WorldWideScience

Sample records for hops constituent colupulone

  1. Influence of the constituent alpha acids of Ukrainian varieties of hops and hop preparations on quality indicators of mash and beer

    Directory of Open Access Journals (Sweden)

    L. Protsenko

    2015-05-01

    Full Text Available Introduction. The aim of the study is to establish the dependence of the bitterness of mash and the beer intoxication on the quality and quantity of the homologues of alpha acids in the Ukrainian varieties of hops, and on the content of cohumulone in alpha acids in particular. Materials and methods.Aromatic and bitter hop sorts of Ukrainian selection with different content of cohumulone in alpha-acids were investigated and so was the beer, made of these components. High performance liquid chromatography (HPLC was used to determine the amount and composition of bitter hop substances and their transformation products in the brewing process; also there were spectrophotometric methods for quality control of bitterness of hopped mash and finished beer in use. Results and discussion. The composition of bitter substances of aromatic and bitter hop sorts of Ukrainian selection was analyzed and so the beer, made of them. It was noted that the alpha-acids of the analyzed sorts incorporate a wide range of cohumulone content rated from 16.7% in the Kumyr sort to 44,1% in the Ruslan sort. The dependences between the quality and quantity of the bitter hop sorts and bitterness and quality of hopped mash and beer were established. The content of cohumulone in alphaacids of hops has to be less than 28% to obtain quality bitter beer. The role of the beta-acid compoundsin the formation of bitter mash, hopped with aroma hop varieties with a ratio of beta to alpha acids acids around one, is much more important compared to the bitter varieties. Conclusions. The conducted researches show that in applying the bitter hops with different compositon of alphaacids for mash intoxication, this usage is more effective in the sorts that have a large content of cohumulone.

  2. Wheeled hopping robot

    Science.gov (United States)

    Fischer, Gary J [Albuquerque, NM

    2010-08-17

    The present invention provides robotic vehicles having wheeled and hopping mobilities that are capable of traversing (e.g. by hopping over) obstacles that are large in size relative to the robot and, are capable of operation in unpredictable terrain over long range. The present invention further provides combustion powered linear actuators, which can include latching mechanisms to facilitate pressurized fueling of the actuators, as can be used to provide wheeled vehicles with a hopping mobility.

  3. Mechanisms of hop inhibition: hop ionophores.

    Science.gov (United States)

    Behr, Jürgen; Vogel, Rudi F

    2009-07-22

    In this work, the mechanism of hop inhibition toward (beer spoiling) bacteria is revised. The mode of action of iso-alpha-acids was investigated via bilayer lipid membrane (BLM) measurements and growth challenges of hop-sensitive and -resistant Lactobacillus brevis strains in the presence of uncouplers of class I and II or a H(+)/Mn(2+) exchanger. The antibacterial action of iso-alpha-acids as proton ionophores could be confirmed by the BLM measurements; however, the reported ionophore properties, as electroneutral H(+)/Mn(2+) exchangers, could not be verified. Potentiometric measurements indicated the manganese-dependent enhancement of transmembrane charge permeation. The origin of high membrane potentials in the presence of manganese, as well as the strongly elevated membrane conductivity with concomitant increase in effectiveness of an uncoupler, suggest a different origin of charge transfer under these conditions. The mode of antibacterial action of hop ionophores can be described as proton ionophores of class I/II, which are capable transporting protons within a wide range of pH due to their inherent complexity of chemical composition. However, growth challenges in the presence of both types of ionophore classes in combination with the measured unusual high BLM potentials in the presence of manganese and at low pH indicate an additional mechanism of inhibition by hop compounds. The latter may be due to the nature/properties of hop compounds, which are known to be highly reactive substances. As a consequence, hop resistance of bacteria can be described as multiple resistance to a heterogeneous mixture of compounds comprising different known and yet unknown charge transport mechanisms, which were dependent on several factors, for example, compound concentrations, cation composition, and pH value. Thus, only specialists such as some L. brevis strains, which can cope with unusually low intracellular manganese levels, can survive hop stress. Accordingly, cross

  4. Hopping Robot with Wheels

    Science.gov (United States)

    Barlow, Edward; Marzwell, Nevellie; Fuller, Sawyer; Fionni, Paolo; Tretton, Andy; Burdick, Joel; Schell, Steve

    2003-01-01

    A small prototype mobile robot is capable of (1) hopping to move rapidly or avoid obstacles and then (2) moving relatively slowly and precisely on the ground by use of wheels in the manner of previously reported exploratory robots of the "rover" type. This robot is a descendant of a more primitive hopping robot described in "Minimally Actuated Hopping Robot" (NPO- 20911), NASA Tech Briefs, Vol. 26, No. 11 (November 2002), page 50. There are many potential applications for robots with hopping and wheeled-locomotion (roving) capabilities in diverse fields of endeavor, including agriculture, search-and-rescue operations, general military operations, removal or safe detonation of land mines, inspection, law enforcement, and scientific exploration on Earth and remote planets. The combination of hopping and roving enables this robot to move rapidly over very rugged terrain, to overcome obstacles several times its height, and then to position itself precisely next to a desired target. Before a long hop, the robot aims itself in the desired hopping azimuth and at a desired takeoff angle above horizontal. The robot approaches the target through a series of hops and short driving operations utilizing the steering wheels for precise positioning.

  5. Hopping transport in solids

    CERN Document Server

    Pollak, M

    1991-01-01

    The hopping process, which differs substantially from conventional transport processes in crystals, is the central process in the transport phenomena discussed in this book. Throughout the book the term ``hopping'' is defined as the inelastic tunneling transfer of an electron between two localized electronic states centered at different locations. Such processes do not occur in conventional electronic transport in solids, since localized states are not compatible with the translational symmetry of crystals.The rapid growth of interest in hopping transport has followed in the footsteps of the

  6. Characterization of novel varietal floral hop aromas by headspace solid phase microextraction and gas chromatography-mass spectrometry/olfactometry.

    Science.gov (United States)

    Van Opstaele, Filip; De Causmaecker, Brecht; Aerts, Guido; De Cooman, Luc

    2012-12-19

    In this study, headspace solid phase microextraction (HS-SPME) and gas chromatography-mass spectrometry (GC-MS) were optimized and implemented to investigate the volatile composition of novel floral hop essences prepared from four German aroma hop varieties. In total, 91 different constituents were assigned, which were further grouped into monoterpene hydrocarbons, esters, ketones, aldehydes, furans, and oxygenated and nonoxygenated sesquiterpenes. Most volatiles belong to the ester group, whereas the monoterpene hydrocarbon β-myrcene appears to be the predominant compound in all hop oil preparations investigated. Furthermore, as demonstrated by principal component analysis, varietal floral hop essences are clearly discriminated on the basis of their characteristic volatile composition. Via GC-olfactometry on the floral essence variety Spalter Select, β-myrcene and 2-undecanone were identified as the most potent odorants. Several hop oil constituents were reported for the first time as impact odorants of hop aroma.

  7. Hip-Hop Education Resources

    Science.gov (United States)

    Hall, Marcella Runell

    2009-01-01

    Hip-hop music and culture are often cited as being public pedagogy, meaning the music itself has intrinsic educational value. Non-profit organizations and individual educators have graciously taken the lead in utilizing hip-hop to educate. As the academy continues to debate its effectiveness, teachers and community organizers are moving forward.…

  8. Determination of volatile compounds in different hop varieties by headspace-trap GC/MS--in comparison with conventional hop essential oil analysis.

    Science.gov (United States)

    Aberl, Anita; Coelhan, Mehmet

    2012-03-21

    A headspace (HS)-trap method in combination with gas chromatography (GC)-mass spectrometry (MS) was developed for the determination of volatile constituents in hops. The highly sensitive HS-trap system reduces the detection limit by using up to four trap enrichment cycles. Seventy hop samples of different varieties and cultivation regions, from the 2008 harvest, were examined using the HS-trap-GC-MS method and the established "European Brewery Convention" (EBC) method for hop essential oil analysis. Twenty-one different volatiles were quantified for each hop sample. For all compounds, except caryophyllene oxide, a strong correlation was found between the results of the HS-trap method and the EBC method. Experiments have revealed that the EBC method using steam distillation is not appropriate for thermolabile compounds, such as caryophyllene oxide, due to decomposition during boiling. The HS-trap method is fast and sensitive, requires small sample amounts and minimal sample preparation, and is easy to apply.

  9. Hopping in a Molecular Wire

    Directory of Open Access Journals (Sweden)

    R. Marco

    2004-12-01

    Full Text Available We utilize the Hubbard model approach in analyzing the effect of the hopping parameter in the transport properties of a two-atom molecular device (Kostyrko & Bulka, 2003. The system consists of a molecule with two identical atoms connecting two metal electrodes. In this model, two important and realistic energy parameters are considered which affects the transport properties. The first is the kinetic energy required to “hop” from one atomic site to the next. We call this parameter the hopping term denoted by t, in arbitrary units of energy. The next is an on-site Coulombic repulsion, U, between two electrons on the same atomic site.

  10. Hip-Hop and the Academic Canon

    Science.gov (United States)

    Abe, Daudi

    2009-01-01

    Over the last 30 years, the hip-hop movement has risen from the margins to become the preeminent force in US popular culture. In more recent times academics have begun to harness the power of hip-hop culture and use it as a means of infusing transformative knowledge into the mainstream academic discourse. On many college campuses, hip-hop's…

  11. Hip-Hop Pop Art

    Science.gov (United States)

    Talley, Clarence, Sr.

    2011-01-01

    Art has a way of helping students better understand and appreciate the world around them, particularly the things that are most important to them. Hip hop is one of those generational genres that capture the attention of young students like few other things do. Drawing on this genre to get students to create art is an excellent way to demonstrate…

  12. Hopping models and ac universality

    DEFF Research Database (Denmark)

    Dyre, Jeppe; Schrøder, Thomas

    2002-01-01

    Some general relations for hopping models are established. We proceed to discuss the universality of the ac conductivity which arises in the extreme disorder limit of the random barrier model. It is shown that the relevant dimension entering into the diffusion cluster approximation (DCA) is the h......Some general relations for hopping models are established. We proceed to discuss the universality of the ac conductivity which arises in the extreme disorder limit of the random barrier model. It is shown that the relevant dimension entering into the diffusion cluster approximation (DCA......) is the harmonic (fracton) dimension of the diffusion cluster. The temperature scaling of the dimensionless frequency entering into the DCA is discussed. Finally, some open problems regarding ac universality are listed....

  13. Fundamentals of beer and hop chemistry

    OpenAIRE

    De Keukeleire, Denis

    2000-01-01

    Beer brewing is an intricate process encompassing mixing and further elaboration of four essential raw materials, including barley malt, brewing water, hops and yeast. Particularly hops determine to a great extent typical beer qualities such as bitter taste, hoppy flavour, and foam stability. Conversely, hop-derived bitter acids account for an offending lightstruck flavour, which is formed on exposure of beer to light. These various processes are presented in detail, while due emphasis is pla...

  14. Fundamentals of beer and hop chemistry

    Directory of Open Access Journals (Sweden)

    Denis De Keukeleire

    2000-02-01

    Full Text Available Beer brewing is an intricate process encompassing mixing and further elaboration of four essential raw materials, including barley malt, brewing water, hops and yeast. Particularly hops determine to a great extent typical beer qualities such as bitter taste, hoppy flavour, and foam stability. Conversely, hop-derived bitter acids account for an offending lightstruck flavour, which is formed on exposure of beer to light. These various processes are presented in detail, while due emphasis is placed on state-of-the-art hop technology, which provides brewers with efficient means to control bitterness, foam, and light-stability thereby allowing for the production of beers with consistent quality.

  15. Free energy basin-hopping

    Science.gov (United States)

    Sutherland-Cash, K. H.; Wales, D. J.; Chakrabarti, D.

    2015-04-01

    A global optimisation scheme is presented using basin-hopping with the acceptance criterion based on approximate free energy for the corresponding local minima of the potential energy. The method is illustrated for atomic and colloidal clusters and peptides to examine how the predicted global free energy minimum changes with temperature. Using estimates for the local free energies based on harmonic vibrational densities of states provides a computationally effective framework for predicting trends in structure at finite temperature. The resulting scheme represents a powerful tool for exploration of energy landscapes throughout molecular science.

  16. Hip-Hop Guayaquil: culturas viajeras e identidades locales

    Directory of Open Access Journals (Sweden)

    1999-01-01

    Full Text Available HIP-HOP GUAYAQUIL: CULTURES ITINÉRANTES ET IDENTITES LOCALES. Le hip-hop est un style de musique contemporaine caractérisé par une orchestration d’œuvres lyriques rapées, la superposition de morceaux de musique enregistrés dans le passé par différents artistes, et une instrumentation électronique, tout cela sur des rythmes de basse réguliers et constants. Le hip-hop, musique accompagnée de ses propres danses et de sa mode, est le produit du déplacement et de la transformation d’une variété d’idéologies politiques de la communauté noire qui se constituent à partir de relations qui se modifient entre elles, et en relation avec les cultures dominantes contre lesquelles elles luttent quotidiennement. À l’origine, le hip-hop est lié à des mouvements d’identité de jeunes noirs. Dans cet article, il est intéressant d’étudier le rôle du hip-hop dans la formulation d’une identité entre jeunes métisses et noirs des secteurs populaires de Guayaquil. Cet exemple illustre la nécessité d’inclure dans l’analyse les dimensions politiques des processus de traduction du global au niveau local. El hip-hop es un género de música contemporánea caracterizado por la orquestación de líricas que son rapeadas, superposición de fragmentos de música grabada en el pasado por diferentes artistas, e instrumentación electrónica, todo ello sobre ritmos de bajo regulares y constantes. Como un tipo de música acompañado por sus propias formas de danza y moda, el hip-hop es producto del viaje y la transformación de una variedad de ideologías políticas de la comunidad negra que se constituyen a sí mismas en relaciones cambiantes entre sí y en relación a las culturas dominantes contra las cuales luchan cotidianamente. El hip-hop está ligado, en su contexto originario, a políticas de identidad defendidas por jóvenes negros. Lo que interesa explorar en este artículo es el papel del hip-hop en la formulación de una identidad

  17. Fasilitas Pelatihan dan Pergelaran Seni Tari Hip Hop di Surabaya

    OpenAIRE

    Yanuar, Sandy

    2014-01-01

    Fasilitas Pelatihan dan Pergelaran Seni Tari Hip Hop di Surabaya merupakan fasilitas yang disediakan bagi semua penari Hip Hop di Surabaya untuk berlatih menari dan mempertunjukan tarian Hip Hop. Fasilitas ini tersedia bagi semua penari Hip Hop termasuk penari difable, mengingat kaum difable juga dapat menari Hip Hop. Namun karena di Surabaya belum memiliki fasilitas yang memadai bagi semua penari Hip Hop termasuk penari difable untuk menari dan memiliki tempat pertunjukan yang berkarakter Hi...

  18. Hops

    Science.gov (United States)

    ... by mouth for medicinal uses. Special precautions & warnings: Pregnancy and breast-feeding: There is not enough reliable ... that are changed by the liver include theophylline, omeprazole, clozapine, progesterone, lansoprazole, flutamide, oxaliplatin, erlotinib, and caffeine. ...

  19. Hop-by-HopWorm Propagation with Carryover Epidemic Model in Mobile Sensor Networks

    Directory of Open Access Journals (Sweden)

    Jun-Won Ho

    2015-10-01

    Full Text Available In the internet, a worm is usually propagated in a random multi-hop contact manner. However, the attacker will not likely select this random multi-hop propagation approach in a mobile sensor network. This is because multi-hop worm route paths to random vulnerable targets can be often breached due to node mobility, leading to failure of fast worm spread under this strategy. Therefore, an appropriate propagation strategy is needed for mobile sensor worms. To meet this need, we discuss a hop-by-hop worm propagation model in mobile sensor networks. In a hop-by-hop worm propagation model, benign nodes are infected by worm in neighbor-to-neighbor spread manner. Since worm infection occurs in hop-by-hop contact, it is not substantially affected by a route breach incurred by node mobility. We also propose the carryover epidemic model to deal with the worm infection quota deficiency that might occur when employing an epidemic model in a mobile sensor network. We analyze worm infection capability under the carryover epidemic model. Moreover, we simulate hop-by-hop worm propagation with carryover epidemic model by using an ns-2 simulator. The simulation results demonstrate that infection quota carryovers are seldom observed where a node’s maximum speed is no less than 20 m/s.

  20. Pertunjukan Teater Karo Hip Hop Kontemporer KAI

    Directory of Open Access Journals (Sweden)

    Silvia Anggreni Purba

    2013-11-01

    Pertunjukan Teater Karo Hip Hop Kontemporer KAI. The performance of Karo Theater collaborated with Hip Hop stems from a simple idea to collaborate Karo cultural traditions with popular culture. The performances can be enjoyed without having limitation on the language and culture. The process of combining two different cultures is a form of hybrid culture, and it may occur due to the globalization process. Through the process of deposition of the observations and strong impression, this performance is then brought into the form of Hip Hop as a preferred form which is energetic, personal and global. This performance is part of a modern tragedy with its destructive character which has explored the emotion and has presented it to the audiences. The exploration of Karo cultural tradition and Hip Hop dance as a language of symbols is able to reinforce words. The movement is not revealed by the verbal phrase but is presented through the movement of Hip Hop dance. The interpretation of the legend and texts into movement is carried out through the training process at the laboratory as a searching process and experiment, and afterward can be realized by considering the basic elements of Hip Hop, Karo cultural elements and performance. Karo Hip Hop Theatre is expected to become a preferred aesthetic form of a modern theater without losing its tradition form. Keyword: a contemporary Karo theater, Hip Hop, hybrid culture.

  1. Biomechanical differences between incline and plane hopping.

    Science.gov (United States)

    Kannas, Theodoros M; Kellis, Eleftherios; Amiridis, Ioannis G

    2011-12-01

    Kannas, TM, Kellis, E, and Amiridis, IG. Biomechanical differences between incline and plane hopping. J Strength Cond Res 25(12): 3334-3341, 2011-The need for the generation of higher joint power output during performance of dynamic activities led us to investigate the force-length relationship of the plantar flexors during consecutive stretch-shortening cycles of hopping. The hypothesis of this study was that hopping (consecutive jumps with the knee as straight as possible) on an inclined (15°) surface might lead to a better jumping performance compared with hopping on a plane surface (0°). Twelve active men performed 3 sets of 10 consecutive hops on both an incline and plane surface. Ground reaction forces; ankle and knee joint kinematics; electromyographic (EMG) activity from the medial gastrocnemius (MG), soleus (Sol) and tibialis anterior (TA); and architectural data from the MG were recorded. The results showed that participants jumped significantly higher (p plane surface (27.52 ± 4.97 cm). No differences in temporal characteristics between the 2 types of jumps were observed. Incline hopping induced significantly greater ankle dorsiflexion and knee extension at takeoff compared with plane hopping (p propulsion phase were significantly higher during incline compared with that during plane hopping (p plane surface.

  2. How Does a Hopping Kangaroo Breathe?

    Science.gov (United States)

    Giuliodori, Mauricio J.; Lujan, Heidi L.; Janbaih, Hussein; DiCarlo, Stephen E.

    2010-01-01

    We developed a model to demonstrate how a hopping kangaroo breathes. Interestingly, a kangaroo uses less energy to breathe while hopping than while standing still. This occurs, in part, because rather than using muscle power to move air into and out of the lungs, air is pulled into (inspiration) and pushed out of (expiration) the lungs as the…

  3. Hip-hop and urban studies

    NARCIS (Netherlands)

    Jaffe, R.

    2014-01-01

    How can urban studies research engage fruitfully with hip-hop? This contribution responds to the essays by David Beer and Martin Lamotte on ‘street music’, urban ethnography and ghettoized communities. It discusses how a social science engagement with hip-hop texts might differ from cultural studies

  4. Protein sliding and hopping kinetics on DNA

    CERN Document Server

    DeSantis, Michael C; Wang, Y M

    2010-01-01

    Using Monte-Carlo simulations, we deconvolved the sliding and hopping kinetics of GFP-LacI proteins on elongated DNA from their experimentally observed seconds-long diffusion trajectories. Our simulations suggest the following results: (1) in each diffusion trajectory, a protein makes on average hundreds of alternating slides and hops with a mean sliding time of several tens of ms; (2) sliding dominates the root mean square displacement of fast diffusion trajectories, whereas hopping dominates slow ones; (3) flow and variations in salt concentration have limited effects on hopping kinetics, while in vivo DNA configuration is not expected to influence sliding kinetics; furthermore, (4) the rate of occurrence for hops longer than 200 nm agrees with experimental data for EcoRV proteins.

  5. Small polaron hopping transport along DNA molecules

    Energy Technology Data Exchange (ETDEWEB)

    Triberis, G P [University of Athens, Physics Department, Solid State Section, Panepistimiopolis, GR-15784 Zografos, Athens (Greece); Simserides, C [University of Athens, Physics Department, Solid State Section, Panepistimiopolis, GR-15784 Zografos, Athens (Greece); Leibniz Institute for Neurobiology, Special Laboratory for Non-Invasive Brain Imaging, Brenneckestrasse 6, D-39118 Magdeburg (Germany); Karavolas, V C [University of Athens, Physics Department, Solid State Section, Panepistimiopolis, GR-15784 Zografos, Athens (Greece)

    2005-05-04

    We present a small polaron hopping model for interpreting the strong temperature (T) dependence of the electrical conductivity, {sigma}, observed at high (h) temperatures along DNA molecules. The model takes into account the one-dimensional character of the system and the presence of disorder in the DNA double helix. Percolation-theoretical considerations lead to analytical expressions for the high temperature multiphonon-assisted small polaron hopping conductivity, the hopping distance and their temperature dependence. The experimental data for lambda phage DNA ({lambda}-DNA) and poly(dA)-poly(dT) DNA follow nicely the theoretically predicted behaviour (ln{sigma}{sup h}{proportional_to}T{sup -2/3}). Moreover, our model leads to realistic values of the maximum hopping distances, supporting the idea of multiphonon-assisted hopping of small polarons between next nearest neighbours of the DNA molecular 'wire'. The low temperature case is also investigated.

  6. Perceived bitterness character of beer in relation to hop variety and the impact of hop aroma.

    Science.gov (United States)

    Oladokun, Olayide; James, Sue; Cowley, Trevor; Dehrmann, Frieda; Smart, Katherine; Hort, Joanne; Cook, David

    2017-09-01

    The impact of hop variety and hop aroma on perceived beer bitterness intensity and character was investigated using analytical and sensory methods. Beers made from malt extract were hopped with 3 distinctive hop varieties (Hersbrucker, East Kent Goldings, Zeus) to achieve equi-bitter levels. A trained sensory panel determined the bitterness character profile of each singly-hopped beer using a novel lexicon. Results showed different bitterness character profiles for each beer, with hop aroma also found to change the hop variety-derived bitterness character profiles of the beer. Rank-rating evaluations further showed the significant effect of hop aroma on selected key bitterness character attributes, by increasing perceived harsh and lingering bitterness, astringency, and bitterness intensity via cross-modal flavour interactions. This study advances understanding of the complexity of beer bitterness perception by demonstrating that hop variety selection and hop aroma both impact significantly on the perceived intensity and character of this key sensory attribute. Copyright © 2017 Elsevier Ltd. All rights reserved.

  7. Nerve Conduction Through Dendrites via Proton Hopping.

    Science.gov (United States)

    Kier, Lemont B

    2017-01-01

    In our previous studies of nerve conduction conducted by proton hopping, we have considered the axon, soma, synapse and the nodes of Ranvier. The role of proton hopping described the passage of information through each of these units of a typical nerve system. The synapse projects information from the axon to the dendrite and their associated spines. We have invoked the passage of protons via a hopping mechanism to illustrate the continuum of the impulse through the system, via the soma following the dendrites. This is proposed to be a continuum invoked by the proton hopping method. With the proposal of the activity through the dendrites, via proton hopping, a complete model of the nerve function is invoked. At each step to the way, a water pathway is present and is invoked in the proposed model as the carrier of the message via proton hopping. The importance of the dendrites is evident by the presence of a vast number of spines, each possessing the possibility to carry unique messages through the nervous system. With this model of the role of dendrites, functioning with the presence of proton hopping, a complete model of the nerve system is presented. The validity of this model will be available for further studies and models to assess it's validity. Copyright© Bentham Science Publishers; For any queries, please email at epub@benthamscience.org.

  8. Mixed quantum-classical equilibrium: Surface hopping.

    Science.gov (United States)

    Schmidt, J R; Parandekar, Priya V; Tully, John C

    2008-07-28

    We re-examine the analysis of the equilibrium limits of the fewest switches surface hopping algorithm for mixed quantum-classical dynamics. In contrast with previously reported results, we show that surface hopping does not, in general, exactly yield Boltzmann equilibrium, but that in practice the observed deviations are quite small. We also demonstrate that surface hopping does approach the exact equilibrium distribution in both the limits of small adiabatic splitting and/or strong nonadiabatic coupling. We verify these analytical results with numerical simulations for a simple two-level quantum system connected to a bath of classical particles.

  9. Steerable Hopping Six-Legged Robot

    Science.gov (United States)

    Younse, Paulo; Aghazarian, Hrand

    2010-01-01

    The figure depicts selected aspects of a six-legged robot that moves by hopping and that can be steered in the sense that it can be launched into a hop in a controllable direction. This is a prototype of hopping robots being developed for use in scientific exploration of rough terrain on remote planets that have surface gravitation less than that of Earth. Hopping robots could also be used on Earth, albeit at diminished hopping distances associated with the greater Earth gravitation. The upper end of each leg is connected through two universal joints to an upper and a lower hexagonal frame, such that the tilt of the leg depends on the relative position of the two frames. Two non-back-driveable worm-gear motor drives are used to control the relative position of the two frames along two axes 120 apart, thereby controlling the common tilt of all six legs and thereby, further, controlling the direction of hopping. Each leg includes an upper and a lower aluminum frame segment with a joint between them. A fiberglass spring, connected via hinges to both segments, is used to store hopping energy prior to launch into a hop and to cushion the landing at the end of the hop. A cable for loading the spring is run into each leg through the center of the universal joints and then down along the center lines of the segments to the lower end of the leg. A central spool actuated by a motor with a harmonic drive and an electromagnetic clutch winds in all six cables to compress all six springs (thereby also flexing all six legs) simultaneously. To ensure that all the legs push off and land in the same direction, timing- belt pulley drives are attached to the leg segments, restricting the flexing and extension of all six legs to a common linear motion. In preparation for a hop, the spool can be driven to load the spring legs by an amount corresponding to a desired hop distance within range. The amount of compression can be computed from the reading of a shaft-angle encoder that

  10. Hip-hop, Onegin - pop! / Tatjana Aleksandrova

    Index Scriptorium Estoniae

    Aleksandrova, Tatjana, 1945-

    2004-01-01

    Erateatrikooli KS, mida juhib Svetlana Krassman, lavastus A. Pushkini poeemi "Jevgeni Onegin" motiividel. Noortelavastuse muusikalises seades kasutatakse klassikalise muusika aranzheeringuid ja räppi, kostüümidraamat koos hip-hop rõivastiiliga

  11. Collision-based mechanics of bipedal hopping

    National Research Council Canada - National Science Library

    Gutmann, Anne K; Lee, David V; McGowan, Craig P

    2013-01-01

    .... Previous studies have found that large bipedal hoppers can elastically store and return a large fraction of the energy required to hop, whereas small bipedal hoppers can only elastically store...

  12. HIP HOP for HIV Awareness: Using Hip Hop Culture to Promote Community-Level HIV Prevention

    Science.gov (United States)

    Hill, Mandy J.; Hallmark, Camden J.; McNeese, Marlene; Blue, Nike; Ross, Michael W.

    2014-01-01

    The goal of this paper was to determine the effectiveness of the HIP HOP for HIV Awareness intervention, an innovative model utilising an exchange of an HIV test for a hip hop concert ticket, in a metropolitan city among African American youth and young adults. A subset of intervention participants participated in standardised testing, sex…

  13. Solid-phase microextraction of hop volatiles. Potential use for determination and verification of hop varieties.

    Science.gov (United States)

    Kovacevic, M; Kac, M

    2001-05-18

    The composition of hop essential oil is an important tool for evaluation of hop quality. As each hop variety has a typical essential oil pattern (fingerprint), hop oil analyses can be used to distinguish between hop varieties. The headspace solid-phase microextraction (SPME) method as described in this contribution is a simple sample preparation technique and represents an alternative procedure for essential oil fingerprint determination. Different SPME parameters (extraction temperature, extraction time and sample mass) were studied and the results were compared with those obtained by the routine distillation method. It is shown that SPME results can be used for determination and verification of varieties grown in Slovenia by means of principal components analysis.

  14. RAZVOJ OBLAČIL V HIP HOP KULTURI

    OpenAIRE

    Marić, Sanja

    2010-01-01

    V diplomskem delu smo raziskovali, kako so se hip hop oblačila razvijala skozi obdobja v hip hop kulturi. V teoretičnem deli smo ugotavljali ozadje in dejavnike, ki so vplivali na razvoj hip hop kulture, v empiričnem delu diplomske naloge pa smo izvedli anketni vprašalnik z glavnimi akterji hip hop kulture na slovenski hip hop sceni. Rezultati, ki smo jih dobili, kažejo da so imela oblačila velik vpliv na prepoznavnost in razvoj hip hop kulture po celem svetu. K temu so največ pripomogli ustv...

  15. Protein structure prediction using basin-hopping

    Science.gov (United States)

    Prentiss, Michael C.; Wales, David J.; Wolynes, Peter G.

    2008-06-01

    Associative memory Hamiltonian structure prediction potentials are not overly rugged, thereby suggesting their landscapes are like those of actual proteins. In the present contribution we show how basin-hopping global optimization can identify low-lying minima for the corresponding mildly frustrated energy landscapes. For small systems the basin-hopping algorithm succeeds in locating both lower minima and conformations closer to the experimental structure than does molecular dynamics with simulated annealing. For large systems the efficiency of basin-hopping decreases for our initial implementation, where the steps consist of random perturbations to the Cartesian coordinates. We implemented umbrella sampling using basin-hopping to further confirm when the global minima are reached. We have also improved the energy surface by employing bioinformatic techniques for reducing the roughness or variance of the energy surface. Finally, the basin-hopping calculations have guided improvements in the excluded volume of the Hamiltonian, producing better structures. These results suggest a novel and transferable optimization scheme for future energy function development.

  16. Agrochemical lead optimization by scaffold hopping.

    Science.gov (United States)

    Lamberth, Clemens

    2018-02-01

    Scaffold hopping, the exchange of a specific portion of a potential active ingredient with another substructure with the aim of finding isofunctional molecular structures with significantly different molecular backbones, often offers the chance in lead discovery or optimization to mitigate problems related to toxicity, intellectual property, and insufficient potency or stability. Scaffold hopping tools such as isosteric ring replacement including 1,3 nitrogen shift and cyclic imine-amide isosterism, but also ring opening and ring closure approaches, functional group isosterism, reversion of functional groups, chain shortening, chain lengthening, and scaffolds delivered by natural products, have become a permanent fixture of the innovation and optimization process in crop protection research. Their appropriate use will be explained through examples of success stories in the field of agrochemistry. Analogies to, but also differences from, the main categories of scaffold hopping in medicinal drug discovery are discussed. © 2017 Society of Chemical Industry. © 2017 Society of Chemical Industry.

  17. Determinants of Job Hopping Experience among Private and Public ...

    African Journals Online (AJOL)

    The results revealed that perceive organizational justice; job stress and job hopping significantly jointly predict employees' turnover intention. Additionally, job stress, job hopping and distributive justice which is one of the dimensions of organizational independently significantly predict employees' turnover intention.

  18. Transport of hop aroma compounds across Caco-2 monolayers.

    Science.gov (United States)

    Heinlein, A; Metzger, M; Walles, H; Buettner, A

    2014-11-01

    Although being reported and used as a sedative remedy for several years, the bioactive principle of hop preparations is still not decisively clarified. Understanding absorption and transformation processes of potential physiologically active constituents is essential to evaluate the likeliness of biological effects on humans. Therefore, single hop aroma compounds as well as digestive transformation products thereof have been investigated in view of their human intestinal absorption, applying Caco-2 transport experiments as well as investigations on potential biotransformation processes. Selective and sensitive identification and quantification were thereby achieved by application of two-dimensional high resolution gas chromatography-mass spectrometry in conjunction with stable isotope dilution analysis, leading to the determination of apparent permeability values by different mathematical approaches considering sink and non-sink conditions. Overall, calculated permeability values ranged from 2.6 × 10(-6) to 1.8 × 10(-4) cm s(-1) with all mathematical approaches, indicating high absorption potential and almost complete bioavailability for all tested compounds with hydroxyl-functionalities. Considering this high permeability together with the high lipophilicity of these substances, a passive transcellular uptake route can be speculated. Investigated sesquiterpenes and β-myrcene showed flat absorption profiles while the investigated esters showed decreasing profiles. In view of the lipophilic and volatile nature of the investigated substances, special attention was paid to recovery and mass balance determination. Furthermore, in the course of the transport experiments of 1-octen-3-ol and 3-methyl-2-buten-1-ol, additional biotransformation products were observed, namely 3-octanone and 3-methyl-2-butenal, respectively. The absence of these additional substances in control experiments strongly indicates an intestinal first-pass metabolism of the

  19. Revolutionizing Environmental Education through Indigenous Hip Hop Culture

    Science.gov (United States)

    Gorlewski, Julie; Porfilio, Brad J.

    2012-01-01

    Based upon the life histories of six Indigenous hip hop artists of the Beat Nation artist collective, this essay captures how Indigenous hip hop has the potential to revolutionize environmental education. Hip hop provides Indigenous youth an emancipatory space to raise their opposition to neocolonial controls of Indigenous territories that…

  20. Bounds on the hop domination number of a tree

    Indian Academy of Sciences (India)

    A hop dominating set of a graph is a set of vertices of if for every vertex of () \\ D, there exists u ∈ D such that (, ) = 2. The hop domination number of a graph , denoted by ℎ(), is the minimum cardinality of a hop dominating set of . We prove that for every tree of order with leaves and support ...

  1. Hip-Hopping across China: Intercultural Formulations of Local Identities

    Science.gov (United States)

    Barrett, Catrice

    2012-01-01

    The linguistic dimensions of globalized hip-hop cannot be understood simply as a byproduct of English as an American export. As hip-hop mobilizes, it is common (and arguably necessary) for global hip-hop communities to struggle through purposeful, semiotically rooted dialectics over what constitutes "authentic" and respectable forms of…

  2. HPLC Analysis of [Alpha]- and [Beta]-Acids in Hops

    Science.gov (United States)

    Danenhower, Travis M.; Force, Leyna J.; Petersen, Kenneth J.; Betts, Thomas A.; Baker, Gary A.

    2008-01-01

    Hops have been used for centuries to impart aroma and bitterness to beer. The cones of the female hop plant contain both essential oils, which include many of the fragrant components of hops, and a collection of compounds known as [alpha]- and [beta]-acids that are the precursors to bittering agents. In order for brewers to predict the ultimate…

  3. 21 CFR 172.560 - Modified hop extract.

    Science.gov (United States)

    2010-04-01

    ... 21 Food and Drugs 3 2010-04-01 2009-04-01 true Modified hop extract. 172.560 Section 172.560 Food... Flavoring Agents and Related Substances § 172.560 Modified hop extract. The food additive modified hop extract may be safely used in beer in accordance with the following prescribed conditions: (a) The food...

  4. The Philippine "Hip Hop Stick Dance"

    Science.gov (United States)

    Lewis, Lisa

    2012-01-01

    This article introduces a dance that blends the traditional cultural heritage of the Philippines with modern music and moves. "Hip Hop Stick Dance" incorporates Tinikling (the Philippine national dance) and Arnis (a Filipino style of martial arts) to create a contemporary combination of rhythm, dance, and fitness. It was designed to introduce…

  5. Uudised : Ooper. Hip-hop. Madonna

    Index Scriptorium Estoniae

    2005-01-01

    Rumeenia sopran Nelly Miricioiu Vincenzo Bellini ooperi "Norma" nimiosas Nederlandse Operas Amsaterdamis 7.-28. märtsini. 4. märtsil Tallinna klubis Hollywood üritusel "Hip-Hop Café" New Yorgi duo Camp Lo. Ameerika poplaulja Madonna võttis vastu filmirolli

  6. Injury incidence in hip hop dance.

    Science.gov (United States)

    Ojofeitimi, S; Bronner, S; Woo, H

    2012-06-01

    Hip hop dance has rapidly become a popular international art form. There is limited information on injury patterns in this population. The purpose of this study was to determine injury incidence and patterns among three groups of hip hop dancers. Three hundred and twelve intermediate, advanced, and expert hip hop dancers were recruited at battles, dance conferences, clubs, and on dance related web sites within the United States and internationally. A Web-based survey was conducted over a 6-month period. Inclusion criteria included intermediate and advanced level dancers over the age of 13. Dancers were divided into three main categories: Breakers, Popper/Lockers, and New Schoolers. Separate analysis of variances were used to compare injury pattern differences between groups. Two hundred and thirty-two dancers reported a total of 738 injuries. Five hundred and six of these (sustained by 205 dancers) were time-loss (TL) injuries. Annual injury incidence was 237% (162% involving TL). Lower extremity injuries were 52% and upper extremity injuries 32% of total injuries. Breakers had a higher injury incidence compared with Popper/Lockers, and New Schoolers. Hip hop dancers report injury rates that are higher than other dance forms but similar to gymnastics. These dancers should be educated concerning injury prevention, biomechanics, and use of protective equipment. © 2010 John Wiley & Sons A/S.

  7. Bridge Hopping on Conducting Polymers in Solution

    OpenAIRE

    Hone, Daniel W.; Orland, Henri

    2000-01-01

    Configurational fluctuations of conducting polymers in solution can bring into proximity monomers which are distant from each other along the backbone. Electrons can hop between these monomers across the "bridges" so formed. We show how this can lead to (i) a collapse transition for metallic polymers, and (ii) to the observed dramatic efficiency of acceptor molecules for quenching fluorescence in semiconducting polymers.

  8. Featherless Dinosaurs and the Hip-Hop Simulacrum: Reconsidering Hip-Hop's Appropriateness for the Music Classroom

    Science.gov (United States)

    Kruse, Adam J.

    2016-01-01

    This article offers considerations for music teachers interested in including hip-hop music in their classrooms but who might feel concerned with or overwhelmed by issues of appropriateness. Two concerns related to hip-hop music are examined: language and negative social themes. Commercial interests in hip-hop music have created a simulacrum (or…

  9. The Formation of "Hip-Hop Academicus"--How American Scholars Talk about the Academisation of Hip-Hop

    Science.gov (United States)

    Soderman, Johan

    2013-01-01

    Social activism and education have been associated with hip-hop since it emerged in New York City 38 years ago. Therefore, it might not be surprising that universities have become interested in hip-hop. This article aims to highlight this "hip-hop academisation" and analyse the discursive mechanisms that manifest in these academisation…

  10. Tietoista liikettä : Hip hop -kulttuurin merkitys katutanssin opettamisessa

    OpenAIRE

    Pikkarainen, Sara

    2015-01-01

    Tutkimuksen lähtökohtana oli saada lisää tietoa siitä, kuinka keskeiseksi hip hop -kulttuurin ym-märtäminen koetaan osana tanssinopettajan ammattitaitoa. Tutkimuskysymykseni ovat: Miksi hip hop -kulttuurin ymmärtäminen on merkityksellistä tanssinopetuksen näkökulmasta? Miten hip hop -kulttuuri ilmenee katutanssinopetuksessa tanssikouluympäristössä? Jotta tutkimuskysymyksiin voidaan vastata, täytyy ymmärtää miten hip hop -kulttuuri on vaikuttanut hip hop -tanssin kehittymiseen ja miten hip...

  11. CORVET and HOPS tethering complexes - coordinators of endosome and lysosome fusion.

    Science.gov (United States)

    Balderhaar, Henning J kleine; Ungermann, Christian

    2013-03-15

    Protein and lipid transport along the endolysosomal system of eukaryotic cells depends on multiple fusion and fission events. Over the past few years, the molecular constituents of both fission and fusion machineries have been identified. Here, we focus on the mechanism of membrane fusion at endosomes, vacuoles and lysosomes, and in particular on the role of the two homologous tethering complexes called CORVET and HOPS. Both complexes are heterohexamers; they share four subunits, interact with Rab GTPases and soluble NSF attachment protein receptors (SNAREs) and can tether membranes. Owing to the presence of specific subunits, CORVET is a Rab5 effector complex, whereas HOPS can bind efficiently to late endosomes and lysosomes through Rab7. Based on the recently described overall structure of the HOPS complex and a number of in vivo and in vitro analyses, important insights into their function have been obtained. Here, we discuss the general function of both complexes in yeast and in metazoan cells in the context of endosomal biogenesis and maturation.

  12. Exploiting Multi-user Diversity and Multi-hop Diversity in Dual-hop Broadcast Channels

    KAUST Repository

    Zafar, Ammar

    2013-05-21

    We propose joint user-and-hop scheduling over dual-hop block-fading broadcast channels in order to exploit multi-user diversity gains and multi-hop diversity gains all together. To achieve this objective, the first and second hops are scheduled opportunistically based on the channel state information. The joint scheduling problem is formulated as maximizing the weighted sum of the long term achievable rates of the users under a stability constraint, which means that in the long term the rate received by the relay should equal the rate transmitted by it, in addition to power constraints. We show that this problem is equivalent to a single-hop broadcast channel by treating the source as a virtual user with an optimal weight that maintains the stability constraint. We show how to obtain the source weight either off-line based on channel statistics or on real-time based on channel measurements. Furthermore, we consider special cases including the maximum sum-rate scheduler and the proportional fair scheduler. We also show how to extend the scheme into one that allows multiple user scheduling via superposition coding with successive decoding. Numerical results demonstrate that our proposed joint scheduling scheme enlarges the rate region as compared to scheduling schemes that exploit the diversity gains partially.

  13. Uudised : Pop-karneval. Hip-hop

    Index Scriptorium Estoniae

    2005-01-01

    Muusika- ja kunstikarnevalist "Beta Bubble" 1. apr. Tallinnas Von Krahlis. Pärnu taasühinenud hip-hop-bänd Noizmakaz (TommyBoy ja Alko) sõlmis lepingu plaadifirmaga Mindnote ja annab selle alt apr. keskel välja oma teise albumi "Valitud mõtted".1. apr. tuleb müügile Noizmakazi singel "Miski muu ei loe", debüüt "Social Poetry" ilmus aastal 2001

  14. Gender specific strategies in demanding hopping conditions.

    Science.gov (United States)

    Demirbüken, Ilkşan; Yurdalan, Saadet Ufuk; Savelberg, Hans; Meijer, Kenneth

    2009-01-01

    Difference in leg stiffness between females and males is considered to be a cause of higher rates of Anterior Cruciate Ligament injury in female athletes. Females are believed to have lower stiffness and as a consequence different recruitment strategies to adapt functional tasks. The aim of the current study was to evaluate how leg stiffness is tuned to demanding conditions. 22 healthy subjects (11 Male-11 Female; age: 20-43 years) participated in this study. Subjects performed two-legged hopping tasks (at their preferred rate, as fast as possible and with added mass of 10% bodyweight) on a force platform. Leg stiffness was calculated for each condition as the ratio between peak ground reaction force and vertical displacement of center of mass. In the preferred and added mass conditions males showed substantially higher leg stiffness than females (p= 0.006 and p = 0.002, respectively). When hopping as fast as possible the gender bias in leg stiffness disappeared (p = 0.880). Added mass had no significant effect on change in leg stiffness. Results have shown that females increased their leg stiffness more than males indicating they have no gender limiting capacity to reach objectives of higher demanding tasks (i.e.fastest hopping).The relationship between observed gender differences in leg stiffness and increased Anterior Cruciate Ligament injury rate in females requires further study. Key pointsLeg stiffness is an adaptable property of neuro musculoskeletal system to different functional loading conditions.Females can increase their leg stiffness more than males indicating they have no gender limiting capacity to reach objectives of higher demanding tasks as fastest hopping.

  15. Rethinking Pedagogy in Urban Spaces: Implementing Hip-Hop Pedagogy in the Urban Science Classroom

    Science.gov (United States)

    Adjapong, Edmund S.; Emdin, Christopher

    2015-01-01

    A significant amount of research regarding Hip-Hop Based Education (HHBE) fails to provide insight on how to incorporate elements of Hip-Hop into daily teaching practices; rather Hip-Hop based educators focus mainly on incorporating Hip-Hop culture into curricula. This study explores the benefits of using two specific Hip-Hop pedagogical practices…

  16. Simulating Muscle-Reflex Dynamics in a Simple Hopping Robot

    Science.gov (United States)

    Seyfarth, Andre; Kalveram, Karl Theodor; Geyer, Hartmut

    In legged systems, springy legs facilitate gaits with subsequent contact and flight phases. Here, we test whether electrical motors can generate leg behaviors suitable for stable hopping. We built a vertically operating sledge actuated by a motor-driven leg. The motor torque simulates either a linear leg spring or a muscle-reflex system. For stable hopping significant energy supply was required after midstance. This was achieved by enhancing leg stiffness or by continuously applying positive force feedback to the simulated muscle. The muscle properties combined with positive force feedback result in spring-like behavior which enables stable hopping with adjustable hopping height.

  17. Inorganic constituents in coal

    Energy Technology Data Exchange (ETDEWEB)

    A. Radenovic [University of Zagreb, Sisak (Croatia). Faculty of Metallurgy

    2006-07-01

    Coal contains not only organic matter but also small amounts of inorganic constituents. More than one hundred different minerals and virtually every element in the periodic table have been found in coal. Commonly found group minerals in coal are: major (quartz, pyrite, clays and carbonates), minor, and trace minerals. Coal includes a lot of elements of low mass fraction of the order of w=0.01 or 0.001 %. They are trace elements connected with organic matter or minerals comprised in coal. The fractions of trace elements usually decrease when the rank of coal increases. Fractions of the inorganic elements are different, depending on the coal bed and basin. A variety of analytical methods and techniques can be used to determine the mass fractions, mode of occurrence, and distribution of organic constituents in coal. There are many different instrumental methods for analysis of coal and coal products but atomic absorption spectroscopy (AAS) is the one most commonly used. Fraction and mode of occurrence are one of the main factors that have influence on transformation and separation of inorganic constituents during coal conversion. Coal, as an important world energy source and component for non-fuels usage, will be continuously and widely used in the future due to its relatively abundant reserves. However, there is a conflict between the requirements for increased use of coal on the one hand and less pollution on the other. It's known that the environmental impacts, due to either coal mining or coal usage, can be: air, water and land pollution. Although, minor components, inorganic constituents can exert a significant influence on the economic value, utilization, and environmental impact of the coal.

  18. Inorganic Constituents in Coal

    Directory of Open Access Journals (Sweden)

    Rađenović A.

    2006-02-01

    Full Text Available Coal contains not only organic matter but also small amounts of inorganic constituents. More thanone hundred different minerals and virtually every element in the periodic table have been foundin coal. Commonly found group minerals in coal are: major (quartz, pyrite, clays and carbonates,minor, and trace minerals. Coal includes a lot of elements of low mass fraction of the orderof w=0.01 or 0.001 %. They are trace elements connected with organic matter or minerals comprisedin coal. The fractions of trace elements usually decrease when the rank of coal increases.Fractions of the inorganic elements are different, depending on the coal bed and basin. A varietyof analytical methods and techniques can be used to determine the mass fractions, mode ofoccurrence, and distribution of organic constituents in coal. There are many different instrumentalmethods for analysis of coal and coal products but atomic absorption spectroscopy – AAS is theone most commonly used. Fraction and mode of occurrence are one of the main factors that haveinfluence on transformation and separation of inorganic constituents during coal conversion.Coal, as an important world energy source and component for non-fuels usage, will be continuouslyand widely used in the future due to its relatively abundant reserves. However, there is aconflict between the requirements for increased use of coal on the one hand and less pollution onthe other. It’s known that the environmental impacts, due to either coal mining or coal usage, canbe: air, water and land pollution. Although, minor components, inorganic constituents can exert asignificant influence on the economic value, utilization, and environmental impact of the coal.

  19. Hip-Hop Is the Healer: Sense of Belonging and Diversity among Hip-Hop Collegians

    Science.gov (United States)

    Sulé, V. Thandi

    2016-01-01

    Sense of belonging is recognized as a factor contributing to persistence to graduation. Furthermore, interactional diversity is associated with learning and civic outcomes--touted higher education goals. Hip-hop culture, one of the most influential cultural creations of the mid-20th century, has succeeded in attracting devotees from diverse…

  20. Being Hipped to Their Hop: Tapping into Young Minds through Hip Hop Play

    Science.gov (United States)

    Broughton, Anthony

    2017-01-01

    Adults gain a wealth of knowledge from listening to the voices of children through intentional observations and interactions [Owocki, G., and Y. M. Goodman. 2002. "Kidwatching: Documenting Children's Literacy Development." Portsmouth: Heinemann]. Hip Hop play may provide optimal opportunities for teachers to tap into the young minds of…

  1. Security for multi-hop wireless networks

    CERN Document Server

    Mahmoud, Mohamed M E A

    2014-01-01

    This Springer Brief discusses efficient security protocols and schemes for multi-hop wireless networks. It presents an overview of security requirements for these networks, explores challenges in securing networks and presents system models. The authors introduce mechanisms to reduce the overhead and identify malicious nodes that drop packets intentionally. Also included is a new, efficient cooperation incentive scheme to stimulate the selfish nodes to relay information packets and enforce fairness. Many examples are provided, along with predictions for future directions of the field. Security

  2. Pipefest hip hop -festivaalin markkinointiviestintä

    OpenAIRE

    Kallio, Timo

    2010-01-01

    Opinnäytetyöni aiheena oli Pipefest hip hop -festivaalien markkinointiviestinnän toteuttaminen. Olin ollut kävijänä tapahtumassa vuodesta 2003 lähtien, ja aloitettuani opinnot digitaalisen äänen ja kaupallisen musiikin suuntautumisvaihtoehdon linjalla, kiinnostuin tapahtuma- ja festivaalijärjestämisestä. Tutustuin tapahtumaa järjestävään tahoon ja aloin työstää Pipefestin markkinointiviestintää. Opintoihini kuuluneella tapahtumatuotannon kurssilla sain paljon oppia tapahtumatuotannosta t...

  3. Maser Source-Finding Methods in HOPS

    Science.gov (United States)

    Walsh, A. J.; Purcell, C.; Longmore, S.; Jordan, C. H.; Lowe, V.

    2012-12-01

    The H2O Southern Galactic Plane Survey (HOPS) has observed 100 deg2 of the Galactic plane, using the Mopra radio telescope to search for emission from multiple spectral lines in the 12-mm band (19.5-27.5GHz). Perhaps the most important of these spectral lines is the 22.2-GHz water-maser transition. We describe the methods used to identify water-maser candidates and subsequent confirmation of the sources. Our methods involve a simple determination of likely candidates by searching peak emission maps, utilising the intrinsic nature of water-maser emission, spatially unresolved and spectrally narrow-lined. We estimate completeness limits and compare our method with results from the DUCHAMP source finder. We find that the two methods perform similarly. We conclude that the similarity in performance is due to the intrinsic limitation of the noise characteristics of the data. The advantages of our method are that it is slightly more efficient in eliminating spurious detections and is simple to implement. The disadvantage is that it is a manual method of finding sources and so is not practical on datasets much larger than HOPS, or for datasets with extended emission that needs to be characterised. We outline a two-stage method for the most efficient means of finding masers, using DUCHAMP.

  4. Potential African Substitutes for Hops in Tropical Beer Brewing ...

    African Journals Online (AJOL)

    Proximate analysis showed that these vegetables had protein and crude fibre values comparable to those of commercial hops. Fat content values were however much higher than those for hops with Grongonema latifolium having the highest values of 19.10%. Garcinia cola with a total resin value of 8.24% and an essential ...

  5. Toward Hip-Hop Pedagogies for Music Education

    Science.gov (United States)

    Kruse, Adam J.

    2016-01-01

    Music education scholarship in the areas of popular, vernacular, and participatory musicianship has grown in the past decades; however, music education research concerned specifically with hip-hop has been relatively scarce. Because hip-hop music can differ tremendously from the traditional western genres with which many music educators are most…

  6. Christian Hip Hop as Pedagogy: A South African Case Study

    Science.gov (United States)

    Abraham, Ibrahim

    2015-01-01

    Drawing on interviews with creators of Christian hip hop music in South Africa, this article demonstrates that this genre of popular music and youth culture is utilised as a form of pedagogy to transmit religious beliefs and values to contemporary youth. The pedagogical aspects of hip hop have been recognised in research on the topic, but the…

  7. Factors of Intensification in the Hops Cluster of Chuvashia

    Science.gov (United States)

    Zakharov, Anatoly I.; Evgrafov, Oleg V.; Zakharov, Dmitry A.; Ivanova, Elena V.; Tolstova, Marija L.; Tsaregorodtsev, Evgeny I.

    2016-01-01

    The complex analysis of development of hop-growing for 1971-2015 is carried out. In the conditions of the field experiment made in the Chuvash Republic hop-growing intensification elements--technology of its cultivation, mechanization are fulfilled. Based on researches it is established that the main internal allowance of increase in efficiency of…

  8. Gap solitons in periodic Schrodinger lattice system with nonlinear hopping

    Directory of Open Access Journals (Sweden)

    Ming Cheng

    2016-10-01

    Full Text Available This article concerns the periodic discrete Schrodinger equation with nonlinear hopping on the infinite integer lattice. We obtain the existence of gap solitons by the linking theorem and concentration compactness method together with a periodic approximation technique. In addition, the behavior of such solutions is studied as $\\alpha\\to 0$. Notice that the nonlinear hopping can be sign changing.

  9. Being Hip-Hop: Beyond Skills and Songs

    Science.gov (United States)

    Kruse, Adam J.

    2016-01-01

    In this article, I offer four principles relevant to hip-hop cultures (keep it real, flip the script, make some noise, and stay fresh) and explore how these principles might affect music classrooms. I argue that a music classroom that works to keep it real, flip the script, make some noise, and stay fresh might go beyond teaching hip-hop skills…

  10. Towards a Pedagogy of Hip Hop in Urban Teacher Education

    Science.gov (United States)

    Bridges, Thurman

    2011-01-01

    This article draws from a qualitative study often Black male K-12 teachers from the Hip Hop Generation who are closely connected to Hip Hop culture and have been effective in addressing the academic and social needs of Black boys. Through an analysis of their social, educational and cultural experiences, this article highlights three organizing…

  11. Framing and Reviewing Hip-Hop Educational Research

    Science.gov (United States)

    Petchauer, Emery

    2009-01-01

    Hip-hop has become relevant to the field of education because of its implications for understanding language, learning, identity, curriculum, and other areas. This integrative review provides historical context and cohesion for the burgeoning and discursive body of hip-hop scholarship by framing it according to three heuristic categories and…

  12. Romani Music - Roma and the Hip-hop Culture

    OpenAIRE

    Dočkal, Tomáš

    2007-01-01

    This thesis is focused on Romani music and its importance for the Romani culture. It examines the popularity of hip-hop among the young Romani generation and Romani hip- hip production. It attempts to define the role of hip-hop culture in young Romanies' lives.

  13. Hip-Hop, the "Obama Effect," and Urban Science Education

    Science.gov (United States)

    Emdin, Christopher; Lee, Okhee

    2012-01-01

    Background/Context: With the ever increasing diversity of schools, and the persistent need to develop teaching strategies for the students who attend today's urban schools, hip-hop culture has been proposed to be a means through which urban youth can find success in school. As a result, studies of the role of hip-hop in urban education have grown…

  14. Investigating Cultural Collision: Educators' Perceptions of Hip-Hop Culture

    Science.gov (United States)

    Beachum, Floyd D.

