WorldWideScience

Sample records for hopping mouse notomys

  1. Water deprivation induces appetite and alters metabolic strategy in Notomys alexis: unique mechanisms for water production in the desert.

    Science.gov (United States)

    Takei, Yoshio; Bartolo, Ray C; Fujihara, Hiroaki; Ueta, Yoichi; Donald, John A

    2012-07-07

    Like many desert animals, the spinifex hopping mouse, Notomys alexis, can maintain water balance without drinking water. The role of the kidney in producing a small volume of highly concentrated urine has been well-documented, but little is known about the physiological mechanisms underpinning the metabolic production of water to offset obligatory water loss. In Notomys, we found that water deprivation (WD) induced a sustained high food intake that exceeded the pre-deprivation level, which was driven by parallel changes in plasma leptin and ghrelin and the expression of orexigenic and anorectic neuropeptide genes in the hypothalamus; these changed in a direction that would stimulate appetite. As the period of WD was prolonged, body fat disappeared but body mass increased gradually, which was attributed to hepatic glycogen storage. Switching metabolic strategy from lipids to carbohydrates would enhance metabolic water production per oxygen molecule, thus providing a mechanism to minimize respiratory water loss. The changes observed in appetite control and metabolic strategy in Notomys were absent or less prominent in laboratory mice. This study reveals novel mechanisms for appetite regulation and energy metabolism that could be essential for desert rodents to survive in xeric environments.

  2. Hops

    Science.gov (United States)

    ... The effectiveness ratings for HOPS are as follows:Body odor. Early research suggests that applying a deodorant that ... specific zinc salt to the underarm can reduce body odor. Insomnia. Some research suggests that taking a combination ...

  3. The response of the natriuretic peptide system to water deprivation in the desert rodent, Notomys alexis.

    Science.gov (United States)

    Heimeier, Rachel A; Donald, John A

    2006-02-01

    Natriuretic peptides (NPs) are regulatory molecules that cause cGMP-mediated diuresis and natriuresis in mammals. Accordingly, it is interesting to consider their role in desert-adapted animals in which water is often limited. This study investigated the response of the natriuretic peptide (NP) system to varying periods of water deprivation (WD) in the Australian desert rodent species, Notomys alexis. It was hypothesised that the expression of the NP system will be down-regulated in water-deprived N. alexis compared to water-replete animals. The plasma levels of ANP were significantly reduced after 3 days of WD, but were unaffected by 7, 14 and 28 days of WD. Water deprivation for 3, 7, 14 days had a variable effect on the mRNA expression of ANP, CNP, NPR-A, NPR-B, and NPR-C, and a uniform down-regulation was not observed. However, after 28 days of WD, mRNA expression was similar to water-replete animals, except for NPR-A. Surprisingly, 7 and 14 days of WD caused an up-regulation in the ability of ANP to stimulate cGMP; this also occurred at 14 days for CNP. Taken together, the mRNA expression and peptide mediated guanylyl cyclase activity data after WD were in the opposite direction to what was predicted. Interestingly, after 28 days of WD, most parameters were similar to those of water-replete animals, which indicates that a down-regulation of the NP system is not part of the physiological response to an absence of free water in N. alexis.

  4. Wheeled hopping robot

    Science.gov (United States)

    Fischer, Gary J [Albuquerque, NM

    2010-08-17

    The present invention provides robotic vehicles having wheeled and hopping mobilities that are capable of traversing (e.g. by hopping over) obstacles that are large in size relative to the robot and, are capable of operation in unpredictable terrain over long range. The present invention further provides combustion powered linear actuators, which can include latching mechanisms to facilitate pressurized fueling of the actuators, as can be used to provide wheeled vehicles with a hopping mobility.

  5. Hopping transport in solids

    CERN Document Server

    Pollak, M

    1991-01-01

    The hopping process, which differs substantially from conventional transport processes in crystals, is the central process in the transport phenomena discussed in this book. Throughout the book the term ``hopping'' is defined as the inelastic tunneling transfer of an electron between two localized electronic states centered at different locations. Such processes do not occur in conventional electronic transport in solids, since localized states are not compatible with the translational symmetry of crystals.The rapid growth of interest in hopping transport has followed in the footsteps of the

  6. Climate, weather, and hops

    Science.gov (United States)

    As climate and weather become more variable, hop growers face increased uncertainty in making decisions about their crop. Given the unprecedented nature of these changes, growers may no longer have enough information and intuitive understanding to adequately assess the situation and evaluate their m...

  7. Electron hopping through proteins

    Czech Academy of Sciences Publication Activity Database

    Warren, J. J.; Ener, M. E.; Vlček, Antonín; Winkler, J. R.; Gray, H. B.

    2012-01-01

    Roč. 256, 21-22 (2012), s. 2478-2487 ISSN 0010-8545 R&D Projects: GA MŠk(CZ) ME10124 Institutional support: RVO:61388955 Keywords : electron transfer * multistep tunneling * hopping maps Subject RIV: CG - Electrochemistry Impact factor: 11.016, year: 2012

  8. Basin Hopping Graph

    DEFF Research Database (Denmark)

    Kucharik, Marcel; Hofacker, Ivo; Stadler, Peter

    2014-01-01

    of the folding free energy landscape, however, can provide the relevant information. Results We introduce the basin hopping graph (BHG) as a novel coarse-grained model of folding landscapes. Each vertex of the BHG is a local minimum, which represents the corresponding basin in the landscape. Its edges connect...

  9. Xanthohumol from Hop (Humulus lupulus L.) Is an Efficient Inhibitor of Monocyte Chemoattractant Protein-1 and Tumor Necrosis Factor-a Release in LPS-Stimulated RAW 264.7 Mouse Macrophages and U937 Human Monocytes

    NARCIS (Netherlands)

    Lupinacci, E.; Meijerink, J.; Vincken, J.P.; Gabriele, B.; Gruppen, H.; Witkamp, R.F.

    2009-01-01

    Activated macrophages in adipose tissue play a major role in the chronic inflammatory process that has been linked to the complications of overweight and obesity. The hop plant (Humulus lupulus L.) has been described to possess both anti-inflammatory and antidiabetic effects. In the present study,

  10. Hip-Hop Education Resources

    Science.gov (United States)

    Hall, Marcella Runell

    2009-01-01

    Hip-hop music and culture are often cited as being public pedagogy, meaning the music itself has intrinsic educational value. Non-profit organizations and individual educators have graciously taken the lead in utilizing hip-hop to educate. As the academy continues to debate its effectiveness, teachers and community organizers are moving forward.…

  11. Supercritical fluid extraction of hops

    Directory of Open Access Journals (Sweden)

    ZORAN ZEKOVIC

    2007-01-01

    Full Text Available Five cultivars of hop were extracted by the method of supercritical fluid extraction using carbon dioxide (SFE–CO2 as extractant. The extraction (50 g of hop sample using a CO2 flow rate of 97.725 L/h was done in the two steps: 1. extraction at 150 bar and 40°C for 2.5 h (sample of series A was obtained and, after that, the same sample of hop was extracted in the second step: 2. extraction at 300 bar and 40 °C for 2.5 h (sample of series B was obtained. The Magnum cultivar was chosen for the investigation of the extraction kinetics. For the qualitative and quantitative analysis of the obtained hop extracts, the GC-MS method was used. Two of four themost common compounds of hop aroma (a-humulene and b-caryophyllene were detected in samples of series A. In addition, isomerized a-acids and a high content of b-acids were detected. The a-acids content in the samples of series B was the highest in the extract of the Magnum cultivar (it is a bitter variety of hop. The low contents of a-acids in all the other hop samples resulted in extracts with low a-acids content, i.e., that contents were under the prescribed a-acids content.

  12. Hall effect in hopping regime

    International Nuclear Information System (INIS)

    Avdonin, A.; Skupiński, P.; Grasza, K.

    2016-01-01

    A simple description of the Hall effect in the hopping regime of conductivity in semiconductors is presented. Expressions for the Hall coefficient and Hall mobility are derived by considering averaged equilibrium electron transport in a single triangle of localization sites in a magnetic field. Dependence of the Hall coefficient is analyzed in a wide range of temperature and magnetic field values. Our theoretical result is applied to our experimental data on temperature dependence of Hall effect and Hall mobility in ZnO. - Highlights: • Expressions for Hall coefficient and mobility for hopping conductivity are derived. • Theoretical result is compared with experimental curves measured on ZnO. • Simultaneous action of free and hopping conduction channels is considered. • Non-linearity of hopping Hall coefficient is predicted.

  13. Hall effect in hopping regime

    Energy Technology Data Exchange (ETDEWEB)

    Avdonin, A., E-mail: avdonin@ifpan.edu.pl [Institute of Physics, Polish Academy of Sciences, Al. Lotników 32/46, 02-668 Warszawa (Poland); Skupiński, P. [Institute of Physics, Polish Academy of Sciences, Al. Lotników 32/46, 02-668 Warszawa (Poland); Grasza, K. [Institute of Physics, Polish Academy of Sciences, Al. Lotników 32/46, 02-668 Warszawa (Poland); Institute of Electronic Materials Technology, ul. Wólczyńska 133, 01-919 Warszawa (Poland)

    2016-02-15

    A simple description of the Hall effect in the hopping regime of conductivity in semiconductors is presented. Expressions for the Hall coefficient and Hall mobility are derived by considering averaged equilibrium electron transport in a single triangle of localization sites in a magnetic field. Dependence of the Hall coefficient is analyzed in a wide range of temperature and magnetic field values. Our theoretical result is applied to our experimental data on temperature dependence of Hall effect and Hall mobility in ZnO. - Highlights: • Expressions for Hall coefficient and mobility for hopping conductivity are derived. • Theoretical result is compared with experimental curves measured on ZnO. • Simultaneous action of free and hopping conduction channels is considered. • Non-linearity of hopping Hall coefficient is predicted.

  14. Supercritical carbon dioxide hop extraction

    Directory of Open Access Journals (Sweden)

    Pfaf-Šovljanski Ivana I.

    2005-01-01

    Full Text Available The hop of Magnum cultivar was extracted using supercritical carbon dioxide (SFE-as extractant. Extraction was carried out in the two steps: the first one being carried out at 150 bar and 40°C for 2.5 h (Extract A, and the second was the extraction of the same hop sample at 300 bar and 40°C for 2.5 h (Extract B. Extraction kinetics of the system hop-SFE-CO2 was investigated. Two of four most common compounds of hop aroma (α-humulene and β-caryophyllene were detected in Extract A. Isomerised α-acids and β-acids were detected too. a-Acid content in Extract B was high (that means it is a bitter variety of hop. Mathematical modeling using empirical model characteristic time model and simple single sphere model has been performed on Magnum cultivar extraction experimental results. Characteristic time model equations, best fitted experimental results. Empirical model equation, fitted results well, while simple single sphere model equation poorly approximated the results.

  15. Hip-Hop and the Academic Canon

    Science.gov (United States)

    Abe, Daudi

    2009-01-01

    Over the last 30 years, the hip-hop movement has risen from the margins to become the preeminent force in US popular culture. In more recent times academics have begun to harness the power of hip-hop culture and use it as a means of infusing transformative knowledge into the mainstream academic discourse. On many college campuses, hip-hop's…

  16. Hip-Hop Pop Art

    Science.gov (United States)

    Talley, Clarence, Sr.

    2011-01-01

    Art has a way of helping students better understand and appreciate the world around them, particularly the things that are most important to them. Hip hop is one of those generational genres that capture the attention of young students like few other things do. Drawing on this genre to get students to create art is an excellent way to demonstrate…

  17. Hopping models and ac universality

    DEFF Research Database (Denmark)

    Dyre, Jeppe; Schrøder, Thomas

    2002-01-01

    Some general relations for hopping models are established. We proceed to discuss the universality of the ac conductivity which arises in the extreme disorder limit of the random barrier model. It is shown that the relevant dimension entering into the diffusion cluster approximation (DCA) is the h......Some general relations for hopping models are established. We proceed to discuss the universality of the ac conductivity which arises in the extreme disorder limit of the random barrier model. It is shown that the relevant dimension entering into the diffusion cluster approximation (DCA......) is the harmonic (fracton) dimension of the diffusion cluster. The temperature scaling of the dimensionless frequency entering into the DCA is discussed. Finally, some open problems regarding ac universality are listed....

  18. Wireless Multi Hop Access Networks and Protocols

    OpenAIRE

    Nilsson Plymoth, Anders

    2007-01-01

    As more and more applications and services in our society now depend on the Internet, it is important that dynamically deployed wireless multi hop networks are able to gain access to the Internet and other infrastructure networks and services. This thesis proposes and evaluates solutions for providing multi hop Internet Access. It investigates how ad hoc networks can be combined with wireless and mesh networks in order to create wireless multi hop access networks. When several access points t...

  19. Fundamentals of beer and hop chemistry

    Directory of Open Access Journals (Sweden)

    Denis De Keukeleire

    2000-02-01

    Full Text Available Beer brewing is an intricate process encompassing mixing and further elaboration of four essential raw materials, including barley malt, brewing water, hops and yeast. Particularly hops determine to a great extent typical beer qualities such as bitter taste, hoppy flavour, and foam stability. Conversely, hop-derived bitter acids account for an offending lightstruck flavour, which is formed on exposure of beer to light. These various processes are presented in detail, while due emphasis is placed on state-of-the-art hop technology, which provides brewers with efficient means to control bitterness, foam, and light-stability thereby allowing for the production of beers with consistent quality.

  20. Fasilitas Pelatihan dan Pergelaran Seni Tari Hip Hop di Surabaya

    OpenAIRE

    Yanuar, Sandy

    2014-01-01

    Fasilitas Pelatihan dan Pergelaran Seni Tari Hip Hop di Surabaya merupakan fasilitas yang disediakan bagi semua penari Hip Hop di Surabaya untuk berlatih menari dan mempertunjukan tarian Hip Hop. Fasilitas ini tersedia bagi semua penari Hip Hop termasuk penari difable, mengingat kaum difable juga dapat menari Hip Hop. Namun karena di Surabaya belum memiliki fasilitas yang memadai bagi semua penari Hip Hop termasuk penari difable untuk menari dan memiliki tempat pertunjukan yang berkarakter Hi...

  1. Hop-by-HopWorm Propagation with Carryover Epidemic Model in Mobile Sensor Networks

    Directory of Open Access Journals (Sweden)

    Jun-Won Ho

    2015-10-01

    Full Text Available In the internet, a worm is usually propagated in a random multi-hop contact manner. However, the attacker will not likely select this random multi-hop propagation approach in a mobile sensor network. This is because multi-hop worm route paths to random vulnerable targets can be often breached due to node mobility, leading to failure of fast worm spread under this strategy. Therefore, an appropriate propagation strategy is needed for mobile sensor worms. To meet this need, we discuss a hop-by-hop worm propagation model in mobile sensor networks. In a hop-by-hop worm propagation model, benign nodes are infected by worm in neighbor-to-neighbor spread manner. Since worm infection occurs in hop-by-hop contact, it is not substantially affected by a route breach incurred by node mobility. We also propose the carryover epidemic model to deal with the worm infection quota deficiency that might occur when employing an epidemic model in a mobile sensor network. We analyze worm infection capability under the carryover epidemic model. Moreover, we simulate hop-by-hop worm propagation with carryover epidemic model by using an ns-2 simulator. The simulation results demonstrate that infection quota carryovers are seldom observed where a node’s maximum speed is no less than 20 m/s.

  2. Pertunjukan Teater Karo Hip Hop Kontemporer KAI

    Directory of Open Access Journals (Sweden)

    Silvia Anggreni Purba

    2013-11-01

    Pertunjukan Teater Karo Hip Hop Kontemporer KAI. The performance of Karo Theater collaborated with Hip Hop stems from a simple idea to collaborate Karo cultural traditions with popular culture. The performances can be enjoyed without having limitation on the language and culture. The process of combining two different cultures is a form of hybrid culture, and it may occur due to the globalization process. Through the process of deposition of the observations and strong impression, this performance is then brought into the form of Hip Hop as a preferred form which is energetic, personal and global. This performance is part of a modern tragedy with its destructive character which has explored the emotion and has presented it to the audiences. The exploration of Karo cultural tradition and Hip Hop dance as a language of symbols is able to reinforce words. The movement is not revealed by the verbal phrase but is presented through the movement of Hip Hop dance. The interpretation of the legend and texts into movement is carried out through the training process at the laboratory as a searching process and experiment, and afterward can be realized by considering the basic elements of Hip Hop, Karo cultural elements and performance. Karo Hip Hop Theatre is expected to become a preferred aesthetic form of a modern theater without losing its tradition form. Keyword: a contemporary Karo theater, Hip Hop, hybrid culture.

  3. How Does a Hopping Kangaroo Breathe?

    Science.gov (United States)

    Giuliodori, Mauricio J.; Lujan, Heidi L.; Janbaih, Hussein; DiCarlo, Stephen E.

    2010-01-01

    We developed a model to demonstrate how a hopping kangaroo breathes. Interestingly, a kangaroo uses less energy to breathe while hopping than while standing still. This occurs, in part, because rather than using muscle power to move air into and out of the lungs, air is pulled into (inspiration) and pushed out of (expiration) the lungs as the…

  4. Hip-hop and urban studies

    NARCIS (Netherlands)

    Jaffe, R.

    2014-01-01

    How can urban studies research engage fruitfully with hip-hop? This contribution responds to the essays by David Beer and Martin Lamotte on ‘street music’, urban ethnography and ghettoized communities. It discusses how a social science engagement with hip-hop texts might differ from cultural studies

  5. Hopping Conductivity Enhanced by Microwave Radiation

    International Nuclear Information System (INIS)

    Ovadyahu, Z

    2012-01-01

    Hopping conductivity is enhanced when exposed to microwave (MW) fields. Data taken on several Anderson-localized systems and granular-aluminium are presented to illustrate the generality of the phenomenon. It is suggested that the effect is due to a field-enhanced hopping, which is the ac version of a non-ohmic effect familiar from studies in the dc transport regime.

  6. Helicobacter pylori HopE and HopV porins present scarce expression among clinical isolates

    Science.gov (United States)

    Lienlaf, Maritza; Morales, Juan Pablo; Díaz, María Inés; Díaz, Rodrigo; Bruce, Elsa; Siegel, Freddy; León, Gloria; Harris, Paul R; Venegas, Alejandro

    2010-01-01

    AIM: To evaluate how widely Helicobacter pylori (H. pylori) HopE and HopV porins are expressed among Chilean isolates and how seroprevalent they are among infected patients in Chile. METHODS: H. pylori hopE and hopV genes derived from strain CHCTX-1 were cloned by polymerase chain reaction (PCR), sequenced and expressed in Escherichia coli AD494 (DE3). Gel-purified porins were used to prepare polyclonal antibodies. The presence of both genes was tested by PCR in a collection of H. pylori clinical isolates and their expression was detected in lysates by immunoblotting. Immune responses against HopE, HopV and other H. pylori antigens in sera from infected and non-infected patients were tested by Western blotting using these sera as first antibody on recombinant H. pylori antigens. RESULTS: PCR and Western blotting assays revealed that 60 and 82 out of 130 Chilean isolates carried hopE and hopV genes, respectively, but only 16 and 9, respectively, expressed these porins. IgG serum immunoreactivity evaluation of 69 H. pylori-infected patients revealed that HopE and HopV were infrequently recognized (8.7% and 10.1% respectively) compared to H. pylori VacA (68.1%) and CagA (59.5%) antigens. Similar values were detected for IgA serum immunoreactivity against HopE (11.6%) and HopV (10.5%) although lower values for VacA (42%) and CagA (17.4%) were obtained when compared to the IgG response. CONCLUSION: A scarce expression of HopE and HopV among Chilean isolates was found, in agreement with the infrequent seroconversion against these antigens when tested in infected Chilean patients. PMID:20082477

  7. Perceived bitterness character of beer in relation to hop variety and the impact of hop aroma.

    Science.gov (United States)

    Oladokun, Olayide; James, Sue; Cowley, Trevor; Dehrmann, Frieda; Smart, Katherine; Hort, Joanne; Cook, David

    2017-09-01

    The impact of hop variety and hop aroma on perceived beer bitterness intensity and character was investigated using analytical and sensory methods. Beers made from malt extract were hopped with 3 distinctive hop varieties (Hersbrucker, East Kent Goldings, Zeus) to achieve equi-bitter levels. A trained sensory panel determined the bitterness character profile of each singly-hopped beer using a novel lexicon. Results showed different bitterness character profiles for each beer, with hop aroma also found to change the hop variety-derived bitterness character profiles of the beer. Rank-rating evaluations further showed the significant effect of hop aroma on selected key bitterness character attributes, by increasing perceived harsh and lingering bitterness, astringency, and bitterness intensity via cross-modal flavour interactions. This study advances understanding of the complexity of beer bitterness perception by demonstrating that hop variety selection and hop aroma both impact significantly on the perceived intensity and character of this key sensory attribute. Copyright © 2017 Elsevier Ltd. All rights reserved.

  8. Hopping models for ion conduction in noncrystals

    DEFF Research Database (Denmark)

    Dyre, Jeppe; Schrøder, Thomas

    2007-01-01

    semiconductors). These universalities are subject of much current interest, for instance interpreted in the context of simple hopping models. In the present paper we first discuss the temperature dependence of the dc conductivity in hopping models and the importance of the percolation phenomenon. Next......, the experimental (quasi)universality of the ac conductivity is discussed. It is shown that hopping models are able to reproduce the experimental finding that the response obeys time-temperature superposition, while at the same time a broad range of activation energies is involved in the conduction process. Again...

  9. Variable range hopping in ZnO films

    Science.gov (United States)

    Ali, Nasir; Ghosh, Subhasis

    2018-04-01

    We report the variable range hopping in ZnO films grown by RF magnetron sputtering in different argon and oxygen partial pressure. It has been found that Mott variable range hopping dominant over Efros variable range hopping in all ZnO films. It also has been found that hopping distance and energy increases with increasing oxygen partial pressure.

  10. Hopping absorption edge in silicon inversion layers

    International Nuclear Information System (INIS)

    Kostadinov, I.Z.

    1983-09-01

    The low frequency gap observed in the absorption spectrum of silicon inversion layers is related to the AC variable range hopping. The frequency dependence of the absorption coefficient is calculated. (author)

  11. Hip-hop, Onegin - pop! / Tatjana Aleksandrova

    Index Scriptorium Estoniae

    Aleksandrova, Tatjana, 1945-

    2004-01-01

    Erateatrikooli KS, mida juhib Svetlana Krassman, lavastus A. Pushkini poeemi "Jevgeni Onegin" motiividel. Noortelavastuse muusikalises seades kasutatakse klassikalise muusika aranzheeringuid ja räppi, kostüümidraamat koos hip-hop rõivastiiliga

  12. Beer spoilage bacteria and hop resistance.

    Science.gov (United States)

    Sakamoto, Kanta; Konings, Wil N

    2003-12-31

    For brewing industry, beer spoilage bacteria have been problematic for centuries. They include some lactic acid bacteria such as Lactobacillus brevis, Lactobacillus lindneri and Pediococcus damnosus, and some Gram-negative bacteria such as Pectinatus cerevisiiphilus, Pectinatus frisingensis and Megasphaera cerevisiae. They can spoil beer by turbidity, acidity and the production of unfavorable smell such as diacetyl or hydrogen sulfide. For the microbiological control, many advanced biotechnological techniques such as immunoassay and polymerase chain reaction (PCR) have been applied in place of the conventional and time-consuming method of incubation on culture media. Subsequently, a method is needed to determine whether the detected bacterium is capable of growing in beer or not. In lactic acid bacteria, hop resistance is crucial for their ability to grow in beer. Hop compounds, mainly iso-alpha-acids in beer, have antibacterial activity against Gram-positive bacteria. They act as ionophores which dissipate the pH gradient across the cytoplasmic membrane and reduce the proton motive force (pmf). Consequently, the pmf-dependent nutrient uptake is hampered, resulting in cell death. The hop-resistance mechanisms in lactic acid bacteria have been investigated. HorA was found to excrete hop compounds in an ATP-dependent manner from the cell membrane to outer medium. Additionally, increased proton pumping by the membrane bound H(+)-ATPase contributes to hop resistance. To energize such ATP-dependent transporters hop-resistant cells contain larger ATP pools than hop-sensitive cells. Furthermore, a pmf-dependent hop transporter was recently presented. Understanding the hop-resistance mechanisms has enabled the development of rapid methods to discriminate beer spoilage strains from nonspoilers. The horA-PCR method has been applied for bacterial control in breweries. Also, a discrimination method was developed based on ATP pool measurement in lactobacillus cells. However

  13. Degradation of hop bitter acids by fungi

    International Nuclear Information System (INIS)

    Huszcza, Ewa; Bartmanska, Agnieszka; Aniol, Miroslaw; Maczka, Wanda; Zolnierczyk, Anna; Wawrzenczyk, Czeslaw

    2008-01-01

    Nine fungal strains related to: Trametes versicolor, Nigrospora oryzae, Inonotus radiatus, Crumenulopsis sororia, Coryneum betulinum, Cryptosporiopsis radicicola, Fusarium equiseti, Rhodotorula glutinis and Candida parapsilosis were tested for their ability to degrade humulones and lupulones. The best results were obtained for T. versicolor culture, in which humulones and lupulones were fully degraded after 4 days of incubation in the dark or after 36 h in the light. The experiments were performed on a commercial hop extract and on sterilized spent hops

  14. HIP HOP for HIV Awareness: Using Hip Hop Culture to Promote Community-Level HIV Prevention

    Science.gov (United States)

    Hill, Mandy J.; Hallmark, Camden J.; McNeese, Marlene; Blue, Nike; Ross, Michael W.

    2014-01-01

    The goal of this paper was to determine the effectiveness of the HIP HOP for HIV Awareness intervention, an innovative model utilising an exchange of an HIV test for a hip hop concert ticket, in a metropolitan city among African American youth and young adults. A subset of intervention participants participated in standardised testing, sex…

  15. RAZVOJ OBLAČIL V HIP HOP KULTURI

    OpenAIRE

    Marić, Sanja

    2010-01-01

    V diplomskem delu smo raziskovali, kako so se hip hop oblačila razvijala skozi obdobja v hip hop kulturi. V teoretičnem deli smo ugotavljali ozadje in dejavnike, ki so vplivali na razvoj hip hop kulture, v empiričnem delu diplomske naloge pa smo izvedli anketni vprašalnik z glavnimi akterji hip hop kulture na slovenski hip hop sceni. Rezultati, ki smo jih dobili, kažejo da so imela oblačila velik vpliv na prepoznavnost in razvoj hip hop kulture po celem svetu. K temu so največ pripomogli ustv...

  16. Collective probabilities algorithm for surface hopping calculations

    International Nuclear Information System (INIS)

    Bastida, Adolfo; Cruz, Carlos; Zuniga, Jose; Requena, Alberto

    2003-01-01

    General equations that transition probabilities of the hopping algorithms in surface hopping calculations must obey to assure the equality between the average quantum and classical populations are derived. These equations are solved for two particular cases. In the first it is assumed that probabilities are the same for all trajectories and that the number of hops is kept to a minimum. These assumptions specify the collective probabilities (CP) algorithm, for which the transition probabilities depend on the average populations for all trajectories. In the second case, the probabilities for each trajectory are supposed to be completely independent of the results from the other trajectories. There is, then, a unique solution of the general equations assuring that the transition probabilities are equal to the quantum population of the target state, which is referred to as the independent probabilities (IP) algorithm. The fewest switches (FS) algorithm developed by Tully is accordingly understood as an approximate hopping algorithm which takes elements from the accurate CP and IP solutions. A numerical test of all these hopping algorithms is carried out for a one-dimensional two-state problem with two avoiding crossings which shows the accuracy and computational efficiency of the collective probabilities algorithm proposed, the limitations of the FS algorithm and the similarity between the results offered by the IP algorithm and those obtained with the Ehrenfest method

  17. Research on synchronization technology of frequency hopping communication system

    Science.gov (United States)

    Zhao, Xiangwu; Quan, Houde; Cui, Peizhang

    2018-05-01

    Frequency Hopping (FH) communication is a technology of spread spectrum communication. It has strong anti-interference, anti-interception and security capabilities, and has been widely applied in the field of communications. Synchronization technology is one of the most crucial technologies in frequency hopping communication. The speed of synchronization establishment and the reliability of synchronous system directly affect the performance of frequency hopping communication system. Therefore, the research of synchronization technology in frequency hopping communication has important value.

  18. Hip-Hopping across China: Intercultural Formulations of Local Identities

    Science.gov (United States)

    Barrett, Catrice

    2012-01-01

    The linguistic dimensions of globalized hip-hop cannot be understood simply as a byproduct of English as an American export. As hip-hop mobilizes, it is common (and arguably necessary) for global hip-hop communities to struggle through purposeful, semiotically rooted dialectics over what constitutes "authentic" and respectable forms of…

  19. HPLC Analysis of [Alpha]- and [Beta]-Acids in Hops

    Science.gov (United States)

    Danenhower, Travis M.; Force, Leyna J.; Petersen, Kenneth J.; Betts, Thomas A.; Baker, Gary A.

    2008-01-01

    Hops have been used for centuries to impart aroma and bitterness to beer. The cones of the female hop plant contain both essential oils, which include many of the fragrant components of hops, and a collection of compounds known as [alpha]- and [beta]-acids that are the precursors to bittering agents. In order for brewers to predict the ultimate…

  20. Revolutionizing Environmental Education through Indigenous Hip Hop Culture

    Science.gov (United States)

    Gorlewski, Julie; Porfilio, Brad J.

    2012-01-01

    Based upon the life histories of six Indigenous hip hop artists of the Beat Nation artist collective, this essay captures how Indigenous hip hop has the potential to revolutionize environmental education. Hip hop provides Indigenous youth an emancipatory space to raise their opposition to neocolonial controls of Indigenous territories that…

  1. Performance analysis of multi-hop wireless packet networks

    Directory of Open Access Journals (Sweden)

    Lim J.-T.

    1997-01-01

    Full Text Available In this paper, a unified analytical framework for performance analysis of multi-hop wireless packet networks is developed. The effect of coupling between the hops on the degradation of the delay-throughput characteristics and the probability of blocking is investigated. The issue of hop decoupling is addressed.

  2. Uudised : Ooper. Hip-hop. Madonna

    Index Scriptorium Estoniae

    2005-01-01

    Rumeenia sopran Nelly Miricioiu Vincenzo Bellini ooperi "Norma" nimiosas Nederlandse Operas Amsaterdamis 7.-28. märtsini. 4. märtsil Tallinna klubis Hollywood üritusel "Hip-Hop Café" New Yorgi duo Camp Lo. Ameerika poplaulja Madonna võttis vastu filmirolli

  3. Injury incidence in hip hop dance.

    Science.gov (United States)

    Ojofeitimi, S; Bronner, S; Woo, H

    2012-06-01

    Hip hop dance has rapidly become a popular international art form. There is limited information on injury patterns in this population. The purpose of this study was to determine injury incidence and patterns among three groups of hip hop dancers. Three hundred and twelve intermediate, advanced, and expert hip hop dancers were recruited at battles, dance conferences, clubs, and on dance related web sites within the United States and internationally. A Web-based survey was conducted over a 6-month period. Inclusion criteria included intermediate and advanced level dancers over the age of 13. Dancers were divided into three main categories: Breakers, Popper/Lockers, and New Schoolers. Separate analysis of variances were used to compare injury pattern differences between groups. Two hundred and thirty-two dancers reported a total of 738 injuries. Five hundred and six of these (sustained by 205 dancers) were time-loss (TL) injuries. Annual injury incidence was 237% (162% involving TL). Lower extremity injuries were 52% and upper extremity injuries 32% of total injuries. Breakers had a higher injury incidence compared with Popper/Lockers, and New Schoolers. Hip hop dancers report injury rates that are higher than other dance forms but similar to gymnastics. These dancers should be educated concerning injury prevention, biomechanics, and use of protective equipment. © 2010 John Wiley & Sons A/S.

  4. The Philippine "Hip Hop Stick Dance"

    Science.gov (United States)

    Lewis, Lisa

    2012-01-01

    This article introduces a dance that blends the traditional cultural heritage of the Philippines with modern music and moves. "Hip Hop Stick Dance" incorporates Tinikling (the Philippine national dance) and Arnis (a Filipino style of martial arts) to create a contemporary combination of rhythm, dance, and fitness. It was designed to introduce…

  5. Communication: Fully coherent quantum state hopping

    Energy Technology Data Exchange (ETDEWEB)

    Martens, Craig C., E-mail: cmartens@uci.edu [University of California, Irvine, California 92697-2025 (United States)

    2015-10-14

    In this paper, we describe a new and fully coherent stochastic surface hopping method for simulating mixed quantum-classical systems. We illustrate the approach on the simple but unforgiving problem of quantum evolution of a two-state quantum system in the limit of unperturbed pure state dynamics and for dissipative evolution in the presence of both stationary and nonstationary random environments. We formulate our approach in the Liouville representation and describe the density matrix elements by ensembles of trajectories. Population dynamics are represented by stochastic surface hops for trajectories representing diagonal density matrix elements. These are combined with an unconventional coherent stochastic hopping algorithm for trajectories representing off-diagonal quantum coherences. The latter generalizes the binary (0,1) “probability” of a trajectory to be associated with a given state to allow integers that can be negative or greater than unity in magnitude. Unlike existing surface hopping methods, the dynamics of the ensembles are fully entangled, correctly capturing the coherent and nonlocal structure of quantum mechanics.

  6. The Formation of "Hip-Hop Academicus"--How American Scholars Talk about the Academisation of Hip-Hop

    Science.gov (United States)

    Soderman, Johan

    2013-01-01

    Social activism and education have been associated with hip-hop since it emerged in New York City 38 years ago. Therefore, it might not be surprising that universities have become interested in hip-hop. This article aims to highlight this "hip-hop academisation" and analyse the discursive mechanisms that manifest in these academisation…

  7. Featherless Dinosaurs and the Hip-Hop Simulacrum: Reconsidering Hip-Hop's Appropriateness for the Music Classroom

    Science.gov (United States)

    Kruse, Adam J.

    2016-01-01

    This article offers considerations for music teachers interested in including hip-hop music in their classrooms but who might feel concerned with or overwhelmed by issues of appropriateness. Two concerns related to hip-hop music are examined: language and negative social themes. Commercial interests in hip-hop music have created a simulacrum (or…

  8. Epigenetic changes detected in micropropagated hop plants.

    Science.gov (United States)

    Peredo, Elena L; Arroyo-García, Rosa; Revilla, M Angeles

    2009-07-01

    Micropropagation is a widely used technique in hops (Humulus lupulus L.). However, to the best of our knowledge, the genetic and epigenetic stability of the microplants has never been tested before. In the present study, two hop accessions were established in vitro and micropropagated for 2 years. The genetic and epigenetic stability of the in vitro plants was analyzed with several molecular techniques: random amplified DNA polymorphism (RAPD), retrotransposon microsatellite amplified polymorphism (REMAP), and methylation-sensitive amplification polymorphism (MSAP). No genetic variation among control and treated plants was found, even after 12 cycles of micropropagation. Epigenetic variation was detected, first, when field and in vitro samples were compared. Nearly a 30% of the detected fragments presented the same pattern of alterations in all the vitroplants. Second, lower levels of epigenetic variation were detected among plants from the different subcultures. Part of this detected variation seemed to be accumulated along the 12 sequential subcultures tested.

  9. Exploiting Multi-user Diversity and Multi-hop Diversity in Dual-hop Broadcast Channels

    KAUST Repository

    Zafar, Ammar

    2013-05-21

    We propose joint user-and-hop scheduling over dual-hop block-fading broadcast channels in order to exploit multi-user diversity gains and multi-hop diversity gains all together. To achieve this objective, the first and second hops are scheduled opportunistically based on the channel state information. The joint scheduling problem is formulated as maximizing the weighted sum of the long term achievable rates of the users under a stability constraint, which means that in the long term the rate received by the relay should equal the rate transmitted by it, in addition to power constraints. We show that this problem is equivalent to a single-hop broadcast channel by treating the source as a virtual user with an optimal weight that maintains the stability constraint. We show how to obtain the source weight either off-line based on channel statistics or on real-time based on channel measurements. Furthermore, we consider special cases including the maximum sum-rate scheduler and the proportional fair scheduler. We also show how to extend the scheme into one that allows multiple user scheduling via superposition coding with successive decoding. Numerical results demonstrate that our proposed joint scheduling scheme enlarges the rate region as compared to scheduling schemes that exploit the diversity gains partially.

  10. Uudised : Pop-karneval. Hip-hop

    Index Scriptorium Estoniae

    2005-01-01

    Muusika- ja kunstikarnevalist "Beta Bubble" 1. apr. Tallinnas Von Krahlis. Pärnu taasühinenud hip-hop-bänd Noizmakaz (TommyBoy ja Alko) sõlmis lepingu plaadifirmaga Mindnote ja annab selle alt apr. keskel välja oma teise albumi "Valitud mõtted".1. apr. tuleb müügile Noizmakazi singel "Miski muu ei loe", debüüt "Social Poetry" ilmus aastal 2001

  11. Small polaron hopping in magnetic semiconductors

    International Nuclear Information System (INIS)

    Emin, D.; Liu, N.L.H.

    1978-01-01

    In a number of magnetic insulators it has been hypothesized that the charge carriers form small polarons. The transfer of an electron between magnetic sites and how the magnetic nature of the material affects the rate which characterizes small-polaron hops between magnetic sites were studied. The basic transfer processes are addressed from a many-electron point in which the itinerant electron is treated as indistinguishable from those which contribute unpaired spins at the magnetic sites

  12. Hops (Humulus lupulus) Content in Beer Modulates Effects of Beer on the Liver After Acute Ingestion in Female Mice.

    Science.gov (United States)

    Landmann, Marianne; Sellmann, Cathrin; Engstler, Anna Janina; Ziegenhardt, Doreen; Jung, Finn; Brombach, Christine; Bergheim, Ina

    2017-01-01

    Using a binge-drinking mouse model, we aimed to determine whether hops (Humulus lupulus) in beer is involved in the less damaging effects of acute beer consumption on the liver in comparison with ethanol. Female C57BL/6 J mice were either fed one iso-alcoholic and iso-caloric bolus dose of ethanol, beer, beer without hops (6 g ethanol/kg body weight) or an iso-caloric bolus of maltodextrin control solution. Markers of steatosis, intestinal barrier function, activation of toll-like receptor 4 signaling cascades, lipid peroxidation and lipogenesis were determined in liver, small intestine and plasma 2 h and 12 h after acute alcohol ingestion. Alcohol-induced hepatic fat accumulation was significantly attenuated in mice fed beer whereas in those fed beer without hops, hepatic fat accumulation was similar to that found in ethanol-fed mice. While markers of intestinal barrier function e.g. portal endotoxin levels and lipogenesis only differed slightly between groups, hepatic concentrations of myeloid differentiation primary response gene 88, inducible nitric oxide synthase (iNOS) and plasminogen-activator inhibitor 1 protein as well as of 4-hydroxynonenal and 3-nitrotyrosine protein adducts were similarly elevated in livers of mice fed ethanol or beer without hops when compared with controls. Induction of these markers was markedly attenuated in mice fed hops-containing beer. Taken together, our data suggest that hops in beer markedly attenuated acute alcohol-induced liver steatosis in female mice through mechanisms involving a suppression of iNOS induction in the liver. © The Author 2016. Medical Council on Alcohol and Oxford University Press. All rights reserved.

  13. Rethinking Pedagogy in Urban Spaces: Implementing Hip-Hop Pedagogy in the Urban Science Classroom

    Science.gov (United States)

    Adjapong, Edmund S.; Emdin, Christopher

    2015-01-01

    A significant amount of research regarding Hip-Hop Based Education (HHBE) fails to provide insight on how to incorporate elements of Hip-Hop into daily teaching practices; rather Hip-Hop based educators focus mainly on incorporating Hip-Hop culture into curricula. This study explores the benefits of using two specific Hip-Hop pedagogical practices…

  14. Hip-Hop Is the Healer: Sense of Belonging and Diversity among Hip-Hop Collegians

    Science.gov (United States)

    Sulé, V. Thandi

    2016-01-01

    Sense of belonging is recognized as a factor contributing to persistence to graduation. Furthermore, interactional diversity is associated with learning and civic outcomes--touted higher education goals. Hip-hop culture, one of the most influential cultural creations of the mid-20th century, has succeeded in attracting devotees from diverse…

  15. Extraction of bitter acids from hops and hop products using pressurized solvent extraction (PSE)

    Czech Academy of Sciences Publication Activity Database

    Čulík, J.; Jurková, M.; Horák, T.; Čejka, P.; Kellner, V.; Dvořák, J.; Karásek, Pavel; Roth, Michal

    2009-01-01

    Roč. 115, č. 3 (2009), s. 220-225 ISSN 0046-9750 R&D Projects: GA ČR GA203/08/1536; GA MŠk 1M0570 Institutional research plan: CEZ:AV0Z40310501 Keywords : hops * bitter acids * pressurized solvent extraction Subject RIV: CB - Analytical Chemistry, Separation Impact factor: 1.000, year: 2009

  16. Being Hipped to Their Hop: Tapping into Young Minds through Hip Hop Play

    Science.gov (United States)

    Broughton, Anthony

    2017-01-01

    Adults gain a wealth of knowledge from listening to the voices of children through intentional observations and interactions [Owocki, G., and Y. M. Goodman. 2002. "Kidwatching: Documenting Children's Literacy Development." Portsmouth: Heinemann]. Hip Hop play may provide optimal opportunities for teachers to tap into the young minds of…

  17. Variational study of the pair hopping model

    International Nuclear Information System (INIS)

    Fazekas, P.

    1990-01-01

    We study the ground state of a Hamiltonian introduced by Kolb and Penson for modelling situations in which small electron pairs are formed. The Hamiltonian consists of a tight binding band term, and a term describing the nearest neighbour hopping of electron pairs. We give a Gutzwiller-type variational treatment, first with a single-parameter Ansatz treated in the single site Gutzwiller approximation, and then with more complicated trial wave functions, and an improved Gutzwiller approximation. The calculation yields a transition from a partially paired normal state, in which the spin susceptibility has a diminished value, into a fully paired state. (author). 16 refs, 2 figs

  18. Security for multi-hop wireless networks

    CERN Document Server

    Mahmoud, Mohamed M E A

    2014-01-01

    This Springer Brief discusses efficient security protocols and schemes for multi-hop wireless networks. It presents an overview of security requirements for these networks, explores challenges in securing networks and presents system models. The authors introduce mechanisms to reduce the overhead and identify malicious nodes that drop packets intentionally. Also included is a new, efficient cooperation incentive scheme to stimulate the selfish nodes to relay information packets and enforce fairness. Many examples are provided, along with predictions for future directions of the field. Security

  19. Being Hip-Hop: Beyond Skills and Songs

    Science.gov (United States)

    Kruse, Adam J.

    2016-01-01

    In this article, I offer four principles relevant to hip-hop cultures (keep it real, flip the script, make some noise, and stay fresh) and explore how these principles might affect music classrooms. I argue that a music classroom that works to keep it real, flip the script, make some noise, and stay fresh might go beyond teaching hip-hop skills…

  20. Framing Hip Hop: New Methodologies for New Times

    Science.gov (United States)

    Dimitriadis, Greg

    2015-01-01

    This article revisits the central impulse behind early advocacy for ethnographic approaches to hip hop--that critics should try as much as possible to limit their own certainties around what hip hop can and might mean. While ethnographic approaches can engender the kinds of personal dislocations that allow for this negotiation, they do not…

  1. Christian Hip Hop as Pedagogy: A South African Case Study

    Science.gov (United States)

    Abraham, Ibrahim

    2015-01-01

    Drawing on interviews with creators of Christian hip hop music in South Africa, this article demonstrates that this genre of popular music and youth culture is utilised as a form of pedagogy to transmit religious beliefs and values to contemporary youth. The pedagogical aspects of hip hop have been recognised in research on the topic, but the…

  2. Hip-Hop, the "Obama Effect," and Urban Science Education

    Science.gov (United States)

    Emdin, Christopher; Lee, Okhee

    2012-01-01

    Background/Context: With the ever increasing diversity of schools, and the persistent need to develop teaching strategies for the students who attend today's urban schools, hip-hop culture has been proposed to be a means through which urban youth can find success in school. As a result, studies of the role of hip-hop in urban education have grown…

  3. Romani Music - Roma and the Hip-hop Culture

    OpenAIRE

    Dočkal, Tomáš

    2007-01-01

    This thesis is focused on Romani music and its importance for the Romani culture. It examines the popularity of hip-hop among the young Romani generation and Romani hip- hip production. It attempts to define the role of hip-hop culture in young Romanies' lives.

  4. Hip Hop as Empowerment: Voices in El Alto, Bolivia

    Science.gov (United States)

    Tarifa, Ariana

    2012-01-01

    In response to neoliberal policies that have been in place since 1985, Bolivian young people have increasingly used hip hop music as a means of protest and to reclaim social and political participation. Hip hop in Latin America tells the story of the struggles that marginalized people have suffered, and speaks to the effects of international…

  5. Hop powdery mildew control through alteration of spring pruning practices

    Science.gov (United States)

    Since 1997, Podosphaera macularis, the causal agent of hop powdery mildew, has become a recurrent threat to hops in the Pacific Northwest because of the potential to reduce cone yield and quality. Disease management practices often involve preventative fungicide applications, but alternative approac...

  6. Investigating Cultural Collision: Educators' Perceptions of Hip-Hop Culture

    Science.gov (United States)

    Beachum, Floyd D.

    2013-01-01

    Hip-hop music has been embraced worldwide by youth, pummeled in the media for supposedly increasing social misery and hailed as a significant musical breakthrough. Hip-hop culture has transcended musical boundaries and now impacts speech, clothing, mannerisms, movies, websites, television programming, magazines, and energy drinks (Dyson, 2007;…

  7. Gap solitons in periodic Schrodinger lattice system with nonlinear hopping

    Directory of Open Access Journals (Sweden)

    Ming Cheng

    2016-10-01

    Full Text Available This article concerns the periodic discrete Schrodinger equation with nonlinear hopping on the infinite integer lattice. We obtain the existence of gap solitons by the linking theorem and concentration compactness method together with a periodic approximation technique. In addition, the behavior of such solutions is studied as $\\alpha\\to 0$. Notice that the nonlinear hopping can be sign changing.

  8. Toward Hip-Hop Pedagogies for Music Education

    Science.gov (United States)

    Kruse, Adam J.

    2016-01-01

    Music education scholarship in the areas of popular, vernacular, and participatory musicianship has grown in the past decades; however, music education research concerned specifically with hip-hop has been relatively scarce. Because hip-hop music can differ tremendously from the traditional western genres with which many music educators are most…

  9. Framing and Reviewing Hip-Hop Educational Research

    Science.gov (United States)

    Petchauer, Emery

    2009-01-01

    Hip-hop has become relevant to the field of education because of its implications for understanding language, learning, identity, curriculum, and other areas. This integrative review provides historical context and cohesion for the burgeoning and discursive body of hip-hop scholarship by framing it according to three heuristic categories and…

  10. Towards a Pedagogy of Hip Hop in Urban Teacher Education

    Science.gov (United States)

    Bridges, Thurman

    2011-01-01

    This article draws from a qualitative study often Black male K-12 teachers from the Hip Hop Generation who are closely connected to Hip Hop culture and have been effective in addressing the academic and social needs of Black boys. Through an analysis of their social, educational and cultural experiences, this article highlights three organizing…

  11. Electronic and vibrational hopping transport in boron carbides

    International Nuclear Information System (INIS)

    Emin, D.

    1991-01-01

    General concepts of hopping-type transport and localization are reviewed. Disorder, electronic correlations and atomic displacements, effects ignored in electronic band structure calculations, foster localization of electronic charge carriers. Examples are given that illustrate the efficacy of these effects in producing localization. This introduction is followed by a brief discussion of the relation between hopping-type transport and localization. The fundamentals of the formation, localization, and hopping transport of small polarons and/or bipolarons is then described. Electronic transport in boron carbides is presented as an example of the adiabatic hopping of small bipolarons. Finally, the notion of vibrational hopping is introduced. The high-temperature thermal diffusion in boron carbides is presented as a potential application of this idea

  12. Vortex variable range hopping in a conventional superconducting film

    Science.gov (United States)

    Percher, Ilana M.; Volotsenko, Irina; Frydman, Aviad; Shklovskii, Boris I.; Goldman, Allen M.

    2017-12-01

    The behavior of a disordered amorphous thin film of superconducting indium oxide has been studied as a function of temperature and magnetic field applied perpendicular to its plane. A superconductor-insulator transition has been observed, though the isotherms do not cross at a single point. The curves of resistance versus temperature on the putative superconducting side of this transition, where the resistance decreases with decreasing temperature, obey two-dimensional Mott variable-range hopping of vortices over wide ranges of temperature and resistance. To estimate the parameters of hopping, the film is modeled as a granular system and the hopping of vortices is treated in a manner analogous to hopping of charges. The reason the long-range interaction between vortices over the range of magnetic fields investigated does not lead to a stronger variation of resistance with temperature than that of two-dimensional Mott variable-range hopping remains unresolved.

  13. Hip Hop Culture's OGs: A Narrative Inquiry into the Intersection of Hip Hop Culture, Black Males and Their Schooling Experiences

    Science.gov (United States)

    Buchanan, Ian P.

    2013-01-01

    Using a critical race lens, this narrative study employs a focus group design to explore the intersections between black males, hip hop culture and schooling experiences. To provide a sociocultural grounding, this study first reviews the research literature around hip hop culture.s sociocultural development and its impact as a culture force that…

  14. Hip-Hop Is My Passport! Using Hip-Hop and Digital Literacies to Understand Global Citizenship Education

    Science.gov (United States)

    Horton, Akesha Monique

    2013-01-01

    Hip-hop has exploded around the world among youth. It is not simply an American source of entertainment; it is a global cultural movement that provides a voice for youth worldwide who have not been able to express their "cultural world" through mainstream media. The emerging field of critical hip-hop pedagogy has produced little…

  15. Communication devices for network-hopping communications and methods of network-hopping communications

    Science.gov (United States)

    Buttles, John W

    2013-04-23

    Wireless communication devices include a software-defined radio coupled to processing circuitry. The system controller is configured to execute computer programming code. Storage media is coupled to the system controller and includes computer programming code configured to cause the system controller to configure and reconfigure the software-defined radio to operate on each of a plurality of communication networks according to a selected sequence. Methods for communicating with a wireless device and methods of wireless network-hopping are also disclosed.

  16. Direct current hopping conductance along DNA chain

    Institute of Scientific and Technical Information of China (English)

    Ma Song-Shan; Xu Hui; Liu Xiao-Liang; Li Ming-Jun

    2007-01-01

    This paper proposes a model of direct current(DC) electron hopping transport in DNA,in which DNA is considered as a binary one-dimensional disordered system.To quantitatively study the DC conductivity in DNA,it numerically calculates the DC conductivity of DNA chains with difierent parameter values.The result shows that the DC conductivity of DNA chain increases with the increase of temperature.And the conductivity of DNA chain is depended on the probability P.which represents the degree of compositional disorder in a DNA sequence to some extent.For P<0.5,the conductivity of DNA chain decreases with the increase of P,while for P≥0.5,the conductivity increases with the increase of p.The DC conductivity in DNA chain also varies with the change of the electric field,it presents non-Ohm's law conductivity characteristics.

  17. Bit-padding information guided channel hopping

    KAUST Repository

    Yang, Yuli

    2011-02-01

    In the context of multiple-input multiple-output (MIMO) communications, we propose a bit-padding information guided channel hopping (BP-IGCH) scheme which breaks the limitation that the number of transmit antennas has to be a power of two based on the IGCH concept. The proposed scheme prescribes different bit-lengths to be mapped onto the indices of the transmit antennas and then uses padding technique to avoid error propagation. Numerical results and comparisons, on both the capacity and the bit error rate performances, are provided and show the advantage of the proposed scheme. The BP-IGCH scheme not only offers lower complexity to realize the design flexibility, but also achieves better performance. © 2011 IEEE.

  18. Particle hopping vs. fluid-dynamical models for traffic flow

    Energy Technology Data Exchange (ETDEWEB)

    Nagel, K.

    1995-12-31

    Although particle hopping models have been introduced into traffic science in the 19509, their systematic use has only started recently. Two reasons for this are, that they are advantageous on modem computers, and that recent theoretical developments allow analytical understanding of their properties and therefore more confidence for their use. In principle, particle hopping models fit between microscopic models for driving and fluiddynamical models for traffic flow. In this sense, they also help closing the conceptual gap between these two. This paper shows connections between particle hopping models and traffic flow theory. It shows that the hydrodynamical limits of certain particle hopping models correspond to the Lighthill-Whitham theory for traffic flow, and that only slightly more complex particle hopping models produce already the correct traffic jam dynamics, consistent with recent fluid-dynamical models for traffic flow. By doing so, this paper establishes that, on the macroscopic level, particle hopping models are at least as good as fluid-dynamical models. Yet, particle hopping models have at least two advantages over fluid-dynamical models: they straightforwardly allow microscopic simulations, and they include stochasticity.

  19. Suppression of hop looper (Lepidoptera: Noctuidae) by the fungicide pyraclostrobin.

    Science.gov (United States)

    Woods, J L; Gent, D H

    2014-04-01

    The hop looper, Hypena humuli Harris, is a reemergent pest of hop that often requires treatment to mitigate crop damage. In 4 yr of field trials, plots treated with fungicides were observed to sustain less hop looper defoliation compared with nontreated plots. Further investigation revealed that abundance of hop looper and associated defoliation were reduced when the fungicide pyraclostrobin was applied in late July to early August. Two other fungicides possessing active ingredients in the same chemical family (quinone outside inhibitor) did not reduce abundance of hop looper or its defoliation. Pyraclostrobin is efficacious against powdery mildew diseases, and the application timing evaluated in these studies corresponds with a period of juvenile susceptibility of hop cones to the disease. Use of fungicides containing pyraclostrobin at this time may have the ancillary benefit of reducing hop looper damage, potentially obviating the need for broad-spectrum insecticides later in the season. Follow-up studies are warranted to determine whether pyraclostrobin may inhibit other lepidopteran species.

