the host is A(V) = 0.15 +/- 0.1 and the star-formation rate (SFR) from the UV continuum is 1.3 +/- 0.3 M-circle dot yr(-1) (not corrected...... for the effects of extinction). Other galaxy template spectra than starbursts failed to reproduce the observed SED. We also present VLT spectra leading to the detection of Halpha from the GRB host galaxy. A SFR of 2.8 +/- 0.7 M-circle dot yr(-1) is inferred from the Halpha line flux, and the presence of a young...

  7. Nucleotide composition of the Zika virus RNA genome and its codon usage

    NARCIS (Netherlands)

    van Hemert, Formijn; Berkhout, Ben

    2016-01-01

    RNA viruses have genomes with a distinct nucleotide composition and codon usage. We present the global characteristics of the RNA genome of Zika virus (ZIKV), an emerging pathogen within the Flavivirus genus. ZIKV was first isolated in 1947 in Uganda, caused a widespread epidemic in South and

  8. Nucleotide sequence of the Agrobacterium tumefaciens octopine Ti plasmid-encoded tmr gene

    NARCIS (Netherlands)

    Heidekamp, F.; Dirkse, W.G.; Hille, J.; Ormondt, H. van

    1983-01-01

    The nucleotide sequence of the tmr gene, encoded by the octopine Ti plasmid from Agrobacterium tumefaciens (pTiAch5), was determined. The T-DNA, which encompasses this gene, is involved in tumor formation and maintenance, and probably mediates the cytokinin-independent growth of transformed plant

  9. Building the library of RNA 3D nucleotide conformations using the clustering approach

    Directory of Open Access Journals (Sweden)

    Zok Tomasz

    2015-09-01

    Full Text Available An increasing number of known RNA 3D structures contributes to the recognition of various RNA families and identification of their features. These tasks are based on an analysis of RNA conformations conducted at different levels of detail. On the other hand, the knowledge of native nucleotide conformations is crucial for structure prediction and understanding of RNA folding. However, this knowledge is stored in structural databases in a rather distributed form. Therefore, only automated methods for sampling the space of RNA structures can reveal plausible conformational representatives useful for further analysis. Here, we present a machine learning-based approach to inspect the dataset of RNA three-dimensional structures and to create a library of nucleotide conformers. A median neural gas algorithm is applied to cluster nucleotide structures upon their trigonometric description. The clustering procedure is two-stage: (i backbone- and (ii ribose-driven. We show the resulting library that contains RNA nucleotide representatives over the entire data, and we evaluate its quality by computing normal distribution measures and average RMSD between data points as well as the prototype within each cluster.

  10. Understanding specificity in metabolic pathways-Structural biology of human nucleotide metabolism

    International Nuclear Information System (INIS)

    Welin, Martin; Nordlund, Paer

    2010-01-01

    Interactions are the foundation of life at the molecular level. In the plethora of activities in the cell, the evolution of enzyme specificity requires the balancing of appropriate substrate affinity with a negative selection, in order to minimize interactions with other potential substrates in the cell. To understand the structural basis for enzyme specificity, the comparison of structural and biochemical data between enzymes within pathways using similar substrates and effectors is valuable. Nucleotide metabolism is one of the largest metabolic pathways in the human cell and is of outstanding therapeutic importance since it activates and catabolises nucleoside based anti-proliferative drugs and serves as a direct target for anti-proliferative drugs. In recent years the structural coverage of the enzymes involved in human nucleotide metabolism has been dramatically improved and is approaching completion. An important factor has been the contribution from the Structural Genomics Consortium (SGC) at Karolinska Institutet, which recently has solved 33 novel structures of enzymes and enzyme domains in human nucleotide metabolism pathways and homologs thereof. In this review we will discuss some of the principles for substrate specificity of enzymes in human nucleotide metabolism illustrated by a selected set of enzyme families where a detailed understanding of the structural determinants for specificity is now emerging.

  11. The nucleotide sequence of 5S ribosomal RNA from Micrococcus lysodeikticus.

    Science.gov (United States)

    Hori, H; Osawa, S; Murao, K; Ishikura, H

    1980-01-01

    The nucleotide sequence of ribosomal 5S RNA from Micrococcus lysodeikticus is pGUUACGGCGGCUAUAGCGUGGGGGAAACGCCCGGCCGUAUAUCGAACCCGGAAGCUAAGCCCCAUAGCGCCGAUGGUUACUGUAACCGGGAGGUUGUGGGAGAGUAGGUCGCCGCCGUGAOH. When compared to other 5S RNAs, the sequence homology is greatest with Thermus aquaticus, and these two 5S RNAs reveal several features intermediate between those of typical gram-positive bacteria and gram-negative bacteria. PMID:6780979

  12. Sirtuin 1 gene rs2273773 C >T single nucleotide polymorphism and ...

    African Journals Online (AJOL)

    Background: Sirtuin-1 (SIRT-1), a protein has been found to protect the cells against oxidative stress due to its deacetylase activity. In this investigation, we aimed to study SIRT-1 gene rs2273773 C >T single nucleotide polymorphism and markers of serum protein oxidation (protein carbonyl and sulfhydryl groups) in ...

  13. Evolutionary and structural perspectives of plant cyclic nucleotide-gated cation channels

    KAUST Repository

    Zelman, Alice K.; Dawe, Adam; Gehring, Christoph A; Berkowitz, Gerald A.

    2012-01-01

    , including Ca2+ and K+. CNGCs are present in both plant and animal cells, typically in the plasma membrane; recent studies have also documented their presence in prokaryotes. All eukaryote CNGC polypeptides have a cyclic nucleotide-binding domain and a

  14. 2′-O-methyl nucleotide modified DNA substrates influence the ...

    Indian Academy of Sciences (India)

    2014-07-18

    Jul 18, 2014 ... 1. Introduction. Due to the development of novel nucleotide derivatives, ..... which is located in a spiral ring made of 152-157 bases before α6. ..... 8 126–. 130. Majlessi M, Nelson NC and Becker MM 1998 Advantages of 2'-O-.

  15. Twelve single nucleotide polymorphisms on chromosome 19q13.2-13.3

    DEFF Research Database (Denmark)

    Yin, Jiaoyang; Vogel, Ulla; Gerdes, Lars Ulrik

    2003-01-01

    The genetic susceptibility to basal cell carcinoma (BCC) among Danish psoriatic patients was investigated in association studies with 12 single nucleotide polymorphisms on chromosome 19q13.2-3. The results show a significant association between BCC and the A-allele of a polymorphism in ERCCI exon4...

  16. Factor 11 single-nucleotide variants in women with heavy menstrual bleeding

    NARCIS (Netherlands)

    Wiewel-Verschueren, Sophie; Mulder, Andre B.; Meijer, Karina; Mulder, Rene

    2017-01-01

    In a previous study it was shown that lower factor XI (FXI) levels in women with heavy menstrual bleeding (HMB). Our aim was to determine the single-nucleotide variants (SNVs) in the F11 gene in women with HMB. In addition, an extensive literature search was performed to determine the clinical

  17. Single nucleotide polymorphism discovery in bovine liver using RNA-seq technology

    DEFF Research Database (Denmark)

    Pareek, Chandra Shekhar; Błaszczyk, Paweł; Dziuba, Piotr

    2017-01-01

    Background RNA-seq is a useful next-generation sequencing (NGS) technology that has been widely used to understand mammalian transcriptome architecture and function. In this study, a breed-specific RNA-seq experiment was utilized to detect putative single nucleotide polymorphisms (SNPs) in liver...

  18. Infectious mononucleosis-linked HLA class I single nucleotide polymorphism is associated with multiple sclerosis.

    Science.gov (United States)

    Jafari, Naghmeh; Broer, Linda; Hoppenbrouwers, Ilse A; van Duijn, Cornelia M; Hintzen, Rogier Q

    2010-11-01

    Multiple sclerosis is a presumed autoimmune disease associated with genetic and environmental risk factors such as infectious mononucleosis. Recent research has shown infectious mononucleosis to be associated with a specific HLA class I polymorphism. Our aim was to test if the infectious mononucleosis-linked HLA class I single nucleotide polymorphism (rs6457110) is also associated with multiple sclerosis. Genotyping of the HLA-A single nucleotide polymorphism rs6457110 using TaqMan was performed in 591 multiple sclerosis cases and 600 controls. The association of multiple sclerosis with the HLA-A single nucleotide polymorphism was tested using logistic regression adjusted for age, sex and HLA-DRB1*1501. HLA-A minor allele (A) is associated with multiple sclerosis (OR = 0.68; p = 4.08 × 10( -5)). After stratification for HLA-DRB1*1501 risk allele (T) carrier we showed a significant OR of 0.70 (p = 0.003) for HLA-A. HLA class I single nucleotide polymorphism rs6457110 is associated with infectious mononucleosis and multiple sclerosis, independent of the major class II allele, supporting the hypothesis that shared genetics may contribute to the association between infectious mononucleosis and multiple sclerosis.

  19. Resampling nucleotide sequences with closest-neighbor trimming and its comparison to other methods.

    Directory of Open Access Journals (Sweden)

    Kouki Yonezawa

    Full Text Available A large number of nucleotide sequences of various pathogens are available in public databases. The growth of the datasets has resulted in an enormous increase in computational costs. Moreover, due to differences in surveillance activities, the number of sequences found in databases varies from one country to another and from year to year. Therefore, it is important to study resampling methods to reduce the sampling bias. A novel algorithm-called the closest-neighbor trimming method-that resamples a given number of sequences from a large nucleotide sequence dataset was proposed. The performance of the proposed algorithm was compared with other algorithms by using the nucleotide sequences of human H3N2 influenza viruses. We compared the closest-neighbor trimming method with the naive hierarchical clustering algorithm and [Formula: see text]-medoids clustering algorithm. Genetic information accumulated in public databases contains sampling bias. The closest-neighbor trimming method can thin out densely sampled sequences from a given dataset. Since nucleotide sequences are among the most widely used materials for life sciences, we anticipate that our algorithm to various datasets will result in reducing sampling bias.

  20. Pyridine nucleotides in regulation of cell death and survival by redox and non-redox reactions.

    Science.gov (United States)

    Novak Kujundžić, Renata; Žarković, Neven; Gall Trošelj, Koraljka

    2014-01-01

    Changes of the level and ratios of pyridine nucleotides determine metabolism- dependent cellular redox status and the activity of poly(ADP-ribose) polymerases (PARPs) and sirtuins, thereby influencing several processes closely related to cell survival and death. Pyridine nucleotides participate in numerous metabolic reactions whereby their net cellular level remains constant, but the ratios of NAD+/NADP+ and NADH/NADPH oscillate according to metabolic changes in response to diverse stress signals. In non-redox reactions, NAD+ is degraded and quickly, afterward, resynthesized in the NAD+ salvage pathway, unless overwhelming activation of PARP-1 consumes NAD+ to the point of no return, when the cell can no longer generate enough ATP to accommodate NAD+ resynthesis. The activity of PARP-1 is mandatory for the onset of cytoprotective autophagy on sublethal stress signals. It has become increasingly clear that redox status, largely influenced by the metabolism-dependent composition of the pyridine nucleotides pool, plays an important role in the synthesis of pro-apoptotic and anti-apoptotic sphingolipids. Awareness of the involvement of the prosurvival sphingolipid, sphingosine-1-phosphate, in transition from inflammation to malignant transformation has recently emerged. Here, the participation of pyridine nucleotides in redox and non-redox reactions, sphingolipid metabolism, and their role in cell fate decisions is reviewed.

  1. SUMO and ubiquitin-dependent XPC exchange drives nucleotide excision repair

    DEFF Research Database (Denmark)

    Van Cuijk, Loes; Van Belle, Gijsbert J.; Turkyilmaz, Yasemin

    2015-01-01

    XPC recognizes UV-induced DNA lesions and initiates their removal by nucleotide excision repair (NER). Damage recognition in NER is tightly controlled by ubiquitin and SUMO modifications. Recent studies have shown that the SUMO-targeted ubiquitin ligase RNF111 promotes K63-linked ubiquitylation o...

  2. Grinding up Wheat: a Massive Loss of Nucleotide Diversity Since Domestication

    DEFF Research Database (Denmark)

    Haudry, Anabelle; Cenci, Alberto; Ravel, Catherine

    2007-01-01

    Several demographic and selective events occurred during the domestication of wheat from the allotetraploid wild emmer (Triticum turgidum ssp. dicoccoides). Cultivated wheat has since been affected by other historical events. We analyzed nucleotide diversity at 21 loci in a sample of 101 individu...

  3. A fluorimetric readout reporting the kinetics of nucleotide-induced human ribonucleotide reductase oligomerization.

    Science.gov (United States)

    Fu, Yuan; Lin, Hongyu; Wisitpitthaya, Somsinee; Blessing, William A; Aye, Yimon

    2014-11-24

    Human ribonucleotide reductase (hRNR) is a target of nucleotide chemotherapeutics in clinical use. The nucleotide-induced oligomeric regulation of hRNR subunit α is increasingly being recognized as an innate and drug-relevant mechanism for enzyme activity modulation. In the presence of negative feedback inhibitor dATP and leukemia drug clofarabine nucleotides, hRNR-α assembles into catalytically inert hexameric complexes, whereas nucleotide effectors that govern substrate specificity typically trigger α-dimerization. Currently, both knowledge of and tools to interrogate the oligomeric assembly pathway of RNR in any species in real time are lacking. We therefore developed a fluorimetric assay that reliably reports on oligomeric state changes of α with high sensitivity. The oligomerization-directed fluorescence quenching of hRNR-α, covalently labeled with two fluorophores, allows for direct readout of hRNR dimeric and hexameric states. We applied the newly developed platform to reveal the timescales of α self-assembly, driven by the feedback regulator dATP. This information is currently unavailable, despite the pharmaceutical relevance of hRNR oligomeric regulation. © 2014 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  4. Solubilization and reconstitution of the formylmethionylleucylphenylalanine receptor coupled to guanine nucleotide regulatory protein

    International Nuclear Information System (INIS)

    Williamson, K.; Dickey, B.F.; Pyun, H.Y.; Navarro, J.

    1988-01-01

    The authors describe the solubilization, resolution, and reconstitution of the formylmethionylleucylphenylalanine (fMet-Leu-Phe) receptor and guanine nucleotide regulatory proteins (G-proteins). The receptor was solubilized with 3-[(3-cholamidopropyl)dimethylammonio]-1-propanesulfonate. Guanine nucleotides decreased the number of high-affinity binding sites and accelerated the rate of dissociation of the receptor-ligand complex, suggesting that the solubilized receptor remained coupled to endogenous G-proteins. The solubilized receptor was resolved from endogenous G-proteins by fractionation on a wheat germ agglutinin (WGA)-Sepharose 4B column. High-affinity [ 3 H]fMet-Leu-Phe binding to the WGA-purified receptor was diminished and exhibited reduced guanine nucleotide sensitivity. High-affinity [ 3 H]fMET-Leu-Phe binding and guanine nucleotide sensitivity were reconstituted upon the addition of purified brain G-proteins. Similar results were obtained when the receptor was reconstituted with brain G-proteins into phospholipid vesicles by gel filtration chromatography. In addition, they also demonstrated fMET-Leu-Phe-dependent GTP hydrolysis in the reconstituted vesicles. The results of this work indicate that coupling of the fMet-Leu-Phe receptor to G-proteins converts the receptor to a high-affinity binding state and that agonist produces activation of G-proteins. The resolution and functional reconstitution of this receptor should provide an important step toward the elucidation of the molecular mechanism of the fMet-Leu-Phe transduction system in neutrophils

  5. Development and characterization of 35 single nucleotide polymorphism markers for the brown alga Fucus vesiculosus

    NARCIS (Netherlands)

    Canovas, Fernando; Mota, Catarina; Ferreira-Costa, Joana; Serrao, Ester; Coyer, Jim; Olsen, Jeanine; Pearson, Gareth

    2011-01-01

    We characterized 35 single nucleotide polymorphism (SNP) markers for the brown alga Fucus vesiculosus. Based on existing Fucus Expressed Sequence Tag libraries for heat and desiccation-stressed tissue, SNPs were developed and confirmed by re-sequencing cDNA from a diverse panel of individuals. SNP

  6. Targeted Metabolic Engineering Guided by Computational Analysis of Single-Nucleotide Polymorphisms (SNPs)

    DEFF Research Database (Denmark)

    Udatha, D B R K Gupta; Rasmussen, Simon; Sicheritz-Pontén, Thomas

    2013-01-01

    The non-synonymous SNPs, the so-called non-silent SNPs, which are single-nucleotide variations in the coding regions that give "birth" to amino acid mutations, are often involved in the modulation of protein function. Understanding the effect of individual amino acid mutations on a protein...

  7. Association between nucleotide mutation of eNOS gene and serum ...

    African Journals Online (AJOL)

    Various mutation on endothelial nitric oxide synthase (eNOs) gene cause reduced production of NO, the expansion factor (VEF) and may accelerate the process of atherosclerosis. The study was designed to investigate the frequency of T-786C polymorphism of the gene or nucleotide mutation of eNOS gene in patients ...

  8. A lateral flow biosensor for detection of single nucleotide polymorphism by circular strand displacement reaction.

    Science.gov (United States)

    Xiao, Zhuo; Lie, Puchang; Fang, Zhiyuan; Yu, Luxin; Chen, Junhua; Liu, Jie; Ge, Chenchen; Zhou, Xuemeng; Zeng, Lingwen

    2012-09-04

    A lateral flow biosensor for detection of single nucleotide polymorphism based on circular strand displacement reaction (CSDPR) has been developed. Taking advantage of high fidelity of T4 DNA ligase, signal amplification by CSDPR, and the optical properties of gold nanoparticles, this assay has reached a detection limit of 0.01 fM.

  9. Slow spontaneous [Ca2+]i oscillations reflect nucleotide release from renal epithelia

    DEFF Research Database (Denmark)

    Geyti, Christine Stride; Odgaard, Elvin V. P.; Overgaard, Morten Thaarup

    2008-01-01

    Renal epithelia can be provoked mechanically to release nucleotides, which subsequently increases the intracellular Ca(2+) concentration [Ca(2+)](i) through activation of purinergic (P2) receptors. Cultured cells often show spontaneous [Ca(2+)](i) oscillations, a feature suggested to involve nucl...