    2013-01-01

    Hip-hop music has been embraced worldwide by youth, pummeled in the media for supposedly increasing social misery and hailed as a significant musical breakthrough. Hip-hop culture has transcended musical boundaries and now impacts speech, clothing, mannerisms, movies, websites, television programming, magazines, and energy drinks (Dyson, 2007;…

  15. Framing Hip Hop: New Methodologies for New Times

    Science.gov (United States)

    Dimitriadis, Greg

    2015-01-01

    This article revisits the central impulse behind early advocacy for ethnographic approaches to hip hop--that critics should try as much as possible to limit their own certainties around what hip hop can and might mean. While ethnographic approaches can engender the kinds of personal dislocations that allow for this negotiation, they do not…

  16. Hip Hop as Empowerment: Voices in El Alto, Bolivia

    Science.gov (United States)

    Tarifa, Ariana

    2012-01-01

    In response to neoliberal policies that have been in place since 1985, Bolivian young people have increasingly used hip hop music as a means of protest and to reclaim social and political participation. Hip hop in Latin America tells the story of the struggles that marginalized people have suffered, and speaks to the effects of international…

  17. Hip-Hop Is My Passport! Using Hip-Hop and Digital Literacies to Understand Global Citizenship Education

    Science.gov (United States)

    Horton, Akesha Monique

    2013-01-01

    Hip-hop has exploded around the world among youth. It is not simply an American source of entertainment; it is a global cultural movement that provides a voice for youth worldwide who have not been able to express their "cultural world" through mainstream media. The emerging field of critical hip-hop pedagogy has produced little…

  18. Hip Hop Culture's OGs: A Narrative Inquiry into the Intersection of Hip Hop Culture, Black Males and Their Schooling Experiences

    Science.gov (United States)

    Buchanan, Ian P.

    2013-01-01

    Using a critical race lens, this narrative study employs a focus group design to explore the intersections between black males, hip hop culture and schooling experiences. To provide a sociocultural grounding, this study first reviews the research literature around hip hop culture.s sociocultural development and its impact as a culture force that…

  19. Communication devices for network-hopping communications and methods of network-hopping communications

    Science.gov (United States)

    Buttles, John W

    2013-04-23

    Wireless communication devices include a software-defined radio coupled to processing circuitry. The system controller is configured to execute computer programming code. Storage media is coupled to the system controller and includes computer programming code configured to cause the system controller to configure and reconfigure the software-defined radio to operate on each of a plurality of communication networks according to a selected sequence. Methods for communicating with a wireless device and methods of wireless network-hopping are also disclosed.

  20. Bit-padding information guided channel hopping

    KAUST Repository

    Yang, Yuli

    2011-02-01

    In the context of multiple-input multiple-output (MIMO) communications, we propose a bit-padding information guided channel hopping (BP-IGCH) scheme which breaks the limitation that the number of transmit antennas has to be a power of two based on the IGCH concept. The proposed scheme prescribes different bit-lengths to be mapped onto the indices of the transmit antennas and then uses padding technique to avoid error propagation. Numerical results and comparisons, on both the capacity and the bit error rate performances, are provided and show the advantage of the proposed scheme. The BP-IGCH scheme not only offers lower complexity to realize the design flexibility, but also achieves better performance. © 2011 IEEE.

  1. Job-hopping and New Firm Survival

    DEFF Research Database (Denmark)

    Failla, Virgilio

    for this theory, little is known about the characteristics of this so called `balanced´ skills set. Do entrepreneurial outcomes of individuals presenting a highly varied work experiences differ from entrepreneurs with a less varied career' In particular, how do the characteristics of the entrepreneurs´ job...... is the right experience that enhances the new ventures´ performances. Fallick, Fleischman and Reibtzer (1996) argue that frequent job-hopping facilitates the rapid reallocation of resources toward firms with the best innovations. This could be the result of the fact that especially high quality individuals who...... employed in the start-up they founded. This initial evidence suggests that successful jack-of-all trades are people who do not wander across industries, but those who accumulate a variety of experiences by occupying different roles in the parent organization....

  2. Suppression of hop looper (Lepidoptera: Noctuidae) by the fungicide pyraclostrobin.

    Science.gov (United States)

    Woods, J L; Gent, D H

    2014-04-01

    The hop looper, Hypena humuli Harris, is a reemergent pest of hop that often requires treatment to mitigate crop damage. In 4 yr of field trials, plots treated with fungicides were observed to sustain less hop looper defoliation compared with nontreated plots. Further investigation revealed that abundance of hop looper and associated defoliation were reduced when the fungicide pyraclostrobin was applied in late July to early August. Two other fungicides possessing active ingredients in the same chemical family (quinone outside inhibitor) did not reduce abundance of hop looper or its defoliation. Pyraclostrobin is efficacious against powdery mildew diseases, and the application timing evaluated in these studies corresponds with a period of juvenile susceptibility of hop cones to the disease. Use of fungicides containing pyraclostrobin at this time may have the ancillary benefit of reducing hop looper damage, potentially obviating the need for broad-spectrum insecticides later in the season. Follow-up studies are warranted to determine whether pyraclostrobin may inhibit other lepidopteran species.

  3. Holstein polarons and triplet bipolarons with NNN hopping

    Science.gov (United States)

    Chakraborty, Monodeep; Taraphder, A.; Berciu, Mona

    2017-05-01

    We study the ground state of 1D Holstein single polaron with next nearest neighbour electron hopping (NNN), employing a variational approximation based on exact diagonalization. Our investigation reveals that, depending upon the sign and magnitude of the NNN hopping integral with respect to nearest neighbour hopping, the polaron band minima may occur at non-zero kGS. We compare the present scenario with the SSH polarons, where a similar feature is also observed, albeit, due to very different mechanism. Our initial investigation of triplet bipolarons, in presence of an attractive extended Hubbard interactions, further substantiates the differences between the present model and the SSH model.

  4. Characterization of hop pectins shows the presence of an arabinogalactan-protein

    NARCIS (Netherlands)

    Oosterveld, A.; Voragen, A.G.J.; Schols, H.A.

    2002-01-01

    Hop pectins were extracted from spent hops using acid extraction conditions and were characterized chemically. The acid extraction of spent hops resulted in a yield of 2°containing 59 f polysaccharides. The hop pectins under investigation had a relatively high molecular weight and an intrinsic

  5. Let Me Blow Your Mind: Hip Hop Feminist Futures in Theory and Praxis

    Science.gov (United States)

    Lindsey, Treva B.

    2015-01-01

    This essay brings together key theoretical interventions in hip-hop feminism to explore the continued, but undervalued, significance of hip-hop feminism in urban education. More specifically, the essay challenges narrow conceptualizations of the "hip hop subject" as Black and male by using hip-hop feminist theory to incorporate the lived…

  6. Occurrence of Theaspirane and its Odorant Degradation Products in Hop and Beer.

    Science.gov (United States)

    Scholtes, Caroline; Nizet, Sabrina; Massart, Hadrien; Gerbaux, Pascal; Collin, Sonia

    2015-09-23

    In model oxidized media, six theaspirane-derived compounds were identified by gas chromatography-high resolution mass spectrometry: 4-hydroxy-7,8-dihydro-β-ionone, 6-hydroxy-7,8-dihydro-α-ionone, dihydrodehydro-β-ionone, two monoepoxides, and a derived alcohol. Only 4-hydroxy-7,8-dihydro-β-ionone and dihydrodehydro-β-ionone have been described previously in the literature. Investigation of hop revealed five of these compounds in free form together with theaspirane (especially in the Mosaic variety), while the Citra and Amarillo hop varieties emerged as very interesting for the release of theaspirane, 4-hydroxy-7,8-dihydro-β-ionone, and dihydrodehydro-β-ionone from glucoside precursors. For the first time, theaspirane, 4-hydroxy-7,8-dihydro-β-ionone, 6-hydroxy-7,8-dihydro-α-ionone, and both monoepoxides were found in a fresh commercial top fermentation beer (only theaspirane, 4-hydroxy-7,8-dihydro-β-ionone, and dihydrodehydro-β-ionone have recently been mentioned as Gueuze constituents).

  7. Performance Analysis of Millimeter-Wave Multi-hop Machine-to-Machine Networks Based on Hop Distance Statistics.

    Science.gov (United States)

    Jung, Haejoon; Lee, In-Ho

    2018-01-12

    As an intrinsic part of the Internet of Things (IoT) ecosystem, machine-to-machine (M2M) communications are expected to provide ubiquitous connectivity between machines. Millimeter-wave (mmWave) communication is another promising technology for the future communication systems to alleviate the pressure of scarce spectrum resources. For this reason, in this paper, we consider multi-hop M2M communications, where a machine-type communication (MTC) device with the limited transmit power relays to help other devices using mmWave. To be specific, we focus on hop distance statistics and their impacts on system performances in multi-hop wireless networks (MWNs) with directional antenna arrays in mmWave for M2M communications. Different from microwave systems, in mmWave communications, wireless channel suffers from blockage by obstacles that heavily attenuate line-of-sight signals, which may result in limited per-hop progress in MWNs. We consider two routing strategies aiming at different types of applications and derive the probability distributions of their hop distances. Moreover, we provide their baseline statistics assuming the blockage-free scenario to quantify the impact of blockages. Based on the hop distance analysis, we propose a method to estimate the end-to-end performances (e.g., outage probability, hop count, and transmit energy) of the mmWave MWNs, which provides important insights into mmWave MWN design without time-consuming and repetitive end-to-end simulation.

  8. Comparison of the most odor-active compounds in fresh and dried hop cones (Humulus lupulus L. variety spalter select) based on GC-olfactometry and odor dilution techniques.

    Science.gov (United States)

    Steinhaus, M; Schieberle, P

    2000-05-01

    Application of aroma extract dilution analysis on the volatiles obtained from dried cones of Spalter Select hops grown in the German hop-growing area of Hallertau revealed 23 odorants in the flavor dilution (FD) factor range of 16-4096, 20 of which could be identified. On the basis of high FD factors, trans-4, 5-epoxy-(E)-2-decenal, linalool, and myrcene were identified as the most potent odorants, followed by ethyl 2-methylpropanoate, methyl 2-methylbutanoate, (Z)-1,5-octadien-3-one, nonanal, (E,Z)-1,3, 5-undecatriene, 1,3(E),5(Z),9-undecatetraene, propyl 2-methylbutanoate, 4-ethenyl-2-methoxyphenol, and 1-octen-3-one. Ten of the high-impact hop aroma compounds had previously not been identified as hop constituents and, in particular, 1,3(E),5(Z), 9-undecatetraene has not yet been reported as a food odorant. In an extract obtained from fresh hops, in addition to the odorants found in dry hops, (Z)-3-hexenal was characterized as a further key odorant rendering an additional green aroma note to the fresh material.

  9. Field dependence of hopping mobility: Lattice models against spatial disorder

    Science.gov (United States)

    Oelerich, J. O.; Nenashev, A. V.; Dvurechenskii, A. V.; Gebhard, F.; Baranovskii, S. D.

    2017-11-01

    The theoretical description of the effect of the electric field F on the hopping mobility μ belongs to the not-yet-resolved problems related to charge transport in disordered materials. An often proposed solution is to simulate hopping transport via sites placed on regular grids and to fit the results by phenomenological equations. This approach currently dominates the theoretical research of hopping transport in organic disordered semiconductors. We show that the dependence μ (F ) in the case of regular grids can drastically differ from that in systems with spatial disorder. While μ increases with F on lattices, it can decrease in random systems with the same material parameters. Moreover, the material parameters responsible for the dependence μ (F ) on lattices differ from those responsible for μ (F ) in spatially disordered systems, which makes lattice models inappropriate for studying the field dependence of the hopping mobility.

  10. Two-Hop Secure Communication Using an Untrusted Relay

    National Research Council Canada - National Science Library

    He, Xiang; Yener, Aylin

    2009-01-01

    .... Yet, the information it relays needs to be kept secret from it. In this two-hop communication scenario, where the use of the untrusted relay node is essential, we find that a positive secrecy rate is achievable...

  11. Hip Hop Dance Experience Linked to Sociocognitive Ability

    National Research Council Canada - National Science Library

    Justin W Bonny; Jenna C Lindberg; Marc C Pacampara

    2017-01-01

    .... In the present study, we examined whether experience in a different activity, hip hop dance, is also linked to cognitive abilities connected with STEM skills as well as social cognition ability...

  12. Hopping trajectory optimization for surface exploration on small bodies

    Science.gov (United States)

    Liu, Yanjie; Zhu, Shengying; Cui, Pingyuan; Yu, Zhengshi; Zong, Hua

    2017-07-01

    Surface exploration is an important way to improve the understanding of small bodies. Considering the irregular and weak gravity field near a small body, the movement of the surface explorer is generally achieved by hopping. In this paper, a guidance algorithm method based on convex optimization approach for pinpoint hopping movement on a small body is developed in order to improve the stability and accuracy of surface exploration. We formulate a fuel-optimal control problem for the single pinpoint hopping and convert it into a second-order cone programming (SOCP) problem which can be solved effectively by primal-dual-interior points method. A multi-hopping scenario is also proposed for the long-distance transfer. To certificate the performance of the proposed guidance algorithm, a full set of simulations are conducted and the effectiveness are analyzed.

  13. Hip hop jako kulturní styl, jeho spicifika a vliv na teenagery

    OpenAIRE

    Pospíšil, Jan

    2008-01-01

    This thesis involves history of hip hop, its specifics and elements, it talks about influence of hip hip subculture on teenagers and points to positive and negative aspects connected to this culture style. In this way is work sectionalized into chapters. First part talks about history of hip hop, connection between religion and hip hop and also about Czech hip hop. Second part specifies on main elements of hip hop culture as DJing, MCing, breakdance, beatbox and graffiti. Last part focuses on...

  14. Low Power Multi-Hop Networking Analysis in Intelligent Environments

    Directory of Open Access Journals (Sweden)

    Josu Etxaniz

    2017-05-01

    Full Text Available Intelligent systems are driven by the latest technological advances in many different areas such as sensing, embedded systems, wireless communications or context recognition. This paper focuses on some of those areas. Concretely, the paper deals with wireless communications issues in embedded systems. More precisely, the paper combines the multi-hop networking with Bluetooth technology and a quality of service (QoS metric, the latency. Bluetooth is a radio license-free worldwide communication standard that makes low power multi-hop wireless networking available. It establishes piconets (point-to-point and point-to-multipoint links and scatternets (multi-hop networks. As a result, many Bluetooth nodes can be interconnected to set up ambient intelligent networks. Then, this paper presents the results of the investigation on multi-hop latency with park and sniff Bluetooth low power modes conducted over the hardware test bench previously implemented. In addition, the empirical models to estimate the latency of multi-hop communications over Bluetooth Asynchronous Connectionless Links (ACL in park and sniff mode are given. The designers of devices and networks for intelligent systems will benefit from the estimation of the latency in Bluetooth multi-hop communications that the models provide.

  15. The Hip-Hop club scene: Gender, grinding and sex.

    Science.gov (United States)

    Muñoz-Laboy, Miguel; Weinstein, Hannah; Parker, Richard

    2007-01-01

    Hip-Hop culture is a key social medium through which many young men and women from communities of colour in the USA construct their gender. In this study, we focused on the Hip-Hop club scene in New York City with the intention of unpacking narratives of gender dynamics from the perspective of young men and women, and how these relate to their sexual experiences. We conducted a three-year ethnographic study that included ethnographic observations of Hip-Hop clubs and their social scene, and in-depth interviews with young men and young women aged 15-21. This paper describes how young people negotiate gender relations on the dance floor of Hip-Hop clubs. The Hip-Hop club scene represents a context or setting where young men's masculinities are contested by the social environment, where women challenge hypermasculine privilege and where young people can set the stage for what happens next in their sexual and emotional interactions. Hip-Hop culture therefore provides a window into the gender and sexual scripts of many urban minority youth. A fuller understanding of these patterns can offer key insights into the social construction of sexual risk, as well as the possibilities for sexual health promotion, among young people in urban minority populations.

  16. Extreme Kinematics in Selected Hip Hop Dance Sequences.

    Science.gov (United States)

    Bronner, Shaw; Ojofeitimi, Sheyi; Woo, Helen

    2015-09-01

    Hip hop dance has many styles including breakdance (breaking), house, popping and locking, funk, streetdance, krumping, Memphis jookin', and voguing. These movements combine the complexity of dance choreography with the challenges of gymnastics and acrobatic movements. Despite high injury rates in hip hop dance, particularly in breakdance, to date there are no published biomechanical studies in this population. The purpose of this study was to compare representative hip hop steps found in breakdance (toprock and breaking) and house and provide descriptive statistics of the angular displacements that occurred in these sequences. Six expert female hip hop dancers performed three choreographed dance sequences, top rock, breaking, and house, to standardized music-based tempos. Hip, knee, and ankle kinematics were collected during sequences that were 18 to 30 sec long. Hip, knee, and ankle three-dimensional peak joint angles were compared in repeated measures ANOVAs with post hoc tests where appropriate (pHip hop maximal joint angles exceeded reported activities of daily living and high injury sports such as gymnastics. Hip hop dancers work at weight-bearing joint end ranges where muscles are at a functional disadvantage. These results may explain why lower extremity injury rates are high in this population.

  17. Low Power Multi-Hop Networking Analysis in Intelligent Environments.

    Science.gov (United States)

    Etxaniz, Josu; Aranguren, Gerardo

    2017-05-19

    Intelligent systems are driven by the latest technological advances in many different areas such as sensing, embedded systems, wireless communications or context recognition. This paper focuses on some of those areas. Concretely, the paper deals with wireless communications issues in embedded systems. More precisely, the paper combines the multi-hop networking with Bluetooth technology and a quality of service (QoS) metric, the latency. Bluetooth is a radio license-free worldwide communication standard that makes low power multi-hop wireless networking available. It establishes piconets (point-to-point and point-to-multipoint links) and scatternets (multi-hop networks). As a result, many Bluetooth nodes can be interconnected to set up ambient intelligent networks. Then, this paper presents the results of the investigation on multi-hop latency with park and sniff Bluetooth low power modes conducted over the hardware test bench previously implemented. In addition, the empirical models to estimate the latency of multi-hop communications over Bluetooth Asynchronous Connectionless Links (ACL) in park and sniff mode are given. The designers of devices and networks for intelligent systems will benefit from the estimation of the latency in Bluetooth multi-hop communications that the models provide.

  18. antibacterial constituents of calliandra haematocephala

    African Journals Online (AJOL)

    ANTIBACTERIAL CONSTITUENTS OF CALLIANDRA HAEMATOCEPHALA. R Nia, SA Adesanya, IN Okeke, HC Illoh, SJ Adesina. Abstract. The EtOAC extractable constituents of the bark of C. haematocephala were active against selected bacteria. Fractionation by chromatographic methods, gave known compounds ...

  19. Hip Hop Syllabus: AME/MUS 303 Hip Hop: Art, Culture, and Politics

    Directory of Open Access Journals (Sweden)

    Sarah Hentges

    2013-10-01

    Full Text Available This syllabus represents a course taught online through the University of Maine at Augusta in the fall of 2011 (and every otheryear thereafter. Critical pedagogy can be a challenge in any classroom, and the challenges in an online classroom are compounded. However, the subject matter and approach of Hip Hop can be a powerful tool in teaching students critical thinking skills as well in laying a foundation for interdisciplinary and intersectional theory; here these elements are represented through curriculum—the themes, texts, contexts,approaches, structure, and assignments.

  20. Fast Hopping Frequency Generation in Digital CMOS

    CERN Document Server

    Farazian, Mohammad; Gudem, Prasad S

    2013-01-01

    Overcoming the agility limitations of conventional frequency synthesizers in multi-band OFDM ultra wideband is a key research goal in digital technology. This volume outlines a frequency plan that can generate all the required frequencies from a single fixed frequency, able to implement center frequencies with no more than two levels of SSB mixing. It recognizes the need for future synthesizers to bypass on-chip inductors and operate at low voltages to enable the increased integration and efficiency of networked appliances. The author examines in depth the architecture of the dividers that generate the necessary frequencies from a single base frequency and are capable of establishing a fractional division ratio.   Presenting the first CMOS inductorless single PLL 14-band frequency synthesizer for MB-OFDMUWB makes this volume a key addition to the literature, and with the synthesizer capable of arbitrary band-hopping in less than two nanoseconds, it operates well within the desired range on a 1.2-volt power s...

  1. Assimilation and Hip-Hop : Interethnic Relations and the Americanization of New Immigrants in Hip-Hop Culture

    OpenAIRE

    Aahlin, Audun Kjus

    2013-01-01

    The conflict thesis and the segmented assimilation theory account for two of the most significant trends in American immigration and ethnicity studies. Both of these major theoretical styles are utterly pessimistic towards interethnic relations in the United States and assimilation into African American urban culture. I have asked in this thesis if the experiences and the history of hip-hop culture can counterbalance these negative interpretations of interethnic relations. Hip-hop culture has...

  2. Acoustic cues to Nehiyawewin constituency

    Science.gov (United States)

    Cook, Clare; Muehlbauer, Jeff

    2005-04-01

    This study examines how speakers use acoustic cues, e.g., pitch and pausing, to establish syntactic and semantic constituents in Nehiyawewin, an Algonquian language. Two Nehiyawewin speakers autobiographies, which have been recorded, transcribed, and translated by H. C. Wolfart in collaboration with a native speaker of Nehiyawewin, provide natural-speech data for the study. Since it is difficult for a non-native-speaker to reliably distinguish Nehiyawewin constituents, an intermediary is needed. The transcription provides this intermediary through punctuation marks (commas, semi-colons, em-dashes, periods), which have been shown to consistently mark constituency structure [Nunberg, CSLI 1990]. The acoustic cues are thus mapped onto the punctuated constituents, and then similar constituents are compared to see what acoustic cues they share. Preliminarily, the clearest acoustic signal to a constituent boundary is a pitch drop preceding the boundary and/or a pitch reset on the syllable following the boundary. Further, constituent boundaries marked by a period consistently end on a low pitch, are followed by a pitch reset of 30-90 Hz and have an average pause of 1.9 seconds. I also discuss cross-speaker cues, and prosodic cues that do not correlate to punctuation, with implications for the transcriptional view of orthography [Marckwardt, Oxford 1942].

  3. From "They" Science to "Our" Science: Hip Hop Epistemology in STEAM Education

    Science.gov (United States)

    Dolberry, Maurice E.

    Hip hop has moved from being considered a type of music into being understood as a culture in which a prominent type of music originates. Hip hop culture has a philosophy and epistemological constructs as well. This study analyzed those constructs to determine how conceptions of science factor in hip hop worldviews. Pedagogical models in culturally responsive teaching and Science, Technology, Engineering, Arts, and Mathematics (STEAM) education were also examined to discern their philosophical connections with hip hop culture. These connections were used to create two theoretical models. The first one, Hip Hop Science, described how scientific thought functions in hip hop culture. The second model, Hip Hop STEAM Pedagogy, proposes how hip hop culture can inform STEAM teaching practices. The study began by using Critical Race Theory to create a theoretical framework proposing how the two theoretical models could be derived from the philosophical and pedagogical concepts. Content analysis and narrative inquiry were used to analyze data collected from scholarly texts, hip hop songs, and interviews with hip hop-responsive educators. The data from these sources were used initially to assess the adequacy of the proposed theoretical framework, and subsequently to improve its viability. Four overlapping themes emerged from the data analyses, including hip hop-resistance to formal education; how hip hop culture informs pedagogical practice in hip hop-responsive classrooms; conceptions of knowledge and reality that shape how hip hoppers conduct scientific inquiry; and hip hop-based philosophies of effective teaching for hip hoppers as a marginalized cultural group. The findings indicate that there are unique connections between hip hop epistemology, sciencemindedness, and pedagogical practices in STEAM education. The revised theoretical framework clarified the nature of these connections, and supported claims from prior research that hip hop culture provides viable sites of

  4. Mic Power? Connections and the hip hop nation in Kampala, Uganda

    DEFF Research Database (Denmark)

    Schneidermann, Nanna

    2014-01-01

    Hip hop culture has been celebrated in the media and scholarship as a universal youth language, part of a global hip hop nation, and a type of counter-public. This article examines the everyday meanings and practices of hip hop among hip hop activists in Kampala, Uganda, specifically within...... the Batuuze rap group. Rather than portraying hip hop as a counter-public of the disempowered, I argue that the Batuuze engagement is based on what I call moral economy that enables the negotiation of connections in social and cultural networks towards what is considered a good life. Here, the hip hop nation...

  5. Hip Hop Dance Experience Linked to Sociocognitive Ability.

    Directory of Open Access Journals (Sweden)

    Justin W Bonny

    Full Text Available Expertise within gaming (e.g., chess, video games and kinesthetic (e.g., sports, classical dance activities has been found to be linked with specific cognitive skills. Some of these skills, working memory, mental rotation, problem solving, are linked to higher performance in science, technology, math, and engineering (STEM disciplines. In the present study, we examined whether experience in a different activity, hip hop dance, is also linked to cognitive abilities connected with STEM skills as well as social cognition ability. Dancers who varied in hip hop and other dance style experience were presented with a set of computerized tasks that assessed working memory capacity, mental rotation speed, problem solving efficiency, and theory of mind. We found that, when controlling for demographic factors and other dance style experience, those with greater hip hop dance experience were faster at mentally rotating images of hands at greater angle disparities and there was a trend for greater accuracy at identifying positive emotions displayed by cropped images of human faces. We suggest that hip hop dance, similar to other more technical activities such as video gameplay, tap some specific cognitive abilities that underlie STEM skills. Furthermore, we suggest that hip hop dance experience can be used to reach populations who may not otherwise be interested in other kinesthetic or gaming activities and potentially enhance select sociocognitive skills.

  6. Hip Hop Dance Experience Linked to Sociocognitive Ability.

    Science.gov (United States)

    Bonny, Justin W; Lindberg, Jenna C; Pacampara, Marc C

    2017-01-01

    Expertise within gaming (e.g., chess, video games) and kinesthetic (e.g., sports, classical dance) activities has been found to be linked with specific cognitive skills. Some of these skills, working memory, mental rotation, problem solving, are linked to higher performance in science, technology, math, and engineering (STEM) disciplines. In the present study, we examined whether experience in a different activity, hip hop dance, is also linked to cognitive abilities connected with STEM skills as well as social cognition ability. Dancers who varied in hip hop and other dance style experience were presented with a set of computerized tasks that assessed working memory capacity, mental rotation speed, problem solving efficiency, and theory of mind. We found that, when controlling for demographic factors and other dance style experience, those with greater hip hop dance experience were faster at mentally rotating images of hands at greater angle disparities and there was a trend for greater accuracy at identifying positive emotions displayed by cropped images of human faces. We suggest that hip hop dance, similar to other more technical activities such as video gameplay, tap some specific cognitive abilities that underlie STEM skills. Furthermore, we suggest that hip hop dance experience can be used to reach populations who may not otherwise be interested in other kinesthetic or gaming activities and potentially enhance select sociocognitive skills.

  7. Discrimination of different hop varieties using headspace gas chromatographic data

    Directory of Open Access Journals (Sweden)

    Jorge Katia

    2003-01-01

    Full Text Available Methods for characterization of hop varieties include analyses of bitter acids and essential oils, followed by comparison of the chemical composition, particularly chromatographic profiles. In the present work discrimination of different hop varieties was carried out based on their essential oil volatile composition, assessed by headspace gas chromatography, with subsequent statistical treatment of the data. Differences and similarities were determined in samples from USA, New Zealand and Europe, using correlation and cluster analysis. Aroma hops presented low levels of myrcene while bitter samples showed high levels of beta-caryophyllene, aloaromadendrene and also the sum of the marker ratios, independently of being in the form of pellets or extracts. Highly correlated samples with no significant differences have good possibility to substitute each other in the beer manufacture.

  8. Switched diversity strategies for dual-hop relaying systems

    KAUST Repository

    Gaaloul, Fakhreddine

    2011-04-29

    This paper investigates the effect of different switched diversity configurations on the implementation complexity and achieved performance of dual-hop amplify-and-forward (AF) relaying networks. A low-complexity model of the relay station is adopted, wherein single-input single-output antenna configuration is employed. Each of the transmitter and the receiver however employs multiple antennas to improve the overall link performance. Single-phase and two-phase based receive switching strategies are investigated assuming optimum first hop signal-to-noise ratio (SNR). Moreover, the simple scheme in which the switched diversity is applied independently over the two hops is studied using tight upper bounds. Thorough performance comparisons and switching thresholds optimization for the aforementioned strategies are presented. Simulation results are also provided to validate the mathematical development and to verify the numerical computations.

  9. Lattice Gauge Quantum Simulation via State-Dependent Hopping

    DEFF Research Database (Denmark)

    Salami Dehkharghani, Amin

    2017-01-01

    We develop a quantum simulator architecture that is suitable for the simulation of U(1) Abelian gauge theories such as quantum electrodynamics. Our approach relies on the ability to control the hopping of a particle through a barrier by means of the internal quantum states of a neutral or charged...... impurity-particle sitting at the barrier. This scheme is highly experimentally feasible, as the correlated hopping does not require fine-tuning of the intra- and inter-species interactions. We investigate the applicability of the scheme in a double well potential, which is the basic building block...

  10. Information structure in Wichí: focus marker hop

    OpenAIRE

    Ekaterina Levina

    2013-01-01

    Abstract: The present paper provides an overview of the functions of the morphological focus marker hop in the grammar of Wichí, a Mataco-Mataguayan language spoken in the North of Argentina and the South of Bolivia. Basing the analysis on the corpus which I have compiled from the existing research which has been published on the language so far, we can conclude that the focus marker hop can but does not have to be used for the focusing of the subject, object, predicate, adverbial as well as ...

  11. Starting with Style: Toward a Second Wave of Hip-Hop Education Research and Practice

    Science.gov (United States)

    Petchauer, Emery

    2015-01-01

    One fundamental breakthrough in the field of hip-hop education in recent years is the shift from understanding hip-hop solely as content to understanding hip-hop also as aesthetic form. In this article, I chart the roots of this shift across disciplines and focus on what it might mean for the future of hip-hop education, pedagogy, and research in…

  12. Suppression of Plant Immune Responses by the Pseudomonas savastanoi pv. savastanoi NCPPB 3335 Type III Effector Tyrosine Phosphatases HopAO1 and HopAO2

    Science.gov (United States)

    Castañeda-Ojeda, María Pilar; Moreno-Pérez, Alba; Ramos, Cayo; López-Solanilla, Emilia

    2017-01-01

    The effector repertoire of the olive pathogen P. savastanoi pv. savastanoi NCPPB 3335 includes two members of the HopAO effector family, one of the most diverse T3E families of the P. syringae complex. The study described here explores the phylogeny of these dissimilar members, HopAO1 and HopAO2, among the complex and reveals their activities as immune defense suppressors. Although HopAO1 is predominantly encoded by phylogroup 3 strains isolated from woody organs of woody hosts, both HopAO1 and HopAO2 are phylogenetically clustered according to the woody/herbaceous nature of their host of isolation, suggesting host specialization of the HopAO family across the P. syringae complex. HopAO1 and HopAO2 translocate into plant cells and show hrpL-dependent expression, which allows their classification as actively deployed type III effectors. Our data also show that HopAO1 and HopAO2 possess phosphatase activity, a hallmark of the members of this family. Both of them exert an inhibitory effect on early plant defense responses, such as ROS production and callose deposition, and are able to suppress ETI responses induced by the effectorless polymutant of P. syringae pv. tomato DC3000 (DC3000D28E) in Nicotiana. Moreover, we demonstrate that a ΔhopAO1 mutant of P. savastanoi NCPBB 3335 exhibits a reduced fitness and virulence in olive plants, which supports the relevance of this effector during the interaction of this strain with its host plants. This work contributes to the field with the first report regarding functional analysis of HopAO homologs encoded by P. syringae or P. savastanoi strains isolated from woody hosts. PMID:28529516

  13. Localization of networks with presence and distance constraints based on 1-hop and 2-hop mass–spring optimization

    Directory of Open Access Journals (Sweden)

    Gabriele Oliva

    2016-03-01

    Full Text Available In this paper we consider the localization of a sensor network where the nodes are heterogeneous, in that some of them are able to measure the distance from their neighbors, while some others are just able to detect their presence, and we provide a post-processing algorithm that can be used to improve an initial estimate for the location of the nodes, based on a mass–spring optimization approach, taking into account presence and distance information, as well as one-hop and two-hop information.

  14. Flipping the Misogynist Script: Gender, Agency, Hip Hop and Music Education

    Science.gov (United States)

    Tobias, Evan S.

    2014-01-01

    Excluding Hip Hop culture and rap music from music education misses opportunities for addressing key aspects of popular culture, society, and students' lives. This article addresses intersections of Hip Hop, gender, and music education to forward potential Hip Hop praxis. After tracing related scholarship, I discuss and problematize…

  15. Behind Beats and Rhymes: Working Class from a Hampton Roads Hip Hop Homeplace

    Science.gov (United States)

    Durham, Aisha S.

    2009-01-01

    The film documentary titled "Hip Hop: beyond beats and rhymes" captures ongoing conversations among scholars, cultural critics, and hip hop insiders about the state of African Americans by interrogating distinct expressive forms associated with hip hop culture. Durham draws from two scenes to describe her memories as the researched…

  16. "Deeper than Rap": Gifted Males and Their Relationship with Hip Hop Culture

    Science.gov (United States)

    Callahan, J. Sean; Grantham, Tarek C.

    2012-01-01

    One would be hard-pressed to deny the impact that hip hop is having on gifted students. More specifically, because hip hop is a creative and exciting male-dominated culture, gifted males gravitate to hip hop culture. From the perspective of two Black men from two different generations, this article was inspired by discussions about the role of hip…

  17. Beats, Rhymes, and Classroom Life: Hip-Hop Pedagogy and the Politics of Identity

    Science.gov (United States)

    Hill, Marc Lamont

    2009-01-01

    For over a decade, educators have looked to capitalize on the appeal of hip-hop culture, sampling its language, techniques, and styles as a way of reaching out to students. But beyond a fashionable hipness, what does hip-hop have to offer our schools? In this revelatory new book, Marc Lamont Hill shows how a serious engagement with hip-hop culture…

  18. Wish to Live: The Hip-Hop Feminism Pedagogy Reader. Educational Psychology. Volume 3

    Science.gov (United States)

    Brown, Ruth Nicole, Ed.; Kwakye, Chamara Jewel, Ed.

    2012-01-01

    "Wish To Live: The Hip-hop Feminism Pedagogy Reader" moves beyond the traditional understanding of the four elements of hip-hop culture--rapping, breakdancing, graffiti art, and deejaying--to articulate how hip-hop feminist scholarship can inform educational practices and spark, transform, encourage, and sustain local and global youth…

  19. [Chemical constituents in Buddleja albiflora].

    Science.gov (United States)

    Tao, Liang; Huang, Jincheng; Zhao, Yanping; Li, Chong

    2009-12-01

    To study the chemical constituents of Buddleja albiflora. The constituents were isolated by column chromatography and their structures were elucidated by spectroscopic methods. Eleven compounds were isolated and identified as luteolin (1), quercetin (2), quercetin-3-O-beta-D-glucopyranoside (3), apigenin (4), apigenin-7-O-beta-D-glucopyranoside (5), apigenin-7-O-neohesperidoside (6), acacetin-7-O-beta-L-rhamnopyranosyl-(1-6)-beta-D-glucopyranoside (7), cranioside A (8), acetylmartynoside B (9), 4"-O-acetylmartynoside (10), isomartynoside (11). All these compounds were obtained from B. albiflora for the first time and compound 8 was obtained from the genus Buddleja for the first time.

  20. [Chemical constituents from Pholidota cantonensis].

    Science.gov (United States)

    Li, Bin; Gao, Jie-ying; Li, Juan; Chen, Yu-yan; Li, Shun-xiang

    2014-06-01

    To isolate and elucidate the constituents from whole plant of Pholidota cantonensis. The constituents were isolated and purified by silica gel, Sephadex LH-20 and MCI gel chromatography and recrystallization. The structures were elucida- ted on the basis of the chemical evidence and spectroscopic data. Ten compounds were obtained : batatasin ll(1), orchinol(2), ephmeranthoquinone(3 ), densiflorol B (4) , 3, 5-dimethoxy-4-hydroxy-propiophenone (5) , cinnamic acid (6) , syringaresinol (7) ,24- methylenencycoartanol( 8),ergosterol peroxide(9) and β-sitosterol( 10). Compounds 6 and 9 are isolated from Pholidota genus for the first time,and compounds 4,5 and 7 are isolated from this plant for the first time.

  1. Investigación a ritmo de hip-hop

    Directory of Open Access Journals (Sweden)

    Melisa Rivière

    2013-09-01

    Full Text Available Soñando se resiste. Hip-hop; en la calle y al parque. Varios autores. Alcaldía Mayor de Bogotá, Secretaría de Cultura, Recreación y Deporte, Orquesta Filarmónica de Bogotá, Bogotá, 2010, 180 págs.

  2. Three-Dimensional Tracking of Interfacial Hopping Diffusion

    Science.gov (United States)

    Wang, Dapeng; Wu, Haichao; Schwartz, Daniel K.

    2017-12-01

    Theoretical predictions have suggested that molecular motion at interfaces—which influences processes including heterogeneous catalysis, (bio)chemical sensing, lubrication and adhesion, and nanomaterial self-assembly—may be dominated by hypothetical "hops" through the adjacent liquid phase, where a diffusing molecule readsorbs after a given hop according to a probabilistic "sticking coefficient." Here, we use three-dimensional (3D) single-molecule tracking to explicitly visualize this process for human serum albumin at solid-liquid interfaces that exert varying electrostatic interactions on the biomacromolecule. Following desorption from the interface, a molecule experiences multiple unproductive surface encounters before readsorption. An average of approximately seven surface collisions is required for the repulsive surfaces, decreasing to approximately two and a half for surfaces that are more attractive. The hops themselves are also influenced by long-range interactions, with increased electrostatic repulsion causing hops of longer duration and distance. These findings explicitly demonstrate that interfacial diffusion is dominated by biased 3D Brownian motion involving bulk-surface coupling and that it can be controlled by influencing short- and long-range adsorbate-surface interactions.

  3. Interference-based routing in multi-hop wireless infrastructures

    NARCIS (Netherlands)

    Heijenk, Geert; Liu, F.; Braun, Torsten; Carle, Georg; Koucheryavy, Yevgeni; Tsaoussidis, Vassilis

    In this paper, multi-hop wireless infrastructures are identified as a way to increase user data rates and/or capacity of wireless systems by means of a high base station density without high base station interconnection costs. For such a system, a new routing algorithm, named Balanced Interference

  4. Maroc-hop: music and youth identities in the Netherlands

    NARCIS (Netherlands)

    Gazzah, M.; Herrera, L.; Bayat, A.

    2010-01-01

    Two musical forms highly popular among youths of Moroccan origin in the Netherlands—Maroc-hop and Shaabi—permit youths to express specific and multiple identities in local contexts. Shaabi, a popular form of Moroccan folk music used to be found mainly in the private setting of family celebrations,

  5. Contribution of afferent feedback and descending drive to human hopping

    DEFF Research Database (Denmark)

    Zuur, Abraham T.; Lundbye-Jensen, Jesper; Leukel, Christian

    2010-01-01

    During hopping an early burst can be observed in the EMG from the soleus muscle starting about 45 ms after touch-down. It may be speculated that this early EMG burst is a stretch reflex response superimposed on activity from a supra-spinal origin. We hypothesised that if a stretch reflex indeed c...

  6. Potential African Substitutes for Hops in Tropical Beer Brewing

    African Journals Online (AJOL)

    1' Department of Food Science and Nutrition, E.N.S.A.I.. P. O. Box. 455, University ofNgaoundere, Cameroon. 2' Department of Food Technology, Faculty of Technology, University of Ibadan, Nigeria. "Corresponding author. Abstract. The potential ... Industry (Hough er dl., 1982, Grant,. 1977). Hops contribute to foam stability.

  7. Molecular mechanisms of Tetranychus urticae chemical adaptation in hop fields.

    Science.gov (United States)

    Piraneo, Tara G; Bull, Jon; Morales, Mariany A; Lavine, Laura C; Walsh, Douglas B; Zhu, Fang

    2015-12-01

    The two-spotted spider mite, Tetranychus urticae Koch is a major pest that feeds on >1,100 plant species. Many perennial crops including hop (Humulus lupulus) are routinely plagued by T. urticae infestations. Hop is a specialty crop in Pacific Northwest states, where 99% of all U.S. hops are produced. To suppress T. urticae, growers often apply various acaricides. Unfortunately T. urticae has been documented to quickly develop resistance to these acaricides which directly cause control failures. Here, we investigated resistance ratios and distribution of multiple resistance-associated mutations in field collected T. urticae samples compared with a susceptible population. Our research revealed that a mutation in the cytochrome b gene (G126S) in 35% tested T. urticae populations and a mutation in the voltage-gated sodium channel gene (F1538I) in 66.7% populations may contribute resistance to bifenazate and bifenthrin, respectively. No mutations were detected in Glutamate-gated chloride channel subunits tested, suggesting target site insensitivity may not be important in our hop T. urticae resistance to abamectin. However, P450-mediated detoxification was observed and is a putative mechanism for abamectin resistance. Molecular mechanisms of T. urticae chemical adaptation in hopyards is imperative new information that will help growers develop effective and sustainable management strategies.

  8. Interference-based routing in multi-hop wireless infrastructures

    NARCIS (Netherlands)

    Heijenk, Geert; Liu, F.; Braun, T.; Carle, G.; Koucheryavy, Y.; Tsaoussidis, V.

    In this paper, multi-hop wireless infrastructures are identified as a way to increase user data rates and/or capacity of wireless systems by means of a high base station density without high base station interconnection costs. For such a system, a new routing algorithm, named balanced interference

  9. Hopping in a supercooled binary Lennard-Jones liquid

    DEFF Research Database (Denmark)

    Schrøder, Thomas; Dyre, Jeppe

    1998-01-01

    A binary Lennard–Jones liquid has been investigated by molecular dynamics at equilibrium supercooled conditions. At the lowest temperature investigated, hopping is present in the system as indicated by a secondary peak in 4r2Gs(r,t), where Gs(r,t) is the van Hove self correlation function...

  10. Young Children Manifest Spiritualities in Their Hip-Hop Writing

    Science.gov (United States)

    Norton, Nadjwa E. L.

    2014-01-01

    In this article, the author combines multicultural feminist critical theories with the voices of Black and Latina/Latino young spiritual children to extend culturally responsive teaching. The author illuminates how children use their hip-hop writing to construct themselves as people who communicate with God, choose spiritual content for their…

  11. Examining Hip-Hop as Culturally Relevant Pedagogy

    Science.gov (United States)

    Kim, Jung; Pulido, Isaura

    2015-01-01

    Culturally relevant pedagogy is a framework that conceptualizes the process of student learning as contingent upon educators' deep understanding of students' cultural backgrounds to co-construct knowledge and develop academic skills. Concurrently, there are a growing number of studies that explore hip-hop as a culturally relevant curriculum for…

  12. Morphological and control criteria for self-stable underwater hopping.

    Science.gov (United States)

    Calisti, Marcello; Laschi, Cecilia

    2017-10-04

    This paper presents the self-stabilisation features of a hopping gait during underwater legged locomotion. We used a bio-inspired fundamental model of this gait, the underwater spring-loaded inverted pendulum model, to numerically derive quantitative (dimension of the basin of attraction, Floquet multipliers, mean horizontal speed) and qualitative (shape of the basin) features which characterise the self-stability of the system. Furthermore, we compared the results obtained with a terrestrial self-stable running model (i.e. the spring-loaded inverted pendulum with swing-leg retraction) to highlight the role of water-related components in relation to dynamic legged locomotion. The analysis revealed fundamental morphological and actuation parameters that could be used to design self-stabilising underwater hopping machines, as well as elucidating their role with respect to stability and speed. Underwater hopping is a simple and reliable locomotion, as it does not require complex control feedback to reject significant disturbances. Thanks to its high self-stabilising property, underwater hopping appears to be a reliable alternative locomotion for underwater robots. © 2017 IOP Publishing Ltd.

  13. Exact results on the steady state of a hopping model

    Science.gov (United States)

    Zhang, M. Q.

    1987-03-01

    A hopping model described by Katz, Lebowitz, and Spohn [J. Stat. Phys. 34, 497 (1983)] and by Valles and Marro [J. Stat. Phys. 43, 441 (1986)] is studied analytically for small lattice systems. The dependence of the nonequilibrium steady state on various parameters and transition rate functions is obtained exactly. The results are compared with simulations on large systems.

  14. Range and energetics of charge hopping in organic semiconductors

    Science.gov (United States)

    Abdalla, Hassan; Zuo, Guangzheng; Kemerink, Martijn

    2017-12-01

    The recent upswing in attention for the thermoelectric properties of organic semiconductors (OSCs) adds urgency to the need for a quantitative description of the range and energetics of hopping transport in organic semiconductors under relevant circumstances, i.e., around room temperature (RT). In particular, the degree to which hops beyond the nearest neighbor must be accounted for at RT is still largely unknown. Here, measurements of charge and energy transport in doped OSCs are combined with analytical modeling to reach the univocal conclusion that variable-range hopping is the proper description in a large class of disordered OSC at RT. To obtain quantitative agreement with experiment, one needs to account for the modification of the density of states by ionized dopants. These Coulomb interactions give rise to a deep tail of trap states that is independent of the material's initial energetic disorder. Insertion of this effect into a classical Mott-type variable-range hopping model allows one to give a quantitative description of temperature-dependent conductivity and thermopower measurements on a wide range of disordered OSCs. In particular, the model explains the commonly observed quasiuniversal power-law relation between the Seebeck coefficient and the conductivity.

  15. Chicano Hip-Hop as Interethnic Contact Zone

    Science.gov (United States)

    McFarland, Pancho

    2008-01-01

    Hip-hop is an interethnic contact zone that allows for the creation of new expressive cultures and new identities for young people. Its openness derives in part from the wide range of expression and interpretation allowed in 182 "McFarland" African musics. Moving beyond the often stifling options offered by an earlier generation that focused on…

  16. Surface hopping modeling of two-dimensional spectra

    NARCIS (Netherlands)

    Tempelaar, Roel; Vegte, Cornelis P. van der; Knoester, Jasper; Jansen, Thomas L.C.

    2013-01-01

    Recently, two-dimensional (2D) electronic spectroscopy has become an important tool to unravel the excited state properties of complex molecular assemblies, such as biological light harvesting systems. In this work, we propose a method for simulating 2D electronic spectra based on a surface hopping

  17. Multiple-hopping trajectories near a rotating asteroid

    Science.gov (United States)

    Shen, Hong-Xin; Zhang, Tian-Jiao; Li, Zhao; Li, Heng-Nian

    2017-03-01

    We present a study of the transfer orbits connecting landing points of irregular-shaped asteroids. The landing points do not touch the surface of the asteroids and are chosen several meters above the surface. The ant colony optimization technique is used to calculate the multiple-hopping trajectories near an arbitrary irregular asteroid. This new method has three steps which are as follows: (1) the search of the maximal clique of candidate target landing points; (2) leg optimization connecting all landing point pairs; and (3) the hopping sequence optimization. In particular this method is applied to asteroids 433 Eros and 216 Kleopatra. We impose a critical constraint on the target landing points to allow for extensive exploration of the asteroid: the relative distance between all the arrived target positions should be larger than a minimum allowed value. Ant colony optimization is applied to find the set and sequence of targets, and the differential evolution algorithm is used to solve for the hopping orbits. The minimum-velocity increment tours of hopping trajectories connecting all the landing positions are obtained by ant colony optimization. The results from different size asteroids indicate that the cost of the minimum velocity-increment tour depends on the size of the asteroids.

  18. THE EFFECTS OF SINGLE LEG HOP PROGRESSION AND DOUBLE LEGS HOP PROGRESSION EXERCISE TO INCREASE SPEED AND EXPLOSIVE POWER OF LEG MUSCLE

    Directory of Open Access Journals (Sweden)

    Nining W. Kusnanik

    2015-05-01

    Full Text Available The main purpose of this study was to determine the effect of single leg hop progression and double legs hop progression exercise to increase speed and explosive power of leg muscles. Plyometric is one of the training methods that can increase explosive power. There are many models of plyometric training including single leg hop progression and double leg hop progression. This research was experimental using match subject design techniques. The subjects of this study were 39 students who joined basketball school club. There were 3 groups in this study: Group 1 were 13 students who given sin¬gle leg hop progression exercise, Group 2 were 13 students who given double legs hop progression exercise, Group 3 were 13 students who given conventional exercise. The data was collected during pre test and post test by testing 30m speed running and vertical jump. The data was analyzed using Analysis of Varians (Anova. It was found that there were significantly increased on speed and explosive power of leg muscles of Group 1 and Group 2. It can be stated that single leg hop progression exercise was more effective than double leg hop progression exercise. The recent findings supported the hypothesis that single leg hop progression and double legs hop progression exercise can increase speed and explosive power of leg muscles. These finding were supported by some previous studies (Singh, et al, 2011; Shallaby, H.K., 2010. The single leg hop progression is more effective than double legs hop progression. This finding was consistent with some previous evidences (McCurdy, et al, 2005; Makaruk et al, 2011.

  19. Hop pellets as an interesting source of antioxidant active compounds

    Directory of Open Access Journals (Sweden)

    Andrea Holubková

    2013-02-01

    Full Text Available Hop is a plant used by humankind for thousands of years. This plant is one of the main and indispensable raw materials for the beer production. It is used for various dishes preparation in the cuisine. Hop is also used to inhibit bacterial contamination. The hop extracts are used for its sedative, antiseptic and antioxidant properties in medicine, as a part of many phytopharmaceuticals. The present paper have focused on the extraction of polyphenolic compounds from 4 samples of hop pellets varieties of Aurora, Saaz, Lublin and Saphir, on the analyzing of bioactive substances (polyphenolics and flavonoids in prepared extracts and on the determination of antioxidant activity.  The highest content of polyphenolic substances was determined in the sample Lublin (153.06 mg gallic acid (GAE/g and Saaz (151.87 mg GAE/g. The amount of flavonoids in the samples  was descending order Saaz > Saphir > Aurora > Lublin. Hops, as plant, is known by high content of antioxidant active substances. Antioxidant activity was determined using three independent spectrofotometric methods, radical scavenging assays using 2,2′-azino-bis-3-ethylbenzthiazoline-6-sulphonic acid (ABTS and 1,1-diphenyl-2-picrylhydrazyl (DPPH radical and ferric reducing antioxidant power (FRAP. The sample Aurora showed the highest ability to scavenge of ABTS radical cation. Antioxidant activity continued to decline in a row Saphir> Lublin> Saaz. The same trend was also observed by using the FRAP assay. The most effective DPPH radical scavengering activity had the sample Saaz a Saphir (p>0.05.doi:10.5219/270 Normal 0 21 false false false SK X-NONE X-NONE

  20. Antifungal constituents of Melicope borbonica

    DEFF Research Database (Denmark)

    Simonsen, Henrik Toft; Adsersen, Anne; Bremner, Paul

    2004-01-01

    , as the major constituents. All three compounds exhibited moderate antifungal activity against Candida albicans and Penicillium expansum, in accordance with the traditional use of the plant. Moreover, 2,4,6-trimethoxyacetophenone (methylxanthoxylin), three other coumarins [7-(3-methyl-2-butenyloxy)-6...

  1. Immunomodulation by the Pseudomonas syringae HopZ type III effector family in Arabidopsis.

    Directory of Open Access Journals (Sweden)

    Jennifer D Lewis

    Full Text Available Pseudomonas syringae employs a type III secretion system to inject 20-30 different type III effector (T3SE proteins into plant host cells. A major role of T3SEs is to suppress plant immune responses and promote bacterial infection. The YopJ/HopZ acetyltransferases are a superfamily of T3SEs found in both plant and animal pathogenic bacteria. In P. syringae, this superfamily includes the evolutionarily diverse HopZ1, HopZ2 and HopZ3 alleles. To investigate the roles of the HopZ family in immunomodulation, we generated dexamethasone-inducible T3SE transgenic lines of Arabidopsis for HopZ family members and characterized them for immune suppression phenotypes. We show that all of the HopZ family members can actively suppress various facets of Arabidopsis immunity in a catalytic residue-dependent manner. HopZ family members can differentially suppress the activation of mitogen-activated protein (MAP kinase cascades or the production of reactive oxygen species, whereas all members can promote the growth of non-virulent P. syringae. Localization studies show that four of the HopZ family members containing predicted myristoylation sites are localized to the vicinity of the plasma membrane while HopZ3 which lacks the myristoylation site is at least partially nuclear localized, suggesting diversification of immunosuppressive mechanisms. Overall, we demonstrate that despite significant evolutionary diversification, all HopZ family members can suppress immunity in Arabidopsis.

  2. The content of vitamine E in hop cones of the Saaz variety

    Directory of Open Access Journals (Sweden)

    Helena Pluháčková

    2013-01-01

    Full Text Available The activity of vitamin E, total content of tocols and the content of individual isomers: α-tocopherols, β-tocopherols, γ-tocopherols and δ-tocopherols was monitored in samples of hop cones of the world-important Saaz variety. Hop cone samples originated from hop-breeding area Tršice, Czech Republic. The method used for the determination of vitamin E in barley was modified and used for this quantitative analysis. The results indicate that monitored characteristics are influenced by the year of harvest (2010 or 2011 but also by the age of hop-gardens (hop bucks. High values of vitamin E activity (up to 67.79 mg.kg−1 and total content of tocols (up to 76.31 mg.kg−1 in hop cones are worth further attention from the viewpoint of alternative use of hops.

  3. Information structure in Wichí: focus marker hop

    Directory of Open Access Journals (Sweden)

    Ekaterina Levina

    2013-12-01

    Full Text Available Abstract: The present paper provides an overview of the functions of the morphological focus marker hop in the grammar of Wichí, a Mataco-Mataguayan language spoken in the North of Argentina and the South of Bolivia. Basing the analysis on the corpus which I have compiled from the existing research which has been published on the language so far, we can conclude that the focus marker hop can but does not have to be used for the focusing of the subject, object, predicate, adverbial as well as on entire dependent clauses in the language. The focus marker hop can express both the informational focus as well as the contrastive focus. In the case of predicate focusing the verum-focus can also be marked and the focus marker can scope over the complex predicate. Key words: Wichí; Languages of America; Information structure; Focus marker.  Resumo: O presente artigo fornece uma visão geral das funções do marcador morfológico hop na gramática de Wichí, uma linguagem Mataco-Mataguayan falada no norte da Argentina e no sul da Bolívia. Com base na análise do corpus que compilamos a partir das pesquisas existentes e publicadas sobre a língua até agora, podemos concluir que o marcador de foco hop pode, mas não tem que, necessariamente, ser usado para o foco no sujeito, objeto, predicado, advérbio, bem como nas cláusulas inteiramente dependentes na língua. O marcador de foco hop pode expressar tanto o foco informacional quanto o foco contrastante. No caso do predicado com foco no verum-foco, também pode ser marcado e o marcador de foco sobre o predicado complexo pode se estender. Palavras-chave: Wichí; idiomas da América; estrutura de informação; marcador de foco.  Resumen: El articulo presentado ofrece una descripción general de las funciones del marcador morfológico de foco hop en la gramática de la lengua Wichí, hablada en el Norte de Argentina y el Sur de Bolivia. El presente análisis hecho a base del corpus formado de

  4. Respiratory disease associated with occupational inhalation to hop (Humulus lupulus) during harvest and processing.

    Science.gov (United States)

    Reeb-Whitaker, Carolyn K; Bonauto, David K

    2014-11-01

    There is little published evidence for occupational respiratory disease caused by hop dust inhalation. In the United States, hops are commercially produced in the Pacific Northwest region. To describe occupational respiratory disease in hop workers. Washington State workers' compensation claims filed by hop workers for respiratory disease were systematically identified and reviewed. Incidence rates of respiratory disease in hop workers were compared with rates in field vegetable crop farm workers. Fifty-seven cases of respiratory disease associated with hop dust inhalation were reported from 1995 to 2011. Most cases (61%) were diagnosed by the attending health care practitioner as having work-related asthma. Seven percent of cases were diagnosed as chronic obstructive pulmonary disease, and the remaining cases were diagnosed as allergic respiratory disorders (eg, allergic rhinitis) or asthma-associated symptoms (eg, dyspnea). Cases were associated with hop harvesting, secondary hop processing, and indirect exposure. The incidence rate of respiratory disease in hop workers was 15 cases per 10,000 full-time workers, which was 30 times greater than the incidence rate for field vegetable crop workers. A strong temporal association between hop dust exposure and respiratory symptoms and a clear association between an increase in hop dust concentrations and the clinical onset of symptoms were apparent in 3 cases. Occupational exposure to hop dust is associated with respiratory disease. Respiratory disease rates were higher in hop workers than in a comparison group of agricultural workers. Additional research is needed before hop dust can be confirmed as a causative agent for occupational asthma. Copyright © 2014 American College of Allergy, Asthma & Immunology. Published by Elsevier Inc. All rights reserved.

