SIRT1 may play a crucial role in overload-induced hypertrophy of skeletal muscle.
Koltai, Erika; Bori, Zoltán; Chabert, Clovis; Dubouchaud, Hervé; Naito, Hisashi; Machida, Shuichi; Davies, Kelvin Ja; Murlasits, Zsolt; Fry, Andrew C; Boldogh, Istvan; Radak, Zsolt
2017-06-01
Silent mating type information regulation 2 homologue 1 (SIRT1) activity and content increased significantly in overload-induced hypertrophy. SIRT1-mediated signalling through Akt, the endothelial nitric oxide synthase mediated pathway, regulates anabolic process in the hypertrophy of skeletal muscle. The regulation of catabolic signalling via forkhead box O 1 and protein ubiquitination is SIRT1 dependent. Overload-induced changes in microRNA levels regulate SIRT1 and insulin-like growth factor 1 signalling. Significant skeletal muscle mass guarantees functional wellbeing and is important for high level performance in many sports. Although the molecular mechanism for skeletal muscle hypertrophy has been well studied, it still is not completely understood. In the present study, we used a functional overload model to induce plantaris muscle hypertrophy by surgically removing the soleus and gastrocnemius muscles in rats. Two weeks of muscle ablation resulted in a 40% increase in muscle mass, which was associated with a significant increase in silent mating type information regulation 2 homologue 1 (SIRT1) content and activity (P overload-induced hypertrophy. These findings, along with the well-known regulatory roles that SIRT1 plays in modulating both anabolic and catabolic pathways, allow us to propose the hypothesis that SIRT1 may actually play a crucial causal role in overload-induced hypertrophy of skeletal muscle. This hypothesis will now require rigorous direct and functional testing. © 2017 The Authors. The Journal of Physiology © 2017 The Physiological Society.
TRBP and eIF6 homologue in Marsupenaeus japonicus play crucial roles in antiviral response.
Directory of Open Access Journals (Sweden)
Shuai Wang
Full Text Available Plants and invertebrates can suppress viral infection through RNA silencing, mediated by RNA-induced silencing complex (RISC. Trans-activation response RNA-binding protein (TRBP, consisting of three double-stranded RNA-binding domains, is a component of the RISC. In our previous paper, a TRBP homologue in Fenneropenaeus chinensis (Fc-TRBP was reported to directly bind to eukaryotic initiation factor 6 (Fc-eIF6. In this study, we further characterized the function of TRBP and the involvement of TRBP and eIF6 in antiviral RNA interference (RNAi pathway of shrimp. The double-stranded RNA binding domains (dsRBDs B and C of the TRBP from Marsupenaeus japonicus (Mj-TRBP were found to mediate the interaction of TRBP and eIF6. Gel-shift assays revealed that the N-terminal of Mj-TRBP dsRBD strongly binds to double-stranded RNA (dsRNA and that the homodimer of the TRBP mediated by the C-terminal dsRBD increases the affinity to dsRNA. RNAi against either Mj-TRBP or Mj-eIF6 impairs the dsRNA-induced sequence-specific RNAi pathway and facilitates the proliferation of white spot syndrome virus (WSSV. These results further proved the important roles of TRBP and eIF6 in the antiviral response of shrimp.
