Rapid differentiation of Chinese hop varieties (Humulus lupulus) using volatile fingerprinting by HS-SPME-GC-MS combined with multivariate statistical analysis.

Science.gov (United States)

Liu, Zechang; Wang, Liping; Liu, Yumei

2018-01-18

Hops impart flavor to beer, with the volatile components characterizing the various hop varieties and qualities. Fingerprinting, especially flavor fingerprinting, is often used to identify 'flavor products' because inconsistencies in the description of flavor may lead to an incorrect definition of beer quality. Compared to flavor fingerprinting, volatile fingerprinting is simpler and easier. We performed volatile fingerprinting using head space-solid phase micro-extraction gas chromatography-mass spectrometry combined with similarity analysis and principal component analysis (PCA) for evaluating and distinguishing between three major Chinese hops. Eighty-four volatiles were identified, which were classified into seven categories. Volatile fingerprinting based on similarity analysis did not yield any obvious result. By contrast, hop varieties and qualities were identified using volatile fingerprinting based on PCA. The potential variables explained the variance in the three hop varieties. In addition, the dendrogram and principal component score plot described the differences and classifications of hops. Volatile fingerprinting plus multivariate statistical analysis can rapidly differentiate between the different varieties and qualities of the three major Chinese hops. Furthermore, this method can be used as a reference in other fields. © 2018 Society of Chemical Industry. © 2018 Society of Chemical Industry.

Exact Results on Quantum Interference and Magnetoconductance in Variable-Range Hopping

Science.gov (United States)

Lin, Yeong-Lieh; Nori, Franco

1997-03-01

We study quantum interference effects on the transition strength for strongly localized electrons hopping on 2D square and 3D cubic lattices in a magnetic field B. In 2D, we obtain closed-form expressions for the tunneling probability between two arbitrary sites by exactly summing the corresponding phase factors of all directed paths connecting them. An analytic expression for the magnetoconductance, as an explicit function of the magnetic flux, is derived. A positive MC is clearly observed when turning on the magnetic field. When the strength of B reaches a certain value, which is inversely proportional to twice the hopping length, the MC is increased by a factor of two compared to that at zero field. The periodicity in the flux of the MC is found to be equal to hc/2e. In the experimentally important 3D case, we show how the interference patterns and the small-B behavior of the magnetoconductance vary according to the orientation of B. Furthermore, for a 3D sample, the effect on the low-flux MC due to the randomness of the angles between the hopping direction and the orientation of B is examined analytically.(Y.-L. Lin and F. Nori, Phys. Rev. Lett. 76), 4580 (1996); Phys. Rev. B 53, 15543 (1996).

The effect of correlations on the non-ohmic behavior of the small-polaron hopping conductivity in 1D and 3D disordered systems

International Nuclear Information System (INIS)

Dimakogianni, M; Triberis, G P

2010-01-01

According to percolation theory the investigation of charge transport in disordered systems is equivalent to the study of the possibility of the passage of the carriers through a random network of impedances which interconnect the different lattice sites. When the site energies are not the same, the energy of a site affects the incoming as well as the outgoing impedances connected to the given site and this gives rise to correlations between neighboring impedances. This new condition characterizes the transport process and imposes the evaluation of the average number of sites accessible by a bond from a given site for all possible configurations of sites that satisfy the percolation condition. The generalized molecular crystal model, appropriate for the study of small-polaron hopping transport in disordered systems, and the Kubo formula permit the evaluation of these impedances. Taking correlations into account, theoretical percolation considerations applicable to one-dimensional and three-dimensional disordered systems, lead to analytical expressions for the temperature and electric field dependence of the DC conductivity at high (multi-phonon-assisted hopping) and low (few-phonon-assisted hopping) temperatures. The theoretical analysis reveals the effect of correlations on the non-ohmic behavior of the small-polaron hopping conductivity and permits the evaluation of the maximum hopping distance. Quantitative estimates of this effect are presented comparing the theoretical results, including correlations with those ignoring them, previously reported, applying them to recent experimental data for a wide temperature range and from low up to moderate electric fields.

Perceived bitterness character of beer in relation to hop variety and the impact of hop aroma.

Science.gov (United States)

Oladokun, Olayide; James, Sue; Cowley, Trevor; Dehrmann, Frieda; Smart, Katherine; Hort, Joanne; Cook, David

2017-09-01

The impact of hop variety and hop aroma on perceived beer bitterness intensity and character was investigated using analytical and sensory methods. Beers made from malt extract were hopped with 3 distinctive hop varieties (Hersbrucker, East Kent Goldings, Zeus) to achieve equi-bitter levels. A trained sensory panel determined the bitterness character profile of each singly-hopped beer using a novel lexicon. Results showed different bitterness character profiles for each beer, with hop aroma also found to change the hop variety-derived bitterness character profiles of the beer. Rank-rating evaluations further showed the significant effect of hop aroma on selected key bitterness character attributes, by increasing perceived harsh and lingering bitterness, astringency, and bitterness intensity via cross-modal flavour interactions. This study advances understanding of the complexity of beer bitterness perception by demonstrating that hop variety selection and hop aroma both impact significantly on the perceived intensity and character of this key sensory attribute. Copyright © 2017 Elsevier Ltd. All rights reserved.

Hip-Hop Guayaquil: culturas viajeras e identidades locales

Directory of Open Access Journals (Sweden)

1999-01-01

Full Text Available HIP-HOP GUAYAQUIL: CULTURES ITINÉRANTES ET IDENTITES LOCALES. Le hip-hop est un style de musique contemporaine caractérisé par une orchestration d’œuvres lyriques rapées, la superposition de morceaux de musique enregistrés dans le passé par différents artistes, et une instrumentation électronique, tout cela sur des rythmes de basse réguliers et constants. Le hip-hop, musique accompagnée de ses propres danses et de sa mode, est le produit du déplacement et de la transformation d’une variété d’idéologies politiques de la communauté noire qui se constituent à partir de relations qui se modifient entre elles, et en relation avec les cultures dominantes contre lesquelles elles luttent quotidiennement. À l’origine, le hip-hop est lié à des mouvements d’identité de jeunes noirs. Dans cet article, il est intéressant d’étudier le rôle du hip-hop dans la formulation d’une identité entre jeunes métisses et noirs des secteurs populaires de Guayaquil. Cet exemple illustre la nécessité d’inclure dans l’analyse les dimensions politiques des processus de traduction du global au niveau local. El hip-hop es un género de música contemporánea caracterizado por la orquestación de líricas que son rapeadas, superposición de fragmentos de música grabada en el pasado por diferentes artistas, e instrumentación electrónica, todo ello sobre ritmos de bajo regulares y constantes. Como un tipo de música acompañado por sus propias formas de danza y moda, el hip-hop es producto del viaje y la transformación de una variedad de ideologías políticas de la comunidad negra que se constituyen a sí mismas en relaciones cambiantes entre sí y en relación a las culturas dominantes contra las cuales luchan cotidianamente. El hip-hop está ligado, en su contexto originario, a políticas de identidad defendidas por jóvenes negros. Lo que interesa explorar en este artículo es el papel del hip-hop en la formulación de una identidad

Low-Complexity Combining Schemes in Dual-Hop AF Relaying Systems

KAUST Repository

Gaaloul, Fakhreddine

2011-07-18

This paper investigates the performance of different low-complexity combining schemes in the context of dual-hop amplify-and-forward (AF) relaying networks. It is assumed that the relay uses single transmit (receive) antenna due to space limitation and to reduce the processing complexity. On the other hand, the transmitter and the receiver use antenna arrays to improve the overall diversity gain. However, this gain is achieved at the expense of increased processing complexity and power consumption. To this end, some combining schemes aiming at reducing the processing complexity and decreasing the number of active receive channels are investigated. Through the analysis, new formulas for the end-to-end signal-to-noise ratio (SNR) statistics in slowly varying and frequency flat Rayleigh fading channels are derived, which are then used to present some performance measures. Numerical and simulation results are presented to clarify the trade-off between the achieved diversity gain and the receive processing complexity. © 2011 IEEE.

Wireless Multi Hop Access Networks and Protocols

OpenAIRE

Nilsson Plymoth, Anders

2007-01-01

As more and more applications and services in our society now depend on the Internet, it is important that dynamically deployed wireless multi hop networks are able to gain access to the Internet and other infrastructure networks and services. This thesis proposes and evaluates solutions for providing multi hop Internet Access. It investigates how ad hoc networks can be combined with wireless and mesh networks in order to create wireless multi hop access networks. When several access points t...

Helicobacter pylori HopE and HopV porins present scarce expression among clinical isolates

Science.gov (United States)

Lienlaf, Maritza; Morales, Juan Pablo; Díaz, María Inés; Díaz, Rodrigo; Bruce, Elsa; Siegel, Freddy; León, Gloria; Harris, Paul R; Venegas, Alejandro

2010-01-01

AIM: To evaluate how widely Helicobacter pylori (H. pylori) HopE and HopV porins are expressed among Chilean isolates and how seroprevalent they are among infected patients in Chile. METHODS: H. pylori hopE and hopV genes derived from strain CHCTX-1 were cloned by polymerase chain reaction (PCR), sequenced and expressed in Escherichia coli AD494 (DE3). Gel-purified porins were used to prepare polyclonal antibodies. The presence of both genes was tested by PCR in a collection of H. pylori clinical isolates and their expression was detected in lysates by immunoblotting. Immune responses against HopE, HopV and other H. pylori antigens in sera from infected and non-infected patients were tested by Western blotting using these sera as first antibody on recombinant H. pylori antigens. RESULTS: PCR and Western blotting assays revealed that 60 and 82 out of 130 Chilean isolates carried hopE and hopV genes, respectively, but only 16 and 9, respectively, expressed these porins. IgG serum immunoreactivity evaluation of 69 H. pylori-infected patients revealed that HopE and HopV were infrequently recognized (8.7% and 10.1% respectively) compared to H. pylori VacA (68.1%) and CagA (59.5%) antigens. Similar values were detected for IgA serum immunoreactivity against HopE (11.6%) and HopV (10.5%) although lower values for VacA (42%) and CagA (17.4%) were obtained when compared to the IgG response. CONCLUSION: A scarce expression of HopE and HopV among Chilean isolates was found, in agreement with the infrequent seroconversion against these antigens when tested in infected Chilean patients. PMID:20082477

Fluctuation kinetics of fluorescence hopping quenching in the Nd3+:Y2O3 spherical nanoparticles

International Nuclear Information System (INIS)

Orlovskii, Yu.V.; Popov, A.V.; Platonov, V.V.; Fedorenko, S.G.; Sildos, I.; Osipov, V.V.

2013-01-01

We study the peculiarities of energy transfer kinetics from the 4 F 3/2 laser level in the Nd 3+ doped Y 2 O 3 spherical nanoparticles of monoclinic phase synthesized by laser ablation of solid targets with subsequent recondensation in flow of air at atmospheric pressure comparing to the similar bulk crystal. We show that the fluorescence quenching in the nanoparticles is determined by two processes depending on Nd 3+ concentration and the degree of dehydration. At concentrations less than 1% the fluorescence quenching is mainly determined by direct (static) quenching by vibrations of OH − molecular groups associated with oxygen vacancies. At concentrations greater than 1 at % quenching is due to energy migration over neodymium ions, followed by the Nd 3+ –OH − quenching. In the latter case, the first time in a solid-state impurity laser medium we observe non-stationary kinetics on the entire length of a time-dependent luminescence quenching, starting from static decay and ending with fluctuation kinetics of fluorescence hopping quenching. -- Highlights: ► We prepare monoclinic Nd 3+ :Y 2 O 3 spherical NPs of mean D=12 nm by laser ablation of solid targets. ► We detect the fluorescence quenching of Nd 3+ the 4 F 3/2 level by vibrations of OH – molecular groups. ► We find that at 0.1% of Nd 3+ the process of static quenching by vibrations of OH – dominates. ► We find that Nd 3+ –Nd 3+ energy migration accelerates the Nd 3+ –OH − quenching at 1% of Nd 3+ . ► We detect non-stationary quenching kinetics ending with fluctuation stage of hopping quenching

Potential Cost Savings for Use of 3D Printing Combined With 3D Imaging and CPLM for Fleet Maintenance and Revitalization

Science.gov (United States)

2014-04-30

bäÉîÉåíÜ=^ååì~ä=^Åèìáëáíáçå= oÉëÉ~êÅÜ=póãéçëáìã= qÜìêëÇ~ó=pÉëëáçåë= sçäìãÉ=ff= = Potential Cost Savings for Use of 3D Printing Combined With 3D...TYPE 3. DATES COVERED 00-00-2014 to 00-00-2014 4. TITLE AND SUBTITLE Potential Cost Savings for Use of 3D Printing Combined With 3D Imaging and...Chair: RADM David Lewis, USN Program Executive Officer, SHIPS Potential Cost Savings for Use of 3D Printing Combined With 3D Imaging and CPLM for

Variable-range hopping in 2D quasi-1D electronic systems

International Nuclear Information System (INIS)

Teber, S.

2005-12-01

A semi-phenomenological theory of variable-range hopping (VRH) is developed for two-dimensional (2D) quasi-one-dimensional (quasi-1D) systems such as arrays of quantum wires in the Wigner crystal regime. The theory follows the phenomenology of Efros, Mott and Shklovskii allied with microscopic arguments. We first derive the Coulomb gap in the single-particle density of states, g(ε), where ε is the energy of the charge excitation. We then derive the main exponential dependence of the electron conductivity in the linear (L), i.e. σ(T) ∼ exp [-(T L /T) γL ], and current in the non-linear (NL), i.e. j(E) ∼ [-(E NL /E) γNL ], response regimes (E is the applied electric field). Due to the strong anisotropy of the system and its peculiar dielectric properties we show that unusual, with respect to known results, Coulomb gaps open followed by unusual VRH laws, i.e. with respect to the disorder-dependence of T L and E NL and the values of γ L and γ NL . (author)

Cultivated grapevines represent a symptomless reservoir for the transmission of hop stunt viroid to hop crops: 15 years of evolutionary analysis.

Directory of Open Access Journals (Sweden)

Yoko Kawaguchi-Ito

Full Text Available Hop stunt was a mysterious disorder that first emerged in the 1940s in commercial hops in Japan. To investigate the origin of this disorder, we infected hops with natural Hop stunt viroid (HpSVd isolates derived from four host species (hop, grapevine, plum and citrus, which except for hop represent possible sources of the ancestral viroid. These plants were maintained for 15 years, then analyzed the HpSVd variants present. Here we show that the variant originally found in cultivated grapevines gave rise to various combinations of mutations at positions 25, 26, 54, 193, and 281. However, upon prolonged infection, these variants underwent convergent evolution resulting in a limited number of adapted mutants. Some of them showed nucleotide sequences identical to those currently responsible for hop stunt epidemics in commercial hops in Japan, China, and the United States. Therefore, these results indicate that we have successfully reproduced the original process by which a natural HpSVd variant naturally introduced into cultivated hops was able to mutate into the HpSVd variants that are currently present in commercial hops. Furthermore, and importantly, we have identified cultivated grapevines as a symptomless reservoir in which HSVd can evolve and be transmitted to hop crops to cause epidemics.

Combining 2D angiogenesis and 3D osteosarcoma microtissues to improve vascularization.

Science.gov (United States)

Chaddad, Hassan; Kuchler-Bopp, Sabine; Fuhrmann, Guy; Gegout, Hervé; Ubeaud-Sequier, Geneviève; Schwinté, Pascale; Bornert, Fabien; Benkirane-Jessel, Nadia; Idoux-Gillet, Ysia

2017-11-15

Angiogenesis is now well known for being involved in tumor progression, aggressiveness, emergence of metastases, and also resistance to cancer therapies. In this study, to better mimic tumor angiogenesis encountered in vivo, we used 3D culture of osteosarcoma cells (MG-63) that we deposited on 2D endothelial cells (HUVEC) grown in monolayer. We report that endothelial cells combined with tumor cells were able to form a well-organized network, and that tubule-like structures corresponding to new vessels infiltrate tumor spheroids. These vessels presented a lumen and expressed specific markers as CD31 and collagen IV. The combination of 2D endothelial cells and 3D microtissues of tumor cells also increased expression of angiogenic factors as VEGF, CXCR4 and ICAM1. The cell environment is the key point to develop tumor vascularization in vitro and to be closer to tumor encountered in vivo. Copyright © 2017 Elsevier Inc. All rights reserved.

Two-dimensional variable range hopping in the spin-liquid candidate κ-(BEDT-TTF)2Cu2(CN)3

International Nuclear Information System (INIS)

Čulo, M.; Tafra, E.; Basletić, M.; Tomić, S.; Hamzić, A.; Korin-Hamzić, B.; Dressel, M.; Schlueter, J.A.

2015-01-01

We present the measurements of the magnetotransport properties of the spin liquid candidate κ-(BEDT-TTF) 2 Cu 2 (CN) 3 . The temperature dependencies of dc resistivity and Hall coefficient R H as well as magnetoresistance at fixed temperatures in magnetic fields up to 5 T suggest that the charge transport takes place via 2D variable range hopping among localized states

Particle trapping and hopping in an optofluidic fishnet

Science.gov (United States)

Shi, Y. Z.; Xiong, S.; Zhang, Y.; Chin, L. K.; Wu, J. H.; Chen, T. N.; Liu, A. Q.

2017-08-01

Particle jumping between optical potentials has attracted much attention owing to its extensive involvement in many physical and biological experiments. In some circumstances, particle jumping indicates escaping from the optical trap, which is an issue people are trying to avoid. Nevertheless, particle jumping can facilitate the individual trap in each laser spot in the optical lattice and enable sorting and delivery of nanoparticles. Particle hopping has not been seen in fluid because Fluidic drag force dramatically reduce the dwell time of particle or break the potential well. Here, we observe particle hopping in the microchannel by three reasons, e.g., particle collision or aggregation, light disturbing by pretrapped particle and fake trapping position. We show that commonly ignored particle influence to the light could create a new isolated trapping position, where particle hops to the adjacent potential well. The hopping happens in an optofluidic fishnet which is comprised of discrete hotspots enabling 2D patterning of particles in the flow stream for the first time. We also achieve a 2D patterning of cryptosporidium in the microchannel. Our observed particle hopping in the flow stream completes the family of particle kinetics in potential wells and inspires new interests in the particle disturbed optical trapping. The 2D patterning of particles benefits the parallel study of biological samples in the flow stream and have potential on cell sorting and drug delivery.

Communication: Fully coherent quantum state hopping

Energy Technology Data Exchange (ETDEWEB)

Martens, Craig C., E-mail: cmartens@uci.edu [University of California, Irvine, California 92697-2025 (United States)

2015-10-14

In this paper, we describe a new and fully coherent stochastic surface hopping method for simulating mixed quantum-classical systems. We illustrate the approach on the simple but unforgiving problem of quantum evolution of a two-state quantum system in the limit of unperturbed pure state dynamics and for dissipative evolution in the presence of both stationary and nonstationary random environments. We formulate our approach in the Liouville representation and describe the density matrix elements by ensembles of trajectories. Population dynamics are represented by stochastic surface hops for trajectories representing diagonal density matrix elements. These are combined with an unconventional coherent stochastic hopping algorithm for trajectories representing off-diagonal quantum coherences. The latter generalizes the binary (0,1) “probability” of a trajectory to be associated with a given state to allow integers that can be negative or greater than unity in magnitude. Unlike existing surface hopping methods, the dynamics of the ensembles are fully entangled, correctly capturing the coherent and nonlocal structure of quantum mechanics.

Pertunjukan Teater Karo Hip Hop Kontemporer KAI

Directory of Open Access Journals (Sweden)

Silvia Anggreni Purba

2013-11-01

Pertunjukan Teater Karo Hip Hop Kontemporer KAI. The performance of Karo Theater collaborated with Hip Hop stems from a simple idea to collaborate Karo cultural traditions with popular culture. The performances can be enjoyed without having limitation on the language and culture. The process of combining two different cultures is a form of hybrid culture, and it may occur due to the globalization process. Through the process of deposition of the observations and strong impression, this performance is then brought into the form of Hip Hop as a preferred form which is energetic, personal and global. This performance is part of a modern tragedy with its destructive character which has explored the emotion and has presented it to the audiences. The exploration of Karo cultural tradition and Hip Hop dance as a language of symbols is able to reinforce words. The movement is not revealed by the verbal phrase but is presented through the movement of Hip Hop dance. The interpretation of the legend and texts into movement is carried out through the training process at the laboratory as a searching process and experiment, and afterward can be realized by considering the basic elements of Hip Hop, Karo cultural elements and performance. Karo Hip Hop Theatre is expected to become a preferred aesthetic form of a modern theater without losing its tradition form. Keyword: a contemporary Karo theater, Hip Hop, hybrid culture.

Studying the hopping parameters of half-Heusler NaAuS using maximally localized Wannier function

Science.gov (United States)

Sihi, Antik; Lal, Sohan; Pandey, Sudhir K.

2018-04-01

Here, the electronic behavior of half-Heusler NaAuS is studied using PBEsol exchange correlation functional by plotting the band structure curve. These bands are reproduced using maximally localized Wannier function using WANNIER90. Tight-binding bands are nicely matched with density functional theory bands. By fitting the tight-binding model, hopping parameter for NaAuS is obtained by including Na 2s, 2p, Au 6s, 5p, 5d and S 3s, 3p orbitals within the energy interval of -5 to 16 eV around the Fermi level. In present study, hopping integrals for NaAuS are computed for the first primitive unit cell atoms as well as the first nearest neighbor primitive unit cell. The most dominating hopping integrals are found for Na (3s) - S (3s), Na (2px) - S (2px), Au (6s) - S (3px), Au (6s) - S (3py) and Au (6s) - S (3pz) orbitals. The hopping integrals for the first nearest neighbor primitive unit cell are also discussed in this manuscript. In future, these hopping integrals are very important to find the topological invariant for NaAuS compound.

Electron hopping through proteins

Czech Academy of Sciences Publication Activity Database

Warren, J. J.; Ener, M. E.; Vlček, Antonín; Winkler, J. R.; Gray, H. B.

2012-01-01

Roč. 256, 21-22 (2012), s. 2478-2487 ISSN 0010-8545 R&D Projects: GA MŠk(CZ) ME10124 Institutional support: RVO:61388955 Keywords : electron transfer * multistep tunneling * hopping maps Subject RIV: CG - Electrochemistry Impact factor: 11.016, year: 2012

Effect of electronic coupling of Watson-Crick hopping in DNA poly(dA)-poly(dT)

Science.gov (United States)

Risqi, A. M.; Yudiarsah, E.

2017-07-01

Charge transport properties of poly(dA)-poly(dT) DNA has been studied by using thigh binding Hamiltonian approach. Molecule DNA that we use consist of 32 base pair of adenine (A) and thymine (T) and backbone is consist of phosphate and sugar. The molecule DNA is contacted electrode at both ends. Charge transport in molecule DNA depend on the environment, we studied the effect of electronic coupling of Watson-Crick hopping in poly(dA)-poly(dT) DNA to transmission probability and characteristic I-V. The electronic coupling constant influence charge transport between adenine-thymine base pairs at the same site. Transmission probability is studied by using transfer matrix and scattering matrix method, and the result of transmission probability is used to calculate the characteristic I-V by using formula Landauer Buttiker. The result shows that when the electronic coupling increase then transmission probability and characteristic I-V increase slightly.

Hydrodynamic mean-field solutions of 1D exclusion processes with spatially varying hopping rates

Energy Technology Data Exchange (ETDEWEB)

Lakatos, Greg; O' Brien, John; Chou, Tom [Department of Biomathematics and Institute for Pure and Applied Mathematics, UCLA, Los Angeles, CA 90095 (United States)

2006-03-10

We analyse the open boundary partially asymmetric exclusion process with smoothly varying internal hopping rates in the infinite-size, mean-field limit. The mean-field equations for particle densities are written in terms of Ricatti equations with the steady-state current J as a parameter. These equations are solved both analytically and numerically. Upon imposing the boundary conditions set by the injection and extraction rates, the currents J are found self-consistently. We find a number of cases where analytic solutions can be found exactly or approximated. Results for J from asymptotic analyses for slowly varying hopping rates agree extremely well with those from extensive Monte Carlo simulations, suggesting that mean-field currents asymptotically approach the exact currents in the hydrodynamic limit, as the hopping rates vary slowly over the lattice. If the forward hopping rate is greater than or less than the backward hopping rate throughout the entire chain, the three standard steady-state phases are preserved. Our analysis reveals the sensitivity of the current to the relative phase between the forward and backward hopping rate functions.

Hydrodynamic mean-field solutions of 1D exclusion processes with spatially varying hopping rates

International Nuclear Information System (INIS)

Lakatos, Greg; O'Brien, John; Chou, Tom

2006-01-01

We analyse the open boundary partially asymmetric exclusion process with smoothly varying internal hopping rates in the infinite-size, mean-field limit. The mean-field equations for particle densities are written in terms of Ricatti equations with the steady-state current J as a parameter. These equations are solved both analytically and numerically. Upon imposing the boundary conditions set by the injection and extraction rates, the currents J are found self-consistently. We find a number of cases where analytic solutions can be found exactly or approximated. Results for J from asymptotic analyses for slowly varying hopping rates agree extremely well with those from extensive Monte Carlo simulations, suggesting that mean-field currents asymptotically approach the exact currents in the hydrodynamic limit, as the hopping rates vary slowly over the lattice. If the forward hopping rate is greater than or less than the backward hopping rate throughout the entire chain, the three standard steady-state phases are preserved. Our analysis reveals the sensitivity of the current to the relative phase between the forward and backward hopping rate functions

Automated assignment and 3D structure calculations using combinations of 2D homonuclear and 3D heteronuclear NOESY spectra

International Nuclear Information System (INIS)

Oezguen, Numan; Adamian, Larisa; Xu Yuan; Rajarathnam, Krishna; Braun, Werner

2002-01-01

The NOAH/DIAMOD suite uses feedback filtering and self-correcting distance geometry to generate 3D structures from unassigned NOESY spectra. In this study we determined the minimum set of experiments needed to generate a high quality structure bundle. Different combinations of 3D 15 N-edited, 13 C-edited HSQC-NOESY and 2D homonuclear 1 H- 1 H NOESY spectra of the 77 amino acid protein, myeloid progenitor inhibitory factor-1 (MPIF-1) were used as input for NOAH/DIAMOD calculations. The quality of the assignments of NOESY cross peaks and the accuracy of the automatically generated 3D structures were compared to those obtained with a conventional manual procedure. Combining data from two types of experiments synergistically increased the number of peaks assigned unambiguously in both individual spectra. As a general trend for the accuracy of the structures we observed structural variations in the backbone fold of the final structures of about 2 A for single spectral data, of 1 A to 1.5 A for double spectral data, and of 0.6 A for triple spectral data sets. The quality of the assignments and 3D structures from the optimal data using all three spectra were similar to those obtained from traditional assignment methods with structural variations within the bundle of 0.6 A and 1.3 A for backbone and heavy atoms, respectively. Almost all constraints (97%) of the automatic NOESY cross peak assignments were cross compatible with the structures from the conventional manual assignment procedure, and an even larger proportion (99%) of the manually derived constraints were compatible with the automatically determined 3D structures. The two mean structures determined by both methods differed only by 1.3 A rmsd for the backbone atoms in the well-defined regions of the protein. Thus NOAD/DIAMOD analysis of spectra from labeled proteins provides a reliable method for high throughput analysis of genomic targets

Extreme Kinematics in Selected Hip Hop Dance Sequences.

Science.gov (United States)

Bronner, Shaw; Ojofeitimi, Sheyi; Woo, Helen

2015-09-01

Hip hop dance has many styles including breakdance (breaking), house, popping and locking, funk, streetdance, krumping, Memphis jookin', and voguing. These movements combine the complexity of dance choreography with the challenges of gymnastics and acrobatic movements. Despite high injury rates in hip hop dance, particularly in breakdance, to date there are no published biomechanical studies in this population. The purpose of this study was to compare representative hip hop steps found in breakdance (toprock and breaking) and house and provide descriptive statistics of the angular displacements that occurred in these sequences. Six expert female hip hop dancers performed three choreographed dance sequences, top rock, breaking, and house, to standardized music-based tempos. Hip, knee, and ankle kinematics were collected during sequences that were 18 to 30 sec long. Hip, knee, and ankle three-dimensional peak joint angles were compared in repeated measures ANOVAs with post hoc tests where appropriate (pHip hop maximal joint angles exceeded reported activities of daily living and high injury sports such as gymnastics. Hip hop dancers work at weight-bearing joint end ranges where muscles are at a functional disadvantage. These results may explain why lower extremity injury rates are high in this population.

Wish to Live: The Hip-Hop Feminism Pedagogy Reader. Educational Psychology. Volume 3

Science.gov (United States)

Brown, Ruth Nicole, Ed.; Kwakye, Chamara Jewel, Ed.

2012-01-01

"Wish To Live: The Hip-hop Feminism Pedagogy Reader" moves beyond the traditional understanding of the four elements of hip-hop culture--rapping, breakdancing, graffiti art, and deejaying--to articulate how hip-hop feminist scholarship can inform educational practices and spark, transform, encourage, and sustain local and global youth…

BER Analysis Using Beat Probability Method of 3D Optical CDMA Networks with Double Balanced Detection

Directory of Open Access Journals (Sweden)

Chih-Ta Yen

2015-01-01

Full Text Available This study proposes novel three-dimensional (3D matrices of wavelength/time/spatial code for code-division multiple-access (OCDMA networks, with a double balanced detection mechanism. We construct 3D carrier-hopping prime/modified prime (CHP/MP codes by extending a two-dimensional (2D CHP code integrated with a one-dimensional (1D MP code. The corresponding coder/decoder pairs were based on fiber Bragg gratings (FBGs and tunable optical delay lines integrated with splitters/combiners. System performance was enhanced by the low cross correlation properties of the 3D code designed to avoid the beat noise phenomenon. The CHP/MP code cardinality increased significantly compared to the CHP code under the same bit error rate (BER. The results indicate that the 3D code method can enhance system performance because both the beating terms and multiple-access interference (MAI were reduced by the double balanced detection mechanism. Additionally, the optical component can also be relaxed for high transmission scenery.

Bose-Einstein condensation in chains with power-law hoppings: Exact mapping on the critical behavior in d-dimensional regular lattices.

Science.gov (United States)

Dias, W S; Bertrand, D; Lyra, M L

2017-06-01

Recent experimental progress on the realization of quantum systems with highly controllable long-range interactions has impelled the study of quantum phase transitions in low-dimensional systems with power-law couplings. Long-range couplings mimic higher-dimensional effects in several physical contexts. Here, we provide the exact relation between the spectral dimension d at the band bottom and the exponent α that tunes the range of power-law hoppings of a one-dimensional ideal lattice Bose gas. We also develop a finite-size scaling analysis to obtain some relevant critical exponents and the critical temperature of the BEC transition. In particular, an irrelevant dangerous scaling field has to be taken into account when the hopping range is sufficiently large to make the effective dimensionality d>4.

Bose-Einstein condensation in chains with power-law hoppings: Exact mapping on the critical behavior in d -dimensional regular lattices

Science.gov (United States)

Dias, W. S.; Bertrand, D.; Lyra, M. L.

2017-06-01

Recent experimental progress on the realization of quantum systems with highly controllable long-range interactions has impelled the study of quantum phase transitions in low-dimensional systems with power-law couplings. Long-range couplings mimic higher-dimensional effects in several physical contexts. Here, we provide the exact relation between the spectral dimension d at the band bottom and the exponent α that tunes the range of power-law hoppings of a one-dimensional ideal lattice Bose gas. We also develop a finite-size scaling analysis to obtain some relevant critical exponents and the critical temperature of the BEC transition. In particular, an irrelevant dangerous scaling field has to be taken into account when the hopping range is sufficiently large to make the effective dimensionality d >4 .

Hop-by-HopWorm Propagation with Carryover Epidemic Model in Mobile Sensor Networks

Directory of Open Access Journals (Sweden)

Jun-Won Ho

2015-10-01

Full Text Available In the internet, a worm is usually propagated in a random multi-hop contact manner. However, the attacker will not likely select this random multi-hop propagation approach in a mobile sensor network. This is because multi-hop worm route paths to random vulnerable targets can be often breached due to node mobility, leading to failure of fast worm spread under this strategy. Therefore, an appropriate propagation strategy is needed for mobile sensor worms. To meet this need, we discuss a hop-by-hop worm propagation model in mobile sensor networks. In a hop-by-hop worm propagation model, benign nodes are infected by worm in neighbor-to-neighbor spread manner. Since worm infection occurs in hop-by-hop contact, it is not substantially affected by a route breach incurred by node mobility. We also propose the carryover epidemic model to deal with the worm infection quota deficiency that might occur when employing an epidemic model in a mobile sensor network. We analyze worm infection capability under the carryover epidemic model. Moreover, we simulate hop-by-hop worm propagation with carryover epidemic model by using an ns-2 simulator. The simulation results demonstrate that infection quota carryovers are seldom observed where a node’s maximum speed is no less than 20 m/s.

Combining heterogenous features for 3D hand-held object recognition

Science.gov (United States)

Lv, Xiong; Wang, Shuang; Li, Xiangyang; Jiang, Shuqiang

2014-10-01

Object recognition has wide applications in the area of human-machine interaction and multimedia retrieval. However, due to the problem of visual polysemous and concept polymorphism, it is still a great challenge to obtain reliable recognition result for the 2D images. Recently, with the emergence and easy availability of RGB-D equipment such as Kinect, this challenge could be relieved because the depth channel could bring more information. A very special and important case of object recognition is hand-held object recognition, as hand is a straight and natural way for both human-human interaction and human-machine interaction. In this paper, we study the problem of 3D object recognition by combining heterogenous features with different modalities and extraction techniques. For hand-craft feature, although it reserves the low-level information such as shape and color, it has shown weakness in representing hiconvolutionalgh-level semantic information compared with the automatic learned feature, especially deep feature. Deep feature has shown its great advantages in large scale dataset recognition but is not always robust to rotation or scale variance compared with hand-craft feature. In this paper, we propose a method to combine hand-craft point cloud features and deep learned features in RGB and depth channle. First, hand-held object segmentation is implemented by using depth cues and human skeleton information. Second, we combine the extracted hetegerogenous 3D features in different stages using linear concatenation and multiple kernel learning (MKL). Then a training model is used to recognize 3D handheld objects. Experimental results validate the effectiveness and gerneralization ability of the proposed method.

THE EFFECTS OF SINGLE LEG HOP PROGRESSION AND DOUBLE LEGS HOP PROGRESSION EXERCISE TO INCREASE SPEED AND EXPLOSIVE POWER OF LEG MUSCLE

Directory of Open Access Journals (Sweden)

Nining W. Kusnanik

2015-05-01

Full Text Available The main purpose of this study was to determine the effect of single leg hop progression and double legs hop progression exercise to increase speed and explosive power of leg muscles. Plyometric is one of the training methods that can increase explosive power. There are many models of plyometric training including single leg hop progression and double leg hop progression. This research was experimental using match subject design techniques. The subjects of this study were 39 students who joined basketball school club. There were 3 groups in this study: Group 1 were 13 students who given sin¬gle leg hop progression exercise, Group 2 were 13 students who given double legs hop progression exercise, Group 3 were 13 students who given conventional exercise. The data was collected during pre test and post test by testing 30m speed running and vertical jump. The data was analyzed using Analysis of Varians (Anova. It was found that there were significantly increased on speed and explosive power of leg muscles of Group 1 and Group 2. It can be stated that single leg hop progression exercise was more effective than double leg hop progression exercise. The recent findings supported the hypothesis that single leg hop progression and double legs hop progression exercise can increase speed and explosive power of leg muscles. These finding were supported by some previous studies (Singh, et al, 2011; Shallaby, H.K., 2010. The single leg hop progression is more effective than double legs hop progression. This finding was consistent with some previous evidences (McCurdy, et al, 2005; Makaruk et al, 2011.

Low Power Multi-Hop Networking Analysis in Intelligent Environments.

Science.gov (United States)

Etxaniz, Josu; Aranguren, Gerardo

2017-05-19

Intelligent systems are driven by the latest technological advances in many different areas such as sensing, embedded systems, wireless communications or context recognition. This paper focuses on some of those areas. Concretely, the paper deals with wireless communications issues in embedded systems. More precisely, the paper combines the multi-hop networking with Bluetooth technology and a quality of service (QoS) metric, the latency. Bluetooth is a radio license-free worldwide communication standard that makes low power multi-hop wireless networking available. It establishes piconets (point-to-point and point-to-multipoint links) and scatternets (multi-hop networks). As a result, many Bluetooth nodes can be interconnected to set up ambient intelligent networks. Then, this paper presents the results of the investigation on multi-hop latency with park and sniff Bluetooth low power modes conducted over the hardware test bench previously implemented. In addition, the empirical models to estimate the latency of multi-hop communications over Bluetooth Asynchronous Connectionless Links (ACL) in park and sniff mode are given. The designers of devices and networks for intelligent systems will benefit from the estimation of the latency in Bluetooth multi-hop communications that the models provide.

Using high-order polynomial basis in 3-D EM forward modeling based on volume integral equation method

Science.gov (United States)

Kruglyakov, Mikhail; Kuvshinov, Alexey

2018-05-01

3-D interpretation of electromagnetic (EM) data of different origin and scale becomes a common practice worldwide. However, 3-D EM numerical simulations (modeling)—a key part of any 3-D EM data analysis—with realistic levels of complexity, accuracy and spatial detail still remains challenging from the computational point of view. We present a novel, efficient 3-D numerical solver based on a volume integral equation (IE) method. The efficiency is achieved by using a high-order polynomial (HOP) basis instead of the zero-order (piecewise constant) basis that is invoked in all routinely used IE-based solvers. We demonstrate that usage of the HOP basis allows us to decrease substantially the number of unknowns (preserving the same accuracy), with corresponding speed increase and memory saving.

Effects of powdery mildew fungicide programs on twospotted spider mite (Acari: Tetranychidae), hop aphid (Hemiptera: Aphididae), and their natural enemies in hop yards.

Science.gov (United States)

Gent, D H; James, D G; Wright, L C; Brooks, D J; Barbour, J D; Dreves, A J; Fisher, G C; Walton, V M

2009-02-01

Twospotted spider mite, Tetranychus urticae Koch (Acari: Tetranychidae), and hop aphid, Phorodon humuli (Schrank) (Hemiptera: Aphididae), are the most important arthropod pests of hop (Humulus lupulus L.) in the Northern Hemisphere. A potential barrier for greater adoption of conservation biological control strategies for spider mites and hop aphid is the extensive use of fungicides for management of hop powdery mildew, Podosphaera macularis (Wallr.:Fr.) U. Braun & S. Takamatsu. Field studies conducted in experimental plots in Oregon and Washington in 2005 and 2006 quantified the effects of powdery mildew fungicide programs (i.e., sulfur, paraffinic oil, and synthetic fungicides) on arthropod pests and natural enemies on hop. Fungicide treatment significantly affected spider mite populations in all four studies. Multiple applications of sulfur fungicides applied before burr development resulted in 1.4-3.3-fold greater spider mite populations during summer. Near the cessation of the sulfur applications, or after a lag of 20-30 d, spider mite populations increased significantly faster on sulfur treated plants compared with water-treated plants in three of four experiments. The effect of paraffinic oil on spider mites was varied, leading to exacerbation of spider mites in Oregon and Washington in 2005, suppression of mites in Oregon in 2006, and no significant effect compared with water in Washington in 2006. Significant relative treatment effects for cone damage due to spider mite feeding were detected in Oregon in 2005 in plots treated with sulfur and paraffinic oil compared with water and synthetic fungicides. Mean populations of hop aphids were similar among treatments in Oregon, although sulfur treatment suppressed hop aphid populations in Washington in 2005 and 2006. Populations of individual predacious insect species and cumulative abundance of macropredators were not consistently suppressed or stimulated by treatments in all trials. However, predatory mite

A 3.96 GHz phase-locked loop for mode-1 MB-OFDM UWB hopping carrier generation

Energy Technology Data Exchange (ETDEWEB)

Zheng Yongzheng; Li Weinan; Xia Lingli; Huang Yumei; Hong Zhiliang, E-mail: yumeihuang@fudan.edu.c [State Key Laboratory of ASIC and System, Fudan University, Shanghai 201203 (China)

2009-07-15

A fully integrated phase-locked loop (PLL) is presented for a single quadrature output frequency of 3.96 GHz. The proposed PLL can be applied to mode-1 MB-OFDM UWB hopping carrier generation. An adaptive frequency calibration loop is incorporated into the PLL. The capacitance area in the loop filter is largely reduced through a capacitor multiplier. Implemented in a CMOS process, this PLL draws 13.0 mA current from a single 1.2 V supply while occupying 0.55 mm{sup 2} die area. Measurement results show that the PLL achieves a phase noise of-70 dBc/Hz at 10 kHz offset and -113 dBc/Hz at 1 MHz offset. The integrated RMS jitter from 1 kHz to 10 MHz is 2.2 ps. The reference spur level is less than -68 dBc.

A 3.96 GHz phase-locked loop for mode-1 MB-OFDM UWB hopping carrier generation

International Nuclear Information System (INIS)

Zheng Yongzheng; Li Weinan; Xia Lingli; Huang Yumei; Hong Zhiliang

2009-01-01

A fully integrated phase-locked loop (PLL) is presented for a single quadrature output frequency of 3.96 GHz. The proposed PLL can be applied to mode-1 MB-OFDM UWB hopping carrier generation. An adaptive frequency calibration loop is incorporated into the PLL. The capacitance area in the loop filter is largely reduced through a capacitor multiplier. Implemented in a CMOS process, this PLL draws 13.0 mA current from a single 1.2 V supply while occupying 0.55 mm 2 die area. Measurement results show that the PLL achieves a phase noise of-70 dBc/Hz at 10 kHz offset and -113 dBc/Hz at 1 MHz offset. The integrated RMS jitter from 1 kHz to 10 MHz is 2.2 ps. The reference spur level is less than -68 dBc.

Electron hopping and optic phonons in Eu3S4

International Nuclear Information System (INIS)

Guentherodt, G.

1981-01-01

Raman scattering on single crystals of Eu 3 S 4 does not show the allowed q=o phonon modes in the cubic phase and exhibits no new modes in the distorted low temperature phase (T 2- ions. This mode does not show any anomaly near the charge order -disorder phase transition Tsub(t)=186 K. Temperature tunable spin fluctuations associated with the temperature activated Eu 2+ → Eu 3+ electron hopping are detected in the scattering intensity, superimposed on the usual thermal spin disorder. (author)

Correlated Hopping in the 1D Falicov--Kimball Model

Science.gov (United States)

Gajek, Z.; Lemanski, R.

2001-10-01

Ground state phase diagrams in the canonical ensemble of the one-dimensional Falicov-Kimball Model (FKM) with the correlated hopping are presented for several values of the model parameters. As compare to the conventional FKM, the diagrams exhibit a loss of the particle--hole symmetry.

Assessing hopping developmental level in childhood using wearable inertial sensor devices.

Science.gov (United States)

Masci, Ilaria; Vannozzi, Giuseppe; Getchell, Nancy; Cappozzo, Aurelio

2012-07-01

Assessing movement skills is a fundamental issue in motor development. Current process-oriented assessments, such as developmental sequences, are based on subjective judgments; if paired with quantitative assessments, a better understanding of movement performance and developmental change could be obtained. Our purpose was to examine the use of inertial sensors to evaluate developmental differences in hopping over distance. Forty children executed the task wearing the inertial sensor and relevant time durations and 3D accelerations were obtained. Subjects were also categorized in different developmental levels according to the hopping developmental sequence. Results indicated that some time and kinematic parameters changed with some developmental levels, possibly as a function of anthropometry and previous motor experience. We concluded that, since inertial sensors were suitable in describing hopping performance and sensitive to developmental changes, this technology is promising as an in-field and user-independent motor development assessment tool.

Correlated Hopping in the 1d Falicov-Kimball Model

International Nuclear Information System (INIS)

Gajek, Z.; Lemanski, R.

2001-01-01

Ground state phase diagrams in the canonical ensemble of the one-dimensional Falicov-Kimball Model FKM) with the correlated hopping are presented for several values of the model parameters. As compare to the conventional FKM, the diagrams exhibit a loss of the particle-hole symmetry. (author)

Performance Analysis of RF-FSO Multi-Hop Networks

KAUST Repository

Makki, Behrooz

2017-05-12

We study the performance of multi-hop networks composed of millimeter wave (MMW)-based radio frequency (RF) and free-space optical (FSO) links. The results are obtained in the cases with and without hybrid automatic repeat request (HARQ). Taking the MMW characteristics of the RF links into account, we derive closed-form expressions for the network outage probability. We also evaluate the effect of various parameters such as power amplifiers efficiency, number of antennas as well as different coherence times of the RF and the FSO links on the system performance. Finally, we present mappings between the performance of RF- FSO multi-hop networks and the ones using only the RF- or the FSO-based communication, in the sense that with appropriate parameter settings the same outage probability is achieved in these setups. The results show the efficiency of the RF-FSO setups in different conditions. Moreover, the HARQ can effectively improve the outage probability/energy efficiency, and compensate the effect of hardware impairments in RF-FSO networks. For common parameter settings of the RF-FSO dual- hop networks, outage probability 10^{-4} and code rate 3 nats-per-channel-use, the implementation of HARQ with a maximum of 2 and 3 retransmissions reduces the required power, compared to the cases with no HARQ, by 13 and 17 dB, respectively.

Combined Sector and Channel Hopping Schemes for Efficient Rendezvous in Directional Antenna Cognitive Radio Networks

Directory of Open Access Journals (Sweden)

AbdulMajid M. Al-Mqdashi

2017-01-01

Full Text Available Rendezvous is a prerequisite and important process for secondary users (SUs to establish data communications in cognitive radio networks (CRNs. Recently, there has been a proliferation of different channel hopping- (CH- based schemes that can provide rendezvous without relying on any predetermined common control channel. However, the existing CH schemes were designed with omnidirectional antennas which can degrade their rendezvous performance when applied in CRNs that are highly crowded with primary users (PUs. In such networks, the large number of PUs may lead to the inexistence of any common available channel between neighboring SUs which result in a failure of their rendezvous process. In this paper, we consider the utilization of directional antennas in CRNs for tackling the issue. Firstly, we propose two coprimality-based sector hopping (SH schemes that can provide efficient pairwise sector rendezvous in directional antenna CRNs (DIR-CRNs. Then, we propose an efficient CH scheme that can be combined within the SH schemes for providing a simultaneous sector and channel rendezvous. The guaranteed rendezvous of our schemes are proven by deriving the theoretical upper bounds of their rendezvous delay metrics. Furthermore, extensive simulation comparisons with other related rendezvous schemes are conducted to illustrate the significant outperformance of our schemes.

Wheeled hopping robot

Science.gov (United States)

Fischer, Gary J [Albuquerque, NM

2010-08-17

The present invention provides robotic vehicles having wheeled and hopping mobilities that are capable of traversing (e.g. by hopping over) obstacles that are large in size relative to the robot and, are capable of operation in unpredictable terrain over long range. The present invention further provides combustion powered linear actuators, which can include latching mechanisms to facilitate pressurized fueling of the actuators, as can be used to provide wheeled vehicles with a hopping mobility.

FWM behavior in 2-D time-spreading wavelength-hopping OCDMA systems

Science.gov (United States)

Bazan, Taher M.

2017-03-01

A new formula for the signal-to-four-wave mixing (FWM) crosstalk in 2-D time-spreading wavelength-hopping (TW) optical code division multiple access (OCDMA) systems is derived. The influence of several system parameters on the signal-to-FWM crosstalk ratio (SXR) is analyzed, including transmitted power per chip, code length, the number of active users, code weight, wavelength spacing, and transmission distance. Furthermore, for the first time, a closed-form expression for the total number of possible FWM products employing symmetric TW codes with equal wavelength spacing is investigated. The results show that SXR is sensitive to minor variations in system parameters, especially the launched power level and the code length while the wavelength spacing has a less impact on the level of the generated FWM power.

Ultra-high-performance liquid chromatography profiling method for chemical screening of proanthocyanidins in Czech hops

Czech Academy of Sciences Publication Activity Database

Olšovská, J.; Kameník, Zdeněk; Čejka, P.; Jurková, M.; Mikyška, A.

2013-01-01

Roč. 116, NOV (2013), s. 919-926 ISSN 0039-9140 R&D Projects: GA MŠk(CZ) EE2.3.30.0003 Institutional support: RVO:61388971 Keywords : Flavan-3-ol * Catechin * Hops Subject RIV: CB - Analytical Chemistry, Separation Impact factor: 3.511, year: 2013

A 0.75V 523W 40dB-SFDR frequency-hopping synthesizer for wireless sensor networks in 90nm CMOS

NARCIS (Netherlands)

Lopelli, E.; Tang, van der J.D.; Philips, K.J.P.; Roermund, van A.H.M.; Gyselinckx, B.