  5. Fast frequency hopping codes applied to SAC optical CDMA network

    Science.gov (United States)

    Tseng, Shin-Pin

    2015-06-01

    This study designed a fast frequency hopping (FFH) code family suitable for application in spectral-amplitude-coding (SAC) optical code-division multiple-access (CDMA) networks. The FFH code family can effectively suppress the effects of multiuser interference and had its origin in the frequency hopping code family. Additional codes were developed as secure codewords for enhancing the security of the network. In considering the system cost and flexibility, simple optical encoders/decoders using fiber Bragg gratings (FBGs) and a set of optical securers using two arrayed-waveguide grating (AWG) demultiplexers (DeMUXs) were also constructed. Based on a Gaussian approximation, expressions for evaluating the bit error rate (BER) and spectral efficiency (SE) of SAC optical CDMA networks are presented. The results indicated that the proposed SAC optical CDMA network exhibited favorable performance.

  6. Mixed quantum-classical equilibrium in global flux surface hopping.

    Science.gov (United States)

    Sifain, Andrew E; Wang, Linjun; Prezhdo, Oleg V

    2015-06-14

    Global flux surface hopping (GFSH) generalizes fewest switches surface hopping (FSSH)—one of the most popular approaches to nonadiabatic molecular dynamics—for processes exhibiting superexchange. We show that GFSH satisfies detailed balance and leads to thermodynamic equilibrium with accuracy similar to FSSH. This feature is particularly important when studying electron-vibrational relaxation and phonon-assisted transport. By studying the dynamics in a three-level quantum system coupled to a classical atom in contact with a classical bath, we demonstrate that both FSSH and GFSH achieve the Boltzmann state populations. Thermal equilibrium is attained significantly faster with GFSH, since it accurately represents the superexchange process. GFSH converges closer to the Boltzmann averages than FSSH and exhibits significantly smaller statistical errors.

  7. Mixed quantum-classical equilibrium in global flux surface hopping

    Energy Technology Data Exchange (ETDEWEB)

    Sifain, Andrew E. [Department of Physics and Astronomy, University of Southern California, Los Angeles, California 90089-0485 (United States); Wang, Linjun; Prezhdo, Oleg V. [Department of Chemistry, University of Southern California, Los Angeles, California 90089-1062 (United States)

    2015-06-14

    Global flux surface hopping (GFSH) generalizes fewest switches surface hopping (FSSH)—one of the most popular approaches to nonadiabatic molecular dynamics—for processes exhibiting superexchange. We show that GFSH satisfies detailed balance and leads to thermodynamic equilibrium with accuracy similar to FSSH. This feature is particularly important when studying electron-vibrational relaxation and phonon-assisted transport. By studying the dynamics in a three-level quantum system coupled to a classical atom in contact with a classical bath, we demonstrate that both FSSH and GFSH achieve the Boltzmann state populations. Thermal equilibrium is attained significantly faster with GFSH, since it accurately represents the superexchange process. GFSH converges closer to the Boltzmann averages than FSSH and exhibits significantly smaller statistical errors.

  8. Stationary Currents in Particle Systems with Constrained Hopping Rates

    Science.gov (United States)

    Cirillo, Emilio N. M.; Colangeli, Matteo; Muntean, Adrian

    2016-04-01

    We study the effect on the stationary currents of constraints affecting the hopping rates in stochastic particle systems. In the framework of zero range processes with drift within a finite volume, we discuss how the current is reduced by the presence of the constraint and deduce exact formulae, fully explicit in some cases. The model discussed here has been introduced by Cirillo et al. (Does communication enhance pedestrians transport in the dark? To appear in C. R. Mécanique 344 (2016), 19-23) and is relevant for the description of pedestrian motion in elongated dark corridors, where the constraint on the hopping rates can be related to limitations on the interaction distance among pedestrians, but finds also applications in the modeling of various transport phenomena.

  9. O CIRCUITO HIP HOP NA REGIÃO DE CAMPINAS

    Directory of Open Access Journals (Sweden)

    Cristiano Nunes Alves

    2013-01-01

    Full Text Available This paper examines the thickness of the circuit hip hop in the region of Campinas and it’s a part of an inventory made in fifteen cities of the region, between 2003 and 2005. The circuit hip hop growing in Campinas since the decade of 1980, and has been expanding in the context of urbanization and metropolis. We noticed some residual cultural component in places involves, among others, the alternative production involved by a technically and territorial division of labor spurred by circuits upside of information. The culture of the streets and these circuits, survive to the urban division and fragmentation. It is, therefore, a study of the region of Campinas as a place that houses technical, informational and communicational densities. We analyzed geographical conditions of contemporary life in this region, inquiring about the communication and the informational components in the use of the territory.

  10. Cooperative MIMO technology in multiple hops wireless sensor networks

    Science.gov (United States)

    Yuan, Lina; Chen, Huajun; Gong, Jing

    2017-03-01

    The limited lifetime is one of the important factors restricted wireless sensor networks (WSNs), when possible, wireless nodes often operate with small batteries, while battery replacement is a very difficult and expensive. So the nodes must work long hours in the case of no battery replacement. Therefore, in WSNs, minimizing energy consumption is an important design consideration, at the same time, the transmission strategies of energy efficiency must be used for data forwarding. This paper, using cooperative multiple input multiple output(MIMO) technology combined with multiple hops technology, has put forward a new transmission model, i.e., the MIMO-MISO(multi-input multi-output)/MIMO-MIMO model. Simulation results demonstrate the proposed MIMO-MISO/MIMO-MIMO to minimize energy consumption of each node every node for multi-hop WSNs, to save a great deal of energy for a larger transmission distance, which makes the life of the entire network be extended.

  11. Effects of Powdery Mildew Fungicide Programs on Twospotted Spider Mite (Acari: Tetranychidae), Hop Aphid (Homoptera: Aphididae), and Their Natural Enemies in Hop Yards

    Science.gov (United States)

    Twospotted spider mite, Tetranychus urticae Koch (Acari:Tetranychidae), and hop aphid, Phorodon humuli (Schrank) (Homoptera:Aphidiae), are the most important arthropod pests of hop (Humulus lupulus L.) in the Northern Hemisphere. A potential barrier for greater adoption of conservation biological c...

  12. Hip-Hop(e): The Cultural Practice and Critical Pedagogy of International Hip-Hop. Adolescent Cultures, School, and Society. Volume 56

    Science.gov (United States)

    Porfilio, Brad J., Ed.; Viola, Michael J., Ed.

    2012-01-01

    Illuminating hip-hop as an important cultural practice and a global social movement, this collaborative project highlights the emancipatory messages and cultural work generated by the organic intellectuals of global hip-hop. Contributors describe the social realities--globalization, migration, poverty, criminalization, and racism--youth are…

  13. HipHop Scholastics: Effective Teacher Professional Learning

    OpenAIRE

    Garcia, Itoco

    2016-01-01

    AbstractHipHop Scholastics: Effective Teacher Professional LearningbyItoco GarcíaDoctor of EducationUniversity of California, BerkeleyProfessor P. David Pearson, ChairMeeting the needs of culturally and linguistically diverse students in order to improve their academic engagement and achievement is a central challenge to American education. A Critical Race analysis and synthesis of academic research on teacher professional learning, Culturally Relevant Pedagogy (CRP), and the mismatch between...

  14. Reconstruction of Frequency Hopping Signals From Multi-Coset Samples

    OpenAIRE

    Lim, Chia Wei; Wakin, Michael B.

    2016-01-01

    Multi-Coset (MC) sampling is a well established, practically feasible scheme for sampling multiband analog signals below the Nyquist rate. MC sampling has gained renewed interest in the Compressive Sensing (CS) community, due partly to the fact that in the frequency domain, MC sampling bears a strong resemblance to other sub-Nyquist CS acquisition protocols. In this paper, we consider MC sampling of analog frequency hopping signals, which can be viewed as multiband signals with changing band ...

  15. Opportunistic Access in Frequency Hopping Cognitive Radio Networks

    Science.gov (United States)

    2014-03-27

    frequency hopping radio to mitigate the interference caused by other transmitters in a contentious environment such as the unlicensed 2.4 GHz region...Avionics Circle WPAFB, OH 45433 vasu.chakravarthy@us.af.mil 937- 528 -8269 AFRL/RYWE 12. DISTRIBUTION / AVAILABILITY STATEMENT DISTRIBUTION STATEMENT A...unlicensed 2.4 GHz region. Additionally, this work demonstrates how dynamic spectrum access techniques can be used not only to prevent interfering with

  16. Nanoscale live cell imaging using hopping probe ion conductance microscopy

    Science.gov (United States)

    Novak, Pavel; Li, Chao; Shevchuk, Andrew I.; Stepanyan, Ruben; Caldwell, Matthew; Hughes, Simon; Smart, Trevor G.; Gorelik, Julia; Ostanin, Victor P.; Lab, Max J.; Moss, Guy W. J.; Frolenkov, Gregory I.; Klenerman, David; Korchev, Yuri E.

    2009-01-01

    We describe a major advance in scanning ion conductance microscopy: a new hopping mode that allows non-contact imaging of the complex surfaces of live cells with resolution better than 20 nm. The effectiveness of this novel technique was demonstrated by imaging networks of cultured rat hippocampal neurons and mechanosensory stereocilia of mouse cochlear hair cells. The technique allows studying nanoscale phenomena on the surface of live cells under physiological conditions. PMID:19252505

  17. Simulation of Frequency Hopping Communication System Based On MATLAB

    OpenAIRE

    Xu Xiaoping; Wang Weiqi; Yi Lan; Rong Jie; Wang Anqi

    2016-01-01

    In today’s information age, how to carry out the accurate information communication is a crucial issue in the field of communication, which is widely used in civil and military fields. Frequency hopping communication system is a typical spectrum communication system, it is in military communication, mobile communication, computer wireless data transmission and wireless LAN and other fields have a very wide range of applications, has become the current short wave communication is one of the im...

  18. Two-legged hopping in autism spectrum disorders

    Directory of Open Access Journals (Sweden)

    Matthew F. Moran

    2013-03-01

    Full Text Available Sensory processing deficits are common within autism spectrum disorders (ASD. Deficits have a heterogeneous dispersion across the spectrum and multimodal processing tasks are thought to magnify integration difficulties. Two-legged hopping in place in sync with an auditory cue (2.3, 3.0 Hz was studied in a group of six individuals with expressive language impaired ASD (ELI-ASD and an age-matched control group. Vertical ground reaction force data were collected and discrete Fourier transforms were utilized to determine dominant hopping cadence. Effective leg stiffness was computed through a mass-spring model representation. The ELI-ASD group were unsuccessful in matching their hopping cadence (2.21±0.30 hops•sec-1, 2.35±0.41 hops•sec-1 to either auditory cue with greater deviations at the 3.0 Hz cue. In contrast, the control group was able to match hopping cadence (2.35±0.06 hops•sec-1, 3.02±0.10 hops•sec-1 to either cue via an adjustment of effective leg stiffness. The ELI-ASD group demonstrated a varied response with an interquartile range (IQR in excess of 0.5 hops•sec-1 as compared to the control group with an IQR < 0.03 hops•sec-1. Several sensorimotor mechanisms could explain the inability of participants with ELI-ASD to modulate motor output to match an external auditory cue. These results suggest that a multimodal gross motor task can (1 discriminate performance among a group of individuals with severe autism, and (2 could be a useful quantitative tool for evaluating motor performance in individuals with ASD individuals.

  19. Hip-Hop Development™ Bridging the Generational Divide for Youth Development

    Directory of Open Access Journals (Sweden)

    P. Thandi Hicks Harper

    2007-09-01

    Full Text Available Hip-Hop culture in the lives of youth can not be ignored. This research is based on the premise that youth workers who expect ongoing successes must increase their Hip-Hop culture competence. The study examined the knowledge of and attitude towards Hip-Hop by educators who participated in a Hip-Hop 101 workshop. Their perceptions relevant to the importance of Hip-Hop awareness and application for positively influencing youth behaviors were also explored. Results revealed that workshop participants significantly increased their Hip-Hop knowledge. They also demonstrated significantly more favorable attitudes toward Hip-Hop and its use for youth development. Findings suggest that the workshop promoted an environment conducive to bridging the generation gap between youth who embrace Hip-Hop, and educators who have a less favorable view. This research provides insight into Hip-Hop Developmenttm as a core component for establishing the kinds of youth-adult partnerships necessary for today’s Hip-Hop generation’s self-growth, skill enhancement, and leadership development.

  20. Hsp70/Hsp90 organising protein (hop): beyond interactions with chaperones and prion proteins.

    Science.gov (United States)

    Baindur-Hudson, Swati; Edkins, Adrienne L; Blatch, Gregory L

    2015-01-01

    The Hsp70/Hsp90 organising protein (Hop), also known as stress-inducible protein 1 (STI1), has received considerable attention for diverse cellular functions in both healthy and diseased states. There is extensive evidence that intracellular Hop is a co-chaperone of the major chaperones Hsp70 and Hsp90, playing an important role in the productive folding of Hsp90 client proteins. Consequently, Hop is implicated in a number of key signalling pathways, including aberrant pathways leading to cancer. However, Hop is also secreted and it is now well established that Hop also serves as a receptor for the prion protein, PrP(C). The intracellular and extracellular forms of Hop most likely represent two different isoforms, although the molecular determinants of these divergent functions are yet to be identified. There is also a growing body of research that reports the involvement of Hop in cellular activities that appear independent of either chaperones or PrP(C). While Hop has been shown to have various cellular functions, its biological function remains elusive. However, recent knockout studies in mammals suggest that Hop has an important role in embryonic development. This review provides a critical overview of the latest molecular, cellular and biological research on Hop, critically evaluating its function in healthy systems and how this function is adapted in diseases states.

  1. Lack of association between gastric cancer and hopQ alleles in Helicobacter pylori

    Directory of Open Access Journals (Sweden)

    Kazemi Elham

    2016-01-01

    Full Text Available Helicobacter pylori use a number of mechanisms to survive in the stomach lumen. The presence of these bacteria in the stomach can lead to gastritis and reduction in stomach acid production. Acute inflammation can directly damage to the peripheral cells that are responsible for the secretion of acid. The risk of developing gastric carcinoma is associated to heterogeneity of Helicobacter pylori virulence factors (such as cagA. The HopQ is one of the outer membrane proteins involved in bacterial adherence to gastric mucosa and has been suggested to also play a role in the virulence of H. pylori. This gene has been shown in two types. The purpose of the current study was to investigate the association between different H. pylori virulence hopQ alleles (types I and II and patients with gastroduodenal disorders. For this purpose 58 stomach biopsies the of patients with gastric cancer and 100 saliva samples from healthy individuals were collected. Then genomic DNA was purified and PCR for was done for desired genes via specific primers. The H. pylori infections were diagnosed by PCR for GlmM gene. Then frequencies of hopQI+, hopQII+ and hopQI+ hopQII+ genotypes were determined in H. pylori infected cases. Statistical analysis showed that there were not significant differences between healthy and diseased ones for genotypes hopQI+, hopQII+ and hopQI+ hopQII+.

  2. Duplex Schemes in Multiple Antenna Two-Hop Relaying

    Directory of Open Access Journals (Sweden)

    Anja Klein

    2008-04-01

    Full Text Available A novel scheme for two-hop relaying defined as space division duplex (SDD relaying is proposed. In SDD relaying, multiple antenna beamforming techniques are applied at the intermediate relay station (RS in order to separate downlink and uplink signals of a bi-directional two-hop communication between two nodes, namely, S1 and S2. For conventional amplify-and-forward two-hop relaying, there appears a loss in spectral efficiency due to the fact that the RS cannot receive and transmit simultaneously on the same channel resource. In SDD relaying, this loss in spectral efficiency is circumvented by giving up the strict separation of downlink and uplink signals by either time division duplex or frequency division duplex. Two novel concepts for the derivation of the linear beamforming filters at the RS are proposed; they can be designed either by a three-step or a one-step concept. In SDD relaying, receive signals at S1 are interfered by transmit signals of S1, and receive signals at S2 are interfered by transmit signals of S2. An efficient method in order to combat this kind of interference is proposed in this paper. Furthermore, it is shown how the overall spectral efficiency of SDD relaying can be improved if the channels from S1 and S2 to the RS have different qualities.

  3. Performance Analysis of RF-FSO Multi-Hop Networks

    KAUST Repository

    Makki, Behrooz

    2017-05-12

    We study the performance of multi-hop networks composed of millimeter wave (MMW)-based radio frequency (RF) and free-space optical (FSO) links. The results are obtained in the cases with and without hybrid automatic repeat request (HARQ). Taking the MMW characteristics of the RF links into account, we derive closed-form expressions for the network outage probability. We also evaluate the effect of various parameters such as power amplifiers efficiency, number of antennas as well as different coherence times of the RF and the FSO links on the system performance. Finally, we present mappings between the performance of RF- FSO multi-hop networks and the ones using only the RF- or the FSO-based communication, in the sense that with appropriate parameter settings the same outage probability is achieved in these setups. The results show the efficiency of the RF-FSO setups in different conditions. Moreover, the HARQ can effectively improve the outage probability/energy efficiency, and compensate the effect of hardware impairments in RF-FSO networks. For common parameter settings of the RF-FSO dual- hop networks, outage probability 10^{-4} and code rate 3 nats-per-channel-use, the implementation of HARQ with a maximum of 2 and 3 retransmissions reduces the required power, compared to the cases with no HARQ, by 13 and 17 dB, respectively.

  4. Origins of Photodamage in Pheomelanin Constituents: Photochemistry of 4-Hydroxybenzothiazole.

    Science.gov (United States)

    Karsili, Tolga N V; Marchetti, Barbara; Matsika, Spiridoula

    2018-02-02

    4-Hydroxybenzothiazole (HBT) is a molecular constituent of pheomelanin $-$ a polymeric skin centered pigment which acts as a natural photoprotector against harmful solar-UV radiation. Its molecular structure is therefore required to sustain a degree of photostability upon electronic excitation with UV irradiation. Despite its function as a protector against UV, pheomelanin is known to be less photostable than that of its close derivative eumelanin - a dark skin centered pigment. The HBT subunit has long being attributed as a key contributor to the lack of photostability of pheomelanin - a hypothesis which we aim to test in this manuscript. Using high-level multi-reference computational methods, coupled with on-the-fly surface-hopping molecular dynamics, we find many excited-state reaction paths that show potential detriment to HBT $-$ leading to phototoxic radicals and products that are distinct from the original ground-state molecule. Such radicals and photoproducts include those formed by classic $\\pi\\sigma$* photodissociations, intramolecular proton-transfer and ring-opening reactions. Such reactions shed light on the types of molecular structure that show photo-detrimental effects upon UV irradiation - allowing judicious predictions for synthetic analogues that may offer enhanced photoprotection in commercial sunscreens.

  5. Multi-Hop Link Capacity of Multi-Route Multi-Hop MRC Diversity for a Virtual Cellular Network

    Science.gov (United States)

    Daou, Imane; Kudoh, Eisuke; Adachi, Fumiyuki

    In virtual cellular network (VCN), proposed for high-speed mobile communications, the signal transmitted from a mobile terminal is received by some wireless ports distributed in each virtual cell and relayed to the central port that acts as a gateway to the core network. In this paper, we apply the multi-route MHMRC diversity in order to decrease the transmit power and increase the multi-hop link capacity. The transmit power, the interference power and the link capacity are evaluated for DS-CDMA multi-hop VCN by computer simulation. The multi-route MHMRC diversity can be applied to not only DS-CDMA but also other access schemes (i. e. MC-CDMA, OFDM, etc.).

  6. Some volatile constituents of female dog urine.

    Science.gov (United States)

    Schultz, T H; Kruse, S M; Flath, R A

    1985-02-01

    The volatile compounds from female beagle urine, across the state of estrus, were examined by headspace gas chromatography and mass spectrometry. The major constituents identified were methyl propyl sulfide, methyl butyl sulfide, and acetone. Nine minor constituents, including trimethyl amine and five disulfides, were identified. Two of the unidentified minor constituents may possibly be associated with the state of estrus.

  7. Population dynamics and integrated control of the damson-hop aphid Phorodon humuli (Schrank on hops in Spain

    Directory of Open Access Journals (Sweden)

    A. Lorenzana

    2013-04-01

    Full Text Available The hop aphid Phorodon humuli (Schrank (Hemiptera: Aphididae is a serious pest in most areas where hops are grown. A field trial was performed on a hop yard throughout 2002, 2003 and 2004 in León (Spain in order to analyse the population development of Phorodon humuli and its natural enemies, as well as to determine the most effective integrated program of insecticide treatments. The basic population development pattern of P. humuli was similar in the three years: the population peaked between mid to late June, and then decreased in late June/early July, rising again and reaching another peak in mid-July, after which it began to decline, rising once more in late August; this last rise is characteristic of Spain and has not been recorded in the rest of Europe. The hop aphid’s main natural enemy found on the leaves was Coccinella septempunctata (Coleoptera: Coccinellidae. The multiple regression analysis showed that aphids are positively related with the presence of beetle eggs and mean daily temperatures and negatively related with maximum daily temperature integral above 27ºC in plots without insecticide treatment. The most effective program of insecticide (imidacloprid treatments consisted of an initial treatment in June and a second treatment in the second half of July or at the beginning of August. However, a single treatment in June would be sufficient when in this last period the maximum daily temperatures were higher than 27ºC for at least 15 days, avoiding in this way the harmful effects of imidacloprid on predators.

  8. INNOVATION CONSTITUENT OF SUSTAINABLE DEVELOPMENT

    Directory of Open Access Journals (Sweden)

    O. Zhylinska

    2014-06-01

    Full Text Available The paper substantiates an innovation constituent of sustainable development along with environmental, social and economic pillars of the concept. Determining of implementation details of innovation activity by J. Schumpeter is a theoretical prerequisite to understanding of innovation constituent. An innovator-entrepreneur provides a customer with an information image of 'new combinations.' The image is created by identifying customer's future needs, which outline business aims, subject and appropriate means for creating the innovation products. However, consumer choice is largely motivated by values and specific rules of behavior. The rules of consumer society that in the industrial age become the motive, morality and institution, did not consider the reproductive capabilities of the environment. This disagreement was previously presented in The Limits to Growth by the Club of Rome and was reflected in the concept of sustainable development, which gained immense significance after the report of the World Commission on Environment and Development in 1987 (Our Common Future. The study highlights importance for establishment of new social values that motivate innovators to change their thinking, comprehend their responsibility not only to consumers but also to the environment and future generations. The Rio+20 Corporate Sustainability Forum: Innovation and Collaboration for the Future We want, organized by the UN Global Compact, demonstrates the interest of entrepreneurs in practical implementation of the concept of sustainable development, through an effective innovation activity. The paper summarizes management tools for implementing business commitments to action in priority areas of ensuring sustainable development: Energy & Climate, Water & Ecosystems, Agriculture & Food, Economics & Finance of Sustainable Development, Social Development, and Urbanization & Cities. Main stages of changes in companies are outlined for making responsible

  9. The inorganic constituents of echinoderms

    Science.gov (United States)

    Clarke, F.W.; Wheeler, W.C.

    1915-01-01

    In a recent paper on the composition of crinoid skeletons we showed that crinoids contain large quantities of magnesia, and that its proportion varies with the temperature of the water in which the creatures live. This result was so novel and surprising that it seemed desirable to examine other echinoderms and to ascertain whether they showed the same characteristics and regularity. A number of sea urchins and starfishes were therefore studied, their inorganic constituents being analyzed in the same manner as those of the crinoids

  10. Volatile Constituents of Zhumaria Majdae

    Directory of Open Access Journals (Sweden)

    Yazdanparst

    1993-07-01

    Full Text Available Capillary gas chromatography mass spectrometry (GC- MS analyses of a sample of essential oil of zhumaria Linalool ned by simple water distillation of the pulverized air - dired leaves and flowers of the plant indicated that Linalool and comphor are the two major constituents of the volatile oil. Sylvestrene , y -terpinene, a- Pinene, b - carene, camphene, and Epiborneol constitute the other main components of the essential oil. The GC - MS chromatogram indicated the presence of more than fifty - components in the oil, most of them were present in trace amounts. In this study, the chemical structures of twenty of these consti tuents were elucidated using GC - MS analysis.

  11. Deterministic Multi-hop Controlled Teleportation of Arbitrary Single-Qubit State

    Science.gov (United States)

    Peng, Jia-yin; Bai, Ming-qiang; Mo, Zhi-wen

    2017-10-01

    Multi-hop teleportation is of great significance due to long-distance delivery of quantum information and wireless quantum communication networks. In existing protocols of multi-hop teleportation, the more nodes, the smaller the success probability. In this paper, fusing the ideas of multi-hop teleportation and controlled teleportation, we put forward a scheme for implementing multi-hop controlled teleportation of single-qubit state. A set of ingenious three-qubit non-maximally entangled states are constructed to serve as the quantum channels. The information is perfectly transmitted hop by hop through teleportation under the control of the supervisors. Unit success probability can be achieved independent of channel's entanglement degree and the number of intermediate nodes. Only Pauli operations, single-qubit rotation, Hadamard gate, controlled-NOT gate, Bell-state measurement and single-qubit measurement are used in our scheme, so this scheme is easily realized in physical experiment.

  12. Blind Compressed Sensing Parameter Estimation of Non-cooperative Frequency Hopping Signal

    Directory of Open Access Journals (Sweden)

    Chen Ying

    2016-10-01

    Full Text Available To overcome the disadvantages of a non-cooperative frequency hopping communication system, such as a high sampling rate and inadequate prior information, parameter estimation based on Blind Compressed Sensing (BCS is proposed. The signal is precisely reconstructed by the alternating iteration of sparse coding and basis updating, and the hopping frequencies are directly estimated based on the results. Compared with conventional compressive sensing, blind compressed sensing does not require prior information of the frequency hopping signals; hence, it offers an effective solution to the inadequate prior information problem. In the proposed method, the signal is first modeled and then reconstructed by Orthonormal Block Diagonal Blind Compressed Sensing (OBD-BCS, and the hopping frequencies and hop period are finally estimated. The simulation results suggest that the proposed method can reconstruct and estimate the parameters of noncooperative frequency hopping signals with a low signal-to-noise ratio.

  13. Droppin’ Knowledge on Race: Hip-Hop, White Adolescents, and Anti-Racism Education

    Directory of Open Access Journals (Sweden)

    Steven Netcoh

    2013-10-01

    Full Text Available In this essay, the author examines how Hip-Hop can be mobilized in anti-racism educational initatives.  The author claims that existing research on Hip-Hop and white adolescents suggests a negative corrleation between white youths' engagement with Hip-Hop and their understanding of how race and racism function in American society.  In response to this research, the author argues Hip-Hop's diverse racial discourses and ideologies must be made the subject of direct and critical inquiry in secondary and post-secondary classrooms to maximize its democratic potential.  The author outlines specific approaches for how teachers can employ Hip-Hop in anti-racism curricula in secondary and post-secondary classrooms.  Collectively, the essay serves as a preliminary investigation of Hip-Hop pedagogies of race and whiteness.

  14. Structural influence on atomic hopping and electronic states of Pd-based bulk metallic glasses

    OpenAIRE

    Tang, X.-P.; Löffler, Jörg F.; Schwarz, R. B.; Johnson, William L.; Wu, Yue

    2005-01-01

    Atomic motion and electronic structures of Pd–Ni–Cu–P bulk metallic glasses were investigated using 31P nuclear magnetic resonance. The hopping rate of P atoms was determined by the stimulated echo technique. Significant hopping was observed in all alloys well below the glass transition temperature. Increasing the Cu content to above 25 at. % increases P hopping significantly, consistent with the previous finding that the openness of the structure increases with Cu content. In contrast, P h...

  15. [Phenolic constituents from Oplopanax horridus].

    Science.gov (United States)

    Huang, Wei-Hua; Luo, Wei; Wang, Chong-Zhi; Yuan, Chun-Su; Nie, Ming-Kun; Shi, Shu-Yun; Zhou, Hong-Hao; Ouyang, Dong-Sheng

    2014-05-01

    The chemical constituents were isolated and purified by various chromatographic techniques indluding silica gel, reverse phase silica gel, sephadex LH-20 and pre-HPLC and identified by their physicochemical properties and spectral data. Sixteen phenolic compounds had been isolated and n-butanol extracts which were fractionated from the ethanol extract of Oplopanax horridus roots bark. Their structures were identified as below, including 7 phenylpropanoid compounds, ferulic acid (1), 3-acetylcaffeic acid (2), caffeic acid (3), homovanillyl alcohol 4-O-beta-D-glucopyranoside (4), 3-hydroxyphenethyl alcohol 4-O-beta-D-glucopyranoside (5), 3, 5-dimethoxycinnamyl alcohol 4-O-beta-D-glucopyranoside (6), and 3-dimethoxycinnamyl alcohol 4-O-beta-D-glucopyranoside (7). Three coumarins, scopoletin (8), esculetin (9) and 3'-angeloyl-4'-acetyl-cis-knellactone (10). And 6 lignan compounds, (+)-isolaricires-inol-9'-O-beta-D-glucopyranoside (11), 3, 3'-dimethoxy-4, 9, 9'-trihydroxy-4', 7-epoxy-5', 8-lignan-4, 9-bis-O-beta-D-glucopyranoside (12), (+)-5, 5'-dimethoxylariciresinol 4'-O-beta-D-glucopyranoside (13), (-)-5,5'-dimethoxylariciresinol 4'-O-beta-D-glucopyranoside (14), (-)-pinoresinol 4'-O-beta-D-glucopyranoside (15), and (+)-5, 5'-dimethoxylariciresinol 9'-O-beta-D-glucopyranoside (16). All compounds were isolated and identified for the first time from this plant All the constituents except compounds 4, 6, 12 and 13 were obtained for the first time from the genus Oplopanax.

  16. Generalized adiabatic polaron hopping: Meyer-Neldel compensation and Poole-Frenkel behavior.

    Science.gov (United States)

    Emin, David

    2008-04-25

    The commonly employed adiabatic treatment of polaron hopping is extended to treat the continuous alteration of a carrier wave function with the atoms' movements and a carrier's long-range interaction with a polar surrounding. These features, respectively, introduce carrier-induced softening of the atoms' vibrations and a hopping activation energy that depends on hopping distance. The Meyer-Neldel compensation effect results from carrier-induced softening of vibrations. Poole-Frenkel behavior emerges for electric-field driven polaron hopping in ionic and polar media.

  17. Animal galloping and human hopping: an energetics and biomechanics laboratory exercise.

    Science.gov (United States)

    Lindstedt, Stan L; Mineo, Patrick M; Schaeffer, Paul J

    2013-12-01

    This laboratory exercise demonstrates fundamental principles of mammalian locomotion. It provides opportunities to interrogate aspects of locomotion from biomechanics to energetics to body size scaling. It has the added benefit of having results with robust signal to noise so that students will have success even if not "meticulous" in attention to detail. First, using respirometry, students measure the energetic cost of hopping at a "preferred" hop frequency. This is followed by hopping at an imposed frequency half of the preferred. By measuring the O2 uptake and work done with each hop, students calculate mechanical efficiency. Lessons learned from this laboratory include 1) that the metabolic cost per hop at half of the preferred frequency is nearly double the cost at the preferred frequency; 2) that when a person is forced to hop at half of their preferred frequency, the mechanical efficiency is nearly that predicted for muscle but is much higher at the preferred frequency; 3) that the preferred hop frequency is strongly body size dependent; and 4) that the hop frequency of a human is nearly identical to the galloping frequency predicted for a quadruped of our size. Together, these exercises demonstrate that humans store and recover elastic recoil potential energy when hopping but that energetic savings are highly frequency dependent. This stride frequency is dependent on body size such that frequency is likely chosen to maximize this function. Finally, by requiring students to make quantitative solutions using appropriate units and dimensions of the physical variables, these exercises sharpen analytic and quantitative skills.

  18. A Review of Hip Hop-Based Interventions for Health Literacy, Health Behaviors, and Mental Health.

    Science.gov (United States)

    Robinson, Cendrine; Seaman, Elizabeth L; Montgomery, LaTrice; Winfrey, Adia

    2017-07-01

    African-American children and adolescents experience an undue burden of disease for many health outcomes compared to their White peers. More research needs to be completed for this priority population to improve their health outcomes and ameliorate health disparities. Integrating hip hop music or hip hop dance into interventions may help engage African-American youth in health interventions and improve their health outcomes. We conducted a review of the literature to characterize hip hop interventions and determine their potential to improve health. We searched Web of Science, Scopus, PsycINFO, and EMBASE to identify studies that assessed hip hop interventions. To be included, studies had to (1) be focused on a psychosocial or physical health intervention that included hip hop and (2) present quantitative data assessing intervention outcomes. Twenty-three articles were identified as meeting all inclusion criteria and were coded by two reviewers. Articles were assessed with regards to sample characteristics, study design, analysis, intervention components, and results. Hip hop interventions have been developed to improve health literacy, health behavior, and mental health. The interventions were primarily targeted to African-American and Latino children and adolescents. Many of the health literacy and mental health studies used non-experimental study designs. Among the 12 (of 14) health behavior studies that used experimental designs, the association between hip hop interventions and positive health outcomes was inconsistent. The number of experimental hip hop intervention studies is limited. Future research is required to determine if hip hop interventions can promote health.

  19. Helicobacter pylori adhesin HopQ engages in a virulence-enhancing interaction with human CEACAMs.

    Science.gov (United States)

    Javaheri, Anahita; Kruse, Tobias; Moonens, Kristof; Mejías-Luque, Raquel; Debraekeleer, Ayla; Asche, Carmen I; Tegtmeyer, Nicole; Kalali, Behnam; Bach, Nina C; Sieber, Stephan A; Hill, Darryl J; Königer, Verena; Hauck, Christof R; Moskalenko, Roman; Haas, Rainer; Busch, Dirk H; Klaile, Esther; Slevogt, Hortense; Schmidt, Alexej; Backert, Steffen; Remaut, Han; Singer, Bernhard B; Gerhard, Markus

    2016-10-17

    Helicobacter pylori specifically colonizes the human gastric epithelium and is the major causative agent for ulcer disease and gastric cancer development. Here, we identify members of the carcinoembryonic antigen-related cell adhesion molecule (CEACAM) family as receptors of H. pylori and show that HopQ is the surface-exposed adhesin that specifically binds human CEACAM1, CEACAM3, CEACAM5 and CEACAM6. HopQ-CEACAM binding is glycan-independent and targeted to the N-domain. H. pylori binding induces CEACAM1-mediated signalling, and the HopQ-CEACAM1 interaction enables translocation of the virulence factor CagA into host cells and enhances the release of pro-inflammatory mediators such as interleukin-8. Based on the crystal structure of HopQ, we found that a β-hairpin insertion (HopQ-ID) in HopQ's extracellular 3+4 helix bundle domain is important for CEACAM binding. A peptide derived from this domain competitively inhibits HopQ-mediated activation of the Cag virulence pathway, as genetic or antibody-mediated abrogation of the HopQ function shows. Together, our data suggest the HopQ-CEACAM1 interaction to be a potentially promising novel therapeutic target to combat H. pylori-associated diseases.

  20. Hip-hop as a resource for understanding the urban context

    Science.gov (United States)

    Brown, Bryan

    2010-06-01

    This review explores Edmin's "Science education for the hip-hop generation" by documenting how he frames hip-hop as a means to access urban student culture. He argues that hip-hop is more than a mere music genre, but rather a culture that provides young people with ways of connecting to the world. Two primary ideas emerged as central to his work. First, he contends that students develop communal relationships and collective identities based on the common experiences expressed in hip-hop. Second, he identifies how the conscious recognition of institutional oppression serves a central feature in urban schools. Emdin's rich, and personal call for a greater understanding of hip-hop culture provides the text with an unmatched strength. He skillfully uses personal narratives from his own experience as well as quotes and references from hip-hop songs to make the nuances of hip hop transparent to science educators. Conversely, the limitation of this text is found in its unfulfilled promise to provide pragmatic examples of how to engage in a hip-hop based science education. Emdin's work is ultimately valuable as it extends our current knowledge about urban students and hip-hop in meaningful ways.

  1. [Chemical constituents of Scolopendra negrocapitis].

    Science.gov (United States)

    Fang, H; Deng, F; Yan, Y; Wang, K

    1999-05-01

    The chemical constituent of Scolopendra negrocapitis Zhang et Wang were systematically analyzed and compared with S. subspinipes mutilans L. Koch. The results showed the lipid content was 18.7%, protein was 63.4% and total amino acid was 11.9%; S. negrocapitis contained the same twelve fat acids (the content of unsaturated fat acid was nearly 64% in its fat acids), twenty one amino acids and twelve trace elements as S. subspinipes mutilans had. The protein of S. negrocapitis showed forteen bands as determined by polyacrylamide gel electrophoresis. S. negrocapitis and S. subspinipes mutilans have the same main chemical composition. The contents of compositions are different. S. negrocapitis is worth as the nature resources of medicinal centepede.

  2. Child-Mediated Stroke Communication: findings from Hip Hop Stroke.

    Science.gov (United States)

    Williams, Olajide; DeSorbo, Alexandra; Noble, James; Gerin, William

    2012-01-01

    Low thrombolysis rates for acute ischemic stroke are linked to delays in seeking immediate treatment due to low public stroke awareness. We aimed to assess whether "Child-Mediated Stroke Communication" could improve stroke literacy of parents of children enrolled in a school-based stroke literacy program called Hip Hop Stroke. Parents of children aged 9 to 12 years from 2 public schools in Harlem, New York City, were recruited to participate in stroke literacy questionnaires before and after their child's participation in Hip Hop Stroke, a novel Child-Mediated Stroke Communication intervention delivered in school auditoriums. Parental recall of stroke information communicated through their child was assessed 1-week after the intervention. Fifth and sixth grade students (n=182) were enrolled into Hip Hop Stroke. One hundred two parents were approached in person to participate; 75 opted to participate and 71 completed both the pretest and post-test (74% response rate and 95% retention rate). Parental stroke literacy improved after the program; before the program, 3 parents of 75 (3.9%) were able to identify the 5 cardinal stroke symptoms, distracting symptom (chest pains), and had an urgent action plan (calling 911) compared with 21 of 71 parents (29.6%) postintervention (P<0.001). The FAST mnemonic was known by 2 (2.7%) of participants before the program versus 29 (41%) after program completion (P<0.001). Knowledge of stroke signs and symptoms remains low among residents of this high-risk population. The use of Child-Mediated Stroke Communication suggests that school children aged 9 to 12 years may be effective conduits of critical stroke knowledge to their parents.

  3. Exploiting sparsity in free energy basin-hopping

    Science.gov (United States)

    Sutherland-Cash, Kyle H.; Mantell, Rosemary G.; Wales, David J.

    2017-10-01

    We present acceleration of the vibrational frequency calculations required in free energy basin-hopping (FEBH) global optimisation using sparse Cholesky factorisation. We describe an interface with the SuiteSparse software package that facilitates these calculations, and present results detailing the accuracy and speedups obtained for atomic clusters and biomolecules. For the larger systems, exploiting sparsity reduces the computational cost by factors of ten to thirty, with no significant loss in accuracy. This approach will therefore provide access to the vibrational density of states, and hence to local harmonic free energies, for structure prediction and thermodynamic properties of more complex systems.

  4. Spectral Efficiency of Random Time-Hopping CDMA

    OpenAIRE

    Ferrante, Guido Carlo; Di Benedetto, Maria-Gabriella

    2013-01-01

    Traditionally paired with impulsive communications, Time-Hopping CDMA (TH-CDMA) is a multiple access technique that separates users in time by coding their transmissions into pulses occupying a subset of $N_\\mathsf{s}$ chips out of the total $N$ included in a symbol period, in contrast with traditional Direct-Sequence CDMA (DS-CDMA) where $N_\\mathsf{s}=N$. This work analyzes TH-CDMA with random spreading, by determining whether peculiar theoretical limits are identifiable, with both optimal a...

  5. The Analysis Of Slang Words In Selected Hip Hop Songs

    OpenAIRE

    Manalu, Sadrakh Anthony

    2015-01-01

    Slang is a language structure that evolved in modern times that in his particular use by young people. Slang develops in tune with its evolving culture in the environment so that the slang does not have a time, place or community background limit. Slang can also be found in almost every language in the world, in this case the author discusses the use of slang words contained in the English language in specialized its African American Hip Hop culture. In this paper entitled "The Analysis of Sl...

  6. Conscious Hip-Hop, Change, and the Obama Era

    Directory of Open Access Journals (Sweden)

    Murray Forman

    2010-05-01

    Full Text Available This article identifies a particular aspect of hip-hop’s range of cultural production—conscious rap—in order to isolate one of the more politicized discursive options available to youth in America and a site where critical perspectives on post-Civil Rights America have emerged most forcefully. It further suggests that Obama’s political rise corresponds with a new phase in hip-hop and has impacted the ways in which its creative artists frame and articulate issues of race, class, and identity.

  7. High-Speed On-Board Data Processing for Science Instruments: HOPS

    Science.gov (United States)

    Beyon, Jeffrey

    2015-01-01

    The project called High-Speed On-Board Data Processing for Science Instruments (HOPS) has been funded by NASA Earth Science Technology Office (ESTO) Advanced Information Systems Technology (AIST) program during April, 2012 â€" April, 2015. HOPS is an enabler for science missions with extremely high data processing rates. In this three-year effort of HOPS, Active Sensing of CO2 Emissions over Nights, Days, and Seasons (ASCENDS) and 3-D Winds were of interest in particular. As for ASCENDS, HOPS replaces time domain data processing with frequency domain processing while making the real-time on-board data processing possible. As for 3-D Winds, HOPS offers real-time high-resolution wind profiling with 4,096-point fast Fourier transform (FFT). HOPS is adaptable with quick turn-around time. Since HOPS offers reusable user-friendly computational elements, its FPGA IP Core can be modified for a shorter development period if the algorithm changes. The FPGA and memory bandwidth of HOPS is 20 GB/sec while the typical maximum processor-to-SDRAM bandwidth of the commercial radiation tolerant high-end processors is about 130-150 MB/sec. The inter-board communication bandwidth of HOPS is 4 GB/sec while the effective processor-to-cPCI bandwidth of commercial radiation tolerant high-end boards is about 50-75 MB/sec. Also, HOPS offers VHDL cores for the easy and efficient implementation of ASCENDS and 3-D Winds, and other similar algorithms. A general overview of the 3-year development of HOPS is the goal of this presentation.

  8. Bilateral deficit of spring-like behaviour during hopping in sprinters.

    Science.gov (United States)

    Otsuka, Mitsuo; Kurihara, Toshiyuki; Isaka, Tadao

    2017-12-20

    Unilateral leg stiffness is a key contributor to sprint running speed, thereby great bilateral deficit (BLD) of leg stiffness would be expected to be observed in sprinters. However, it remains clear only BLD of leg stiffness at the preferred hopping frequency in non-sprinters. The purpose of this study was to clarify the BLD of spring-like behaviour in hopping at various frequencies and the effect of chronic adaptation via sprint running experience on BLD during the hopping. Fifteen male experienced sprinters and 12 male novices participated in this study. They were instructed to hop in place at three frequencies (2.0, 2.5, and 3.0 Hz), and to perform hopping with maximal effort. Ground reaction forces (GRF) of both legs during the hopping were recorded using two force plates. At higher hopping frequencies during the unilateral and bilateral hopping, smaller peak value of vertical GRF (F max) and greater leg stiffness (K leg) were significantly observed. The BLD index of F max and the BLD index of K leg were significantly smaller at higher hopping frequencies. No significant differences of BLD index of F max and BLD index of K leg were observed between sprinters and novices. Our results demonstrate that neuromuscular inhibition in the contralateral leg changes during the hopping based on hopping frequency. This suggests that plyometric training in the beginning of rehabilitation should involve bilateral jumping at a high frequency. In experienced sprinters, detailed mechanics of chronic neuromuscular adaptation via unilateral facilitation of spring-like behaviour should be assessed by measuring electromyographic activity.

  9. Communication: Global flux surface hopping in Liouville space

    Science.gov (United States)

    Wang, Linjun; Sifain, Andrew E.; Prezhdo, Oleg V.

    2015-11-01

    Recent years have witnessed substantial progress in the surface hopping (SH) formulation of non-adiabatic molecular dynamics. A generalization of the traditional fewest switches SH (FSSH), global flux SH (GFSH) utilizes the gross population flow between states to derive SH probabilities. The Liouville space formulation of FSSH puts state populations and coherences on equal footing, by shifting the hopping dynamics from Hilbert to Liouville space. Both ideas have shown superior results relative to the standard FSSH in Hilbert space, which has been the most popular approach over the past two and a half decades. By merging the two ideas, we develop GFSH in Liouville space. The new method is nearly as straightforward as the standard FSSH, and carries comparable computational expense. Tested with a representative super-exchange model, it gives the best performance among all existing techniques in the FSSH series. The obtained numerical results match almost perfectly the exact quantum mechanical solutions. Moreover, the results are nearly invariant under the choice of a basis state representation for SH, in contrast to the earlier techniques which exhibit notable basis set dependence. Unique to the developed approach, this property is particularly encouraging, because exact quantum dynamics is representation independent. GFSH in Liouville space significantly improves accuracy and applicability of SH for a broad range of chemical and physical processes.

  10. A decentralized scheduling algorithm for time synchronized channel hopping

    Directory of Open Access Journals (Sweden)

    Andrew Tinka

    2011-09-01

    Full Text Available Time Synchronized Channel Hopping (TSCH is an existing Medium Access Control scheme which enables robust communication through channel hopping and high data rates through synchronization. It is based on a time-slotted architecture, and its correct functioning depends on a schedule which is typically computed by a central node. This paper presents, to our knowledge, the first scheduling algorithm for TSCH networks which both is distributed and which copes with mobile nodes. Two variations on scheduling algorithms are presented. Aloha-based scheduling allocates one channel for broadcasting advertisements for new neighbors. Reservation- based scheduling augments Aloha-based scheduling with a dedicated timeslot for targeted advertisements based on gossip information. A mobile ad hoc motorized sensor network with frequent connectivity changes is studied, and the performance of the two proposed algorithms is assessed. This performance analysis uses both simulation results and the results of a field deployment of floating wireless sensors in an estuarial canal environment. Reservation-based scheduling performs significantly better than Aloha-based scheduling, suggesting that the improved network reactivity is worth the increased algorithmic complexity and resource consumption.

  11. Augmented Ehrenfest dynamics yields a rate for surface hopping

    Science.gov (United States)

    Subotnik, Joseph E.

    2010-04-01

    We present a new algorithm for mixed quantum-classical dynamics that helps bridge the gap between mean-field (Ehrenfest) and surface-hopping dynamics by defining a natural rate of decoherence. In order to derive this decoherence result, we have expanded the number of independent variables in the usual Ehrenfest routine so that mixed quantum-classical derivatives are now propagated in time alongside the usual Ehrenfest variables. Having done so, we compute a unique rate of decoherence using two independent approaches: (i) by comparing the equations of motion for the joint nuclear-electronic probability density in phase space according to Ehrenfest dynamics versus partial Wigner transform dynamics and (ii) by introducing a frozen Gaussian interpretation of Ehrenfest dynamics which allows nuclear wave packets to separate. The first consequence of this work is a means to rigorously check the accuracy of standard Ehrenfest dynamics. Second, this paper suggests a nonadiabatic dynamics algorithm, whereby the nuclei are propagated on the mean-field (Ehrenfest) potential energy surface and undergo stochastic decoherence events. Our work resembles the surface-hopping algorithm of Schwartz and co-workers [J. Chem. Phys. 123, 234106 (2005)]—only now without any adjustable parameters. For the case of two electronic states, we present numerical results on the so-called "Tully problems" and emphasize that future numerical benchmarking is still needed. Future work will also treat the problem of three or more electronic states.

  12. Problem Formulation and Analysis of the 1-Hop ARQ Links

    Science.gov (United States)

    Cheung, K.-M.

    2013-08-01

    In space communications, standard link analysis assumes that messages are sent once. For a communication link that uses an error-correction coding scheme, bit-error rate (BER) or frame-error rate (FER), and link margins are common metrics that characterize the quality of a link, and they are used to determine the supportable data rate. With the advent of Automatic Repeat-reQuest (ARQ) protocols, when messages are corrupted during transmission, they can be resent multiple times automatically until they are correctly received and acknowledged. The concept of BER, FER, and link margin cannot be directly applied, and the link analysis approach for ARQ links needs to be reexamined. In this article, we provide the problem formulation and extend the standard link analysis approach to a 1-hop ARQ link (no routing), under the assumption that code-block errors occur independently as in the case of space communications. We develop analytical models that describe the statistical behavior of standard 1-hop ARQ links. By integrating these analytical ARQ protocol models into the standard link analysis, we bypass the need to simulate or emulate the ARQ protocol operations, and generate relevant statistics on effective data rate, effective throughput, latency, and FER.

  13. Surface-hopping dynamics and decoherence with quantum equilibrium structure.

    Science.gov (United States)

    Grunwald, Robbie; Kim, Hyojoon; Kapral, Raymond

    2008-04-28

    In open quantum systems, decoherence occurs through interaction of a quantum subsystem with its environment. The computation of expectation values requires a knowledge of the quantum dynamics of operators and sampling from initial states of the density matrix describing the subsystem and bath. We consider situations where the quantum evolution can be approximated by quantum-classical Liouville dynamics and examine the circumstances under which the evolution can be reduced to surface-hopping dynamics, where the evolution consists of trajectory segments exclusively evolving on single adiabatic surfaces, with probabilistic hops between these surfaces. The justification for the reduction depends on the validity of a Markovian approximation on a bath averaged memory kernel that accounts for quantum coherence in the system. We show that such a reduction is often possible when initial sampling is from either the quantum or classical bath initial distributions. If the average is taken only over the quantum dispersion that broadens the classical distribution, then such a reduction is not always possible.

  14. Robust hopping based on virtual pendulum posture control.

    Science.gov (United States)

    Sharbafi, Maziar A; Maufroy, Christophe; Ahmadabadi, Majid Nili; Yazdanpanah, Mohammad J; Seyfarth, Andre

    2013-09-01

    A new control approach to achieve robust hopping against perturbations in the sagittal plane is presented in this paper. In perturbed hopping, vertical body alignment has a significant role for stability. Our approach is based on the virtual pendulum concept, recently proposed, based on experimental findings in human and animal locomotion. In this concept, the ground reaction forces are pointed to a virtual support point, named virtual pivot point (VPP), during motion. This concept is employed in designing the controller to balance the trunk during the stance phase. New strategies for leg angle and length adjustment besides the virtual pendulum posture control are proposed as a unified controller. This method is investigated by applying it on an extension of the spring loaded inverted pendulum (SLIP) model. Trunk, leg mass and damping are added to the SLIP model in order to make the model more realistic. The stability is analyzed by Poincaré map analysis. With fixed VPP position, stability, disturbance rejection and moderate robustness are achieved, but with a low convergence speed. To improve the performance and attain higher robustness, an event-based control of the VPP position is introduced, using feedback of the system states at apexes. Discrete linear quartic regulator is used to design the feedback controller. Considerable enhancements with respect to stability, convergence speed and robustness against perturbations and parameter changes are achieved.

  15. OFDMA Cellular Networks with Opportunistic Two-Hop Relays

    Directory of Open Access Journals (Sweden)

    Calcev George

    2009-01-01

    Full Text Available We investigate the benefits of two-hop opportunistic relay in time division duplex (TDD OFDMA cellular network configurations. The paper starts with a short analytical model for the two-hop opportunistic relay. The model expresses the probability of finding a suitable relay node in the presence of lognormal fading and it allows the computation of the expected number of out-of-coverage nodes, as well as the end-to-end spectrum efficiency increase due to opportunistic relaying. The paper then presents results for Monte Carlo simulations of opportunistic relay in some realistic scenarios. Specifically, the simulations consider two scenarios. The first scenario uses the propagation model and a wide-area 19-cell configuration specified in 802.16 OFDMA cellular standard evaluation methodologies. In the second scenario, a Manhattan-like 19-cell topology is used. Our simulations show 11% to 33% in throughput increase when the opportunistic relay technology is used. Our results evaluate the benefits of the opportunistic relay in both scenarios in terms of coverage extension and throughput increase.

  16. Hip-Hop to Health Jr. for Latino preschool children.

    Science.gov (United States)

    Fitzgibbon, Marian L; Stolley, Melinda R; Schiffer, Linda; Van Horn, Linda; KauferChristoffel, Katherine; Dyer, Alan

    2006-09-01

    Hip-Hop to Health Jr. was a diet/physical activity intervention designed to reduce gains in BMI (kilograms per meter squared) in preschool minority children. Twelve predominantly Latino Head Start centers participated in a group-randomized trial conducted between Fall 2001 and Winter 2003. Six centers were randomized to a culturally proficient 14-week (three times weekly) diet/physical activity intervention. Parents participated by completing weekly homework assignments. The children in the other six centers received a general health intervention that did not address either diet or physical activity. The primary outcome was change in BMI, and secondary outcomes were changes in dietary intake and physical activity. Measures were collected at baseline, post-intervention, and at Years 1 and 2 follow-up. There were no significant differences between intervention and control schools in either primary or secondary outcomes at post-intervention, Year 1, or Year 2 follow-ups. When Hip-Hop to Health Jr. was conducted in predominantly black Head Start centers, it was effective in reducing subsequent increases in BMI in preschool children. In contrast, when the program was conducted in Latino centers, it was not effective. Although the intervention did not prevent excessive weight gain in Latino children, it was very well received. Future interventions with this population may require further cultural tailoring and a more robust parent intervention.

  17. Results from HOPS: A multiwavelength census of Orion protostars

    Science.gov (United States)

    Fischer, W. J.; Megeath, S. T.; Stutz, A. M.; Tobin, J. J.; Ali, B.; Stanke, T.; Osorio, M.; Furlan, E.; HOPS Team; Orion Protostar Survey

    2013-02-01

    Surveys with the Spitzer and Herschel space observatories are now enabling the discovery and characterization of large samples of protostars in nearby molecular clouds, providing the observational basis for a detailed understanding of star formation in diverse environments. We are pursuing this goal with the Herschel Orion Protostar Survey (HOPS), which targets 328 Spitzer-identified protostars in the Orion molecular clouds, the largest star-forming region in the nearest 500 pc. The sample encompasses all phases of protostellar evolution and a wide range of formation environments, from dense clusters to relative isolation. With a grid of radiative transfer models, we fit the 1-870 μm spectral energy distributions (SEDs) of the protostars to estimate their envelope densities, cavity opening angles, inclinations, and total luminosities. After correcting the bolometric luminosities and temperatures of the sources for foreground extinction and inclination, we find a spread of several orders of magnitude in luminosity at all evolutionary states, a constant median luminosity over the more evolved stages, and a possible deficit of high-inclination, rapidly infalling envelopes among the Spitzer-identified sample. We have detected over 100 new sources in the Herschel images; some of them may fill this deficit. We also report results from modeling the pre- and post-outburst 1-870 μm SEDs of V2775 Ori (HOPS 223), a known FU Orionis outburster in the sample. It is the least luminous FU Ori star with a protostellar envelope.