Directory of Open Access Journals (Sweden)
Bateman Alex
2009-09-01
Full Text Available Abstract Background Peptidase family A1, to which pepsin belongs, had been assumed to be restricted to eukaryotes. The tertiary structure of pepsin shows two lobes with similar folds and it has been suggested that the gene has arisen from an ancient duplication and fusion event. The only sequence similarity between the lobes is restricted to the motif around the active site aspartate and a hydrophobic-hydrophobic-Gly motif. Together, these contribute to an essential structural feature known as a psi-loop. There is one such psi-loop in each lobe, and so each lobe presents an active Asp. The human immunodeficiency virus peptidase, retropepsin, from peptidase family A2 also has a similar fold but consists of one lobe only and has to dimerize to be active. All known members of family A1 show the bilobed structure, but it is unclear if the ancestor of family A1 was similar to an A2 peptidase, or if the ancestral retropepsin was derived from a half-pepsin gene. The presence of a pepsin homologue in a prokaryote might give insights into the evolution of the pepsin family. Results Homologues of the aspartic peptidase pepsin have been found in the completed genomic sequences from seven species of bacteria. The bacterial homologues, unlike those from eukaryotes, do not possess signal peptides, and would therefore be intracellular acting at neutral pH. The bacterial homologues have Thr218 replaced by Asp, a change which in renin has been shown to confer activity at neutral pH. No pepsin homologues could be detected in any archaean genome. Conclusion The peptidase family A1 is found in some species of bacteria as well as eukaryotes. The bacterial homologues fall into two groups, one from oceanic bacteria and one from plant symbionts. The bacterial homologues are all predicted to be intracellular proteins, unlike the eukaryotic enzymes. The bacterial homologues are bilobed like pepsin, implying that if no horizontal gene transfer has occurred the duplication
The First Call Note Plays a Crucial Role in Frog Vocal Communication.
Yue, Xizi; Fan, Yanzhu; Xue, Fei; Brauth, Steven E; Tang, Yezhong; Fang, Guangzhan
2017-08-31
Vocal Communication plays a crucial role in survival and reproductive success in most amphibian species. Although amphibian communication sounds are often complex consisting of many temporal features, we know little about the biological significance of each temporal component. The present study examined the biological significance of notes of the male advertisement calls of the Emei music frog (Babina daunchina) using the optimized electroencephalogram (EEG) paradigm of mismatch negativity (MMN). Music frog calls generally contain four to six notes separated approximately by 150 millisecond intervals. A standard stimulus (white noise) and five deviant stimuli (five notes from one advertisement call) were played back to each subject while simultaneously recording multi-channel EEG signals. The results showed that the MMN amplitude for the first call note was significantly larger than for that of the others. Moreover, the MMN amplitudes evoked from the left forebrain and midbrain were typically larger than those from the right counterpart. These results are consistent with the ideas that the first call note conveys more information than the others for auditory recognition and that there is left-hemisphere dominance for processing information derived from conspecific calls in frogs.
Rella, Monika; Elliot, Joann L; Revett, Timothy J; Lanfear, Jerry; Phelan, Anne; Jackson, Richard M; Turner, Anthony J; Hooper, Nigel M
2007-01-01
Abstract Background Mammalian angiotensin converting enzyme (ACE) plays a key role in blood pressure regulation. Although multiple ACE-like proteins exist in non-mammalian organisms, to date only one other ACE homologue, ACE2, has been identified in mammals. Results Here we report the identification and characterisation of the gene encoding a third homologue of ACE, termed ACE3, in several mammalian genomes. The ACE3 gene is located on the same chromosome downstream of the ACE gene. Multiple ...
Alexiadis, Anastasios; Delidakis, Christos; Kalantidis, Kriton
2017-07-01
The conserved 3'-5' RNA exonuclease ERI1 is implicated in RNA interference inhibition, 5.8S rRNA maturation and histone mRNA maturation and turnover. The single ERI1 homologue in Drosophila melanogaster Snipper (Snp) is a 3'-5' exonuclease, but its in vivo function remains elusive. Here, we report Snp requirement for normal Drosophila development, since its perturbation leads to larval arrest and tissue-specific downregulation results in abnormal tissue development. Additionally, Snp directly interacts with histone mRNA, and its depletion results in drastic reduction in histone transcript levels. We propose that Snp protects the 3'-ends of histone mRNAs and upon its absence, histone transcripts are readily degraded. This in turn may lead to cell cycle delay or arrest, causing growth arrest and developmental perturbations. © 2017 Federation of European Biochemical Societies.