2009-01-01

This paper presents a baseband Frequency-Hopping Synthesizer (FHS) architecture that achieves the above requirements, along with its circuit implementation. The system uses a combination of digital techniques, such as CMOS programmable dividers for scalability, low power and robustness, and analog

A new method of hybrid frequency hopping signals selection and blind parameter estimation

Science.gov (United States)

Zeng, Xiaoyu; Jiao, Wencheng; Sun, Huixian

2018-04-01

Frequency hopping communication is widely used in military communications at home and abroad. In the case of single-channel reception, it is scarce to process multiple frequency hopping signals both effectively and simultaneously. A method of hybrid FH signals selection and blind parameter estimation is proposed. The method makes use of spectral transformation, spectral entropy calculation and PRI transformation basic theory to realize the sorting and parameter estimation of the components in the hybrid frequency hopping signal. The simulation results show that this method can correctly classify the frequency hopping component signal, and the estimated error of the frequency hopping period is about 5% and the estimated error of the frequency hopping frequency is less than 1% when the SNR is 10dB. However, the performance of this method deteriorates seriously at low SNR.

Differential modulation of plant immune responses by diverse members of the Pseudomonas savastanoi pv. savastanoi HopAF type III effector family.

Science.gov (United States)

Castañeda-Ojeda, M Pilar; López-Solanilla, Emilia; Ramos, Cayo

2017-06-01

The Pseudomonas savastanoi pv. savastanoi NCPPB 3335 type III secretion system (T3SS) effector repertoire includes 33 candidates, seven of which translocate into host cells and interfere with plant defences. The present study was performed to investigate the co-existence of both plasmid- and chromosomal-encoded members of the HopAF effector family, HopAF1-1 and HopAF1-2, respectively, in the genome of NCPPB 3335. Here, we show that the HopAF1 paralogues are widely distributed in the Pseudomonas syringae complex, where HopAF1-1 is most similar to the homologues encoded by other P. syringae pathovars infecting woody hosts that belong to phylogroups 1 and 3. We show that the expression of both HopAF1-1 and HopAF-2 is transcriptionally dependent on HrpL and demonstrate their delivery into Nicotiana tabacum leaves. Although the heterologous delivery of either HopAF1-1 or HopAF1-2 significantly suppressed the production of defence-associated reactive oxygen species levels, only HopAF1-2 reduced the levels of callose deposition. Moreover, the expression of HopAF1-2 by functionally effectorless P. syringae pv. tomato DC3000D28E completely inhibited the hypersensitive response in tobacco and significantly increased the competitiveness of the strain in Nicotiana benthamiana. Despite their functional differences, subcellular localization studies reveal that green fluorescent protein (GFP) fusions to either HopAF1-1 or HopAF1-2 are targeted to the plasma membrane when they are expressed in plant cells, a process that is completely dependent on the integrity of their N-myristoylation motif. Our results further support the notion that highly similar T3SS effectors might differentially interact with diverse plant targets, even when they co-localize in the same cell compartment. © 2016 BSPP AND JOHN WILEY & SONS LTD.

Majorana edge States in atomic wires coupled by pair hopping.

Science.gov (United States)

Kraus, Christina V; Dalmonte, Marcello; Baranov, Mikhail A; Läuchli, Andreas M; Zoller, P

2013-10-25

We present evidence for Majorana edge states in a number conserving theory describing a system of spinless fermions on two wires that are coupled by pair hopping. Our analysis is based on a combination of a qualitative low energy approach and numerical techniques using the density matrix renormalization group. In addition, we discuss an experimental realization of pair-hopping interactions in cold atom gases confined in optical lattices.

Elimination of hop latent viroid upon developmental activation of pollen nucleases

Czech Academy of Sciences Publication Activity Database

Matoušek, Jaroslav; Orctová, Lidmila; Škopek, Josef; Pešina, Karel; Steger, G.

2008-01-01

Roč. 389, č. 7 (2008), s. 905-918 ISSN 1431-6730 R&D Projects: GA AV ČR(CZ) 1QS500510558; GA ČR GA521/06/1149 Institutional research plan: CEZ:AV0Z50510513 Keywords : hop latent viroid * elimination Subject RIV: EE - Microbiology, Virology Impact factor: 3.035, year: 2008

HOP: Achieving Efficient Anonymity in MANETs by Combining HIP, OLSR, and Pseudonyms

Directory of Open Access Journals (Sweden)

Campos Javier

2011-01-01

Full Text Available Offering secure and anonymous communications in mobile ad hoc networking environments is essential to achieve confidence and privacy, thus promoting widespread adoption of this kind of networks. In addition, some minimum performance levels must be achieved for any solution to be practical and become widely adopted. In this paper, we propose and implement HOP, a novel solution based on cryptographic Host Identity Protocol (HIP that offers security and user-level anonymity in MANET environments while maintaining good performance levels. In particular, we introduce enhancements to the authentication process to achieve Host Identity Tag (HIT relationship anonymity, along with source/destination HIT anonymity when combined with multihoming. Afterward we detail how we integrate our improved version of HIP with the OLSR routing protocol to achieve efficient support for pseudonyms. We implemented our proposal in an experimental testbed, and the results obtained show that performance levels achieved are quite good, and that the integration with OLSR is achieved with a low overhead.

Comparison of Low-Complexity Diversity Schemes for Dual-Hop AF Relaying Systems

KAUST Repository

Gaaloul, Fakhreddine

2012-02-13

This paper investigates the performance of two low-complexity combining schemes, which are based on one- or two-phase observation, to mitigate multipath fading in dual-hop amplify-and-forward relaying systems. For the one-phase-based combining, a single-antenna station is assumed to relay information from a multiple-antenna transmitter to a multiple-antenna receiver, and the activation of the receive antennas is adaptively performed based on the second-hop statistics, regardless of the first-hop conditions. On the other hand, the two-phase-based combining suggests using multiple single-antenna stations between the multiple-antenna transmitter and the single-antenna receiver, where the suitable set of active relays is identified according to the precombining end-to-end fading conditions. To facilitate comparisons between the two schemes, formulations for the statistics of the combined signal-to-noise ratio and some performance measures are presented. Numerical and simulation results are shown to clarify the tradeoff between the achieved diversity-array gain, the processing complexity, and the power consumption.

Throughput Analysis on 3-Dimensional Underwater Acoustic Network with One-Hop Mobile Relay

Science.gov (United States)

Zhong, Xuefeng; Fan, Jiasheng; Guan, Quansheng; Ji, Fei; Yu, Hua

2018-01-01

Underwater acoustic communication network (UACN) has been considered as an essential infrastructure for ocean exploitation. Performance analysis of UACN is important in underwater acoustic network deployment and management. In this paper, we analyze the network throughput of three-dimensional randomly deployed transmitter–receiver pairs. Due to the long delay of acoustic channels, complicated networking protocols with heavy signaling overhead may not be appropriate. In this paper, we consider only one-hop or two-hop transmission, to save the signaling cost. That is, we assume the transmitter sends the data packet to the receiver by one-hop direct transmission, or by two-hop transmission via mobile relays. We derive the closed-form formulation of packet delivery rate with respect to the transmission delay and the number of transmitter–receiver pairs. The correctness of the derivation results are verified by computer simulations. Our analysis indicates how to obtain a precise tradeoff between the delay constraint and the network capacity. PMID:29337911

Throughput Analysis on 3-Dimensional Underwater Acoustic Network with One-Hop Mobile Relay.

Science.gov (United States)

Zhong, Xuefeng; Chen, Fangjiong; Fan, Jiasheng; Guan, Quansheng; Ji, Fei; Yu, Hua

2018-01-16

Underwater acoustic communication network (UACN) has been considered as an essential infrastructure for ocean exploitation. Performance analysis of UACN is important in underwater acoustic network deployment and management. In this paper, we analyze the network throughput of three-dimensional randomly deployed transmitter-receiver pairs. Due to the long delay of acoustic channels, complicated networking protocols with heavy signaling overhead may not be appropriate. In this paper, we consider only one-hop or two-hop transmission, to save the signaling cost. That is, we assume the transmitter sends the data packet to the receiver by one-hop direct transmission, or by two-hop transmission via mobile relays. We derive the closed-form formulation of packet delivery rate with respect to the transmission delay and the number of transmitter-receiver pairs. The correctness of the derivation results are verified by computer simulations. Our analysis indicates how to obtain a precise tradeoff between the delay constraint and the network capacity.

Combining Synchronous and Asynchronous Collaboration within 3D City Models

Science.gov (United States)

Klimke, Jan; Döllner, Jürgen

This paper presents an approach for combining spatially distributed synchronous and asynchronous collaboration within 3D city models. Software applications use these models as additional communication medium to facilitate communication of georeferenced and geospatial information. Collaboration tools should support both the communication with other collaborators and their awareness of the current collaboration context. To support collaborative knowledge construction and gathering, we have designed a collaboration system to facilitate (a) creation of annotations that have 3D references to the virtual 3D city model and (b) collection information about the context in which these annotations are created. Our approach supports synchronous collaboration in connection with the creation of non volatile, precisely georeferenced units of information allow for a comprehensible form of cooperation in spatially distributed settings. Storage and retrieval of this information is provided through a Web Feature Service, which eases integration of collaboration data into existing applications. We further introduce a visualization technique that integrates annotations as complex structured data into the 3D visualization. This avoids media breaks and disruptions in working processes and creates a spatial coherence between annotation and annotated feature or geometry.

Hopping conductivity via deep impurity states in InP

International Nuclear Information System (INIS)

Kuznetsov, V.P.; Messerer, M.A.; Omel'yanovskij, Eh.M.

1984-01-01

Hopping (epsilon 3 ) and Mott conductivities via deep impurity compounds with localization radius below 10 A have been studied using as an example Mn in InP. It is shown, that the existing theory of hopping conductivity in low-alloyed semiconductors with Na 3 << 1 can be Used for the case of deep centres as successfully as for the case of insignificant hydrogen-like impurities. Fundamental parameters of the theory: localization radius of wave function of deep impurities, state density near the Fermi level, mean hop length, are determined

The Philippine "Hip Hop Stick Dance"

Science.gov (United States)

Lewis, Lisa

2012-01-01

This article introduces a dance that blends the traditional cultural heritage of the Philippines with modern music and moves. "Hip Hop Stick Dance" incorporates Tinikling (the Philippine national dance) and Arnis (a Filipino style of martial arts) to create a contemporary combination of rhythm, dance, and fitness. It was designed to introduce…

Combining Different Modalities for 3D Imaging of Biological Objects

CERN Document Server

Tsyganov, E; Kulkarni, P; Mason, R; Parkey, R; Seliuonine, S; Shay, J; Soesbe, T; Zhezher, V; Zinchenko, A I

2005-01-01

A resolution enhanced NaI(Tl)-scintillator micro-SPECT device using pinhole collimator geometry has been built and tested with small animals. This device was constructed based on a depth-of-interaction measurement using a thick scintillator crystal and a position sensitive PMT to measure depth-dependent scintillator light profiles. Such a measurement eliminates the parallax error that degrades the high spatial resolution required for small animal imaging. This novel technique for 3D gamma-ray detection was incorporated into the micro-SPECT device and tested with a $^{57}$Co source and $^{98m}$Tc-MDP injected in mice body. To further enhance the investigating power of the tomographic imaging different imaging modalities can be combined. In particular, as proposed and shown in this paper, the optical imaging permits a 3D reconstruction of the animal's skin surface thus improving visualization and making possible depth-dependent corrections, necessary for bioluminescence 3D reconstruction in biological objects. ...

Hip external rotation strength predicts hop performance after anterior cruciate ligament reconstruction.

Science.gov (United States)

Kline, Paul W; Burnham, Jeremy; Yonz, Michael; Johnson, Darren; Ireland, Mary Lloyd; Noehren, Brian

2018-04-01

Quadriceps strength and single-leg hop performance are commonly evaluated prior to return to sport after anterior cruciate ligament reconstruction (ACLR). However, few studies have documented potential hip strength deficits after ACLR, or ascertained the relative contribution of quadriceps and hip strength to hop performance. Patients cleared for return to sports drills after ACLR were compared to a control group. Participants' peak isometric knee extension, hip abduction, hip extension, and hip external rotation (HER) strength were measured. Participants also performed single-leg hops, timed hops, triple hops, and crossover hops. Between-limb comparisons for the ACLR to control limb and the non-operative limb were made using independent two-sample and paired sample t tests. Pearson's correlations and stepwise multiple linear regression were used to determine the relationships and predictive ability of limb strength, graft type, sex, and limb dominance to hop performance. Sixty-five subjects, 20 ACLR [11F, age 22.8 (15-45) years, 8.3 ± 2 months post-op, mass 70.47 ± 12.95 kg, height 1.71 ± 0.08 m, Tegner 5.5 (3-9)] and 45 controls [22F, age 25.8 (15-45) years, mass 74.0 ± 15.2 kg, height 1.74 ± 0.1 m, Tegner 6 (3-7)], were tested. Knee extension (4.4 ± 1.5 vs 5.4 ± 1.8 N/kg, p = 0.02), HER (1.4 ± 0.4 vs 1.7 ± 0.5 N/kg, p = 0.04), single-leg hop (146 ± 37 vs 182 ± 38% limb length, p hop (417 ± 106 vs 519 ± 102% limb length, p hop (3.3 ± 2.0 vs 2.3 ± 0.6 s, p hop (364 ± 107 vs 446 ± 123% limb length, p = 0.01) were significantly impaired in the operative versus control subject limbs. Similar deficits existed between the operative and non-operative limbs. Knee extension and HER strength were significantly correlated with each of the hop tests, but only HER significantly predicted hop performance. After ACLR, patients have persistent HER strength, knee extension strength, and hop test deficits in the

Hybrid Detectors for Neutrons Combining Phenyl- Polysiloxanes with 3D Silicon Detectors

International Nuclear Information System (INIS)

Dalla Palma, Matteo; Quaranta, Alberto; Collazuol, Gianmaria; Carturan, Sara; Cinausero, Marco; Gramegna, Fabiana; Marchi, Tommaso; Dalla Betta, Gian-Franco; Mendicino, Roberto; Povoli, Marco; Boscardin, Maurizio; Giacomini, Gabriele; Ronchin, Sabina; Zorzi, Nicola

2013-06-01

We report on the initial results of a research project aimed at the development hybrid detectors for fast neutrons by combining a phenyl-polysiloxane-based converter with a 3D silicon detector. To this purpose, new 3D sensor structures have been designed, fabricated and electrically tested, showing low depletion voltage and good leakage current. Moreover, the radiation detection capability of 3D sensors was tested by measuring the signals recorded from alpha particles, gamma rays, and pulsed lasers. The converter has been poured into the 3D cavities with excellent coupling, as confirmed by cross-section SEM analyses. Preliminary tests with neutrons have been carried out on the first hybrid detector prototypes at the CN accelerator of INFN LNL. The device design and technology are discussed, along with the first results from the electrical and functional characterization. (authors)

A low-spurious fast-hopping MB-OFDM UWB synthesizer

Energy Technology Data Exchange (ETDEWEB)

Chen Danfeng; Li Wei; Li Ning; Ren Junyan, E-mail: w-li@fudan.edu.c [State Key Laboratory of ASIC and System, Fudan University, Shanghai 201203 (China)

2010-06-15

A frequency synthesizer for the ultra-wide band (UWB) group no. 1 is proposed. The synthesizer uses a phase-locked loop (PLL) and single-sideband (SSB) mixers to generate the three center frequencies of the first band group by mixing 4224 MHz with {+-}264 MHz and 792 MHz, respectively. A novel multi-QSSB mixer is designed to combine the function of frequency selection and frequency conversion for low power and high linearity. The synthesizer is fabricated in Jazz 0.18-{mu}m RF CMOS technology. The measured reference spur is as low as -69 dBc and the maximum spur is the LO leakage of -32 dBc. A low phase noise of -110 dBc/Hz - 1 MHz offset and an integrated phase noise of 1.86{sup 0} are achieved. The hopping time between different bands is less than 1.8 ns. The synthesizer consumes 30 mA from a 1.8 V supply. (semiconductor integrated circuits)

A low-spurious fast-hopping MB-OFDM UWB synthesizer

International Nuclear Information System (INIS)

Chen Danfeng; Li Wei; Li Ning; Ren Junyan

2010-01-01

A frequency synthesizer for the ultra-wide band (UWB) group no. 1 is proposed. The synthesizer uses a phase-locked loop (PLL) and single-sideband (SSB) mixers to generate the three center frequencies of the first band group by mixing 4224 MHz with ±264 MHz and 792 MHz, respectively. A novel multi-QSSB mixer is designed to combine the function of frequency selection and frequency conversion for low power and high linearity. The synthesizer is fabricated in Jazz 0.18-μm RF CMOS technology. The measured reference spur is as low as -69 dBc and the maximum spur is the LO leakage of -32 dBc. A low phase noise of -110 dBc/Hz - 1 MHz offset and an integrated phase noise of 1.86 0 are achieved. The hopping time between different bands is less than 1.8 ns. The synthesizer consumes 30 mA from a 1.8 V supply. (semiconductor integrated circuits)

On the Capacity of a GSM Frequency Hopping network with Intelligent Underlayer-Overlayer

DEFF Research Database (Denmark)

Nielsen, Thomas Toftegaard; Wigard, Jeroen; Mogensen, Preben Elgaard

1997-01-01

. By combining this reuse partitioning with frequency hopping, an increase in the network capacity in terms of carried traffic per cell is achieved. Simulations have indicated that for slow moving mobiles a gain of approximately 35% is achieved by this new feature when compared with a frequency hopping network...

Combining different modalities for 3D imaging of biological objects

International Nuclear Information System (INIS)

Tsyganov, Eh.; Antich, P.; Kulkarni, P.; Mason, R.; Parkey, R.; Seliuonine, S.; Shay, J.; Soesbe, T.; Zhezher, V.; Zinchenko, A.

2005-01-01

A resolution enhanced NaI(Tl)-scintillator micro-SPECT device using pinhole collimator geometry has been built and tested with small animals. This device was constructed based on a depth-of-interaction measurement using a thick scintillator crystal and a position sensitive PMT to measure depth-dependent scintillator light profiles. Such a measurement eliminates the parallax error that degrades the high spatial resolution required for small animal imaging. This novel technique for 3D gamma-ray detection was incorporated into the micro-SPECT device and tested with a 57 Co source and 98m Tc-MDP injected in mice body. To further enhance the investigating power of the tomographic imaging different imaging modalities can be combined. In particular, as proposed and shown, the optical imaging permits a 3D reconstruction of the animal's skin surface thus improving visualization and making possible depth-dependent corrections, necessary for bioluminescence 3D reconstruction in biological objects. This structural information can provide even more detail if the x-ray tomography is used as presented in the paper

Observation of correlation effects in the hopping transport in amorphous silicon

International Nuclear Information System (INIS)

Voegele, V.; Kalbitzer, S.; Boehringer, K.

1985-01-01

Amorphous silicon films have been modified by the implantation of Au or Si ions. The d.c. conductivity, measured between 300 and 15 K, was found to exhibit hopping exponents m which increase with decreasing temperature. Depending on the varied defect densities, m ranges between the limits of 1/4 and 1. These results can be explained by variable-range-hopping theory, if a Coulomb correlation term is included. (author)

Electrolytic conductivity-the hopping mechanism of the proton and beyond

International Nuclear Information System (INIS)

Gileadi, E.; Kirowa-Eisner, E.

2006-01-01

The hopping mechanism of electrolytic conductivity is analyzed, employing mixtures of two solvents: one that sustains the hopping mechanism and the other that does not inhibit it directly, but interferes with it by diluting the solvent that sustains hopping. Measurement of the equivalent conductivity shows that the excess proton conductivities of H 3 O + and OH - increases with increasing temperature, although the number of hydrogen bonds is known to decrease. In mixtures of acetonitrile with water, proton hopping does not start until a threshold concentration of about 20 vol.% water has been reached, while no such threshold concentration is observed upon addition of methanol to acetonitrile. It is concluded that in the former the proton is transferred to a cluster of water molecules, which can be formed only if there is enough water in the solvent mixture. This observation leads to the concept of mono-water, which is the state of water molecules when they constitute a small minority in the solvent mixtures, as opposed to bulk water, which consists of clusters of variable sizes. Systems in which a hopping mechanism of heavy ions has been observed include Br - /Br 2 and I - /I 2 . In these cases the triple ions Br 3 - and I 3 - , respectively are formed, and serve as the mediators for the transfer of the simple halogen ion. A very large increase of conductivity was observed upon solidification of the Br - /Br 3 - system, probably caused by favorable linear alignment of ions in the solid. The conductivity of acidified methanol decreases upon addition of water, because the affinity of the proton to water is higher than to methanol, thus water can act as a scavenger for protons. This behavior exemplifies a general observation, namely that conductivity by hopping can only occur when the Gibbs energy of the system does not change significantly following ion transfer; otherwise the ions would be trapped in the more stable state, hindering further propagation by hopping

Featherless Dinosaurs and the Hip-Hop Simulacrum: Reconsidering Hip-Hop's Appropriateness for the Music Classroom

Science.gov (United States)

Kruse, Adam J.

2016-01-01

This article offers considerations for music teachers interested in including hip-hop music in their classrooms but who might feel concerned with or overwhelmed by issues of appropriateness. Two concerns related to hip-hop music are examined: language and negative social themes. Commercial interests in hip-hop music have created a simulacrum (or…

Range and energetics of charge hopping in organic semiconductors

Science.gov (United States)

Abdalla, Hassan; Zuo, Guangzheng; Kemerink, Martijn

2017-12-01

The recent upswing in attention for the thermoelectric properties of organic semiconductors (OSCs) adds urgency to the need for a quantitative description of the range and energetics of hopping transport in organic semiconductors under relevant circumstances, i.e., around room temperature (RT). In particular, the degree to which hops beyond the nearest neighbor must be accounted for at RT is still largely unknown. Here, measurements of charge and energy transport in doped OSCs are combined with analytical modeling to reach the univocal conclusion that variable-range hopping is the proper description in a large class of disordered OSC at RT. To obtain quantitative agreement with experiment, one needs to account for the modification of the density of states by ionized dopants. These Coulomb interactions give rise to a deep tail of trap states that is independent of the material's initial energetic disorder. Insertion of this effect into a classical Mott-type variable-range hopping model allows one to give a quantitative description of temperature-dependent conductivity and thermopower measurements on a wide range of disordered OSCs. In particular, the model explains the commonly observed quasiuniversal power-law relation between the Seebeck coefficient and the conductivity.

Hopping transport in solids

CERN Document Server

Pollak, M

1991-01-01

The hopping process, which differs substantially from conventional transport processes in crystals, is the central process in the transport phenomena discussed in this book. Throughout the book the term ``hopping'' is defined as the inelastic tunneling transfer of an electron between two localized electronic states centered at different locations. Such processes do not occur in conventional electronic transport in solids, since localized states are not compatible with the translational symmetry of crystals.The rapid growth of interest in hopping transport has followed in the footsteps of the

Purely hopping conduction in c-axis oriented LiNbO3 thin films

Science.gov (United States)

Shandilya, Swati; Tomar, Monika; Sreenivas, K.; Gupta, Vinay

2009-05-01

Dielectric constant and ac conductivity of highly c-axis oriented LiNbO3 thin film grown by pulsed laser deposition were studied in a metal-insulator-metal configuration over a wide temperature (200 to 450 K) and frequency (100 Hz to 1 MHz) range. The preferred oriented Al (1%) doped ZnO film with electrical conductivity 1.1×103 Ω-1 cm-1 was deposited for dual purpose: (1) to serve as nucleating center for LiNbO3 crystallites along preferred c-axis growth direction, and (2) to act as a suitable bottom electrode for electrical studies. The room temperature dc conductivity (σdc) of LiNbO3 film was about 5.34×10-10 Ω-1 cm-1 with activation energy ˜0.3 eV, indicating extrinsic conduction. The ac conductivity σac was found to be much higher in comparison to σdc in the low temperature region (300 K), σac shows a weak frequency dependence, whereas dielectric constant exhibits a strong frequency dispersion. The dielectric dispersion data has been discussed in the light of theoretical models based on Debye type mixed conduction and purely hopping conduction. The dominant conduction in c-axis oriented LiNbO3 thin film is attributed to the purely hopping where both σdc and σac arise due to same mechanism.

Biological effects of combined resveratrol and vitamin D3 on ovarian tissue.

Science.gov (United States)

Uberti, Francesca; Morsanuto, Vera; Aprile, Silvio; Ghirlanda, Sabrina; Stoppa, Ian; Cochis, Andrea; Grosa, Giorgio; Rimondini, Lia; Molinari, Claudio

2017-09-15

Resveratrol (3,5,4'-trihydroxy-trans-stilbene) is a natural antioxidant polyphenol able to exert a wide range of biological effect on several tissues. Despite its important beneficial properties, it has a low water solubility, which limits its therapeutic applications in humans. Resveratrol also acts as a phytoestrogen that modulates estrogen receptor (ER)-mediated transcription. In addition, it has been shown that ovarian tissues benefit greatly from vitamin D3, which exerts its beneficial effects through VDR receptors. The aim was to evaluate the cooperative effects of resveratrol combined with vitamin D3 on ovarian cells and tissues and some other organs as well. Moreover, the modulation of specific intracellular pathways involving ER and VDR receptors has been studied. The experiments were performed both in vitro and in vivo, to analyze cell viability, radical oxygen species production, signal transductions through Western Blot, and resveratrol quantification by HPLC. Cell viability, radical oxygen species production, and intracellular pathways have been studied on CHO-K1 cells. Also, the relative mechanism activated following oral intake in female Wistar rats as animal model was investigated, evaluating bioavailability, biodistribution and signal transduction in heart, kidney, liver and ovarian tissues. Both in in vitro and in vivo experiments, resveratrol exerts more evident effects when administered in combination with vitD in ovarian cells, showing a common biphasic cooperative effect: The role of vitamin D3 in maintaining and supporting the biological activity of resveratrol has been clearly observed. Moreover, resveratrol plus vitamin D3 blood concentrations showed a biphasic absorption rate. Such results could be used as a fundamental data for the development of new therapies for gynecological conditions, such as hot-flashes.

SHOP: scaffold hopping by GRID-based similarity searches

DEFF Research Database (Denmark)

Bergmann, Rikke; Linusson, Anna; Zamora, Ismael

2007-01-01

A new GRID-based method for scaffold hopping (SHOP) is presented. In a fully automatic manner, scaffolds were identified in a database based on three types of 3D-descriptors. SHOP's ability to recover scaffolds was assessed and validated by searching a database spiked with fragments of known...... scaffolds were in the 31 top-ranked scaffolds. SHOP also identified new scaffolds with substantially different chemotypes from the queries. Docking analysis indicated that the new scaffolds would have similar binding modes to those of the respective query scaffolds observed in X-ray structures...

Supercritical fluid extraction of hops

Directory of Open Access Journals (Sweden)

ZORAN ZEKOVIC

2007-01-01

Full Text Available Five cultivars of hop were extracted by the method of supercritical fluid extraction using carbon dioxide (SFE–CO2 as extractant. The extraction (50 g of hop sample using a CO2 flow rate of 97.725 L/h was done in the two steps: 1. extraction at 150 bar and 40°C for 2.5 h (sample of series A was obtained and, after that, the same sample of hop was extracted in the second step: 2. extraction at 300 bar and 40 °C for 2.5 h (sample of series B was obtained. The Magnum cultivar was chosen for the investigation of the extraction kinetics. For the qualitative and quantitative analysis of the obtained hop extracts, the GC-MS method was used. Two of four themost common compounds of hop aroma (a-humulene and b-caryophyllene were detected in samples of series A. In addition, isomerized a-acids and a high content of b-acids were detected. The a-acids content in the samples of series B was the highest in the extract of the Magnum cultivar (it is a bitter variety of hop. The low contents of a-acids in all the other hop samples resulted in extracts with low a-acids content, i.e., that contents were under the prescribed a-acids content.

RAZVOJ OBLAČIL V HIP HOP KULTURI

OpenAIRE

Marić, Sanja

2010-01-01

V diplomskem delu smo raziskovali, kako so se hip hop oblačila razvijala skozi obdobja v hip hop kulturi. V teoretičnem deli smo ugotavljali ozadje in dejavnike, ki so vplivali na razvoj hip hop kulture, v empiričnem delu diplomske naloge pa smo izvedli anketni vprašalnik z glavnimi akterji hip hop kulture na slovenski hip hop sceni. Rezultati, ki smo jih dobili, kažejo da so imela oblačila velik vpliv na prepoznavnost in razvoj hip hop kulture po celem svetu. K temu so največ pripomogli ustv...

Treatment of vitiligo vulgaris with the combination therapy of topical steroid and vitamin D3 compound

Directory of Open Access Journals (Sweden)

Yoko Konishi

2012-06-01

Full Text Available We reported here two cases of vitiligo vulgaris successfully treated with the combination therapy of topical steroid and vitamin D3 compound and currently maintained by vitamin D3 analog without any adverse effects: skin atrophy, striae or telangiectasia on the exposed areas. The best-known mechanism of topical vitamin D3 analog is the enhancement of keratinocytes differentiation and anti-proliferative effects. Vitamin D3 analog is also reported to suppress T-cell mediated immunity, T-cell skin recruitment, and skin infiltration via down-regulating cutaneous lymphocyte antigen expression. Furthermore, vitamin D3 compounds are known to influence melanocyte maturation and differentiation and also to up-regulate melanogenesis. Autoreactive lymphocytes against melanocytes are one of the causes. Topical vitamin D3 analog may control vitiligo itself, however stronger immunosuppressive effects of topical corticosteroid may contribute to rapid re-pigmentation suppressing auto-reactive lymphocytes. The topical combination therapy is a simple, effective and safe option for vitiligo vulgaris in sun-exposed areas.

3D measurement using combined Gray code and dual-frequency phase-shifting approach

Science.gov (United States)

Yu, Shuang; Zhang, Jing; Yu, Xiaoyang; Sun, Xiaoming; Wu, Haibin; Liu, Xin

2018-04-01

The combined Gray code and phase-shifting approach is a commonly used 3D measurement technique. In this technique, an error that equals integer multiples of the phase-shifted fringe period, i.e. period jump error, often exists in the absolute analog code, which can lead to gross measurement errors. To overcome this problem, the present paper proposes 3D measurement using a combined Gray code and dual-frequency phase-shifting approach. Based on 3D measurement using the combined Gray code and phase-shifting approach, one set of low-frequency phase-shifted fringe patterns with an odd-numbered multiple of the original phase-shifted fringe period is added. Thus, the absolute analog code measured value can be obtained by the combined Gray code and phase-shifting approach, and the low-frequency absolute analog code measured value can also be obtained by adding low-frequency phase-shifted fringe patterns. Then, the corrected absolute analog code measured value can be obtained by correcting the former by the latter, and the period jump errors can be eliminated, resulting in reliable analog code unwrapping. For the proposed approach, we established its measurement model, analyzed its measurement principle, expounded the mechanism of eliminating period jump errors by error analysis, and determined its applicable conditions. Theoretical analysis and experimental results show that the proposed approach can effectively eliminate period jump errors, reliably perform analog code unwrapping, and improve the measurement accuracy.

Combinatorial analysis of lupulin gland transcription factors from R2R3Myb, bHLH and WDR families indicates a complex regulation of chs_H1 genes essential for prenylflavonoid biosynthesis in hop (Humulus Lupulus L.

Directory of Open Access Journals (Sweden)

Matoušek Jaroslav

2012-02-01

Full Text Available Abstract Background Lupulin glands of hop produce a specific metabolome including hop bitter acids valuable for the brewing process and prenylflavonoids with promising health-beneficial activities. The detailed analysis of the transcription factor (TF-mediated regulation of the oligofamily of one of the key enzymes, i.e., chalcone synthase CHS_H1 that efficiently catalyzes the production of naringenin chalcone, a direct precursor of prenylflavonoids in hop, constitutes an important part of the dissection of the biosynthetic pathways leading to the accumulation of these compounds. Results Homologues of flavonoid-regulating TFs HlMyb2 (M2, HlbHLH2 (B2 and HlWDR1 (W1 from hop were cloned using a lupulin gland-specific cDNA library from the hop variety Osvald's 72. Using a "combinatorial" transient GUS expression system it was shown that these unique lupulin-gland-associated TFs significantly activated the promoter (P of chs_H1 in ternary combinations of B2, W1 and either M2 or the previously characterized HlMyb3 (M3. The promoter activation was strongly dependent on the Myb-P binding box TCCTACC having a core sequence CCWACC positioned on its 5' end region and it seems that the complexity of the promoter plays an important role. M2B2W1-mediated activation significantly exceeded the strength of expression of native chs_H1 gene driven by the 35S promoter of CaMV, while M3B2W1 resulted in 30% of the 35S:chs_H1 expression level, as quantified by real-time PCR. Another newly cloned hop TF, HlMyb7, containing a transcriptional repressor-like motif pdLNLD/ELxiG/S (PDLNLELRIS, was identified as an efficient inhibitor of chs_H1-activating TFs. Comparative analyses of hop and A. thaliana TFs revealed a complex activation of Pchs_H1 and Pchs4 in combinatorial or independent manners. Conclusions This study on the sequences and functions of various lupulin gland-specific transcription factors provides insight into the complex character of the regulation of the

The Formation of "Hip-Hop Academicus"--How American Scholars Talk about the Academisation of Hip-Hop

Science.gov (United States)

Soderman, Johan

2013-01-01

Social activism and education have been associated with hip-hop since it emerged in New York City 38 years ago. Therefore, it might not be surprising that universities have become interested in hip-hop. This article aims to highlight this "hip-hop academisation" and analyse the discursive mechanisms that manifest in these academisation…

Over-expression of the transcription factor HlMYB3 in transgenic hop (Humulus lupulus L. cv. Tettnanger) modulates the expression of genes involved in the biosynthesis of flavonoids and phloroglucinols

Czech Academy of Sciences Publication Activity Database

Gatica-Arias, A.; Stanke, M.; Häntzschel, K.R.; Matoušek, Jaroslav; Weber, G.

2013-01-01

Roč. 113, č. 2 (2013), s. 279-289 ISSN 0167-6857 R&D Projects: GA ČR GA521/08/0740 Institutional support: RVO:60077344 Keywords : Hop * R2R3 MYB transcription factors * Genetic transformation * Flavonoid biosynthesis Subject RIV: EB - Genetics ; Molecular Biology Impact factor: 2.612, year: 2013

Small polaron hopping conduction in samples of ceramic La1.4Sr1.6Mn2O7.06

International Nuclear Information System (INIS)

Nakatsugawa, H.; Iguchi, E.; Jung, W.H.; Munakata, F.

1999-01-01

The ceramic sample of La 1.4 Sr 1.6 Mn 2 O 7.06 exhibits the metal-insulator transition and a negative magnetoresistance in the vicinity of the Curie temperature (T C ∼ 100 K). The dc magnetic susceptibility between 100 K and 280 K is nearly constant and decreases gradually with increasing temperature above 280 K. The measurements of dc resistivity and the thermoelectric power indicate that small polaron hopping conduction takes place at T > 280 K. The spin ordering due to the two-dimensional d x 2 -y 2 state occurring at T > 280 K is directly related to the hopping conduction above 280 K, although the spin ordering due to the one-dimensional d 3z 2 -r 2 state takes place at T > T C . The two-dimensional d x 2 -y 2 state extending within the MnO 2 sheets starts to narrow and leads to the carrier localisation at 280 K. The effective number of holes in this sample estimated from the thermoelectric power is considerably smaller than the nominal value. This indicates that the small polaron hopping conduction takes place predominantly within the in-plane MnO 2 sheets. A discussion is given of the experimental results of the ceramic sample of La 2/3 Ca 1/3 MnO 2.98 . Copyright (1999) CSIRO Australia

Combining 3D printed forms with textile structures - mechanical and geometrical properties of multi-material systems

International Nuclear Information System (INIS)

Sabantina, L; Kinzel, F; Ehrmann, A; Finsterbusch, K

2015-01-01

The 3D printing belongs to the rapidly emerging technologies which have the chance to revolutionize the way products are created. In the textile industry, several designers have already presented creations of shoes, dresses or other garments which could not be produced with common techniques. 3D printing, however, is still far away from being a usual process in textile and clothing production. The main challenge results from the insufficient mechanical properties, especially the low tensile strength, of pure 3D printed products, prohibiting them from replacing common technologies such as weaving or knitting. Thus, one way to the application of 3D printed forms in garments is combining them with textile fabrics, the latter ensuring the necessary tensile strength. This article reports about different approaches to combine 3D printed polymers with different textile materials and fabrics, showing chances and limits of this technique. (paper)

Exploiting Multi-user Diversity and Multi-hop Diversity in Dual-hop Broadcast Channels

KAUST Repository

Zafar, Ammar

2013-05-21

We propose joint user-and-hop scheduling over dual-hop block-fading broadcast channels in order to exploit multi-user diversity gains and multi-hop diversity gains all together. To achieve this objective, the first and second hops are scheduled opportunistically based on the channel state information. The joint scheduling problem is formulated as maximizing the weighted sum of the long term achievable rates of the users under a stability constraint, which means that in the long term the rate received by the relay should equal the rate transmitted by it, in addition to power constraints. We show that this problem is equivalent to a single-hop broadcast channel by treating the source as a virtual user with an optimal weight that maintains the stability constraint. We show how to obtain the source weight either off-line based on channel statistics or on real-time based on channel measurements. Furthermore, we consider special cases including the maximum sum-rate scheduler and the proportional fair scheduler. We also show how to extend the scheme into one that allows multiple user scheduling via superposition coding with successive decoding. Numerical results demonstrate that our proposed joint scheduling scheme enlarges the rate region as compared to scheduling schemes that exploit the diversity gains partially.

Variable range hopping in ZnO films

Science.gov (United States)

Ali, Nasir; Ghosh, Subhasis

2018-04-01

We report the variable range hopping in ZnO films grown by RF magnetron sputtering in different argon and oxygen partial pressure. It has been found that Mott variable range hopping dominant over Efros variable range hopping in all ZnO films. It also has been found that hopping distance and energy increases with increasing oxygen partial pressure.

Comparison of Low-Complexity Diversity Schemes for Dual-Hop AF Relaying Systems

KAUST Repository

Gaaloul, Fakhreddine; Alouini, Mohamed-Slim; Radaydeh, Redha M.

2012-01-01

This paper investigates the performance of two low-complexity combining schemes, which are based on one- or two-phase observation, to mitigate multipath fading in dual-hop amplify-and-forward relaying systems. For the one-phase-based combining, a

Hall effect in hopping regime

International Nuclear Information System (INIS)

Avdonin, A.; Skupiński, P.; Grasza, K.

2016-01-01

A simple description of the Hall effect in the hopping regime of conductivity in semiconductors is presented. Expressions for the Hall coefficient and Hall mobility are derived by considering averaged equilibrium electron transport in a single triangle of localization sites in a magnetic field. Dependence of the Hall coefficient is analyzed in a wide range of temperature and magnetic field values. Our theoretical result is applied to our experimental data on temperature dependence of Hall effect and Hall mobility in ZnO. - Highlights: • Expressions for Hall coefficient and mobility for hopping conductivity are derived. • Theoretical result is compared with experimental curves measured on ZnO. • Simultaneous action of free and hopping conduction channels is considered. • Non-linearity of hopping Hall coefficient is predicted.

Hall effect in hopping regime

Energy Technology Data Exchange (ETDEWEB)

Avdonin, A., E-mail: avdonin@ifpan.edu.pl [Institute of Physics, Polish Academy of Sciences, Al. Lotników 32/46, 02-668 Warszawa (Poland); Skupiński, P. [Institute of Physics, Polish Academy of Sciences, Al. Lotników 32/46, 02-668 Warszawa (Poland); Grasza, K. [Institute of Physics, Polish Academy of Sciences, Al. Lotników 32/46, 02-668 Warszawa (Poland); Institute of Electronic Materials Technology, ul. Wólczyńska 133, 01-919 Warszawa (Poland)

2016-02-15

A simple description of the Hall effect in the hopping regime of conductivity in semiconductors is presented. Expressions for the Hall coefficient and Hall mobility are derived by considering averaged equilibrium electron transport in a single triangle of localization sites in a magnetic field. Dependence of the Hall coefficient is analyzed in a wide range of temperature and magnetic field values. Our theoretical result is applied to our experimental data on temperature dependence of Hall effect and Hall mobility in ZnO. - Highlights: • Expressions for Hall coefficient and mobility for hopping conductivity are derived. • Theoretical result is compared with experimental curves measured on ZnO. • Simultaneous action of free and hopping conduction channels is considered. • Non-linearity of hopping Hall coefficient is predicted.

Combining 3d Volume and Mesh Models for Representing Complicated Heritage Buildings

Science.gov (United States)

Tsai, F.; Chang, H.; Lin, Y.-W.

2017-08-01

This study developed a simple but effective strategy to combine 3D volume and mesh models for representing complicated heritage buildings and structures. The idea is to seamlessly integrate 3D parametric or polyhedral models and mesh-based digital surfaces to generate a hybrid 3D model that can take advantages of both modeling methods. The proposed hybrid model generation framework is separated into three phases. Firstly, after acquiring or generating 3D point clouds of the target, these 3D points are partitioned into different groups. Secondly, a parametric or polyhedral model of each group is generated based on plane and surface fitting algorithms to represent the basic structure of that region. A "bare-bones" model of the target can subsequently be constructed by connecting all 3D volume element models. In the third phase, the constructed bare-bones model is used as a mask to remove points enclosed by the bare-bones model from the original point clouds. The remaining points are then connected to form 3D surface mesh patches. The boundary points of each surface patch are identified and these boundary points are projected onto the surfaces of the bare-bones model. Finally, new meshes are created to connect the projected points and original mesh boundaries to integrate the mesh surfaces with the 3D volume model. The proposed method was applied to an open-source point cloud data set and point clouds of a local historical structure. Preliminary results indicated that the reconstructed hybrid models using the proposed method can retain both fundamental 3D volume characteristics and accurate geometric appearance with fine details. The reconstructed hybrid models can also be used to represent targets in different levels of detail according to user and system requirements in different applications.

Combined photogrammetry and 3-D CAD for plant documentation and planning of refits

International Nuclear Information System (INIS)

Fraas, K.C.; Giese, U.; Kamsties, K.D.

1991-01-01

Meticulous advance planning and erection studies using a three-dimensional computer-aided design model of the plant area concerned can reduce the problem that unexpected events during a plant refit will prolong the required inspection period. This presupposes that a 3-D CAD scale model of the running plant has been generated. A method is described with which the as-built condition of the plant area is converted into a 3-D CAD model by combining photogrammetry with 3-D CAD. The minimum amount of time required for in-plant surveying and the completeness and clarity of results are the special advantages of this method in comparison with other measurement techniques. Selected applications are presented. (orig.) [de

Supercritical carbon dioxide hop extraction

Directory of Open Access Journals (Sweden)

Pfaf-Šovljanski Ivana I.

2005-01-01

Full Text Available The hop of Magnum cultivar was extracted using supercritical carbon dioxide (SFE-as extractant. Extraction was carried out in the two steps: the first one being carried out at 150 bar and 40°C for 2.5 h (Extract A, and the second was the extraction of the same hop sample at 300 bar and 40°C for 2.5 h (Extract B. Extraction kinetics of the system hop-SFE-CO2 was investigated. Two of four most common compounds of hop aroma (α-humulene and β-caryophyllene were detected in Extract A. Isomerised α-acids and β-acids were detected too. a-Acid content in Extract B was high (that means it is a bitter variety of hop. Mathematical modeling using empirical model characteristic time model and simple single sphere model has been performed on Magnum cultivar extraction experimental results. Characteristic time model equations, best fitted experimental results. Empirical model equation, fitted results well, while simple single sphere model equation poorly approximated the results.

Is 3D MPRAGE better than the combination DIR/PSIR for cortical lesion detection at 3T MRI?

Science.gov (United States)

Nelson, Flavia; Poonawalla, Aziz; Datta, Sushmita; Wolinsky, Jerry; Narayana, Ponnada

2014-03-01

Based on the application of newer magnetic resonance imaging (MRI) acquisition sequences, the detection of cortical lesions (CL) in multiple sclerosis (MS) has significantly improved. Double inversion recovery (DIR) at 3T has increased the detection sensitivity and classification specificity when combined with phase sensitive inversion recovery (PSIR). Previous findings with 3D magnetization prepared rapid acquisition with gradient echo (MPRAGE) sequences, showed improved classification specificity of purely intracortical (IC) and mixed (MX) lesions, compared to the classification based on DIR/PSIR. Direct comparison between the detection of CL by 3D MPRAGE and by DIR/PSIR at 3T has not been evaluated. Eleven subjects were imaged on a 3T magnet. DIR/PSIR and 3D MPRAGE images were reviewed independently. Each image set was reviewed twice; only lesions detected on both sessions were scored. Review time per scan was ~5min for DIR/PSIR and ~15min for 3D MPRAGE. We identified 141 CL (62 IC+79 MX) based on DIR/PSIR images vs. 93 (38 IC+55 MX) based on MPRAGE from all eleven patients. MPRAGE under-detected the number of CL in seven cases and over-detected the number of CL in three, only one case had the same number of CL on both sets of images. Combination DIR/PSIR at 3T is superior to 3D MPRAGE for detection of cortical gray matter lesions in MS. The contrast-to-noise ratio of CL appears to be inferior on the MPRAGE images relative to DIR/PSIR. © 2013 Published by Elsevier B.V.

Odor-Active Compounds in the Special Flavor Hops Huell Melon and Polaris.

Science.gov (United States)

Neiens, Silva D; Steinhaus, Martin

2018-02-14

The volatiles isolated from samples of the special flavor hop varieties, Huell Melon and Polaris, and from the aroma hop variety, Hallertau Tradition, by solvent extraction and solvent-assisted flavor evaporation (SAFE) were subjected to a comparative aroma extract dilution analysis (cAEDA), which resulted in 46 odor-active compounds in the flavor dilution (FD) factor range of 16 to 2048. On the basis of high FD factors, myrcene, (3R)-linalool, and 2- and 3-methylbutanoic acid were confirmed as important variety-independent hop odorants. (1R,4S)-Calamenene was identified for the first time as an odor-active compound in hops. Clear differences in the FD factors and their subsequent objectification by stable isotope dilution quantitation suggested that high concentrations of the esters ethyl 2-methylbutanoate, ethyl 2-methylpropanoate, and propyl 2-methylbutanoate cause the characteristic fruity, cantaloupe-like odor note in Huell Melon hops, whereas the fruity and minty odor notes in Polaris are associated with high amounts of 3-methylbutyl acetate and 1,8-cineole.

Hip-Hop Education Resources

Science.gov (United States)

Hall, Marcella Runell

2009-01-01

Hip-hop music and culture are often cited as being public pedagogy, meaning the music itself has intrinsic educational value. Non-profit organizations and individual educators have graciously taken the lead in utilizing hip-hop to educate. As the academy continues to debate its effectiveness, teachers and community organizers are moving forward.…

Performance Analysis of Millimeter-Wave Multi-hop Machine-to-Machine Networks Based on Hop Distance Statistics

Directory of Open Access Journals (Sweden)

Haejoon Jung

2018-01-01

Full Text Available As an intrinsic part of the Internet of Things (IoT ecosystem, machine-to-machine (M2M communications are expected to provide ubiquitous connectivity between machines. Millimeter-wave (mmWave communication is another promising technology for the future communication systems to alleviate the pressure of scarce spectrum resources. For this reason, in this paper, we consider multi-hop M2M communications, where a machine-type communication (MTC device with the limited transmit power relays to help other devices using mmWave. To be specific, we focus on hop distance statistics and their impacts on system performances in multi-hop wireless networks (MWNs with directional antenna arrays in mmWave for M2M communications. Different from microwave systems, in mmWave communications, wireless channel suffers from blockage by obstacles that heavily attenuate line-of-sight signals, which may result in limited per-hop progress in MWNs. We consider two routing strategies aiming at different types of applications and derive the probability distributions of their hop distances. Moreover, we provide their baseline statistics assuming the blockage-free scenario to quantify the impact of blockages. Based on the hop distance analysis, we propose a method to estimate the end-to-end performances (e.g., outage probability, hop count, and transmit energy of the mmWave MWNs, which provides important insights into mmWave MWN design without time-consuming and repetitive end-to-end simulation.

Performance Analysis of Millimeter-Wave Multi-hop Machine-to-Machine Networks Based on Hop Distance Statistics.

Science.gov (United States)

Jung, Haejoon; Lee, In-Ho

2018-01-12

As an intrinsic part of the Internet of Things (IoT) ecosystem, machine-to-machine (M2M) communications are expected to provide ubiquitous connectivity between machines. Millimeter-wave (mmWave) communication is another promising technology for the future communication systems to alleviate the pressure of scarce spectrum resources. For this reason, in this paper, we consider multi-hop M2M communications, where a machine-type communication (MTC) device with the limited transmit power relays to help other devices using mmWave. To be specific, we focus on hop distance statistics and their impacts on system performances in multi-hop wireless networks (MWNs) with directional antenna arrays in mmWave for M2M communications. Different from microwave systems, in mmWave communications, wireless channel suffers from blockage by obstacles that heavily attenuate line-of-sight signals, which may result in limited per-hop progress in MWNs. We consider two routing strategies aiming at different types of applications and derive the probability distributions of their hop distances. Moreover, we provide their baseline statistics assuming the blockage-free scenario to quantify the impact of blockages. Based on the hop distance analysis, we propose a method to estimate the end-to-end performances (e.g., outage probability, hop count, and transmit energy) of the mmWave MWNs, which provides important insights into mmWave MWN design without time-consuming and repetitive end-to-end simulation.