  18. Hops 383: an Outbursting Class 0 Protostar in Orion

    Science.gov (United States)

    Safron, Emily J.; Fischer, William J.; Megeath, S. Thomas; Furlan, Elise; Stutz, Amelia M.; Stanke, Thomas; Billot, Nicolas; Rebull, Luisa M.; Tobin, John J.; Ali, Babar; Allen, Lori E.; Booker, Joseph; Watson, Dan M.; Wilson, T. L.

    2015-02-01

    We report the dramatic mid-infrared brightening between 2004 and 2006 of Herschel Orion Protostar Survey (HOPS) 383, a deeply embedded protostar adjacent to NGC 1977 in Orion. By 2008, the source became a factor of 35 brighter at 24 μm with a brightness increase also apparent at 4.5 μm. The outburst is also detected in the submillimeter by comparing APEX/SABOCA to SCUBA data, and a scattered-light nebula appeared in NEWFIRM Ks imaging. The post-outburst spectral energy distribution indicates a Class 0 source with a dense envelope and a luminosity between 6 and 14 {{L}⊙ }. Post-outburst time-series mid- and far-infrared photometry show no long-term fading and variability at the 18% level between 2009 and 2012. HOPS 383 is the first outbursting Class 0 object discovered, pointing to the importance of episodic accretion at early stages in the star formation process. Its dramatic rise and lack of fading over a 6 year period hint that it may be similar to FU Ori outbursts, although the luminosity appears to be significantly smaller than the canonical luminosities of such objects.

  19. Effects of compositional defects on small polaron hopping in micas.

    Science.gov (United States)

    Rosso, Kevin M; Ilton, Eugene S

    2005-06-22

    Hartree-Fock calculations and electron transfer (ET) theory were used to model the effects of compositional defects on ET in the brucite-like octahedral sheet of mica. ET was modeled as an Fe(IIIII) valence interchange reaction across shared octahedral edges of the M2-M2 iron sublattice. The model entails the hopping of localized electrons and small polaron behavior. Hartree-Fock calculations indicate that substitution of F for structural OH bridges increases the reorganization energy lambda, decreases the electronic coupling matrix element V(AB), and thereby substantially decreases the hopping rate. The lambda increase arises from modification of the metal-ligand bond force constants, and the V(AB) decrease arises from reduction of superexchange interaction through anion bridges. Deprotonation of an OH bridge, consistent with a possible mechanism of maintaining charge neutrality during net oxidation, yields a net increase in the ET rate. Although substitution of Al or Mg for Fe in M1 sites distorts the structure of adjacent Fe-occupied M2 sites, the distortion has little net impact on ET rates through these M2 sites. Hence the main effect of Al or Mg substitution for Fe, should it occur in the M2 sublattice, is to block ET pathways. Collectively, these findings pave the way for larger-scale oxidation/reduction models to be constructed for realistic, compositionally diverse micas.

  20. Link and route availability for Inter-working multi-hop wireless networks

    CSIR Research Space (South Africa)

    Salami, O

    2009-09-01

    Full Text Available In inter-working multi-hop wireless networks, establishing resilient connectivity between source-destination node pairs is a major issue. The issue of connectivity in multi-hop wireless networks have been studied. However, these analyses focused...

  1. Sampling Practices and Social Spaces: Exploring a Hip-Hop Approach to Higher Education

    Science.gov (United States)

    Petchauer, Emery

    2010-01-01

    Much more than a musical genre, hip-hop culture exists as an animating force in the lives of many young adults. This article looks beyond the moral concerns often associated with rap music to explore how hip-hop as a larger set of expressions and practices implicates the educational experiences, activities, and approaches for students. The article…

  2. Contributions to the quality control of two crops of economic importance : hops and yerba mate

    NARCIS (Netherlands)

    Wilson, Erica Georgina

    2012-01-01

    Quality control of plants is essential and at the same time very challenging.In this thesis, studies involving quality issues of two plants used in the production of two popular beverages, hops (in beer) and Ilex paraguariensis (yerba mate) were undertaken. Hops are used as bittering agents and to

  3. Hip-Hop and a Hybrid Text in a Postsecondary English Class

    Science.gov (United States)

    Sanchez, Deborah M.

    2010-01-01

    This study explores the epistemology present in hip-hop music and its reflection in the writing of one African American student in a postsecondary transitional English class. An integration of hip-hop and academic literacy practices in the student's essay challenges the supremacy of a "standard" academic English and deficit perspectives about…

  4. Effect of storage on the brewing properties of tropical hop substitutes

    African Journals Online (AJOL)

    SERVER

    2007-06-18

    Jun 18, 2007 ... conventional hops stored at 25oC for 30 weeks (12-17%) by Marr (1985) and Laws (1983). The reduction in the soft resin content of hops is a common phenomenon which is associated with the oxidative depreciation of the soft resins to hard resins with storage, Hough (1980). However, the low percentage ...

  5. Affiliation and Alienation: Hip-Hop, Rap, and Urban Science Education

    Science.gov (United States)

    Emdin, Christopher

    2010-01-01

    The critiques of rap artists and other participants in hip-hop culture provide data for teachers and researchers to investigate the attitudes of US urban youth towards schooling. This study explores the complex relationships between hip-hop and science education by examining how rap lyrics project beliefs about schooling, the relevance of existing…

  6. Characterisation of the Plasmodium falciparum Hsp70-Hsp90 organising protein (PfHop).

    Science.gov (United States)

    Gitau, Grace W; Mandal, Pradipta; Blatch, Gregory L; Przyborski, Jude; Shonhai, Addmore

    2012-03-01

    Malaria is caused by Plasmodium species, whose transmission to vertebrate hosts is facilitated by mosquito vectors. The transition from the cold blooded mosquito vector to the host represents physiological stress to the parasite, and additionally malaria blood stage infection is characterised by intense fever periods. In recent years, it has become clear that heat shock proteins play an essential role during the parasite's life cycle. Plasmodium falciparum expresses two prominent heat shock proteins: heat shock protein 70 (PfHsp70) and heat shock protein 90 (PfHsp90). Both of these proteins have been implicated in the development and pathogenesis of malaria. In eukaryotes, Hsp70 and Hsp90 proteins are functionally linked by an essential adaptor protein known as the Hsp70-Hsp90 organising protein (Hop). In this study, recombinant P. falciparum Hop (PfHop) was heterologously produced in E. coli and purified by nickel affinity chromatography. Using specific anti-PfHop antisera, the expression and localisation of PfHop in P. falciparum was investigated. PfHop was shown to co-localise with PfHsp70 and PfHsp90 in parasites at the trophozoite stage. Gel filtration and co-immunoprecipitation experiments suggested that PfHop was present in a complex together with PfHsp70 and PfHsp90. The association of PfHop with both PfHsp70 and PfHsp90 suggests that this protein may mediate the functional interaction between the two chaperones.

  7. Hegemony, Hope, and the Harlem Renaissance: Taking Hip Hop Culture Seriously

    Science.gov (United States)

    Price, Robert J., Jr.

    2005-01-01

    Adult education instructors and administrators, who typically are not members of the hip hop generation, often have little knowledge and understanding of rap music (also known as gangsta rap) and hip hop culture, and consequently do not take the black popular cultural phenomenon seriously as it relates to adult education. Adult educators,…

  8. Role of next-nearest-neighbour hopping in the internal structure of ...

    Indian Academy of Sciences (India)

    The thermodynamic properties such as entropy and specific heat are studied as functions of temperature with various NNN hopping strength. Results show that with the inclusion of negative NNN hopping, the system becomes more ordered. A qualitative transition temperature region has been estimated. It is shown that with ...

  9. Connectivity model for Inter-working multi-hop wireless networks

    CSIR Research Space (South Africa)

    Salami, O

    2009-08-01

    Full Text Available In Inter-working multi-hop wireless networks, establishing resilient connectivity between source-destination node pairs is a major issue. The issues of connectivity in Multi-hop wireless networks have been studied. However, these analyses focused...

  10. Don't Believe the Hype: Hip-Hop Literacies and English Education

    Science.gov (United States)

    Belle, Crystal

    2016-01-01

    Current scholarship suggests that many youths identify with hip-hop, especially youths of color. Study of this artistic form has been suggested as a means of helping youths acquire and become fluent in literacy practices. This article explores how the use of a hip-hop literacies curriculum addressed the literacy skills of urban ninth-grade English…

  11. Polish Hip Hop as a Form of Multiliteracies and Situated Learning

    Science.gov (United States)

    Torrence, Michael L.

    2009-01-01

    The purpose of this ethnographic study was to examine Hip Hop in Poland through the lens of multiliteracies and situated learning. This analysis is concerned with the transmission of Hip Hop to and within Wroclaw, Poland, and its acculturation and assimilation in Wroclaw, Poland. Further, this study seeks to illustrate how professional Polish Hip…

  12. Student Perceptions of the Hip Hop Culture's Influence on the Undergraduate Experience

    Science.gov (United States)

    Wessel, Roger D.; Wallaert, Kerry A.

    2011-01-01

    This study sought to determine how identification and engagement with the hip hop culture influenced the educational experiences of undergraduate students at a Midwestern, predominately White university by interviewing 11 students who self-identified as being immersed in the hip hop culture. Through a qualitative, phenomenological investigation,…

  13. Supporting Communication and Argumentation in Urban Science Education: Hip-Hop, the Battle, and the Cypher

    Science.gov (United States)

    Emdin, Christopher

    2011-01-01

    This paper is based on an exploration of communication and argumentation in urban science classrooms, and provides a description of the role that Hip-hop based education plays in supporting these major components of science education. The paper is intended to both support, and critique conventional uses of hip-hop based education, and provide…

  14. Representin': Drawing from Hip-Hop and Urban Youth Culture to Inform Teacher Education

    Science.gov (United States)

    Irizarry, Jason G.

    2009-01-01

    The potential of drawing from urban youth culture, and hip-hop more specifically, to serve as a bridge to the standard curriculum has been well documented. However, the richness and potential benefits of hip-hop are more far-reaching and present significant implications for teacher education and professional development efforts as well. This…

  15. Hip-Hop's Influence on the Identity Development of Black Female College Students: A Literature Review

    Science.gov (United States)

    Henry, Wilma J.; West, Nicole M.; Jackson, Andrea

    2010-01-01

    This article explores unique issues regarding the effects of hip-hop culture on the identity development of young Black female college students. Through the lenses of womanist and Black feminist perspectives, the intersecting impact of race and gender are reviewed within the context of the competing influences of hip-hop on Black female identity.…

  16. Deal with It We Must: Education, Social Justice, and the Curriculum of Hip Hop Culture

    Science.gov (United States)

    Baszile, Denise Taliaferro

    2009-01-01

    Although hip hop culture has been one of the most significant urban youth movements over the last three decades, it has only recently gained attention within the educational literature as a force to be reckoned with. And even then, much of the literature seeks to understand how hip hop can be used to engage students in the official school…

  17. Hip-Hop Culture in College Students' Lives: Elements, Embodiment, and Higher Edutainment

    Science.gov (United States)

    Petchauer, Emery

    2011-01-01

    College campuses have become rich sites of hip-hop culture and knowledge production. Despite the attention that campus personnel and researchers have paid to student life, the field of higher education has often misunderstood the ways that hip-hop culture exists in college students' lives. Based upon in-depth interviews, observations of…

  18. Hip-Hop, Social Justice, and Environmental Education: Toward a Critical Ecological Literacy

    Science.gov (United States)

    Cermak, Michael J.

    2012-01-01

    This essay describes an educational initiative that used environmentally themed (green) hip-hop to stimulate learning in an environmental science classroom. Students were then challenged to compose their own green hip-hop and their lyrics demonstrated skills that have thematic consistency around what is called a Critical Ecological Literacy (CEL).…

  19. HOP/NECC1, a novel regulator of mouse trophoblast differentiation.

    Science.gov (United States)

    Asanoma, Kazuo; Kato, Hidenori; Yamaguchi, Shinichiro; Shin, Chong Hyun; Liu, Zhi-Ping; Kato, Kiyoko; Inoue, Takafumi; Miyanari, Yoko; Yoshikawa, Koji; Sonoda, Kenzo; Fukushima, Kotaro; Wake, Norio

    2007-08-17

    Homeodomain-only protein/not expressed in choriocarcinoma clone 1 (HOP/NECC1) is a newly identified gene that modifies the expression of cardiac-specific genes and thereby regulates heart development. More recently, HOP/NECC1 was reported to be a suppressor of choriocarcinogenesis. Here, we examined the temporal expression profile of HOP/NECC1 in wild-type mouse placenta. We found that E8.5-E9.5 wild-type placenta expressed HOP/NECC1 in the giant cell and spongiotrophoblast layers. HOP/NECC1 (-/-) placenta exhibited marked propagation of giant cell layers and, in turn reduction of spongiotrophoblast formation. We demonstrated SRF transcriptional activity increased in the differentiating trophoblasts and forced expression of SRF in a trophoblast stem (TS) cell line induces the differentiation into giant cells. Negative regulation of SRF (serum response factor) by the binding of HOP/NECC1 protein contributed at least in part to the generation of these placental defects. Gradual induction of HOP/NECC1 in response to differentiation stimuli may result in the decision to differentiate into a particular type of trophoblastic cell lineage and result in non-lethal defects shown by the HOP/NECC1 (-/-) placentas.

  20. Expression of HopAI interferes with MAP kinase signalling in Magnaporthe oryzae.

    Science.gov (United States)

    Zhang, Xue; Liu, Wende; Li, Yang; Li, Guotian; Xu, Jin-Rong

    2017-10-01

    The Pmk1 and Mps1 MAP kinases are essential for appressorium formation and plant infection in Magnaporthe oryzae. However, their exact roles during invasive growth are not clear because pmk1 and mps1 mutants are defective in penetration. To further characterize their functions after penetration, in this study we expressed the Pseudomonas syringae effector HopAI known to inactivate plant MAP kinases in M. oryzae. Constitutive expression of HopAI with the RP27 or TrpC promoter resulted in defects in hyphal growth, conidiation, appressorium penetration and pathogenicity, which is similar to the phenotype of the mps1 mutant. HopAI interacted strongly with Mps1 in vivo and expression of dominant active MKK2 partially suppressed the defects of PRP27 -HopAI transformants, which were significantly reduced in Mps1 phosphorylation. When the infection-specific MIR1 (Magnaporthe-infection-related gene-1) promoter was used to express HopAI, PMIR1 -HopAI transformants were defective in the spreading of invasive hyphae and elicited strong defense responses in penetrated plant cells. Expression of HopAI in Fusarium graminearum also mainly affected the activation of Mgv1, an Mps1 orthologue. Taken together, our results showed that Mps1 is the major intracellular target of HopAI when it is overexpressed, and MAP kinase signalling is important for cell-to-cell movement of invasive hyphae in M. oryzae. © 2017 Society for Applied Microbiology and John Wiley & Sons Ltd.

  1. We Got Next: Hip-Hop Pedagogy and the Next Generation of Democratic Education

    Science.gov (United States)

    Dando, Michael

    2017-01-01

    Using daily experiences and existing identities as the subject matter, a hip-hop-centered class encourages students to develop a critical lens so that they can "envision a social order which supports their full humanity" (Shor, 1987, p. 48) and embraces the idea that hip-hop culture provides context for students to develop critical…

  2. Empowerment in Context: Lessons from Hip-Hop Culture for Social Work Practice

    Science.gov (United States)

    Travis, Raphael, Jr.; Deepak, Anne

    2011-01-01

    Hip-hop culture can be used as a conduit to enhanced cultural competence and practice skills through the individual and community empowerment framework. This framework is introduced as a tool for direct practice that allows social workers to understand the competing messages within hip-hop culture and how they may impact youths by promoting or…

  3. Evaluating the Impact of Transmission Power on Selecting Tall Vehicles as Best Next Communication Hop

    NARCIS (Netherlands)

    Qiao, Yu; Klein Wolterink, W.; Karagiannis, Georgios; Heijenk, Geert

    The relatively low height of antennas on communicating vehicles in Vehicular Ad Hoc Networks (VANETs) makes one hop and as well multi-hop Vehicle-to-Vehicle (V2V) communication susceptible to obstruction by other vehicles on the road. When the transmitter or receiver (or both) is a Tall vehi- cle,

  4. Proust, Hip-Hop, and Death in First-Year Composition

    Science.gov (United States)

    Sirc, Geoffrey

    2006-01-01

    Hip-hop as content in a first-year writing course offers students a powerful way to connect with their worlds. This article draws on Marcel Proust as a kind of rhyme to legitimate hip-hop as a substantive expressive medium to achieve artistry in writing.

  5. Hip-Hop as a Resource for Understanding the Urban Context: A Review of Christopher Edmin's--Science Education for the Hip-Hop Generation, Sense Publishers, Rotterdam, 2010

    Science.gov (United States)

    Brown, Bryan

    2010-01-01

    This review explores Edmin's "Science education for the hip-hop generation" by documenting how he frames hip-hop as a means to access urban student culture. He argues that hip-hop is more than a mere music genre, but rather a culture that provides young people with ways of connecting to the world. Two primary ideas emerged as central to…

  6. Throw Yo' Voice Out: Disability as a Desirable Practice in Hip-Hop Vocal Performance

    Directory of Open Access Journals (Sweden)

    Alex S. Porco

    2014-12-01

    Full Text Available Disabled bodies and disabling spaces— especially the recording studio— shape the sound iconicity of hip-hop vocal performances. The disabled voice is the audible sign by which hip-hop artists trouble cultural definitions of the self and other; exceptionalism and failure; the natural and techno-mediated; comedy and tragedy; and aesthetic play and seriousness. Hip-hop vocal performances also function as self-conscious acts of transvaluation that challenge the discursive dominance of ableism. A materialist approach to vocal performance resists reducing voice to a silent metaphor for race, oppositionality, or liberation; and it emphasizes, instead, the physiological and social processes that render hip-hop voices unique, particular, and audible. It emphasizes the agency hip-hop artists possess in seeking out disabled bodies and assuming disabled identities for aesthetic and political ends. Thus, the body is returned to the analysis of style.

  7. [Chemical constituents from Cinnamomum cassia].

    Science.gov (United States)

    He, Shan; Jiang, Yong; Tu, Peng-fei

    2015-09-01

    Various column chromatography, such as silica gel, Sephadex LH-20, ODS, and semi-preparative HPLC was used to isolate and purify the chemical constituents from Cinnamomum cassia. The structures were determined on the basis of NMR and MS spectral data analysis, together with the comparison with literature data. Fifteen compounds were isolated from the 85% aqueous ethanol extract of C. cassia, and their structures were identified as (2R, 3R)-5,7,3',4'-tetramethoxyflavan-3-ol( 1), (2R, 3R)-5,7-dimethoxy-3',4'-methylenedioxyflavan-3-ol (2), coumarin (3), cinnamic acid (4), (E)-2-hydroxy-phenylpropionic acid cinnamoyl ester (5), 3, 3', 4, 4'-tetrahydroxy biphenyl (6), methylstictic acid (7), epi-boscialin (8), (1R,2S,3S,4S)-2,3-epoxy-1, 4-dihydroxy-5-methyl-5-cyelohexene (9), 4,5-dihydroxy-3-methyl cyclohex-2-enone (10), cis-4-hydroxymellein (11), and 2-hydroxy-4-methoxyl-cinnamaldehyde (12). Compounds 5-11 were obtained from this genus plants for the first time.

  8. Infrared Measurements of Atmospheric Constituents

    Science.gov (United States)

    Murcray, Frank J.

    1998-01-01

    This research program studies atmospheric trace gas concentrations and altitude distributions, particularly for those gases that are important in stratospheric chemistry and radiative balance. Measurements are made with infrared remote sensing instruments, either ground based or balloon-borne. Most of the ground based instruments are part of the Network for Detection of Stratospheric Change (NDSC), including a very high spectral resolution solar absorption spectrometer at Mauna Loa Observatory and similar system at McMurdo Station, Antarctica (operated in collaboration with the New Zealand NIWA). Additionally, we are deriving stratospheric constituent data from the spectra obtained at the DOE Atmospheric Radiation Measurements (ARM) program's site in north-central Oklahoma. We have an atmospheric emission spectrometer system at the South Pole (with additional support from NSF), and an identical NSF support instrument at Eureka, NWT, Canada. Our balloon-borne instruments include a very high resolution solar absorption spectrometer system, a smaller, slightly lower resolution solar spectrometer system, a high resolution atmospheric emission spectrometer, and several medium resolution emission spectrometers (CAESRs) that are usually flown piggyback. During the past year, we participated in the MANTRA balloon flight from Saskatoon, Saskatchewan, with the high resolution solar spectrometer system. Several of our instruments were extensively compared to (UARS) Upper Atmosphere Research Satellite observations, and so provide a data set with known connections to UARS. In the longer term, the data can be used to relate UARS data to (EOS) Earth Observing System and (ADEOS) Advanced Airborne Earth Observing System.

  9. Comparative transcriptional analysis of hop responses to infection with Verticillium nonalfalfae.

    Science.gov (United States)

    Progar, Vasja; Jakše, Jernej; Štajner, Nataša; Radišek, Sebastjan; Javornik, Branka; Berne, Sabina

    2017-10-01

    Dynamic transcriptome profiling revealed excessive, yet ineffective, immune response to V. nonalfalfae infection in susceptible hop, global gene downregulation in shoots of resistant hop and only a few infection-associated genes in roots. Hop (Humulus lupulus L.) production is hampered by Verticillium wilt, a disease predominantly caused by the soil-borne fungus Verticillium nonalfalfae. Only a few hop cultivars exhibit resistance towards it and mechanisms of this resistance have not been discovered. In this study, we compared global transcriptional responses in roots and shoots of resistant and susceptible hop plants infected by a lethal strain of V. nonalfalfae. Time-series differential gene expression profiles between infected and mock inoculated plants were determined and subjected to network-based analysis of functional enrichment. In the resistant hop cultivar, a remarkably low number of genes were differentially expressed in roots in response to V. nonalfalfae infection, while the majority of differentially expressed genes were down-regulated in shoots. The most significantly affected genes were related to cutin biosynthesis, cell wall biogenesis, lateral root development and terpenoid biosynthesis. On the other hand, susceptible hop exhibited a strong defence response in shoots and roots, including increased expression of genes associated with plant responses, such as innate immunity, wounding, jasmonic acid pathway and chitinase activity. Strong induction of defence-associated genes in susceptible hop and a low number of infection-responsive genes in the roots of resistant hop are consistent with previous findings, confirming the pattern of excessive response of the susceptible cultivar, which ultimately fails to protect the plant from V. nonalfalfae. This research offers a multifaceted overview of transcriptional responses of susceptible and resistant hop cultivars to V. nonalfalfae infection and represents a valuable resource in the study of this plant

  10. Complex Personhood of Hip Hop & the Sensibilities of the Culture That Fosters Knowledge of Self & Self-Determination

    Science.gov (United States)

    Love, Bettina L.

    2016-01-01

    Hip hop music and culture have a complex identity in that hip hop is based in self-determination, resistance, and the long enduring fight for Black freedom, but was also created alongside the seductiveness of the material and psychological conditions of capitalism, sexism, and patriarchy. Hip hop pedagogy (HHP) as a pedagogical framework is…

  11. Characteristics of compounds in hops using cyclic voltammetry, UV-VIS, FTIR and GC-MS analysis.

    Science.gov (United States)

    Masek, Anna; Chrzescijanska, Ewa; Kosmalska, Anna; Zaborski, Marian

    2014-08-01

    The article presents the antioxidant properties of the extracts of hop EI and EII, by the electrochemical methods on a platinum electrode and comparative analysis of the composition of the extracts of hops using UV-VIS, FTIR and GC-MS methods. The hops extract EI, was obtained from the waste of the hops cone. The hops extract EII, was obtained from the hops cone itself. Hops contain a wide range of polyphenolic compounds with antioxidant properties divided in various chemical classes. Flavonoids and other polyphenolic compounds contained in hops show antioxidant capacity because of the presence of hydroxyl groups in various configurations and numbers within their molecules. The electrochemical properties and antioxidant capacity of hop samples were determined to select the most effective antioxidant. Based on the cyclic and pulse voltammograms, it was observed that hop extract EI contains polyphenols that are oxidised at a less positive potential than extract EII, i.e., it shows better antioxidant capacity. From the analysis of the UV-VIS and FTIR spectra and the GC-MS analysis, it was observed that extract EI contains less phenyl compounds than EII. In addition to flavonoids, EII contains hop acids and chlorophyll. The solutions of hop extracts show very good antioxidant capacities; therefore, they can effectively inhibit or slow negative oxidation reactions and scavenge free radicals and reactive oxygen species (ROS). Copyright © 2014 Elsevier Ltd. All rights reserved.

  12. Bringing Back Sweet (and Not so Sweet) Memories: The Cultural Politics of Memory, Hip-Hop, and Generational Identities

    Science.gov (United States)

    Hill, Marc Lamont

    2009-01-01

    This article examines the salience of collective "memory" and "remembering" among a group of students in Hip-Hop Lit, a hip-hop centered English literature course that I co-taught at "Howard High School," an urban high school in the Northeastern United States. Specifically, this article examines the memory work that occurred within Hip-Hop Lit in…

  13. RNAi knockdown of Hop (Hsp70/Hsp90 organising protein) decreases invasion via MMP-2 down regulation.

    LENUS (Irish Health Repository)

    Walsh, Naomi

    2011-07-28

    We previously identified Hop as over expressed in invasive pancreatic cancer cell lines and malignant tissues of pancreatic cancer patients, suggesting an important role for Hop in the biology of invasive pancreatic cancer. Hop is a co-chaperone protein that binds to both Hsp70\\/Hsp90. We hypothesised that by targeting Hop, signalling pathways modulating invasion and client protein stabilisation involving Hsp90-dependent complexes may be altered. In this study, we show that Hop knockdown by small interfering (si)RNA reduces the invasion of pancreatic cancer cells, resulting in decreased expression of the downstream target gene, matrix metalloproteinases-2 (MMP-2). Hop in conditioned media co-immunoprecipitates with MMP-2, implicating a possible extracellular function for Hop. Knockdown of Hop expression also reduced expression levels of Hsp90 client proteins, HER2, Bcr-Abl, c-MET and v-Src. Furthermore, Hop is strongly expressed in high grade PanINs compared to lower PanIN grades, displaying differential localisation in invasive ductal pancreatic cancer, indicating that the localisation of Hop is an important factor in pancreatic tumours. Our data suggests that the attenuation of Hop expression inactivates key signal transduction proteins which may decrease the invasiveness of pancreatic cancer cells possibly through the modulation of Hsp90 activity. Therefore, targeting Hop in pancreatic cancer may constitute a viable strategy for targeted cancer therapy.

  14. Engaging Black Males on Their Own Terms: What Schools Can Learn from Black Males Who Produce Hip-Hop

    Science.gov (United States)

    Irby, Decoteau J.; Petchauer, Emery; Kirkland, David

    2013-01-01

    Education scholars and practitioners have much to learn about engagement and motivation of Black males by directing their inquiries to more organic sites of hip-hop cultural production outside of schools. One such site is the hip-hop's informal labor economy where Black males engage in earning money through hip-hop cultural production. Labor…

  15. Involvement of Vacuolar Sequestration and Active Transport in Tolerance of Saccharomyces cerevisiae to Hop Iso-?-Acids

    NARCIS (Netherlands)

    Hazelwood, L.A.; Walsh, M.C.; Pronk, J.T.; Daran, J.M.

    2009-01-01

    The hop plant, Humulus lupulus L., has an exceptionally high content of secondary metabolites, the hop -acids, which possess a range of beneficial properties, including antiseptic action. Studies performed on the mode of action of hop iso--acids have hitherto been restricted to lactic acid bacteria.

  16. CHEMICAL INVESTIGATION OF THE VOLATILE CONSTITUENTS ...

    African Journals Online (AJOL)

    The major volatile constituents of the oils from the integral parts of Cleome viscosa L. from Nigeria have been identified by GC, GC/MS and 1H NMR. The main constituents of the non-polar fraction of the oils were monoterpene hydrocarbons (21% in stem/leaves, 15% in seed/fruits, 12% in roots) and some oxygenated ...

  17. [Studies on chemical constituents of Clerodendrum bungei].

    Science.gov (United States)

    Gao, Li-ming; Wei, Xiao-mei; He, Yang-qing

    2003-11-01

    To study the constituents from Clerodendrum bungei. The constituents were isolated and purified with chromatographic methods, and identified by NMR, MS and IR. Five compounds were isolated, beta-sitosterol (1), taraxerol (2), glochidone (3), glochidonol (4), glochidiol (5). Compounds (3), (4) and (5) were isolated for the first time from C. bungei.

  18. Nonregenerative Dual-Hop Cooperative Links with Selection Diversity

    Directory of Open Access Journals (Sweden)

    Karagiannidis George K

    2006-01-01

    Full Text Available The end-to-end performance of dual-hop cooperative diversity systems equipped with nonregenerative relays and a selection combining receiver at the destination terminal over independent and nonidentical Nakagami- fading channels is studied. Closed-form expressions for the cumulative distribution function and the probability density function of the end-to-end signal-to-noise ratio ( are presented, while analytical formulae are derived for the moments and the moment generating function. Using these statistical results, closed-form expressions for the outage probability are presented for both channel state information and fixed gain relays. Furthermore, for the case of fixed gain relay, the average end-to-end , the amount of fading, and the average bit error rate can be numerically evaluated. The proposed mathematical analysis is complemented by numerical examples, including the effects on the overall performance of the s unbalancing as well as the fading severity.

  19. SDN-Based Double Hopping Communication against Sniffer Attack

    Directory of Open Access Journals (Sweden)

    Zheng Zhao

    2016-01-01

    Full Text Available Sniffer attack has been a severe threat to network communication security. Traditional network usually uses static network configuration, which provides convenience to sniffer attack. In this paper, an SDN-based double hopping communication (DHC approach is proposed to solve this problem. In DHC, ends in communication packets as well as the routing paths are changed dynamically. Therefore, the traffic will be distributed to multiple flows and transmitted along different paths. Moreover, the data from multiple users will be mixed, bringing difficulty for attackers in obtaining and recovering the communication data, so that sniffer attack will be prevented effectively. It is concluded that DHC is able to increase the overhead of sniffer attack, as well as the difficulty of communication data recovery.

  20. Systematic network coding for two-hop lossy transmissions

    Science.gov (United States)

    Li, Ye; Blostein, Steven; Chan, Wai-Yip

    2015-12-01

    In this paper, we consider network transmissions over a single or multiple parallel two-hop lossy paths. These scenarios occur in applications such as sensor networks or WiFi offloading. Random linear network coding (RLNC), where previously received packets are re-encoded at intermediate nodes and forwarded, is known to be a capacity-achieving approach for these networks. However, a major drawback of RLNC is its high encoding and decoding complexity. In this work, a systematic network coding method is proposed. We show through both analysis and simulation that the proposed method achieves higher end-to-end rate as well as lower computational cost than RLNC for finite field sizes and finite-sized packet transmissions.

  1. Double-hop networks using VSATs for the Intelsat system

    Science.gov (United States)

    Mizuno, Toshio; Nohara, Mitsuo; Watanabe, Fumio; Takeuchi, Yoshio; Honda, Teruhiko

    The double-hop VSAT (very small aperture terminal) network was studied with emphasis on its feasibility and networking in the Intelsat system. The results of channel-capacity estimation indicate that reasonable channel capacity and availability objectives equal to those for Super IBS (Intelsat business services) are attainable through the use of the uplink and downlink power control incorporated in the outbound link with BPSK/SCPC (binary-phase shift keying/single channel per carrier) transmission. Possible network architectures for various beam configurations were devised, and the accessibility of individual network architectures was analyzed in terms of blocking probability and call setup time. Based on the results of architecture study, an example implementation of VSAT system is shown. Furthermore, experimental results on the developed VSAT system are discussed. The experiment showed that the transmit power control for the outbound SCPC carrier is conducive to meeting stringent performance objectives stipulated for international digital transmissions.

  2. Cu1-x Fe x O: hopping transport and ferromagnetism.

    Science.gov (United States)

    Nasir, Mohd; Islam, Rakibul; Ahmed, Md A; Ayaz, Saniya; Kumar, Gautham; Kumar, Sunil; Prajapat, C L; Roussel, Frederick; Biring, Sajal; Sen, Somaditya

    2017-09-01

    Single phase, sol-gel prepared Cu1-x Fe x O (0 ≤ x ≤ 0.125) powders are characterized in terms of structural, electronic and magnetic properties. Using dielectric and magnetic studies we investigate the coupling of electron and spin. The electrical conductivities and activation energies are studied with increasing Fe content. Modelling of experimental conductivity data emphasizes a single hopping mechanism for all samples except x = 0.125, which have two activation energies. Hole doping is confirmed by confirming a majority Fe3+ substitution of Cu2+ in CuO from X-ray photoelectron spectroscopy studies (XPS). Such a substitution results in stabilized ferromagnetism. Fe substitution introduces variation in coercivity as an intrinsic magnetic property in Fe-doped CuO, and not as a secondary impurity phase.

  3. Coupled catastrophes: sudden shifts cascade and hop among interdependent systems.

    Science.gov (United States)

    Brummitt, Charles D; Barnett, George; D'Souza, Raissa M

    2015-11-06

    An important challenge in several disciplines is to understand how sudden changes can propagate among coupled systems. Examples include the synchronization of business cycles, population collapse in patchy ecosystems, markets shifting to a new technology platform, collapses in prices and in confidence in financial markets, and protests erupting in multiple countries. A number of mathematical models of these phenomena have multiple equilibria separated by saddle-node bifurcations. We study this behaviour in its normal form as fast-slow ordinary differential equations. In our model, a system consists of multiple subsystems, such as countries in the global economy or patches of an ecosystem. Each subsystem is described by a scalar quantity, such as economic output or population, that undergoes sudden changes via saddle-node bifurcations. The subsystems are coupled via their scalar quantity (e.g. trade couples economic output; diffusion couples populations); that coupling moves the locations of their bifurcations. The model demonstrates two ways in which sudden changes can propagate: they can cascade (one causing the next), or they can hop over subsystems. The latter is absent from classic models of cascades. For an application, we study the Arab Spring protests. After connecting the model to sociological theories that have bistability, we use socioeconomic data to estimate relative proximities to tipping points and Facebook data to estimate couplings among countries. We find that although protests tend to spread locally, they also seem to 'hop' over countries, like in the stylized model; this result highlights a new class of temporal motifs in longitudinal network datasets. © 2015 The Authors.

  4. Agronomic performance and beer quality assessment of twenty hop cultivars grown in Central Italy

    Directory of Open Access Journals (Sweden)

    Francesco Rossini

    2016-08-01

    Full Text Available Hop market and beer industry have always been of secondary relevance in Italy as compared to grape and wine sector. Hence, hop cultivars and the information for growing hops have been generated almost entirely from the major hop production countries. Identifying cultivars that perform well in Mediterranean environments is therefore essential to successfully start hop cultivation and breeding activity in this new growing region. To evaluate the intraspecific diversity of hop in Central Italy, 20 female hop genotypes with different origin were screened during three growing seasons (2013-2015 in an experimental hop yard. Cones yield, plant height and crop phenology were evaluated to determine which cultivars were best suited to the Mediterranean climate. Moreover, given the rising interest for the development of local beers with distinguishing aroma, a sensory analysis was performed and beers flavoured with locally produced and imported cones were compared. A significant diversity among cultivars was found for all parameters investigated. The results indicated that weather condition during flowering and development of cones markedly affected yield and plant height. Cones yield was negatively correlated with thermal time (r=–0.5, P<0.05 to harvest and positively with plant height (r=0.56, P<0.05. Cascade, Hallertauer Magnum, Hersbrucker Spat and Yeoman showed the best adaptability to the Mediterranean growing conditions as they were the top-performing cultivars across the three years. Sensory analysis evidenced the importance of cultivar selection as determining factor for flavouring properties of beers. In general, results showed that the origin of cones strongly affected the mouth feel of beers. More complex and appreciated aroma profiles were identified for beers flavoured with local cones than those hopped with commercial products.

  5. The Effect of Rap/Hip-Hop Music on Young Adult Smoking: An Experimental Study.

    Science.gov (United States)

    Harakeh, Zeena; Bogt, Tom F M Ter

    2018-02-16

    Music may influence young people's behavior through its lyrics. Substance use references occur more frequently in rap/hip-hop than in other music genres. The aim was to examine whether the exposure to rap/hip-hop lyrics referring to substance use affected cigarette smoking. An experiment with a 3-group between subject design was conducted among 74 daily-smoking young adults ranging in age from 17 to 25 years old. Three conditions were tested in a mobile lab (camper vehicle) from May to December 2011, i.e., regular chart pop music (N = 28), rap/hip-hop with non-frequent references to substance use (N = 24), and rap/hip-hop with frequent references to substance use (N = 22). One-way ANOVA showed that participants listening to substance use infused rap/hip-hop songs felt significantly less pleasant, liked the songs less, and comprehended the songs less compared to participants listening to pop songs. Poisson loglinear analyses revealed that compared to the pop music condition, none of the two rap/hip-hop music conditions had a significant effect on acute smoking. Thus, contrary to expectations, the two different rap/hip-hop conditions did not have a significantly different effect on acute smoking. Listening to rap/hip-hop, even rap hip/hop with frequent referrals to substance use (primarily alcohol and drug use, and general smoking referrals), does not seem to encourage cigarette smoking among Dutch daily-smoking young adults, at least short term.

  6. Effect of Drive Row Ground Covers on Hop (Rosales: Cannabaceae) Yard Arthropod Pests in Vermont, USA.

    Science.gov (United States)

    Calderwood, L; Cubins, J; Vesty, D; Darby, H

    2017-04-01

    Alternatives to pesticides are necessary for the management of hop (Humulus lupulus L.) arthropod pests. The three major arthropod pests in northeastern US hop production include two-spotted spider mite, Tetranychus urticae Koch, hop aphid Phorodon humuli (Schrank), and potato leafhopper, Empoasca fabae Harris. This 3-yr study (2012-2014) in Vermont investigated the effect of flowering ground covers on arthropod pest abundance. Hop cultivars 'Nugget' and 'Cascade' were evaluated under a strip-split plot experimental design. Ground cover treatments included 1) Control: mowed red clover (Trifolium pratense) and resident weeds, 2) Clover: red clover, and 3) Diverse: common yarrow (Achillea millefolium), beebalm (Monarda fistulosa), red clover, and annual sunflower (Helianthus annuus). Natural enemies were grouped by associated pest and indicated by our mixed model to be strong predictors of the number of hop aphid and potato leafhopper on hop plants. In year two, ground cover treatment had a significant effect on two-spotted spider mite abundance where fewer two-spotted spider mite were observed on hop plants in Diverse plots. The established, un-mowed Clover treatment was preferred by potato leafhopper over Diverse ground cover and hop plants. This revealed the potential for clover ground cover to serve as a trap crop for potato leafhopper management in northeastern hop yards. Our findings are evidence that ground covers implemented for conservation biological control may serve more specific pest management functions instead of or in addition to boosting top-down pest pressure. © The Authors 2017. Published by Oxford University Press on behalf of Entomological Society of America. All rights reserved. For Permissions, please email: journals.permissions@oup.com.

  7. Mott and Efros-Shklovskii hopping conductions in porous silicon nanostructures

    Science.gov (United States)

    Islam, Md. Nazrul; Ram, Sanjay K.; Kumar, Satyendra

    2009-05-01

    Electrical conductivity of electrochemically etched porous silicon was studied over a wide temperature range from 15 to 450 K. Applicability of various electrical transport mechanisms has been critically analyzed. While the conductivity data above room temperature shows extended state conduction, lowering the temperature leads to Berthelot-type conduction (180-280 K). Further, Mott's hopping (in the range 140-180 K) and Efros-Shklovskii hopping (below 120 K) conduction are found to be operating in lower temperature ranges. A clear crossover from Mott to Efros-Shklovskii variable range hopping transport is observed at low temperatures.

  8. Optimal Design of Dual-Hop VLC/RF Communication System With Energy Harvesting

    KAUST Repository

    Rakia, Tamer

    2016-07-28

    In this letter, we consider a dual-hop heterogeneous visible light communication (VLC)/radio frequency (RF) communication system to extend the coverage of VLC systems. Besides detecting the information over VLC link, the relay is able to harvest energy from the first-hop VLC link, by extracting the direct current component of the received optical signal, and uses the harvested energy to retransmit the data to a mobile terminal over the second-hop RF link. We investigate the optimal design of the hybrid system in terms of data rate maximization.

  9. High temperature electrical conductivity due to small polaron hopping motion in DNA molecules

    Energy Technology Data Exchange (ETDEWEB)

    Triberis, G P [University of Athens, Physics Department, Solid State Section, Panepistimiopolis, 15784 Zografos, Athens (Greece); Karavolas, V C [University of Athens, Physics Department, Solid State Section, Panepistimiopolis, 15784 Zografos, Athens (Greece); Simserides, C D [University of Athens, Physics Department, Solid State Section, Panepistimiopolis, 15784 Zografos, Athens (Greece); Leibniz Institute for Neurobiology, Special Lab for Non-Invasing Brain Imaging, Brenneckestr. 6, D-39118 Magdeburg (Germany)

    2005-01-01

    We present a small polaron hopping model to interpret the high-temperature electrical conductivity measured along the DNA molecules. The model takes into account the one-dimensional character of the system and the presence of disorder in the DNA double helix. The experimental data for the lambda phage DNA ({lambda}-DNA) and the poly(dA)-poly(dT) DNA follow nicely the theoretically predicted behavior leading to realistic values of the maximum hopping distances supporting the idea of multiphonon-assisted hopping of small polarons between next nearest neighbors of the DNA molecular 'wire'.

  10. [Studies on chemical constituents of Pholidota yunnanensis].

    Science.gov (United States)

    Bi, Zhi-ming; Wang, Zheng-tao; Xu, Luo-shan; Xu, Guo-jun

    2004-01-01

    To investigate the chemical constituents from Pholidota yunnanensis. Various chromatographic techniques were employed for isolation and purification of the constituents. The structures were elucidated by chemical and spectral analyses. Seven compounds were obtained and they were identified by spectroscopic analysis as n-nonacosane, cyclopholidone, n-dotriacontanoic acid, n-octacostyl ferulate, cyclopholidonol, cycloneolitsol and beta-sitosterol, respectively. n-octacostyl ferulate and cycloneolitsol were isolated from genus Pholidota for the first time.

  11. Hazardous constituent source term. Revision 2

    Energy Technology Data Exchange (ETDEWEB)

    1994-11-17

    The Department of Energy (DOE) has several facilities that either generate and/or store transuranic (TRU)-waste from weapons program research and production. Much of this waste also contains hazardous waste constituents as regulated under Subtitle C of the Resource Conservation and Recovery Act (RCRA). Toxicity characteristic metals in the waste principally include lead, occurring in leaded rubber gloves and shielding. Other RCRA metals may occur as contaminants in pyrochemical salt, soil, debris, and sludge and solidified liquids, as well as in equipment resulting from decontamination and decommissioning activities. Volatile organic compounds (VOCS) contaminate many waste forms as a residue adsorbed on surfaces or occur in sludge and solidified liquids. Due to the presence of these hazardous constituents, applicable disposal regulations include land disposal restrictions established by Hazardous and Solid Waste Amendments (HSWA). The DOE plans to dispose of TRU-mixed waste from the weapons program in the Waste Isolation Pilot Plant (WIPP) by demonstrating no-migration of hazardous constituents. This paper documents the current technical basis for methodologies proposed to develop a post-closure RCRA hazardous constituent source term. For the purposes of demonstrating no-migration, the hazardous constituent source term is defined as the quantities of hazardous constituents that are available for transport after repository closure. Development of the source term is only one of several activities that will be involved in the no-migration demonstration. The demonstration will also include uncertainty and sensitivity analyses of contaminant transport.

  12. The effects of next-to-nearest-neighbour hopping on Bose–Einstein ...

    Indian Academy of Sciences (India)

    - to-nearest-neighbour boson hopping (t ) energy on Bose–Einstein condensation in cubic lattices. We consider both non-interacting and repulsively interacting bosons moving in the lowest Bloch band. The interacting bosons are studied using ...

  13. You know what it is: learning words through listening to hip-hop.

    Science.gov (United States)

    Chesley, Paula

    2011-01-01

    Music listeners have difficulty correctly understanding and remembering song lyrics. However, results from the present study support the hypothesis that young adults can learn African-American English (AAE) vocabulary from listening to hip-hop music. Non-African-American participants first gave free-response definitions to AAE vocabulary items, after which they answered demographic questions as well as questions addressing their social networks, their musical preferences, and their knowledge of popular culture. Results from the survey show a positive association between the number of hip-hop artists listened to and AAE comprehension vocabulary scores. Additionally, participants were more likely to know an AAE vocabulary item if the hip-hop artists they listen to use the word in their song lyrics. Together, these results suggest that young adults can acquire vocabulary through exposure to hip-hop music, a finding relevant for research on vocabulary acquisition, the construction of adolescent and adult identities, and the adoption of lexical innovations.

  14. Juventud y comunicacion: reflexiones sobre practicas comunicativas de resistencia en la cultura hip hop de Medellin

    National Research Council Canada - National Science Library

    Garces Montoya, Angela

    2011-01-01

    ... de la apropiacion de medios de comunicacion alternativos. En este articulo se reconocen los desarrollos comunicativos en portales web y estudios de grabacion, apropiados por las culturas juveniles, en especial el movimiento hip hop de Medellin...

  15. Research on Improved DV-HOP Algorithm against Wormhole Attacks in WSN

    Directory of Open Access Journals (Sweden)

    Wang Xue-Wen

    2016-01-01

    Full Text Available The secure location of node is significant in the WSN (Wireless Sensor Networks of the troop frontier defence system. The wormhole attack is a big threat in the secure location. The credibility of the beacon node was used to determine the malicious nodes produced by wormhole attack in the WSN. The estimated method of multibeacon nodes was adopted to improve DV-HOP algorithm after excluding the malicious nodes. In this paper, we compared the basic DV-HOP algorithm and the improved DV-HOP algorithm in the coverage percentage and the error of network localization by simulating. The simulation results indicate that the improved DV-HOP algorithm makes the localization coverage percentage can reach 90% on a certain scale of the network, and it makes the error percentage lower when the number of beacons is different.

  16. You Know What It Is: Learning Words through Listening to Hip-Hop: e28248

    National Research Council Canada - National Science Library

    Paula Chesley

    2011-01-01

    ..., their musical preferences, and their knowledge of popular culture. Results from the survey show a positive association between the number of hip-hop artists listened to and AAE comprehension vocabulary scores...

  17. You know what it is: learning words through listening to hip-hop

    National Research Council Canada - National Science Library

    Chesley, Paula

    2011-01-01

    ..., their musical preferences, and their knowledge of popular culture. Results from the survey show a positive association between the number of hip-hop artists listened to and AAE comprehension vocabulary scores...

  18. Hip external rotation strength predicts hop performance after anterior cruciate ligament reconstruction.

    Science.gov (United States)

    Kline, Paul W; Burnham, Jeremy; Yonz, Michael; Johnson, Darren; Ireland, Mary Lloyd; Noehren, Brian

    2017-04-04

    Quadriceps strength and single-leg hop performance are commonly evaluated prior to return to sport after anterior cruciate ligament reconstruction (ACLR). However, few studies have documented potential hip strength deficits after ACLR, or ascertained the relative contribution of quadriceps and hip strength to hop performance. Patients cleared for return to sports drills after ACLR were compared to a control group. Participants' peak isometric knee extension, hip abduction, hip extension, and hip external rotation (HER) strength were measured. Participants also performed single-leg hops, timed hops, triple hops, and crossover hops. Between-limb comparisons for the ACLR to control limb and the non-operative limb were made using independent two-sample and paired sample t tests. Pearson's correlations and stepwise multiple linear regression were used to determine the relationships and predictive ability of limb strength, graft type, sex, and limb dominance to hop performance. Sixty-five subjects, 20 ACLR [11F, age 22.8 (15-45) years, 8.3 ± 2 months post-op, mass 70.47 ± 12.95 kg, height 1.71 ± 0.08 m, Tegner 5.5 (3-9)] and 45 controls [22F, age 25.8 (15-45) years, mass 74.0 ± 15.2 kg, height 1.74 ± 0.1 m, Tegner 6 (3-7)], were tested. Knee extension (4.4 ± 1.5 vs 5.4 ± 1.8 N/kg, p = 0.02), HER (1.4 ± 0.4 vs 1.7 ± 0.5 N/kg, p = 0.04), single-leg hop (146 ± 37 vs 182 ± 38% limb length, p hop (417 ± 106 vs 519 ± 102% limb length, p hop (3.3 ± 2.0 vs 2.3 ± 0.6 s, p hop (364 ± 107 vs 446 ± 123% limb length, p = 0.01) were significantly impaired in the operative versus control subject limbs. Similar deficits existed between the operative and non-operative limbs. Knee extension and HER strength were significantly correlated with each of the hop tests, but only HER significantly predicted hop performance. After ACLR, patients have persistent HER strength, knee extension strength, and hop test deficits in the

  19. You know what it is: learning words through listening to hip-hop

    National Research Council Canada - National Science Library

    Chesley, Paula

    2011-01-01

    ...) vocabulary from listening to hip-hop music. Non-African-American participants first gave free-response definitions to AAE vocabulary items, after which they answered demographic questions as well as questions addressing their social networks...

  20. HOP/NECC1, A Novel Regulator of Mouse Trophoblast Differentiation

    National Research Council Canada - National Science Library

    Kazuo Asanoma; Hidenori Kato; Shinichiro Yamaguchi; Chong Hyun Shin; Zhi-Ping Liu; Kiyoko Kato; Takafumi Inoue; Yoko Miyanari; Koji Yoshikawa; Kenzo Sonoda; Kotaro Fukushima; Norio Wake

    2007-01-01

    Homeodomain-only protein/not expressed in choriocarcinoma clone 1 (HOP/NECC1) is a newly identified gene that modifies the expression of cardiac-specific genes and thereby regulates heart development...

  1. STUDY ON THE EVOLUTION OF THE HOP MARKET IN ROMANIA DURING THE PERIOD 2007-2014

    Directory of Open Access Journals (Sweden)

    Irina - Adriana CHIURCIU

    2015-06-01

    Full Text Available The aim of this article is to present the evolution of hop market during the period 2007-2014 in Romania. It is based on the statistical data provided by the National Institute of Statistics and by the Ministry of Agriculture and Rural Development. The indicators used for processing the data are the following: the total production, the cultivated areas of hop and the quantity of hop imported and exported. From the analysis of the results obtained we can observe a decrease of 69.51% in 2012 from the total production in comparison with 2007. In the last years of the period in study, from 2012 to 2014, it increased by 104.4%. However the inland production is insufficient for the local beer industry. Romania has to import vast amounts of hops to ensure the brewers requirements across the country.

  2. The Creation of Districts and Constituencies in Ghana: Some ...

    African Journals Online (AJOL)

    multi-constituency districts which were carved up on the basis of the existing constituencies ... criteria for the creation of constituencies and mandates the Electoral ..... and collective decision-making based on consensus at the grassroots" and.

  3. Blind Compressed Sensing Parameter Estimation of Non-cooperative Frequency Hopping Signal

    OpenAIRE

    Chen Ying; Zhong Fei; Guo Shuxu

    2016-01-01

    To overcome the disadvantages of a non-cooperative frequency hopping communication system, such as a high sampling rate and inadequate prior information, parameter estimation based on Blind Compressed Sensing (BCS) is proposed. The signal is precisely reconstructed by the alternating iteration of sparse coding and basis updating, and the hopping frequencies are directly estimated based on the results. Compared with conventional compressive sensing, blind compressed sensing does not require pr...

  4. Electron Tunneling and Hopping Possibilites in RuO2 Thick Films

    OpenAIRE

    Halder, N. C.

    1983-01-01

    It is proposed in this paper that the temperature coefficient of resistivity (TCR) in thick film resistors arises from (i) the usual particle-to-particle conduction, (ii) electron tunneling, and (iii) the phononassisted hopping. Equations for activation energies are derived for the temperature minimum of the resistance with and without hopping. New equations for TCR are suggested. Some extensive calculations of TCR and activation energy have been made for RuO2 thick film resistors, the result...

  5. Study of one-dimensional electron hopping and its effects on ESR line shape

    Energy Technology Data Exchange (ETDEWEB)

    Tang, Jau [Argonne National Lab., IL (United States); Dikshit, S.N. [Univ. of Chicago, IL (United States). Dept. of Chemistry; Norris, J.R. [Argonne National Lab., IL (United States)]|[Univ. of Chicago, IL (United States). Dept. of Chemistry

    1997-08-01

    Random hopping processes between discrete sites along a finite open chain or around a closed finite loop are examined. Closed form formulae are prescribed for the dependence of the ESR (electron spin resonance) line shape on the chain length and hopping rate. Significant differences between the closed loop and open chain are demonstrated. Deviation at short time from the results of diffusion in a continuum is presented.

  6. Measurement and Analysis of Single-Hop Delay on an IP Backbone Network

    OpenAIRE

    Papagiannaki, Konstantina; Moon, Sue; Fraleigh, Chuck; Thiran, Patrick; Diot, Christophe

    2003-01-01

    We measure and analyze the single-hop packet delay through operational routers in the Sprint Internet protocol (IP) backbone network. After presenting our delay measurements through a single router for OC-3 and OC-12 link speeds, we propose a methodology to identify the factors contributing to single-hop delay. In addition to packet processing, transmission, and queueing delay at the output link, we observe the presence of very large delays that cannot be explained within the context of a fir...

  7. Age-related muscle activation profiles and joint stiffness regulation in repetitive hopping

    OpenAIRE

    Hoffrén, Merja; Ishikawa, Masaki; Rantalainen, Timo; Avela, Janne; Komi, Paavo

    2011-01-01

    It is well documented that increasing effort during exercise is characterized by an increase in electromyographic activity of the relevant muscles. How aging influences this relationship is a matter of great interest. In the present study, nine young and 24 elderly subjects did repetitive hopping with maximal effort as well as with 50%, 65%, 75% and 90% intensities. During hopping joint kinematics were measured together with electromyographic activity (EMG) from the soleus, gastrocnemius medi...

  8. Effective one-dimensionality of universal ac hopping conduction in the extreme disorder limit

    DEFF Research Database (Denmark)

    Dyre, Jeppe; Schrøder, Thomas

    1996-01-01

    A phenomenological picture of ac hopping in the symmetric hopping model (regular lattice, equal site energies, random energy barriers) is proposed according to which conduction in the extreme disorder limit is dominated by essentially one-dimensional "percolation paths." Modeling a percolation pa...... as strictly one dimensional with a sharp jump rate cutoff leads to an expression for the universal ac conductivity that fits computer simulations in two and three dimensions better than the effective medium approximation....

  9. Development of aromatic hop compounds and bitterness in beer during room temperature- and cold storage based on three different hopping methods

    OpenAIRE

    Torgals, Ann Elisabeth

    2015-01-01

    The main objective of this study was to determine whether storage temperature or hopping method had influence on the aroma and bitterness in beer. The focus was set on the aroma that comes from hops, and not from yeast. The secondary objective to this study was to explore the development of the alcohol, CO2 and bitterness in the beer after priming and bottling. The thesis’ main perspective is that of home brewers, and to some extent that of microbreweries. Beer was brewed with 100 % pilsn...