Epoxy adhesive plays crucial role at CERN
2007-01-01
"Epoxy adhesives are set to play a vital role in Europe's biggest-ever scientific experiment at the European Centrefor Nuclear Research (CERN) in Geneva, Switzerland, thereby helping scientists gain a better understanding of the origins of the universe." (1/2 page)
Epoxy adhesive plays crucial role at CERN
2006-01-01
"Epoxy adhesives are set to play a vital role in Europe's biggest-ever scientific experiment at the European Centre for Nuclear Research (CERN) in Geneva, Switzerland, thereby helping scientists gain a better understanding of the origins of the universe." (1 page)
Homologue Pairing in Flies and Mammals: Gene Regulation When Two Are Involved
Directory of Open Access Journals (Sweden)
Manasi S. Apte
2012-01-01
Full Text Available Chromosome pairing is usually discussed in the context of meiosis. Association of homologues in germ cells enables chromosome segregation and is necessary for fertility. A few organisms, such as flies, also pair their entire genomes in somatic cells. Most others, including mammals, display little homologue pairing outside of the germline. Experimental evidence from both flies and mammals suggests that communication between homologues contributes to normal genome regulation. This paper will contrast the role of pairing in transmitting information between homologues in flies and mammals. In mammals, somatic homologue pairing is tightly regulated, occurring at specific loci and in a developmentally regulated fashion. Inappropriate pairing, or loss of normal pairing, is associated with gene misregulation in some disease states. While homologue pairing in flies is capable of influencing gene expression, the significance of this for normal expression remains unknown. The sex chromosomes pose a particularly interesting situation, as females are able to pair X chromosomes, but males cannot. The contribution of homologue pairing to the biology of the X chromosome will also be discussed.
Three TFL1 homologues regulate floral initiation in the biofuel plant Jatropha curcas
Li, Chaoqiong; Fu, Qiantang; Niu, Longjian; Luo, Li; Chen, Jianghua; Xu, Zeng-Fu
2017-01-01
Recent research revealed that TERMINAL FLOWER 1 (TFL1) homologues are involved in the critical developmental process of floral initiation in several plant species. In this study, the functions of three putative TFL1 homologues (JcTFL1a, JcTFL1b and JcTFL1c) in the biofuel plant Jatropha curcas were analysed using the transgenic approach. JcTFL1b and JcTFL1c, but not JcTFL1a, could complement the TFL1 function and rescue early flowering and determinate inflorescence phenotype in tfl1-14 Arabidopsis mutant, thus suggesting that JcTFL1b and JcTFL1c may be homologues of TFL1. Transgenic Jatropha overexpressing JcTFL1a, JcTFL1b or JcTFL1c showed late flowering, whereas only JcTFL1b and JcTFL1c overexpression delayed flowering in transgenic Arabidopsis. JcTFL1b-RNAi transgenic Jatropha consistently exhibited moderately early flowering phenotype. JcFT and JcAP1 were significantly downregulated in transgenic Jatropha overexpressing JcTFL1a, JcTFL1b or JcTFL1c, which suggested that the late flowering phenotype of these transgenic Jatropha may result from the repressed expression of JcFT and JcAP1. Our results indicate that these three JcTFL1 genes play redundant roles in repressing flowering in Jatropha. PMID:28225036
Over-expression, purification and characterization of an Asc-1 homologue from Gloeobacter violaceus
DEFF Research Database (Denmark)
Wang, Xiaole; Hald, Helle; Ernst, Heidi Asschenfeldt
2010-01-01
The human alanine-serine-cysteine transporter 1 (Asc-1) belongs to the slc7a family of solute carrier transporters. Asc-1 mediates the uptake of D-serine in an exchanger-type fashion, coupling the process to the release of alanine and cysteine. Among the bacterial Asc-1 homologues, one transporter...... of auto-induction was crucial for obtaining high yields and purity of the transporter. The transporter was purified with yields in the range of 0.2-0.4 mg per L culture and eluted in a single peak from a size-exclusion column. The circular dichroism spectrum revealed a folded and apparently all...
Homologue Pairing in Flies and Mammals: Gene Regulation When Two Are Involved
Apte, Manasi S.; Meller, Victoria H.