Switched diversity strategies for dual-hop amplify-and-forward relaying systems

KAUST Repository

Gaaloul, Fakhreddine

2012-01-01

This study investigates different receive single-branch switch-based diversity schemes for dual-hop amplify-and-forward relaying networks. Specifically, three receive processing algorithms are adopted, in which the receive branch is selected using the arbitrary selection algorithm, the switching algorithm, or the switching algorithm with post-examining best branch selection. The identification of the receive branch is carried out for two different system models. For the first model, a single-antenna relaying station is used in conjunction with a multiple-antenna transceiver, where the processing is performed independently of the first hop-fading conditions. The second model suggests the use of parallel deployment of single-antenna relays to transfer information from a multiple-antenna transmitter to a single-antenna receiver, where the active relaying station is determined based on the pre-combining end-to-end fading conditions. Performance comparisons for various transmission scenarios on the first hop are presented using new formulations for the statistics of the combined signal-to-noise ratio. Simulation results are also provided to validate the mathematical development and to verify the numerical computations. © 2012 The Institution of Engineering and Technology.

Three-dimensional (3D)- computed tomography bronchography and angiography combined with 3D-video-assisted thoracic surgery (VATS) versus conventional 2D-VATS anatomic pulmonary segmentectomy for the treatment of non-small cell lung cancer.

Science.gov (United States)

She, Xiao-Wei; Gu, Yun-Bin; Xu, Chun; Li, Chang; Ding, Cheng; Chen, Jun; Zhao, Jun

2018-02-01

Compared to the pulmonary lobe, the anatomical structure of the pulmonary segment is relatively complex and prone to variation, thus the risk and difficulty of segmentectomy is increased. We compared three-dimensional computed tomography bronchography and angiography (3D-CTBA) combined with 3D video-assisted thoracic surgery (3D-VATS) to perform segmentectomy to conventional two-dimensional (2D)-VATS for the treatment of non-small cell lung cancer (NSCLC). We retrospectively reviewed the data of randomly selected patients who underwent 3D-CTBA combined with 3D-VATS (3D-CTBA-VATS) or 2D-VATS at the Department of Thoracic Surgery, The First Affiliated Hospital of Soochow University Hospital, from January 2014 to May 2017. The operative duration of 3D group was significantly shorter than the 2D group (P 0.05). The extent of intraoperative bleeding and postoperative drainage in the 3D group was significantly lower than in the 2D group (P 3D group was shorter than in the 2D group (P 0.05). However, hemoptysis and pulmonary air leakage (>3d) occurred significantly less frequently in the 3D than in the 2D group (P 3D-CTBA-VATS is a more accurate and smooth technique and leads to reduced intraoperative and postoperative complications. © 2018 The Authors. Thoracic Cancer published by China Lung Oncology Group and John Wiley & Sons Australia, Ltd.

A Comparison of Vertical Stiffness Values Calculated from Different Measures of Center of Mass Displacement in Single-Leg Hopping.

Science.gov (United States)

Mudie, Kurt L; Gupta, Amitabh; Green, Simon; Hobara, Hiroaki; Clothier, Peter J

2017-02-01

This study assessed the agreement between K vert calculated from 4 different methods of estimating vertical displacement of the center of mass (COM) during single-leg hopping. Healthy participants (N = 38) completed a 10-s single-leg hopping effort on a force plate, with 3D motion of the lower limb, pelvis, and trunk captured. Derived variables were calculated for a total of 753 hop cycles using 4 methods, including: double integration of the vertical ground reaction force, law of falling bodies, a marker cluster on the sacrum, and a segmental analysis method. Bland-Altman plots demonstrated that K vert calculated using segmental analysis and double integration methods have a relatively small bias (0.93 kN⋅m -1 ) and 95% limits of agreement (-1.89 to 3.75 kN⋅m -1 ). In contrast, a greater bias was revealed between sacral marker cluster and segmental analysis (-2.32 kN⋅m -1 ), sacral marker cluster and double integration (-3.25 kN⋅m -1 ), and the law of falling bodies compared with all methods (17.26-20.52 kN⋅m -1 ). These findings suggest the segmental analysis and double integration methods can be used interchangeably for the calculation of K vert during single-leg hopping. The authors propose the segmental analysis method to be considered the gold standard for the calculation of K vert during single-leg, on-the-spot hopping.

Beer spoilage bacteria and hop resistance.

Science.gov (United States)

Sakamoto, Kanta; Konings, Wil N

2003-12-31

For brewing industry, beer spoilage bacteria have been problematic for centuries. They include some lactic acid bacteria such as Lactobacillus brevis, Lactobacillus lindneri and Pediococcus damnosus, and some Gram-negative bacteria such as Pectinatus cerevisiiphilus, Pectinatus frisingensis and Megasphaera cerevisiae. They can spoil beer by turbidity, acidity and the production of unfavorable smell such as diacetyl or hydrogen sulfide. For the microbiological control, many advanced biotechnological techniques such as immunoassay and polymerase chain reaction (PCR) have been applied in place of the conventional and time-consuming method of incubation on culture media. Subsequently, a method is needed to determine whether the detected bacterium is capable of growing in beer or not. In lactic acid bacteria, hop resistance is crucial for their ability to grow in beer. Hop compounds, mainly iso-alpha-acids in beer, have antibacterial activity against Gram-positive bacteria. They act as ionophores which dissipate the pH gradient across the cytoplasmic membrane and reduce the proton motive force (pmf). Consequently, the pmf-dependent nutrient uptake is hampered, resulting in cell death. The hop-resistance mechanisms in lactic acid bacteria have been investigated. HorA was found to excrete hop compounds in an ATP-dependent manner from the cell membrane to outer medium. Additionally, increased proton pumping by the membrane bound H(+)-ATPase contributes to hop resistance. To energize such ATP-dependent transporters hop-resistant cells contain larger ATP pools than hop-sensitive cells. Furthermore, a pmf-dependent hop transporter was recently presented. Understanding the hop-resistance mechanisms has enabled the development of rapid methods to discriminate beer spoilage strains from nonspoilers. The horA-PCR method has been applied for bacterial control in breweries. Also, a discrimination method was developed based on ATP pool measurement in lactobacillus cells. However

Hip-Hop and the Academic Canon

Science.gov (United States)

Abe, Daudi

2009-01-01

Over the last 30 years, the hip-hop movement has risen from the margins to become the preeminent force in US popular culture. In more recent times academics have begun to harness the power of hip-hop culture and use it as a means of infusing transformative knowledge into the mainstream academic discourse. On many college campuses, hip-hop's…

Fundamentals of beer and hop chemistry

Directory of Open Access Journals (Sweden)

Denis De Keukeleire

2000-02-01

Full Text Available Beer brewing is an intricate process encompassing mixing and further elaboration of four essential raw materials, including barley malt, brewing water, hops and yeast. Particularly hops determine to a great extent typical beer qualities such as bitter taste, hoppy flavour, and foam stability. Conversely, hop-derived bitter acids account for an offending lightstruck flavour, which is formed on exposure of beer to light. These various processes are presented in detail, while due emphasis is placed on state-of-the-art hop technology, which provides brewers with efficient means to control bitterness, foam, and light-stability thereby allowing for the production of beers with consistent quality.

A Hybrid DV-Hop Algorithm Using RSSI for Localization in Large-Scale Wireless Sensor Networks.

Science.gov (United States)

Cheikhrouhou, Omar; M Bhatti, Ghulam; Alroobaea, Roobaea

2018-05-08

With the increasing realization of the Internet-of-Things (IoT) and rapid proliferation of wireless sensor networks (WSN), estimating the location of wireless sensor nodes is emerging as an important issue. Traditional ranging based localization algorithms use triangulation for estimating the physical location of only those wireless nodes that are within one-hop distance from the anchor nodes. Multi-hop localization algorithms, on the other hand, aim at localizing the wireless nodes that can physically be residing at multiple hops away from anchor nodes. These latter algorithms have attracted a growing interest from research community due to the smaller number of required anchor nodes. One such algorithm, known as DV-Hop (Distance Vector Hop), has gained popularity due to its simplicity and lower cost. However, DV-Hop suffers from reduced accuracy due to the fact that it exploits only the network topology (i.e., number of hops to anchors) rather than the distances between pairs of nodes. In this paper, we propose an enhanced DV-Hop localization algorithm that also uses the RSSI values associated with links between one-hop neighbors. Moreover, we exploit already localized nodes by promoting them to become additional anchor nodes. Our simulations have shown that the proposed algorithm significantly outperforms the original DV-Hop localization algorithm and two of its recently published variants, namely RSSI Auxiliary Ranging and the Selective 3-Anchor DV-hop algorithm. More precisely, in some scenarios, the proposed algorithm improves the localization accuracy by almost 95%, 90% and 70% as compared to the basic DV-Hop, Selective 3-Anchor, and RSSI DV-Hop algorithms, respectively.

Interchain coupling and 3D modeling of trans-polyacetylene

International Nuclear Information System (INIS)

Bronold, F.; Saxena, A.; Bishop, A.R.

1992-01-01

In spite of the success of the SSH model for trans-polyacetylene in interpreting many experimental results (e.g. optical and magnetic properties) there remain some aspects of the real material which are outside the scope of the simple 1D model. Especially ordering phenomena of doped and undoped trans-polyacetylene as well as transport properties (e.g. electronic and thermal conductivity) are beyond a 1D description. There are many attempts to construct a transport theory for this novel class of materials using solitons or polaxons as the basic ingredients. But so far it is not yet clear whether these typical 1D excitations still exist in crystalline transpolyacetylene. Therefore, to clarify the role which intrinsic self-localized nonlinear excitations characteristic of 1D models play in the bulk (3D) material, we study the stability of a polaronic excitation against interchain coupling. As a preliminary step we consider first two coupled t-(CH) x -chains where the π-electrons are allowed to hop from one chain to the other. Then we introduce a 3D generalization of the SSH model and study a polaron in a 3D crystalline environment

3D composite image, 3D MRI, 3D SPECT, hydrocephalus

International Nuclear Information System (INIS)

Mito, T.; Shibata, I.; Sugo, N.; Takano, M.; Takahashi, H.

2002-01-01

The three-dimensional (3D)SPECT imaging technique we have studied and published for the past several years is an analytical tool that permits visual expression of the cerebral circulation profile in various cerebral diseases. The greatest drawback of SPECT is that the limitation on precision of spacial resolution makes intracranial localization impossible. In 3D SPECT imaging, intracranial volume and morphology may vary with the threshold established. To solve this problem, we have produced complimentarily combined SPECT and helical-CT 3D images by means of general-purpose visualization software for intracranial localization. In hydrocephalus, however, the key subject to be studied is the profile of cerebral circulation around the ventricles of the brain. This suggests that, for displaying the cerebral ventricles in three dimensions, CT is a difficult technique whereas MRI is more useful. For this reason, we attempted to establish the profile of cerebral circulation around the cerebral ventricles by the production of combined 3D images of SPECT and MRI. In patients who had shunt surgery for hydrocephalus, a difference between pre- and postoperative cerebral circulation profiles was assessed by a voxel distribution curve, 3D SPECT images, and combined 3D SPECT and MRI images. As the shunt system in this study, an Orbis-Sigma valve of the automatic cerebrospinal fluid volume adjustment type was used in place of the variable pressure type Medos valve currently in use, because this device requires frequent changes in pressure and a change in pressure may be detected after MRI procedure. The SPECT apparatus used was PRISM3000 of the three-detector type, and 123I-IMP was used as the radionuclide in a dose of 222 MBq. MRI data were collected with an MAGNEXa+2 with a magnetic flux density of 0.5 tesla under the following conditions: field echo; TR 50 msec; TE, 10 msec; flip, 30ueK; 1 NEX; FOV, 23 cm; 1-mm slices; and gapless. 3D images are produced on the workstation TITAN

Fabrication of Capacitive Acoustic Resonators Combining 3D Printing and 2D Inkjet Printing Techniques

Directory of Open Access Journals (Sweden)

Rubaiyet Iftekharul Haque

2015-10-01

Full Text Available A capacitive acoustic resonator developed by combining three-dimensional (3D printing and two-dimensional (2D printed electronics technique is described. During this work, a patterned bottom structure with rigid backplate and cavity is fabricated directly by a 3D printing method, and then a direct write inkjet printing technique has been employed to print a silver conductive layer. A novel approach has been used to fabricate a diaphragm for the acoustic sensor as well, where the conductive layer is inkjet-printed on a pre-stressed thin organic film. After assembly, the resulting structure contains an electrically conductive diaphragm positioned at a distance from a fixed bottom electrode separated by a spacer. Measurements confirm that the transducer acts as capacitor. The deflection of the diaphragm in response to the incident acoustic single was observed by a laser Doppler vibrometer and the corresponding change of capacitance has been calculated, which is then compared with the numerical result. Observation confirms that the device performs as a resonator and provides adequate sensitivity and selectivity at its resonance frequency.

Young Children Manifest Spiritualities in Their Hip-Hop Writing

Science.gov (United States)

Norton, Nadjwa E. L.

2014-01-01

In this article, the author combines multicultural feminist critical theories with the voices of Black and Latina/Latino young spiritual children to extend culturally responsive teaching. The author illuminates how children use their hip-hop writing to construct themselves as people who communicate with God, choose spiritual content for their…

Hip-hop and urban studies

NARCIS (Netherlands)

Jaffe, R.

2014-01-01

How can urban studies research engage fruitfully with hip-hop? This contribution responds to the essays by David Beer and Martin Lamotte on ‘street music’, urban ethnography and ghettoized communities. It discusses how a social science engagement with hip-hop texts might differ from cultural studies

Hop/STI1 modulates retinal proliferation and cell death independent of PrPC

International Nuclear Information System (INIS)

Arruda-Carvalho, Maithe; Njaine, Brian; Silveira, Mariana S.; Linden, Rafael; Chiarini, Luciana B.

2007-01-01

Hop/STI1 is a co-chaperone adaptor protein for Hsp70/Hsp90 complexes. Hop/STI1 is found extracellularly and modulates cell death and differentiation through interaction with the prion protein (PrP C ). Here, we investigated the expression of hop/STI1 and its role upon cell proliferation and cell death in the developing retina. Hop/STI1 is more expressed in developing rat retina than in the mature tissue. Hop/STI1 blocks retinal cell death in the neuroblastic layer (NBL) in a PrP C dependent manner, but failed to protect ganglion cells against axotomy-induced cell death. An antibody raised against hop/STI1 (α-STI1) blocked both ganglion cell and NBL cell death independent of PrP C . cAMP/PKA, ERK, PI3K and PKC signaling pathways were not involved in these effects. Hop/STI1 treatment reduced proliferation, while α-STI1 increased proliferation in the developing retina, both independent of PrP C . We conclude that hop/STI1 can modulate both proliferation and cell death in the developing retina independent of PrP C

Susceptibility of Pediococcus isolates to antimicrobial compounds in relation to hop-resistance and beer-spoilage.

Science.gov (United States)

Haakensen, Monique; Vickers, David M; Ziola, Barry

2009-09-07

Though important in the context of food microbiology and as potential pathogens in immuno-compromised humans, bacterial isolates belonging to the genus Pediococcus are best known for their association with contamination of ethanol fermentation processes (beer, wine, or fuel ethanol). Use of antimicrobial compounds (e.g., hop-compounds, Penicillin) by some industries to combat Pediococcus contaminants is long-standing, yet knowledge about the resistance of pediococci to antimicrobial agents is minimal. Here we examined Pediococcus isolates to determine whether antibiotic resistance is associated with resistance to hops, presence of genes known to correlate with beer spoilage, or with ability to grow in beer. Lactic acid bacteria susceptibility test broth medium (LSM) used in combination with commercially available GPN3F antimicrobial susceptibility plates was an effective method for assessing antimicrobial susceptibility of Pediococcus isolates. We report the finding of Vancomycin-susceptible Pediococcus isolates from four species. Interestingly, we found that hop-resistant, beer-spoilage, and beer-spoilage gene-harbouring isolates had a tendency to be more susceptible, rather than more resistant, to antimicrobial compounds. Our findings indicate that the mechanisms involved in conferring hop-resistance or ability to spoil beer by Pediococcus isolates are not associated with resistance to antibiotics commonly used for treatment of human infections. Also, Vancomycin-resistance was found to be isolate-specific and not intrinsic to the genus as previously believed.

Evaluation of Estrogenic Activity of Licorice Species in Comparison with Hops Used in Botanicals for Menopausal Symptoms

Science.gov (United States)

Hajirahimkhan, Atieh; Simmler, Charlotte; Yuan, Yang; Anderson, Jeffrey R.; Chen, Shao-Nong; Nikolić, Dejan; Dietz, Birgit M.; Pauli, Guido F.; van Breemen, Richard B.; Bolton, Judy L.

2013-01-01

The increased cancer risk associated with hormone therapies has encouraged many women to seek non-hormonal alternatives including botanical supplements such as hops (Humulus lupulus) and licorice (Glycyrrhiza spec.) to manage menopausal symptoms. Previous studies have shown estrogenic properties for hops, likely due to the presence of 8-prenylnarigenin, and chemopreventive effects mainly attributed to xanthohumol. Similarly, a combination of estrogenic and chemopreventive properties has been reported for various Glycyrrhiza species. The major goal of the current study was to evaluate the potential estrogenic effects of three licorice species (Glycyrrhiza glabra, G. uralensis, and G. inflata) in comparison with hops. Extracts of Glycyrrhiza species and spent hops induced estrogen responsive alkaline phosphatase activity in endometrial cancer cells, estrogen responsive element (ERE)-luciferase in MCF-7 cells, and Tff1 mRNA in T47D cells. The estrogenic activity decreased in the order H. lupulus > G. uralensis > G. inflata > G. glabra. Liquiritigenin was found to be the principle phytoestrogen of the licorice extracts; however, it exhibited lower estrogenic effects compared to 8-prenylnaringenin in functional assays. Isoliquiritigenin, the precursor chalcone of liquiritigenin, demonstrated significant estrogenic activities while xanthohumol, a metabolic precursor of 8-prenylnaringenin, was not estrogenic. Liquiritigenin showed ERβ selectivity in competitive binding assay and isoliquiritigenin was equipotent for ER subtypes. The estrogenic activity of isoliquiritigenin could be the result of its cyclization to liquiritigenin under physiological conditions. 8-Prenylnaringenin had nanomolar estrogenic potency without ER selectivity while xanthohumol did not bind ERs. These data demonstrated that Glycyrrhiza species with different contents of liquiritigenin have various levels of estrogenic activities, suggesting the importance of precise labeling of botanical

Evaluation of estrogenic activity of licorice species in comparison with hops used in botanicals for menopausal symptoms.

Directory of Open Access Journals (Sweden)

Atieh Hajirahimkhan

Full Text Available The increased cancer risk associated with hormone therapies has encouraged many women to seek non-hormonal alternatives including botanical supplements such as hops (Humulus lupulus and licorice (Glycyrrhiza spec. to manage menopausal symptoms. Previous studies have shown estrogenic properties for hops, likely due to the presence of 8-prenylnarigenin, and chemopreventive effects mainly attributed to xanthohumol. Similarly, a combination of estrogenic and chemopreventive properties has been reported for various Glycyrrhiza species. The major goal of the current study was to evaluate the potential estrogenic effects of three licorice species (Glycyrrhiza glabra, G. uralensis, and G. inflata in comparison with hops. Extracts of Glycyrrhiza species and spent hops induced estrogen responsive alkaline phosphatase activity in endometrial cancer cells, estrogen responsive element (ERE-luciferase in MCF-7 cells, and Tff1 mRNA in T47D cells. The estrogenic activity decreased in the order H. lupulus > G. uralensis > G. inflata > G. glabra. Liquiritigenin was found to be the principle phytoestrogen of the licorice extracts; however, it exhibited lower estrogenic effects compared to 8-prenylnaringenin in functional assays. Isoliquiritigenin, the precursor chalcone of liquiritigenin, demonstrated significant estrogenic activities while xanthohumol, a metabolic precursor of 8-prenylnaringenin, was not estrogenic. Liquiritigenin showed ERβ selectivity in competitive binding assay and isoliquiritigenin was equipotent for ER subtypes. The estrogenic activity of isoliquiritigenin could be the result of its cyclization to liquiritigenin under physiological conditions. 8-Prenylnaringenin had nanomolar estrogenic potency without ER selectivity while xanthohumol did not bind ERs. These data demonstrated that Glycyrrhiza species with different contents of liquiritigenin have various levels of estrogenic activities, suggesting the importance of precise labeling of

Respiratory disease associated with occupational inhalation to hop (Humulus lupulus) during harvest and processing.

Science.gov (United States)

Reeb-Whitaker, Carolyn K; Bonauto, David K

2014-11-01

There is little published evidence for occupational respiratory disease caused by hop dust inhalation. In the United States, hops are commercially produced in the Pacific Northwest region. To describe occupational respiratory disease in hop workers. Washington State workers' compensation claims filed by hop workers for respiratory disease were systematically identified and reviewed. Incidence rates of respiratory disease in hop workers were compared with rates in field vegetable crop farm workers. Fifty-seven cases of respiratory disease associated with hop dust inhalation were reported from 1995 to 2011. Most cases (61%) were diagnosed by the attending health care practitioner as having work-related asthma. Seven percent of cases were diagnosed as chronic obstructive pulmonary disease, and the remaining cases were diagnosed as allergic respiratory disorders (eg, allergic rhinitis) or asthma-associated symptoms (eg, dyspnea). Cases were associated with hop harvesting, secondary hop processing, and indirect exposure. The incidence rate of respiratory disease in hop workers was 15 cases per 10,000 full-time workers, which was 30 times greater than the incidence rate for field vegetable crop workers. A strong temporal association between hop dust exposure and respiratory symptoms and a clear association between an increase in hop dust concentrations and the clinical onset of symptoms were apparent in 3 cases. Occupational exposure to hop dust is associated with respiratory disease. Respiratory disease rates were higher in hop workers than in a comparison group of agricultural workers. Additional research is needed before hop dust can be confirmed as a causative agent for occupational asthma. Copyright © 2014 American College of Allergy, Asthma & Immunology. Published by Elsevier Inc. All rights reserved.

Combined parameters estimation for 131I dosimetry treatment planning in Hyperthyroidism using 2D and 3D

International Nuclear Information System (INIS)

Hermanos Ameijeiras, La Habana (Cuba))" data-affiliation=" (Departamento de Medicina Nuclear, HCQ Hermanos Ameijeiras, La Habana (Cuba))" >López Díaz, Adlín; Hermanos Ameijeiras, La Habana (Cuba))" data-affiliation=" (Departamento de Medicina Nuclear, HCQ Hermanos Ameijeiras, La Habana (Cuba))" >San Pedro, Aley Palau; Hermanos Ameijeiras, La Habana (Cuba))" data-affiliation=" (Departamento de Medicina Nuclear, HCQ Hermanos Ameijeiras, La Habana (Cuba))" >Martín Escuela, Juan Miguel; Reynosa Montejo, Reysel; Torres Aroche, Leonel Alberto

2017-01-01

Optimization and verification of Specific Patient Treatment Planning with unsealed sources in hyperthyroidism diseases is a desirable goal from medical and radiation protection viewpoints. In order to verify the estimation of patient’s specific treatment dose and his/her related parameters, a combination of 3 different apparatus or pieces of equipment used in nuclear medicine were studied - the Iodine Probe, a Philips Forte Camera with pinhole collimators and a Mediso Nucline with HEGP for planar and SPECT techniques- by using the typical neck phantom and 131 I sources simulating diagnosis and treatment procedure. The linear behavior on diagnostic and therapeutic activity range was verified, showing a linear correlation fitting factor R 2 > 0,99. The differences between thyroid uptake determinations in all equipment were less than 6 % for therapeutic activities and less than 1,1 % in the diagnostic range. The combined protocol to calculate all the necessary parameters for the patient treatment dose planning using 2D or 3D approach was established and verified, avoiding wasting time with gamma cameras and with only one administration of 131 I. (author)

Structure and DNA-binding of meiosis-specific protein Hop2

Science.gov (United States)

Zhou, Donghua; Moktan, Hem; Pezza, Roberto

2014-03-01

Here we report structure elucidation of the DNA binding domain of homologous pairing protein 2 (Hop2), which is important to gene diversity when sperms and eggs are produced. Together with another protein Mnd1, Hop2 enhances the strand invasion activity of recombinase Dmc1 by over 30 times, facilitating proper synapsis of homologous chromosomes. However, the structural and biochemical bases for the function of Hop2 and Mnd1 have not been well understood. As a first step toward such understanding, we recently solved the structure for the N-terminus of Hop2 (1-84) using solution NMR. This fragment shows a typical winged-head conformation with recognized DNA binding activity. DNA interacting sites were then investigated by chemical shift perturbations in a titration experiment. Information of these sites was used to guide protein-DNA docking with MD simulation, revealing that helix 3 is stably lodged in the DNA major groove and that wing 1 (connecting strands 2 and 3) transiently comes in contact with the minor groove in nanosecond time scale. Mutagenesis analysis further confirmed the DNA binding sites in this fragment of the protein.

Fasilitas Pelatihan dan Pergelaran Seni Tari Hip Hop di Surabaya

OpenAIRE

Yanuar, Sandy

2014-01-01

Fasilitas Pelatihan dan Pergelaran Seni Tari Hip Hop di Surabaya merupakan fasilitas yang disediakan bagi semua penari Hip Hop di Surabaya untuk berlatih menari dan mempertunjukan tarian Hip Hop. Fasilitas ini tersedia bagi semua penari Hip Hop termasuk penari difable, mengingat kaum difable juga dapat menari Hip Hop. Namun karena di Surabaya belum memiliki fasilitas yang memadai bagi semua penari Hip Hop termasuk penari difable untuk menari dan memiliki tempat pertunjukan yang berkarakter Hi...

Structure and Charge Hopping Dynamics in Green Rust

International Nuclear Information System (INIS)

Wander, Matthew C.; Rosso, Kevin M.; Schoonen, Martin A.

2007-01-01

Green rust is a family of mixed-valent iron phases formed by a number of abiotic and biotic processes under alkaline suboxic conditions. Due to its high Fe2+ content, green rust is a potentially important phase for pollution remediation by serving as a powerful electron donor for reductive transformation. However, mechanisms of oxidation of this material are poorly understood. An essential component of the green rust structure is a mixed-valent brucite-like Fe(OH)2 sheet comprised of a two dimensional network of edge-sharing iron octahedra. Room temperature Mossbauer spectra show a characteristic signature for intermediate valence on the iron atoms in this sheet, indicative of a Fe2+-Fe3+ valence interchange reaction faster than approximately 107s-1. Using Fe(OH)2 as structural analogue for reduced green rust, we performed Hartree-Fock calculations on periodic slab models and cluster representations to determine the structure and hopping mobility of Fe3+ hole polarons in this material, providing a first principles assessment of the Fe2+-Fe3+ valence interchange reaction rate. The calculations show that among three possible symmetry unique iron-to-iron hops within a sheet, a hop to next-nearest neighbors at an intermediate distance of 5.6Angstroms is the fastest. The predicted rate is on the order of 1012 s-1 consistent the Mossbauer-based constraint. All other possibilities, including hopping across interlayer spaces, are predicted to be slower than 107s-1. Collectively, the findings suggest the possibility of hole self-diffusion along sheets as a mechanism for regeneration of lattice Fe2+ sites, consistent with previous experimental observations of edge-inward progressive oxidation of green rust.

Electronic and vibrational hopping transport in boron carbides

International Nuclear Information System (INIS)

Emin, D.

1991-01-01

General concepts of hopping-type transport and localization are reviewed. Disorder, electronic correlations and atomic displacements, effects ignored in electronic band structure calculations, foster localization of electronic charge carriers. Examples are given that illustrate the efficacy of these effects in producing localization. This introduction is followed by a brief discussion of the relation between hopping-type transport and localization. The fundamentals of the formation, localization, and hopping transport of small polarons and/or bipolarons is then described. Electronic transport in boron carbides is presented as an example of the adiabatic hopping of small bipolarons. Finally, the notion of vibrational hopping is introduced. The high-temperature thermal diffusion in boron carbides is presented as a potential application of this idea

HIP HOP for HIV Awareness: Using Hip Hop Culture to Promote Community-Level HIV Prevention

Science.gov (United States)

Hill, Mandy J.; Hallmark, Camden J.; McNeese, Marlene; Blue, Nike; Ross, Michael W.

2014-01-01

The goal of this paper was to determine the effectiveness of the HIP HOP for HIV Awareness intervention, an innovative model utilising an exchange of an HIV test for a hip hop concert ticket, in a metropolitan city among African American youth and young adults. A subset of intervention participants participated in standardised testing, sex…

On the Performance of Millimeter Wave-based RF-FSO Multi-hop and Mesh Networks

KAUST Repository

Makki, Behrooz

2017-09-22

This paper studies the performance of multi-hop and mesh networks composed of millimeter wave-based radio frequency (RF) and free-space optical (FSO) links. The results are obtained in cases with and without hybrid automatic repeat request (HARQ). Using the central limit theorem as well as other state-of-the-art approximation schemes, we derive closed-form expressions for the networks’ outage probability and ergodic achievable rates. We also evaluate the effect of various parameters such as power amplifiers efficiency, number of antennas as well as different coherence times of the RF and the FSO links on the system performance. Finally, we determine the minimum number of the transmit antennas in the RF link such that the same rate is supported in the RF- and the FSO-based hops. The results show the efficiency of the RF-FSO setups in different conditions. Moreover, HARQ can effectively improve the outage probability/energy efficiency, and compensate for the effect of hardware impairments in RF-FSO networks. For common parameter settings of the RF-FSO dual-hop networks, outage probability of 10−4 and code rate of 3 nats-per-channel-use, the implementation of HARQ with a maximum of 2 and 3 retransmissions reduces the required power, compared to cases with open-loop communication, by 13 and 17 dB, respectively.

Investigation Into the Utilization of 3D Printing in Laser Cooling Experiments

Science.gov (United States)

Hazlett, Eric; Nelson, Brandon; de Leon, Sam Diaz; Shaw, Jonah

2016-05-01

With the advancement of 3D printing new opportunities are abound in many different fields, but with the balance between the precisions of atomic physics experiments and the material properties of current 3D printers the benefit of 3D printing technology needs to be investigated. We report on the progress of two investigations of 3D printing of benefit to atomic physics experiments: laser feedback module and the other being an optical chopper. The first investigation looks into creation of a 3D printed laser diode feedback module. This 3D printed module would allow for the quick realization of an external cavity diode laser that would have an adjustable cavity distance. We will report on the first tests of this system, by looking at Rb spectroscopy and mode-hop free tuning range as well as possibilities of using these lasers for MOT generation. We will also discuss our investigation into a 3D-printed optical chopper that utilizes an Arduino and a computer hard drive motor. By implementing an additional Arduino we create a low cost way to quickly measure laser beam waists.

A combined system for 3D printing cybersecurity

Science.gov (United States)

Straub, Jeremy

2017-06-01

Previous work has discussed the impact of cybersecurity breaches on 3D printed objects. Multiple attack types that could weaken objects, make them unsuitable for certain applications and even create safety hazards have been presented. This paper considers a visible light sensing-based verification system's efficacy as a means of thwarting cybersecurity threats to 3D printing. This system detects discrepancies between expected and actual printed objects (based on an independent pristine CAD model). Whether reliance on an independent CAD model is appropriate is also considered. The future of 3D printing is projected and the importance of cybersecurity in this future is discussed.

Multiscale 3D manufacturing: combining thermal extrusion printing with additive and subtractive direct laser writing

Science.gov (United States)

Malinauskas, Mangirdas; Lukoševičius, Laurynas; MackevičiÅ«tÄ--, DovilÄ--; BalčiÅ«nas, Evaldas; RekštytÄ--, Sima; Paipulas, Domas

2014-05-01

A novel approach for efficient manufacturing of three-dimensional (3D) microstructured scaffolds designed for cell studies and tissue engineering applications is presented. A thermal extrusion (fused filament fabrication) 3D printer is employed as a simple and low-cost tabletop device enabling rapid materialization of CAD models out of biocompatible and biodegradable polylactic acid (PLA). Here it was used to produce cm- scale microporous (pore size varying from 100 to 400 µm) scaffolds. The fabricated objects were further laser processed in a direct laser writing (DLW) subtractive (ablation) and additive (lithography) manners. The first approach enables precise surface modification by creating micro-craters, holes and grooves thus increasing the surface roughness. An alternative way is to immerse the 3D PLA scaffold in a monomer solution and use the same DLW setup to refine its inner structure by fabricating dots, lines or a fine mesh on top as well as inside the pores of previously produced scaffolds. The DLW technique is empowered by ultrafast lasers - it allows 3D structuring with high spatial resolution in a great variety of photosensitive materials. Structure geometry on macro- to micro- scales could be finely tuned by combining these two fabrication techniques. Such artificial 3D substrates could be used for cell growth or as biocompatible-biodegradable implants. This combination of distinct material processing techniques enables rapid fabrication of diverse functional micro- featured and integrated devices. Hopefully, the proposed approach will find numerous applications in the field of ms, microfluidics, microoptics and many others.

Design and Dynamics Analysis of a Bio-Inspired Intermittent Hopping Robot for Planetary Surface Exploration

Directory of Open Access Journals (Sweden)

Long Bai

2012-10-01

Full Text Available A small, bio-inspired and minimally actuated intermittent hopping robot for planetary surface exploration is proposed in this paper. The robot uses a combined-geared six-bar linkage/spring mechanism, which has a possible rich trajectory and metamorphic characteristics and, due to this, the robot is able to recharge, lock/release and jump by using just a micro-power motor as the actuator. Since the robotic system has a closed-chain structure and employs underactuated redundant motion, the constrained multi-body dynamics are derived with time-varying driving parameters and ground unilateral constraint both taken into consideration. In addition, the established dynamics equations, mixed of higher order differential and algebraic expressions, are solved by the immediate integration algorithm. A prototype is implemented and experiments are carried out. The results show that the robot, using a micro-power motor as the actuator and solar cells as the power supply, can achieve a biomimetic multi-body hopping stance and a nonlinearly increasing driving force. Typically, the robot can jump a horizontal distance of about 1 m and a vertical height of about 0.3 m, with its trunk and foot moving stably during takeoff. In addition, the computational and experimental results are consistent as regards the hopping performance of the robot, which suggests that the proposed dynamics model and its solution have general applicability to motion prediction and the performance analysis of intermittent hopping robots.

Susceptibility of Pediococcus isolates to antimicrobial compounds in relation to hop-resistance and beer-spoilage

Directory of Open Access Journals (Sweden)

Ziola Barry

2009-09-01

Full Text Available Abstract Background Though important in the context of food microbiology and as potential pathogens in immuno-compromised humans, bacterial isolates belonging to the genus Pediococcus are best known for their association with contamination of ethanol fermentation processes (beer, wine, or fuel ethanol. Use of antimicrobial compounds (e.g., hop-compounds, Penicillin by some industries to combat Pediococcus contaminants is long-standing, yet knowledge about the resistance of pediococci to antimicrobial agents is minimal. Here we examined Pediococcus isolates to determine whether antibiotic resistance is associated with resistance to hops, presence of genes known to correlate with beer spoilage, or with ability to grow in beer. Results Lactic acid bacteria susceptibility test broth medium (LSM used in combination with commercially available GPN3F antimicrobial susceptibility plates was an effective method for assessing antimicrobial susceptibility of Pediococcus isolates. We report the finding of Vancomycin-susceptible Pediococcus isolates from four species. Interestingly, we found that hop-resistant, beer-spoilage, and beer-spoilage gene-harbouring isolates had a tendency to be more susceptible, rather than more resistant, to antimicrobial compounds. Conclusion Our findings indicate that the mechanisms involved in conferring hop-resistance or ability to spoil beer by Pediococcus isolates are not associated with resistance to antibiotics commonly used for treatment of human infections. Also, Vancomycin-resistance was found to be isolate-specific and not intrinsic to the genus as previously believed.

Revolutionizing Environmental Education through Indigenous Hip Hop Culture

Science.gov (United States)

Gorlewski, Julie; Porfilio, Brad J.

2012-01-01

Based upon the life histories of six Indigenous hip hop artists of the Beat Nation artist collective, this essay captures how Indigenous hip hop has the potential to revolutionize environmental education. Hip hop provides Indigenous youth an emancipatory space to raise their opposition to neocolonial controls of Indigenous territories that…

Performance analysis of multi-hop wireless packet networks

Directory of Open Access Journals (Sweden)

Lim J.-T.

1997-01-01

Full Text Available In this paper, a unified analytical framework for performance analysis of multi-hop wireless packet networks is developed. The effect of coupling between the hops on the degradation of the delay-throughput characteristics and the probability of blocking is investigated. The issue of hop decoupling is addressed.

Linking the mechanics and energetics of hopping with elastic ankle exoskeletons.

Science.gov (United States)

Farris, Dominic James; Sawicki, Gregory S

2012-12-15

The springlike mechanics of the human leg during bouncing gaits has inspired the design of passive assistive devices that use springs to aid locomotion. The purpose of this study was to test whether a passive spring-loaded ankle exoskeleton could reduce the mechanical and energetic demands of bilateral hopping on the musculoskeletal system. Joint level kinematics and kinetics were collected with electromyographic and metabolic energy consumption data for seven participants hopping at four frequencies (2.2, 2.5, 2.8, and 3.2 Hz). Hopping was performed without an exoskeleton; with an springless exoskeleton; and with a spring-loaded exoskeleton. Spring-loaded ankle exoskeletons reduced plantar flexor muscle activity and the biological contribution to ankle joint moment (15-25%) and average positive power (20-40%). They also facilitated reductions in metabolic power (15-20%) across frequencies from 2.2 to 2.8 Hz compared with hopping with a springless exoskeleton. Reductions in metabolic power compared with hopping with no exoskeleton were restricted to hopping at 2.5 Hz only (12%). These results highlighted the importance of reducing the rate of muscular force production and work to achieve metabolic reductions. They also highlighted the importance of assisting muscles acting at the knee joint. Exoskeleton designs may need to be tuned to optimize exoskeleton mass, spring stiffness, and spring slack length to achieve greater metabolic reductions.

Antimicrobial activity of hop extracts against foodborne pathogens for meat applications.

Science.gov (United States)

Kramer, B; Thielmann, J; Hickisch, A; Muranyi, P; Wunderlich, J; Hauser, C

2015-03-01

The objective of this study was the fundamental investigation of the antimicrobial efficiency of various hop extracts against selected foodborne pathogens in vitro, as well as their activity against Listeria monocytogenes in a model meat marinade and on marinated pork tenderloins. In a first step, the minimum inhibitory concentrations (MIC) of three hop extracts containing either α- or β-acids or xanthohumol were determined against test bacteria including L. monocytogenes, Staphylococcus aureus, Salmonella enterica and Escherichia coli by a colorimetric method based on the measurement of bacterial metabolic activity. Moreover, the influence of either lactic or citric acid on the antimicrobial activity of the hop extracts was evaluated. The efficiency of hop extracts as a natural food preservative was then tested in a model meat marinade at 2 and 8°C, respectively, and finally on marinated pork. The experiments showed that Gram-positive bacteria were strongly inhibited by hop extracts containing β-acids and xanthohumol (MIC values of 6.3 and 12.5 ppm, respectively), whereas the antimicrobial activity of the investigated α-acid extract was significantly lower (MIC values of 200 ppm). Gram-negative bacteria were highly resistant against all tested hop extracts. Acidification of the test media led to a decrease of the MIC values. The inhibitory activity of the hop extracts against L. monocytogenes was strongly reduced in a fat-containing model meat marinade, but the efficiency of β-acids in this matrix could be increased by lowering pH and storage temperatures. By applying 0.5 % β-acids at pH = 5 in a model marinade, the total aerobic count of pork tenderloins was reduced up to 0.9 log10 compared with marinated pork without hop extract after 2 weeks of storage at 5°C. β-acid containing hop extracts have proven to possess a high antimicrobial activity against Gram-positive bacteria in vitro and in a practice-related application for food preservation

The iterative hopping expansion algorithm for Monte Carlo calculations with very light fermions

International Nuclear Information System (INIS)

Montvay, I.

1985-03-01

The number of numerical operations necessary for a Monte Carlo simulation with very light fermions (like u- and d-quarks in quantum chromodynamics) is estimated within the iterative hopping expansion method. (orig.)

Hip-Hop Is My Passport! Using Hip-Hop and Digital Literacies to Understand Global Citizenship Education

Science.gov (United States)

Horton, Akesha Monique

2013-01-01

Hip-hop has exploded around the world among youth. It is not simply an American source of entertainment; it is a global cultural movement that provides a voice for youth worldwide who have not been able to express their "cultural world" through mainstream media. The emerging field of critical hip-hop pedagogy has produced little…

Culturally Relevant Teaching: Hip-Hop Pedagogy in Urban Schools. Counterpoints: Studies in the Postmodern Theory of Education. Volume 396

Science.gov (United States)

Prier, Darius D.

2012-01-01

"Culturally Relevant Teaching" centers hip-hop culture as a culturally relevant form of critical pedagogy in urban pre-service teacher education programs. In this important book, Darius D. Prier explores how hip-hop artists construct a sense of democratic education and pedagogy with transformative possibilities in their schools and communities. In…

Particle hopping vs. fluid-dynamical models for traffic flow

Energy Technology Data Exchange (ETDEWEB)

Nagel, K.

1995-12-31

Although particle hopping models have been introduced into traffic science in the 19509, their systematic use has only started recently. Two reasons for this are, that they are advantageous on modem computers, and that recent theoretical developments allow analytical understanding of their properties and therefore more confidence for their use. In principle, particle hopping models fit between microscopic models for driving and fluiddynamical models for traffic flow. In this sense, they also help closing the conceptual gap between these two. This paper shows connections between particle hopping models and traffic flow theory. It shows that the hydrodynamical limits of certain particle hopping models correspond to the Lighthill-Whitham theory for traffic flow, and that only slightly more complex particle hopping models produce already the correct traffic jam dynamics, consistent with recent fluid-dynamical models for traffic flow. By doing so, this paper establishes that, on the macroscopic level, particle hopping models are at least as good as fluid-dynamical models. Yet, particle hopping models have at least two advantages over fluid-dynamical models: they straightforwardly allow microscopic simulations, and they include stochasticity.

Hip-hop as a resource for understanding the urban context

Science.gov (United States)

Brown, Bryan

2010-06-01

This review explores Edmin's "Science education for the hip-hop generation" by documenting how he frames hip-hop as a means to access urban student culture. He argues that hip-hop is more than a mere music genre, but rather a culture that provides young people with ways of connecting to the world. Two primary ideas emerged as central to his work. First, he contends that students develop communal relationships and collective identities based on the common experiences expressed in hip-hop. Second, he identifies how the conscious recognition of institutional oppression serves a central feature in urban schools. Emdin's rich, and personal call for a greater understanding of hip-hop culture provides the text with an unmatched strength. He skillfully uses personal narratives from his own experience as well as quotes and references from hip-hop songs to make the nuances of hip hop transparent to science educators. Conversely, the limitation of this text is found in its unfulfilled promise to provide pragmatic examples of how to engage in a hip-hop based science education. Emdin's work is ultimately valuable as it extends our current knowledge about urban students and hip-hop in meaningful ways.

Combining ESPI with laser scanning for 3D characterization of racing tyres sections

Science.gov (United States)

Pagliarulo, Vito; Farroni, Flavio; Ferraro, Pietro; Lanzotti, Antonio; Martorelli, Massimo; Memmolo, Pasquale; Speranza, Domenico; Timpone, Francesco

2018-05-01

In this work is exploited the possibility to use two optical techniques and combining their measurements for the 3D characterization of different tyres with particular attention to the tyre's section. Electronic Speckle Pattern Interferometry (ESPI) and Laser Scanner (LS) based on principle of triangulation have been employed for investigating and studying the tyre's section and 3D shape respectively. As case studies two different racing tyres, Michelin S9H and Pirelli Diablo respectively, have been considered. The investigation has been focused at the aim to evaluate and measure the section's components in order to add to the 3D model obtained by Laser Scanning accurate information about the different layers along through the tyres sections. It is important to note that the assessment about the different layers along the section is a very difficult task to obtain by visual inspection or classical microscopy and even with the LS. Here we demonstrate that the different layers can be easily highlighted and identified by mean of the ESPI.

HapHop-Physio: a computer game to support cognitive therapies in children

Directory of Open Access Journals (Sweden)

Rico-Olarte C

2017-07-01

Full Text Available Carolina Rico-Olarte,1 Diego M López,1 Santiago Narváez,1 Charic D Farinango,1 Peter S Pharow2 1Faculty of Electronics and Telecommunications Engineering, Universidad del Cauca, Telematics Engineering Research Group, Popayán, Colombia; 2Fraunhofer Institute of Digital Media and Technology IDMT, Ilmenau, Germany Background: Care and support of children with physical or mental disabilities are accompanied with serious concerns for parents, families, healthcare institutions, schools, and their communities. Recent studies and technological innovations have demonstrated the feasibility of providing therapy and rehabilitation services to children supported by computer games. Objective: The aim of this paper is to present HapHop-Physio, an innovative computer game that combines exercise with fun and learning, developed to support cognitive therapies in children. Methods: Conventional software engineering methods such as the Scrum methodology, a functionality test and a related usability test, were part of the comprehensive methodology adapted to develop HapHop-Physio. Results: The game supports visual and auditory attention therapies, as well as visual and auditory memory activities. The game was developed by a multidisciplinary team, which was based on the Hopscotch® platform provided by Fraunhofer Institute for Digital Media Technology IDMT Institute in Germany, and designed in collaboration with a rehabilitation clinic in Colombia. HapHop-Physio was tested and evaluated to probe its functionality and user satisfaction. Conclusion: The results show the development of an easy-to-use and funny game by a multidisciplinary team using state-of-the-art videogame technologies and software methodologies. Children testing the game concluded that they would like to play again while undergoing rehabilitation therapies. Keywords: computer game, exer-games, cognitive therapies, rehabilitation

One-shot 3D scanning by combining sparse landmarks with dense gradient information

Science.gov (United States)

Di Martino, Matías; Flores, Jorge; Ferrari, José A.

2018-06-01

Scene understanding is one of the most challenging and popular problems in the field of robotics and computer vision and the estimation of 3D information is at the core of most of these applications. In order to retrieve the 3D structure of a test surface we propose a single shot approach that combines dense gradient information with sparse absolute measurements. To that end, we designed a colored pattern that codes fine horizontal and vertical fringes, with sparse corners landmarks. By measuring the deformation (bending) of horizontal and vertical fringes, we are able to estimate surface local variations (i.e. its gradient field). Then corner sparse landmarks are detected and matched to infer spare absolute information about the test surface height. Local gradient information is combined with the sparse absolute values which work as anchors to guide the integration process. We show that this can be mathematically done in a very compact and intuitive way by properly defining a Poisson-like partial differential equation. Then we address in detail how the problem can be formulated in a discrete domain and how it can be practically solved by straight forward linear numerical solvers. Finally, validation experiment are presented.

The Effect of Rap/Hip-Hop Music on Young Adult Smoking: An Experimental Study.

Science.gov (United States)

Harakeh, Zeena; Bogt, Tom F M Ter

2018-02-16

Music may influence young people's behavior through its lyrics. Substance use references occur more frequently in rap/hip-hop than in other music genres. The aim was to examine whether the exposure to rap/hip-hop lyrics referring to substance use affected cigarette smoking. An experiment with a 3-group between subject design was conducted among 74 daily-smoking young adults ranging in age from 17 to 25 years old. Three conditions were tested in a mobile lab (camper vehicle) from May to December 2011, i.e., regular chart pop music (N = 28), rap/hip-hop with non-frequent references to substance use (N = 24), and rap/hip-hop with frequent references to substance use (N = 22). One-way ANOVA showed that participants listening to substance use infused rap/hip-hop songs felt significantly less pleasant, liked the songs less, and comprehended the songs less compared to participants listening to pop songs. Poisson loglinear analyses revealed that compared to the pop music condition, none of the two rap/hip-hop music conditions had a significant effect on acute smoking. Thus, contrary to expectations, the two different rap/hip-hop conditions did not have a significantly different effect on acute smoking. Listening to rap/hip-hop, even rap hip/hop with frequent referrals to substance use (primarily alcohol and drug use, and general smoking referrals), does not seem to encourage cigarette smoking among Dutch daily-smoking young adults, at least short term.

Research on synchronization technology of frequency hopping communication system

Science.gov (United States)

Zhao, Xiangwu; Quan, Houde; Cui, Peizhang

2018-05-01

Frequency Hopping (FH) communication is a technology of spread spectrum communication. It has strong anti-interference, anti-interception and security capabilities, and has been widely applied in the field of communications. Synchronization technology is one of the most crucial technologies in frequency hopping communication. The speed of synchronization establishment and the reliability of synchronous system directly affect the performance of frequency hopping communication system. Therefore, the research of synchronization technology in frequency hopping communication has important value.

Optimal combination of illusory and luminance-defined 3-D surfaces: A role for ambiguity.