  20. Scaffold hopping in drug discovery using inductive logic programming.

    Science.gov (United States)

    Tsunoyama, Kazuhisa; Amini, Ata; Sternberg, Michael J E; Muggleton, Stephen H

    2008-05-01

    In chemoinformatics, searching for compounds which are structurally diverse and share a biological activity is called scaffold hopping. Scaffold hopping is important since it can be used to obtain alternative structures when the compound under development has unexpected side-effects. Pharmaceutical companies use scaffold hopping when they wish to circumvent prior patents for targets of interest. We propose a new method for scaffold hopping using inductive logic programming (ILP). ILP uses the observed spatial relationships between pharmacophore types in pretested active and inactive compounds and learns human-readable rules describing the diverse structures of active compounds. The ILP-based scaffold hopping method is compared to two previous algorithms (chemically advanced template search, CATS, and CATS3D) on 10 data sets with diverse scaffolds. The comparison shows that the ILP-based method is significantly better than random selection while the other two algorithms are not. In addition, the ILP-based method retrieves new active scaffolds which were not found by CATS and CATS3D. The results show that the ILP-based method is at least as good as the other methods in this study. ILP produces human-readable rules, which makes it possible to identify the three-dimensional features that lead to scaffold hopping. A minor variant of a rule learnt by ILP for scaffold hopping was subsequently found to cover an inhibitor identified by an independent study. This provides a successful result in a blind trial of the effectiveness of ILP to generate rules for scaffold hopping. We conclude that ILP provides a valuable new approach for scaffold hopping.

  1. Hopping conductivity via deep impurity states in InP

    International Nuclear Information System (INIS)

    Kuznetsov, V.P.; Messerer, M.A.; Omel'yanovskij, Eh.M.

    1984-01-01

    Hopping (epsilon 3 ) and Mott conductivities via deep impurity compounds with localization radius below 10 A have been studied using as an example Mn in InP. It is shown, that the existing theory of hopping conductivity in low-alloyed semiconductors with Na 3 << 1 can be Used for the case of deep centres as successfully as for the case of insignificant hydrogen-like impurities. Fundamental parameters of the theory: localization radius of wave function of deep impurities, state density near the Fermi level, mean hop length, are determined

  2. Crossover in tunneling hops in systems of strongly localized electrons

    International Nuclear Information System (INIS)

    Lien Nguyen, V.; Gamietea, A.D.

    1995-11-01

    Accurate Monte-Carlo simulation data show a consistent crossover in different characters of tunneling hops in two-dimensional systems of strongly localized electrons in the presence of scattering and quantum interference of hopping paths. The results also suggest a negative answer to the question whether there is a two-dimensional sign phase transition. The fractal behaviour observed in the direction perpendicular to the hopping direction is found to be similar to that for eigenstates in one-dimensional localized systems. (author). 16 refs, 6 figs

  3. Let Me Blow Your Mind: Hip Hop Feminist Futures in Theory and Praxis

    Science.gov (United States)

    Lindsey, Treva B.

    2015-01-01

    This essay brings together key theoretical interventions in hip-hop feminism to explore the continued, but undervalued, significance of hip-hop feminism in urban education. More specifically, the essay challenges narrow conceptualizations of the "hip hop subject" as Black and male by using hip-hop feminist theory to incorporate the lived…

  4. Characterization of hop pectins shows the presence of an arabinogalactan-protein

    NARCIS (Netherlands)

    Oosterveld, A.; Voragen, A.G.J.; Schols, H.A.

    2002-01-01

    Hop pectins were extracted from spent hops using acid extraction conditions and were characterized chemically. The acid extraction of spent hops resulted in a yield of 2°containing 59 f polysaccharides. The hop pectins under investigation had a relatively high molecular weight and an intrinsic

  5. Understanding Mott's law from scaling of variable-range-hopping currents and intrinsic current fluctuations

    NARCIS (Netherlands)

    Pasveer, W.F.; Michels, M.A.J.

    2006-01-01

    We have used the master equation to simulate variable-range hopping (VRH) of charges in a strongly disordered d-dimensional energy landscape (d=1,2,3). The current distribution over hopping distances and hopping energies gives a clear insight into the difference between hops that occur most

  6. Performance Analysis of Millimeter-Wave Multi-hop Machine-to-Machine Networks Based on Hop Distance Statistics

    Directory of Open Access Journals (Sweden)

    Haejoon Jung

    2018-01-01

    Full Text Available As an intrinsic part of the Internet of Things (IoT ecosystem, machine-to-machine (M2M communications are expected to provide ubiquitous connectivity between machines. Millimeter-wave (mmWave communication is another promising technology for the future communication systems to alleviate the pressure of scarce spectrum resources. For this reason, in this paper, we consider multi-hop M2M communications, where a machine-type communication (MTC device with the limited transmit power relays to help other devices using mmWave. To be specific, we focus on hop distance statistics and their impacts on system performances in multi-hop wireless networks (MWNs with directional antenna arrays in mmWave for M2M communications. Different from microwave systems, in mmWave communications, wireless channel suffers from blockage by obstacles that heavily attenuate line-of-sight signals, which may result in limited per-hop progress in MWNs. We consider two routing strategies aiming at different types of applications and derive the probability distributions of their hop distances. Moreover, we provide their baseline statistics assuming the blockage-free scenario to quantify the impact of blockages. Based on the hop distance analysis, we propose a method to estimate the end-to-end performances (e.g., outage probability, hop count, and transmit energy of the mmWave MWNs, which provides important insights into mmWave MWN design without time-consuming and repetitive end-to-end simulation.

  7. Performance Analysis of Millimeter-Wave Multi-hop Machine-to-Machine Networks Based on Hop Distance Statistics.

    Science.gov (United States)

    Jung, Haejoon; Lee, In-Ho

    2018-01-12

    As an intrinsic part of the Internet of Things (IoT) ecosystem, machine-to-machine (M2M) communications are expected to provide ubiquitous connectivity between machines. Millimeter-wave (mmWave) communication is another promising technology for the future communication systems to alleviate the pressure of scarce spectrum resources. For this reason, in this paper, we consider multi-hop M2M communications, where a machine-type communication (MTC) device with the limited transmit power relays to help other devices using mmWave. To be specific, we focus on hop distance statistics and their impacts on system performances in multi-hop wireless networks (MWNs) with directional antenna arrays in mmWave for M2M communications. Different from microwave systems, in mmWave communications, wireless channel suffers from blockage by obstacles that heavily attenuate line-of-sight signals, which may result in limited per-hop progress in MWNs. We consider two routing strategies aiming at different types of applications and derive the probability distributions of their hop distances. Moreover, we provide their baseline statistics assuming the blockage-free scenario to quantify the impact of blockages. Based on the hop distance analysis, we propose a method to estimate the end-to-end performances (e.g., outage probability, hop count, and transmit energy) of the mmWave MWNs, which provides important insights into mmWave MWN design without time-consuming and repetitive end-to-end simulation.

  8. Hip hop jako kulturní styl, jeho spicifika a vliv na teenagery

    OpenAIRE

    POSPÍŠIL, Jan

    2008-01-01

    This thesis involves history of hip hop, its specifics and elements, it talks about influence of hip hip subculture on teenagers and points to positive and negative aspects connected to this culture style. In this way is work sectionalized into chapters. First part talks about history of hip hop, connection between religion and hip hop and also about Czech hip hop. Second part specifies on main elements of hip hop culture as DJing, MCing, breakdance, beatbox and graffiti. Last part focuses on...

  9. Switched diversity strategies for dual-hop relaying systems

    KAUST Repository

    Gaaloul, Fakhreddine; Alouini, Mohamed-Slim; Radaydeh, Redha M.

    2011-01-01

    This paper investigates the effect of different switched diversity configurations on the implementation complexity and achieved performance of dual-hop amplify-and-forward (AF) relaying networks. A low-complexity model of the relay station

  10. Majorana edge States in atomic wires coupled by pair hopping.

    Science.gov (United States)

    Kraus, Christina V; Dalmonte, Marcello; Baranov, Mikhail A; Läuchli, Andreas M; Zoller, P

    2013-10-25

    We present evidence for Majorana edge states in a number conserving theory describing a system of spinless fermions on two wires that are coupled by pair hopping. Our analysis is based on a combination of a qualitative low energy approach and numerical techniques using the density matrix renormalization group. In addition, we discuss an experimental realization of pair-hopping interactions in cold atom gases confined in optical lattices.

  11. Signaling induced by hop/STI-1 depends on endocytosis

    International Nuclear Information System (INIS)

    Americo, Tatiana A.; Chiarini, Luciana B.; Linden, Rafael

    2007-01-01

    The co-chaperone hop/STI-1 is a ligand of the cell surface prion protein (PrP C ), and their interaction leads to signaling and biological effects. Among these, hop/STI-1 induces proliferation of A172 glioblastoma cells, dependent on both PrP C and activation of the Erk pathway. We tested whether clathrin-mediated endocytosis affects signaling induced by hop/STI-1. Both hyperosmolarity induced by sucrose and monodansyl-cadaverine blocked Erk activity induced by hop/STI-1, without affecting the high basal Akt activity typical of A172. The endocytosis inhibitors also affected the sub-cellular distribution of phosphorylated Erk, consistent with blockade of the latter's activity. The data indicate that signaling induced by hop/STI-1 depends on endocytosis. These findings are consistent with a role of sub-cellular trafficking in signal transduction following engagement by PrP C by ligands such as hop/STI-1, and may help help unravel both the functions of the prion protein, as well as possible loss-of-function components of prion diseases

  12. Low Power Multi-Hop Networking Analysis in Intelligent Environments.

    Science.gov (United States)

    Etxaniz, Josu; Aranguren, Gerardo

    2017-05-19

    Intelligent systems are driven by the latest technological advances in many different areas such as sensing, embedded systems, wireless communications or context recognition. This paper focuses on some of those areas. Concretely, the paper deals with wireless communications issues in embedded systems. More precisely, the paper combines the multi-hop networking with Bluetooth technology and a quality of service (QoS) metric, the latency. Bluetooth is a radio license-free worldwide communication standard that makes low power multi-hop wireless networking available. It establishes piconets (point-to-point and point-to-multipoint links) and scatternets (multi-hop networks). As a result, many Bluetooth nodes can be interconnected to set up ambient intelligent networks. Then, this paper presents the results of the investigation on multi-hop latency with park and sniff Bluetooth low power modes conducted over the hardware test bench previously implemented. In addition, the empirical models to estimate the latency of multi-hop communications over Bluetooth Asynchronous Connectionless Links (ACL) in park and sniff mode are given. The designers of devices and networks for intelligent systems will benefit from the estimation of the latency in Bluetooth multi-hop communications that the models provide.

  13. Extreme Kinematics in Selected Hip Hop Dance Sequences.

    Science.gov (United States)

    Bronner, Shaw; Ojofeitimi, Sheyi; Woo, Helen

    2015-09-01

    Hip hop dance has many styles including breakdance (breaking), house, popping and locking, funk, streetdance, krumping, Memphis jookin', and voguing. These movements combine the complexity of dance choreography with the challenges of gymnastics and acrobatic movements. Despite high injury rates in hip hop dance, particularly in breakdance, to date there are no published biomechanical studies in this population. The purpose of this study was to compare representative hip hop steps found in breakdance (toprock and breaking) and house and provide descriptive statistics of the angular displacements that occurred in these sequences. Six expert female hip hop dancers performed three choreographed dance sequences, top rock, breaking, and house, to standardized music-based tempos. Hip, knee, and ankle kinematics were collected during sequences that were 18 to 30 sec long. Hip, knee, and ankle three-dimensional peak joint angles were compared in repeated measures ANOVAs with post hoc tests where appropriate (pHip hop maximal joint angles exceeded reported activities of daily living and high injury sports such as gymnastics. Hip hop dancers work at weight-bearing joint end ranges where muscles are at a functional disadvantage. These results may explain why lower extremity injury rates are high in this population.

  14. The Hip-Hop club scene: Gender, grinding and sex.

    Science.gov (United States)

    Muñoz-Laboy, Miguel; Weinstein, Hannah; Parker, Richard

    2007-01-01

    Hip-Hop culture is a key social medium through which many young men and women from communities of colour in the USA construct their gender. In this study, we focused on the Hip-Hop club scene in New York City with the intention of unpacking narratives of gender dynamics from the perspective of young men and women, and how these relate to their sexual experiences. We conducted a three-year ethnographic study that included ethnographic observations of Hip-Hop clubs and their social scene, and in-depth interviews with young men and young women aged 15-21. This paper describes how young people negotiate gender relations on the dance floor of Hip-Hop clubs. The Hip-Hop club scene represents a context or setting where young men's masculinities are contested by the social environment, where women challenge hypermasculine privilege and where young people can set the stage for what happens next in their sexual and emotional interactions. Hip-Hop culture therefore provides a window into the gender and sexual scripts of many urban minority youth. A fuller understanding of these patterns can offer key insights into the social construction of sexual risk, as well as the possibilities for sexual health promotion, among young people in urban minority populations.

  15. Relationships between Xanthohumol and Polyphenol Content in Hop Leaves and Hop Cones with Regard to Water Supply and Cultivar

    Science.gov (United States)

    Čeh, Barbara; Kač, Milica; Košir, Iztok J.; Abram, Veronika

    2007-01-01

    The effect of water supply – especially of drought stress – on the content of some secondary metabolites in hops (Humulus lupulus L.) was studied. The experiment took place in 2006. Some relevant data from 2005 were included for comparison. Leaves and cones of nine hop cultivars grown under field conditions as well as in a pot experiment under three water regimes were analyzed. The cultivars ranged from those most grown in Slovenia to promising crossbreed being tested. Leaves were sampled from July 18, 2006 to August 18, 2006, while cones were picked in the time of technological maturity. Standard analytical methods were applied to determine the contents of xanthohumol, polyphenols and α-acids in hop leaves and hop cones. The contents of the secondary metabolites in question depended more on the cultivar under investigation than on the water supply, at least as far the growing conditions for a relatively normal development of the plant were met.

  16. Fast Hopping Frequency Generation in Digital CMOS

    CERN Document Server

    Farazian, Mohammad; Gudem, Prasad S

    2013-01-01

    Overcoming the agility limitations of conventional frequency synthesizers in multi-band OFDM ultra wideband is a key research goal in digital technology. This volume outlines a frequency plan that can generate all the required frequencies from a single fixed frequency, able to implement center frequencies with no more than two levels of SSB mixing. It recognizes the need for future synthesizers to bypass on-chip inductors and operate at low voltages to enable the increased integration and efficiency of networked appliances. The author examines in depth the architecture of the dividers that generate the necessary frequencies from a single base frequency and are capable of establishing a fractional division ratio.   Presenting the first CMOS inductorless single PLL 14-band frequency synthesizer for MB-OFDMUWB makes this volume a key addition to the literature, and with the synthesizer capable of arbitrary band-hopping in less than two nanoseconds, it operates well within the desired range on a 1.2-volt power s...

  17. Transmembrane and ubiquitin-like domain-containing protein 1 (Tmub1/HOPS facilitates surface expression of GluR2-containing AMPA receptors.

    Directory of Open Access Journals (Sweden)

    Hyunjeong Yang

    Full Text Available Some ubiquitin-like (UBL domain-containing proteins are known to play roles in receptor trafficking. Alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionic acid receptors (AMPARs undergo constitutive cycling between the intracellular compartment and the cell surface in the central nervous system. However, the function of UBL domain-containing proteins in the recycling of the AMPARs to the synaptic surface has not yet been reported.Here, we report that the Transmembrane and ubiquitin-like domain-containing 1 (Tmub1 protein, formerly known as the Hepatocyte Odd Protein Shuttling (HOPS protein, which is abundantly expressed in the brain and which exists in a synaptosomal membrane fraction, facilitates the recycling of the AMPAR subunit GluR2 to the cell surface. Neurons transfected with Tmub1/HOPS-RNAi plasmids showed a significant reduction in the AMPAR current as compared to their control neurons. Consistently, the synaptic surface expression of GluR2, but not of GluR1, was significantly decreased in the neurons transfected with the Tmub1/HOPS-RNAi and increased in the neurons overexpressing EGFP-Tmub1/HOPS. The altered surface expression of GluR2 was speculated to be due to the altered surface-recycling of the internalized GluR2 in our recycling assay. Eventually, we found that GluR2 and glutamate receptor interacting protein (GRIP were coimmunoprecipitated by the anti-Tmub1/HOPS antibody from the mouse brain. Taken together, these observations show that the Tmub1/HOPS plays a role in regulating basal synaptic transmission; it contributes to maintain the synaptic surface number of the GluR2-containing AMPARs by facilitating the recycling of GluR2 to the plasma membrane.

  18. From "They" Science to "Our" Science: Hip Hop Epistemology in STEAM Education

    Science.gov (United States)

    Dolberry, Maurice E.

    Hip hop has moved from being considered a type of music into being understood as a culture in which a prominent type of music originates. Hip hop culture has a philosophy and epistemological constructs as well. This study analyzed those constructs to determine how conceptions of science factor in hip hop worldviews. Pedagogical models in culturally responsive teaching and Science, Technology, Engineering, Arts, and Mathematics (STEAM) education were also examined to discern their philosophical connections with hip hop culture. These connections were used to create two theoretical models. The first one, Hip Hop Science, described how scientific thought functions in hip hop culture. The second model, Hip Hop STEAM Pedagogy, proposes how hip hop culture can inform STEAM teaching practices. The study began by using Critical Race Theory to create a theoretical framework proposing how the two theoretical models could be derived from the philosophical and pedagogical concepts. Content analysis and narrative inquiry were used to analyze data collected from scholarly texts, hip hop songs, and interviews with hip hop-responsive educators. The data from these sources were used initially to assess the adequacy of the proposed theoretical framework, and subsequently to improve its viability. Four overlapping themes emerged from the data analyses, including hip hop-resistance to formal education; how hip hop culture informs pedagogical practice in hip hop-responsive classrooms; conceptions of knowledge and reality that shape how hip hoppers conduct scientific inquiry; and hip hop-based philosophies of effective teaching for hip hoppers as a marginalized cultural group. The findings indicate that there are unique connections between hip hop epistemology, sciencemindedness, and pedagogical practices in STEAM education. The revised theoretical framework clarified the nature of these connections, and supported claims from prior research that hip hop culture provides viable sites of

  19. Cultivated grapevines represent a symptomless reservoir for the transmission of hop stunt viroid to hop crops: 15 years of evolutionary analysis.

    Directory of Open Access Journals (Sweden)

    Yoko Kawaguchi-Ito

    Full Text Available Hop stunt was a mysterious disorder that first emerged in the 1940s in commercial hops in Japan. To investigate the origin of this disorder, we infected hops with natural Hop stunt viroid (HpSVd isolates derived from four host species (hop, grapevine, plum and citrus, which except for hop represent possible sources of the ancestral viroid. These plants were maintained for 15 years, then analyzed the HpSVd variants present. Here we show that the variant originally found in cultivated grapevines gave rise to various combinations of mutations at positions 25, 26, 54, 193, and 281. However, upon prolonged infection, these variants underwent convergent evolution resulting in a limited number of adapted mutants. Some of them showed nucleotide sequences identical to those currently responsible for hop stunt epidemics in commercial hops in Japan, China, and the United States. Therefore, these results indicate that we have successfully reproduced the original process by which a natural HpSVd variant naturally introduced into cultivated hops was able to mutate into the HpSVd variants that are currently present in commercial hops. Furthermore, and importantly, we have identified cultivated grapevines as a symptomless reservoir in which HSVd can evolve and be transmitted to hop crops to cause epidemics.

  20. Surface hopping simulation of vibrational predissociation of methanol dimer

    Science.gov (United States)

    Jiang, Ruomu; Sibert, Edwin L.

    2012-06-01

    The mixed quantum-classical surface hopping method is applied to the vibrational predissociation of methanol dimer, and the results are compared to more exact quantum calculations. Utilizing the vibrational SCF basis, the predissociation problem is cast into a curve crossing problem between dissociative and quasibound surfaces with different vibrational character. The varied features of the dissociative surfaces, arising from the large amplitude OH torsion, generate rich predissociation dynamics. The fewest switches surface hopping algorithm of Tully [J. Chem. Phys. 93, 1061 (1990), 10.1063/1.459170] is applied to both diabatic and adiabatic representations. The comparison affords new insight into the criterion for selecting the suitable representation. The adiabatic method's difficulty with low energy trajectories is highlighted. In the normal crossing case, the diabatic calculations yield good results, albeit showing its limitation in situations where tunneling is important. The quadratic scaling of the rates on coupling strength is confirmed. An interesting resonance behavior is identified and is dealt with using a simple decoherence scheme. For low lying dissociative surfaces that do not cross the quasibound surface, the diabatic method tends to overestimate the predissociation rate whereas the adiabatic method is qualitatively correct. Analysis reveals the major culprits involve Rabi-like oscillation, treatment of classically forbidden hops, and overcoherence. Improvements of the surface hopping results are achieved by adopting a few changes to the original surface hopping algorithms.

  1. Particle trapping and hopping in an optofluidic fishnet

    Science.gov (United States)

    Shi, Y. Z.; Xiong, S.; Zhang, Y.; Chin, L. K.; Wu, J. H.; Chen, T. N.; Liu, A. Q.

    2017-08-01

    Particle jumping between optical potentials has attracted much attention owing to its extensive involvement in many physical and biological experiments. In some circumstances, particle jumping indicates escaping from the optical trap, which is an issue people are trying to avoid. Nevertheless, particle jumping can facilitate the individual trap in each laser spot in the optical lattice and enable sorting and delivery of nanoparticles. Particle hopping has not been seen in fluid because Fluidic drag force dramatically reduce the dwell time of particle or break the potential well. Here, we observe particle hopping in the microchannel by three reasons, e.g., particle collision or aggregation, light disturbing by pretrapped particle and fake trapping position. We show that commonly ignored particle influence to the light could create a new isolated trapping position, where particle hops to the adjacent potential well. The hopping happens in an optofluidic fishnet which is comprised of discrete hotspots enabling 2D patterning of particles in the flow stream for the first time. We also achieve a 2D patterning of cryptosporidium in the microchannel. Our observed particle hopping in the flow stream completes the family of particle kinetics in potential wells and inspires new interests in the particle disturbed optical trapping. The 2D patterning of particles benefits the parallel study of biological samples in the flow stream and have potential on cell sorting and drug delivery.

  2. Hip Hop Dance Experience Linked to Sociocognitive Ability.

    Science.gov (United States)

    Bonny, Justin W; Lindberg, Jenna C; Pacampara, Marc C

    2017-01-01

    Expertise within gaming (e.g., chess, video games) and kinesthetic (e.g., sports, classical dance) activities has been found to be linked with specific cognitive skills. Some of these skills, working memory, mental rotation, problem solving, are linked to higher performance in science, technology, math, and engineering (STEM) disciplines. In the present study, we examined whether experience in a different activity, hip hop dance, is also linked to cognitive abilities connected with STEM skills as well as social cognition ability. Dancers who varied in hip hop and other dance style experience were presented with a set of computerized tasks that assessed working memory capacity, mental rotation speed, problem solving efficiency, and theory of mind. We found that, when controlling for demographic factors and other dance style experience, those with greater hip hop dance experience were faster at mentally rotating images of hands at greater angle disparities and there was a trend for greater accuracy at identifying positive emotions displayed by cropped images of human faces. We suggest that hip hop dance, similar to other more technical activities such as video gameplay, tap some specific cognitive abilities that underlie STEM skills. Furthermore, we suggest that hip hop dance experience can be used to reach populations who may not otherwise be interested in other kinesthetic or gaming activities and potentially enhance select sociocognitive skills.

  3. Hip Hop Dance Experience Linked to Sociocognitive Ability.

    Directory of Open Access Journals (Sweden)

    Justin W Bonny

    Full Text Available Expertise within gaming (e.g., chess, video games and kinesthetic (e.g., sports, classical dance activities has been found to be linked with specific cognitive skills. Some of these skills, working memory, mental rotation, problem solving, are linked to higher performance in science, technology, math, and engineering (STEM disciplines. In the present study, we examined whether experience in a different activity, hip hop dance, is also linked to cognitive abilities connected with STEM skills as well as social cognition ability. Dancers who varied in hip hop and other dance style experience were presented with a set of computerized tasks that assessed working memory capacity, mental rotation speed, problem solving efficiency, and theory of mind. We found that, when controlling for demographic factors and other dance style experience, those with greater hip hop dance experience were faster at mentally rotating images of hands at greater angle disparities and there was a trend for greater accuracy at identifying positive emotions displayed by cropped images of human faces. We suggest that hip hop dance, similar to other more technical activities such as video gameplay, tap some specific cognitive abilities that underlie STEM skills. Furthermore, we suggest that hip hop dance experience can be used to reach populations who may not otherwise be interested in other kinesthetic or gaming activities and potentially enhance select sociocognitive skills.

  4. Hopping control channel MAC protocol for opportunistic spectrum access networks

    Institute of Scientific and Technical Information of China (English)

    FU Jing-tuan; JI Hong; MAO Xu

    2010-01-01

    Opportunistic spectrum access (OSA) is considered as a promising approach to mitigate spectrum scarcity by allowing unlicensed users to exploit spectrum opportunities in licensed frequency bands. Derived from the existing channel-hopping multiple access (CHMA) protocol,we introduce a hopping control channel medium access control (MAC) protocol in the context of OSA networks. In our proposed protocol,all nodes in the network follow a common channel-hopping sequence; every frequency channel can be used as control channel and data channel. Considering primary users' occupancy of the channel,we use a primary user (PU) detection model to calculate the channel availability for unlicensed users' access. Then,a discrete Markov chain analytical model is applied to describe the channel states and deduce the system throughput. Through simulation,we present numerical results to demonstrate the throughput performance of our protocol and thus validate our work.

  5. Comparison of Rheological Properties of Hopped Wort and Malt Wort

    Directory of Open Access Journals (Sweden)

    Petr Trávníček

    2015-01-01

    Full Text Available The aim of this work is determination rheological properties of hopped wort and malt wort and their comparison. In the paper following rheological properties has been described: the dependence of viscosity on a temperature of a sample and hysteresis loop test. The time dependence test was performed for a confirmation thixotropic behaviour. Based on measured values Arrhenius mathematical model has been applied. The activation energy was determined by using of this model. Tests have been carried out in the temperature range from 5 °C to 40 °C. Rheological tests proved that malt wort behaves as Newtonian fluid in all temperatures and hopped wort behaves as non-Newtonian fluid at low temperatures. Thixotropic behaviour is caused by the content of the rests of hops heads or malt scraps.

  6. Switched diversity strategies for dual-hop relaying systems

    KAUST Repository

    Gaaloul, Fakhreddine

    2011-04-29

    This paper investigates the effect of different switched diversity configurations on the implementation complexity and achieved performance of dual-hop amplify-and-forward (AF) relaying networks. A low-complexity model of the relay station is adopted, wherein single-input single-output antenna configuration is employed. Each of the transmitter and the receiver however employs multiple antennas to improve the overall link performance. Single-phase and two-phase based receive switching strategies are investigated assuming optimum first hop signal-to-noise ratio (SNR). Moreover, the simple scheme in which the switched diversity is applied independently over the two hops is studied using tight upper bounds. Thorough performance comparisons and switching thresholds optimization for the aforementioned strategies are presented. Simulation results are also provided to validate the mathematical development and to verify the numerical computations.

  7. Hopping magnetotransport via nonzero orbital momentum states and organic magnetoresistance.

    Science.gov (United States)

    Alexandrov, Alexandre S; Dediu, Valentin A; Kabanov, Victor V

    2012-05-04

    In hopping magnetoresistance of doped insulators, an applied magnetic field shrinks the electron (hole) s-wave function of a donor or an acceptor and this reduces the overlap between hopping sites resulting in the positive magnetoresistance quadratic in a weak magnetic field, B. We extend the theory of hopping magnetoresistance to states with nonzero orbital momenta. Different from s states, a weak magnetic field expands the electron (hole) wave functions with positive magnetic quantum numbers, m>0, and shrinks the states with negative m in a wide region outside the point defect. This together with a magnetic-field dependence of injection/ionization rates results in a negative weak-field magnetoresistance, which is linear in B when the orbital degeneracy is lifted. The theory provides a possible explanation of a large low-field magnetoresistance in disordered π-conjugated organic materials.

  8. Contribution of afferent feedback and descending drive to human hopping

    DEFF Research Database (Denmark)

    Zuur, Abraham T.; Lundbye-Jensen, Jesper; Leukel, Christian

    2010-01-01

    During hopping an early burst can be observed in the EMG from the soleus muscle starting about 45 ms after touch-down. It may be speculated that this early EMG burst is a stretch reflex response superimposed on activity from a supra-spinal origin. We hypothesised that if a stretch reflex indeed...... contributes to the early EMG burst, then advancing or delaying the touch-down without the subject's knowledge should similarly advance or delay the burst. This was indeed the case when touch-down was advanced or delayed by shifting the height of a programmable platform up or down between two hops...... and this resulted in a correspondent shift of the early EMG burst. Our second hypothesis was that the motor cortex contributes to the first EMG burst during hopping. If so, inhibition of the motor cortex would reduce the magnitude of the burst. By applying a low-intensity magnetic stimulus it was possible...

  9. Dual-Hop VLC/RF Transmission System with Energy Harvesting Relay under Delay Constraint

    KAUST Repository

    Rakia, Tamer; Yang, Hong-Chuan; Gebali, Fayez; Alouini, Mohamed-Slim

    2017-01-01

    In this paper, we introduce a dual-hop visible light communication (VLC) / radio frequency (RF) transmission system to extend the coverage of indoor VLC systems. The relay between the two hops is able to harvest light energy from different

  10. From Broken Glass to Ruf Diamonds: Manchester Hip Hop

    OpenAIRE

    de Paor-Evans, Adam

    2018-01-01

    When one considers music culture in Manchester during the 1980s and 1990s, Hip Hop is not an obvious cultural arena for discussion. However, amidst the spectacle of The Haçienda, the pop boom of Factory Records and the evolution of rave subculture and form of dance music which produced the pop cultural phenomenon of Madchester; in the space of music between The Fall and The Charlatans where brief stardom was found by Inspiral Carpets, Northside and Candyflip, Mancunian Hip Hop was also evolvi...

  11. Starting with Style: Toward a Second Wave of Hip-Hop Education Research and Practice

    Science.gov (United States)

    Petchauer, Emery

    2015-01-01

    One fundamental breakthrough in the field of hip-hop education in recent years is the shift from understanding hip-hop solely as content to understanding hip-hop also as aesthetic form. In this article, I chart the roots of this shift across disciplines and focus on what it might mean for the future of hip-hop education, pedagogy, and research in…

  12. Suppression of Plant Immune Responses by the Pseudomonas savastanoi pv. savastanoi NCPPB 3335 Type III Effector Tyrosine Phosphatases HopAO1 and HopAO2

    Directory of Open Access Journals (Sweden)

    María Pilar Castañeda-Ojeda

    2017-05-01

    Full Text Available The effector repertoire of the olive pathogen P. savastanoi pv. savastanoi NCPPB 3335 includes two members of the HopAO effector family, one of the most diverse T3E families of the P. syringae complex. The study described here explores the phylogeny of these dissimilar members, HopAO1 and HopAO2, among the complex and reveals their activities as immune defense suppressors. Although HopAO1 is predominantly encoded by phylogroup 3 strains isolated from woody organs of woody hosts, both HopAO1 and HopAO2 are phylogenetically clustered according to the woody/herbaceous nature of their host of isolation, suggesting host specialization of the HopAO family across the P. syringae complex. HopAO1 and HopAO2 translocate into plant cells and show hrpL-dependent expression, which allows their classification as actively deployed type III effectors. Our data also show that HopAO1 and HopAO2 possess phosphatase activity, a hallmark of the members of this family. Both of them exert an inhibitory effect on early plant defense responses, such as ROS production and callose deposition, and are able to suppress ETI responses induced by the effectorless polymutant of P. syringae pv. tomato DC3000 (DC3000D28E in Nicotiana. Moreover, we demonstrate that a ΔhopAO1 mutant of P. savastanoi NCPBB 3335 exhibits a reduced fitness and virulence in olive plants, which supports the relevance of this effector during the interaction of this strain with its host plants. This work contributes to the field with the first report regarding functional analysis of HopAO homologs encoded by P. syringae or P. savastanoi strains isolated from woody hosts.

  13. Suppression of Plant Immune Responses by the Pseudomonas savastanoi pv. savastanoi NCPPB 3335 Type III Effector Tyrosine Phosphatases HopAO1 and HopAO2

    Science.gov (United States)

    Castañeda-Ojeda, María Pilar; Moreno-Pérez, Alba; Ramos, Cayo; López-Solanilla, Emilia

    2017-01-01

    The effector repertoire of the olive pathogen P. savastanoi pv. savastanoi NCPPB 3335 includes two members of the HopAO effector family, one of the most diverse T3E families of the P. syringae complex. The study described here explores the phylogeny of these dissimilar members, HopAO1 and HopAO2, among the complex and reveals their activities as immune defense suppressors. Although HopAO1 is predominantly encoded by phylogroup 3 strains isolated from woody organs of woody hosts, both HopAO1 and HopAO2 are phylogenetically clustered according to the woody/herbaceous nature of their host of isolation, suggesting host specialization of the HopAO family across the P. syringae complex. HopAO1 and HopAO2 translocate into plant cells and show hrpL-dependent expression, which allows their classification as actively deployed type III effectors. Our data also show that HopAO1 and HopAO2 possess phosphatase activity, a hallmark of the members of this family. Both of them exert an inhibitory effect on early plant defense responses, such as ROS production and callose deposition, and are able to suppress ETI responses induced by the effectorless polymutant of P. syringae pv. tomato DC3000 (DC3000D28E) in Nicotiana. Moreover, we demonstrate that a ΔhopAO1 mutant of P. savastanoi NCPBB 3335 exhibits a reduced fitness and virulence in olive plants, which supports the relevance of this effector during the interaction of this strain with its host plants. This work contributes to the field with the first report regarding functional analysis of HopAO homologs encoded by P. syringae or P. savastanoi strains isolated from woody hosts. PMID:28529516

  14. Post-Menopausal Vaginal Hemorrhage Related to the Use of a Hop-Containing Phytotherapeutic Product

    NARCIS (Netherlands)

    van Hunsel, Florence; van de Koppel, Sonja; van Puijenbroek, Eugène

    2015-01-01

    Two 54-year-old women developed abdominal cramps and vaginal hemorrhage as a result of endometrial hyperplasia during treatment with a hop-containing phytotherapeutic product (MenoCool®) for post-menopausal complaints. The women used the hop-containing phytotherapeutic product (418 mg of hop per

  15. Flipping the Misogynist Script: Gender, Agency, Hip Hop and Music Education

    Science.gov (United States)

    Tobias, Evan S.

    2014-01-01

    Excluding Hip Hop culture and rap music from music education misses opportunities for addressing key aspects of popular culture, society, and students' lives. This article addresses intersections of Hip Hop, gender, and music education to forward potential Hip Hop praxis. After tracing related scholarship, I discuss and problematize…

  16. Energy management that generates terrain following versus apex-preserving hopping in man and machine.

    Science.gov (United States)

    Kalveram, Karl Theodor; Haeufle, Daniel F B; Seyfarth, André; Grimmer, Sten

    2012-01-01

    While hopping, 12 subjects experienced a sudden step down of 5 or 10 cm. Results revealed that the hopping style was "terrain following". It means that the subjects pursued to keep the distance between maximum hopping height (apex) and ground profile constant. The spring-loaded inverse pendulum (SLIP) model, however, which is currently considered as template for stable legged locomotion would predict apex-preserving hopping, by which the absolute maximal hopping height is kept constant regardless of changes of the ground level. To get more insight into the physics of hopping, we outlined two concepts of energy management: "constant energy supply", by which in each bounce--regardless of perturbations--the same amount of mechanical energy is injected, and "lost energy supply", by which the mechanical energy that is going to be dissipated in the current cycle is assessed and replenished. When tested by simulations and on a robot testbed capable of hopping, constant energy supply generated stable and robust terrain following hopping, whereas lost energy supply led to something like apex-preserving hopping, which, however, lacks stability as well as robustness. Comparing simulated and machine hopping with human hopping suggests that constant energy supply has a good chance to be used by humans to generate hopping.

  17. "Deeper than Rap": Gifted Males and Their Relationship with Hip Hop Culture

    Science.gov (United States)

    Callahan, J. Sean; Grantham, Tarek C.

    2012-01-01

    One would be hard-pressed to deny the impact that hip hop is having on gifted students. More specifically, because hip hop is a creative and exciting male-dominated culture, gifted males gravitate to hip hop culture. From the perspective of two Black men from two different generations, this article was inspired by discussions about the role of hip…

  18. Behind Beats and Rhymes: Working Class from a Hampton Roads Hip Hop Homeplace

    Science.gov (United States)

    Durham, Aisha S.

    2009-01-01

    The film documentary titled "Hip Hop: beyond beats and rhymes" captures ongoing conversations among scholars, cultural critics, and hip hop insiders about the state of African Americans by interrogating distinct expressive forms associated with hip hop culture. Durham draws from two scenes to describe her memories as the researched…

  19. Beats, Rhymes, and Classroom Life: Hip-Hop Pedagogy and the Politics of Identity

    Science.gov (United States)

    Hill, Marc Lamont

    2009-01-01

    For over a decade, educators have looked to capitalize on the appeal of hip-hop culture, sampling its language, techniques, and styles as a way of reaching out to students. But beyond a fashionable hipness, what does hip-hop have to offer our schools? In this revelatory new book, Marc Lamont Hill shows how a serious engagement with hip-hop culture…

  20. Wish to Live: The Hip-Hop Feminism Pedagogy Reader. Educational Psychology. Volume 3

    Science.gov (United States)

    Brown, Ruth Nicole, Ed.; Kwakye, Chamara Jewel, Ed.

    2012-01-01

    "Wish To Live: The Hip-hop Feminism Pedagogy Reader" moves beyond the traditional understanding of the four elements of hip-hop culture--rapping, breakdancing, graffiti art, and deejaying--to articulate how hip-hop feminist scholarship can inform educational practices and spark, transform, encourage, and sustain local and global youth…

  1. Adjusting Sensing Range to Maximize Throughput on Ad-Hoc Multi-Hop Wireless Networks

    National Research Council Canada - National Science Library

    Roberts, Christopher

    2003-01-01

    .... Such a network is referred to as a multi-hop ad-hoc network, or simply a multi-hop network. Most multi-hop network protocols use some form of carrier sensing to determine if the wireless channel is in use...

  2. Costs and returns of producing hops in established tree plantations

    Science.gov (United States)

    Kim Ha; Shadi Atallah; Tamara Benjamin; Lori Hoagland; Lenny Farlee; Keith. Woeste

    2017-01-01

    This article is the first of two publications that analyzes economic opportunities in forest farming for Indiana forest plantation owners. This study explores growing hops along the fence lines of newly established forest stands, while the second study investigates producing American ginseng in older (20- to 30-year-old) forests. The economic analysis presented in this...

  3. Range and energetics of charge hopping in organic semiconductors

    Science.gov (United States)

    Abdalla, Hassan; Zuo, Guangzheng; Kemerink, Martijn

    2017-12-01

    The recent upswing in attention for the thermoelectric properties of organic semiconductors (OSCs) adds urgency to the need for a quantitative description of the range and energetics of hopping transport in organic semiconductors under relevant circumstances, i.e., around room temperature (RT). In particular, the degree to which hops beyond the nearest neighbor must be accounted for at RT is still largely unknown. Here, measurements of charge and energy transport in doped OSCs are combined with analytical modeling to reach the univocal conclusion that variable-range hopping is the proper description in a large class of disordered OSC at RT. To obtain quantitative agreement with experiment, one needs to account for the modification of the density of states by ionized dopants. These Coulomb interactions give rise to a deep tail of trap states that is independent of the material's initial energetic disorder. Insertion of this effect into a classical Mott-type variable-range hopping model allows one to give a quantitative description of temperature-dependent conductivity and thermopower measurements on a wide range of disordered OSCs. In particular, the model explains the commonly observed quasiuniversal power-law relation between the Seebeck coefficient and the conductivity.

  4. Wireless multi-hop networks with stealing : large buffer asymptotics

    NARCIS (Netherlands)

    Guillemin, F.; Knessl, C.; Leeuwaarden, van J.S.H.

    2010-01-01

    Wireless networks equipped with CSMA are scheduled in a fully distributed manner. A disadvantage of such distributed control in multi-hop networks is the hidden node problem that causes the effect of stealing, in which a downstream node steals the channel from an upstream node with probability p.

  5. Examining Hip-Hop as Culturally Relevant Pedagogy

    Science.gov (United States)

    Kim, Jung; Pulido, Isaura

    2015-01-01

    Culturally relevant pedagogy is a framework that conceptualizes the process of student learning as contingent upon educators' deep understanding of students' cultural backgrounds to co-construct knowledge and develop academic skills. Concurrently, there are a growing number of studies that explore hip-hop as a culturally relevant curriculum for…

  6. Crossing the Lexicon: Anglicisms in the German Hip Hop Community

    Science.gov (United States)

    Garley, Matthew E.

    2012-01-01

    The influence of English on German has been an ongoing subject of intense popular and academic interest in the German sphere. In order to better understand this language contact situation, this research project investigates anglicisms--instances of English language material in a German language context--in the German hip hop community, where the…

  7. Powdery mildew reaction of hop cultivars and USDA germplasm, 2015

    Science.gov (United States)

    This research was conducted to identify possible sources of resistance to the disease powdery mildew in publicly-available hop germplasm and cultivars. Germplasm with the highest levels of downy mildew resistance in the USDA collection and various cultivars of interest were screened for their reac...

  8. Performance Analysis of RF-FSO Multi-Hop Networks

    KAUST Repository

    Makki, Behrooz; Svensson, Tommy; Brandt-Pearce, Maite; Alouini, Mohamed-Slim

    2017-01-01

    We study the performance of multi-hop networks composed of millimeter wave (MMW)-based radio frequency (RF) and free-space optical (FSO) links. The results are obtained in the cases with and without hybrid automatic repeat request (HARQ). Taking

  9. Correlated Hopping in the 1D Falicov--Kimball Model

    Science.gov (United States)

    Gajek, Z.; Lemanski, R.

    2001-10-01

    Ground state phase diagrams in the canonical ensemble of the one-dimensional Falicov-Kimball Model (FKM) with the correlated hopping are presented for several values of the model parameters. As compare to the conventional FKM, the diagrams exhibit a loss of the particle--hole symmetry.

  10. Correlated Hopping in the 1d Falicov-Kimball Model

    International Nuclear Information System (INIS)

    Gajek, Z.; Lemanski, R.

    2001-01-01

    Ground state phase diagrams in the canonical ensemble of the one-dimensional Falicov-Kimball Model FKM) with the correlated hopping are presented for several values of the model parameters. As compare to the conventional FKM, the diagrams exhibit a loss of the particle-hole symmetry. (author)

  11. Young Children Manifest Spiritualities in Their Hip-Hop Writing

    Science.gov (United States)

    Norton, Nadjwa E. L.

    2014-01-01

    In this article, the author combines multicultural feminist critical theories with the voices of Black and Latina/Latino young spiritual children to extend culturally responsive teaching. The author illuminates how children use their hip-hop writing to construct themselves as people who communicate with God, choose spiritual content for their…

  12. Maroc-hop: music and youth identities in the Netherlands

    NARCIS (Netherlands)

    Gazzah, M.; Herrera, L.; Bayat, A.

    2010-01-01

    Two musical forms highly popular among youths of Moroccan origin in the Netherlands—Maroc-hop and Shaabi—permit youths to express specific and multiple identities in local contexts. Shaabi, a popular form of Moroccan folk music used to be found mainly in the private setting of family celebrations,

  13. Investigación a ritmo de hip-hop

    Directory of Open Access Journals (Sweden)

    Melisa Rivière

    2013-09-01

    Full Text Available Soñando se resiste. Hip-hop; en la calle y al parque. Varios autores. Alcaldía Mayor de Bogotá, Secretaría de Cultura, Recreación y Deporte, Orquesta Filarmónica de Bogotá, Bogotá, 2010, 180 págs.

  14. High Order Differential Frequency Hopping: Design and Analysis

    Directory of Open Access Journals (Sweden)

    Yong Li

    2015-01-01

    Full Text Available This paper considers spectrally efficient differential frequency hopping (DFH system design. Relying on time-frequency diversity over large spectrum and high speed frequency hopping, DFH systems are robust against hostile jamming interference. However, the spectral efficiency of conventional DFH systems is very low due to only using the frequency of each channel. To improve the system capacity, in this paper, we propose an innovative high order differential frequency hopping (HODFH scheme. Unlike in traditional DFH where the message is carried by the frequency relationship between the adjacent hops using one order differential coding, in HODFH, the message is carried by the frequency and phase relationship using two-order or higher order differential coding. As a result, system efficiency is increased significantly since the additional information transmission is achieved by the higher order differential coding at no extra cost on either bandwidth or power. Quantitative performance analysis on the proposed scheme demonstrates that transmission through the frequency and phase relationship using two-order or higher order differential coding essentially introduces another dimension to the signal space, and the corresponding coding gain can increase the system efficiency.

  15. THE EFFECTS OF SINGLE LEG HOP PROGRESSION AND DOUBLE LEGS HOP PROGRESSION EXERCISE TO INCREASE SPEED AND EXPLOSIVE POWER OF LEG MUSCLE

    Directory of Open Access Journals (Sweden)

    Nining W. Kusnanik

    2015-05-01

    Full Text Available The main purpose of this study was to determine the effect of single leg hop progression and double legs hop progression exercise to increase speed and explosive power of leg muscles. Plyometric is one of the training methods that can increase explosive power. There are many models of plyometric training including single leg hop progression and double leg hop progression. This research was experimental using match subject design techniques. The subjects of this study were 39 students who joined basketball school club. There were 3 groups in this study: Group 1 were 13 students who given sin¬gle leg hop progression exercise, Group 2 were 13 students who given double legs hop progression exercise, Group 3 were 13 students who given conventional exercise. The data was collected during pre test and post test by testing 30m speed running and vertical jump. The data was analyzed using Analysis of Varians (Anova. It was found that there were significantly increased on speed and explosive power of leg muscles of Group 1 and Group 2. It can be stated that single leg hop progression exercise was more effective than double leg hop progression exercise. The recent findings supported the hypothesis that single leg hop progression and double legs hop progression exercise can increase speed and explosive power of leg muscles. These finding were supported by some previous studies (Singh, et al, 2011; Shallaby, H.K., 2010. The single leg hop progression is more effective than double legs hop progression. This finding was consistent with some previous evidences (McCurdy, et al, 2005; Makaruk et al, 2011.

  16. Mouse adhalin

    DEFF Research Database (Denmark)

    Liu, L; Vachon, P H; Kuang, W

    1997-01-01

    . To analyze the biological roles of adhalin, we cloned the mouse adhalin cDNA, raised peptide-specific antibodies to its cytoplasmic domain, and examined its expression and localization in vivo and in vitro. The mouse adhalin sequence was 80% identical to that of human, rabbit, and hamster. Adhalin...... was specifically expressed in striated muscle cells and their immediate precursors, and absent in many other cell types. Adhalin expression in embryonic mouse muscle was coincident with primary myogenesis. Its expression was found to be up-regulated at mRNA and protein levels during myogenic differentiation...

  17. Hop pellets as an interesting source of antioxidant active compounds

    Directory of Open Access Journals (Sweden)

    Andrea Holubková

    2013-02-01

    Full Text Available Hop is a plant used by humankind for thousands of years. This plant is one of the main and indispensable raw materials for the beer production. It is used for various dishes preparation in the cuisine. Hop is also used to inhibit bacterial contamination. The hop extracts are used for its sedative, antiseptic and antioxidant properties in medicine, as a part of many phytopharmaceuticals. The present paper have focused on the extraction of polyphenolic compounds from 4 samples of hop pellets varieties of Aurora, Saaz, Lublin and Saphir, on the analyzing of bioactive substances (polyphenolics and flavonoids in prepared extracts and on the determination of antioxidant activity.  The highest content of polyphenolic substances was determined in the sample Lublin (153.06 mg gallic acid (GAE/g and Saaz (151.87 mg GAE/g. The amount of flavonoids in the samples  was descending order Saaz > Saphir > Aurora > Lublin. Hops, as plant, is known by high content of antioxidant active substances. Antioxidant activity was determined using three independent spectrofotometric methods, radical scavenging assays using 2,2′-azino-bis-3-ethylbenzthiazoline-6-sulphonic acid (ABTS and 1,1-diphenyl-2-picrylhydrazyl (DPPH radical and ferric reducing antioxidant power (FRAP. The sample Aurora showed the highest ability to scavenge of ABTS radical cation. Antioxidant activity continued to decline in a row Saphir> Lublin> Saaz. The same trend was also observed by using the FRAP assay. The most effective DPPH radical scavengering activity had the sample Saaz a Saphir (p>0.05.doi:10.5219/270 Normal 0 21 false false false SK X-NONE X-NONE

  18. Communication: Proper treatment of classically forbidden electronic transitions significantly improves detailed balance in surface hopping

    Energy Technology Data Exchange (ETDEWEB)

    Sifain, Andrew E. [Department of Physics and Astronomy, University of Southern California, Los Angeles, California 90089-0485 (United States); Wang, Linjun [Department of Chemistry, Zhejiang University, Hangzhou 310027 (China); Prezhdo, Oleg V. [Department of Physics and Astronomy, University of Southern California, Los Angeles, California 90089-0485 (United States); Department of Chemistry, University of Southern California, Los Angeles, California 90089-1062 (United States)

    2016-06-07

    Surface hopping is the most popular method for nonadiabatic molecular dynamics. Many have reported that it does not rigorously attain detailed balance at thermal equilibrium, but does so approximately. We show that convergence to the Boltzmann populations is significantly improved when the nuclear velocity is reversed after a classically forbidden hop. The proposed prescription significantly reduces the total number of classically forbidden hops encountered along a trajectory, suggesting that some randomization in nuclear velocity is needed when classically forbidden hops constitute a large fraction of attempted hops. Our results are verified computationally using two- and three-level quantum subsystems, coupled to a classical bath undergoing Langevin dynamics.

  19. Secure Connectivity Probability of Multi‐hop Clustered Randomize‐and‐Forward Networks

    Directory of Open Access Journals (Sweden)

    Xiaowei Wang

    2017-10-01

    Full Text Available This work investigates secure cluster‐aided multi‐hop randomize‐and‐forward networks. We present a hop‐by‐hop multi‐hop transmission scheme with relay selection, which evaluates for each cluster the relays that can securely receive the message. We propose an analytical model to derive the secure connectivity probability (SCP of the hop‐by‐hop transmission scheme. For comparison, we also analyze SCPs of traditional end‐to‐end transmission schemes with two relay‐selection policies. We perform simulations, and our analytical results verify that the proposed hop‐by‐hop scheme is superior to end‐to‐end schemes, especially with a large number of hops or high eavesdropper channel quality. Numerical results also show that the proposed hop‐by‐hop scheme achieves near‐optimal performance in terms of the SCP.

  20. The content of vitamine E in hop cones of the Saaz variety

    Directory of Open Access Journals (Sweden)

    Helena Pluháčková

    2013-01-01

    Full Text Available The activity of vitamin E, total content of tocols and the content of individual isomers: α-tocopherols, β-tocopherols, γ-tocopherols and δ-tocopherols was monitored in samples of hop cones of the world-important Saaz variety. Hop cone samples originated from hop-breeding area Tršice, Czech Republic. The method used for the determination of vitamin E in barley was modified and used for this quantitative analysis. The results indicate that monitored characteristics are influenced by the year of harvest (2010 or 2011 but also by the age of hop-gardens (hop bucks. High values of vitamin E activity (up to 67.79 mg.kg−1 and total content of tocols (up to 76.31 mg.kg−1 in hop cones are worth further attention from the viewpoint of alternative use of hops.

  1. Respiratory disease associated with occupational inhalation to hop (Humulus lupulus) during harvest and processing.

    Science.gov (United States)

    Reeb-Whitaker, Carolyn K; Bonauto, David K

    2014-11-01

    There is little published evidence for occupational respiratory disease caused by hop dust inhalation. In the United States, hops are commercially produced in the Pacific Northwest region. To describe occupational respiratory disease in hop workers. Washington State workers' compensation claims filed by hop workers for respiratory disease were systematically identified and reviewed. Incidence rates of respiratory disease in hop workers were compared with rates in field vegetable crop farm workers. Fifty-seven cases of respiratory disease associated with hop dust inhalation were reported from 1995 to 2011. Most cases (61%) were diagnosed by the attending health care practitioner as having work-related asthma. Seven percent of cases were diagnosed as chronic obstructive pulmonary disease, and the remaining cases were diagnosed as allergic respiratory disorders (eg, allergic rhinitis) or asthma-associated symptoms (eg, dyspnea). Cases were associated with hop harvesting, secondary hop processing, and indirect exposure. The incidence rate of respiratory disease in hop workers was 15 cases per 10,000 full-time workers, which was 30 times greater than the incidence rate for field vegetable crop workers. A strong temporal association between hop dust exposure and respiratory symptoms and a clear association between an increase in hop dust concentrations and the clinical onset of symptoms were apparent in 3 cases. Occupational exposure to hop dust is associated with respiratory disease. Respiratory disease rates were higher in hop workers than in a comparison group of agricultural workers. Additional research is needed before hop dust can be confirmed as a causative agent for occupational asthma. Copyright © 2014 American College of Allergy, Asthma & Immunology. Published by Elsevier Inc. All rights reserved.

  2. Hip-Hop Guayaquil: culturas viajeras e identidades locales

    Directory of Open Access Journals (Sweden)

    1999-01-01

    Full Text Available HIP-HOP GUAYAQUIL: CULTURES ITINÉRANTES ET IDENTITES LOCALES. Le hip-hop est un style de musique contemporaine caractérisé par une orchestration d’œuvres lyriques rapées, la superposition de morceaux de musique enregistrés dans le passé par différents artistes, et une instrumentation électronique, tout cela sur des rythmes de basse réguliers et constants. Le hip-hop, musique accompagnée de ses propres danses et de sa mode, est le produit du déplacement et de la transformation d’une variété d’idéologies politiques de la communauté noire qui se constituent à partir de relations qui se modifient entre elles, et en relation avec les cultures dominantes contre lesquelles elles luttent quotidiennement. À l’origine, le hip-hop est lié à des mouvements d’identité de jeunes noirs. Dans cet article, il est intéressant d’étudier le rôle du hip-hop dans la formulation d’une identité entre jeunes métisses et noirs des secteurs populaires de Guayaquil. Cet exemple illustre la nécessité d’inclure dans l’analyse les dimensions politiques des processus de traduction du global au niveau local. El hip-hop es un género de música contemporánea caracterizado por la orquestación de líricas que son rapeadas, superposición de fragmentos de música grabada en el pasado por diferentes artistas, e instrumentación electrónica, todo ello sobre ritmos de bajo regulares y constantes. Como un tipo de música acompañado por sus propias formas de danza y moda, el hip-hop es producto del viaje y la transformación de una variedad de ideologías políticas de la comunidad negra que se constituyen a sí mismas en relaciones cambiantes entre sí y en relación a las culturas dominantes contra las cuales luchan cotidianamente. El hip-hop está ligado, en su contexto originario, a políticas de identidad defendidas por jóvenes negros. Lo que interesa explorar en este artículo es el papel del hip-hop en la formulación de una identidad

  3. Mixed quantum-classical equilibrium in global flux surface hopping

    International Nuclear Information System (INIS)

    Sifain, Andrew E.; Wang, Linjun; Prezhdo, Oleg V.