2011-01-01
Chromosome pairing is usually discussed in the context of meiosis. Association of homologues in germ cells enables chromosome segregation and is necessary for fertility. A few organisms, such as flies, also pair their entire genomes in somatic cells. Most others, including mammals, display little homologue pairing outside of the germline. Experimental evidence from both flies and mammals suggests that communication between homologues contributes to normal genome regulation. This paper will co...
Dinesh, Bhimareddy; Squillaci, Marco A; Ménard-Moyon, Cécilia; Samorì, Paolo; Bianco, Alberto
2015-10-14
The integration of carbon nanotubes (CNTs) into organized nanostructures is of great interest for applications in materials science and biomedicine. In this work we studied the self-assembly of β and γ homologues of diphenylalanine peptides under different solvent and pH conditions. We aimed to investigate the role of peptide backbone in tuning the formation of different types of nanostructures alone or in combination with carbon nanotubes. In spite of having the same side chain, β and γ peptides formed distinctively different nanofibers, a clear indication of the role played by the backbone homologation on the self-assembly. The variation of the pH allowed to transform the nanofibers into spherical structures. Moreover, the co-assembly of β and γ peptides with carbon nanotubes covalently functionalized with the same peptide generated unique dendritic assemblies. This comparative study on self-assembly using diphenylalanine backbone homologues and of the co-assembly with CNT covalent conjugates is the first example exploring the capacity of β and γ peptides to adopt precise nanostructures, particularly in combination with carbon nanotubes. The dendritic organization obtained by mixing carbon nanotubes and peptides might find interesting applications in tissue engineering and neuronal interfacing.
Directory of Open Access Journals (Sweden)
Jianrao HU, Mingfu CAO, Jiong Chen
2009-10-01
Full Text Available Bactericidal/permeability-increasing protein (BPI and LPS-binding protein (LBP play an important role in host defence. Current evidence shows that BPI/LBP may be widely existed in different cells and tissue types of animals. A full-length cDNA clone encoding a BPI/LBP homologue (dBPI, 1757bp in size, was characterized in venom gland of the hundred-pace snake Deinagkistrodon acutus. Its deduced amino acid sequence of 417 residues had 13.8%–21.5% identity to BPI like 1(BPIL1 and BPI like 3(BPIL3 of other animals. Conserved cysteine residues which are involved in disulfide bond formation between the final strand of the N-terminal beta sheet and the long alpha helix of BPI are identified as Cys146-Cys183 of dBPI. Phylogenetic tree analysis showed that the BPI/LBP homologues formed five large clusters and dBPI was in a large cluster including BPIL1 and BPIL3. dBPI mRNA shows a tissue specific expression in venom gland. This is the first study to identify the cDNA encoding BPI/LBP homologues from reptiles [Current Zoology 55 (5: –2009].
Monolayer structures of alkyl aldehydes: Odd-membered homologues
International Nuclear Information System (INIS)
Phillips, T.K.; Clarke, S.M.; Bhinde, T.; Castro, M.A.; Millan, C.; Medina, S.
2011-01-01
Crystalline monolayers of three aldehydes with an odd number of carbon atoms in the alkyl chain (C 7 , C 9 and C 11 ) at low coverages are observed by a combination of X-ray and neutron diffraction. Analysis of the diffraction data is discussed and possible monolayer crystal structures are proposed; although unique structures could not be ascertained for all molecules. We conclude that the structures are flat on the surface, with the molecules lying in the plane of the layer. The C 11 homologue is determined to have a plane group of either p2, pgb or pgg, and for the C 7 homologue the p2 plane group is preferred.
International Nuclear Information System (INIS)
Azevedo, W.F.; Ward, R.J.; Lombardi, F.R.; Arni, R.K.; Soares, A.M.; Giglio, J.R.; Fontes, M.R.M.