Science.gov (United States)

Hartle, Brittney; Wilcox, Laurie M; Murray, Richard F

2018-04-01

The shape of the illusory surface in stereoscopic Kanizsa figures is determined by the interpolation of depth from the luminance edges of adjacent inducing elements. Despite ambiguity in the position of illusory boundaries, observers reliably perceive a coherent three-dimensional (3-D) surface. However, this ambiguity may contribute additional uncertainty to the depth percept beyond what is expected from measurement noise alone. We evaluated the intrinsic ambiguity of illusory boundaries by using a cue-combination paradigm to measure the reliability of depth percepts elicited by stereoscopic illusory surfaces. We assessed the accuracy and precision of depth percepts using 3-D Kanizsa figures relative to luminance-defined surfaces. The location of the surface peak was defined by illusory boundaries, luminance-defined edges, or both. Accuracy and precision were assessed using a depth-discrimination paradigm. A maximum likelihood linear cue combination model was used to evaluate the relative contribution of illusory and luminance-defined signals to the perceived depth of the combined surface. Our analysis showed that the standard deviation of depth estimates was consistent with an optimal cue combination model, but the points of subjective equality indicated that observers consistently underweighted the contribution of illusory boundaries. This systematic underweighting may reflect a combination rule that attributes additional intrinsic ambiguity to the location of the illusory boundary. Although previous studies show that illusory and luminance-defined contours share many perceptual similarities, our model suggests that ambiguity plays a larger role in the perceptual representation of illusory contours than of luminance-defined contours.

MR venography using the 3D-MEDIC (multi echo data imaging combination) sequence for lower extremities

International Nuclear Information System (INIS)

Kitagawa, Hisashi; Kishi, Takayuki; Saito, Ryo; Shohji, Tomokazu; Noguchi, Keiji; Sunohara, Nobuo

2008-01-01

It is possible to diagnose varicose vein from medical history and physical examinations including inspection and palpation. Non-contrast enhanced MRV (magnetic resonance venography) is becoming popular because it can be easily performed without being affected by the radiographer's skill. We thought that the use of MEDIC (multi echo data imaging combination) would enable us to delineate varicose veins within a short acquisition time and without need for synchronization or contrast enhancement. We used the SIEMENS MAGNETOM Avanto 1.5-Tesla unit to acquire images. Our subjects were five healthy volunteers and five patients with varicose vein. The signal strength of deep veins and muscles were measured. The SNR (signal-to-nose ratio) of deep veins and the CNR (contrast-to-noise ratio) between deep veins and muscles were also measured. Flip angle, fat suppression methods, MTC (magnetic transfer contrast) pulse, and combined echo. Using the optimum image acquisition protocol following our preliminary study with varicose vein patients, the ability of the 3D-MEDIC method to delineate varicose veins was compared with that of the electrocardiogram (ECG)-synchronized two-dimensional time of flight (2D-TOF) method. We found that the following settings would enable us to acquire images from a wide range=coronal, within short acquisition time and needless ECG-triggering. Flip angle=20 degrees, fat suppression method=water excitation, MTC pulse=ON, combined echo=2. 3D-MEDIC was better than the 2D-TOF method in delineating the varicose vein itself and the connection between the varicose vein and deep veins. It is expected that 3D-MEDIC may be useful in the clinical diagnosis of varicose veins. (author)

Plasmodium falciparum Hop (PfHop Interacts with the Hsp70 Chaperone in a Nucleotide-Dependent Fashion and Exhibits Ligand Selectivity.

Directory of Open Access Journals (Sweden)

Tawanda Zininga

Full Text Available Heat shock proteins (Hsps play an important role in the development and pathogenicity of malaria parasites. One of the most prominent functions of Hsps is to facilitate the folding of other proteins. Hsps are thought to play a crucial role when malaria parasites invade their host cells and during their subsequent development in hepatocytes and red blood cells. It is thought that Hsps maintain proteostasis under the unfavourable conditions that malaria parasites encounter in the host environment. Although heat shock protein 70 (Hsp70 is capable of independent folding of some proteins, its functional cooperation with heat shock protein 90 (Hsp90 facilitates folding of some proteins such as kinases and steroid hormone receptors into their fully functional forms. The cooperation of Hsp70 and Hsp90 occurs through an adaptor protein called Hsp70-Hsp90 organising protein (Hop. We previously characterised the Hop protein from Plasmodium falciparum (PfHop. We observed that the protein co-localised with the cytosol-localised chaperones, PfHsp70-1 and PfHsp90 at the blood stages of the malaria parasite. In the current study, we demonstrated that PfHop is a stress-inducible protein. We further explored the direct interaction between PfHop and PfHsp70-1 using far Western and surface plasmon resonance (SPR analyses. The interaction of the two proteins was further validated by co-immunoprecipitation studies. We observed that PfHop and PfHsp70-1 associate in the absence and presence of either ATP or ADP. However, ADP appears to promote the association of the two proteins better than ATP. In addition, we investigated the specific interaction between PfHop TPR subdomains and PfHsp70-1/ PfHsp90, using a split-GFP approach. This method allowed us to observe that TPR1 and TPR2B subdomains of PfHop bind preferentially to the C-terminus of PfHsp70-1 compared to PfHsp90. Conversely, the TPR2A motif preferentially interacted with the C-terminus of PfHsp90. Finally, we

Hopping models for ion conduction in noncrystals

DEFF Research Database (Denmark)

Dyre, Jeppe; Schrøder, Thomas

2007-01-01

semiconductors). These universalities are subject of much current interest, for instance interpreted in the context of simple hopping models. In the present paper we first discuss the temperature dependence of the dc conductivity in hopping models and the importance of the percolation phenomenon. Next......, the experimental (quasi)universality of the ac conductivity is discussed. It is shown that hopping models are able to reproduce the experimental finding that the response obeys time-temperature superposition, while at the same time a broad range of activation energies is involved in the conduction process. Again...

How Does a Hopping Kangaroo Breathe?

Science.gov (United States)

Giuliodori, Mauricio J.; Lujan, Heidi L.; Janbaih, Hussein; DiCarlo, Stephen E.

2010-01-01

We developed a model to demonstrate how a hopping kangaroo breathes. Interestingly, a kangaroo uses less energy to breathe while hopping than while standing still. This occurs, in part, because rather than using muscle power to move air into and out of the lungs, air is pulled into (inspiration) and pushed out of (expiration) the lungs as the…

Suppression of hop looper (Lepidoptera: Noctuidae) by the fungicide pyraclostrobin.

Science.gov (United States)

Woods, J L; Gent, D H

2014-04-01

The hop looper, Hypena humuli Harris, is a reemergent pest of hop that often requires treatment to mitigate crop damage. In 4 yr of field trials, plots treated with fungicides were observed to sustain less hop looper defoliation compared with nontreated plots. Further investigation revealed that abundance of hop looper and associated defoliation were reduced when the fungicide pyraclostrobin was applied in late July to early August. Two other fungicides possessing active ingredients in the same chemical family (quinone outside inhibitor) did not reduce abundance of hop looper or its defoliation. Pyraclostrobin is efficacious against powdery mildew diseases, and the application timing evaluated in these studies corresponds with a period of juvenile susceptibility of hop cones to the disease. Use of fungicides containing pyraclostrobin at this time may have the ancillary benefit of reducing hop looper damage, potentially obviating the need for broad-spectrum insecticides later in the season. Follow-up studies are warranted to determine whether pyraclostrobin may inhibit other lepidopteran species.

Two-surface Monte Carlo with basin hopping: quantum mechanical trajectory and multiple stationary points of water cluster.

Science.gov (United States)

Bandyopadhyay, Pradipta

2008-04-07

The efficiency of the two-surface monte carlo (TSMC) method depends on the closeness of the actual potential and the biasing potential used to propagate the system of interest. In this work, it is shown that by combining the basin hopping method with TSMC, the efficiency of the method can be increased by several folds. TSMC with basin hopping is used to generate quantum mechanical trajectory and large number of stationary points of water clusters.

From "They" Science to "Our" Science: Hip Hop Epistemology in STEAM Education

Science.gov (United States)

Dolberry, Maurice E.

Hip hop has moved from being considered a type of music into being understood as a culture in which a prominent type of music originates. Hip hop culture has a philosophy and epistemological constructs as well. This study analyzed those constructs to determine how conceptions of science factor in hip hop worldviews. Pedagogical models in culturally responsive teaching and Science, Technology, Engineering, Arts, and Mathematics (STEAM) education were also examined to discern their philosophical connections with hip hop culture. These connections were used to create two theoretical models. The first one, Hip Hop Science, described how scientific thought functions in hip hop culture. The second model, Hip Hop STEAM Pedagogy, proposes how hip hop culture can inform STEAM teaching practices. The study began by using Critical Race Theory to create a theoretical framework proposing how the two theoretical models could be derived from the philosophical and pedagogical concepts. Content analysis and narrative inquiry were used to analyze data collected from scholarly texts, hip hop songs, and interviews with hip hop-responsive educators. The data from these sources were used initially to assess the adequacy of the proposed theoretical framework, and subsequently to improve its viability. Four overlapping themes emerged from the data analyses, including hip hop-resistance to formal education; how hip hop culture informs pedagogical practice in hip hop-responsive classrooms; conceptions of knowledge and reality that shape how hip hoppers conduct scientific inquiry; and hip hop-based philosophies of effective teaching for hip hoppers as a marginalized cultural group. The findings indicate that there are unique connections between hip hop epistemology, sciencemindedness, and pedagogical practices in STEAM education. The revised theoretical framework clarified the nature of these connections, and supported claims from prior research that hip hop culture provides viable sites of

Hip-Hopping across China: Intercultural Formulations of Local Identities

Science.gov (United States)

Barrett, Catrice

2012-01-01

The linguistic dimensions of globalized hip-hop cannot be understood simply as a byproduct of English as an American export. As hip-hop mobilizes, it is common (and arguably necessary) for global hip-hop communities to struggle through purposeful, semiotically rooted dialectics over what constitutes "authentic" and respectable forms of…

Effect of application timing and method on efficacy and phytotoxicity of 1,3-D, chloropicrin and metam-sodium combinations in squash plasticulture.

Science.gov (United States)

Desaeger, Johan A; Seebold, Kenneth W; Csinos, Alex S

2008-03-01

Metam-sodium, 1,3-dichloropropene (1,3-D) and chloropicrin are widely used soil fumigants. Combined application of metam-sodium and 1,3-D + chloropicrin is intended to improve efficacy and broaden spectrum of control, but little is known about the effect on crop safety. This study aimed to evaluate the effects of application timing of fumigant combinations on soilborne pest and disease control (nematodes, soil fungi and weeds) and growth of squash. Two separate tests with chisel-injected and drip-applied fumigant combinations and plant-back times ranging from 1 to 4 weeks were conducted in Tifton, GA, USA, in spring and fall 2002. Fumigant combinations using 1,3-D, chloropicrin and metam-sodium were as effective as methyl bromide in controlling Meloidogyne incognita (Kofoid & White) Chitwood, Pythium irregulare Buis., Rhizoctonia solani Kühn and Cyperus esculentus L. Chisel-applied combinations were more effective in terms of root-knot nematode control than drip-applied combinations. Root-knot nematode reduced squash yields by up to 60%. Phytotoxicity problems and lower yields were observed during spring, especially following 1,3-D + chloropicrin and when plant-back periods were shorter. The main problem with fumigant alternatives to methyl bromide may not be reduced efficacy but, in particular for 1,3-D products, loss of flexibility in terms of longer plant-back periods. (c) 2008 Society of Chemical Industry.

Analysis of the trajectory surface hopping method from the Markov state model perspective

International Nuclear Information System (INIS)

Akimov, Alexey V.; Wang, Linjun; Prezhdo, Oleg V.; Trivedi, Dhara

2015-01-01

We analyze the applicability of the seminal fewest switches surface hopping (FSSH) method of Tully to modeling quantum transitions between electronic states that are not coupled directly, in the processes such as Auger recombination. We address the known deficiency of the method to describe such transitions by introducing an alternative definition for the surface hopping probabilities, as derived from the Markov state model perspective. We show that the resulting transition probabilities simplify to the quantum state populations derived from the time-dependent Schrödinger equation, reducing to the rapidly switching surface hopping approach of Tully and Preston. The resulting surface hopping scheme is simple and appeals to the fundamentals of quantum mechanics. The computational approach is similar to the FSSH method of Tully, yet it leads to a notably different performance. We demonstrate that the method is particularly accurate when applied to superexchange modeling. We further show improved accuracy of the method, when applied to one of the standard test problems. Finally, we adapt the derived scheme to atomistic simulation, combine it with the time-domain density functional theory, and show that it provides the Auger energy transfer timescales which are in good agreement with experiment, significantly improving upon other considered techniques. (author)

Characterization of hop pectins shows the presence of an arabinogalactan-protein

NARCIS (Netherlands)

Oosterveld, A.; Voragen, A.G.J.; Schols, H.A.

2002-01-01

Hop pectins were extracted from spent hops using acid extraction conditions and were characterized chemically. The acid extraction of spent hops resulted in a yield of 2°containing 59 f polysaccharides. The hop pectins under investigation had a relatively high molecular weight and an intrinsic

Hopping Conductivity Enhanced by Microwave Radiation

International Nuclear Information System (INIS)

Ovadyahu, Z

2012-01-01

Hopping conductivity is enhanced when exposed to microwave (MW) fields. Data taken on several Anderson-localized systems and granular-aluminium are presented to illustrate the generality of the phenomenon. It is suggested that the effect is due to a field-enhanced hopping, which is the ac version of a non-ohmic effect familiar from studies in the dc transport regime.

Axionic D3-D7 Inflation

CERN Document Server

Burgess, C P; Postma, M

2009-01-01

We study the motion of a D3 brane moving within a Type IIB string vacuum compactified to 4D on K3 x T_2/Z_2 in the presence of D7 and O7 planes. We work within the effective 4D supergravity describing how the mobile D3 interacts with the lightest bulk moduli of the compactification, including the effects of modulus-stabilizing fluxes. We seek inflationary solutions to the resulting equations, performing our search numerically in order to avoid resorting to approximate parameterizations of the low-energy potential. We consider uplifting from D-terms and from the supersymmetry-breaking effects of anti-D3 branes. We find examples of slow-roll inflation (with anti-brane uplifting) with the mobile D3 moving along the toroidal directions, falling towards a D7-O7 stack starting from the antipodal point. The inflaton turns out to be a linear combination of the brane position and the axionic partner of the K3 volume modulus, and the similarity of the potential along the inflaton direction with that of racetrack inflat...

Study of conduction mechanism in Fe{sub 2}O{sub 3} doped Na{sub 2}O·Bi{sub 2}O{sub 3}·B{sub 2}O{sub 3} semiconducting glasses

Energy Technology Data Exchange (ETDEWEB)

Ahlawat, Navneet [Matu Ram Institute of Engineering and Management, Rohtak 124001, Haryana (India); Aghamkar, Praveen [Department of Physics, Chaudhary Devi Lal University, Sirsa 125055, Haryana (India); Agarwal, Ashish [Department of Applied Physics, Guru Jambheshwar University of Science & Technology, Hisar 125001, Haryana (India); Ahlawat, Neetu, E-mail: neetugju@yahoo.co.in [Department of Applied Physics, Guru Jambheshwar University of Science & Technology, Hisar 125001, Haryana (India)

2016-02-01

Conduction mechanism in Fe{sub 2}O{sub 3} doped Na{sub 2}O·Bi{sub 2}O{sub 3}·B{sub 2}O{sub 3} semiconducting glass system was studied in frequency range 10 Hz to 1 MHz and at temperatures between room temperature and 663 K. The total conductivity spectrum follows universal power law with frequency exponent ‘s’ value less than unity and lies in the range 0.51≤s≤0.78. These ranges of ‘s’ values indicate that the carrier transport is predominately due to hopping electrons between charged defects and show temperature dependence as predicted by correlated barrier hopping (CBH) model. The change in activation energy of dc conductivity with temperature reveals the change in conduction mode from small polaron hopping (SPH) at high temperatures (T>θ{sub D}/2) to variable range hopping (VRH) at low temperatures (T<θ{sub D}/2). The range of density of states at Fermi level N (E{sub F})=7.25×10{sup 21}–1.32×10{sup 21} eV{sup −1} cm{sup −3} at temperatures below θ{sub D}/2 corresponds to localized states near Fermi level. The large values of activation energy W{sub 2} (0.067–0.155 eV) dominated the conduction may results in high range of temperature (T=503– 423 K) for variable-range hopping conduction in these glasses.

Secure Connectivity Probability of Multi‐hop Clustered Randomize‐and‐Forward Networks

Directory of Open Access Journals (Sweden)

Xiaowei Wang

2017-10-01

Full Text Available This work investigates secure cluster‐aided multi‐hop randomize‐and‐forward networks. We present a hop‐by‐hop multi‐hop transmission scheme with relay selection, which evaluates for each cluster the relays that can securely receive the message. We propose an analytical model to derive the secure connectivity probability (SCP of the hop‐by‐hop transmission scheme. For comparison, we also analyze SCPs of traditional end‐to‐end transmission schemes with two relay‐selection policies. We perform simulations, and our analytical results verify that the proposed hop‐by‐hop scheme is superior to end‐to‐end schemes, especially with a large number of hops or high eavesdropper channel quality. Numerical results also show that the proposed hop‐by‐hop scheme achieves near‐optimal performance in terms of the SCP.

Signaling induced by hop/STI-1 depends on endocytosis

International Nuclear Information System (INIS)

Americo, Tatiana A.; Chiarini, Luciana B.; Linden, Rafael

2007-01-01

The co-chaperone hop/STI-1 is a ligand of the cell surface prion protein (PrP C ), and their interaction leads to signaling and biological effects. Among these, hop/STI-1 induces proliferation of A172 glioblastoma cells, dependent on both PrP C and activation of the Erk pathway. We tested whether clathrin-mediated endocytosis affects signaling induced by hop/STI-1. Both hyperosmolarity induced by sucrose and monodansyl-cadaverine blocked Erk activity induced by hop/STI-1, without affecting the high basal Akt activity typical of A172. The endocytosis inhibitors also affected the sub-cellular distribution of phosphorylated Erk, consistent with blockade of the latter's activity. The data indicate that signaling induced by hop/STI-1 depends on endocytosis. These findings are consistent with a role of sub-cellular trafficking in signal transduction following engagement by PrP C by ligands such as hop/STI-1, and may help help unravel both the functions of the prion protein, as well as possible loss-of-function components of prion diseases

HPLC Analysis of [Alpha]- and [Beta]-Acids in Hops

Science.gov (United States)

Danenhower, Travis M.; Force, Leyna J.; Petersen, Kenneth J.; Betts, Thomas A.; Baker, Gary A.

2008-01-01

Hops have been used for centuries to impart aroma and bitterness to beer. The cones of the female hop plant contain both essential oils, which include many of the fragrant components of hops, and a collection of compounds known as [alpha]- and [beta]-acids that are the precursors to bittering agents. In order for brewers to predict the ultimate…

Conductance of partially disordered graphene: crossover from temperature-dependent to field-dependent variable-range hopping

International Nuclear Information System (INIS)

Cheah, C Y; Jaurigue, L C; Kaiser, A B; Gómez-Navarro, C

2013-01-01

We report an analysis of low-temperature measurements of the conductance of partially disordered reduced graphene oxide, finding that the data follow a simple crossover scenario. At room temperature, the conductance is dominated by two-dimensional (2D) electric field-assisted, thermally driven (Pollak–Riess) variable-range hopping (VRH) through highly disordered regions. However, at lower temperatures T, we find a smooth crossover to follow the exp(−E 0 /E) 1/3 field-driven (Shklovskii) 2D VRH conductance behaviour when the electric field E exceeds a specific crossover value E C (T) 2D =(E a E 0 1/3 /3) 3/4 determined by the scale factors E 0 and E a for the high-field and intermediate-field regimes respectively. Our crossover scenario also accounts well for experimental data reported by other authors for three-dimensional disordered carbon networks, suggesting wide applicability. (paper)

Efficacy of the combination of VitD3, Ca, and Zn in application of infantile rickets

Directory of Open Access Journals (Sweden)

Xiao-Yan Lin

2016-06-01

Full Text Available Objective: To explore the clinical efficacy of the combination of VitD3, Ca, and Zn in application of infantile rickets. Methods: A total of 70 infants with rickets who were admitted in our hospital from January, 2015 to January, 2016 were included in the study and randomized into the study group and the control group. The patients in the control group were given VitD3 injection, 300 000 IU, IM, 1 time/month, in the first month, and were given VitAD, 1 granule/time, 1 time/d, and D-Cal, 1 bag/time, 1 time/d, in the second month. On this basis, the patients in the study group were given zinc gluconate oral liquid, 10-20 mL/d. Threemonth treatment was regarded as one course. The peripheral blood before and after treatment was collected. The full automatic biochemical analyzer was used to detect Ca, P, Zn, and BALP. ELISA was used to detect 25-(OHD3. The single photon absorptionmeter was used to determine the bone mineral density of radius and ulna. The efficacy was estimated. Results: After treatment, Zn, Ca, P, and 25-(OHD3 in the two groups were significantly elevated, but BALP was significantly reduced when compared with before treatment. The improvement of various biochemical indicators in the study group was significantly superior to that in the control group. After treatment, the bone mineral density of radius and ulna in the two groups was significantly elevated when compared with before treatment. The elevated degree of bone mineral density in the study group was significantly superior to that in the control group. The total effective rate in the study group (94.3% was significantly higher than that in the control group (71.4%. Conclusions: The combination of VitD3, Ca, and Zn in the treatment of infantile rickets can balance the microelement level, synergize to promote the bone formation, and enhance the bone mineral density, with a safe and reliable efficacy; therefore, it deserves to be widely recommended in the clinic.

Single-Leg Hop Test Performance and Isokinetic Knee Strength After Anterior Cruciate Ligament Reconstruction in Athletes.

Science.gov (United States)

Sueyoshi, Ted; Nakahata, Akihiro; Emoto, Gen; Yuasa, Tomoki

2017-11-01

Isokinetic strength and hop tests are commonly used to assess athletes' readiness to return to sport after knee surgery. The purpose of this study was to investigate the results of single-leg hop and isokinetic knee strength testing in athletes who underwent anterior cruciate ligament reconstruction (ACLR) upon returning to sport participation as well as to study the correlation between these 2 test batteries. The secondary purpose was to compare the test results by graft type (patellar tendon or hamstring). It was hypothesized that there would be no statistically significant limb difference in either isokinetic knee strength or single-leg hop tests, that there would be a moderate to strong correlation between the 2 test batteries, and that there would be no significant difference between graft types. Cross-sectional study; Level of evidence, 3. Twenty-nine high school and collegiate athletes who underwent ACLR participated in this study. At the time of return to full sport participation, a series of hop tests and knee extension/flexion isokinetic strength measurements were conducted. The results were analyzed using analysis of variance and Pearson correlation ( r ). The timed 6-m hop test was the only hop test that showed a significant difference between the involved and uninvolved limbs (2.3 and 2.2 seconds, respectively; P = .02). A significant difference between limbs in knee strength was found for flexion peak torque/body weight at 180 deg/s ( P = .03), flexion total work/body weight at 180 deg/s ( P = .04), and flexion peak torque/body weight at 300 deg/s ( P = .03). The strongest correlation between the hop tests and knee strength was found between the total distance of the hop tests and flexion total work/body weight at 300 deg/s ( r = 0.69) and between the timed 6-m hop test and flexion peak torque/body weight at 300 deg/s ( r = -0.54). There was no statistically significant difference in hop test performance or isokinetic knee strength between graft types

Raman, dielectric and variable range hopping nature of Gd2O3-doped K0.5N0.5NbO3 piezoelectric ceramics

Directory of Open Access Journals (Sweden)

Mahesh Peddigari

2015-10-01

Full Text Available (K0.5Na0.5NbO3 (KNN + x wt% Gd2O3 (x = 0 -1.5 ceramics have been prepared by conventional solid state reaction method. The effect of Gd2O3 on the structural, microstructural and dielectric properties of KNN ceramics were studied systematically. The effect of Gd2O3 on phase transformation from orthorhombic to psuedocubic structure is explained interms of changes in the internal vibration modes of NbO6 octahedra. The Raman intensity of the stretching mode v1 enhanced and shifted toward higher wavenumber with Gd2O3 concentration, which is attributed to the increase in polarizability and change in the O-Nb-O bond angles. Microstructural analysis revealed that the grain size of the KNN ceramics decreases from 2.26 ± 1.07 μm to 0.35 ± 0.13 μm and becomes homogenous with an increase in Gd2O3 concentration. The frequency dependent dielectric spectra are analyzed by using Havriliak-Negami function. The fitted symmetry parameter and relaxation time (τ are found to be 0.914 and 8.78 × 10−10 ± 5.5 × 10−11 s, respectively for the sample doped with x = 1.0. The addition of Gd2O3 to the KNN shifted the polymorphic phase transition orthorhombic to tetragonal transition temperature (TO-T from 199oC to 85oC with enhanced dielectric permittivity (ε′ = 1139 at 1 MHz. The sample with x = 1.0, shown a high dielectric permittivity (ε′ = 879 and low dielectric loss (<5% in the broad temperature range (-140oC – 150oC with the Curie temperature 307 oC can have the potential for high temperature piezoelectric and tunable RF circuit applications. The temperature dependent AC-conductivity follows the variable range hopping conduction mechanism by obtaining the slope -0.25 from the ln[ln(ρac] versus ln(T graph in the temperature range of 133 K-308 K. The effect of Gd2O3 on the Mott’s parameters such as density of states (N(EF, hopping length (RH, and hopping energy (WH have been discussed.

Relationships between Xanthohumol and Polyphenol Content in Hop Leaves and Hop Cones with Regard to Water Supply and Cultivar

Science.gov (United States)

Čeh, Barbara; Kač, Milica; Košir, Iztok J.; Abram, Veronika

2007-01-01

The effect of water supply – especially of drought stress – on the content of some secondary metabolites in hops (Humulus lupulus L.) was studied. The experiment took place in 2006. Some relevant data from 2005 were included for comparison. Leaves and cones of nine hop cultivars grown under field conditions as well as in a pot experiment under three water regimes were analyzed. The cultivars ranged from those most grown in Slovenia to promising crossbreed being tested. Leaves were sampled from July 18, 2006 to August 18, 2006, while cones were picked in the time of technological maturity. Standard analytical methods were applied to determine the contents of xanthohumol, polyphenols and α-acids in hop leaves and hop cones. The contents of the secondary metabolites in question depended more on the cultivar under investigation than on the water supply, at least as far the growing conditions for a relatively normal development of the plant were met.

Synthesis and Antiproliferative Activity of Minor Hops Prenylflavonoids and New Insights on Prenyl Group Cyclization

Directory of Open Access Journals (Sweden)

Jarosław Popłoński

2018-03-01

Full Text Available Synthesis of minor prenylflavonoids found in hops and their non-natural derivatives were performed. The antiproliferative activity of the obtained compounds against some human cancer cell lines was investigated. Using xanthohumol isolated from spent hops as a lead compound, a series of minor hop prenylflavonoids and synthetic derivatives were obtained by isomerization, cyclisation, oxidative-cyclisation, oxidation, reduction and demethylation reactions. Three human cancer cell lines—breast (MCF-7, prostate (PC-3 and colon (HT-29—were used in antiproliferative assays, with cisplatin as a control compound. Five minor hop prenyl flavonoids and nine non-natural derivatives of xanthohumol have been synthetized. Syntheses of xanthohumol K, its dihydro- and tetrahydro-derivatives and 1″,2″,α,β-tetrahydroxanthohumol C were described for the first time. All of the minor hops prenyl flavonoids exhibited strong to moderate antiproliferative activity in vitro. The minor hops flavonoids xanthohumol C and 1″,2″-dihydroxanthohumol K and non-natural 2,3-dehydroisoxanthohumol exhibited the activity comparable to cisplatin. Results described in the article suggest that flavonoids containing chromane- and chromene-like moieties, especially chalcones, are potent antiproliferative agents. The developed new efficient, regioselective cyclisation reaction of the xanthohumol prenyl group to 1″,2″-dihydroxantohumol K may be used in the synthesis of other compounds with the chromane moiety.

Toward Hip-Hop Pedagogies for Music Education

Science.gov (United States)

Kruse, Adam J.

2016-01-01

Music education scholarship in the areas of popular, vernacular, and participatory musicianship has grown in the past decades; however, music education research concerned specifically with hip-hop has been relatively scarce. Because hip-hop music can differ tremendously from the traditional western genres with which many music educators are most…

Framing and Reviewing Hip-Hop Educational Research

Science.gov (United States)

Petchauer, Emery

2009-01-01

Hip-hop has become relevant to the field of education because of its implications for understanding language, learning, identity, curriculum, and other areas. This integrative review provides historical context and cohesion for the burgeoning and discursive body of hip-hop scholarship by framing it according to three heuristic categories and…

H-Ransac a Hybrid Point Cloud Segmentation Combining 2d and 3d Data

Science.gov (United States)

Adam, A.; Chatzilari, E.; Nikolopoulos, S.; Kompatsiaris, I.

2018-05-01

In this paper, we present a novel 3D segmentation approach operating on point clouds generated from overlapping images. The aim of the proposed hybrid approach is to effectively segment co-planar objects, by leveraging the structural information originating from the 3D point cloud and the visual information from the 2D images, without resorting to learning based procedures. More specifically, the proposed hybrid approach, H-RANSAC, is an extension of the well-known RANSAC plane-fitting algorithm, incorporating an additional consistency criterion based on the results of 2D segmentation. Our expectation that the integration of 2D data into 3D segmentation will achieve more accurate results, is validated experimentally in the domain of 3D city models. Results show that HRANSAC can successfully delineate building components like main facades and windows, and provide more accurate segmentation results compared to the typical RANSAC plane-fitting algorithm.

Vortex variable range hopping in a conventional superconducting film

Science.gov (United States)

Percher, Ilana M.; Volotsenko, Irina; Frydman, Aviad; Shklovskii, Boris I.; Goldman, Allen M.

2017-12-01

The behavior of a disordered amorphous thin film of superconducting indium oxide has been studied as a function of temperature and magnetic field applied perpendicular to its plane. A superconductor-insulator transition has been observed, though the isotherms do not cross at a single point. The curves of resistance versus temperature on the putative superconducting side of this transition, where the resistance decreases with decreasing temperature, obey two-dimensional Mott variable-range hopping of vortices over wide ranges of temperature and resistance. To estimate the parameters of hopping, the film is modeled as a granular system and the hopping of vortices is treated in a manner analogous to hopping of charges. The reason the long-range interaction between vortices over the range of magnetic fields investigated does not lead to a stronger variation of resistance with temperature than that of two-dimensional Mott variable-range hopping remains unresolved.

Collective probabilities algorithm for surface hopping calculations

International Nuclear Information System (INIS)

Bastida, Adolfo; Cruz, Carlos; Zuniga, Jose; Requena, Alberto

2003-01-01

General equations that transition probabilities of the hopping algorithms in surface hopping calculations must obey to assure the equality between the average quantum and classical populations are derived. These equations are solved for two particular cases. In the first it is assumed that probabilities are the same for all trajectories and that the number of hops is kept to a minimum. These assumptions specify the collective probabilities (CP) algorithm, for which the transition probabilities depend on the average populations for all trajectories. In the second case, the probabilities for each trajectory are supposed to be completely independent of the results from the other trajectories. There is, then, a unique solution of the general equations assuring that the transition probabilities are equal to the quantum population of the target state, which is referred to as the independent probabilities (IP) algorithm. The fewest switches (FS) algorithm developed by Tully is accordingly understood as an approximate hopping algorithm which takes elements from the accurate CP and IP solutions. A numerical test of all these hopping algorithms is carried out for a one-dimensional two-state problem with two avoiding crossings which shows the accuracy and computational efficiency of the collective probabilities algorithm proposed, the limitations of the FS algorithm and the similarity between the results offered by the IP algorithm and those obtained with the Ehrenfest method

Identification of the transition arrays 3d74s-3d74p in Br X and 3d64s-3d64p in Br XI

International Nuclear Information System (INIS)

Zeng, X.T.; Jupen, C.; Bengtsson, P.; Engstroem, L.; Westerlind, M.; Martinson, I.

1991-01-01

We report a beam-foil study of multiply ionized bromine in the region 400-1300A, performed with 6 and 8 MeV Br ions from a tandem accelerator. At these energies transitions belonging to Fe-like Br X and Mn-like Br XI are expected to be prominent. We have identified 31 lines as 3d 7 4s-3d 7 4p transitions in Br X, from which 16 levels of the previously unknown 3d 7 4s configuration could be established. We have also added 6 new 3d 7 4p levels to the 99 previously known. For Br XI we have classified 9 lines as 3d 6 4s-3d 6 4p combinations. The line identifications have been corroborated by isoelectronic comparisons and theoretical calculations using the superposition-of-configurations technique. (orig.)

An Effective Hybrid Routing Algorithm in WSN: Ant Colony Optimization in combination with Hop Count Minimization

Directory of Open Access Journals (Sweden)

Ailian Jiang

2018-03-01

Full Text Available Low cost, high reliability and easy maintenance are key criteria in the design of routing protocols for wireless sensor networks (WSNs. This paper investigates the existing ant colony optimization (ACO-based WSN routing algorithms and the minimum hop count WSN routing algorithms by reviewing their strengths and weaknesses. We also consider the critical factors of WSNs, such as energy constraint of sensor nodes, network load balancing and dynamic network topology. Then we propose a hybrid routing algorithm that integrates ACO and a minimum hop count scheme. The proposed algorithm is able to find the optimal routing path with minimal total energy consumption and balanced energy consumption on each node. The algorithm has unique superiority in terms of searching for the optimal path, balancing the network load and the network topology maintenance. The WSN model and the proposed algorithm have been implemented using C++. Extensive simulation experimental results have shown that our algorithm outperforms several other WSN routing algorithms on such aspects that include the rate of convergence, the success rate in searching for global optimal solution, and the network lifetime.

3D biometrics systems and applications

CERN Document Server

Zhang, David

2013-01-01

Includes discussions on popular 3D imaging technologies, combines them with biometric applications, and then presents real 3D biometric systems Introduces many efficient 3D feature extraction, matching, and fusion algorithms Techniques presented have been supported by experimental results using various 3D biometric classifications

Theory of one-dimensional hopping motion of a heavy particle interacting with phonons by different couplings

Science.gov (United States)

Itai, K.

1987-02-01

Two models which describe one-dimensional hopping motion of a heavy particle interacting with phonons are discussed. Model A corresponds to hopping in 1D metals or to the polaron problem. In model B the momentum dependence of the particle-phonon coupling is proportional to k-1/2. The scaling equations show that only in model B does localization occur for a coupling larger than a critical value. In the localization region this model shows close analogy to the Caldeira-Leggett model for macroscopic quantum tunneling.

Hip-Hop(e): The Cultural Practice and Critical Pedagogy of International Hip-Hop. Adolescent Cultures, School, and Society. Volume 56

Science.gov (United States)

Porfilio, Brad J., Ed.; Viola, Michael J., Ed.

2012-01-01

Illuminating hip-hop as an important cultural practice and a global social movement, this collaborative project highlights the emancipatory messages and cultural work generated by the organic intellectuals of global hip-hop. Contributors describe the social realities--globalization, migration, poverty, criminalization, and racism--youth are…

Mic Power? Connections and the hip hop nation in Kampala, Uganda

DEFF Research Database (Denmark)

Schneidermann, Nanna

2014-01-01

Hip hop culture has been celebrated in the media and scholarship as a universal youth language, part of a global hip hop nation, and a type of counter-public. This article examines the everyday meanings and practices of hip hop among hip hop activists in Kampala, Uganda, specifically within...... the Batuuze rap group. Rather than portraying hip hop as a counter-public of the disempowered, I argue that the Batuuze engagement is based on what I call moral economy that enables the negotiation of connections in social and cultural networks towards what is considered a good life. Here, the hip hop nation...... is less of an alternative public sphere and more a way of articulating and contextualizing the world in a specific locality, which produces connections and opportunities in the young rappers’ lives....

2D-3D registration for cranial radiation therapy using a 3D kV CBCT and a single limited field-of-view 2D kV radiograph.

Science.gov (United States)

Munbodh, Reshma; Knisely, Jonathan Ps; Jaffray, David A; Moseley, Douglas J

2018-05-01

We present and evaluate a fully automated 2D-3D intensity-based registration framework using a single limited field-of-view (FOV) 2D kV radiograph and a 3D kV CBCT for 3D estimation of patient setup errors during brain radiotherapy. We evaluated two similarity measures, the Pearson correlation coefficient on image intensity values (ICC) and maximum likelihood measure with Gaussian noise (MLG), derived from the statistics of transmission images. Pose determination experiments were conducted on 2D kV radiographs in the anterior-posterior (AP) and left lateral (LL) views and 3D kV CBCTs of an anthropomorphic head phantom. In order to minimize radiation exposure and exclude nonrigid structures from the registration, limited FOV 2D kV radiographs were employed. A spatial frequency band useful for the 2D-3D registration was identified from the bone-to-no-bone spectral ratio (BNBSR) of digitally reconstructed radiographs (DRRs) computed from the 3D kV planning CT of the phantom. The images being registered were filtered accordingly prior to computation of the similarity measures. We evaluated the registration accuracy achievable with a single 2D kV radiograph and with the registration results from the AP and LL views combined. We also compared the performance of the 2D-3D registration solutions proposed to that of a commercial 3D-3D registration algorithm, which used the entire skull for the registration. The ground truth was determined from markers affixed to the phantom and visible in the CBCT images. The accuracy of the 2D-3D registration solutions, as quantified by the root mean squared value of the target registration error (TRE) calculated over a radius of 3 cm for all poses tested, was ICC AP : 0.56 mm, MLG AP : 0.74 mm, ICC LL : 0.57 mm, MLG LL : 0.54 mm, ICC (AP and LL combined): 0.19 mm, and MLG (AP and LL combined): 0.21 mm. The accuracy of the 3D-3D registration algorithm was 0.27 mm. There was no significant difference in mean TRE for the 2D-3D registration

The Hip-Hop club scene: Gender, grinding and sex.

Science.gov (United States)

Muñoz-Laboy, Miguel; Weinstein, Hannah; Parker, Richard

2007-01-01

Hip-Hop culture is a key social medium through which many young men and women from communities of colour in the USA construct their gender. In this study, we focused on the Hip-Hop club scene in New York City with the intention of unpacking narratives of gender dynamics from the perspective of young men and women, and how these relate to their sexual experiences. We conducted a three-year ethnographic study that included ethnographic observations of Hip-Hop clubs and their social scene, and in-depth interviews with young men and young women aged 15-21. This paper describes how young people negotiate gender relations on the dance floor of Hip-Hop clubs. The Hip-Hop club scene represents a context or setting where young men's masculinities are contested by the social environment, where women challenge hypermasculine privilege and where young people can set the stage for what happens next in their sexual and emotional interactions. Hip-Hop culture therefore provides a window into the gender and sexual scripts of many urban minority youth. A fuller understanding of these patterns can offer key insights into the social construction of sexual risk, as well as the possibilities for sexual health promotion, among young people in urban minority populations.

Tailorable Surface Morphology of 3D Scaffolds by Combining Additive Manufacturing with Thermally Induced Phase Separation.

Science.gov (United States)

Di Luca, Andrea; de Wijn, Joost R; van Blitterswijk, Clemens A; Camarero-Espinosa, Sandra; Moroni, Lorenzo

2017-08-01

The functionalization of biomaterials substrates used for cell culture is gearing towards an increasing control over cell activity. Although a number of biomaterials have been successfully modified by different strategies to display tailored physical and chemical surface properties, it is still challenging to step from 2D substrates to 3D scaffolds with instructive surface properties for cell culture and tissue regeneration. In this study, additive manufacturing and thermally induced phase separation are combined to create 3D scaffolds with tunable surface morphology from polymer gels. Surface features vary depending on the gel concentration, the exchanging temperature, and the nonsolvent used. When preosteoblasts (MC-3T3 cells) are cultured on these scaffolds, a significant increase in alkaline phosphatase activity is measured for submicron surface topography, suggesting a potential role on early cell differentiation. © 2017 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

Combined magnetic vector-scalar potential finite element computation of 3D magnetic field and performance of modified Lundell alternators in Space Station applications. Ph.D. Thesis

Science.gov (United States)

Wang, Ren H.

1991-01-01

A method of combined use of magnetic vector potential (MVP) based finite element (FE) formulations and magnetic scalar potential (MSP) based FE formulations for computation of three-dimensional (3D) magnetostatic fields is developed. This combined MVP-MSP 3D-FE method leads to considerable reduction by nearly a factor of 3 in the number of unknowns in comparison to the number of unknowns which must be computed in global MVP based FE solutions. This method allows one to incorporate portions of iron cores sandwiched in between coils (conductors) in current-carrying regions. Thus, it greatly simplifies the geometries of current carrying regions (in comparison with the exclusive MSP based methods) in electric machinery applications. A unique feature of this approach is that the global MSP solution is single valued in nature, that is, no branch cut is needed. This is again a superiority over the exclusive MSP based methods. A Newton-Raphson procedure with a concept of an adaptive relaxation factor was developed and successfully used in solving the 3D-FE problem with magnetic material anisotropy and nonlinearity. Accordingly, this combined MVP-MSP 3D-FE method is most suited for solution of large scale global type magnetic field computations in rotating electric machinery with very complex magnetic circuit geometries, as well as nonlinear and anisotropic material properties.

Task Assignment and Path Planning for Multiple Autonomous Underwater Vehicles Using 3D Dubins Curves †.

Science.gov (United States)

Cai, Wenyu; Zhang, Meiyan; Zheng, Yahong Rosa

2017-07-11

This paper investigates the task assignment and path planning problem for multiple AUVs in three dimensional (3D) underwater wireless sensor networks where nonholonomic motion constraints of underwater AUVs in 3D space are considered. The multi-target task assignment and path planning problem is modeled by the Multiple Traveling Sales Person (MTSP) problem and the Genetic Algorithm (GA) is used to solve the MTSP problem with Euclidean distance as the cost function and the Tour Hop Balance (THB) or Tour Length Balance (TLB) constraints as the stop criterion. The resulting tour sequences are mapped to 2D Dubins curves in the X - Y plane, and then interpolated linearly to obtain the Z coordinates. We demonstrate that the linear interpolation fails to achieve G 1 continuity in the 3D Dubins path for multiple targets. Therefore, the interpolated 3D Dubins curves are checked against the AUV dynamics constraint and the ones satisfying the constraint are accepted to finalize the 3D Dubins curve selection. Simulation results demonstrate that the integration of the 3D Dubins curve with the MTSP model is successful and effective for solving the 3D target assignment and path planning problem.

Hip hop jako kulturní styl, jeho spicifika a vliv na teenagery

OpenAIRE

POSPÍŠIL, Jan

2008-01-01

This thesis involves history of hip hop, its specifics and elements, it talks about influence of hip hip subculture on teenagers and points to positive and negative aspects connected to this culture style. In this way is work sectionalized into chapters. First part talks about history of hip hop, connection between religion and hip hop and also about Czech hip hop. Second part specifies on main elements of hip hop culture as DJing, MCing, breakdance, beatbox and graffiti. Last part focuses on...

The content of vitamine E in hop cones of the Saaz variety

Directory of Open Access Journals (Sweden)

Helena Pluháčková

2013-01-01

Full Text Available The activity of vitamin E, total content of tocols and the content of individual isomers: α-tocopherols, β-tocopherols, γ-tocopherols and δ-tocopherols was monitored in samples of hop cones of the world-important Saaz variety. Hop cone samples originated from hop-breeding area Tršice, Czech Republic. The method used for the determination of vitamin E in barley was modified and used for this quantitative analysis. The results indicate that monitored characteristics are influenced by the year of harvest (2010 or 2011 but also by the age of hop-gardens (hop bucks. High values of vitamin E activity (up to 67.79 mg.kg−1 and total content of tocols (up to 76.31 mg.kg−1 in hop cones are worth further attention from the viewpoint of alternative use of hops.

Hop pellets as an interesting source of antioxidant active compounds

Directory of Open Access Journals (Sweden)

Andrea Holubková

2013-02-01

Full Text Available Hop is a plant used by humankind for thousands of years. This plant is one of the main and indispensable raw materials for the beer production. It is used for various dishes preparation in the cuisine. Hop is also used to inhibit bacterial contamination. The hop extracts are used for its sedative, antiseptic and antioxidant properties in medicine, as a part of many phytopharmaceuticals. The present paper have focused on the extraction of polyphenolic compounds from 4 samples of hop pellets varieties of Aurora, Saaz, Lublin and Saphir, on the analyzing of bioactive substances (polyphenolics and flavonoids in prepared extracts and on the determination of antioxidant activity.  The highest content of polyphenolic substances was determined in the sample Lublin (153.06 mg gallic acid (GAE/g and Saaz (151.87 mg GAE/g. The amount of flavonoids in the samples  was descending order Saaz > Saphir > Aurora > Lublin. Hops, as plant, is known by high content of antioxidant active substances. Antioxidant activity was determined using three independent spectrofotometric methods, radical scavenging assays using 2,2′-azino-bis-3-ethylbenzthiazoline-6-sulphonic acid (ABTS and 1,1-diphenyl-2-picrylhydrazyl (DPPH radical and ferric reducing antioxidant power (FRAP. The sample Aurora showed the highest ability to scavenge of ABTS radical cation. Antioxidant activity continued to decline in a row Saphir> Lublin> Saaz. The same trend was also observed by using the FRAP assay. The most effective DPPH radical scavengering activity had the sample Saaz a Saphir (p>0.05.doi:10.5219/270 Normal 0 21 false false false SK X-NONE X-NONE

Romani Music - Roma and the Hip-hop Culture

OpenAIRE

Dočkal, Tomáš

2007-01-01

This thesis is focused on Romani music and its importance for the Romani culture. It examines the popularity of hip-hop among the young Romani generation and Romani hip- hip production. It attempts to define the role of hip-hop culture in young Romanies' lives.

Being Hip-Hop: Beyond Skills and Songs

Science.gov (United States)

Kruse, Adam J.

2016-01-01

In this article, I offer four principles relevant to hip-hop cultures (keep it real, flip the script, make some noise, and stay fresh) and explore how these principles might affect music classrooms. I argue that a music classroom that works to keep it real, flip the script, make some noise, and stay fresh might go beyond teaching hip-hop skills…

Apply 3D model on the customized product color combination for the interior decoration

Science.gov (United States)

Chen, Cheih-Ying

2013-03-01

The customized product color interface for the interior decoration is designed to simulate the display of various color combination sofas in the interior of the room. There are 144 color combinations of the spatial image resulted from four the interior rooms and 36 popular color sofas. The image compositing technique is adopted to appear the 144 color combinations of the spatial image on computer screen. This study tests the experience of using the interface by the questionnaire for User Interface Satisfaction (QUIS). The results show that the high grade of evaluation items including wonderful, easy, satisfying, stimulating and flexible for the experience of users. Therefore, the entrepreneur who wants to display the color primarily commodity could using the customized color combination interface with 3D models for consumers to take opportunity to find the appropriate products to meet with the interior room, so as to shorten communication time between entrepreneurs and consumers.

Injury incidence in hip hop dance.

Science.gov (United States)

Ojofeitimi, S; Bronner, S; Woo, H

2012-06-01

Hip hop dance has rapidly become a popular international art form. There is limited information on injury patterns in this population. The purpose of this study was to determine injury incidence and patterns among three groups of hip hop dancers. Three hundred and twelve intermediate, advanced, and expert hip hop dancers were recruited at battles, dance conferences, clubs, and on dance related web sites within the United States and internationally. A Web-based survey was conducted over a 6-month period. Inclusion criteria included intermediate and advanced level dancers over the age of 13. Dancers were divided into three main categories: Breakers, Popper/Lockers, and New Schoolers. Separate analysis of variances were used to compare injury pattern differences between groups. Two hundred and thirty-two dancers reported a total of 738 injuries. Five hundred and six of these (sustained by 205 dancers) were time-loss (TL) injuries. Annual injury incidence was 237% (162% involving TL). Lower extremity injuries were 52% and upper extremity injuries 32% of total injuries. Breakers had a higher injury incidence compared with Popper/Lockers, and New Schoolers. Hip hop dancers report injury rates that are higher than other dance forms but similar to gymnastics. These dancers should be educated concerning injury prevention, biomechanics, and use of protective equipment. © 2010 John Wiley & Sons A/S.

Basin Hopping Graph

DEFF Research Database (Denmark)

Kucharik, Marcel; Hofacker, Ivo; Stadler, Peter

2014-01-01

of the folding free energy landscape, however, can provide the relevant information. Results We introduce the basin hopping graph (BHG) as a novel coarse-grained model of folding landscapes. Each vertex of the BHG is a local minimum, which represents the corresponding basin in the landscape. Its edges connect...

Blind Compressed Sensing Parameter Estimation of Non-cooperative Frequency Hopping Signal

Directory of Open Access Journals (Sweden)

Chen Ying

2016-10-01

Full Text Available To overcome the disadvantages of a non-cooperative frequency hopping communication system, such as a high sampling rate and inadequate prior information, parameter estimation based on Blind Compressed Sensing (BCS is proposed. The signal is precisely reconstructed by the alternating iteration of sparse coding and basis updating, and the hopping frequencies are directly estimated based on the results. Compared with conventional compressive sensing, blind compressed sensing does not require prior information of the frequency hopping signals; hence, it offers an effective solution to the inadequate prior information problem. In the proposed method, the signal is first modeled and then reconstructed by Orthonormal Block Diagonal Blind Compressed Sensing (OBD-BCS, and the hopping frequencies and hop period are finally estimated. The simulation results suggest that the proposed method can reconstruct and estimate the parameters of noncooperative frequency hopping signals with a low signal-to-noise ratio.