    2015-01-01

    Global flux surface hopping (GFSH) generalizes fewest switches surface hopping (FSSH)—one of the most popular approaches to nonadiabatic molecular dynamics—for processes exhibiting superexchange. We show that GFSH satisfies detailed balance and leads to thermodynamic equilibrium with accuracy similar to FSSH. This feature is particularly important when studying electron-vibrational relaxation and phonon-assisted transport. By studying the dynamics in a three-level quantum system coupled to a classical atom in contact with a classical bath, we demonstrate that both FSSH and GFSH achieve the Boltzmann state populations. Thermal equilibrium is attained significantly faster with GFSH, since it accurately represents the superexchange process. GFSH converges closer to the Boltzmann averages than FSSH and exhibits significantly smaller statistical errors

  4. Fast frequency hopping codes applied to SAC optical CDMA network

    Science.gov (United States)

    Tseng, Shin-Pin

    2015-06-01

    This study designed a fast frequency hopping (FFH) code family suitable for application in spectral-amplitude-coding (SAC) optical code-division multiple-access (CDMA) networks. The FFH code family can effectively suppress the effects of multiuser interference and had its origin in the frequency hopping code family. Additional codes were developed as secure codewords for enhancing the security of the network. In considering the system cost and flexibility, simple optical encoders/decoders using fiber Bragg gratings (FBGs) and a set of optical securers using two arrayed-waveguide grating (AWG) demultiplexers (DeMUXs) were also constructed. Based on a Gaussian approximation, expressions for evaluating the bit error rate (BER) and spectral efficiency (SE) of SAC optical CDMA networks are presented. The results indicated that the proposed SAC optical CDMA network exhibited favorable performance.

  5. O CIRCUITO HIP HOP NA REGIÃO DE CAMPINAS

    Directory of Open Access Journals (Sweden)

    Cristiano Nunes Alves

    2013-01-01

    Full Text Available This paper examines the thickness of the circuit hip hop in the region of Campinas and it’s a part of an inventory made in fifteen cities of the region, between 2003 and 2005. The circuit hip hop growing in Campinas since the decade of 1980, and has been expanding in the context of urbanization and metropolis. We noticed some residual cultural component in places involves, among others, the alternative production involved by a technically and territorial division of labor spurred by circuits upside of information. The culture of the streets and these circuits, survive to the urban division and fragmentation. It is, therefore, a study of the region of Campinas as a place that houses technical, informational and communicational densities. We analyzed geographical conditions of contemporary life in this region, inquiring about the communication and the informational components in the use of the territory.

  6. Hopping mixed hybrid excitations in multiple composite quantum wire structures

    International Nuclear Information System (INIS)

    Nguyen Ba An; Tran Thai Hoa

    1995-10-01

    A structure consisting of N pairs of inorganic semiconductor and organic quantum wires is considered theoretically. In such an isolated pair of wires, while the intrawire coupling forms Wannier-Mott exciton in an inorganic semiconductor quantum wire and Frenkel exciton in an organic one, the interwire coupling gives rise to hybrid excitons residing within the pair. When N pairs of wires are packed together 2N new mixed hybrid modes appear that are the true elementary excitations and can hop throughout the whole structure. Energies and wave functions of such hopping mixed hybrid excitations are derived analytically in detail accounting for the global interwire coupling and the different polarization configurations. (author). 19 refs

  7. Rend og hop - Vi si´r stop

    DEFF Research Database (Denmark)

    Lund, Ole

    Rapporten er en evaluering af projekt Rend og hop som foregik fra 2006 - 2008 i Varde kommune. Projektet bestod af en specifik del og en genrele del, som henholdsvist var et tilbud til overvægtige børn med henblik på at give dem et sundere liv, og et forsøg på at gøre sundhed til en mere dominere......Rapporten er en evaluering af projekt Rend og hop som foregik fra 2006 - 2008 i Varde kommune. Projektet bestod af en specifik del og en genrele del, som henholdsvist var et tilbud til overvægtige børn med henblik på at give dem et sundere liv, og et forsøg på at gøre sundhed til en mere...

  8. Hip-Hop(e): The Cultural Practice and Critical Pedagogy of International Hip-Hop. Adolescent Cultures, School, and Society. Volume 56

    Science.gov (United States)

    Porfilio, Brad J., Ed.; Viola, Michael J., Ed.

    2012-01-01

    Illuminating hip-hop as an important cultural practice and a global social movement, this collaborative project highlights the emancipatory messages and cultural work generated by the organic intellectuals of global hip-hop. Contributors describe the social realities--globalization, migration, poverty, criminalization, and racism--youth are…

  9. Hsp70/Hsp90 organising protein (hop): beyond interactions with chaperones and prion proteins.

    Science.gov (United States)

    Baindur-Hudson, Swati; Edkins, Adrienne L; Blatch, Gregory L

    2015-01-01

    The Hsp70/Hsp90 organising protein (Hop), also known as stress-inducible protein 1 (STI1), has received considerable attention for diverse cellular functions in both healthy and diseased states. There is extensive evidence that intracellular Hop is a co-chaperone of the major chaperones Hsp70 and Hsp90, playing an important role in the productive folding of Hsp90 client proteins. Consequently, Hop is implicated in a number of key signalling pathways, including aberrant pathways leading to cancer. However, Hop is also secreted and it is now well established that Hop also serves as a receptor for the prion protein, PrP(C). The intracellular and extracellular forms of Hop most likely represent two different isoforms, although the molecular determinants of these divergent functions are yet to be identified. There is also a growing body of research that reports the involvement of Hop in cellular activities that appear independent of either chaperones or PrP(C). While Hop has been shown to have various cellular functions, its biological function remains elusive. However, recent knockout studies in mammals suggest that Hop has an important role in embryonic development. This review provides a critical overview of the latest molecular, cellular and biological research on Hop, critically evaluating its function in healthy systems and how this function is adapted in diseases states.

  10. Cross-layer optimization of wireless multi-hop networks

    OpenAIRE

    Soldati, Pablo

    2007-01-01

    The interest in wireless communications has grown constantly for the past decades, leading to an enormous number of applications and services embraced by billions of users. In order to meet the increasing demand for mobile Internet access, several high data-rate radio networking technologies have been proposed to offer wide area high-speed wireless communications, eventually replacing fixed (wired) networks for many applications. This thesis considers cross-layer optimization of multi-hop rad...

  11. Structure and Charge Hopping Dynamics in Green Rust

    International Nuclear Information System (INIS)

    Wander, Matthew C.; Rosso, Kevin M.; Schoonen, Martin A.

    2007-01-01

    Green rust is a family of mixed-valent iron phases formed by a number of abiotic and biotic processes under alkaline suboxic conditions. Due to its high Fe2+ content, green rust is a potentially important phase for pollution remediation by serving as a powerful electron donor for reductive transformation. However, mechanisms of oxidation of this material are poorly understood. An essential component of the green rust structure is a mixed-valent brucite-like Fe(OH)2 sheet comprised of a two dimensional network of edge-sharing iron octahedra. Room temperature Mossbauer spectra show a characteristic signature for intermediate valence on the iron atoms in this sheet, indicative of a Fe2+-Fe3+ valence interchange reaction faster than approximately 107s-1. Using Fe(OH)2 as structural analogue for reduced green rust, we performed Hartree-Fock calculations on periodic slab models and cluster representations to determine the structure and hopping mobility of Fe3+ hole polarons in this material, providing a first principles assessment of the Fe2+-Fe3+ valence interchange reaction rate. The calculations show that among three possible symmetry unique iron-to-iron hops within a sheet, a hop to next-nearest neighbors at an intermediate distance of 5.6Angstroms is the fastest. The predicted rate is on the order of 1012 s-1 consistent the Mossbauer-based constraint. All other possibilities, including hopping across interlayer spaces, are predicted to be slower than 107s-1. Collectively, the findings suggest the possibility of hole self-diffusion along sheets as a mechanism for regeneration of lattice Fe2+ sites, consistent with previous experimental observations of edge-inward progressive oxidation of green rust.

  12. Duplex Schemes in Multiple Antenna Two-Hop Relaying

    Directory of Open Access Journals (Sweden)

    Anja Klein

    2008-04-01

    Full Text Available A novel scheme for two-hop relaying defined as space division duplex (SDD relaying is proposed. In SDD relaying, multiple antenna beamforming techniques are applied at the intermediate relay station (RS in order to separate downlink and uplink signals of a bi-directional two-hop communication between two nodes, namely, S1 and S2. For conventional amplify-and-forward two-hop relaying, there appears a loss in spectral efficiency due to the fact that the RS cannot receive and transmit simultaneously on the same channel resource. In SDD relaying, this loss in spectral efficiency is circumvented by giving up the strict separation of downlink and uplink signals by either time division duplex or frequency division duplex. Two novel concepts for the derivation of the linear beamforming filters at the RS are proposed; they can be designed either by a three-step or a one-step concept. In SDD relaying, receive signals at S1 are interfered by transmit signals of S1, and receive signals at S2 are interfered by transmit signals of S2. An efficient method in order to combat this kind of interference is proposed in this paper. Furthermore, it is shown how the overall spectral efficiency of SDD relaying can be improved if the channels from S1 and S2 to the RS have different qualities.

  13. Performance Analysis of RF-FSO Multi-Hop Networks

    KAUST Repository

    Makki, Behrooz

    2017-05-12

    We study the performance of multi-hop networks composed of millimeter wave (MMW)-based radio frequency (RF) and free-space optical (FSO) links. The results are obtained in the cases with and without hybrid automatic repeat request (HARQ). Taking the MMW characteristics of the RF links into account, we derive closed-form expressions for the network outage probability. We also evaluate the effect of various parameters such as power amplifiers efficiency, number of antennas as well as different coherence times of the RF and the FSO links on the system performance. Finally, we present mappings between the performance of RF- FSO multi-hop networks and the ones using only the RF- or the FSO-based communication, in the sense that with appropriate parameter settings the same outage probability is achieved in these setups. The results show the efficiency of the RF-FSO setups in different conditions. Moreover, the HARQ can effectively improve the outage probability/energy efficiency, and compensate the effect of hardware impairments in RF-FSO networks. For common parameter settings of the RF-FSO dual- hop networks, outage probability 10^{-4} and code rate 3 nats-per-channel-use, the implementation of HARQ with a maximum of 2 and 3 retransmissions reduces the required power, compared to the cases with no HARQ, by 13 and 17 dB, respectively.

  14. Multi-Hop Link Capacity of Multi-Route Multi-Hop MRC Diversity for a Virtual Cellular Network

    Science.gov (United States)

    Daou, Imane; Kudoh, Eisuke; Adachi, Fumiyuki

    In virtual cellular network (VCN), proposed for high-speed mobile communications, the signal transmitted from a mobile terminal is received by some wireless ports distributed in each virtual cell and relayed to the central port that acts as a gateway to the core network. In this paper, we apply the multi-route MHMRC diversity in order to decrease the transmit power and increase the multi-hop link capacity. The transmit power, the interference power and the link capacity are evaluated for DS-CDMA multi-hop VCN by computer simulation. The multi-route MHMRC diversity can be applied to not only DS-CDMA but also other access schemes (i. e. MC-CDMA, OFDM, etc.).

  15. Population dynamics and integrated control of the damson-hop aphid Phorodon humuli (Schrank on hops in Spain

    Directory of Open Access Journals (Sweden)

    A. Lorenzana

    2013-04-01

    Full Text Available The hop aphid Phorodon humuli (Schrank (Hemiptera: Aphididae is a serious pest in most areas where hops are grown. A field trial was performed on a hop yard throughout 2002, 2003 and 2004 in León (Spain in order to analyse the population development of Phorodon humuli and its natural enemies, as well as to determine the most effective integrated program of insecticide treatments. The basic population development pattern of P. humuli was similar in the three years: the population peaked between mid to late June, and then decreased in late June/early July, rising again and reaching another peak in mid-July, after which it began to decline, rising once more in late August; this last rise is characteristic of Spain and has not been recorded in the rest of Europe. The hop aphid’s main natural enemy found on the leaves was Coccinella septempunctata (Coleoptera: Coccinellidae. The multiple regression analysis showed that aphids are positively related with the presence of beetle eggs and mean daily temperatures and negatively related with maximum daily temperature integral above 27ºC in plots without insecticide treatment. The most effective program of insecticide (imidacloprid treatments consisted of an initial treatment in June and a second treatment in the second half of July or at the beginning of August. However, a single treatment in June would be sufficient when in this last period the maximum daily temperatures were higher than 27ºC for at least 15 days, avoiding in this way the harmful effects of imidacloprid on predators.

  16. Droppin’ Knowledge on Race: Hip-Hop, White Adolescents, and Anti-Racism Education

    Directory of Open Access Journals (Sweden)

    Steven Netcoh

    2013-10-01

    Full Text Available In this essay, the author examines how Hip-Hop can be mobilized in anti-racism educational initatives.  The author claims that existing research on Hip-Hop and white adolescents suggests a negative corrleation between white youths' engagement with Hip-Hop and their understanding of how race and racism function in American society.  In response to this research, the author argues Hip-Hop's diverse racial discourses and ideologies must be made the subject of direct and critical inquiry in secondary and post-secondary classrooms to maximize its democratic potential.  The author outlines specific approaches for how teachers can employ Hip-Hop in anti-racism curricula in secondary and post-secondary classrooms.  Collectively, the essay serves as a preliminary investigation of Hip-Hop pedagogies of race and whiteness.

  17. Blind Compressed Sensing Parameter Estimation of Non-cooperative Frequency Hopping Signal

    Directory of Open Access Journals (Sweden)

    Chen Ying

    2016-10-01

    Full Text Available To overcome the disadvantages of a non-cooperative frequency hopping communication system, such as a high sampling rate and inadequate prior information, parameter estimation based on Blind Compressed Sensing (BCS is proposed. The signal is precisely reconstructed by the alternating iteration of sparse coding and basis updating, and the hopping frequencies are directly estimated based on the results. Compared with conventional compressive sensing, blind compressed sensing does not require prior information of the frequency hopping signals; hence, it offers an effective solution to the inadequate prior information problem. In the proposed method, the signal is first modeled and then reconstructed by Orthonormal Block Diagonal Blind Compressed Sensing (OBD-BCS, and the hopping frequencies and hop period are finally estimated. The simulation results suggest that the proposed method can reconstruct and estimate the parameters of noncooperative frequency hopping signals with a low signal-to-noise ratio.

  18. A new method of hybrid frequency hopping signals selection and blind parameter estimation

    Science.gov (United States)

    Zeng, Xiaoyu; Jiao, Wencheng; Sun, Huixian

    2018-04-01

    Frequency hopping communication is widely used in military communications at home and abroad. In the case of single-channel reception, it is scarce to process multiple frequency hopping signals both effectively and simultaneously. A method of hybrid FH signals selection and blind parameter estimation is proposed. The method makes use of spectral transformation, spectral entropy calculation and PRI transformation basic theory to realize the sorting and parameter estimation of the components in the hybrid frequency hopping signal. The simulation results show that this method can correctly classify the frequency hopping component signal, and the estimated error of the frequency hopping period is about 5% and the estimated error of the frequency hopping frequency is less than 1% when the SNR is 10dB. However, the performance of this method deteriorates seriously at low SNR.

  19. Mic Power? Connections and the hip hop nation in Kampala, Uganda

    DEFF Research Database (Denmark)

    Schneidermann, Nanna

    2014-01-01

    Hip hop culture has been celebrated in the media and scholarship as a universal youth language, part of a global hip hop nation, and a type of counter-public. This article examines the everyday meanings and practices of hip hop among hip hop activists in Kampala, Uganda, specifically within...... the Batuuze rap group. Rather than portraying hip hop as a counter-public of the disempowered, I argue that the Batuuze engagement is based on what I call moral economy that enables the negotiation of connections in social and cultural networks towards what is considered a good life. Here, the hip hop nation...... is less of an alternative public sphere and more a way of articulating and contextualizing the world in a specific locality, which produces connections and opportunities in the young rappers’ lives....

  20. Method Development and Validation for UHPLC-MS-MS Determination of Hop Prenylflavonoids in Human Serum

    OpenAIRE

    Yuan, Yang; Qiu, Xi; Nikolic, Dejan; Dahl, Jeffrey H.; van Breemen, Richard B.

    2012-01-01

    Hops (Humulus lupulus L.) are used in the brewing of beer, and hop extracts containing prenylated compounds such as xanthohumol and 8-prenylnaringenin are under investigation as dietary supplements for cancer chemoprevention and for the management of hot flashes in menopausal women. To facilitate clinical studies of hop safety and efficacy, a selective, sensitive, and fast ultra-high pressure liquid chromatography tandem mass spectrometry (UHPLC-MS-MS) method was developed and validated for t...

  1. Savage Vernacular: Performing Race, Memory, and Hip Hop in Filipino America

    OpenAIRE

    Villegas, Mark

    2015-01-01

    By observing and analyzing live performances, music, visual art, interviews, television shows, and online discourse, this dissertation traces the ways in which Filipino American hip hop performance remembers the racialized histories of the Filipino body. Through both quotidian and spectacular performances in hip hop, Filipino Americans have been contributing to crucial forms of knowledge that help unpack the terms of Filipino and American culture. Hip hop culture, I argue, operates as a produ...

  2. Hop limited epidemic-like information spreading in mobile social networks with selfish nodes

    Science.gov (United States)

    Wu, Yahui; Deng, Su; Huang, Hongbin

    2013-07-01

    Similar to epidemics, information can be transmitted directly among users in mobile social networks. Different from epidemics, we can control the spreading process by adjusting the corresponding parameters (e.g., hop count) directly. This paper proposes a theoretical model to evaluate the performance of an epidemic-like spreading algorithm, in which the maximal hop count of the information is limited. In addition, our model can be used to evaluate the impact of users’ selfish behavior. Simulations show the accuracy of our theoretical model. Numerical results show that the information hop count can have an important impact. In addition, the impact of selfish behavior is related to the information hop count.

  3. Hop limited epidemic-like information spreading in mobile social networks with selfish nodes

    International Nuclear Information System (INIS)

    Wu, Yahui; Deng, Su; Huang, Hongbin

    2013-01-01

    Similar to epidemics, information can be transmitted directly among users in mobile social networks. Different from epidemics, we can control the spreading process by adjusting the corresponding parameters (e.g., hop count) directly. This paper proposes a theoretical model to evaluate the performance of an epidemic-like spreading algorithm, in which the maximal hop count of the information is limited. In addition, our model can be used to evaluate the impact of users’ selfish behavior. Simulations show the accuracy of our theoretical model. Numerical results show that the information hop count can have an important impact. In addition, the impact of selfish behavior is related to the information hop count. (paper)

  4. Antifeedant activity of xanthohumol and supercritical carbon dioxide extract of spent hops against stored product pests.

    Science.gov (United States)

    Jackowski, J; Hurej, M; Rój, E; Popłoński, J; Kośny, L; Huszcza, E

    2015-08-01

    Xanthohumol, a prenylated flavonoid from hops, and a supercritical carbon dioxide extract of spent hops were studied for their antifeedant activity against stored product insect pests: Sitophilus granarius L., Tribolium confusum Duv. and Trogoderma granarium Everts. Xanthohumol exhibited medium deterrent activity against the adults of S. granarius L. and larvae of T. confusum Duv. The spent hops extract was more active than xanthohumol towards the adults of T. confusum Duv. The potential application of the crude spent hops extract as a feeding deterrent against the stored product pests is proposed.

  5. Optimization of conditions for supercritical fluid extraction of flavonoids from hops (Humulus lupulus L.)*

    Science.gov (United States)

    He, Guo-qing; Xiong, Hao-ping; Chen, Qi-he; Ruan, Hui; Wang, Zhao-yue; Traoré, Lonseny

    2005-01-01

    Waste hops are good sources of flavonoids. Extraction of flavonoids from waste hops (SC-CO2 extracted hops) using supercritical fluids technology was investigated. Various temperatures, pressures and concentrations of ethanol (modifier) and the ratio (w/w) of solvent to material were tested in this study. The results of single factor and orthogonal experiments showed that at 50 °C, 25 MPa, the ratio of solvent to material (50%), ethanol concentration (80%) resulted in maximum extraction yield flavonoids (7.8 mg/g). HPLC-MS analysis of the extracts indicated that flavonoids obtained were xanthohumol, the principal prenylflavonoid in hops. PMID:16187413

  6. Hip-hop as a resource for understanding the urban context

    Science.gov (United States)

    Brown, Bryan

    2010-06-01

    This review explores Edmin's "Science education for the hip-hop generation" by documenting how he frames hip-hop as a means to access urban student culture. He argues that hip-hop is more than a mere music genre, but rather a culture that provides young people with ways of connecting to the world. Two primary ideas emerged as central to his work. First, he contends that students develop communal relationships and collective identities based on the common experiences expressed in hip-hop. Second, he identifies how the conscious recognition of institutional oppression serves a central feature in urban schools. Emdin's rich, and personal call for a greater understanding of hip-hop culture provides the text with an unmatched strength. He skillfully uses personal narratives from his own experience as well as quotes and references from hip-hop songs to make the nuances of hip hop transparent to science educators. Conversely, the limitation of this text is found in its unfulfilled promise to provide pragmatic examples of how to engage in a hip-hop based science education. Emdin's work is ultimately valuable as it extends our current knowledge about urban students and hip-hop in meaningful ways.

  7. A Review of Hip Hop-Based Interventions for Health Literacy, Health Behaviors, and Mental Health.

    Science.gov (United States)

    Robinson, Cendrine; Seaman, Elizabeth L; Montgomery, LaTrice; Winfrey, Adia

    2017-07-01

    African-American children and adolescents experience an undue burden of disease for many health outcomes compared to their White peers. More research needs to be completed for this priority population to improve their health outcomes and ameliorate health disparities. Integrating hip hop music or hip hop dance into interventions may help engage African-American youth in health interventions and improve their health outcomes. We conducted a review of the literature to characterize hip hop interventions and determine their potential to improve health. We searched Web of Science, Scopus, PsycINFO, and EMBASE to identify studies that assessed hip hop interventions. To be included, studies had to (1) be focused on a psychosocial or physical health intervention that included hip hop and (2) present quantitative data assessing intervention outcomes. Twenty-three articles were identified as meeting all inclusion criteria and were coded by two reviewers. Articles were assessed with regards to sample characteristics, study design, analysis, intervention components, and results. Hip hop interventions have been developed to improve health literacy, health behavior, and mental health. The interventions were primarily targeted to African-American and Latino children and adolescents. Many of the health literacy and mental health studies used non-experimental study designs. Among the 12 (of 14) health behavior studies that used experimental designs, the association between hip hop interventions and positive health outcomes was inconsistent. The number of experimental hip hop intervention studies is limited. Future research is required to determine if hip hop interventions can promote health.

  8. Child-Mediated Stroke Communication: findings from Hip Hop Stroke.

    Science.gov (United States)

    Williams, Olajide; DeSorbo, Alexandra; Noble, James; Gerin, William

    2012-01-01

    Low thrombolysis rates for acute ischemic stroke are linked to delays in seeking immediate treatment due to low public stroke awareness. We aimed to assess whether "Child-Mediated Stroke Communication" could improve stroke literacy of parents of children enrolled in a school-based stroke literacy program called Hip Hop Stroke. Parents of children aged 9 to 12 years from 2 public schools in Harlem, New York City, were recruited to participate in stroke literacy questionnaires before and after their child's participation in Hip Hop Stroke, a novel Child-Mediated Stroke Communication intervention delivered in school auditoriums. Parental recall of stroke information communicated through their child was assessed 1-week after the intervention. Fifth and sixth grade students (n=182) were enrolled into Hip Hop Stroke. One hundred two parents were approached in person to participate; 75 opted to participate and 71 completed both the pretest and post-test (74% response rate and 95% retention rate). Parental stroke literacy improved after the program; before the program, 3 parents of 75 (3.9%) were able to identify the 5 cardinal stroke symptoms, distracting symptom (chest pains), and had an urgent action plan (calling 911) compared with 21 of 71 parents (29.6%) postintervention (P<0.001). The FAST mnemonic was known by 2 (2.7%) of participants before the program versus 29 (41%) after program completion (P<0.001). Knowledge of stroke signs and symptoms remains low among residents of this high-risk population. The use of Child-Mediated Stroke Communication suggests that school children aged 9 to 12 years may be effective conduits of critical stroke knowledge to their parents.

  9. Anisotropy of hopping conductivity in TIGaSe2, crystal

    International Nuclear Information System (INIS)

    Nadjafov, A.I.; Sardarli, R.M.; Samedov, O. A.; Abdullayev, A.P.; Zeynalova, E.A.; Jabbarov, J.H.

    2005-01-01

    Full Text: The temperature dependences of electrical conductivity of a chained semiconductor crystal TIGaTe 2 in a direction of chains and perpendicularly have been investigated. It was established that in a constant electrical field in both crystallographic directions took place hopping conductivity with variable length of a jump on located near Fermi level. The energy activation of conductivity has been determined. It was appreciated density of a condition in a vicinity of a Fermi level, their disorder, radius of localization, average distance of jumps of carriers

  10. Semiclassical quantization of nonadiabatic systems with hopping periodic orbits

    International Nuclear Information System (INIS)

    Fujii, Mikiya; Yamashita, Koichi

    2015-01-01

    We present a semiclassical quantization condition, i.e., quantum–classical correspondence, for steady states of nonadiabatic systems consisting of fast and slow degrees of freedom (DOFs) by extending Gutzwiller’s trace formula to a nonadiabatic form. The quantum–classical correspondence indicates that a set of primitive hopping periodic orbits, which are invariant under time evolution in the phase space of the slow DOF, should be quantized. The semiclassical quantization is then applied to a simple nonadiabatic model and accurately reproduces exact quantum energy levels. In addition to the semiclassical quantization condition, we also discuss chaotic dynamics involved in the classical limit of nonadiabatic dynamics

  11. SHOP: scaffold hopping by GRID-based similarity searches

    DEFF Research Database (Denmark)

    Bergmann, Rikke; Linusson, Anna; Zamora, Ismael

    2007-01-01

    A new GRID-based method for scaffold hopping (SHOP) is presented. In a fully automatic manner, scaffolds were identified in a database based on three types of 3D-descriptors. SHOP's ability to recover scaffolds was assessed and validated by searching a database spiked with fragments of known...... scaffolds were in the 31 top-ranked scaffolds. SHOP also identified new scaffolds with substantially different chemotypes from the queries. Docking analysis indicated that the new scaffolds would have similar binding modes to those of the respective query scaffolds observed in X-ray structures...

  12. Electron hopping and optic phonons in Eu3S4

    International Nuclear Information System (INIS)

    Guentherodt, G.

    1981-01-01

    Raman scattering on single crystals of Eu 3 S 4 does not show the allowed q=o phonon modes in the cubic phase and exhibits no new modes in the distorted low temperature phase (T 2- ions. This mode does not show any anomaly near the charge order -disorder phase transition Tsub(t)=186 K. Temperature tunable spin fluctuations associated with the temperature activated Eu 2+ → Eu 3+ electron hopping are detected in the scattering intensity, superimposed on the usual thermal spin disorder. (author)

  13. High-Speed On-Board Data Processing for Science Instruments: HOPS

    Science.gov (United States)

    Beyon, Jeffrey

    2015-01-01

    The project called High-Speed On-Board Data Processing for Science Instruments (HOPS) has been funded by NASA Earth Science Technology Office (ESTO) Advanced Information Systems Technology (AIST) program during April, 2012 â€" April, 2015. HOPS is an enabler for science missions with extremely high data processing rates. In this three-year effort of HOPS, Active Sensing of CO2 Emissions over Nights, Days, and Seasons (ASCENDS) and 3-D Winds were of interest in particular. As for ASCENDS, HOPS replaces time domain data processing with frequency domain processing while making the real-time on-board data processing possible. As for 3-D Winds, HOPS offers real-time high-resolution wind profiling with 4,096-point fast Fourier transform (FFT). HOPS is adaptable with quick turn-around time. Since HOPS offers reusable user-friendly computational elements, its FPGA IP Core can be modified for a shorter development period if the algorithm changes. The FPGA and memory bandwidth of HOPS is 20 GB/sec while the typical maximum processor-to-SDRAM bandwidth of the commercial radiation tolerant high-end processors is about 130-150 MB/sec. The inter-board communication bandwidth of HOPS is 4 GB/sec while the effective processor-to-cPCI bandwidth of commercial radiation tolerant high-end boards is about 50-75 MB/sec. Also, HOPS offers VHDL cores for the easy and efficient implementation of ASCENDS and 3-D Winds, and other similar algorithms. A general overview of the 3-year development of HOPS is the goal of this presentation.

  14. Effect of storage on the brewing properties of tropical hop substitutes

    African Journals Online (AJOL)

    SERVER

    2007-06-18

    Jun 18, 2007 ... Conclusively, tropical hop substitutes stored at 5 ± 1oC to 27 ± 1oC can still be used for brewing even after three to six months storage. .... which is associated with the oxidative depreciation of the soft resins to hard resins ... Changes in the soft resin levels of hop substitutes with storage. Soft resin levels (%).

  15. Hegemony, Hope, and the Harlem Renaissance: Taking Hip Hop Culture Seriously

    Science.gov (United States)

    Price, Robert J., Jr.

    2005-01-01

    Adult education instructors and administrators, who typically are not members of the hip hop generation, often have little knowledge and understanding of rap music (also known as gangsta rap) and hip hop culture, and consequently do not take the black popular cultural phenomenon seriously as it relates to adult education. Adult educators,…

  16. Empowerment in Context: Lessons from Hip-Hop Culture for Social Work Practice

    Science.gov (United States)

    Travis, Raphael, Jr.; Deepak, Anne

    2011-01-01

    Hip-hop culture can be used as a conduit to enhanced cultural competence and practice skills through the individual and community empowerment framework. This framework is introduced as a tool for direct practice that allows social workers to understand the competing messages within hip-hop culture and how they may impact youths by promoting or…

  17. Teaching Controversal Topics in Contemporary German Culture through Hip-Hop

    Science.gov (United States)

    Putnam, Michael

    2006-01-01

    This article discusses the rich cultural resources embedded with German hip-hop music and its potential impact on the foreign language classroom. In particular, this article suggests methods and materials for integrating German hip-hop music in the discussion of recent controversial cultural events and attitudes in German after the "Wende."

  18. Hop/STI1 modulates retinal proliferation and cell death independent of PrPC

    International Nuclear Information System (INIS)

    Arruda-Carvalho, Maithe; Njaine, Brian; Silveira, Mariana S.; Linden, Rafael; Chiarini, Luciana B.

    2007-01-01

    Hop/STI1 is a co-chaperone adaptor protein for Hsp70/Hsp90 complexes. Hop/STI1 is found extracellularly and modulates cell death and differentiation through interaction with the prion protein (PrP C ). Here, we investigated the expression of hop/STI1 and its role upon cell proliferation and cell death in the developing retina. Hop/STI1 is more expressed in developing rat retina than in the mature tissue. Hop/STI1 blocks retinal cell death in the neuroblastic layer (NBL) in a PrP C dependent manner, but failed to protect ganglion cells against axotomy-induced cell death. An antibody raised against hop/STI1 (α-STI1) blocked both ganglion cell and NBL cell death independent of PrP C . cAMP/PKA, ERK, PI3K and PKC signaling pathways were not involved in these effects. Hop/STI1 treatment reduced proliferation, while α-STI1 increased proliferation in the developing retina, both independent of PrP C . We conclude that hop/STI1 can modulate both proliferation and cell death in the developing retina independent of PrP C

  19. Hip-Hop Culture in College Students' Lives: Elements, Embodiment, and Higher Edutainment

    Science.gov (United States)

    Petchauer, Emery

    2011-01-01

    College campuses have become rich sites of hip-hop culture and knowledge production. Despite the attention that campus personnel and researchers have paid to student life, the field of higher education has often misunderstood the ways that hip-hop culture exists in college students' lives. Based upon in-depth interviews, observations of…

  20. Hip-Hop's Influence on the Identity Development of Black Female College Students: A Literature Review

    Science.gov (United States)

    Henry, Wilma J.; West, Nicole M.; Jackson, Andrea

    2010-01-01

    This article explores unique issues regarding the effects of hip-hop culture on the identity development of young Black female college students. Through the lenses of womanist and Black feminist perspectives, the intersecting impact of race and gender are reviewed within the context of the competing influences of hip-hop on Black female identity.…

  1. Polish Hip Hop as a Form of Multiliteracies and Situated Learning

    Science.gov (United States)

    Torrence, Michael L.

    2009-01-01

    The purpose of this ethnographic study was to examine Hip Hop in Poland through the lens of multiliteracies and situated learning. This analysis is concerned with the transmission of Hip Hop to and within Wroclaw, Poland, and its acculturation and assimilation in Wroclaw, Poland. Further, this study seeks to illustrate how professional Polish Hip…

  2. Simple Models for the Performance Evaluation of a Class of Two-Hop Relay Protocols

    NARCIS (Netherlands)

    Al Hanbali, Ahmad; Kherani, Arzad A.; Nain, Philippe

    2007-01-01

    We evaluate the performance of a class of two-hop relay protocols for mobile ad hoc networks. The interest is on the multicopy two-hop relay (MTR) protocol, where the source may generate multiple copies of a packet and use relay nodes to deliver the packet (or a copy) to its destination, and on the

  3. Simple models for the performance evaluation of a class of two-hop relay protocols

    NARCIS (Netherlands)

    Al Hanbali, A.; Kherani, A.A.; Nain, P.; Akyildiz, I.F.; Sivakumar, R.; Ekici, E.; Cavalcante de Oliveira, J.; McNair, J.

    2007-01-01

    We evaluate the performance of a class of two-hop relay protocols for mobile ad hoc networks. The interest is on the multicopy two-hop relay (MTR) protocol, where the source may generate multiple copies of a packet and use relay nodes to deliver the packet (or a copy) to its destination, and on the

  4. Hip-Hop, Social Justice, and Environmental Education: Toward a Critical Ecological Literacy

    Science.gov (United States)

    Cermak, Michael J.

    2012-01-01

    This essay describes an educational initiative that used environmentally themed (green) hip-hop to stimulate learning in an environmental science classroom. Students were then challenged to compose their own green hip-hop and their lyrics demonstrated skills that have thematic consistency around what is called a Critical Ecological Literacy (CEL).…

  5. Muziki wa Hip Hop na Haki Za Kijamii: Dhima, Changamoto na ...

    African Journals Online (AJOL)

    Ni dhahiri kuwa haki za kijamii zinaweza kuwasilishwa kwa jamii pana kupitia sanaa ya hip hop. Makala haya basi, yanabainisha dhima na mchango wa muziki wa hip hop katika masuala ya haki za kijamii, yanafafanua changamoto za muziki huu katika kuwasilisha haki za kijamii na kutoa mapendekezo kwa makundi ...

  6. Hop acid-rich spent craft brewer's yeast modulates gut bacterial growth

    Science.gov (United States)

    Alpha and beta hop acids (humulones and lupulones) from Humulus lupulus are inhibitors of Gram-positive organisms and important natural antibiotics for beer fermentation and carbohydrate feed stocks for biofuel production. Recent observations (Bryant and Cohen) of high levels of hop acids in spent ...

  7. Connectivity model for Inter-working multi-hop wireless networks

    CSIR Research Space (South Africa)

    Salami, O

    2009-08-01

    Full Text Available pairs in inter-working multi-hop wireless networks can be evaluated based on the availability of radio links and communication routes. This paper presents an analytical study of the link and route availability in inter-working multi-hop wireless networks....

  8. Two Hop Adaptive Vector Based Quality Forwarding for Void Hole Avoidance in Underwater WSNs.

    Science.gov (United States)

    Javaid, Nadeem; Ahmed, Farwa; Wadud, Zahid; Alrajeh, Nabil; Alabed, Mohamad Souheil; Ilahi, Manzoor

    2017-08-01

    Underwater wireless sensor networks (UWSNs) facilitate a wide range of aquatic applications in various domains. However, the harsh underwater environment poses challenges like low bandwidth, long propagation delay, high bit error rate, high deployment cost, irregular topological structure, etc. Node mobility and the uneven distribution of sensor nodes create void holes in UWSNs. Void hole creation has become a critical issue in UWSNs, as it severely affects the network performance. Avoiding void hole creation benefits better coverage over an area, less energy consumption in the network and high throughput. For this purpose, minimization of void hole probability particularly in local sparse regions is focused on in this paper. The two-hop adaptive hop by hop vector-based forwarding (2hop-AHH-VBF) protocol aims to avoid the void hole with the help of two-hop neighbor node information. The other protocol, quality forwarding adaptive hop by hop vector-based forwarding (QF-AHH-VBF), selects an optimal forwarder based on the composite priority function. QF-AHH-VBF improves network good-put because of optimal forwarder selection. QF-AHH-VBF aims to reduce void hole probability by optimally selecting next hop forwarders. To attain better network performance, mathematical problem formulation based on linear programming is performed. Simulation results show that by opting these mechanisms, significant reduction in end-to-end delay and better throughput are achieved in the network.

  9. QTL analysis of resistance to powdery mildew in Hop (Humulus lupulus L.)

    Science.gov (United States)

    Powdery mildew infection of hop results in significant production losses on an annual basis by reducing yields as well as cone quality. One of the best means to increase yield and quality is the production of resistant hop lines. Breeding for resistance can be significantly improved and accelerate...

  10. Membrane-bound ATPase contributes to hop resistance of Lactobacillus brevis

    NARCIS (Netherlands)

    Sakamoto, K; van Veen, HW; Saito, H; Kobayashi, H; Konings, WN

    2002-01-01

    The activity of the membrane-bound H+-ATPase of the beer spoilage bacterium Lactobacillus brevis ABBC45 increased upon adaptation to bacteriostatic hop compounds. The ATPase activity was optimal around pH 5.6 and increased up to fourfold when L. brevis was exposed to 666 muM hop compounds. The

  11. Trends in German Hip Hop Music and Its Usefulness for the Classroom

    Science.gov (United States)

    Schmidt, Johannes

    2008-01-01

    German hip hop music has proved productive, especially since 2000 when rap in Germany experienced something like a first crisis. As a response, German hip hop artists and record labels have ventured off in several different directions including other musical genres, different topics, and new approaches to German rap. This article discusses the…

  12. Hip-Hop and a Hybrid Text in a Postsecondary English Class

    Science.gov (United States)

    Sanchez, Deborah M.

    2010-01-01

    This study explores the epistemology present in hip-hop music and its reflection in the writing of one African American student in a postsecondary transitional English class. An integration of hip-hop and academic literacy practices in the student's essay challenges the supremacy of a "standard" academic English and deficit perspectives about…

  13. We Got Next: Hip-Hop Pedagogy and the Next Generation of Democratic Education

    Science.gov (United States)

    Dando, Michael

    2017-01-01

    Using daily experiences and existing identities as the subject matter, a hip-hop-centered class encourages students to develop a critical lens so that they can "envision a social order which supports their full humanity" (Shor, 1987, p. 48) and embraces the idea that hip-hop culture provides context for students to develop critical…

  14. Supporting Communication and Argumentation in Urban Science Education: Hip-Hop, the Battle, and the Cypher

    Science.gov (United States)

    Emdin, Christopher

    2011-01-01

    This paper is based on an exploration of communication and argumentation in urban science classrooms, and provides a description of the role that Hip-hop based education plays in supporting these major components of science education. The paper is intended to both support, and critique conventional uses of hip-hop based education, and provide…

  15. Affiliation and Alienation: Hip-Hop, Rap, and Urban Science Education

    Science.gov (United States)

    Emdin, Christopher

    2010-01-01

    The critiques of rap artists and other participants in hip-hop culture provide data for teachers and researchers to investigate the attitudes of US urban youth towards schooling. This study explores the complex relationships between hip-hop and science education by examining how rap lyrics project beliefs about schooling, the relevance of existing…

  16. Sampling Practices and Social Spaces: Exploring a Hip-Hop Approach to Higher Education

    Science.gov (United States)

    Petchauer, Emery

    2010-01-01

    Much more than a musical genre, hip-hop culture exists as an animating force in the lives of many young adults. This article looks beyond the moral concerns often associated with rap music to explore how hip-hop as a larger set of expressions and practices implicates the educational experiences, activities, and approaches for students. The article…

  17. Student Perceptions of the Hip Hop Culture's Influence on the Undergraduate Experience

    Science.gov (United States)

    Wessel, Roger D.; Wallaert, Kerry A.

    2011-01-01

    This study sought to determine how identification and engagement with the hip hop culture influenced the educational experiences of undergraduate students at a Midwestern, predominately White university by interviewing 11 students who self-identified as being immersed in the hip hop culture. Through a qualitative, phenomenological investigation,…

  18. Don't Believe the Hype: Hip-Hop Literacies and English Education

    Science.gov (United States)

    Belle, Crystal

    2016-01-01

    Current scholarship suggests that many youths identify with hip-hop, especially youths of color. Study of this artistic form has been suggested as a means of helping youths acquire and become fluent in literacy practices. This article explores how the use of a hip-hop literacies curriculum addressed the literacy skills of urban ninth-grade English…

  19. Deal with It We Must: Education, Social Justice, and the Curriculum of Hip Hop Culture

    Science.gov (United States)

    Baszile, Denise Taliaferro

    2009-01-01

    Although hip hop culture has been one of the most significant urban youth movements over the last three decades, it has only recently gained attention within the educational literature as a force to be reckoned with. And even then, much of the literature seeks to understand how hip hop can be used to engage students in the official school…

  20. Contributions to the quality control of two crops of economic importance : hops and yerba mate

    NARCIS (Netherlands)

    Wilson, Erica Georgina

    2012-01-01

    Quality control of plants is essential and at the same time very challenging.In this thesis, studies involving quality issues of two plants used in the production of two popular beverages, hops (in beer) and Ilex paraguariensis (yerba mate) were undertaken. Hops are used as bittering agents and to

  1. On the Capacity of a GSM Frequency Hopping network with Intelligent Underlayer-Overlayer

    DEFF Research Database (Denmark)

    Nielsen, Thomas Toftegaard; Wigard, Jeroen; Mogensen, Preben Elgaard

    1997-01-01

    . By combining this reuse partitioning with frequency hopping, an increase in the network capacity in terms of carried traffic per cell is achieved. Simulations have indicated that for slow moving mobiles a gain of approximately 35% is achieved by this new feature when compared with a frequency hopping network...

  2. System optimization for peer-to-peer multi hop video broadcasting in wireless ad hoc networks

    NARCIS (Netherlands)

    Dedeoglu, V.; Atici, C.; Salman, F.S.; Sunay, M.O.

    2008-01-01

    We consider peer-to-peer video broadcasting using cooperation among peers in an ad hoc wireless network. As opposed to the traditional single hop broadcasting, multiple hops cause an increase in broadcast video quality while creating interference and increasing transmission delay. We develop

  3. Generalization of fewest-switches surface hopping for coherences

    Science.gov (United States)

    Tempelaar, Roel; Reichman, David R.

    2018-03-01

    Fewest-switches surface hopping (FSSH) is perhaps the most widely used mixed quantum-classical approach for the modeling of non-adiabatic processes, but its original formulation is restricted to (adiabatic) population terms of the quantum density matrix, leaving its implementations with an inconsistency in the treatment of populations and coherences. In this article, we propose a generalization of FSSH that treats both coherence and population terms on equal footing and which formally reduces to the conventional FSSH algorithm for the case of populations. This approach, coherent fewest-switches surface hopping (C-FSSH), employs a decoupling of population relaxation and pure dephasing and involves two replicas of the classical trajectories interacting with two active surfaces. Through extensive benchmark calculations of a spin-boson model involving a Debye spectral density, we demonstrate the potential of C-FSSH to deliver highly accurate results for a large region of parameter space. Its uniform description of populations and coherences is found to resolve incorrect behavior observed for conventional FSSH in various cases, in particular at low temperature, while the parameter space regions where it breaks down are shown to be quite limited. Its computational expenses are virtually identical to conventional FSSH.

  4. Robust hopping based on virtual pendulum posture control

    International Nuclear Information System (INIS)

    Sharbafi, Maziar A; Ahmadabadi, Majid Nili; Yazdanpanah, Mohammad J; Maufroy, Christophe; Seyfarth, Andre

    2013-01-01

    A new control approach to achieve robust hopping against perturbations in the sagittal plane is presented in this paper. In perturbed hopping, vertical body alignment has a significant role for stability. Our approach is based on the virtual pendulum concept, recently proposed, based on experimental findings in human and animal locomotion. In this concept, the ground reaction forces are pointed to a virtual support point, named virtual pivot point (VPP), during motion. This concept is employed in designing the controller to balance the trunk during the stance phase. New strategies for leg angle and length adjustment besides the virtual pendulum posture control are proposed as a unified controller. This method is investigated by applying it on an extension of the spring loaded inverted pendulum (SLIP) model. Trunk, leg mass and damping are added to the SLIP model in order to make the model more realistic. The stability is analyzed by Poincaré map analysis. With fixed VPP position, stability, disturbance rejection and moderate robustness are achieved, but with a low convergence speed. To improve the performance and attain higher robustness, an event-based control of the VPP position is introduced, using feedback of the system states at apexes. Discrete linear quartic regulator is used to design the feedback controller. Considerable enhancements with respect to stability, convergence speed and robustness against perturbations and parameter changes are achieved. (paper)

  5. A decentralized scheduling algorithm for time synchronized channel hopping

    Directory of Open Access Journals (Sweden)

    Andrew Tinka

    2011-09-01

    Full Text Available Time Synchronized Channel Hopping (TSCH is an existing Medium Access Control scheme which enables robust communication through channel hopping and high data rates through synchronization. It is based on a time-slotted architecture, and its correct functioning depends on a schedule which is typically computed by a central node. This paper presents, to our knowledge, the first scheduling algorithm for TSCH networks which both is distributed and which copes with mobile nodes. Two variations on scheduling algorithms are presented. Aloha-based scheduling allocates one channel for broadcasting advertisements for new neighbors. Reservation- based scheduling augments Aloha-based scheduling with a dedicated timeslot for targeted advertisements based on gossip information. A mobile ad hoc motorized sensor network with frequent connectivity changes is studied, and the performance of the two proposed algorithms is assessed. This performance analysis uses both simulation results and the results of a field deployment of floating wireless sensors in an estuarial canal environment. Reservation-based scheduling performs significantly better than Aloha-based scheduling, suggesting that the improved network reactivity is worth the increased algorithmic complexity and resource consumption.

  6. Asynchronous Channel-Hopping Scheme under Jamming Attacks

    Directory of Open Access Journals (Sweden)

    Yongchul Kim

    2018-01-01

    Full Text Available Cognitive radio networks (CRNs are considered an attractive technology to mitigate inefficiency in the usage of licensed spectrum. CRNs allow the secondary users (SUs to access the unused licensed spectrum and use a blind rendezvous process to establish communication links between SUs. In particular, quorum-based channel-hopping (CH schemes have been studied recently to provide guaranteed blind rendezvous in decentralized CRNs without using global time synchronization. However, these schemes remain vulnerable to jamming attacks. In this paper, we first analyze the limitations of quorum-based rendezvous schemes called asynchronous channel hopping (ACH. Then, we introduce a novel sequence sensing jamming attack (SSJA model in which a sophisticated jammer can dramatically reduce the rendezvous success rates of ACH schemes. In addition, we propose a fast and robust asynchronous rendezvous scheme (FRARS that can significantly enhance robustness under jamming attacks. Our numerical results demonstrate that the performance of the proposed scheme vastly outperforms the ACH scheme when there are security concerns about a sequence sensing jammer.

  7. Effects of compositional defects on small polaron hopping in micas.

    Science.gov (United States)

    Rosso, Kevin M; Ilton, Eugene S

    2005-06-22

    Hartree-Fock calculations and electron transfer (ET) theory were used to model the effects of compositional defects on ET in the brucite-like octahedral sheet of mica. ET was modeled as an Fe(IIIII) valence interchange reaction across shared octahedral edges of the M2-M2 iron sublattice. The model entails the hopping of localized electrons and small polaron behavior. Hartree-Fock calculations indicate that substitution of F for structural OH bridges increases the reorganization energy lambda, decreases the electronic coupling matrix element V(AB), and thereby substantially decreases the hopping rate. The lambda increase arises from modification of the metal-ligand bond force constants, and the V(AB) decrease arises from reduction of superexchange interaction through anion bridges. Deprotonation of an OH bridge, consistent with a possible mechanism of maintaining charge neutrality during net oxidation, yields a net increase in the ET rate. Although substitution of Al or Mg for Fe in M1 sites distorts the structure of adjacent Fe-occupied M2 sites, the distortion has little net impact on ET rates through these M2 sites. Hence the main effect of Al or Mg substitution for Fe, should it occur in the M2 sublattice, is to block ET pathways. Collectively, these findings pave the way for larger-scale oxidation/reduction models to be constructed for realistic, compositionally diverse micas.

  8. Hip-Hop to Health Jr. for Latino preschool children.

    Science.gov (United States)

    Fitzgibbon, Marian L; Stolley, Melinda R; Schiffer, Linda; Van Horn, Linda; KauferChristoffel, Katherine; Dyer, Alan

    2006-09-01

    Hip-Hop to Health Jr. was a diet/physical activity intervention designed to reduce gains in BMI (kilograms per meter squared) in preschool minority children. Twelve predominantly Latino Head Start centers participated in a group-randomized trial conducted between Fall 2001 and Winter 2003. Six centers were randomized to a culturally proficient 14-week (three times weekly) diet/physical activity intervention. Parents participated by completing weekly homework assignments. The children in the other six centers received a general health intervention that did not address either diet or physical activity. The primary outcome was change in BMI, and secondary outcomes were changes in dietary intake and physical activity. Measures were collected at baseline, post-intervention, and at Years 1 and 2 follow-up. There were no significant differences between intervention and control schools in either primary or secondary outcomes at post-intervention, Year 1, or Year 2 follow-ups. When Hip-Hop to Health Jr. was conducted in predominantly black Head Start centers, it was effective in reducing subsequent increases in BMI in preschool children. In contrast, when the program was conducted in Latino centers, it was not effective. Although the intervention did not prevent excessive weight gain in Latino children, it was very well received. Future interventions with this population may require further cultural tailoring and a more robust parent intervention.

  9. Interaction between hopping and static spins in a discrete network

    Energy Technology Data Exchange (ETDEWEB)

    Ciccarello, Francesco, E-mail: francesco.ciccarello@sns.it [CNISM and Dipartimento di Fisica, Universita' degli Studi di Palermo, Viale delle Scienze, Edificio 18, I-90128 Palermo (Italy); NEST, Scuola Normale Superiore and Istituto Nanoscienze-CNR, Piazza dei Cavalieri 7, I-56126 Pisa (Italy)

    2011-06-27

    We consider a process where a spin hops across a discrete network and at certain sites couples to static spins. While this setting is implementable in various scenarios (e.g. quantum dots or coupled cavities) the physics of such processes is still basically unknown. Here, we take a first step along this line by scrutinizing a two-site and a three-site lattices, each with two static spins. Despite a generally complex dynamics occurs, we show a regime such that the spin dynamics is described by an effective three-spin chain. Tasks such as entanglement generation and quantum state transfer can be achieved accordingly. -- Highlights: → We study mobile spins hopping in a discrete network and coupled to static spins. → This setting can be implemented in various scenarios. → We address a two-site and a three-site lattice, each with two static spins. → We show a regime where the setup can be described by an effective three-spin chain. → Accordingly, it is prone to be exploited for some QIP applications.

  10. HOPS 383: AN OUTBURSTING CLASS 0 PROTOSTAR IN ORION

    Energy Technology Data Exchange (ETDEWEB)

    Safron, Emily J.; Megeath, S. Thomas; Booker, Joseph [Ritter Astrophysical Observatory, Department of Physics and Astronomy, University of Toledo, Toledo, OH (United States); Fischer, William J. [NASA Goddard Space Flight Center, Greenbelt, MD (United States); Furlan, Elise; Rebull, Luisa M. [Infrared Processing and Analysis Center, Caltech, Pasadena, CA (United States); Stutz, Amelia M. [Max-Planck-Institut für Astronomie, Heidelberg (Germany); Stanke, Thomas [European Southern Observatory, Garching bei München (Germany); Billot, Nicolas [Instituto de Radio Astronomía Milimétrica, Granada (Spain); Tobin, John J. [Leiden Observatory, Leiden (Netherlands); Ali, Babar [Space Science Institute, Boulder, CO (United States); Allen, Lori E. [National Optical Astronomy Observatory, Tucson, AZ (United States); Watson, Dan M. [Department of Physics and Astronomy, University of Rochester, Rochester, NY (United States); Wilson, T. L., E-mail: wjfischer@gmail.com [Naval Research Laboratory, Washington, DC (United States)

    2015-02-10

    We report the dramatic mid-infrared brightening between 2004 and 2006 of Herschel Orion Protostar Survey (HOPS) 383, a deeply embedded protostar adjacent to NGC 1977 in Orion. By 2008, the source became a factor of 35 brighter at 24 μm with a brightness increase also apparent at 4.5 μm. The outburst is also detected in the submillimeter by comparing APEX/SABOCA to SCUBA data, and a scattered-light nebula appeared in NEWFIRM K{sub s} imaging. The post-outburst spectral energy distribution indicates a Class 0 source with a dense envelope and a luminosity between 6 and 14 L{sub ⊙}. Post-outburst time-series mid- and far-infrared photometry show no long-term fading and variability at the 18% level between 2009 and 2012. HOPS 383 is the first outbursting Class 0 object discovered, pointing to the importance of episodic accretion at early stages in the star formation process. Its dramatic rise and lack of fading over a 6 year period hint that it may be similar to FU Ori outbursts, although the luminosity appears to be significantly smaller than the canonical luminosities of such objects.

  11. Hip-Hop as a Resource for Understanding the Urban Context: A Review of Christopher Edmin's--Science Education for the Hip-Hop Generation, Sense Publishers, Rotterdam, 2010

    Science.gov (United States)

    Brown, Bryan

    2010-01-01

    This review explores Edmin's "Science education for the hip-hop generation" by documenting how he frames hip-hop as a means to access urban student culture. He argues that hip-hop is more than a mere music genre, but rather a culture that provides young people with ways of connecting to the world. Two primary ideas emerged as central to…

  12. Hopping system control with an approximated dynamics model and upper-body motion

    Energy Technology Data Exchange (ETDEWEB)

    Lee, Hyang Jun; Oh, Jun Ho [KAIST, Daejeon (Korea, Republic of)

    2015-11-15

    A hopping system is highly non-linear due to the nature of its dynamics, which has alternating phases in a cycle, flight and stance phases and related transitions. Every control method that stabilizes the hopping system satisfies the Poincaré stability condition. At the Poincaré section, a hopping system cycle is considered as discrete sectional data set. By controlling the sectional data in a discrete control form, we can generate a stable hopping cycle. We utilize phase-mapping matrices to build a Poincaré return map by approximating the dynamics of the hopping system with SLIP model. We can generate various Poincaré stable gait patterns with the approximated discrete control form which uses upper-body motions as inputs.