1997-01-01
Full text. Phospho lipases A2 (PLA 2 ; E C 3.1.1.4, phosphatides s n-2 acyl hydrolases) hydrolysis the s n-2 ester bond of phospholipids showing enhanced activity at lamellar or membrane surfaces. Intracellular PLA 2 s are involved at phospholipid metabolism and signal transduction, whereas extracellular PLA 2 s are found in mammalian pancreatic juices, the venoms of snakes, lizards and insects. Based on their high primary sequence similarity, extracellular PLA 2 s are separated into Classes I, II and III. Class II PLA 2 s are found in snake venoms of Crotalidae an Viperidae species, and include the sub-family of Lys PLA 2 s homologue. he coordination of the Ca 2+ ion in the PLA 2 calcium-binding loop includes and aspartate at position 49. In the catalytically active PLA 2 s, this calcium ion plays a critical role in the stabilization of the tetrahedral transition state intermediate in the catalytic mechanism. The conservative substitution Asp49-Lys results in a decreased calcium affinity with a concomitant loss of catalytic activity, and naturally occurring PLA 2 s-homologues showing the same substitution are catalytically inactive. However, the Lys PLA 2 s possess cytolytic and myotoxic activities and furthermore retain the ability to disrupt the integrity of both plasma membranes and model lipid layers by a ca 2+ -independent mechanism for which there is no evidence of lipid hydrolysis. Lys 49 PLA 2 homologues have been isolated from several Bothrops spp. venoms including B. moojeni. Therefore, in order to improve our understanding of the molecular basis of the myotoxic and Ca 2+ independent membrane damaging activities we have determined the crystal structure of MjTX-II, a Lys 49 homologue from the venom of B. moojeni. The model presented has been determined at 2.0 A resolution and refined to a crystallographic residual of 19.7% (R f ree=28.1%). (author)
Kasthuri, Saranya Revathy; Premachandra, H K A; Umasuthan, Navaneethaiyer; Whang, Ilson; Lee, Jehee
2013-09-15
Repertoires of proteins and small peptides play numerous physiological roles as hormones, antimicrobial peptides, and cellular signaling factors. The beta-thymosins are a group of small acidic peptides involved in processes such as actin sequestration, neuronal development, wound healing, tissue repair, and angiogenesis. Recent characterization of the beta thymosins as immunological regulators in invertebrates led to our identification and characterization of a beta-thymosin homologue (Tβ) from Haliotis discus discus. The cDNA possessed an ORF of 132 bp encoding a protein of 44 amino acids with a molecular mass of 4977 Da. The amino acid sequence shows high identity with another molluskan beta-thymosin and has a characteristic actin binding motif (LKKTET) and glutamyl donors. Phylogenetic analysis showed a close relationship with molluskan homologues, as well as its distinct identity and common ancestral origin. Genomic analysis revealed a 3 exon-2 intron structure similar to the other homologues. In silico promoter analysis also revealed significant transcription factor binding sites, providing evidence for the expression of this gene under different cellular conditions, including stress or pathogenic attack. Tissue distribution profiling revealed a ubiquitous presence in all the examined tissues, but with the highest expression in mantle and hemocyte. Immune challenge with lipopolysaccharide, poly I:C and Vibrio parahemolyticus induced beta-thymosin expression in gill and hemocytes, affirming an immune-related role in invertebrates. Copyright © 2013 Elsevier B.V. All rights reserved.
The Mycobacterium tuberculosis homologue of the Mycobacterium ...
African Journals Online (AJOL)
With the completion of genome sequencing of Mycobacterium tuberculosis and upsurge in the incidence of M. tuberculosis infection worldwide partly as a result of HIV pandemic, there is need for rationale approach to vaccine and chemotherapy discoveries for M. tuberculosis. The homologue of mig gene of. Mycobacterium ...
Detection of a Yersinia pestis gene homologue in rodent samples
Directory of Open Access Journals (Sweden)
Timothy A. Giles
2016-08-01
Full Text Available A homologue to a widely used genetic marker, pla, for Yersinia pestis has been identified in tissue samples of two species of rat (Rattus rattus and Rattus norvegicus and of mice (Mus musculus and Apodemus sylvaticus using a microarray based platform to screen for zoonotic pathogens of interest. Samples were from urban locations in the UK (Liverpool and Canada (Vancouver. The results indicate the presence of an unknown bacterium that shares a homologue for the pla gene of Yersinia pestis, so caution should be taken when using this gene as a diagnostic marker.