Hip Hop Culture's OGs: A Narrative Inquiry into the Intersection of Hip Hop Culture, Black Males and Their Schooling Experiences

Science.gov (United States)

Buchanan, Ian P.

2013-01-01

Using a critical race lens, this narrative study employs a focus group design to explore the intersections between black males, hip hop culture and schooling experiences. To provide a sociocultural grounding, this study first reviews the research literature around hip hop culture.s sociocultural development and its impact as a culture force that…

Quantitation of 4-Methyl-4-sulfanylpentan-2-one (4MSP) in Hops by a Stable Isotope Dilution Assay in Combination with GC×GC-TOFMS: Method Development and Application To Study the Influence of Variety, Provenance, Harvest Year, and Processing on 4MSP Concentrations.

Science.gov (United States)

Reglitz, Klaas; Steinhaus, Martin

2017-03-22

A stable isotope dilution assay was developed for quantitation of 4-methyl-4-sulfanylpentan-2-one (4MSP) in hops. The approach included the use of 4-( 13 C)methyl-4-sulfanyl(1,3,5- 13 C 3 )pentan-2-one as internal standard, selective isolation of hop thiols by mercurated agarose, and GC×GC-TOFMS analysis. Application of the method to 53 different hop samples revealed 4MSP concentrations between <1 and 114 μg/kg. Notably high concentrations were associated with United States varieties such as Citra, Eureka, Simcoe, and Apollo, whereas 4MSP was absent from traditional German and English varieties. Further experiments showed that besides the variety, also harvest year and storage vitally influenced 4MSP concentrations, whereas the impact of provenance was less pronounced. Hop processing such as drying and pelletizing had only a minor impact on 4MSP concentrations. Like the majority of other hop volatiles, 4MSP is predominantly located in the lupulin glands.

RECONSTRUCTION OF 3D VECTOR MODELS OF BUILDINGS BY COMBINATION OF ALS, TLS AND VLS DATA

Directory of Open Access Journals (Sweden)

H. Boulaassal

2012-09-01

Full Text Available Airborne Laser Scanning (ALS, Terrestrial Laser Scanning (TLS and Vehicle based Laser Scanning (VLS are widely used as data acquisition methods for 3D building modelling. ALS data is often used to generate, among others, roof models. TLS data has proven its effectiveness in the geometric reconstruction of building façades. Although the operating algorithms used in the processing chain of these two kinds of data are quite similar, their combination should be more investigated. This study explores the possibility of combining ALS and TLS data for simultaneously producing 3D building models from bird point of view and pedestrian point of view. The geometric accuracy of roofs and façades models is different due to the acquisition techniques. In order to take these differences into account, the surfaces composing roofs and façades are extracted with the same algorithm of segmentation. Nevertheless the segmentation algorithm must be adapted to the properties of the different point clouds. It is based on the RANSAC algorithm, but has been applied in a sequential way in order to extract all potential planar clusters from airborne and terrestrial datasets. Surfaces are fitted to planar clusters, allowing edge detection and reconstruction of vector polygons. Models resulting from TLS data are obviously more accurate than those generated from ALS data. Therefore, the geometry of the roofs is corrected and adapted according to the geometry of the corresponding façades. Finally, the effects of the differences between raw ALS and TLS data on the results of the modeling process are analyzed. It is shown that such combination could be used to produce reliable 3D building models.

Energy management that generates terrain following versus apex-preserving hopping in man and machine.

Science.gov (United States)

Kalveram, Karl Theodor; Haeufle, Daniel F B; Seyfarth, André; Grimmer, Sten

2012-01-01

While hopping, 12 subjects experienced a sudden step down of 5 or 10 cm. Results revealed that the hopping style was "terrain following". It means that the subjects pursued to keep the distance between maximum hopping height (apex) and ground profile constant. The spring-loaded inverse pendulum (SLIP) model, however, which is currently considered as template for stable legged locomotion would predict apex-preserving hopping, by which the absolute maximal hopping height is kept constant regardless of changes of the ground level. To get more insight into the physics of hopping, we outlined two concepts of energy management: "constant energy supply", by which in each bounce--regardless of perturbations--the same amount of mechanical energy is injected, and "lost energy supply", by which the mechanical energy that is going to be dissipated in the current cycle is assessed and replenished. When tested by simulations and on a robot testbed capable of hopping, constant energy supply generated stable and robust terrain following hopping, whereas lost energy supply led to something like apex-preserving hopping, which, however, lacks stability as well as robustness. Comparing simulated and machine hopping with human hopping suggests that constant energy supply has a good chance to be used by humans to generate hopping.

Anomalous temperature dependence of the Seebeck coefficient for the substitutionally-disordered hopping conductors

International Nuclear Information System (INIS)

Raffaelle, R.P.; Parris, P.E.; Anderson, H.U.; Sparlin, D.M.

1991-01-01

Thermoelectric power measurements are presented for the (La,Sr)(Cr,Mn)O 3 series. The nonlinear temperature dependence of the Seebeck coefficient is analyzed in terms of a random distribution of energetically equivalent hopping sites. The limitations of Heikes' formula, which has been traditionally used to calculate small polaron carrier densities in these systems, are discussed. Recent theoretical developments in the interpretation of Seebeck measurements in substitutionally-disordered high-temperature hopping conductors are reviewed

Flipping the Misogynist Script: Gender, Agency, Hip Hop and Music Education

Science.gov (United States)

Tobias, Evan S.

2014-01-01

Excluding Hip Hop culture and rap music from music education misses opportunities for addressing key aspects of popular culture, society, and students' lives. This article addresses intersections of Hip Hop, gender, and music education to forward potential Hip Hop praxis. After tracing related scholarship, I discuss and problematize…

From 2D to 3D: Using Illumination Cones to Build 3d Face Model

International Nuclear Information System (INIS)

Xiao, S S; Jin, M

2006-01-01

To solve the problem derivate by lighting condition and position of the camera, a new method using illumination cones to build 3d face model has been proposed. Due to illumination variability, the same object can show dramatic difference even as being viewed in fixed pose. To handle this variability, an object recognition system must employ a representation that is either invariant to, or can model this variability. The proposed technique presents an appearance-based method for modeling the variability due to illumination in the images of objects. The method differs from past appearance-based methods. Evenmore, a small set of training images is used to generate a representation that the illumination cone models the complete set of images of an object with Lambertian reflectance surface under a combination of arbitrary point light sources at infinity. After building up the illumination cones, researches focus on how to present the 3d model of the face. Combining illumination and texture feature to build up 3d model of the face make it easy solving the problem in recognition of face under different pose

3D shape detection of the indoor space based on 3D-Hough method

OpenAIRE

安齋, 達也; ANZAI, Tatsuya

2013-01-01

This paper describes methods for detecting the 3D shapes of the indoor space that is represented as a combination of planes such as a wall, desk, or whatnot. Detecting the planes makes it possible to perform calibration of multiple sensors and 3D mapping, and then produces various services such as the acquisition of life logs, AR interaction, and invader detection. This paper proposes and verifies three algorithms. First, it mentions a way to use2D-Hough.The proposed technique converts 3D dat...

Hip Hop Dance Experience Linked to Sociocognitive Ability.

Science.gov (United States)

Bonny, Justin W; Lindberg, Jenna C; Pacampara, Marc C

2017-01-01

Expertise within gaming (e.g., chess, video games) and kinesthetic (e.g., sports, classical dance) activities has been found to be linked with specific cognitive skills. Some of these skills, working memory, mental rotation, problem solving, are linked to higher performance in science, technology, math, and engineering (STEM) disciplines. In the present study, we examined whether experience in a different activity, hip hop dance, is also linked to cognitive abilities connected with STEM skills as well as social cognition ability. Dancers who varied in hip hop and other dance style experience were presented with a set of computerized tasks that assessed working memory capacity, mental rotation speed, problem solving efficiency, and theory of mind. We found that, when controlling for demographic factors and other dance style experience, those with greater hip hop dance experience were faster at mentally rotating images of hands at greater angle disparities and there was a trend for greater accuracy at identifying positive emotions displayed by cropped images of human faces. We suggest that hip hop dance, similar to other more technical activities such as video gameplay, tap some specific cognitive abilities that underlie STEM skills. Furthermore, we suggest that hip hop dance experience can be used to reach populations who may not otherwise be interested in other kinesthetic or gaming activities and potentially enhance select sociocognitive skills.

Hip Hop Dance Experience Linked to Sociocognitive Ability.

Directory of Open Access Journals (Sweden)

Justin W Bonny

Full Text Available Expertise within gaming (e.g., chess, video games and kinesthetic (e.g., sports, classical dance activities has been found to be linked with specific cognitive skills. Some of these skills, working memory, mental rotation, problem solving, are linked to higher performance in science, technology, math, and engineering (STEM disciplines. In the present study, we examined whether experience in a different activity, hip hop dance, is also linked to cognitive abilities connected with STEM skills as well as social cognition ability. Dancers who varied in hip hop and other dance style experience were presented with a set of computerized tasks that assessed working memory capacity, mental rotation speed, problem solving efficiency, and theory of mind. We found that, when controlling for demographic factors and other dance style experience, those with greater hip hop dance experience were faster at mentally rotating images of hands at greater angle disparities and there was a trend for greater accuracy at identifying positive emotions displayed by cropped images of human faces. We suggest that hip hop dance, similar to other more technical activities such as video gameplay, tap some specific cognitive abilities that underlie STEM skills. Furthermore, we suggest that hip hop dance experience can be used to reach populations who may not otherwise be interested in other kinesthetic or gaming activities and potentially enhance select sociocognitive skills.

3D FaceCam: a fast and accurate 3D facial imaging device for biometrics applications

Science.gov (United States)

Geng, Jason; Zhuang, Ping; May, Patrick; Yi, Steven; Tunnell, David

2004-08-01

Human faces are fundamentally three-dimensional (3D) objects, and each face has its unique 3D geometric profile. The 3D geometric features of a human face can be used, together with its 2D texture, for rapid and accurate face recognition purposes. Due to the lack of low-cost and robust 3D sensors and effective 3D facial recognition (FR) algorithms, almost all existing FR systems use 2D face images. Genex has developed 3D solutions that overcome the inherent problems in 2D while also addressing limitations in other 3D alternatives. One important aspect of our solution is a unique 3D camera (the 3D FaceCam) that combines multiple imaging sensors within a single compact device to provide instantaneous, ear-to-ear coverage of a human face. This 3D camera uses three high-resolution CCD sensors and a color encoded pattern projection system. The RGB color information from each pixel is used to compute the range data and generate an accurate 3D surface map. The imaging system uses no moving parts and combines multiple 3D views to provide detailed and complete 3D coverage of the entire face. Images are captured within a fraction of a second and full-frame 3D data is produced within a few seconds. This described method provides much better data coverage and accuracy in feature areas with sharp features or details (such as the nose and eyes). Using this 3D data, we have been able to demonstrate that a 3D approach can significantly improve the performance of facial recognition. We have conducted tests in which we have varied the lighting conditions and angle of image acquisition in the "field." These tests have shown that the matching results are significantly improved when enrolling a 3D image rather than a single 2D image. With its 3D solutions, Genex is working toward unlocking the promise of powerful 3D FR and transferring FR from a lab technology into a real-world biometric solution.

HapHop-Physio: a computer game to support cognitive therapies in children.

Science.gov (United States)

Rico-Olarte, Carolina; López, Diego M; Narváez, Santiago; Farinango, Charic D; Pharow, Peter S

2017-01-01

Care and support of children with physical or mental disabilities are accompanied with serious concerns for parents, families, healthcare institutions, schools, and their communities. Recent studies and technological innovations have demonstrated the feasibility of providing therapy and rehabilitation services to children supported by computer games. The aim of this paper is to present HapHop-Physio, an innovative computer game that combines exercise with fun and learning, developed to support cognitive therapies in children. Conventional software engineering methods such as the Scrum methodology, a functionality test and a related usability test, were part of the comprehensive methodology adapted to develop HapHop-Physio. The game supports visual and auditory attention therapies, as well as visual and auditory memory activities. The game was developed by a multidisciplinary team, which was based on the Hopscotch ® platform provided by Fraunhofer Institute for Digital Media Technology IDMT Institute in Germany, and designed in collaboration with a rehabilitation clinic in Colombia. HapHop-Physio was tested and evaluated to probe its functionality and user satisfaction. The results show the development of an easy-to-use and funny game by a multidisciplinary team using state-of-the-art videogame technologies and software methodologies. Children testing the game concluded that they would like to play again while undergoing rehabilitation therapies.

Integrating model checking with HiP-HOPS in model-based safety analysis

International Nuclear Information System (INIS)

Sharvia, Septavera; Papadopoulos, Yiannis

2015-01-01

The ability to perform an effective and robust safety analysis on the design of modern safety–critical systems is crucial. Model-based safety analysis (MBSA) has been introduced in recent years to support the assessment of complex system design by focusing on the system model as the central artefact, and by automating the synthesis and analysis of failure-extended models. Model checking and failure logic synthesis and analysis (FLSA) are two prominent MBSA paradigms. Extensive research has placed emphasis on the development of these techniques, but discussion on their integration remains limited. In this paper, we propose a technique in which model checking and Hierarchically Performed Hazard Origin and Propagation Studies (HiP-HOPS) – an advanced FLSA technique – can be applied synergistically with benefit for the MBSA process. The application of the technique is illustrated through an example of a brake-by-wire system. - Highlights: • We propose technique to integrate HiP-HOPS and model checking. • State machines can be systematically constructed from HiP-HOPS. • The strengths of different MBSA techniques are combined. • Demonstrated through modeling and analysis of brake-by-wire system. • Root cause analysis is automated and system dynamic behaviors analyzed and verified

Droppin’ Knowledge on Race: Hip-Hop, White Adolescents, and Anti-Racism Education

Directory of Open Access Journals (Sweden)

Steven Netcoh

2013-10-01

Full Text Available In this essay, the author examines how Hip-Hop can be mobilized in anti-racism educational initatives.  The author claims that existing research on Hip-Hop and white adolescents suggests a negative corrleation between white youths' engagement with Hip-Hop and their understanding of how race and racism function in American society.  In response to this research, the author argues Hip-Hop's diverse racial discourses and ideologies must be made the subject of direct and critical inquiry in secondary and post-secondary classrooms to maximize its democratic potential.  The author outlines specific approaches for how teachers can employ Hip-Hop in anti-racism curricula in secondary and post-secondary classrooms.  Collectively, the essay serves as a preliminary investigation of Hip-Hop pedagogies of race and whiteness.

Rethinking Pedagogy in Urban Spaces: Implementing Hip-Hop Pedagogy in the Urban Science Classroom

Science.gov (United States)

Adjapong, Edmund S.; Emdin, Christopher

2015-01-01

A significant amount of research regarding Hip-Hop Based Education (HHBE) fails to provide insight on how to incorporate elements of Hip-Hop into daily teaching practices; rather Hip-Hop based educators focus mainly on incorporating Hip-Hop culture into curricula. This study explores the benefits of using two specific Hip-Hop pedagogical practices…

Hip hop e mídia: negociando interesses e ampliando conceitos

Directory of Open Access Journals (Sweden)

Tatiana Verônica Bezerra Galvão

2011-01-01

Full Text Available O hip hop surge no Brasil na década de 80, firmando-se com um conjunto depropostas estéticas e políticas construídas a partir da periferia e voltadas para a reflexãoda realidade de miséria e exclusão social a que está submetida. A proposta é fazer ecoaro descontentamento que sempre existiu por meio de produções artísticas que têm acomunidade e seus problemas como protagonistas. Além de recusar estigmas comomarginalidade e violência, o hip hop acredita e investe na informação como caminhopara uma vida mais significativa. Para torná-la acessível à comunidade, ele vempassando por um processo de organização tal que permite o desenvolvimento e arealização de vários projetos sociais de cunho educativo.

Cloning and characterisation of chs-specific DNA and cDNA sequences from hop (Humulus lupulus L.)

Czech Academy of Sciences Publication Activity Database

Matoušek, Jaroslav; Novák, Petr; Bříza, Jindřich; Patzak, J.; Niedermeierová, Hana

2002-01-01

Roč. 62, - (2002), s. 1007-1018 ISSN 0168-9452 R&D Projects: GA ČR GA521/99/1591 Keywords : hop * genetic manipulation Subject RIV: EB - Genetics ; Molecular Biology Impact factor: 1.556, year: 2002

Structured Light Based 3d Scanning for Specular Surface by the Combination of Gray Code and Phase Shifting

Science.gov (United States)

Zhang, Yujia; Yilmaz, Alper

2016-06-01

Surface reconstruction using coded structured light is considered one of the most reliable techniques for high-quality 3D scanning. With a calibrated projector-camera stereo system, a light pattern is projected onto the scene and imaged by the camera. Correspondences between projected and recovered patterns are computed in the decoding process, which is used to generate 3D point cloud of the surface. However, the indirect illumination effects on the surface, such as subsurface scattering and interreflections, will raise the difficulties in reconstruction. In this paper, we apply maximum min-SW gray code to reduce the indirect illumination effects of the specular surface. We also analysis the errors when comparing the maximum min-SW gray code and the conventional gray code, which justifies that the maximum min-SW gray code has significant superiority to reduce the indirect illumination effects. To achieve sub-pixel accuracy, we project high frequency sinusoidal patterns onto the scene simultaneously. But for specular surface, the high frequency patterns are susceptible to decoding errors. Incorrect decoding of high frequency patterns will result in a loss of depth resolution. Our method to resolve this problem is combining the low frequency maximum min-SW gray code and the high frequency phase shifting code, which achieves dense 3D reconstruction for specular surface. Our contributions include: (i) A complete setup of the structured light based 3D scanning system; (ii) A novel combination technique of the maximum min-SW gray code and phase shifting code. First, phase shifting decoding with sub-pixel accuracy. Then, the maximum min-SW gray code is used to resolve the ambiguity resolution. According to the experimental results and data analysis, our structured light based 3D scanning system enables high quality dense reconstruction of scenes with a small number of images. Qualitative and quantitative comparisons are performed to extract the advantages of our new

Let Me Blow Your Mind: Hip Hop Feminist Futures in Theory and Praxis

Science.gov (United States)

Lindsey, Treva B.

2015-01-01

This essay brings together key theoretical interventions in hip-hop feminism to explore the continued, but undervalued, significance of hip-hop feminism in urban education. More specifically, the essay challenges narrow conceptualizations of the "hip hop subject" as Black and male by using hip-hop feminist theory to incorporate the lived…

Enhancing Network Quality using Baseband Frequency Hopping, Downlink Power Control and DTX in a Live GSM Network

DEFF Research Database (Denmark)

Nielsen, Thomas Toftegaard; Wagard, Jeroen; Skjærris, Søren

1998-01-01

Baseband frequency hopping in the combination with downlink power control and discontinuous transmission has been investigated as a quality improving feature in a live GSM network. Using the dropped call rate and the frame erasure rate to measure the network quality, the use of frequency hopping...... to the statistical inaccuracy with discontinuous transmission in GSM and maybe due to poor performance of the mobile stations, was encountered. The current status is therefore to reject the use of downlink discontinuous transmission until more information about the performance of the mobile stations is found...

Framing Hip Hop: New Methodologies for New Times

Science.gov (United States)

Dimitriadis, Greg

2015-01-01

This article revisits the central impulse behind early advocacy for ethnographic approaches to hip hop--that critics should try as much as possible to limit their own certainties around what hip hop can and might mean. While ethnographic approaches can engender the kinds of personal dislocations that allow for this negotiation, they do not…

Using 3D in Visualization

DEFF Research Database (Denmark)

Wood, Jo; Kirschenbauer, Sabine; Döllner, Jürgen

2005-01-01

to display 3D imagery. The extra cartographic degree of freedom offered by using 3D is explored and offered as a motivation for employing 3D in visualization. The use of VR and the construction of virtual environments exploit navigational and behavioral realism, but become most usefil when combined...... with abstracted representations embedded in a 3D space. The interactions between development of geovisualization, the technology used to implement it and the theory surrounding cartographic representation are explored. The dominance of computing technologies, driven particularly by the gaming industry...

Hip-Hop as a Resource for Understanding the Urban Context: A Review of Christopher Edmin's--Science Education for the Hip-Hop Generation, Sense Publishers, Rotterdam, 2010

Science.gov (United States)

Brown, Bryan

2010-01-01

This review explores Edmin's "Science education for the hip-hop generation" by documenting how he frames hip-hop as a means to access urban student culture. He argues that hip-hop is more than a mere music genre, but rather a culture that provides young people with ways of connecting to the world. Two primary ideas emerged as central to…

Charge transport properties of DNA aperiodic molecule: The role of interbase hopping in Watson-Crick base pair

Science.gov (United States)

Sinurat, E. N.; Yudiarsah, E.

2017-07-01

The charge transport properties of DNA aperiodic molecule has been studied by considering various interbase hopping parameter on Watson-Crick base pair. 32 base pairs long double-stranded DNA aperiodic model with sequence GCTAGTACGTGACGTAGCTAGGATATGCCTGA on one chain and its complement on the other chain is used. Transfer matrix method has been used to calculate transmission probabilities, for determining I-V characteristic using Landauer Büttiker formula. DNA molecule is modeled using tight binding hamiltonian combined with the theory of Slater-Koster. The result show, the increment of Watson-Crick hopping value leads to the transmission probabilities and current of DNA aperiodic molecule increases.

Efficient and reliable 3D dose quality assurance for IMRT by combining independent dose calculations with measurements

NARCIS (Netherlands)

Visser, R.; Wauben, D. J. L.; de Groot, M.; Godart, J.; Langendijk, J. A.; van t Veld, Aart A.; Korevaar, E. W.

Purpose: Advanced radiotherapy treatments require appropriate quality assurance (QA) to verify 3D dose distributions. Moreover, increase in patient numbers demand efficient QA-methods. In this study, a time efficient method that combines model-based QA and measurement-based QA was developed; i.e.,

Task Assignment and Path Planning for Multiple Autonomous Underwater Vehicles Using 3D Dubins Curves †

Directory of Open Access Journals (Sweden)

Wenyu Cai

2017-07-01

Full Text Available This paper investigates the task assignment and path planning problem for multiple AUVs in three dimensional (3D underwater wireless sensor networks where nonholonomic motion constraints of underwater AUVs in 3D space are considered. The multi-target task assignment and path planning problem is modeled by the Multiple Traveling Sales Person (MTSP problem and the Genetic Algorithm (GA is used to solve the MTSP problem with Euclidean distance as the cost function and the Tour Hop Balance (THB or Tour Length Balance (TLB constraints as the stop criterion. The resulting tour sequences are mapped to 2D Dubins curves in the X − Y plane, and then interpolated linearly to obtain the Z coordinates. We demonstrate that the linear interpolation fails to achieve G 1 continuity in the 3D Dubins path for multiple targets. Therefore, the interpolated 3D Dubins curves are checked against the AUV dynamics constraint and the ones satisfying the constraint are accepted to finalize the 3D Dubins curve selection. Simulation results demonstrate that the integration of the 3D Dubins curve with the MTSP model is successful and effective for solving the 3D target assignment and path planning problem.

Use of hop extract as antifungal ingredient for bread making and selection of autochthonous resistant starters for sourdough fermentation.

Science.gov (United States)

Nionelli, Luana; Pontonio, Erica; Gobbetti, Marco; Rizzello, Carlo Giuseppe

2018-02-02

Aiming at meeting the consumers' demand in terms of bio-preservation, the potential of the combination of the lactic acid bacteria fermentation and the addition of hop extract as natural preservative in breadmaking, was exploited. The antifungal properties of a hop (Humulus lupulus) extract were investigated, showing a significant inhibition of the hyphal growth of Aspergillus parasiticus, Penicillium carneum, Penicillium polonicum, Penicillium paneum, Penicillium chermesinum, Aspergillus niger, Penicillium roqueforti. Lactic acid bacteria belonging to species of Enterococcus feacium, Lactobacillus plantarum, Lactobacillus brevis, Lactobacillus helveticus, Lactobacillus curvatus, Pediococcus pentosaceus, and Pediococcus acidilactici were isolated from hop and subjected to selection based on kinetics of growth and acidification. The sourdough (hS) enriched with hop extract (hE), started with three selected strains, had phenols concentration and antioxidant activity higher than those obtained in the same condition but without the hE. Hop-sourdough used in breadmaking delayed the fungal growth (14 days), giving a bread characterized by free aminoacids concentration, antioxidant and phytase activities higher than bread started only with baker's yeast, with or without the addition of hE. Specific volume and cell-total area of the bread containing hE improved, and its sensory profile was characterized by typical sourdough attributes, and a moderate bitter/herbaceous perception.

Connectivity model for Inter-working multi-hop wireless networks

CSIR Research Space (South Africa)

Salami, O

2009-08-01

Full Text Available pairs in inter-working multi-hop wireless networks can be evaluated based on the availability of radio links and communication routes. This paper presents an analytical study of the link and route availability in inter-working multi-hop wireless networks....

Population dynamics and integrated control of the damson-hop aphid Phorodon humuli (Schrank on hops in Spain

Directory of Open Access Journals (Sweden)

A. Lorenzana

2013-04-01

Full Text Available The hop aphid Phorodon humuli (Schrank (Hemiptera: Aphididae is a serious pest in most areas where hops are grown. A field trial was performed on a hop yard throughout 2002, 2003 and 2004 in León (Spain in order to analyse the population development of Phorodon humuli and its natural enemies, as well as to determine the most effective integrated program of insecticide treatments. The basic population development pattern of P. humuli was similar in the three years: the population peaked between mid to late June, and then decreased in late June/early July, rising again and reaching another peak in mid-July, after which it began to decline, rising once more in late August; this last rise is characteristic of Spain and has not been recorded in the rest of Europe. The hop aphid’s main natural enemy found on the leaves was Coccinella septempunctata (Coleoptera: Coccinellidae. The multiple regression analysis showed that aphids are positively related with the presence of beetle eggs and mean daily temperatures and negatively related with maximum daily temperature integral above 27ºC in plots without insecticide treatment. The most effective program of insecticide (imidacloprid treatments consisted of an initial treatment in June and a second treatment in the second half of July or at the beginning of August. However, a single treatment in June would be sufficient when in this last period the maximum daily temperatures were higher than 27ºC for at least 15 days, avoiding in this way the harmful effects of imidacloprid on predators.

Hopping models and ac universality

DEFF Research Database (Denmark)

Dyre, Jeppe; Schrøder, Thomas

2002-01-01

Some general relations for hopping models are established. We proceed to discuss the universality of the ac conductivity which arises in the extreme disorder limit of the random barrier model. It is shown that the relevant dimension entering into the diffusion cluster approximation (DCA) is the h......Some general relations for hopping models are established. We proceed to discuss the universality of the ac conductivity which arises in the extreme disorder limit of the random barrier model. It is shown that the relevant dimension entering into the diffusion cluster approximation (DCA......) is the harmonic (fracton) dimension of the diffusion cluster. The temperature scaling of the dimensionless frequency entering into the DCA is discussed. Finally, some open problems regarding ac universality are listed....

Climate, weather, and hops

Science.gov (United States)

As climate and weather become more variable, hop growers face increased uncertainty in making decisions about their crop. Given the unprecedented nature of these changes, growers may no longer have enough information and intuitive understanding to adequately assess the situation and evaluate their m...

High Order Differential Frequency Hopping: Design and Analysis

Directory of Open Access Journals (Sweden)

Yong Li

2015-01-01

Full Text Available This paper considers spectrally efficient differential frequency hopping (DFH system design. Relying on time-frequency diversity over large spectrum and high speed frequency hopping, DFH systems are robust against hostile jamming interference. However, the spectral efficiency of conventional DFH systems is very low due to only using the frequency of each channel. To improve the system capacity, in this paper, we propose an innovative high order differential frequency hopping (HODFH scheme. Unlike in traditional DFH where the message is carried by the frequency relationship between the adjacent hops using one order differential coding, in HODFH, the message is carried by the frequency and phase relationship using two-order or higher order differential coding. As a result, system efficiency is increased significantly since the additional information transmission is achieved by the higher order differential coding at no extra cost on either bandwidth or power. Quantitative performance analysis on the proposed scheme demonstrates that transmission through the frequency and phase relationship using two-order or higher order differential coding essentially introduces another dimension to the signal space, and the corresponding coding gain can increase the system efficiency.

Hopping system control with an approximated dynamics model and upper-body motion

Energy Technology Data Exchange (ETDEWEB)

Lee, Hyang Jun; Oh, Jun Ho [KAIST, Daejeon (Korea, Republic of)

2015-11-15

A hopping system is highly non-linear due to the nature of its dynamics, which has alternating phases in a cycle, flight and stance phases and related transitions. Every control method that stabilizes the hopping system satisfies the Poincaré stability condition. At the Poincaré section, a hopping system cycle is considered as discrete sectional data set. By controlling the sectional data in a discrete control form, we can generate a stable hopping cycle. We utilize phase-mapping matrices to build a Poincaré return map by approximating the dynamics of the hopping system with SLIP model. We can generate various Poincaré stable gait patterns with the approximated discrete control form which uses upper-body motions as inputs.

Investigating Cultural Collision: Educators' Perceptions of Hip-Hop Culture

Science.gov (United States)

Beachum, Floyd D.

2013-01-01

Hip-hop music has been embraced worldwide by youth, pummeled in the media for supposedly increasing social misery and hailed as a significant musical breakthrough. Hip-hop culture has transcended musical boundaries and now impacts speech, clothing, mannerisms, movies, websites, television programming, magazines, and energy drinks (Dyson, 2007;…

Influence of Coherent Tunneling and Incoherent Hopping on the Charge Transfer Mechanism in Linear Donor-Bridge-Acceptor Systems.

Science.gov (United States)

Li, Guangqi; Govind, Niranjan; Ratner, Mark A; Cramer, Christopher J; Gagliardi, Laura

2015-12-17

The mechanism of charge transfer has been observed to change from tunneling to hopping with increasing numbers of DNA base pairs in polynucleotides and with the length of molecular wires. The aim of this paper is to investigate this transition by examining the population dynamics using a tight-binding Hamiltonian with model parameters to describe a linear donor-bridge-acceptor (D-B-A) system. The model includes a primary vibration and an electron-vibration coupling at each site. A further coupling of the primary vibration with a secondary phonon bath allows the system to dissipate energy to the environment and reach a steady state. We apply the quantum master equation (QME) approach, based on second-order perturbation theory in a quantum dissipative system, to examine the dynamical processes involved in charge-transfer and follow the population transfer rate at the acceptor, ka, to shed light on the transition from tunneling to hopping. With a small tunneling parameter, V, the on-site population tends to localize and form polarons, and the hopping mechanism dominates the transfer process. With increasing V, the population tends to be delocalized and the tunneling mechanism dominates. The competition between incoherent hopping and coherent tunneling governs the mechanism of charge transfer. By varying V and the total number of sites, we also examine the onset of the transition from tunneling to hopping with increasing length.

Degradation of hop bitter acids by fungi

International Nuclear Information System (INIS)

Huszcza, Ewa; Bartmanska, Agnieszka; Aniol, Miroslaw; Maczka, Wanda; Zolnierczyk, Anna; Wawrzenczyk, Czeslaw

2008-01-01

Nine fungal strains related to: Trametes versicolor, Nigrospora oryzae, Inonotus radiatus, Crumenulopsis sororia, Coryneum betulinum, Cryptosporiopsis radicicola, Fusarium equiseti, Rhodotorula glutinis and Candida parapsilosis were tested for their ability to degrade humulones and lupulones. The best results were obtained for T. versicolor culture, in which humulones and lupulones were fully degraded after 4 days of incubation in the dark or after 36 h in the light. The experiments were performed on a commercial hop extract and on sterilized spent hops

Deep-sequencing revealed Citrus bark cracking viroid (CBCVd) as a highly aggressive pathogen on hop

Czech Academy of Sciences Publication Activity Database

Jakše, J.; Radišek, S.; Pokorn, T.; Matoušek, Jaroslav; Javornik, B.

2015-01-01

Roč. 64, č. 4 (2015), s. 831-842 ISSN 0032-0862 R&D Projects: GA MŠk(CZ) LH14255 Institutional support: RVO:60077344 Keywords : Bioinformatic * Citrus bark cracking viroid * Hop * Next-generation sequencing Subject RIV: EB - Genetics ; Molecular Biology Impact factor: 2.383, year: 2015

Crossover in tunneling hops in systems of strongly localized electrons

International Nuclear Information System (INIS)

Lien Nguyen, V.; Gamietea, A.D.

1995-11-01

Accurate Monte-Carlo simulation data show a consistent crossover in different characters of tunneling hops in two-dimensional systems of strongly localized electrons in the presence of scattering and quantum interference of hopping paths. The results also suggest a negative answer to the question whether there is a two-dimensional sign phase transition. The fractal behaviour observed in the direction perpendicular to the hopping direction is found to be similar to that for eigenstates in one-dimensional localized systems. (author). 16 refs, 6 figs

Hsp70/Hsp90 organising protein (hop): beyond interactions with chaperones and prion proteins.

Science.gov (United States)

Baindur-Hudson, Swati; Edkins, Adrienne L; Blatch, Gregory L

2015-01-01

The Hsp70/Hsp90 organising protein (Hop), also known as stress-inducible protein 1 (STI1), has received considerable attention for diverse cellular functions in both healthy and diseased states. There is extensive evidence that intracellular Hop is a co-chaperone of the major chaperones Hsp70 and Hsp90, playing an important role in the productive folding of Hsp90 client proteins. Consequently, Hop is implicated in a number of key signalling pathways, including aberrant pathways leading to cancer. However, Hop is also secreted and it is now well established that Hop also serves as a receptor for the prion protein, PrP(C). The intracellular and extracellular forms of Hop most likely represent two different isoforms, although the molecular determinants of these divergent functions are yet to be identified. There is also a growing body of research that reports the involvement of Hop in cellular activities that appear independent of either chaperones or PrP(C). While Hop has been shown to have various cellular functions, its biological function remains elusive. However, recent knockout studies in mammals suggest that Hop has an important role in embryonic development. This review provides a critical overview of the latest molecular, cellular and biological research on Hop, critically evaluating its function in healthy systems and how this function is adapted in diseases states.

Switched diversity strategies for dual-hop relaying systems

KAUST Repository

Gaaloul, Fakhreddine

2011-04-29

This paper investigates the effect of different switched diversity configurations on the implementation complexity and achieved performance of dual-hop amplify-and-forward (AF) relaying networks. A low-complexity model of the relay station is adopted, wherein single-input single-output antenna configuration is employed. Each of the transmitter and the receiver however employs multiple antennas to improve the overall link performance. Single-phase and two-phase based receive switching strategies are investigated assuming optimum first hop signal-to-noise ratio (SNR). Moreover, the simple scheme in which the switched diversity is applied independently over the two hops is studied using tight upper bounds. Thorough performance comparisons and switching thresholds optimization for the aforementioned strategies are presented. Simulation results are also provided to validate the mathematical development and to verify the numerical computations.

New STS molecular markers for assessment of genetic diversity and DNA fingerprinting in hop (Humulus lupulus L.).

Science.gov (United States)

Patzak, Josef; Vrba, Lukás; Matousek, Jaroslav

2007-01-01

Molecular markers have been increasingly used in genetic studies of crop species for their applicability in breeding programs. In this work, we report on the development of new sequence-tagged site (STS) markers based on sequence information from several identified hop (Humulus lupulus L.) genes. We demonstrate the usefulness of these STS markers and compare them to SSRs for identifying hop genotypes and estimating genetic diversity in a collection of 68 hop cultivars from around the world. We found 3 individual gene variants (A, B, C) of the chs_H1 gene in this collection. The most frequent gene variant, B (AJ304877), was not detected in Mt. Hood, Glacier, and Horizon (US) cultivars. Gene variant A came from an American germplasm through wild hops. We found length polymorphism in intron 1 of the chs2 gene, and 4 different amplified markers were detected in PCRs. The chs3 gene was found in only one third of the cultivars. None of the variants of the studied CHS genes were found in Humulus japonicus. We detected 5 major gene variants of DNA-binding protein in the collection of H. lupulus cultivars and 2 others in H. japonicus. We also found 3 individual gene variants of an endochitinase gene. The distribution of gene variants did not correlate with any resistance. We proved that developed STS markers can be successfully used for the analysis of genetic diversity and can substitute and supplement SSR markers in hop.

Surface hopping simulation of vibrational predissociation of methanol dimer

Science.gov (United States)

Jiang, Ruomu; Sibert, Edwin L.

2012-06-01

The mixed quantum-classical surface hopping method is applied to the vibrational predissociation of methanol dimer, and the results are compared to more exact quantum calculations. Utilizing the vibrational SCF basis, the predissociation problem is cast into a curve crossing problem between dissociative and quasibound surfaces with different vibrational character. The varied features of the dissociative surfaces, arising from the large amplitude OH torsion, generate rich predissociation dynamics. The fewest switches surface hopping algorithm of Tully [J. Chem. Phys. 93, 1061 (1990), 10.1063/1.459170] is applied to both diabatic and adiabatic representations. The comparison affords new insight into the criterion for selecting the suitable representation. The adiabatic method's difficulty with low energy trajectories is highlighted. In the normal crossing case, the diabatic calculations yield good results, albeit showing its limitation in situations where tunneling is important. The quadratic scaling of the rates on coupling strength is confirmed. An interesting resonance behavior is identified and is dealt with using a simple decoherence scheme. For low lying dissociative surfaces that do not cross the quasibound surface, the diabatic method tends to overestimate the predissociation rate whereas the adiabatic method is qualitatively correct. Analysis reveals the major culprits involve Rabi-like oscillation, treatment of classically forbidden hops, and overcoherence. Improvements of the surface hopping results are achieved by adopting a few changes to the original surface hopping algorithms.

Backoff-stage synchronization in three-hop string-topology wireless networks with hidden nodes

Science.gov (United States)

Sanada, Kosuke; Sekiya, Hiroo; Komuro, Nobuyoshi; Sakata, Shiro

In IEEE 802.11 wireless multi-hop networks, each node works individually and their individual operations generate entire network dynamics. It is important to clarify the network dynamics in wireless multi-hop networks for designing and constructing multi-hop communication networks. This paper presents the network-dynamics investigations for three-hop string-topology wireless network in detail. From the investigations, a “backoff-stage synchronization” phenomenon, which is mutuality between hidden nodes, is found. The mechanism of the backoff-stage synchronization is expressed and the sufficient conditions for the synchronization occurrence are given. This phenomenon gives some impacts on the IEEE 802.11 multi-hop-network communications.

Multi-Hop Link Capacity of Multi-Route Multi-Hop MRC Diversity for a Virtual Cellular Network

Science.gov (United States)

Daou, Imane; Kudoh, Eisuke; Adachi, Fumiyuki

In virtual cellular network (VCN), proposed for high-speed mobile communications, the signal transmitted from a mobile terminal is received by some wireless ports distributed in each virtual cell and relayed to the central port that acts as a gateway to the core network. In this paper, we apply the multi-route MHMRC diversity in order to decrease the transmit power and increase the multi-hop link capacity. The transmit power, the interference power and the link capacity are evaluated for DS-CDMA multi-hop VCN by computer simulation. The multi-route MHMRC diversity can be applied to not only DS-CDMA but also other access schemes (i. e. MC-CDMA, OFDM, etc.).

Adjusting Sensing Range to Maximize Throughput on Ad-Hoc Multi-Hop Wireless Networks

National Research Council Canada - National Science Library

Roberts, Christopher

2003-01-01

.... Such a network is referred to as a multi-hop ad-hoc network, or simply a multi-hop network. Most multi-hop network protocols use some form of carrier sensing to determine if the wireless channel is in use...

Simultaneous acquisition of 3D shape and deformation by combination of interferometric and correlation-based laser speckle metrology.

Science.gov (United States)

Dekiff, Markus; Berssenbrügge, Philipp; Kemper, Björn; Denz, Cornelia; Dirksen, Dieter

2015-12-01

A metrology system combining three laser speckle measurement techniques for simultaneous determination of 3D shape and micro- and macroscopic deformations is presented. While microscopic deformations are determined by a combination of Digital Holographic Interferometry (DHI) and Digital Speckle Photography (DSP), macroscopic 3D shape, position and deformation are retrieved by photogrammetry based on digital image correlation of a projected laser speckle pattern. The photogrammetrically obtained data extend the measurement range of the DHI-DSP system and also increase the accuracy of the calculation of the sensitivity vector. Furthermore, a precise assignment of microscopic displacements to the object's macroscopic shape for enhanced visualization is achieved. The approach allows for fast measurements with a simple setup. Key parameters of the system are optimized, and its precision and measurement range are demonstrated. As application examples, the deformation of a mandible model and the shrinkage of dental impression material are measured.

A Low-Cost Time-Hopping Impulse Radio System for High Data Rate Transmission

Directory of Open Access Journals (Sweden)

Jinyun Zhang

2005-03-01

Full Text Available We present an efficient, low-cost implementation of time-hopping impulse radio that fulfills the spectral mask mandated by the FCC and is suitable for high-data-rate, short-range communications. Key features are (i all-baseband implementation that obviates the need for passband components, (ii symbol-rate (not chip rate sampling, A/D conversion, and digital signal processing, (iii fast acquisition due to novel search algorithms, and (iv spectral shaping that can be adapted to accommodate different spectrum regulations and interference environments. Computer simulations show that this system can provide 110 Mbps at 7–10 m distance, as well as higher data rates at shorter distances under FCC emissions limits. Due to the spreading concept of time-hopping impulse radio, the system can sustain multiple simultaneous users, and can suppress narrowband interference effectively.

Triple-Layer Vascular Grafts Fabricated by Combined E-Jet 3D Printing and Electrospinning.

Science.gov (United States)

Huang, Ruiying; Gao, Xiangkai; Wang, Jian; Chen, Haoxiang; Tong, Chunyi; Tan, Yongjun; Tan, Zhikai

2018-05-29

Small-diameter tissue-engineered vascular grafts are urgently needed for clinic arterial substitute. To simulate the structures and functions of natural blood vessels, we designed a novel triple-layer poly(ε-caprolactone) (PCL) fibrous vascular graft by combining E-jet 3D printing and electrospinning techniques. The resultant vascular graft consisted of an interior layer comprising 3D-printed highly aligned strong fibers, a middle layer made by electrospun densely fibers, and an exterior structure composed of mixed fibers fabricated by co-electrospraying. The biocompatible triple-layer graft was used for in vivo implantation, and results demonstrated that the longitudinally-aligned fibers within the lumen of the graft could enhance the proliferation and migration of endothelial cells, while maintained good mechanical properties. The exterior layer provided a pathway that encouraged cells to migrate into the scaffold after implantation. This experimental graft overcame the limitations of conventionally electrospun vascular grafts of inadequate porosity and lowly cell penetration. The unique structure of the triple-layer vascular graft promoted cell growth and infiltration in vivo, thus provided an encouraging substitute for in situ tissue engineering.

Mortality in American Hip-Hop and Rap Recording Artists, 1987-2014.

Science.gov (United States)

Lawson, Carl J

2015-12-01

The deaths of American hip-hop and rap recording artists often receive considerable media attention. However, these artists' deaths have not been examined as a distinct group like the deaths of rock, classical, jazz, and pop music artists. This is a seminal epidemiological analysis on the deaths of an understudied group, American hip-hop and rap music recording artists. Media reports were analyzed of the deaths of American hip-hop and rap music recording artists that occurred from January 1, 1987 to December 31, 2014. The decedents' age, sex, race, cause of death, stage names, and city and state of death were recorded for analysis. The most commonly reported cause of death was homicide. The 280 deaths were categorized as homicide (55%), unintentional injury (13%), cardiovascular (7%), undetermined/undisclosed (7%), cancer (6%), other (5%), suicide (4%), and infectious disease (3%). The mean reported age at death was 30 yrs (range 15-75) and the median was 29 yrs; 97% were male and 92% were black. All but one of the homicides were committed with firearms. Homicide was the most commonly reported cause of death. Public health focus and guidance for hip-hop and rap recording artists should mirror that for African-American men and adolescent males ages 15-54 yrs, for whom the leading causes of death are homicide, unintentional injury, and heart disease. Given the preponderance of homicide deaths in this analysis, premature mortality reduction efforts should focus on violence prevention and conflict mitigation.

Savage Vernacular: Performing Race, Memory, and Hip Hop in Filipino America

OpenAIRE

Villegas, Mark

2015-01-01

By observing and analyzing live performances, music, visual art, interviews, television shows, and online discourse, this dissertation traces the ways in which Filipino American hip hop performance remembers the racialized histories of the Filipino body. Through both quotidian and spectacular performances in hip hop, Filipino Americans have been contributing to crucial forms of knowledge that help unpack the terms of Filipino and American culture. Hip hop culture, I argue, operates as a produ...

"Deeper than Rap": Gifted Males and Their Relationship with Hip Hop Culture

Science.gov (United States)

Callahan, J. Sean; Grantham, Tarek C.

2012-01-01

One would be hard-pressed to deny the impact that hip hop is having on gifted students. More specifically, because hip hop is a creative and exciting male-dominated culture, gifted males gravitate to hip hop culture. From the perspective of two Black men from two different generations, this article was inspired by discussions about the role of hip…

Being Hipped to Their Hop: Tapping into Young Minds through Hip Hop Play

Science.gov (United States)

Broughton, Anthony

2017-01-01

Adults gain a wealth of knowledge from listening to the voices of children through intentional observations and interactions [Owocki, G., and Y. M. Goodman. 2002. "Kidwatching: Documenting Children's Literacy Development." Portsmouth: Heinemann]. Hip Hop play may provide optimal opportunities for teachers to tap into the young minds of…

Starting with Style: Toward a Second Wave of Hip-Hop Education Research and Practice

Science.gov (United States)

Petchauer, Emery

2015-01-01

One fundamental breakthrough in the field of hip-hop education in recent years is the shift from understanding hip-hop solely as content to understanding hip-hop also as aesthetic form. In this article, I chart the roots of this shift across disciplines and focus on what it might mean for the future of hip-hop education, pedagogy, and research in…

Hop powdery mildew control through alteration of spring pruning practices

Science.gov (United States)

Since 1997, Podosphaera macularis, the causal agent of hop powdery mildew, has become a recurrent threat to hops in the Pacific Northwest because of the potential to reduce cone yield and quality. Disease management practices often involve preventative fungicide applications, but alternative approac...

ACL-reconstructed and ACL-deficient individuals show differentiated trunk, hip, and knee kinematics during vertical hops more than 20 years post-injury.

Science.gov (United States)

Markström, Jonas L; Tengman, Eva; Häger, Charlotte K

2018-02-01

Little is known regarding movement strategies in the long term following injury of the anterior cruciate ligament (ACL), and even less about comparisons of reconstructed and deficient knees in relation to healthy controls. The present purpose was to compare trunk, hip, and knee kinematics during a one-leg vertical hop (VH) ~20 years post-ACL injury between persons treated with surgery and physiotherapy (ACL R ), solely physiotherapy (ACL PT ), and controls (CTRL). Between-leg kinematic differences within groups were also investigated. Sixty-six persons who suffered unilateral ACL injury on average 23 ± 2 years ago (32 ACL R , 34 ACL PT ) and 33 controls performed the VH. Peak trunk, hip, and knee angles during Take-off and Landing phases recorded with a 3D motion capture system were analysed with multivariate statistics. Significant group effects during both Take-off and Landing were found, with ACL PT differing from CTRL in Take-off with a combination of less knee flexion and knee internal rotation, and from both ACL R and CTRL in Landing with less hip and knee flexion, knee internal rotation, and greater hip adduction. ACL R also presented different kinematics to ACL PT and CTRL in Take-off with a combination of greater trunk flexion, hip flexion, hip internal rotation, and less knee abduction, and in Landing with greater trunk flexion and hip internal rotation. Further, different kinematics and hop height were found between legs within groups in both Take-off and Landing for both ACL groups, but not for CTRL. Different kinematics for the injured leg for both ACL groups compared to CTRL and between treatment groups, as well as between legs within treatment groups, indicate long-term consequences of injury. Compensatory mechanisms for knee protection seem to prevail over time irrespective of initial treatment, possibly increasing the risk of re-injury and triggering the development of osteoarthritis. Detailed investigation of movement strategies during the VH

Hip-Hop, the "Obama Effect," and Urban Science Education

Science.gov (United States)

Emdin, Christopher; Lee, Okhee

2012-01-01

Background/Context: With the ever increasing diversity of schools, and the persistent need to develop teaching strategies for the students who attend today's urban schools, hip-hop culture has been proposed to be a means through which urban youth can find success in school. As a result, studies of the role of hip-hop in urban education have grown…

Hip Hop as Empowerment: Voices in El Alto, Bolivia

Science.gov (United States)

Tarifa, Ariana

2012-01-01

In response to neoliberal policies that have been in place since 1985, Bolivian young people have increasingly used hip hop music as a means of protest and to reclaim social and political participation. Hip hop in Latin America tells the story of the struggles that marginalized people have suffered, and speaks to the effects of international…

Charge Energy Transport in Hopping Systems with Rapidly Decreasing Density of States

Science.gov (United States)

Mendels, Dan; Organic Electronics Group Technion Team

2014-03-01

An accurate description of the carrier hopping topology in the energy domain of hopping systems incorporating a rapidly decreasing density of states and the subsequent energetic position of these systems' so called effective conduction band is crucial for rationalizing and quantifying these systems' thermo-electric properties, doping related phenomena and carrier gradient effects such as the emergence of the General Einstein Relation under degenerate conditions. Additionally, as will be shown, the 'mobile' carriers propagating through the system can have excess energies reaching 0.3eV above the system quasi-Fermi energy. Hence, since these mobile carriers are most prone to reach systems interfaces and interact with oppositely charged carriers, their excess energy should be considered in determining the efficiencies of energy dependent processes such as carrier recombination and exciton dissociation. In light of the stated motivations, a comprehensive numerical and analytical study of the topology of hopping in the energetic density of such systems (i.e. the statistics regarding which energy values carriers visit most and in what manner) was implemented and the main statistical features of the hopping process that determine the position in energy of the system's effective conduction band were distilled. The obtained results also help shed light on yet to be elucidated discrepancies between predictions given by the widely employed transport energy concept and Monte Carlo simulations.