  13. Backoff-stage synchronization in three-hop string-topology wireless networks with hidden nodes

    Science.gov (United States)

    Sanada, Kosuke; Sekiya, Hiroo; Komuro, Nobuyoshi; Sakata, Shiro

    In IEEE 802.11 wireless multi-hop networks, each node works individually and their individual operations generate entire network dynamics. It is important to clarify the network dynamics in wireless multi-hop networks for designing and constructing multi-hop communication networks. This paper presents the network-dynamics investigations for three-hop string-topology wireless network in detail. From the investigations, a “backoff-stage synchronization” phenomenon, which is mutuality between hidden nodes, is found. The mechanism of the backoff-stage synchronization is expressed and the sufficient conditions for the synchronization occurrence are given. This phenomenon gives some impacts on the IEEE 802.11 multi-hop-network communications.

  14. Throw Yo' Voice Out: Disability as a Desirable Practice in Hip-Hop Vocal Performance

    Directory of Open Access Journals (Sweden)

    Alex S. Porco

    2014-12-01

    Full Text Available Disabled bodies and disabling spaces— especially the recording studio— shape the sound iconicity of hip-hop vocal performances. The disabled voice is the audible sign by which hip-hop artists trouble cultural definitions of the self and other; exceptionalism and failure; the natural and techno-mediated; comedy and tragedy; and aesthetic play and seriousness. Hip-hop vocal performances also function as self-conscious acts of transvaluation that challenge the discursive dominance of ableism. A materialist approach to vocal performance resists reducing voice to a silent metaphor for race, oppositionality, or liberation; and it emphasizes, instead, the physiological and social processes that render hip-hop voices unique, particular, and audible. It emphasizes the agency hip-hop artists possess in seeking out disabled bodies and assuming disabled identities for aesthetic and political ends. Thus, the body is returned to the analysis of style.

  15. RNAi knockdown of Hop (Hsp70/Hsp90 organising protein) decreases invasion via MMP-2 down regulation.

    LENUS (Irish Health Repository)

    Walsh, Naomi

    2011-07-28

    We previously identified Hop as over expressed in invasive pancreatic cancer cell lines and malignant tissues of pancreatic cancer patients, suggesting an important role for Hop in the biology of invasive pancreatic cancer. Hop is a co-chaperone protein that binds to both Hsp70\\/Hsp90. We hypothesised that by targeting Hop, signalling pathways modulating invasion and client protein stabilisation involving Hsp90-dependent complexes may be altered. In this study, we show that Hop knockdown by small interfering (si)RNA reduces the invasion of pancreatic cancer cells, resulting in decreased expression of the downstream target gene, matrix metalloproteinases-2 (MMP-2). Hop in conditioned media co-immunoprecipitates with MMP-2, implicating a possible extracellular function for Hop. Knockdown of Hop expression also reduced expression levels of Hsp90 client proteins, HER2, Bcr-Abl, c-MET and v-Src. Furthermore, Hop is strongly expressed in high grade PanINs compared to lower PanIN grades, displaying differential localisation in invasive ductal pancreatic cancer, indicating that the localisation of Hop is an important factor in pancreatic tumours. Our data suggests that the attenuation of Hop expression inactivates key signal transduction proteins which may decrease the invasiveness of pancreatic cancer cells possibly through the modulation of Hsp90 activity. Therefore, targeting Hop in pancreatic cancer may constitute a viable strategy for targeted cancer therapy.

  16. Engaging Black Males on Their Own Terms: What Schools Can Learn from Black Males Who Produce Hip-Hop

    Science.gov (United States)

    Irby, Decoteau J.; Petchauer, Emery; Kirkland, David

    2013-01-01

    Education scholars and practitioners have much to learn about engagement and motivation of Black males by directing their inquiries to more organic sites of hip-hop cultural production outside of schools. One such site is the hip-hop's informal labor economy where Black males engage in earning money through hip-hop cultural production. Labor…

  17. Complex Personhood of Hip Hop & the Sensibilities of the Culture That Fosters Knowledge of Self & Self-Determination

    Science.gov (United States)

    Love, Bettina L.

    2016-01-01

    Hip hop music and culture have a complex identity in that hip hop is based in self-determination, resistance, and the long enduring fight for Black freedom, but was also created alongside the seductiveness of the material and psychological conditions of capitalism, sexism, and patriarchy. Hip hop pedagogy (HHP) as a pedagogical framework is…

  18. Involvement of Vacuolar Sequestration and Active Transport in Tolerance of Saccharomyces cerevisiae to Hop Iso-?-Acids

    NARCIS (Netherlands)

    Hazelwood, L.A.; Walsh, M.C.; Pronk, J.T.; Daran, J.M.

    2009-01-01

    The hop plant, Humulus lupulus L., has an exceptionally high content of secondary metabolites, the hop -acids, which possess a range of beneficial properties, including antiseptic action. Studies performed on the mode of action of hop iso--acids have hitherto been restricted to lactic acid bacteria.

  19. Implementation of surface hopping molecular dynamics using semiempirical methods

    International Nuclear Information System (INIS)

    Fabiano, E.; Keal, T.W.; Thiel, W.

    2008-01-01

    A molecular dynamics driver and surface hopping algorithm for nonadiabatic dynamics has been implemented in a development version of the MNDO semiempirical electronic structure package. The required energies, gradients and nonadiabatic couplings are efficiently evaluated on the fly using semiempirical configuration interaction methods. The choice of algorithms for the time evolution of the nuclear motion and quantum amplitudes is discussed, and different schemes for the computation of nonadiabatic couplings are analysed. The importance of molecular orbital tracking and electronic state following is underlined in the context of configuration interaction calculations. The method is applied to three case studies (ethylene, methaniminium ion, and methanimine) using the orthogonalization corrected OM2 Hamiltonian. In all three cases decay times and dynamics paths similar to high-level ab initio results are obtained

  20. Nonregenerative Dual-Hop Cooperative Links with Selection Diversity

    Directory of Open Access Journals (Sweden)

    Karagiannidis George K

    2006-01-01

    Full Text Available The end-to-end performance of dual-hop cooperative diversity systems equipped with nonregenerative relays and a selection combining receiver at the destination terminal over independent and nonidentical Nakagami- fading channels is studied. Closed-form expressions for the cumulative distribution function and the probability density function of the end-to-end signal-to-noise ratio ( are presented, while analytical formulae are derived for the moments and the moment generating function. Using these statistical results, closed-form expressions for the outage probability are presented for both channel state information and fixed gain relays. Furthermore, for the case of fixed gain relay, the average end-to-end , the amount of fading, and the average bit error rate can be numerically evaluated. The proposed mathematical analysis is complemented by numerical examples, including the effects on the overall performance of the s unbalancing as well as the fading severity.

  1. SDN-Based Double Hopping Communication against Sniffer Attack

    Directory of Open Access Journals (Sweden)

    Zheng Zhao

    2016-01-01

    Full Text Available Sniffer attack has been a severe threat to network communication security. Traditional network usually uses static network configuration, which provides convenience to sniffer attack. In this paper, an SDN-based double hopping communication (DHC approach is proposed to solve this problem. In DHC, ends in communication packets as well as the routing paths are changed dynamically. Therefore, the traffic will be distributed to multiple flows and transmitted along different paths. Moreover, the data from multiple users will be mixed, bringing difficulty for attackers in obtaining and recovering the communication data, so that sniffer attack will be prevented effectively. It is concluded that DHC is able to increase the overhead of sniffer attack, as well as the difficulty of communication data recovery.

  2. Mode competition and hopping in optomechanical nano-oscillators

    Science.gov (United States)

    Zhang, Xingwang; Lin, Tong; Tian, Feng; Du, Han; Zou, Yongchao; Chau, Fook Siong; Zhou, Guangya

    2018-04-01

    We investigate the inter-mode nonlinear interaction in the multi-mode optomechanical nano-oscillator which consists of coupled silicon nanocantilevers, where the integrated photonic crystal nanocavities provide the coupling between the optical and mechanical modes. Due to the self-saturation and cross-saturation of the mechanical gain, the inter-mode competition is observed, which leads to the bistable operation of the optomechanical nano-oscillator: only one of the mechanical modes can oscillate at any one time, and the oscillation of one mode extremely suppresses that of the other with a side mode suppression ratio (SMSR) up to 40 dB. In the meantime, mode hopping, i.e., the optomechanical oscillation switches from one mode to the other, is also observed and found to be able to be provoked by excitation laser fluctuations.

  3. Vibrational spectroscopy and chemometrics for rapid, quantitative analysis of bitter acids in hops (Humulus lupulus).

    Science.gov (United States)

    Killeen, Daniel P; Andersen, David H; Beatson, Ron A; Gordon, Keith C; Perry, Nigel B

    2014-12-31

    Hops, Humulus lupulus, are grown worldwide for use in the brewing industry to impart characteristic flavor and aroma to finished beer. Breeders produce many varietal crosses with the aim of improving and diversifying commercial hops varieties. The large number of crosses critical to a successful breeding program imposes high demands on the supporting chemical analytical laboratories. With the aim of reducing the analysis time associated with hops breeding, quantitative partial least-squares regression (PLS-R) models have been produced, relating reference data acquired by the industrial standard HPLC and UV methods, to vibrational spectra of the same, chemically diverse hops sample set. These models, produced from rapidly acquired infrared (IR), near-infrared (NIR), and Raman spectra, were appraised using standard statistical metrics. Results demonstrated that all three spectroscopic methods could be used for screening hops for α-acid, total bitter acids, and cohumulone concentrations in powdered hops. Models generated from Raman and IR spectra also showed potential for use in screening hops varieties for xanthohumol concentrations. NIR analysis was performed using both a standard benchtop spectrometer and a portable NIR spectrometer, with comparable results obtained by both instruments. Finally, some important vibrational features of cohumulone, colupulone, and xanthohumol were assigned using DFT calculations, which allow more insightful interpretation of PLS-R latent variable plots.

  4. Coupled catastrophes: sudden shifts cascade and hop among interdependent systems

    Science.gov (United States)

    Barnett, George; D'Souza, Raissa M.

    2015-01-01

    An important challenge in several disciplines is to understand how sudden changes can propagate among coupled systems. Examples include the synchronization of business cycles, population collapse in patchy ecosystems, markets shifting to a new technology platform, collapses in prices and in confidence in financial markets, and protests erupting in multiple countries. A number of mathematical models of these phenomena have multiple equilibria separated by saddle-node bifurcations. We study this behaviour in its normal form as fast–slow ordinary differential equations. In our model, a system consists of multiple subsystems, such as countries in the global economy or patches of an ecosystem. Each subsystem is described by a scalar quantity, such as economic output or population, that undergoes sudden changes via saddle-node bifurcations. The subsystems are coupled via their scalar quantity (e.g. trade couples economic output; diffusion couples populations); that coupling moves the locations of their bifurcations. The model demonstrates two ways in which sudden changes can propagate: they can cascade (one causing the next), or they can hop over subsystems. The latter is absent from classic models of cascades. For an application, we study the Arab Spring protests. After connecting the model to sociological theories that have bistability, we use socioeconomic data to estimate relative proximities to tipping points and Facebook data to estimate couplings among countries. We find that although protests tend to spread locally, they also seem to ‘hop' over countries, like in the stylized model; this result highlights a new class of temporal motifs in longitudinal network datasets. PMID:26559684

  5. Photometric evidence of electron precipitation induced by first hop whistlers

    International Nuclear Information System (INIS)

    Doolittle, J.H.; Carpenter, D.L.

    1983-01-01

    Electron precipitation events induced by discrete VLF whistler mode waves have previously been detected by photometers at Siple Station, Antarctica. This paper presents the first observations of ionospheric optical emissions correlated with VLF waves at the conjugate location, near Roberval, Quebec. Since most whistlers recorded at Siple or Roberval originate in the north, Roberval affords a clear perspective on the direct precipitation induced during the first pass of the wave as it propagates southward. For such a wave the direct precipitation and that induced in the ''mirrored mode'' by the returning two-hop wave should differ in arrival time by roughly twice the wave propagation time between hemispheres, while at Siple the effects of the direct and mirrored modes may overlap in time. A well defined series of observations of structured lambda4278 optical emissions was observed on August 30, 1979 in the aftermath of an intense magnetic storm. The optical emissions were found to lead the arrival time of the two-hop waves by about 0.7 s instead of lagging the local waves by about 1--2 s as had been previously observed for whistler driven events at Siple. The observed arrival time relationships are consistent with the predictions of a cyclotron resonance interaction model, and thus support previous observations of x-rays at Roberval. The importance of the first pass of the wave is further emphasized by an approximate proportionality between the amplitude of the VLF waves recorded at Siple and the intensity of the optical emission bursts at Roberval. Although structured optical emissions correlated with wave bursts can clearly be detected at Roberval, relatively large magnetospheric particle fluxes may be required to produce such events

  6. The Effect of Rap/Hip-Hop Music on Young Adult Smoking: An Experimental Study.

    Science.gov (United States)

    Harakeh, Zeena; Bogt, Tom F M Ter

    2018-02-16

    Music may influence young people's behavior through its lyrics. Substance use references occur more frequently in rap/hip-hop than in other music genres. The aim was to examine whether the exposure to rap/hip-hop lyrics referring to substance use affected cigarette smoking. An experiment with a 3-group between subject design was conducted among 74 daily-smoking young adults ranging in age from 17 to 25 years old. Three conditions were tested in a mobile lab (camper vehicle) from May to December 2011, i.e., regular chart pop music (N = 28), rap/hip-hop with non-frequent references to substance use (N = 24), and rap/hip-hop with frequent references to substance use (N = 22). One-way ANOVA showed that participants listening to substance use infused rap/hip-hop songs felt significantly less pleasant, liked the songs less, and comprehended the songs less compared to participants listening to pop songs. Poisson loglinear analyses revealed that compared to the pop music condition, none of the two rap/hip-hop music conditions had a significant effect on acute smoking. Thus, contrary to expectations, the two different rap/hip-hop conditions did not have a significantly different effect on acute smoking. Listening to rap/hip-hop, even rap hip/hop with frequent referrals to substance use (primarily alcohol and drug use, and general smoking referrals), does not seem to encourage cigarette smoking among Dutch daily-smoking young adults, at least short term.

  7. Agronomic performance and beer quality assessment of twenty hop cultivars grown in Central Italy

    Directory of Open Access Journals (Sweden)

    Francesco Rossini

    2016-08-01

    Full Text Available Hop market and beer industry have always been of secondary relevance in Italy as compared to grape and wine sector. Hence, hop cultivars and the information for growing hops have been generated almost entirely from the major hop production countries. Identifying cultivars that perform well in Mediterranean environments is therefore essential to successfully start hop cultivation and breeding activity in this new growing region. To evaluate the intraspecific diversity of hop in Central Italy, 20 female hop genotypes with different origin were screened during three growing seasons (2013-2015 in an experimental hop yard. Cones yield, plant height and crop phenology were evaluated to determine which cultivars were best suited to the Mediterranean climate. Moreover, given the rising interest for the development of local beers with distinguishing aroma, a sensory analysis was performed and beers flavoured with locally produced and imported cones were compared. A significant diversity among cultivars was found for all parameters investigated. The results indicated that weather condition during flowering and development of cones markedly affected yield and plant height. Cones yield was negatively correlated with thermal time (r=–0.5, P<0.05 to harvest and positively with plant height (r=0.56, P<0.05. Cascade, Hallertauer Magnum, Hersbrucker Spat and Yeoman showed the best adaptability to the Mediterranean growing conditions as they were the top-performing cultivars across the three years. Sensory analysis evidenced the importance of cultivar selection as determining factor for flavouring properties of beers. In general, results showed that the origin of cones strongly affected the mouth feel of beers. More complex and appreciated aroma profiles were identified for beers flavoured with local cones than those hopped with commercial products.

  8. Optimal Design of Dual-Hop VLC/RF Communication System With Energy Harvesting

    KAUST Repository

    Rakia, Tamer

    2016-07-28

    In this letter, we consider a dual-hop heterogeneous visible light communication (VLC)/radio frequency (RF) communication system to extend the coverage of VLC systems. Besides detecting the information over VLC link, the relay is able to harvest energy from the first-hop VLC link, by extracting the direct current component of the received optical signal, and uses the harvested energy to retransmit the data to a mobile terminal over the second-hop RF link. We investigate the optimal design of the hybrid system in terms of data rate maximization.

  9. Plasmodium falciparum Hop (PfHop Interacts with the Hsp70 Chaperone in a Nucleotide-Dependent Fashion and Exhibits Ligand Selectivity.

    Directory of Open Access Journals (Sweden)

    Tawanda Zininga

    Full Text Available Heat shock proteins (Hsps play an important role in the development and pathogenicity of malaria parasites. One of the most prominent functions of Hsps is to facilitate the folding of other proteins. Hsps are thought to play a crucial role when malaria parasites invade their host cells and during their subsequent development in hepatocytes and red blood cells. It is thought that Hsps maintain proteostasis under the unfavourable conditions that malaria parasites encounter in the host environment. Although heat shock protein 70 (Hsp70 is capable of independent folding of some proteins, its functional cooperation with heat shock protein 90 (Hsp90 facilitates folding of some proteins such as kinases and steroid hormone receptors into their fully functional forms. The cooperation of Hsp70 and Hsp90 occurs through an adaptor protein called Hsp70-Hsp90 organising protein (Hop. We previously characterised the Hop protein from Plasmodium falciparum (PfHop. We observed that the protein co-localised with the cytosol-localised chaperones, PfHsp70-1 and PfHsp90 at the blood stages of the malaria parasite. In the current study, we demonstrated that PfHop is a stress-inducible protein. We further explored the direct interaction between PfHop and PfHsp70-1 using far Western and surface plasmon resonance (SPR analyses. The interaction of the two proteins was further validated by co-immunoprecipitation studies. We observed that PfHop and PfHsp70-1 associate in the absence and presence of either ATP or ADP. However, ADP appears to promote the association of the two proteins better than ATP. In addition, we investigated the specific interaction between PfHop TPR subdomains and PfHsp70-1/ PfHsp90, using a split-GFP approach. This method allowed us to observe that TPR1 and TPR2B subdomains of PfHop bind preferentially to the C-terminus of PfHsp70-1 compared to PfHsp90. Conversely, the TPR2A motif preferentially interacted with the C-terminus of PfHsp90. Finally, we

  10. Research on Improved DV-HOP Algorithm against Wormhole Attacks in WSN

    Directory of Open Access Journals (Sweden)

    Wang Xue-Wen

    2016-01-01

    Full Text Available The secure location of node is significant in the WSN (Wireless Sensor Networks of the troop frontier defence system. The wormhole attack is a big threat in the secure location. The credibility of the beacon node was used to determine the malicious nodes produced by wormhole attack in the WSN. The estimated method of multibeacon nodes was adopted to improve DV-HOP algorithm after excluding the malicious nodes. In this paper, we compared the basic DV-HOP algorithm and the improved DV-HOP algorithm in the coverage percentage and the error of network localization by simulating. The simulation results indicate that the improved DV-HOP algorithm makes the localization coverage percentage can reach 90% on a certain scale of the network, and it makes the error percentage lower when the number of beacons is different.

  11. Multi-hop routing in wireless sensor networks an overview, taxonomy, and research challenges

    CERN Document Server

    Rani, Shalli

    2016-01-01

    This brief provides an overview of recent developments in multi-hop routing protocols for Wireless Sensor Networks (WSNs). It introduces the various classifications of routing protocols and lists the pros and cons of each category, going beyond the conceptual overview of routing classifications offered in other books. Recently many researchers have proposed numerous multi-hop routing protocols and thereby created a need for a book that provides its readers with an up-to-date road map of this research paradigm.   The authors present some of the most relevant results achieved by applying an algorithmic approach to the research on multi-hop routing protocols. The book covers measurements, experiences and lessons learned from the implementation of multi-hop communication prototypes. Furthermore, it describes future research challenges and as such serves as a useful guide for students and researchers alike.

  12. The SAHR Setup-Controlling Hopping Speed and Height Using a Single Actuator

    Directory of Open Access Journals (Sweden)

    N. Cherouvim

    2008-01-01

    Full Text Available In this paper we present and experimentally validate a control method for regulating both the forward speed and the apex height of a one-legged hopping robot, using only a single actuator. The control method is based on a dynamic model of the hopping robot and makes use of the dynamic coupling of the vertical and forward motions of the robot. The control is applied first to a simulated model of the robot and shown to track a desired forward robot speed and a desired apex height. Then the SAHR (single actuator hopping robot hardware is introduced and is used as an experimental platform with which to evaluate the performance of the control method. The control method is applied to the physical setup and is shown to lead to a stable hopping gait with a desired forward speed and apex height, despite the unmodelled disturbances met on the laboratory floor.

  13. Optimal Design of Dual-Hop VLC/RF Communication System With Energy Harvesting

    KAUST Repository

    Rakia, Tamer; Yang, Hong Chuan; Gebali, Fayez; Alouini, Mohamed-Slim

    2016-01-01

    In this letter, we consider a dual-hop heterogeneous visible light communication (VLC)/radio frequency (RF) communication system to extend the coverage of VLC systems. Besides detecting the information over VLC link, the relay is able to harvest

  14. The iterative hopping expansion algorithm for Monte Carlo calculations with very light fermions

    International Nuclear Information System (INIS)

    Montvay, I.

    1985-03-01

    The number of numerical operations necessary for a Monte Carlo simulation with very light fermions (like u- and d-quarks in quantum chromodynamics) is estimated within the iterative hopping expansion method. (orig.)

  15. Switched diversity strategies for dual-hop amplify-and-forward relaying systems

    KAUST Repository

    Gaaloul, Fakhreddine; Radaydeh, Redha Mahmoud Mesleh; Alouini, Mohamed-Slim

    2012-01-01

    This study investigates different receive single-branch switch-based diversity schemes for dual-hop amplify-and-forward relaying networks. Specifically, three receive processing algorithms are adopted, in which the receive branch is selected using

  16. Antiproliferative effects of prenylflavonoids from hops on human colon cancer cell lines

    Czech Academy of Sciences Publication Activity Database

    Hudcová, T.; Bryndová, Jana; Fialová, K.; Fiala, J.; Karabín, M.; Jelínek, L.; Dostalek, P.

    2014-01-01

    Roč. 120, č. 3 (2014), s. 225-230 ISSN 0046-9750 Institutional support: RVO:67985823 Keywords : hop * prenylflavonoids * xanthohumol * isoxanthohumol * antiproliferative * colon cancer Subject RIV: GM - Food Processing Impact factor: 1.240, year: 2014

  17. Memory effects, two color percolation, and the temperature dependence of Mott variable-range hopping

    Science.gov (United States)

    Agam, Oded; Aleiner, Igor L.

    2014-06-01

    There are three basic processes that determine hopping transport: (a) hopping between normally empty sites (i.e., having exponentially small occupation numbers at equilibrium), (b) hopping between normally occupied sites, and (c) transitions between normally occupied and unoccupied sites. In conventional theories all these processes are considered Markovian and the correlations of occupation numbers of different sites are believed to be small (i.e., not exponential in temperature). We show that, contrary to this belief, memory effects suppress the processes of type (c) and manifest themselves in a subleading exponential temperature dependence of the variable-range hopping conductivity. This temperature dependence originates from the property that sites of type (a) and (b) form two independent resistor networks that are weakly coupled to each other by processes of type (c). This leads to a two-color percolation problem which we solve in the critical region.

  18. Multi-hop Relaying: An End-to-End Delay Analysis

    KAUST Repository

    Chaaban, Anas; Sezgin, Aydin

    2015-01-01

    The impact of multi-hopping schemes on the communication latency in a relay channel is studied. The main aim is to characterize conditions under which such schemes decrease the communication latency given a reliability requirement. Both decode

  19. Energy-efficient power allocation of two-hop cooperative systems with imperfect channel estimation

    KAUST Repository

    Amin, Osama; Bedeer, Ebrahim; Ahmed, Mohamed H.; Dobre, Octavia A.; Alouini, Mohamed-Slim

    2015-01-01

    an accurate EE metric for cooperative two-hop systems that use the amplify-and-forward relaying scheme. Different from the existing research that assumes the availability of perfect channel state information (CSI) at the communication cooperative nodes, we

  20. A Stochastic Geometry Model for Multi-hop Highway Vehicular Communication

    KAUST Repository

    Farooq, Muhammad Junaid; Elsawy, Hesham; Alouini, Mohamed-Slim

    2015-01-01

    dissemination. This paper exploits stochastic geometry to develop a tractable and accurate modeling framework to characterize the multi-hop transmissions for vehicular networks in a multi-lane highway setup. In particular, we study the tradeoffs between per

  1. Dual-Hop FSO Transmission Systems over Gamma-Gamma Turbulence with Pointing Errors

    KAUST Repository

    Zedini, Emna; Soury, Hamza; Alouini, Mohamed-Slim

    2016-01-01

    In this paper, we analyze the end-to-end performance of dual-hop free-space optical (FSO) fixed gain relaying systems under heterodyne detection and intensity modulation with direct detection techniques in the presence of atmospheric turbulence

  2. You know what it is: learning words through listening to hip-hop.

    Science.gov (United States)

    Chesley, Paula

    2011-01-01

    Music listeners have difficulty correctly understanding and remembering song lyrics. However, results from the present study support the hypothesis that young adults can learn African-American English (AAE) vocabulary from listening to hip-hop music. Non-African-American participants first gave free-response definitions to AAE vocabulary items, after which they answered demographic questions as well as questions addressing their social networks, their musical preferences, and their knowledge of popular culture. Results from the survey show a positive association between the number of hip-hop artists listened to and AAE comprehension vocabulary scores. Additionally, participants were more likely to know an AAE vocabulary item if the hip-hop artists they listen to use the word in their song lyrics. Together, these results suggest that young adults can acquire vocabulary through exposure to hip-hop music, a finding relevant for research on vocabulary acquisition, the construction of adolescent and adult identities, and the adoption of lexical innovations.

  3. Hip external rotation strength predicts hop performance after anterior cruciate ligament reconstruction.

    Science.gov (United States)

    Kline, Paul W; Burnham, Jeremy; Yonz, Michael; Johnson, Darren; Ireland, Mary Lloyd; Noehren, Brian

    2018-04-01

    Quadriceps strength and single-leg hop performance are commonly evaluated prior to return to sport after anterior cruciate ligament reconstruction (ACLR). However, few studies have documented potential hip strength deficits after ACLR, or ascertained the relative contribution of quadriceps and hip strength to hop performance. Patients cleared for return to sports drills after ACLR were compared to a control group. Participants' peak isometric knee extension, hip abduction, hip extension, and hip external rotation (HER) strength were measured. Participants also performed single-leg hops, timed hops, triple hops, and crossover hops. Between-limb comparisons for the ACLR to control limb and the non-operative limb were made using independent two-sample and paired sample t tests. Pearson's correlations and stepwise multiple linear regression were used to determine the relationships and predictive ability of limb strength, graft type, sex, and limb dominance to hop performance. Sixty-five subjects, 20 ACLR [11F, age 22.8 (15-45) years, 8.3 ± 2 months post-op, mass 70.47 ± 12.95 kg, height 1.71 ± 0.08 m, Tegner 5.5 (3-9)] and 45 controls [22F, age 25.8 (15-45) years, mass 74.0 ± 15.2 kg, height 1.74 ± 0.1 m, Tegner 6 (3-7)], were tested. Knee extension (4.4 ± 1.5 vs 5.4 ± 1.8 N/kg, p = 0.02), HER (1.4 ± 0.4 vs 1.7 ± 0.5 N/kg, p = 0.04), single-leg hop (146 ± 37 vs 182 ± 38% limb length, p hop (417 ± 106 vs 519 ± 102% limb length, p hop (3.3 ± 2.0 vs 2.3 ± 0.6 s, p hop (364 ± 107 vs 446 ± 123% limb length, p = 0.01) were significantly impaired in the operative versus control subject limbs. Similar deficits existed between the operative and non-operative limbs. Knee extension and HER strength were significantly correlated with each of the hop tests, but only HER significantly predicted hop performance. After ACLR, patients have persistent HER strength, knee extension strength, and hop test deficits in the

  4. Interplay of radiative and nonradiative transitions in surface hopping with radiation-molecule interactions

    Energy Technology Data Exchange (ETDEWEB)

    Bajo, Juan José [Departamento de Química-Física I, Universidad Complutense de Madrid, 28040 Madrid (Spain); Granucci, Giovanni, E-mail: giovanni.granucci@unipi.it; Persico, Maurizio [Università di Pisa, Dipartimento di Chimica e Chimica Industriale, via Risorgimento 35, 56126 Pisa (Italy)

    2014-01-28

    We implemented a method for the treatment of field induced transitions in trajectory surface hopping simulations, in the framework of the local diabatization scheme, especially suited for on-the-fly dynamics. The method is applied to a simple one-dimensional model with an avoided crossing and compared with quantum wavepacket dynamics. The results show the importance of introducing a proper decoherence correction to surface hopping, in order to obtain meaningful results. Also the energy conservation policy of standard surface hopping must be revised: in fact, the quantum wavepacket energetics is well reproduced if energy absorption/emission is allowed for in the hops determined by radiation-molecule coupling. To our knowledge, this is the first time the issues of decoherence and energy conservation have been analyzed in depth to devise a mixed quantum-classical method for dynamics with molecule-field interactions.

  5. Distributed Detection with Collisions in a Random, Single-Hop Wireless Sensor Network

    Science.gov (United States)

    2013-05-26

    public release; distribution is unlimited. Distributed detection with collisions in a random, single-hop wireless sensor network The views, opinions...1274 2 ABSTRACT Distributed detection with collisions in a random, single-hop wireless sensor network Report Title We consider the problem of... WIRELESS SENSOR NETWORK Gene T. Whipps?† Emre Ertin† Randolph L. Moses† ?U.S. Army Research Laboratory, Adelphi, MD 20783 †The Ohio State University

  6. Observation of correlation effects in the hopping transport in amorphous silicon

    International Nuclear Information System (INIS)

    Voegele, V.; Kalbitzer, S.; Boehringer, K.

    1985-01-01

    Amorphous silicon films have been modified by the implantation of Au or Si ions. The d.c. conductivity, measured between 300 and 15 K, was found to exhibit hopping exponents m which increase with decreasing temperature. Depending on the varied defect densities, m ranges between the limits of 1/4 and 1. These results can be explained by variable-range-hopping theory, if a Coulomb correlation term is included. (author)

  7. Anomalous temperature dependence of the Seebeck coefficient for the substitutionally-disordered hopping conductors

    International Nuclear Information System (INIS)

    Raffaelle, R.P.; Parris, P.E.; Anderson, H.U.; Sparlin, D.M.

    1991-01-01

    Thermoelectric power measurements are presented for the (La,Sr)(Cr,Mn)O 3 series. The nonlinear temperature dependence of the Seebeck coefficient is analyzed in terms of a random distribution of energetically equivalent hopping sites. The limitations of Heikes' formula, which has been traditionally used to calculate small polaron carrier densities in these systems, are discussed. Recent theoretical developments in the interpretation of Seebeck measurements in substitutionally-disordered high-temperature hopping conductors are reviewed

  8. Effective one-dimensionality of universal ac hopping conduction in the extreme disorder limit

    DEFF Research Database (Denmark)

    Dyre, Jeppe; Schrøder, Thomas

    1996-01-01

    A phenomenological picture of ac hopping in the symmetric hopping model (regular lattice, equal site energies, random energy barriers) is proposed according to which conduction in the extreme disorder limit is dominated by essentially one-dimensional "percolation paths." Modeling a percolation path...... as strictly one dimensional with a sharp jump rate cutoff leads to an expression for the universal ac conductivity that fits computer simulations in two and three dimensions better than the effective medium approximation....

  9. Effects of powdery mildew fungicide programs on twospotted spider mite (Acari: Tetranychidae), hop aphid (Hemiptera: Aphididae), and their natural enemies in hop yards.

    Science.gov (United States)

    Gent, D H; James, D G; Wright, L C; Brooks, D J; Barbour, J D; Dreves, A J; Fisher, G C; Walton, V M

    2009-02-01

    Twospotted spider mite, Tetranychus urticae Koch (Acari: Tetranychidae), and hop aphid, Phorodon humuli (Schrank) (Hemiptera: Aphididae), are the most important arthropod pests of hop (Humulus lupulus L.) in the Northern Hemisphere. A potential barrier for greater adoption of conservation biological control strategies for spider mites and hop aphid is the extensive use of fungicides for management of hop powdery mildew, Podosphaera macularis (Wallr.:Fr.) U. Braun & S. Takamatsu. Field studies conducted in experimental plots in Oregon and Washington in 2005 and 2006 quantified the effects of powdery mildew fungicide programs (i.e., sulfur, paraffinic oil, and synthetic fungicides) on arthropod pests and natural enemies on hop. Fungicide treatment significantly affected spider mite populations in all four studies. Multiple applications of sulfur fungicides applied before burr development resulted in 1.4-3.3-fold greater spider mite populations during summer. Near the cessation of the sulfur applications, or after a lag of 20-30 d, spider mite populations increased significantly faster on sulfur treated plants compared with water-treated plants in three of four experiments. The effect of paraffinic oil on spider mites was varied, leading to exacerbation of spider mites in Oregon and Washington in 2005, suppression of mites in Oregon in 2006, and no significant effect compared with water in Washington in 2006. Significant relative treatment effects for cone damage due to spider mite feeding were detected in Oregon in 2005 in plots treated with sulfur and paraffinic oil compared with water and synthetic fungicides. Mean populations of hop aphids were similar among treatments in Oregon, although sulfur treatment suppressed hop aphid populations in Washington in 2005 and 2006. Populations of individual predacious insect species and cumulative abundance of macropredators were not consistently suppressed or stimulated by treatments in all trials. However, predatory mite

  10. Development of aromatic hop compounds and bitterness in beer during room temperature- and cold storage based on three different hopping methods

    OpenAIRE

    Torgals, Ann Elisabeth

    2015-01-01

    The main objective of this study was to determine whether storage temperature or hopping method had influence on the aroma and bitterness in beer. The focus was set on the aroma that comes from hops, and not from yeast. The secondary objective to this study was to explore the development of the alcohol, CO2 and bitterness in the beer after priming and bottling. The thesis’ main perspective is that of home brewers, and to some extent that of microbreweries. Beer was brewed with 100 % pilsn...

  11. Routing protocol for wireless quantum multi-hop mesh backbone network based on partially entangled GHZ state

    Science.gov (United States)

    Xiong, Pei-Ying; Yu, Xu-Tao; Zhang, Zai-Chen; Zhan, Hai-Tao; Hua, Jing-Yu

    2017-08-01

    Quantum multi-hop teleportation is important in the field of quantum communication. In this study, we propose a quantum multi-hop communication model and a quantum routing protocol with multihop teleportation for wireless mesh backbone networks. Based on an analysis of quantum multi-hop protocols, a partially entangled Greenberger-Horne-Zeilinger (GHZ) state is selected as the quantum channel for the proposed protocol. Both quantum and classical wireless channels exist between two neighboring nodes along the route. With the proposed routing protocol, quantum information can be transmitted hop by hop from the source node to the destination node. Based on multi-hop teleportation based on the partially entangled GHZ state, a quantum route established with the minimum number of hops. The difference between our routing protocol and the classical one is that in the former, the processes used to find a quantum route and establish quantum channel entanglement occur simultaneously. The Bell state measurement results of each hop are piggybacked to quantum route finding information. This method reduces the total number of packets and the magnitude of air interface delay. The deduction of the establishment of a quantum channel between source and destination is also presented here. The final success probability of quantum multi-hop teleportation in wireless mesh backbone networks was simulated and analyzed. Our research shows that quantum multi-hop teleportation in wireless mesh backbone networks through a partially entangled GHZ state is feasible.

  12. A Hybrid DV-Hop Algorithm Using RSSI for Localization in Large-Scale Wireless Sensor Networks.

    Science.gov (United States)

    Cheikhrouhou, Omar; M Bhatti, Ghulam; Alroobaea, Roobaea

    2018-05-08

    With the increasing realization of the Internet-of-Things (IoT) and rapid proliferation of wireless sensor networks (WSN), estimating the location of wireless sensor nodes is emerging as an important issue. Traditional ranging based localization algorithms use triangulation for estimating the physical location of only those wireless nodes that are within one-hop distance from the anchor nodes. Multi-hop localization algorithms, on the other hand, aim at localizing the wireless nodes that can physically be residing at multiple hops away from anchor nodes. These latter algorithms have attracted a growing interest from research community due to the smaller number of required anchor nodes. One such algorithm, known as DV-Hop (Distance Vector Hop), has gained popularity due to its simplicity and lower cost. However, DV-Hop suffers from reduced accuracy due to the fact that it exploits only the network topology (i.e., number of hops to anchors) rather than the distances between pairs of nodes. In this paper, we propose an enhanced DV-Hop localization algorithm that also uses the RSSI values associated with links between one-hop neighbors. Moreover, we exploit already localized nodes by promoting them to become additional anchor nodes. Our simulations have shown that the proposed algorithm significantly outperforms the original DV-Hop localization algorithm and two of its recently published variants, namely RSSI Auxiliary Ranging and the Selective 3-Anchor DV-hop algorithm. More precisely, in some scenarios, the proposed algorithm improves the localization accuracy by almost 95%, 90% and 70% as compared to the basic DV-Hop, Selective 3-Anchor, and RSSI DV-Hop algorithms, respectively.

  13. The acute effects of heavy back squats on mechanical variables during a series of bilateral hops.

    Science.gov (United States)

    Moir, Gavin L; Dale, Jonathan R; Dietrich, Wendy W

    2009-07-01

    The purpose of the present study was to investigate the acute effects of performing a heavy resistance exercise (HRE) protocol on the mechanical variables during a series of bilateral hops. In a block-randomized design, 10 strength trained men performed an HRE or a control treatment before performing 5 series of bilateral hops separated by 2 minutes of passive recovery. Each series of bilateral hops was performed for 15 seconds on a force platform with the subject hopping at a frequency of 2.0 Hz. From the vertical force trace, the vertical force during the countermovement phase of each hop, the negative displacement during the countermovement phase, and the vertical stiffness were calculated. The HRE treatment consisted of performing parallel back squats with 40, 50, 60, and 80% of each subject's 1-repetition maximum after a series of dynamic stretches. The control treatment consisted of the dynamic stretches only. No significant differences in any of the mechanical variables were reported after the 2 treatments (p > 0.05). There were no significant correlations between the absolute maximal strength values and the percent change in any of the mechanical variables after the 2 treatments. Despite the lack of significant changes reported for the group, there were some notable individual responses. It is possible that increases in vertical stiffness during bilateral hops can be achieved after an HRE protocol in certain individuals. However, practitioners should be aware of the specificity issues and the individual nature of the responses to such protocols.

  14. Linking the mechanics and energetics of hopping with elastic ankle exoskeletons.

    Science.gov (United States)

    Farris, Dominic James; Sawicki, Gregory S

    2012-12-15

    The springlike mechanics of the human leg during bouncing gaits has inspired the design of passive assistive devices that use springs to aid locomotion. The purpose of this study was to test whether a passive spring-loaded ankle exoskeleton could reduce the mechanical and energetic demands of bilateral hopping on the musculoskeletal system. Joint level kinematics and kinetics were collected with electromyographic and metabolic energy consumption data for seven participants hopping at four frequencies (2.2, 2.5, 2.8, and 3.2 Hz). Hopping was performed without an exoskeleton; with an springless exoskeleton; and with a spring-loaded exoskeleton. Spring-loaded ankle exoskeletons reduced plantar flexor muscle activity and the biological contribution to ankle joint moment (15-25%) and average positive power (20-40%). They also facilitated reductions in metabolic power (15-20%) across frequencies from 2.2 to 2.8 Hz compared with hopping with a springless exoskeleton. Reductions in metabolic power compared with hopping with no exoskeleton were restricted to hopping at 2.5 Hz only (12%). These results highlighted the importance of reducing the rate of muscular force production and work to achieve metabolic reductions. They also highlighted the importance of assisting muscles acting at the knee joint. Exoskeleton designs may need to be tuned to optimize exoskeleton mass, spring stiffness, and spring slack length to achieve greater metabolic reductions.

  15. The small GTPase Arl8b regulates assembly of the mammalian HOPS complex on lysosomes

    Science.gov (United States)

    Khatter, Divya; Raina, Vivek B.; Dwivedi, Devashish; Sindhwani, Aastha; Bahl, Surbhi; Sharma, Mahak

    2015-01-01

    The homotypic fusion and protein sorting (HOPS) complex is a multi-subunit complex conserved from yeast to mammals that regulates late endosome and lysosome fusion. However, little is known about how the HOPS complex is recruited to lysosomes in mammalian cells. Here, we report that the small GTPase Arl8b, but not Rab7 (also known as RAB7A), is essential for membrane localization of the human (h)Vps41 subunit of the HOPS complex. Assembly of the core HOPS subunits to Arl8b- and hVps41-positive lysosomes is guided by their subunit–subunit interactions. RNA interference (RNAi)-mediated depletion of hVps41 resulted in the impaired degradation of EGFR that was rescued upon expression of wild-type but not an Arl8b-binding-defective mutant of hVps41, suggesting that Arl8b-dependent lysosomal localization of hVps41 is required for its endocytic function. Furthermore, we have also identified that the Arl8b effector SKIP (also known as PLEKHM2) interacts with and recruits HOPS subunits to Arl8b and kinesin-positive peripheral lysosomes. Accordingly, RNAi-mediated depletion of SKIP impaired lysosomal trafficking and degradation of EGFR. These findings reveal that Arl8b regulates the association of the human HOPS complex with lysosomal membranes, which is crucial for the function of this tethering complex in endocytic degradation. PMID:25908847

  16. The small GTPase Arl8b regulates assembly of the mammalian HOPS complex on lysosomes.

    Science.gov (United States)

    Khatter, Divya; Raina, Vivek B; Dwivedi, Devashish; Sindhwani, Aastha; Bahl, Surbhi; Sharma, Mahak

    2015-05-01

    The homotypic fusion and protein sorting (HOPS) complex is a multi-subunit complex conserved from yeast to mammals that regulates late endosome and lysosome fusion. However, little is known about how the HOPS complex is recruited to lysosomes in mammalian cells. Here, we report that the small GTPase Arl8b, but not Rab7 (also known as RAB7A), is essential for membrane localization of the human (h)Vps41 subunit of the HOPS complex. Assembly of the core HOPS subunits to Arl8b- and hVps41-positive lysosomes is guided by their subunit-subunit interactions. RNA interference (RNAi)-mediated depletion of hVps41 resulted in the impaired degradation of EGFR that was rescued upon expression of wild-type but not an Arl8b-binding-defective mutant of hVps41, suggesting that Arl8b-dependent lysosomal localization of hVps41 is required for its endocytic function. Furthermore, we have also identified that the Arl8b effector SKIP (also known as PLEKHM2) interacts with and recruits HOPS subunits to Arl8b and kinesin-positive peripheral lysosomes. Accordingly, RNAi-mediated depletion of SKIP impaired lysosomal trafficking and degradation of EGFR. These findings reveal that Arl8b regulates the association of the human HOPS complex with lysosomal membranes, which is crucial for the function of this tethering complex in endocytic degradation. © 2015. Published by The Company of Biologists Ltd.

  17. Condom use and hip hop culture: the case of urban young men in New York City.

    Science.gov (United States)

    Muñoz-Laboy, Miguel A; Castellanos, Daniel H; Haliburton, Chanel S; del Aguila, Ernesto Vasquez; Weinstein, Hannah J; Parker, Richard G

    2008-06-01

    We explored how young men's perceptions of and participation in hip hop culture--urban social and artistic expressions, such as clothing style, breakdancing, graffiti, and rap music--and how contextual factors of the hip hop scene may be associated with their condom use, condom-use self-efficacy, and sense of community. We conducted a cross-sectional survey of 95 African American and Latino men aged 15 to 25 years as part of a 4-year ethnographic study in New York City. Differences in young men's perceptions of and levels of affiliation with hip hop culture were not statistically associated with differences in their sense of community or condom-use self-efficacy. Frequency of participation in the hip hop nightclub scene was the strongest factor negatively associated with condom use. Popular discourses on young men's health risks often blame youths' cultures such as the hip hop culture for increased risk practices but do not critically examine how risk emerges in urban young men's lives and what aspects of youths' culture can be protective. Further research needs to focus on contextual factors of risk such as the role of hip hop nightlife on increased HIV risk.

  18. No evidence hip joint angle modulates intrinsically produced stretch reflex in human hopping.

    Science.gov (United States)

    Gibson, W; Campbell, A; Allison, G

    2013-09-01

    Motor output in activities such as walking and hopping is suggested to be mediated neurally by purported stretch reflex augmentation of muscle output. Reflex EMG activity during these tasks has been frequently investigated in the soleus muscle; with alterations in reflex amplitude being associated with changes in hip joint angle/phase of the gait cycle. Previous work has focussed on reflex activity induced by an artificial perturbation or by induction of H-reflexes. As such, it is currently unknown if stretch reflex activity induced intrinsically (as part of the task) is modulated by changes in hip joint angle. This study investigated whether hip joint angle modulated reflex EMG 'burst' activity during a hopping task performed on a custom-built partially reclined sleigh. Ten subjects participated; EMG and kinematic data (VICON motor capture system) was collected for each hop cycle. Participants completed 5 sets of 30s of self-paced hopping in (1) hip neutral and (2) hip 60° flexion conditions. There was no difference in EMG 'burst' activity or in sagittal plane kinematics (knee/ankle) in the hopping task between the two conditions. The results indicate that during a functional task such as hopping, changes in hip angle do not alter the stretch reflex-like activity associated with landing. Copyright © 2013 Elsevier B.V. All rights reserved.

  19. Hydrodynamic mean-field solutions of 1D exclusion processes with spatially varying hopping rates

    Energy Technology Data Exchange (ETDEWEB)

    Lakatos, Greg; O' Brien, John; Chou, Tom [Department of Biomathematics and Institute for Pure and Applied Mathematics, UCLA, Los Angeles, CA 90095 (United States)

    2006-03-10

    We analyse the open boundary partially asymmetric exclusion process with smoothly varying internal hopping rates in the infinite-size, mean-field limit. The mean-field equations for particle densities are written in terms of Ricatti equations with the steady-state current J as a parameter. These equations are solved both analytically and numerically. Upon imposing the boundary conditions set by the injection and extraction rates, the currents J are found self-consistently. We find a number of cases where analytic solutions can be found exactly or approximated. Results for J from asymptotic analyses for slowly varying hopping rates agree extremely well with those from extensive Monte Carlo simulations, suggesting that mean-field currents asymptotically approach the exact currents in the hydrodynamic limit, as the hopping rates vary slowly over the lattice. If the forward hopping rate is greater than or less than the backward hopping rate throughout the entire chain, the three standard steady-state phases are preserved. Our analysis reveals the sensitivity of the current to the relative phase between the forward and backward hopping rate functions.

  20. Hydrodynamic mean-field solutions of 1D exclusion processes with spatially varying hopping rates

    International Nuclear Information System (INIS)

    Lakatos, Greg; O'Brien, John; Chou, Tom

    2006-01-01

    We analyse the open boundary partially asymmetric exclusion process with smoothly varying internal hopping rates in the infinite-size, mean-field limit. The mean-field equations for particle densities are written in terms of Ricatti equations with the steady-state current J as a parameter. These equations are solved both analytically and numerically. Upon imposing the boundary conditions set by the injection and extraction rates, the currents J are found self-consistently. We find a number of cases where analytic solutions can be found exactly or approximated. Results for J from asymptotic analyses for slowly varying hopping rates agree extremely well with those from extensive Monte Carlo simulations, suggesting that mean-field currents asymptotically approach the exact currents in the hydrodynamic limit, as the hopping rates vary slowly over the lattice. If the forward hopping rate is greater than or less than the backward hopping rate throughout the entire chain, the three standard steady-state phases are preserved. Our analysis reveals the sensitivity of the current to the relative phase between the forward and backward hopping rate functions

  1. Synthesis and Antiproliferative Activity of Minor Hops Prenylflavonoids and New Insights on Prenyl Group Cyclization

    Directory of Open Access Journals (Sweden)

    Jarosław Popłoński

    2018-03-01

    Full Text Available Synthesis of minor prenylflavonoids found in hops and their non-natural derivatives were performed. The antiproliferative activity of the obtained compounds against some human cancer cell lines was investigated. Using xanthohumol isolated from spent hops as a lead compound, a series of minor hop prenylflavonoids and synthetic derivatives were obtained by isomerization, cyclisation, oxidative-cyclisation, oxidation, reduction and demethylation reactions. Three human cancer cell lines—breast (MCF-7, prostate (PC-3 and colon (HT-29—were used in antiproliferative assays, with cisplatin as a control compound. Five minor hop prenyl flavonoids and nine non-natural derivatives of xanthohumol have been synthetized. Syntheses of xanthohumol K, its dihydro- and tetrahydro-derivatives and 1″,2″,α,β-tetrahydroxanthohumol C were described for the first time. All of the minor hops prenyl flavonoids exhibited strong to moderate antiproliferative activity in vitro. The minor hops flavonoids xanthohumol C and 1″,2″-dihydroxanthohumol K and non-natural 2,3-dehydroisoxanthohumol exhibited the activity comparable to cisplatin. Results described in the article suggest that flavonoids containing chromane- and chromene-like moieties, especially chalcones, are potent antiproliferative agents. The developed new efficient, regioselective cyclisation reaction of the xanthohumol prenyl group to 1″,2″-dihydroxantohumol K may be used in the synthesis of other compounds with the chromane moiety.

  2. Centralized mouse repositories.

    Science.gov (United States)

    Donahue, Leah Rae; Hrabe de Angelis, Martin; Hagn, Michael; Franklin, Craig; Lloyd, K C Kent; Magnuson, Terry; McKerlie, Colin; Nakagata, Naomi; Obata, Yuichi; Read, Stuart; Wurst, Wolfgang; Hörlein, Andreas; Davisson, Muriel T

    2012-10-01

    Because the mouse is used so widely for biomedical research and the number of mouse models being generated is increasing rapidly, centralized repositories are essential if the valuable mouse strains and models that have been developed are to be securely preserved and fully exploited. Ensuring the ongoing availability of these mouse strains preserves the investment made in creating and characterizing them and creates a global resource of enormous value. The establishment of centralized mouse repositories around the world for distributing and archiving these resources has provided critical access to and preservation of these strains. This article describes the common and specialized activities provided by major mouse repositories around the world.

  3. SDN-based path hopping communication against eavesdropping attack

    Science.gov (United States)

    Zhang, Chuanhao; Bu, Youjun; Zhao, Zheng

    2016-10-01

    Network eavesdropping is one of the most popular means used by cyber attackers, which has been a severe threat to network communication security. Adversaries could capture and analyze network communication data from network nodes or links, monitor network status and steal sensitive data such as username and password etc. Traditional network usually uses static network configuration, and existing defense methods, including firewall, IDS, IPS etc., cannot prevent eavesdropping, which has no distinguishing characteristic. Network eavesdropping become silent during most of the time of the attacking process, which is why it is difficult to discover and to defend. But A successful eavesdropping attack also has its' precondition, which is the target path should be relatively stable and has enough time of duration. So, In order to resolve this problem, it has to work on the network architecture. In this paper, a path hopping communication(PHC) mechanism based on Software Define Network (SDN) was proposed to solve this problem. In PHC, Ends in communication packets as well as the routing paths were changed dynamically. Therefore, the traffic would be distributed to multiple flows and transmitted along different paths. so that Network eavesdropping attack could be prevented effectively. It was concluded that PHC was able to increase the overhead of Network eavesdropping, as well as the difficulty of communication data recovery.

  4. Characteristics of alternating current hopping conductivity in DNA sequences

    International Nuclear Information System (INIS)

    Song-Shan, Ma; Hui, Xu; Huan-You, Wang; Rui, Guo

    2009-01-01

    This paper presents a model to describe alternating current (AC) conductivity of DNA sequences, in which DNA is considered as a one-dimensional (1D) disordered system, and electrons transport via hopping between localized states. It finds that AC conductivity in DNA sequences increases as the frequency of the external electric field rises, and it takes the form of ø ac (ω) ∼ ω 2 ln 2 (1/ω). Also AC conductivity of DNA sequences increases with the increase of temperature, this phenomenon presents characteristics of weak temperature-dependence. Meanwhile, the AC conductivity in an off-diagonally correlated case is much larger than that in the uncorrelated case of the Anderson limit in low temperatures, which indicates that the off-diagonal correlations in DNA sequences have a great effect on the AC conductivity, while at high temperature the off-diagonal correlations no longer play a vital role in electric transport. In addition, the proportion of nucleotide pairs p also plays an important role in AC electron transport of DNA sequences. For p < 0.5, the conductivity of DNA sequence decreases with the increase of p, while for p ≥ 0.5, the conductivity increases with the increase of p. (cross-disciplinary physics and related areas of science and technology)

  5. GHz band frequency hopping PLL-based frequency synthesizers

    Institute of Scientific and Technical Information of China (English)

    XU Yong; WANG Zhi-gong; GUAN Yu; XU Zhi-jun; QIAO Lu-feng

    2005-01-01

    In this paper we describe a full-integrated circuit containing all building blocks of a completed PLL-based synthesizer except for low pass filter(LPF).The frequency synthesizer is designed for a frequency hopping (FH) transceiver operating up to 1.5 GHz as a local oscillator. The architecture of Voltage Controlled Oscillator (VCO) is optimized to get better performance, and a phase noise of -111.85-dBc/Hz @ 1 MHz and a tuning range of 250 MHz are gained at a centre frequency of 1.35 GHz.A novel Dual-Modulus Prescaler(DMP) is designed to achieve a very low jitter and a lower power.The settling time of PLL is 80 μs while the reference frequency is 400 KHz.This monolithic frequency synthesizer is to integrate all main building blocks of PLL except for the low pass filter,with a maximum VCO output frequency of 1.5 GHz,and is fabricated with a 0.18 μm mixed signal CMOS process. Low power dissipation, low phase noise, large tuning range and fast settling time are gained in this design.

  6. Power and delay optimisation in multi-hop wireless networks

    KAUST Repository

    Xia, Li

    2014-02-05

    In this paper, we study the optimisation problem of transmission power and delay in a multi-hop wireless network consisting of multiple nodes. The goal is to determine the optimal policy of transmission rates at various buffer and channel states in order to minimise the power consumption and the queueing delay of the whole network. With the assumptions of interference-free links and independently and identically distributed (i.i.d.) channel states, we formulate this problem using a semi-open Jackson network model for data transmission and a Markov model for channel states transition. We derive a difference equation of the system performance under any two different policies. The necessary and sufficient condition of optimal policy is obtained. We also prove that the system performance is monotonic with respect to (w.r.t.) the transmission rate and the optimal transmission rate can be either maximal or minimal. That is, the ‘bang-bang’ control is an optimal control. This optimality structure greatly reduces the problem complexity. Furthermore, we develop an iterative algorithm to find the optimal solution. Finally, we conduct the simulation experiments to demonstrate the effectiveness of our approach. We hope our work can shed some insights on solving this complicated optimisation problem.