  10. Interaction of organophosphorus pesticides with DNA nucleotides on a Boron-doped diamond electrode

    Energy Technology Data Exchange (ETDEWEB)

    Garbellini, Gustavo S.; Uliana, Carolina V.; Yamanaka, Hideko, E-mail: gustgarb@yahoo.com.br [Universidade Estadual Paulista Julio de Mesquita Filho (UNESP), Bauru, SP (Brazil). Dept. de Quimica Analitica

    2013-12-01

    Diamond electrode was used to evaluate the interaction of the nucleotides guanosine monophosphate (GMP) and adenosine monophosphate (AMP) with the pesticides chlorpyrifos, methamidophos and monocrotophos. Changes were observed in the currents and peak potentials of the nucleotide voltammograms in the presence of the pesticides, with dependence on the pesticide concentration (from 5.0 Multiplication-Sign 10{sup -7} to 5.0 Multiplication-Sign 10{sup -5} mol L{sup -1}) and the interaction time (from 1 min to 4 h). This is probably due to binding of the pesticides to the nitrogenous bases present in the nucleotides, which could lead to problems in the DNA replication and biological functions of nucleotides. The pesticides showed stronger interaction with AMP than with GMP. Studies of the interaction of 50 Micro-Sign g mL{sup -1} DNA with the pesticides (from 30 min to 4 h and from 1.0 Multiplication-Sign 10{sup -6} to 6.0 Multiplication-Sign 10{sup -5} mol L{sup -1}) did not reveal any peaks relating to double helix opening or DNA unwinding. (author)

  11. Analysis of multiple single nucleotide polymorphisms (SNP) on DNA traces from plasma and dried blood samples

    NARCIS (Netherlands)

    Catsburg, Arnold; van der Zwet, Wil C.; Morre, Servaas A.; Ouburg, Sander; Vandenbroucke-Grauls, Christina M. J. E.; Savelkoul, Paul H. M.

    2007-01-01

    Reliable analysis of single nucleotide polymorphisms (SNPs) in DNA derived from samples containing low numbers of cells or from suboptimal sources can be difficult. A new procedure to characterize multiple SNPs in traces of DNA from plasma and old dried blood samples was developed. Six SNPs in the

  12. Determination of the Nucleic Acid Adducts Structure at the Nucleoside/Nucleotide Level by NMR Spectroscopy

    Czech Academy of Sciences Publication Activity Database

    Dračínský, Martin; Pohl, Radek

    2015-01-01

    Roč. 28, č. 2 (2015), s. 155-165 ISSN 0893-228X R&D Projects: GA ČR GA13-24880S Institutional support: RVO:61388963 Keywords : NMR spectroscopy * nucleic acids * nucleotides Subject RIV: CC - Organic Chemistry Impact factor: 3.025, year: 2015

  13. Lupus-related single nucleotide polymorphisms and risk of diffuse large B-cell lymphoma

    NARCIS (Netherlands)

    Bernatsky, Sasha; Velásquez García, Héctor A; Spinelli, John; Gaffney, Patrick; Smedby, Karin E; Ramsey-Goldman, Rosalind; Wang, Sophia S.; Adami, Hans-Olov; Albanes, Demetrius; Angelucci, Emanuele; Ansell, Stephen M.; Asmann, Yan W.; Becker, Nikolaus; Benavente, Yolanda; Berndt, Sonja I.; Bertrand, Kimberly A.; Birmann, Brenda M.; Boeing, Heiner; Boffetta, Paolo; Bracci, Paige M.; Brennan, Paul; Brooks-Wilson, Angela R.; Cerhan, James R.; Chanock, Stephen J.; Clavel, Jacqueline; Conde, Lucia; Cotenbader, Karen H; Cox, David G; Cozen, Wendy; Crouch, Simon; De Roos, Anneclaire J.; De Sanjose, Silvia; Di Lollo, Simonetta; Diver, W. Ryan; Dogan, Ahmet; Foretova, Lenka; Ghesquières, Hervé; Giles, Graham G.; Glimelius, Bengt; Habermann, Thomas M.; Haioun, Corinne; Hartge, Patricia; Hjalgrim, Henrik; Holford, Theodore R.; Holly, Elizabeth A.; Jackson, Rebecca D.; Kaaks, Rudolph; Kane, Eleanor; Kelly, Rachel S.; Klein, Robert J.; Kraft, Peter; Kricker, Anne; Lan, Qing; Lawrence, Charles; Liebow, Mark; Lightfoot, Tracy; Link, Brian K.; Maynadie, Marc; McKay, James; Melbye, Mads; Molina, Thierry Jo; Monnereau, Alain; Morton, Lindsay M.; Nieters, Alexandra; North, Kari E.; Novak, Anne J.; Offit, Kenneth; Purdue, Mark P.; Rais, Marco; Riby, Jacques; Roman, Eve; Rothman, Nathaniel; Salles, Gilles; Severi, Gianluca; Severson, Richard K.; Skibola, Christine F.; Slager, Susan L.; Smith, Alex; Smith, Martyn T.; Southey, Melissa C.; Staines, Anthony; Teras, Lauren R.; Thompson, Carrie A.; Tilly, Hervé; Tinker, Lesley F.; Tjonneland, Anne; Turner, Jenny; Vajdic, Claire M.; Vermeulen, Roel C H; Vijai, Joseph; Vineis, Paolo; Virtamo, Jarmo; Wang, Zhaoming; Weinstein, Stephanie; Witzig, Thomas E.; Zelenetz, Andrew; Zeleniuch-Jacquotte, Anne; Zhang, Yawei; Zheng, Tongzhang; Zucca, Mariagrazia; Clarke, Ann E

    2017-01-01

    Objective: Determinants of the increased risk of diffuse large B-cell lymphoma (DLBCL) in SLE are unclear. Using data from a recent lymphoma genome-wide association study (GWAS), we assessed whether certain lupus-related single nucleotide polymorphisms (SNPs) were also associated with DLBCL.

  14. Synthesis of Benzene and Pyridine 2-C-Methyl-C-ribonucleosides and -nucleotides

    Czech Academy of Sciences Publication Activity Database

    Tokarenko, Anna; Poštová Slavětínská, Lenka; Klepetářová, Blanka; Hocek, Michal

    2015-01-01

    Roč. 2015, č. 36 (2015), s. 7962-7983 ISSN 1434-193X R&D Projects: GA ČR GAP207/11/0344 Institutional support: RVO:61388963 Keywords : nucleosides * nucleotides * glycosides * antiviral agents * cross - coupling Subject RIV: CC - Organic Chemistry Impact factor: 3.068, year: 2015

  15. Synthesis of Substituted Benzyl Homo-C-Ribonucleosides and -Nucleotides as Carba-Analogues of Phosphoribosylanthranilate

    Czech Academy of Sciences Publication Activity Database

    Kubelka, Tomáš; Slavětínská, Lenka; Hocek, Michal

    -, č. 26 (2012), s. 4969-4981 ISSN 1434-193X R&D Projects: GA ČR GAP207/11/0344; GA AV ČR IAA400550902 Institutional support: RVO:61388963 Keywords : C-nucleosides * homonucleosides * cross - coupling * nucleotides Subject RIV: CC - Organic Chemistry Impact factor: 3.344, year: 2012

  16. Adsorption of nucleotides onto Fe-Mg-Al rich swelling clays

    Science.gov (United States)

    Feuillie, Cécile; Daniel, Isabelle; Michot, Laurent J.; Pedreira-Segade, Ulysse

    2013-11-01

    Mineral surfaces may have played a role in the origin of the first biopolymers, by concentrating organic monomers from a dilute ocean. Swelling clays provide a high surface area for the concentration of prebiotic monomers, and have therefore been the subject of numerous investigations. In that context, montmorillonite, the most abundant swelling clay in modern environments, has been extensively studied with regard to adsorption and polymerization of nucleic acids. However, montmorillonite was probably rather marginal on the primitive ocean floor compared to iron-magnesium rich phyllosilicates such as nontronite that results from the hydrothermal alteration of a mafic or ultramafic oceanic crust. In the present paper, we study the adsorption of nucleotides on montmorillonite and nontronite, at various pH and ionic strength conditions plausible for Archean sea-water. A thorough characterization of the mineral surfaces shows that nucleotide adsorb mainly on the edge faces of the smectites by ligand exchange between the phosphate groups of the nucleotides and the -OH groups from the edge sites over a wide pH range (4-10). Nontronite is more reactive than montmorillonite. At low pH, additional ion exchange may play a role as the nucleotides become positively charged.

  17. Transmembrane Domain Single-Nucleotide Polymorphisms Impair Expression and Transport Activity of ABC Transporter ABCG2

    NARCIS (Netherlands)

    Sjostedt, N.; Heuvel, J.J.M.W. van den; Koenderink, J.B.; Kidron, H.

    2017-01-01

    PURPOSE: To study the function and expression of nine naturally occurring single-nucleotide polymorphisms (G406R, F431L, S441N, P480L, F489L, M515R, L525R, A528T and T542A) that are predicted to reside in the transmembrane regions of the ABC transporter ABCG2. METHODS: The transport activity of the

  18. Typing of canine parvovirus isolates using mini-sequencing based single nucleotide polymorphism analysis.

    Science.gov (United States)

    Naidu, Hariprasad; Subramanian, B Mohana; Chinchkar, Shankar Ramchandra; Sriraman, Rajan; Rana, Samir Kumar; Srinivasan, V A

    2012-05-01

    The antigenic types of canine parvovirus (CPV) are defined based on differences in the amino acids of the major capsid protein VP2. Type specificity is conferred by a limited number of amino acid changes and in particular by few nucleotide substitutions. PCR based methods are not particularly suitable for typing circulating variants which differ in a few specific nucleotide substitutions. Assays for determining SNPs can detect efficiently nucleotide substitutions and can thus be adapted to identify CPV types. In the present study, CPV typing was performed by single nucleotide extension using the mini-sequencing technique. A mini-sequencing signature was established for all the four CPV types (CPV2, 2a, 2b and 2c) and feline panleukopenia virus. The CPV typing using the mini-sequencing reaction was performed for 13 CPV field isolates and the two vaccine strains available in our repository. All the isolates had been typed earlier by full-length sequencing of the VP2 gene. The typing results obtained from mini-sequencing matched completely with that of sequencing. Typing could be achieved with less than 100 copies of standard plasmid DNA constructs or ≤10¹ FAID₅₀ of virus by mini-sequencing technique. The technique was also efficient for detecting multiple types in mixed infections. Copyright © 2012 Elsevier B.V. All rights reserved.

  19. Oligodeoxynucleotides containing 2'-amino-LNA nucleotides as constrained morpholino phosphoramidate and phosphorodiamidate monomers

    DEFF Research Database (Denmark)

    Kristensen, Kim Vejlegaard; Paul, Sibasish; Kosbar, Tamer

    2017-01-01

    Incorporation in a 2'→5' direction of a phosphorodiamidite 2'-amino-LNA-T nucleotide as the morpholino phosphoramidate and N,N-dimethylamino phosphorodiamidate monomers into six oligonucleotides is reported. Thermal denaturation studies showed that the novel 2'-amino-LNA-based morpholino monomers...

  20. Dietary nucleotide supplementation raises erythrocyte 2, 3-diphosphoglycerate concentration in neonatal rats.

    Science.gov (United States)

    Scopesi, F; Verkeste, C M; Paola, D; Gazzolo, D; Pronzato, M A; Bruschettini, P L; Marinari, U M

    1999-03-01

    The present study was designed to test if dietary intake of nucleotides increases erythrocyte 2,3-diphosphoglycerate (2,3-DPG) in neonatal rats. To this end, rat pups were fed a nucleotide-supplemented formula (S, n = 14) from d 9 until d 16 after birth. The results were compared with those obtained from a group of breast-fed pups (C, n = 14) and a group of pups artificially fed with nucleotide-free formula (NS, n = 14). Neonatal weight, 2,3-DPG concentration, hematocrit (Hct) and hemoglobin concentration (Hb) were determined before the experiment (d 9) and after 7 d of treatment (d 16). In all groups, 2,3-DPG concentration was greater at d 16 than d 9, and the increase was greater in the S group than in the NS group. Alterations in neonatal weight, Hct and Hb concentration did not differ among the groups. On d 16 the 2, 3-DPG/Hb ratio, reflecting the affinity of hemoglobin for oxygen, was significantly higher in the C and S groups than in the NS group. We conclude that in neonatal rats, dietary nucleotides increase erythrocyte 2,3-DPG concentration. Studies need to be conducted in humans to assess the effect of this increase on both neonatal peripheral hemodynamics and metabolism in this species.

  1. Synthesis of Hydrazone-Modified Nucleotides and Their Polymerase Incorporation onto DNA for Redox Labeling

    Czech Academy of Sciences Publication Activity Database

    Raindlová, Veronika; Pohl, Radek; Klepetářová, Blanka; Havran, Luděk; Šimková, Eva; Horáková Brázdilová, Petra; Pivoňková, Hana; Fojta, Miroslav; Hocek, Michal

    2012-01-01

    Roč. 77, č. 8 (2012), s. 652-662 ISSN 2192-6506 R&D Projects: GA AV ČR(CZ) IAA400040901; GA ČR GBP206/12/G151 Institutional research plan: CEZ:AV0Z40550506; CEZ:AV0Z50040702 Keywords : DNA * oligonucleotides * polymerase * hydrazones * nucleotides Subject RIV: CC - Organic Chemistry

  2. Single-nucleotide polymorphism of INS, INSR, IRS1, IRS2, PPAR-G ...

    Indian Academy of Sciences (India)

    2017-03-02

    Mar 2, 2017 ... Abstract. Polycystic ovary syndrome (PCOS) is the most common and a complex female endocrine disorder, and is one of the leading cause of female infertility. Here, we aimed to investigate the association of single-nucleotide polymorphism of INS, INSR,. IRS1, IRS2, PPAR-G and CAPN10 gene in the ...

  3. On the biased nucleotide composition of the human coronavirus RNA genome

    NARCIS (Netherlands)

    Berkhout, Ben; van Hemert, Formijn

    2015-01-01

    We investigated the nucleotide composition of the RNA genome of the six human coronaviruses. Some general coronavirus characteristics were apparent (e.g. high U, low C count), but we also detected species-specific signatures. Most strikingly, the high U and low C proportions are quite variable and

  4. Enhanced activity of the purine nucleotide cycle of the exercising muscle in patients with hyperthyroidism.

    Science.gov (United States)

    Fukui, H; Taniguchi , S; Ueta, Y; Yoshida, A; Ohtahara, A; Hisatome, I; Shigemasa, C

    2001-05-01

    Myopathy frequently develops in patients with hyperthyroidism, but its precise mechanism is not clearly understood. In this study we focused on the purine nucleotide cycle, which contributes to ATP balance in skeletal muscles. To investigate purine metabolism in muscles, we measured metabolites related to the purine nucleotide cycle using the semiischemic forearm test. We examined the following four groups: patients with untreated thyrotoxic Graves' disease (untreated group), patients with Graves' disease treated with methimazole (treated group), patients in remission (remission group), and healthy volunteers (control group). To trace the glycolytic process, we measured glycolytic metabolites (lactate and pyruvate) as well as purine metabolites (ammonia and hypoxanthine). In the untreated group, the levels of lactate, pyruvate, and ammonia released were remarkably higher than those in the control group. Hypoxanthine release also increased in the untreated group, but the difference among the patient groups was not statistically significant. The accelerated purine catabolism did not improve after 3 months of treatment with methimazole, but it was completely normalized in the remission group. This indicated that long-term maintenance of thyroid function was necessary for purine catabolism to recover. We presume that an unbalanced ATP supply or conversion of muscle fiber type may account for the acceleration of the purine nucleotide cycle under thyrotoxicosis. Such acceleration of the purine nucleotide cycle is thought to be in part a protective mechanism against a rapid collapse of the ATP energy balance in exercising muscles of patients with hyperthyroidism.

  5. Coupling of guanine nucleotide inhibitory protein to somatostatin receptors on pancreatic acinar membranes

    International Nuclear Information System (INIS)

    Sakamoto, C.; Matozaki, T.; Nagao, M.; Baba, S.

    1987-01-01

    Guanine nucleotides and pertussis toxin were used to investigate whether somatostatin receptors interact with the guanine nucleotide inhibitory protein (NI) on pancreatic acinar membranes in the rat. Guanine nucleotides reduced 125 I-[Tyr 1 ]somatostatin binding to acinar membranes up to 80%, with rank order of potency being 5'-guanylyl imidodiphosphate [Gpp(NH)p]>GTP>TDP>GMP. Scatchard analysis revealed that the decrease in somatostatin binding caused by Gpp(NH)p was due to the decrease in the maximum binding capacity without a significant change in the binding affinity. The inhibitory effect of Gpp(NH)p was partially abolished in the absence of Mg 2+ . When pancreatic acini were treated with 1 μg/ml pertussis toxin for 4 h, subsequent 125 I-[Tyr 1 ]somatostatin binding to acinar membranes was reduced. Pertussis toxin treatment also abolished the inhibitory effect of somatostatin on vasoactive intestinal peptide-stimulated increase in cellular content of adenosine 3',5'-cyclic monophosphate (cAMP) in the acini. The present results suggest that 1) somatostatin probably functions in the pancreas to regulate adenylate cyclase enzyme system via Ni, 2) the extent of modification of Ni is correlated with the ability of somatostatin to inhibit cAMP accumulation in acini, and 3) guanine nucleotides also inhibit somatostatin binding to its receptor

  6. Dynamic interaction of TTDA with TFIIH is stabilized by nucleotide excision repair in living cells.

    NARCIS (Netherlands)

    G. Giglia-Mari (Giuseppina); C. Miquel (Catherine); A.F. Theil (Arjan); P.O. Mari (Pierre-Olivier); D. Hoogstraten (Deborah); J.M.Y. Ng (Jessica); C. Dinant (Christoffel); J.H.J. Hoeijmakers (Jan); W. Vermeulen (Wim)

    2006-01-01

    textabstractTranscription/repair factor IIH (TFIIH) is essential for RNA polymerase II transcription and nucleotide excision repair (NER). This multi-subunit complex consists of ten polypeptides, including the recently identified small 8-kDa trichothiodystrophy group A (TTDA)/ hTFB5 protein.

  7. Nucleotide variation in ATHK1 region of Arabidopsis thaliana and its ...

    African Journals Online (AJOL)

    The ATHK1 gene in Arabidopsis encodes a putative histidine kinase that is transcriptionally upregulated in response to changes in external osmolarity. In this work, we investigated the nucleotide variability of the ATHK1 gene in a sample of 32 core Arabidopsis accessions originating from different ecoclimatic regions and ...

  8. Unexpected absence of genetic separation of a highly diverse population of hookworms from geographically isolated hosts.