  10. Solution structure and DNA-binding properties of the winged helix domain of the meiotic recombination HOP2 protein.

    Science.gov (United States)

    Moktan, Hem; Guiraldelli, Michel F; Eyster, Craig A; Zhao, Weixing; Lee, Chih-Ying; Mather, Timothy; Camerini-Otero, R Daniel; Sung, Patrick; Zhou, Donghua H; Pezza, Roberto J

    2014-05-23

    The HOP2 protein is required for efficient double-strand break repair which ensures the proper synapsis of homologous chromosomes and normal meiotic progression. We previously showed that in vitro HOP2 shows two distinctive activities: when it is incorporated into a HOP2-MND1 heterodimer, it stimulates DMC1 and RAD51 recombination activities, and the purified HOP2 alone is proficient in promoting strand invasion. The structural and biochemical basis of HOP2 action in recombination are poorly understood; therefore, they are the focus of this work. Herein, we present the solution structure of the amino-terminal portion of mouse HOP2, which contains a typical winged helix DNA-binding domain. Together with NMR spectral changes in the presence of double-stranded DNA, protein docking on DNA, and mutation analysis to identify the amino acids involved in DNA coordination, our results on the three-dimensional structure of HOP2 provide key information on the fundamental structural and biochemical requirements directing the interaction of HOP2 with DNA. These results, in combination with mutational experiments showing the role of a coiled-coil structural feature involved in HOP2 self-association, allow us to explain important aspects of the function of HOP2 in recombination. © 2014 by The American Society for Biochemistry and Molecular Biology, Inc.

  11. Routing protocol for wireless quantum multi-hop mesh backbone network based on partially entangled GHZ state

    Science.gov (United States)

    Xiong, Pei-Ying; Yu, Xu-Tao; Zhang, Zai-Chen; Zhan, Hai-Tao; Hua, Jing-Yu

    2017-08-01

    Quantum multi-hop teleportation is important in the field of quantum communication. In this study, we propose a quantum multi-hop communication model and a quantum routing protocol with multihop teleportation for wireless mesh backbone networks. Based on an analysis of quantum multi-hop protocols, a partially entangled Greenberger-Horne-Zeilinger (GHZ) state is selected as the quantum channel for the proposed protocol. Both quantum and classical wireless channels exist between two neighboring nodes along the route. With the proposed routing protocol, quantum information can be transmitted hop by hop from the source node to the destination node. Based on multi-hop teleportation based on the partially entangled GHZ state, a quantum route established with the minimum number of hops. The difference between our routing protocol and the classical one is that in the former, the processes used to find a quantum route and establish quantum channel entanglement occur simultaneously. The Bell state measurement results of each hop are piggybacked to quantum route finding information. This method reduces the total number of packets and the magnitude of air interface delay. The deduction of the establishment of a quantum channel between source and destination is also presented here. The final success probability of quantum multi-hop teleportation in wireless mesh backbone networks was simulated and analyzed. Our research shows that quantum multi-hop teleportation in wireless mesh backbone networks through a partially entangled GHZ state is feasible.

  12. Random free energy barrier hopping model for ac conduction in chalcogenide glasses

    Directory of Open Access Journals (Sweden)

    Ram Murti

    2016-03-01

    Full Text Available The random free energy barrier hopping model is proposed to explain the ac conductivity (σac of chalcogenide glasses. The Coulomb correlation is consistently accounted for in the polarizability and defect distribution functions and the relaxation time is augmented to include the overlapping of hopping particle wave functions. It is observed that ac and dc conduction in chalcogenides are due to same mechanism and Meyer-Neldel (MN rule is the consequence of temperature dependence of hopping barriers. The exponential parameter s is calculated and it is found that s is subjected to sample preparation and measurement conditions and its value can be less than or greater than one. The calculated results for a − Se, As2S3, As2Se3 and As2Te3 are found in close agreement with the experimental data. The bipolaron and single polaron hopping contributions dominates at lower and higher temperatures respectively and in addition to high energy optical phonons, low energy optical and high energy acoustic phonons also contribute to the hopping process. The variations of hopping distance with temperature is also studied. The estimated defect number density and static barrier heights are compared with other existing calculations.

  13. Condom use and hip hop culture: the case of urban young men in New York City.

    Science.gov (United States)

    Muñoz-Laboy, Miguel A; Castellanos, Daniel H; Haliburton, Chanel S; del Aguila, Ernesto Vasquez; Weinstein, Hannah J; Parker, Richard G

    2008-06-01

    We explored how young men's perceptions of and participation in hip hop culture--urban social and artistic expressions, such as clothing style, breakdancing, graffiti, and rap music--and how contextual factors of the hip hop scene may be associated with their condom use, condom-use self-efficacy, and sense of community. We conducted a cross-sectional survey of 95 African American and Latino men aged 15 to 25 years as part of a 4-year ethnographic study in New York City. Differences in young men's perceptions of and levels of affiliation with hip hop culture were not statistically associated with differences in their sense of community or condom-use self-efficacy. Frequency of participation in the hip hop nightclub scene was the strongest factor negatively associated with condom use. Popular discourses on young men's health risks often blame youths' cultures such as the hip hop culture for increased risk practices but do not critically examine how risk emerges in urban young men's lives and what aspects of youths' culture can be protective. Further research needs to focus on contextual factors of risk such as the role of hip hop nightlife on increased HIV risk.

  14. No evidence hip joint angle modulates intrinsically produced stretch reflex in human hopping.

    Science.gov (United States)

    Gibson, W; Campbell, A; Allison, G

    2013-09-01

    Motor output in activities such as walking and hopping is suggested to be mediated neurally by purported stretch reflex augmentation of muscle output. Reflex EMG activity during these tasks has been frequently investigated in the soleus muscle; with alterations in reflex amplitude being associated with changes in hip joint angle/phase of the gait cycle. Previous work has focussed on reflex activity induced by an artificial perturbation or by induction of H-reflexes. As such, it is currently unknown if stretch reflex activity induced intrinsically (as part of the task) is modulated by changes in hip joint angle. This study investigated whether hip joint angle modulated reflex EMG 'burst' activity during a hopping task performed on a custom-built partially reclined sleigh. Ten subjects participated; EMG and kinematic data (VICON motor capture system) was collected for each hop cycle. Participants completed 5 sets of 30s of self-paced hopping in (1) hip neutral and (2) hip 60° flexion conditions. There was no difference in EMG 'burst' activity or in sagittal plane kinematics (knee/ankle) in the hopping task between the two conditions. The results indicate that during a functional task such as hopping, changes in hip angle do not alter the stretch reflex-like activity associated with landing. Copyright © 2013 Elsevier B.V. All rights reserved.

  15. Two-Hop Secure Communication Using an Untrusted Relay

    Directory of Open Access Journals (Sweden)

    Xiang He

    2009-01-01

    Full Text Available We consider a source-destination pair that can only communicate through an untrusted intermediate relay node. The intermediate node is willing to employ a designated relaying scheme to facilitate reliable communication between the source and the destination. Yet, the information it relays needs to be kept secret from it. In this two-hop communication scenario, where the use of the untrusted relay node is essential, we find that a positive secrecy rate is achievable. The center piece of the achievability scheme is the help provided by either the destination node with transmission capability, or an external “good samaritan” node. In either case, the helper performs cooperative jamming that confuses the eavesdropping relay and disables it from being able to decipher what it is relaying. We next derive an upper bound on the secrecy rate for this system. We observe that the gap between the upper bound and the achievable rate vanishes as the power of the relay node goes to infinity. Overall, the paper presents a case for intentional interference, that is, cooperative jamming, as an enabler for secure communication.

  16. Two-hop Secure Communication Using an Untrusted Relay

    CERN Document Server

    He, Xiang

    2009-01-01

    We consider a source-destination pair that can only communicate through an untrusted intermediate relay node. The intermediate node is willing to employ a designated relaying scheme to facilitate reliable communication between the source and the destination. Yet, the information it relays needs to be kept secret from it. In this two-hop communication scenario, where the use of the untrusted relay node is essential, we find that a positive secrecy rate is achievable. The center piece of the achievability scheme is the help provided by either the destination node with transmission capability, or an external "good samaritan" node. In either case, the helper performs cooperative jamming that confuses the eavesdropping relay and disables it from being able to decipher what it is relaying. We next derive an upper bound on the secrecy rate for this system. We observe that the gap between the upper bound and the achievable rate vanishes as the power of the relay node goes to infinity. Overall, the paper presents a ca...

  17. Power and delay optimisation in multi-hop wireless networks

    KAUST Repository

    Xia, Li

    2014-02-05

    In this paper, we study the optimisation problem of transmission power and delay in a multi-hop wireless network consisting of multiple nodes. The goal is to determine the optimal policy of transmission rates at various buffer and channel states in order to minimise the power consumption and the queueing delay of the whole network. With the assumptions of interference-free links and independently and identically distributed (i.i.d.) channel states, we formulate this problem using a semi-open Jackson network model for data transmission and a Markov model for channel states transition. We derive a difference equation of the system performance under any two different policies. The necessary and sufficient condition of optimal policy is obtained. We also prove that the system performance is monotonic with respect to (w.r.t.) the transmission rate and the optimal transmission rate can be either maximal or minimal. That is, the ‘bang-bang’ control is an optimal control. This optimality structure greatly reduces the problem complexity. Furthermore, we develop an iterative algorithm to find the optimal solution. Finally, we conduct the simulation experiments to demonstrate the effectiveness of our approach. We hope our work can shed some insights on solving this complicated optimisation problem.

  18. Nonlinear hopping transport in ring systems and open channels.

    Science.gov (United States)

    Einax, Mario; Körner, Martin; Maass, Philipp; Nitzan, Abraham

    2010-01-21

    We study the nonlinear hopping transport in one-dimensional rings and open channels. Analytical results are derived for the stationary current response to a constant bias without assuming any specific coupling of the rates to the external fields. It is shown that anomalous large effective jump lengths, as observed in recent experiments by taking the ratio of the third-order nonlinear and the linear conductivity, can occur already in ordered systems. Rectification effects due to site energy disorder in ring systems are expected to become irrelevant for large system sizes. In open channels, in contrast, rectification effects occur already for disorder in the jump barriers and do not vanish in the thermodynamic limit. Numerical solutions for a sinusoidal bias show that the ring system provides a good description for the transport behavior in the open channel for intermediate and high frequencies. For low frequencies temporal variations in the mean particle number have to be taken into account in the open channel, which cannot be captured in the more simple ring model.

  19. Child-Mediated Stroke Communication: Findings from Hip Hop Stroke

    Science.gov (United States)

    Williams, Olajide; DeSorbo, Alexandra; Noble, James; Gerin, William

    2011-01-01

    Background and Purpose Low thrombolysis rates for acute ischemic stroke is linked to delays in seeking immediate treatment due to low public stroke awareness. We aimed to assess whether “Child-Mediated Stroke Communication” (CMSC) could improve stroke literacy parents of children enrolled in a school-based stroke literacy program called Hip Hop Stroke (HHS). Methods Parents of children aged 9 to 12 years from two public schools in Harlem, NYC, were recruited to participate in stroke literacy questionnaires before and after their child’s participation in HHS, a novel CMSC intervention delivered in school auditoriums. Parental recall of stroke information communicated through their child was assessed 1-week following the intervention. Results Fifth and Sixth grade students (n =182) were enrolled into HHS. 102 parents were approached in person to participate; 75 opted to participate and 71 completed both pretest and post-test (74% response rate and 95% retention rate). Parental stroke literacy improved after the program: before the program, 3 parents of 75 (3.9%) were able to identify the five cardinal stroke symptoms, distracting symptom (chest pains), and had an urgent action plan (calling 911), compared to 21 of 71 parents (29.6%) post-intervention (pstroke signs and symptoms remains low among residents of this high-risk population. The use of Child-Mediated Stroke Communication suggests that schoolchildren aged 9-12 may be effective conduits of critical stroke knowledge to their Parents. PMID:22033995

  20. SDN-based path hopping communication against eavesdropping attack

    Science.gov (United States)

    Zhang, Chuanhao; Bu, Youjun; Zhao, Zheng

    2016-10-01

    Network eavesdropping is one of the most popular means used by cyber attackers, which has been a severe threat to network communication security. Adversaries could capture and analyze network communication data from network nodes or links, monitor network status and steal sensitive data such as username and password etc. Traditional network usually uses static network configuration, and existing defense methods, including firewall, IDS, IPS etc., cannot prevent eavesdropping, which has no distinguishing characteristic. Network eavesdropping become silent during most of the time of the attacking process, which is why it is difficult to discover and to defend. But A successful eavesdropping attack also has its' precondition, which is the target path should be relatively stable and has enough time of duration. So, In order to resolve this problem, it has to work on the network architecture. In this paper, a path hopping communication(PHC) mechanism based on Software Define Network (SDN) was proposed to solve this problem. In PHC, Ends in communication packets as well as the routing paths were changed dynamically. Therefore, the traffic would be distributed to multiple flows and transmitted along different paths. so that Network eavesdropping attack could be prevented effectively. It was concluded that PHC was able to increase the overhead of Network eavesdropping, as well as the difficulty of communication data recovery.

  1. El griot no ha muerto, viva el hip-hop

    Directory of Open Access Journals (Sweden)

    Fco. Javier González García-Mamely

    2015-11-01

    Full Text Available La oratura en África ha jugado un papel vital a lo largo de los milenios como un (único medio de preservar y transmitir la historia, la cultura y el imaginario de cada comunidad. El griot es un claro modelo de las artes orales, pero ha sufrido cambios drásticos en su modo de vida y en los recursos narrativos de los que dispone. Tras el mecenazgo de los grandes reyes y las sucesivas llegadas del islam, el colonialismo y los procesos de modernización y occidentalización, los griots se han tenido que adaptar a nuevos patrones, audiencias y medios de comunicación, convirtiéndose en políticos o en figuras del espectáculo. La aparición del rap y el hip-hop reclamando ser los “modernos griots” ha ocasionado una respuesta crítica y una atracción viral hacia el nuevo fenómeno, sea éste un nuevo género o una reinvención de la oratura del antiguo griot.

  2. Family-based hip-hop to health: outcome results.

    Science.gov (United States)

    Fitzgibbon, Marian L; Stolley, Melinda R; Schiffer, Linda; Kong, Angela; Braunschweig, Carol L; Gomez-Perez, Sandra L; Odoms-Young, Angela; Van Horn, Linda; Christoffel, Katherine Kaufer; Dyer, Alan R

    2013-02-01

    This pilot study tested the feasibility of Family-Based Hip-Hop to Health, a school-based obesity prevention intervention for 3-5-year-old Latino children and their parents, and estimated its effectiveness in producing smaller average changes in BMI at 1-year follow-up. Four Head Start preschools administered through the Chicago Public Schools were randomly assigned to receive a Family-Based Intervention (FBI) or a General Health Intervention (GHI). Parents signed consent forms for 147 of the 157 children enrolled. Both the school-based and family-based components of the intervention were feasible, but attendance for the parent intervention sessions was low. Contrary to expectations, a downtrend in BMI Z-score was observed in both the intervention and control groups. While the data reflect a downward trend in obesity among these young Hispanic children, obesity rates remained higher at 1-year follow-up (15%) than those reported by the National Health and Nutrition Examination Survey (2009-2010) for 2-5-year-old children (12.1%). Developing evidence-based strategies for obesity prevention among Hispanic families remains a challenge. Copyright © 2012 The Obesity Society.

  3. Power and delay optimisation in multi-hop wireless networks

    Science.gov (United States)

    Xia, Li; Shihada, Basem

    2014-06-01

    In this paper, we study the optimisation problem of transmission power and delay in a multi-hop wireless network consisting of multiple nodes. The goal is to determine the optimal policy of transmission rates at various buffer and channel states in order to minimise the power consumption and the queueing delay of the whole network. With the assumptions of interference-free links and independently and identically distributed (i.i.d.) channel states, we formulate this problem using a semi-open Jackson network model for data transmission and a Markov model for channel states transition. We derive a difference equation of the system performance under any two different policies. The necessary and sufficient condition of optimal policy is obtained. We also prove that the system performance is monotonic with respect to (w.r.t.) the transmission rate and the optimal transmission rate can be either maximal or minimal. That is, the 'bang-bang' control is an optimal control. This optimality structure greatly reduces the problem complexity. Furthermore, we develop an iterative algorithm to find the optimal solution. Finally, we conduct the simulation experiments to demonstrate the effectiveness of our approach. We hope our work can shed some insights on solving this complicated optimisation problem.

  4. Self-dual quasiperiodic systems with power-law hopping

    Science.gov (United States)

    Gopalakrishnan, Sarang

    2017-08-01

    We introduce and explore a family of self-dual models of single-particle motion in quasiperiodic potentials, with hopping amplitudes that fall off as a power law with exponent p . These models are generalizations of the familiar Aubry-André model. For large enough p , their static properties are similar to those of the Aubry-André model, although the low-frequency conductivity in the localized phase is sensitive to p . For p ≲2.1 the Aubry-André localization transition splits into three transitions; two distinct intermediate regimes with both localized and delocalized states appear near the self-dual point of the Aubry-André model. In the intermediate regimes, the density of states is singular continuous in much of the spectrum, and is approximately self-similar: states form narrow energy bands, which are divided into yet narrower subbands; we find no clear sign of a mobility edge. When p law is recovered when the power law is slowly decaying. We present evidence that many of these features persist in models that are away from self-duality.

  5. Antimicrobial activity of hop extracts against foodborne pathogens for meat applications.

    Science.gov (United States)

    Kramer, B; Thielmann, J; Hickisch, A; Muranyi, P; Wunderlich, J; Hauser, C

    2015-03-01

    The objective of this study was the fundamental investigation of the antimicrobial efficiency of various hop extracts against selected foodborne pathogens in vitro, as well as their activity against Listeria monocytogenes in a model meat marinade and on marinated pork tenderloins. In a first step, the minimum inhibitory concentrations (MIC) of three hop extracts containing either α- or β-acids or xanthohumol were determined against test bacteria including L. monocytogenes, Staphylococcus aureus, Salmonella enterica and Escherichia coli by a colorimetric method based on the measurement of bacterial metabolic activity. Moreover, the influence of either lactic or citric acid on the antimicrobial activity of the hop extracts was evaluated. The efficiency of hop extracts as a natural food preservative was then tested in a model meat marinade at 2 and 8°C, respectively, and finally on marinated pork. The experiments showed that Gram-positive bacteria were strongly inhibited by hop extracts containing β-acids and xanthohumol (MIC values of 6.3 and 12.5 ppm, respectively), whereas the antimicrobial activity of the investigated α-acid extract was significantly lower (MIC values of 200 ppm). Gram-negative bacteria were highly resistant against all tested hop extracts. Acidification of the test media led to a decrease of the MIC values. The inhibitory activity of the hop extracts against L. monocytogenes was strongly reduced in a fat-containing model meat marinade, but the efficiency of β-acids in this matrix could be increased by lowering pH and storage temperatures. By applying 0.5 % β-acids at pH = 5 in a model marinade, the total aerobic count of pork tenderloins was reduced up to 0.9 log10 compared with marinated pork without hop extract after 2 weeks of storage at 5°C. β-acid containing hop extracts have proven to possess a high antimicrobial activity against Gram-positive bacteria in vitro and in a practice-related application for food preservation

  6. Characterization of Volatile Components from Hüller Bitterer Hop Variety Using In-Tube Extraction GC-MS Analysis

    Directory of Open Access Journals (Sweden)

    Liana Claudia Salanță

    2015-05-01

    Full Text Available The composition of hop oil contributes to the aroma of beer and the essential oil profile of hop samples contains valuable information for brewers. The aim of this study was to characterize the Hüller Bitterer hop variety, during the development of hop cones, by analysis the composition of volatile oil using in-tube extraction gas chromatography–mass spectrometry (ITEX-GC–MS. The obtained results show that the ITEX-GC/MS method is suitable for the determination of volatile compounds from hop samples. A number of 60 compounds were separated and 50 of them were identified. The most important volatile compounds found in Hüller Bitterer hop variety belonging to the monoterpenes and sesquiterpenes classes are represented by: β-myrcene, β-caryophyllene and α-humulene. 

  7. Conjunction, Ellipsis, and Other Discontinuous Constituents in the Constituent Object Parser.

    Science.gov (United States)

    Metzler, Douglas P.; And Others

    1990-01-01

    Describes the Constituent Object Parser (COP), a domain independent syntactic parser developed for use in information retrieval and similar applications. The syntactic structure of natural language entities is discussed, and the mechanisms by which COP handles the problems of conjunctions, ellipsis, and discontinuous constituents are explained.…

  8. Within-field distribution of the damson-hop aphid Phorodon humuli (Schrank (Hemiptera: Aphididae and natural enemies on hops in Spain

    Directory of Open Access Journals (Sweden)

    Alicia Lorenzana

    2017-07-01

    Full Text Available A field trial was performed in a hop yard throughout 2002, 2003 and 2004 in order to determine the within-field distribution of Phorodon humuli (Schrank (Hemiptera: Aphididae and its natural enemies. The distribution of P. humuli was directly affected by the position of the hop plants in the garden, with significantly higher concentrations of aphids (p=0.0122 in 2002 and p=0.0006 in 2003 observed along the edge. However, in 2004 the plants located on the marginal plots had similar populations to those on the more inner plots. This can be explained by a higher wind speed which made it more difficult to land on edge plants first. The hop aphid’s main natural enemy was Coccinella septempunctata (Coleoptera: Coccinellidae, whose population was greatest where the aphids were most abundant with a significantly greater number of eggs (p=0.0230 and adults (p=0.0245 in 2003. Lacewing eggs were also frequently observed, with a significantly higher population (p=0.0221 in 2003 and p=0.0046 in 2004 where the aphid numbers were high. The number of winged aphids was greatest towards the margins of the garden in 2003. It is argued that the spatial distribution of the hop aphid and its natural enemies could be used to plan a sampling program and to estimate the population densities of these insects for use in integrated pest management programs.

  9. Hip-Hop High School: A Study of the Attitudes, Beliefs and Perceptions of Suburban High School Faculty towards Representation of the Hip-Hop Culture

    Science.gov (United States)

    Rowland, Ronald K.

    2011-01-01

    Research historically has demonstrated that a generational disconnect between the popular cultures from which students and teachers define normative behavior can impact classroom management and student learning. The purpose of this study was to examine attitudes, beliefs and perceptions of high school faculty toward the hip-hop culture and its…

  10. [Chemical constituents from seeds of Ziziphus mauritiana].

    Science.gov (United States)

    Guo, Sheng; Duan, Jin-Ao; Zhao, Jin-Long; Qian, Da-Wei; Zhang, Wen-Jie

    2014-03-01

    To study the chemical constituents in the seeds of Ziziphus mauritiana. The constituents were isolated by silica column chromatography and their structures were elucidated by physico-chemical properties and spectroscopic analysis. Twelve compounds were isolated from the seeds of Ziziphus mauritiana and identified as betulinic aldehyde (1), betulinic acid (2), ceanothic acid (3), frangufoline (4), spinosin (5), beta-sitosterol (6), daucosterol (7), daucosterol-6'-octadecanoate (8), sucrose (9), docosanoic acid (10), stearic acid (11), palmitoleic acid (12). All the compounds are obtained from Ziziphus mauritiana seeds for the first time and compounds 4,5 and 8 are isolated from this plant for the first time.

  11. [Chemical constituents in the introduced Coleus forskohlii].

    Science.gov (United States)

    Zhang, Weiwei; Kong, Lingyi

    2009-08-01

    To study the chemical constituents in the introduced Coleus forskohlii. The chemical constituents were isolated by column chromato-graphy. The structures were elucidated on the basis of IR, MS, 1H-NMR and 13C-NMR experiments. Eight compounds were obtained, the structures of which were identified as cytochalasin B (1), N-benzoyl-L-phenylalaninol (2), 3,6-dibenzyl-2,5-dioxopiperazine (3), 2-furoic acid (4), vanillic acid (5), loliolide (6) and forskolin D (7). Compounds 1-6 were isolated from the genus Coleus for the first time.

  12. [Chemical constituents of Fortunella margarita fruits].

    Science.gov (United States)

    Ge, Yong-Bin

    2014-03-01

    To study the chemical constituents of the fruits of Fortunella margarita. The constituents were isolated and purified on silica gel column and other column chromatography, and their structures were determined by means of spectral techniques and physicochemical data. 11 compounds were isolated and identified as fortunellin (1), naringenin (2), phloridzin (3), nicotinflorin (4), rhoifolin (5), 4'-methoxy vitexin-2"-O-alpha-L-rhamnopyranoside (6), 4'-methoxy isovitexin-2"-O-alpha-L-rhamnopyranoside (7), rutin (8), phloretin-3', 5'-di-C-beta-glucopyranoside (9), 5-hydroxymethyl-furaldehyde (10) and beta-sitosterol (11). Compound 2 - 4,7 and 10 are isolated from the plant for the first time.

  13. Between-session reliability of four hop tests and the agility T-test.

    Science.gov (United States)

    Munro, Allan G; Herrington, Lee C

    2011-05-01

    The purposes of this study were firstly to investigate whether learning affects were present in the administration of 4 hop tests and the Agility T-test and secondly to assess the between-session reliability of these tests. Twenty-two recreational athletes (11 women: age 22.3 ± 3.7 years, height 167.7 ± 6.2 cm, weight 59.2 ± 6.9 kg and 11 men: age 22.8 ± 3.1 years, height 179.8 ± 4 cm, weight 79.6 ± 10 kg) took part in the study. The subjects performed 6 repetitions of each hop test and 4 repetitions of the Agility T-test once a week over a period of 3 weeks. Distances were normalized to leg length and presented as a percentage value for the single, triple and crossover hop. Results showed that there were significant differences in scores between genders and that learning affects were present in all tests. Intraclass correlation coefficients ranged from 0.76 to 0.92 for the hop tests and 0.82 to 0.96 for the Agility T-test. The results indicated that the hop and Agility T-tests are reliable tests for use with subjects in a clinical or team sport environment. The error measurement statistics presented could be of help to practitioners to determine whether changes in individuals' scores in the hop and Agility T-tests are because of a true change in performance or measurement error. Of most importance was the fact that all subjects achieved at least 90% limb symmetry index on all 4 hop tests. Therefore, we recommend that a minimum limb symmetry value of 90%, rather than previously recommended 85%, should be adopted during rehabilitation and conditioning.

  14. Evaluation of airborne methyl salicylate for improved conservation biological control of two-spotted spider mite and hop aphid in Oregon hop yards.

    Science.gov (United States)

    Woods, J L; James, D G; Lee, J C; Gent, D H

    2011-12-01

    The use of synthetic herbivore-induced plant volatiles (HIPV) to attract natural enemies has received interest as a tool to enhance conservation biological control (CBC). Methyl salicylate (MeSA) is a HIPV that is attractive to several key predators of two-spotted spider mite, Tetranychus urticae Koch (Acari: Tetranychidae), and hop aphid, Phorodon humuli (Schrank) (Homoptera: Aphididae). A 2-year study was conducted to evaluate the recommended commercial use of MeSA in hop yards in Oregon. Slow-release MeSA dispensers were stapled to supporting poles in 0.5 ha plots and these plots were compared to a paired non-treated plot on each of three farms in 2008 and 2009. Across both years, there was a trend for reduced (range 40-91%) mean seasonal numbers of T. urticae in five of the six MeSA-baited plots. Stethorus spp., key spider mite predators, tended to be more numerous in MeSA-baited plots compared to control plots on a given farm. Mean seasonal densities of hop aphid and other natural enemies (e.g., Orius spp. and Anystis spp.) were similar between MeSA-treated and control plots. Variability among farms in suppression of two-spotted spider mites and attraction of Stethorus spp. suggests that the use of MeSA to enhance CBC of spider mites in commercial hop yards may be influenced by site-specific factors related to the agroecology of individual farms or seasonal effects that require further investigation. The current study also suggests that CBC of hop aphid with MeSA in this environment may be unsatisfactory.

  15. Model of mesons with constituent gluons

    Energy Technology Data Exchange (ETDEWEB)

    Horn, D.; Mandula, J.

    1978-02-01

    A model of mesons composed of a quark, an antiquark, and a gluon is proposed. The binding of the constituents is provided by a confining linear potential between the gluon and the quarks. The lowest states of the model are described, and their relative masses evaluated, for the case of heavy (charmed) quarks, i.e., ccg states.

  16. Phytochemicals and selected mineral constituents of Phaseolus ...

    African Journals Online (AJOL)

    The aqueous extract of Phaseolus vulgaris pods was screened for its phytochemical constituents. Selected mineral elements were also determined. Standard procedures were adopted for the phytochemical screening. Flame photometry and atomic absorption spectrophotometry was employed for mineral analysis. Alkaloids ...

  17. Phytochemical constituents and antioxidant activities of aqueous ...

    African Journals Online (AJOL)

    USER

    2010-08-02

    Aug 2, 2010 ... Medicinal plants contain bioactive compounds capable of preventing and fighting oxidative related diseases. These compounds must be screened and assayed before effective drugs are developed. Thus, phytochemical constituents and antioxidant activities of aqueous and methanol stem extracts of ...

  18. Simultaneous Determination of Seven Constituents in Herbal ...

    African Journals Online (AJOL)

    Simultaneous Determination of Seven Constituents in Herbal Prescription Jaeumganghwa-Tang Using HPLC-PDA. CS Seo, JH Kim, HK Shin. Abstract. A simple and accurate high-performance liquid chromatographic method was applied to the quantitative analysis of seven components of the traditional herbal prescription ...

  19. Some Swazi phytomedicines and their constituents | Amusan ...

    African Journals Online (AJOL)

    Ethnobotanical surveys of Manzini and Shiselweni regions of Swaziland were conducted to document new phytomedicines used in Swaziland and to determine their chemical constituents with a view to provide the scientific basis of the use of the remedies in traditional medical practice and as a guide to bioprospecting for ...

  20. The fragrance mix and its constituents

    DEFF Research Database (Denmark)

    Johansen, J D; Menné, T

    1995-01-01

    Results from 14 years of patch testing with the fragrance mix and its constituents are reviewed. From 1979-1992, 8215 consecutive patients were patch tested with the fragrance mix and 449 (5.5%) had a positive reaction. An increase in the frequency of reactions to fragrance mix was seen from the ...

  1. Phytochemical constituents and antioxidant properties of acetone ...

    African Journals Online (AJOL)

    Phytochemical constituents and antioxidant properties of acetone extract of Cleome gynandra (L.) growing in the Eastern Cape, South Africa. ... Conclusion: C. gynandra possesses high secondary metabolites which accounts for its strong antioxidant ability thus justifying its use as natural occurring antioxidants in folkloric ...

  2. Phytochemical constituents of some Nigerian medicinal plants ...

    African Journals Online (AJOL)

    ... the absence of tannins in S. acuta and flavonoids in S. cayennsis respectively. The significance of the plants in traditional medicine and the importance of the distribution of these chemical constituents were discussed with respect to the role of these plants in ethnomedicine in Nigeria. African Journal of Biotechnology Vol.

  3. Salmonella exploits the host endolysosomal tethering factor HOPS complex to promote its intravacuolar replication

    Science.gov (United States)

    Sindhwani, Aastha; Kaur, Harmeet; Tuli, Amit

    2017-01-01

    Salmonella enterica serovar typhimurium extensively remodels the host late endocytic compartments to establish its vacuolar niche within the host cells conducive for its replication, also known as the Salmonella-containing vacuole (SCV). By maintaining a prolonged interaction with late endosomes and lysosomes of the host cells in the form of interconnected network of tubules (Salmonella-induced filaments or SIFs), Salmonella gains access to both membrane and fluid-phase cargo from these compartments. This is essential for maintaining SCV membrane integrity and for bacterial intravacuolar nutrition. Here, we have identified the multisubunit lysosomal tethering factor—HOPS (HOmotypic fusion and Protein Sorting) complex as a crucial host factor facilitating delivery of late endosomal and lysosomal content to SCVs, providing membrane for SIF formation, and nutrients for intravacuolar bacterial replication. Accordingly, depletion of HOPS subunits significantly reduced the bacterial load in non-phagocytic and phagocytic cells as well as in a mouse model of Salmonella infection. We found that Salmonella effector SifA in complex with its binding partner; SKIP, interacts with HOPS subunit Vps39 and mediates recruitment of this tethering factor to SCV compartments. The lysosomal small GTPase Arl8b that binds to, and promotes membrane localization of Vps41 (and other HOPS subunits) was also required for HOPS recruitment to SCVs and SIFs. Our findings suggest that Salmonella recruits the host late endosomal and lysosomal membrane fusion machinery to its vacuolar niche for access to host membrane and nutrients, ensuring its intracellular survival and replication. PMID:29084291

  4. Effects of prophylactic ankle and knee braces on leg stiffness during hopping.

    Science.gov (United States)

    Hobara, Hiroaki; Hashizume, Satoru; Kobayashi, Yoshiyuki

    2017-01-01

    During human movement, the leg can be represented as a mechanical spring, with its stiffness potentially contributing to sports performance and injury prevention. Although many individuals perform athletic activities with joint stabilizers, little is known about the effects of prophylactic lower extremity braces on leg stiffness. The objective of this study was to investigate the effect of ankle and/or knee braces on leg stiffness measured during one-legged hopping at a range of frequencies. Thirteen male participants performed one-legged hopping with their dominant leg at frequencies of 2.2, 2.6, and 3.0 Hz. All participants were randomly tested under the following four brace conditions: 1) no brace (control), 2) prophylactic ankle brace, 3) prophylactic knee brace, and 4) prophylactic ankle and knee braces. Based on a spring-mass model, leg stiffness was calculated using data from an accelerometer. It was found that leg stiffness increased with increasing hopping frequency for each brace condition. However, there were no significant differences in leg stiffness among the four brace conditions at the three hopping frequencies. Since some level of leg stiffness is needed for optimal athletic performance and training, these results suggest that ankle and knee braces do not significantly interfere with dynamic hopping activities.

  5. Cascading Multi-Hop Reservation and Transmission in Underwater Acoustic Sensor Networks

    Directory of Open Access Journals (Sweden)

    Jae-Won Lee

    2014-10-01

    Full Text Available The long propagation delay in an underwater acoustic channel makes designing an underwater media access control (MAC protocol more challenging. In particular, handshaking-based MAC protocols widely used in terrestrial radio channels have been known to be inappropriate in underwater acoustic channels, because of the inordinately large latency involved in exchanging control packets. Furthermore, in the case of multi-hop relaying in a hop-by-hop handshaking manner, the end-to-end delay significantly increases. In this paper, we propose a new MAC protocol named cascading multi-hop reservation and transmission (CMRT. In CMRT, intermediate nodes between a source and a destination may start handshaking in advance for the next-hop relaying before handshaking for the previous node is completed. By this concurrent relaying, control packet exchange and data delivery cascade down to the destination. In addition, to improve channel utilization, CMRT adopts a packet-train method where multiple data packets are sent together by handshaking once. Thus, CMRT reduces the time taken for control packet exchange and accordingly increases the throughput. The performance of CMRT is evaluated and compared with that of two conventional MAC protocols (multiple-access collision avoidance for underwater (MACA-U and MACA-U with packet trains (MACA-UPT. The results show that CMRT outperforms other MAC protocols in terms of both throughput and end-to-end delay.

  6. Odor-Active Compounds in the Special Flavor Hops Huell Melon and Polaris.

    Science.gov (United States)

    Neiens, Silva D; Steinhaus, Martin

    2018-02-05

    The volatiles isolated from samples of the special flavor hop varieties, Huell Melon and Polaris, and from the aroma hop variety, Hallertau Tradition, by solvent extraction and solvent-assisted flavor evaporation (SAFE) were subjected to a comparative aroma extract dilution analysis (cAEDA), which resulted in 46 odor-active compounds in the flavor dilution (FD) factor range of 16 to 2048. On the basis of high FD factors, myrcene, (3R)-linalool, and 2- and 3-methylbutanoic acid were confirmed as important variety-independent hop odorants. (1R,4S)-Calamenene was identified for the first time as an odor-active compound in hops. Clear differences in the FD factors and their subsequent objectification by stable isotope dilution quantitation suggested that high concentrations of the esters ethyl 2-methylbutanoate, ethyl 2-methylpropanoate, and propyl 2-methylbutanoate cause the characteristic fruity, cantaloupe-like odor note in Huell Melon hops, whereas the fruity and minty odor notes in Polaris are associated with high amounts of 3-methylbutyl acetate and 1,8-cineole.

  7. Effects of prophylactic ankle and knee braces on leg stiffness during hopping

    Directory of Open Access Journals (Sweden)

    Hobara H

    2017-04-01

    Full Text Available Hiroaki Hobara, Satoru Hashizume, Yoshiyuki Kobayashi Human Informatics Research Institute, National Institute of Advanced Industrial Science and Technology, Tokyo, Japan Abstract: During human movement, the leg can be represented as a mechanical spring, with its stiffness potentially contributing to sports performance and injury prevention. Although many individuals perform athletic activities with joint stabilizers, little is known about the effects of prophylactic lower extremity braces on leg stiffness. The objective of this study was to investigate the effect of ankle and/or knee braces on leg stiffness measured during one-legged ­hopping at a range of frequencies. Thirteen male participants performed one-legged hopping with their dominant leg at frequencies of 2.2, 2.6, and 3.0 Hz. All participants were randomly tested under the following four brace conditions: 1 no brace (control, 2 prophylactic ankle brace, 3 prophylactic knee brace, and 4 prophylactic ankle and knee braces. Based on a spring–mass model, leg stiffness was calculated using data from an accelerometer. It was found that leg stiffness increased with increasing hopping frequency for each brace condition. However, there were no significant differences in leg stiffness among the four brace conditions at the three hopping frequencies. Since some level of leg stiffness is needed for optimal athletic performance and training, these results suggest that ankle and knee braces do not significantly interfere with dynamic hopping activities. Keywords: spring–mass model, injury prevention, compensatory strategy

  8. Resonant hopping of a robot controlled by an artificial neural oscillator.

    Science.gov (United States)

    Pelc, Evan H; Daley, Monica A; Ferris, Daniel P

    2008-06-01

    The bouncing gaits of terrestrial animals (hopping, running, trotting) can be modeled as a hybrid dynamic system, with spring-mass dynamics during stance and ballistic motion during the aerial phase. We used a simple hopping robot controlled by an artificial neural oscillator to test the ability of the neural oscillator to adaptively drive this hybrid dynamic system. The robot had a single joint, actuated by an artificial pneumatic muscle in series with a tendon spring. We examined how the oscillator-robot system responded to variation in two neural control parameters: descending neural drive and neuromuscular gain. We also tested the ability of the oscillator-robot system to adapt to variations in mechanical properties by changing the series and parallel spring stiffnesses. Across a 100-fold variation in both supraspinal gain and muscle gain, hopping frequency changed by less than 10%. The neural oscillator consistently drove the system at the resonant half-period for the stance phase, and adapted to a new resonant half-period when the muscle series and parallel stiffnesses were altered. Passive cycling of elastic energy in the tendon accounted for 70-79% of the mechanical work done during each hop cycle. Our results demonstrate that hopping dynamics were largely determined by the intrinsic properties of the mechanical system, not the specific choice of neural oscillator parameters. The findings provide the first evidence that an artificial neural oscillator will drive a hybrid dynamic system at partial resonance.

  9. Integration of intrinsic muscle properties, feed-forward and feedback signals for generating and stabilizing hopping.

    Science.gov (United States)

    Haeufle, D F B; Grimmer, S; Kalveram, K-T; Seyfarth, A

    2012-07-07

    It was hypothesized that a tight integration of feed-forward and feedback-driven muscle activation with the characteristic intrinsic muscle properties is a key feature of locomotion in challenging environments. In this simulation study it was investigated whether a combination of feed-forward and feedback signals improves hopping stability compared with those simulations with one individual type of activation. In a reduced one-dimensional hopping model with a Hill-type muscle (one contractile element, neither serial nor parallel elastic elements), the level of detail of the muscle's force-length-velocity relation and the type of activation generation (feed-forward, feedback and combination of both) were varied to test their influence on periodic hopping. The stability of the hopping patterns was evaluated by return map analysis. It was found that the combination of feed-forward and proprioceptive feedback improved hopping stability. Furthermore, the nonlinear Hill-type representation of intrinsic muscle properties led to a faster reduction of perturbations than a linear approximation, independent of the type of activation. The results emphasize the ability of organisms to exploit the stabilizing properties of intrinsic muscle characteristics.

  10. HopW1 from Pseudomonas syringae disrupts the actin cytoskeleton to promote virulence in Arabidopsis.

    Directory of Open Access Journals (Sweden)

    Yongsung Kang

    2014-06-01

    Full Text Available A central mechanism of virulence of extracellular bacterial pathogens is the injection into host cells of effector proteins that modify host cellular functions. HopW1 is an effector injected by the type III secretion system that increases the growth of the plant pathogen Pseudomonas syringae on the Columbia accession of Arabidopsis. When delivered by P. syringae into plant cells, HopW1 causes a reduction in the filamentous actin (F-actin network and the inhibition of endocytosis, a known actin-dependent process. When directly produced in plants, HopW1 forms complexes with actin, disrupts the actin cytoskeleton and inhibits endocytosis as well as the trafficking of certain proteins to vacuoles. The C-terminal region of HopW1 can reduce the length of actin filaments and therefore solubilize F-actin in vitro. Thus, HopW1 acts by disrupting the actin cytoskeleton and the cell biological processes that depend on actin, which in turn are needed for restricting P. syringae growth in Arabidopsis.

  11. Multi-hop localization algorithm based on grid-scanning for wireless sensor networks.

    Science.gov (United States)

    Wan, Jiangwen; Guo, Xiaolei; Yu, Ning; Wu, Yinfeng; Feng, Renjian

    2011-01-01

    For large-scale wireless sensor networks (WSNs) with a minority of anchor nodes, multi-hop localization is a popular scheme for determining the geographical positions of the normal nodes. However, in practice existing multi-hop localization methods suffer from various kinds of problems, such as poor adaptability to irregular topology, high computational complexity, low positioning accuracy, etc. To address these issues in this paper, we propose a novel Multi-hop Localization algorithm based on Grid-Scanning (MLGS). First, the factors that influence the multi-hop distance estimation are studied and a more realistic multi-hop localization model is constructed. Then, the feasible regions of the normal nodes are determined according to the intersection of bounding square rings. Finally, a verifiably good approximation scheme based on grid-scanning is developed to estimate the coordinates of the normal nodes. Additionally, the positioning accuracy of the normal nodes can be improved through neighbors' collaboration. Extensive simulations are performed in isotropic and anisotropic networks. The comparisons with some typical algorithms of node localization confirm the effectiveness and efficiency of our algorithm.

  12. Optimal hop position-based minimum energy routing protocol for underwater acoustic sensor networks

    Directory of Open Access Journals (Sweden)

    K.S. Geethu

    2015-05-01

    Full Text Available Development of energy-efficient routing protocols is a major concern in the design of underwater acoustic sensor networks (UASNs since UASN nodes are typically powered by batteries, which are difficult to replace or recharge in aquatic environments. This study proposes an optimal hop position-based energy-efficient routing protocol for UASNs. Initially, the authors present an analytical model to compute the total energy consumption in a multi-hop UASN for deep water scenario, taking into account dependence of usable bandwidth on transmission distance and propagation characteristics of underwater acoustic channel. They derive analytical solution for the optimal hop distance that minimises total energy consumption in the network. They then propose an energy-efficient routing protocol that relies on the computation of optimal hop distance. In their routing scheme, selection of forwarding nodes are based on their depth, residual energy and closeness to the computed optimal hop position corresponding to source node. Simulation results show that total energy consumption of the network gets reduced drastically, leading to improvement in network lifetime. Moreover, the proposed routing scheme makes use of courier nodes to handle coverage-hole problem. The efficient movement of courier nodes improves packet delivery ratio and network throughput.

  13. Exact Open Quantum System Dynamics Using the Hierarchy of Pure States (HOPS).

    Science.gov (United States)

    Hartmann, Richard; Strunz, Walter T

    2017-11-09

    We show that the general and numerically exact Hierarchy of Pure States method (HOPS) is very well applicable to calculate the reduced dynamics of an open quantum system. In particular, we focus on environments with a sub-Ohmic spectral density (SD) resulting in an algebraic decay of the bath correlation function (BCF). The universal applicability of HOPS, reaching from weak to strong coupling for zero and nonzero temperature, is demonstrated by solving the spin-boson model for which we find perfect agreement with other methods, each one suitable for a special regime of parameters. The challenges arising in the strong coupling regime are not only reflected in the computational effort needed for the HOPS method to converge but also in the necessity for an importance sampling mechanism, accounted for by the nonlinear variant of HOPS. In order to include nonzero-temperature effects in the strong coupling regime we found that it is highly favorable for the HOPS method to use the zero-temperature BCF and include temperature via a stochastic Hermitian contribution to the system Hamiltonian.

  14. Culturas juveniles en tono de mujer. Hip hop en Medellín (Colombia.

    Directory of Open Access Journals (Sweden)

    Ángela Garcés Montoya.

    2011-04-01

    Full Text Available This article is part of the research project, “Youth musical mediations,” that explores the appropriation of alternative means of communication which allow the young to develop identities sharply differentiated from those the adult world. In particular, the article examines the world of hip hop in Medellín and the ways that youth participate in it. To follow key trajectories of women in hip hop, their voices, feelings, and memories must be uncovered. This will allow us to see how the few women who are currently part of hip hop scene in Medellín and Colombia enter, move through, and persevere in it. Since women constitute only a small percentage of the youth who live and remake hip hop in Medellín, it is important to understand how they manage to live in a male-colored world. If hip hop is about strength, denunciation, confrontation, and resistance, it seems that these qualities are more appropriate for men than for women

  15. Defined subunit arrangement and rab interactions are required for functionality of the HOPS tethering complex.

    Science.gov (United States)

    Ostrowicz, Clemens W; Bröcker, Cornelia; Ahnert, Franziska; Nordmann, Mirjana; Lachmann, Jens; Peplowska, Karolina; Perz, Angela; Auffarth, Kathrin; Engelbrecht-Vandré, Siegfried; Ungermann, Christian

    2010-10-01

    Within the endomembrane system of eukaryotic cells, multisubunit tethering complexes together with their corresponding Rab-GTPases coordinate vesicle tethering and fusion. Here, we present evidence that two homologous hexameric tethering complexes, the endosomal CORVET (Class C core vacuole/endosome transport) and the vacuolar HOPS (homotypic vacuole fusion and protein sorting) complex, have similar subunit topologies. Both complexes contain two Rab-binding proteins at one end, and the Sec1/Munc18-like Vps33 at the opposite side, suggesting a model on membrane bridging via Rab-GTP and SNARE binding. In agreement, HOPS activity can be reconstituted using purified subcomplexes containing the Rab and Vps33 module, but requires all six subunits for activity. At the center of HOPS and CORVET, the class C proteins Vps11 and Vps18 connect the two parts, and Vps11 binds both HOPS Vps39 and CORVET Vps3 via the same binding site. As HOPS Vps39 is also found at endosomes, our data thus suggest that these tethering complexes follow defined but distinct assembly pathways, and may undergo transition by simple subunit interchange. © 2010 John Wiley & Sons A/S.

  16. Joint Scheduling for Dual-Hop Block-Fading Broadcast Channels

    KAUST Repository

    Zafar, Ammar

    2012-09-16

    In this paper, we propose joint user-and-hop scheduling over dual-hop block-fading broadcast channels in order to exploit multi-user diversity gains and multi-hop diversity gains all together. To achieve this objective, the first and second hops are scheduled opportunistically based on the channel state information and as a prerequisite we assume that the relay, which is half-duplex and operates using decode-and-forward, is capable of storing the received packets from the source until the channel condition of the destined user becomes good to be scheduled. We formulate the joint scheduling problem as maximizing the weighted sum of the long term achievable rates by the users under a stability constraint, which means that on the long term the rate received by the relay should equal the rate transmitted by it, in addition to constant or variable power constraints. We show that this problem is equivalent to a single-hop broadcast channel by treating the source as a virtual user with an optimal priority weight that maintains the stability constraint. We show how to obtain the source weight either off-line based on channel statistics or on real-time based on channel measurements. Furthermore, we consider special cases including the maximum sum rate scheduler and the proportional fair scheduler. We demonstrate via numerical results that our proposed joint scheduling scheme enlarges the rate region as compared with a scheme that employs multi-user scheduling alone.

  17. Hip-Hop to Health Jr. Randomized Effectiveness Trial

    Science.gov (United States)

    Kong, Angela; Buscemi, Joanna; Stolley, Melinda R.; Schiffer, Linda A.; Kim, Yoonsang; Braunschweig, Carol L.; Gomez-Perez, Sandra L.; Blumstein, Lara B.; Van Horn, Linda; Dyer, Alan R.; Fitzgibbon, Marian L.

    2015-01-01

    Introduction The preschool years provide a unique window of opportunity to intervene on obesity-related lifestyle risk factors during the formative years of a child’s life. The purpose of this study was to assess the impact of a preschool-based obesity prevention effectiveness trial at 1-year follow-up. Design RCT. Settings/participants Primarily African American children (aged 3–5 years, N=618) attending Head Start preschool programs administered by Chicago Public Schools. Methods Eighteen preschools were randomly assigned in 2007–2008 to receive either: (1) a 14-week teacher-delivered intervention focused on healthy lifestyle behaviors; or (2) a 14-week teacher-delivered general health curriculum (control group). Main outcome measures The primary outcome, BMI, was measured at baseline, post-intervention, and 1-year follow-up. Diet and screen time behaviors were also assessed at these time points. Multilevel mixed effects models were used to test for between-group differences. Data were analyzed in 2014. Results Significant between-group differences were observed in diet, but not in BMI z-score or screen time at 1-year follow-up. Diet differences favored the intervention arm over controls in overall diet quality (p=0.02) and in subcomponents of diet quality, as measured by the Healthy Eating Index-2005, and in fruit intake (servings/day, excludes juice) (p=0.02). Diet quality worsened more among controls than the intervention group at 1-year follow-up. Conclusions The adaptation of Hip-Hop to Health Jr. produced modest benefits in diet quality, but did not significantly impact weight gain trajectory. Not unlike other effectiveness trials, this real-world version delivered by Head Start teachers produced fewer benefits than the more rigorous efficacy trial. It is important to understand and build upon the lessons learned from these types of trials so that we can design, implement, and disseminate successful evidence-based programs more widely and effectively

  18. A fast-hopping 3-band CMOS frequency synthesizer for MB-OFDM UWB system

    Science.gov (United States)

    Yongzheng, Zheng; Lingli, Xia; Weinan, Li; Yumei, Huang; Zhiliang, Hong

    2009-09-01

    A fast-hopping 3-band (mode 1) multi-band orthogonal frequency division multiplexing ultra-wideband frequency synthesizer is presented. This synthesizer uses two phase-locked loops for generating steady frequencies and one quadrature single-sideband mixer for frequency shifting and quadrature frequency generation. The generated carriers can hop among 3432 MHz, 3960 MHz, and 4488 MHz. Implemented in a 0.13 μm CMOS process, this fully integrated synthesizer consumes 27 mA current from a 1.2 V supply. Measurement shows that the out-of-band spurious tones are below -50 dBc, while the in-band spurious tones are below -34 dBc. The measured hopping time is below 2 ns. The core die area is 1.0 × 1.8 mm2.

  19. The interplay of crack hopping, delamination and interface failure in drying nanoparticle films.

    Science.gov (United States)

    Yang, Bin; Sharp, James S; Smith, Mike I

    2016-08-25

    Films formed through the drying of nanoparticle suspensions release the build-up of strain through a variety of different mechanisms including shear banding, crack formation and delamination. Here we show that important connections exist between these different phenomena: delamination depends on the dynamics of crack hopping, which in turn is influenced by the presence of shear bands. We also show that delamination does not occur uniformly across the film. As cracks hop they locally initiate the delamination of the film which warps with a timescale much longer than that associated with the hopping of cracks. The motion of a small region of the delamination front, where the shear component of interfacial crack propagation is believed to be enhanced, results in the deposition of a complex zig-zag pattern on the supporting substrate.

  20. Subunit organisation of in vitro reconstituted HOPS and CORVET multisubunit membrane tethering complexes.

    Directory of Open Access Journals (Sweden)

    Zhong Guo

    Full Text Available Biochemical and structural analysis of macromolecular protein assemblies remains challenging due to technical difficulties in recombinant expression, engineering and reconstitution of multisubunit complexes. Here we use a recently developed cell-free protein expression system based on the protozoan Leishmania tarentolae to produce in vitro all six subunits of the 600 kDa HOPS and CORVET membrane tethering complexes. We demonstrate that both subcomplexes and the entire HOPS complex can be reconstituted in vitro resulting in a comprehensive subunit interaction map. To our knowledge this is the largest eukaryotic protein complex in vitro reconstituted to date. Using the truncation and interaction analysis, we demonstrate that the complex is assembled through short hydrophobic sequences located in the C-terminus of the individual Vps subunits. Based on this data we propose a model of the HOPS and CORVET complex assembly that reconciles the available biochemical and structural data.

  1. Interaction-induced hopping phase in driven-dissipative coupled photonic microcavities

    CERN Document Server

    Rodriguez, S R K; Sagnes, I; Gratiet, L Le; Galopin, E; Lemaitre, A; Bloch, J

    2016-01-01

    Bosons hopping across sites and interacting on-site are the essence of the Bose-Hubbard model (BHM). Inspired by the success of BHM simulators with atoms in optical lattices, proposals for implementing the BHM with photons in coupled nonlinear cavities have emerged. Two coupled semiconductor microcavities constitute a model system where the hopping, interaction, and decay of exciton polaritons --- mixed light-matter quasiparticles --- can be engineered in combination with site-selective coherent driving to implement the driven-dissipative two-site optical BHM. Here we explore the interplay of interference and nonlinearity in this system, in a regime where three distinct density profiles can be observed under identical driving conditions. We demonstrate how the phase acquired by polaritons hopping between cavities can be controlled through effective polariton-polariton interactions. Our results open new perspectives for synthesizing density-dependent gauge fields for polaritons in two-dimensional multicavity s...

  2. Optimal inhomogeneity for pairing in Hubbard systems with next-nearest-neighbor hopping

    Science.gov (United States)

    Wachtel, Gideon; Baruch, Shirit; Orgad, Dror

    2017-08-01

    Previous studies have shown that bipartite Hubbard systems with inhomogeneous hopping amplitudes can exhibit higher pair-binding energies than the uniform model. Here we examine whether this result holds for systems with a more generic band structure. To this end, we use exact diagonalization and the density matrix renormalization-group method to study the 4 ×4 Hubbard cluster and the two-leg Hubbard ladder with checkerboard-modulated nearest-neighbor hopping, t , and next-nearest-neighbor (diagonal) hopping, td. We find that the strongest pairing continues to occur at an intermediate level of inhomogeneity. While the maximal pair-binding energy is enhanced by a positive td/t , it is suppressed and appears at weaker repulsion strengths and lower hole concentrations when td/t is negative. We point out a possible connection between the pairing maximum and the magnetic properties of the system.

  3. Multi-hop Relaying: An End-to-End Delay Analysis

    KAUST Repository

    Chaaban, Anas

    2015-12-01

    The impact of multi-hopping schemes on the communication latency in a relay channel is studied. The main aim is to characterize conditions under which such schemes decrease the communication latency given a reliability requirement. Both decode-forward (DF) and amplify-forward (AF) with block coding are considered, and are compared with the point-to-point (P2P) scheme which ignores the relay. Latency expressions for the three schemes are derived, and conditions under which DF and AF reduce latency are obtained for high signal-to-noise ratio (SNR). Interestingly, these conditions are more strict when compared to the conditions under which the same multi-hopping schemes achieve higher long-term (information-theoretic) rates than P2P. It turns out that the relation between the sourcedestination SNR and the harmonic mean of the SNR’s of the channels to and from the relay dictates whether multi-hopping reduces latency or not.

  4. A fast-hopping 3-band CMOS frequency synthesizer for MB-OFDM UWB system

    Energy Technology Data Exchange (ETDEWEB)

    Zheng Yongzheng; Xia Lingli; Li Weinan; Huang Yumei; Hong Zhiliang, E-mail: yumeihuang@fudan.edu.c [State Key Laboratory of ASIC and System, Fudan University, Shanghai 201203 (China)

    2009-09-15

    A fast-hopping 3-band (mode 1) multi-band orthogonal frequency division multiplexing ultra-wideband frequency synthesizer is presented. This synthesizer uses two phase-locked loops for generating steady frequencies and one quadrature single-sideband mixer for frequency shifting and quadrature frequency generation. The generated carriers can hop among 3432 MHz, 3960 MHz, and 4488 MHz. Implemented in a 0.13 {mu}m CMOS process, this fully integrated synthesizer consumes 27 mA current from a 1.2 V supply. Measurement shows that the out-of-band spurious tones are below -50 dBc, while the in-band spurious tones are below -34 dBc. The measured hopping time is below 2 ns. The core die area is 1.0 x 1.8 mm{sup 2}.