  7. Two-Hop Secure Communication Using an Untrusted Relay

    Directory of Open Access Journals (Sweden)

    Xiang He

    2009-01-01

    Full Text Available We consider a source-destination pair that can only communicate through an untrusted intermediate relay node. The intermediate node is willing to employ a designated relaying scheme to facilitate reliable communication between the source and the destination. Yet, the information it relays needs to be kept secret from it. In this two-hop communication scenario, where the use of the untrusted relay node is essential, we find that a positive secrecy rate is achievable. The center piece of the achievability scheme is the help provided by either the destination node with transmission capability, or an external “good samaritan” node. In either case, the helper performs cooperative jamming that confuses the eavesdropping relay and disables it from being able to decipher what it is relaying. We next derive an upper bound on the secrecy rate for this system. We observe that the gap between the upper bound and the achievable rate vanishes as the power of the relay node goes to infinity. Overall, the paper presents a case for intentional interference, that is, cooperative jamming, as an enabler for secure communication.

  8. Characteristics of alternating current hopping conductivity in DNA sequences

    Institute of Scientific and Technical Information of China (English)

    Ma Song-Shan; Xu Hui; Wang Huan-You; Guo Rui

    2009-01-01

    This paper presents a model to describe alternating current (AC) conductivity of DNA sequences,in which DNA is considered as a one-dimensional (1D) disordered system,and electrons transport via hopping between localized states.It finds that AC conductivity in DNA sequences increases as the frequency of the external electric field rises,and it takes the form of σac(ω)~ω2 ln2(1/ω).Also AC conductivity of DNA sequences increases with the increase of temperature,this phenomenon presents characteristics of weak temperature-dependence.Meanwhile,the AC conductivity in an off diagonally correlated case is much larger than that in the uncorrelated case of the Anderson limit in low temperatures,which indicates that the off-diagonal correlations in DNA sequences have a great effect on the AC conductivity,while at high temperature the off-diagonal correlations no longer play a vital role in electric transport. In addition,the proportion of nucleotide pairs p also plays an important role in AC electron transport of DNA sequences.For p<0.5,the conductivity of DNA sequence decreases with the increase of p,while for p > 0.5,the conductivity increases with the increase of p.

  9. Therapeutic Perspectives of 8-Prenylnaringenin, a Potent Phytoestrogen from Hops

    Directory of Open Access Journals (Sweden)

    Kateřina Štulíková

    2018-03-01

    Full Text Available Hop (Humulus lupulus L., as a key ingredient for beer brewing, is also a source of many biologically active molecules. A notable compound, 8-prenylnaringenin (8-PN, structurally belonging to the group of prenylated flavonoids, was shown to be a potent phytoestrogen, and thus, became the topic of active research. Here, we overview the pharmacological properties of 8-PN and its therapeutic opportunities. Due to its estrogenic effects, administration of 8-PN represents a novel therapeutic approach to the treatment of menopausal and post-menopausal symptoms that occur as a consequence of a progressive decline in hormone levels in women. Application of 8-PN in the treatment of menopause has been clinically examined with promising results. Other activities that have already been assessed include the potential to prevent bone-resorption or inhibition of tumor growth. On the other hand, the use of phytoestrogens is frequently questioned regarding possible adverse effects associated with long-term consumption. In conclusion, we emphasize the implications of using 8-PN in future treatments of menopausal and post-menopausal symptoms, including the need for precise evidence and further investigations to define the safety risks related to its therapeutic use.

  10. Characterization of Hop-and-Sink Locomotion of Water Fleas

    Science.gov (United States)

    Skipper, A. N.; Murphy, D. W.; Webster, D. R.

    2017-11-01

    The freshwater crustacean Daphnia magna is a widely studied zooplankton in relation to food webs, predator-prey interactions, and other biological/ecological considerations; however, their locomotion is poorly quantified and understood. These water fleas utilize a hop-and-sink mechanism that consists of making quick, impulsive jumps by beating their antennae to propel themselves forward (roughly 1 body length). The animals then sink for a period, during which they stretch out their antennae to increase drag and thereby reduce their sinking velocity. Time-resolved three-dimensional flow fields surrounding the animals were quantified with a unique infrared tomographic particle image velocimetry (tomo-PIV) system. Three-dimensional kinematics data were also extracted from the image sequences. In the current work, we compared body kinematics and flow disturbance among organisms of size in the range of 1.3 to 2.8 mm. The stroke cycle averaged 150 +/- 20 ms, with each stroke cycle split nearly evenly between power and recovery strokes. The kinematics data collapsed onto a self-similar curve when properly nondimensionalized, and a general trend was shown to exist between the nondimensionalized peak body speed and body length. The fluid flow induced by each antennae consisted of a viscous vortex ring that demonstrated a slow decay in the wake. The viscous dissipation showed no clear dependence on body size, whereas the volume of fluid exceeding 5 mm/s (the speed near the sinking speed of the animal) decayed more slowly with increasing body size.

  11. El griot no ha muerto, viva el hip-hop

    Directory of Open Access Journals (Sweden)

    Fco. Javier González García-Mamely

    2015-11-01

    Full Text Available La oratura en África ha jugado un papel vital a lo largo de los milenios como un (único medio de preservar y transmitir la historia, la cultura y el imaginario de cada comunidad. El griot es un claro modelo de las artes orales, pero ha sufrido cambios drásticos en su modo de vida y en los recursos narrativos de los que dispone. Tras el mecenazgo de los grandes reyes y las sucesivas llegadas del islam, el colonialismo y los procesos de modernización y occidentalización, los griots se han tenido que adaptar a nuevos patrones, audiencias y medios de comunicación, convirtiéndose en políticos o en figuras del espectáculo. La aparición del rap y el hip-hop reclamando ser los “modernos griots” ha ocasionado una respuesta crítica y una atracción viral hacia el nuevo fenómeno, sea éste un nuevo género o una reinvención de la oratura del antiguo griot.

  12. Family-based hip-hop to health: outcome results.

    Science.gov (United States)

    Fitzgibbon, Marian L; Stolley, Melinda R; Schiffer, Linda; Kong, Angela; Braunschweig, Carol L; Gomez-Perez, Sandra L; Odoms-Young, Angela; Van Horn, Linda; Christoffel, Katherine Kaufer; Dyer, Alan R

    2013-02-01

    This pilot study tested the feasibility of Family-Based Hip-Hop to Health, a school-based obesity prevention intervention for 3-5-year-old Latino children and their parents, and estimated its effectiveness in producing smaller average changes in BMI at 1-year follow-up. Four Head Start preschools administered through the Chicago Public Schools were randomly assigned to receive a Family-Based Intervention (FBI) or a General Health Intervention (GHI). Parents signed consent forms for 147 of the 157 children enrolled. Both the school-based and family-based components of the intervention were feasible, but attendance for the parent intervention sessions was low. Contrary to expectations, a downtrend in BMI Z-score was observed in both the intervention and control groups. While the data reflect a downward trend in obesity among these young Hispanic children, obesity rates remained higher at 1-year follow-up (15%) than those reported by the National Health and Nutrition Examination Survey (2009-2010) for 2-5-year-old children (12.1%). Developing evidence-based strategies for obesity prevention among Hispanic families remains a challenge. Copyright © 2012 The Obesity Society.

  13. Antimicrobial activity of hop extracts against foodborne pathogens for meat applications.

    Science.gov (United States)

    Kramer, B; Thielmann, J; Hickisch, A; Muranyi, P; Wunderlich, J; Hauser, C

    2015-03-01

    The objective of this study was the fundamental investigation of the antimicrobial efficiency of various hop extracts against selected foodborne pathogens in vitro, as well as their activity against Listeria monocytogenes in a model meat marinade and on marinated pork tenderloins. In a first step, the minimum inhibitory concentrations (MIC) of three hop extracts containing either α- or β-acids or xanthohumol were determined against test bacteria including L. monocytogenes, Staphylococcus aureus, Salmonella enterica and Escherichia coli by a colorimetric method based on the measurement of bacterial metabolic activity. Moreover, the influence of either lactic or citric acid on the antimicrobial activity of the hop extracts was evaluated. The efficiency of hop extracts as a natural food preservative was then tested in a model meat marinade at 2 and 8°C, respectively, and finally on marinated pork. The experiments showed that Gram-positive bacteria were strongly inhibited by hop extracts containing β-acids and xanthohumol (MIC values of 6.3 and 12.5 ppm, respectively), whereas the antimicrobial activity of the investigated α-acid extract was significantly lower (MIC values of 200 ppm). Gram-negative bacteria were highly resistant against all tested hop extracts. Acidification of the test media led to a decrease of the MIC values. The inhibitory activity of the hop extracts against L. monocytogenes was strongly reduced in a fat-containing model meat marinade, but the efficiency of β-acids in this matrix could be increased by lowering pH and storage temperatures. By applying 0.5 % β-acids at pH = 5 in a model marinade, the total aerobic count of pork tenderloins was reduced up to 0.9 log10 compared with marinated pork without hop extract after 2 weeks of storage at 5°C. β-acid containing hop extracts have proven to possess a high antimicrobial activity against Gram-positive bacteria in vitro and in a practice-related application for food preservation

  14. The apparently contradictory energetics of hopping and running: the counter-intuitive effect of constraints resolves the paradox.

    Science.gov (United States)

    Gutmann, Anne K; Bertram, John E A

    2017-01-15

    Metabolic rate appears to increase with the rate of force application for running. Leg function during ground contact is similar in hopping and running, so one might expect that this relationship would hold for hopping as well. Surprisingly, metabolic rate appeared to decrease with increasing force rate for hopping. However, this paradox is the result of comparing different cross-sections of the metabolic cost landscapes for hopping and running. The apparent relationship between metabolic rate and force rate observed in treadmill running is likely not a fundamental characteristic of muscle physiology, but a result of runners responding to speed constraints, i.e. runners selecting step frequencies that minimize metabolic cost per distance for a series of treadmill-specified speeds. Evaluating hopping metabolic rate over a narrow range of hop frequencies similar to that selected by treadmill runners yields energy use trends similar to those of running. © 2017. Published by The Company of Biologists Ltd.

  15. Chemical transformations of characteristic hop secondary metabolites in relation to beer properties and the brewing process: a review.

    Science.gov (United States)

    Steenackers, Bart; De Cooman, Luc; De Vos, Dirk

    2015-04-01

    The annual production of hops (Humulus lupulus L.) exceeds 100,000 mt and is almost exclusively consumed by the brewing industry. The value of hops is attributed to their characteristic secondary metabolites; these metabolites are precursors which are transformed during the brewing process into important bittering, aromatising and preservative components with rather low efficiency. By selectively transforming these components off-line, both their utilisation efficiency and functionality can be significantly improved. Therefore, the chemical transformations of these secondary metabolites will be considered with special attention to recent advances in the field. The considered components are the hop alpha-acids, hop beta-acids and xanthohumol, which are components unique to hops, and alpha-humulene and beta-caryophyllene, sesquiterpenes which are highly characteristic of hops. Copyright © 2014 Elsevier Ltd. All rights reserved.

  16. Within-field distribution of the damson-hop aphid Phorodon humuli (Schrank) (Hemiptera: Aphididae) and natural enemies on hops in Spain

    Energy Technology Data Exchange (ETDEWEB)

    Lorenzana, A.; Hermoso de Mendoza, A.; Seco, V.; Campelo, P.; Casquero, P.A.

    2017-07-01

    A field trial was performed in a hop yard throughout 2002, 2003 and 2004 in order to determine the within-field distribution of Phorodon humuli (Schrank) (Hemiptera: Aphididae) and its natural enemies. The distribution of P. humuli was directly affected by the position of the hop plants in the garden, with significantly higher concentrations of aphids (p=0.0122 in 2002 and p=0.0006 in 2003) observed along the edge. However, in 2004 the plants located on the marginal plots had similar populations to those on the more inner plots. This can be explained by a higher wind speed which made it more difficult to land on edge plants first. The hop aphid’s main natural enemy was Coccinella septempunctata (Coleoptera: Coccinellidae), whose population was greatest where the aphids were most abundant with a significantly greater number of eggs (p=0.0230) and adults (p=0.0245) in 2003. Lacewing eggs were also frequently observed, with a significantly higher population (p=0.0221 in 2003 and p=0.0046 in 2004) where the aphid numbers were high. The number of winged aphids was greatest towards the margins of the garden in 2003. It is argued that the spatial distribution of the hop aphid and its natural enemies could be used to plan a sampling program and to estimate the population densities of these insects for use in integrated pest management programs.

  17. Hip-Hop High School: A Study of the Attitudes, Beliefs and Perceptions of Suburban High School Faculty towards Representation of the Hip-Hop Culture

    Science.gov (United States)

    Rowland, Ronald K.

    2011-01-01

    Research historically has demonstrated that a generational disconnect between the popular cultures from which students and teachers define normative behavior can impact classroom management and student learning. The purpose of this study was to examine attitudes, beliefs and perceptions of high school faculty toward the hip-hop culture and its…

  18. Within-field distribution of the damson-hop aphid Phorodon humuli (Schrank) (Hemiptera: Aphididae) and natural enemies on hops in Spain

    International Nuclear Information System (INIS)

    Lorenzana, A.; Hermoso de Mendoza, A.; Seco, V.; Campelo, P.; Casquero, P.A.

    2017-01-01

    A field trial was performed in a hop yard throughout 2002, 2003 and 2004 in order to determine the within-field distribution of Phorodon humuli (Schrank) (Hemiptera: Aphididae) and its natural enemies. The distribution of P. humuli was directly affected by the position of the hop plants in the garden, with significantly higher concentrations of aphids (p=0.0122 in 2002 and p=0.0006 in 2003) observed along the edge. However, in 2004 the plants located on the marginal plots had similar populations to those on the more inner plots. This can be explained by a higher wind speed which made it more difficult to land on edge plants first. The hop aphid’s main natural enemy was Coccinella septempunctata (Coleoptera: Coccinellidae), whose population was greatest where the aphids were most abundant with a significantly greater number of eggs (p=0.0230) and adults (p=0.0245) in 2003. Lacewing eggs were also frequently observed, with a significantly higher population (p=0.0221 in 2003 and p=0.0046 in 2004) where the aphid numbers were high. The number of winged aphids was greatest towards the margins of the garden in 2003. It is argued that the spatial distribution of the hop aphid and its natural enemies could be used to plan a sampling program and to estimate the population densities of these insects for use in integrated pest management programs.

  19. Sensor-Motor Maps for Describing Linear Reflex Composition in Hopping.

    Science.gov (United States)

    Schumacher, Christian; Seyfarth, André

    2017-01-01

    In human and animal motor control several sensory organs contribute to a network of sensory pathways modulating the motion depending on the task and the phase of execution to generate daily motor tasks such as locomotion. To better understand the individual and joint contribution of reflex pathways in locomotor tasks, we developed a neuromuscular model that describes hopping movements. In this model, we consider the influence of proprioceptive length (LFB), velocity (VFB) and force feedback (FFB) pathways of a leg extensor muscle on hopping stability, performance and efficiency (metabolic effort). Therefore, we explore the space describing the blending of the monosynaptic reflex pathway gains. We call this reflex parameter space a sensor-motor map . The sensor-motor maps are used to visualize the functional contribution of sensory pathways in multisensory integration. We further evaluate the robustness of these sensor-motor maps to changes in tendon elasticity, body mass, segment length and ground compliance. The model predicted that different reflex pathway compositions selectively optimize specific hopping characteristics (e.g., performance and efficiency). Both FFB and LFB were pathways that enable hopping. FFB resulted in the largest hopping heights, LFB enhanced hopping efficiency and VFB had the ability to disable hopping. For the tested case, the topology of the sensor-motor maps as well as the location of functionally optimal compositions were invariant to changes in system designs (tendon elasticity, body mass, segment length) or environmental parameters (ground compliance). Our results indicate that different feedback pathway compositions may serve different functional roles. The topology of the sensor-motor map was predicted to be robust against changes in the mechanical system design indicating that the reflex system can use different morphological designs, which does not apply for most robotic systems (for which the control often follows a specific

  20. Is a Multi-Hop Relay Scheme Gainful in an IEEE 802.22-Based Cognitive Radio System?

    Science.gov (United States)

    Shin, Jungchae; Lee, Dong-Kyu; Cho, Ho-Shin

    In this paper, we formulate a plan to operate multi-hop relays in IEEE 802.22-based cognitive radio (CR) systems and evaluate system performance to consider the propriety of a multi-hop relay scheme in CR systems. A centralized radio resource management and a simple deployment of relay stations (RSs) are assessed to make relay operations feasible under CR conditions. Simulation results show that the proposed multi-hop relay scheme significantly increases system throughput compared to a no-relay CR system as the incumbent user (IU) traffic gets heavier. Furthermore, the optimal number of hops can be determined given the traffic conditions.

  1. The Pseudomonas syringae type III effector HopG1 targets mitochondria, alters plant development, and suppresses plant innate immunity

    Science.gov (United States)

    Block, Anna; Guo, Ming; Li, Guangyong; Elowsky, Christian; Clemente, Thomas E.; Alfano, James R.

    2009-01-01

    Summary The bacterial plant pathogen Pseudomonas syringae uses a type III protein secretion system to inject type III effectors into plant cells. Primary targets of these effectors appear to be effector-triggered immunity (ETI) and pathogen-associated molecular pattern (PAMP)-triggered immunity (PTI). The type III effector HopG1 is a suppressor of ETI that is broadly conserved in bacterial plant pathogens. Here we show that HopG1 from P. syringae pv. tomato DC3000 also suppresses PTI. Interestingly, HopG1 localizes to plant mitochondria, suggesting that its suppression of innate immunity may be linked to a perturbation of mitochondrial function. While HopG1 possesses no obvious mitochondrial signal peptide, its N-terminal two-thirds was sufficient for mitochondrial localization. A HopG1-GFP fusion lacking HopG1’s N-terminal 13 amino acids was not localized to the mitochondria reflecting the importance of the N-terminus for targeting. Constitutive expression of HopG1 in Arabidopsis thaliana, Nicotiana tabacum (tobacco) and Lycopersicon esculentum (tomato) dramatically alters plant development resulting in dwarfism, increased branching and infertility. Constitutive expression of HopG1 in planta leads to reduced respiration rates and an increased basal level of reactive oxygen species. These findings suggest that HopG1’s target is mitochondrial and that effector/target interaction promotes disease by disrupting mitochondrial functions. PMID:19863557

  2. Evaluation of airborne methyl salicylate for improved conservation biological control of two-spotted spider mite and hop aphid in Oregon hop yards.

    Science.gov (United States)

    Woods, J L; James, D G; Lee, J C; Gent, D H

    2011-12-01

    The use of synthetic herbivore-induced plant volatiles (HIPV) to attract natural enemies has received interest as a tool to enhance conservation biological control (CBC). Methyl salicylate (MeSA) is a HIPV that is attractive to several key predators of two-spotted spider mite, Tetranychus urticae Koch (Acari: Tetranychidae), and hop aphid, Phorodon humuli (Schrank) (Homoptera: Aphididae). A 2-year study was conducted to evaluate the recommended commercial use of MeSA in hop yards in Oregon. Slow-release MeSA dispensers were stapled to supporting poles in 0.5 ha plots and these plots were compared to a paired non-treated plot on each of three farms in 2008 and 2009. Across both years, there was a trend for reduced (range 40-91%) mean seasonal numbers of T. urticae in five of the six MeSA-baited plots. Stethorus spp., key spider mite predators, tended to be more numerous in MeSA-baited plots compared to control plots on a given farm. Mean seasonal densities of hop aphid and other natural enemies (e.g., Orius spp. and Anystis spp.) were similar between MeSA-treated and control plots. Variability among farms in suppression of two-spotted spider mites and attraction of Stethorus spp. suggests that the use of MeSA to enhance CBC of spider mites in commercial hop yards may be influenced by site-specific factors related to the agroecology of individual farms or seasonal effects that require further investigation. The current study also suggests that CBC of hop aphid with MeSA in this environment may be unsatisfactory.

  3. Design, testing, and performance of a hybrid micro vehicle---The Hopping Rotochute

    Science.gov (United States)

    Beyer, Eric W.

    The Hopping Rotochute is a new hybrid micro vehicle that has been developed to robustly explore environments with rough terrain while minimizing energy consumption over long periods of time. The device consists of a small coaxial rotor system housed inside a lightweight cage. The vehicle traverses an area by intermittently powering a small electric motor which drives the rotor system, allowing the vehicle to hop over obstacles of various shapes and sizes. A movable internal mass controls the direction of travel while the egg-like exterior shape and low mass center allows the vehicle to passively reorient itself to an upright attitude when in contact with the ground. This dissertation presents the design, fabrication, and testing of a radio-controlled Hopping Rotochute prototype as well as an analytical study of the flight performance of the device. The conceptual design iterations are first outlined which were driven by the mission and system requirements assigned to the vehicle. The aerodynamic, mechanical, and electrical design of a prototype is then described, based on the final conceptual design, with particular emphasis on the fundamental trades that must be negotiated for this type of hopping vehicle. The fabrication and testing of this prototype is detailed as well as experimental results obtained from a motion capture system. Basic flight performance of the prototype are reported which demonstrates that the Hopping Rotochute satisfies all appointed system requirements. A dynamic model of the Hopping Rotochute is also developed in this thesis and employed to predict the flight performance of the vehicle. The dynamic model includes aerodynamic loads from the body and rotor system as well as a soft contact model to estimate the forces and moments during ground contact. The experimental methods used to estimate the dynamic model parameters are described while comparisons between measured and simulated motion are presented. Good correlation between these motions

  4. Electrolytic conductivity-the hopping mechanism of the proton and beyond

    International Nuclear Information System (INIS)

    Gileadi, E.; Kirowa-Eisner, E.

    2006-01-01

    The hopping mechanism of electrolytic conductivity is analyzed, employing mixtures of two solvents: one that sustains the hopping mechanism and the other that does not inhibit it directly, but interferes with it by diluting the solvent that sustains hopping. Measurement of the equivalent conductivity shows that the excess proton conductivities of H 3 O + and OH - increases with increasing temperature, although the number of hydrogen bonds is known to decrease. In mixtures of acetonitrile with water, proton hopping does not start until a threshold concentration of about 20 vol.% water has been reached, while no such threshold concentration is observed upon addition of methanol to acetonitrile. It is concluded that in the former the proton is transferred to a cluster of water molecules, which can be formed only if there is enough water in the solvent mixture. This observation leads to the concept of mono-water, which is the state of water molecules when they constitute a small minority in the solvent mixtures, as opposed to bulk water, which consists of clusters of variable sizes. Systems in which a hopping mechanism of heavy ions has been observed include Br - /Br 2 and I - /I 2 . In these cases the triple ions Br 3 - and I 3 - , respectively are formed, and serve as the mediators for the transfer of the simple halogen ion. A very large increase of conductivity was observed upon solidification of the Br - /Br 3 - system, probably caused by favorable linear alignment of ions in the solid. The conductivity of acidified methanol decreases upon addition of water, because the affinity of the proton to water is higher than to methanol, thus water can act as a scavenger for protons. This behavior exemplifies a general observation, namely that conductivity by hopping can only occur when the Gibbs energy of the system does not change significantly following ion transfer; otherwise the ions would be trapped in the more stable state, hindering further propagation by hopping

  5. Biological and chemical standardization of a hop (Humulus lupulus) botanical dietary supplement.

    Science.gov (United States)

    Krause, Elizabeth; Yuan, Yang; Hajirahimkhan, Atieh; Dong, Huali; Dietz, Birgit M; Nikolic, Dejan; Pauli, Guido F; Bolton, Judy L; van Breemen, Richard B

    2014-06-01

    Concerned about the safety of conventional estrogen replacement therapy, women are using botanical dietary supplements as alternatives for the management of menopausal symptoms such as hot flashes. Before botanical dietary supplements can be evaluated clinically for safety and efficacy, botanically authenticated and standardized forms are required. To address the demand for a standardized, estrogenic botanical dietary supplement, an extract of hops (Humulus lupulus L.) was developed. Although valued in the brewing of beer, hop extracts are used as anxiolytics and hypnotics and have well-established estrogenic constituents. Starting with a hop cultivar used in the brewing industry, spent hops (the residue remaining after extraction of bitter acids) were formulated into a botanical dietary supplement that was then chemically and biologically standardized. Biological standardization utilized the estrogen-dependent induction of alkaline phosphatase in the Ishikawa cell line. Chemical standardization was based on the prenylated phenols in hops that included estrogenic 8-prenylnaringenin, its isomer 6-prenylnaringenin, and pro-estrogenic isoxanthohumol and its isomeric chalcone xanthohumol, all of which were measured using high-performance liquid chromatography-tandem mass spectrometry. The product of this process was a reproducible botanical extract suitable for subsequent investigations of safety and efficacy. Copyright © 2014 John Wiley & Sons, Ltd.

  6. Cascading Multi-Hop Reservation and Transmission in Underwater Acoustic Sensor Networks

    Directory of Open Access Journals (Sweden)

    Jae-Won Lee

    2014-10-01

    Full Text Available The long propagation delay in an underwater acoustic channel makes designing an underwater media access control (MAC protocol more challenging. In particular, handshaking-based MAC protocols widely used in terrestrial radio channels have been known to be inappropriate in underwater acoustic channels, because of the inordinately large latency involved in exchanging control packets. Furthermore, in the case of multi-hop relaying in a hop-by-hop handshaking manner, the end-to-end delay significantly increases. In this paper, we propose a new MAC protocol named cascading multi-hop reservation and transmission (CMRT. In CMRT, intermediate nodes between a source and a destination may start handshaking in advance for the next-hop relaying before handshaking for the previous node is completed. By this concurrent relaying, control packet exchange and data delivery cascade down to the destination. In addition, to improve channel utilization, CMRT adopts a packet-train method where multiple data packets are sent together by handshaking once. Thus, CMRT reduces the time taken for control packet exchange and accordingly increases the throughput. The performance of CMRT is evaluated and compared with that of two conventional MAC protocols (multiple-access collision avoidance for underwater (MACA-U and MACA-U with packet trains (MACA-UPT. The results show that CMRT outperforms other MAC protocols in terms of both throughput and end-to-end delay.

  7. Joint Scheduling for Dual-Hop Block-Fading Broadcast Channels

    KAUST Repository

    Zafar, Ammar

    2012-09-16

    In this paper, we propose joint user-and-hop scheduling over dual-hop block-fading broadcast channels in order to exploit multi-user diversity gains and multi-hop diversity gains all together. To achieve this objective, the first and second hops are scheduled opportunistically based on the channel state information and as a prerequisite we assume that the relay, which is half-duplex and operates using decode-and-forward, is capable of storing the received packets from the source until the channel condition of the destined user becomes good to be scheduled. We formulate the joint scheduling problem as maximizing the weighted sum of the long term achievable rates by the users under a stability constraint, which means that on the long term the rate received by the relay should equal the rate transmitted by it, in addition to constant or variable power constraints. We show that this problem is equivalent to a single-hop broadcast channel by treating the source as a virtual user with an optimal priority weight that maintains the stability constraint. We show how to obtain the source weight either off-line based on channel statistics or on real-time based on channel measurements. Furthermore, we consider special cases including the maximum sum rate scheduler and the proportional fair scheduler. We demonstrate via numerical results that our proposed joint scheduling scheme enlarges the rate region as compared with a scheme that employs multi-user scheduling alone.

  8. Back-Hopping in Spin-Transfer-Torque Devices: Possible Origin and Countermeasures

    Science.gov (United States)

    Abert, Claas; Sepehri-Amin, Hossein; Bruckner, Florian; Vogler, Christoph; Hayashi, Masamitsu; Suess, Dieter

    2018-05-01

    The effect of undesirable high-frequency free-layer switching in magnetic multilayer systems, referred to as back-hopping, is investigated by means of the spin-diffusion model. A possible origin of the back-hopping effect is found to be the destabilization of the pinned layer, which leads to the perpetual switching of both layers. While the presented mechanism is not claimed to be the only possible reason for back-hopping, we show that it is a fundamental effect that will occur in any spin-transfer-torque device when exceeding a critical current. The influence of different material parameters on the critical switching currents for the free and pinned layer is obtained by micromagnetic simulations. The spin-diffusion model enables an accurate description of the torque on both layers, depending on various material parameters. It is found that the choice of a free-layer material with low polarization β and saturation magnetization Ms and a pinned-layer material with high β and Ms leads to a low free-layer critical current and a high pinned-layer critical current and hence reduces the likelihood of back-hopping. While back-hopping has been observed in various types of devices, there are only a few experiments that exhibit this effect in perpendicularly magnetized systems. However, our simulations suggest that the described effect will also gain importance in perpendicular systems due to the loss of pinned-layer anisotropy for decreasing device sizes.

  9. Multi-hop localization algorithm based on grid-scanning for wireless sensor networks.

    Science.gov (United States)

    Wan, Jiangwen; Guo, Xiaolei; Yu, Ning; Wu, Yinfeng; Feng, Renjian

    2011-01-01

    For large-scale wireless sensor networks (WSNs) with a minority of anchor nodes, multi-hop localization is a popular scheme for determining the geographical positions of the normal nodes. However, in practice existing multi-hop localization methods suffer from various kinds of problems, such as poor adaptability to irregular topology, high computational complexity, low positioning accuracy, etc. To address these issues in this paper, we propose a novel Multi-hop Localization algorithm based on Grid-Scanning (MLGS). First, the factors that influence the multi-hop distance estimation are studied and a more realistic multi-hop localization model is constructed. Then, the feasible regions of the normal nodes are determined according to the intersection of bounding square rings. Finally, a verifiably good approximation scheme based on grid-scanning is developed to estimate the coordinates of the normal nodes. Additionally, the positioning accuracy of the normal nodes can be improved through neighbors' collaboration. Extensive simulations are performed in isotropic and anisotropic networks. The comparisons with some typical algorithms of node localization confirm the effectiveness and efficiency of our algorithm.

  10. Odor-Active Compounds in the Special Flavor Hops Huell Melon and Polaris.

    Science.gov (United States)

    Neiens, Silva D; Steinhaus, Martin

    2018-02-14

    The volatiles isolated from samples of the special flavor hop varieties, Huell Melon and Polaris, and from the aroma hop variety, Hallertau Tradition, by solvent extraction and solvent-assisted flavor evaporation (SAFE) were subjected to a comparative aroma extract dilution analysis (cAEDA), which resulted in 46 odor-active compounds in the flavor dilution (FD) factor range of 16 to 2048. On the basis of high FD factors, myrcene, (3R)-linalool, and 2- and 3-methylbutanoic acid were confirmed as important variety-independent hop odorants. (1R,4S)-Calamenene was identified for the first time as an odor-active compound in hops. Clear differences in the FD factors and their subsequent objectification by stable isotope dilution quantitation suggested that high concentrations of the esters ethyl 2-methylbutanoate, ethyl 2-methylpropanoate, and propyl 2-methylbutanoate cause the characteristic fruity, cantaloupe-like odor note in Huell Melon hops, whereas the fruity and minty odor notes in Polaris are associated with high amounts of 3-methylbutyl acetate and 1,8-cineole.

  11. Jumping and Hopping in Elite and Amateur Orienteering Athletes and Correlations to Sprinting and Running

    DEFF Research Database (Denmark)

    Hébert-Losier, Kim; Jensen, Kurt; Holmberg, Hans-Christer

    2014-01-01

    PURPOSE: Jumping and hopping are used to measure lower-body muscle power, stiffness, and stretch-shortening cycle utilization in sports, with several studies reporting correlations between such measures and sprinting and/or running abilities in athletes. Neither jumping and hopping nor correlatio...... and rapid generation of high relative maximal forces, especially vertically. These functional measures were more closely related to sprinting and/or running abilities, indicating benefits of lower-body training in orienteering.......PURPOSE: Jumping and hopping are used to measure lower-body muscle power, stiffness, and stretch-shortening cycle utilization in sports, with several studies reporting correlations between such measures and sprinting and/or running abilities in athletes. Neither jumping and hopping nor correlations...... with sprinting and/or running have been examined in orienteering athletes. METHODS: We investigated squat jump (SJ), countermovement jump (CMJ), standing long jump (SLJ), and hopping performed by 8 elite and 8 amateur male foot-orienteering athletes (29 ± 7 y, 183 ± 5 cm, 73 ± 7 kg) and possible correlations...

  12. Exact Open Quantum System Dynamics Using the Hierarchy of Pure States (HOPS).

    Science.gov (United States)

    Hartmann, Richard; Strunz, Walter T

    2017-12-12

    We show that the general and numerically exact Hierarchy of Pure States method (HOPS) is very well applicable to calculate the reduced dynamics of an open quantum system. In particular, we focus on environments with a sub-Ohmic spectral density (SD) resulting in an algebraic decay of the bath correlation function (BCF). The universal applicability of HOPS, reaching from weak to strong coupling for zero and nonzero temperature, is demonstrated by solving the spin-boson model for which we find perfect agreement with other methods, each one suitable for a special regime of parameters. The challenges arising in the strong coupling regime are not only reflected in the computational effort needed for the HOPS method to converge but also in the necessity for an importance sampling mechanism, accounted for by the nonlinear variant of HOPS. In order to include nonzero-temperature effects in the strong coupling regime we found that it is highly favorable for the HOPS method to use the zero-temperature BCF and include temperature via a stochastic Hermitian contribution to the system Hamiltonian.

  13. A study on a wheel-based stair-climbing robot with a hopping mechanism

    Science.gov (United States)

    Kikuchi, Koki; Sakaguchi, Keisuke; Sudo, Takayuki; Bushida, Naoki; Chiba, Yasuhiro; Asai, Yuji

    2008-08-01

    In this study, we propose a simple hopping mechanism using the vibration of a two-degree-of-freedom system for a wheel-based stair-climbing robot. The robot, consisting of two bodies connected by springs and a wire, hops by releasing energy stored in the springs and quickly travels using wheels mounted in its lower body. The trajectories of the bodies during hopping change in accordance with the design parameters, such as the reduced mass of the two bodies, the mass ratio between the upper and lower bodies, the spring constant, the control parameters such as the initial contraction of the spring and the wire tension. This property allows the robot to quickly and economically climb up and down stairs, leap over obstacles, and landing softly without complex control. In this paper, the characteristics of hopping motion for the design and control parameters are clarified by both numerical simulations and experiments. Furthermore, using the robot design based on the results the abilities to hop up and down a step, leap over a cable, and land softly are demonstrated.

  14. Culturas juveniles en tono de mujer. Hip hop en Medellín (Colombia.

    Directory of Open Access Journals (Sweden)

    Ángela Garcés Montoya.

    2011-04-01

    Full Text Available This article is part of the research project, “Youth musical mediations,” that explores the appropriation of alternative means of communication which allow the young to develop identities sharply differentiated from those the adult world. In particular, the article examines the world of hip hop in Medellín and the ways that youth participate in it. To follow key trajectories of women in hip hop, their voices, feelings, and memories must be uncovered. This will allow us to see how the few women who are currently part of hip hop scene in Medellín and Colombia enter, move through, and persevere in it. Since women constitute only a small percentage of the youth who live and remake hip hop in Medellín, it is important to understand how they manage to live in a male-colored world. If hip hop is about strength, denunciation, confrontation, and resistance, it seems that these qualities are more appropriate for men than for women

  15. Multi-hop Relaying: An End-to-End Delay Analysis

    KAUST Repository

    Chaaban, Anas

    2015-12-01

    The impact of multi-hopping schemes on the communication latency in a relay channel is studied. The main aim is to characterize conditions under which such schemes decrease the communication latency given a reliability requirement. Both decode-forward (DF) and amplify-forward (AF) with block coding are considered, and are compared with the point-to-point (P2P) scheme which ignores the relay. Latency expressions for the three schemes are derived, and conditions under which DF and AF reduce latency are obtained for high signal-to-noise ratio (SNR). Interestingly, these conditions are more strict when compared to the conditions under which the same multi-hopping schemes achieve higher long-term (information-theoretic) rates than P2P. It turns out that the relation between the sourcedestination SNR and the harmonic mean of the SNR’s of the channels to and from the relay dictates whether multi-hopping reduces latency or not.

  16. Orbital Kondo effect due to assisted hopping: Superconductivity, mass enhancement in Cooper oxides with apical oxygen

    International Nuclear Information System (INIS)

    Zawadowski, A.; Penc, K.; Zimanyi, G.

    1991-07-01

    Orbital Kondo effect is treated in a model, where additional to the conduction band there are localized orbitals with energy not very far from the Fermi energy. If the hopping between the conduction band and the localized heavy orbitals depends on the occupation of the conduction band orbital then orbital Kondo correlation occurs. The assisted hopping vertex is enhanced due to the Coulomb interaction between the heavy orbital and the conduction band. The enhanced hopping results in mass enhancement and attractive interaction in the conduction band. The superconductivity transition temperature is calculated. The models of this type can be applied to the high-T c superconductors where the non-bonding oxygen orbitals of the apical oxygens play the role of heavy orbitals. For an essential range of the parameters the T c obtained is about 100K. (author). 22 refs, 9 figs

  17. Electronic transport of molecular nanowires by considering of electron hopping energy between the second neighbors

    Directory of Open Access Journals (Sweden)

    H Rabani

    2015-07-01

    Full Text Available In this paper, we study the electronic conductance of molecular nanowires by considering the electron hopping between the first and second neighbors with the help Green’s function method at the tight-binding approach. We investigate three types of structures including linear uniform and periodic chains as well as poly(p-phenylene molecule which are embedded between two semi-infinite metallic leads. The results show that in the second neighbor approximation, the resonance, anti-resonance and Fano phenomena occur in the conductance spectra of these structures. Moreover, a new gap is observed at edge of the lead energy band wich its width depends on the value of the electron hopping energy between the second neighbors. In the systems including intrinsic gap, this hopping energy shifts the gap in the energy spectra.

  18. A New Time-Hopping Multiple Access Communication System Simulator: Application to Ultra-Wideband

    Directory of Open Access Journals (Sweden)

    José M. Páez-Borrallo

    2005-03-01

    Full Text Available Time-hopping ultra-wideband technology presents some very attractive features for future indoor wireless systems in terms of achievable transmission rate and multiple access capabilities. This paper develops an algorithm to design time-hopping system simulators specially suitable for ultra-wideband, which takes advantage of some of the specific characteristics of this kind of systems. The algorithm allows an improvement of both the time capabilities and the achievable sampling rate and can be used to research into the influence of different parameters on the performance of the system. An additional result is the validation of a new general performance formula for time-hopping ultra-wideband systems with multipath channels.

  19. A fast-hopping 3-band CMOS frequency synthesizer for MB-OFDM UWB system

    International Nuclear Information System (INIS)

    Zheng Yongzheng; Xia Lingli; Li Weinan; Huang Yumei; Hong Zhiliang

    2009-01-01

    A fast-hopping 3-band (mode 1) multi-band orthogonal frequency division multiplexing ultra-wideband frequency synthesizer is presented. This synthesizer uses two phase-locked loops for generating steady frequencies and one quadrature single-sideband mixer for frequency shifting and quadrature frequency generation. The generated carriers can hop among 3432 MHz, 3960 MHz, and 4488 MHz. Implemented in a 0.13 μm CMOS process, this fully integrated synthesizer consumes 27 mA current from a 1.2 V supply. Measurement shows that the out-of-band spurious tones are below -50 dBc, while the in-band spurious tones are below -34 dBc. The measured hopping time is below 2 ns. The core die area is 1.0 x 1.8 mm 2 .

  20. A fast-hopping 3-band CMOS frequency synthesizer for MB-OFDM UWB system

    Energy Technology Data Exchange (ETDEWEB)

    Zheng Yongzheng; Xia Lingli; Li Weinan; Huang Yumei; Hong Zhiliang, E-mail: yumeihuang@fudan.edu.c [State Key Laboratory of ASIC and System, Fudan University, Shanghai 201203 (China)

    2009-09-15

    A fast-hopping 3-band (mode 1) multi-band orthogonal frequency division multiplexing ultra-wideband frequency synthesizer is presented. This synthesizer uses two phase-locked loops for generating steady frequencies and one quadrature single-sideband mixer for frequency shifting and quadrature frequency generation. The generated carriers can hop among 3432 MHz, 3960 MHz, and 4488 MHz. Implemented in a 0.13 {mu}m CMOS process, this fully integrated synthesizer consumes 27 mA current from a 1.2 V supply. Measurement shows that the out-of-band spurious tones are below -50 dBc, while the in-band spurious tones are below -34 dBc. The measured hopping time is below 2 ns. The core die area is 1.0 x 1.8 mm{sup 2}.

  1. Industrial brewing yeast engineered for the production of primary flavor determinants in hopped beer.

    Science.gov (United States)

    Denby, Charles M; Li, Rachel A; Vu, Van T; Costello, Zak; Lin, Weiyin; Chan, Leanne Jade G; Williams, Joseph; Donaldson, Bryan; Bamforth, Charles W; Petzold, Christopher J; Scheller, Henrik V; Martin, Hector Garcia; Keasling, Jay D

    2018-03-20

    Flowers of the hop plant provide both bitterness and "hoppy" flavor to beer. Hops are, however, both a water and energy intensive crop and vary considerably in essential oil content, making it challenging to achieve a consistent hoppy taste in beer. Here, we report that brewer's yeast can be engineered to biosynthesize aromatic monoterpene molecules that impart hoppy flavor to beer by incorporating recombinant DNA derived from yeast, mint, and basil. Whereas metabolic engineering of biosynthetic pathways is commonly enlisted to maximize product titers, tuning expression of pathway enzymes to affect target production levels of multiple commercially important metabolites without major collateral metabolic changes represents a unique challenge. By applying state-of-the-art engineering techniques and a framework to guide iterative improvement, strains are generated with target performance characteristics. Beers produced using these strains are perceived as hoppier than traditionally hopped beers by a sensory panel in a double-blind tasting.

  2. Assessing hopping developmental level in childhood using wearable inertial sensor devices.

    Science.gov (United States)

    Masci, Ilaria; Vannozzi, Giuseppe; Getchell, Nancy; Cappozzo, Aurelio

    2012-07-01

    Assessing movement skills is a fundamental issue in motor development. Current process-oriented assessments, such as developmental sequences, are based on subjective judgments; if paired with quantitative assessments, a better understanding of movement performance and developmental change could be obtained. Our purpose was to examine the use of inertial sensors to evaluate developmental differences in hopping over distance. Forty children executed the task wearing the inertial sensor and relevant time durations and 3D accelerations were obtained. Subjects were also categorized in different developmental levels according to the hopping developmental sequence. Results indicated that some time and kinematic parameters changed with some developmental levels, possibly as a function of anthropometry and previous motor experience. We concluded that, since inertial sensors were suitable in describing hopping performance and sensitive to developmental changes, this technology is promising as an in-field and user-independent motor development assessment tool.

  3. Mode-hopping mechanism generating colored noise in a magnetic tunnel junction based spin torque oscillator

    International Nuclear Information System (INIS)

    Sharma, Raghav; Dürrenfeld, P.; Iacocca, E.; Heinonen, O. G.; Åkerman, J.; Muduli, P. K.

    2014-01-01

    The frequency noise spectrum of a magnetic tunnel junction based spin torque oscillator is examined where multiple modes and mode-hopping events are observed. The frequency noise spectrum is found to consist of both white noise and 1/f frequency noise. We find a systematic and similar dependence of both white noise and 1/f frequency noise on bias current and the relative angle between the reference and free layers, which changes the effective damping and hence the mode-hopping behavior in this system. The frequency at which the 1/f frequency noise changes to white noise increases as the free layer is aligned away from the anti-parallel orientation w.r.t the reference layer. These results indicate that the origin of 1/f frequency noise is related to mode-hopping, which produces both white noise as well as 1/f frequency noise similar to the case of ring lasers.

  4. Surface hopping, transition state theory, and decoherence. II. Thermal rate constants and detailed balance

    Energy Technology Data Exchange (ETDEWEB)

    Jain, Amber; Subotnik, Joseph E., E-mail: subotnik@sas.upenn.edu [Department of Chemistry, University of Pennsylvania, 231 South 34th Street, Philadelphia, Pennsylvania 19104 (United States)

    2015-10-07

    We investigate a simple approach to compute a non-adiabatic thermal rate constant using the fewest switches surface hopping (FSSH) dynamics. We study the effects of both decoherence (using our augmented-FSSH (A-FSSH) algorithm) and forbidden hops over a large range of parameters, including high and low friction regimes, and weak and strong electronic coupling regimes. Furthermore, when possible, we benchmark our results against exact hierarchy equations of motion results, where we usually find a maximum error of roughly a factor of two (at reasonably large temperatures). In agreement with Hammes-Schiffer and Tully, we find that a merger of transition state theory and surface hopping can be both accurate and efficient when performed correctly. We further show that detailed balance is followed approximately by A-FSSH dynamics.

  5. Subunit Organisation of In Vitro Reconstituted HOPS and CORVET Multisubunit Membrane Tethering Complexes

    Science.gov (United States)

    Guo, Zhong; Johnston, Wayne; Kovtun, Oleksiy; Mureev, Sergey; Bröcker, Cornelia; Ungermann, Christian; Alexandrov, Kirill

    2013-01-01

    Biochemical and structural analysis of macromolecular protein assemblies remains challenging due to technical difficulties in recombinant expression, engineering and reconstitution of multisubunit complexes. Here we use a recently developed cell-free protein expression system based on the protozoan Leishmania tarentolae to produce in vitro all six subunits of the 600 kDa HOPS and CORVET membrane tethering complexes. We demonstrate that both subcomplexes and the entire HOPS complex can be reconstituted in vitro resulting in a comprehensive subunit interaction map. To our knowledge this is the largest eukaryotic protein complex in vitro reconstituted to date. Using the truncation and interaction analysis, we demonstrate that the complex is assembled through short hydrophobic sequences located in the C-terminus of the individual Vps subunits. Based on this data we propose a model of the HOPS and CORVET complex assembly that reconciles the available biochemical and structural data. PMID:24312556

  6. Hip-Hop to Health Jr. Randomized Effectiveness Trial

    Science.gov (United States)

    Kong, Angela; Buscemi, Joanna; Stolley, Melinda R.; Schiffer, Linda A.; Kim, Yoonsang; Braunschweig, Carol L.; Gomez-Perez, Sandra L.; Blumstein, Lara B.; Van Horn, Linda; Dyer, Alan R.; Fitzgibbon, Marian L.

    2015-01-01

    Introduction The preschool years provide a unique window of opportunity to intervene on obesity-related lifestyle risk factors during the formative years of a child’s life. The purpose of this study was to assess the impact of a preschool-based obesity prevention effectiveness trial at 1-year follow-up. Design RCT. Settings/participants Primarily African American children (aged 3–5 years, N=618) attending Head Start preschool programs administered by Chicago Public Schools. Methods Eighteen preschools were randomly assigned in 2007–2008 to receive either: (1) a 14-week teacher-delivered intervention focused on healthy lifestyle behaviors; or (2) a 14-week teacher-delivered general health curriculum (control group). Main outcome measures The primary outcome, BMI, was measured at baseline, post-intervention, and 1-year follow-up. Diet and screen time behaviors were also assessed at these time points. Multilevel mixed effects models were used to test for between-group differences. Data were analyzed in 2014. Results Significant between-group differences were observed in diet, but not in BMI z-score or screen time at 1-year follow-up. Diet differences favored the intervention arm over controls in overall diet quality (p=0.02) and in subcomponents of diet quality, as measured by the Healthy Eating Index-2005, and in fruit intake (servings/day, excludes juice) (p=0.02). Diet quality worsened more among controls than the intervention group at 1-year follow-up. Conclusions The adaptation of Hip-Hop to Health Jr. produced modest benefits in diet quality, but did not significantly impact weight gain trajectory. Not unlike other effectiveness trials, this real-world version delivered by Head Start teachers produced fewer benefits than the more rigorous efficacy trial. It is important to understand and build upon the lessons learned from these types of trials so that we can design, implement, and disseminate successful evidence-based programs more widely and effectively

  7. Hip-Hop Feminism: A Standpoint to Enhance the Positive Self-Identity of Black College Women

    Science.gov (United States)

    Henry, Wilma J.

    2010-01-01

    The popularity of hip-hop among young Black college women, coupled with the deluge of negative and positive messages in this culture regarding these women's identity, signals an opportunity for the arrival of a contemporary, culturally relevant epistemology--hip-hop feminism. Through the lens of Black feminist theory, this article explores hip-hop…

  8. Camp of Hip-Hop - kõigile kohustuslik / Mari Hiiemäe ; kommenteerinud Joel Juht

    Index Scriptorium Estoniae

    Hiiemäe, Mari

    2012-01-01

    Üheksandat korda toimuvast rahvusvahelisest tantsulaagrist ja tänavakultuuri tutvustavast noortelaagrist Camp of Hip-Hop, mis toimub Lääne Virumaal Käsmus. 28. juunil toimub kõigile huvilistele meelelahutusüritus Camp of Hip-Hop Championships, kus näitavad oma tantsuoskusi laagris osalejad ja maailmas tunnustatud koreograafid

  9. "Dear Tupac, You Speak to Me": Recruiting Hip Hop as Curriculum at a School for Pregnant and Parenting Teens

    Science.gov (United States)

    Hallman, Heidi L.

    2009-01-01

    This article provides a rich representation of how in-school practices that recruit students' "out-of-school" literacies, such as hip hop, can be used as critical bridges in students' learning. Hip hop, conceptualized in this article as an "out-of-school" literacy, works as a vehicle for curricular change at Eastview School for Pregnant and…

  10. "They Wasn't Makin' My Kinda Music": A Hip-Hop Musician's Perspective on School, Schooling, and School Music

    Science.gov (United States)

    Kruse, Adam J.

    2016-01-01

    This article focuses on a hip-hop perspective of school, schooling, and school music. The study involves applications of ethnographic (including autoethnographic) techniques within the framework of a holistic multiple case study. One case is an adult amateur hip-hop musician named Terrence (pseudonym), and the other is myself (a traditionally…

  11. Culturally Relevant Teaching: Hip-Hop Pedagogy in Urban Schools. Counterpoints: Studies in the Postmodern Theory of Education. Volume 396

    Science.gov (United States)

    Prier, Darius D.

    2012-01-01

    "Culturally Relevant Teaching" centers hip-hop culture as a culturally relevant form of critical pedagogy in urban pre-service teacher education programs. In this important book, Darius D. Prier explores how hip-hop artists construct a sense of democratic education and pedagogy with transformative possibilities in their schools and communities. In…

  12. Arab Spring, "Favelas," Borders, and the Artistic Transnational Migration: Toward a Curriculum for a Global Hip-Hop Nation

    Science.gov (United States)

    Ibrahim, Awad

    2017-01-01

    Straddling between the purely political and the poetically artistic, I am arguing, is a Global Hip-Hop Nation (GHHN), which is yet to be charted and its cartography is yet to be demarcated. Taking two examples, the first a Hip-Hop song from within the Arab Spring and the second from the "favelas" in Brazil, my intent is to show what…

  13. Dialoguing, Cultural Capital, and Student Engagement: Toward a Hip Hop Pedagogy in the High School and University Classroom

    Science.gov (United States)

    Rodriguez, Louie F.

    2009-01-01

    Hip hop culture is typically excluded from conventional educational spaces within the U.S. Drawing on the experiences of an educator who works with urban high school students and university level pre- and in-service educators, this article examines the role of hip hop culture for student engagement in two settings--an alternative high school…

  14. Bridging Theory and Practice: Using Hip-Hop Pedagogy as a Culturally Relevant Approach in the Urban Science Classroom

    Science.gov (United States)

    Adjapong, Edmund S.

    2017-01-01

    This dissertation explores the context of urban science education as it relates to the achievement and engagement of urban youth. This study provides a framework for Hip-Hop Pedagogy, an approach to teaching and learning anchored in the creative elements of Hip-Hop culture, in STEM as an innovative approach to teaching and learning demonstrates…

  15. I Feel What He Was Doin': Responding to Justice-Oriented Teaching through Hip-Hop Aesthetics

    Science.gov (United States)

    Petchauer, Emery

    2011-01-01

    This study illustrates a set of learning activities designed from two hip-hop aesthetics and explores their use among a classroom of African American preservice teachers who graduated from urban school districts. Based on the two hip-hop aesthetics of kinetic consumption and autonomy/distance, the specific goal of these learning activities is to…

  16. Sista Girl Rock: Women of Colour and Hip-Hop Deejaying as Raced/Gendered Knowledge and Language

    Science.gov (United States)

    Craig, Todd; Kynard, Carmen

    2017-01-01

    This article seeks to introduce and situate a seldom-explored subject: the role and contribution of women hip-hop deejays in the testosterone-filled genre called hip-hop. Grounding the analysis in the interviews of six women deejays--Spinderella, Kuttin Kandi, Pam the Funkstress, Reborn, Shorty Wop and Natasha Diggs--"Sista Girl Rock"…

  17. "You Don't Have to Claim Her": Reconstructing Black Femininity through Critical Hip-Hop Literacy

    Science.gov (United States)

    Kelly, Lauren Leigh

    2016-01-01

    This article explores the ways in which females who identify with hip-hop often develop and construct their identities in relation to media representations of blackness and femininity in hip-hop music and culture. In order for educators to support female students in constructing identities of empowerment and agency, they should be willing and able…

  18. Fresh Faces, New Places: Moving beyond Teacher-Researcher Perspectives in Hip-Hop-Based Education Research

    Science.gov (United States)

    Irby, Decoteau J.; Hall, H. Bernard

    2011-01-01

    Grounded in critical and culturally relevant theory, hip-hop-based education (HHBE) research documents the use of hip-hop in educational settings. Despite the richness of the emerging field, overreliance on teacher-researcher perspectives leaves much to be desired. Little is known of the extent and ways HHBE is used by nonresearching K-12…

  19. Industrial brewing yeast engineered for the production of primary flavor determinants in hopped beer

    DEFF Research Database (Denmark)

    Denby, Charles M.; Li, Rachel A.; Vu, Van T.

    2018-01-01

    Flowers of the hop plant provide both bitterness and "hoppy" flavor to beer. Hops are, however, both a water and energy intensive crop and vary considerably in essential oil content, making it challenging to achieve a consistent hoppy taste in beer. Here, we report that brewer's yeast can...... be engineered to biosynthesize aromatic monoterpene molecules that impart hoppy flavor to beer by incorporating recombinant DNA derived from yeast, mint, and basil. Whereas metabolic engineering of biosynthetic pathways is commonly enlisted to maximize product titers, tuning expression of pathway enzymes...