    Science.gov (United States)

    Haynes, Benjamin T; Marcus, Alan D; Higgins, Damien P; Gongora, Jaime; Gray, Rachael; Šlapeta, Jan

    2014-12-01

    The high natal site fidelity of endangered Australian sea lions (Neophoca cinerea) along the southern Australian coast suggests that their maternally transmitted parasitic species, such as hookworms, will have restricted potential for dispersal. If this is the case, we would expect to find a hookworm haplotype structure corresponding to that of the host mtDNA haplotype structure; that is, restricted among geographically separated colonies. In this study, we used a fragment of the cytochrome c oxidase I mitochondrial DNA (mtDNA) gene to investigate the diversity of hookworms (Uncinaria sanguinis) in N. cinerea to assess the importance of host distribution and ecology on the evolutionary history of the parasite. High haplotype (h=0.986) and nucleotide diversity (π=0.013) were seen, with 45 unique hookworm mtDNA haplotypes across N. cinerea colonies; with most of the variation (78%) arising from variability within hookworms from individual colonies. This is supported by the low genetic differentiation co-efficient (GST=0.007) and a high gene flow (Nm=35.25) indicating a high migration rate between the populations of hookworms. The haplotype network demonstrated no clear distribution and delineation of haplotypes according to geographical location. Our data rejects the vicariance hypothesis; that female host natal site fidelity and the transmammary route of infection restrict hookworm gene flow between N. cinerea populations and highlights the value of studies of parasite diversity and dispersal to challenge our understanding of parasite and host ecology. Copyright © 2014 Elsevier B.V. All rights reserved.

  9. Canine echinococcosis: genetic diversity of Echinococcus granulosus sensu stricto (s.s.) from definitive hosts.

    Science.gov (United States)

    Boufana, B; Lett, W; Lahmar, S; Griffiths, A; Jenkins, D J; Buishi, I; Engliez, S A; Alrefadi, M A; Eljaki, A A; Elmestiri, F M; Reyes, M M; Pointing, S; Al-Hindi, A; Torgerson, P R; Okamoto, M; Craig, P S

    2015-11-01

    Canids, particularly dogs, constitute the major source of cystic echinococcosis (CE) infection to humans, with the majority of cases being caused by Echinococcus granulosus (G1 genotype). Canine echinococcosis is an asymptomatic disease caused by adult tapeworms of E. granulosus sensu lato (s.l.). Information on the population structure and genetic variation of adult E. granulosus is limited. Using sequenced data of the mitochondrial cytochrome c oxidase subunit 1 (cox1) we examined the genetic diversity and population structure of adult tapeworms of E. granulosus (G1 genotype) from canid definitive hosts originating from various geographical regions and compared it to that reported for the larval metacestode stage from sheep and human hosts. Echinococcus granulosus (s.s) was identified from adult tapeworm isolates from Kenya, Libya, Tunisia, Australia, China, Kazakhstan, United Kingdom and Peru, including the first known molecular confirmation from Gaza and the Falkland Islands. Haplotype analysis showed a star-shaped network with a centrally positioned common haplotype previously described for the metacestode stage from sheep and humans, and the neutrality indices indicated population expansion. Low Fst values suggested that populations of adult E. granulosus were not genetically differentiated. Haplotype and nucleotide diversities for E. granulosus isolates from sheep and human origin were twice as high as those reported from canid hosts. This may be related to self-fertilization of E. granulosus and/or to the longevity of the parasite in the respective intermediate and definitive hosts. Improved nuclear single loci are required to investigate the discrepancies in genetic variation seen in this study.

  10. Virus-mediated suppression of host non-self recognition facilitates horizontal transmission of heterologous viruses.

    Directory of Open Access Journals (Sweden)

    Songsong Wu

    2017-03-01

    Full Text Available Non-self recognition is a common phenomenon among organisms; it often leads to innate immunity to prevent the invasion of parasites and maintain the genetic polymorphism of organisms. Fungal vegetative incompatibility is a type of non-self recognition which often induces programmed cell death (PCD and restricts the spread of molecular parasites. It is not clearly known whether virus infection could attenuate non-self recognition among host individuals to facilitate its spread. Here, we report that a hypovirulence-associated mycoreovirus, named Sclerotinia sclerotiorum mycoreovirus 4 (SsMYRV4, could suppress host non-self recognition and facilitate horizontal transmission of heterologous viruses. We found that cell death in intermingled colony regions between SsMYRV4-infected Sclerotinia sclerotiorum strain and other tested vegetatively incompatible strains was markedly reduced and inhibition barrage lines were not clearly observed. Vegetative incompatibility, which involves Heterotrimeric guanine nucleotide-binding proteins (G proteins signaling pathway, is controlled by specific loci termed het (heterokaryon incompatibility loci. Reactive oxygen species (ROS plays a key role in vegetative incompatibility-mediated PCD. The expression of G protein subunit genes, het genes, and ROS-related genes were significantly down-regulated, and cellular production of ROS was suppressed in the presence of SsMYRV4. Furthermore, SsMYRV4-infected strain could easily accept other viruses through hyphal contact and these viruses could be efficiently transmitted from SsMYRV4-infected strain to other vegetatively incompatible individuals. Thus, we concluded that SsMYRV4 is capable of suppressing host non-self recognition and facilitating heterologous viruses transmission among host individuals. These findings may enhance our understanding of virus ecology, and provide a potential strategy to utilize hypovirulence-associated mycoviruses to control fungal diseases.

  11. Investigating intra-host and intra-herd sequence diversity of foot-and-mouth disease virus.

    Science.gov (United States)

    King, David J; Freimanis, Graham L; Orton, Richard J; Waters, Ryan A; Haydon, Daniel T; King, Donald P

    2016-10-01

    Due to the poor-fidelity of the enzymes involved in RNA genome replication, foot-and-mouth disease (FMD) virus samples comprise of unique polymorphic populations. In this study, deep sequencing was utilised to characterise the diversity of FMD virus (FMDV) populations in 6 infected cattle present on a single farm during the series of outbreaks in the UK in 2007. A novel RT-PCR method was developed to amplify a 7.6kb nucleotide fragment encompassing the polyprotein coding region of the FMDV genome. Illumina sequencing of each sample identified the fine polymorphic structures at each nucleotide position, from consensus level changes to variants present at a 0.24% frequency. These data were used to investigate population dynamics of FMDV at both herd and host levels, evaluate the impact of host on the viral swarm structure and to identify transmission links with viruses recovered from other farms in the same series of outbreaks. In 7 samples, from 6 different animals, a total of 5 consensus level variants were identified, in addition to 104 sub-consensus variants of which 22 were shared between 2 or more animals. Further analysis revealed differences in swarm structures from samples derived from the same animal suggesting the presence of distinct viral populations evolving independently at different lesion sites within the same infected animal. Copyright © 2016 The Authors. Published by Elsevier B.V. All rights reserved.

  12. The binding of glucose and nucleotides to hexokinase from Saccharomyces cerevisiae.

    Science.gov (United States)

    Woolfitt, A R; Kellett, G L; Hoggett, J G

    1988-01-29

    The binding of glucose, ADP and AdoPP[NH]P, to the native PII dimer and PII monomer and the proteolytically-modified SII monomer of hexokinase (ATP:D-hexose 6-phosphotransferase, EC 2.7.1.1) from Saccharomyces cerevisiae was monitored at pH 6.7 by the concomitant quenching of protein fluorescence. The data were analysed in terms of Qmax, the maximal quenching of fluorescence at saturating concentrations of ligand, and [L]0.5, the concentration of ligand at half-maximal quenching. No changes in fluorescence were observed with free enzyme and nucleotide alone. In the presence of saturating levels of glucose, Qmax induced by nucleotide was between 2 and 7%, and [L]0.5 was between 0.12 and 0.56 mM, depending on the nucleotide and enzyme species. Qmax induced by glucose alone was between 22 and 25%, while [L]0.5 was approx. 0.4 mM for either of the monomeric hexokinase forms and 3.4 for PII dimer. In the presence of 6 mM ADP or 2 mM AdoPP[NH]P, Qmax for glucose was increased by up to 4% and [L]0.5 was diminished 3-fold for hexokinase PII monomer, 6-fold for SII monomer, and 15-fold for PII dimer. The results are interpreted in terms of nucleotide-induced conformational change of hexokinase in the presence of glucose and synergistic binding interactions between glucose and nucleotide.

  13. Ras conformational switching: simulating nucleotide-dependent conformational transitions with accelerated molecular dynamics.

    Directory of Open Access Journals (Sweden)

    Barry J Grant

    2009-03-01

    Full Text Available Ras mediates signaling pathways controlling cell proliferation and development by cycling between GTP- and GDP-bound active and inactive conformational states. Understanding the complete reaction path of this conformational change and its intermediary structures is critical to understanding Ras signaling. We characterize nucleotide-dependent conformational transition using multiple-barrier-crossing accelerated molecular dynamics (aMD simulations. These transitions, achieved for the first time for wild-type Ras, are impossible to observe with classical molecular dynamics (cMD simulations due to the large energetic barrier between end states. Mapping the reaction path onto a conformer plot describing the distribution of the crystallographic structures enabled identification of highly populated intermediate structures. These structures have unique switch orientations (residues 25-40 and 57-75 intermediate between GTP and GDP states, or distinct loop3 (46-49, loop7 (105-110, and alpha5 C-terminus (159-166 conformations distal from the nucleotide-binding site. In addition, these barrier-crossing trajectories predict novel nucleotide-dependent correlated motions, including correlations of alpha2 (residues 66-74 with alpha3-loop7 (93-110, loop2 (26-37 with loop10 (145-151, and loop3 (46-49 with alpha5 (152-167. The interconversion between newly identified Ras conformations revealed by this study advances our mechanistic understanding of Ras function. In addition, the pattern of correlated motions provides new evidence for a dynamic linkage between the nucleotide-binding site and the membrane interacting C-terminus critical for the signaling function of Ras. Furthermore, normal mode analysis indicates that the dominant collective motion that occurs during nucleotide-dependent conformational exchange, and captured in aMD (but absent in cMD simulations, is a low-frequency motion intrinsic to the structure.

  14. Serpin functions in host-pathogen interactions

    Directory of Open Access Journals (Sweden)

    Jialing Bao

    2018-04-01

    Full Text Available Serpins are a broadly distributed superfamily of protease inhibitors that are present in all kingdoms of life. The acronym, serpin, is derived from their function as potent serine proteases inhibitors. Early studies of serpins focused on their functions in haemostasis since modulating serine proteases activities are essential for coagulation. Additional research has revealed that serpins function in infection and inflammation, by modulating serine and cysteine proteases activities. The aim of this review is to summarize the accumulating findings and current understanding of the functions of serpins in host-pathogen interactions, serving as host defense proteins as well as pathogenic factors. We also discuss the potential crosstalk between host and pathogen serpins. We anticipate that future research will elucidate the therapeutic value of this novel target.

  15. Salt, chloride, bleach, and innate host defense

    Science.gov (United States)

    Wang, Guoshun; Nauseef, William M.

    2015-01-01

    Salt provides 2 life-essential elements: sodium and chlorine. Chloride, the ionic form of chlorine, derived exclusively from dietary absorption and constituting the most abundant anion in the human body, plays critical roles in many vital physiologic functions, from fluid retention and secretion to osmotic maintenance and pH balance. However, an often overlooked role of chloride is its function in innate host defense against infection. Chloride serves as a substrate for the generation of the potent microbicide chlorine bleach by stimulated neutrophils and also contributes to regulation of ionic homeostasis for optimal antimicrobial activity within phagosomes. An inadequate supply of chloride to phagocytes and their phagosomes, such as in CF disease and other chloride channel disorders, severely compromises host defense against infection. We provide an overview of the roles that chloride plays in normal innate immunity, highlighting specific links between defective chloride channel function and failures in host defense. PMID:26048979

  16. Salt, chloride, bleach, and innate host defense.

    Science.gov (United States)

    Wang, Guoshun; Nauseef, William M

    2015-08-01

    Salt provides 2 life-essential elements: sodium and chlorine. Chloride, the ionic form of chlorine, derived exclusively from dietary absorption and constituting the most abundant anion in the human body, plays critical roles in many vital physiologic functions, from fluid retention and secretion to osmotic maintenance and pH balance. However, an often overlooked role of chloride is its function in innate host defense against infection. Chloride serves as a substrate for the generation of the potent microbicide chlorine bleach by stimulated neutrophils and also contributes to regulation of ionic homeostasis for optimal antimicrobial activity within phagosomes. An inadequate supply of chloride to phagocytes and their phagosomes, such as in CF disease and other chloride channel disorders, severely compromises host defense against infection. We provide an overview of the roles that chloride plays in normal innate immunity, highlighting specific links between defective chloride channel function and failures in host defense. © Society for Leukocyte Biology.

  17. Viral pathogen production in a wild grass host driven by host growth and soil nitrogen.

    Science.gov (United States)

    Whitaker, Briana K; Rúa, Megan A; Mitchell, Charles E

    2015-08-01

    Nutrient limitation is a basic ecological constraint that has received little attention in studies on virus production and disease dynamics. Nutrient availability could directly limit the production of viral nucleic acids and proteins, or alternatively limit host growth and thus indirectly limit metabolic pathways necessary for viral replication. In order to compare direct and indirect effects of nutrient limitation on virus production within hosts, we manipulated soil nitrogen (N) and phosphorus (P) availability in a glasshouse for the wild grass host Bromus hordeaceus and the viral pathogen Barley yellow dwarf virus-PAV. We found that soil N additions increased viral concentrations within host tissues, and the effect was mediated by host growth. Specifically, in statistical models evaluating the roles of host biomass production, leaf N and leaf P, viral production depended most strongly on host biomass, rather than the concentration of either nutrient. Furthermore, at low soil N, larger plants supported greater viral concentrations than smaller ones, whereas at high N, smaller plants supported greater viral concentrations. Our results suggest that enhanced viral productivity under N enrichment is an indirect consequence of nutrient stimulation to host growth rate. Heightened pathogen production in plants has important implications for a world facing increasing rates of nutrient deposition. © 2015 The Authors. New Phytologist © 2015 New Phytologist Trust.

  18. Wolbachia mediate variation of host immunocompetence.

    Directory of Open Access Journals (Sweden)

    Christine Braquart-Varnier

    Full Text Available BACKGROUND: After decades during which endosymbionts were considered as silent in their hosts, in particular concerning the immune system, recent studies have revealed the contrary. In the present paper, we addressed the effect of Wolbachia, the most prevalent endosymbiont in arthropods, on host immunocompetence. To this end, we chose the A. vulgare-Wolbachia symbiosis as a model system because it leads to compare consequences of two Wolbachia strains (wVulC and wVulM on hosts from the same population. Moreover, A. vulgare is the only host-species in which Wolbachia have been directly observed within haemocytes which are responsible for both humoral and cellular immune responses. METHODOLOGY/PRINCIPAL FINDINGS: We sampled gravid females from the same population that were either asymbiotic, infected with wVulC, or infected with wVulM. The offspring from these females were tested and it was revealed that individuals harbouring wVulC exhibited: (i lower haemocyte densities, (ii more intense septicaemia in their haemolymph and (iii a reduced lifespan as compared to individuals habouring wVulM or asymbiotic ones. Therefore, individuals in this population of A. vulgare appeared to suffer more from wVulC than from wVulM. Symbiotic titer and location in the haemocytes did not differ for the two Wolbachia strains showing that these two parameters were not responsible for differences observed in their extended phenotypes in A. vulgare. CONCLUSION/SIGNIFICANCE: The two Wolbachia strains infecting A. vulgare in the same population induced variation in immunocompetence and survival of their hosts. Such variation should highly influence the dynamics of this host-symbiont system. We propose in accordance with previous population genetic works, that wVulM is a local strain that has attenuated its virulence through a long term adaptation process towards local A. vulgare genotypes whereas wVulC, which is a widespread and invasive strain, is not locally adapted.

  19. Host Range Specificity in Verticillium dahliae.

    Science.gov (United States)

    Bhat, R G; Subbarao, K V

    1999-12-01

    ABSTRACT Verticillium dahliae isolates from artichoke, bell pepper, cabbage, cauliflower, chili pepper, cotton, eggplant, lettuce, mint, potato, strawberry, tomato, and watermelon and V. albo-atrum from alfalfa were evaluated for their pathogenicity on all 14 hosts. One-month-old seedlings were inoculated with a spore suspension of about 10(7) conidia per ml using a root-dip technique and incubated in the greenhouse. Disease incidence and severity, plant height, and root and shoot dry weights were recorded 6 weeks after inoculation. Bell pepper, cabbage, cauliflower, cotton, eggplant, and mint isolates exhibited host specificity and differential pathogenicity on other hosts, whereas isolates from artichoke, lettuce, potato, strawberry, tomato, and watermelon did not. Bell pepper was resistant to all Verticillium isolates except isolates from bell pepper and eggplant. Thus, host specificity exists in some isolates of V. dahliae. The same isolates were characterized for vegetative compatibility groups (VCGs) through complementation of nitrate nonutilizing (nit) mutants. Cabbage and cauliflower isolates did not produce nit mutants. The isolate from cotton belonged to VCG 1; isolates from bell pepper, eggplant, potato, and tomato, to VCG 4; and the remaining isolates, to VCG 2. These isolates were also analyzed using the random amplified polymorphic DNA (RAPD) method. Forty random primers were screened, and eighteen of them amplified DNA from Verticillium. Based on RAPD banding patterns, cabbage and cauliflower isolates formed a unique group, distinct from other V. dahliae and V. albo-atrum groups. Minor genetic variations were observed among V. dahliae isolates from other hosts, regardless of whether they were host specific or not. There was no correlation among pathogenicity, VCGs, and RAPD banding patterns. Even though the isolates belonged to different VCGs, they shared similar RAPD profiles. These results suggest that management of Verticillium wilt in some crops

  20. Study of GRBs Hosts Galaxies Vicinity Properties

    Science.gov (United States)

    Bernal, S.; Vasquez, N.; Hoyle, F.

    2017-07-01

    The study of GRBs host galaxies and its vicinity could provide constrains on the progenitor and an opportunity to use these violent explosions to characterize the nature of the highredshift universe. Studies of GRB host galaxies reveal a population of starforming galaxies with great diversity, spanning a wide range of masses, star formation rate, and redshifts. In order to study the galactic ambient of GRBs we used the S. Savaglio catalog from 2015 where 245 GRBs are listed with RA-Dec position and z. We choose 22 GRBs Hosts galaxies from Savaglio catalog and SDSS DR12, with z range 0population characteristics. We calculate the volumetric density populatation of glalaxies around the GRB Hosts within a volume of an sphere whit radius of 10 h-1 Mpc and find a low density compared with a typical group of galaxies. In order to know the galaxies stellar formation state, in regions where GRBs are formed, we made an analysis of color index using SDSS data of μ [λ 3543], r[λ 6231] and calculate the indexes μ-r. We find a value μ-r=2.63, it means that the galactic ambient of GRBs Host regions are statistically redder than void and wall regions on a indirect way (Voids:μ-r=2.043; Walls:μ-r=2.162). Futhermore, we used a inverse concentration index analysis, ICI=R50/R90 and find that galaxies in GRBs Hosts vicinity are also of slightly early type than void and wall galaxies. With this work we provide characteristics on the regions for future works related with highredsift universe that using the GRBs.