In situ repair of bone and cartilage defects using 3D scanning and 3D printing

OpenAIRE

Li, Lan; Yu, Fei; Shi, Jianping; Shen, Sheng; Teng, Huajian; Yang, Jiquan; Wang, Xingsong; Jiang, Qing

2017-01-01

Three-dimensional (3D) printing is a rapidly emerging technology that promises to transform tissue engineering into a commercially successful biomedical industry. However, the use of robotic bioprinters alone is not sufficient for disease treatment. This study aimed to report the combined application of 3D scanning and 3D printing for treating bone and cartilage defects. Three different kinds of defect models were created to mimic three orthopedic diseases: large segmental defects of long bon...

Joint Scheduling for Dual-Hop Block-Fading Broadcast Channels

KAUST Repository

Zafar, Ammar

2012-09-16

In this paper, we propose joint user-and-hop scheduling over dual-hop block-fading broadcast channels in order to exploit multi-user diversity gains and multi-hop diversity gains all together. To achieve this objective, the first and second hops are scheduled opportunistically based on the channel state information and as a prerequisite we assume that the relay, which is half-duplex and operates using decode-and-forward, is capable of storing the received packets from the source until the channel condition of the destined user becomes good to be scheduled. We formulate the joint scheduling problem as maximizing the weighted sum of the long term achievable rates by the users under a stability constraint, which means that on the long term the rate received by the relay should equal the rate transmitted by it, in addition to constant or variable power constraints. We show that this problem is equivalent to a single-hop broadcast channel by treating the source as a virtual user with an optimal priority weight that maintains the stability constraint. We show how to obtain the source weight either off-line based on channel statistics or on real-time based on channel measurements. Furthermore, we consider special cases including the maximum sum rate scheduler and the proportional fair scheduler. We demonstrate via numerical results that our proposed joint scheduling scheme enlarges the rate region as compared with a scheme that employs multi-user scheduling alone.

Influence of system size on simulated charge mobility in amorphous films of tris(8-hydroxyquinolinato)aluminium (Alq3)

Energy Technology Data Exchange (ETDEWEB)

Lukyanov, Alexander; Andrienko, Denis [Max Planck Institute for Polymer Research, Mainz (Germany)

2010-07-01

We present the results of a modeling study of the charge transport in amorphous films of tris(8-hydroxyquinolinato)aluminium (Alq{sub 3}). In our multiscale approach we combine molecular dynamics to generate material morphologies, Marcus theory to evaluate charge hopping rates and kinetic Monte Carlo to simulate charge dynamics. Energetic disorder is taken into account by assigning partial charges to the hopping sites, obtained from DFT B3LYP, 6-311g(d) calculations. In contrast to the previous studies Poole-Frenkel behavior of the mobility is reproduced. Our results indicate strong finite-size effects, meaning that the absolute value of the calculated mobility decreases with the increase of the simulation box size. Simple analogy with a classical percolation problem suggests that very large systems are required to obtain a reliable estimate of the charge carrier mobility.

Transport Properties of the Organic Conductor (TMTSF)2BrO4: Evidence of Variable Range Hopping

DEFF Research Database (Denmark)

Mortensen, Kell; Jacobsen, Claus Schelde; Bechgaard, Klaus

1984-01-01

A study of d.c. and microwave conductivity and thermoelectric power of the organic conductor (TMTSF)2BrO4 is presented. The transport properties are in qualitative agreement with charge transport via variable-range hopping among localized states. The localization is attributed to the anions, which...

Pistachio (Pistacia vera L.) is a new natural host of Hop stunt viroid.

Science.gov (United States)

Elleuch, Amine; Hamdi, Imen; Ellouze, Olfa; Ghrab, Mohamed; Fkahfakh, Hatem; Drira, Noureddine

2013-10-01

Besides hop, Hop stunt viroid (HpSVd) infects many woody species including grapevine, citrus, peach, plum, apricot, almond, pomegranate, mulberry and jujube. Here, we report the first detection of HpSVd in pistachio (Pistacia vera L.). Samples corresponding to 16 pistachio cultivars were obtained from a nearby almond collection. From these samples, low molecular weight RNAs were extracted for double polyacrylamide gel electrophoresis, northern-blot analysis and reverse transcription polymerase chain reaction assays. HpSVd was detected in 4 of the 16 pistachio cultivars in the first year and in 6 in the second, being also detected in the almond collection. Examination of the nucleotide sequences of pistachio and almond isolates revealed 13 new sequence variants. Sequences from pistachio shared 92-96 % similarity with the first reported HpSVd sequence (GenBank X00009), and multiple alignment and phylogenetic analyses showed that one pistachio isolate (HpSVdPis67Jabari) clustered with the plum group, whereas all the others clustered with the hop, and the recombinants plum-citrus and plum-Hop/cit3 groups. By identifying pistachio as a new natural host, we confirm that HpSVd is an ubiquitous and genetically variable viroid that infects many different fruit trees cultivated worldwide.

Evaluation of airborne methyl salicylate for improved conservation biological control of two-spotted spider mite and hop aphid in Oregon hop yards.

Science.gov (United States)

Woods, J L; James, D G; Lee, J C; Gent, D H

2011-12-01

The use of synthetic herbivore-induced plant volatiles (HIPV) to attract natural enemies has received interest as a tool to enhance conservation biological control (CBC). Methyl salicylate (MeSA) is a HIPV that is attractive to several key predators of two-spotted spider mite, Tetranychus urticae Koch (Acari: Tetranychidae), and hop aphid, Phorodon humuli (Schrank) (Homoptera: Aphididae). A 2-year study was conducted to evaluate the recommended commercial use of MeSA in hop yards in Oregon. Slow-release MeSA dispensers were stapled to supporting poles in 0.5 ha plots and these plots were compared to a paired non-treated plot on each of three farms in 2008 and 2009. Across both years, there was a trend for reduced (range 40-91%) mean seasonal numbers of T. urticae in five of the six MeSA-baited plots. Stethorus spp., key spider mite predators, tended to be more numerous in MeSA-baited plots compared to control plots on a given farm. Mean seasonal densities of hop aphid and other natural enemies (e.g., Orius spp. and Anystis spp.) were similar between MeSA-treated and control plots. Variability among farms in suppression of two-spotted spider mites and attraction of Stethorus spp. suggests that the use of MeSA to enhance CBC of spider mites in commercial hop yards may be influenced by site-specific factors related to the agroecology of individual farms or seasonal effects that require further investigation. The current study also suggests that CBC of hop aphid with MeSA in this environment may be unsatisfactory.

A two-hop wireless power transfer system with an efficiency-enhanced power receiver for motion-free capsule endoscopy inspection.

Science.gov (United States)

Sun, Tianjia; Xie, Xiang; Li, Guolin; Gu, Yingke; Deng, Yangdong; Wang, Zhihua

2012-11-01

This paper presents a wireless power transfer system for a motion-free capsule endoscopy inspection. Conventionally, a wireless power transmitter in a specifically designed jacket has to be connected to a strong power source with a long cable. To avoid the power cable and allow patients to walk freely in a room, this paper proposes a two-hop wireless power transfer system. First, power is transferred from a floor to a power relay in the patient's jacket via strong coupling. Next, power is delivered from the power relay to the capsule via loose coupling. Besides making patients much more conformable, the proposed techniques eliminate the sources of reliability issues arisen from the moving cable and connectors. In the capsule, it is critical to enhance the power conversion efficiency. This paper develops a switch-mode rectifier (rectifying efficiency of 93.6%) and a power combination circuit (enhances combining efficiency by 18%). Thanks to the two-hop transfer mechanism and the novel circuit techniques, this system is able to transfer an average power of 24 mW and a peak power of 90 mW from the floor to a 13 mm × 27 mm capsule over a distance of 1 m with the maximum dc-to-dc power efficiency of 3.04%.

Behind Beats and Rhymes: Working Class from a Hampton Roads Hip Hop Homeplace

Science.gov (United States)

Durham, Aisha S.

2009-01-01

The film documentary titled "Hip Hop: beyond beats and rhymes" captures ongoing conversations among scholars, cultural critics, and hip hop insiders about the state of African Americans by interrogating distinct expressive forms associated with hip hop culture. Durham draws from two scenes to describe her memories as the researched…

Penalty kick skill through knee tuck jump exercise and barrier hops exercise

Directory of Open Access Journals (Sweden)

Usli Wargadinata Lingling

2018-01-01

Full Text Available Football always attracts society’s attention. Unfortunately in practice, at school for example, students have difficulties in mastering penalty kick. This research aimed to know the influence of knee tuck jump exercise towards penalty kick result in football and the influence of barrier hops exercise towards penalty kick result in football. The design of this research is pretest–posttest design. The population taken was the entire students from class XI SMK 3 LPPM-RI Batujajar which consisted of 126 students. Purposive sampling technique was used to determine the sample. Intentionally, the writer chose as many as 30 students who joined football extracurricular as sample then divided them into two groups namely group A (knee tuck jump exercise and group B (barrier hops exercise. Based on the result, there was significant difference in mean score between pretest and posttest in group A (29.00 than group B (26.00 towards the result of penalty kick in football. The result of compared t from the difference of two results is 4.92 bigger than t table 1.70. Therefore, knee tuck jump exercise gives more significant result than barrier hops exercise towards penalty kick result in football to the students of football extracurricular in SMK 3 LPPM-RI Batujajar.

Child-Mediated Stroke Communication: findings from Hip Hop Stroke.

Science.gov (United States)

Williams, Olajide; DeSorbo, Alexandra; Noble, James; Gerin, William

2012-01-01

Low thrombolysis rates for acute ischemic stroke are linked to delays in seeking immediate treatment due to low public stroke awareness. We aimed to assess whether "Child-Mediated Stroke Communication" could improve stroke literacy of parents of children enrolled in a school-based stroke literacy program called Hip Hop Stroke. Parents of children aged 9 to 12 years from 2 public schools in Harlem, New York City, were recruited to participate in stroke literacy questionnaires before and after their child's participation in Hip Hop Stroke, a novel Child-Mediated Stroke Communication intervention delivered in school auditoriums. Parental recall of stroke information communicated through their child was assessed 1-week after the intervention. Fifth and sixth grade students (n=182) were enrolled into Hip Hop Stroke. One hundred two parents were approached in person to participate; 75 opted to participate and 71 completed both the pretest and post-test (74% response rate and 95% retention rate). Parental stroke literacy improved after the program; before the program, 3 parents of 75 (3.9%) were able to identify the 5 cardinal stroke symptoms, distracting symptom (chest pains), and had an urgent action plan (calling 911) compared with 21 of 71 parents (29.6%) postintervention (P<0.001). The FAST mnemonic was known by 2 (2.7%) of participants before the program versus 29 (41%) after program completion (P<0.001). Knowledge of stroke signs and symptoms remains low among residents of this high-risk population. The use of Child-Mediated Stroke Communication suggests that school children aged 9 to 12 years may be effective conduits of critical stroke knowledge to their parents.

Interaction and dynamics of homologous pairing protein 2 (HOP2) and DNA studied by MD simulation

Science.gov (United States)

Moktan, Hem; Pezza, Roberto; Zhou, Donghua

2015-03-01

The homologous pairing protein 2 (Hop2) plays an important role in meiosis and DNA repair. Together with protein Mnd1, Hop2 enhances the strand invasion activity of recombinase Dmc1 by over 30 times, facilitating proper synapsis of homologous chromosomes. We recently determined the NMR structure of the N-terminal domain of Hop2 and proposed a model of Protein-DNA complex based on NMR chemical shift perturbations and mutagenesis studies (Moktan, J Biol Chem 2014 10.1074/jbc.M114.548180). However structure and dynamics of the complex have not been studied at the atomic level yet. Here, we used classical MD simulations to study the interactions between the N-terminal HOP2 and DNA. The simulated results indicate that helix3 (H3) interacts with DNA in major groove and wing1 (W1) interacts mostly in minor groove mainly via direct hydrogen bonds. Also it is found that binding leads to reduced fluctuations in both protein and DNA. Several water bridge interactions have been identified. The residue-wise contributions to the interaction energy were evaluated. Also the functional motion of the protein is analyzed using principal component analysis. The results confirmed the importance of H3 and W1 for the stability of the complex, which is consistent with our previous experimental studies.

The effect of combined resistance exercise training and vitamin D3 supplementation on musculoskeletal health and function in older adults: a systematic review and meta-analysis.

Science.gov (United States)

Antoniak, Anneka Elizabeth; Greig, Carolyn A

2017-07-20

In older adults, there is a blunted responsiveness to resistance training and reduced muscle hypertrophy compared with younger adults. There is evidence that both exercise training and vitamin D supplementation may benefit musculoskeletal health in older adults, and it is plausible that in combination their effects may be additive. The aim of this systematic review was to evaluate the effectiveness of combined resistance exercise training and vitamin D 3 supplementation on musculoskeletal health in older adults. A comprehensive search of electronic databases, including Science Direct, Medline, PubMed, Google Scholar and Cochrane Central Register of Controlled Trials (Cochrane CENTRAL accessed by Wiley Science) was conducted. Eligible studies were randomised controlled trials including men and women (aged ≥65 years or mean age ≥65 years); enlisting resistance exercise training and vitamin D 3 supplementation; including outcomes of muscle strength, function, muscle power, body composition, serum vitamin D/calcium status or quality of life comparing results with a control group. The review was informed by a preregistered protocol (http://www.crd.york.ac.uk/PROSPERO/display_record.asp?ID=CRD42015020157). Seven studies including a total of 792 participants were identified. Studies were categorised into two groups; group 1 compared vitamin D 3 supplementation and exercise training versus exercise alone (describing the additive effect of vitamin D 3 supplementation when combined with resistance exercise training) and group 2 compared vitamin D 3 supplementation and exercise training versus vitamin D 3 supplementation alone (describing the additive effect of resistance exercise training when combined with vitamin D 3 supplementation).Meta-analyses for group 1 found muscle strength of the lower limb to be significantly improved within the intervention group (0.98, 95% CI 0.73 to 1.24, pexercise and vitamin D 3 supplementation for the improvement of muscle strength in

Sensor-Motor Maps for Describing Linear Reflex Composition in Hopping

Directory of Open Access Journals (Sweden)

Christian Schumacher

2017-11-01

Full Text Available In human and animal motor control several sensory organs contribute to a network of sensory pathways modulating the motion depending on the task and the phase of execution to generate daily motor tasks such as locomotion. To better understand the individual and joint contribution of reflex pathways in locomotor tasks, we developed a neuromuscular model that describes hopping movements. In this model, we consider the influence of proprioceptive length (LFB, velocity (VFB and force feedback (FFB pathways of a leg extensor muscle on hopping stability, performance and efficiency (metabolic effort. Therefore, we explore the space describing the blending of the monosynaptic reflex pathway gains. We call this reflex parameter space a sensor-motor map. The sensor-motor maps are used to visualize the functional contribution of sensory pathways in multisensory integration. We further evaluate the robustness of these sensor-motor maps to changes in tendon elasticity, body mass, segment length and ground compliance. The model predicted that different reflex pathway compositions selectively optimize specific hopping characteristics (e.g., performance and efficiency. Both FFB and LFB were pathways that enable hopping. FFB resulted in the largest hopping heights, LFB enhanced hopping efficiency and VFB had the ability to disable hopping. For the tested case, the topology of the sensor-motor maps as well as the location of functionally optimal compositions were invariant to changes in system designs (tendon elasticity, body mass, segment length or environmental parameters (ground compliance. Our results indicate that different feedback pathway compositions may serve different functional roles. The topology of the sensor-motor map was predicted to be robust against changes in the mechanical system design indicating that the reflex system can use different morphological designs, which does not apply for most robotic systems (for which the control often follows a

Sensor-Motor Maps for Describing Linear Reflex Composition in Hopping.

Science.gov (United States)

Schumacher, Christian; Seyfarth, André

2017-01-01

In human and animal motor control several sensory organs contribute to a network of sensory pathways modulating the motion depending on the task and the phase of execution to generate daily motor tasks such as locomotion. To better understand the individual and joint contribution of reflex pathways in locomotor tasks, we developed a neuromuscular model that describes hopping movements. In this model, we consider the influence of proprioceptive length (LFB), velocity (VFB) and force feedback (FFB) pathways of a leg extensor muscle on hopping stability, performance and efficiency (metabolic effort). Therefore, we explore the space describing the blending of the monosynaptic reflex pathway gains. We call this reflex parameter space a sensor-motor map . The sensor-motor maps are used to visualize the functional contribution of sensory pathways in multisensory integration. We further evaluate the robustness of these sensor-motor maps to changes in tendon elasticity, body mass, segment length and ground compliance. The model predicted that different reflex pathway compositions selectively optimize specific hopping characteristics (e.g., performance and efficiency). Both FFB and LFB were pathways that enable hopping. FFB resulted in the largest hopping heights, LFB enhanced hopping efficiency and VFB had the ability to disable hopping. For the tested case, the topology of the sensor-motor maps as well as the location of functionally optimal compositions were invariant to changes in system designs (tendon elasticity, body mass, segment length) or environmental parameters (ground compliance). Our results indicate that different feedback pathway compositions may serve different functional roles. The topology of the sensor-motor map was predicted to be robust against changes in the mechanical system design indicating that the reflex system can use different morphological designs, which does not apply for most robotic systems (for which the control often follows a specific

Antiproliferative effects of prenylflavonoids from hops on human colon cancer cell lines

Czech Academy of Sciences Publication Activity Database

Hudcová, T.; Bryndová, Jana; Fialová, K.; Fiala, J.; Karabín, M.; Jelínek, L.; Dostalek, P.

2014-01-01

Roč. 120, č. 3 (2014), s. 225-230 ISSN 0046-9750 Institutional support: RVO:67985823 Keywords : hop * prenylflavonoids * xanthohumol * isoxanthohumol * antiproliferative * colon cancer Subject RIV: GM - Food Processing Impact factor: 1.240, year: 2014

Determination of the Geographical and Botanical Origin of Hops (Humulus lupulus L.) Using Stable Isotopes of C, N, and S.

Science.gov (United States)

Ocvirk, Miha; Ogrinc, Nives; Košir, Iztok Jože

2018-02-28

A need exists for a reliable method to determine the geographical and botanical origin of hops. For this study, three sets of samples were collected: the first set comprised 5 German samples; the second set comprised samples of hops from 10 of the world's major hop-growing regions; and the third comprised the 4 main Slovenian regions. The samples were analyzed using isotope ratio mass spectrometry (IRMS) to obtain δ 13 C, δ 15 N, and δ 34 S values. The δ 15 N (2.2 ‰ to 8.4 ‰) and δ 34 S (0.7 ‰ to 12.3 ‰) values were the most discriminating parameters for classifying hop according to geographical origin. ANOVA showed distinct groupings for 8 out of the 10 hop-growing regions. Although it was not possible to distinguish the geographical origin of hops based on δ 13 C (-28.9 ‰ to -24.7 ‰), in the case of botanical origin, δ 13 C values proved to be the most discriminative albeit with limited success.

Breaking the Crowther limit: Combining depth-sectioning and tilt tomography for high-resolution, wide-field 3D reconstructions

Energy Technology Data Exchange (ETDEWEB)

Hovden, Robert, E-mail: rmh244@cornell.edu [School of Applied and Engineering Physics and Kavli Institute at Cornell for Nanoscale Science, Cornell University, Ithaca, NY 14853 (United States); Ercius, Peter [National Center for Electron Microscopy, Lawrence Berkeley National Laboratory, Berkeley, CA 94720 (United States); Jiang, Yi [Department of Physics, Cornell University, Ithaca, NY 14853 (United States); Wang, Deli; Yu, Yingchao; Abruña, Héctor D. [Department of Chemistry and Chemical Biology, Cornell University, Ithaca, NY 14853 (United States); Elser, Veit [Department of Physics, Cornell University, Ithaca, NY 14853 (United States); Muller, David A. [School of Applied and Engineering Physics and Kavli Institute at Cornell for Nanoscale Science, Cornell University, Ithaca, NY 14853 (United States)

2014-05-01

To date, high-resolution (<1 nm) imaging of extended objects in three-dimensions (3D) has not been possible. A restriction known as the Crowther criterion forces a tradeoff between object size and resolution for 3D reconstructions by tomography. Further, the sub-Angstrom resolution of aberration-corrected electron microscopes is accompanied by a greatly diminished depth of field, causing regions of larger specimens (>6 nm) to appear blurred or missing. Here we demonstrate a three-dimensional imaging method that overcomes both these limits by combining through-focal depth sectioning and traditional tilt-series tomography to reconstruct extended objects, with high-resolution, in all three dimensions. The large convergence angle in aberration corrected instruments now becomes a benefit and not a hindrance to higher quality reconstructions. A through-focal reconstruction over a 390 nm 3D carbon support containing over 100 dealloyed and nanoporous PtCu catalyst particles revealed with sub-nanometer detail the extensive and connected interior pore structure that is created by the dealloying instability. - Highlights: • Develop tomography technique for high-resolution and large field of view. • We combine depth sectioning with traditional tilt tomography. • Through-focal tomography reduces tilts and improves resolution. • Through-focal tomography overcomes the fundamental Crowther limit. • Aberration-corrected becomes a benefit and not a hindrance for tomography.

The crossover between tunnel and hopping conductivity in granulated films of noble metals

Science.gov (United States)

Kavokin, Alexey; Kutrovskaya, Stella; Kucherik, Alexey; Osipov, Anton; Vartanyan, Tigran; Arakelyan, Sergey

2017-11-01

The conductivity of thin films composed by clusters of gold and silver nanoparticles has been studies in a wide range of temperatures. The switch from a temperature independence to an exponential thermal dependence of the conductivity manifests the crossover between the tunnel and thermally activated hopping regimes of the electronic transport at the temperature of 60 °C. The characteristic thermal activation energy that governs hopping of electrons between nanoparticles is estimated as 1.3 eV. We have achieved a good control of the composition and thicknesses of nano-cluster films by use of the laser ablation method in colloidal solutions.

DETERMINATION OF CLINICALLY RELEVANT DIFFERENCES IN FRONTAL PLANE HOP TESTS IN WOMEN'S COLLEGIATE BASKETBALL AND SOCCER PLAYERS

Science.gov (United States)

Hardesty, Kelly; Hegedus, Eric J.; Ford, Kevin R.; Nguyen, Anh‐Dung

2017-01-01

Background ACL injury prevention programs are less successful in female basketball players than in soccer players. Previous authors have identified anthropometric and biomechanical differences between the athletes and different sport‐specific demands, including a higher frequency of frontal plane activities in basketball. Current injury risk screening and preventive training practices do not place a strong emphasis on frontal plane activities. The medial and lateral triple hop for distance tests may be beneficial for use in the basketball population. Hypothesis/Purpose To 1) establish normative values for the medial and lateral triple hop tests in healthy female collegiate athletes, and 2) analyze differences in test scores between female basketball and soccer players. It was hypothesized that due to the frequent frontal plane demands of their sport, basketball players would exhibit greater performance during these frontal plane performance tests. Study Design Cross‐sectional. Methods Thirty‐two NCAA Division‐1 female athletes (20 soccer, 12 basketball) performed three trials each of a medial and lateral triple hop for distance test. Distances were normalized to height and mass in order to account for anthropometric differences. Repeated measures ANOVAs were performed to identify statistically significant main effects of sport (basketball vs. soccer), and side (right vs. left), and sport x side interactions. Results After accounting for anthropometric differences, soccer players exhibited significantly better performance than basketball players in the medial and lateral triple hop tests (p jumped farther on their left (400.3 ± 41.5 cm) than right (387.9 ± 43.4 cm) limbs, but no side differences were identified in the lateral triple hop. No significant side x sport interactions were identified. Conclusions Women's basketball players exhibit decreased performance of frontal plane hop tests when compared to women's soccer players. Additionally

Uudised : Ooper. Hip-hop. Madonna

Index Scriptorium Estoniae

2005-01-01

Rumeenia sopran Nelly Miricioiu Vincenzo Bellini ooperi "Norma" nimiosas Nederlandse Operas Amsaterdamis 7.-28. märtsini. 4. märtsil Tallinna klubis Hollywood üritusel "Hip-Hop Café" New Yorgi duo Camp Lo. Ameerika poplaulja Madonna võttis vastu filmirolli

3D modeling based on CityEngine

Science.gov (United States)

Jia, Guangyin; Liao, Kaiju

2017-03-01

Currently, there are many 3D modeling softwares, like 3DMAX, AUTOCAD, and more populous BIM softwares represented by REVIT. CityEngine modeling software introduced in this paper can fully utilize the existing GIS data and combine other built models to make 3D modeling on internal and external part of buildings in a rapid and batch manner, so as to improve the 3D modeling efficiency.

Teaching Controversal Topics in Contemporary German Culture through Hip-Hop

Science.gov (United States)

Putnam, Michael

2006-01-01

This article discusses the rich cultural resources embedded with German hip-hop music and its potential impact on the foreign language classroom. In particular, this article suggests methods and materials for integrating German hip-hop music in the discussion of recent controversial cultural events and attitudes in German after the "Wende."

Membrane-bound ATPase contributes to hop resistance of Lactobacillus brevis

NARCIS (Netherlands)

Sakamoto, K; van Veen, HW; Saito, H; Kobayashi, H; Konings, WN

2002-01-01

The activity of the membrane-bound H+-ATPase of the beer spoilage bacterium Lactobacillus brevis ABBC45 increased upon adaptation to bacteriostatic hop compounds. The ATPase activity was optimal around pH 5.6 and increased up to fourfold when L. brevis was exposed to 666 muM hop compounds. The

Within-field distribution of the damson-hop aphid Phorodon humuli (Schrank) (Hemiptera: Aphididae) and natural enemies on hops in Spain

Energy Technology Data Exchange (ETDEWEB)

Lorenzana, A.; Hermoso de Mendoza, A.; Seco, V.; Campelo, P.; Casquero, P.A.

2017-07-01

A field trial was performed in a hop yard throughout 2002, 2003 and 2004 in order to determine the within-field distribution of Phorodon humuli (Schrank) (Hemiptera: Aphididae) and its natural enemies. The distribution of P. humuli was directly affected by the position of the hop plants in the garden, with significantly higher concentrations of aphids (p=0.0122 in 2002 and p=0.0006 in 2003) observed along the edge. However, in 2004 the plants located on the marginal plots had similar populations to those on the more inner plots. This can be explained by a higher wind speed which made it more difficult to land on edge plants first. The hop aphid’s main natural enemy was Coccinella septempunctata (Coleoptera: Coccinellidae), whose population was greatest where the aphids were most abundant with a significantly greater number of eggs (p=0.0230) and adults (p=0.0245) in 2003. Lacewing eggs were also frequently observed, with a significantly higher population (p=0.0221 in 2003 and p=0.0046 in 2004) where the aphid numbers were high. The number of winged aphids was greatest towards the margins of the garden in 2003. It is argued that the spatial distribution of the hop aphid and its natural enemies could be used to plan a sampling program and to estimate the population densities of these insects for use in integrated pest management programs.

Within-field distribution of the damson-hop aphid Phorodon humuli (Schrank) (Hemiptera: Aphididae) and natural enemies on hops in Spain

International Nuclear Information System (INIS)

Lorenzana, A.; Hermoso de Mendoza, A.; Seco, V.; Campelo, P.; Casquero, P.A.

2017-01-01

A field trial was performed in a hop yard throughout 2002, 2003 and 2004 in order to determine the within-field distribution of Phorodon humuli (Schrank) (Hemiptera: Aphididae) and its natural enemies. The distribution of P. humuli was directly affected by the position of the hop plants in the garden, with significantly higher concentrations of aphids (p=0.0122 in 2002 and p=0.0006 in 2003) observed along the edge. However, in 2004 the plants located on the marginal plots had similar populations to those on the more inner plots. This can be explained by a higher wind speed which made it more difficult to land on edge plants first. The hop aphid’s main natural enemy was Coccinella septempunctata (Coleoptera: Coccinellidae), whose population was greatest where the aphids were most abundant with a significantly greater number of eggs (p=0.0230) and adults (p=0.0245) in 2003. Lacewing eggs were also frequently observed, with a significantly higher population (p=0.0221 in 2003 and p=0.0046 in 2004) where the aphid numbers were high. The number of winged aphids was greatest towards the margins of the garden in 2003. It is argued that the spatial distribution of the hop aphid and its natural enemies could be used to plan a sampling program and to estimate the population densities of these insects for use in integrated pest management programs.

Hopping and band mobilities of pentacene, rubrene, and 2,7-dioctyl[1]benzothieno[3,2-b][1]benzothiophene (C8-BTBT) from first principle calculations.

Science.gov (United States)

Kobayashi, Hajime; Kobayashi, Norihito; Hosoi, Shizuka; Koshitani, Naoki; Murakami, Daisuke; Shirasawa, Raku; Kudo, Yoshihiro; Hobara, Daisuke; Tokita, Yuichi; Itabashi, Masao

2013-07-07

Hopping and band mobilities of holes in organic semiconductors at room temperature were estimated from first principle calculations. Relaxation times of charge carriers were evaluated using the acoustic deformation potential model. It is found that van der Waals interactions play an important role in determining accurate relaxation times. The hopping mobilities of pentacene, rubrene, and 2,7-dioctyl[1]benzothieno[3,2-b][1]benzothiophene (C8-BTBT) in bulk single crystalline structures were found to be smaller than 4 cm(2)∕Vs, whereas the band mobilities were estimated between 36 and 58 cm(2)∕Vs, which are close to the maximum reported experimental values. This strongly suggests that band conductivity is dominant in these materials even at room temperature.

In situ repair of bone and cartilage defects using 3D scanning and 3D printing.

Science.gov (United States)

Li, Lan; Yu, Fei; Shi, Jianping; Shen, Sheng; Teng, Huajian; Yang, Jiquan; Wang, Xingsong; Jiang, Qing

2017-08-25

Three-dimensional (3D) printing is a rapidly emerging technology that promises to transform tissue engineering into a commercially successful biomedical industry. However, the use of robotic bioprinters alone is not sufficient for disease treatment. This study aimed to report the combined application of 3D scanning and 3D printing for treating bone and cartilage defects. Three different kinds of defect models were created to mimic three orthopedic diseases: large segmental defects of long bones, free-form fracture of femoral condyle, and International Cartilage Repair Society grade IV chondral lesion. Feasibility of in situ 3D bioprinting for these diseases was explored. The 3D digital models of samples with defects and corresponding healthy parts were obtained using high-resolution 3D scanning. The Boolean operation was used to achieve the shape of the defects, and then the target geometries were imported in a 3D bioprinter. Two kinds of photopolymerized hydrogels were synthesized as bioinks. Finally, the defects of bone and cartilage were restored perfectly in situ using 3D bioprinting. The results of this study suggested that 3D scanning and 3D bioprinting could provide another strategy for tissue engineering and regenerative medicine.

Research on Improved DV-HOP Algorithm against Wormhole Attacks in WSN

Directory of Open Access Journals (Sweden)

Wang Xue-Wen

2016-01-01

Full Text Available The secure location of node is significant in the WSN (Wireless Sensor Networks of the troop frontier defence system. The wormhole attack is a big threat in the secure location. The credibility of the beacon node was used to determine the malicious nodes produced by wormhole attack in the WSN. The estimated method of multibeacon nodes was adopted to improve DV-HOP algorithm after excluding the malicious nodes. In this paper, we compared the basic DV-HOP algorithm and the improved DV-HOP algorithm in the coverage percentage and the error of network localization by simulating. The simulation results indicate that the improved DV-HOP algorithm makes the localization coverage percentage can reach 90% on a certain scale of the network, and it makes the error percentage lower when the number of beacons is different.

Fabrication of scalable tissue engineering scaffolds with dual-pore microarchitecture by combining 3D printing and particle leaching

Energy Technology Data Exchange (ETDEWEB)

Mohanty, Soumyaranjan; Sanger, Kuldeep; Heiskanen, Arto [DTU Nanotech, Department of Micro- and Nanotechnology, Technical University of Denmark, Ørsteds Plads, DK-2800 Kgs. Lyngby (Denmark); Trifol, Jon; Szabo, Peter [Danish Polymer Centre, Department of Chemical and Biochemical Engineering, Søltofts Plads, Building 229, DK-2800 Kgs. Lyngby (Denmark); Dufva, Marin; Emnéus, Jenny [DTU Nanotech, Department of Micro- and Nanotechnology, Technical University of Denmark, Ørsteds Plads, DK-2800 Kgs. Lyngby (Denmark); Wolff, Anders, E-mail: anders.wolff@nanotech.dtu.dk [DTU Nanotech, Department of Micro- and Nanotechnology, Technical University of Denmark, Ørsteds Plads, DK-2800 Kgs. Lyngby (Denmark)

2016-04-01

Limitations in controlling scaffold architecture using traditional fabrication techniques are a problem when constructing engineered tissues/organs. Recently, integration of two pore architectures to generate dual-pore scaffolds with tailored physical properties has attracted wide attention in tissue engineering community. Such scaffolds features primary structured pores which can efficiently enhance nutrient/oxygen supply to the surrounding, in combination with secondary random pores, which give high surface area for cell adhesion and proliferation. Here, we present a new technique to fabricate dual-pore scaffolds for various tissue engineering applications where 3D printing of poly(vinyl alcohol) (PVA) mould is combined with salt leaching process. In this technique the sacrificial PVA mould, determining the structured pore architecture, was filled with salt crystals to define the random pore regions of the scaffold. After crosslinking the casted polymer the combined PVA-salt mould was dissolved in water. The technique has advantages over previously reported ones, such as automated assembly of the sacrificial mould, and precise control over pore architecture/dimensions by 3D printing parameters. In this study, polydimethylsiloxane and biodegradable poly(ϵ-caprolactone) were used for fabrication. However, we show that this technique is also suitable for other biocompatible/biodegradable polymers. Various physical and mechanical properties of the dual-pore scaffolds were compared with control scaffolds with either only structured or only random pores, fabricated using previously reported methods. The fabricated dual-pore scaffolds supported high cell density, due to the random pores, in combination with uniform cell distribution throughout the scaffold, and higher cell proliferation and viability due to efficient nutrient/oxygen transport through the structured pores. In conclusion, the described fabrication technique is rapid, inexpensive, scalable, and compatible

Fabrication of scalable tissue engineering scaffolds with dual-pore microarchitecture by combining 3D printing and particle leaching

International Nuclear Information System (INIS)

Mohanty, Soumyaranjan; Sanger, Kuldeep; Heiskanen, Arto; Trifol, Jon; Szabo, Peter; Dufva, Marin; Emnéus, Jenny; Wolff, Anders

2016-01-01

Limitations in controlling scaffold architecture using traditional fabrication techniques are a problem when constructing engineered tissues/organs. Recently, integration of two pore architectures to generate dual-pore scaffolds with tailored physical properties has attracted wide attention in tissue engineering community. Such scaffolds features primary structured pores which can efficiently enhance nutrient/oxygen supply to the surrounding, in combination with secondary random pores, which give high surface area for cell adhesion and proliferation. Here, we present a new technique to fabricate dual-pore scaffolds for various tissue engineering applications where 3D printing of poly(vinyl alcohol) (PVA) mould is combined with salt leaching process. In this technique the sacrificial PVA mould, determining the structured pore architecture, was filled with salt crystals to define the random pore regions of the scaffold. After crosslinking the casted polymer the combined PVA-salt mould was dissolved in water. The technique has advantages over previously reported ones, such as automated assembly of the sacrificial mould, and precise control over pore architecture/dimensions by 3D printing parameters. In this study, polydimethylsiloxane and biodegradable poly(ϵ-caprolactone) were used for fabrication. However, we show that this technique is also suitable for other biocompatible/biodegradable polymers. Various physical and mechanical properties of the dual-pore scaffolds were compared with control scaffolds with either only structured or only random pores, fabricated using previously reported methods. The fabricated dual-pore scaffolds supported high cell density, due to the random pores, in combination with uniform cell distribution throughout the scaffold, and higher cell proliferation and viability due to efficient nutrient/oxygen transport through the structured pores. In conclusion, the described fabrication technique is rapid, inexpensive, scalable, and compatible

MAP3D: a media processor approach for high-end 3D graphics

Science.gov (United States)

Darsa, Lucia; Stadnicki, Steven; Basoglu, Chris

1999-12-01

Equator Technologies, Inc. has used a software-first approach to produce several programmable and advanced VLIW processor architectures that have the flexibility to run both traditional systems tasks and an array of media-rich applications. For example, Equator's MAP1000A is the world's fastest single-chip programmable signal and image processor targeted for digital consumer and office automation markets. The Equator MAP3D is a proposal for the architecture of the next generation of the Equator MAP family. The MAP3D is designed to achieve high-end 3D performance and a variety of customizable special effects by combining special graphics features with high performance floating-point and media processor architecture. As a programmable media processor, it offers the advantages of a completely configurable 3D pipeline--allowing developers to experiment with different algorithms and to tailor their pipeline to achieve the highest performance for a particular application. With the support of Equator's advanced C compiler and toolkit, MAP3D programs can be written in a high-level language. This allows the compiler to successfully find and exploit any parallelism in a programmer's code, thus decreasing the time to market of a given applications. The ability to run an operating system makes it possible to run concurrent applications in the MAP3D chip, such as video decoding while executing the 3D pipelines, so that integration of applications is easily achieved--using real-time decoded imagery for texturing 3D objects, for instance. This novel architecture enables an affordable, integrated solution for high performance 3D graphics.

Affiliation and Alienation: Hip-Hop, Rap, and Urban Science Education

Science.gov (United States)

Emdin, Christopher

2010-01-01

The critiques of rap artists and other participants in hip-hop culture provide data for teachers and researchers to investigate the attitudes of US urban youth towards schooling. This study explores the complex relationships between hip-hop and science education by examining how rap lyrics project beliefs about schooling, the relevance of existing…

Comparison of post-contrast 3D-T1-MPRAGE, 3D-T1-SPACE and 3D-T2-FLAIR MR images in evaluation of meningeal abnormalities at 3-T MRI.

Science.gov (United States)

Jeevanandham, Balaji; Kalyanpur, Tejas; Gupta, Prashant; Cherian, Mathew

2017-06-01

This study was to assess the usefulness of newer three-dimensional (3D)-T 1 sampling perfection with application optimized contrast using different flip-angle evolutions (SPACE) and 3D-T 2 fluid-attenuated inversion recovery (FLAIR) sequences in evaluation of meningeal abnormalities. 78 patients who presented with high suspicion of meningeal abnormalities were evaluated using post-contrast 3D-T 2 -FLAIR, 3D-T 1 magnetization-prepared rapid gradient-echo (MPRAGE) and 3D-T 1 -SPACE sequences. The images were evaluated independently by two radiologists for cortical gyral, sulcal space, basal cisterns and dural enhancement. The diagnoses were confirmed by further investigations including histopathology. Post-contrast 3D-T 1 -SPACE and 3D-T 2 -FLAIR images yielded significantly more information than MPRAGE images (p evaluation of meningeal abnormalities and when used in combination have the maximum sensitivity for leptomeningeal abnormalities. The negative-predictive value is nearly 100%, where no leptomeningeal abnormality was detected on these sequences. Advances in knowledge: Post-contrast 3D-T 1 -SPACE and 3D-T 2 -FLAIR images are more useful than 3D-T 1 -MPRAGE images in evaluation of meningeal abnormalities.

Slopes, nearly constant loss, universality, and hopping rates for dispersive ionic conduction

International Nuclear Information System (INIS)

Macdonald, J Ross; Ahmad, Mohamad M

2007-01-01

The title topics are investigated, discussed, and new insights provided by considering isothermal frequency response data for seven different materials having quite different conductivity spans and involving different electrode polarization effects and temperatures. These data sets were fitted using several different models, including the Kohlrausch-related K0 and K1 ones derived from stretched-exponential response in the temporal domain. The quasi-universal UN model, the K1 with its shape parameter, β 1 , fixed at 1/3, fitted most of the data very well, and its fits of such data were used to compare its predictions for hopping rate with those derived from fitting with the conventional 'universal dynamic response' Almond-West real-part-of-conductivity model. The K1-model theoretical hopping rate, involving the mean waiting time for a hop and derived from microscopic stochastic analysis, was roughly twice as large as the empirical Almond-West rate for most of the materials considered and should be used in place of it. Its use in a generalized Nernst-Einstein equation led to comparison of estimates of the concentration of fully dissociated mobile charge carriers in superionic PbSnF 4 with earlier estimates of Ahmad using an Almond-West hopping rate value. Agreement with an independent structure-derived value was relatively poor. Fitting results obtained using the K0 model, for Na 2 SO 4 data sets for two different polycrystalline material phases, and involving severely limited conductivity variation, were far superior to those obtained using the K1 model. The estimated values of the K0 shape parameter, β 0 , were close to 1/3 for both phases, strongly suggesting that the charge motion was one dimensional for each phase, even though they involved different crystalline structures

Hybrid 3D-2D printing for bone scaffolds fabrication

Science.gov (United States)

Seleznev, V. A.; Prinz, V. Ya

2017-02-01

It is a well-known fact that bone scaffold topography on micro- and nanometer scale influences the cellular behavior. Nano-scale surface modification of scaffolds allows the modulation of biological activity for enhanced cell differentiation. To date, there has been only a limited success in printing scaffolds with micro- and nano-scale features exposed on the surface. To improve on the currently available imperfect technologies, in our paper we introduce new hybrid technologies based on a combination of 2D (nano imprint) and 3D printing methods. The first method is based on using light projection 3D printing and simultaneous 2D nanostructuring of each of the layers during the formation of the 3D structure. The second method is based on the sequential integration of preliminarily created 2D nanostructured films into a 3D printed structure. The capabilities of the developed hybrid technologies are demonstrated with the example of forming 3D bone scaffolds. The proposed technologies can be used to fabricate complex 3D micro- and nanostructured products for various fields.

RNAi knockdown of Hop (Hsp70/Hsp90 organising protein) decreases invasion via MMP-2 down regulation.

LENUS (Irish Health Repository)

Walsh, Naomi

2011-07-28

We previously identified Hop as over expressed in invasive pancreatic cancer cell lines and malignant tissues of pancreatic cancer patients, suggesting an important role for Hop in the biology of invasive pancreatic cancer. Hop is a co-chaperone protein that binds to both Hsp70\\/Hsp90. We hypothesised that by targeting Hop, signalling pathways modulating invasion and client protein stabilisation involving Hsp90-dependent complexes may be altered. In this study, we show that Hop knockdown by small interfering (si)RNA reduces the invasion of pancreatic cancer cells, resulting in decreased expression of the downstream target gene, matrix metalloproteinases-2 (MMP-2). Hop in conditioned media co-immunoprecipitates with MMP-2, implicating a possible extracellular function for Hop. Knockdown of Hop expression also reduced expression levels of Hsp90 client proteins, HER2, Bcr-Abl, c-MET and v-Src. Furthermore, Hop is strongly expressed in high grade PanINs compared to lower PanIN grades, displaying differential localisation in invasive ductal pancreatic cancer, indicating that the localisation of Hop is an important factor in pancreatic tumours. Our data suggests that the attenuation of Hop expression inactivates key signal transduction proteins which may decrease the invasiveness of pancreatic cancer cells possibly through the modulation of Hsp90 activity. Therefore, targeting Hop in pancreatic cancer may constitute a viable strategy for targeted cancer therapy.

Post-Menopausal Vaginal Hemorrhage Related to the Use of a Hop-Containing Phytotherapeutic Product

NARCIS (Netherlands)

van Hunsel, Florence; van de Koppel, Sonja; van Puijenbroek, Eugène

2015-01-01

Two 54-year-old women developed abdominal cramps and vaginal hemorrhage as a result of endometrial hyperplasia during treatment with a hop-containing phytotherapeutic product (MenoCool®) for post-menopausal complaints. The women used the hop-containing phytotherapeutic product (418 mg of hop per

Two Hop Adaptive Vector Based Quality Forwarding for Void Hole Avoidance in Underwater WSNs.

Science.gov (United States)

Javaid, Nadeem; Ahmed, Farwa; Wadud, Zahid; Alrajeh, Nabil; Alabed, Mohamad Souheil; Ilahi, Manzoor

2017-08-01

Underwater wireless sensor networks (UWSNs) facilitate a wide range of aquatic applications in various domains. However, the harsh underwater environment poses challenges like low bandwidth, long propagation delay, high bit error rate, high deployment cost, irregular topological structure, etc. Node mobility and the uneven distribution of sensor nodes create void holes in UWSNs. Void hole creation has become a critical issue in UWSNs, as it severely affects the network performance. Avoiding void hole creation benefits better coverage over an area, less energy consumption in the network and high throughput. For this purpose, minimization of void hole probability particularly in local sparse regions is focused on in this paper. The two-hop adaptive hop by hop vector-based forwarding (2hop-AHH-VBF) protocol aims to avoid the void hole with the help of two-hop neighbor node information. The other protocol, quality forwarding adaptive hop by hop vector-based forwarding (QF-AHH-VBF), selects an optimal forwarder based on the composite priority function. QF-AHH-VBF improves network good-put because of optimal forwarder selection. QF-AHH-VBF aims to reduce void hole probability by optimally selecting next hop forwarders. To attain better network performance, mathematical problem formulation based on linear programming is performed. Simulation results show that by opting these mechanisms, significant reduction in end-to-end delay and better throughput are achieved in the network.

Acoustic position finding of partial discharges in transformers. Combination of partial discharge measurement technology with 3D visualization; Akustische Ortung von Teilentladungen in Transformatoren. TE-Messtechnik und 3-D-Visualisierung kombiniert

Energy Technology Data Exchange (ETDEWEB)

Kraetge, Alexander; Hoek, Stefan [Omicron Electronics GmbH, Klaus (Austria)

2013-11-01

A new measuring system facilitates the detection of partial discharges in transformers by means of the fully synchronous combination of measurement technology for electrical partial discharges with intuitive 3D visualization of the test object. The contribution under consideration describes the application of this system with examples from the measurement practice.

See-through 3D technology for augmented reality

Science.gov (United States)

Lee, Byoungho; Lee, Seungjae; Li, Gang; Jang, Changwon; Hong, Jong-Young

2017-06-01

Augmented reality is recently attracting a lot of attention as one of the most spotlighted next-generation technologies. In order to get toward realization of ideal augmented reality, we need to integrate 3D virtual information into real world. This integration should not be noticed by users blurring the boundary between the virtual and real worlds. Thus, ultimate device for augmented reality can reconstruct and superimpose 3D virtual information on the real world so that they are not distinguishable, which is referred to as see-through 3D technology. Here, we introduce our previous researches to combine see-through displays and 3D technologies using emerging optical combiners: holographic optical elements and index matched optical elements. Holographic optical elements are volume gratings that have angular and wavelength selectivity. Index matched optical elements are partially reflective elements using a compensation element for index matching. Using these optical combiners, we could implement see-through 3D displays based on typical methodologies including integral imaging, digital holographic displays, multi-layer displays, and retinal projection. Some of these methods are expected to be optimized and customized for head-mounted or wearable displays. We conclude with demonstration and analysis of fundamental researches for head-mounted see-through 3D displays.

Sequence analyses reveal that a TPR-DP module, surrounded by recombinable flanking introns, could be at the origin of eukaryotic Hop and Hip TPR-DP domains and prokaryotic GerD proteins.

Science.gov (United States)

Hernández Torres, Jorge; Papandreou, Nikolaos; Chomilier, Jacques

2009-05-01

The co-chaperone Hop [heat shock protein (HSP) organising protein] is known to bind both Hsp70 and Hsp90. Hop comprises three repeats of a tetratricopeptide repeat (TPR) domain, each consisting of three TPR motifs. The first and last TPR domains are followed by a domain containing several dipeptide (DP) repeats called the DP domain. These analyses suggest that the hop genes result from successive recombination events of an ancestral TPR-DP module. From a hydrophobic cluster analysis of homologous Hop protein sequences derived from gene families, we can postulate that shifts in the open reading frames are at the origin of the present sequences. Moreover, these shifts can be related to the presence or absence of biological function. We propose to extend the family of Hop co-chaperons into the kingdom of bacteria, as several structurally related genes have been identified by hydrophobic cluster analysis. We also provide evidence of common structural characteristics between hop and hip genes, suggesting a shared precursor of ancestral TPR-DP domains.