  20. Lower bounds on the periodic Hamming correlations of frequency hopping sequences with low hit zone

    Institute of Scientific and Technical Information of China (English)

    2006-01-01

    In this paper, several periodic Hamming correlation lower bounds for frequency hopping sequences with low hit zone, with respect to the size p of the frequency slot set, the sequence length L, the family size M, low hit zone LH ( or no hit zone NH ), the maximum periodic Hamming autocorrelation sidelobe Ha and the maximum periodic Hamming crosscorrelation Hc, are established. It is shown that the new bounds include the known Lempel-Greenberger bounds, T.S. Seay bounds and Peng-Fan bounds for the conventional frequency hopping sequences as special cases.

  1. On the Performance Analysis of Dual-Hop FSO Fixed Gain Transmission Systems

    KAUST Repository

    Zedini, Emna

    2015-12-12

    Novel exact closed-form results for the end-to-end performance analysis of dual-hop free-space optical (FSO) fixed-gain relaying systems under heterodyne detection as well as intensity modulation with direct detection techniques in the presence of atmospheric turbulence as well as pointing errors are presented. By using dual-hop FSO relaying, we demonstrate a better system performance relative to the single FSO link. Numerical and Monte-Carlo simulation results are provided to verify the accuracy of the newly proposed results, and a perfect agreement is observed.

  2. Hopping transport and electrical conductivity in one-dimensional systems with off-diagonal disorder

    International Nuclear Information System (INIS)

    Ma Songshan; Xu Hui; Li Yanfeng; Song Zhaoquan

    2007-01-01

    In this paper, we present a model to describe hopping transport and electrical conductivity of one-dimensional systems with off-diagonal disorder, in which electrons are transported via hopping between localized states. We find that off-diagonal disorder leads to delocalization and drastically enhances the electrical conductivity of systems. The model also quantitatively explains the temperature and electrical field dependence of the conductivity in one-dimensional systems with off-diagonal disorder. In addition, we also show the dependence of the conductivity on the strength of off-diagonal disorder

  3. Hopping mobility of charge carriers in polymers in the earliest stages after their generation

    International Nuclear Information System (INIS)

    Tyutnev, A.P.; Subbotin, A.V.; Chekunaev, N.I.

    1989-01-01

    It has been found that both the photo- and the radiation conductivity of a number of polymers (primarily polyvinylcarbazole, polystyrene, and polyethylene terephthalate) are of a molecular nature, and movement of the generated charge carriers is by a hopping and not by a band mechanism. Analytical expressions for the instantaneous effective mobility and effective displacement of charge carriers in a unitary electric field were obtained in the approximation of isolated pairs of nearest neighbors for four species (monoenergetic, exponential, Gaussian, and bilevel) of energy application of hopping sites randomly distributed in space. Problems of the application of these expressions to real polymers are discussed on the example of polyvinylcarbazole

  4. Hip-Hop Fight Club: Radical Theory, Education, and Practice in and beyond the Classroom

    Directory of Open Access Journals (Sweden)

    Jared A. Ball

    2013-10-01

    Full Text Available Hip-hop remains a viable method for the teaching of radical theory, emancipatory journalism and Africana Media Theory.  Fight Club is an emergent model that builds from existing hip-hop traditions of freetyle battling where critical thought and intellectual challenges of hueristic norms are upended.  This article argues in favor of bringing the Fight Club model into the classroom which allows for heightened student engagement and the inclusion of radical theoretical approaches to the study of mass media, communication and journalism.

  5. Wavelength-Hopping Time-Spreading Optical CDMA With Bipolar Codes

    Science.gov (United States)

    Kwong, Wing C.; Yang, Guu-Chang; Chang, Cheng-Yuan

    2005-01-01

    Two-dimensional wavelength-hopping time-spreading coding schemes have been studied recently for supporting greater numbers of subscribers and simultaneous users than conventional one-dimensional approaches in optical code-division multiple-access (OCDMA) systems. To further improve both numbers without sacrificing performance, a new code design utilizing bipolar codes for both wavelength hopping and time spreading is studied and analyzed in this paper. A rapidly programmable, integratable hardware design for this new coding scheme, based on arrayed-waveguide gratings, is also discussed.

  6. Surface hopping, transition state theory and decoherence. I. Scattering theory and time-reversibility.

    Science.gov (United States)

    Jain, Amber; Herman, Michael F; Ouyang, Wenjun; Subotnik, Joseph E

    2015-10-07

    We provide an in-depth investigation of transmission coefficients as computed using the augmented-fewest switches surface hopping algorithm in the low energy regime. Empirically, microscopic reversibility is shown to hold approximately. Furthermore, we show that, in some circumstances, including decoherence on top of surface hopping calculations can help recover (as opposed to destroy) oscillations in the transmission coefficient as a function of energy; these oscillations can be studied analytically with semiclassical scattering theory. Finally, in the spirit of transition state theory, we also show that transmission coefficients can be calculated rather accurately starting from the curve crossing point and running trajectories forwards and backwards.

  7. The crossover between tunnel and hopping conductivity in granulated films of noble metals

    Science.gov (United States)

    Kavokin, Alexey; Kutrovskaya, Stella; Kucherik, Alexey; Osipov, Anton; Vartanyan, Tigran; Arakelyan, Sergey

    2017-11-01

    The conductivity of thin films composed by clusters of gold and silver nanoparticles has been studies in a wide range of temperatures. The switch from a temperature independence to an exponential thermal dependence of the conductivity manifests the crossover between the tunnel and thermally activated hopping regimes of the electronic transport at the temperature of 60 °C. The characteristic thermal activation energy that governs hopping of electrons between nanoparticles is estimated as 1.3 eV. We have achieved a good control of the composition and thicknesses of nano-cluster films by use of the laser ablation method in colloidal solutions.

  8. Quantum Hall effect and hopping conductivity in n-InGaAs/InAlAs nanoheterostructures

    Energy Technology Data Exchange (ETDEWEB)

    Gudina, S. V., E-mail: svpopova@imp.uran.ru; Arapov, Yu. G.; Saveliev, A. P.; Neverov, V. N.; Podgornykh, S. M.; Shelushinina, N. G.; Yakunin, M. V. [Russian Academy of Sciences, Mikheev Institute of Metal Physics, Ural Branch (Russian Federation); Vasil’evskii, I. S.; Vinichenko, A. N. [National Research Nuclear University MEPhI (Russian Federation)

    2016-12-15

    The longitudinal and Hall magnetoresistances are measured in the quantum Hall effect regime in the n-InGaAs/InAlAs heterostructures at temperatures of T = (1.8–30) K in magnetic fields up to B = 9 T. Temperature-induced transport in the region of the longitudinal resistance minima, corresponding to the plateau regions at Hall resistance, is investigated within the framework of the concept of hopping conductivity in a strongly localized electron system. The analysis of variable-range hopping conductivity in the region of the second, third, and fourth plateau of the quantum Hall effect provides the possibility of determining the localization length exponent.

  9. An SDN-Based Fingerprint Hopping Method to Prevent Fingerprinting Attacks

    Directory of Open Access Journals (Sweden)

    Zheng Zhao

    2017-01-01

    Full Text Available Fingerprinting attacks are one of the most severe threats to the security of networks. Fingerprinting attack aims to obtain the operating system information of target hosts to make preparations for future attacks. In this paper, a fingerprint hopping method (FPH is proposed based on software-defined networks to defend against fingerprinting attacks. FPH introduces the idea of moving target defense to show a hopping fingerprint toward the fingerprinting attackers. The interaction of the fingerprinting attack and its defense is modeled as a signal game, and the equilibriums of the game are analyzed to develop an optimal defense strategy. Experiments show that FPH can resist fingerprinting attacks effectively.

  10. Multilingualism and Hip Hop Consumption in Nigeria: Accounting for the Local Acceptance of a Global Phenomenon Hip-Hop und Mehrsprachigkeit in Nigeria: Zur Erklärung der lokalen Akzeptanz eines globalen Phänomens

    Directory of Open Access Journals (Sweden)

    Olusegun Fariudeen Liadi

    2012-01-01

    Full Text Available Hip hop music has enjoyed global popularity and patronage on a level that has transcended that of most other music genres. It is perhaps due to the genre’s worldwide popularity that many forms of hip hop have sprung up across the globe. The Nigerian version of the music has been overwhelmingly accepted by a good number of youths in the country irrespective of class, religion and social status. However, there is some speculation as to what factors are responsible for the recent sudden boom in the popular consumption of this genre among the youth, since hip hop has been a feature of the Nigerian musical landscape since the 1980s. With the aid of qualitative data collection instruments – thirty in-depth interviews and six key informant interviews among hip hop fans and club DJs, respectively – the study establishes the centrality of multilingualism as a primary reason for the acceptance of hip hop among Nigerian youth.Hip-Hop-Musik ist weltweit in einem Maße populär, das die meisten anderen Musikrichtungen übertrifft. Vielleicht hat diese weltweite Beliebtheit dazu geführt, dass rund um den Globus unterschiedliche Formen des Hip-Hop aus dem Boden geschossen sind. Die nigerianische Version dieser Musikrichtung wird von einer überwältigenden Zahl Jugendlicher im Land angenommen, unabhängig von sozialem Status und Religionszugehörigkeit. Es wird jedoch darüber spekuliert, welche Faktoren den jüngsten plötzlichen Boom in dieser Musikrichtung erklären, denn Hip-Hop ist schon seit den 1980er Jahren Teil der nigerianischen Musiklandschaft. Mit Hilfe einer qualitativen Datenerhebung – 30 detaillierte Interviews sowie sechs Interviews mit Schlüsselpersonen unter Hip-Hop-Fans und Club-DJs – kann der Autor die Mehrsprachigkeit als wichtigsten Grund für die Akzeptanz des Hip-Hop unter nigerianischen Jugendlichen ermitteln.

  11. In and out of love with hip-hop: saliency of sexual scripts for young adult African American women in hip-hop and Black-oriented television.

    Science.gov (United States)

    Coleman, M Nicole; Butler, Ebony O; Long, Amanda M; Fisher, Felicia D

    2016-10-01

    Hip-hop media and Black-oriented reality television are powerful mechanisms for conveying and promoting stereotypes of Black women. Black women's sexuality is frequently presented as highly-salient in each medium. However, little is known about the impact of those images on Black women's sexuality and identity. The current study uses focus-group methodology to engage young adult Black in critical discussion of two predominant sexual scripts found in hip-hop music and Black-oriented reality television - the Freak and the Gold Digger. Analyses revealed shared and distinct aspects of each sexual script represented in both media and the impact of those scripts on participants' experiences. Implications for future research are discussed.

  12. Corporeidade e sexualidade em dançarinos de rua: axé e hip hop Bodyness and sexuality of street dancers: axé and hip hop

    Directory of Open Access Journals (Sweden)

    Fernando Luiz Cardoso

    2011-12-01

    Full Text Available Analisaram-se aspectos da corporeidade e sexualidade em dançarinos de hip hop e axé (35 homens e 49 mulheres comparativamente a indivíduos não-dançarinos expectadores da plateia (21 homens e 19 mulheres, via questionário anônimo. Os dançarinos de axé foram os mais satisfeitos com suas vidas sexuais, com as preliminares sexuais e os que mais gostavam de se masturbarem em relação aos de hip hop e plateia. Dançarinos do axé apresentaram uma sexualidade mais vinculada ao conhecimento corporal e conexões afetivas. Em ambos estilos, os dançarinos homens davam maior ênfase à genitália e a libido em relação aos aspectos da afetividade.We analyzed selected aspects of the bodyness and sexuality of hip hop and axé dancers (35 men and 49 women in comparison with non-dancer controls (21 men and 19 women through anonymous questionnaire. The axé dancers were the most satisfied with their sexual lives, with sexual preliminaries and who liked more to masturbate when compared with the hip hop dancers and controls. Axé dancers of both sexes presented a strong link between their sexuality and their corporal knowledge and affective connections. Men dancers were more focused in their genitals and gave stronger sexual emphasis to libido rather than affectivity.

  13. Auto-acetylation on K289 is not essential for HopZ1a-mediated plant defense suppression

    Directory of Open Access Journals (Sweden)

    Jose Sebastian Rufian

    2015-07-01

    Full Text Available The Pseudomonas syringae type III-secreted effector HopZ1a is a member of the HopZ / YopJ superfamily of effectors that triggers immunity in Arabidopsis. We have previously shown that HopZ1a suppresses both local (effector-triggered immunity, ETI and systemic immunity (systemic acquired resistance, SAR triggered by the heterologous effector AvrRpt2. HopZ1a has been shown to possess acetyltransferase activity, and this activity is essential to trigger immunity in Arabidopsis. HopZ1a acetyltransferase activity has been reported to require the auto-acetylation of the effector on a specific lysine (K289 residue. In this paper we analyze the relevance of autoacetylation of lysine residue 289 in HopZ1a ability to suppress plant defenses, and on the light of the results obtained, we also revise its relevance for HopZ1a avirulence activity. Our results indicate that, while the HopZ1aK289R mutant is impaired to some degree in its virulence and avirulence activities, is by no means phenotypically equivalent to the catalytically inactive HopZ1aC216A, since it is still able to trigger a defense response that induces detectable macroscopic HR and effectively protects Arabidopsis from infection, reducing growth of P. syringae within the plant. We also present evidence that the HopZ1aK289R mutant still displays virulence activities, partially suppressing both ETI and SAR.

  14. Hip-Hop--What's in It for the Academy? Self-Understanding, Pedagogy and Aesthetical Learning Processes in Everyday Cultural Praxis

    Science.gov (United States)

    Söderman, Johan; Sernhede, Ove

    2016-01-01

    Since hip-hop first appeared in New York over 35 years ago, it has been associated with social activism and education. Accordingly, it is not surprising that academic institutions in universities and K-12 schools are interested in hip-hop. In this article, we will highlight the "hip-hop academisation" and map out a new direction in a…

  15. "Words of Wisdom": An Expectancy-Value Examination of Relationships among Hip-Hop Racial Socialization and Racial Identity of African-American College Students

    Science.gov (United States)

    Gangloff-Bailey, Felicia

    2017-01-01

    The influence of hip hop culture and music on African-American youth is profound and can be used as a tool to shape positive outcomes in education. Hip hop has been used effectively in the classroom to engage students and enhance their critical thinking (Gangloff-Bailey & Freeman, 2014). In addition, hip hop has been described as a socializer…

  16. Single-Leg Hop Test Performance and Isokinetic Knee Strength After Anterior Cruciate Ligament Reconstruction in Athletes.

    Science.gov (United States)

    Sueyoshi, Ted; Nakahata, Akihiro; Emoto, Gen; Yuasa, Tomoki

    2017-11-01

    Isokinetic strength and hop tests are commonly used to assess athletes' readiness to return to sport after knee surgery. The purpose of this study was to investigate the results of single-leg hop and isokinetic knee strength testing in athletes who underwent anterior cruciate ligament reconstruction (ACLR) upon returning to sport participation as well as to study the correlation between these 2 test batteries. The secondary purpose was to compare the test results by graft type (patellar tendon or hamstring). It was hypothesized that there would be no statistically significant limb difference in either isokinetic knee strength or single-leg hop tests, that there would be a moderate to strong correlation between the 2 test batteries, and that there would be no significant difference between graft types. Cross-sectional study; Level of evidence, 3. Twenty-nine high school and collegiate athletes who underwent ACLR participated in this study. At the time of return to full sport participation, a series of hop tests and knee extension/flexion isokinetic strength measurements were conducted. The results were analyzed using analysis of variance and Pearson correlation ( r ). The timed 6-m hop test was the only hop test that showed a significant difference between the involved and uninvolved limbs (2.3 and 2.2 seconds, respectively; P = .02). A significant difference between limbs in knee strength was found for flexion peak torque/body weight at 180 deg/s ( P = .03), flexion total work/body weight at 180 deg/s ( P = .04), and flexion peak torque/body weight at 300 deg/s ( P = .03). The strongest correlation between the hop tests and knee strength was found between the total distance of the hop tests and flexion total work/body weight at 300 deg/s ( r = 0.69) and between the timed 6-m hop test and flexion peak torque/body weight at 300 deg/s ( r = -0.54). There was no statistically significant difference in hop test performance or isokinetic knee strength between graft types

  17. Improved Intelligent Underlay-Overlay Combined with Frequency Hopping in GSM

    DEFF Research Database (Denmark)

    Wigard, Jeroen; Nielsen, Thomas Toftegaard; Mogensen, Preben Elgaard

    1997-01-01

    IUO (intelligent underlay-overlay) in a combination with random frequency hopping in GSM is analysed. Several improvements to the original IUO concept analysed in Nielsen et al. (1997) are introduced. With the improved IUO concept it is possible to load a network configuration consisting of 4...

  18. Risk Assessment Using The Homeland-Defense Operational Planning System (HOPS)

    International Nuclear Information System (INIS)

    Durling, R L; Price, D E; Spero, K K

    2005-01-01

    For over ten years, the Counterproliferation Analysis and Planning System (CAPS) at Lawrence Livermore National Laboratory (LLNL) has been a planning tool used by U.S. combatant commands for mission support planning against foreign programs engaged in the manufacture of weapons of mass destruction (WMD). CAPS is endorsed by the Secretary of Defense as the preferred counterproliferation tool to be used by the nation's armed services. A sister system, the Homeland-Defense Operational Planning System (HOPS), is a new operational planning tool leveraging CAPS expertise designed to support the defense of the U.S. homeland. HOPS provides planners with a basis to make decisions to protect against acts of terrorism, focusing on the defense of facilities critical to U.S. infrastructure. Criticality of facilities, structures, and systems is evaluated on a composite matrix of specific projected casualty, economic, and sociopolitical impact bins. Based on these criteria, significant unidentified vulnerabilities are identified and secured. To provide insight into potential successes by malevolent actors, HOPS analysts strive to base their efforts mainly on unclassified open-source data. However, more cooperation is needed between HOPS analysts and facility representatives to provide an advantage to those whose task is to defend these facilities. Evaluated facilities include: refineries, major ports, nuclear power plants and other nuclear licensees, dams, government installations, convention centers, sports stadiums, tourist venues, and public and freight transportation systems. A generalized summary of analyses of U.S. infrastructure facilities will be presented

  19. Risk Assessment Using The Homeland-Defense Operational Planning System (HOPS)

    International Nuclear Information System (INIS)

    Price, D E; Durling, R L

    2005-01-01

    The Homeland-Defense Operational Planning System (HOPS), is a new operational planning tool leveraging Lawrence Livermore National Laboratory's expertise in weapons systems and in sparse information analysis to support the defense of the U.S. homeland. HOPS provides planners with a basis to make decisions to protect against acts of terrorism, focusing on the defense of facilities critical to U.S. infrastructure. Criticality of facilities, structures, and systems is evaluated on a composite matrix of specific projected casualty, economic, and sociopolitical impact bins. Based on these criteria, significant unidentified vulnerabilities are identified and secured. To provide insight into potential successes by malevolent actors, HOPS analysts strive to base their efforts mainly on unclassified open-source data. However, more cooperation is needed between HOPS analysts and facility representatives to provide an advantage to those whose task is to defend these facilities. Evaluated facilities include: refineries, major ports, nuclear power plants and other nuclear licensees, dams, government installations, convention centers, sports stadiums, tourist venues, and public and freight transportation systems. A generalized summary of analyses of U.S. infrastructure facilities will be presented

  20. Use of the Homeland-Defense Operational Planning System (HOPS) for Emergency Management

    International Nuclear Information System (INIS)

    Durling, Jr. R.L.; Price, D.E.

    2005-01-01

    The Homeland-Defense Operational Planning System (HOPS), is a new operational planning tool leveraging Lawrence Livermore National Laboratory's expertise in weapons systems and in sparse information analysis to support the defense of the U.S. homeland. HOPS provides planners with a basis to make decisions to protect against acts of terrorism, focusing on the defense of facilities critical to U.S. infrastructure. Criticality of facilities, structures, and systems is evaluated on a composite matrix of specific projected casualty, economic, and sociopolitical impact bins. Based on these criteria, significant unidentified vulnerabilities are identified and secured. To provide insight into potential successes by malevolent actors, HOPS analysts strive to base their efforts mainly on unclassified open-source data. However, more cooperation is needed between HOPS analysts and facility representatives to provide an advantage to those whose task is to defend these facilities. Evaluated facilities include: refineries, major ports, nuclear power plants and other nuclear licensees, dams, government installations, convention centers, sports stadiums, tourist venues, and public and freight transportation systems. A generalized summary of analyses of U.S. infrastructure facilities will be presented

  1. Vulnerability And Risk Assessment Using The Homeland-Defense Operational Planning System (HOPS)

    International Nuclear Information System (INIS)

    Durling, R.L. Jr.; Price, D.E.; Spero, K.K.

    2005-01-01

    For over ten years, the Counterproliferation Analysis and Planning System (CAPS) at Lawrence Livermore National Laboratory (LLNL) has been a planning tool used by U.S. combatant commands for mission support planning against foreign programs engaged in the manufacture of weapons of mass destruction (WMD). CAPS is endorsed by the Secretary of Defense as the preferred counterproliferation tool to be used by the nation's armed services. A sister system, the Homeland-Defense Operational Planning System (HOPS), is a new operational planning tool leveraging CAPS expertise designed to support the defense of the U.S. homeland. HOPS provides planners with a basis to make decisions to protect against acts of terrorism, focusing on the defense of facilities critical to U.S. infrastructure. Criticality of facilities, structures, and systems is evaluated on a composite matrix of specific projected casualty, economic, and sociopolitical impact bins. Based on these criteria, significant unidentified vulnerabilities are identified and secured. To provide insight into potential successes by malevolent actors, HOPS analysts strive to base their efforts mainly on unclassified open-source data. However, more cooperation is needed between HOPS analysts and facility representatives to provide an advantage to those whose task is to defend these facilities. Evaluated facilities include: refineries, major ports, nuclear power plants and other nuclear licensees, dams, government installations, convention centers, sports stadiums, tourist venues, and public and freight transportation systems. A generalized summary of analyses of U.S. infrastructure facilities is presented

  2. A feedback-retransmission based asynchronous frequency hopping MAC protocol for military aeronautical ad hoc networks

    Directory of Open Access Journals (Sweden)

    Jinhui TANG

    2018-05-01

    Full Text Available Attacking time-sensitive targets has rigid demands for the timeliness and reliability of information transmission, while typical Media Access Control (MAC designed for this application works well only in very light-load scenarios; as a consequence, the performances of system throughput and channel utilization are degraded. For this problem, a feedback-retransmission based asynchronous FRequency hopping Media Access (FRMA control protocol is proposed. Burst communication, asynchronous Frequency Hopping (FH, channel coding, and feedback retransmission are utilized in FRMA. With the mechanism of asynchronous FH, immediate packet transmission and multi-packet reception can be realized, and thus the timeliness is improved. Furthermore, reliability can be achieved via channel coding and feedback retransmission. With theories of queuing theory, Markov model, packets collision model, and discrete Laplace transformation, the formulas of packet success probability, system throughput, average packet end-to-end delay, and delay distribution are obtained. The approximation accuracy of theoretical derivation is verified by experimental results. Within a light-load network, the proposed FRMA has the ability of millisecond delay and 99% reliability as well as outperforms the non-feedback-retransmission based asynchronous frequency hopping media access control protocol. Keywords: Ad hoc networks, Aeronautical communications, Frequency hopping, Media Access Control (MAC, Time-sensitive

  3. Naija Hip Hop: An Analysis of the Music of 2Face Idibia | Oikelome ...

    African Journals Online (AJOL)

    In recent times, contemporary discourse on the analysis of popular music has taken the front burner. This is as a result of the growing trend of this genre in the stream of world music and the numerous awards being won by Nigerian hip hop artistes both at home and abroad. This paper examines the music of Innocent “2 ...

  4. Adaptation to partial resistance to powdery mildew in the hop cultivar Cascade by Podosphaera macularis

    Science.gov (United States)

    The hop cultivar Cascade has been grown in the Pacific Northwestern U.S. with minimal input for management of powdery mildew (Podosphaera macularis) for nearly 20 years due to the putatively quantitative resistance in this cultivar. While partial resistance is generally thought to be more durable th...

  5. Charge Energy Transport in Hopping Systems with Rapidly Decreasing Density of States

    Science.gov (United States)

    Mendels, Dan; Organic Electronics Group Technion Team

    2014-03-01

    An accurate description of the carrier hopping topology in the energy domain of hopping systems incorporating a rapidly decreasing density of states and the subsequent energetic position of these systems' so called effective conduction band is crucial for rationalizing and quantifying these systems' thermo-electric properties, doping related phenomena and carrier gradient effects such as the emergence of the General Einstein Relation under degenerate conditions. Additionally, as will be shown, the 'mobile' carriers propagating through the system can have excess energies reaching 0.3eV above the system quasi-Fermi energy. Hence, since these mobile carriers are most prone to reach systems interfaces and interact with oppositely charged carriers, their excess energy should be considered in determining the efficiencies of energy dependent processes such as carrier recombination and exciton dissociation. In light of the stated motivations, a comprehensive numerical and analytical study of the topology of hopping in the energetic density of such systems (i.e. the statistics regarding which energy values carriers visit most and in what manner) was implemented and the main statistical features of the hopping process that determine the position in energy of the system's effective conduction band were distilled. The obtained results also help shed light on yet to be elucidated discrepancies between predictions given by the widely employed transport energy concept and Monte Carlo simulations.

  6. Effect of storage on the brewing properties of tropical hop substitutes ...

    African Journals Online (AJOL)

    Tropical hop substitute from utazi (UTZ) Gongronema latifolium, bitter cola (BTC), Garcinia kola, bitter leaf (BTL), Vernonia amygdalina and a blend (1:1.41:2.89) of the three (HSB) respectively, were produced. Stability studies were carried out to predict their suitability for brewing after one to six months storage at 5 ± 1oC ...

  7. Wireless three-hop networks with stealing II : exact solutions through boundary value problems

    NARCIS (Netherlands)

    Guillemin, F.; Knessl, C.; Leeuwaarden, van J.S.H.

    2013-01-01

    We study the stationary distribution of a random walk in the quarter plane arising in the study of three-hop wireless networks with stealing. Our motivation is to find exact tail asymptotics (beyond logarithmic estimates) for the marginal distributions, which requires an exact solution for the

  8. Pistachio (Pistacia vera L.) is a new natural host of Hop stunt viroid.

    Science.gov (United States)

    Elleuch, Amine; Hamdi, Imen; Ellouze, Olfa; Ghrab, Mohamed; Fkahfakh, Hatem; Drira, Noureddine

    2013-10-01

    Besides hop, Hop stunt viroid (HpSVd) infects many woody species including grapevine, citrus, peach, plum, apricot, almond, pomegranate, mulberry and jujube. Here, we report the first detection of HpSVd in pistachio (Pistacia vera L.). Samples corresponding to 16 pistachio cultivars were obtained from a nearby almond collection. From these samples, low molecular weight RNAs were extracted for double polyacrylamide gel electrophoresis, northern-blot analysis and reverse transcription polymerase chain reaction assays. HpSVd was detected in 4 of the 16 pistachio cultivars in the first year and in 6 in the second, being also detected in the almond collection. Examination of the nucleotide sequences of pistachio and almond isolates revealed 13 new sequence variants. Sequences from pistachio shared 92-96 % similarity with the first reported HpSVd sequence (GenBank X00009), and multiple alignment and phylogenetic analyses showed that one pistachio isolate (HpSVdPis67Jabari) clustered with the plum group, whereas all the others clustered with the hop, and the recombinants plum-citrus and plum-Hop/cit3 groups. By identifying pistachio as a new natural host, we confirm that HpSVd is an ubiquitous and genetically variable viroid that infects many different fruit trees cultivated worldwide.

  9. A performance study of two hop transmission in mixed underlay RF and FSO fading channels

    KAUST Repository

    Ansari, Imran Shafique; Abdallah, Mohamed M.; Alouini, Mohamed-Slim; Qaraqe, Khalid A.

    2014-01-01

    In this work, we present the performance analysis of a dual-hop transmission system composed of asymmetric radio frequency (RF) and free-space optical (FSO) links in underlay cognitive networks. For the RF link, we consider an underlay cognitive

  10. An implementation of traffic light system using multi-hop Ad hoc networks

    KAUST Repository

    Ansari, Imran Shafique

    2009-01-01

    as a router, since routes are mostly multi-hop, due to the limited power transmission set by government agencies, (e.g. the Federal Communication Commission (FCC), which is 1 Watt in Industrial Scientific and Medical (ISM) band. The natures of wireless

  11. Design and Dynamics Analysis of a Bio-Inspired Intermittent Hopping Robot for Planetary Surface Exploration

    Directory of Open Access Journals (Sweden)

    Long Bai

    2012-10-01

    Full Text Available A small, bio-inspired and minimally actuated intermittent hopping robot for planetary surface exploration is proposed in this paper. The robot uses a combined-geared six-bar linkage/spring mechanism, which has a possible rich trajectory and metamorphic characteristics and, due to this, the robot is able to recharge, lock/release and jump by using just a micro-power motor as the actuator. Since the robotic system has a closed-chain structure and employs underactuated redundant motion, the constrained multi-body dynamics are derived with time-varying driving parameters and ground unilateral constraint both taken into consideration. In addition, the established dynamics equations, mixed of higher order differential and algebraic expressions, are solved by the immediate integration algorithm. A prototype is implemented and experiments are carried out. The results show that the robot, using a micro-power motor as the actuator and solar cells as the power supply, can achieve a biomimetic multi-body hopping stance and a nonlinearly increasing driving force. Typically, the robot can jump a horizontal distance of about 1 m and a vertical height of about 0.3 m, with its trunk and foot moving stably during takeoff. In addition, the computational and experimental results are consistent as regards the hopping performance of the robot, which suggests that the proposed dynamics model and its solution have general applicability to motion prediction and the performance analysis of intermittent hopping robots.

  12. Elimination of hop latent viroid upon developmental activation of pollen nucleases

    Czech Academy of Sciences Publication Activity Database

    Matoušek, Jaroslav; Orctová, Lidmila; Škopek, Josef; Pešina, Karel; Steger, G.

    2008-01-01

    Roč. 389, č. 7 (2008), s. 905-918 ISSN 1431-6730 R&D Projects: GA AV ČR(CZ) 1QS500510558; GA ČR GA521/06/1149 Institutional research plan: CEZ:AV0Z50510513 Keywords : hop latent viroid * elimination Subject RIV: EE - Microbiology, Virology Impact factor: 3.035, year: 2008

  13. Structure and DNA-binding of meiosis-specific protein Hop2

    Science.gov (United States)

    Zhou, Donghua; Moktan, Hem; Pezza, Roberto

    2014-03-01

    Here we report structure elucidation of the DNA binding domain of homologous pairing protein 2 (Hop2), which is important to gene diversity when sperms and eggs are produced. Together with another protein Mnd1, Hop2 enhances the strand invasion activity of recombinase Dmc1 by over 30 times, facilitating proper synapsis of homologous chromosomes. However, the structural and biochemical bases for the function of Hop2 and Mnd1 have not been well understood. As a first step toward such understanding, we recently solved the structure for the N-terminus of Hop2 (1-84) using solution NMR. This fragment shows a typical winged-head conformation with recognized DNA binding activity. DNA interacting sites were then investigated by chemical shift perturbations in a titration experiment. Information of these sites was used to guide protein-DNA docking with MD simulation, revealing that helix 3 is stably lodged in the DNA major groove and that wing 1 (connecting strands 2 and 3) transiently comes in contact with the minor groove in nanosecond time scale. Mutagenesis analysis further confirmed the DNA binding sites in this fragment of the protein.

  14. From Rhymes to Resistance: Hip-Hop as a Critical Lens in Promoting Socially Just Teaching

    Science.gov (United States)

    Shelby-Caffey, Crystal; Byfield, Lavern; Solbrig, Stephanie

    2018-01-01

    If an educator is to take a critical stance, teach students to do the same, and design lessons that engage students in thoughtful discussions and actions surrounding issues of social justice, then discussions of politics, race, culture, economics and systems of power are crucial to this work, and the use of hip-hop is a worthwhile endeavour. In…

  15. Youth Perspectives on the Intersections of Violence, Gender, and Hip-Hop

    Science.gov (United States)

    Hernandez, Diana; Weinstein, Hannah; Munoz-Laboy, Miguel

    2012-01-01

    Youth's perceptions of violence within their social environments can provide relevant insights into the gender-based interpersonal violence epidemic in inner-city communities. To explore this issue, we examined two sets of narratives with young men and women, aged 15 to 21, involved in hip-hop culture in New York City. In the analysis, we reveal…

  16. Pharmacological profile of Xanthohumol, a Prenylated Flavonoid from Hops (Humulus lupulus)

    DEFF Research Database (Denmark)

    Liu, Ming; Hansen, Poul Erik; Wang, Genzhu

    2015-01-01

    The female inflorescences of hops (Humulus lupulus L.), a well-known bittering agent used in the brewing industry, have long been used in traditional medicines. Xanthohumol (XN) is one of the bioactive substances contributing to its medical applications. Among foodstuffs XN is found primarily in ...

  17. Uudised : Muusikal Lennonist kukkus läbi. Erkki Otsman. Hip-hop

    Index Scriptorium Estoniae

    2005-01-01

    Don Scardino lavastatud John Lennoni elu ja heliloomingu pinnalt sündinud muusikali etendamisest Ameerikas. Erkki Otsmani esinemisest 24. sept. Euroopa keelte päeva raames Krakovis. Los Angelese hip-hop-muusika plaadifirma Stones Throw sügisene Euroopa-turnee sel nädalal Tallinnas: Rock Café's 24. sept. esinevad MCd Wildchild, Declaime ja MED

  18. Crossover from quantum tunneling to classical hopping of domain walls in ferromagnets

    Science.gov (United States)

    Zhou, Bin; Liang, Jiu-Qing; Pu, Fu-Cho

    2001-09-01

    In the model of quantum tunneling of domain walls in ferromagnets given by Chudnovsky et al., the crossover from quantum tunneling to classical hopping is investigated. Considering the periodical boundary condition of spatial coordinate, the type of transition depends critically on the length of ferromagnet along the Y-axis.

  19. Robust segmentation of medical images using competitive hop field neural network as a clustering tool

    International Nuclear Information System (INIS)

    Golparvar Roozbahani, R.; Ghassemian, M. H.; Sharafat, A. R.

    2001-01-01

    This paper presents the application of competitive Hop field neural network for medical images segmentation. Our proposed approach consists of Two steps: 1) translating segmentation of the given medical image into an optimization problem, and 2) solving this problem by a version of Hop field network known as competitive Hop field neural network. Segmentation is considered as a clustering problem and its validity criterion is based on both intra set distance and inter set distance. The algorithm proposed in this paper is based on gray level features only. This leads to near optimal solutions if both intra set distance and inter set distance are considered at the same time. If only one of these distances is considered, the result of segmentation process by competitive Hop field neural network will be far from optimal solution and incorrect even for very simple cases. Furthermore, sometimes the algorithm receives at unacceptable states. Both these problems may be solved by contributing both in tera distance and inter distances in the segmentation (optimization) process. The performance of the proposed algorithm is tested on both phantom and real medical images. The promising results and the robustness of algorithm to system noises show near optimal solutions

  20. Characterization of resistance to powdery mildew in the Hop cultivars Newport and Comet

    Science.gov (United States)

    Hop powdery mildew, caused by Podosphaera macularis, is an important disease in the Northwestern U.S. Outbreaks of powdery mildew on cultivars previously resistant to the disease have been reported increasingly with the emergence of virulent pathogen strains capable of overcoming a commonly deployed...

  1. Mortality in American Hip-Hop and Rap Recording Artists, 1987-2014.

    Science.gov (United States)

    Lawson, Carl J

    2015-12-01

    The deaths of American hip-hop and rap recording artists often receive considerable media attention. However, these artists' deaths have not been examined as a distinct group like the deaths of rock, classical, jazz, and pop music artists. This is a seminal epidemiological analysis on the deaths of an understudied group, American hip-hop and rap music recording artists. Media reports were analyzed of the deaths of American hip-hop and rap music recording artists that occurred from January 1, 1987 to December 31, 2014. The decedents' age, sex, race, cause of death, stage names, and city and state of death were recorded for analysis. The most commonly reported cause of death was homicide. The 280 deaths were categorized as homicide (55%), unintentional injury (13%), cardiovascular (7%), undetermined/undisclosed (7%), cancer (6%), other (5%), suicide (4%), and infectious disease (3%). The mean reported age at death was 30 yrs (range 15-75) and the median was 29 yrs; 97% were male and 92% were black. All but one of the homicides were committed with firearms. Homicide was the most commonly reported cause of death. Public health focus and guidance for hip-hop and rap recording artists should mirror that for African-American men and adolescent males ages 15-54 yrs, for whom the leading causes of death are homicide, unintentional injury, and heart disease. Given the preponderance of homicide deaths in this analysis, premature mortality reduction efforts should focus on violence prevention and conflict mitigation.

  2. Hip-Hop, Digital Media, and the Changing Face of Music Education

    Science.gov (United States)

    Thibeault, Matthew D.

    2010-01-01

    In this article, the author describes a true story about Dwayne Carter Jr., a rapper most music educators probably don't know but one who is beloved throughout the world as "Lil Wayne." Critics overwhelmingly proclaimed Lil Wayne the top rapper in the hip-hop game, and the album and his work leading up to it were universally regarded as some of…

  3. Rap as the language of conflict in hip-hop subculture

    Directory of Open Access Journals (Sweden)

    Т М Кожелупенко

    2008-12-01

    Full Text Available This article is devoted to such notions of sociolinguistics as subculture and the language of conflict. These aspects are studied by the example of the rapidly developing hip-hop subculture and rap-texts as its main component.

  4. Students' Informal Inference about the Binomial Distribution of "Bunny Hops": A Dialogic Perspective

    Science.gov (United States)

    Kazak, Sibel; Fujita, Taro; Wegerif, Rupert

    2016-01-01

    The study explores the development of 11-year-old students' informal inference about random bunny hops through student talk and use of computer simulation tools. Our aim in this paper is to draw on dialogic theory to explain how students make shifts in perspective, from intuition-based reasoning to more powerful, formal ways of using probabilistic…

  5. An efficient solution to the decoherence enhanced trivial crossing problem in surface hopping

    Science.gov (United States)

    Bai, Xin; Qiu, Jing; Wang, Linjun

    2018-03-01

    We provide an in-depth investigation of the time interval convergence when both trivial crossing and decoherence corrections are applied to Tully's fewest switches surface hopping (FSSH) algorithm. Using one force-based and one energy-based decoherence strategies as examples, we show decoherence corrections intrinsically enhance the trivial crossing problem. We propose a restricted decoherence (RD) strategy and incorporate it into the self-consistent (SC) fewest switches surface hopping algorithm [L. Wang and O. V. Prezhdo, J. Phys. Chem. Lett. 5, 713 (2014)]. The resulting SC-FSSH-RD approach is applied to general Hamiltonians with different electronic couplings and electron-phonon couplings to mimic charge transport in tens to hundreds of molecules. In all cases, SC-FSSH-RD allows us to use a large time interval of 0.1 fs for convergence and the simulation time is reduced by over one order of magnitude. Both the band and hopping mechanisms of charge transport have been captured perfectly. SC-FSSH-RD makes surface hops in the adiabatic representation and can be implemented in both diabatic and locally diabatic representations for wave function propagation. SC-FSSH-RD can potentially describe general nonadiabatic dynamics of electrons and excitons in organics and other materials.

  6. A Stochastic Geometry Model for Multi-hop Highway Vehicular Communication

    KAUST Repository

    Farooq, Muhammad Junaid

    2015-11-19

    Carrier sense multiple access (CSMA) protocol is standardized for vehicular communication to ensure a distributed and efficient communication between vehicles. However, several vehicular applications require efficient multi-hop information dissemination. This paper exploits stochastic geometry to develop a tractable and accurate modeling framework to characterize the multi-hop transmissions for vehicular networks in a multi-lane highway setup. In particular, we study the tradeoffs between per-hop packet forward progress, per-hop transmission success probability, and spatial frequency reuse (SFR) efficiency imposed by different packet forwarding schemes, namely, most forward with fixed radius (MFR), the nearest with forward progress (NFP), and the random with forward progress (RFP). We also define a new performance metric, denoted as the aggregate packet progress (APP), which is a dimensionless quantity that captures the aforementioned tradeoffs. To this end, the developed model reveals the interplay between the spectrum sensing threshold (th) of the CSMA protocol and the packet forwarding scheme. Our results show that, in contrary to ALOHA networks which always favor NFP, MFR may achieve the highest APP in CSMA networks if th is properly chosen.

  7. Ultra-high-performance liquid chromatography profiling method for chemical screening of proanthocyanidins in Czech hops

    Czech Academy of Sciences Publication Activity Database

    Olšovská, J.; Kameník, Zdeněk; Čejka, P.; Jurková, M.; Mikyška, A.

    2013-01-01

    Roč. 116, NOV (2013), s. 919-926 ISSN 0039-9140 R&D Projects: GA MŠk(CZ) EE2.3.30.0003 Institutional support: RVO:61388971 Keywords : Flavan-3-ol * Catechin * Hops Subject RIV: CB - Analytical Chemistry, Separation Impact factor: 3.511, year: 2013

  8. Link and route availability for Inter-working multi-hop wireless networks

    CSIR Research Space (South Africa)

    Salami, O

    2009-09-01

    Full Text Available pairs in inter-working multi-hop wireless networks can be evaluated based on the availability and reliability of radio links that form the communication path linking the nodes. This paper presents an analytical study of the link and route availability...

  9. Throughput Analysis on 3-Dimensional Underwater Acoustic Network with One-Hop Mobile Relay

    Science.gov (United States)

    Zhong, Xuefeng; Fan, Jiasheng; Guan, Quansheng; Ji, Fei; Yu, Hua

    2018-01-01

    Underwater acoustic communication network (UACN) has been considered as an essential infrastructure for ocean exploitation. Performance analysis of UACN is important in underwater acoustic network deployment and management. In this paper, we analyze the network throughput of three-dimensional randomly deployed transmitter–receiver pairs. Due to the long delay of acoustic channels, complicated networking protocols with heavy signaling overhead may not be appropriate. In this paper, we consider only one-hop or two-hop transmission, to save the signaling cost. That is, we assume the transmitter sends the data packet to the receiver by one-hop direct transmission, or by two-hop transmission via mobile relays. We derive the closed-form formulation of packet delivery rate with respect to the transmission delay and the number of transmitter–receiver pairs. The correctness of the derivation results are verified by computer simulations. Our analysis indicates how to obtain a precise tradeoff between the delay constraint and the network capacity. PMID:29337911

  10. Development of partial ontogenic resistance to powdery mildew in Hop cones and its management implications

    Science.gov (United States)

    Knowledge of processes leading to crop damage is central to devising rational approaches to disease management. Multiple experiments established that infection of hop cones by Podosphaera macularis was most severe if inoculation occurred within 15 to 21 days after bloom. This period of infection was...

  11. Infestation of hop seed (Humulus lupulus) by chasmothecia of the powdery mildew fungus, Podosphaera macularis

    Science.gov (United States)

    Powdery mildew is responsible for large economic losses in hop in the primary production regions of the crop in the Pacific Northwestern U.S. (Gent et al. 2008). Podosphaera macularis is heterothallic, but to date only the MAT1-1 mating type has been confirmed in the Pacific Northwest (Wolfenbarger...

  12. Powdery mildew caused by Podosphaera macularis on hop (Humulus lupulus) in North Carolina

    Science.gov (United States)

    In June 2015, a grower in western North Carolina detected powdery mildew in a small hop yard. Characteristic colonies of the pathogen where observed on cultivars Cashmere, Cascade, and Chinook. Leaves with powdery mildew were collected from cultivar Cashmere for confirmation of the pathogen identi...

  13. Analysis of the trajectory surface hopping method from the Markov state model perspective

    International Nuclear Information System (INIS)

    Akimov, Alexey V.; Wang, Linjun; Prezhdo, Oleg V.; Trivedi, Dhara

    2015-01-01

    We analyze the applicability of the seminal fewest switches surface hopping (FSSH) method of Tully to modeling quantum transitions between electronic states that are not coupled directly, in the processes such as Auger recombination. We address the known deficiency of the method to describe such transitions by introducing an alternative definition for the surface hopping probabilities, as derived from the Markov state model perspective. We show that the resulting transition probabilities simplify to the quantum state populations derived from the time-dependent Schrödinger equation, reducing to the rapidly switching surface hopping approach of Tully and Preston. The resulting surface hopping scheme is simple and appeals to the fundamentals of quantum mechanics. The computational approach is similar to the FSSH method of Tully, yet it leads to a notably different performance. We demonstrate that the method is particularly accurate when applied to superexchange modeling. We further show improved accuracy of the method, when applied to one of the standard test problems. Finally, we adapt the derived scheme to atomistic simulation, combine it with the time-domain density functional theory, and show that it provides the Auger energy transfer timescales which are in good agreement with experiment, significantly improving upon other considered techniques. (author)

  14. Interaction and dynamics of homologous pairing protein 2 (HOP2) and DNA studied by MD simulation

    Science.gov (United States)

    Moktan, Hem; Pezza, Roberto; Zhou, Donghua

    2015-03-01

    The homologous pairing protein 2 (Hop2) plays an important role in meiosis and DNA repair. Together with protein Mnd1, Hop2 enhances the strand invasion activity of recombinase Dmc1 by over 30 times, facilitating proper synapsis of homologous chromosomes. We recently determined the NMR structure of the N-terminal domain of Hop2 and proposed a model of Protein-DNA complex based on NMR chemical shift perturbations and mutagenesis studies (Moktan, J Biol Chem 2014 10.1074/jbc.M114.548180). However structure and dynamics of the complex have not been studied at the atomic level yet. Here, we used classical MD simulations to study the interactions between the N-terminal HOP2 and DNA. The simulated results indicate that helix3 (H3) interacts with DNA in major groove and wing1 (W1) interacts mostly in minor groove mainly via direct hydrogen bonds. Also it is found that binding leads to reduced fluctuations in both protein and DNA. Several water bridge interactions have been identified. The residue-wise contributions to the interaction energy were evaluated. Also the functional motion of the protein is analyzed using principal component analysis. The results confirmed the importance of H3 and W1 for the stability of the complex, which is consistent with our previous experimental studies.

  15. Toward quantitative prediction of charge mobility in organic semiconductors: tunneling enabled hopping model.

    Science.gov (United States)

    Geng, Hua; Peng, Qian; Wang, Linjun; Li, Haijiao; Liao, Yi; Ma, Zhiying; Shuai, Zhigang

    2012-07-10

    A tunneling-enabled hopping mechanism is proposed, providing a pratical tool to quantitatively assess charge mobility in organic semiconductors. The paradoxical phenomena in TIPS-pentacene is well explained in that the optical probe indicates localized charges while transport measurements show bands of charge. Copyright © 2012 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  16. Deep-sequencing revealed Citrus bark cracking viroid (CBCVd) as a highly aggressive pathogen on hop

    Czech Academy of Sciences Publication Activity Database

    Jakše, J.; Radišek, S.; Pokorn, T.; Matoušek, Jaroslav; Javornik, B.

    2015-01-01

    Roč. 64, č. 4 (2015), s. 831-842 ISSN 0032-0862 R&D Projects: GA MŠk(CZ) LH14255 Institutional support: RVO:60077344 Keywords : Bioinformatic * Citrus bark cracking viroid * Hop * Next-generation sequencing Subject RIV: EB - Genetics ; Molecular Biology Impact factor: 2.383, year: 2015

  17. Analysis of route availability in inter-working multi-hop wireless networks

    CSIR Research Space (South Africa)

    Salami, O

    2009-07-01

    Full Text Available In order to link a source-destination node pair in inter-working multi-hop wireless networks, links or routes must first be available. It is only after establishing the availability of links and routes between nodes that factors which affect...

  18. Media/Visual Literacy Art Education: Sexism in Hip-Hop Music Videos

    Science.gov (United States)

    Chung, Sheng Kuan

    2007-01-01

    Media programs like hip-hop music videos are powerful aesthetic agents that inspire teenagers. Thus, they have tremendous influence on young people's identity formation, lifestyle choices, and knowledge construction which are manifested in the ways teens dress, express themselves, behave, and interact with each other. However, because of the…

  19. Low-Complexity Combining Schemes in Dual-Hop AF Relaying Systems

    KAUST Repository

    Gaaloul, Fakhreddine; Alouini, Mohamed-Slim; Radaydeh, Redha M.

    2011-01-01

    This paper investigates the performance of different low-complexity combining schemes in the context of dual-hop amplify-and-forward (AF) relaying networks. It is assumed that the relay uses single transmit (receive) antenna due to space limitation

  20. Comparison of Low-Complexity Diversity Schemes for Dual-Hop AF Relaying Systems

    KAUST Repository

    Gaaloul, Fakhreddine; Alouini, Mohamed-Slim; Radaydeh, Redha M.

    2012-01-01

    This paper investigates the performance of two low-complexity combining schemes, which are based on one- or two-phase observation, to mitigate multipath fading in dual-hop amplify-and-forward relaying systems. For the one-phase-based combining, a

  1. All-electronic suppression of mode hopping noise in diode lasers

    DEFF Research Database (Denmark)

    Bager, L.

    1990-01-01

    A simple all-electronic stabilization scheme is presented for suppression of external-cavity mode-hopping noise in diode lasers. This excess noise is generated when the laser is subjected to optical feedback and may degrade the overall performance of optical systems including sensors. Suppression...

  2. Performance Analysis of Mixed Nakagami- m and Gamma–Gamma Dual-Hop FSO Transmission Systems

    KAUST Repository

    Zedini, Emna; Ansari, Imran Shafique; Alouini, Mohamed-Slim

    2015-01-01

    In this paper, we carry out a unified performance analysis of a dual-hop relay system over the asymmetric links composed of both radio-frequency (RF) and unified free-space optical (FSO) links under the effect of pointing errors. Both fixed

  3. Spatial reuse of wireless medium in multi-hop wireless sensor networks

    NARCIS (Netherlands)

    Geerlings, J.; Geerlings, J.; van Hoesel, L.F.W.; Hoeksema, F.W.; Slump, Cornelis H.; Havinga, Paul J.M.

    2007-01-01

    The idea of multi-hop communication originates from the 1990’s and is eagerly incorporated in the wireless sensor network research field, since a tremendous amount of energy can be saved by letting —often battery powered– nodes in the network assist each other in forwarding packets. In such systems

  4. Characterization of the Migration of Hop Volatiles into Different Crown Cork Liner Polymers and Can Coatings.

    Science.gov (United States)

    Wietstock, Philip C; Glattfelder, Richard; Garbe, Leif-Alexander; Methner, Frank-Jürgen

    2016-04-06

    Absorption of hop volatiles by crown cork liner polymers and can coatings was investigated in beer during storage. All hop volatiles measured were prone to migrate into the closures, and the absorption kinetics was demonstrated to fit Fick's second law of diffusion well for a plane sheet. The extent and rate of diffusion were significantly dissimilar and were greatly dependent upon the nature of the volatile. Diffusion coefficients ranged from 1.32 × 10(-5) cm(2)/day (limonene) to 0.26 × 10(-5) cm(2)/day (α-humulene). The maximum amounts absorbed into the material at equilibrium were in the following order: limonene > α-humulene > trans-caryophyllene > myrcene ≫ linalool > α-terpineol > geraniol. With the application of low-density polyethylene (LDPE) liners with oxygen-scavenging functionality, oxygen-barrier liners made up from high-density polyethylene (HDPE) or liner polymers from a different manufacturer had no significant effect on the composition of hop volatiles in beers after prolonged storage of 55 days; however, significantly higher amounts of myrcene and limonene were found in the oxygen-barrier-type crown cork, while all other closures behaved similarly. Can coatings were demonstrated to absorb hop volatiles in a similar pattern as crown corks but to a lesser extent. Consequently, significantly higher percentages of myrcene were found in the beers.

  5. Effect of doping Ca on polaron hopping in LaSr 2 Mn 2 O 7

    Indian Academy of Sciences (India)

    ... Lecture Workshops · Refresher Courses · Symposia · Live Streaming. Home; Journals; Pramana – Journal of Physics; Volume 58; Issue 5-6. Effect of doping Ca on polaron hopping in LaSr2Mn2O7. S N Bhatia Osama A Yassin. Colossal Magnetoresistance & Other Materials Volume 58 Issue 5-6 May-June 2002 pp 1061- ...

  6. Translingualism, Kenyan Hip-Hop and Emergent Ethnicities: Implications for Language Theory and Pedagogy

    Science.gov (United States)

    Milu, Esther

    2018-01-01

    This article reports on preliminary findings of three prominent Kenyan hip-hop artists, Jua Cali, Abbas Kubaff, and Nazizi Hirji, as they theorize and construct emergent ethnicities vis-à-vis their translingual practices. Using in-depth phenomenological interviews, observations of their everyday language use, and analysis of their language choices…

  7. Pedagogical Ideas on Sonic, Mediated, and Virtual Musical Landscapes: Teaching Hip Hop in a University Classroom

    Science.gov (United States)

    Dhokai, Niyati

    2012-01-01

    Based on the experience of teaching the history of American hip hop music to a classroom of Canadian university students, the author considers the disjuncture between the cultural orientations of herself and her students. The author considers teaching methods to solve the place-based disjuncture that often occurs when teaching genres such as hip…

  8. "Folkbildning" through Hip-Hop: How the Ideals of Three Rappers Parallel a Scandinavian Educational Tradition

    Science.gov (United States)

    Soderman, Johan

    2011-01-01

    The purpose of this article is to show how the rappers' talk about hip-hop and its connection to pedagogy and social activism parallel the Scandinavian tradition of folkbildning. Scandinavian folkbildning can be seen as a movement to provide voluntary education for the general population. It can also be the name of the process of learning in which…

  9. Abortion and contemporary hip-hop: a thematic analysis of lyrics from 1990-2015.

    Science.gov (United States)

    Premkumar, Ashish; Brown, Katherine; Mengesha, Biftu; Jackson, Andrea V

    2017-07-01

    To evaluate the representation of abortion in contemporary hip-hop music, gaining insight into the myriad of attitudes of abortion in the black community. We used Genius, an online storehouse for lyrical content, to identify songs by querying the database for search terms related to family planning, including slang terms. We then cross-referenced identified songs using an online list of songs about abortion. We analyzed eligible songs using grounded theory in order to identify key themes. Of 6577 songs available, a total of 101 songs performed by 122 individual artists met inclusion criteria. The majority of artists were Black men; five artists were Black women. Key themes were: use of abortion as braggadocio; equating abortion with sin, genocide, or murder; male pressure for women to seek abortion; and the specific association of Planned Parenthood services with abortion. The moral and ethical themes surrounding abortion in hip-hop lyrics reveal a unique perspective within a marginalized community. The overall negative context of abortion in hip-hop lyrics needs to be reconciled with the gendered, economic, historical, political, racial and ethnic background of hip-hop and rap music in America. This study is the first to evaluate lyrical content from contemporary popular music in relation to abortion and family planning. Examining the intersection of reproductive rights and popular culture can provide a unique insight into the limited knowledge of the perspectives of abortion in the black community. Copyright © 2017 Elsevier Inc. All rights reserved.