  1. Manipulation of host membranes by bacterial effectors.

    Science.gov (United States)

    Ham, Hyeilin; Sreelatha, Anju; Orth, Kim

    2011-07-18

    Bacterial pathogens interact with host membranes to trigger a wide range of cellular processes during the course of infection. These processes include alterations to the dynamics between the plasma membrane and the actin cytoskeleton, and subversion of the membrane-associated pathways involved in vesicle trafficking. Such changes facilitate the entry and replication of the pathogen, and prevent its phagocytosis and degradation. In this Review, we describe the manipulation of host membranes by numerous bacterial effectors that target phosphoinositide metabolism, GTPase signalling and autophagy.

  2. Glycoconjugates in host-helminth interactions

    Directory of Open Access Journals (Sweden)

    Nina Salinger Prasanphanich

    2013-08-01

    Full Text Available Helminths are multicellular parasitic worms that comprise a major class of human pathogens and cause an immense amount of suffering worldwide. Helminths possess an abundance of complex and unique glycoconjugates that interact with both the innate and adaptive arms of immunity in definitive and intermediate hosts. These glycoconjugates represent a major untapped reservoir of immunomodulatory compounds, which have the potential to treat autoimmune and inflammatory disorders, and antigenic glycans, which could be exploited as vaccines and diagnostics. This review will survey current knowledge of the interactions between helminth glycans and host immunity and highlight the gaps in our understanding which are relevant to advancing therapeutics, vaccine development and diagnostics.

  3. Heat production / host rock compatibility; Waermeentwicklung / Gesteinsvertraeglichkeit

    Energy Technology Data Exchange (ETDEWEB)

    Meleshyn, A.; Weyand, T.; Bracke, G.; Kull, H.; Wieczorek, K.

    2016-05-15

    For the final high-level radioactive waste repository potential host rock formations are either rock salt or clays (Kristallin). Heat generating waste (decay heat of the radioactive materials) can be absorbed by the host rock. The effect of temperature increase on the thermal conductivity, the thermal expansion and the mechanical properties of salt, Kristallin, clays and argilliferous geotechnical barriers are described. Further issues of the report are the mineralogical behavior, phase transformations, hydrochemistry, microbial processes, gas formation, thermochemical processes and gas ingress. Recommendations for further research are summarized.

  4. Unfolding Role of a Danger Molecule Adenosine Signaling in Modulation of Microbial Infection and Host Cell Response

    Directory of Open Access Journals (Sweden)

    Jaden S. Lee

    2018-01-01

    Full Text Available Ectonucleotidases CD39 and CD73, specific nucleotide metabolizing enzymes located on the surface of the host, can convert a pro-inflammatory environment driven by a danger molecule extracellular-ATP to an adenosine-mediated anti-inflammatory milieu. Accordingly, CD39/CD73 signaling has been strongly implicated in modulating the intensity, duration, and composition of purinergic danger signals delivered to host. Recent studies have eluted potential roles for CD39 and CD73 in selective triggering of a variety of host immune cells and molecules in the presence of pathogenic microorganisms or microbial virulence molecules. Growing evidence also suggests that CD39 and CD73 present complimentary, but likely differential, actions against pathogens to shape the course and severity of microbial infection as well as the associated immune response. Similarly, adenosine receptors A2A and A2B have been proposed to be major immunomodulators of adenosine signaling during chronic inflammatory conditions induced by opportunistic pathogens, such as oral colonizer Porphyromonas gingivalis. Therefore, we here review the recent studies that demonstrate how complex network of molecules in the extracellular adenosine signaling machinery and their interactions can reshape immune responses and may also be targeted by opportunistic pathogens to establish successful colonization in human mucosal tissues and modulate the host immune response.

  5. Adenovirus E4ORF1-induced MYC activation promotes host cell anabolic glucose metabolism and virus replication.

    Science.gov (United States)

    Thai, Minh; Graham, Nicholas A; Braas, Daniel; Nehil, Michael; Komisopoulou, Evangelia; Kurdistani, Siavash K; McCormick, Frank; Graeber, Thomas G; Christofk, Heather R

    2014-04-01

    Virus infections trigger metabolic changes in host cells that support the bioenergetic and biosynthetic demands of viral replication. Although recent studies have characterized virus-induced changes in host cell metabolism (Munger et al., 2008; Terry et al., 2012), the molecular mechanisms by which viruses reprogram cellular metabolism have remained elusive. Here, we show that the gene product of adenovirus E4ORF1 is necessary for adenovirus-induced upregulation of host cell glucose metabolism and sufficient to promote enhanced glycolysis in cultured epithelial cells by activation of MYC. E4ORF1 localizes to the nucleus, binds to MYC, and enhances MYC binding to glycolytic target genes, resulting in elevated expression of specific glycolytic enzymes. E4ORF1 activation of MYC promotes increased nucleotide biosynthesis from glucose intermediates and enables optimal adenovirus replication in primary lung epithelial cells. Our findings show how a viral protein exploits host cell machinery to reprogram cellular metabolism and promote optimal progeny virion generation. Copyright © 2014 Elsevier Inc. All rights reserved.

  6. DNA incorporation of 6-thioguanine nucleotides during maintenance therapy of childhood acute lymphoblastic leukaemia and non-Hodgkin lymphoma

    DEFF Research Database (Denmark)

    Hedeland, Rikke L; Hvidt, Kristian; Nersting, Jacob

    2010-01-01

    To explore the DNA incorporation of 6-thioguanine nucleotide levels (DNA-6TGN) during 6-mercaptopurine (6MP) therapy of childhood acute lymphoblastic leukaemia (ALL) and non-Hodgkin lymphoma (NHL) and its relation to erythrocyte levels of their metabolites: 6-thioguanine-nucleotides (E-6TGN...

  7. Simulation of the coupling between nucleotide binding and transmembrane domains in the ABC transporter BtuCD

    DEFF Research Database (Denmark)

    Sonne, Jacob; Kandt, C.; Peters, Günther H.j.

    2007-01-01

    The nucleotide-induced structural rearrangements in ATP binding cassette (ABC) transporters, leading to substrate translocation, are largely unknown. We have modeled nucleotide binding and release in the vitamin B12 importer BtuCD using perturbed elastic network calculations and biased molecular...

  8. Genome-wide divergence and linkage disequilibrium analyses for Capsicum baccatum revealed by genome-anchored single nucleotide polymorphisms

    Science.gov (United States)

    Principal component analysis (PCA) with 36,621 polymorphic genome-anchored single nucleotide polymorphisms (SNPs) identified collectively for Capsicum annuum and Capsicum baccatum was used to show the distribution of these 2 important incompatible cultivated pepper species. Estimated mean nucleotide...

  9. Ceramic Hosts for Fission Products Immobilization

    Energy Technology Data Exchange (ETDEWEB)

    Peter C Kong

    2010-07-01

    Natural spinel, perovskite and zirconolite rank among the most leach resistant of mineral forms. They also have a strong affinity for a large number of other elements and including actinides. Specimens of natural perovskite and zirconolite were radioisotope dated and found to have survived at least 2 billion years of natural process while still remain their loading of uranium and thorium . Developers of the Synroc waste form recognized and exploited the capability of these minerals to securely immobilize TRU elements in high-level waste . However, the Synroc process requires a relatively uniform input and hot pressing equipment to produce the waste form. It is desirable to develop alternative approaches to fabricate these durable waste forms to immobilize the radioactive elements. One approach is using a high temperature process to synthesize these mineral host phases to incorporate the fission products in their crystalline structures. These mineral assemblages with immobilized fission products are then isolated in a durable high temperature glass for periods measured on a geologic time scale. This is a long term research concept and will begin with the laboratory synthesis of the pure spinel (MgAl2O4), perovskite (CaTiO3) and zirconolite (CaZrTi2O7) from their constituent oxides. High temperature furnace and/or thermal plasma will be used for the synthesis of these ceramic host phases. Nonradioactive strontium oxide will be doped into these ceramic phases to investigate the development of substitutional phases such as Mg1-xSrxAl2O4, Ca1-xSrxTiO3 and Ca1-xSrxZrTi2O7. X-ray diffraction will be used to establish the crystalline structures of the pure ceramic hosts and the substitution phases. Scanning electron microscopy and energy dispersive X-ray analysis (SEM-EDX) will be performed for product morphology and fission product surrogates distribution in the crystalline hosts. The range of strontium doping is planned to reach the full substitution of the divalent

  10. Host specificity in bat ectoparasites: a natural experiment.

    Science.gov (United States)

    Seneviratne, Sampath S; Fernando, H Chandrika; Udagama-Randeniya, Preethi V

    2009-07-15

    We undertook a field study to determine patterns of specialisation of ectoparasites in cave-dwelling bats in Sri Lanka. The hypothesis tested was that strict host specificity (monoxeny) could evolve through the development of differential species preferences through association with the different host groups. Three species of cave-dwelling bats were chosen to represent a wide range of host-parasite associations (monoxeny to polyxeny), and both sympatric and allopatric roosting assemblages. Of the eight caves selected, six caves were "allopatric" roosts where two of each housed only one of the three host species examined: Rousettus leschenaulti (Pteropodidae), Rhinolophus rouxi and Hipposideros speoris (Rhinolophidae). The remaining two caves were "sympatric" roosts and housed all three host species. Thirty bats of each species were examined for ectoparasites in each cave, which resulted in a collection of nycteribiid and streblid flies, an ischnopsyllid bat flea, argasid and ixodid ticks, and mites belonging to three families. The host specificity of bat parasites showed a trend to monoxeny in which 70% of the 30 species reported were monoxenous. Odds ratios derived from chi(2)-tests revealed two levels of host preferences in less-specific parasites (i) the parasite was found on two host species under conditions of both host sympatry and host allopatry, with a preference for a single host in the case of host sympatry and (ii) the preference for a single host was very high, hence under conditions of host sympatry, it was confined to the preferred host only. However, under conditions of host allopatry, it utilized both hosts. There appears to be an increasing prevalence in host preferences of the parasites toward confinement to a single host species. The ecological isolation of the bat hosts and a long history of host-parasite co-existence could have contributed to an overall tendency of bat ectoparasites to become specialists, here reflected in the high percentage

  11. Co-niche construction between hosts and symbionts

    Indian Academy of Sciences (India)

    Symbiosis is a process that can generate evolutionary novelties and can extend the phenotypic niche space of organisms. Symbionts can act together with their hosts to co-construct host organs, within which symbionts are housed. Once established within hosts, symbionts can also influence various aspects of host ...

  12. Host shifts enhance diversification of ectomycorrhizal fungi: diversification rate analysis of the ectomycorrhizal fungal genera Strobilomyces and Afroboletus with an 80-gene phylogeny.

    Science.gov (United States)

    Sato, Hirotoshi; Tanabe, Akifumi S; Toju, Hirokazu

    2017-04-01

    Mutualisms with new host lineages can provide symbionts with novel ecological opportunities to expand their geographical distribution, thereby leading to evolutionary diversification. Because ectomycorrhizal (ECM) fungi provide ideal opportunities to test the relationship between host shifts and diversification, we tested whether mutualism with new host lineages could increase the diversification rates of ECM fungi. Using a Bayesian tree inferred from 23 027-base nucleotide sequences of 80 single-copy genes, we tested whether the diversification rate had changed through host-shift events in the monophyletic clade containing the ECM fungal genera Strobilomyces and Afroboletus. The results indicated that these fungi were initially associated with Caesalpinioideae/Monotoideae in Africa, acquired associations with Dipterocarpoideae in tropical Asia, and then switched to Fagaceae/Pinaceae and Nothofagaceae/Eucalyptus. Fungal lineages associated with Fagaceae/Pinaceae were inferred to have approximately four-fold and two-fold greater diversification rates than those associated with Caesalpinioideae/Monotoideae and Dipterocarpoideae or Nothofagaceae/Eucalyptus, respectively. Moreover, the diversification rate shift was inferred to follow the host shift to Fagaceae/Pinaceae. Our study suggests that host-shift events, particularly those occurring with respect to Fagaceae/Pinaceae, can provide ecological opportunities for the rapid diversification of Strobilomyces-Afroboletus. Although further studies are needed for generalization, we propose a possible diversification scenario of ECM fungi. © 2016 The Authors. New Phytologist © 2016 New Phytologist Trust.

  13. A genome-wide survey for host response of silkworm, Bombyx mori during pathogen Bacillus bombyseptieus infection.

    Directory of Open Access Journals (Sweden)

    Lulin Huang

    Full Text Available Host-pathogen interactions are complex relationships, and a central challenge is to reveal the interactions between pathogens and their hosts. Bacillus bombysepticus (Bb which can produces spores and parasporal crystals was firstly separated from the corpses of the infected silkworms (Bombyx mori. Bb naturally infects the silkworm can cause an acute fuliginosa septicaemia and kill the silkworm larvae generally within one day in the hot and humid season. Bb pathogen of the silkworm can be used for investigating the host responses after the infection. Gene expression profiling during four time-points of silkworm whole larvae after Bb infection was performed to gain insight into the mechanism of Bb-associated host whole body effect. Genome-wide survey of the host genes demonstrated many genes and pathways modulated after the infection. GO analysis of the induced genes indicated that their functions could be divided into 14 categories. KEGG pathway analysis identified that six types of basal metabolic pathway were regulated, including genetic information processing and transcription, carbohydrate metabolism, amino acid and nitrogen metabolism, nucleotide metabolism, metabolism of cofactors and vitamins, and xenobiotic biodegradation and metabolism. Similar to Bacillus thuringiensis (Bt, Bb can also induce a silkworm poisoning-related response. In this process, genes encoding midgut peritrophic membrane proteins, aminopeptidase N receptors and sodium/calcium exchange protein showed modulation. For the first time, we found that Bb induced a lot of genes involved in juvenile hormone synthesis and metabolism pathway upregulated. Bb also triggered the host immune responses, including cellular immune response and serine protease cascade melanization response. Real time PCR analysis showed that Bb can induce the silkworm systemic immune response, mainly by the Toll pathway. Anti-microorganism peptides (AMPs, including of Attacin, Lebocin, Enbocin, Gloverin

  14. Host-pathogen interactions in typhoid fever

    NARCIS (Netherlands)

    de Jong, H.K.

    2015-01-01

    This thesis focuses on host-pathogen interactions in Salmonella Typhi and Burkholderia pseudomallei infections and explores the interplay between these bacteria and the innate immune system. Typhoid fever is one of the most common causes of bacterial infection in low-income countries. With adequate

  15. Circumnuclear Structures in Megamaser Host Galaxies

    Energy Technology Data Exchange (ETDEWEB)

    Pjanka, Patryk; Greene, Jenny E. [Department of Astrophysical Sciences, Princeton University, 4 Ivy Lane, Princeton, NJ 08544 (United States); Seth, Anil C. [Department of Physics and Astronomy, University of Utah, Salt Lake City, UT 84112 (United States); Braatz, James A.; Lo, Fred K. Y. [National Radio Astronomy Observatory, 520 Edgemont Road, Charlottesville, VA 22903 (United States); Henkel, Christian [Max-Planck-Institut für Radioastronomie, Auf dem Hügel 69, D-53121 Bonn (Germany); Läsker, Ronald, E-mail: ppjanka@princeton.edu [Finnish Centre for Astronomy with ESO (FINCA), University of Turku, Väisäläntie 20, FI-21500 Kaarina (Finland)

    2017-08-01

    Using the Hubble Space Telescope , we identify circumnuclear (100–500 pc scale) structures in nine new H{sub 2}O megamaser host galaxies to understand the flow of matter from kpc-scale galactic structures down to the supermassive black holes (SMBHs) at galactic centers. We double the sample analyzed in a similar way by Greene et al. and consider the properties of the combined sample of 18 sources. We find that disk-like structure is virtually ubiquitous when we can resolve <200 pc scales, in support of the notion that non-axisymmetries on these scales are a necessary condition for SMBH fueling. We perform an analysis of the orientation of our identified nuclear regions and compare it with the orientation of megamaser disks and the kpc-scale disks of the hosts. We find marginal evidence that the disk-like nuclear structures show increasing misalignment from the kpc-scale host galaxy disk as the scale of the structure decreases. In turn, we find that the orientation of both the ∼100 pc scale nuclear structures and their host galaxy large-scale disks is consistent with random with respect to the orientation of their respective megamaser disks.

  16. Probing Pseudomonas syringae host interactions using metatranscriptomics

    Science.gov (United States)

    Transcriptome analyses during the interaction of plants and pathogens can be used to provide insights into molecular mechanisms of plant resistance as well as the mechanisms used by bacteria to adapt to hosts and cause disease. We performed a dual in planta RNA-Seq experiment to profile RNA expressi...

  17. Late effects of radiation: host factors

    International Nuclear Information System (INIS)

    Fry, R.J.M.; Storer, J.B.

    1983-01-01

    The paper discusses the influence of host factors on radiation late effects and in particular cancer. Radiation induces cellular changes that result in initiated cells with a potential to become cancers. The expression of the initiated cells as tumors is influenced, if not determined, by both tissue and systemic factors that are sex-, age-, and species-dependent

  18. Five bid to host Middle East synchroton

    CERN Multimedia

    McCabe, H

    1999-01-01

    Germany is willing to donate a synchrotron to a research centre to be built somewhere in the Middle East. Bids to host the centre were submitted by Turkey, Cyprus, Iran, the Palestinian Authority and Egypt. Funding of at least 30 million US dollars still needs to be found (1 page).

  19. Microbial manipulation of host sex determination

    NARCIS (Netherlands)

    Beukeboom, Leo W.

    A recent study in the lepidopteran Ostrinia scapulalis shows that endosymbionts can actively manipulate the sex determination mechanism of their host. Wolbachia bacteria alter the sex-specific splicing of the doublesex master switch gene. In ZZ males of this female heterogametic system, the female

  20. Road MAPs to engineer host microbiomes

    NARCIS (Netherlands)

    Oyserman, B. O.; Medema, Marnix H; Raaijmakers, J.M.

    2018-01-01

    Microbiomes contribute directly or indirectly to host health and fitness. Thus far, investigations into these emergent traits, referred to here as microbiome-associated phenotypes (MAPs), have been primarily qualitative and taxonomy-driven rather than quantitative and trait-based. We present the

  1. Host Families Matter: The Homestay Manual.

    Science.gov (United States)

    Peace Corps, Washington, DC. Information Collection and Exchange Div.