  5. Jumping and Hopping in Elite and Amateur Orienteering Athletes and Correlations to Sprinting and Running

    DEFF Research Database (Denmark)

    Hébert-Losier, Kim; Jensen, Kurt; Holmberg, Hans-Christer

    2014-01-01

    PURPOSE: Jumping and hopping are used to measure lower-body muscle power, stiffness, and stretch-shortening cycle utilization in sports, with several studies reporting correlations between such measures and sprinting and/or running abilities in athletes. Neither jumping and hopping nor correlations...... to road, path, and forest running and sprinting performance, as well as running economy, velocity at anaerobic threshold, and VO2peak from treadmill assessments. RESULTS: During SJs and CMJs, elites demonstrated superior relative peak forces, time-to-peak forces, and pre-stretch augmentation albeit lower......-stretch augmentation and forest running velocities. Pre-stretch augmentation and time-to-peak forces were moderately correlated to VO2peak. Correlations between running economy and jumping or hopping were small or trivial. CONCLUSIONS: Overall, our elites exhibited superior stretch-shortening cycle utilization...

  6. Mode-hopping mechanism generating colored noise in a magnetic tunnel junction based spin torque oscillator

    Energy Technology Data Exchange (ETDEWEB)

    Sharma, Raghav [Department of Physics, Indian Institute of Technology, Delhi, New Delhi 110016 (India); Dürrenfeld, P.; Iacocca, E. [Department of Physics, University of Gothenburg, Gothenburg 412 96 (Sweden); Heinonen, O. G. [Argonne National Laboratory, Materials Science Division, Lemont, Illinois 60439 (United States); Åkerman, J. [Department of Physics, University of Gothenburg, Gothenburg 412 96 (Sweden); Materials Physics, School of ICT, KTH-Royal Institute of Technology, Electrum 229, Kista 164 40 (Sweden); Muduli, P. K. [Department of Physics, Indian Institute of Technology, Delhi, New Delhi 110016 (India); Department of Physics, University of Gothenburg, Gothenburg 412 96 (Sweden)

    2014-09-29

    The frequency noise spectrum of a magnetic tunnel junction based spin torque oscillator is examined where multiple modes and mode-hopping events are observed. The frequency noise spectrum is found to consist of both white noise and 1/f frequency noise. We find a systematic and similar dependence of both white noise and 1/f frequency noise on bias current and the relative angle between the reference and free layers, which changes the effective damping and hence the mode-hopping behavior in this system. The frequency at which the 1/f frequency noise changes to white noise increases as the free layer is aligned away from the anti-parallel orientation w.r.t the reference layer. These results indicate that the origin of 1/f frequency noise is related to mode-hopping, which produces both white noise as well as 1/f frequency noise similar to the case of ring lasers.

  7. Stretch reflex improves rolling stability during hopping of a decerebrate biped system.

    Science.gov (United States)

    Rosendo, Andre; Liu, Xiangxiao; Shimizu, Masahiro; Hosoda, Koh

    2015-01-19

    When humans hop, attitude recovery can be observed in both the sagittal and frontal planes. While it is agreed that the brain plays an important role in leg placement, the role of low-level feedback (the stretch reflex) on frontal plane stabilization remains unclear. Seeking to better understand the contribution of the soleus stretch reflex to rolling stability, we performed experiments on a biomimetic humanoid hopping robot. Various reflex responses to touching the floor, ranging from no response to long muscle activations, were examined, and the effect of a delay upon touching the floor was also examined. We found that the stretch reflex brought the system closer to stable, straight hopping. The presence of a delay did not affect the results; both the cases with and without a delay outperformed the case without a reflex response. The results of this study highlight the importance of low-level control in locomotion for which body stabilization does not require higher-level signals.

  8. Topological Properties of Electrons in Honeycomb Lattice with Detuned Hopping Energy.

    Science.gov (United States)

    Wu, Long-Hua; Hu, Xiao

    2016-04-14

    Honeycomb lattice can support electronic states exhibiting Dirac energy dispersion, with graphene as the icon. We propose to derive nontrivial topology by grouping six neighboring sites of honeycomb lattice into hexagons and enhancing the inter-hexagon hopping energies over the intra-hexagon ones. We reveal that this manipulation opens a gap in the energy dispersion and drives the system into a topological state. The nontrivial topology is characterized by the index associated with a pseudo time-reversal symmetry emerging from the C6 symmetry of the hopping texture, where the angular momentum of orbitals accommodated on the hexagonal "artificial atoms" behaves as the pseudospin. The size of topological gap is proportional to the hopping-energy difference, which can be larger than typical spin-orbit couplings by orders of magnitude and potentially renders topological electronic transports available at high temperatures.

  9. Quando as ruas abrigam a arte: a cena hip hop no Recife (1980-2014)

    OpenAIRE

    Alves, Cristiano Nunes

    2015-01-01

    Operacionalizando a noção de cena, cara a estudo da produção artística nos lugares, analisa-se a espessura da cultura hip hop no Recife, desde os anos 1980 até os dias atuais. Desenvolve-se uma abordagem pautada no cotidiano enquanto dimensão geográfica, problematizando-se os nexos entre a cultura hip hop, a ação dos sujeitos nos lugares e o abrigo da comunicação na metrópole. Para esmiuçar a Cena Hip Hop em Recife, além do levantamento bibliográfico e documental sobre a temática, foram funda...

  10. Electronic transport of molecular nanowires by considering of electron hopping energy between the second neighbors

    Directory of Open Access Journals (Sweden)

    H Rabani

    2015-07-01

    Full Text Available In this paper, we study the electronic conductance of molecular nanowires by considering the electron hopping between the first and second neighbors with the help Green’s function method at the tight-binding approach. We investigate three types of structures including linear uniform and periodic chains as well as poly(p-phenylene molecule which are embedded between two semi-infinite metallic leads. The results show that in the second neighbor approximation, the resonance, anti-resonance and Fano phenomena occur in the conductance spectra of these structures. Moreover, a new gap is observed at edge of the lead energy band wich its width depends on the value of the electron hopping energy between the second neighbors. In the systems including intrinsic gap, this hopping energy shifts the gap in the energy spectra.

  11. Chemical composition of two samples of Humulus lupulus flowers (vernalized and wild hops

    Directory of Open Access Journals (Sweden)

    2017-11-01

    Full Text Available Background and objectives: Humulus lupulus, a plant belonging to the family Cannabaceae, is used as a medicinal plant with therapeutic applications in different nations. In this study, two samples of H. lupulus (vernalized and wild hops were selected for further analysis about differences of their essential oils. Methods: The essential oils from the flowers of two H. lupulus (vernalized and wild hops were achieved through hydrodistillation and analyzed via gas chromatography-mass spectrometry. Retention indices for all compounds were determined according to the kovats retention indices using n-alkanes series as standards. The components of the essential oils were identified by comparison of the retention indices and mass spectral data with those for the standards. Results: Analysis of the vernalized hops essential oil resulted in the identification of 64 components, representing 87.04 % of the total essential oil that principally contained β-caryophyllene (25.3%, β-bisabolole (16.7% and β-elemene (5.3%. In the case ofwild hops, 49 components were identified, representing 80.9% of theessential oil, among them β-bisabolole (35.2%, β-myrcene (13.3% and β-sesquiphellandrene (11.3% were the main compounds. Overall, both vernalized and wild hops possessed sesquiterpene hydrocarbons inhigher contents, followed bynon-terpenoid compounds, oxygenated sesquiterpenes and finally monoterpenoids in less amounts. Conclusion: Concerning the results of this study we found some similarities and differences among vernalized and wild hops and also in comparison with other species of the genus Humulus. Generally, mentioned similarities and differences might be attributed to both intrinsic and extrinsic factors affecting both the quality and quantity of the obtained essential oils.

  12. Long-term oral administration of hop flower extracts mitigates Alzheimer phenotypes in mice.

    Directory of Open Access Journals (Sweden)

    Norio Sasaoka

    Full Text Available Coincident with the expanding population of aged people, the incidence of Alzheimer disease (AD is rapidly increasing in most advanced countries. At present, no effective prophylactics are available. Among several pathological mechanisms proposed for AD, the "amyloid hypothesis" has been most widely accepted, in which accumulation or deposition of Aβ is considered to be the initial event. Thus, prevention of Aβ production would be an ideal strategy for the treatment or prevention of AD. Aβ is produced via the proteolytic cleavage of its precursor protein, APP (amyloid precursor protein, by two different enzymes, β and γ-secretases. Indeed, inhibitors against either or both enzymes have been developed and tested for clinical efficacy. Based on the "amyloid hypothesis", we developed a luciferase-based screening method to monitor γ-secretase activity, screened more than 1,600 plant extracts, most of which have long been used in Chinese medicine, and observed that Hop extracts significantly inhibit Aβ production in cultured cells. A major component of the inhibitory activity was purified, and its chemical identity was determined by NMR to be Garcinielliptone HC. In vivo, oral administration of Hop extracts to AD model mice decreased Aβ depositions in the cerebral cortex of the parietal lobe, hippocampus, and artery walls (amyloid angiopathy in the brains. In a Morris water maze test, AD model mice that had daily consumed Hop extracts in their drinking water showed significant mitigation of memory impairment at ages of 9 and 12 months. Moreover, in the open field test oral administration of Hop extracts also prevented an emotional disturbance that appeared in the AD mice at 18 months. Despite lifelong consumption of Hop extracts, no deleterious side effects were observed at any age. These results support the "amyloid hypothesis", and indicate that Hop extract is a promising candidate for an effective prophylactic for AD.

  13. Spring-like leg behaviour, musculoskeletal mechanics and control in maximum and submaximum height human hopping

    OpenAIRE

    Bobbert, Maarten F; Richard Casius, L. J.

    2011-01-01

    The purpose of this study was to understand how humans regulate their ‘leg stiffness’ in hopping, and to determine whether this regulation is intended to minimize energy expenditure. ‘Leg stiffness’ is the slope of the relationship between ground reaction force and displacement of the centre of mass (CM). Variations in leg stiffness were achieved in six subjects by having them hop at maximum and submaximum heights at a frequency of 1.7 Hz. Kinematics, ground reaction forces and electromyogram...

  14. Hip-Hop Fight Club: Radical Theory, Education, and Practice in and beyond the Classroom

    Directory of Open Access Journals (Sweden)

    Jared A. Ball

    2013-10-01

    Full Text Available Hip-hop remains a viable method for the teaching of radical theory, emancipatory journalism and Africana Media Theory.  Fight Club is an emergent model that builds from existing hip-hop traditions of freetyle battling where critical thought and intellectual challenges of hueristic norms are upended.  This article argues in favor of bringing the Fight Club model into the classroom which allows for heightened student engagement and the inclusion of radical theoretical approaches to the study of mass media, communication and journalism.

  15. Asymmetric Exclusion Process with Constrained Hopping and Parallel Dynamics at a Junction

    Science.gov (United States)

    Liu, Mingzhe; Tuo, Xianguo; Li, Zhe; Yang, Jianbo

    In this article totally asymmetric simple exclusion process (TASEP) with constrained hopping and parallel dynamics at a junction is investigated using a mean-field approximation and Monte Carlo simulations. The constrained particle hopping probability r (r ≤ 1) at a junction may correspond to a delay caused by a driver choosing the right direction or a delay waiting for green traffic light in the real world. There are six stationary phases in the system, which can reflect free flow and congested traffic situations. Correlations at the junction point are investigated via simulations. It is observed that small r leads to stronger correlations. The theoretical results are agreement with computer simulations well.

  16. The crossover between tunnel and hopping conductivity in granulated films of noble metals

    Science.gov (United States)

    Kavokin, Alexey; Kutrovskaya, Stella; Kucherik, Alexey; Osipov, Anton; Vartanyan, Tigran; Arakelyan, Sergey

    2017-11-01

    The conductivity of thin films composed by clusters of gold and silver nanoparticles has been studies in a wide range of temperatures. The switch from a temperature independence to an exponential thermal dependence of the conductivity manifests the crossover between the tunnel and thermally activated hopping regimes of the electronic transport at the temperature of 60 °C. The characteristic thermal activation energy that governs hopping of electrons between nanoparticles is estimated as 1.3 eV. We have achieved a good control of the composition and thicknesses of nano-cluster films by use of the laser ablation method in colloidal solutions.

  17. On the Performance Analysis of Dual-Hop FSO Fixed Gain Transmission Systems

    KAUST Repository

    Zedini, Emna

    2015-12-12

    Novel exact closed-form results for the end-to-end performance analysis of dual-hop free-space optical (FSO) fixed-gain relaying systems under heterodyne detection as well as intensity modulation with direct detection techniques in the presence of atmospheric turbulence as well as pointing errors are presented. By using dual-hop FSO relaying, we demonstrate a better system performance relative to the single FSO link. Numerical and Monte-Carlo simulation results are provided to verify the accuracy of the newly proposed results, and a perfect agreement is observed.

  18. An SDN-Based Fingerprint Hopping Method to Prevent Fingerprinting Attacks

    Directory of Open Access Journals (Sweden)

    Zheng Zhao

    2017-01-01

    Full Text Available Fingerprinting attacks are one of the most severe threats to the security of networks. Fingerprinting attack aims to obtain the operating system information of target hosts to make preparations for future attacks. In this paper, a fingerprint hopping method (FPH is proposed based on software-defined networks to defend against fingerprinting attacks. FPH introduces the idea of moving target defense to show a hopping fingerprint toward the fingerprinting attackers. The interaction of the fingerprinting attack and its defense is modeled as a signal game, and the equilibriums of the game are analyzed to develop an optimal defense strategy. Experiments show that FPH can resist fingerprinting attacks effectively.

  19. Dual-Hop Transmission Scheme Based on Hierarchical Modulation in Wireless Networks

    Science.gov (United States)

    Shin, Jeong-Chul; Song, Jin-Hyuk; Kim, Jee-Hoon; Song, Hyoung-Kyu

    Dual-hop wireless transmission is a technique by which the channel from the source to the destination is divided into two shorter links using relays. By using this transmission, the communications reliability is improved whereas the throughput might go down since the dual-hop transmission is performed by two times. In this letter, we propose a scheme that uses hierarchical modulation at the source and adaptive modulation based on cyclic redundancy check (CRC) code at the relays. The proposed scheme is evaluated in terms of the bit error rate (BER) and throughput performances.

  20. Sclerotinia wilt of Hop (Humulus lupulus) caused by Sclerotinia sclerotiorum in the Pacific Northwest U.S.

    Science.gov (United States)

    Sclerotinia sclerotiorum is a widespread, destructive pathogen with an exceptionally broad host range. During June 2011, wilted hop plants (Humulus lupulus cv. Nugget) were observed in a hop yard in Marion County, Oregon. Some affected plants had upward curled leaves with necrotic margins, whereas o...

  1. Characterization of Volatile Components from Hüller Bitterer Hop Variety Using In-Tube Extraction GC-MS Analysis

    National Research Council Canada - National Science Library

    Salanță, Liana Claudia; Tofană, Maria; Socaci, Sonia; Pop, Carmen; Pop, Anamaria; Cuceu, Ana

    2015-01-01

    .... The aim of this study was to characterize the Hüller Bitterer hop variety, during the development of hop cones, by analysis the composition of volatile oil using in-tube extraction gas chromatography–mass spectrometry (ITEX-GC–MS...

  2. Camp of Hip-Hop - kõigile kohustuslik / Mari Hiiemäe ; kommenteerinud Joel Juht

    Index Scriptorium Estoniae

    Hiiemäe, Mari

    2012-01-01

    Üheksandat korda toimuvast rahvusvahelisest tantsulaagrist ja tänavakultuuri tutvustavast noortelaagrist Camp of Hip-Hop, mis toimub Lääne Virumaal Käsmus. 28. juunil toimub kõigile huvilistele meelelahutusüritus Camp of Hip-Hop Championships, kus näitavad oma tantsuoskusi laagris osalejad ja maailmas tunnustatud koreograafid

  3. Hip-Hop Feminism: A Standpoint to Enhance the Positive Self-Identity of Black College Women

    Science.gov (United States)

    Henry, Wilma J.

    2010-01-01

    The popularity of hip-hop among young Black college women, coupled with the deluge of negative and positive messages in this culture regarding these women's identity, signals an opportunity for the arrival of a contemporary, culturally relevant epistemology--hip-hop feminism. Through the lens of Black feminist theory, this article explores hip-hop…

  4. Involvement of Vacuolar Sequestration and Active Transport in Tolerance of Saccharomyces cerevisiae to Hop Iso-α-Acids▿ † ¶

    Science.gov (United States)

    Hazelwood, Lucie A.; Walsh, Michael C.; Pronk, Jack T.; Daran, Jean-Marc

    2010-01-01

    The hop plant, Humulus lupulus L., has an exceptionally high content of secondary metabolites, the hop α-acids, which possess a range of beneficial properties, including antiseptic action. Studies performed on the mode of action of hop iso-α-acids have hitherto been restricted to lactic acid bacteria. The present study investigated molecular mechanisms of hop iso-α-acid resistance in the model eukaryote Saccharomyces cerevisiae. Growth inhibition occurred at concentrations of hop iso-α-acids that were an order of magnitude higher than those found with hop-tolerant prokaryotes. Chemostat-based transcriptome analysis and phenotype screening of the S. cerevisiae haploid gene deletion collection were used as complementary methods to screen for genes involved in hop iso-α-acid detoxification and tolerance. This screening and further analysis of deletion mutants confirmed that yeast tolerance to hop iso-α-acids involves three major processes, active proton pumping into the vacuole by the vacuolar-type ATPase to enable vacuolar sequestration of iso-α-acids and alteration of cell wall structure and, to a lesser extent, active export of iso-α-acids across the plasma membrane. Furthermore, iso-α-acids were shown to affect cellular metal homeostasis by acting as strong zinc and iron chelators. PMID:19915041

  5. Development of biological control of Tetranychus urticae (Acari:Tetranychidae) and Phorodon humuli (Hemiptera: Aphididae) in Oregon Hop yards

    Science.gov (United States)

    The temporal development of biological control of arthropod pests in perennial cropping systems is largely unreported. In this study, the development of biological control of twospotted spider mite, Tetranychus urticae Koch and hop aphid, Phorodon humuli (Schrank) in a new planting of hop in Oregon...

  6. An Educational Exploration of Homophobia and Sexism in Rap and Hip Hop: Homo-Thugs and Divas in da House

    Science.gov (United States)

    Chiu, Nicholas

    2005-01-01

    In this paper, the author explores the connections between hip hop and rap, sexism and homophobia, and children and teens. He describes the implications or potential consequences of sexism and homophobia within the music and media culture of hip hop and rap (with the focus on how it affects young viewers and fans in terms of gender [identity]…

  7. Culturally Relevant Teaching: Hip-Hop Pedagogy in Urban Schools. Counterpoints: Studies in the Postmodern Theory of Education. Volume 396

    Science.gov (United States)

    Prier, Darius D.

    2012-01-01

    "Culturally Relevant Teaching" centers hip-hop culture as a culturally relevant form of critical pedagogy in urban pre-service teacher education programs. In this important book, Darius D. Prier explores how hip-hop artists construct a sense of democratic education and pedagogy with transformative possibilities in their schools and communities. In…

  8. "You Don't Have to Claim Her": Reconstructing Black Femininity through Critical Hip-Hop Literacy

    Science.gov (United States)

    Kelly, Lauren Leigh

    2016-01-01

    This article explores the ways in which females who identify with hip-hop often develop and construct their identities in relation to media representations of blackness and femininity in hip-hop music and culture. In order for educators to support female students in constructing identities of empowerment and agency, they should be willing and able…

  9. Sista Girl Rock: Women of Colour and Hip-Hop Deejaying as Raced/Gendered Knowledge and Language

    Science.gov (United States)

    Craig, Todd; Kynard, Carmen

    2017-01-01

    This article seeks to introduce and situate a seldom-explored subject: the role and contribution of women hip-hop deejays in the testosterone-filled genre called hip-hop. Grounding the analysis in the interviews of six women deejays--Spinderella, Kuttin Kandi, Pam the Funkstress, Reborn, Shorty Wop and Natasha Diggs--"Sista Girl Rock"…

  10. Fresh Faces, New Places: Moving beyond Teacher-Researcher Perspectives in Hip-Hop-Based Education Research

    Science.gov (United States)

    Irby, Decoteau J.; Hall, H. Bernard

    2011-01-01

    Grounded in critical and culturally relevant theory, hip-hop-based education (HHBE) research documents the use of hip-hop in educational settings. Despite the richness of the emerging field, overreliance on teacher-researcher perspectives leaves much to be desired. Little is known of the extent and ways HHBE is used by nonresearching K-12…

  11. "They Wasn't Makin' My Kinda Music": A Hip-Hop Musician's Perspective on School, Schooling, and School Music

    Science.gov (United States)

    Kruse, Adam J.

    2016-01-01

    This article focuses on a hip-hop perspective of school, schooling, and school music. The study involves applications of ethnographic (including autoethnographic) techniques within the framework of a holistic multiple case study. One case is an adult amateur hip-hop musician named Terrence (pseudonym), and the other is myself (a traditionally…

  12. Arab Spring, "Favelas," Borders, and the Artistic Transnational Migration: Toward a Curriculum for a Global Hip-Hop Nation

    Science.gov (United States)

    Ibrahim, Awad

    2017-01-01

    Straddling between the purely political and the poetically artistic, I am arguing, is a Global Hip-Hop Nation (GHHN), which is yet to be charted and its cartography is yet to be demarcated. Taking two examples, the first a Hip-Hop song from within the Arab Spring and the second from the "favelas" in Brazil, my intent is to show what…

  13. Bridging Theory and Practice: Using Hip-Hop Pedagogy as a Culturally Relevant Approach in the Urban Science Classroom

    Science.gov (United States)

    Adjapong, Edmund S.

    2017-01-01

    This dissertation explores the context of urban science education as it relates to the achievement and engagement of urban youth. This study provides a framework for Hip-Hop Pedagogy, an approach to teaching and learning anchored in the creative elements of Hip-Hop culture, in STEM as an innovative approach to teaching and learning demonstrates…

  14. I Feel What He Was Doin': Responding to Justice-Oriented Teaching through Hip-Hop Aesthetics

    Science.gov (United States)

    Petchauer, Emery

    2011-01-01

    This study illustrates a set of learning activities designed from two hip-hop aesthetics and explores their use among a classroom of African American preservice teachers who graduated from urban school districts. Based on the two hip-hop aesthetics of kinetic consumption and autonomy/distance, the specific goal of these learning activities is to…

  15. Dialoguing, Cultural Capital, and Student Engagement: Toward a Hip Hop Pedagogy in the High School and University Classroom

    Science.gov (United States)

    Rodriguez, Louie F.

    2009-01-01

    Hip hop culture is typically excluded from conventional educational spaces within the U.S. Drawing on the experiences of an educator who works with urban high school students and university level pre- and in-service educators, this article examines the role of hip hop culture for student engagement in two settings--an alternative high school…

  16. "Dear Tupac, You Speak to Me": Recruiting Hip Hop as Curriculum at a School for Pregnant and Parenting Teens

    Science.gov (United States)

    Hallman, Heidi L.

    2009-01-01

    This article provides a rich representation of how in-school practices that recruit students' "out-of-school" literacies, such as hip hop, can be used as critical bridges in students' learning. Hip hop, conceptualized in this article as an "out-of-school" literacy, works as a vehicle for curricular change at Eastview School for Pregnant and…

  17. [Chemical Constituents from Leaves of Liquidambar formosana].

    Science.gov (United States)

    Liao, Yuan-yue; Fu, Hui-zheng; Zhou, Guo-ping; Zhong, Rui-jian; Yuan, Hui; Guo, Qing; Yan, Qing-wei

    2014-12-01

    To study the chemical constituents of the leaves of Liquidambarformosana. The chemical constituents were isolated and purified by column chromatography on silicagel, Sephadex LH-20 and MPLC. Their structures were elucidated on the basis of physicochemical properties and special analysis. Eight compounds were isolated from the leaves of Liquidambar formosana, whose structures were elucidated as gallic acid (1), p-hydroxy-benzoic acid (2), 3-methoxy-4-hydroxy-benzoic acid (3), 3,5-dihydroxy-4-methoxy-benzoic acid (4) kaempferol (5), 3,4-dihydroxy-benzoic acid (6), 3,4-dihydroxy-5-methoxy-benzoic acid (7) and 3β,23,29-trihydroxy-olean-12-en-28-oic acid-β-D-glucopyranosyl ester (8). Compounds 1-8 are isolated from the leaves of Liquidambar formosana for the first time.

  18. Water Vapor Corrosion in EBC Constituent Materials

    Science.gov (United States)

    Kowalski, Benjamin; Fox, Dennis; Jacobson, Nathan S.

    2017-01-01

    Environmental Barrier Coating (EBC) materials are sought after to protect ceramic matrix composites (CMC) in high temperature turbine engines. CMCs are particularly susceptible to degradation from oxidation, Ca-Al-Mg-Silicate (CMAS), and water vapor during high temperature operation which necessitates the use of EBCs. However, the work presented here focuses on water vapor induced recession in EBC constituent materials. For example, in the presence of water vapor, silica will react to form Si(OH)4 (g) which will eventually corrode the material away. To investigate the recession rate in EBC constituent materials under high temperature water vapor conditions, thermal gravimetric analysis (TGA) is employed. The degradation process can then be modeled through a simple boundary layer expression. Ultimately, comparisons are made between various single- and poly-crystalline materials (e.g. TiO2, SiO2) against those found in literature.

  19. [Chemical constituents contained in Populus tomentosa].

    Science.gov (United States)

    Liu, Haiping; Chao, Zhimao; Wu, Xiaoyi; Tan, Zhigao; Wang, Chun; Sun, Wen

    2012-05-01

    To separate and identify chemical constituents from stem barks of male plants of Populus tomentosa. Fresh stem barks of P. tomentosa were extracted with methanol to obtain extracts which were suspended in water and blended successively with petroleum ether, ethyl acetate and n-butanol. Various chromatographic techniques were used to separate and purify the constituents extracted with ethyl acetate and n-butanol fractions. Their structures were identified on the basis of their physicochemical properties and spectral data. Twelve compounds were separated with ethyl acetate and n-butanol fractions and identified as benzoic acid (1), daucosterol (2), tremuloidin (3), rhamnocitrin (4), sakuranetin (5), 7-O-methylaromadendrin (6), isograndidentatin A (7), siebolside B (8), sakuranin (9), micranthoside (10), alpha-D-glucopyranose (11), and sucrose (12). Compounds 4-12 were separated from this plant for the first time. Of them, compound 10 was separated from this plant genus for the first time.

  20. [Studies on chemical constituents of Patrinia villosa].

    Science.gov (United States)

    Peng, Jin-Yong; Fan, Guo-Rong; Wu, Yu-Tian

    2006-01-01

    To investigate the chemical constituents of Patrinia villosa. The chemical constituents were isolated by silica gel column chromatography and semi-preparative high-performance liquid chromatography, and identified by physicochemical properties and spectral analysis (MS, 1H-NMR and 13C-NMR). Seven compounds were isolated from ethyl acetate and n-butanol extract and identified as: 5-hydroxyl-7, 3', 4'-trimethoxy flavone (I), 5-hydroxyl-7, 4'-dimethoxy flavone (II), luteolin (III), quercetin (IV), isoorientin (V), isovitexin (VI) and 8-C glucosylprunetin (VII). Compounds I , II, III, V, VI and VIII were obtained from the plant of genus Patrinia for the first time, compound IV was separated from P. villosa for the first time.

  1. In and out of love with hip-hop: saliency of sexual scripts for young adult African American women in hip-hop and Black-oriented television.

    Science.gov (United States)

    Coleman, M Nicole; Butler, Ebony O; Long, Amanda M; Fisher, Felicia D

    2016-10-01

    Hip-hop media and Black-oriented reality television are powerful mechanisms for conveying and promoting stereotypes of Black women. Black women's sexuality is frequently presented as highly-salient in each medium. However, little is known about the impact of those images on Black women's sexuality and identity. The current study uses focus-group methodology to engage young adult Black in critical discussion of two predominant sexual scripts found in hip-hop music and Black-oriented reality television - the Freak and the Gold Digger. Analyses revealed shared and distinct aspects of each sexual script represented in both media and the impact of those scripts on participants' experiences. Implications for future research are discussed.

  2. Multilingualism and Hip Hop Consumption in Nigeria: Accounting for the Local Acceptance of a Global Phenomenon Hip-Hop und Mehrsprachigkeit in Nigeria: Zur Erklärung der lokalen Akzeptanz eines globalen Phänomens

    Directory of Open Access Journals (Sweden)

    Olusegun Fariudeen Liadi

    2012-01-01

    Full Text Available Hip hop music has enjoyed global popularity and patronage on a level that has transcended that of most other music genres. It is perhaps due to the genre’s worldwide popularity that many forms of hip hop have sprung up across the globe. The Nigerian version of the music has been overwhelmingly accepted by a good number of youths in the country irrespective of class, religion and social status. However, there is some speculation as to what factors are responsible for the recent sudden boom in the popular consumption of this genre among the youth, since hip hop has been a feature of the Nigerian musical landscape since the 1980s. With the aid of qualitative data collection instruments – thirty in-depth interviews and six key informant interviews among hip hop fans and club DJs, respectively – the study establishes the centrality of multilingualism as a primary reason for the acceptance of hip hop among Nigerian youth.Hip-Hop-Musik ist weltweit in einem Maße populär, das die meisten anderen Musikrichtungen übertrifft. Vielleicht hat diese weltweite Beliebtheit dazu geführt, dass rund um den Globus unterschiedliche Formen des Hip-Hop aus dem Boden geschossen sind. Die nigerianische Version dieser Musikrichtung wird von einer überwältigenden Zahl Jugendlicher im Land angenommen, unabhängig von sozialem Status und Religionszugehörigkeit. Es wird jedoch darüber spekuliert, welche Faktoren den jüngsten plötzlichen Boom in dieser Musikrichtung erklären, denn Hip-Hop ist schon seit den 1980er Jahren Teil der nigerianischen Musiklandschaft. Mit Hilfe einer qualitativen Datenerhebung – 30 detaillierte Interviews sowie sechs Interviews mit Schlüsselpersonen unter Hip-Hop-Fans und Club-DJs – kann der Autor die Mehrsprachigkeit als wichtigsten Grund für die Akzeptanz des Hip-Hop unter nigerianischen Jugendlichen ermitteln.

  3. Upgrading of biomass constituents to liquid fuels

    Energy Technology Data Exchange (ETDEWEB)

    Bhatia, V.K.; Padmaja, K.V.; Kamra, S.; Singh, J.; Badoni, R.P. (Indian Inst. of Petroleum, Dehra Dun (India))

    1993-01-01

    To develop energy crops for liquid fuels, non-polar constituents (biocrudes) from indigenous laticiferous species ([ital Euphorbia antiquorum, E. antisyphilitica, E. caducifolia, E. neriifolia, E. nivulia, E. royleana, Calotropis procera, C. gigantea] and [ital Cryptostegia grandiflora]) were subjected to fixed-bed catalytic cracking using a commercial catalyst. The possibility of utilizing part of naphtha, one of the products of the conversion process, for the recovery of biocrude was also explored. 15 refs., 4 tabs.

  4. Chemical constituents and bioactivities of starfish.

    Science.gov (United States)

    Dong, Guang; Xu, Tunhai; Yang, Bin; Lin, Xiuping; Zhou, Xuefeng; Yang, Xianwen; Liu, Yonghong

    2011-05-01

    Starfish have been the research topic in many chemical and pharmacological laboratories due to their complex secondary metabolites and diverse bioactivities. The aim of this review is to provide an up-to-date review on the chemistry and bioactivity of compounds isolated from all kinds of starfish to illustrate the chemodiversity and biological significance of these constituents, along with their geographical distribution where it is discernible. Copyright © 2011 Verlag Helvetica Chimica Acta AG, Zürich.

  5. The volatile constituents of Salvia leucantha.

    Science.gov (United States)

    Rojas, Luis B; Visbal, Tomas; Morillo, Marielba; de Rojas, Yndra Cordero; Arzola, Juan Carmona; Usubillaga, Alfredo

    2010-06-01

    Salvia leucantha Cav. (Lamiaceae), native to Mexico, is found in Venezuela in parks and gardens. Hydrodistillation of the fresh leaves of this plant yielded 0.05% of essential oil. GC and GC/MS analyses permitted the identification of 30 compounds, which made up 95.9% of the oil. The most abundant constituents were bornyl acetate (24.1%), beta-gurjunene (14.8%), beta-caryophyllene (14.1%), dillapiol (11.0%) and bicyclogermacrene (8.9%).

  6. Potential Antidepressant Constituents of Nigella sativa Seeds.

    Science.gov (United States)

    Elkhayat, Ehab S; Alorainy, Mohammad S; El-Ashmawy, Ibrahim M; Fat'hi, Shawkat

    2016-01-01

    Nigella sativa Linn. is well known seed in the Middle East, Asia, and the Far East as a natural remedy for many ailments and as a flavoring agent proclaimed medicinal usage dating back to the ancient Egyptians, Greeks, and Romans. An authentic saying of the Prophet Muhammad (Peace Be Upon Him) about black seed is also quoted in Al-Bukhari. This study was carried out to evaluate the antidepressant effect and isolate the potential antidepressant constituents of the polar extract of N. sativa seeds. The antidepressant effect was evaluated through the immobility duration in tail suspension and forced swim tests (FSTs). Albino mice were orally treated with N. sativa polar extract and its RP-18 column chromatography fractions (50 and 100 mg/kg,). The polar extract and two of its sub-fractions were significantly able to decrease the immobility time of mice when subjected to both tail suspension and FSTs, the effects are comparable to standard drug (Sertraline, 5 mg/kg). However, these treatments did not affect the number of crossings and rearing in the open field test. Phytochemical investigation of the two active fractions led to the isolation of quercetin-3-O-α-L-rhamnopyranoside 1, quercetin-7-O-β-D-gluco- pyranoside 2, tauroside E 3, and sapindoside B as the potential antidepressant constituents. Phytochemical and biological evaluation the antidepressant constituents in Nigella sativa using the tail suspension and forced swim methods afforded the isolation and identification of quercetin-3-O-α-L rhamnopyranoside, quercetin-7-O-β-D gluco pyranoside, tauroside E, and sapindoside B as the potential antidepressant constituents in the polar extract of N. sativa. The isolated compounds were identified through extensive NMR analysis (1D, 2D, ESI MS). Abbreviations used: TST: Tail suspension test, FST: Forced swim test, OFT: An Open field test.

  7. [Chemical constituents from herb of Pholidota cantonensis].

    Science.gov (United States)

    Li, Jian-chen; Feng, Li; Nohara, Toshihiro

    2008-07-01

    To study the chemical constituents of Pholidota cantonensis. The compounds were isolated and purified on silica gel, Sephadex LH-20, Chromatorex ODS column chromatography and the structures were determined based on the spectral and chemical evidences. Four compounds were obtained and characterized as pholidonone (1), ephemeranthoquinone (2), orchinol (3), batatasin III (4). They have been isolated from this plant for the first time and pholidonone (1) was a new compound.

  8. Corporeidade e sexualidade em dançarinos de rua: axé e hip hop Bodyness and sexuality of street dancers: axé and hip hop

    Directory of Open Access Journals (Sweden)

    Fernando Luiz Cardoso

    2011-12-01

    Full Text Available Analisaram-se aspectos da corporeidade e sexualidade em dançarinos de hip hop e axé (35 homens e 49 mulheres comparativamente a indivíduos não-dançarinos expectadores da plateia (21 homens e 19 mulheres, via questionário anônimo. Os dançarinos de axé foram os mais satisfeitos com suas vidas sexuais, com as preliminares sexuais e os que mais gostavam de se masturbarem em relação aos de hip hop e plateia. Dançarinos do axé apresentaram uma sexualidade mais vinculada ao conhecimento corporal e conexões afetivas. Em ambos estilos, os dançarinos homens davam maior ênfase à genitália e a libido em relação aos aspectos da afetividade.We analyzed selected aspects of the bodyness and sexuality of hip hop and axé dancers (35 men and 49 women in comparison with non-dancer controls (21 men and 19 women through anonymous questionnaire. The axé dancers were the most satisfied with their sexual lives, with sexual preliminaries and who liked more to masturbate when compared with the hip hop dancers and controls. Axé dancers of both sexes presented a strong link between their sexuality and their corporal knowledge and affective connections. Men dancers were more focused in their genitals and gave stronger sexual emphasis to libido rather than affectivity.

  9. Nonadiabatic surface hopping Herman-Kluk semiclassical initial value representation method revisited: applications to Tully's three model systems.

    Science.gov (United States)

    Wu, Yinghua; Herman, Michael F

    2005-10-08

    The nonadiabatic surface hopping Herman-Kluk (HK) semiclassical initial value representation (SC-IVR) method for nonadiabatic problems is reformulated. The method has the same spirit as Tully's surface hopping technique [J. Chem. Phys. 93, 1061 (1990)] and almost keeps the same structure as the original single-surface HK SC-IVR method except that trajectories can hop to other surfaces according to the hopping probabilities and phases, which can be easily integrated along the paths. The method is based on a rather general nonadiabatic semiclassical surface hopping theory developed by Herman [J. Chem. Phys. 103, 8081 (1995)], which has been shown to be accurate to the first order in h and through all the orders of the nonadiabatic coupling amplitude. Our simulation studies on the three model systems suggested by Tully demonstrate that this method is practical and capable of describing nonadiabatic quantum dynamics for various coupling situations in very good agreement with benchmark calculations.

  10. Activation of proestrogens from hops (Humulus lupulus L.) by intestinal microbiota; conversion of isoxanthohumol into 8-prenylnaringenin.

    Science.gov (United States)

    Possemiers, Sam; Heyerick, Arne; Robbens, Veerle; De Keukeleire, Denis; Verstraete, Willy

    2005-08-10

    Hop, an essential ingredient in most beers, contains a number of prenylflavonoids, among which 8-prenylnaringenin (8-PN) would be the most potent phytoestrogen currently known. Although a number of health effects are attributed to these compounds, only a few reports are available about the bioavailability of prenylflavonoids and the transformation potency of the intestinal microbial community. To test these transformations, four fecal samples were incubated with xanthohumol, isoxanthohumol (IX), and 8-PN. Upon incubation with IX, present in strong ales up to 4 mg/L, 36% was converted into 8-PN in one fecal sample and the estrogenic properties of the sample drastically increased. In an experiment with 12 fecal cultures, this conversion was observed in one-third of the samples, indicating the importance of interindividual variability in the intestinal microbial community. Eubacterium limosum was identified to be capable of this conversion (O-demethylation) of IX into 8-PN, and after strain selection, a conversion efficiency of 90% was achieved. Finally, strain supplementation to a nonconverting fecal sample led to rapid and high 8-PN production at only 1% (v/v) addition. Up to now, the concentration of 8-PN in beer was considered too low to affect human health. However, these results show that the activity of the intestinal microbial community could more than 10-fold increase the exposure concentration. Because prenylflavonoids are present in many beers with IX being the major constituent, the results raise the question whether moderate beer consumption might contribute to increased in vivo levels of 8-PN and even influence human health.

  11. K-targeted metabolomic analysis extends chemical subtraction to DESIGNER extracts: selective depletion of extracts of hops (Humulus lupulus).

    Science.gov (United States)

    Ramos Alvarenga, René F; Friesen, J Brent; Nikolić, Dejan; Simmler, Charlotte; Napolitano, José G; van Breemen, Richard; Lankin, David C; McAlpine, James B; Pauli, Guido F; Chen, Shao-Nong

    2014-12-26

    This study introduces a flexible and compound targeted approach to Deplete and Enrich Select Ingredients to Generate Normalized Extract Resources, generating DESIGNER extracts, by means of chemical subtraction or augmentation of metabolites. Targeting metabolites based on their liquid-liquid partition coefficients (K values), K targeting uses countercurrent separation methodology to remove single or multiple compounds from a chemically complex mixture, according to the following equation: DESIGNER extract = total extract ± target compound(s). Expanding the scope of the recently reported depletion of extracts by immunoaffinity or solid phase liquid chromatography, the present approach allows a more flexible, single- or multi-targeted removal of constituents from complex extracts such as botanicals. Chemical subtraction enables both chemical and biological characterization, including detection of synergism/antagonism by both the subtracted targets and the remaining metabolite mixture, as well as definition of the residual complexity of all fractions. The feasibility of the DESIGNER concept is shown by K-targeted subtraction of four bioactive prenylated phenols, isoxanthohumol (1), 8-prenylnaringenin (2), 6-prenylnaringenin (3), and xanthohumol (4), from a standardized hops (Humulus lupulus L.) extract using specific solvent systems. Conversely, adding K-targeted isolates allows enrichment of the original extract and hence provides an augmented DESIGNER material. Multiple countercurrent separation steps were used to purify each of the four compounds, and four DESIGNER extracts with varying depletions were prepared. The DESIGNER approach innovates the characterization of chemically complex extracts through integration of enabling technologies such as countercurrent separation, K-by-bioactivity, the residual complexity concepts, as well as quantitative analysis by (1)H NMR, LC-MS, and HiFSA-based NMR fingerprinting.

  12. Auto-acetylation on K289 is not essential for HopZ1a-mediated plant defense suppression

    Directory of Open Access Journals (Sweden)

    Jose Sebastian Rufian

    2015-07-01

    Full Text Available The Pseudomonas syringae type III-secreted effector HopZ1a is a member of the HopZ / YopJ superfamily of effectors that triggers immunity in Arabidopsis. We have previously shown that HopZ1a suppresses both local (effector-triggered immunity, ETI and systemic immunity (systemic acquired resistance, SAR triggered by the heterologous effector AvrRpt2. HopZ1a has been shown to possess acetyltransferase activity, and this activity is essential to trigger immunity in Arabidopsis. HopZ1a acetyltransferase activity has been reported to require the auto-acetylation of the effector on a specific lysine (K289 residue. In this paper we analyze the relevance of autoacetylation of lysine residue 289 in HopZ1a ability to suppress plant defenses, and on the light of the results obtained, we also revise its relevance for HopZ1a avirulence activity. Our results indicate that, while the HopZ1aK289R mutant is impaired to some degree in its virulence and avirulence activities, is by no means phenotypically equivalent to the catalytically inactive HopZ1aC216A, since it is still able to trigger a defense response that induces detectable macroscopic HR and effectively protects Arabidopsis from infection, reducing growth of P. syringae within the plant. We also present evidence that the HopZ1aK289R mutant still displays virulence activities, partially suppressing both ETI and SAR.

  13. Hip-Hop--What's in It for the Academy? Self-Understanding, Pedagogy and Aesthetical Learning Processes in Everyday Cultural Praxis

    Science.gov (United States)

    Söderman, Johan; Sernhede, Ove

    2016-01-01

    Since hip-hop first appeared in New York over 35 years ago, it has been associated with social activism and education. Accordingly, it is not surprising that academic institutions in universities and K-12 schools are interested in hip-hop. In this article, we will highlight the "hip-hop academisation" and map out a new direction in a…

  14. Constituents of Kawal, fermented Cassia obtusifolia leaves, a ...

    African Journals Online (AJOL)

    Administrator

    /MC. Thirty three constituents were identified. The major components are found to be aliphatic acids and identified as .... constituents of the raw materials by the yeast during ... Fragrance Volatiles by Glass Capillary Chromatography, Academic.

  15. All-electronic suppression of mode hopping noise in diode lasers

    DEFF Research Database (Denmark)

    Bager, L.

    1990-01-01

    A simple all-electronic stabilization scheme is presented for suppression of external-cavity mode-hopping noise in diode lasers. This excess noise is generated when the laser is subjected to optical feedback and may degrade the overall performance of optical systems including sensors. Suppression...

  16. Application of time-hopping UWB range-bit rate performance in the UWB sensor networks

    NARCIS (Netherlands)

    Nascimento, J.R.V. do; Nikookar, H.

    2008-01-01

    In this paper, the achievable range-bit rate performance is evaluated for Time-Hopping (TH) UWB networks complying with the FCC outdoor emission limits in the presence of Multiple Access Interference (MAI). Application of TH-UWB range-bit rate performance is presented for UWB sensor networks.

  17. Analysis of route availability in inter-working multi-hop wireless networks

    CSIR Research Space (South Africa)

    Salami, O

    2009-07-01

    Full Text Available In order to link a source-destination node pair in inter-working multi-hop wireless networks, links or routes must first be available. It is only after establishing the availability of links and routes between nodes that factors which affect...

  18. An adaptive resource control mechanism in multi-hop ad-hoc networks

    NARCIS (Netherlands)

    Yang, Y.; Heijenk, Geert; Haverkort, Boudewijn R.H.M.; Masip Bruin, Xavier; Verchere, Dominique; Tsaoussidis, Vassilis; Yannuzzi, Marcelo

    This paper presents an adaptive resource control mechanism for multi-hop ad-hoc network systems, which avoids bottleneck problems caused by the node-fairness property of IEEE 802.11. In our proposal, the feedback information from the downstream bottleneck, derived from Request-To-Send (RTS) and

  19. Implementing FORMS for the Monterey Bay Forecasting System Using HOPS and ROMS

    National Research Council Canada - National Science Library

    Gangopadhyay, Avijit

    2004-01-01

    ...) to implement the feature-oriented regional modeling system (FORMS) capabilities in the West Coast ROMS and HOPS modeling efforts for synoptic nowcast, forecast and 3D-VARS and ESSE-based assimilation in the Monterey Bay region, and (iii...

  20. Pharmacological profile of Xanthohumol, a Prenylated Flavonoid from Hops (Humulus lupulus)

    DEFF Research Database (Denmark)

    Liu, Ming; Hansen, Poul Erik; Wang, Genzhu

    2015-01-01

    The female inflorescences of hops (Humulus lupulus L.), a well-known bittering agent used in the brewing industry, have long been used in traditional medicines. Xanthohumol (XN) is one of the bioactive substances contributing to its medical applications. Among foodstuffs XN is found primarily in ...

  1. Variable-range hopping conductivity in Lu-doped Bi2Te3

    Science.gov (United States)

    Ivanov, Oleg; Yaprintsev, Maxim

    2018-02-01

    The Seebeck coefficient enhancement due to an increase of density-of-states effective mass of electron has been found in n-type Bi1.9Lu0.1Te3. This enhancement is assumed to be related to forming the narrow and non-parabolic impurity (Lu) band with local maximum of electronic density of states lying near the Fermi level. Minimum in the specific electrical resistivity, ρ, originated from change of conductivity mechanism was observed at temperature Tm ≈ 11 K. Above Tm, the ρ change is due to decrease of electron mobility via acoustic phonon scattering. Below Tm, the variable-range hopping conductivity takes place. The electron hops between the localized states of the impurity energy band occur via tunneling process. Using the temperature and magnetic field dependences of ρ, the localization radius of electron was estimated as ≈6 nm. Two parts in the magnetic field dependence of the electrical resistivity were found at temperature of 2 K. At weak magnetic fields, the ρ change is in agreement with the variable-range hopping conductivity mechanism. At high magnetic fields, the positive and almost linear transverse and longitudinal magnetoresistances were observed at low temperatures. Both variable-range hopping conductivity and positive linear magnetoresistance are characteristics of disordered and inhomogeneous semiconductors.

  2. Critical Multimodal Hip Hop Production: A Social Justice Approach to African American Language and Literacy Practices

    Science.gov (United States)

    Turner, K. C. Nat; Hayes, Nini, Visaya; Way, Kate

    2013-01-01

    This article features key findings from a study that highlights the transformative impact of a pedagogical approach that employs Critical Multimodal Hip Hop Production (CMHHP). The study took place in an extended day program in a northern California public middle school among a group of 30, urban, African American, Chicano/a/Latino/a, and Asian…

  3. Characterization of the Migration of Hop Volatiles into Different Crown Cork Liner Polymers and Can Coatings.

    Science.gov (United States)

    Wietstock, Philip C; Glattfelder, Richard; Garbe, Leif-Alexander; Methner, Frank-Jürgen

    2016-04-06

    Absorption of hop volatiles by crown cork liner polymers and can coatings was investigated in beer during storage. All hop volatiles measured were prone to migrate into the closures, and the absorption kinetics was demonstrated to fit Fick's second law of diffusion well for a plane sheet. The extent and rate of diffusion were significantly dissimilar and were greatly dependent upon the nature of the volatile. Diffusion coefficients ranged from 1.32 × 10(-5) cm(2)/day (limonene) to 0.26 × 10(-5) cm(2)/day (α-humulene). The maximum amounts absorbed into the material at equilibrium were in the following order: limonene > α-humulene > trans-caryophyllene > myrcene ≫ linalool > α-terpineol > geraniol. With the application of low-density polyethylene (LDPE) liners with oxygen-scavenging functionality, oxygen-barrier liners made up from high-density polyethylene (HDPE) or liner polymers from a different manufacturer had no significant effect on the composition of hop volatiles in beers after prolonged storage of 55 days; however, significantly higher amounts of myrcene and limonene were found in the oxygen-barrier-type crown cork, while all other closures behaved similarly. Can coatings were demonstrated to absorb hop volatiles in a similar pattern as crown corks but to a lesser extent. Consequently, significantly higher percentages of myrcene were found in the beers.

  4. Sampling Memories: Using Hip-Hop Aesthetics to Learn from Urban Schooling Experiences

    Science.gov (United States)

    Petchauer, Emery

    2012-01-01

    This article theorizes and charts the implementation of a learning activity designed from the hip-hop aesthetic of sampling. The purpose of this learning activity was to enable recent urban school graduates to reflect upon their previous schooling experiences as a platform for future learning in higher education. This article illustrates what…

  5. Characterization of the Mammalian CORVET and HOPS Complexes and Their Modular Restructuring for Endosome Specificity

    NARCIS (Netherlands)

    van der Kant, Rik; Jonker, Caspar T. H.; Wijdeven, Ruud H.; Bakker, Jeroen; Janssen, Lennert; Klumperman, Judith; Neefjes, Jacques

    2015-01-01

    Trafficking of cargo through the endosomal system depends on endosomal fusion events mediated by SNARE proteins, Rab-GTPases, and multisubunit tethering complexes. The CORVET and HOPS tethering complexes, respectively, regulate early and late endosomal tethering and have been characterized in detail

  6. Uudised : Muusikal Lennonist kukkus läbi. Erkki Otsman. Hip-hop

    Index Scriptorium Estoniae

    2005-01-01

    Don Scardino lavastatud John Lennoni elu ja heliloomingu pinnalt sündinud muusikali etendamisest Ameerikas. Erkki Otsmani esinemisest 24. sept. Euroopa keelte päeva raames Krakovis. Los Angelese hip-hop-muusika plaadifirma Stones Throw sügisene Euroopa-turnee sel nädalal Tallinnas: Rock Café's 24. sept. esinevad MCd Wildchild, Declaime ja MED

  7. Comparison of four extraction methods for analysis of volatile hop-derived aroma compounds in beer.

    Science.gov (United States)

    Richter, Tobias M; Eyres, Graham T; Silcock, Patrick; Bremer, Phil J

    2017-11-01

    The volatile organic compound profile in beer is derived from hops, malt, yeast, and interactions between the ingredients, making it very diverse and complex. Due to the range and diversity of the volatile organic compounds present, the choice of the extraction method is extremely important for optimal sensitivity and selectivity. This study compared four extraction methods for hop-derived compounds in beer late hopped with Nelson Sauvin. Extraction capacity and variation were compared for headspace solid-phase micro extraction, stir bar sorptive extraction, headspace sorptive extraction, and solvent-assisted flavor evaporation. Generally, stir bar sorptive extraction was better suited for acids, headspace sorptive extraction for esters and aldehydes, while headspace solid-phase microextraction was less sensitive overall, extracting 40% fewer compounds. Solvent-assisted flavor evaporation with dichloromethane was not suitable for the extraction of hop-derived volatile organic compounds in beer, as the profile was strongly skewed towards alcohols and acids. Overall, headspace sorptive extraction is found to be best suited, closely followed by stir bar sorptive extraction. © 2017 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  8. A Ratchet Lens: Black Queer Youth, Agency, Hip Hop, and the Black Ratchet Imagination

    Science.gov (United States)

    Love, Bettina L.

    2017-01-01

    This article explores the utilization of the theory of a Black ratchet imagination as a methodological perspective to examine the multiple intersections of Black and queer identity constructions within the space of hip hop. In particular, I argue for the need of a methodological lens that recognizes, appreciates, and struggles with the fluidity,…

  9. A Stochastic Geometry Model for Multi-hop Highway Vehicular Communication

    KAUST Repository

    Farooq, Muhammad Junaid

    2015-11-19

    Carrier sense multiple access (CSMA) protocol is standardized for vehicular communication to ensure a distributed and efficient communication between vehicles. However, several vehicular applications require efficient multi-hop information dissemination. This paper exploits stochastic geometry to develop a tractable and accurate modeling framework to characterize the multi-hop transmissions for vehicular networks in a multi-lane highway setup. In particular, we study the tradeoffs between per-hop packet forward progress, per-hop transmission success probability, and spatial frequency reuse (SFR) efficiency imposed by different packet forwarding schemes, namely, most forward with fixed radius (MFR), the nearest with forward progress (NFP), and the random with forward progress (RFP). We also define a new performance metric, denoted as the aggregate packet progress (APP), which is a dimensionless quantity that captures the aforementioned tradeoffs. To this end, the developed model reveals the interplay between the spectrum sensing threshold (th) of the CSMA protocol and the packet forwarding scheme. Our results show that, in contrary to ALOHA networks which always favor NFP, MFR may achieve the highest APP in CSMA networks if th is properly chosen.

  10. Characterization of resistance to powdery mildew in the Hop cultivars Newport and Comet

    Science.gov (United States)

    Hop powdery mildew, caused by Podosphaera macularis, is an important disease in the Northwestern U.S. Outbreaks of powdery mildew on cultivars previously resistant to the disease have been reported increasingly with the emergence of virulent pathogen strains capable of overcoming a commonly deployed...

  11. Polaron hopping mediated by nuclear tunnelling in semiconducting polymers at high carrier density

    NARCIS (Netherlands)

    Asadi, Kamal; Kronemeijer, Auke J.; Cramer, Tobias; Koster, L. Jan Anton; Blom, Paul W. M.; de Leeuw, Dago M.

    The transition rate for a single hop of a charge carrier in a semiconducting polymer is assumed to be thermally activated. As the temperature approaches absolute zero, the predicted conductivity becomes infinitesimal in contrast to the measured finite conductivity. Here we present a uniform

  12. Improved Intelligent Underlay-Overlay Combined with Frequency Hopping in GSM

    DEFF Research Database (Denmark)

    Wigard, Jeroen; Nielsen, Thomas Toftegaard; Mogensen, Preben Elgaard

    1997-01-01

    IUO (intelligent underlay-overlay) in a combination with random frequency hopping in GSM is analysed. Several improvements to the original IUO concept analysed in Nielsen et al. (1997) are introduced. With the improved IUO concept it is possible to load a network configuration consisting of 4...