Programming 2D/3D shape-shifting with hobbyist 3D printers† †Electronic supplementary information (ESI) available. See DOI: 10.1039/c7mh00269f

Science.gov (United States)

van Manen, Teunis; Janbaz, Shahram

2017-01-01

Materials and devices with advanced functionalities often need to combine complex 3D shapes with functionality-inducing surface features. Precisely controlled bio-nanopatterns, printed electronic components, and sensors/actuators are all examples of such surface features. However, the vast majority of the refined technologies that are currently available for creating functional surface features work only on flat surfaces. Here we present initially flat constructs that upon triggering by high temperatures change their shape to a pre-programmed 3D shape, thereby enabling the combination of surface-related functionalities with complex 3D shapes. A number of shape-shifting materials have been proposed during the last few years based on various types of advanced technologies. The proposed techniques often require multiple fabrication steps and special materials, while being limited in terms of the 3D shapes they could achieve. The approach presented here is a single-step printing process that requires only a hobbyist 3D printer and inexpensive off-the-shelf materials. It also lends itself to a host of design strategies based on self-folding origami, instability-driven pop-up, and ‘sequential’ shape-shifting to unprecedentedly expand the space of achievable 3D shapes. This combination of simplicity and versatility is a key to widespread applications. PMID:29308207

Hip-Hop Is the Healer: Sense of Belonging and Diversity among Hip-Hop Collegians

Science.gov (United States)

Sulé, V. Thandi

2016-01-01

Sense of belonging is recognized as a factor contributing to persistence to graduation. Furthermore, interactional diversity is associated with learning and civic outcomes--touted higher education goals. Hip-hop culture, one of the most influential cultural creations of the mid-20th century, has succeeded in attracting devotees from diverse…

Towards a Pedagogy of Hip Hop in Urban Teacher Education

Science.gov (United States)

Bridges, Thurman

2011-01-01

This article draws from a qualitative study often Black male K-12 teachers from the Hip Hop Generation who are closely connected to Hip Hop culture and have been effective in addressing the academic and social needs of Black boys. Through an analysis of their social, educational and cultural experiences, this article highlights three organizing…

Gastrocnemius fascicle and achilles tendon length at the end of the eccentric phase in a single and multiple countermovement hop.

Science.gov (United States)

Lidstone, Daniel E; van Werkhoven, Herman; Needle, Alan R; Rice, Paige E; McBride, Jeffrey M

2018-02-01

The purpose of this investigation was to compare fascicle and tendon length of the gastrocnemius at the end of the eccentric phase during a hop utilizing a single countermovement (sCM) versus multiple countermovement (mCM1, mCM2, mCM3) strategy. Seventeen healthy males performed nine hopping trials of sCM and nine trials of mCM. Ankle and knee joint angle and lower leg length from videography and muscle ultrasound were used to calculate muscle-tendon unit (MTU), fascicle and tendon length. Sacral marker data was used to determine hopping height. Force- and displacement-time curves were utilized to calculate work. Muscle activity of the lateral and medial gastrocnemius was also measured. Fascicle length was significantly shorter (mCM3: 6.2 ± 1.5 cm, sCM: 7.3 ± 2.0 cm) and tendon length was significantly longer (mCM3: 36.5 ± 3.6 cm, sCM: 35.5 ± 3.8 cm) at the end of the eccentric phase in mCM3 in comparison to sCM. Maximal hopping height (mCM: 14.6 ± 3.1 cm, sCM: 13.1 ± 2.5 cm), eccentric phase gastrocnemius muscle activity (mCM medial gastrocnemius: 0.10 ± 0.03 mV, mCM lateral gastrocnemius: 0.08 ± 0.04 mV, sCM medial gastrocnemius: 0.07 ± 0.03 mV, sCM lateral gastrocnemius: 0.05 ± 0.04 mV), and both eccentric (mCM3: 46.6 ± 19.4 J, sCM: 38.5 ± 15.9 J) and concentric work (mCM3: 87.6 ± 26.5 J, sCM: 80.9 ± 27.6 J) were significantly higher for mCM3 compared to sCM. The results indicate that a multiple countermovement hop strategy results in shorter fascicle length and longer tendon length at the end of the eccentric phase. In addition, greater eccentric phase muscle activity during the third countermovement (mCM3) in comparison to a single countermovement hop (sCM) was observed. A multiple countermovement strategy appears to result in higher hopping height and greater work done in both the eccentric and concentric phase indicating possible contribution of stored

Hip-Hop Pop Art

Science.gov (United States)

Talley, Clarence, Sr.

2011-01-01

Art has a way of helping students better understand and appreciate the world around them, particularly the things that are most important to them. Hip hop is one of those generational genres that capture the attention of young students like few other things do. Drawing on this genre to get students to create art is an excellent way to demonstrate…

A Stochastic Geometry Model for Multi-hop Highway Vehicular Communication

KAUST Repository

Farooq, Muhammad Junaid

2015-11-19

Carrier sense multiple access (CSMA) protocol is standardized for vehicular communication to ensure a distributed and efficient communication between vehicles. However, several vehicular applications require efficient multi-hop information dissemination. This paper exploits stochastic geometry to develop a tractable and accurate modeling framework to characterize the multi-hop transmissions for vehicular networks in a multi-lane highway setup. In particular, we study the tradeoffs between per-hop packet forward progress, per-hop transmission success probability, and spatial frequency reuse (SFR) efficiency imposed by different packet forwarding schemes, namely, most forward with fixed radius (MFR), the nearest with forward progress (NFP), and the random with forward progress (RFP). We also define a new performance metric, denoted as the aggregate packet progress (APP), which is a dimensionless quantity that captures the aforementioned tradeoffs. To this end, the developed model reveals the interplay between the spectrum sensing threshold (th) of the CSMA protocol and the packet forwarding scheme. Our results show that, in contrary to ALOHA networks which always favor NFP, MFR may achieve the highest APP in CSMA networks if th is properly chosen.

Risk Assessment Using The Homeland-Defense Operational Planning System (HOPS)

International Nuclear Information System (INIS)

Price, D E; Durling, R L

2005-01-01

The Homeland-Defense Operational Planning System (HOPS), is a new operational planning tool leveraging Lawrence Livermore National Laboratory's expertise in weapons systems and in sparse information analysis to support the defense of the U.S. homeland. HOPS provides planners with a basis to make decisions to protect against acts of terrorism, focusing on the defense of facilities critical to U.S. infrastructure. Criticality of facilities, structures, and systems is evaluated on a composite matrix of specific projected casualty, economic, and sociopolitical impact bins. Based on these criteria, significant unidentified vulnerabilities are identified and secured. To provide insight into potential successes by malevolent actors, HOPS analysts strive to base their efforts mainly on unclassified open-source data. However, more cooperation is needed between HOPS analysts and facility representatives to provide an advantage to those whose task is to defend these facilities. Evaluated facilities include: refineries, major ports, nuclear power plants and other nuclear licensees, dams, government installations, convention centers, sports stadiums, tourist venues, and public and freight transportation systems. A generalized summary of analyses of U.S. infrastructure facilities will be presented

Beats, Rhymes, and Classroom Life: Hip-Hop Pedagogy and the Politics of Identity

Science.gov (United States)

Hill, Marc Lamont

2009-01-01

For over a decade, educators have looked to capitalize on the appeal of hip-hop culture, sampling its language, techniques, and styles as a way of reaching out to students. But beyond a fashionable hipness, what does hip-hop have to offer our schools? In this revelatory new book, Marc Lamont Hill shows how a serious engagement with hip-hop culture…

Hip-hop, Onegin - pop! / Tatjana Aleksandrova

Index Scriptorium Estoniae

Aleksandrova, Tatjana, 1945-

2004-01-01

Erateatrikooli KS, mida juhib Svetlana Krassman, lavastus A. Pushkini poeemi "Jevgeni Onegin" motiividel. Noortelavastuse muusikalises seades kasutatakse klassikalise muusika aranzheeringuid ja räppi, kostüümidraamat koos hip-hop rõivastiiliga

Development of aromatic hop compounds and bitterness in beer during room temperature- and cold storage based on three different hopping methods

OpenAIRE

Torgals, Ann Elisabeth

2015-01-01

The main objective of this study was to determine whether storage temperature or hopping method had influence on the aroma and bitterness in beer. The focus was set on the aroma that comes from hops, and not from yeast. The secondary objective to this study was to explore the development of the alcohol, CO2 and bitterness in the beer after priming and bottling. The thesis’ main perspective is that of home brewers, and to some extent that of microbreweries. Beer was brewed with 100 % pilsn...

Composites of 3D-Printed Polymers and Textile Fabrics*

Science.gov (United States)

Martens, Yasmin; Ehrmann, Andrea

2017-08-01

3D printing belongs to the rapidly emerging technologies of our time. Due to its recent drawback - the technology is relatively slow compared with other primary shaping methods, such as injection molding -, 3D printing is often not used for creating complete large components but to add specific features to existing larger objects. One of the possibilities to create such composites with an additional value consists in combining 3D printed polymers with textile fabrics. Several attempts have been made to enhance the adhesion between both materials, a task which is still challenging for diverse material combinations. Our paper reports about new experiments combining 3D printed embossed designs, snap fasteners and zip fasteners with different textile base materials, showing the possibilities and technical limits of these novel composites.

Multi-hop localization algorithm based on grid-scanning for wireless sensor networks.

Science.gov (United States)

Wan, Jiangwen; Guo, Xiaolei; Yu, Ning; Wu, Yinfeng; Feng, Renjian

2011-01-01

For large-scale wireless sensor networks (WSNs) with a minority of anchor nodes, multi-hop localization is a popular scheme for determining the geographical positions of the normal nodes. However, in practice existing multi-hop localization methods suffer from various kinds of problems, such as poor adaptability to irregular topology, high computational complexity, low positioning accuracy, etc. To address these issues in this paper, we propose a novel Multi-hop Localization algorithm based on Grid-Scanning (MLGS). First, the factors that influence the multi-hop distance estimation are studied and a more realistic multi-hop localization model is constructed. Then, the feasible regions of the normal nodes are determined according to the intersection of bounding square rings. Finally, a verifiably good approximation scheme based on grid-scanning is developed to estimate the coordinates of the normal nodes. Additionally, the positioning accuracy of the normal nodes can be improved through neighbors' collaboration. Extensive simulations are performed in isotropic and anisotropic networks. The comparisons with some typical algorithms of node localization confirm the effectiveness and efficiency of our algorithm.

Exact Open Quantum System Dynamics Using the Hierarchy of Pure States (HOPS).

Science.gov (United States)

Hartmann, Richard; Strunz, Walter T

2017-12-12

We show that the general and numerically exact Hierarchy of Pure States method (HOPS) is very well applicable to calculate the reduced dynamics of an open quantum system. In particular, we focus on environments with a sub-Ohmic spectral density (SD) resulting in an algebraic decay of the bath correlation function (BCF). The universal applicability of HOPS, reaching from weak to strong coupling for zero and nonzero temperature, is demonstrated by solving the spin-boson model for which we find perfect agreement with other methods, each one suitable for a special regime of parameters. The challenges arising in the strong coupling regime are not only reflected in the computational effort needed for the HOPS method to converge but also in the necessity for an importance sampling mechanism, accounted for by the nonlinear variant of HOPS. In order to include nonzero-temperature effects in the strong coupling regime we found that it is highly favorable for the HOPS method to use the zero-temperature BCF and include temperature via a stochastic Hermitian contribution to the system Hamiltonian.

Study on aggregation and electric properties in the micro-region of functionalized dithieno[2, 3-b: 3′, 2′-d]thiophene (DTT) oligomers

Energy Technology Data Exchange (ETDEWEB)

Jiang, Xiaohong; Huang, Xiaowei; Zhang, Jiajia; Lu, Zhijuan; Wang, Hua; Du, Zuliang, E-mail: zld@henu.edu.cn [Key Laboratory for Special Functional Materials of Ministry of Education, Henan University, Kaifeng, 475004 (China)

2016-07-15

Three kinds of 2,5,-diphenyl-dithienol[2, 3-b: 3′, 2′-d]thiophene (DP-DTT), 2,5,-distyryl-dithienol[2, 3-b: 3′, 2′-d]thiophene (DEP-DTT) and 2,5,-thienyl-dithienol[2, 3-b: 3′, 2′-d]thiophene (DET-DTT) micro-region structure and electronic properties were studied. Thin films of these functionalized DTT oligomers were prepared in a one-step drop-casting deposition onto highly oriented pyrolytic graphite substrates. The surface structure of these films was characterized by atomic force microscopy (AFM). Conducting probe atomic force microscope (C-AFM) and Kelvin probe force microscope (KFM) were both used to characterize the electronic transport behavior and surface potential distribution. The substituents of DTT oligomers can greatly affect their aggregation and the hopping conductance mechanism was used to explain the Au-DTTs-HOPG junctions. KFM investigation revealed that these oligomers with different substituents have different highest occupied molecular orbital energy levels. The corresponding theoretical analysis reveals similar result to KFM characterization. The I-V results indicated that the aggregates of molecules were the dominating factor to their micro-region electrical transport.

Christian Hip Hop as Pedagogy: A South African Case Study

Science.gov (United States)

Abraham, Ibrahim

2015-01-01

Drawing on interviews with creators of Christian hip hop music in South Africa, this article demonstrates that this genre of popular music and youth culture is utilised as a form of pedagogy to transmit religious beliefs and values to contemporary youth. The pedagogical aspects of hip hop have been recognised in research on the topic, but the…

Hop acid-rich spent craft brewer's yeast modulates gut bacterial growth

Science.gov (United States)

Alpha and beta hop acids (humulones and lupulones) from Humulus lupulus are inhibitors of Gram-positive organisms and important natural antibiotics for beer fermentation and carbohydrate feed stocks for biofuel production. Recent observations (Bryant and Cohen) of high levels of hop acids in spent ...

New STS molecular markers for assessment of genetic diversity and DNA fingerprinting in hop (Humulus lupulus L.)

Czech Academy of Sciences Publication Activity Database

Patzak, J.; Vrba, Lukáš; Matoušek, Jaroslav

2007-01-01

Roč. 50, č. 1 (2007), s. 15-25 ISSN 0831-2796 R&D Projects: GA ČR GA521/03/0072 Institutional research plan: CEZ:AV0Z50510513 Keywords : hop (Humulus lupulus L.) * genetic diversity Subject RIV: EB - Genetics ; Molecular Biology Impact factor: 1.785, year: 2007

Hop limited epidemic-like information spreading in mobile social networks with selfish nodes

Science.gov (United States)

Wu, Yahui; Deng, Su; Huang, Hongbin

2013-07-01

Similar to epidemics, information can be transmitted directly among users in mobile social networks. Different from epidemics, we can control the spreading process by adjusting the corresponding parameters (e.g., hop count) directly. This paper proposes a theoretical model to evaluate the performance of an epidemic-like spreading algorithm, in which the maximal hop count of the information is limited. In addition, our model can be used to evaluate the impact of users’ selfish behavior. Simulations show the accuracy of our theoretical model. Numerical results show that the information hop count can have an important impact. In addition, the impact of selfish behavior is related to the information hop count.

Hop limited epidemic-like information spreading in mobile social networks with selfish nodes

International Nuclear Information System (INIS)

Wu, Yahui; Deng, Su; Huang, Hongbin

2013-01-01

Similar to epidemics, information can be transmitted directly among users in mobile social networks. Different from epidemics, we can control the spreading process by adjusting the corresponding parameters (e.g., hop count) directly. This paper proposes a theoretical model to evaluate the performance of an epidemic-like spreading algorithm, in which the maximal hop count of the information is limited. In addition, our model can be used to evaluate the impact of users’ selfish behavior. Simulations show the accuracy of our theoretical model. Numerical results show that the information hop count can have an important impact. In addition, the impact of selfish behavior is related to the information hop count. (paper)

3D PHOTOGRAPHS IN CULTURAL HERITAGE

Directory of Open Access Journals (Sweden)

W. Schuhr

2013-07-01

color differences. Though 3D photographs are a well established basic photographic and photogrammetric tool, they are still a matter of research and practical improvement: – For example, multistage concepts for 3D heritage photographs, e.g., combining before and aft images and images showing different focus, daytime etc., as well as combining 3D imagery of different sensors and comparing 3D imagery with drawings etc. and even standards for exposing and processing 3D heritage photographs are only some topics for recent research. – To advise on state-of-the-art 3D visualisation methodology for Cultural heritage purposes an updated synoptically overview, even claiming completeness, also will be dealt with. – 3D photographs increasingly should replace old fashioned subjective interpreted manual 2D drawings (in 2D only of heritage monuments. – Currently we are witnesses of early developments, showing Cultural Heritage objects in 3D crystal as well as in 3D printings.

Extended 3D Line Segments from RGB-D Data for Pose Estimation

DEFF Research Database (Denmark)

Buch, Anders Glent; Jessen, Jeppe Barsøe; Kraft, Dirk

2013-01-01

We propose a method for the extraction of complete and rich symbolic line segments in 3D based on RGB-D data. Edges are detected by combining cues from the RGB image and the aligned depth map. 3D line segments are then reconstructed by back-projecting 2D line segments and intersecting this with l...... this with local surface patches computed from the 3D point cloud. Different edge types are classified using the new enriched representation and the potential of this representation for the task of pose estimation is demonstrated....

Effect of rosuvastatin monotherapy and in combination with fenofibrate or omega-3 fatty acids on serum vitamin D levels.

Science.gov (United States)

Makariou, Stefania E; Liberopoulos, Evangelos N; Agouridis, Aris P; Challa, Anna; Elisaf, Moses

2012-12-01

Low levels of 25(OH) vitamin D [25(OH)VitD] have been recognized as a new cardiovascular disease (CVD) risk factor. Statins seem to increase 25(OH)VitD concentration. To investigate whether combined treatment with the usual dose of rosuvastatin plus fenofibrate or omega-3 fatty acids would increase 25(OH)VitD levels compared with the high-dose rosuvastatin monotherapy in participants with mixed dislipidemia. We randomly allocated 60 patients with mixed dyslipidemia (low-density lipoprotein cholesterol: >160 mg/dL plus triglycerides: >200 mg/dL) to receive rosuvastatin 40 mg (n = 22), rosuvastatin 10 mg plus fenofibrate 200 mg (n = 21), or rosuvastatin 10 mg plus omega-3 fatty acids 2 g (n = 17) daily for 3 months. Our primary end point was changes in the levels of serum 25(OH)VitD. Rosuvastatin monotherapy was associated with a 53% increase in 25(OH)VitD (from 14.6 [1.0-38.0] to 17.8 [5.3-49.6] ng/mL; P = .000). Rosuvastatin plus micronized fenofibrate and rosuvastatin plus omega-3 fatty acids were associated with increases of 64% (from 14.1 [1.0-48.0] to 18.4 [6.7-52.4] ng/mL, P = .001) and 61% (from 10.4 [6.6-38.4] to 14.0 [9.6-37.6] ng/mL, P = .04), respectively. The changes in 25(OH)VitD after treatment were comparable in the 3 groups. High-dose rosuvastatin monotherapy and the usual dose of rosuvastatin plus fenofibrate or omega-3 fatty acids are associated with significant and similar increases in the 25(OH)VitD levels. This increase may be relevant in terms of CVD risk prevention.

Combination of photogrammetric and geoelectric methods to assess 3d structures associated to natural hazards

Science.gov (United States)

Fargier, Yannick; Dore, Ludovic; Antoine, Raphael; Palma Lopes, Sérgio; Fauchard, Cyrille

2016-04-01

The extraction of subsurface materials is a key element for the economy of a nation. However, natural degradation of underground quarries is a major issue from an economic and public safety point of view. Consequently, the quarries stakeholders require relevant tools to define hazards associated to these structures. Safety assessment methods of underground quarries are recent and mainly based on rock physical properties. This kind of method leads to a certain homogeneity assumption of pillar internal properties that can cause an underestimation of the risk. Electrical Resistivity Imaging (ERI) is a widely used method that possesses two advantages to overcome this limitation. The first is to provide a qualitative understanding for the detection and monitoring of anomalies in the pillar body (e.g. faults). The second is to provide a quantitative description of the electrical resistivity distribution inside the pillar. This quantitative description can be interpreted with constitutive laws to help decision support (water content decreases the mechanical resistance of a chalk). However, conventional 2D and 3D Imaging techniques are usually applied to flat surface surveys or to surfaces with moderate topography. A 3D inversion of more complex media (case of the pillar) requires a full consideration of the geometry that was never taken into account before. The Photogrammetric technique presents a cost effective solution to obtain an accurate description of the external geometry of a complex media. However, this method has never been fully coupled with a geophysical method to enhance/improve the inversion process. Consequently we developed a complete procedure showing that photogrammetric and ERI tools can be efficiently combined to assess a complex 3D structure. This procedure includes in a first part a photogrammetric survey, a processing stage with an open source software and a post-processing stage finalizing a 3D surface model. The second part necessitates the

Communication: Proper treatment of classically forbidden electronic transitions significantly improves detailed balance in surface hopping

Energy Technology Data Exchange (ETDEWEB)

Sifain, Andrew E. [Department of Physics and Astronomy, University of Southern California, Los Angeles, California 90089-0485 (United States); Wang, Linjun [Department of Chemistry, Zhejiang University, Hangzhou 310027 (China); Prezhdo, Oleg V. [Department of Physics and Astronomy, University of Southern California, Los Angeles, California 90089-0485 (United States); Department of Chemistry, University of Southern California, Los Angeles, California 90089-1062 (United States)

2016-06-07

Surface hopping is the most popular method for nonadiabatic molecular dynamics. Many have reported that it does not rigorously attain detailed balance at thermal equilibrium, but does so approximately. We show that convergence to the Boltzmann populations is significantly improved when the nuclear velocity is reversed after a classically forbidden hop. The proposed prescription significantly reduces the total number of classically forbidden hops encountered along a trajectory, suggesting that some randomization in nuclear velocity is needed when classically forbidden hops constitute a large fraction of attempted hops. Our results are verified computationally using two- and three-level quantum subsystems, coupled to a classical bath undergoing Langevin dynamics.

3D ultrasound-CT registration of the liver using combined landmark-intensity information

International Nuclear Information System (INIS)

Lange, Thomas; Schlag, Peter M.; Papenberg, Nils; Heldmann, Stefan; Modersitzki, Jan; Fischer, Bernd; Lamecker, Hans

2009-01-01

An important issue in computer-assisted surgery of the liver is a fast and reliable transfer of preoperative resection plans to the intraoperative situation. One problem is to match the planning data, derived from preoperative CT or MR images, with 3D ultrasound images of the liver, acquired during surgery. As the liver deforms significantly in the intraoperative situation non-rigid registration is necessary. This is a particularly challenging task because pre- and intraoperative image data stem from different modalities and ultrasound images are generally very noisy. One way to overcome these problems is to incorporate prior knowledge into the registration process. We propose a method of combining anatomical landmark information with a fast non-parametric intensity registration approach. Mathematically, this leads to a constrained optimization problem. As distance measure we use the normalized gradient field which allows for multimodal image registration. A qualitative and quantitative validation on clinical liver data sets of three different patients has been performed. We used the distance of dense corresponding points on vessel center lines for quantitative validation. The combined landmark and intensity approach improves the mean and percentage of point distances above 3 mm compared to rigid and thin-plate spline registration based only on landmarks. The proposed algorithm offers the possibility to incorporate additional a priori knowledge - in terms of few landmarks - provided by a human expert into a non-rigid registration process. (orig.)

Sequence analyses reveal that a TPR–DP module, surrounded by recombinable flanking introns, could be at the origin of eukaryotic Hop and Hip TPR–DP domains and prokaryotic GerD proteins

Science.gov (United States)

Papandreou, Nikolaos; Chomilier, Jacques

2008-01-01

The co-chaperone Hop [heat shock protein (HSP) organising protein] is known to bind both Hsp70 and Hsp90. Hop comprises three repeats of a tetratricopeptide repeat (TPR) domain, each consisting of three TPR motifs. The first and last TPR domains are followed by a domain containing several dipeptide (DP) repeats called the DP domain. These analyses suggest that the hop genes result from successive recombination events of an ancestral TPR–DP module. From a hydrophobic cluster analysis of homologous Hop protein sequences derived from gene families, we can postulate that shifts in the open reading frames are at the origin of the present sequences. Moreover, these shifts can be related to the presence or absence of biological function. We propose to extend the family of Hop co-chaperons into the kingdom of bacteria, as several structurally related genes have been identified by hydrophobic cluster analysis. We also provide evidence of common structural characteristics between hop and hip genes, suggesting a shared precursor of ancestral TPR–DP domains. Electronic supplementary material The online version of this article (doi:10.1007/s12192-008-0083-8) contains supplementary material, which is available to authorized users. PMID:18987995

PRODUCTION WITH 3D PRINTERS IN TEXTILES [REVIEW

OpenAIRE

KESKIN Reyhan; GOCEK Ikilem

2015-01-01

3D printers are gaining more attention, finding different applications and 3D printing is being regarded as a ‘revolution’ of the 2010s for production. 3D printing is a production method that produces 3-dimensional objects by combining very thin layers over and over to form the object using 3D scanners or via softwares either private or open source. 3D printed materials find application in a large range of fields including aerospace, automotive, medicine and material science. There are severa...

Routing protocol for wireless quantum multi-hop mesh backbone network based on partially entangled GHZ state

Science.gov (United States)

Xiong, Pei-Ying; Yu, Xu-Tao; Zhang, Zai-Chen; Zhan, Hai-Tao; Hua, Jing-Yu

2017-08-01

Quantum multi-hop teleportation is important in the field of quantum communication. In this study, we propose a quantum multi-hop communication model and a quantum routing protocol with multihop teleportation for wireless mesh backbone networks. Based on an analysis of quantum multi-hop protocols, a partially entangled Greenberger-Horne-Zeilinger (GHZ) state is selected as the quantum channel for the proposed protocol. Both quantum and classical wireless channels exist between two neighboring nodes along the route. With the proposed routing protocol, quantum information can be transmitted hop by hop from the source node to the destination node. Based on multi-hop teleportation based on the partially entangled GHZ state, a quantum route established with the minimum number of hops. The difference between our routing protocol and the classical one is that in the former, the processes used to find a quantum route and establish quantum channel entanglement occur simultaneously. The Bell state measurement results of each hop are piggybacked to quantum route finding information. This method reduces the total number of packets and the magnitude of air interface delay. The deduction of the establishment of a quantum channel between source and destination is also presented here. The final success probability of quantum multi-hop teleportation in wireless mesh backbone networks was simulated and analyzed. Our research shows that quantum multi-hop teleportation in wireless mesh backbone networks through a partially entangled GHZ state is feasible.

Paradigma preventivo e lógica identitária nas abordagens sobre o Hip Hop

Directory of Open Access Journals (Sweden)

Rodrigo Lages e Silva

2008-06-01

Full Text Available Este artigo faz uma revisão das pesquisas acadêmicas sobre o Hip Hop, apontando a preponderância do conceito de identidade nas referidas teorizações. Neste sentido, pretende-se contextualizar a ascensão do conceito de identidade nas visões sobre o Hip Hop, em direção a sua conjugação com o conceito de cidadania. Tal lógica identitária está intimamente ligada à construção da noção de categorias desviantes. Forjada sob o pano de fundo da urbanização, a lógica identitária é a expressão acadêmica de uma racionalidade a que denominamos de paradigma preventivo, cuja função é antecipar-se a uma eventual potência violenta que os jovens moradores de periferia representariam. Portanto, trata-se de entender a fabricação do subúrbio e da juventude como problema social, analisando, assim, as concepções que dão sustentação aos ideais corretivos e moralizantes que as abordagens sobre o Hip Hop expressam através de uma ênfase nos seus benefícios identitários.

Gap solitons in periodic Schrodinger lattice system with nonlinear hopping

Directory of Open Access Journals (Sweden)

Ming Cheng

2016-10-01

Full Text Available This article concerns the periodic discrete Schrodinger equation with nonlinear hopping on the infinite integer lattice. We obtain the existence of gap solitons by the linking theorem and concentration compactness method together with a periodic approximation technique. In addition, the behavior of such solutions is studied as $\\alpha\\to 0$. Notice that the nonlinear hopping can be sign changing.

Culturas juveniles en tono de mujer. Hip hop en Medellín (Colombia.

Directory of Open Access Journals (Sweden)

Ángela Garcés Montoya.

2011-04-01

Full Text Available This article is part of the research project, “Youth musical mediations,” that explores the appropriation of alternative means of communication which allow the young to develop identities sharply differentiated from those the adult world. In particular, the article examines the world of hip hop in Medellín and the ways that youth participate in it. To follow key trajectories of women in hip hop, their voices, feelings, and memories must be uncovered. This will allow us to see how the few women who are currently part of hip hop scene in Medellín and Colombia enter, move through, and persevere in it. Since women constitute only a small percentage of the youth who live and remake hip hop in Medellín, it is important to understand how they manage to live in a male-colored world. If hip hop is about strength, denunciation, confrontation, and resistance, it seems that these qualities are more appropriate for men than for women

Agronomic performance and beer quality assessment of twenty hop cultivars grown in Central Italy

Directory of Open Access Journals (Sweden)

Francesco Rossini

2016-08-01

Full Text Available Hop market and beer industry have always been of secondary relevance in Italy as compared to grape and wine sector. Hence, hop cultivars and the information for growing hops have been generated almost entirely from the major hop production countries. Identifying cultivars that perform well in Mediterranean environments is therefore essential to successfully start hop cultivation and breeding activity in this new growing region. To evaluate the intraspecific diversity of hop in Central Italy, 20 female hop genotypes with different origin were screened during three growing seasons (2013-2015 in an experimental hop yard. Cones yield, plant height and crop phenology were evaluated to determine which cultivars were best suited to the Mediterranean climate. Moreover, given the rising interest for the development of local beers with distinguishing aroma, a sensory analysis was performed and beers flavoured with locally produced and imported cones were compared. A significant diversity among cultivars was found for all parameters investigated. The results indicated that weather condition during flowering and development of cones markedly affected yield and plant height. Cones yield was negatively correlated with thermal time (r=–0.5, P<0.05 to harvest and positively with plant height (r=0.56, P<0.05. Cascade, Hallertauer Magnum, Hersbrucker Spat and Yeoman showed the best adaptability to the Mediterranean growing conditions as they were the top-performing cultivars across the three years. Sensory analysis evidenced the importance of cultivar selection as determining factor for flavouring properties of beers. In general, results showed that the origin of cones strongly affected the mouth feel of beers. More complex and appreciated aroma profiles were identified for beers flavoured with local cones than those hopped with commercial products.

Mood after various brief exercise and sport modes: aerobics, hip-hop dancing, ice skating, and body conditioning.

Science.gov (United States)

Kim, Sungwoon; Kim, Jingu

2007-06-01

To investigate the potential psychological benefits of brief exercise and sport activities on positive mood alterations, 45 Korean high school and 232 undergraduate students enrolled in physical education and stress management classes voluntarily participated and were randomly assigned to one of four activities: aerobic exercise, body conditioning, hip-hop dancing, and ice skating. Mood changes from before to after exercise (2 pm to 3 pm) were measured based on a Korean translation of the Subjective Exercise Experiences Scale. The findings suggested that the aerobics and hip-hop dancing groups rated positive well-being higher than the body conditioning and ice skating groups. Immediately after exercise, psychological distress was rated lower in the aerobics and hip-hop dancing groups, as was fatigue.

Coupling 2D/3D registration method and statistical model to perform 3D reconstruction from partial x-rays images data.

Science.gov (United States)

Cresson, T; Chav, R; Branchaud, D; Humbert, L; Godbout, B; Aubert, B; Skalli, W; De Guise, J A

2009-01-01

3D reconstructions of the spine from a frontal and sagittal radiographs is extremely challenging. The overlying features of soft tissues and air cavities interfere with image processing. It is also difficult to obtain information that is accurate enough to reconstruct complete 3D models. To overcome these problems, the proposed method efficiently combines the partial information contained in two images from a patient with a statistical 3D spine model generated from a database of scoliotic patients. The algorithm operates through two simultaneous iterating processes. The first one generates a personalized vertebra model using a 2D/3D registration process with bone boundaries extracted from radiographs, while the other one infers the position and the shape of other vertebrae from the current estimation of the registration process using a statistical 3D model. Experimental evaluations have shown good performances of the proposed approach in terms of accuracy and robustness when compared to CT-scan.

Proses Produksi Pembuatan Tekstur Material pada Desain 3d Karakter Menggunakan Perangkat Lunak Maxon 3D Bodypaint

Directory of Open Access Journals (Sweden)

Ardiyan Ardiyan

2014-10-01

Full Text Available Digital production proses using integrated image editor software, which has own drawing tools function, makes easier producing textures material that applied in 3D model. The feature of image editor combined with 3D Editor Software makes the easier adjustment of 3D model needs when we see the visible improvement, so the software utilization will be more efficient. In the discussion, this study is done by making the production of 3D model, that is the 3D Character that has material texturing from utilizing the available image editor software features, so the alternative production by using the integrated image editor is possibly to be done. The discussion can be utilized as an insight into the manufacture of technical design in determining the design workflow of 3D models. Utilization of software take one example of software Maxon Cinema 4D version 14, which is used as a reference as software that integrates image processing therein. 

Design, testing, and performance of a hybrid micro vehicle---The Hopping Rotochute

Science.gov (United States)

Beyer, Eric W.

The Hopping Rotochute is a new hybrid micro vehicle that has been developed to robustly explore environments with rough terrain while minimizing energy consumption over long periods of time. The device consists of a small coaxial rotor system housed inside a lightweight cage. The vehicle traverses an area by intermittently powering a small electric motor which drives the rotor system, allowing the vehicle to hop over obstacles of various shapes and sizes. A movable internal mass controls the direction of travel while the egg-like exterior shape and low mass center allows the vehicle to passively reorient itself to an upright attitude when in contact with the ground. This dissertation presents the design, fabrication, and testing of a radio-controlled Hopping Rotochute prototype as well as an analytical study of the flight performance of the device. The conceptual design iterations are first outlined which were driven by the mission and system requirements assigned to the vehicle. The aerodynamic, mechanical, and electrical design of a prototype is then described, based on the final conceptual design, with particular emphasis on the fundamental trades that must be negotiated for this type of hopping vehicle. The fabrication and testing of this prototype is detailed as well as experimental results obtained from a motion capture system. Basic flight performance of the prototype are reported which demonstrates that the Hopping Rotochute satisfies all appointed system requirements. A dynamic model of the Hopping Rotochute is also developed in this thesis and employed to predict the flight performance of the vehicle. The dynamic model includes aerodynamic loads from the body and rotor system as well as a soft contact model to estimate the forces and moments during ground contact. The experimental methods used to estimate the dynamic model parameters are described while comparisons between measured and simulated motion are presented. Good correlation between these motions

A Review of Hip Hop-Based Interventions for Health Literacy, Health Behaviors, and Mental Health.

Science.gov (United States)

Robinson, Cendrine; Seaman, Elizabeth L; Montgomery, LaTrice; Winfrey, Adia

2017-07-01

African-American children and adolescents experience an undue burden of disease for many health outcomes compared to their White peers. More research needs to be completed for this priority population to improve their health outcomes and ameliorate health disparities. Integrating hip hop music or hip hop dance into interventions may help engage African-American youth in health interventions and improve their health outcomes. We conducted a review of the literature to characterize hip hop interventions and determine their potential to improve health. We searched Web of Science, Scopus, PsycINFO, and EMBASE to identify studies that assessed hip hop interventions. To be included, studies had to (1) be focused on a psychosocial or physical health intervention that included hip hop and (2) present quantitative data assessing intervention outcomes. Twenty-three articles were identified as meeting all inclusion criteria and were coded by two reviewers. Articles were assessed with regards to sample characteristics, study design, analysis, intervention components, and results. Hip hop interventions have been developed to improve health literacy, health behavior, and mental health. The interventions were primarily targeted to African-American and Latino children and adolescents. Many of the health literacy and mental health studies used non-experimental study designs. Among the 12 (of 14) health behavior studies that used experimental designs, the association between hip hop interventions and positive health outcomes was inconsistent. The number of experimental hip hop intervention studies is limited. Future research is required to determine if hip hop interventions can promote health.

3-D Vector Flow Imaging

DEFF Research Database (Denmark)

Holbek, Simon

, if this significant reduction in the element count can still provide precise and robust 3-D vector flow estimates in a plane. The study concludes that the RC array is capable of estimating precise 3-D vector flow both in a plane and in a volume, despite the low channel count. However, some inherent new challenges...... ultrasonic vector flow estimation and bring it a step closer to a clinical application. A method for high frame rate 3-D vector flow estimation in a plane using the transverse oscillation method combined with a 1024 channel 2-D matrix array is presented. The proposed method is validated both through phantom...... hampers the task of real-time processing. In a second study, some of the issue with the 2-D matrix array are solved by introducing a 2-D row-column (RC) addressing array with only 62 + 62 elements. It is investigated both through simulations and via experimental setups in various flow conditions...

Muziki wa Hip Hop na Haki Za Kijamii: Dhima, Changamoto na ...

African Journals Online (AJOL)

Ni dhahiri kuwa haki za kijamii zinaweza kuwasilishwa kwa jamii pana kupitia sanaa ya hip hop. Makala haya basi, yanabainisha dhima na mchango wa muziki wa hip hop katika masuala ya haki za kijamii, yanafafanua changamoto za muziki huu katika kuwasilisha haki za kijamii na kutoa mapendekezo kwa makundi ...

Optimization of conditions for supercritical fluid extraction of flavonoids from hops (Humulus lupulus L.)*

Science.gov (United States)

He, Guo-qing; Xiong, Hao-ping; Chen, Qi-he; Ruan, Hui; Wang, Zhao-yue; Traoré, Lonseny

2005-01-01

Waste hops are good sources of flavonoids. Extraction of flavonoids from waste hops (SC-CO2 extracted hops) using supercritical fluids technology was investigated. Various temperatures, pressures and concentrations of ethanol (modifier) and the ratio (w/w) of solvent to material were tested in this study. The results of single factor and orthogonal experiments showed that at 50 °C, 25 MPa, the ratio of solvent to material (50%), ethanol concentration (80%) resulted in maximum extraction yield flavonoids (7.8 mg/g). HPLC-MS analysis of the extracts indicated that flavonoids obtained were xanthohumol, the principal prenylflavonoid in hops. PMID:16187413

Effect of anionic surfactant concentration on the variable range hopping conduction in polypyrrole nanoparticles

International Nuclear Information System (INIS)

Rawal, Ishpal; Kaur, Amarjeet

2014-01-01

The mechanism of charge transport in polypyrrole (PPy) nanoparticles prepared with different concentrations (5 to 30 mM) of anionic surfactant (sodium dodecyl sulfate) is reported. Transmission electron microscopy technique confirms the formation of PPy nanoparticles of sizes ∼52 to 28 nm under surfactant directed approach. The room temperature electrical conductivity of the prepared nanoparticles found to increase from 3 to 22 S/cm with surfactant concentration. The temperature dependent activation energy rules out the possibility of band conduction mechanism in the prepared PPy nanoparticles and thus the synthesized nanoparticles are analyzed under variable range hopping (VRH) model for conduction mechanism. The PPy nanoparticles, reduced with liquid ammonia, hold 3D VRH conduction mechanism for the charge transport. However, in the doped samples, some deviation from 3D VRH conduction behavior at higher temperatures (>150 K) has been observed. This may be attributed to the presence of anionic surfactant in these samples. The doping of anionic surfactant causes rise in conducting islands, which may lead to the change in the shape/distribution of density of states governed by Gaussian or exponential type near Fermi level

Effect of anionic surfactant concentration on the variable range hopping conduction in polypyrrole nanoparticles

Science.gov (United States)

Rawal, Ishpal; Kaur, Amarjeet

2014-01-01

The mechanism of charge transport in polypyrrole (PPy) nanoparticles prepared with different concentrations (5 to 30 mM) of anionic surfactant (sodium dodecyl sulfate) is reported. Transmission electron microscopy technique confirms the formation of PPy nanoparticles of sizes ˜52 to 28 nm under surfactant directed approach. The room temperature electrical conductivity of the prepared nanoparticles found to increase from 3 to 22 S/cm with surfactant concentration. The temperature dependent activation energy rules out the possibility of band conduction mechanism in the prepared PPy nanoparticles and thus the synthesized nanoparticles are analyzed under variable range hopping (VRH) model for conduction mechanism. The PPy nanoparticles, reduced with liquid ammonia, hold 3D VRH conduction mechanism for the charge transport. However, in the doped samples, some deviation from 3D VRH conduction behavior at higher temperatures (>150 K) has been observed. This may be attributed to the presence of anionic surfactant in these samples. The doping of anionic surfactant causes rise in conducting islands, which may lead to the change in the shape/distribution of density of states governed by Gaussian or exponential type near Fermi level.

Combining Public Domain and Professional Panoramic Imagery for the Accurate and Dense 3d Reconstruction of the Destroyed Bel Temple in Palmyra

Science.gov (United States)

Wahbeh, W.; Nebiker, S.; Fangi, G.

2016-06-01

This paper exploits the potential of dense multi-image 3d reconstruction of destroyed cultural heritage monuments by either using public domain touristic imagery only or by combining the public domain imagery with professional panoramic imagery. The focus of our work is placed on the reconstruction of the temple of Bel, one of the Syrian heritage monuments, which was destroyed in September 2015 by the so called "Islamic State". The great temple of Bel is considered as one of the most important religious buildings of the 1st century AD in the East with a unique design. The investigations and the reconstruction were carried out using two types of imagery. The first are freely available generic touristic photos collected from the web. The second are panoramic images captured in 2010 for documenting those monuments. In the paper we present a 3d reconstruction workflow for both types of imagery using state-of-the art dense image matching software, addressing the non-trivial challenges of combining uncalibrated public domain imagery with panoramic images with very wide base-lines. We subsequently investigate the aspects of accuracy and completeness obtainable from the public domain touristic images alone and from the combination with spherical panoramas. We furthermore discuss the challenges of co-registering the weakly connected 3d point cloud fragments resulting from the limited coverage of the touristic photos. We then describe an approach using spherical photogrammetry as a virtual topographic survey allowing the co-registration of a detailed and accurate single 3d model of the temple interior and exterior.

Optimal Design of Dual-Hop VLC/RF Communication System With Energy Harvesting

KAUST Repository

Rakia, Tamer

2016-07-28

In this letter, we consider a dual-hop heterogeneous visible light communication (VLC)/radio frequency (RF) communication system to extend the coverage of VLC systems. Besides detecting the information over VLC link, the relay is able to harvest energy from the first-hop VLC link, by extracting the direct current component of the received optical signal, and uses the harvested energy to retransmit the data to a mobile terminal over the second-hop RF link. We investigate the optimal design of the hybrid system in terms of data rate maximization.

Cascading Multi-Hop Reservation and Transmission in Underwater Acoustic Sensor Networks

Directory of Open Access Journals (Sweden)

Jae-Won Lee

2014-10-01

Full Text Available The long propagation delay in an underwater acoustic channel makes designing an underwater media access control (MAC protocol more challenging. In particular, handshaking-based MAC protocols widely used in terrestrial radio channels have been known to be inappropriate in underwater acoustic channels, because of the inordinately large latency involved in exchanging control packets. Furthermore, in the case of multi-hop relaying in a hop-by-hop handshaking manner, the end-to-end delay significantly increases. In this paper, we propose a new MAC protocol named cascading multi-hop reservation and transmission (CMRT. In CMRT, intermediate nodes between a source and a destination may start handshaking in advance for the next-hop relaying before handshaking for the previous node is completed. By this concurrent relaying, control packet exchange and data delivery cascade down to the destination. In addition, to improve channel utilization, CMRT adopts a packet-train method where multiple data packets are sent together by handshaking once. Thus, CMRT reduces the time taken for control packet exchange and accordingly increases the throughput. The performance of CMRT is evaluated and compared with that of two conventional MAC protocols (multiple-access collision avoidance for underwater (MACA-U and MACA-U with packet trains (MACA-UPT. The results show that CMRT outperforms other MAC protocols in terms of both throughput and end-to-end delay.

New Directions in 3D Medical Modeling: 3D-Printing Anatomy and Functions in Neurosurgical Planning

Science.gov (United States)

Árnadóttir, Íris; Gíslason, Magnús; Ólafsson, Ingvar

2017-01-01

This paper illustrates the feasibility and utility of combining cranial anatomy and brain function on the same 3D-printed model, as evidenced by a neurosurgical planning case study of a 29-year-old female patient with a low-grade frontal-lobe glioma. We herein report the rapid prototyping methodology utilized in conjunction with surgical navigation to prepare and plan a complex neurosurgery. The method introduced here combines CT and MRI images with DTI tractography, while using various image segmentation protocols to 3D model the skull base, tumor, and five eloquent fiber tracts. This 3D model is rapid-prototyped and coregistered with patient images and a reported surgical navigation system, establishing a clear link between the printed model and surgical navigation. This methodology highlights the potential for advanced neurosurgical preparation, which can begin before the patient enters the operation theatre. Moreover, the work presented here demonstrates the workflow developed at the National University Hospital of Iceland, Landspitali, focusing on the processes of anatomy segmentation, fiber tract extrapolation, MRI/CT registration, and 3D printing. Furthermore, we present a qualitative and quantitative assessment for fiber tract generation in a case study where these processes are applied in the preparation of brain tumor resection surgery. PMID:29065569

New Directions in 3D Medical Modeling: 3D-Printing Anatomy and Functions in Neurosurgical Planning

Directory of Open Access Journals (Sweden)

Paolo Gargiulo

2017-01-01

Full Text Available This paper illustrates the feasibility and utility of combining cranial anatomy and brain function on the same 3D-printed model, as evidenced by a neurosurgical planning case study of a 29-year-old female patient with a low-grade frontal-lobe glioma. We herein report the rapid prototyping methodology utilized in conjunction with surgical navigation to prepare and plan a complex neurosurgery. The method introduced here combines CT and MRI images with DTI tractography, while using various image segmentation protocols to 3D model the skull base, tumor, and five eloquent fiber tracts. This 3D model is rapid-prototyped and coregistered with patient images and a reported surgical navigation system, establishing a clear link between the printed model and surgical navigation. This methodology highlights the potential for advanced neurosurgical preparation, which can begin before the patient enters the operation theatre. Moreover, the work presented here demonstrates the workflow developed at the National University Hospital of Iceland, Landspitali, focusing on the processes of anatomy segmentation, fiber tract extrapolation, MRI/CT registration, and 3D printing. Furthermore, we present a qualitative and quantitative assessment for fiber tract generation in a case study where these processes are applied in the preparation of brain tumor resection surgery.

Estimating 3D Object Parameters from 2D Grey-Level Images

NARCIS (Netherlands)

Houkes, Z.

2000-01-01

This thesis describes a general framework for parameter estimation, which is suitable for computer vision applications. The approach described combines 3D modelling, animation and estimation tools to determine parameters of objects in a scene from 2D grey-level images. The animation tool predicts

Patient-specific puzzle implant preformed with 3D-printed rapid prototype model for combined orbital floor and medial wall fracture.

Science.gov (United States)

Kim, Young Chul; Min, Kyung Hyun; Choi, Jong Woo; Koh, Kyung S; Oh, Tae Suk; Jeong, Woo Shik

2018-04-01

The management of combined orbital floor and medial wall fractures involving the inferomedial strut is challenging due to absence of stable cornerstone. In this article, we proposed surgical strategies using customized 3D puzzle implant preformed with Rapid Prototype (RP) skull model. Retrospective review was done in 28 patients diagnosed with combined orbital floor and medial wall fracture. Using preoperative CT scans, original and mirror-imaged RP skull models for each patient were prepared and sterilized. In all patients, porous polyethylene-coated titanium mesh was premolded onto RP skull model in two ways; Customized 3D jigsaw puzzle technique was used in 15 patients with comminuted inferomedial strut, whereas individual 3D implant technique was used in each fracture for 13 patients with intact inferomedial strut. Outcomes including enophthalmos, visual acuity, and presence of diplopia were assessed and orbital volume was measured using OsiriX software preoperatively and postoperatively. Satisfactory results were achieved in both groups in terms of clinical improvements. Of 10 patients with preoperative diplopia, 9 improved in 6 months, except one with persistent symptom who underwent extraocular muscle rupture. 18 patients who had moderate to severe enophthalmos preoperatively improved, and one remained with mild degree. Orbital volume ratio, defined as volumetric ratio between affected and control orbit, decreased from 127.6% to 99.79% (p puzzle and individual reconstruction technique provide accurate restoration of combined orbital floor and medial wall fractures. Copyright © 2017 British Association of Plastic, Reconstructive and Aesthetic Surgeons. Published by Elsevier Ltd. All rights reserved.

Wavelength-Hopping Time-Spreading Optical CDMA With Bipolar Codes

Science.gov (United States)

Kwong, Wing C.; Yang, Guu-Chang; Chang, Cheng-Yuan

2005-01-01

Two-dimensional wavelength-hopping time-spreading coding schemes have been studied recently for supporting greater numbers of subscribers and simultaneous users than conventional one-dimensional approaches in optical code-division multiple-access (OCDMA) systems. To further improve both numbers without sacrificing performance, a new code design utilizing bipolar codes for both wavelength hopping and time spreading is studied and analyzed in this paper. A rapidly programmable, integratable hardware design for this new coding scheme, based on arrayed-waveguide gratings, is also discussed.

Hegemony, Hope, and the Harlem Renaissance: Taking Hip Hop Culture Seriously

Science.gov (United States)

Price, Robert J., Jr.