    This manual provides guidelines, sample documents, and sample lesson plans for the trainers, trainees, and host families involved in homestays for Peace Corps volunteers. The manual contains 11 sections that deal with the following topics: (1) introduction; (2) policy, timelines, and responsibilities; (3) medical and financial issues; (4) host…

  2. From Dietary Fiber to Host Physiology

    DEFF Research Database (Denmark)

    Koh, Ara; De Vadder, Filipe; Kovatcheva-Datchary, Petia

    2016-01-01

    executors of diet-based microbial influence on the host. Here, we will review data supporting the diverse functional roles carried out by a major class of bacterial metabolites, the short-chain fatty acids (SCFAs). SCFAs can directly activate G-coupled-receptors, inhibit histone deacetylases, and serve...

  3. Gastrointestinal function in the parasitized host

    International Nuclear Information System (INIS)

    Castro, G.A.

    1981-01-01

    Emphasis in this review is on (1) digestive-absorptive, secretory and smooth muscle functions altered by gastrointestinal (GI) parasites, (2) mechanisms by which parasites induce changes, and (3) the influence of parasite-induced alterations on the health of the host. Examples involving laboratory and domestic animals indicate that inflammation is an important factor in pathological alterations in epithelial and smooth muscle tissues throughout the alimentary canal. Observations on GI secretory activity reveal an influence of parasites on the host GI endocrine system. It is argued that assessments of the significance of parasite-induced changes on the host must be balanced with the adaptive potential and 'reserve capacity' of the GI system. In this regard host immunity should be considered a specific adaptation. Some tracer studies are mentioned marginally, such as the use of 14 C polyethylene glycol to estimate the direction of not fluid movement in the small intestine, and the use of 51 Cr to demonstrate the significantly faster intestinal transit in Trichinella spiralis infected animals

  4. Host-pathogen interactions during apoptosis

    Indian Academy of Sciences (India)

    Unknown

    349. Keywords. Antioxidant; baculovirus; host-pathogen; eIF2α-kinase; P35; PKR .... conferring a selective advantage to the virus, the capacity to prevent apoptosis is ..... totic extracts were found to cleave purified PKR in vitro. These findings ...

  5. Host Genetics: Fine-Tuning Innate Signaling

    OpenAIRE

    Fellay, Jacques; Goldstein, David B.

    2007-01-01

    A polymorphism modulating innate immunity signal transduction has recently been shown to influence human susceptibility to many different infections, providing one more indication of the potential of host genetics to reveal physiological pathways and mechanisms that influence resistance to infectious diseases.

  6. Host country language ability and expatriate adjustment

    DEFF Research Database (Denmark)

    Selmer, Jan; Lauring, Jakob

    2015-01-01

    countries, one with an easy, relatively simple language and the other with a difficult, highly complex language. Consistent with Goal-Setting Theory, results indicated a relative advantage of expatriates’ language ability in terms of their adjustment in the host country with the difficult language...

  7. Natal Host Plants Can Alter Herbivore Competition.

    Science.gov (United States)

    Pan, Huipeng; Preisser, Evan L; Su, Qi; Jiao, Xiaoguo; Xie, Wen; Wang, Shaoli; Wu, Qingjun; Zhang, Youjun

    2016-01-01

    Interspecific competition between herbivores is widely recognized as an important determinant of community structure. Although researchers have identified a number of factors capable of altering competitive interactions, few studies have addressed the influence of neighboring plant species. If adaptation to/ epigenetic effects of an herbivore's natal host plant alter its performance on other host plants, then interspecific herbivore interactions may play out differently in heterogeneous and homogenous plant communities. We tested wether the natal host plant of a whitefly population affected interactions between the Middle-east Asia Minor 1 (MEAM1) and Mediterranean (MED) cryptic species of the whitefly Bemisia tabaci by rearing the offspring of a cabbage-derived MEAM1 population and a poinsettia-derived MED population together on three different host plants: cotton, poinsettia, and cabbage. We found that MED dominated on poinsettia and that MEAM1 dominated on cabbage, results consistent with previous research. MED also dominated when reared with MEAM1 on cotton, however, a result at odds with multiple otherwise-similar studies that reared both species on the same natal plant. Our work provides evidence that natal plants affect competitive interactions on another plant species, and highlights the potential importance of neighboring plant species on herbivore community composition in agricultral systems.

  8. Host defence peptides in human burns.

    Science.gov (United States)

    Kaus, Aljoscha; Jacobsen, Frank; Sorkin, Michael; Rittig, Andrea; Voss, Bruno; Daigeler, Adrien; Sudhoff, Holger; Steinau, Hans-Ulrich; Steinstraesser, Lars

    2008-02-01

    The goal of this study was to analyse expression profiles of human epithelial host defence peptides in burned and unburned skin tissue, samples of which were obtained during debridements and snap-frozen in liquid nitrogen. Total RNA was isolated, and cDNA of epithelial host defence peptides and proteins (hCAP-18/LL-37, hBD1-hBD4, dermcidin, S100A7/psoriasin and RNAse7) was quantified by qRT-PCR. In situ hybridisation and immunohistochemical staining localised gene expression of hCAP-18/LL-37, hBD2 and hBD3 in histological sections. Most of the analysed host defence peptides and proteins showed higher mRNA levels in partial-thickness burns than in unburned tissue. In situ hybridisation revealed expression of hCAP-18/LL-37, hBD2 and hBD3 at the surface of burns that was independent of burn depth. However, the finding of higher host defence peptide gene expression rates does not correlate with the incidence of wound infection in burns. We hypothesise that the epithelial innate immune response in burns is complex.

  9. Studies of Reservoir Hosts for Marburg virus

    DEFF Research Database (Denmark)

    Swanepoel, Robert; Smit, Sheilagh B; Rollin, Pierre E

    2007-01-01

    To determine reservoir hosts for Marburg virus (MARV), we examined the fauna of a mine in northeastern Democratic Republic of the Congo. The mine was associated with a protracted outbreak of Marburg hemorrhagic fever during 1998-2000. We found MARV nucleic acid in 12 bats, comprising 3.0%-3.6% of...

  10. Nucleotide variability and linkage disequilibrium patterns in the porcine MUC4 gene

    Directory of Open Access Journals (Sweden)

    Yang Ming

    2012-07-01

    Full Text Available Abstract Background MUC4 is a type of membrane anchored glycoprotein and serves as the major constituent of mucus that covers epithelial surfaces of many tissues such as trachea, colon and cervix. MUC4 plays important roles in the lubrication and protection of the surface epithelium, cell proliferation and differentiation, immune response, cell adhesion and cancer development. To gain insights into the evolution of the porcine MUC4 gene, we surveyed the nucleotide variability and linkage disequilibrium (LD within this gene in Chinese indigenous breeds and Western commercial breeds. Results A total of 53 SNPs covering the MUC4 gene were genotyped on 5 wild boars and 307 domestic pigs representing 11 Chinese breeds and 3 Western breeds. The nucleotide variability, haplotype phylogeny and LD extent of MUC4 were analyzed in these breeds. Both Chinese and Western breeds had considerable nucleotide diversity at the MUC4 locus. Western pig breeds like Duroc and Large White have comparable nucleotide diversity as many of Chinese breeds, thus artificial selection for lean pork production have not reduced the genetic variability of MUC4 in Western commercial breeds. Haplotype phylogeny analyses indicated that MUC4 had evolved divergently in Chinese and Western pigs. The dendrogram of genetic differentiation between breeds generally reflected demographic history and geographical distribution of these breeds. LD patterns were unexpectedly similar between Chinese and Western breeds, in which LD usually extended less than 20 kb. This is different from the presumed high LD extent (more than 100 kb in Western commercial breeds. The significant positive Tajima’D, and Fu and Li’s D statistics in a few Chinese and Western breeds implied that MUC4 might undergo balancing selection in domestic breeds. Nevertheless, we cautioned that the significant statistics could be upward biased by SNP ascertainment process. Conclusions Chinese and Western breeds have

  11. Star formation quenching in quasar host galaxies

    Science.gov (United States)

    Carniani, Stefano

    2017-10-01

    Galaxy evolution is likely to be shaped by negative feedback from active galactic nuclei (AGN). In the whole range of redshifts and luminosities studied so far, galaxies hosting an AGN frequently show fast and extended outflows consisting in both ionised and molecular gas. Such outflows could potentially quench the start formation within the host galaxy, but a clear evidence of negative feedback in action is still missing. Hereby I will analyse integral-field spectroscopic data for six quasars at z ˜2.4 obtained with SINFONI in the H- and K-band. All the quasars show [OIII]λ5007 line detection of fast, extended outflows. Also, the high signal-to-noise SINFONI observations allow the identification of faint narrow Hα emission (FWHM anti-correlated with star-formation powered emission, i.e. star formation is suppressed in the area affected by the outflow. Nonetheless as narrow, spatially-extended Hα emission, indicating star formation rates of at least 50 - 100 M⊙/yr, has been detected, either AGN feedback is not affecting the whole host galaxy, or star formation is completely quenched only by several feedback episodes. On the other hand, a positive feedback scenario, supported by narrow emission in Hα extending along the edges of the outflow cone, suggests that galaxy-wide outflows could also have a twofold role in the evolution of the host galaxy. Finally, I will present CO(3-2) ALMA data for three out of the six QSOs observed with SINFONI. Flux maps obtained for the CO(3-2) transition suggest that molecular gas within the host galaxy is swept away by fast winds. A negative-feedback scenario is supported by the inferred molecular gas mass in all three objects, which is significantly below what observed in non-active main-sequence galaxies at high-z.

  12. Complete nucleotide sequence of the multidrug resistance IncA/C plasmid pR55 from Klebsiella pneumoniae isolated in 1969.

    Science.gov (United States)

    Doublet, Benoît; Boyd, David; Douard, Gregory; Praud, Karine; Cloeckaert, Axel; Mulvey, Michael R

    2012-10-01

    To determine the complete nucleotide sequence of the multidrug resistance IncA/C plasmid pR55 from a clinical Klebsiella pneumoniae strain that was isolated from a urinary tract infection in 1969 in a French hospital and compare it with those of contemporary emerging IncA/C plasmids. The plasmid was purified and sequenced using a 454 sequencing approach. After draft assembly, additional PCRs and walking reads were performed for gap closure. Sequence comparisons and multiple alignments with other IncA/C plasmids were done using the BLAST algorithm and CLUSTAL W, respectively. Plasmid pR55 (170 810 bp) revealed a shared plasmid backbone (>99% nucleotide identity) with current members of the IncA/C(2) multidrug resistance plasmid family that are widely disseminating antibiotic resistance genes. Nevertheless, two specific multidrug resistance gene arrays probably acquired from other genetic elements were identified inserted at conserved hotspot insertion sites in the IncA/C backbone. A novel transposon named Tn6187 showed an atypical mixed transposon configuration composed of two mercury resistance operons and two transposition modules that are related to Tn21 and Tn1696, respectively, and an In0-type integron. IncA/C(2) multidrug resistance plasmids have a broad host range and have been implicated in the dissemination of antibiotic resistance among Enterobacteriaceae from humans and animals. This typical IncA/C(2) genetic scaffold appears to carry various multidrug resistance gene arrays and is now also a successful vehicle for spreading AmpC-like cephalosporinase and metallo-β-lactamase genes, such as bla(CMY) and bla(NDM), respectively.

  13. Trophic relationships between the parasitic plant species Phelipanche ramosa (L. and different hosts depending on host phenological stage and host growth rate

    Directory of Open Access Journals (Sweden)

    Delphine Moreau

    2016-07-01

    Full Text Available Phelipanche ramosa (L. Pomel (branched broomrape is a holoparasitic plant that reproduces on crops and also on weeds, which contributes to increase the parasite seed bank in fields. This parasite extracts all its nutrients at the host's expense so that host-parasite trophic relationships are crucial to determine host and parasite growth. This study quantified the intensity with which P. ramosa draws assimilates from its host and analyzed whether it varied with host species, host phenological stage and host growth rate. A greenhouse experiment was conducted on three host species: the crop species Brassica napus (L. (oilseed rape and two weed species, Capsella bursa-pastoris (L. Medik. and Geranium dissectum (L.. Plants were grown with or without P. ramosa and under three light levels to modulate host growth rate. The proportion of host biomass loss due to parasitism by P. ramosa differed between host species (at host fructification, biomass loss ranged from 34% to 84%. Brassica napus and C. bursa-pastoris displayed a similar response to P. ramosa, probably because they belong to the same botanical family. The sensitivity to P. ramosa in each host species could be related to the precocity of P. ramosa development on them. Host compartments could be ranked as a function of their sensitivity to parasitism, with the reproductive compartment being the most severely affected, followed by stems and roots. The proportion of biomass allocated to leaves was not reduced by parasitism. The proportion of pathosystem biomass allocated to the parasite depended on host species. It generally increased with host stage progression but was constant across light induced-host growth rate, showing that P. ramosa adapts its growth to host biomass production. The rank order of host species in terms of sink strength differed from that in terms of host sensitivity. Finally, for B. napus, the biomass of individual parasite shoots decreased with increasing their number per

  14. Host sharing and host manipulation by larval helminths in shore crabs: cooperation or conflict?

    Science.gov (United States)

    Poulin, Robert; Nichol, Katherine; Latham, A David M

    2003-04-01

    Larval helminths of different species that share the same intermediate host and are transmitted by predation to the same definitive host may cooperate in their attempts to manipulate the behaviour of the intermediate host, while at the same time having conflicts of interests over the use of host resources. A few studies have indicated that intermediate hosts harbouring larval helminths have altered concentrations of neurotransmitters in their nervous system, and thus measuring levels of neurotransmitters in host brains could serve to assess the respective and combined effect of different helminth species on host behaviour. Here, we investigate potential cooperation and conflict among three helminths in two species of crab intermediate hosts. The acanthocephalan Profilicollis spp., the trematode Maritrema sp. and an acuariid nematode, all use Macrophthalmus hirtipes (Ocypodidae) as intermediate host, whereas Profilicollis and Maritrema also use Hemigrapsus crenulatus (Grapsidae). All three helminths mature inside gulls or other shore birds. There was a significant decrease in the mean volume of Profilicollis cystacanths as the intensity of infection by this parasite increased in H. crenulatus, the only host in which this was investigated; however, there was no measurable effect of other helminth species on the size of acanthocephalans, suggesting no interspecific conflict over resource use within crabs. There was, in contrast, evidence of a positive interspecific association between the two most common helminth species: numbers of Profilicollis and Maritrema were positively correlated among crabs, independently of crab size, in M. hirtipes but not H. crenulatus. More importantly, we found that the total number of larval helminths per crab correlated significantly, and negatively, with concentrations of serotonin in crab brains, again only in M. hirtipes; numbers of each parasite species separately did not covary in either crab species with serotonin or dopamine, the

  15. In-host microevolution of Aspergillus fumigatus: A phenotypic and genotypic analysis.

    Science.gov (United States)

    Ballard, Eloise; Melchers, Willem J G; Zoll, Jan; Brown, Alistair J P; Verweij, Paul E; Warris, Adilia

    2018-04-01

    In order to survive, Aspergillus fumigatus must adapt to specific niche environments. Adaptation to the human host includes modifications facilitating persistent colonisation and the development of azole resistance. The aim of this study is to advance understanding of the genetic and physiological adaptation of A. fumigatus in patients during infection and treatment. Thirteen A. fumigatus strains were isolated from a single chronic granulomatous disease patient suffering from persistent and recurrent invasive aspergillosis over a period of 2 years. All strains had identical microsatellite genotypes and were considered isogenic. Whole genome comparisons identified 248 non-synonymous single nucleotide polymorphisms. These non-synonymous mutations have potential to play a role in in-host adaptation. The first 2 strains isolated were azole susceptible, whereas later isolates were itraconazole, voriconazole and/or posaconazole resistant. Growth assays in the presence and absence of various antifungal stressors highlighted minor changes in growth rate and stress resistance, with exception of one isolate showing a significant growth defect. Poor conidiation was observed in later isolates. In certain drug resistant isolates conidiation was restored in the presence of itraconazole. Differences in virulence were observed as demonstrated in a Galleria mellonella infection model. We conclude that the microevolution of A. fumigatus in this patient has driven the emergence of both Cyp51A-independent and Cyp51A-dependent, azole resistance mechanisms, and additional phenotypes that are likely to have promoted fungal persistence. Copyright © 2018 The Author(s). Published by Elsevier Inc. All rights reserved.

  16. Nucleotide sequence of the coat protein gene of the Skierniewice isolate of plum pox virus (PPV)

    International Nuclear Information System (INIS)

    Wypijewski, K.; Musial, W.; Augustyniak, J.; Malinowski, T.

    1994-01-01

    The coat protein (CP) gene of the Skierniewice isolate of plum pox virus (PPV-S) has been amplified using the reverse transcription - polymerase chain reaction (RT-PCR), cloned and sequenced. The nucleotide sequence of the gene and the deduced amino-acid sequences of PPV-S CP were compared with those of other PPV strains. The nucleotide sequence showed very high homology to most of the published sequences. The motif: Asp-Ala-Gly (DAG), important for the aphid transmissibility, was present in the amino-acid sequence. Our isolate did not react in ELISA with monoclonal antibodies MAb06 supposed to be specific for PPV-D. (author). 32 refs, 1 fig., 2 tabs

  17. Molecular cloning and complete nucleotide sequence of a human ventricular myosin light chain 1

    Energy Technology Data Exchange (ETDEWEB)

    Hoffmann, E; Shi, Q W; Floroff, M; Mickle, D A.G.; Wu, T W; Olley, P M; Jackowski, G

    1988-03-25

    Human ventricular plasmid library was constructed. The library was screened with the oligonucleotide probe (17-mer) corresponding to a conserve region of myosin light chain 1 near the carboxy terminal. Full length cDNA recombinant plasmid containing 1100 bp insert was isolated. RNA blot hybridization with this insert detected a message of approximately 1500 bp corresponding to the size of VLCl and mRNA. Complete nucleotide sequence of the coding region was determined in M13 subclones using dideoxy chain termination method. With the isolation of this clone (pCD HLVCl), the publication of the complete nucleotide sequence of HVLCl and the predicted secondary structure of this protein will aid in understanding of the biochemistry of myosin and its function in contraction, the evolution of myosin light genes and the genetic, developmental and physiological regulation of myosin genes.