  13. Vulnerability And Risk Assessment Using The Homeland-Defense Operational Planning System (HOPS)

    Energy Technology Data Exchange (ETDEWEB)

    Durling, Jr., R L; Price, D E; Spero, K K

    2005-01-03

    For over ten years, the Counterproliferation Analysis and Planning System (CAPS) at Lawrence Livermore National Laboratory (LLNL) has been a planning tool used by U.S. combatant commands for mission support planning against foreign programs engaged in the manufacture of weapons of mass destruction (WMD). CAPS is endorsed by the Secretary of Defense as the preferred counterproliferation tool to be used by the nation's armed services. A sister system, the Homeland-Defense Operational Planning System (HOPS), is a new operational planning tool leveraging CAPS expertise designed to support the defense of the U.S. homeland. HOPS provides planners with a basis to make decisions to protect against acts of terrorism, focusing on the defense of facilities critical to U.S. infrastructure. Criticality of facilities, structures, and systems is evaluated on a composite matrix of specific projected casualty, economic, and sociopolitical impact bins. Based on these criteria, significant unidentified vulnerabilities are identified and secured. To provide insight into potential successes by malevolent actors, HOPS analysts strive to base their efforts mainly on unclassified open-source data. However, more cooperation is needed between HOPS analysts and facility representatives to provide an advantage to those whose task is to defend these facilities. Evaluated facilities include: refineries, major ports, nuclear power plants and other nuclear licensees, dams, government installations, convention centers, sports stadiums, tourist venues, and public and freight transportation systems. A generalized summary of analyses of U.S. infrastructure facilities is presented.

  14. Risk Assessment Using The Homeland-Defense Operational Planning System (HOPS)

    Energy Technology Data Exchange (ETDEWEB)

    Price, D E; Durling, R L

    2005-10-10

    The Homeland-Defense Operational Planning System (HOPS), is a new operational planning tool leveraging Lawrence Livermore National Laboratory's expertise in weapons systems and in sparse information analysis to support the defense of the U.S. homeland. HOPS provides planners with a basis to make decisions to protect against acts of terrorism, focusing on the defense of facilities critical to U.S. infrastructure. Criticality of facilities, structures, and systems is evaluated on a composite matrix of specific projected casualty, economic, and sociopolitical impact bins. Based on these criteria, significant unidentified vulnerabilities are identified and secured. To provide insight into potential successes by malevolent actors, HOPS analysts strive to base their efforts mainly on unclassified open-source data. However, more cooperation is needed between HOPS analysts and facility representatives to provide an advantage to those whose task is to defend these facilities. Evaluated facilities include: refineries, major ports, nuclear power plants and other nuclear licensees, dams, government installations, convention centers, sports stadiums, tourist venues, and public and freight transportation systems. A generalized summary of analyses of U.S. infrastructure facilities will be presented.

  15. Risk Assessment Using The Homeland-Defense Operational Planning System (HOPS)

    Energy Technology Data Exchange (ETDEWEB)

    Durling, R L; Price, D E; Spero, K K

    2005-06-06

    For over ten years, the Counterproliferation Analysis and Planning System (CAPS) at Lawrence Livermore National Laboratory (LLNL) has been a planning tool used by U.S. combatant commands for mission support planning against foreign programs engaged in the manufacture of weapons of mass destruction (WMD). CAPS is endorsed by the Secretary of Defense as the preferred counterproliferation tool to be used by the nation's armed services. A sister system, the Homeland-Defense Operational Planning System (HOPS), is a new operational planning tool leveraging CAPS expertise designed to support the defense of the U.S. homeland. HOPS provides planners with a basis to make decisions to protect against acts of terrorism, focusing on the defense of facilities critical to U.S. infrastructure. Criticality of facilities, structures, and systems is evaluated on a composite matrix of specific projected casualty, economic, and sociopolitical impact bins. Based on these criteria, significant unidentified vulnerabilities are identified and secured. To provide insight into potential successes by malevolent actors, HOPS analysts strive to base their efforts mainly on unclassified open-source data. However, more cooperation is needed between HOPS analysts and facility representatives to provide an advantage to those whose task is to defend these facilities. Evaluated facilities include: refineries, major ports, nuclear power plants and other nuclear licensees, dams, government installations, convention centers, sports stadiums, tourist venues, and public and freight transportation systems. A generalized summary of analyses of U.S. infrastructure facilities will be presented.

  16. Adaptation to partial resistance to powdery mildew in the hop cultivar Cascade by Podosphaera macularis

    Science.gov (United States)

    The hop cultivar Cascade has been grown in the Pacific Northwestern U.S. with minimal input for management of powdery mildew (Podosphaera macularis) for nearly 20 years due to the putatively quantitative resistance in this cultivar. While partial resistance is generally thought to be more durable th...

  17. Table Hopping in the Cafeteria: An Exploration of "Racial" Integration in Early Adolescent Social Groups.

    Science.gov (United States)

    Zisman, Paul; Wilson, Vernon

    1992-01-01

    Qualitative and quantitative studies of a class of 208 urban eighth graders demonstrate that loose-knit peer groups encourage interracial integration, whereas cliques do not. Loose-knit voluntary peer groups created by the social dynamic of cafeteria table hopping provide an opportunity for meaningful cross-race interaction. (SLD)

  18. Effect of harvest time on some in vitro functional properties of hop polyphenols.

    Science.gov (United States)

    Inui, Takako; Okumura, Koharu; Matsui, Hiroo; Hosoya, Takahiro; Kumazawa, Shigenori

    2017-06-15

    Health benefits of hop polyphenols are well studied. In the present investigation, we examined the antioxidant activity, anti-nitric oxide (NO) production, and anti-adipocyte differentiation of polyphenols extracted from hops (HPP), harvested at different times for over 4years. Saaz hop variety from the Czech Republic was used in the in vitro assays. Twenty-three polyphenols were quantitatively analyzed using Orbitrap liquid chromatography-mass spectrometry (LC-MS), and their health promoting effects were assayed individually. Strong effects of low concentrations of HPP were observed in the above three assays. A significant increase in anti-adipocyte differentiation activity per unit weight of HPP was obtained in the early harvested samples. A significant difference in anti-NO production activity per unit weight of HPP was observed among the different harvest years. HPP significantly increased in early harvested samples. Our results suggest that some in vitro functional properties of hops vary with harvest time and year and are dependent on different polyphenols. Copyright © 2017 Elsevier Ltd. All rights reserved.

  19. You Know What It Is: Learning Words through Listening to Hip-Hop

    Science.gov (United States)

    Chesley, Paula

    2011-01-01

    Music listeners have difficulty correctly understanding and remembering song lyrics. However, results from the present study support the hypothesis that young adults can learn African-American English (AAE) vocabulary from listening to hip-hop music. Non-African-American participants first gave free-response definitions to AAE vocabulary items, after which they answered demographic questions as well as questions addressing their social networks, their musical preferences, and their knowledge of popular culture. Results from the survey show a positive association between the number of hip-hop artists listened to and AAE comprehension vocabulary scores. Additionally, participants were more likely to know an AAE vocabulary item if the hip-hop artists they listen to use the word in their song lyrics. Together, these results suggest that young adults can acquire vocabulary through exposure to hip-hop music, a finding relevant for research on vocabulary acquisition, the construction of adolescent and adult identities, and the adoption of lexical innovations. PMID:22205942

  20. Mortality in American Hip-Hop and Rap Recording Artists, 1987-2014.

    Science.gov (United States)

    Lawson, Carl J

    2015-12-01

    The deaths of American hip-hop and rap recording artists often receive considerable media attention. However, these artists' deaths have not been examined as a distinct group like the deaths of rock, classical, jazz, and pop music artists. This is a seminal epidemiological analysis on the deaths of an understudied group, American hip-hop and rap music recording artists. Media reports were analyzed of the deaths of American hip-hop and rap music recording artists that occurred from January 1, 1987 to December 31, 2014. The decedents' age, sex, race, cause of death, stage names, and city and state of death were recorded for analysis. The most commonly reported cause of death was homicide. The 280 deaths were categorized as homicide (55%), unintentional injury (13%), cardiovascular (7%), undetermined/undisclosed (7%), cancer (6%), other (5%), suicide (4%), and infectious disease (3%). The mean reported age at death was 30 yrs (range 15-75) and the median was 29 yrs; 97% were male and 92% were black. All but one of the homicides were committed with firearms. Homicide was the most commonly reported cause of death. Public health focus and guidance for hip-hop and rap recording artists should mirror that for African-American men and adolescent males ages 15-54 yrs, for whom the leading causes of death are homicide, unintentional injury, and heart disease. Given the preponderance of homicide deaths in this analysis, premature mortality reduction efforts should focus on violence prevention and conflict mitigation.

  1. Design and Dynamics Analysis of a Bio-Inspired Intermittent Hopping Robot for Planetary Surface Exploration

    Directory of Open Access Journals (Sweden)

    Long Bai

    2012-10-01

    Full Text Available A small, bio-inspired and minimally actuated intermittent hopping robot for planetary surface exploration is proposed in this paper. The robot uses a combined-geared six-bar linkage/spring mechanism, which has a possible rich trajectory and metamorphic characteristics and, due to this, the robot is able to recharge, lock/release and jump by using just a micro-power motor as the actuator. Since the robotic system has a closed-chain structure and employs underactuated redundant motion, the constrained multi-body dynamics are derived with time-varying driving parameters and ground unilateral constraint both taken into consideration. In addition, the established dynamics equations, mixed of higher order differential and algebraic expressions, are solved by the immediate integration algorithm. A prototype is implemented and experiments are carried out. The results show that the robot, using a micro-power motor as the actuator and solar cells as the power supply, can achieve a biomimetic multi-body hopping stance and a nonlinearly increasing driving force. Typically, the robot can jump a horizontal distance of about 1 m and a vertical height of about 0.3 m, with its trunk and foot moving stably during takeoff. In addition, the computational and experimental results are consistent as regards the hopping performance of the robot, which suggests that the proposed dynamics model and its solution have general applicability to motion prediction and the performance analysis of intermittent hopping robots.

  2. Throughput Analysis on 3-Dimensional Underwater Acoustic Network with One-Hop Mobile Relay.

    Science.gov (United States)

    Zhong, Xuefeng; Chen, Fangjiong; Fan, Jiasheng; Guan, Quansheng; Ji, Fei; Yu, Hua

    2018-01-16

    Underwater acoustic communication network (UACN) has been considered as an essential infrastructure for ocean exploitation. Performance analysis of UACN is important in underwater acoustic network deployment and management. In this paper, we analyze the network throughput of three-dimensional randomly deployed transmitter-receiver pairs. Due to the long delay of acoustic channels, complicated networking protocols with heavy signaling overhead may not be appropriate. In this paper, we consider only one-hop or two-hop transmission, to save the signaling cost. That is, we assume the transmitter sends the data packet to the receiver by one-hop direct transmission, or by two-hop transmission via mobile relays. We derive the closed-form formulation of packet delivery rate with respect to the transmission delay and the number of transmitter-receiver pairs. The correctness of the derivation results are verified by computer simulations. Our analysis indicates how to obtain a precise tradeoff between the delay constraint and the network capacity.

  3. A Double Rate Localization Algorithm with One Anchor for Multi-Hop Underwater Acoustic Networks.

    Science.gov (United States)

    Gao, Jingjie; Shen, Xiaohong; Zhao, Ruiqin; Mei, Haodi; Wang, Haiyan

    2017-04-28

    Localization is a basic issue for underwater acoustic networks (UANs). Currently, most localization algorithms only perform well in one-hop networks or need more anchors which are not suitable for the underwater environment. In this paper, we proposed a double rate localization algorithm with one anchor for multi-hop underwater acoustic networks (DRL). The algorithm firstly presents a double rate scheme which separates the localization procedure into two modes to increase the ranging accuracy in multi-hop UANs while maintaining the transmission rate. Then an optimal selection scheme of reference nodes was proposed to reduce the influence of references' topology on localization performance. The proposed DRL algorithm can be used in the multi-hop UANs to increase the localization accuracy and reduce the usage of anchor nodes. The simulation and experimental results demonstrated that the proposed DRL algorithm has a better localization performance than the previous algorithms in many aspects such as accuracy and communication cost, and is more suitable to the underwater environment.

  4. You know what it is: learning words through listening to hip-hop.

    Directory of Open Access Journals (Sweden)

    Paula Chesley

    Full Text Available Music listeners have difficulty correctly understanding and remembering song lyrics. However, results from the present study support the hypothesis that young adults can learn African-American English (AAE vocabulary from listening to hip-hop music. Non-African-American participants first gave free-response definitions to AAE vocabulary items, after which they answered demographic questions as well as questions addressing their social networks, their musical preferences, and their knowledge of popular culture. Results from the survey show a positive association between the number of hip-hop artists listened to and AAE comprehension vocabulary scores. Additionally, participants were more likely to know an AAE vocabulary item if the hip-hop artists they listen to use the word in their song lyrics. Together, these results suggest that young adults can acquire vocabulary through exposure to hip-hop music, a finding relevant for research on vocabulary acquisition, the construction of adolescent and adult identities, and the adoption of lexical innovations.

  5. Global Ill-Literacies: Hip Hop Cultures, Youth Identities, and the Politics of Literacy

    Science.gov (United States)

    Alim, H. Samy

    2011-01-01

    This article focuses on the emergence of what the author refers to as "global ill-literacies," that is, the hybrid, transcultural linguistic and literacy practices of Hip Hop youth in local and global contexts, as well as the pedagogical possibilities that scholars open up as they engage these forms. By reviewing a broad but focused range of…

  6. Media/Visual Literacy Art Education: Sexism in Hip-Hop Music Videos

    Science.gov (United States)

    Chung, Sheng Kuan

    2007-01-01

    Media programs like hip-hop music videos are powerful aesthetic agents that inspire teenagers. Thus, they have tremendous influence on young people's identity formation, lifestyle choices, and knowledge construction which are manifested in the ways teens dress, express themselves, behave, and interact with each other. However, because of the…

  7. Cultivating the Spatial Politics of Community-Based Literacy Practices in Hip-Hop

    Science.gov (United States)

    Prier, Darius D.

    2013-01-01

    In this article, the social imagination of community-based sites of urban resistance enable out-of-school literacy practices in Black popular culture to foreground the contemporary context in which youth empowerment is nurtured in out-of-school learning settings. Second, the author chronicles how youth advocates in hip-hop--based community…

  8. "Folkbildning" through Hip-Hop: How the Ideals of Three Rappers Parallel a Scandinavian Educational Tradition

    Science.gov (United States)

    Soderman, Johan

    2011-01-01

    The purpose of this article is to show how the rappers' talk about hip-hop and its connection to pedagogy and social activism parallel the Scandinavian tradition of folkbildning. Scandinavian folkbildning can be seen as a movement to provide voluntary education for the general population. It can also be the name of the process of learning in which…

  9. Pedagogical Ideas on Sonic, Mediated, and Virtual Musical Landscapes: Teaching Hip Hop in a University Classroom

    Science.gov (United States)

    Dhokai, Niyati

    2012-01-01

    Based on the experience of teaching the history of American hip hop music to a classroom of Canadian university students, the author considers the disjuncture between the cultural orientations of herself and her students. The author considers teaching methods to solve the place-based disjuncture that often occurs when teaching genres such as hip…

  10. Hip-Hop, Digital Media, and the Changing Face of Music Education

    Science.gov (United States)

    Thibeault, Matthew D.

    2010-01-01

    In this article, the author describes a true story about Dwayne Carter Jr., a rapper most music educators probably don't know but one who is beloved throughout the world as "Lil Wayne." Critics overwhelmingly proclaimed Lil Wayne the top rapper in the hip-hop game, and the album and his work leading up to it were universally regarded as some of…

  11. Use of the Homeland-Defense Operational Planning System (HOPS) for Emergency Management

    Energy Technology Data Exchange (ETDEWEB)

    Durling, Jr., R L; Price, D E

    2005-12-16

    The Homeland-Defense Operational Planning System (HOPS), is a new operational planning tool leveraging Lawrence Livermore National Laboratory's expertise in weapons systems and in sparse information analysis to support the defense of the U.S. homeland. HOPS provides planners with a basis to make decisions to protect against acts of terrorism, focusing on the defense of facilities critical to U.S. infrastructure. Criticality of facilities, structures, and systems is evaluated on a composite matrix of specific projected casualty, economic, and sociopolitical impact bins. Based on these criteria, significant unidentified vulnerabilities are identified and secured. To provide insight into potential successes by malevolent actors, HOPS analysts strive to base their efforts mainly on unclassified open-source data. However, more cooperation is needed between HOPS analysts and facility representatives to provide an advantage to those whose task is to defend these facilities. Evaluated facilities include: refineries, major ports, nuclear power plants and other nuclear licensees, dams, government installations, convention centers, sports stadiums, tourist venues, and public and freight transportation systems. A generalized summary of analyses of U.S. infrastructure facilities will be presented.

  12. Gait-Based Quadruped Robot Planar Hopping Control with Energy Planning

    Directory of Open Access Journals (Sweden)

    Hui Chai

    2016-02-01

    Full Text Available To improve the mobility of the quadruped robot, a planar hopping control approach is proposed based on trotting gait. With the proposed approach, three joints of the stance legs are active and the fourth leg is passive. A planar kinematic model of the supporting phase is built and the calculated positions and posture of the torso are used as feedback for motion control. The forces and torque acting at the CoM of the robot torso in the plane are fully controllable and decoupled with the control approach based on a virtual model. The planar motions on three axes are controlled independently. For the hopping control, the total energy in a hopping cycle on the vertical direction is planned according to the desired hopping height of the torso's CoM and the virtual vertical stiffness of the torso is generated using the elastic potential energy of the virtual model. We verify the approach and its robustness using simulation experiments and show the results at the end of this paper.

  13. Youth Perspectives on the Intersections of Violence, Gender, and Hip-Hop

    Science.gov (United States)

    Hernandez, Diana; Weinstein, Hannah; Munoz-Laboy, Miguel

    2012-01-01

    Youth's perceptions of violence within their social environments can provide relevant insights into the gender-based interpersonal violence epidemic in inner-city communities. To explore this issue, we examined two sets of narratives with young men and women, aged 15 to 21, involved in hip-hop culture in New York City. In the analysis, we reveal…

  14. Rap as the language of conflict in hip-hop subculture

    Directory of Open Access Journals (Sweden)

    Т М Кожелупенко

    2008-12-01

    Full Text Available This article is devoted to such notions of sociolinguistics as subculture and the language of conflict. These aspects are studied by the example of the rapidly developing hip-hop subculture and rap-texts as its main component.

  15. Structure and DNA-binding of meiosis-specific protein Hop2

    Science.gov (United States)

    Zhou, Donghua; Moktan, Hem; Pezza, Roberto

    2014-03-01

    Here we report structure elucidation of the DNA binding domain of homologous pairing protein 2 (Hop2), which is important to gene diversity when sperms and eggs are produced. Together with another protein Mnd1, Hop2 enhances the strand invasion activity of recombinase Dmc1 by over 30 times, facilitating proper synapsis of homologous chromosomes. However, the structural and biochemical bases for the function of Hop2 and Mnd1 have not been well understood. As a first step toward such understanding, we recently solved the structure for the N-terminus of Hop2 (1-84) using solution NMR. This fragment shows a typical winged-head conformation with recognized DNA binding activity. DNA interacting sites were then investigated by chemical shift perturbations in a titration experiment. Information of these sites was used to guide protein-DNA docking with MD simulation, revealing that helix 3 is stably lodged in the DNA major groove and that wing 1 (connecting strands 2 and 3) transiently comes in contact with the minor groove in nanosecond time scale. Mutagenesis analysis further confirmed the DNA binding sites in this fragment of the protein.

  16. Abortion and contemporary hip-hop: a thematic analysis of lyrics from 1990-2015.

    Science.gov (United States)

    Premkumar, Ashish; Brown, Katherine; Mengesha, Biftu; Jackson, Andrea V

    2017-07-01

    To evaluate the representation of abortion in contemporary hip-hop music, gaining insight into the myriad of attitudes of abortion in the black community. We used Genius, an online storehouse for lyrical content, to identify songs by querying the database for search terms related to family planning, including slang terms. We then cross-referenced identified songs using an online list of songs about abortion. We analyzed eligible songs using grounded theory in order to identify key themes. Of 6577 songs available, a total of 101 songs performed by 122 individual artists met inclusion criteria. The majority of artists were Black men; five artists were Black women. Key themes were: use of abortion as braggadocio; equating abortion with sin, genocide, or murder; male pressure for women to seek abortion; and the specific association of Planned Parenthood services with abortion. The moral and ethical themes surrounding abortion in hip-hop lyrics reveal a unique perspective within a marginalized community. The overall negative context of abortion in hip-hop lyrics needs to be reconciled with the gendered, economic, historical, political, racial and ethnic background of hip-hop and rap music in America. This study is the first to evaluate lyrical content from contemporary popular music in relation to abortion and family planning. Examining the intersection of reproductive rights and popular culture can provide a unique insight into the limited knowledge of the perspectives of abortion in the black community. Copyright © 2017 Elsevier Inc. All rights reserved.

  17. Quantum simulation of correlated-hopping models with fermions in optical lattices

    NARCIS (Netherlands)

    Liberto, M. Di; Creffield, C. E.; Japaridze, G. I.; Smith, C. Morais

    2014-01-01

    By using a modulated magnetic field in a Feshbach resonance for ultracold fermionic atoms in optical lattices, we show that it is possible to engineer a class of models usually referred to as correlated-hopping models. These models differ from the Hubbard model in exhibiting additional

  18. Effect of storage on the brewing properties of tropical hop substitutes ...

    African Journals Online (AJOL)

    Tropical hop substitute from utazi (UTZ) Gongronema latifolium, bitter cola (BTC), Garcinia kola, bitter leaf (BTL), Vernonia amygdalina and a blend (1:1.41:2.89) of the three (HSB) respectively, were produced. Stability studies were carried out to predict their suitability for brewing after one to six months storage at 5 ± 1oC ...

  19. Spring-like leg behaviour, musculoskeletal mechanics and control in maximum and submaximum height human hopping

    NARCIS (Netherlands)

    Bobbert, M.F.

    2011-01-01

    The purpose of this study was to understand how humans regulate their 'leg stiffness' in hopping, and to determine whether this regulation is intended to minimize energy expenditure. 'Leg stiffness' is the slope of the relationship between ground reaction force and displacement of the centre of mass

  20. From Haydn to Hip-Hop: Meeting Students' Needs in an Urban Classroom

    Science.gov (United States)

    Vagi, Robert

    2010-01-01

    When an inner-city Arizona music teacher found himself faced with too many orchestra students and not enough instruments, he took a risky but rewarding left turn--into rap music. In this article, the author describes how he teaches his hip-hop class, the challenges in creating and teaching the class, and the positive results. (Contains 21…

  1. Naija Hip Hop: An Analysis of the Music of 2Face Idibia | Oikelome ...

    African Journals Online (AJOL)

    In recent times, contemporary discourse on the analysis of popular music has taken the front burner. This is as a result of the growing trend of this genre in the stream of world music and the numerous awards being won by Nigerian hip hop artistes both at home and abroad. This paper examines the music of Innocent “2 ...

  2. HOP'N after-school project: an obesity prevention randomized controlled trial

    Directory of Open Access Journals (Sweden)

    Coleman Karen J

    2010-12-01

    Full Text Available Abstract Background This paper reports the primary outcomes of the Healthy Opportunities for Physical Activity and Nutrition (HOP'N after-school project, which was an effectiveness trial designed to evaluate the prevention of childhood obesity through building the capacity of after-school staff to increase physical activity (PA and fruit and vegetable (FV opportunities. Methods We conducted a three-year, nested cross-sectional group randomized controlled effectiveness trial. After a baseline assessment year (2005-2006, schools and their after-school programs were randomized to the HOP'N after-school program (n = 4 or control (n = 3, and assessed for two subsequent years (intervention year 1, 2006-2007; intervention year 2, 2007-2008. Across the three years, 715 fourth grade students, and 246 third and fourth grade after-school program participants were included in the study. HOP'N included community government human service agency (Cooperative Extension led community development efforts, a three-time yearly training of after-school staff, daily PA for 30 minutes following CATCH guidelines, a daily healthful snack, and a weekly nutrition and PA curriculum (HOP'N Club. Child outcomes included change in age- and gender-specific body mass index z-scores (BMIz across the school year and PA during after-school time measured by accelerometers. The success of HOP'N in changing after-school program opportunities was evaluated by observations over the school year of after-school program physical activity sessions and snack FV offerings. Data were analyzed in 2009. Results The intervention had no impact on changes in BMIz. Overweight/obese children attending HOP'N after-school programs performed 5.92 minutes more moderate-to-vigorous PA per day after intervention, which eliminated a baseline year deficit of 9.65 minutes per day (p Conclusions The HOP'N program had a positive impact on overweight/obese children's PA and after-school active recreation time

  3. [The chemical constituents of Polygala hongkongensis Hemsl].

    Science.gov (United States)

    Wu, Jian-feng; Chen, Si-bao; Chen, Shi-lin; Tu, Peng-fei

    2007-07-01

    Polygala hongkongensis Polycalaceae is mostly distributed in southern China, such as Guangdong, Jiangxi, Fujian and Sichuan provinces. And its herbs is used as a remedy of heat-clearing and detoxicating, removing food retention, promoting blood flow and expelling phlegm to arrest coughing in the folk medicine. Previous phytochemical investigations on Polygala plants have reported that the main chemical constituents are sapaonins, xanthones and oligosaccharide esters. To the best of our knowledge, there is no chemical report on the Polygala hongkongensis Hemsl. yet. In order to search and make use of natural resources from Polygala and to find the bioactive compounds and new compounds, we carried out studies on chemical constituents of this plant. The herbs of P. hongkongensis were extracted with 70% MeOH. The extract was combined and evaporated in vacuum to residue, which was suspended in water and successively partitioned with EtOAc and n-BuOH. Part of the n-BuOH extract was isolated and purified by various column chromatographs such as a macroporous resin, silica gel, Sephadex LH-20 column and semipreparative HPLC. The structures of isolated and purified compounds were determined by spectral analysis such as UV, IR, HRESI-MS, ESI-MS, 1H NMR, 13C NMR, HMQC, HMBC, H-H COSY, NOESY and physico-chemical property. Six compounds were identified as polyhongkonggaline (1), 3, 6'-di-O-sinapoyl-sucrose (2), tenuifoliside A (3), glomeratose D (4), cis-syringin (5), syringaresinol-4'-O-beta-D-monoglucoside (6). Compounds 1 is new compound, and 2-6 were isolated from this plant for the first time. Farther studies on the chemical constituents and pharmacological activities of P. hongkongensis will be carried out.

  4. Detailed balance, internal consistency, and energy conservation in fragment orbital-based surface hopping

    Science.gov (United States)

    Carof, Antoine; Giannini, Samuele; Blumberger, Jochen

    2017-12-01

    We have recently introduced an efficient semi-empirical non-adiabatic molecular dynamics method for the simulation of charge transfer/transport in molecules and molecular materials, denoted fragment orbital-based surface hopping (FOB-SH) [J. Spencer et al., J. Chem. Phys. 145, 064102 (2016)]. In this method, the charge carrier wavefunction is expanded in a set of charge localized, diabatic electronic states and propagated in the time-dependent potential due to classical nuclear motion. Here we derive and implement an exact expression for the non-adiabatic coupling vectors between the adiabatic electronic states in terms of nuclear gradients of the diabatic electronic states. With the non-adiabatic coupling vectors (NACVs) available, we investigate how different flavours of fewest switches surface hopping affect detailed balance, internal consistency, and total energy conservation for electron hole transfer in a molecular dimer with two electronic states. We find that FOB-SH satisfies detailed balance across a wide range of diabatic electronic coupling strengths provided that the velocities are adjusted along the direction of the NACV to satisfy total energy conservation upon a surface hop. This criterion produces the right fraction of energy-forbidden (frustrated) hops, which is essential for correct population of excited states, especially when diabatic couplings are on the order of the thermal energy or larger, as in organic semiconductors and DNA. Furthermore, we find that FOB-SH is internally consistent, that is, the electronic surface population matches the average quantum amplitudes, but only in the limit of small diabatic couplings. For large diabatic couplings, inconsistencies are observed as the decrease in excited state population due to frustrated hops is not matched by a corresponding decrease in quantum amplitudes. The derivation provided here for the NACV should be generally applicable to any electronic structure approach where the electronic

  5. Design, Development and Control of a Hopping Machine – an Exercise in Biomechatronics

    Directory of Open Access Journals (Sweden)

    Kuldip Naik

    2010-01-01

    Full Text Available Hopping is a complicated dynamic behaviour in the animal kingdom. Development of a hopping machine that can mimic the biomechanics of jumping in Homo sapiens is envisioned. In this context, the design, development and control of a cost-effective, pneumatically actuated, one-legged hopping machine were initiated at the University ofRegina in 2005. The pneumatic actuator has a simple design that employs an off-the-shelf on/off control valve which regulates the air pressure supplied to the hopper's body using a pulse width modulated (PWM signal. The objective is to maintain a constant jumping height in the hopper after going through a finite number of hopping cycles. The mechanistic model of the system was investigated in full detail. This model facilitates: (1 the design of the actuating system, and (2 the synthesis and verification of different control strategies in a simulation environment prior to implementation in the real world. The movement of the hopper is supported by a vertical slide; therefore, the hopper can only jump in place. However, the proposed control strategy and the propulsion unit can be further utilised for stable hopping in a 3-D environment. A model-free Neuro-PD controller was then designed, trained and implemented on a real system. Simulation and experimentation showed promising results. This system can be used as an educational tool for teaching real-time control of hybrid and non-linear systems. It can be also used as a biomechatronics test bed to simulate the effect of different timings in firing action potentials in jump-causing leg muscles on achieving a desired jumping height in the animal kingdom.

  6. Chemical constituents of Breynia glauca leaves

    Directory of Open Access Journals (Sweden)

    Butsarakham Supudompol

    2005-08-01

    Full Text Available From the leaves of Breynia glauca, eight compounds including friedelin (1, 3-oxo- 4,5-sitosterone (2, friedelan-3β-ol (3, β-sitosterol (4, kaempferol (5, arbutin (6, kaempferol-3-O-rutinoside (7 and quercetion-3-O-glucoside (8 were isolated. The presence of these compounds supports the traditional use of this plant as a detoxifying agent. In addition, all of these chemical constituents were tested for antiviral potential against herpes simplex virus types 1 and 2, but were found to be inactive at 50 μg/ml.

  7. Chemical constituents of Salacia elliptica (Celastraceae

    Directory of Open Access Journals (Sweden)

    Lucienir Pains Duarte

    2010-01-01

    Full Text Available The chemical investigation of Salacia elliptica allowed to the isolation of 20 constituents: two polyols, one xanthone, a mixture of long chain hydrocarbons, one carboxylic acid, one polymer, two steroidal compounds, one aromatic ester and eleven pentacyclic triterpenes. These triterpenes include 3β-stearyloxy-oleanane, 3β-stearyloxy-ursane, one seco-friedelane, and eight compounds of the friedelane serie. The chemical structure and the relative configuration of a new triterpene 1,3-dioxo-16α-hydroxyfriedelane (15 were established through ¹H and 13C NMR including 2D experiments (HMBC, HMQC, COSY and NOESY and herein reported for the first time.

  8. Chemical constituents of Salacia elliptica (Celastraceae)

    Energy Technology Data Exchange (ETDEWEB)

    Duarte, Lucienir Pains; Figueiredo, Rute Cunha; Sousa, Grasiely Faria de; Soares, Debora Barbosa da Silva; Rodrigues, Salomao Bento Vasconcelos; Silva, Fernando Cesar; Silva, Gracia Divina de Fatima, E-mail: lucienir@ufmg.b [Universidade Federal de Minas Gerais (UFMG), Belo Horizonte, MG (Brazil). Dept. de Quimica; Vieira Filho, Sidney Augusto [Universidade Federal de Ouro Preto, MG (Brazil). Escola de Farmacia. Dept. de Farmacia

    2010-07-01

    The chemical investigation of Salacia elliptica allowed to the isolation of 20 constituents: two polyols, one xanthone, a mixture of long chain hydrocarbons, one carboxylic acid, one polymer, two steroidal compounds, one aromatic ester and eleven pentacyclic triterpenes. These triterpenes include 3{beta}-stearyloxy-oleanane, 3{beta}-stearyloxy-ursane, one seco-friedelane, and eight compounds of the friedelane series. The chemical structure and the relative configuration of a new triterpene 1,3-dioxo-16alpha-hydroxyfriedelane (15) were established through {sup 1}H and {sup 13}C NMR including 2D experiments (HMBC, HMQC, COSY and NOESY) and herein reported for the first time (author)

  9. High Prevalence of Helicobacter pylori hopQ II Genotype Isolated from Iranian Patients with Gastroduodenal Disorders

    Directory of Open Access Journals (Sweden)

    Amin Talebi Bezmin Abadi

    2014-01-01

    Full Text Available Helicobacter pylori plays an important role in the pathogenesis of chronic gastritis, peptic ulceration, and noncardia gastric cancer. Several putative virulence factors for H. pylori have been identified including vacA, babA, and iceA. HopQ is one of the outer membrane proteins involved in bacterial adherence to gastric mucosa and has been suggested to also play a role in the virulence of H. pylori. Due to the substantial geographic differences in the prevalence of H. pylori virulence factors reported, the main purpose of the current study was to investigate the association between different H. pylori virulence hopQ alleles (types I and II and patients with gastroduodenal disorders. The presence of H. pylori and hopQ alleles in gastric biopsy specimens was identified by specific PCR assays. H. pylori type II hopQ was found to be significantly associated with gastric cancer patients (odds ratio: 3.47, 95% CI: 1.56–5.89. Information about the prevalence of H. pylori hopQ type II can be used for determining the high-risk diseases type which is actually colonized by H. pylori hopQ type II positive strains. The presence of H. pylori hopQ type II should be investigated in different geographical regions as confirmatory findings may provide a definite biomarker attributed to the pathogenesis of certain severe digestive diseases.

  10. Hop/Sti1 – A Two-Faced Cochaperone Involved in Pattern Recognition Receptor Maturation and Viral Infection

    Directory of Open Access Journals (Sweden)

    Christian E. Lamm

    2017-10-01

    Full Text Available Perception of pathogens by host pattern recognition receptors (PRRs or R proteins is a prerequisite to promote successful immune responses. The Hsp70/Hsp90 organizing protein Hop/Sti1, a multifunctional cochaperone, has been implicated in the maturation of a receptor-like kinase (RLK necessary for chitin sensing. However, it remains unknown whether Hop/Sti1 is generally participating in PRR genesis. Using RNA-interference (RNAi, we silenced Hop/Sti1 expression in Nicotiana tabacum to gain further insight into the role of the cochaperone in plant defense responses. As expected, transgenic plants do not respond to chitin treatment anymore. In contrast to this, trafficking and functionality of the flagellin PRR FLS2 were unaltered, suggesting a selective involvement of Hop/Sti1 during PRR maturation. Furthermore, Hop/Sti1 was identified as a cellular determinant of Potato virus Y (PVY symptom development in tobacco, since PVY was able to accumulate to near wild-type level without provoking the usual veinal necrosis phenotype. In addition, typical antiviral host defense responses were suppressed in the transgenic plants. These data suggest that perception of PVY is dependent on Hop/Sti1-mediated receptor maturation, while viral symptoms represent a failing attempt to restrict PVY spread. In addition, Hop/Sti1 colocalized with virus-induced membrane aggregates in wild-type plants. The retention of Hop/Sti1 in potential viral replication complexes suggests a role during viral translation/replication, explaining why RNAi-lines do not exhibit increased susceptibility to PVY. This study provides evidence for a dual role of Hop/Sti1 in PRR maturation and pathogen perception as well as in promoting viral proliferation.

  11. Comparison of the carboxy-terminal DP-repeat region in the co-chaperones Hop and Hip.

    Science.gov (United States)

    Nelson, Gregory M; Huffman, Holly; Smith, David F

    2003-01-01

    Functional steroid receptor complexes are assembled and maintained by an ordered pathway of interactions involving multiple components of the cellular chaperone machinery. Two of these components, Hop and Hip, serve as co-chaperones to the major heat shock proteins (Hsps), Hsp70 and Hsp90, and participate in intermediate stages of receptor assembly. In an effort to better understand the functions of Hop and Hip in the assembly process, we focused on a region of similarity located near the C-terminus of each co-chaperone. Contained within this region is a repeated sequence motif we have termed the DP repeat. Earlier mutagenesis studies implicated the DP repeat of either Hop or Hip in Hsp70 binding and in normal assembly of the co-chaperones with progesterone receptor (PR) complexes. We report here that the DP repeat lies within a protease-resistant domain that extends to or is near the C-terminus of both co-chaperones. Point mutations in the DP repeats render the C-terminal regions hypersensitive to proteolysis. In addition, a Hop DP mutant displays altered proteolytic digestion patterns, which suggest that the DP-repeat region influences the folding of other Hop domains. Although the respective DP regions of Hop and Hip share sequence and structural similarities, they are not functionally interchangeable. Moreover, a double-point mutation within the second DP-repeat unit of Hop that converts this to the sequence found in Hip disrupts Hop function; however, the corresponding mutation in Hip does not alter its function. We conclude that the DP repeats are important structural elements within a C-terminal domain, which is important for Hop and Hip function.

  12. Analysis of gamma irradiated pepper constituents, 5

    Energy Technology Data Exchange (ETDEWEB)

    Takagi, Kazuko; Okuyama, Tsuneo; Ishikawa, Toshihiro.

    1988-11-01

    Gamma irradiated peppers (10 krad, 100 krad, 1 Mrad) were analyzed by HPLC. The extraction method and HPLC conditions were same as the first report, that is, the extraction from pepper was performed by Automatic Air Hammer and the extracted samples were separated on a reversed phase C/sub 8/ column with a concave gradient from 0.1% trifluoroaceticacid (TFA) in water to 75% acetonitrile-0.1% TFA in water for 60 minutes and detected at 210 nm, 280 nm. It is difficult to compare with irradiated and unirradiated pepper constituents by their peak height or area. And the method of multivariant statistically analysis was introduced. The 'peak n area/peak n + 1 area' ratio was calculated by computer. Each peak area was accounted by integrator. The value of these ratio were called 'parameter'. Each chromatogram has 741 parameters calculated with 39 chromatographic peaks. And these parameters were abopted to the multivariant statiscally analysis. Comparison of constituents between irradiated pepper and unirradiated pepper was done by 741 parameters. The correlation of parameters between irradiated and unirradiated was investigated by use of computer. Some parameters of irradiated case were selected as which had no correlation with unirradiated case. That is to say these parameters were thought to be changed with gamma spectrum irradiation. By this method, Coumarin was identified as a changed component with gamma irradiation.

  13. Procesos hopping a través del modelo difusional en materiales nanocristalinos usados para aplicaciones fotovoltaicas

    OpenAIRE

    Mesa, Fredy

    2014-01-01

    Se presentan los modelos de hopping de rango variable (variable range hopping; VRH), vecinos cercanos (nearest neighbor hopping; NNH) y barreras de potencial presentes en las fronteras de grano; como mecanismos de transporte eléctrico predominantes en los materiales semiconductores para aplicaciones fotovoltaicas. Las medidas de conductividad a oscuras en función de temperatura fueron realizadas para región de bajas temperaturas entre 120 y 400 K con Si y compuestos Cu3BiS2 y Cu2ZnSnSe4. Sigu...

  14. Variable-range electron hopping, conductivity cross-over and space-charge relaxation in C60Br6

    OpenAIRE

    Manesh, Zachariah; Romanini, Michela; Zygouri, Panagiota; Gournis, Dimitrios; Tamarit Mur, José Luis; Barrio Casado, María del; Macovez, Roberto

    2016-01-01

    Dielectric spectroscopy is employed to probe the frequency-dependent conductivity and dipolar dielectric response of solid C60Br6. Below approximately 215 K, charge conduction is electronic and well described by Mott's variable-range polaron hopping model, with effective hopping activation energy Ea varying between 0.12 eV at 125 K and 0.16 eV at 220 K, and most probable hopping range varying between 100 and 125% of the decay length of the localized polaron's wavefunction. Above 215 K a new c...

  15. O jovem no movimento hip hop: espaço potencial de criatividade e identificação?

    OpenAIRE

    Ballalai, Rodrigo Clemente [UNESP

    2009-01-01

    A partir de experiência de estágios da graduação em Psicologia, particularmente no trabalho desenvolvido junto ao “Programa de Liberdade Assistida” da FEBEM, unidade Bauru, quando oferecemos um pronto atendimento psicológico a seus participantes, iniciamos o contato com o movimento hip hop. Entrevistamos jovens que se identificam com o movimento hip hop, analisando sua trajetória ao ingressarem nos grupos organizados de hip hop do município de Bauru. Analisamos suas biografias e percepções qu...

  16. Escola e movimento hip hop: o campo das possibilidades educativas para a juventude / Education and the hip hop movement: the field of educative possibilities for the youth

    Directory of Open Access Journals (Sweden)

    Jaileila de Araújo Menezes

    2010-09-01

    Full Text Available Este trabalho resulta de estudo de caso e pretende compreender como vem ocorrendo o diálogo entre a escola pública e o movimento hip hop, considerando-se os desafios para a construção de práticas educativas significativas para a juventude. Trata do caráter educativo do movimento, a partir das dimensões de construção da cidadania, da cultura política, da configuração do cenário sociopolítico e econômico, da subjetividade e da organização política. Para isso, acompanharam-se atividades desenvolvidas em uma crew do movimento, localizada em um bairro periférico da cidade de Recife, e a prática educativa desse movimento no contexto escolar circunscrito no Programa Escola Aberta. Visualizou-se, na experiência do movimento hip hop no programa, uma oportunidade de aprendizagem para a escola, no sentido de contextualizar seus saberes, de modo a ganhar maior adesão da comunidade escolar, em especial dos jovens. Nesse sentido, encontraram-se duas modalidades de apropriação das práticas educativas do movimento pela escola: instrumental e pedagógica, que sinalizam para a necessidade de inserção do programa na política educacional e nos projetos político-pedagógicos. Com o acompanhamento das atividades e as entrevistas, pôde-se problematizar a interface educação-segurança presente no programa como fator limitante para os aprendizados de participação esperados para a escola pública em contexto democrático. Evidencia-se essa situação nas oficinas de hip hop, em que jovens com a tarefa de educar outros jovens deparam-se com esse dilema ou simplesmente sucumbem a uma política que despotencializa suas práticas educativas. This paper results from a case study and aims to understand how there has been dialogue between the public school and hip hop movement, considering the challenges to building meaningful educational practices for youth. We treat the character education movement from the dimensions of the construction of

  17. [Chemical constituents from Salvia przewalskii Maxim].

    Science.gov (United States)

    Yang, Li-Xin; Li, Xing-Cui; Liu, Chao; Xiao, Lei; Qin, De-Hua; Chen, Ruo-Yun

    2011-07-01

    The investigation on Salvia przewalskii Maxim was carried out to find the relationship of the constituents and their pharmacological activities. The isolation and purification were performed by various chromatographies such as silica gel, Sephadex LH-20, RP-C18 column chromatography, etc. Further investigation on the fraction of the 95% ethanol extract of Salvia przewalskii Maxim yielded przewalskin Y-1 (1), anhydride of tanshinone-II A (2), sugiol (3), epicryptoacetalide (4), cryptoacetalide (5), arucadiol (6), 1-dehydromiltirone (7), miltirone (8), cryptotanshinone (9), tanshinone II A (10) and isotanshinone-I (11). Their structures were elucidated by the spectral analysis such as NMR (Nuclear Magnetic Resonance) and MS (Mass Spectrometry). Compound 1 is a new compound. Compounds 4 and 5 are mirror isomers (1 : 3). Compounds 4, 5, 6, 8, 11 were isolated from Salvia przewalskii Maxim for the first time.

  18. [Chemical constituents of Trichosanthes kirilowii Maxim].

    Science.gov (United States)

    Sun, Xiao-Ye; Wu, Hong-Hua; Fu, Ai-Zhen; Zhang, Peng

    2012-07-01

    To study the chemical constituents of Trichosanthes kirilowii Maxim., chromatographic methods such as D101 macroporous resin, silica gel column chromatographic technology, Sephadex LH-20, octadecylsilyl (ODS) column chromatographic technique and preparative HPLC were used and nine compounds were isolated from a 95% (v/v) ethanol extract of the plant. By using spectroscopic techniques including 1H NMR, 13C NMR, 1H-1H COSY, HSQC and HMBC, these compounds were identified as 5-ethoxymethyl-1-carboxyl propyl-1H-pyrrole-2-carbaldehyde (1), 5-hydroxymethyl-2-furfural (2), chrysoeriol (3), 4'-hydroxyscutellarin (4), vanillic acid (5), alpha-spinasterol (6), beta-D-glucopyranosyl-a-spinasterol (7), stigmast-7-en-3beta-ol (8), and adenosine (9), separately. Among them, compound 1 is a new compound, and compounds 3, 4 and 5 are isolated from the genus Trichosanthes kirilowii Maxim. for the first time.

  19. Antimelanoma and Antityrosinase from Alpinia galangal Constituents

    Directory of Open Access Journals (Sweden)

    Chih-Yu Lo

    2013-01-01

    Full Text Available Two compounds, 1,7-bis(4-hydroxyphenyl-1,4,6-heptatrien-3-one (BHPHTO and bisdemethoxycurcumin (BDMC they have been isolated from the rhizomes of Alpinia galangal, and the structures of both pure constituents were determined using spectroscopic analyses. The study examined the bioeffectivenesses of the two compounds on the human melanoma A2058 and showed that significantly inhibited the proliferation of melanoma cells in the cell viability assay. This research was also taken on the tests to B16-F10 cell line and showed minor inhibitory consequences of cellular tyrosinase activities and melanin contents. Our results revealed the anticancer effects of A. galangal compounds, and therefore, the target compounds could be potentially applied in the therapeutic application and the food industry.

  20. [Chemical constituents of Artemisia lactiflora(II)].

    Science.gov (United States)

    Lin, Fu-Di; Luo, Dang-Wei; Ye, Jing; Xiao, Mei-Tian

    2014-07-01

    To study the chemical constituents of Artemisia lactiflora. The compounds were isolated by column chromatography with silica gel, C18 reverse-phase silica gel, semi-preparative HPLC, and their structures were elucidated on the basis of spectral analysis. Twelve compounds were isolated from alcohol extracts of A. lactiflora and identified as 7-hydroxycoumarin (1), 7-methoxycoumarin (2), balanophonin (3), aurantiamide (4), aurantiamide acetate (5), isovitexin (6), kaempferol-3-O-beta-D-rutinoside (7), rutin (8), caffeic acid ethyl ester (9), quercetin (10), methyl 3, 5-di-O-caffeoyl quinate (11) and methyl 3, 4-di-O-caffeoyl quinate (12), respectively. Compounds 3-12 were obtained from this plant for the first time.

  1. [Chemical constituents in root of Hemerocallis fulva].

    Science.gov (United States)

    Yang, Zhong-Duo L; Li, Tao; Li, Yuan-Chao

    2008-02-01

    To study the chemical constituents of the root of Hemerocallis fulva. Compounds were isolated by repeated silica gel, Sephadex LH-20, MCI gel, etc. column chromatography and their structures were determined by spectral analyses and physicochemical properties. From the n-butanol fraction of the EtOH extract of the roots of H. fulva, 9 glycosides were isolated and identified as sweroside (1), laganin (2), picraquassioside C (3), puerarin (4), 3'-methoxypuerarin (5), 7-hydro xylnaphthalide-O-beta-D-glucopyranoside (6), orcinol-3-O-beta-glucopyranoside (7), HN saponin F (8), hederagenin-3-0-beta D-glucopyranosyl-(1-3)-alpha-L-arabinopyranoside-28-O-beta-D-glucopyranosyl ester (9). Compounds 1-9 were isolated from the genus Hemerocallis for the first time.

  2. Chemical constituents of Saxifraga stolonifera (L.) Meeb.

    Science.gov (United States)

    Feng, Wei-Sheng; Li, Zhen; Zheng, Xiao-Ke; Li, Yuan-Jing; Su, Fang-Yi; Zhang, Yan-Li

    2010-06-01

    To study the chemical constituents of Saxifraga stolonifera (L.) Meeb., chromatographic techniques were applied to separate and purify the compounds, and their structures were confirmed on the basis of physicochemical properties and spectral data. Ten compounds were isolated and identified as 5-O-methylnorbergenin (1), 3, 4-dihydroxyallylbenzene-4-O-beta-D-glucopyranoside (2), (7R, 8S)-4, 9, 9'-trihydroxyl-3-methoxyl-7, 8-dihydrobenzofuran-1'-propylneolignan-3'-O-beta-D-glucopyranoside (3), quercetin-3-O-beta-D-xylopyranosyl-(1 --> 2)-beta-D-galactopyranoside (4), kaempferol-3-O-alpha-L-rhamnopyranoside (5), (3S, 5R, 6R, 7E, 9R)-3, 5, 6, 9-tetrahydroxy-7-megastigmane (6), benzyl-O-alpha-L-rhamnopyranosyl-(1 --> 6)-beta-D-glucopyranoside (7), p-hydroxyacetophenone (8), pyrogallic acid (9) and p-hydroxyphenol (10). Compound 1 is a new compound. Compounds 2-10 were isolated from this plant for the first time.

  3. [Chemical constituents of Datura stramonium seeds].

    Science.gov (United States)

    Li, Jianwen; Lin, Binbin; Wang, Guokai; Gao, Hongjie; Qin, Minjian

    2012-02-01

    To study chemical constituents in the seeds of Datura Stramonium (Solanaceae family). Compounds were isolated and purified by silica gel, MCI and Sephadex LH-20 column chromatography, and their structures were determined based on physicochemical constants and spectroscopic analysis including NMR and MS. Twelve compounds were isolated and identified from Datura stramonium, they were N-trans-feruloyl tryptamine (1), hyoscyamilactol (2), scopoletin (3), umckalin (4), daturaolone (5), daturadiol (6), N-trans-ferulicacyl- tyramine (7), cleomiscosin A (8), fraxetin (9), scopolamine (10), 1-Acetyl-7-hydrox-beta-carbol-ine (11), 7-hydroxy-beta-carbolinel-propionic acid (12). Compound 2, 7, 9 and 12 were obtained from Datura genus for the first time, whereas compound 1, 4, 8 and 11 were obtained from the Solanaceae family for the first time.

  4. Chemical Constituents of Caesalpinia decapetala (Roth Alston

    Directory of Open Access Journals (Sweden)

    Song Yang

    2013-01-01

    Full Text Available The current study targets the chemical constituents of Caesalpinia decapetala (Roth Alston and investigates the bioactivities of the isolated compounds. Fourteen known compounds were isolated using column chromatography, and structural identification was performed by physical and spectral analyses. The biological activities of the compounds were also evaluated by 3-(4,5-dimethythiazol-2-yl-2,5-diphenyl tetrazolium bromide (MTT and 2,2-diphenlyl-1-picrylhydrazyl (DPPH assays. Emodin (6, baicalein (9, and apigenin (12 displayed antitumor activities against the MGC-803 cell line, while quercetin (2, rutin (5, baicalein (9, and epicatechin (13 showed stronger DPPH scavenging activities compared with ascorbic acid. Andrographolide (1, quercetin (2, bergenin (4, rutin (5, emodin (6, betulin (7, baicalein (9, polydatin (10, salicin (11, and apigenin (12, were obtained from C. decapetala (Roth Alston for the first time.

  5. Constituent gluons and the static quark potential

    Energy Technology Data Exchange (ETDEWEB)

    Greensite, Jeff [San Francisco State Univ., CA (United States); Szczepaniak, Adam P. [Indiana Univ., Bloomington, IN (United States); Thomas Jefferson National Accelerator Facility (TJNAF), Newport News, VA (United States)

    2016-04-01

    We suggest that Hamiltonian matrix elements between physical states in QCD might be approximated, in Coulomb gauge, by "lattice-improved" tree diagrams; i.e. tree diagram contributions with dressed ghost, transverse gluon, and Coulomb propagators obtained from lattice simulations. Such matrix elements can be applied to a variational treatment of hadronic states which include constituent gluons. As an illustration and first application of this hybrid approach, we derive a variational estimate of the heavy quark potential for distances up to 2.5 fm. The Coulomb string tension in SU(3) gauge theory is about a factor of four times greater than the asymptotic string tension. In our variational approach, using for simplicity a single variational parameter, we can reduce this overshoot by nearly the factor required. The building blocks of our approach are Coulomb gauge propagators, and in this connection we present new lattice results for the ghost and transverse gluon propagators in position space.

  6. Applications of Constituent Data Assimilation Systems

    Science.gov (United States)

    Rood, Richard B.; Stajner, Ivanka

    1999-01-01

    Organizations in Europe, Australia, and the United States have recently broadened constituent assimilation activities beyond that water vapor, which has been assimilated for years in the numerical weather prediction community. Many of these activities have focused on ozone, with some efforts focused on the entire suite of reactive constituents that control the ozone distribution. This talk will draw from results from the near real-time ozone data assimilation system being run by NASA's Data Assimilation Office. This system utilizes ozone observations from both the TOMS and the SBUV instrument to generate global synoptic maps of ozone. The initial application of this product is to provide ozone fields to assist in the atmospheric corrections' that are necessary for the retrieval of information from other NASA instruments. The validation of the ozone assimilation system shows that the assimilated product agrees well with independent HALOE and ozonesonde observations. This suggests that the product is of sufficient quality to be extended to other applications. This talk will enumerate these other applications and present initial results from exploratory research. The applications being considered include estimates of tropospheric ozone, provision of ozone fields for interactive retrievals, use of analysis increments from the assimilation to evaluate model performance, and development of long-term consistent three-dimensional global ozone fields. The results from the exploratory studies are promising, and help demonstrate how assumptions made in the p development of the ozone assimilation impact the other applications. For instance, RMS errors in the current product are large near the tropopause, which is sensitive to the specification of vertical correlation functions, which in turns impacts the amount of ozone analyzed to be in the troposphere. How these sensitivities impact the different applications will also be discussed.

  7. Transport of Manure Constituents in Runoff

    Science.gov (United States)

    Shelton, D.; Guber, A.; Sadeghi, A. M.; Sikora, L. M.; Nemes, A.; Pachepsky, Y. A.

    2005-12-01

    Fecal coliforms (FC) are often used as indicators of pathogenic bacteria contamination of surface water from surface-applied manure. Manure constituents other than FC may serve as natural tracers of bacterial contamination provided the rates of release from manure and surface transport mechanisms are similar. The objective of this work was to compare fecal coliforms (FC), organic carbon (OC), and water-soluble phosphorus (P) transport from dissolving manure applied on hillslopes with different soil texture and surface cover conditions under simulated rainfall. Two-by-six meters runoff plots were set in triplicate on vegetated and bare 20% slopes with sandy loam and clay loam soils at the ARS Beltsville Agricultural Research Center. Fresh bovine manure was applied at the top 30-cm wide strip, and at 50 cm x 30 cm miniplots in the immediate vicinity of runoff plots. Rainfall (ca. 6 cm per hour) was simulated for 1 hour on bare plots and for 1.5 hours on vegetated plots. Runoff was collected from gutters at the edge of runoff plots and miniplots at five-min intervals. In general, the volume of runoff was less from vegetated plots than from bare plots, and was less from sandy loam plots than from clay loam plots. Partitioning of fecal coliforms between runoff and suspended sediment was quantified using the partitioning coefficient Kd. The Kd values were greater for the sandy loam plot than the clay loam soil. The value of the partitioning coefficient increased from spring to fall at all plots. Release kinetics of FC and soluble P were similar. The fast release stage of about 20 minutes was followed by aa relatively slow release stage. Both soil texture and vegetation significantly affected transport of the manure constituents. More than 70% of manure FC and OC were transported with runoff over bare plots, and less than 15% over vegetation plots. Overall, manure-borne P appears to be a promising potential tracer for assessing of manure-borne bacteria transport.

  8. Scheduling for dual-hop block-fading channels with two source-user pairs sharing one relay

    KAUST Repository

    Zafar, Ammar

    2013-09-01

    In this paper, we maximize the achievable rate region of a dual-hop network with two sources serving two users independently through a single shared relay. We formulate the problem as maximizing the sum of the weighted long term average throughputs of the two users under stability constraints on the long term throughputs of the source-user pairs. In order to solve the problem, we propose a joint user-and-hop scheduling scheme, which schedules the first or second hop opportunistically based on instantaneous channel state information, in order to exploit multiuser diversity and multihop diversity gains. Numerical results show that the proposed joint scheduling scheme enhances the achievable rate region as compared to a scheme that employs multi-user scheduling on the second-hop alone. Copyright © 2013 by the Institute of Electrical and Electronic Engineers, Inc.