2005-01-01

Adult education instructors and administrators, who typically are not members of the hip hop generation, often have little knowledge and understanding of rap music (also known as gangsta rap) and hip hop culture, and consequently do not take the black popular cultural phenomenon seriously as it relates to adult education. Adult educators,…

Hip-Hop and a Hybrid Text in a Postsecondary English Class

Science.gov (United States)

Sanchez, Deborah M.

2010-01-01

This study explores the epistemology present in hip-hop music and its reflection in the writing of one African American student in a postsecondary transitional English class. An integration of hip-hop and academic literacy practices in the student's essay challenges the supremacy of a "standard" academic English and deficit perspectives about…

Novel 3D media technologies

CERN Document Server

Dagiuklas, Tasos

2015-01-01

This book describes recent innovations in 3D media and technologies, with coverage of 3D media capturing, processing, encoding, and adaptation, networking aspects for 3D Media, and quality of user experience (QoE). The contributions are based on the results of the FP7 European Project ROMEO, which focuses on new methods for the compression and delivery of 3D multi-view video and spatial audio, as well as the optimization of networking and compression jointly across the future Internet. The delivery of 3D media to individual users remains a highly challenging problem due to the large amount of data involved, diverse network characteristics and user terminal requirements, as well as the user’s context such as their preferences and location. As the number of visual views increases, current systems will struggle to meet the demanding requirements in terms of delivery of consistent video quality to fixed and mobile users. ROMEO will present hybrid networking solutions that combine the DVB-T2 and DVB-NGH broadcas...

Calibrated HDRI in 3D point clouds

DEFF Research Database (Denmark)

Bülow, Katja; Tamke, Martin

2017-01-01

the challenges of dynamic smart lighting planning in outdoor urban space. This paper presents findings on how 3D capturing of outdoor environments combined with HDRI establishes a new way for analysing and representing the spatial distribution of light in combination with luminance data.......3D-scanning technologies and point clouds as means for spatial representation introduce a new paradigm to the measuring and mapping of physical artefacts and space. This technology also offers possibilities for the measuring and mapping of outdoor urban lighting and has the potential to meet...

Comparison of Rheological Properties of Hopped Wort and Malt Wort

Directory of Open Access Journals (Sweden)

Petr Trávníček

2015-01-01

Full Text Available The aim of this work is determination rheological properties of hopped wort and malt wort and their comparison. In the paper following rheological properties has been described: the dependence of viscosity on a temperature of a sample and hysteresis loop test. The time dependence test was performed for a confirmation thixotropic behaviour. Based on measured values Arrhenius mathematical model has been applied. The activation energy was determined by using of this model. Tests have been carried out in the temperature range from 5 °C to 40 °C. Rheological tests proved that malt wort behaves as Newtonian fluid in all temperatures and hopped wort behaves as non-Newtonian fluid at low temperatures. Thixotropic behaviour is caused by the content of the rests of hops heads or malt scraps.

Solution of the effective Hamiltonian of impurity hopping between two sites in a metal

Science.gov (United States)

Ye, Jinwu

1997-07-01

We analyze in detail all the possible fixed points of the effective Hamiltonian of a nonmagnetic impurity hopping between two sites in a metal obtained by Moustakas and Fisher (MF). We find a line of non-Fermi liquid fixed points which continuously interpolates between the two-channel Kondo fixed point (2CK) and the one-channel, two-impurity Kondo (2IK) fixed point. There is one relevant direction with scaling dimension 12 and one leading irrelevant operator with dimension 32. There is also one marginal operator in the spin sector moving along this line. The marginal operator, combined with the leading irrelevant operator, will generate the relevant operator. For the general position on this line, the leading low-temperature exponents of the specific heat, the hopping susceptibility and the electron conductivity Cimp,χhimp,σ(T) are the same as those of the 2CK, but the finite-size spectrum depends on the position on the line. No universal ratios can be formed from the amplitudes of the three quantities except at the 2CK point on this line where the universal ratios can be formed. At the 2IK point on this line, σ(T)~2σu(1+aT3/2), no universal ratio can be formed either. The additional non-Fermi-liquid fixed point found by MF has the same symmetry as the 2IK, it has two relevant directions with scaling dimension 12, and is therefore also unstable. The leading low-temperature behaviors are Cimp~T,χhimp~lnT,σ(T)~2σu(1+aT3/2) no universal ratios can be formed. The system is shown to flow to a line of Fermi-liquid fixed points which continuously interpolates between the noninteracting fixed point and the two-channel spin-flavor Kondo fixed point discussed by the author previously. The effect of particle-hole symmetry breaking is discussed. The effective Hamiltonian in the external magnetic field is analyzed. The scaling functions for the physical measurable quantities are derived in the different regimes; their predictions for the experiments are given. Finally

3D ARCHITECTURAL VIDEOMAPPING

Directory of Open Access Journals (Sweden)

R. Catanese

2013-07-01

Full Text Available 3D architectural mapping is a video projection technique that can be done with a survey of a chosen building in order to realize a perfect correspondence between its shapes and the images in projection. As a performative kind of audiovisual artifact, the real event of the 3D mapping is a combination of a registered video animation file with a real architecture. This new kind of visual art is becoming very popular and its big audience success testifies new expressive chances in the field of urban design. My case study has been experienced in Pisa for the Luminara feast in 2012.

Multilingualism and Hip Hop Consumption in Nigeria: Accounting for the Local Acceptance of a Global Phenomenon Hip-Hop und Mehrsprachigkeit in Nigeria: Zur Erklärung der lokalen Akzeptanz eines globalen Phänomens

Directory of Open Access Journals (Sweden)

Olusegun Fariudeen Liadi

2012-01-01

Full Text Available Hip hop music has enjoyed global popularity and patronage on a level that has transcended that of most other music genres. It is perhaps due to the genre’s worldwide popularity that many forms of hip hop have sprung up across the globe. The Nigerian version of the music has been overwhelmingly accepted by a good number of youths in the country irrespective of class, religion and social status. However, there is some speculation as to what factors are responsible for the recent sudden boom in the popular consumption of this genre among the youth, since hip hop has been a feature of the Nigerian musical landscape since the 1980s. With the aid of qualitative data collection instruments – thirty in-depth interviews and six key informant interviews among hip hop fans and club DJs, respectively – the study establishes the centrality of multilingualism as a primary reason for the acceptance of hip hop among Nigerian youth.Hip-Hop-Musik ist weltweit in einem Maße populär, das die meisten anderen Musikrichtungen übertrifft. Vielleicht hat diese weltweite Beliebtheit dazu geführt, dass rund um den Globus unterschiedliche Formen des Hip-Hop aus dem Boden geschossen sind. Die nigerianische Version dieser Musikrichtung wird von einer überwältigenden Zahl Jugendlicher im Land angenommen, unabhängig von sozialem Status und Religionszugehörigkeit. Es wird jedoch darüber spekuliert, welche Faktoren den jüngsten plötzlichen Boom in dieser Musikrichtung erklären, denn Hip-Hop ist schon seit den 1980er Jahren Teil der nigerianischen Musiklandschaft. Mit Hilfe einer qualitativen Datenerhebung – 30 detaillierte Interviews sowie sechs Interviews mit Schlüsselpersonen unter Hip-Hop-Fans und Club-DJs – kann der Autor die Mehrsprachigkeit als wichtigsten Grund für die Akzeptanz des Hip-Hop unter nigerianischen Jugendlichen ermitteln.

Multi-hop Relaying: An End-to-End Delay Analysis

KAUST Repository

Chaaban, Anas

2015-12-01

The impact of multi-hopping schemes on the communication latency in a relay channel is studied. The main aim is to characterize conditions under which such schemes decrease the communication latency given a reliability requirement. Both decode-forward (DF) and amplify-forward (AF) with block coding are considered, and are compared with the point-to-point (P2P) scheme which ignores the relay. Latency expressions for the three schemes are derived, and conditions under which DF and AF reduce latency are obtained for high signal-to-noise ratio (SNR). Interestingly, these conditions are more strict when compared to the conditions under which the same multi-hopping schemes achieve higher long-term (information-theoretic) rates than P2P. It turns out that the relation between the sourcedestination SNR and the harmonic mean of the SNR’s of the channels to and from the relay dictates whether multi-hopping reduces latency or not.

High sensitivity and high resolution element 3D analysis by a combined SIMS–SPM instrument

Directory of Open Access Journals (Sweden)

Yves Fleming

2015-04-01

Full Text Available Using the recently developed SIMS–SPM prototype, secondary ion mass spectrometry (SIMS data was combined with topographical data from the scanning probe microscopy (SPM module for five test structures in order to obtain accurate chemical 3D maps: a polystyrene/polyvinylpyrrolidone (PS/PVP polymer blend, a nickel-based super-alloy, a titanium carbonitride-based cermet, a reticle test structure and Mg(OH2 nanoclusters incorporated inside a polymer matrix. The examples illustrate the potential of this combined approach to track and eliminate artefacts related to inhomogeneities of the sputter rates (caused by samples containing various materials, different phases or having a non-flat surface and inhomogeneities of the secondary ion extraction efficiencies due to local field distortions (caused by topography with high aspect ratios. In this respect, this paper presents the measured relative sputter rates between PVP and PS as well as in between the different phases of the TiCN cermet.

Comparison of the carboxy-terminal DP-repeat region in the co-chaperones Hop and Hip.

Science.gov (United States)

Nelson, Gregory M; Huffman, Holly; Smith, David F

2003-01-01

Functional steroid receptor complexes are assembled and maintained by an ordered pathway of interactions involving multiple components of the cellular chaperone machinery. Two of these components, Hop and Hip, serve as co-chaperones to the major heat shock proteins (Hsps), Hsp70 and Hsp90, and participate in intermediate stages of receptor assembly. In an effort to better understand the functions of Hop and Hip in the assembly process, we focused on a region of similarity located near the C-terminus of each co-chaperone. Contained within this region is a repeated sequence motif we have termed the DP repeat. Earlier mutagenesis studies implicated the DP repeat of either Hop or Hip in Hsp70 binding and in normal assembly of the co-chaperones with progesterone receptor (PR) complexes. We report here that the DP repeat lies within a protease-resistant domain that extends to or is near the C-terminus of both co-chaperones. Point mutations in the DP repeats render the C-terminal regions hypersensitive to proteolysis. In addition, a Hop DP mutant displays altered proteolytic digestion patterns, which suggest that the DP-repeat region influences the folding of other Hop domains. Although the respective DP regions of Hop and Hip share sequence and structural similarities, they are not functionally interchangeable. Moreover, a double-point mutation within the second DP-repeat unit of Hop that converts this to the sequence found in Hip disrupts Hop function; however, the corresponding mutation in Hip does not alter its function. We conclude that the DP repeats are important structural elements within a C-terminal domain, which is important for Hop and Hip function.

Case study of 3D fingerprints applications.

Directory of Open Access Journals (Sweden)

Feng Liu

Full Text Available Human fingers are 3D objects. More information will be provided if three dimensional (3D fingerprints are available compared with two dimensional (2D fingerprints. Thus, this paper firstly collected 3D finger point cloud data by Structured-light Illumination method. Additional features from 3D fingerprint images are then studied and extracted. The applications of these features are finally discussed. A series of experiments are conducted to demonstrate the helpfulness of 3D information to fingerprint recognition. Results show that a quick alignment can be easily implemented under the guidance of 3D finger shape feature even though this feature does not work for fingerprint recognition directly. The newly defined distinctive 3D shape ridge feature can be used for personal authentication with Equal Error Rate (EER of ~8.3%. Also, it is helpful to remove false core point. Furthermore, a promising of EER ~1.3% is realized by combining this feature with 2D features for fingerprint recognition which indicates the prospect of 3D fingerprint recognition.

Hip abduction-adduction strength and one-leg hop tests: test-retest reliability and relationship to function in elite ice hockey players.

Science.gov (United States)

Kea, J; Kramer, J; Forwell, L; Birmingham, T

2001-08-01

Single group, test-retest. To determine: (1) hip abduction and adduction torques during concentric and eccentric muscle actions, (2) medial and lateral one-leg hop distances, (3) the test-retest reliability of these measurements, and (4) the relationship between isokinetic measures of hip muscle strength and hop distances in elite ice hockey players. The skating motion used in ice hockey requires strong contractions of the hip and knee musculature. However, baseline scores for hip strength and hop distances, their test-retest reliability, and measures of the extent to which these tests are related for this population are not available. The dominant leg of 27 men (mean age 20 +/- 3 yrs) was tested on 2 occasions. Hip abduction and adduction movements were completed at 60 degrees.s(-1) angular velocity, with the subject lying on the non-test side and the test leg moving vertically in the subject's coronal plane. One-leg hops requiring jumping from and landing on the same leg without losing balance were completed in the medial and lateral directions. Hip adduction torques were significantly greater than abduction torques during both concentric and eccentric muscle actions, while no significant difference was observed between medial and lateral hop distances. Although hop test scores produced excellent ICCs (> 0.75) when determined using scores on 1 occasion, torques needed to be averaged over 2 test occasions to reach this level. Correlations between the strength and hop tests ranged from slight to low (r = -0.26 to 0.27) and were characterized by wide 95% confidence intervals (-0.54 to 0.61). Isokinetic tests of hip abduction and adduction did not provide a strong indication of performance during sideways hop tests. Although isokinetic tests can provide a measure of muscular strength under specific test conditions, they should not be relied upon as a primary indicator of functional abilities or readiness to return to activity.

Polish Hip Hop as a Form of Multiliteracies and Situated Learning

Science.gov (United States)

Torrence, Michael L.

2009-01-01

The purpose of this ethnographic study was to examine Hip Hop in Poland through the lens of multiliteracies and situated learning. This analysis is concerned with the transmission of Hip Hop to and within Wroclaw, Poland, and its acculturation and assimilation in Wroclaw, Poland. Further, this study seeks to illustrate how professional Polish Hip…

Fabrication of Nanostructured Poly-ε-caprolactone 3D Scaffolds for 3D Cell Culture Technology

KAUST Repository

Schipani, Rossana

2015-04-21

Tissue engineering is receiving tremendous attention due to the necessity to overcome the limitations related to injured or diseased tissues or organs. It is the perfect combination of cells and biomimetic-engineered materials. With the appropriate biochemical factors, it is possible to develop new effective bio-devices that are capable to improve or replace biological functions. Latest developments in microfabrication methods, employing mostly synthetic biomaterials, allow the production of three-dimensional (3D) scaffolds that are able to direct cell-to-cell interactions and specific cellular functions in order to drive tissue regeneration or cell transplantation. The presented work offers a rapid and efficient method of 3D scaffolds fabrication by using optical lithography and micro-molding techniques. Bioresorbable polymer poly-ε-caprolactone (PCL) was the material used thanks to its high biocompatibility and ability to naturally degrade in tissues. 3D PCL substrates show a particular combination in the designed length scale: cylindrical shaped pillars with 10μm diameter, 10μm height, arranged in a hexagonal lattice with spacing of 20μm were obtained. The sidewalls of the pillars were nanostructured by attributing a 3D architecture to the scaffold. The suitability of these devices as cell culture technology supports was evaluated by plating NIH/3T3 mouse embryonic fibroblasts and human Neural Stem Cells (hNSC) on them. Scanning Electron Microscopy (SEM) analysis was carried out in order to examine the micro- and nano-patterns on the surface of the supports. In addition, after seeding of cells, SEM and immunofluorescence characterization of the fabricated systems were performed to check adhesion, growth and proliferation. It was observed that cells grow and develop healthy on the bio-polymeric devices by giving rise to well-interconnected networks. 3D PCL nano-patterned pillared scaffold therefore may have considerable potential as effective tool for

A study on a wheel-based stair-climbing robot with a hopping mechanism

Science.gov (United States)

Kikuchi, Koki; Sakaguchi, Keisuke; Sudo, Takayuki; Bushida, Naoki; Chiba, Yasuhiro; Asai, Yuji

2008-08-01

In this study, we propose a simple hopping mechanism using the vibration of a two-degree-of-freedom system for a wheel-based stair-climbing robot. The robot, consisting of two bodies connected by springs and a wire, hops by releasing energy stored in the springs and quickly travels using wheels mounted in its lower body. The trajectories of the bodies during hopping change in accordance with the design parameters, such as the reduced mass of the two bodies, the mass ratio between the upper and lower bodies, the spring constant, the control parameters such as the initial contraction of the spring and the wire tension. This property allows the robot to quickly and economically climb up and down stairs, leap over obstacles, and landing softly without complex control. In this paper, the characteristics of hopping motion for the design and control parameters are clarified by both numerical simulations and experiments. Furthermore, using the robot design based on the results the abilities to hop up and down a step, leap over a cable, and land softly are demonstrated.

Throw Yo' Voice Out: Disability as a Desirable Practice in Hip-Hop Vocal Performance

Directory of Open Access Journals (Sweden)

Alex S. Porco

2014-12-01

Full Text Available Disabled bodies and disabling spaces— especially the recording studio— shape the sound iconicity of hip-hop vocal performances. The disabled voice is the audible sign by which hip-hop artists trouble cultural definitions of the self and other; exceptionalism and failure; the natural and techno-mediated; comedy and tragedy; and aesthetic play and seriousness. Hip-hop vocal performances also function as self-conscious acts of transvaluation that challenge the discursive dominance of ableism. A materialist approach to vocal performance resists reducing voice to a silent metaphor for race, oppositionality, or liberation; and it emphasizes, instead, the physiological and social processes that render hip-hop voices unique, particular, and audible. It emphasizes the agency hip-hop artists possess in seeking out disabled bodies and assuming disabled identities for aesthetic and political ends. Thus, the body is returned to the analysis of style.

Welding distortion analysis of multipass joint combination with different sequences using 3D FEM and experiment

International Nuclear Information System (INIS)

Manurung, Yupiter H.P.; Lidam, Robert Ngendang; Rahim, M. Ridzwan; Zakaria, M. Yusof; Redza, M. Ridhwan; Sulaiman, M. Shahar; Tham, Ghalib; Abas, Sunhaji K.

2013-01-01

This paper presents an investigation of the welding sequence effect on induced angular distortion using FEM and experiments. The specimen of a combined joint geometry was modeled and simulated using Multipass Welding Advisor (MWA) in SYSWELD 2010 based on the thermal-elastic-plastic approach with low manganese carbon steel S3355J2G3 as specimen material and Goldak's double ellipsoid as heat source model. To validate the simulation results, a series of experiments was conducted with two different welding sequences using automated welding process, low carbon steel as parent metal, digital GMAW power source with premixed shielding gas and both-sided clamping technique. Based on the results, it was established that the thermo-elastic-plastic 3D FEM analysis shows good agreement with experimental results and the welding sequence “from outside to inside” induced less angular distortion compared to “from inside to outside”. -- Highlights: • 3D FEM was used to analyze the welding distortion on two different sequences. • Simulation results were validated with experiments using automated welding system. • Simulation results and experiments showed acceptable accuracy. • Welding sequence “outside–inside” showed less distortion than “inside–outside”

Distributed 3-D iterative reconstruction for quantitative SPECT

International Nuclear Information System (INIS)

Ju, Z.W.; Frey, E.C.; Tsui, B.M.W.

1995-01-01

The authors describe a distributed three dimensional (3-D) iterative reconstruction library for quantitative single-photon emission computed tomography (SPECT). This library includes 3-D projector-backprojector pairs (PBPs) and distributed 3-D iterative reconstruction algorithms. The 3-D PBPs accurately and efficiently model various combinations of the image degrading factors including attenuation, detector response and scatter response. These PBPs were validated by comparing projection data computed using the projectors with that from direct Monte Carlo (MC) simulations. The distributed 3-D iterative algorithms spread the projection-backprojection operations for all the projection angles over a heterogeneous network of single or multi-processor computers to reduce the reconstruction time. Based on a master/slave paradigm, these distributed algorithms provide dynamic load balancing and fault tolerance. The distributed algorithms were verified by comparing images reconstructed using both the distributed and non-distributed algorithms. Computation times for distributed 3-D reconstructions running on up to 4 identical processors were reduced by a factor approximately 80--90% times the number of the processors participating, compared to those for non-distributed 3-D reconstructions running on a single processor. When combined with faster affordable computers, this library provides an efficient means for implementing accurate reconstruction and compensation methods to improve quality and quantitative accuracy in SPECT images

No evidence hip joint angle modulates intrinsically produced stretch reflex in human hopping.

Science.gov (United States)

Gibson, W; Campbell, A; Allison, G

2013-09-01

Motor output in activities such as walking and hopping is suggested to be mediated neurally by purported stretch reflex augmentation of muscle output. Reflex EMG activity during these tasks has been frequently investigated in the soleus muscle; with alterations in reflex amplitude being associated with changes in hip joint angle/phase of the gait cycle. Previous work has focussed on reflex activity induced by an artificial perturbation or by induction of H-reflexes. As such, it is currently unknown if stretch reflex activity induced intrinsically (as part of the task) is modulated by changes in hip joint angle. This study investigated whether hip joint angle modulated reflex EMG 'burst' activity during a hopping task performed on a custom-built partially reclined sleigh. Ten subjects participated; EMG and kinematic data (VICON motor capture system) was collected for each hop cycle. Participants completed 5 sets of 30s of self-paced hopping in (1) hip neutral and (2) hip 60° flexion conditions. There was no difference in EMG 'burst' activity or in sagittal plane kinematics (knee/ankle) in the hopping task between the two conditions. The results indicate that during a functional task such as hopping, changes in hip angle do not alter the stretch reflex-like activity associated with landing. Copyright © 2013 Elsevier B.V. All rights reserved.

From Broken Glass to Ruf Diamonds: Manchester Hip Hop

OpenAIRE

de Paor-Evans, Adam

2018-01-01

When one considers music culture in Manchester during the 1980s and 1990s, Hip Hop is not an obvious cultural arena for discussion. However, amidst the spectacle of The Haçienda, the pop boom of Factory Records and the evolution of rave subculture and form of dance music which produced the pop cultural phenomenon of Madchester; in the space of music between The Fall and The Charlatans where brief stardom was found by Inspiral Carpets, Northside and Candyflip, Mancunian Hip Hop was also evolvi...

Auto-acetylation on K289 is not essential for HopZ1a-mediated plant defense suppression

Directory of Open Access Journals (Sweden)

Jose Sebastian Rufian

2015-07-01

Full Text Available The Pseudomonas syringae type III-secreted effector HopZ1a is a member of the HopZ / YopJ superfamily of effectors that triggers immunity in Arabidopsis. We have previously shown that HopZ1a suppresses both local (effector-triggered immunity, ETI and systemic immunity (systemic acquired resistance, SAR triggered by the heterologous effector AvrRpt2. HopZ1a has been shown to possess acetyltransferase activity, and this activity is essential to trigger immunity in Arabidopsis. HopZ1a acetyltransferase activity has been reported to require the auto-acetylation of the effector on a specific lysine (K289 residue. In this paper we analyze the relevance of autoacetylation of lysine residue 289 in HopZ1a ability to suppress plant defenses, and on the light of the results obtained, we also revise its relevance for HopZ1a avirulence activity. Our results indicate that, while the HopZ1aK289R mutant is impaired to some degree in its virulence and avirulence activities, is by no means phenotypically equivalent to the catalytically inactive HopZ1aC216A, since it is still able to trigger a defense response that induces detectable macroscopic HR and effectively protects Arabidopsis from infection, reducing growth of P. syringae within the plant. We also present evidence that the HopZ1aK289R mutant still displays virulence activities, partially suppressing both ETI and SAR.

Hopping absorption edge in silicon inversion layers

International Nuclear Information System (INIS)

Kostadinov, I.Z.

1983-09-01

The low frequency gap observed in the absorption spectrum of silicon inversion layers is related to the AC variable range hopping. The frequency dependence of the absorption coefficient is calculated. (author)

Automated 3-D Radiation Mapping

International Nuclear Information System (INIS)

Tarpinian, J. E.

1991-01-01

This work describes an automated radiation detection and imaging system which combines several state-of-the-art technologies to produce a portable but very powerful visualization tool for planning work in radiation environments. The system combines a radiation detection system, a computerized radiation imaging program, and computerized 3-D modeling to automatically locate and measurements are automatically collected and imaging techniques are used to produce colored, 'isodose' images of the measured radiation fields. The isodose lines from the images are then superimposed over the 3-D model of the area. The final display shows the various components in a room and their associated radiation fields. The use of an automated radiation detection system increases the quality of radiation survey obtained measurements. The additional use of a three-dimensional display allows easier visualization of the area and associated radiological conditions than two-dimensional sketches

Don't Believe the Hype: Hip-Hop Literacies and English Education

Science.gov (United States)

Belle, Crystal

2016-01-01

Current scholarship suggests that many youths identify with hip-hop, especially youths of color. Study of this artistic form has been suggested as a means of helping youths acquire and become fluent in literacy practices. This article explores how the use of a hip-hop literacies curriculum addressed the literacy skills of urban ninth-grade English…

Vibrational spectroscopy and chemometrics for rapid, quantitative analysis of bitter acids in hops (Humulus lupulus).

Science.gov (United States)

Killeen, Daniel P; Andersen, David H; Beatson, Ron A; Gordon, Keith C; Perry, Nigel B

2014-12-31

Hops, Humulus lupulus, are grown worldwide for use in the brewing industry to impart characteristic flavor and aroma to finished beer. Breeders produce many varietal crosses with the aim of improving and diversifying commercial hops varieties. The large number of crosses critical to a successful breeding program imposes high demands on the supporting chemical analytical laboratories. With the aim of reducing the analysis time associated with hops breeding, quantitative partial least-squares regression (PLS-R) models have been produced, relating reference data acquired by the industrial standard HPLC and UV methods, to vibrational spectra of the same, chemically diverse hops sample set. These models, produced from rapidly acquired infrared (IR), near-infrared (NIR), and Raman spectra, were appraised using standard statistical metrics. Results demonstrated that all three spectroscopic methods could be used for screening hops for α-acid, total bitter acids, and cohumulone concentrations in powdered hops. Models generated from Raman and IR spectra also showed potential for use in screening hops varieties for xanthohumol concentrations. NIR analysis was performed using both a standard benchtop spectrometer and a portable NIR spectrometer, with comparable results obtained by both instruments. Finally, some important vibrational features of cohumulone, colupulone, and xanthohumol were assigned using DFT calculations, which allow more insightful interpretation of PLS-R latent variable plots.

Flavonoid production in transgenic hop (Humulus lupulus L.) altered by PAP1/MYB75 from Arabidopsis thaliana L..

Czech Academy of Sciences Publication Activity Database

Gatica-Arias, A.; Farag, M.A.; Stanke, M.; Matoušek, Jaroslav; Wessjohann, L.; Weber, G.

2012-01-01

Roč. 31, č. 1 (2012), s. 111-119 ISSN 0721-7714 R&D Projects: GA ČR GA521/08/0740 Institutional research plan: CEZ:AV0Z50510513 Keywords : Flavonoid biosynthesis * plant transcription factor * hop Humulus lupulus Subject RIV: EB - Genetics ; Molecular Biology Impact factor: 2.509, year: 2012

Biological and chemical standardization of a hop (Humulus lupulus) botanical dietary supplement.

Science.gov (United States)

Krause, Elizabeth; Yuan, Yang; Hajirahimkhan, Atieh; Dong, Huali; Dietz, Birgit M; Nikolic, Dejan; Pauli, Guido F; Bolton, Judy L; van Breemen, Richard B

2014-06-01

Concerned about the safety of conventional estrogen replacement therapy, women are using botanical dietary supplements as alternatives for the management of menopausal symptoms such as hot flashes. Before botanical dietary supplements can be evaluated clinically for safety and efficacy, botanically authenticated and standardized forms are required. To address the demand for a standardized, estrogenic botanical dietary supplement, an extract of hops (Humulus lupulus L.) was developed. Although valued in the brewing of beer, hop extracts are used as anxiolytics and hypnotics and have well-established estrogenic constituents. Starting with a hop cultivar used in the brewing industry, spent hops (the residue remaining after extraction of bitter acids) were formulated into a botanical dietary supplement that was then chemically and biologically standardized. Biological standardization utilized the estrogen-dependent induction of alkaline phosphatase in the Ishikawa cell line. Chemical standardization was based on the prenylated phenols in hops that included estrogenic 8-prenylnaringenin, its isomer 6-prenylnaringenin, and pro-estrogenic isoxanthohumol and its isomeric chalcone xanthohumol, all of which were measured using high-performance liquid chromatography-tandem mass spectrometry. The product of this process was a reproducible botanical extract suitable for subsequent investigations of safety and efficacy. Copyright © 2014 John Wiley & Sons, Ltd.

Back-Hopping in Spin-Transfer-Torque Devices: Possible Origin and Countermeasures

Science.gov (United States)

Abert, Claas; Sepehri-Amin, Hossein; Bruckner, Florian; Vogler, Christoph; Hayashi, Masamitsu; Suess, Dieter

2018-05-01

The effect of undesirable high-frequency free-layer switching in magnetic multilayer systems, referred to as back-hopping, is investigated by means of the spin-diffusion model. A possible origin of the back-hopping effect is found to be the destabilization of the pinned layer, which leads to the perpetual switching of both layers. While the presented mechanism is not claimed to be the only possible reason for back-hopping, we show that it is a fundamental effect that will occur in any spin-transfer-torque device when exceeding a critical current. The influence of different material parameters on the critical switching currents for the free and pinned layer is obtained by micromagnetic simulations. The spin-diffusion model enables an accurate description of the torque on both layers, depending on various material parameters. It is found that the choice of a free-layer material with low polarization β and saturation magnetization Ms and a pinned-layer material with high β and Ms leads to a low free-layer critical current and a high pinned-layer critical current and hence reduces the likelihood of back-hopping. While back-hopping has been observed in various types of devices, there are only a few experiments that exhibit this effect in perpendicularly magnetized systems. However, our simulations suggest that the described effect will also gain importance in perpendicular systems due to the loss of pinned-layer anisotropy for decreasing device sizes.

Hopping magnetotransport via nonzero orbital momentum states and organic magnetoresistance.

Science.gov (United States)

Alexandrov, Alexandre S; Dediu, Valentin A; Kabanov, Victor V

2012-05-04

In hopping magnetoresistance of doped insulators, an applied magnetic field shrinks the electron (hole) s-wave function of a donor or an acceptor and this reduces the overlap between hopping sites resulting in the positive magnetoresistance quadratic in a weak magnetic field, B. We extend the theory of hopping magnetoresistance to states with nonzero orbital momenta. Different from s states, a weak magnetic field expands the electron (hole) wave functions with positive magnetic quantum numbers, m>0, and shrinks the states with negative m in a wide region outside the point defect. This together with a magnetic-field dependence of injection/ionization rates results in a negative weak-field magnetoresistance, which is linear in B when the orbital degeneracy is lifted. The theory provides a possible explanation of a large low-field magnetoresistance in disordered π-conjugated organic materials.

Communication devices for network-hopping communications and methods of network-hopping communications

Science.gov (United States)

Buttles, John W

2013-04-23

Wireless communication devices include a software-defined radio coupled to processing circuitry. The system controller is configured to execute computer programming code. Storage media is coupled to the system controller and includes computer programming code configured to cause the system controller to configure and reconfigure the software-defined radio to operate on each of a plurality of communication networks according to a selected sequence. Methods for communicating with a wireless device and methods of wireless network-hopping are also disclosed.

The SAHR Setup-Controlling Hopping Speed and Height Using a Single Actuator

Directory of Open Access Journals (Sweden)

N. Cherouvim

2008-01-01

Full Text Available In this paper we present and experimentally validate a control method for regulating both the forward speed and the apex height of a one-legged hopping robot, using only a single actuator. The control method is based on a dynamic model of the hopping robot and makes use of the dynamic coupling of the vertical and forward motions of the robot. The control is applied first to a simulated model of the robot and shown to track a desired forward robot speed and a desired apex height. Then the SAHR (single actuator hopping robot hardware is introduced and is used as an experimental platform with which to evaluate the performance of the control method. The control method is applied to the physical setup and is shown to lead to a stable hopping gait with a desired forward speed and apex height, despite the unmodelled disturbances met on the laboratory floor.

You know what it is: learning words through listening to hip-hop.

Science.gov (United States)

Chesley, Paula

2011-01-01

Music listeners have difficulty correctly understanding and remembering song lyrics. However, results from the present study support the hypothesis that young adults can learn African-American English (AAE) vocabulary from listening to hip-hop music. Non-African-American participants first gave free-response definitions to AAE vocabulary items, after which they answered demographic questions as well as questions addressing their social networks, their musical preferences, and their knowledge of popular culture. Results from the survey show a positive association between the number of hip-hop artists listened to and AAE comprehension vocabulary scores. Additionally, participants were more likely to know an AAE vocabulary item if the hip-hop artists they listen to use the word in their song lyrics. Together, these results suggest that young adults can acquire vocabulary through exposure to hip-hop music, a finding relevant for research on vocabulary acquisition, the construction of adolescent and adult identities, and the adoption of lexical innovations.

You know what it is: learning words through listening to hip-hop.

Directory of Open Access Journals (Sweden)

Paula Chesley

Full Text Available Music listeners have difficulty correctly understanding and remembering song lyrics. However, results from the present study support the hypothesis that young adults can learn African-American English (AAE vocabulary from listening to hip-hop music. Non-African-American participants first gave free-response definitions to AAE vocabulary items, after which they answered demographic questions as well as questions addressing their social networks, their musical preferences, and their knowledge of popular culture. Results from the survey show a positive association between the number of hip-hop artists listened to and AAE comprehension vocabulary scores. Additionally, participants were more likely to know an AAE vocabulary item if the hip-hop artists they listen to use the word in their song lyrics. Together, these results suggest that young adults can acquire vocabulary through exposure to hip-hop music, a finding relevant for research on vocabulary acquisition, the construction of adolescent and adult identities, and the adoption of lexical innovations.

Role of plasmids in Lactobacillus brevis BSO 464 hop tolerance and beer spoilage.

Science.gov (United States)

Bergsveinson, Jordyn; Baecker, Nina; Pittet, Vanessa; Ziola, Barry

2015-02-01

Specific isolates of lactic acid bacteria (LAB) can grow in the harsh beer environment, thus posing a threat to brew quality and the economic success of breweries worldwide. Plasmid-localized genes, such as horA, horC, and hitA, have been suggested to confer hop tolerance, a trait required for LAB survival in beer. The presence and expression of these genes among LAB, however, do not universally correlate with the ability to grow in beer. Genome sequencing of the virulent beer spoilage organism Lactobacillus brevis BSO 464 revealed the presence of eight plasmids, with plasmids 1, 2, and 3 containing horA, horC, and hitA, respectively. To investigate the roles that these and the other five plasmids play in L. brevis BSO 464 growth in beer, plasmid curing with novobiocin was used to derive 10 plasmid variants. Multiplex PCRs were utilized to determine the presence or absence of each plasmid, and how plasmid loss affected hop tolerance and growth in degassed (noncarbonated) beer was assessed. Loss of three of the eight plasmids was found to affect hop tolerance and growth in beer. Loss of plasmid 2 (horC and 28 other genes) had the most dramatic effect, with loss of plasmid 4 (120 genes) and plasmid 8 (47 genes) having significant, but smaller, impacts. These results support the contention that genes on mobile genetic elements are essential for bacterial growth in beer and that beer spoilage ability is not dependent solely on the three previously described hop tolerance genes or on the chromosome of a beer spoilage LAB isolate.

Alternative therapeutic approach to renal-cell carcinoma: induction of apoptosis with combination of vitamin K3 and D-fraction.

Science.gov (United States)

Degen, Michael; Alexander, Bobby; Choudhury, Muhammad; Eshghi, Majid; Konno, Sensuke

2013-12-01

Because of a dismal prognosis for advanced renal-cell carcinoma (RCC), an alternative therapeutic approach, using vitamin K3 (VK3) and D-fraction (DF) was investigated. VK3 is a synthetic VK derivative and DF is a bioactive mushroom extract, and they have been shown to have antitumor activity. We examined if the combination of VK3 and DF would exhibit the improved anticancer effect on RCC in vitro. Human RCC, ACHN cell line, were treated with varying concentrations of VK3, DF, or a combination of the two. Cell viability was assessed at 72 hours by MTT assay. To explore the possible anticancer mechanism, studies on cell cycle, chromatin modifications, and apoptosis were conducted. VK3 alone led to a ~20% reduction in cell viability at 4 μM, while DF alone induced a 20% to 45% viability reduction at ≥ 500 μg/mL. A combination of VK3 (4 μM) and DF (300 μg/mL) led to a drastic >90% viability reduction, however. Cell cycle analysis indicated that VK3/DF treatment induced a G1 cell cycle arrest, accompanied by the up-regulation of p21(WAF1) and p27(Kip1). Histone deacetylase (HDAC) was also significantly (~60%) inactivated, indicating chromatin modifications. In addition, Western blot analysis revealed that the up-regulation of Bax and activation of poly-(ADP-ribose)-polymerase (PARP) were seen in VK3/DF-treated cells, indicating induction of apoptosis. The combination of VK3 and DF can lead to a profound reduction in ACHN cell viability, through a p21(WAF1)-mediated G1 cell cycle arrest, and ultimately induces apoptosis. Therefore, the combination of VK3/DF may have clinical implications as an alternative, improved therapeutic modality for advanced RCC.

Comparison of modern 3D and 2D MR imaging sequences of the wrist at 3 Tesla

International Nuclear Information System (INIS)

Rehnitz, C.; Klaan, B.; Amarteifio, E.; Kauczor, H.U.; Weber, M.A.; Stillfried, F. von; Burkholder, I.

2016-01-01

To compare the image quality of modern 3 D and 2 D sequences for dedicated wrist imaging at 3 Tesla (T) MRI. At 3 T MRI, 18 patients (mean age: 36.2 years) with wrist pain and 16 healthy volunteers (mean age: 26.4 years) were examined using 2 D proton density-weighted fat-saturated (PDfs), isotropic 3 D TrueFISP, 3 D MEDIC, and 3 D PDfs SPACE sequences. Image quality was rated on a five-point scale (0 - 4) including overall image quality (OIQ), visibility of important structures (cartilage, ligaments, TFCC) and degree of artifacts. Signal-to-noise ratios (SNR) and contrast-to-noise ratios (CNR) of cartilage/bone/muscle/fluid as well as the mean overall SNR/CNR were calculated using region-of-interest analysis. ANOVA, paired t-, and Wilcoxon-signed-rank tests were applied. The image quality of all tested sequences was superior to 3 D PDfs SPACE (p < 0.01). 3 D TrueFISP had the highest combined cartilage score (mean: 3.4) and performed better in cartilage comparisons against 3 D PDfs SPACE in both groups and 2 D PDfs in volunteers (p < 0.05). 3 D MEDIC performed better in 7 of 8 comparisons (p < 0.05) regarding ligaments and TFCC. 2 D PDfs provided constantly high scores. The mean overall SNR/CNR for 2 D PDfs, 3 D PDfs SPACE, 3 D TrueFISP, and 3 D MEDIC were 68/65, 32/27, 45/47, and 57/45, respectively. 2 D PDfs performed best in most SNR/CNR comparisons (p < 0.05) and 3 D MEDIC performed best within the 3 D sequences (p < 0.05). Except 3 D PDfs SPACE, all tested 3 D and 2 D sequences provided high image quality. 3 D TrueFISP was best for cartilage imaging, 3 D MEDIC for ligaments and TFCC and 2 D PDfs for general wrist imaging.

Combining Front Vehicle Detection with 3D Pose Estimation for a Better Driver Assistance

Directory of Open Access Journals (Sweden)

Yu Peng

2012-09-01

Full Text Available Driver assistant systems enhance traffic safety and efficiency. The accurate 3D pose of a front vehicle can help a driver to make the right decision on the road. We propose a novel real-time system to estimate the 3D pose of the front vehicle. This system consists of two parallel threads: vehicle rear tracking and mapping. The vehicle rear is first identified in the video captured by an onboard camera, after license plate localization and foreground extraction. The 3D pose estimation technique is then employed with respect to the extracted vehicle rear. Most current 3D pose estimation techniques need prior models or a stereo initialization with user cooperation. It is extremely difficult to obtain prior models due to the varying appearance of vehicles' rears. Moreover, it is unsafe to ask for drivers' cooperation when a vehicle is running. In our system, two initial keyframes for stereo algorithms are automatically extracted by vehicle rear detection and tracking. Map points are defined as a collection of point features extracted from the vehicle's rear with their 3D information. These map points are inferences that relate the 2D features detected in following vehicles' rears with the 3D world. The relative 3D pose of the onboard camera to the front vehicle rear is then estimated through matching the map points with point features detected on the front vehicle rear. We demonstrate the capabilities of our system by testing on real-time and synthesized videos. In order to make the experimental analysis visible, we demonstrated an estimated 3D pose through augmented reality, which needs accurate and real-time 3D pose estimation.

Low temperature resistivity studies of SmB6: Observation of two-dimensional variable-range hopping conductivity

Science.gov (United States)

Batkova, Marianna; Batko, Ivan; Gabáni, Slavomír; Gažo, Emil; Konovalova, Elena; Filippov, Vladimir

2018-05-01

We studied electrical resistance of a single-crystalline SmB6 sample with a focus on the region of the "low-temperature resistivity plateau". Our observations did not show any true saturation of the electrical resistance at temperatures below 3 K down to 70 mK. According to our findings, temperature dependence of the electrical conduction in a certain temperature interval above 70 mK can be decomposed into a temperature-independent term and a temperature-activated term that can be described by variable-range hopping formula for two-dimensional systems, exp [ -(T0 / T) 1 / 3 ]. Thus, our results indicate importance of hopping type of electrical transport in the near-surface region of SmB6.

Mode competition and hopping in optomechanical nano-oscillators

Science.gov (United States)

Zhang, Xingwang; Lin, Tong; Tian, Feng; Du, Han; Zou, Yongchao; Chau, Fook Siong; Zhou, Guangya

2018-04-01

We investigate the inter-mode nonlinear interaction in the multi-mode optomechanical nano-oscillator which consists of coupled silicon nanocantilevers, where the integrated photonic crystal nanocavities provide the coupling between the optical and mechanical modes. Due to the self-saturation and cross-saturation of the mechanical gain, the inter-mode competition is observed, which leads to the bistable operation of the optomechanical nano-oscillator: only one of the mechanical modes can oscillate at any one time, and the oscillation of one mode extremely suppresses that of the other with a side mode suppression ratio (SMSR) up to 40 dB. In the meantime, mode hopping, i.e., the optomechanical oscillation switches from one mode to the other, is also observed and found to be able to be provoked by excitation laser fluctuations.

Effect of storage on the brewing properties of tropical hop substitutes

African Journals Online (AJOL)

SERVER

2007-06-18

Jun 18, 2007 ... Conclusively, tropical hop substitutes stored at 5 ± 1oC to 27 ± 1oC can still be used for brewing even after three to six months storage. .... which is associated with the oxidative depreciation of the soft resins to hard resins ... Changes in the soft resin levels of hop substitutes with storage. Soft resin levels (%).

QTL analysis of resistance to powdery mildew in Hop (Humulus lupulus L.)

Science.gov (United States)

Powdery mildew infection of hop results in significant production losses on an annual basis by reducing yields as well as cone quality. One of the best means to increase yield and quality is the production of resistant hop lines. Breeding for resistance can be significantly improved and accelerate...

Student Perceptions of the Hip Hop Culture's Influence on the Undergraduate Experience

Science.gov (United States)

Wessel, Roger D.; Wallaert, Kerry A.

2011-01-01

This study sought to determine how identification and engagement with the hip hop culture influenced the educational experiences of undergraduate students at a Midwestern, predominately White university by interviewing 11 students who self-identified as being immersed in the hip hop culture. Through a qualitative, phenomenological investigation,…

Reconstruction and Analysis of Shapes from 3D Scans

NARCIS (Netherlands)

Haar, F.B. ter

2009-01-01

In this thesis, we measure 3D shapes with the use of 3D laser technology, a recent technology that combines physics, mathematics, and computer science to acquire the surface geometry of 3D shapes in the computer. We use this surface geometry to fully reconstruct real world shapes as computer models,

Use of 3D printed models in medical education: A randomized control trial comparing 3D prints versus cadaveric materials for learning external cardiac anatomy.

Science.gov (United States)

Lim, Kah Heng Alexander; Loo, Zhou Yaw; Goldie, Stephen J; Adams, Justin W; McMenamin, Paul G

2016-05-06

Three-dimensional (3D) printing is an emerging technology capable of readily producing accurate anatomical models, however, evidence for the use of 3D prints in medical education remains limited. A study was performed to assess their effectiveness against cadaveric materials for learning external cardiac anatomy. A double blind randomized controlled trial was undertaken on undergraduate medical students without prior formal cardiac anatomy teaching. Following a pre-test examining baseline external cardiac anatomy knowledge, participants were randomly assigned to three groups who underwent self-directed learning sessions using either cadaveric materials, 3D prints, or a combination of cadaveric materials/3D prints (combined materials). Participants were then subjected to a post-test written by a third party. Fifty-two participants completed the trial; 18 using cadaveric materials, 16 using 3D models, and 18 using combined materials. Age and time since completion of high school were equally distributed between groups. Pre-test scores were not significantly different (P = 0.231), however, post-test scores were significantly higher for 3D prints group compared to the cadaveric materials or combined materials groups (mean of 60.83% vs. 44.81% and 44.62%, P = 0.010, adjusted P = 0.012). A significant improvement in test scores was detected for the 3D prints group (P = 0.003) but not for the other two groups. The finding of this pilot study suggests that use of 3D prints do not disadvantage students relative to cadaveric materials; maximally, results suggest that 3D may confer certain benefits to anatomy learning and supports their use and ongoing evaluation as supplements to cadaver-based curriculums. Anat Sci Educ 9: 213-221. © 2015 American Association of Anatomists. © 2015 American Association of Anatomists.

Involvement of Vacuolar Sequestration and Active Transport in Tolerance of Saccharomyces cerevisiae to Hop Iso-?-Acids

NARCIS (Netherlands)

Hazelwood, L.A.; Walsh, M.C.; Pronk, J.T.; Daran, J.M.

2009-01-01

The hop plant, Humulus lupulus L., has an exceptionally high content of secondary metabolites, the hop -acids, which possess a range of beneficial properties, including antiseptic action. Studies performed on the mode of action of hop iso--acids have hitherto been restricted to lactic acid bacteria.

Multi-hop routing in wireless sensor networks an overview, taxonomy, and research challenges

CERN Document Server

Rani, Shalli

2016-01-01

This brief provides an overview of recent developments in multi-hop routing protocols for Wireless Sensor Networks (WSNs). It introduces the various classifications of routing protocols and lists the pros and cons of each category, going beyond the conceptual overview of routing classifications offered in other books. Recently many researchers have proposed numerous multi-hop routing protocols and thereby created a need for a book that provides its readers with an up-to-date road map of this research paradigm.   The authors present some of the most relevant results achieved by applying an algorithmic approach to the research on multi-hop routing protocols. The book covers measurements, experiences and lessons learned from the implementation of multi-hop communication prototypes. Furthermore, it describes future research challenges and as such serves as a useful guide for students and researchers alike.

Interplay of radiative and nonradiative transitions in surface hopping with radiation-molecule interactions

Energy Technology Data Exchange (ETDEWEB)

Bajo, Juan José [Departamento de Química-Física I, Universidad Complutense de Madrid, 28040 Madrid (Spain); Granucci, Giovanni, E-mail: giovanni.granucci@unipi.it; Persico, Maurizio [Università di Pisa, Dipartimento di Chimica e Chimica Industriale, via Risorgimento 35, 56126 Pisa (Italy)

2014-01-28

We implemented a method for the treatment of field induced transitions in trajectory surface hopping simulations, in the framework of the local diabatization scheme, especially suited for on-the-fly dynamics. The method is applied to a simple one-dimensional model with an avoided crossing and compared with quantum wavepacket dynamics. The results show the importance of introducing a proper decoherence correction to surface hopping, in order to obtain meaningful results. Also the energy conservation policy of standard surface hopping must be revised: in fact, the quantum wavepacket energetics is well reproduced if energy absorption/emission is allowed for in the hops determined by radiation-molecule coupling. To our knowledge, this is the first time the issues of decoherence and energy conservation have been analyzed in depth to devise a mixed quantum-classical method for dynamics with molecule-field interactions.

3D Printed Robotic Hand

Science.gov (United States)

Pizarro, Yaritzmar Rosario; Schuler, Jason M.; Lippitt, Thomas C.

2013-01-01

Dexterous robotic hands are changing the way robots and humans interact and use common tools. Unfortunately, the complexity of the joints and actuations drive up the manufacturing cost. Some cutting edge and commercially available rapid prototyping machines now have the ability to print multiple materials and even combine these materials in the same job. A 3D model of a robotic hand was designed using Creo Parametric 2.0. Combining "hard" and "soft" materials, the model was printed on the Object Connex350 3D printer with the purpose of resembling as much as possible the human appearance and mobility of a real hand while needing no assembly. After printing the prototype, strings where installed as actuators to test mobility. Based on printing materials, the manufacturing cost of the hand was $167, significantly lower than other robotic hands without the actuators since they have more complex assembly processes.

3D visualisation of the middle ear and adjacent structures using reconstructed multi-slice CT datasets, correlating 3D images and virtual endoscopy to the 2D cross-sectional images