  18. Effects of preservation methods on amino acids and 5'-nucleotides of Agaricus bisporus mushrooms.

    Science.gov (United States)

    Liu, Ying; Huang, Fan; Yang, Hong; Ibrahim, S A; Wang, Yan-Feng; Huang, Wen

    2014-04-15

    In this study, the proximate composition, free amino acids content and 5'-nucleotides in frozen, canned and salted Agaricus bisporus (A. bisporus) were investigated. We found that the three kinds of A. bisporus products were good sources of protein, with amount varying in the ranges of 16.54-24.35g/100g (dry weight). Freezing, canning and salting process, followed by 6months of storage led to a significant reduction in free amino acids, especially tyrosine, alanine, glutamine and cysteine. There were medium levels of MSG-like amino acids in frozen A. bisporus and canned A. bisporus, and low levels of MSG-like amino acids in salted A. bisporus. The mount of flavor 5'-nucleotides in frozen A. bisporus was higher than that of canned and salted A. bisporus. The present study thus suggests that freezing is beneficial for the preservation of A. bisporus. Copyright © 2013 Elsevier Ltd. All rights reserved.

  19. Prioritizing single-nucleotide polymorphisms and variants associated with clinical mastitis

    Directory of Open Access Journals (Sweden)

    Suravajhala P

    2017-06-01

    Full Text Available Prashanth Suravajhala,1 Alfredo Benso2 1Department of Molecular Biology and Genetics, Center for Quantitative Genetics and Genomics, Aarhus University, Aarhus, Denmark; 2Department of Control and Computer Engineering, Politecnico di Torino, Torino, Italy Abstract: Next-generation sequencing technology has provided resources to easily explore and identify candidate single-nucleotide polymorphisms (SNPs and variants. However, there remains a challenge in identifying and inferring the causal SNPs from sequence data. A problem with different methods that predict the effect of mutations is that they produce false positives. In this hypothesis, we provide an overview of methods known for identifying causal variants and discuss the challenges, fallacies, and prospects in discerning candidate SNPs. We then propose a three-point classification strategy, which could be an additional annotation method in identifying causalities. Keywords: clinical mastitis, single-nucleotide polymorphisms, variants, associations, diseases, linkage disequilibrium, GWAS

  20. Effect of ionizing radiation on calcium and cyclic nucleotides metabolism in rats of different age

    International Nuclear Information System (INIS)

    Efimova, N.I.; Libenson, S.V.

    1982-01-01

    Some features of mechanism of calcium homeostasis and cyclic nucleotide exchange breakage in case of acute radiation injury of rats of various age were studied. It is established that calcium level in blood in nonpuberal animals, calcium and cAMP excretion with urine are minimal and reach maximum at puberal age. cGMP excretion with urine and concentrational levels of cAMP and cGMP in blood do not change with age. It is shown that calcium excretion with urine decreases adaptively in conditions of acute radiation injury in rats of all age groups. Maximal shifts in cAMP/cGMP ratio were noted in nonpuberal animals, whereas maximal adaptive-compensatory abilities in the regulation system of calcium homeostasis and cyclic nucleotides are typical to adolescent puberal animals

  1. Protected DNA strand displacement for enhanced single nucleotide discrimination in double-stranded DNA.

    Science.gov (United States)

    Khodakov, Dmitriy A; Khodakova, Anastasia S; Huang, David M; Linacre, Adrian; Ellis, Amanda V

    2015-03-04

    Single nucleotide polymorphisms (SNPs) are a prime source of genetic diversity. Discriminating between different SNPs provides an enormous leap towards the better understanding of the uniqueness of biological systems. Here we report on a new approach for SNP discrimination using toehold-mediated DNA strand displacement. The distinctiveness of the approach is based on the combination of both 3- and 4-way branch migration mechanisms, which allows for reliable discrimination of SNPs within double-stranded DNA generated from real-life human mitochondrial DNA samples. Aside from the potential diagnostic value, the current study represents an additional way to control the strand displacement reaction rate without altering other reaction parameters and provides new insights into the influence of single nucleotide substitutions on 3- and 4-way branch migration efficiency and kinetics.

  2. Role of Metal Oxides in Chemical Evolution: Interaction of Ribose Nucleotides with Alumina

    Science.gov (United States)

    Arora, Avnish Kumar; Kamaluddin

    2009-03-01

    Interaction of ribonucleotides—namely, 5‧-AMP, 5‧-GMP, 5‧-CMP, and 5‧-UMP—with acidic, neutral, and basic alumina has been studied. Purine nucleotides showed higher adsorption on alumina in comparison with pyrimidine nucleotides under acidic conditions. Adsorption data obtained followed Langmuir adsorption isotherm, and Xm and KL values were calculated. On the basis of infrared spectral studies of ribonucleotides, alumina, and ribonucleotide-alumina adducts, we propose that the nitrogen base and phosphate moiety of the ribonucleotides interact with the positive charge surface of alumina. Results of the present study may indicate the importance of alumina in concentrating organic molecules from dilute aqueous solutions in primeval seas in the course of chemical evolution on Earth.

  3. An algorithm and program for finding sequence specific oligo-nucleotide probes for species identification

    Directory of Open Access Journals (Sweden)

    Tautz Diethard

    2002-03-01

    Full Text Available Abstract Background The identification of species or species groups with specific oligo-nucleotides as molecular signatures is becoming increasingly popular for bacterial samples. However, it shows also great promise for other small organisms that are taxonomically difficult to tract. Results We have devised here an algorithm that aims to find the optimal probes for any given set of sequences. The program requires only a crude alignment of these sequences as input and is optimized for performance to deal also with very large datasets. The algorithm is designed such that the position of mismatches in the probes influences the selection and makes provision of single nucleotide outloops. Program implementations are available for Linux and Windows.

  4. A Lateral Flow Biosensor for the Detection of Single Nucleotide Polymorphisms.

    Science.gov (United States)

    Zeng, Lingwen; Xiao, Zhuo

    2017-01-01

    A lateral flow biosensor (LFB) is introduced for the detection of single nucleotide polymorphisms (SNPs). The assay is composed of two steps: circular strand displacement reaction and lateral flow biosensor detection. In step 1, the nucleotide at SNP site is recognized by T4 DNA ligase and the signal is amplified by strand displacement DNA polymerase, which can be accomplished at a constant temperature. In step 2, the reaction product of step 1 is detected by a lateral flow biosensor, which is a rapid and cost effective tool for nuclei acid detection. Comparing with conventional methods, it requires no complicated machines. It is suitable for the use of point of care diagnostics. Therefore, this simple, cost effective, robust, and promising LFB detection method of SNP has great potential for the detection of genetic diseases, personalized medicine, cancer related mutations, and drug-resistant mutations of infectious agents.

  5. Host preference of the bean weevil Zabrotes subfasciatus

    Institute of Scientific and Technical Information of China (English)

    Isabel Ribeiro do Valle Teixeira; Angel Roberto Barchuk; Fernando Sérgio Zucoloto

    2008-01-01

    It is largely known that the range of an insect diet is mostly determined by oviposition behavior, mainly in species with endophytic larvae such as Zabrotes subfasciatus.However, the proximate factors determining host choice and the subsequent steps leading to the expansion or reduction of the host number and occasional host shifts are largelyun known. We analyzed various factors determining host preference of Z. subfasciatus through the evaluation of: (i) oviposition preference of a wild population of Z. subfasciatus on the usual host (bean) and unusual hosts (lentil, chickpea and soy), and the performance of the offspring; (ii) artificial selection for increasing preference for hosts initially less frequently chosen; (iii) comparison of oviposition behavior between two different popula-tions (reared for~30 generations in beans or chickpeas, respectively); (iv) oviposition timing on usual and unusual hosts; and (v) identification of preference hierarchies. We found that when using unusual hosts, there is no correlation between performance and preference and that the preference hierarchy changes only slightly when the population passes through several generations on the less frequently accepted host. We also found a positive response to artificial selection for increasing oviposition on the less preferred host; however, when the host-choice experiment involved two varieties of the usual host, the response was faster than when the choice involved usual and unusual hosts. Finally, beetles reared on an unusual host (chickpea) for 26 generations showed similar good fitness on both usual and unusual hosts,indicating that the use of a new host does not necessarily result in the loss of performance on the original host. Nevertheless, this population showed lower fitness on the usual host than that of the original population, suggesting an underlying partial trade-off phenomenon which may contribute to a broadening of diet of this insect species.

  6. Lack of nucleotide variability in a beetle pest with extreme inbreeding

    OpenAIRE

    Andreev, D.; Breilid, H.; Kirkendall, L.; Brun, Luc-Olivier; French-Constant, R.H.

    1998-01-01

    The coffee berry borer beetle #Hypothenemus hampei$ (Ferrari) (#Curculionidae$ : #Scolytinae$) is the major insect pest of coffee and has spread to most of the coffee-growing countries of the world. This beetle also displays an usual life cycle, with regular sibling mating. This regular inbreeding and the population bottlenecks occuring on colonization of new regions should lead to low levels of genetic diversity. We were therefore interested in determining the level of nucleotide variation i...

  7. Non-nucleotide Agonists Triggering P2X7 Receptor Activation and Pore Formation

    Directory of Open Access Journals (Sweden)

    Francesco Di Virgilio

    2018-02-01

    Full Text Available The P2X7 receptor (P2X7R is a ligand-gated plasma membrane ion channel belonging to the P2X receptor subfamily activated by extracellular nucleotides. General consensus holds that the physiological (and maybe the only agonist is ATP. However, scattered evidence generated over the last several years suggests that ATP might not be the only agonist, especially at inflammatory sites. Solid data show that NAD+ covalently modifies the P2X7R of mouse T lymphocytes, thus lowering the ATP threshold for activation. Other structurally unrelated agents have been reported to activate the P2X7R via a poorly understood mechanism of action: (a the antibiotic polymyxin B, possibly a positive allosteric P2X7R modulator, (b the bactericidal peptide LL-37, (c the amyloidogenic β peptide, and (d serum amyloid A. Some agents, such as Alu-RNA, have been suggested to activate the P2X7R acting on the intracellular N- or C-terminal domains. Mode of P2X7R activation by these non-nucleotide ligands is as yet unknown; however, these observations raise the intriguing question of how these different non-nucleotide ligands may co-operate with ATP at inflammatory or tumor sites. New information obtained from the cloning and characterization of the P2X7R from exotic mammalian species (e.g., giant panda and data from recent patch-clamp studies are strongly accelerating our understanding of P2X7R mode of operation, and may provide hints to the mechanism of activation of P2X7R by non-nucleotide ligands.

  8. Non-thiolate ligation of nickel by nucleotide-free UreG of Klebsiella aerogenes

    Energy Technology Data Exchange (ETDEWEB)

    Martin-Diaconescu, Vlad; Joseph, Crisjoe A.; Boer, Jodi L.; Mulrooney, Scott B.; Hausinger, Robert P.; Maroney, Michael J.

    2016-12-21

    Nickel-dependent ureases are activated by a multiprotein complex that includes the GTPase UreG. Prior studies showed that nucleotide-free UreG from Klebsiella aerogenes is monomeric and binds one nickel or zinc ion with near-equivalent affinity using an undefined binding site, whereas nucleotide-free UreG from Helicobacter pylori selectively binds one zinc ion per dimer via a universally conserved Cys-Pro-His motif in each protomer. Iodoacetamide-treated K. aerogenes UreG was nearly unaffected in nickel binding compared to non-treated sample, suggesting the absence of thiolate ligands to the metal. X-ray absorption spectroscopy of nickel-bound UreG showed the metal possessed four-coordinate geometry with all O/N donor ligands including one imidazole, thus confirming the absence of thiolate ligation. The nickel site in Strep-tag II-modified protein possessed six-coordinate geometry, again with all O/N donor ligands, but now including two or three imidazoles. An identical site was noted for the Strep-tag II-modified H74A variant, substituted in the Cys-Pro-His motif, ruling out coordination by this His residue. These results are consistent with metal binding to both His6 and a His residue of the fusion peptide in Strep-tagged K. aerogenes UreG. We conclude that the nickel- and zinc-binding site in nucleotide-free K. aerogenes UreG is distinct from that of nucleotide-free H. pylori UreG and does not involve the Cys-Pro-His motif. Further, we show the Strep-tag II can perturb metal coordination of this protein.

  9. Calcium-dependent, cyclic nucleotide-independent steroidogenesis in the bovine placenta.

    OpenAIRE

    Shemesh, M; Hansel, W; Strauss, J F

    1984-01-01

    Dispersed bovine placental cells (fetal cotyledon and maternal caruncle) were shown to synthesize progesterone. To determine if their steroidogenic activity could be modulated by a cyclic nucleotide-mediated process, we added luteinizing hormone, 8-bromoadenosine 3',5'-monophosphate, 8-bromoguanosine 3',5'-monophosphate, adenosine, or cholera toxin to dispersed cells from placentomes of 100-283 days gestational age and examined progesterone synthesis during 3-to 16-hr incubation periods. Net ...

  10. Robust embryo identification using first polar body single nucleotide polymorphism microarray-based DNA fingerprinting.

    Science.gov (United States)

    Treff, Nathan R; Su, Jing; Kasabwala, Natasha; Tao, Xin; Miller, Kathleen A; Scott, Richard T

    2010-05-01

    This study sought to validate a novel, minimally invasive system for embryo tracking by single nucleotide polymorphism microarray-based DNA fingerprinting of the first polar body. First polar body-based assignments of which embryos implanted and were delivered after multiple ET were 100% consistent with previously validated embryo DNA fingerprinting-based assignments. Copyright 2010 American Society for Reproductive Medicine. Published by Elsevier Inc. All rights reserved.

  11. Prolinol-based nucleoside phosphonic acids: new isosteric conformationally flexible nucleotide analogues

    Czech Academy of Sciences Publication Activity Database

    Vaněk, Václav; Buděšínský, Miloš; Rinnová, Markéta; Rosenberg, Ivan

    2009-01-01

    Roč. 65, č. 4 (2009), s. 862-876 ISSN 0040-4020 R&D Projects: GA ČR GA203/05/0827; GA MŠk(CZ) LC06077; GA MŠk LC512; GA MŠk(CZ) LC06061 Institutional research plan: CEZ:AV0Z40550506 Keywords : nucleotide analogues * phosphonates * prolinol derivatives * N- alkylation Subject RIV: CC - Organic Chemistry Impact factor: 3.219, year: 2009

  12. Adenine and guanine nucleotide metabolism during platelet storage at 22 degree C

    International Nuclear Information System (INIS)

    Edenbrandt, C.M.; Murphy, S.

    1990-01-01

    Adenine and guanine nucleotide metabolism of platelet concentrates (PCs) was studied during storage for transfusion at 22 +/- 2 degrees C over a 7-day period using high-pressure liquid chromatography. There was a steady decrease in platelet adenosine triphosphate (ATP) and adenosine diphosphate (ADP), which was balanced quantitatively by an increase in plasma hypoxanthine. As expected, ammonia accumulated along with hypoxanthine but at a far greater rate. A fall in platelet guanosine triphosphate (GTP) and guanosine diphosphate (GDP) paralleled the fall in ATP + ADP. When adenine was present in the primary anticoagulant, it was carried over into the PC and metabolized. ATP, GTP, total adenine nucleotides, and total guanine nucleotides declined more slowly in the presence of adenine than in its absence. With adenine, the increase in hypoxanthine concentration was more rapid and quantitatively balanced the decrease in adenine and platelet ATP + ADP. Plasma xanthine rose during storage but at a rate that exceeded the decline in GTP + GDP. When platelet ATP + ADP was labeled with 14C-adenine at the initiation of storage, half of the radioactivity was transferred to hypoxanthine (45%) and GTP + GDP + xanthine (5%) by the time storage was completed. The isotopic data were consistent with the presence of a radioactive (metabolic) and a nonradioactive (storage) pool of ATP + ADP at the initiation of storage with each pool contributing approximately equally to the decline in ATP + ADP during storage. The results suggested a continuing synthesis of GTP + GDP from ATP + ADP, explaining the slower rate of fall of GTP + GDP relative to the rate of rise of plasma xanthine. Throughout storage, platelets were able to incorporate 14C-hypoxanthine into both adenine and guanine nucleotides but at a rate that was only one fourth the rate of hypoxanthine accumulation

  13. Nucleotide sequence analysis of regions of adenovirus 5 DNA containing the origins of DNA replication

    International Nuclear Information System (INIS)

    Steenbergh, P.H.

    1979-01-01

    The purpose of the investigations described is the determination of nucleotide sequences at the molecular ends of the linear adenovirus type 5 DNA. Knowledge of the primary structure at the termini of this DNA molecule is of particular interest in the study of the mechanism of replication of adenovirus DNA. The initiation- and termination sites of adenovirus DNA replication are located at the ends of the DNA molecule. (Auth.)

  14. Protected DNA strand displacement for enhanced single nucleotide discrimination in double-stranded DNA

    OpenAIRE

    Khodakov, Dmitriy A.; Khodakova, Anastasia S.; Huang, David M.; Linacre, Adrian; Ellis, Amanda V.

    2015-01-01

    Single nucleotide polymorphisms (SNPs) are a prime source of genetic diversity. Discriminating between different SNPs provides an enormous leap towards the better understanding of the uniqueness of biological systems. Here we report on a new approach for SNP discrimination using toehold-mediated DNA strand displacement. The distinctiveness of the approach is based on the combination of both 3- and 4-way branch migration mechanisms, which allows for reliable discrimination of SNPs within doubl...

  15. Mesenchymal stem cells from different murine tissues have differential capacity to metabolize extracellular nucleotides.

    Science.gov (United States)

    Iser, Isabele C; Bracco, Paula A; Gonçalves, Carlos E I; Zanin, Rafael F; Nardi, Nance B; Lenz, Guido; Battastini, Ana Maria O; Wink, Márcia R

    2014-10-01

    Mesenchymal stem cells (MSCs) have shown a great potential for cell-based therapy and many different therapeutic purposes. Despite the recent advances in the knowledge of MSCs biology, their biochemical and molecular properties are still poorly defined. Ecto-nucleoside triphosphate diphosphohydrolases (E-NTPDases) and ecto-5'-nucleotidase (eNT/CD73) are widely expressed enzymes that hydrolyze extracellular nucleotides, generating an important cellular signaling cascade. Currently, studies have evidenced the relationship between the purinergic system and the development, maintenance, and differentiation of stem cells. The objective of this study is to identify the NTPDases and eNT/CD73 and compare the levels of nucleotide hydrolysis on MSCs isolated from different murine tissues (bone marrow, lung, vena cava, kidney, pancreas, spleen, skin, and adipose tissue). MSCs from all tissues investigated expressed the ectoenzymes at different levels. In MSCs from pancreas and adipose tissue, the hydrolysis of triphosphonucleosides was significantly higher when compared to the other cells. The diphosphonucleosides were hydrolyzed at a higher rate by MSC from pancreas when compared to MSC from other tissues. The differential nucleotide hydrolysis activity and enzyme expression in these cells suggests that MSCs play different roles in regulating the purinergic system in these tissues. Overall MSCs are an attractive adult-derived cell population for therapies, however, the fact that ecto-nucleotide metabolism can affect the microenvironment, modulating important events, such as immune response, makes the assessment of this metabolism an important part of the characterization of MSCs to be applied therapeutically. © 2014 Wiley Periodicals, Inc.