  10. A Ratchet Lens: Black Queer Youth, Agency, Hip Hop, and the Black Ratchet Imagination

    Science.gov (United States)

    Love, Bettina L.

    2017-01-01

    This article explores the utilization of the theory of a Black ratchet imagination as a methodological perspective to examine the multiple intersections of Black and queer identity constructions within the space of hip hop. In particular, I argue for the need of a methodological lens that recognizes, appreciates, and struggles with the fluidity,…

  11. Critical Multimodal Hip Hop Production: A Social Justice Approach to African American Language and Literacy Practices

    Science.gov (United States)

    Turner, K. C. Nat; Hayes, Nini, Visaya; Way, Kate

    2013-01-01

    This article features key findings from a study that highlights the transformative impact of a pedagogical approach that employs Critical Multimodal Hip Hop Production (CMHHP). The study took place in an extended day program in a northern California public middle school among a group of 30, urban, African American, Chicano/a/Latino/a, and Asian…

  12. Global Ill-Literacies: Hip Hop Cultures, Youth Identities, and the Politics of Literacy

    Science.gov (United States)

    Alim, H. Samy

    2011-01-01

    This article focuses on the emergence of what the author refers to as "global ill-literacies," that is, the hybrid, transcultural linguistic and literacy practices of Hip Hop youth in local and global contexts, as well as the pedagogical possibilities that scholars open up as they engage these forms. By reviewing a broad but focused range of…

  13. Sampling Memories: Using Hip-Hop Aesthetics to Learn from Urban Schooling Experiences

    Science.gov (United States)

    Petchauer, Emery

    2012-01-01

    This article theorizes and charts the implementation of a learning activity designed from the hip-hop aesthetic of sampling. The purpose of this learning activity was to enable recent urban school graduates to reflect upon their previous schooling experiences as a platform for future learning in higher education. This article illustrates what…

  14. You know what it is: learning words through listening to hip-hop.

    Directory of Open Access Journals (Sweden)

    Paula Chesley

    Full Text Available Music listeners have difficulty correctly understanding and remembering song lyrics. However, results from the present study support the hypothesis that young adults can learn African-American English (AAE vocabulary from listening to hip-hop music. Non-African-American participants first gave free-response definitions to AAE vocabulary items, after which they answered demographic questions as well as questions addressing their social networks, their musical preferences, and their knowledge of popular culture. Results from the survey show a positive association between the number of hip-hop artists listened to and AAE comprehension vocabulary scores. Additionally, participants were more likely to know an AAE vocabulary item if the hip-hop artists they listen to use the word in their song lyrics. Together, these results suggest that young adults can acquire vocabulary through exposure to hip-hop music, a finding relevant for research on vocabulary acquisition, the construction of adolescent and adult identities, and the adoption of lexical innovations.

  15. Cultivating the Spatial Politics of Community-Based Literacy Practices in Hip-Hop

    Science.gov (United States)

    Prier, Darius D.

    2013-01-01

    In this article, the social imagination of community-based sites of urban resistance enable out-of-school literacy practices in Black popular culture to foreground the contemporary context in which youth empowerment is nurtured in out-of-school learning settings. Second, the author chronicles how youth advocates in hip-hop--based community…

  16. Throughput Analysis on 3-Dimensional Underwater Acoustic Network with One-Hop Mobile Relay.

    Science.gov (United States)

    Zhong, Xuefeng; Chen, Fangjiong; Fan, Jiasheng; Guan, Quansheng; Ji, Fei; Yu, Hua

    2018-01-16

    Underwater acoustic communication network (UACN) has been considered as an essential infrastructure for ocean exploitation. Performance analysis of UACN is important in underwater acoustic network deployment and management. In this paper, we analyze the network throughput of three-dimensional randomly deployed transmitter-receiver pairs. Due to the long delay of acoustic channels, complicated networking protocols with heavy signaling overhead may not be appropriate. In this paper, we consider only one-hop or two-hop transmission, to save the signaling cost. That is, we assume the transmitter sends the data packet to the receiver by one-hop direct transmission, or by two-hop transmission via mobile relays. We derive the closed-form formulation of packet delivery rate with respect to the transmission delay and the number of transmitter-receiver pairs. The correctness of the derivation results are verified by computer simulations. Our analysis indicates how to obtain a precise tradeoff between the delay constraint and the network capacity.

  17. Self-Organization Scheme for Balanced Routing in Large-Scale Multi-Hop Networks

    DEFF Research Database (Denmark)

    Badiu, Mihai Alin; Saad, David; Coon, Justin P.

    2018-01-01

    We propose a self-organization scheme for cost-effective and load-balanced routing in multi-hop networks. To avoid overloading nodes that provide favourable routing conditions, we assign each node with a cost function that penalizes high loads. Thus, finding routes to sink nodes is formulated...

  18. An analytical model for the performance of geographical multi-hop broadcast

    NARCIS (Netherlands)

    Klein Wolterink, W.; Heijenk, G.; Berg, J.L. van den

    2012-01-01

    In this paper we present an analytical model accurately describing the behaviour of a multi-hop broadcast protocol. Our model covers the scenario in which a message is forwarded over a straight road and inter-node distances are distributed exponentially. Intermediate forwarders draw a small random

  19. Adaptive Demand-Driven Multicast Routing in Multi-Hop Wireless Ad Hoc Networks

    National Research Council Canada - National Science Library

    Jetcheva, Jorjeta G

    2004-01-01

    ...) nodes that wish to communicate. Each node in the ad hoc network acts as a router and forwards packets on behalf of other nodes, allowing nodes that are not within wireless range of each other to communicate over multi-hop paths...

  20. Characterization of the Mammalian CORVET and HOPS Complexes and Their Modular Restructuring for Endosome Specificity

    NARCIS (Netherlands)

    van der Kant, Rik; Jonker, Caspar T. H.; Wijdeven, Ruud H.; Bakker, Jeroen; Janssen, Lennert; Klumperman, Judith; Neefjes, Jacques

    2015-01-01

    Trafficking of cargo through the endosomal system depends on endosomal fusion events mediated by SNARE proteins, Rab-GTPases, and multisubunit tethering complexes. The CORVET and HOPS tethering complexes, respectively, regulate early and late endosomal tethering and have been characterized in detail

  1. Spring-like leg behaviour, musculoskeletal mechanics and control in maximum and submaximum height human hopping

    NARCIS (Netherlands)

    Bobbert, M.F.

    2011-01-01

    The purpose of this study was to understand how humans regulate their 'leg stiffness' in hopping, and to determine whether this regulation is intended to minimize energy expenditure. 'Leg stiffness' is the slope of the relationship between ground reaction force and displacement of the centre of mass

  2. Sensor-Motor Maps for Describing Linear Reflex Composition in Hopping

    Directory of Open Access Journals (Sweden)

    Christian Schumacher

    2017-11-01

    Full Text Available In human and animal motor control several sensory organs contribute to a network of sensory pathways modulating the motion depending on the task and the phase of execution to generate daily motor tasks such as locomotion. To better understand the individual and joint contribution of reflex pathways in locomotor tasks, we developed a neuromuscular model that describes hopping movements. In this model, we consider the influence of proprioceptive length (LFB, velocity (VFB and force feedback (FFB pathways of a leg extensor muscle on hopping stability, performance and efficiency (metabolic effort. Therefore, we explore the space describing the blending of the monosynaptic reflex pathway gains. We call this reflex parameter space a sensor-motor map. The sensor-motor maps are used to visualize the functional contribution of sensory pathways in multisensory integration. We further evaluate the robustness of these sensor-motor maps to changes in tendon elasticity, body mass, segment length and ground compliance. The model predicted that different reflex pathway compositions selectively optimize specific hopping characteristics (e.g., performance and efficiency. Both FFB and LFB were pathways that enable hopping. FFB resulted in the largest hopping heights, LFB enhanced hopping efficiency and VFB had the ability to disable hopping. For the tested case, the topology of the sensor-motor maps as well as the location of functionally optimal compositions were invariant to changes in system designs (tendon elasticity, body mass, segment length or environmental parameters (ground compliance. Our results indicate that different feedback pathway compositions may serve different functional roles. The topology of the sensor-motor map was predicted to be robust against changes in the mechanical system design indicating that the reflex system can use different morphological designs, which does not apply for most robotic systems (for which the control often follows a

  3. KDT501, a derivative from hops, normalizes glucose metabolism and body weight in rodent models of diabetes.

    Directory of Open Access Journals (Sweden)

    Veera R Konda

    Full Text Available AIMS/HYPOTHESIS: We developed KDT501, a novel substituted 1,3-cyclopentadione chemically derived from hop extracts, and evaluated it in various in vitro and in vivo models of diabetes and insulin sensitivity. METHODS: KDT501 was evaluated for anti-inflammatory effects in monocyte/macrophage cells; agonistic activity for peroxisome proliferator-activated receptors (PPAR; lipogenesis and gene expression profile in human subcutaneous adipocytes. Body composition, glucose, insulin sensitivity, and lipids were assessed in diet-induced obesity (DIO mice and Zucker Diabetic Fatty (ZDF rats after oral administration. RESULTS: KDT501 mediated lipogenesis in 3T3L1 and human subcutaneous adipocytes; however, the gene expression profile of KDT501 differed from that of the full PPARγ agonist rosiglitazone, suggesting that KDT501 has pleiotropic biological activities. In addition, KDT501 showed only modest, partial PPARγ agonist activity and exhibited anti-inflammatory effects in monocytes/macrophages that were not observed with rosiglitazone. In a DIO mouse model, oral administration of KDT501 significantly reduced fed blood glucose, glucose/insulin AUC following an oral glucose bolus, and body fat. In ZDF rats, oral administration of KDT501 significantly reduced fed glucose, fasting plasma glucose, and glucose AUC after an oral glucose bolus. Significant, dose-dependent reductions of plasma hemoglobin A1c, weight gain, total cholesterol, and triglycerides were also observed in animals receiving KDT501. CONCLUSION: These results indicate that KDT501 produces a unique anti-diabetic profile that is distinct in its spectrum of pharmacological effects and biological mechanism from both metformin and pioglitazone. KDT501 may thus constitute a novel therapeutic agent for the treatment of Type 2 diabetes and associated conditions.

  4. Gaze beats mouse

    DEFF Research Database (Denmark)

    Mateo, Julio C.; San Agustin, Javier; Hansen, John Paulin

    2008-01-01

    Facial EMG for selection is fast, easy and, combined with gaze pointing, it can provide completely hands-free interaction. In this pilot study, 5 participants performed a simple point-and-select task using mouse or gaze for pointing and a mouse button or a facial-EMG switch for selection. Gaze...

  5. Hop Distance Symmetry Does Not Indicate Normal Landing Biomechanics in Adolescent Athletes With Recent Anterior Cruciate Ligament Reconstruction.

    Science.gov (United States)

    Wren, Tishya A L; Mueske, Nicole M; Brophy, Christopher H; Pace, J Lee; Katzel, Mia J; Edison, Bianca R; VandenBerg, Curtis D; Zaslow, Tracy L

    2018-03-30

    Study Design Retrospective cohort. Background Return to sport (RTS) protocols after anterior cruciate ligament reconstruction (ACLR) often include assessment of hop distance symmetry. However, it is unclear if movement deficits are present regardless of hop symmetry. Objectives To assess biomechanics and symmetry of adolescent athletes following ACLR during a single leg hop for distance. Methods Forty-six patients with ACLR (5-12 months post-surgery; 27 female; age 15.6, SD 1.7 years) were classified as asymmetric (operative limb hop distance biomechanics were compared among operative and contralateral limbs and 24 symmetric controls (12 female; age 14.7, SD 1.5 years) using ANOVA. Results Compared to controls, asymmetric patients hopped a shorter distance on their operative limb (P<0.001), while symmetric patients hopped an intermediate distance on both sides (P≥0.12). During landing, operative limbs, regardless of hop distance, exhibited lower knee flexion moments compared to controls and the contralateral side (P≤0.04) with lower knee energy absorption than the contralateral side (P≤0.006). During take-off, both symmetric and asymmetric patients had less hip extension and smaller ankle range of motion on the operative side compared with controls (P≤0.05). Asymmetric patients also had lower hip range of motion on the operative, compared with the contralateral, side (P=0.001). Conclusion Both symmetric and asymmetric patients offloaded the operative knee; symmetric patients achieved symmetry in part by hopping a shorter distance on the contralateral side. Therefore, hop distance symmetry may not be an adequate test of single limb function and RTS readiness. Level of Evidence 2b. J Orthop Sports Phys Ther, Epub 30 Mar 2018. doi:10.2519/jospt.2018.7817.

  6. Genetic interactions between the chromosome axis-associated protein Hop1 and homologous recombination determinants in Schizosaccharomyces pombe.

    Science.gov (United States)

    Brown, Simon David; Jarosinska, Olga Dorota; Lorenz, Alexander

    2018-03-17

    Hop1 is a component of the meiosis-specific chromosome axis and belongs to the evolutionarily conserved family of HORMA domain proteins. Hop1 and its orthologs in higher eukaryotes are a major factor in promoting double-strand DNA break formation and inter-homolog recombination. In budding yeast and mammals, they are also involved in a meiotic checkpoint kinase cascade monitoring the completion of double-strand DNA break repair. We used the fission yeast, Schizosaccharomyces pombe, which lacks a canonical synaptonemal complex to test whether Hop1 has a role beyond supporting the generation of double-strand DNA breaks and facilitating inter-homolog recombination events. We determined how mutants of homologous recombination factors genetically interact with hop1, studied the role(s) of the HORMA domain of Hop1, and characterized a bio-informatically predicted interactor of Hop1, Aho1 (SPAC688.03c). Our observations indicate that in fission yeast, Hop1 does require its HORMA domain to support wild-type levels of meiotic recombination and localization to meiotic chromatin. Furthermore, we show that hop1∆ only weakly interacts genetically with mutants of homologous recombination factors, and in fission yeast likely has no major role beyond break formation and promoting inter-homolog events. We speculate that after the evolutionary loss of the synaptonemal complex, Hop1 likely has become less important for modulating recombination outcome during meiosis in fission yeast, and that this led to a concurrent rewiring of genetic pathways controlling meiotic recombination.

  7. Comparison of the carboxy-terminal DP-repeat region in the co-chaperones Hop and Hip.

    Science.gov (United States)

    Nelson, Gregory M; Huffman, Holly; Smith, David F

    2003-01-01

    Functional steroid receptor complexes are assembled and maintained by an ordered pathway of interactions involving multiple components of the cellular chaperone machinery. Two of these components, Hop and Hip, serve as co-chaperones to the major heat shock proteins (Hsps), Hsp70 and Hsp90, and participate in intermediate stages of receptor assembly. In an effort to better understand the functions of Hop and Hip in the assembly process, we focused on a region of similarity located near the C-terminus of each co-chaperone. Contained within this region is a repeated sequence motif we have termed the DP repeat. Earlier mutagenesis studies implicated the DP repeat of either Hop or Hip in Hsp70 binding and in normal assembly of the co-chaperones with progesterone receptor (PR) complexes. We report here that the DP repeat lies within a protease-resistant domain that extends to or is near the C-terminus of both co-chaperones. Point mutations in the DP repeats render the C-terminal regions hypersensitive to proteolysis. In addition, a Hop DP mutant displays altered proteolytic digestion patterns, which suggest that the DP-repeat region influences the folding of other Hop domains. Although the respective DP regions of Hop and Hip share sequence and structural similarities, they are not functionally interchangeable. Moreover, a double-point mutation within the second DP-repeat unit of Hop that converts this to the sequence found in Hip disrupts Hop function; however, the corresponding mutation in Hip does not alter its function. We conclude that the DP repeats are important structural elements within a C-terminal domain, which is important for Hop and Hip function.

  8. An analysis of the accuracy of an initial value representation surface hopping wave function in the interaction and asymptotic regions

    International Nuclear Information System (INIS)

    Sergeev, Alexey; Herman, Michael F.

    2006-01-01

    The behavior of an initial value representation surface hopping wave function is examined. Since this method is an initial value representation for the semiclassical solution of the time independent Schroedinger equation for nonadiabatic problems, it has computational advantages over the primitive surface hopping wave function. The primitive wave function has been shown to provide transition probabilities that accurately compare with quantum results for model problems. The analysis presented in this work shows that the multistate initial value representation surface hopping wave function should approach the primitive result in asymptotic regions and provide transition probabilities with the same level of accuracy for scattering problems as the primitive method

  9. Study on a resource allocation scheme in multi-hop MIMO-OFDM systems over lognormal-rayleigh compound channels

    Directory of Open Access Journals (Sweden)

    LIU Jun

    2015-10-01

    Full Text Available For new generation wireless communication networks,this paper studies the optimization of the capacity and end-to-end throughput of the MIMO-OFDM based multi-hop relay systems.A water-filling power allocation method is proposed to improve the channel capacity and the throughput of the MIMO-OFDM system based multi-hop relay system in the Lognormal-Rayleigh shadowing compound channels.Simulations on the capacity and throughput show that the water-filling algorithm can improve the system throughput effectively in the MIMO-OFDM multi-hop relay system.

  10. Escola e movimento hip hop: o campo das possibilidades educativas para a juventude / Education and the hip hop movement: the field of educative possibilities for the youth

    Directory of Open Access Journals (Sweden)

    Jaileila de Araújo Menezes

    2010-09-01

    Full Text Available Este trabalho resulta de estudo de caso e pretende compreender como vem ocorrendo o diálogo entre a escola pública e o movimento hip hop, considerando-se os desafios para a construção de práticas educativas significativas para a juventude. Trata do caráter educativo do movimento, a partir das dimensões de construção da cidadania, da cultura política, da configuração do cenário sociopolítico e econômico, da subjetividade e da organização política. Para isso, acompanharam-se atividades desenvolvidas em uma crew do movimento, localizada em um bairro periférico da cidade de Recife, e a prática educativa desse movimento no contexto escolar circunscrito no Programa Escola Aberta. Visualizou-se, na experiência do movimento hip hop no programa, uma oportunidade de aprendizagem para a escola, no sentido de contextualizar seus saberes, de modo a ganhar maior adesão da comunidade escolar, em especial dos jovens. Nesse sentido, encontraram-se duas modalidades de apropriação das práticas educativas do movimento pela escola: instrumental e pedagógica, que sinalizam para a necessidade de inserção do programa na política educacional e nos projetos político-pedagógicos. Com o acompanhamento das atividades e as entrevistas, pôde-se problematizar a interface educação-segurança presente no programa como fator limitante para os aprendizados de participação esperados para a escola pública em contexto democrático. Evidencia-se essa situação nas oficinas de hip hop, em que jovens com a tarefa de educar outros jovens deparam-se com esse dilema ou simplesmente sucumbem a uma política que despotencializa suas práticas educativas. This paper results from a case study and aims to understand how there has been dialogue between the public school and hip hop movement, considering the challenges to building meaningful educational practices for youth. We treat the character education movement from the dimensions of the construction of

  11. Siim Nestor soovitab : Noor, värske ja psühhedeelne hip-hop / Siim Nestor

    Index Scriptorium Estoniae

    Nestor, Siim, 1974-

    2002-01-01

    Keskkooli-noorte hip-hop-kollektiiv BAP presenteerib oma vastilmunud albumit "Who Am I?" 28. veebr. Tallinna Kunstigümnaasiumis, kaastegev äsja albumi "Tabamata Ime" ilmutanud ansambel Luarvik-Luarvik

  12. Detecting mode hopping in single-longitudinal-mode fiber ring lasers based on an unbalanced fiber Michelson interferometer.

    Science.gov (United States)

    Ma, Mingxiang; Hu, Zhengliang; Xu, Pan; Wang, Wei; Hu, Yongming

    2012-10-20

    A method of detecting mode hopping for single-longitudinal-mode (SLM) fiber ring lasers has been proposed and experimentally demonstrated. The method that is based on an unbalanced Michelson interferometer (MI) utilizing phase generated carrier modulation instantly transforms mode-hopping dynamics into steep phase changes of the interferometer. Multiform mode hops in an SLM erbium-doped fiber ring laser with an 18.6 MHz mode spacing have been detected exactly in real-time domain and discussed in detail. Numerical results show that the MI-based method has a high testing sensitivity for identifying mode hopping, which will play a significant role in evaluating the output stability of SLM fiber lasers.

  13. Scheduling for dual-hop block-fading channels with two source-user pairs sharing one relay

    KAUST Repository

    Zafar, Ammar

    2013-09-01

    In this paper, we maximize the achievable rate region of a dual-hop network with two sources serving two users independently through a single shared relay. We formulate the problem as maximizing the sum of the weighted long term average throughputs of the two users under stability constraints on the long term throughputs of the source-user pairs. In order to solve the problem, we propose a joint user-and-hop scheduling scheme, which schedules the first or second hop opportunistically based on instantaneous channel state information, in order to exploit multiuser diversity and multihop diversity gains. Numerical results show that the proposed joint scheduling scheme enhances the achievable rate region as compared to a scheme that employs multi-user scheduling on the second-hop alone. Copyright © 2013 by the Institute of Electrical and Electronic Engineers, Inc.

  14. Role of band states and trap states in the electrical properties of organic semiconductors: Hopping versus mobility edge model

    KAUST Repository

    Mehraeen, Shafigh; Coropceanu, Veaceslav; Bré das, Jean-Luc

    2013-01-01

    We compare the merits of a hopping model and a mobility edge model in the description of the effect of charge-carrier concentration on the electrical conductivity, carrier mobility, and Fermi energy of organic semiconductors. We consider the case

  15. Mouse Genome Informatics (MGI)

    Data.gov (United States)

    U.S. Department of Health & Human Services — MGI is the international database resource for the laboratory mouse, providing integrated genetic, genomic, and biological data to facilitate the study of human...

  16. Mouse Phenome Database (MPD)

    Data.gov (United States)

    U.S. Department of Health & Human Services — The Mouse Phenome Database (MPD) has characterizations of hundreds of strains of laboratory mice to facilitate translational discoveries and to assist in selection...

  17. Two-surface Monte Carlo with basin hopping: quantum mechanical trajectory and multiple stationary points of water cluster.

    Science.gov (United States)

    Bandyopadhyay, Pradipta

    2008-04-07

    The efficiency of the two-surface monte carlo (TSMC) method depends on the closeness of the actual potential and the biasing potential used to propagate the system of interest. In this work, it is shown that by combining the basin hopping method with TSMC, the efficiency of the method can be increased by several folds. TSMC with basin hopping is used to generate quantum mechanical trajectory and large number of stationary points of water clusters.

  18. Radio resource management scheme and outage analysis for network-assisted multi-hop D2D communications

    Directory of Open Access Journals (Sweden)

    Leila Melki

    2016-11-01

    Full Text Available In a cellular network it's very difficult to make spectrum resource more efficiently. Device-to-Device (D2D technology enables new service opportunities, and provides high throughput and reliable communication while reducing the base station load. For better total performance, short-range D2D links and cellular links share the same radio resource and the management of interference becomes a crucial task. Here we argue that single-hop D2D technology can be used to further improve cellular networks performance if the key D2D radio resource management algorithms are suitably extended to support multi-hop D2D communications. Aiming to establish a new paradigm for the analysis and design of multi-hop D2D communications, We propose a radio resource allocation for multi-hop D2D routes based on interference avoidance approach in LTE-A networks. On top of that, we investigate the outage probability of D2D communication. We first introduce a new definition of outage probability by considering the maximum distance to be allowable for single-hop transmission. Then we study and analyze the outage performance of a multi-hop D2D route. We derive the general closed form expression of outage probability of the multi-hop D2D routes. The results demonstrate that the D2D radio, sharing the same resources as the cellular network, provide higher capacity compared to pure cellular communication where all the data is transmitted through the base station. They also demonstrate that the new method of calculation of D2D multi hop outage probability has better performance than classical method defined in the literature.

  19. Information guided channel hopping with an arbitrary number of transmit antennas

    KAUST Repository

    Yang, Yuli; Aï ssa, Sonia

    2012-01-01

    In order to realize the information guided channel hopping, also known as spatial modulation, with more design flexibility, in this paper we propose a novel scheme that allows operation with an arbitrary number of transmit antennas. Once the number of transmit antennas is not a power of two, the antennas' symbols are mapped by different numbers of bits. Subsequently, constellations with different orders are exploited for the modulation of radiated symbols so as to guarantee that the total number of bits transmitted at each time slot remains the same. Furthermore, we introduce a decoding algorithm with low complexity for this design. Numerical results on bit error rate performance are provided and substantiate that the proposed scheme turns out to be a promising alternative to the design of information guided channel hopping. © 2012 IEEE.

  20. Information guided channel hopping with an arbitrary number of transmit antennas

    KAUST Repository

    Yang, Yuli

    2012-10-01

    In order to realize the information guided channel hopping, also known as spatial modulation, with more design flexibility, in this paper we propose a novel scheme that allows operation with an arbitrary number of transmit antennas. Once the number of transmit antennas is not a power of two, the antennas\\' symbols are mapped by different numbers of bits. Subsequently, constellations with different orders are exploited for the modulation of radiated symbols so as to guarantee that the total number of bits transmitted at each time slot remains the same. Furthermore, we introduce a decoding algorithm with low complexity for this design. Numerical results on bit error rate performance are provided and substantiate that the proposed scheme turns out to be a promising alternative to the design of information guided channel hopping. © 2012 IEEE.

  1. Dual-Hop VLC/RF Transmission System with Energy Harvesting Relay under Delay Constraint

    KAUST Repository

    Rakia, Tamer

    2017-02-09

    In this paper, we introduce a dual-hop visible light communication (VLC) / radio frequency (RF) transmission system to extend the coverage of indoor VLC systems. The relay between the two hops is able to harvest light energy from different artificial light sources and sunlight entering the room. The relay receives data packet over a VLC channel and uses the harvested energy to retransmit it to a mobile terminal over an RF channel. We develop a novel statistical model for the harvested electrical power and analyze the probability of data packet loss. We define a system design parameter (α ∈ [0, 1)) that controls the time dedicated for excess energy harvesting and data packet retransmission. It was found that the parameter has an optimal value which minimizes the packet loss probability. Further more, this optimal value is independent of the RF channel path loss. However, optimal showed inverse dependence on the packet size.

  2. A Low-Cost Time-Hopping Impulse Radio System for High Data Rate Transmission

    Directory of Open Access Journals (Sweden)

    Jinyun Zhang

    2005-03-01

    Full Text Available We present an efficient, low-cost implementation of time-hopping impulse radio that fulfills the spectral mask mandated by the FCC and is suitable for high-data-rate, short-range communications. Key features are (i all-baseband implementation that obviates the need for passband components, (ii symbol-rate (not chip rate sampling, A/D conversion, and digital signal processing, (iii fast acquisition due to novel search algorithms, and (iv spectral shaping that can be adapted to accommodate different spectrum regulations and interference environments. Computer simulations show that this system can provide 110 Mbps at 7–10 m distance, as well as higher data rates at shorter distances under FCC emissions limits. Due to the spreading concept of time-hopping impulse radio, the system can sustain multiple simultaneous users, and can suppress narrowband interference effectively.

  3. Quantum interference magnetoconductance of polycrystalline germanium films in the variable-range hopping regime

    Science.gov (United States)

    Li, Zhaoguo; Peng, Liping; Zhang, Jicheng; Li, Jia; Zeng, Yong; Zhan, Zhiqiang; Wu, Weidong

    2018-06-01

    Direct evidence of quantum interference magnetotransport in polycrystalline germanium films in the variable-range hopping (VRH) regime is reported. The temperature dependence of the conductivity of germanium films fulfilled the Mott VRH mechanism with the form of ? in the low-temperature regime (?). For the magnetotransport behaviour of our germanium films in the VRH regime, a crossover, from negative magnetoconductance at the low-field to positive magnetoconductance at the high-field, is observed while the zero-field conductivity is higher than the critical value (?). In the regime of ?, the magnetoconductance is positive and quadratic in the field for some germanium films. These features are in agreement with the VRH magnetotransport theory based on the quantum interference effect among random paths in the hopping process.

  4. Accelerated sampling by infinite swapping of path integral molecular dynamics with surface hopping

    Science.gov (United States)

    Lu, Jianfeng; Zhou, Zhennan

    2018-02-01

    To accelerate the thermal equilibrium sampling of multi-level quantum systems, the infinite swapping limit of a recently proposed multi-level ring polymer representation is investigated. In the infinite swapping limit, the ring polymer evolves according to an averaged Hamiltonian with respect to all possible surface index configurations of the ring polymer and thus connects the surface hopping approach to the mean-field path-integral molecular dynamics. A multiscale integrator for the infinite swapping limit is also proposed to enable efficient sampling based on the limiting dynamics. Numerical results demonstrate the huge improvement of sampling efficiency of the infinite swapping compared with the direct simulation of path-integral molecular dynamics with surface hopping.

  5. Outage probability of dual-hop FSO fixed gain relay transmission systems

    KAUST Repository

    Zedini, Emna

    2016-12-24

    In this paper, we analyze the end-to-end performance of dual-hop free-space optical (FSO) fixed gain relaying systems in the presence of atmospheric turbulence as well as pointing errors. More specifically, an exact closed-form expression for the outage probability is presented in terms of the bivariate Fox\\'s H function that accounts for both heterodyne detection as well as intensity modulation with direct detection. At high signal-to-noise ratio (SNR) regime, we provide very tight asymptotic result for this performance metric in terms of simple elementary functions. By using dual-hop FSO relaying, we demonstrate a better system performance as compared to the single FSO link. Numerical and Monte-Carlo simulation results are provided to verify the accuracy of the newly proposed results, and a perfect agreement is observed.

  6. Strong-coupling behaviour of two t - J chains with interchain single-electron hopping

    International Nuclear Information System (INIS)

    Zhang Guangming; Feng Shiping; Yu Lu.

    1994-01-01

    Using the fermion-spin transformation to implement spin-charge separation of constrained electrons, a model of two t - J chains with interchain single-electron hopping is studied by abelian bosonization. After spin-charge decoupling the charge dynamics can be trivially solved, while the spin dynamics is determined by a strong-coupling fixed point where the correlation functions can be calculated explicitly. This is a generalization of the Luther-Emery line for two-coupled t - J chains. The interchain single-electron hopping changes the asymptotic behaviour of the interchain spin-spin correlation functions and the electron Green function, but their exponents are independent of the coupling strength. (author). 25 refs

  7. 8-Prenylnaringenin from hop (Humulus lupulus L. – a panacea for menopause?

    Directory of Open Access Journals (Sweden)

    Minecka Aldona

    2017-12-01

    Full Text Available 8-Prenylnaryngenin (8-PN is the strongest known phytoestrogen (PE. Its main source is the female inflorescences of hops (Humulus lupulus L.. 8-PN, which, in contrast to other PEs, is proven to have stronger activity and higher affinity for the α subtype of estrogen receptor (ER. Therefore, it may be an effective substitute for hormone replacement therapy (HRT. The studies in postmenopausal women have shown its particular effectiveness in reducing hot flashes. However, a strong stimulation of uterus by 8-PN may be associated with the occurrence of adverse effects (eg. bleeding and increase the risk of carcinogenesis. The H. lupulus extracts preparations are currently supplements which makes control of the doses used and thus increases the occurrence of uncontrolled self-treatment difficult. This paper presents the current knowledge on 8-PN and discusses the potential risks associated with use of hops to alleviate the symptoms of menopause.

  8. Role of plasmids in Lactobacillus brevis BSO 464 hop tolerance and beer spoilage.

    Science.gov (United States)

    Bergsveinson, Jordyn; Baecker, Nina; Pittet, Vanessa; Ziola, Barry

    2015-02-01

    Specific isolates of lactic acid bacteria (LAB) can grow in the harsh beer environment, thus posing a threat to brew quality and the economic success of breweries worldwide. Plasmid-localized genes, such as horA, horC, and hitA, have been suggested to confer hop tolerance, a trait required for LAB survival in beer. The presence and expression of these genes among LAB, however, do not universally correlate with the ability to grow in beer. Genome sequencing of the virulent beer spoilage organism Lactobacillus brevis BSO 464 revealed the presence of eight plasmids, with plasmids 1, 2, and 3 containing horA, horC, and hitA, respectively. To investigate the roles that these and the other five plasmids play in L. brevis BSO 464 growth in beer, plasmid curing with novobiocin was used to derive 10 plasmid variants. Multiplex PCRs were utilized to determine the presence or absence of each plasmid, and how plasmid loss affected hop tolerance and growth in degassed (noncarbonated) beer was assessed. Loss of three of the eight plasmids was found to affect hop tolerance and growth in beer. Loss of plasmid 2 (horC and 28 other genes) had the most dramatic effect, with loss of plasmid 4 (120 genes) and plasmid 8 (47 genes) having significant, but smaller, impacts. These results support the contention that genes on mobile genetic elements are essential for bacterial growth in beer and that beer spoilage ability is not dependent solely on the three previously described hop tolerance genes or on the chromosome of a beer spoilage LAB isolate.

  9. Evaluating the Effectiveness of IP Hopping via an Address Routing Gateway

    Science.gov (United States)

    2013-03-01

    supportable? How does latency affect this? • Is ARG stable when presented with corrupt, malformed , and/or replayed packets? Each question is tested in a...is the heart of ARG. It maintains the state of the gateways (e.g., keys, hop intervals, times) it knows about and transfers packets to and from the...4. Is ARG stable when presented with corrupt, malformed , or replayed packets? It is hypothesized that ARG correctly classifies 99% of traffic it

  10. Biological and Chemical Standardization of a Hop (Humulus lupulus) Botanical Dietary Supplement

    OpenAIRE

    Krause, Elizabeth; Yuan, Yang; Hajirahimkhan, Atieh; Dong, Huali; Dietz, Birgit M.; Nikolic, Dejan; Pauli, Guido F.; Bolton, Judy L.; van Breemen, Richard B.

    2014-01-01

    Concerned about the safety of conventional estrogen replacement therapy, women are using botanical dietary supplements as alternatives for the management of menopausal symptoms such as hot flashes. Before botanical dietary supplements can be evaluated clinically for safety and efficacy, botanically authenticated and standardized forms are required. To address the demand for a standardized, estrogenic botanical dietary supplement, an extract of hops (Humulus lupulus, L.) was developed. Althoug...

  11. Scaling behavior and variable hopping conductivity in the quantum Hall plateau transition

    International Nuclear Information System (INIS)

    Tu, Tao; Zhao, Yong-Jie; Guo, Guo-Ping; Hao, Xiao-Jie; Guo, Guang-Can

    2007-01-01

    We have measured the temperature dependence of the longitudinal resistivity ρ xx of a two-dimensional electron system in the regime of the quantum Hall plateau transition. We extracted the quantitative form of scaling function for ρ xx and compared it with the results of ordinary scaling theory and variable range hopping based theory. We find that the two alternative theoretically proposed scaling functions are valid in different regions

  12. Tamil hip-hop in Malaysia : the history, politics, and sounds of diasporic identity

    OpenAIRE

    Manoharan, Pravina

    2017-01-01

    This study examines past and contemporary configurations of Tamil identity as expressed through the different religious folk and musical experiences of the minority diasporic community in Malaysia. It seeks to show how deeply felt experiences of the colonial past still influence contemporary expressions of identity by Tamil hip-hop musicians in the context of the popular music industry in post-colonial Malaysia. In doing so, what is revealed is how narratives of identity within the Tamil dias...

  13. Low temperature hopping conduction in amorphous Gesub(x)Sesub(1-x)

    International Nuclear Information System (INIS)

    Mehra, R.M.; Kumar, H.; Agarwal, S.C.; Sikka, P.; Mathur, P.C.

    1985-08-01

    Bulk amorphous samples of Gesub(x)Sesub(1-x) (0.5<=x<=0.7) were prepared by quenching. Dc conductivity measurements were carried out in the temperature range 77-300 K. In the low temperature region, the conduction occurs due to variable range hopping in the localized states near the Fermi level. The results are explained by Mott, Pollak and Butcher's models. Butcher's model which is based on the equivalent of conduction network is compatible with the results. (author)

  14. Rendezvous Protocols and Dynamic Frequency Hopping Interference Design for Anti-Jamming Satellite Communication

    Science.gov (United States)

    2013-11-25

    previously considered this proactive approach to combat unintentional, persistent (non- reactive) interference . In this project, we plan on extending our...channel” (or code ) by chance, through public knowledge of the underlying protocol semantics , or by compromising one of the network devices. An alternative...AFRL-RV-PS- AFRL-RV-PS- TR-2013-0142 TR-2013-0142 RENDEZVOUS PROTOCOLS AND DYNAMIC FREQUENCY HOPPING INTERFERENCE DESIGN FOR ANTI-JAMMING

  15. A Wheel-based Stair-climbing Robot with a Hopping Mechanism

    OpenAIRE

    Kikuchi, Koki; Bushida, Naoki; Sakaguchi, Keisuke; Chiba, Yasuhiro; Otsuka, Hiroshi; Saito, Yusuke; Hirano, Masamitsu; Kobayashi, Shunya

    2010-01-01

    We introduced a wheel-based stair-climbing robot with a hopping mechanism for stairclimbing. The robot, consisting of two body parts connected by springs, climbed stairs quickly, softly, and economically by using the vibration of a two-degrees-of-freedom system. In the future, we intend to shorten the required tread length by controlling the wire tension and minimizing the body length to realize a practical stair-climbing robot.

  16. A spherical electron cloud hopping model for studying product branching ratios of dissociative recombination.

    Science.gov (United States)

    Yu, Hua-Gen

    2008-05-21

    A spherical electron cloud hopping (SECH) model is proposed to study the product branching ratios of dissociative recombination (DR) of polyatomic systems. In this model, the fast electron-captured process is treated as an instantaneous hopping of a cloud of uniform spherical fractional point charges onto a target M+q ion (or molecule). The sum of point charges (-1) simulates the incident electron. The sphere radius is determined by a critical distance (Rc eM) between the incoming electron (e-) and the target, at which the potential energy of the e(-)-M+q system is equal to that of the electron-captured molecule M+q(-1) in a symmetry-allowed electronic state with the same structure as M(+q). During the hopping procedure, the excess energies of electron association reaction are dispersed in the kinetic energies of M+q(-1) atoms to conserve total energy. The kinetic energies are adjusted by linearly adding atomic momenta in the direction of driving forces induced by the scattering electron. The nuclear dynamics of the resultant M+q(-1) molecule are studied by using a direct ab initio dynamics method on the adiabatic potential energy surface of M+q(-1), or together with extra adiabatic surface(s) of M+q(-1). For the latter case, the "fewest switches" surface hopping algorithm of Tully was adapted to deal with the nonadiabaticity in trajectory propagations. The SECH model has been applied to study the DR of both CH+ and H3O+(H2O)2. The theoretical results are consistent with the experiment. It was found that water molecules play an important role in determining the product branching ratios of the molecular cluster ion.

  17. Slopes, nearly constant loss, universality, and hopping rates for dispersive ionic conduction

    International Nuclear Information System (INIS)

    Macdonald, J Ross; Ahmad, Mohamad M

    2007-01-01

    The title topics are investigated, discussed, and new insights provided by considering isothermal frequency response data for seven different materials having quite different conductivity spans and involving different electrode polarization effects and temperatures. These data sets were fitted using several different models, including the Kohlrausch-related K0 and K1 ones derived from stretched-exponential response in the temporal domain. The quasi-universal UN model, the K1 with its shape parameter, β 1 , fixed at 1/3, fitted most of the data very well, and its fits of such data were used to compare its predictions for hopping rate with those derived from fitting with the conventional 'universal dynamic response' Almond-West real-part-of-conductivity model. The K1-model theoretical hopping rate, involving the mean waiting time for a hop and derived from microscopic stochastic analysis, was roughly twice as large as the empirical Almond-West rate for most of the materials considered and should be used in place of it. Its use in a generalized Nernst-Einstein equation led to comparison of estimates of the concentration of fully dissociated mobile charge carriers in superionic PbSnF 4 with earlier estimates of Ahmad using an Almond-West hopping rate value. Agreement with an independent structure-derived value was relatively poor. Fitting results obtained using the K0 model, for Na 2 SO 4 data sets for two different polycrystalline material phases, and involving severely limited conductivity variation, were far superior to those obtained using the K1 model. The estimated values of the K0 shape parameter, β 0 , were close to 1/3 for both phases, strongly suggesting that the charge motion was one dimensional for each phase, even though they involved different crystalline structures

  18. Hip-hop solutions of the 2N-body problem

    Science.gov (United States)

    Barrabés, Esther; Cors, Josep Maria; Pinyol, Conxita; Soler, Jaume

    2006-05-01

    Hip-hop solutions of the 2N-body problem with equal masses are shown to exist using an analytic continuation argument. These solutions are close to planar regular 2N-gon relative equilibria with small vertical oscillations. For fixed N, an infinity of these solutions are three-dimensional choreographies, with all the bodies moving along the same closed curve in the inertial frame.

  19. The role of intrinsic muscle properties for stable hopping-stability is achieved by the force-velocity relation

    International Nuclear Information System (INIS)

    Haeufle, D F B; Grimmer, S; Seyfarth, A

    2010-01-01

    A reductionist approach was presented to investigate which level of detail of the physiological muscle is required for stable locomotion. Periodic movements of a simplified one-dimensional hopping model with a Hill-type muscle (one contractile element, neither serial nor parallel elastic elements) were analyzed. Force-length and force-velocity relations of the muscle were varied in three levels of approximation (constant, linear and Hill-shaped nonlinear) resulting in nine different hopping models of different complexity. Stability of these models was evaluated by return map analysis and the performance by the maximum hopping height. The simplest model (constant force-length and constant force-velocity relations) outperformed all others in the maximum hopping height but was unstable. Stable hopping was achieved with linear and Hill-shaped nonlinear characteristic of the force-velocity relation. The characteristics of the force-length relation marginally influenced hopping stability. The results of this approach indicate that the intrinsic properties of the contractile element are responsible for stabilization of periodic movements. This connotes that (a) complex movements like legged locomotion could benefit from stabilizing effects of muscle properties, and (b) technical systems could benefit from the emerging stability when implementing biological characteristics into artificial muscles.

  20. Determination of the Geographical and Botanical Origin of Hops (Humulus lupulus L.) Using Stable Isotopes of C, N, and S.

    Science.gov (United States)

    Ocvirk, Miha; Ogrinc, Nives; Košir, Iztok Jože

    2018-02-28

    A need exists for a reliable method to determine the geographical and botanical origin of hops. For this study, three sets of samples were collected: the first set comprised 5 German samples; the second set comprised samples of hops from 10 of the world's major hop-growing regions; and the third comprised the 4 main Slovenian regions. The samples were analyzed using isotope ratio mass spectrometry (IRMS) to obtain δ 13 C, δ 15 N, and δ 34 S values. The δ 15 N (2.2 ‰ to 8.4 ‰) and δ 34 S (0.7 ‰ to 12.3 ‰) values were the most discriminating parameters for classifying hop according to geographical origin. ANOVA showed distinct groupings for 8 out of the 10 hop-growing regions. Although it was not possible to distinguish the geographical origin of hops based on δ 13 C (-28.9 ‰ to -24.7 ‰), in the case of botanical origin, δ 13 C values proved to be the most discriminative albeit with limited success.

  1. Performance analysis of decode-and-forward dual-hop optical spatial modulation with diversity combiner over atmospheric turbulence

    Science.gov (United States)

    Odeyemi, Kehinde O.; Owolawi, Pius A.; Srivastava, Viranjay M.

    2017-11-01

    Dual-hops transmission is a growing interest technique that can be used to mitigate against atmospheric turbulence along the Free Space Optical (FSO) communication links. This paper analyzes the performance of Decode-and-Forward (DF) dual-hops FSO systems in-conjunction with spatial modulation and diversity combiners over a Gamma-Gamma atmospheric turbulence channel using heterodyne detection. Maximum Ratio Combiner (MRC), Equal Gain Combiner (EGC) and Selection Combiner (SC) are considered at the relay and destination as mitigation tools to improve the system error performance. Power series expansion of modified Bessel function is used to derive the closed form expression for the end-to-end Average Pairwise Error Probability (APEP) expressions for each of the combiners under study and a tight upper bound on the Average Bit Error Rate (ABER) per hop is given. Thus, the overall end-to-end ABER for the dual-hops FSO system is then evaluated. The numerical results depicted that dual-hops transmission systems outperformed the direct link systems. Moreover, the impact of having the same and different combiners at the relay and destination are also presented. The results also confirm that the combination of dual hops transmission with spatial modulation and diversity combiner significantly improves the systems error rate with the MRC combiner offering an optimal performance with respect to variation in atmospheric turbulence, change in links average received SNR and link range of the system.

  2. Hop-distance relationship analysis with quasi-UDG model for node localization in wireless sensor networks

    Directory of Open Access Journals (Sweden)

    Chen Ping

    2011-01-01

    Full Text Available Abstract In wireless sensor networks (WSNs, location information plays an important role in many fundamental services which includes geographic routing, target tracking, location-based coverage, topology control, and others. One promising approach in sensor network localization is the determination of location based on hop counts. A critical priori of this approach that directly influences the accuracy of location estimation is the hop-distance relationship. However, most of the related works on the hop-distance relationship assume the unit-disk graph (UDG model that is unrealistic in a practical scenario. In this paper, we formulate the hop-distance relationship for quasi-UDG model in WSNs where sensor nodes are randomly and independently deployed in a circular region based on a Poisson point process. Different from the UDG model, quasi-UDG model has the non-uniformity property for connectivity. We derive an approximated recursive expression for the probability of the hop count with a given geographic distance. The border effect and dependence problem are also taken into consideration. Furthermore, we give the expressions describing the distribution of distance with known hop counts for inner nodes and those suffered from the border effect where we discover the insignificance of the border effect. The analytical results are validated by simulations showing the accuracy of the employed approximation. Besides, we demonstrate the localization application of the formulated relationship and show the accuracy improvement in the WSN localization.

  3. A very general rate expression for charge hopping in semiconducting polymers

    Energy Technology Data Exchange (ETDEWEB)

    Fornari, Rocco P.; Aragó, Juan; Troisi, Alessandro [Department of Chemistry and Centre for Scientific Computing, University of Warwick, Coventry CV4 7AL (United Kingdom)

    2015-05-14

    We propose an expression of the hopping rate between localized states in semiconducting disordered polymers that contain the most used rates in the literature as special cases. We stress that these rates cannot be obtained directly from electron transfer rate theories as it is not possible to define diabatic localized states if the localization is caused by disorder, as in most polymers, rather than nuclear polarization effects. After defining the separate classes of accepting and inducing nuclear modes in the system, we obtain a general expression of the hopping rate. We show that, under the appropriate limits, this expression reduces to (i) a single-phonon rate expression or (ii) the Miller-Abrahams rate or (iii) a multi-phonon expression. The description of these limits from a more general expression is useful to interpolate between them, to validate the assumptions of each limiting case, and to define the simplest rate expression that still captures the main features of the charge transport. When the rate expression is fed with a range of realistic parameters the deviation from the Miller-Abrahams rate is large or extremely large, especially for hopping toward lower energy states, due to the energy gap law.

  4. Comparison of Low-Complexity Diversity Schemes for Dual-Hop AF Relaying Systems

    KAUST Repository

    Gaaloul, Fakhreddine

    2012-02-13

    This paper investigates the performance of two low-complexity combining schemes, which are based on one- or two-phase observation, to mitigate multipath fading in dual-hop amplify-and-forward relaying systems. For the one-phase-based combining, a single-antenna station is assumed to relay information from a multiple-antenna transmitter to a multiple-antenna receiver, and the activation of the receive antennas is adaptively performed based on the second-hop statistics, regardless of the first-hop conditions. On the other hand, the two-phase-based combining suggests using multiple single-antenna stations between the multiple-antenna transmitter and the single-antenna receiver, where the suitable set of active relays is identified according to the precombining end-to-end fading conditions. To facilitate comparisons between the two schemes, formulations for the statistics of the combined signal-to-noise ratio and some performance measures are presented. Numerical and simulation results are shown to clarify the tradeoff between the achieved diversity-array gain, the processing complexity, and the power consumption.

  5. A Method for Dynamically Selecting the Best Frequency Hopping Technique in Industrial Wireless Sensor Network Applications.

    Science.gov (United States)

    Fernández de Gorostiza, Erlantz; Berzosa, Jorge; Mabe, Jon; Cortiñas, Roberto

    2018-02-23

    Industrial wireless applications often share the communication channel with other wireless technologies and communication protocols. This coexistence produces interferences and transmission errors which require appropriate mechanisms to manage retransmissions. Nevertheless, these mechanisms increase the network latency and overhead due to the retransmissions. Thus, the loss of data packets and the measures to handle them produce an undesirable drop in the QoS and hinder the overall robustness and energy efficiency of the network. Interference avoidance mechanisms, such as frequency hopping techniques, reduce the need for retransmissions due to interferences but they are often tailored to specific scenarios and are not easily adapted to other use cases. On the other hand, the total absence of interference avoidance mechanisms introduces a security risk because the communication channel may be intentionally attacked and interfered with to hinder or totally block it. In this paper we propose a method for supporting the design of communication solutions under dynamic channel interference conditions and we implement dynamic management policies for frequency hopping technique and channel selection at runtime. The method considers several standard frequency hopping techniques and quality metrics, and the quality and status of the available frequency channels to propose the best combined solution to minimize the side effects of interferences. A simulation tool has been developed and used in this work to validate the method.

  6. HapHop-Physio: a computer game to support cognitive therapies in children.

    Science.gov (United States)

    Rico-Olarte, Carolina; López, Diego M; Narváez, Santiago; Farinango, Charic D; Pharow, Peter S

    2017-01-01

    Care and support of children with physical or mental disabilities are accompanied with serious concerns for parents, families, healthcare institutions, schools, and their communities. Recent studies and technological innovations have demonstrated the feasibility of providing therapy and rehabilitation services to children supported by computer games. The aim of this paper is to present HapHop-Physio, an innovative computer game that combines exercise with fun and learning, developed to support cognitive therapies in children. Conventional software engineering methods such as the Scrum methodology, a functionality test and a related usability test, were part of the comprehensive methodology adapted to develop HapHop-Physio. The game supports visual and auditory attention therapies, as well as visual and auditory memory activities. The game was developed by a multidisciplinary team, which was based on the Hopscotch ® platform provided by Fraunhofer Institute for Digital Media Technology IDMT Institute in Germany, and designed in collaboration with a rehabilitation clinic in Colombia. HapHop-Physio was tested and evaluated to probe its functionality and user satisfaction. The results show the development of an easy-to-use and funny game by a multidisciplinary team using state-of-the-art videogame technologies and software methodologies. Children testing the game concluded that they would like to play again while undergoing rehabilitation therapies.

  7. Exact Results on Quantum Interference and Magnetoconductance in Variable-Range Hopping

    Science.gov (United States)

    Lin, Yeong-Lieh; Nori, Franco

    1997-03-01

    We study quantum interference effects on the transition strength for strongly localized electrons hopping on 2D square and 3D cubic lattices in a magnetic field B. In 2D, we obtain closed-form expressions for the tunneling probability between two arbitrary sites by exactly summing the corresponding phase factors of all directed paths connecting them. An analytic expression for the magnetoconductance, as an explicit function of the magnetic flux, is derived. A positive MC is clearly observed when turning on the magnetic field. When the strength of B reaches a certain value, which is inversely proportional to twice the hopping length, the MC is increased by a factor of two compared to that at zero field. The periodicity in the flux of the MC is found to be equal to hc/2e. In the experimentally important 3D case, we show how the interference patterns and the small-B behavior of the magnetoconductance vary according to the orientation of B. Furthermore, for a 3D sample, the effect on the low-flux MC due to the randomness of the angles between the hopping direction and the orientation of B is examined analytically.(Y.-L. Lin and F. Nori, Phys. Rev. Lett. 76), 4580 (1996); Phys. Rev. B 53, 15543 (1996).

  8. A Study on Coexistence Capability Evaluations of the Enhanced Channel Hopping Mechanism in WBANs

    Directory of Open Access Journals (Sweden)

    Zhongcheng Wei

    2017-01-01

    Full Text Available As an important coexistence technology, channel hopping can reduce the interference among Wireless Body Area Networks (WBANs. However, it simultaneously brings some issues, such as energy waste, long latency and communication interruptions, etc. In this paper, we propose an enhanced channel hopping mechanism that allows multiple WBANs coexisted in the same channel. In order to evaluate the coexistence performance, some critical metrics are designed to reflect the possibility of channel conflict. Furthermore, by taking the queuing and non-queuing behaviors into consideration, we present a set of analysis approaches to evaluate the coexistence capability. On the one hand, we present both service-dependent and service-independent analysis models to estimate the number of coexisting WBANs. On the other hand, based on the uniform distribution assumption and the additive property of Possion-stream, we put forward two approximate methods to compute the number of occupied channels. Extensive simulation results demonstrate that our estimation approaches can provide an effective solution for coexistence capability estimation. Moreover, the enhanced channel hopping mechanism can significantly improve the coexistence capability and support a larger arrival rate of WBANs.

  9. In Search of the Golden Age Hip-Hop Sound (1986–1996

    Directory of Open Access Journals (Sweden)

    Ben Duinker

    2017-09-01

    Full Text Available The notion of a musical repertoire's "sound" is frequently evoked in journalism and scholarship, but what parameters comprise such a sound? This question is addressed through a statistically-driven corpus analysis of hip-hop music released during the genre's Golden Age era. The first part of the paper presents a methodology for developing, transcribing, and analyzing a corpus of 100 hip-hop tracks released during the Golden Age. Eight categories of aurally salient musical and production parameters are analyzed: tempo, orchestration and texture, harmony, form, vocal and lyric profiles, global and local production effects, vocal doubling and backing, and loudness and compression. The second part of the paper organizes the analysis data into three trend categories: trends of change (parameters that change over time, trends of prevalence (parameters that remain generally constant across the corpus, and trends of similarity (parameters that are similar from song to song. These trends form a generalized model of the Golden Age hip-hop sound which considers both global (the whole corpus and local (unique songs within the corpus contexts. By operationalizing "sound" as the sum of musical and production parameters, aspects of popular music that are resistant to traditional music-analytical methods can be considered.

  10. Switched diversity strategies for dual-hop amplify-and-forward relaying systems

    KAUST Repository

    Gaaloul, Fakhreddine

    2012-01-01

    This study investigates different receive single-branch switch-based diversity schemes for dual-hop amplify-and-forward relaying networks. Specifically, three receive processing algorithms are adopted, in which the receive branch is selected using the arbitrary selection algorithm, the switching algorithm, or the switching algorithm with post-examining best branch selection. The identification of the receive branch is carried out for two different system models. For the first model, a single-antenna relaying station is used in conjunction with a multiple-antenna transceiver, where the processing is performed independently of the first hop-fading conditions. The second model suggests the use of parallel deployment of single-antenna relays to transfer information from a multiple-antenna transmitter to a single-antenna receiver, where the active relaying station is determined based on the pre-combining end-to-end fading conditions. Performance comparisons for various transmission scenarios on the first hop are presented using new formulations for the statistics of the combined signal-to-noise ratio. Simulation results are also provided to validate the mathematical development and to verify the numerical computations. © 2012 The Institution of Engineering and Technology.