  9. Siim Nestor soovitab : Noor, värske ja psühhedeelne hip-hop / Siim Nestor

    Index Scriptorium Estoniae

    Nestor, Siim, 1974-

    2002-01-01

    Keskkooli-noorte hip-hop-kollektiiv BAP presenteerib oma vastilmunud albumit "Who Am I?" 28. veebr. Tallinna Kunstigümnaasiumis, kaastegev äsja albumi "Tabamata Ime" ilmutanud ansambel Luarvik-Luarvik

  10. The phenolic content and antioxidant activity of the aqueous and hydroalcoholic extracts of hops and their pellets

    National Research Council Canada - National Science Library

    Kowalczyk, Dariusz; Świeca, Michał; Cichocka, Joanna; Gawlik‐Dziki, Urszula

    2013-01-01

    The goal of this study was to investigate how three commonly used systems (water, 50% methanol and 50% ethanol) affected the yields of phenolic substances and the antioxidant capacity of extracts prepared from hops...

  11. The effect of inter-strand hopping term on charge transport properties of an aperiodic DNA molecule

    Science.gov (United States)

    Rahman, R.; Yudiarsah, E.

    2017-07-01

    The effect of inter-strand hopping on charge transport process in an aperiodic DNA molecule has been studied using a tight-binding Hamiltonian model. In this study, a double stranded aperiodic DNA molecule with sequence GCTAGTACGTGACGTAGCTAGGATATGCCTGA in one strand and its complement strand is used. The molecule is connected to an electrode on both ends. In the model, inter-base electron hopping is taken into account and represented by the inter-strand hopping parameter. The charge transport properties are studied from calculating transmission probability and I-V characteristics. Transfer matrix and scattering matrix methods are simultaneously used in computing transmission probability. The transmission probability is used in calculating the I-V characteristics using Launder-Büttiker formula. The result shows that change in inter-strand hopping term changes transmission probability, which changes I-V characteristics. The effect is clearer at high voltage and high temperature.

  12. An amino acid substitution in the Drosophila hopTum-l Jak kinase causes leukemia-like hematopoietic defects.

    Science.gov (United States)

    Luo, H; Hanratty, W P; Dearolf, C R

    1995-01-01

    Proteins of the Jak family of non-receptor kinases play important roles in mammalian hematopoietic signal transduction. They mediate the cellular response to a wide range of cytokines and growth factors. A dominant mutation in a Drosophila Jak kinase, hopscotchTumorous-lethal (hopTum-l), causes hematopoietic defects. Here we conduct a molecular analysis of hopTum-l. We demonstrate that the hopTum-l hematopoietic phenotype is caused by a single amino acid substitution of glycine to glutamic acid at residue 341. We generate a true revertant of the hopTum-l mutation, in which both the molecular lesion and the mutant hematopoietic phenotype revert back to wild type. We also examine the effects of the G341E substitution in transgenic flies. The results indicate that a mutant Jak kinase can cause leukemia-like abnormalities. Images PMID:7729418

  13. Hopping conduction mechanism of Pr1-xNdxMnO3 (x=0.3,0.5,0.7)

    Science.gov (United States)

    Biswas, Sanjay; Pal, Sudipta

    2017-05-01

    The temperature dependences of DC electrical resistivity (ρ) of Pr1-xNdxMnO3 (x=0.3, 0.5, 0.7) have been studied in the temperature range from 115K up to 390 K. The samples were prepared by solid state reaction method. In the measured temperature range the resistivity decreases with increasing temperature for all the samples, indicating semiconductor-like behaviour. In the high temperature region, the electrical conduction follows small polaron hopping (SPH) mechanism showing exponential variation of resistivity with temperature. The activation energy decreases with Nd concentration. The low temperature resistivity data follows Mott's ln(ρT -1/2) ˜ T -1/4 law of VRH conduction mechanism. The estimated values of hopping distances (R) and hopping energies (W) of the samples start to decrease with increasing Nd concentrations. The effect of rare earth site doping on the hopping mechanism have been discussed.

  14. Elevated Knee Joint Kinetics and Reduced Ankle Kinetics Are Present During Jogging and Hopping After Achilles Tendon Ruptures.

    Science.gov (United States)

    Willy, Richard W; Brorsson, Annelie; Powell, Hayley C; Willson, John D; Tranberg, Roy; Grävare Silbernagel, Karin

    2017-04-01

    Deficits in plantarflexor function are common after an Achilles tendon rupture. These deficits may result in an altered distribution of joint loads during lower extremity tasks. We hypothesized that, regardless of treatment, the Achilles tendon-ruptured limb would exhibit deficits in ankle kinematics and joint power while exhibiting elevated knee joint power and patellofemoral joint loads during walking, jogging, and hopping. We further hypothesized that this loading pattern would be most evident during jogging and hopping. Controlled laboratory study. Thirty-four participants (17 participants treated surgically, 17 treated nonsurgically) were tested at a mean 6.1 ± 2.0 years after an Achilles tendon rupture. Lower extremity kinematics and kinetics were assessed while participants completed walking, jogging, and single-legged hopping trials. Patellofemoral joint stress was calculated via a musculoskeletal model. Data were analyzed via mixed-model repeated analyses of variance (α = .05) and the limb symmetry index (LSI). No differences ( P ≥ .05) were found between the surgical and nonsurgical groups. In both groups, large side-to-side deficits in the plantarflexion angle at toeoff (LSI: 53.5%-73.9%) were noted during walking, jogging, and hopping in the involved limb. Side-to-side deficits in the angular velocity were only present during jogging (LSI: 93.5%) and hopping (LSI: 92.5%). This pattern was accompanied by large deficits in eccentric (LSI: 80.8%-94.7%) and concentric (LSI: 82.2%-84.7%) ankle joint powers in the involved limb during all tasks. Interestingly, only jogging and hopping demonstrated greater knee joint loads when compared with the uninvolved limb. Concentric knee power was greater during jogging (LSI: 117.2%) and hopping (LSI: 115.9%) compared with the uninvolved limb. Similarly, peak patellofemoral joint stress was greater in the involved limb during jogging (LSI: 107.5%) and hopping (LSI: 107.1%), while only hopping had a greater loading

  15. Sex attractant pheromone of damson-hop aphid Phorodon humuli (Homoptera, aphididae).

    Science.gov (United States)

    Campbell, C A; Dawson, G W; Griffiths, D C; Pettersson, J; Pickett, J A; Wadhams, L J; Woodcock, C M

    1990-12-01

    Behavioral studies using an olfactometer demonstrated that sexual females (oviparae) of the damson-hop aphid,Phorodon humuli, release a pheromone to which males respond. Volatiles produced by the oviparae were analyzed by coupled gas chromatography-single cell recording from the secondary rhinaria on the male antenna and showed the presence of one peak with major activity. Coupled gas chrornatography-mass spectrometry suggested a nepetalactol, which was shown to have the 4aR, 7S, 7aS stereochemistry by synthesis from the corresponding nepetalactone isolated from the labiate plantNepeta mussinii. Although the stereochemistry at carbon-1 is not yet established, a synthetic sample comprising ca. 70% 1S and 30% 1R attracted highly significant numbers of males to water traps placed within and adjacent to a hop garden. Initial studies also indicated attraction of males in both the olfactometer and in the field by volatiles from the primary host.

  16. Tailoring the photon hopping by nearest and next-nearest-neighbour interaction in photonic arrays

    CERN Document Server

    Caselli, Niccolò; La China, Federico; Gerardino, Annamaria; Li, Lianhe; Linfield, Edmund H; Pagliano, Francesco; Fiore, Andrea; Intonti, Francesca; Gurioli, Massimo

    2015-01-01

    Arrays of photonic cavities are relevant structures for developing large-scale photonic integrated circuits and for investigating basic quantum electrodynamics phenomena, due to the photon hopping between interacting nanoresonators. Here, we investigate, by means of scanning near-field spectroscopy, numerical calculations and an analytical model, the role of different neighboring interactions that give rise to delocalized supermodes in different photonic crystal array configurations. The systems under investigation consist of three nominally identical two-dimensional photonic crystal nanocavities on membrane aligned along the two symmetry axes of the triangular photonic crystal lattice. We find that the nearest and next-nearest-neighbour coupling terms can be of the same relevance. In this case, a non-intuitive picture describes the resonant modes, and the photon hopping between adjacent nano-resonators is strongly affected. Our findings prove that exotic configurations and even post-fabrication engineering o...

  17. Quantum simulation of Abelian lattice gauge theories via state-dependent hopping

    Science.gov (United States)

    Dehkharghani, A. S.; Rico, E.; Zinner, N. T.; Negretti, A.

    2017-10-01

    We develop a quantum simulator architecture that is suitable for the simulation of U(1 ) Abelian gauge theories such as quantum electrodynamics. Our approach relies on the ability to control the hopping of a particle through a barrier by means of the internal quantum states of a neutral or charged impurity particle sitting at the barrier. This scheme is experimentally feasible, as the correlated hopping does not require fine-tuning of the intra- and interspecies interactions. We investigate the applicability of the scheme in a double-well potential, which is the basic building block of the simulator, both at the single-particle and the many-body mean-field level. Moreover, we evaluate its performance for different particle interactions and trapping and, specifically for atom-ion systems, in the presence of micromotion.

  18. Dual-Hop VLC/RF Transmission System with Energy Harvesting Relay under Delay Constraint

    KAUST Repository

    Rakia, Tamer

    2017-02-09

    In this paper, we introduce a dual-hop visible light communication (VLC) / radio frequency (RF) transmission system to extend the coverage of indoor VLC systems. The relay between the two hops is able to harvest light energy from different artificial light sources and sunlight entering the room. The relay receives data packet over a VLC channel and uses the harvested energy to retransmit it to a mobile terminal over an RF channel. We develop a novel statistical model for the harvested electrical power and analyze the probability of data packet loss. We define a system design parameter (α ∈ [0, 1)) that controls the time dedicated for excess energy harvesting and data packet retransmission. It was found that the parameter has an optimal value which minimizes the packet loss probability. Further more, this optimal value is independent of the RF channel path loss. However, optimal showed inverse dependence on the packet size.

  19. Information guided channel hopping with an arbitrary number of transmit antennas

    KAUST Repository

    Yang, Yuli

    2012-10-01

    In order to realize the information guided channel hopping, also known as spatial modulation, with more design flexibility, in this paper we propose a novel scheme that allows operation with an arbitrary number of transmit antennas. Once the number of transmit antennas is not a power of two, the antennas\\' symbols are mapped by different numbers of bits. Subsequently, constellations with different orders are exploited for the modulation of radiated symbols so as to guarantee that the total number of bits transmitted at each time slot remains the same. Furthermore, we introduce a decoding algorithm with low complexity for this design. Numerical results on bit error rate performance are provided and substantiate that the proposed scheme turns out to be a promising alternative to the design of information guided channel hopping. © 2012 IEEE.

  20. Study of the one-dimensional Holstein model with next-nearest-neighbor hopping

    Energy Technology Data Exchange (ETDEWEB)

    Chakraborty, Monodeep; Das, A N [Theoretical Condensed Matter Physics Division, Saha Institute of Nuclear Physics, 1/AF Bidhannagar, Kolkata 700 064 (India); Chakrabarti, Atisdipankar [RKMVC College, Rahara, 24 Parganas (North), West Bengal (India)

    2011-01-19

    We present the effect of next-nearest-neighbor hopping on Holstein polarons. The energy and wavefunction of the ground state and first excited state are obtained by using a conjugate-gradient technique on the variational Hilbert space of the electron-phonon (e-ph) system. We increase the size of the variational space systematically to obtain high accuracy. With the converged wavefunction at our disposal we obtain various physical quantities and correlation functions to get a holistic insight into the physics of e-ph interaction. Our study reveals that the effect of next-nearest-neighbor hopping is most prominent at the physically interesting crossover regime of the e-ph coupling and in the adiabatic regime. We have also performed analytical strong coupling second order perturbation with a Lang-Firsov (LF) phonon basis to account for some features in the strong coupling regime.

  1. Outage probability of dual-hop FSO fixed gain relay transmission systems

    KAUST Repository

    Zedini, Emna

    2016-12-24

    In this paper, we analyze the end-to-end performance of dual-hop free-space optical (FSO) fixed gain relaying systems in the presence of atmospheric turbulence as well as pointing errors. More specifically, an exact closed-form expression for the outage probability is presented in terms of the bivariate Fox\\'s H function that accounts for both heterodyne detection as well as intensity modulation with direct detection. At high signal-to-noise ratio (SNR) regime, we provide very tight asymptotic result for this performance metric in terms of simple elementary functions. By using dual-hop FSO relaying, we demonstrate a better system performance as compared to the single FSO link. Numerical and Monte-Carlo simulation results are provided to verify the accuracy of the newly proposed results, and a perfect agreement is observed.

  2. Direct experimental measurement of single-mode and mode-hopping dynamics in frequency swept lasers.

    Science.gov (United States)

    Butler, T P; Goulding, D; Kelleher, B; O'Shaughnessy, B; Slepneva, S; Hegarty, S P; Huyet, G

    2017-10-30

    A time-resolved study is presented of the single-mode and mode-switching dynamics observed in swept source vertical cavity surfing emitting lasers and swept wavelength short external cavity lasers. A self-delayed interferometric technique is used to experimentally measure the phase and intensity of these frequency swept lasers, allowing direct examination of the modal dynamics. Visualisation of the instantaneous optical spectrum reveals mode-hop free single mode lasing in the case of the vertical cavity laser, with a tuning rate of 6.3 GHz/ns. More complex mode-switching behaviour occurs in the external cavity laser, with the mode-hopping dynamics found to be dominated by the deterministic movement of the spectral filter. Evidence of transient multi-mode operation and mode-pulling is also presented.

  3. Simultaneous Deep Tunneling and Classical Hopping for Hydrogen Diffusion on Metals

    Science.gov (United States)

    Fang, Wei; Richardson, Jeremy O.; Chen, Ji; Li, Xin-Zheng; Michaelides, Angelos

    2017-09-01

    Hydrogen diffusion on metals exhibits rich quantum behavior, which is not yet fully understood. Using simulations, we show that many hydrogen diffusion barriers can be categorized into those with parabolic tops and those with broad tops. With parabolic-top barriers, hydrogen diffusion evolves gradually from classical hopping, to shallow tunneling, to deep tunneling as the temperature (T ) decreases, and noticeable quantum effects persist at moderate T . In contrast, with broad-top barriers quantum effects become important only at low T and the classical-to-quantum transition is sharp, at which classical hopping and deep tunneling both occur. This coexistence indicates that more than one mechanism contributes to the quantum reaction rate. The conventional definition of the classical-to-quantum crossover T is invalid for the broad tops, and we give a new definition. Extending this, we propose a model to predict the transition T for broad-top diffusion, providing a general guide for theory and experiment.

  4. Electrical and thermoelectric transport by variable range hopping in reduced graphene oxide

    Science.gov (United States)

    Park, Min; Hong, Sung Ju; Kim, Kyung Ho; Kang, Hojin; Lee, Minwoo; Jeong, Dae Hong; Park, Yung Woo; Kim, Byung Hoon

    2017-10-01

    This study investigated the transport properties of single-layer reduced graphene oxides (rGOs). The rGOs were prepared by the bubble deposition method followed by thermal reduction. The crossover of the transport mechanism from Efros-Shklovskii (ES) variable range hopping (VRH) between the localized states to Mott-VRH was observed near 70 K using the temperature-dependent conductance. The ES-VRH conduction below 70 K is apparent in the electric field dependence of the field-driven hopping transport in the high-electric field regime. We also figure out that the thermoelectric power is consistent with the 2D Mott VRH above 70 K. We argue that the VRH conduction results from the topological disorders of rGO as confirmed by Raman spectroscopy. This infers that the average distance between defects is approximately 2.0 nm.

  5. A Low-Cost Time-Hopping Impulse Radio System for High Data Rate Transmission

    Directory of Open Access Journals (Sweden)

    Jinyun Zhang

    2005-03-01

    Full Text Available We present an efficient, low-cost implementation of time-hopping impulse radio that fulfills the spectral mask mandated by the FCC and is suitable for high-data-rate, short-range communications. Key features are (i all-baseband implementation that obviates the need for passband components, (ii symbol-rate (not chip rate sampling, A/D conversion, and digital signal processing, (iii fast acquisition due to novel search algorithms, and (iv spectral shaping that can be adapted to accommodate different spectrum regulations and interference environments. Computer simulations show that this system can provide 110 Mbps at 7–10 m distance, as well as higher data rates at shorter distances under FCC emissions limits. Due to the spreading concept of time-hopping impulse radio, the system can sustain multiple simultaneous users, and can suppress narrowband interference effectively.

  6. Radio resource management scheme and outage analysis for network-assisted multi-hop D2D communications

    Directory of Open Access Journals (Sweden)

    Leila Melki

    2016-11-01

    Full Text Available In a cellular network it's very difficult to make spectrum resource more efficiently. Device-to-Device (D2D technology enables new service opportunities, and provides high throughput and reliable communication while reducing the base station load. For better total performance, short-range D2D links and cellular links share the same radio resource and the management of interference becomes a crucial task. Here we argue that single-hop D2D technology can be used to further improve cellular networks performance if the key D2D radio resource management algorithms are suitably extended to support multi-hop D2D communications. Aiming to establish a new paradigm for the analysis and design of multi-hop D2D communications, We propose a radio resource allocation for multi-hop D2D routes based on interference avoidance approach in LTE-A networks. On top of that, we investigate the outage probability of D2D communication. We first introduce a new definition of outage probability by considering the maximum distance to be allowable for single-hop transmission. Then we study and analyze the outage performance of a multi-hop D2D route. We derive the general closed form expression of outage probability of the multi-hop D2D routes. The results demonstrate that the D2D radio, sharing the same resources as the cellular network, provide higher capacity compared to pure cellular communication where all the data is transmitted through the base station. They also demonstrate that the new method of calculation of D2D multi hop outage probability has better performance than classical method defined in the literature.

  7. Musculoskeletal modelling deconstructs the paradoxical effects of elastic ankle exoskeletons on plantar-flexor mechanics and energetics during hopping

    OpenAIRE

    Farris, Dominic James; Hicks, Jennifer L.; Delp, Scott L.; Sawicki, Gregory S.

    2014-01-01

    Experiments have shown that elastic ankle exoskeletons can be used to reduce ankle joint and plantar-flexor muscle loading when hopping in place and, in turn, reduce metabolic energy consumption. However, recent experimental work has shown that such exoskeletons cause less favourable soleus (SO) muscle–tendon mechanics than is observed during normal hopping, which might limit the capacity of the exoskeleton to reduce energy consumption. To directly link plantar-flexor mechanics and energy con...

  8. The HOPS/Class C Vps Complex Tethers High-Curvature Membranes via a Direct Protein-Membrane Interaction.

    Science.gov (United States)

    Ho, Ruoya; Stroupe, Christopher

    2016-10-01

    Membrane tethering is a physical association of two membranes before their fusion. Many membrane tethering factors have been identified, but the interactions that mediate inter-membrane associations remain largely a matter of conjecture. Previously, we reported that the homotypic fusion and protein sorting/Class C vacuolar protein sorting (HOPS/Class C Vps) complex, which has two binding sites for the yeast vacuolar Rab GTPase Ypt7p, can tether two low-curvature liposomes when both membranes bear Ypt7p. Here, we show that HOPS tethers highly curved liposomes to Ypt7p-bearing low-curvature liposomes even when the high-curvature liposomes are protein-free. Phosphorylation of the curvature-sensing amphipathic lipid-packing sensor (ALPS) motif from the Vps41p HOPS subunit abrogates tethering of high-curvature liposomes. A HOPS complex without its Vps39p subunit, which contains one of the Ypt7p binding sites in HOPS, lacks tethering activity, though it binds high-curvature liposomes and Ypt7p-bearing low-curvature liposomes. Thus, HOPS tethers highly curved membranes via a direct protein-membrane interaction. Such high-curvature membranes are found at the sites of vacuole tethering and fusion. There, vacuole membranes bend sharply, generating large areas of vacuole-vacuole contact. We propose that HOPS localizes via the Vps41p ALPS motif to these high-curvature regions. There, HOPS binds via Vps39p to Ypt7p in an apposed vacuole membrane. © 2016 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.

  9. I carried my sorrow songs : the expression of dissent and social protest in the blues and hip hop

    OpenAIRE

    Hansen, Jeanette

    2007-01-01

    This thesis sets out to explore the expression of dissent and social protest in African American music, namely blues and hip hop. My argument is that African American music, and these two genres in particular, has been an important forum for the African American community to express their discontent regarding their situation and treatment in the United States. There is a continuation in black music to make social commentary, and blues and hip hop has the richest subtext in relation to this to...

  10. Analysis of the components of hard resin in hops (Humulus lupulus L.) and structural elucidation of their transformation products formed during the brewing process.

    Science.gov (United States)

    Taniguchi, Yoshimasa; Taniguchi, Harumi; Yamada, Makiko; Matsukura, Yasuko; Koizumi, Hideki; Furihata, Kazuo; Shindo, Kazutoshi

    2014-11-26

    The resins from hops (Humulus lupulus L.), which add the bitter taste to beer, are classified into two main sub-fractions, namely, soft and hard resins. α- and β-Acids in soft resin and their transformation during the wort boiling process are well-studied; however, other constituents in resins, especially hard resin, have been unidentified. In this study, we identified humulinones and hulupones as soft-resin components, in addition to 4'-hydroxyallohumulinones and tricyclooxyisohumulones A and B as hard-resin components. These compounds are all oxidation products derived from α- or β-acids. We also investigated compositional changes in the hard resin during the wort boiling process, which has a significant effect on the taste of the beer, by using model boiling experiments. The major changes were identified to be isomerization of 4'-hydroxyallohumulinones into 4'-hydroxyallo-cis-humulinones, followed by decomposition into cis-oxyhumulinic acids. These findings will be helpful in systematically evaluating and optimizing the effect of the hard resin on beer quality.

  11. Unified description for hopping transport in organic semiconductors including both energetic disorder and polaronic contributions

    OpenAIRE

    Fishchuk, I. I; Kadashchuk, Andriy; Hoffmann, S. T.; Athanasopoulos, S.; Genoe, Jan; Bässler, H.; Köhler, A.

    2013-01-01

    We developed an analytical model to describe hopping transport in organic semiconductors including both energetic disorder and polaronic contributions due to geometric relaxation. The model is based on a Marcus jump rate in terms of the small-polaron concept with a Gaussian energetic disorder, and it is premised upon a generalized effective medium approach yet avoids shortcomings involved in the effective transport energy or percolation concepts. It is superior to our previous treatment [ Phy...

  12. Improving Data Dissemination in Multi-Hop Cognitive Radio Ad-Hoc Networks

    OpenAIRE

    Rehmani, Mubashir Husain; Carneiro Viana, Aline; Khalife, Hicham; Fdida, Serge

    2011-01-01

    International audience; In this paper, we present SURF, a distributed channel selection strategy for efficient data dissemination in multi-hop cognitive radio ad-hoc networks (CRNs). SURF classifies the available channels on the basis of primary radio unoccupancy and the number of cognitive radio neighbors using the channels. Through extensive NS-2 simulations, we compare the performance of SURF with three related approaches. Simulation results confirm that SURF is effective in selecting the ...

  13. Influence of the modulated hopping on the one-dimensional interacting electron system

    Science.gov (United States)

    Ding, Hanqin; Zhang, Jun

    2015-10-01

    By introducing a modulation parameter (ξ), we study the one-dimensional correlated system with modulated hopping, on-site (U) and nearest-neighbor (V) repulsions in the weak-coupling regime. The induced three-body attraction changes topology of the conventional phase diagram. Besides the usual CDW and SDW phases, a BSDW phase exists for | U - 2 V | √{ πU / 8 t }. Phenomenologically, the general quantum phase diagram including insulating and superconducting phases is discussed.

  14. Jointly Optimal Design for MIMO Radar Frequency-Hopping Waveforms Using Game Theory

    Science.gov (United States)

    2016-04-01

    Jointly Optimal Design for MIMO Radar Frequency-Hopping Waveforms Using Game Theory KEYONG HAN, Student Member, IEEE ARYE NEHORAI, Fellow, IEEE...matrices that result in improved performance over that of separate designs. We propose a game theory framework for the joint design. First, we present...badly when the function evaluation is expensive. In recent years, game theory has been used to solve multiobjective design problems, especially for

  15. Locomotion in extinct giant kangaroos: were sthenurines hop-less monsters?

    Directory of Open Access Journals (Sweden)

    Christine M Janis

    Full Text Available Sthenurine kangaroos (Marsupialia, Diprotodontia, Macropodoidea were an extinct subfamily within the family Macropodidae (kangaroos and rat-kangaroos. These "short-faced browsers" first appeared in the middle Miocene, and radiated in the Plio-Pleistocene into a diversity of mostly large-bodied forms, more robust than extant forms in their build. The largest (Procoptodon goliah had an estimated body mass of 240 kg, almost three times the size of the largest living kangaroos, and there is speculation whether a kangaroo of this size would be biomechanically capable of hopping locomotion. Previously described aspects of sthenurine anatomy (specialized forelimbs, rigid lumbar spine would limit their ability to perform the characteristic kangaroo pentapedal walking (using the tail as a fifth limb, an essential gait at slower speeds as slow hopping is energetically unfeasible. Analysis of limb bone measurements of sthenurines in comparison with extant macropodoids shows a number of anatomical differences, especially in the large species. The scaling of long bone robusticity indicates that sthenurines are following the "normal" allometric trend for macropodoids, while the large extant kangaroos are relatively gracile. Other morphological differences are indicative of adaptations for a novel type of locomotor behavior in sthenurines: they lacked many specialized features for rapid hopping, and they also had anatomy indicative of supporting their body with an upright trunk (e.g., dorsally tipped ischiae, and of supporting their weight on one leg at a time (e.g., larger hips and knees, stabilized ankle joint. We propose that sthenurines adopted a bipedal striding gait (a gait occasionally observed in extant tree-kangaroos: in the smaller and earlier forms, this gait may have been employed as an alternative to pentapedal locomotion at slower speeds, while in the larger Pleistocene forms this gait may have enabled them to evolve to body sizes where hopping

  16. Effect of green manure on the incidence of cyanogenic Pseudomonas strains in hop garden soils.

    Science.gov (United States)

    Paszkowski, Wojciech L; Dwornikiewicz, Jerzy

    2003-05-01

    Incidence of cyanogenic Pseudomonas strains in hop garden soils in relation to the kind of fertilization was studied. Incidence differed with respect to the fertilization treatment and the age of the plantation. Amendment of soil with rye and with white mustard as green manures limited the number of cyanogenic Pseudomonas strains relative to farmyard manures and NPK fertilization. Among all fertilization treatments, cyanogenic Pseudomonas spp. strains had lowest populations in soils amended with white mustard.

  17. Role of plasmids in Lactobacillus brevis BSO 464 hop tolerance and beer spoilage.

    Science.gov (United States)

    Bergsveinson, Jordyn; Baecker, Nina; Pittet, Vanessa; Ziola, Barry

    2015-02-01

    Specific isolates of lactic acid bacteria (LAB) can grow in the harsh beer environment, thus posing a threat to brew quality and the economic success of breweries worldwide. Plasmid-localized genes, such as horA, horC, and hitA, have been suggested to confer hop tolerance, a trait required for LAB survival in beer. The presence and expression of these genes among LAB, however, do not universally correlate with the ability to grow in beer. Genome sequencing of the virulent beer spoilage organism Lactobacillus brevis BSO 464 revealed the presence of eight plasmids, with plasmids 1, 2, and 3 containing horA, horC, and hitA, respectively. To investigate the roles that these and the other five plasmids play in L. brevis BSO 464 growth in beer, plasmid curing with novobiocin was used to derive 10 plasmid variants. Multiplex PCRs were utilized to determine the presence or absence of each plasmid, and how plasmid loss affected hop tolerance and growth in degassed (noncarbonated) beer was assessed. Loss of three of the eight plasmids was found to affect hop tolerance and growth in beer. Loss of plasmid 2 (horC and 28 other genes) had the most dramatic effect, with loss of plasmid 4 (120 genes) and plasmid 8 (47 genes) having significant, but smaller, impacts. These results support the contention that genes on mobile genetic elements are essential for bacterial growth in beer and that beer spoilage ability is not dependent solely on the three previously described hop tolerance genes or on the chromosome of a beer spoilage LAB isolate.

  18. The Hard Cashless Society: Millennial Economics and Street Hop in Johannesburg

    OpenAIRE

    Cole Kai-Lewis, Abimbola Naomi

    2016-01-01

    ABSTRACT OF THE DISSERTATIONThe Hard Cashless Society: Millennial Economics and Street Hop in JohannesburgbyAbimbola Cole Kai-LewisDoctor of Philosophy in EthnomusicologyUniversity of California, Los Angeles, 2016Professor Jacqueline Cogdell DjeDje, Co-ChairProfessor Cheryl L. Keyes, Co-ChairThe concept of the cashless society emerged in the nineteenth century through the writings of author Edward Bellamy. In his work, Looking Backward: 2000-1887 (1888), Bellamy described the implementation o...

  19. Locomotion in extinct giant kangaroos: were sthenurines hop-less monsters?

    Science.gov (United States)

    Janis, Christine M; Buttrill, Karalyn; Figueirido, Borja

    2014-01-01

    Sthenurine kangaroos (Marsupialia, Diprotodontia, Macropodoidea) were an extinct subfamily within the family Macropodidae (kangaroos and rat-kangaroos). These "short-faced browsers" first appeared in the middle Miocene, and radiated in the Plio-Pleistocene into a diversity of mostly large-bodied forms, more robust than extant forms in their build. The largest (Procoptodon goliah) had an estimated body mass of 240 kg, almost three times the size of the largest living kangaroos, and there is speculation whether a kangaroo of this size would be biomechanically capable of hopping locomotion. Previously described aspects of sthenurine anatomy (specialized forelimbs, rigid lumbar spine) would limit their ability to perform the characteristic kangaroo pentapedal walking (using the tail as a fifth limb), an essential gait at slower speeds as slow hopping is energetically unfeasible. Analysis of limb bone measurements of sthenurines in comparison with extant macropodoids shows a number of anatomical differences, especially in the large species. The scaling of long bone robusticity indicates that sthenurines are following the "normal" allometric trend for macropodoids, while the large extant kangaroos are relatively gracile. Other morphological differences are indicative of adaptations for a novel type of locomotor behavior in sthenurines: they lacked many specialized features for rapid hopping, and they also had anatomy indicative of supporting their body with an upright trunk (e.g., dorsally tipped ischiae), and of supporting their weight on one leg at a time (e.g., larger hips and knees, stabilized ankle joint). We propose that sthenurines adopted a bipedal striding gait (a gait occasionally observed in extant tree-kangaroos): in the smaller and earlier forms, this gait may have been employed as an alternative to pentapedal locomotion at slower speeds, while in the larger Pleistocene forms this gait may have enabled them to evolve to body sizes where hopping was no longer

  20. Hip-hop solutions of the 2N-body problem

    Science.gov (United States)

    Barrabés, Esther; Cors, Josep Maria; Pinyol, Conxita; Soler, Jaume

    2006-05-01

    Hip-hop solutions of the 2N-body problem with equal masses are shown to exist using an analytic continuation argument. These solutions are close to planar regular 2N-gon relative equilibria with small vertical oscillations. For fixed N, an infinity of these solutions are three-dimensional choreographies, with all the bodies moving along the same closed curve in the inertial frame.

  1. Non-adiabatic dynamics around a conical intersection with surface-hopping coupled coherent states.

    Science.gov (United States)

    Humeniuk, Alexander; Mitrić, Roland

    2016-06-21

    A surface-hopping extension of the coupled coherent states-method [D. Shalashilin and M. Child, Chem. Phys. 304, 103-120 (2004)] for simulating non-adiabatic dynamics with quantum effects of the nuclei is put forward. The time-dependent Schrödinger equation for the motion of the nuclei is solved in a moving basis set. The basis set is guided by classical trajectories, which can hop stochastically between different electronic potential energy surfaces. The non-adiabatic transitions are modelled by a modified version of Tully's fewest switches algorithm. The trajectories consist of Gaussians in the phase space of the nuclei (coherent states) combined with amplitudes for an electronic wave function. The time-dependent matrix elements between different coherent states determine the amplitude of each trajectory in the total multistate wave function; the diagonal matrix elements determine the hopping probabilities and gradients. In this way, both interference effects and non-adiabatic transitions can be described in a very compact fashion, leading to the exact solution if convergence with respect to the number of trajectories is achieved and the potential energy surfaces are known globally. The method is tested on a 2D model for a conical intersection [A. Ferretti, J. Chem. Phys. 104, 5517 (1996)], where a nuclear wavepacket encircles the point of degeneracy between two potential energy surfaces and interferes with itself. These interference effects are absent in classical trajectory-based molecular dynamics but can be fully incorpo rated if trajectories are replaced by surface hopping coupled coherent states.

  2. Polarization switching and polarization mode hopping in quantum dot vertical-cavity surface-emitting lasers.

    Science.gov (United States)

    Olejniczak, Lukasz; Panajotov, Krassimir; Thienpont, Hugo; Sciamanna, Marc; Mutig, Alex; Hopfer, Friedhelm; Bimberg, Dieter

    2011-01-31

    We show experimentally that polarization mode hopping in quantum dot vertical cavity surface emitting lasers (VCSELs) takes place between nonorthogonal elliptically polarized modes. In contrast to quantum well VCSELs the average dwell time decreases with injection current. This decrease is by 8 orders of magnitude: from seconds to nanoseconds and is achieved without any modifications of the VCSEL internal anisotropies. The observed scaling happens in a range of currents as wide as 8 times the threshold value.

  3. Constituent Model of Extremal non-BPS Black Holes

    CERN Document Server

    Gimon, Eric; Simon, Joan

    2009-01-01

    We interpret extremal non-BPS black holes in four dimensions as threshold bound states of four 1/2-BPS constituents. We verify the no-force condition for each of the primitive constituents in the probe approximation. Our computations are for a seed solution with $\\overline{D0}-D4$ charges and equal $B$-fields, but symmetries extend the result to any U-dual frame. We make the constituent model for the $D0-D6$ system explicit, and also discuss a duality frame where the constituents are $D3$ branes at angles. We demonstrate stability of the constituent model in the weak coupling description of the constituent D-branes. We discuss the relation between the BPS and non-BPS branches of configuration space.

  4. Inhibition of Growth and Ammonia Production of Ruminal Hyper Ammonia-Producing Bacteria by Chinook or Galena Hops after Long-Term Storage

    Directory of Open Access Journals (Sweden)

    Michael D. Flythe

    2017-12-01

    Full Text Available Surplus hops (Humulus lupulus L. that are not needed by the brewing industry could be used as a feed supplement for cattle and other ruminants. Previous research indicates that antimicrobial hops plant secondary metabolites (i.e., α- and β-acids inhibit methane and ammonia production and promote the growth of ruminant animals. The goal was to determine that hop pellets produced for brewing still possessed the requisite antimicrobial activity after 5-year storage. HPLC (high performance liquid chromatography analysis indicated that the α- and β-acid concentrations in two varieties of hops were relatively stable after 5 years of storage under N2. Either hop variety inhibited the growth of the ruminal hyper ammonia-producing bacterium, Clostridium sticklandii SR, in broth culture and Petri plate bioassays. Either hop variety inhibited ammonia production from amino acids or peptides by mixed rumen microorganisms from Holstein steers. These results are similar to those previously obtained with fresh hops, hops extracts, other antimicrobial phytochemicals and typical feed ionophores, such as monensin. The rumen-active antimicrobial phytochemicals in hops can still be present and active after years under certain storage conditions. Further investigation is warranted to determine how surplus and older hops can be used to benefit ruminant nutrition and ruminant industries.

  5. Hop-distance relationship analysis with quasi-UDG model for node localization in wireless sensor networks

    Directory of Open Access Journals (Sweden)

    Chen Ping

    2011-01-01

    Full Text Available Abstract In wireless sensor networks (WSNs, location information plays an important role in many fundamental services which includes geographic routing, target tracking, location-based coverage, topology control, and others. One promising approach in sensor network localization is the determination of location based on hop counts. A critical priori of this approach that directly influences the accuracy of location estimation is the hop-distance relationship. However, most of the related works on the hop-distance relationship assume the unit-disk graph (UDG model that is unrealistic in a practical scenario. In this paper, we formulate the hop-distance relationship for quasi-UDG model in WSNs where sensor nodes are randomly and independently deployed in a circular region based on a Poisson point process. Different from the UDG model, quasi-UDG model has the non-uniformity property for connectivity. We derive an approximated recursive expression for the probability of the hop count with a given geographic distance. The border effect and dependence problem are also taken into consideration. Furthermore, we give the expressions describing the distribution of distance with known hop counts for inner nodes and those suffered from the border effect where we discover the insignificance of the border effect. The analytical results are validated by simulations showing the accuracy of the employed approximation. Besides, we demonstrate the localization application of the formulated relationship and show the accuracy improvement in the WSN localization.

  6. Technical strategy of triple jump: differences of inverted pendulum model between hop-dominated and balance techniques.

    Science.gov (United States)

    Fujibayashi, Nobuaki; Otsuka, Mitsuo; Yoshioka, Shinsuke; Isaka, Tadao

    2017-10-24

    The present study aims to cross-sectionally clarify the characteristics of the motions of an inverted pendulum model, a stance leg, a swing leg and arms in different triple-jumping techniques to understand whether or not hop displacement is relatively longer rather than step and jump displacements. Eighteen male athletes performed the triple jump with a full run-up. Based on the technique of the jumpers, they were classified as hop-dominated (n = 10) or balance (n = 8) jumpers. The kinematic data were calculated using motion capture and compared between the two techniques using the inverted pendulum model. The hop-dominated jumpers had a significantly longer hop displacement and faster vertical centre-of-mass (COM) velocity of their whole body at hop take-off, which was generated by faster rotation behaviours of inverted pendulum model and faster swinging behaviours of arms. Conversely, balance jumpers had a significantly longer jump displacement and faster horizontal COM velocity of their whole body at take-off, which was generated by a stiffer inverted pendulum model and stance leg. The results demonstrate that hop-dominated and balance jumpers enhanced each dominated-jump displacement using different swing- and stance-leg motions. This information may help to enhance the actual displacement of triple jumpers using different jumping techniques.

  7. Performance analysis of decode-and-forward dual-hop optical spatial modulation with diversity combiner over atmospheric turbulence

    Science.gov (United States)

    Odeyemi, Kehinde O.; Owolawi, Pius A.; Srivastava, Viranjay M.

    2017-11-01

    Dual-hops transmission is a growing interest technique that can be used to mitigate against atmospheric turbulence along the Free Space Optical (FSO) communication links. This paper analyzes the performance of Decode-and-Forward (DF) dual-hops FSO systems in-conjunction with spatial modulation and diversity combiners over a Gamma-Gamma atmospheric turbulence channel using heterodyne detection. Maximum Ratio Combiner (MRC), Equal Gain Combiner (EGC) and Selection Combiner (SC) are considered at the relay and destination as mitigation tools to improve the system error performance. Power series expansion of modified Bessel function is used to derive the closed form expression for the end-to-end Average Pairwise Error Probability (APEP) expressions for each of the combiners under study and a tight upper bound on the Average Bit Error Rate (ABER) per hop is given. Thus, the overall end-to-end ABER for the dual-hops FSO system is then evaluated. The numerical results depicted that dual-hops transmission systems outperformed the direct link systems. Moreover, the impact of having the same and different combiners at the relay and destination are also presented. The results also confirm that the combination of dual hops transmission with spatial modulation and diversity combiner significantly improves the systems error rate with the MRC combiner offering an optimal performance with respect to variation in atmospheric turbulence, change in links average received SNR and link range of the system.

  8. Dynamic Task Allocation in Multi-Hop Multimedia Wireless Sensor Networks with Low Mobility

    Directory of Open Access Journals (Sweden)

    Klaus Moessner

    2013-10-01

    Full Text Available This paper presents a task allocation-oriented framework to enable efficient in-network processing and cost-effective multi-hop resource sharing for dynamic multi-hop multimedia wireless sensor networks with low node mobility, e.g., pedestrian speeds. The proposed system incorporates a fast task reallocation algorithm to quickly recover from possible network service disruptions, such as node or link failures. An evolutional self-learning mechanism based on a genetic algorithm continuously adapts the system parameters in order to meet the desired application delay requirements, while also achieving a sufficiently long network lifetime. Since the algorithm runtime incurs considerable time delay while updating task assignments, we introduce an adaptive window size to limit the delay periods and ensure an up-to-date solution based on node mobility patterns and device processing capabilities. To the best of our knowledge, this is the first study that yields multi-objective task allocation in a mobile multi-hop wireless environment under dynamic conditions. Simulations are performed in various settings, and the results show considerable performance improvement in extending network lifetime compared to heuristic mechanisms. Furthermore, the proposed framework provides noticeable reduction in the frequency of missing application deadlines.

  9. Gold Digger or Video Girl: the salience of an emerging hip-hop sexual script.

    Science.gov (United States)

    Ross, Jasmine N; Coleman, Nicole M

    2011-02-01

    Concerns have been expressed in the common discourse and scholarly literature about the negative influence of Hip-Hop on its young listeners' ideas about sex and sexuality. Most of the scholarly literature has focused on the impact of this urban, Black media on young African American girls' sexual self-concept and behaviours. In response to this discourse, Stephens and Phillips (2003) proposed a Hip-Hop sexual scripting model that theorises about specific sexual scripts for young African American women. Their model includes eight different sexual scripts including the Gold Digger script. The present study proposes a ninth emerging script - the Video Girl. Participants were 18 female African American college students, between the ages of 18 and 30 years old from a large urban public university in the Southwest USA. Using q-methodology the present study found support for the existence of a Video Girl script. In addition, the data indicates that this script is distinct but closely related to Stephens and Phillips' Gold Digger script. These findings support their theory by suggesting that Hip-Hop sexual scripts are salient and hold real meaning for this sample.

  10. Dual-Hop FSO Transmission Systems over Gamma-Gamma Turbulence with Pointing Errors

    KAUST Repository

    Zedini, Emna

    2016-11-18

    In this paper, we analyze the end-to-end performance of dual-hop free-space optical (FSO) fixed gain relaying systems under heterodyne detection and intensity modulation with direct detection techniques in the presence of atmospheric turbulence as well as pointing errors. In particular, we derive the cumulative distribution function (CDF) of the end-to-end signal-to-noise ratio (SNR) in exact closed-form in terms of the bivariate Fox’s H function. Capitalizing on this CDF expression, novel closed-form expressions for the outage probability, the average bit-error rate (BER) for different modulation schemes, and the ergodic capacity of dual-hop FSO transmission systems are presented. Moreover, we present very tight asymptotic results for the outage probability and the average BER at high SNR regime in terms of simple elementary functions and we derive the diversity order of the considered system. By using dual-hop FSO relaying, we demonstrate a better system performance as compared to the single FSO link. Numerical and Monte-Carlo simulation results are provided to verify the accuracy of the newly proposed results, and a perfect agreement is observed.

  11. HapHop-Physio: a computer game to support cognitive therapies in children.

    Science.gov (United States)

    Rico-Olarte, Carolina; López, Diego M; Narváez, Santiago; Farinango, Charic D; Pharow, Peter S

    2017-01-01

    Care and support of children with physical or mental disabilities are accompanied with serious concerns for parents, families, healthcare institutions, schools, and their communities. Recent studies and technological innovations have demonstrated the feasibility of providing therapy and rehabilitation services to children supported by computer games. The aim of this paper is to present HapHop-Physio, an innovative computer game that combines exercise with fun and learning, developed to support cognitive therapies in children. Conventional software engineering methods such as the Scrum methodology, a functionality test and a related usability test, were part of the comprehensive methodology adapted to develop HapHop-Physio. The game supports visual and auditory attention therapies, as well as visual and auditory memory activities. The game was developed by a multidisciplinary team, which was based on the Hopscotch(®) platform provided by Fraunhofer Institute for Digital Media Technology IDMT Institute in Germany, and designed in collaboration with a rehabilitation clinic in Colombia. HapHop-Physio was tested and evaluated to probe its functionality and user satisfaction. The results show the development of an easy-to-use and funny game by a multidisciplinary team using state-of-the-art videogame technologies and software methodologies. Children testing the game concluded that they would like to play again while undergoing rehabilitation therapies.

  12. Hopping magnetoresistance in two-dimensional arrays of Ge/Si quantum dots

    Energy Technology Data Exchange (ETDEWEB)

    Yakimov, A.I.; Dvurechenskii, A.V.; Nikiforov, A.I.; Bloshkin, A.A. [Institute of Semiconductor Physics, 630090 Novosibirsk (Russian Federation); Minkov, G.M.; Sherstobitov, A.A. [Institute of Metal Physics, 620219 Ekaterinburg (Russian Federation); Stepina, N.P. [Institute of Semiconductor Physics, 630090 Novosibirsk (Russian Federation); Departamento de Fisica, Universidade de Aveiro, 3810-193 Aveiro (Portugal); Leitao, J.P.; Sobolev, N.A.; Pereira, L.; Carmo, M.C. do [Departamento de Fisica, Universidade de Aveiro, 3810-193 Aveiro (Portugal)

    2006-02-01

    The temperature and magnetic field dependences of the conductivity associated with hopping transport of holes over 2D arrays of Ge/Si quantum dots with various filling factors are studied experimentally. A transition from the Efros-Shklovskii law for the temperature dependence of hopping conductivity to the Arrhenius law with an activation energy equal to 1.0-1.2 meV is observed upon a decrease in temperature. The activation energy for the low-temperature conductivity increases with the magnetic field and attains saturation in fields exceeding 4 T. It is found that the magnetoresistance in layers of quantum dots is essentially anisotropic: the conductivity decreases in magnetic fields oriented perpendicular to a dot layer and increases in a field whose vector lies in the plane of the sample. The absolute values of magnetoresistance for transverse and longitudinal field orientations differ by two orders of magnitude. Effect of spin correlations on the hopping magnetoresistance is discussed. (copyright 2006 WILEY-VCH Verlag GmbH and Co. KGaA, Weinheim) (orig.)

  13. Switched diversity strategies for dual-hop amplify-and-forward relaying systems

    KAUST Repository

    Gaaloul, Fakhreddine

    2012-01-01

    This study investigates different receive single-branch switch-based diversity schemes for dual-hop amplify-and-forward relaying networks. Specifically, three receive processing algorithms are adopted, in which the receive branch is selected using the arbitrary selection algorithm, the switching algorithm, or the switching algorithm with post-examining best branch selection. The identification of the receive branch is carried out for two different system models. For the first model, a single-antenna relaying station is used in conjunction with a multiple-antenna transceiver, where the processing is performed independently of the first hop-fading conditions. The second model suggests the use of parallel deployment of single-antenna relays to transfer information from a multiple-antenna transmitter to a single-antenna receiver, where the active relaying station is determined based on the pre-combining end-to-end fading conditions. Performance comparisons for various transmission scenarios on the first hop are presented using new formulations for the statistics of the combined signal-to-noise ratio. Simulation results are also provided to validate the mathematical development and to verify the numerical computations. © 2012 The Institution of Engineering and Technology.

  14. Comparison of Low-Complexity Diversity Schemes for Dual-Hop AF Relaying Systems

    KAUST Repository

    Gaaloul, Fakhreddine

    2012-02-13

    This paper investigates the performance of two low-complexity combining schemes, which are based on one- or two-phase observation, to mitigate multipath fading in dual-hop amplify-and-forward relaying systems. For the one-phase-based combining, a single-antenna station is assumed to relay information from a multiple-antenna transmitter to a multiple-antenna receiver, and the activation of the receive antennas is adaptively performed based on the second-hop statistics, regardless of the first-hop conditions. On the other hand, the two-phase-based combining suggests using multiple single-antenna stations between the multiple-antenna transmitter and the single-antenna receiver, where the suitable set of active relays is identified according to the precombining end-to-end fading conditions. To facilitate comparisons between the two schemes, formulations for the statistics of the combined signal-to-noise ratio and some performance measures are presented. Numerical and simulation results are shown to clarify the tradeoff between the achieved diversity-array gain, the processing complexity, and the power consumption.

  15. Time-resolved Tomographic PIV Measurements of Water Flea Hopping: Body Size Comparison

    Science.gov (United States)

    Skipper, A. N.; Murphy, D. W.; Webster, D. R.; Yen, J.

    2014-11-01

    The flow field of the freshwater crustacean Daphnia magna is quantified with time-resolved tomographic PIV. In the current work, we compare body kinematics and flow disturbance between organisms of small (body length = 1.8 mm) versus medium (2.3 mm) versus large (2.65 mm) size. These plankters are equipped with a pair of antennae that are biramous such that the protopodite splits or branches into an exopodite and an endopodite. They beat the antennae pair synchronously to impulsively propel themselves, or `hop,' through the water. The stroke cycle of Daphnia magna is roughly 80 ms in duration and this period is evenly split between the power and recovery strokes. A typical hop carries the daphniid one body length forward and is followed by a period of sinking. Unlike copepod escape motion, no body vortex is observed in front of the animal. Rather, the flow induced by each antennae consists of a viscous vortex ring that demonstrates a slow decay. The time-record of velocity (peak of 40 mm/s for the medium specimen) and hop acceleration (1.8 m/s2 for the medium specimen) are compared, as well as the strength, size, and decay of the induced viscous vortex rings. The viscous vortex ring analysis will be presented in the context of a double Stokeslet model consisting of two impulsively applied point forces separated by the animal width.

  16. Achilles tendinopathy alters stretch shortening cycle behaviour during a sub-maximal hopping task.

    Science.gov (United States)

    Debenham, James R; Travers, Mervyn J; Gibson, William; Campbell, Amity; Allison, Garry T

    2016-01-01

    To describe stretch shortening cycle behaviour of the ankle and lower limb in patients with Achilles tendinopathy (AT) and establish differences with healthy volunteers. Between-subjects case-controlled. Fifteen patients with AT (mean age 41.2±12.7 years) and 11 healthy volunteers (CON) (mean age 23.2±6.7 years) performed sub-maximal single-limb hopping on a custom built sledge-jump system. Using 3D motion analysis and surface EMG, temporal kinematic (lower limb stiffness, ankle angle at 80ms pre-contact, ankle angle at contact, peak ankle angle, ankle stretch amplitude) and EMG measures (onset, offset and peak times relative to contact) were captured. Data between AT and CON were compared statistically using a linear mixed model. Patients with AT exhibited significantly increased lower limb stiffness when compared to healthy volunteers (pbehaviour during sub-maximal hopping when compared with healthy volunteers. Patients with AT hop with greater lower limb stiffness, in a greater degree of ankle dorsiflexion and have a greater stretch amplitude. Likewise, delayed muscle activity is evident. These findings have implications in terms of informing the understanding of the pathoaetiology and management of AT. Copyright © 2014 Sports Medicine Australia. Published by Elsevier Ltd. All rights reserved.

  17. A Study on Coexistence Capability Evaluations of the Enhanced Channel Hopping Mechanism in WBANs

    Science.gov (United States)

    Wei, Zhongcheng; Sun, Yongmei; Ji, Yuefeng

    2017-01-01

    As an important coexistence technology, channel hopping can reduce the interference among Wireless Body Area Networks (WBANs). However, it simultaneously brings some issues, such as energy waste, long latency and communication interruptions, etc. In this paper, we propose an enhanced channel hopping mechanism that allows multiple WBANs coexisted in the same channel. In order to evaluate the coexistence performance, some critical metrics are designed to reflect the possibility of channel conflict. Furthermore, by taking the queuing and non-queuing behaviors into consideration, we present a set of analysis approaches to evaluate the coexistence capability. On the one hand, we present both service-dependent and service-independent analysis models to estimate the number of coexisting WBANs. On the other hand, based on the uniform distribution assumption and the additive property of Possion-stream, we put forward two approximate methods to compute the number of occupied channels. Extensive simulation results demonstrate that our estimation approaches can provide an effective solution for coexistence capability estimation. Moreover, the enhanced channel hopping mechanism can significantly improve the coexistence capability and support a larger arrival rate of WBANs. PMID:28098818

  18. A Study on Coexistence Capability Evaluations of the Enhanced Channel Hopping Mechanism in WBANs.

    Science.gov (United States)

    Wei, Zhongcheng; Sun, Yongmei; Ji, Yuefeng

    2017-01-14

    As an important coexistence technology, channel hopping can reduce the interference among Wireless Body Area Networks (WBANs). However, it simultaneously brings some issues, such as energy waste, long latency and communication interruptions, etc. In this paper, we propose an enhanced channel hopping mechanism that allows multiple WBANs coexisted in the same channel. In order to evaluate the coexistence performance, some critical metrics are designed to reflect the possibility of channel conflict. Furthermore, by taking the queuing and non-queuing behaviors into consideration, we present a set of analysis approaches to evaluate the coexistence capability. On the one hand, we present both service-dependent and service-independent analysis models to estimate the number of coexisting WBANs. On the other hand, based on the uniform distribution assumption and the additive property of Possion-stream, we put forward two approximate methods to compute the number of occupied channels. Extensive simulation results demonstrate that our estimation approaches can provide an effective solution for coexistence capability estimation. Moreover, the enhanced channel hopping mechanism can significantly improve the coexistence capability and support a larger arrival rate of WBANs.

  19. Identification of Hop stunt viroid infecting Citrus limon in China using small RNAs deep sequencing approach.

    Science.gov (United States)

    Su, Xiu; Fu, Shuai; Qian, Yajuan; Xu, Yi; Zhou, Xueping

    2015-07-07

    The advent of next generation sequencing technology has allowed for significant advances in plant virus discovery, particularly for identification of covert viruses and previously undescribed viruses. The Citrus limon Burm. f. (C. limon) is a small evergreen tree native to Asia, and . China is the world's top lemon-producing nation. In this work, lemon samples were collected from southwestern of China, where an unknown disease outbreak had caused huge losses in the lemon production industry. Using high-throughput pyrosequencing and the assembly of small RNAs, we showed that the Hop stunt viroid (HSVd) was present in C. limon leaf sample. The majority of it is a main lemon producing agricultural cultivarHop stunt viroid derived siRNAs (HSVd-siRNAs) in C. limon were 21 nucleotides in length, and nearly equal amount of HSVd-siRNAs originated from the plus-genomic RNA strand as from the complementary strand. A bias of HSVd-siRNAs toward sequences beginning with a 5'-Guanine was observed. Furthermore, hotspot analysis showed that a large amount of HSVd-siRNAs derived from the central and variant domains of the HSVd genome. Our results suggest that C. limon could set up a small RNA-mediated gene silencing response to Hop stunt viroid, Interestingly, based on bioinformatics analysis, our results also suggest that the large amounts of HSVd-siRNAs from central and variant domains might be involved in interference with host gene expression and affect symptom development.

  20. Penalty kick skill through knee tuck jump exercise and barrier hops exercise

    Directory of Open Access Journals (Sweden)

    Usli Wargadinata Lingling

    2018-01-01

    Full Text Available Football always attracts society’s attention. Unfortunately in practice, at school for example, students have difficulties in mastering penalty kick. This research aimed to know the influence of knee tuck jump exercise towards penalty kick result in football and the influence of barrier hops exercise towards penalty kick result in football. The design of this research is pretest–posttest design. The population taken was the entire students from class XI SMK 3 LPPM-RI Batujajar which consisted of 126 students. Purposive sampling technique was used to determine the sample. Intentionally, the writer chose as many as 30 students who joined football extracurricular as sample then divided them into two groups namely group A (knee tuck jump exercise and group B (barrier hops exercise. Based on the result, there was significant difference in mean score between pretest and posttest in group A (29.00 than group B (26.00 towards the result of penalty kick in football. The result of compared t from the difference of two results is 4.92 bigger than t table 1.70. Therefore, knee tuck jump exercise gives more significant result than barrier hops exercise towards penalty kick result in football to the students of football extracurricular in SMK 3 LPPM-RI Batujajar.