  16. Nucleotide sequence, transcript mapping, and regulation of the RAD2 gene of Saccharomyces cerevisiae

    International Nuclear Information System (INIS)

    Madura, K.; Prakash, S.

    1986-01-01

    The authors determined the nucleotide sequence, mapped the 5' and 3' nRNA termini, and examined the regulation of the RAD2 gene of Saccharomyces cerevisiae. A long open reading frame within the RAD2 transcribed region encodes a protein of 1031 amino acids with a calculated molecular weight of 117,847. A disruption of the RAD2 gene that deletes the 78 carboxyl terminal codons results in loss of RAD2 function. The 5' ends of RAD2 mRNA show considerable heterogeneity, mapping 5 to 62 nucleotides upstream of the first ATG codon of the long RAD2 open reading frame. The longest RAD2 transcripts also contain a short open reading frame of 37 codons that precedes and overlaps the 5' end of the long RAD2 open reading frame. The RAD2 3' nRNA end maps 171 nucleotides downstream of the TAA termination codon and 20 nucleotides downstream from a 12-base-pair inverted repeat that might function in transcript termination. Northern blot analysis showed a ninefold increase in steady-state levels of RAD2 mRNA after treatment of yeast cells with UV light. The 5' flanking region of the RAD2 gene contains several direct and inverted repeats and a 44-nuclotide-long purine-rich tract. The sequence T G G A G G C A T T A A found at position - 167 to -156 in the RAD2 gene is similar to at sequence present in the 5' flanking regions of the RAD7 and RAD10 genes

  17. Roles of phosphorylation and nucleotide binding domains in calcium transport by sarcoplasmic reticulum adenosinetriphosphatase

    International Nuclear Information System (INIS)

    Teruel, J.A.; Inesi, G.

    1988-01-01

    The roles of the phosphorylation (phosphorylated enzyme intermediate) and nucleotide binding domains in calcium transport were studied by comparing acetyl phosphate and ATP as substrates for the Ca 2+ -ATPase of sarcoplasmic reticulum vesicles. The authors found that the maximal level of phosphoenzyme obtained with either substrate is approximately 4 nmol/mg of protein, corresponding to the stoichiometry of catalytic sites in their preparation. The initial burst of phosphoenzyme formation observed in the transient state, following addition of either substrate, is accompanied by internalization of 2 mol of calcium per mole of phosphoenzyme. The internalized calcium is then translocated with a sequential pattern, independent of the substrate used. Following a rate-limiting step, the phosphoenzyme undergoes hydrolytic cleavage and proceeds to the steady-state activity which is soon back inhibited by the rise of Ca 2+ concentration in the lumen of the vesicles. When the back inhibition is released by the addition of oxalate, substrate utilization and calcium transport occur with a ratio of 1:2, independent of the substrate and its concentration. When the nucleotide binding site is derivatized with FITP, the enzyme can still utilize acetyl phosphate (but not ATP) for calcium transport. These observations demonstrate that the basic coupling mechanism of catalysis and calcium transport involves the phosphorylation and calcium binding domains, and not the nucleotide binding domain. On the other hand, occupancy of the FITC-sensitive nucleotide site is involved in kinetic regulation not only with respect to utilization of substrate for the phosphoryl transfer reaction but also for subsequent steps related to calcium translocation and phosphoenzyme turnover

  18. A single nucleotide change affects fur-dependent regulation of sodB in H. pylori.

    Directory of Open Access Journals (Sweden)

    Beth M Carpenter

    Full Text Available Helicobacter pylori is a significant human pathogen that has adapted to survive the many stresses found within the gastric environment. Superoxide Dismutase (SodB is an important factor that helps H. pylori combat oxidative stress. sodB was previously shown to be repressed by the Ferric Uptake Regulator (Fur in the absence of iron (apo-Fur regulation [1]. Herein, we show that apo regulation is not fully conserved among all strains of H. pylori. apo-Fur dependent changes in sodB expression are not observed under iron deplete conditions in H. pylori strains G27, HPAG1, or J99. However, Fur regulation of pfr and amiE occurs as expected. Comparative analysis of the Fur coding sequence between G27 and 26695 revealed a single amino acid difference, which was not responsible for the altered sodB regulation. Comparison of the sodB promoters from G27 and 26695 also revealed a single nucleotide difference within the predicted Fur binding site. Alteration of this nucleotide in G27 to that of 26695 restored apo-Fur dependent sodB regulation, indicating that a single base difference is at least partially responsible for the difference in sodB regulation observed among these H. pylori strains. Fur binding studies revealed that alteration of this single nucleotide in G27 increased the affinity of Fur for the sodB promoter. Additionally, the single base change in G27 enabled the sodB promoter to bind to apo-Fur with affinities similar to the 26695 sodB promoter. Taken together these data indicate that this nucleotide residue is important for direct apo-Fur binding to the sodB promoter.

  19. Single nucleotide resolution RNA-seq uncovers new regulatory mechanisms in the opportunistic pathogen Streptococcus agalactiae.

    Science.gov (United States)

    Rosinski-Chupin, Isabelle; Sauvage, Elisabeth; Sismeiro, Odile; Villain, Adrien; Da Cunha, Violette; Caliot, Marie-Elise; Dillies, Marie-Agnès; Trieu-Cuot, Patrick; Bouloc, Philippe; Lartigue, Marie-Frédérique; Glaser, Philippe

    2015-05-30

    Streptococcus agalactiae, or Group B Streptococcus, is a leading cause of neonatal infections and an increasing cause of infections in adults with underlying diseases. In an effort to reconstruct the transcriptional networks involved in S. agalactiae physiology and pathogenesis, we performed an extensive and robust characterization of its transcriptome through a combination of differential RNA-sequencing in eight different growth conditions or genetic backgrounds and strand-specific RNA-sequencing. Our study identified 1,210 transcription start sites (TSSs) and 655 transcript ends as well as 39 riboswitches and cis-regulatory regions, 39 cis-antisense non-coding RNAs and 47 small RNAs potentially acting in trans. Among these putative regulatory RNAs, ten were differentially expressed in response to an acid stress and two riboswitches sensed directly or indirectly the pH modification. Strikingly, 15% of the TSSs identified were associated with the incorporation of pseudo-templated nucleotides, showing that reiterative transcription is a pervasive process in S. agalactiae. In particular, 40% of the TSSs upstream genes involved in nucleotide metabolism show reiterative transcription potentially regulating gene expression, as exemplified for pyrG and thyA encoding the CTP synthase and the thymidylate synthase respectively. This comprehensive map of the transcriptome at the single nucleotide resolution led to the discovery of new regulatory mechanisms in S. agalactiae. It also provides the basis for in depth analyses of transcriptional networks in S. agalactiae and of the regulatory role of reiterative transcription following variations of intra-cellular nucleotide pools.

  20. Single nucleotide polymorphism in Egyptian cattle insulin-like growth factor binding protein-3 gene

    Directory of Open Access Journals (Sweden)

    Othman E. Othman

    2014-12-01

    It is concluded that the IGFBP-3/HaeIII polymorphism may be utilized as a good marker for genetic differentiation between cattle animals for different body functions such as growth, metabolism, reproduction, immunity and energy balance. The nucleotide sequences of Egyptian cattle IGFBP-3 A and C alleles were submitted to GenBank with the accession numbers KF899893 and KF899894, respectively.

  1. Nucleotide homeostasis and purinergic nociceptive signaling in rat meninges in migraine-like conditions.

    Science.gov (United States)

    Yegutkin, Gennady G; Guerrero-Toro, Cindy; Kilinc, Erkan; Koroleva, Kseniya; Ishchenko, Yevheniia; Abushik, Polina; Giniatullina, Raisa; Fayuk, Dmitriy; Giniatullin, Rashid

    2016-09-01

    Extracellular ATP is suspected to contribute to migraine pain but regulatory mechanisms controlling pro-nociceptive purinergic mechanisms in the meninges remain unknown. We studied the peculiarities of metabolic and signaling pathways of ATP and its downstream metabolites in rat meninges and in cultured trigeminal cells exposed to the migraine mediator calcitonin gene-related peptide (CGRP). Under resting conditions, meningeal ATP and ADP remained at low nanomolar levels, whereas extracellular AMP and adenosine concentrations were one-two orders higher. CGRP increased ATP and ADP levels in meninges and trigeminal cultures and reduced adenosine concentration in trigeminal cells. Degradation rates for exogenous nucleotides remained similar in control and CGRP-treated meninges, indicating that CGRP triggers nucleotide release without affecting nucleotide-inactivating pathways. Lead nitrate-based enzyme histochemistry of whole mount meninges revealed the presence of high ATPase, ADPase, and AMPase activities, primarily localized in the medial meningeal artery. ATP and ADP induced large intracellular Ca(2+) transients both in neurons and in glial cells whereas AMP and adenosine were ineffective. In trigeminal glia, ATP partially operated via P2X7 receptors. ATP, but not other nucleotides, activated nociceptive spikes in meningeal trigeminal nerve fibers providing a rationale for high degradation rate of pro-nociceptive ATP. Pro-nociceptive effect of ATP in meningeal nerves was reproduced by α,β-meATP operating via P2X3 receptors. Collectively, extracellular ATP, which level is controlled by CGRP, can persistently activate trigeminal nerves in meninges which considered as the origin site of migraine headache. These data are consistent with the purinergic hypothesis of migraine pain and suggest new targets against trigeminal pain.

  2. Host-Specific and Segment-Specific Evolutionary Dynamics of Avian and Human Influenza A Viruses: A Systematic Review

    KAUST Repository

    Kim, Kiyeon

    2016-01-13

    Understanding the evolutionary dynamics of influenza viruses is essential to control both avian and human influenza. Here, we analyze host-specific and segment-specific Tajima’s D trends of influenza A virus through a systematic review using viral sequences registered in the National Center for Biotechnology Information. To avoid bias from viral population subdivision, viral sequences were stratified according to their sampling locations and sampling years. As a result, we obtained a total of 580 datasets each of which consists of nucleotide sequences of influenza A viruses isolated from a single population of hosts at a single sampling site within a single year. By analyzing nucleotide sequences in the datasets, we found that Tajima’s D values of viral sequences were different depending on hosts and gene segments. Tajima’s D values of viruses isolated from chicken and human samples showed negative, suggesting purifying selection or a rapid population growth of the viruses. The negative Tajima’s D values in rapidly growing viral population were also observed in computer simulations. Tajima’s D values of PB2, PB1, PA, NP, and M genes of the viruses circulating in wild mallards were close to zero, suggesting that these genes have undergone neutral selection in constant-sized population. On the other hand, Tajima’s D values of HA and NA genes of these viruses were positive, indicating HA and NA have undergone balancing selection in wild mallards. Taken together, these results indicated the existence of unknown factors that maintain viral subtypes in wild mallards.

  3. Host-Specific and Segment-Specific Evolutionary Dynamics of Avian and Human Influenza A Viruses: A Systematic Review

    KAUST Repository

    Kim, Kiyeon; Omori, Ryosuke; Ueno, Keisuke; Iida, Sayaka; Ito, Kimihito

    2016-01-01

    Understanding the evolutionary dynamics of influenza viruses is essential to control both avian and human influenza. Here, we analyze host-specific and segment-specific Tajima’s D trends of influenza A virus through a systematic review using viral sequences registered in the National Center for Biotechnology Information. To avoid bias from viral population subdivision, viral sequences were stratified according to their sampling locations and sampling years. As a result, we obtained a total of 580 datasets each of which consists of nucleotide sequences of influenza A viruses isolated from a single population of hosts at a single sampling site within a single year. By analyzing nucleotide sequences in the datasets, we found that Tajima’s D values of viral sequences were different depending on hosts and gene segments. Tajima’s D values of viruses isolated from chicken and human samples showed negative, suggesting purifying selection or a rapid population growth of the viruses. The negative Tajima’s D values in rapidly growing viral population were also observed in computer simulations. Tajima’s D values of PB2, PB1, PA, NP, and M genes of the viruses circulating in wild mallards were close to zero, suggesting that these genes have undergone neutral selection in constant-sized population. On the other hand, Tajima’s D values of HA and NA genes of these viruses were positive, indicating HA and NA have undergone balancing selection in wild mallards. Taken together, these results indicated the existence of unknown factors that maintain viral subtypes in wild mallards.

  4. Star Formation Quenching in Quasar Host Galaxies

    Energy Technology Data Exchange (ETDEWEB)

    Carniani, Stefano, E-mail: sc888@mrao.cam.ac.uk [Cavendish Laboratory, University of Cambridge, Cambridge (United Kingdom); Kavli Institute for Cosmology, University of Cambridge, Cambridge (United Kingdom)

    2017-10-16

    Galaxy evolution is likely to be shaped by negative feedback from active galactic nuclei (AGN). In the whole range of redshifts and luminosities studied so far, galaxies hosting an AGN frequently show fast and extended outflows consisting in both ionized and molecular gas. Such outflows could potentially quench the start formation within the host galaxy, but a clear evidence of negative feedback in action is still missing. Hereby I will analyse integral-field spectroscopic data for six quasars at z ~ 2.4 obtained with SINFONI in the H- and K-band. All the quasars show [Oiii]λ5007 line detection of fast, extended outflows. Also, the high signal-to-noise SINFONI observations allow the identification of faint narrow Hα emission (FWHM < 500 km/s), which is spatially extended and associated with star formation in the host galaxy. On paper fast outflows are spatially anti-correlated with star-formation powered emission, i.e., star formation is suppressed in the area affected by the outflow. Nonetheless as narrow, spatially-extended Hα emission, indicating star formation rates of at least 50–100 M{sub ⊙} yr{sup −1}, has been detected, either AGN feedback is not affecting the whole host galaxy, or star formation is completely quenched only by several feedback episodes. On the other hand, a positive feedback scenario, supported by narrow emission in Hα extending along the edges of the outflow cone, suggests that galaxy-wide outflows could also have a twofold role in the evolution of the host galaxy. Finally, I will present CO(3-2) ALMA data for three out of the six QSOs observed with SINFONI. Flux maps obtained for the CO(3-2) transition suggest that molecular gas within the host galaxy is swept away by fast winds. A negative-feedback scenario is supported by the inferred molecular gas mass in all three objects, which is significantly below what observed in non-active main-sequence galaxies at high-z.

  5. Star Formation Quenching in Quasar Host Galaxies

    Directory of Open Access Journals (Sweden)

    Stefano Carniani

    2017-10-01

    Full Text Available Galaxy evolution is likely to be shaped by negative feedback from active galactic nuclei (AGN. In the whole range of redshifts and luminosities studied so far, galaxies hosting an AGN frequently show fast and extended outflows consisting in both ionized and molecular gas. Such outflows could potentially quench the start formation within the host galaxy, but a clear evidence of negative feedback in action is still missing. Hereby I will analyse integral-field spectroscopic data for six quasars at z ~ 2.4 obtained with SINFONI in the H- and K-band. All the quasars show [Oiii]λ5007 line detection of fast, extended outflows. Also, the high signal-to-noise SINFONI observations allow the identification of faint narrow Hα emission (FWHM < 500 km/s, which is spatially extended and associated with star formation in the host galaxy. On paper fast outflows are spatially anti-correlated with star-formation powered emission, i.e., star formation is suppressed in the area affected by the outflow. Nonetheless as narrow, spatially-extended Hα emission, indicating star formation rates of at least 50–100 M⊙ yr−1, has been detected, either AGN feedback is not affecting the whole host galaxy, or star formation is completely quenched only by several feedback episodes. On the other hand, a positive feedback scenario, supported by narrow emission in Hα extending along the edges of the outflow cone, suggests that galaxy-wide outflows could also have a twofold role in the evolution of the host galaxy. Finally, I will present CO(3-2 ALMA data for three out of the six QSOs observed with SINFONI. Flux maps obtained for the CO(3-2 transition suggest that molecular gas within the host galaxy is swept away by fast winds. A negative-feedback scenario is supported by the inferred molecular gas mass in all three objects, which is significantly below what observed in non-active main-sequence galaxies at high-z.

  6. Star Formation Quenching in Quasar Host Galaxies

    International Nuclear Information System (INIS)

    Carniani, Stefano

    2017-01-01

    Galaxy evolution is likely to be shaped by negative feedback from active galactic nuclei (AGN). In the whole range of redshifts and luminosities studied so far, galaxies hosting an AGN frequently show fast and extended outflows consisting in both ionized and molecular gas. Such outflows could potentially quench the start formation within the host galaxy, but a clear evidence of negative feedback in action is still missing. Hereby I will analyse integral-field spectroscopic data for six quasars at z ~ 2.4 obtained with SINFONI in the H- and K-band. All the quasars show [Oiii]λ5007 line detection of fast, extended outflows. Also, the high signal-to-noise SINFONI observations allow the identification of faint narrow Hα emission (FWHM < 500 km/s), which is spatially extended and associated with star formation in the host galaxy. On paper fast outflows are spatially anti-correlated with star-formation powered emission, i.e., star formation is suppressed in the area affected by the outflow. Nonetheless as narrow, spatially-extended Hα emission, indicating star formation rates of at least 50–100 M ⊙ yr −1 , has been detected, either AGN feedback is not affecting the whole host galaxy, or star formation is completely quenched only by several feedback episodes. On the other hand, a positive feedback scenario, supported by narrow emission in Hα extending along the edges of the outflow cone, suggests that galaxy-wide outflows could also have a twofold role in the evolution of the host galaxy. Finally, I will present CO(3-2) ALMA data for three out of the six QSOs observed with SINFONI. Flux maps obtained for the CO(3-2) transition suggest that molecular gas within the host galaxy is swept away by fast winds. A negative-feedback scenario is supported by the inferred molecular gas mass in all three objects, which is significantly below what observed in non-active main-sequence galaxies at high-z.