  11. Dynamic Task Allocation in Multi-Hop Multimedia Wireless Sensor Networks with Low Mobility

    Directory of Open Access Journals (Sweden)

    Klaus Moessner

    2013-10-01

    Full Text Available This paper presents a task allocation-oriented framework to enable efficient in-network processing and cost-effective multi-hop resource sharing for dynamic multi-hop multimedia wireless sensor networks with low node mobility, e.g., pedestrian speeds. The proposed system incorporates a fast task reallocation algorithm to quickly recover from possible network service disruptions, such as node or link failures. An evolutional self-learning mechanism based on a genetic algorithm continuously adapts the system parameters in order to meet the desired application delay requirements, while also achieving a sufficiently long network lifetime. Since the algorithm runtime incurs considerable time delay while updating task assignments, we introduce an adaptive window size to limit the delay periods and ensure an up-to-date solution based on node mobility patterns and device processing capabilities. To the best of our knowledge, this is the first study that yields multi-objective task allocation in a mobile multi-hop wireless environment under dynamic conditions. Simulations are performed in various settings, and the results show considerable performance improvement in extending network lifetime compared to heuristic mechanisms. Furthermore, the proposed framework provides noticeable reduction in the frequency of missing application deadlines.

  12. Dual-Hop FSO Transmission Systems over Gamma-Gamma Turbulence with Pointing Errors

    KAUST Repository

    Zedini, Emna

    2016-11-18

    In this paper, we analyze the end-to-end performance of dual-hop free-space optical (FSO) fixed gain relaying systems under heterodyne detection and intensity modulation with direct detection techniques in the presence of atmospheric turbulence as well as pointing errors. In particular, we derive the cumulative distribution function (CDF) of the end-to-end signal-to-noise ratio (SNR) in exact closed-form in terms of the bivariate Fox’s H function. Capitalizing on this CDF expression, novel closed-form expressions for the outage probability, the average bit-error rate (BER) for different modulation schemes, and the ergodic capacity of dual-hop FSO transmission systems are presented. Moreover, we present very tight asymptotic results for the outage probability and the average BER at high SNR regime in terms of simple elementary functions and we derive the diversity order of the considered system. By using dual-hop FSO relaying, we demonstrate a better system performance as compared to the single FSO link. Numerical and Monte-Carlo simulation results are provided to verify the accuracy of the newly proposed results, and a perfect agreement is observed.

  13. Penalty kick skill through knee tuck jump exercise and barrier hops exercise

    Directory of Open Access Journals (Sweden)

    Usli Wargadinata Lingling

    2018-01-01

    Full Text Available Football always attracts society’s attention. Unfortunately in practice, at school for example, students have difficulties in mastering penalty kick. This research aimed to know the influence of knee tuck jump exercise towards penalty kick result in football and the influence of barrier hops exercise towards penalty kick result in football. The design of this research is pretest–posttest design. The population taken was the entire students from class XI SMK 3 LPPM-RI Batujajar which consisted of 126 students. Purposive sampling technique was used to determine the sample. Intentionally, the writer chose as many as 30 students who joined football extracurricular as sample then divided them into two groups namely group A (knee tuck jump exercise and group B (barrier hops exercise. Based on the result, there was significant difference in mean score between pretest and posttest in group A (29.00 than group B (26.00 towards the result of penalty kick in football. The result of compared t from the difference of two results is 4.92 bigger than t table 1.70. Therefore, knee tuck jump exercise gives more significant result than barrier hops exercise towards penalty kick result in football to the students of football extracurricular in SMK 3 LPPM-RI Batujajar.

  14. Integrating model checking with HiP-HOPS in model-based safety analysis

    International Nuclear Information System (INIS)

    Sharvia, Septavera; Papadopoulos, Yiannis

    2015-01-01

    The ability to perform an effective and robust safety analysis on the design of modern safety–critical systems is crucial. Model-based safety analysis (MBSA) has been introduced in recent years to support the assessment of complex system design by focusing on the system model as the central artefact, and by automating the synthesis and analysis of failure-extended models. Model checking and failure logic synthesis and analysis (FLSA) are two prominent MBSA paradigms. Extensive research has placed emphasis on the development of these techniques, but discussion on their integration remains limited. In this paper, we propose a technique in which model checking and Hierarchically Performed Hazard Origin and Propagation Studies (HiP-HOPS) – an advanced FLSA technique – can be applied synergistically with benefit for the MBSA process. The application of the technique is illustrated through an example of a brake-by-wire system. - Highlights: • We propose technique to integrate HiP-HOPS and model checking. • State machines can be systematically constructed from HiP-HOPS. • The strengths of different MBSA techniques are combined. • Demonstrated through modeling and analysis of brake-by-wire system. • Root cause analysis is automated and system dynamic behaviors analyzed and verified

  15. Gold Digger or Video Girl: the salience of an emerging hip-hop sexual script.

    Science.gov (United States)

    Ross, Jasmine N; Coleman, Nicole M

    2011-02-01

    Concerns have been expressed in the common discourse and scholarly literature about the negative influence of Hip-Hop on its young listeners' ideas about sex and sexuality. Most of the scholarly literature has focused on the impact of this urban, Black media on young African American girls' sexual self-concept and behaviours. In response to this discourse, Stephens and Phillips (2003) proposed a Hip-Hop sexual scripting model that theorises about specific sexual scripts for young African American women. Their model includes eight different sexual scripts including the Gold Digger script. The present study proposes a ninth emerging script - the Video Girl. Participants were 18 female African American college students, between the ages of 18 and 30 years old from a large urban public university in the Southwest USA. Using q-methodology the present study found support for the existence of a Video Girl script. In addition, the data indicates that this script is distinct but closely related to Stephens and Phillips' Gold Digger script. These findings support their theory by suggesting that Hip-Hop sexual scripts are salient and hold real meaning for this sample.

  16. Educative Processes in the Hip Hop: the celebration of the values of the community

    Directory of Open Access Journals (Sweden)

    Cristiano Tierno Siqueira

    2010-05-01

    Full Text Available The objective of this inquiry was to understand and systemize the Educative Processes that characterize Practical the Social one of the Hip Hop of the city of São Carlos, interior of São Paulo; as these young ones if educate and as they educate other people of its communities, longing for to contribute for the valuation of the Movements of Youth and for the elaboration of politics that consider them. For in such a way, we follow some of its activities, as periodic weekly meetings, artistic events, educative activities and parties. The analysis of the data disclosed to some values gifts in the life of these people, as the love for what it becomes, the not arrogant, the necessity of the collective work, the responsibility and the belonging to a community. The men and the women of the Hip Hop invite-in opening the doors of the Schools and University, so that in we let us exempt them of the preconceptions that we construct every day, so that we learn with young of the Hip Hop, as well as with other people who fight for worthy conditions of life. We believe that this inquiry brings contributions to think the education that characterize Practical Social in not-pertaining to school spaces, as well as to rethink the education in the pertaining to school spaces.

  17. Hydraulic Circuit of Mechanical Pruner Drive for Hops on Low Trellises

    Directory of Open Access Journals (Sweden)

    Hoffmann David

    2015-09-01

    Full Text Available A mechanical pruner serves for pruning new hopvine shoots in spring. The later yield depends on the right timing and quality of pruning. That is why hop pruning is one of the most important agrotechnical procedures. A double-disc mechanical pruner used on high trellises cannot be used on low trellises due to its large size. Abroad, for pruning hops on low trellises a specially adapted sprinkler is used (chemical pruning. With regard to the effort to minimize the chemical environmental burden, we opted for the design of the mechanical pruner. Firstly, the low trellis, mechanical pruner, and also elements used in the design of hydraulic circuit are described. Next part of the paper is devoted to the input requirements for both the hydraulic circuit and the mechanical pruner designs. Then a description of an adapted inter-axle carrier used for the experimental model of the hop mechanical pruner and of the effected field measurement follows, along with interpretation of the measured data. These data are depicted in clearly arranged graphs showing the dependency of pressure and hydraulic oil flow on the cutting disc rotational frequency.

  18. Crowding and hopping in a protein’s diffusive transport on DNA

    International Nuclear Information System (INIS)

    Koslover, Elena F; Spakowitz, Andrew J; Díaz de la Rosa, Mario

    2017-01-01

    Diffusion is a ubiquitous phenomenon that impacts virtually all processes that involve random fluctuations, and as such, the foundational work of Smoluchowski has proven to be instrumental in addressing innumerable problems. Here, we focus on a critical biological problem that relies on diffusive transport and is analyzed using a probabilistic treatment originally developed by Smoluchowski. The search of a DNA binding protein for its specific target site is believed to rely on non-specific binding to DNA with transient hops along the chain. In this work, we address the impact of protein crowding along the DNA on the transport of a DNA-binding protein. The crowders dramatically alter the dynamics of the protein while bound to the DNA, resulting in single-file transport that is subdiffusive in nature. However, transient unbinding and hopping results in a long-time behavior (shown to be superdiffusive) that is qualitatively unaffected by the crowding on the DNA. Thus, hopping along the chain mitigates the role that protein crowding has in restricting the translocation dynamics along the chain. The superdiffusion coefficient is influenced by the quantitative values of the effective binding rate, which is influenced by protein crowding. We show that vacancy fraction and superdiffusion coefficient exhibits a non-monotonic relationship under many circumstances. We leverage analytical theory and dynamic Monte Carlo simulations to address this problem. With several additional contributions, the core of our modeling work adopts a reaction-diffusion framework that is based on Smoluchowski’s original work. (paper)

  19. Molecular mechanisms behind the antimicrobial activity of hop iso-α-acids in Lactobacillus brevis.

    Science.gov (United States)

    Schurr, Benjamin C; Hahne, Hannes; Kuster, Bernhard; Behr, Jürgen; Vogel, Rudi F

    2015-04-01

    The main bittering component in beer, hop iso-α-acids, have been characterised as weak acids, which act as ionophores impairing microbial cells' function under acidic conditions as present in beer. Besides medium pH, divalent cations play a central role regarding the efficacy of the antimicrobial effect. The iso-α-acids' non-bitter derivatives humulinic acids can be found in isomerised hop extracts and can be generated during hop storage. Therefore, they have been under investigation concerning their influence on beer sensory properties. This study sketches the molecular mechanism behind iso-α-acids' antimicrobial activity in Lactobacillus (L.) brevis regarding their ionophore activity versus the dependence of the inhibitory potential on manganese binding, and suggests humulinic acids as novel tasteless food preservatives. We designed and synthesised chemically modified iso-α-acids to enhance the basic understanding of the molecular mechanism of antimicrobial iso-α-acids. It could be observed that a manganese-binding dependent transmembrane redox reaction (oxidative stress) plays a crucial role in inhibition. Privation of an acidic hydroxyl group neither erased ionophore activity, nor did it entirely abolish antimicrobial activity. Humulinic acids proved to be highly inhibitory, even outperforming iso-α-acids. Copyright © 2014 Elsevier Ltd. All rights reserved.

  20. Analysis and Relative Evaluation of Connectivity of a Mobile Multi-Hop Network

    Science.gov (United States)

    Nakano, Keisuke; Miyakita, Kazuyuki; Sengoku, Masakazu; Shinoda, Shoji

    In mobile multi-hop networks, a source node S and a destination node D sometimes encounter a situation where there is no multi-hop path between them when a message M, destined for D, arrives at S. In this situation, we cannot send M from S to D immediately; however, we can deliver M to D after waiting some time with the help of two capabilities of mobility. One of the capabilities is to construct a connected multi-hop path by changing the topology of the network during the waiting time (Capability 1), and the other is to move M closer to D during the waiting time (Capability 2). In this paper, we consider three methods to deliver M from S to D by using these capabilities in different ways. Method 1 uses Capability 1 and sends M from S to D after waiting until a connected multi-hop path appears between S and D. Method 2 uses Capability 2 and delivers M to D by allowing a mobile node to carry M from S to D. Method 3 is a combination of Methods 1 and 2 and minimizes the waiting time. We evaluate and compare these three methods in terms of the mean waiting time, from the time when M arrives at S to the time when D starts receiving M, as a new approach to connectivity evaluation. We consider a one-dimensional mobile multi-hop network consisting of mobile nodes flowing in opposite directions along a street. First, we derive some approximate equations and propose an estimation method to compute the mean waiting time of Method 1. Second, we theoretically analyze the mean waiting time of Method 2, and compute a lower bound of that of Method 3. By comparing the three methods under the same assumptions using results of the analyses and some simulation results, we show relations between the mean waiting times of these methods and show how Capabilities 1 and 2 differently affect the mean waiting time.

  1. "Makin' Somethin' Outta Little-to-Nufin'': Racism, Revision and Rotating Records--The Hip-Hop DJ in Composition Praxis

    Science.gov (United States)

    Craig, Todd

    2015-01-01

    Prompted by a moment in the classroom in which the DJ becomes integral for the writing instructor, this article looks at how the hip-hop DJ and hip-hop DJ/Producer become the intrinsic examples for first-year college writing students to think about how they conduct revision in their writing. After a review of two seminal hip-hop books and other…

  2. The Bacterial Effector HopX1 Targets JAZ Transcriptional Repressors to Activate Jasmonate Signaling and Promote Infection in Arabidopsis

    Science.gov (United States)

    Gimenez-Ibanez, Selena; Boter, Marta; Fernández-Barbero, Gemma; Chini, Andrea; Rathjen, John P.; Solano, Roberto

    2014-01-01

    Pathogenicity of Pseudomonas syringae is dependent on a type III secretion system, which secretes a suite of virulence effector proteins into the host cytoplasm, and the production of a number of toxins such as coronatine (COR), which is a mimic of the plant hormone jasmonate-isoleuce (JA-Ile). Inside the plant cell, effectors target host molecules to subvert the host cell physiology and disrupt defenses. However, despite the fact that elucidating effector action is essential to understanding bacterial pathogenesis, the molecular function and host targets of the vast majority of effectors remain largely unknown. Here, we found that effector HopX1 from Pseudomonas syringae pv. tabaci (Pta) 11528, a strain that does not produce COR, interacts with and promotes the degradation of JAZ proteins, a key family of JA-repressors. We show that hopX1 encodes a cysteine protease, activity that is required for degradation of JAZs by HopX1. HopX1 associates with JAZ proteins through its central ZIM domain and degradation occurs in a COI1-independent manner. Moreover, ectopic expression of HopX1 in Arabidopsis induces the expression of JA-dependent genes, represses salicylic acid (SA)-induced markers, and complements the growth of a COR-deficient P. syringae pv. tomato (Pto) DC3000 strain during natural bacterial infections. Furthermore, HopX1 promoted susceptibility when delivered by the natural type III secretion system, to a similar extent as the addition of COR, and this effect was dependent on its catalytic activity. Altogether, our results indicate that JAZ proteins are direct targets of bacterial effectors to promote activation of JA-induced defenses and susceptibility in Arabidopsis. HopX1 illustrates a paradigm of an alternative evolutionary solution to COR with similar physiological outcome. PMID:24558350

  3. DETERMINATION OF CLINICALLY RELEVANT DIFFERENCES IN FRONTAL PLANE HOP TESTS IN WOMEN'S COLLEGIATE BASKETBALL AND SOCCER PLAYERS

    Science.gov (United States)

    Hardesty, Kelly; Hegedus, Eric J.; Ford, Kevin R.; Nguyen, Anh‐Dung

    2017-01-01

    Background ACL injury prevention programs are less successful in female basketball players than in soccer players. Previous authors have identified anthropometric and biomechanical differences between the athletes and different sport‐specific demands, including a higher frequency of frontal plane activities in basketball. Current injury risk screening and preventive training practices do not place a strong emphasis on frontal plane activities. The medial and lateral triple hop for distance tests may be beneficial for use in the basketball population. Hypothesis/Purpose To 1) establish normative values for the medial and lateral triple hop tests in healthy female collegiate athletes, and 2) analyze differences in test scores between female basketball and soccer players. It was hypothesized that due to the frequent frontal plane demands of their sport, basketball players would exhibit greater performance during these frontal plane performance tests. Study Design Cross‐sectional. Methods Thirty‐two NCAA Division‐1 female athletes (20 soccer, 12 basketball) performed three trials each of a medial and lateral triple hop for distance test. Distances were normalized to height and mass in order to account for anthropometric differences. Repeated measures ANOVAs were performed to identify statistically significant main effects of sport (basketball vs. soccer), and side (right vs. left), and sport x side interactions. Results After accounting for anthropometric differences, soccer players exhibited significantly better performance than basketball players in the medial and lateral triple hop tests (p jumped farther on their left (400.3 ± 41.5 cm) than right (387.9 ± 43.4 cm) limbs, but no side differences were identified in the lateral triple hop. No significant side x sport interactions were identified. Conclusions Women's basketball players exhibit decreased performance of frontal plane hop tests when compared to women's soccer players. Additionally

  4. Immunostimulatory mouse granuloma protein.

    Science.gov (United States)

    Fontan, E; Fauve, R M; Hevin, B; Jusforgues, H

    1983-10-01

    Earlier studies have shown that from subcutaneous talc-induced granuloma in mice, a fraction could be extracted that fully protected mice against Listeria monocytogenes. Using standard biochemical procedures--i.e., ammonium sulfate fractionation, preparative electrophoresis, gel filtration chromatography, isoelectric focusing, and preparative polyacrylamide gel electrophoresis--we have now purified an active factor to homogeneity. A single band was obtained in NaDodSO4/polyacrylamide gel with an apparent Mr of 55,000. It migrated with alpha 1-globulins and the isoelectric point was 5 +/- 0.1. The biological activity was destroyed with Pronase but not with trypsin and a monospecific polyclonal rabbit antiserum was obtained. The intravenous injection of 5 micrograms of this "mouse granuloma protein" fully protects mice against a lethal inoculum of L. monocytogenes. Moreover, after their incubation with 10 nM mouse granuloma protein, mouse peritoneal cells became cytostatic against Lewis carcinoma cells.

  5. Burn mouse models

    DEFF Research Database (Denmark)

    Calum, Henrik; Høiby, Niels; Moser, Claus

    2014-01-01

    Severe thermal injury induces immunosuppression, involving all parts of the immune system, especially when large fractions of the total body surface area are affected. An animal model was established to characterize the burn-induced immunosuppression. In our novel mouse model a 6 % third-degree b......Severe thermal injury induces immunosuppression, involving all parts of the immune system, especially when large fractions of the total body surface area are affected. An animal model was established to characterize the burn-induced immunosuppression. In our novel mouse model a 6 % third...... with infected burn wound compared with the burn wound only group. The burn mouse model resembles the clinical situation and provides an opportunity to examine or develop new strategies like new antibiotics and immune therapy, in handling burn wound victims much....

  6. As representações sociais da mulher no movimento hip hop Woman's social representations in the hip-hop movement

    Directory of Open Access Journals (Sweden)

    Priscila Saemi Matsunaga

    2008-04-01

    Full Text Available Este artigo discute as representações sociais da mulher construídas pelo movimento hip hop. Este movimento constitui-se como uma possibilidade de manifestação política de jovens, bem como uma possibilidade de produção artística que, se inicialmente esteve mais presente em espaços não institucionalizados e voltados para a população que vive na periferia, atualmente é consumido por jovens de camadas econômicas distintas. A participação de mulheres, porém, ainda não é significativa (ainda que existam mulheres participando e ouve-se frequentemente músicas (ou raps que veiculam imagens negativas da mulher. Este estudo, portanto, analisa as representações sociais da mulher que estão presentes em letras de rap, problematizando como estas representações constroem, socialmente, modos de "ser" mulher.This paper discusses woman's social representations constructed by the hip-hop movement. This movement constitutes a possibility of younger generations to politically manifest themselves, as well as a possibility of artistic production that at the start was more present in non-institutionalized spaces and aimed at the populations living in marginal districts, it is now being currently consumed by youths of distinct social classes. However, the participation of women has not been significant (even though there are women taking part, and frequently negative images of women are conveyed from these songs (or raps. Thus, this study analyses the woman's social representations which are in rap lyrics, querying how such representations have built social ways of "being" a woman.

  7. New STS molecular markers for assessment of genetic diversity and DNA fingerprinting in hop (Humulus lupulus L.).

    Science.gov (United States)

    Patzak, Josef; Vrba, Lukás; Matousek, Jaroslav

    2007-01-01

    Molecular markers have been increasingly used in genetic studies of crop species for their applicability in breeding programs. In this work, we report on the development of new sequence-tagged site (STS) markers based on sequence information from several identified hop (Humulus lupulus L.) genes. We demonstrate the usefulness of these STS markers and compare them to SSRs for identifying hop genotypes and estimating genetic diversity in a collection of 68 hop cultivars from around the world. We found 3 individual gene variants (A, B, C) of the chs_H1 gene in this collection. The most frequent gene variant, B (AJ304877), was not detected in Mt. Hood, Glacier, and Horizon (US) cultivars. Gene variant A came from an American germplasm through wild hops. We found length polymorphism in intron 1 of the chs2 gene, and 4 different amplified markers were detected in PCRs. The chs3 gene was found in only one third of the cultivars. None of the variants of the studied CHS genes were found in Humulus japonicus. We detected 5 major gene variants of DNA-binding protein in the collection of H. lupulus cultivars and 2 others in H. japonicus. We also found 3 individual gene variants of an endochitinase gene. The distribution of gene variants did not correlate with any resistance. We proved that developed STS markers can be successfully used for the analysis of genetic diversity and can substitute and supplement SSR markers in hop.

  8. Influence of Coherent Tunneling and Incoherent Hopping on the Charge Transfer Mechanism in Linear Donor-Bridge-Acceptor Systems.

    Science.gov (United States)

    Li, Guangqi; Govind, Niranjan; Ratner, Mark A; Cramer, Christopher J; Gagliardi, Laura

    2015-12-17

    The mechanism of charge transfer has been observed to change from tunneling to hopping with increasing numbers of DNA base pairs in polynucleotides and with the length of molecular wires. The aim of this paper is to investigate this transition by examining the population dynamics using a tight-binding Hamiltonian with model parameters to describe a linear donor-bridge-acceptor (D-B-A) system. The model includes a primary vibration and an electron-vibration coupling at each site. A further coupling of the primary vibration with a secondary phonon bath allows the system to dissipate energy to the environment and reach a steady state. We apply the quantum master equation (QME) approach, based on second-order perturbation theory in a quantum dissipative system, to examine the dynamical processes involved in charge-transfer and follow the population transfer rate at the acceptor, ka, to shed light on the transition from tunneling to hopping. With a small tunneling parameter, V, the on-site population tends to localize and form polarons, and the hopping mechanism dominates the transfer process. With increasing V, the population tends to be delocalized and the tunneling mechanism dominates. The competition between incoherent hopping and coherent tunneling governs the mechanism of charge transfer. By varying V and the total number of sites, we also examine the onset of the transition from tunneling to hopping with increasing length.

  9. Studying the hopping parameters of half-Heusler NaAuS using maximally localized Wannier function

    Science.gov (United States)

    Sihi, Antik; Lal, Sohan; Pandey, Sudhir K.

    2018-04-01

    Here, the electronic behavior of half-Heusler NaAuS is studied using PBEsol exchange correlation functional by plotting the band structure curve. These bands are reproduced using maximally localized Wannier function using WANNIER90. Tight-binding bands are nicely matched with density functional theory bands. By fitting the tight-binding model, hopping parameter for NaAuS is obtained by including Na 2s, 2p, Au 6s, 5p, 5d and S 3s, 3p orbitals within the energy interval of -5 to 16 eV around the Fermi level. In present study, hopping integrals for NaAuS are computed for the first primitive unit cell atoms as well as the first nearest neighbor primitive unit cell. The most dominating hopping integrals are found for Na (3s) - S (3s), Na (2px) - S (2px), Au (6s) - S (3px), Au (6s) - S (3py) and Au (6s) - S (3pz) orbitals. The hopping integrals for the first nearest neighbor primitive unit cell are also discussed in this manuscript. In future, these hopping integrals are very important to find the topological invariant for NaAuS compound.

  10. A Comparison of Vertical Stiffness Values Calculated from Different Measures of Center of Mass Displacement in Single-Leg Hopping.

    Science.gov (United States)

    Mudie, Kurt L; Gupta, Amitabh; Green, Simon; Hobara, Hiroaki; Clothier, Peter J

    2017-02-01

    This study assessed the agreement between K vert calculated from 4 different methods of estimating vertical displacement of the center of mass (COM) during single-leg hopping. Healthy participants (N = 38) completed a 10-s single-leg hopping effort on a force plate, with 3D motion of the lower limb, pelvis, and trunk captured. Derived variables were calculated for a total of 753 hop cycles using 4 methods, including: double integration of the vertical ground reaction force, law of falling bodies, a marker cluster on the sacrum, and a segmental analysis method. Bland-Altman plots demonstrated that K vert calculated using segmental analysis and double integration methods have a relatively small bias (0.93 kN⋅m -1 ) and 95% limits of agreement (-1.89 to 3.75 kN⋅m -1 ). In contrast, a greater bias was revealed between sacral marker cluster and segmental analysis (-2.32 kN⋅m -1 ), sacral marker cluster and double integration (-3.25 kN⋅m -1 ), and the law of falling bodies compared with all methods (17.26-20.52 kN⋅m -1 ). These findings suggest the segmental analysis and double integration methods can be used interchangeably for the calculation of K vert during single-leg hopping. The authors propose the segmental analysis method to be considered the gold standard for the calculation of K vert during single-leg, on-the-spot hopping.

  11. Kinematic and Kinetic Analysis of the Single-Leg Triple Hop Test in Women With and Without Patellofemoral Pain.

    Science.gov (United States)

    dos Reis, Amir Curcio; Correa, João Carlos Ferrari; Bley, André Serra; Rabelo, Nayra Deise dos Anjos; Fukuda, Thiago Yukio; Lucareli, Paulo Roberto Garcia

    2015-10-01

    Cross-sectional study. To compare the biomechanical strategies of the trunk and lower extremity during the transition period between the first and second hop of a single-leg triple hop test in women with and without patellofemoral pain (PFP). Recent literature has shown that PFP is associated with biomechanical impairments of the lower extremities. A number of studies have analyzed the position of the trunk and lower extremities for functional activities such as walking, squatting, jumping, and the step-down test. However, studies on more challenging activities, such as the single-leg triple hop test, may be more representative of sports requiring jumping movements. Women between 18 and 35 years of age (control group, n = 20; PFP group, n = 20) participated in the study. Three-dimensional kinematic and kinetic data were collected during the transition period between the first and second hops while participants performed the single-leg triple hop test. Compared to the control group, women with PFP exhibited greater (Pkinetics.

  12. Hops (Humulus lupulus L. Bitter Acids: Modulation of Rumen Fermentation and Potential As an Alternative Growth Promoter

    Directory of Open Access Journals (Sweden)

    Michael D. Flythe

    2017-08-01

    Full Text Available Antibiotics can improve ruminant growth and efficiency by altering rumen fermentation via selective inhibition of microorganisms. However, antibiotic use is increasingly restricted due to concerns about the spread of antibiotic-resistance. Plant-based antimicrobials are alternatives to antibiotics in animal production. The hops plant (Humulus lupulus L. produces a range of bioactive secondary metabolites, including antimicrobial prenylated phloroglucinols, which are commonly called alpha- and beta-acids. These latter compounds can be considered phyto-ionophores, phytochemicals with a similar antimicrobial mechanism of action to ionophore antibiotics (e.g., monensin, lasalocid. Like ionophores, the hop beta-acids inhibit rumen bacteria possessing a classical Gram-positive cell envelope. This selective inhibition causes several effects on rumen fermentation that are beneficial to finishing cattle, such as decreased proteolysis, ammonia production, acetate: propionate ratio, and methane production. This article reviews the effects of hops and hop secondary metabolites on rumen fermentation, including the physiological mechanisms on specific rumen microorganisms, and consequences for the ruminant host and ruminant production. Further, we propose that hop beta-acids are useful model natural products for ruminants because of (1 the ionophore-like mechanism of action and spectrum of activity and (2 the literature available on the plant due to its use in brewing.

  13. Use of hop extract as antifungal ingredient for bread making and selection of autochthonous resistant starters for sourdough fermentation.

    Science.gov (United States)

    Nionelli, Luana; Pontonio, Erica; Gobbetti, Marco; Rizzello, Carlo Giuseppe

    2018-02-02

    Aiming at meeting the consumers' demand in terms of bio-preservation, the potential of the combination of the lactic acid bacteria fermentation and the addition of hop extract as natural preservative in breadmaking, was exploited. The antifungal properties of a hop (Humulus lupulus) extract were investigated, showing a significant inhibition of the hyphal growth of Aspergillus parasiticus, Penicillium carneum, Penicillium polonicum, Penicillium paneum, Penicillium chermesinum, Aspergillus niger, Penicillium roqueforti. Lactic acid bacteria belonging to species of Enterococcus feacium, Lactobacillus plantarum, Lactobacillus brevis, Lactobacillus helveticus, Lactobacillus curvatus, Pediococcus pentosaceus, and Pediococcus acidilactici were isolated from hop and subjected to selection based on kinetics of growth and acidification. The sourdough (hS) enriched with hop extract (hE), started with three selected strains, had phenols concentration and antioxidant activity higher than those obtained in the same condition but without the hE. Hop-sourdough used in breadmaking delayed the fungal growth (14 days), giving a bread characterized by free aminoacids concentration, antioxidant and phytase activities higher than bread started only with baker's yeast, with or without the addition of hE. Specific volume and cell-total area of the bread containing hE improved, and its sensory profile was characterized by typical sourdough attributes, and a moderate bitter/herbaceous perception.

  14. Attractor hopping between polarization dynamical states in a vertical-cavity surface-emitting laser subject to parallel optical injection

    Science.gov (United States)

    Denis-le Coarer, Florian; Quirce, Ana; Valle, Angel; Pesquera, Luis; Rodríguez, Miguel A.; Panajotov, Krassimir; Sciamanna, Marc

    2018-03-01

    We present experimental and theoretical results of noise-induced attractor hopping between dynamical states found in a single transverse mode vertical-cavity surface-emitting laser (VCSEL) subject to parallel optical injection. These transitions involve dynamical states with different polarizations of the light emitted by the VCSEL. We report an experimental map identifying, in the injected power-frequency detuning plane, regions where attractor hopping between two, or even three, different states occur. The transition between these behaviors is characterized by using residence time distributions. We find multistability regions that are characterized by heavy-tailed residence time distributions. These distributions are characterized by a -1.83 ±0.17 power law. Between these regions we find coherence enhancement of noise-induced attractor hopping in which transitions between states occur regularly. Simulation results show that frequency detuning variations and spontaneous emission noise play a role in causing switching between attractors. We also find attractor hopping between chaotic states with different polarization properties. In this case, simulation results show that spontaneous emission noise inherent to the VCSEL is enough to induce this hopping.

  15. Colonization, mouse-style

    Directory of Open Access Journals (Sweden)

    Searle Jeremy B

    2010-10-01

    Full Text Available Abstract Several recent papers, including one in BMC Evolutionary Biology, examine the colonization history of house mice. As well as background for the analysis of mouse adaptation, such studies offer a perspective on the history of movements of the humans that accidentally transported the mice. See research article: http://www.biomedcentral.com/1471-2148/10/325

  16. Efficient and stable transformation of hop (Humulus lupulus L.) var. Eroica by particle bombardment.

    Science.gov (United States)

    Batista, Dora; Fonseca, Sandra; Serrazina, Susana; Figueiredo, Andreia; Pais, Maria Salomé

    2008-07-01

    To the best of our knowledge, this is the first accurate and reliable protocol for hop (Humulus lupulus L.) genetic transformation using particle bombardment. Based on the highly productive regeneration system previously developed by us for hop var. Eroica, two efficient transformation protocols were established using petioles and green organogenic nodular clusters (GONCs) bombarded with gusA reporter and hpt selectable genes. A total of 36 hygromycin B-resistant (hyg(r)) plants obtained upon continuous selection were successfully transferred to the greenhouse, and a first generation group of transplanted plants was followed after spending a complete vegetative cycle. PCR analysis showed the presence of one of both transgenes in 25 plants, corresponding to an integration frequency of 69.4% and an overall transformation efficiency of 7.5%. Although all final transformants were GUS negative, the integration frequency of gusA gene was higher than that of hpt gene. Petiole-derived transgenic plants showed a higher co-integration rate of 76.9%. Real-time PCR analysis confirmed co-integration in 86% of the plants tested and its stability until the first generation, and identified positive plants amongst those previously assessed as hpt (+) only by conventional PCR. Our results suggest that the integration frequencies presented here, as well as those of others, may have been underestimated, and that PCR results should be taken with precaution not only for false positives, but also for false negatives. The protocols here described could be very useful for future introduction of metabolic or resistance traits in hop cultivars even if slight modifications for other genotypes are needed.

  17. Intersection of Hip-Hop and Geoscience: Changes in The Climate

    Science.gov (United States)

    López, R. D.; Heraldo, S. E.; Nawman, M. A.; Gerry, V. R.; Gerry, M. A.

    2017-12-01

    Professionals and educators in the science, technology, engineering, art, and mathematics (STEAM) field rely heavily on scientific communication to convey innovations, concepts, and evidence-based policy. The geosciences presents itself as a unique field to communicate respective scientific endeavors, as research efforts have direct impacts on the Earth's resources and understanding natural processes. Several of the authors have previously composed musical pieces that integrated Earth Sciences with music, utilizing this as mechanism to not only foster creativity, but to also establish more dynamic outreach efforts. Unfortunately, geoscience does not readily present itself as a field that is easily accessible to minorities - particularly women, people of color, and those from disadvantaged communities. However, music is somewhat of a universal form of communication that is accessible to everyone. It is through the intersection of hip-hop and geoscience, that topics can be introduced to communities in unique ways. Flows in Hydrogeology was a previous project that several of the authors produced as a means to connect with youth who identify with the hip-hop community, while encouraging inquiry in the STEAM fields. Several of the authors grew up and still reside in some of the most violent cities in the United States of America. The authors have utilized their respective backgrounds in both upbringing and career endeavors to help bridge the gap between science and disadvantaged communities. The musical piece, Changes in the Climate, illustrates the power of understanding the changes in one's life and surrounding world via delivery of concepts with hip-hop and rap. Therefore this musical composition not only integrates STEAM and music, but also serves as mechanism for outreach and encouraging diversity. Such actions could yield the success of accessing untapped potential, while fostering unique opportunities for future collaboration between professionals in geoscience

  18. HapHop-Physio: a computer game to support cognitive therapies in children

    Directory of Open Access Journals (Sweden)

    Rico-Olarte C

    2017-07-01

    Full Text Available Carolina Rico-Olarte,1 Diego M López,1 Santiago Narváez,1 Charic D Farinango,1 Peter S Pharow2 1Faculty of Electronics and Telecommunications Engineering, Universidad del Cauca, Telematics Engineering Research Group, Popayán, Colombia; 2Fraunhofer Institute of Digital Media and Technology IDMT, Ilmenau, Germany Background: Care and support of children with physical or mental disabilities are accompanied with serious concerns for parents, families, healthcare institutions, schools, and their communities. Recent studies and technological innovations have demonstrated the feasibility of providing therapy and rehabilitation services to children supported by computer games. Objective: The aim of this paper is to present HapHop-Physio, an innovative computer game that combines exercise with fun and learning, developed to support cognitive therapies in children. Methods: Conventional software engineering methods such as the Scrum methodology, a functionality test and a related usability test, were part of the comprehensive methodology adapted to develop HapHop-Physio. Results: The game supports visual and auditory attention therapies, as well as visual and auditory memory activities. The game was developed by a multidisciplinary team, which was based on the Hopscotch® platform provided by Fraunhofer Institute for Digital Media Technology IDMT Institute in Germany, and designed in collaboration with a rehabilitation clinic in Colombia. HapHop-Physio was tested and evaluated to probe its functionality and user satisfaction. Conclusion: The results show the development of an easy-to-use and funny game by a multidisciplinary team using state-of-the-art videogame technologies and software methodologies. Children testing the game concluded that they would like to play again while undergoing rehabilitation therapies. Keywords: computer game, exer-games, cognitive therapies, rehabilitation

  19. Polaron Hopping in Nano-scale Poly(dA–Poly(dT DNA

    Directory of Open Access Journals (Sweden)

    Singh Mahi

    2010-01-01

    Full Text Available Abstract We investigate the current–voltage relationship and the temperature-dependent conductance of nano-scale samples of poly(dA–poly(dT DNA molecules. A polaron hopping model has been used to calculate the I–V characteristic of nano-scale samples of DNA. This model agrees with the data for current versus voltage at temperatures greater than 100 K. The quantities G 0 , i 0 , and T 1d are determined empirically, and the conductivity is estimated for samples of poly(dA–poly(dT.

  20. Majorana zero modes in the hopping-modulated one-dimensional p-wave superconducting model.

    Science.gov (United States)

    Gao, Yi; Zhou, Tao; Huang, Huaixiang; Huang, Ran

    2015-11-20

    We investigate the one-dimensional p-wave superconducting model with periodically modulated hopping and show that under time-reversal symmetry, the number of the Majorana zero modes (MZMs) strongly depends on the modulation period. If the modulation period is odd, there can be at most one MZM. However if the period is even, the number of the MZMs can be zero, one and two. In addition, the MZMs will disappear as the chemical potential varies. We derive the condition for the existence of the MZMs and show that the topological properties in this model are dramatically different from the one with periodically modulated potential.

  1. UnoHop: Efficient Distributed Hash Table with O(1 Lookup Performance

    Directory of Open Access Journals (Sweden)

    Herry Sitepu

    2008-05-01

    Full Text Available Distributed Hash Tables (DHTs with O(1 lookup performance strive to minimize the maintenance traffic which required for propagating membership changes information (events. These events distribution allows each node in the peer-to-peer network maintains accurate routing tables with complete membership information. We present UnoHop, a novel DHT protocol with O(1 lookup performance. The protocol uses an efficient mechanism to distribute events through a dissemination tree that constructed dynamically rooted at the node that detect the events. Our protocol produces symmetric bandwidth usage at all nodes while decreasing the events propagation delay.

  2. A Hop-Count Analysis Scheme for Avoiding Wormhole Attacks in MANET

    Directory of Open Access Journals (Sweden)

    Chi-Sung Laih

    2009-06-01

    Full Text Available MANET, due to the nature of wireless transmission, has more security issues compared to wired environments. A specific type of attack, the Wormhole attack does not require exploiting any nodes in the network and can interfere with the route establishment process. Instead of detecting wormholes from the role of administrators as in previous methods, we implement a new protocol, MHA, using a hop-count analysis from the viewpoint of users without any special environment assumptions. We also discuss previous works which require the role of administrator and their reliance on impractical assumptions, thus showing the advantages of MHA.

  3. Performance analysis of dual-hop relaying systems in the presence of Co-channel interference

    KAUST Repository

    Ikki, Salama Said

    2010-12-01

    In this paper, we investigate the effect of co-channel interference on the performance of dual-hop communications with amplify-and-forward relaying. Based on the derivation of the effective signal-to-interference-plus-noise ratio (SINR) at the destination node of the system, taking into account co-channel interference, we obtain expressions for the error and outage probabilities. Moreover, we study the performance of the system in the high SINR regime. Monte-Carlo simulations are further provided and confirm the accuracy of the analytical results. ©2010 IEEE.

  4. Transcriptome analysis of bitter acid biosynthesis and precursor pathways in hop (Humulus lupulus

    Directory of Open Access Journals (Sweden)

    Clark Shawn M

    2013-01-01

    Full Text Available Abstract Background Bitter acids (e.g. humulone are prenylated polyketides synthesized in lupulin glands of the hop plant (Humulus lupulus which are important contributors to the bitter flavour and stability of beer. Bitter acids are formed from acyl-CoA precursors derived from branched-chain amino acid (BCAA degradation and C5 prenyl diphosphates from the methyl-D-erythritol 4-phosphate (MEP pathway. We used RNA sequencing (RNA-seq to obtain the transcriptomes of isolated lupulin glands, cones with glands removed and leaves from high α-acid hop cultivars, and analyzed these datasets for genes involved in bitter acid biosynthesis including the supply of major precursors. We also measured the levels of BCAAs, acyl-CoA intermediates, and bitter acids in glands, cones and leaves. Results Transcripts encoding all the enzymes of BCAA metabolism were significantly more abundant in lupulin glands, indicating that BCAA biosynthesis and subsequent degradation occurs in these specialized cells. Branched-chain acyl-CoAs and bitter acids were present at higher levels in glands compared with leaves and cones. RNA-seq analysis showed the gland-specific expression of the MEP pathway, enzymes of sucrose degradation and several transcription factors that may regulate bitter acid biosynthesis in glands. Two branched-chain aminotransferase (BCAT enzymes, HlBCAT1 and HlBCAT2, were abundant, with gene expression quantification by RNA-seq and qRT-PCR indicating that HlBCAT1 was specific to glands while HlBCAT2 was present in glands, cones and leaves. Recombinant HlBCAT1 and HlBCAT2 catalyzed forward (biosynthetic and reverse (catabolic reactions with similar kinetic parameters. HlBCAT1 is targeted to mitochondria where it likely plays a role in BCAA catabolism. HlBCAT2 is a plastidial enzyme likely involved in BCAA biosynthesis. Phylogenetic analysis of the hop BCATs and those from other plants showed that they group into distinct biosynthetic (plastidial and

  5. Exact solution of the one-dimensional fermionic model with correlated hopping

    International Nuclear Information System (INIS)

    Schadschneider, A.; Su Gang; Zittartz, J.

    1997-01-01

    We extend the Bethe Ansatz solution of a one-dimensional integrable fermionic model with correlated hopping to the parameter regime Δt > 1. It is found that the model is equivalent to one with interaction 2 - Δt, but with twisted boundary conditions. Apart from the ground state energy we investigate the low-lying excitations and the asymptotic behaviour of the correlation functions. As in the case of Δt < 1 we find dominating superconducting correlations for small doping. The behaviour in this regime therefore differs from that of the non-integrable model with symmetric bond-charge interaction (Hirsch model). (orig.)

  6. Higher order capacity statistics of multi-hop transmission systems over Rayleigh fading channels

    KAUST Repository

    Yilmaz, Ferkan

    2012-03-01

    In this paper, we present an exact analytical expression to evaluate the higher order statistics of the channel capacity for amplify and forward (AF) multihop transmission systems operating over Rayleigh fading channels. Furthermore, we present simple and efficient closed-form expression to the higher order moments of the channel capacity of dual hop transmission system with Rayleigh fading channels. In order to analyze the behavior of the higher order capacity statistics and investigate the usefulness of the mathematical analysis, some selected numerical and simulation results are presented. Our results are found to be in perfect agreement. © 2012 IEEE.

  7. [A novel dipeptidyl peptidase IV inhibitors developed through scaffold hopping and drug splicing strategy].

    Science.gov (United States)

    Wang, Shan-Chun; Zeng, Li-Li; Ding, Yu-Yang; Zeng, Shao-Gao; Song, Hong-Rui; Hu, Wen-Hui; Xie, Hui

    2014-01-01

    Though all the marketed drugs of dipeptidyl peptidase IV inhibitors are structurally different, their inherent correlation is worthy of further investigation. Herein we rapidly discovered a novel DPP-IV inhibitor 8g (IC50 = 4.9 nmol.L-1) which exhibits as good activity and selectivity as the market drugs through scaffold hopping and drug splicing strategies based on alogliptin and linagliptin. This study demonstrated that the employment of classic medicinal chemistry strategy to the marketed drugs with specific target is an efficient approach to discover novel bioactive molecules.

  8. Roma Hip Hop as a Multiculturalist Soundtrack. R-Point: The Pedagogy of a Policy

    Directory of Open Access Journals (Sweden)

    Ana Banić-Grubišić

    2016-02-01

    Full Text Available This paper examines the phenomenon of Roma hip hop in Serbia, its origins and popularization through music workshops for Roma children organized by the non-governmental organization R-Point. The paper analyzes a supposedly liberatory cultural practice, and argues that its designing „from above“, through non-governmental agencies' projects whose declarative aim is to help the Roma, actually petrifies their identity, reducing their entire cultural output to certain elements attractive to the dominant culture and traditionally recognized as „Roma“.

  9. Effects of dietary hop (Humulus lupulus L.) β-acids on quality attributes, composition and oxidative stability of pork meat.

    Science.gov (United States)

    Sbardella, Maicon; Racanicci, Aline Mc; Gois, Franz D; de Lima, Cristiane B; Migotto, Dannielle L; Costa, Leandro B; Miyada, Valdomiro S

    2018-04-01

    The effects of dietary levels of hop β-acids on physical attributes, lipid oxidation and chemical composition of pork meat were evaluated. Thirty-two castrated male pigs obtained from a complete block design feeding experiment (6.23 ± 0.42 kg initial body weight (BW) to 20.45 ± 0.95 kg final BW) and fed diets supplemented with 0, 120, 240 or 360 mg kg -1 hop β-acids during 35 days were slaughtered to sample longissimus dorsi muscle for meat analysis. No effects (P > 0.05) of dietary hop β-acids were observed on meat physical attributes. Quadratic effects (P pork meat. © 2017 Society of Chemical Industry. © 2017 Society of Chemical Industry.

  10. Mood after various brief exercise and sport modes: aerobics, hip-hop dancing, ice skating, and body conditioning.

    Science.gov (United States)

    Kim, Sungwoon; Kim, Jingu

    2007-06-01

    To investigate the potential psychological benefits of brief exercise and sport activities on positive mood alterations, 45 Korean high school and 232 undergraduate students enrolled in physical education and stress management classes voluntarily participated and were randomly assigned to one of four activities: aerobic exercise, body conditioning, hip-hop dancing, and ice skating. Mood changes from before to after exercise (2 pm to 3 pm) were measured based on a Korean translation of the Subjective Exercise Experiences Scale. The findings suggested that the aerobics and hip-hop dancing groups rated positive well-being higher than the body conditioning and ice skating groups. Immediately after exercise, psychological distress was rated lower in the aerobics and hip-hop dancing groups, as was fatigue.

  11. The Hip Hop peer crowd: An opportunity for intervention to reduce tobacco use among at-risk youth.

    Science.gov (United States)

    Walker, Matthew W; Navarro, Mario A; Hoffman, Leah; Wagner, Dana E; Stalgaitis, Carolyn A; Jordan, Jeffrey W

    2018-07-01

    Peer crowds, peer groups with macro-level connections and shared norms that transcend geography and race/ethnicity, have been linked to risky health behaviors. Research has demonstrated that Hip Hop peer crowd identification, which is common among multicultural youth, is associated with increased risk of tobacco use. To address this, the FDA Center for Tobacco Products created Fresh Empire, the first national tobacco education campaign tailored for Hip Hop youth aged 12-17 who are multicultural (Hispanic, African American, Asian-Pacific Islander, or Multiracial). As part of campaign development, peer crowd (Hip Hop, Mainstream, Popular, Alternative, Country) and cigarette smoking status were examined for the first time with a nationally recruited sample. Youth were recruited via targeted social media advertisements. Participants aged 13-17 (n = 5153) self-reported peer crowd identification via the I-Base Survey™ and cigarette smoking status. Differences in smoking status by peer crowd were examined using chi-square and followed up with z-tests to identify specific differences. Alternative youth were most at risk of cigarette smoking, followed by Hip Hop. Specifically, Hip Hop youth were significantly less likely to be Non-susceptible Non-triers than Popular, Mainstream, and Country youth, and more likely to be Experimenters than Popular and Mainstream youth. Representative studies show that Alternative is relatively small compared to other high-risk crowds, such as the Hip Hop peer crowd. The current research underscores the potential utility of interventions tailored to larger at-risk crowds for campaigns like Fresh Empire. Published by Elsevier Ltd.

  12. Hop resistance in the beer spoilage bacterium Lactobacillus brevis is mediated by the ATP-binding cassette multidrug transporter HorA

    NARCIS (Netherlands)

    Sakamoto, K; Margolles, A; van Veen, HW; Konings, WN

    Lactobacillus brevis is a major contaminant of spoiled beer. The organism can grow in beer in spite of the presence of antibacterial hop compounds that give the beer a bitter taste. The hop resistance in L. brevis is, at least in part, dependent on the expression of the horA gene. The deduced amino

  13. White Privilege? The Intersection of Hip-Hop and Whiteness as a Catalyst for Cross-Racial Interaction among White Males

    Science.gov (United States)

    Sulé, Venice Thandi

    2015-01-01

    Given the prevalence of racial segregation in the U.S., college is an opportunity to prepare students for diversity through cross-racial interaction. Hip-hop, a culture steeped in black and Latino experiences, has significant white supporters. Through diversity and critical whiteness frameworks, this research considers how white hip-hop collegians…

  14. Schooling Teachers, Schooling Ourselves: Insights and Reflections from Teaching K-12 Teachers How to Use Hip-Hop to Educate Students

    Science.gov (United States)

    Irby, Decoteau J.; Hall, H. Bernard; Hill, Marc L.

    2013-01-01

    Hip-hop-based education (HHBE) research analyzes how hip-hop culture is used to produce favorable educational outcomes. Despite its richness, the work reveals little about how to prepare practicing K-12 teachers to use HHBE toward the critical ends reflected in extant HHBE literature. In this article, we challenge many tacit assumptions of HHBE…

  15. The Mouse That Soared

    Science.gov (United States)

    2004-09-01

    Astronomers have used an X-ray image to make the first detailed study of the behavior of high-energy particles around a fast moving pulsar. The image, from NASA's Chandra X-ray Observatory, shows the shock wave created as a pulsar plows supersonically through interstellar space. These results will provide insight into theories for the production of powerful winds of matter and antimatter by pulsars. Chandra's image of the glowing cloud, known as the Mouse, shows a stubby bright column of high-energy particles, about four light years in length, swept back by the pulsar's interaction with interstellar gas. The intense source at the head of the X-ray column is the pulsar, estimated to be moving through space at about 1.3 million miles per hour. VLA Radio Image of the Mouse, Full Field VLA Radio Image of the Mouse, Full Field A cone-shaped cloud of radio-wave-emitting particles envelopes the X-ray column. The Mouse, a.k.a. G359.23-0.82, was discovered in 1987 by radio astronomers using the National Science Foundation's Very Large Array in New Mexico. It gets its name from its appearance in radio images that show a compact snout, a bulbous body, and a remarkable long, narrow, tail that extends for about 55 light years. "A few dozen pulsar wind nebulae are known, including the spectacular Crab Nebula, but none have the Mouse's combination of relatively young age and incredibly rapid motion through interstellar space," said Bryan Gaensler of the Harvard-Smithsonian Center for Astrophysics and lead author of a paper on the Mouse that will appear in an upcoming issue of The Astrophysical Journal. "We effectively are seeing a supersonic cosmic wind tunnel, in which we can study the effects of a pulsar's motion on its pulsar wind nebula, and test current theories." Illustration of the Mouse System Illustration of the Mouse System Pulsars are known to be rapidly spinning, highly magnetized neutron stars -- objects so dense that a mass equal to that of the Sun is packed into a

  16. Trapping-to-percolation transition in the hopping diffusion of substitutionally disordered solids with a binary energy distribution

    International Nuclear Information System (INIS)

    Parris, P.E.; Bookout, B.D.

    1993-01-01

    We consider charge carriers that undergo nearest-neighbor hopping among the sites of a binary random lattice, each site of which is associated with one of two possible energies E 1 or E 2 . A general and recently observed feature of this problem not predicted by previous treatments of disordered hopping models is a crossover between trap-limited conduction and percolation. We introduce new energy-projected equations of motion whose solutions reveal the deep conductivity minimum associated with this phenomenon, and compare the results predicted to numerical simulations

  17. Enhancing Network Quality using Baseband Frequency Hopping, Downlink Power Control and DTX in a Live GSM Network

    DEFF Research Database (Denmark)

    Nielsen, Thomas Toftegaard; Wagard, Jeroen; Skjærris, Søren

    1998-01-01

    Baseband frequency hopping in the combination with downlink power control and discontinuous transmission has been investigated as a quality improving feature in a live GSM network. Using the dropped call rate and the frame erasure rate to measure the network quality, the use of frequency hopping...... to the statistical inaccuracy with discontinuous transmission in GSM and maybe due to poor performance of the mobile stations, was encountered. The current status is therefore to reject the use of downlink discontinuous transmission until more information about the performance of the mobile stations is found...

  18. Multi-hop amplify-and-forward relaying cooperation in the presence of I/Q imbalance

    KAUST Repository

    Qi, Jian; Aï ssa, Sonia; Alouini, Mohamed-Slim

    2013-01-01

    In this paper, multi-hop cooperative networks implementing channel state information (CSI)-assisted amplify-and-forward (AF) relaying in the presence of in-phase and quadrature-phase (I/Q) imbalance are investigated. We propose a compensation algorithm for the I/Q imbalance. The performance of the multi-hop CSI-assisted AF cooperative networks with and without compensation for I/Q imbalance in Nakagami-m fading environment is evaluated in terms of average symbol error probability. Numerical results are provided and show that the proposed compensation method can effectively mitigate the impact of I/Q imbalance. © 2013 IEEE.

  19. Charge transport properties of DNA aperiodic molecule: The role of interbase hopping in Watson-Crick base pair

    Science.gov (United States)

    Sinurat, E. N.; Yudiarsah, E.

    2017-07-01

    The charge transport properties of DNA aperiodic molecule has been studied by considering various interbase hopping parameter on Watson-Crick base pair. 32 base pairs long double-stranded DNA aperiodic model with sequence GCTAGTACGTGACGTAGCTAGGATATGCCTGA on one chain and its complement on the other chain is used. Transfer matrix method has been used to calculate transmission probabilities, for determining I-V characteristic using Landauer Büttiker formula. DNA molecule is modeled using tight binding hamiltonian combined with the theory of Slater-Koster. The result show, the increment of Watson-Crick hopping value leads to the transmission probabilities and current of DNA aperiodic molecule increases.

  20. The Association Between Knee Confidence and Muscle Power, Hop Performance, and Postural Orientation in People With Anterior Cruciate Ligament Injury

    DEFF Research Database (Denmark)

    Ageberg, Eva; Roos, Ewa M

    2016-01-01

    power, hop performance, and postural orientation (test for substitution patterns score) as independent variables (absolute value on the injured leg, and limb symmetry index [LSI; injured leg/uninjured leg × 100] or absolute difference between the injured and uninjured legs). Results Sixteen patients...... for substitution patterns scores. In the multivariable analysis, worse vertical jump LSI (P = .043) and worse side hop LSI (P = .012) significantly accounted for 25% of the variation in perceived knee confidence. Conclusion Between-leg differences during demanding tasks are associated with knee confidence...