  7. Fluorinated Nucleotide Modifications Modulate Allele Selectivity of SNP-Targeting Antisense Oligonucleotides

    Directory of Open Access Journals (Sweden)

    Michael E. Østergaard

    2017-06-01

    Full Text Available Antisense oligonucleotides (ASOs have the potential to discriminate between subtle RNA mismatches such as SNPs. Certain mismatches, however, allow ASOs to bind at physiological conditions and result in RNA cleavage mediated by RNase H. We showed that replacing DNA nucleotides in the gap region of an ASO with other chemical modification can improve allele selectivity. Herein, we systematically substitute every position in the gap region of an ASO targeting huntingtin gene (HTT with fluorinated nucleotides. Potency is determined in cell culture against mutant HTT (mtHTT and wild-type HTT (wtHTT mRNA and RNase H cleavage intensities, and patterns are investigated. This study profiled five different fluorinated nucleotides and showed them to have predictable, site-specific effects on RNase H cleavage, and the cleavage patterns were rationalized from a published X-ray structure of human RNase H1. The results herein can be used as a guide for future projects where ASO discrimination of SNPs is important.

  8. Porous silicon surfaces for metabonomics: Detection and identification of nucleotides without matrix interference

    Energy Technology Data Exchange (ETDEWEB)

    Gomez, D.; Azcarate, Sabino [Dpto. de Micro y Nanotecnologias, Fundacion Tekniker, Av. Otaola 20, 20600 Eibar (Spain); Fernandez, Jose A.; Astigarraga, Egoitz [Dpto. de Quimica Fisica, Universidad del Pais Vasco, Campus de Lejona, Lejona (Spain); Marcaide, Arrate [Dpto. de Procesos de Fabricacion, Fundacion Tekniker, Av. Otaola 20, 20600 Eibar (Spain)

    2007-07-01

    In present work, porous silicon surfaces (PSS) have been developed for time of flight mass spectrometric experiments (TOF-MS) in the monitoring of nucleotides, commonly found as metabolites in the cell. The mass range of the studied molecules ({proportional_to} 400 amu) is common to several important messengers and other metabolites. Different porosified surfaces have been developed by means of electrochemical etching and different degree of porosity and pore size achieved as function of silicon dopant concentration, silicon resistivity, current density and the presence or absence of illumination along the process. As main conclusion, it can be said that an interesting commercial nucleotide (Cyclic adenosine monophosphate, c-AMP) has been detected on low concentrations ({proportional_to}hundreds of femtomols) for some of the fabricated porous surfaces. Taking into account that these concentrations are similar to the ones found in real samples, this result opens the possibility to the fabrication of DIOS (Desorption Ionization On Silicon) chips for the detection of nucleotides in biological fluids. (copyright 2007 WILEY-VCH Verlag GmbH and Co. KGaA, Weinheim) (orig.)

  9. Nucleotide Pool Depletion Induces G-Quadruplex-Dependent Perturbation of Gene Expression

    Directory of Open Access Journals (Sweden)

    Charikleia Papadopoulou

    2015-12-01

    Full Text Available Nucleotide pool imbalance has been proposed to drive genetic instability in cancer. Here, we show that slowing replication forks by depleting nucleotide pools with hydroxyurea (HU can also give rise to both transient and permanent epigenetic instability of a reporter locus, BU-1, in DT40 cells. HU induces stochastic formation of Bu-1low variants in dividing cells, which have lost the H3K4me3 present in untreated cells. This instability is potentiated by an intragenic G quadruplex, which also promotes local H2Ax phosphorylation and transient heterochromatinization. Genome-wide, gene expression changes induced by HU significantly overlap with those resulting from loss of the G4-helicases FANCJ, WRN, and BLM. Thus, the effects of global replication stress induced by nucleotide pool depletion can be focused by local replication impediments caused by G quadruplex formation to induce epigenetic instability and changes in gene expression, a mechanism that may contribute to selectable transcriptional changes in cancer.

  10. Nucleotide polymorphisms and haplotype diversity of RTCS gene in China elite maize inbred lines.

    Directory of Open Access Journals (Sweden)

    Enying Zhang

    Full Text Available The maize RTCS gene, encoding a LOB domain transcription factor, plays important roles in the initiation of embryonic seminal and postembryonic shoot-borne root. In this study, the genomic sequences of this gene in 73 China elite inbred lines, including 63 lines from 5 temperate heteroric groups and 10 tropic germplasms, were obtained, and the nucleotide polymorphisms and haplotype diversity were detected. A total of 63 sequence variants, including 44 SNPs and 19 indels, were identified at this locus, and most of them were found to be located in the regions of UTR and intron. The coding region of this gene in all tested inbred lines carried 14 haplotypes, which encoding 7 deferring RTCS proteins. Analysis of the polymorphism sites revealed that at least 6 recombination events have occurred. Among all 6 groups tested, only the P heterotic group had a much lower nucleotide diversity than the whole set, and selection analysis also revealed that only this group was under strong negative selection. However, the set of Huangzaosi and its derived lines possessed a higher nucleotide diversity than the whole set, and no selection signal were identified.

  11. Junctional transfer in cultured vascular endothelium: II. Dye and nucleotide transfer

    International Nuclear Information System (INIS)

    Larson, D.M.; Sheridan, J.D.

    1985-01-01

    Vascular endothelial cultures, derived from large vessels, retain many of the characteristics of their in vivo counterparts. However, the observed reduction in size and complexity of intercellular gap and tight junctions in these cultured cells suggests that important functions, thought to be mediated by these structures, may be altered in vitro. In continuing studies on intercellular communication in vessel wall cells, the authors have quantitated the extent of junctional transfer of small molecular tracers (the fluorescent dye Lucifer Yellow CH and tritiated uridine nucleotides) in confluent cultures of calf aortic (BAEC) and umbilical vein (BVEC) endothelium. Both BAEC and BVEC show extensive (and quantitatively equivalent) dye and nucleotide transfer. As an analogue of intimal endothelium, the authors have also tested dye transfer in freshly isolated sheets of endothelium. Transfer in BAEC and BVEC sheets was more rapid, extensive and homogeneous than in the cultured cells, implying a reduction in molecular coupling as endothelium adapts to culture conditions. In addition, they have documented heterocellular nucleotide transfer between cultured endothelium and vascular smooth muscle cells, of particular interest considering the prevalence of ''myo-endothelial'' junctions in vivo. These data yield further information on junctional transfer in cultured vascular endothelium and have broad implications for the functional integration of the vessel wall in the physiology and pathophysiology of the vasculature

  12. The low-dose combination preparation Vertigoheel activates cyclic nucleotide pathways and stimulates vasorelaxation.

    Science.gov (United States)

    Heinle, H; Tober, C; Zhang, D; Jäggi, R; Kuebler, W M

    2010-01-01

    Vertigo of various and often unknown aetiologies has been associated with and attributed to impaired microvascular perfusion in the inner ear or the vertebrobasilar system. Vertigoheel is a low-dose combination preparation of proven value in the symptomatic treatment of vertigo. In the present study we tested the hypothesis that Vertigoheel's anti-vertiginous properties may in part be due to a vasodilatory effect exerted via stimulation of the adenylate and/or guanylate cyclase pathways. Thus, the influence of Vertigoheel or its single constituents on synthesis and degradation of cyclic nucleotides was measured. Furthermore, vessel myography was used to observe the effect of Vertigoheel on the vasoreactivity of rat carotid arteries. Vertigoheel and one of its constituents, Anamirta cocculus, stimulated adenylate cyclase activity, while another constituent, Conium maculatum, inhibited phosphodiesterase 5, suggesting that the individual constituents of Vertigoheel contribute differentially to a synergistic stimulation of cyclic nucleotide signalling pathways. In rat carotid artery rings, Vertigoheel counteracted phenylephrine-induced tonic vasoconstriction. The present data demonstrate a vasorelaxant effect of Vertigoheel that goes along with a synergistic stimulation of cyclic nucleotide pathways and may provide a mechanistic basis for the documented anti-vertiginous effects of this combination preparation.

  13. Ethanol-induced activation of adenine nucleotide turnover. Evidence for a role of acetate

    International Nuclear Information System (INIS)

    Puig, J.G.; Fox, I.H.

    1984-01-01

    Consumption of alcohol causes hyperuricemia by decreasing urate excretion and increasing its production. Our previous studies indicate that ethanol administration increases uric acid production by increasing ATP degradation to uric acid precursors. To test the hypothesis that ethanol-induced increased urate production results from acetate metabolism and enhanced adenosine triphosphate turnover, we gave intravenous sodium acetate, sodium chloride and ethanol (0.1 mmol/kg per min for 1 h) to five normal subjects. Acetate plasma levels increased from 0.04 +/- 0.01 mM (mean +/- SE) to peak values of 0.35 +/- 0.07 mM and to 0.08 +/- 0.01 mM during acetate and ethanol infusions, respectively. Urinary oxypurines increased to 223 +/- 13% and 316 +/- 44% of the base-line values during acetate and ethanol infusions, respectively. Urinary radioactivity from the adenine nucleotide pool labeled with [8-14C] adenine increased to 171 +/- 27% and to 128 +/- 8% of the base-line values after acetate and ethanol infusions. These data indicate that both ethanol and acetate increase purine nucleotide degradation by enhancing the turnover of the adenine nucleotide pool. They support the hypothesis that acetate metabolism contributes to the increased production of urate associated with ethanol intake

  14. An Engineered Kinetic Amplification Mechanism for Single Nucleotide Variant Discrimination by DNA Hybridization Probes.

    Science.gov (United States)

    Chen, Sherry Xi; Seelig, Georg

    2016-04-20

    Even a single-nucleotide difference between the sequences of two otherwise identical biological nucleic acids can have dramatic functional consequences. Here, we use model-guided reaction pathway engineering to quantitatively improve the performance of selective hybridization probes in recognizing single nucleotide variants (SNVs). Specifically, we build a detection system that combines discrimination by competition with DNA strand displacement-based catalytic amplification. We show, both mathematically and experimentally, that the single nucleotide selectivity of such a system in binding to single-stranded DNA and RNA is quadratically better than discrimination due to competitive hybridization alone. As an additional benefit the integrated circuit inherits the property of amplification and provides at least 10-fold better sensitivity than standard hybridization probes. Moreover, we demonstrate how the detection mechanism can be tuned such that the detection reaction is agnostic to the position of the SNV within the target sequence. in contrast, prior strand displacement-based probes designed for kinetic discrimination are highly sensitive to position effects. We apply our system to reliably discriminate between different members of the let-7 microRNA family that differ in only a single base position. Our results demonstrate the power of systematic reaction network design to quantitatively improve biotechnology.

  15. OrthoANI: An improved algorithm and software for calculating average nucleotide identity.

    Science.gov (United States)

    Lee, Imchang; Ouk Kim, Yeong; Park, Sang-Cheol; Chun, Jongsik

    2016-02-01

    Species demarcation in Bacteria and Archaea is mainly based on overall genome relatedness, which serves a framework for modern microbiology. Current practice for obtaining these measures between two strains is shifting from experimentally determined similarity obtained by DNA-DNA hybridization (DDH) to genome-sequence-based similarity. Average nucleotide identity (ANI) is a simple algorithm that mimics DDH. Like DDH, ANI values between two genome sequences may be different from each other when reciprocal calculations are compared. We compared 63 690 pairs of genome sequences and found that the differences in reciprocal ANI values are significantly high, exceeding 1 % in some cases. To resolve this problem of not being symmetrical, a new algorithm, named OrthoANI, was developed to accommodate the concept of orthology for which both genome sequences were fragmented and only orthologous fragment pairs taken into consideration for calculating nucleotide identities. OrthoANI is highly correlated with ANI (using BLASTn) and the former showed approximately 0.1 % higher values than the latter. In conclusion, OrthoANI provides a more robust and faster means of calculating average nucleotide identity for taxonomic purposes. The standalone software tools are freely available at http://www.ezbiocloud.net/sw/oat.

  16. Endogenous adenosine produced during hypoxia attenuates neutrophil accumulation: coordination by extracellular nucleotide metabolism.

    Science.gov (United States)

    Eltzschig, Holger K; Thompson, Linda F; Karhausen, Jorn; Cotta, Richard J; Ibla, Juan C; Robson, Simon C; Colgan, Sean P

    2004-12-15

    Hypoxia is a well-documented inflammatory stimulus and results in tissue polymorphonuclear leukocyte (PMN) accumulation. Likewise, increased tissue adenosine levels are commonly associated with hypoxia, and given the anti-inflammatory properties of adenosine, we hypothesized that adenosine production via adenine nucleotide metabolism at the vascular surface triggers an endogenous anti-inflammatory response during hypoxia. Initial in vitro studies indicated that endogenously generated adenosine, through activation of PMN adenosine A(2A) and A(2B) receptors, functions as an antiadhesive signal for PMN binding to microvascular endothelia. Intravascular nucleotides released by inflammatory cells undergo phosphohydrolysis via hypoxia-induced CD39 ectoapyrase (CD39 converts adenosine triphosphate/adenosine diphosphate [ATP/ADP] to adenosine monophosphate [AMP]) and CD73 ecto-5'-nucleotidase (CD73 converts AMP to adenosine). Extensions of our in vitro findings using cd39- and cd73-null animals revealed that extracellular adenosine produced through adenine nucleotide metabolism during hypoxia is a potent anti-inflammatory signal for PMNs in vivo. These findings identify CD39 and CD73 as critical control points for endogenous adenosine generation and implicate this pathway as an innate mechanism to attenuate excessive tissue PMN accumulation.

  17. A Cascade of Thermophilic Enzymes As an Approach to the Synthesis of Modified Nucleotides.

    Science.gov (United States)

    Esipov, R S; Abramchik, Yu A; Fateev, I V; Konstantinova, I D; Kostromina, M A; Muravyova, T I; Artemova, K G; Miroshnikov, A I

    2016-01-01

    We propose a new approach for the synthesis of biologically important nucleotides which includes a multi-enzymatic cascade conversion of D -pentoses into purine nucleotides. The approach exploits nucleic acid exchange enzymes from thermophilic microorganisms: ribokinase, phosphoribosylpyrophosphate synthetase, and adenine phosphoribosyltransferase. We cloned the ribokinase gene from Thermus sp . 2.9, as well as two different genes of phosphoribosylpyrophosphate synthetase (PRPP-synthetase) and the adenine phosphoribosyltransferase (APR-transferase) gene from Thermus thermophilus HB27 into the expression vectors, generated high-yield E. coli producer strains, developed methods for the purification of the enzymes, and investigated enzyme substrate specificity. The enzymes were used for the conversion of D -pentoses into 5-phosphates that were further converted into 5-phospho-α- D -pentofuranose 1-pyrophosphates by means of ribokinase and PRPP-synthetases. Target nucleotides were obtained through the condensation of the pyrophosphates with adenine and its derivatives in a reaction catalyzed by APR-transferase. 2-Chloro- and 2-fluoroadenosine monophosphates were synthesized from D -ribose and appropriate heterobases in one pot using a system of thermophilic enzymes in the presence of ATP, ribokinase, PRPP-synthetase, and APR-transferase.

  18. Multilocus analysis of nucleotide variation and speciation in three closely related Populus (Salicaceae) species.

    Science.gov (United States)

    Du, Shuhui; Wang, Zhaoshan; Ingvarsson, Pär K; Wang, Dongsheng; Wang, Junhui; Wu, Zhiqiang; Tembrock, Luke R; Zhang, Jianguo

    2015-10-01

    Historical tectonism and climate oscillations can isolate and contract the geographical distributions of many plant species, and they are even known to trigger species divergence and ultimately speciation. Here, we estimated the nucleotide variation and speciation in three closely related Populus species, Populus tremuloides, P. tremula and P. davidiana, distributed in North America and Eurasia. We analysed the sequence variation in six single-copy nuclear loci and three chloroplast (cpDNA) fragments in 497 individuals sampled from 33 populations of these three species across their geographic distributions. These three Populus species harboured relatively high levels of nucleotide diversity and showed high levels of nucleotide differentiation. Phylogenetic analysis revealed that P. tremuloides diverged earlier than the other two species. The cpDNA haplotype network result clearly illustrated the dispersal route from North America to eastern Asia and then into Europe. Molecular dating results confirmed that the divergence of these three species coincided with the sundering of the Bering land bridge in the late Miocene and a rapid uplift of the Qinghai-Tibetan Plateau around the Miocene/Pliocene boundary. Vicariance-driven successful allopatric speciation resulting from historical tectonism and climate oscillations most likely played roles in the formation of the disjunct distributions and divergence of these three Populus species. © 2015 John Wiley & Sons Ltd.

  19. Approach to analysis of single nucleotide polymorphisms by automated constant denaturant capillary electrophoresis

    International Nuclear Information System (INIS)

    Bjoerheim, Jens; Abrahamsen, Torveig Weum; Kristensen, Annette Torgunrud; Gaudernack, Gustav; Ekstroem, Per O.

    2003-01-01

    Melting gel techniques have proven to be amenable and powerful tools in point mutation and single nucleotide polymorphism (SNP) analysis. With the introduction of commercially available capillary electrophoresis instruments, a partly automated platform for denaturant capillary electrophoresis with potential for routine screening of selected target sequences has been established. The aim of this article is to demonstrate the use of automated constant denaturant capillary electrophoresis (ACDCE) in single nucleotide polymorphism analysis of various target sequences. Optimal analysis conditions for different single nucleotide polymorphisms on ACDCE are evaluated with the Poland algorithm. Laboratory procedures include only PCR and electrophoresis. For direct genotyping of individual SNPs, the samples are analyzed with an internal standard and the alleles are identified by co-migration of sample and standard peaks. In conclusion, SNPs suitable for melting gel analysis based on theoretical thermodynamics were separated by ACDCE under appropriate conditions. With this instrumentation (ABI 310 Genetic Analyzer), 48 samples could be analyzed without any intervention. Several institutions have capillary instrumentation in-house, thus making this SNP analysis method accessible to large groups of researchers without any need for instrument modification

  20. Synthesis and degradation of cyclic nucleotides in brain after a high dose of ionizing radiation

    International Nuclear Information System (INIS)

    Hunt, W.A.; Dalton, T.K.

    1981-01-01

    Previous data from our laboratory have indicated that a high dose of ionizing radiation can deplete the cyclic nucleotides guanosine 3',5'-cyclic monophosphate (cGMP) and adenosine 3',5'-cyclic monophosphate (cAMP) on several areas of the rat brain. cGMP is more sensitive to radiation than cAMP and does not recover for at least 24 h after irradiation. The response of cAMP is transient and recovery occurs within 4 h. The purpose of the present paper is to determine whether alternations in the activity of the synthetic and degradative enzymes that regulate cyclic nucleotide levels could account for the observed effects. Guanylate and adenylate cyclase and cGMP and cAMP phosphodiesterase activities were determined 10 min after irradiation with 10,000 rad of high-energy electrons. No alteration was detected under these experimental conditions. The data suggest that the reduction in cyclic nucleotides is not a direct effect on their metabolic enzymes and is probably secondary to some as yet-undefined action of radiation on the brain