International Nuclear Information System (INIS)
Canduri, R.J.; Ward, R.J.; Azevedo Junior, G.W.F. de; Arni, R.K.; Soares, A.M.; Giglio, J.R.
1997-01-01
Full text. Phospho lipases A2 (PLA 2 ) are small enzymes that specifically hydrolysed the sn-2 ester bond of phospholipids, preferentially in lamellar or micellar aggregates at membrane surfaces. These enzymes are widely distributed in nature and have been extensively studied. Toxic proteins from venoms from Bothrops species include catalytically active PLA 2 s and calcium independent PLA 2L ys 49 homologues. The substitution of Asp49 by Lys greatly diminishes the ability of these PLA 2 to bind calcium, an ion that plays a critical role in the stabilization of the tetrahedral transition state intermediate in the catalytic mechanism. The Lys 49 PLA 2 homologues and therefore catalytically inactive yet maintain cytolytic and myotoxic activities and furthermore retain the ability to disrupt the integrity of both plasma membranes and model lipid bilayers by a poorly understood Ca 2+ independente mechanism. Lys49 PLA 2 homologues demonstrate a specific toxic activity against skeletal muscle, affecting only muscle fibers and leaving other tissue structure such as connective tissue, nerves and vessels essentially unharmed. In order to improve our understanding of the molecular basis of the myotoxic and Ca 2+ -independent membrane damaging activities, we have determined the crystal structure of Pr TX-I, a Lys49 variant from the venom of B. pirajai. The model presented has been determined at 2.8 angstrom resolution and refined to a crystallographic residual of 19.7% (R free =29.7%). (author)
Phosphatase and tensin homologue deleted on chromosome 10 ...
African Journals Online (AJOL)
Phosphatase and tensin homologue deleted on chromosome 10 (PTEN) is a tumor suppressor gene deleted or mutated in many human cancers such as glioblastoma, spinal tumors, prostate, bladder, adrenals, thyroid, breast, endometrium, and colon cancers. They result from loss of heterozygosity (LOH) for the PTEN ...
The Orphan Nuclear Receptor TLX/NR2E1 in Neural Stem Cells and Diseases.
Wang, Tao; Xiong, Jian-Qiong
2016-02-01
The human TLX gene encodes an orphan nuclear receptor predominantly expressed in the central nervous system. Tailess and Tlx, the TLX homologues in Drosophila and mouse, play essential roles in body-pattern formation and neurogenesis during early embryogenesis and perform crucial functions in maintaining stemness and controlling the differentiation of adult neural stem cells in the central nervous system, especially the visual system. Multiple target genes and signaling pathways are regulated by TLX and its homologues in specific tissues during various developmental stages. This review aims to summarize previous studies including many recent updates from different aspects concerning TLX and its homologues in Drosophila and mouse.
Coddeville, Bernadette; Wu, Sz-Wei; Fabre, Emeline; Brassart, Colette; Rombouts, Yoann; Burguière, Adeline; Kremer, Laurent; Khoo, Kay-Hooi; Elass-Rochard, Elisabeth; Guérardel, Yann
2012-10-22
The 45/47 kDa Apa, an immuno-dominant antigen secreted by Mycobacterium tuberculosis is O-mannosylated at multiple sites. Glycosylation of Apa plays a key role in colonization and invasion of the host cells by M. tuberculosis through interactions of Apa with the host immune system C-type lectins. Mycobacterium marinum (M.ma) a fish pathogen, phylogenetically close to M. tuberculosis, induces a granulomatous response with features similar to those described for M. tuberculosis in human. Although M.ma possesses an Apa homologue, its glycosylation status is unknown, and whether this represents a crucial element in the pathophysiology induced by M.ma remains to be addressed. To this aim, we have identified two concanavalin A-reactive 45/47 kDa proteins from M.ma, which have been further purified by a two-step anion exchange chromatography process. Advanced liquid chromatography-nanoESI mass spectrometry-based proteomic analyses of peptides, derived from either tryptic digestion alone or in combination with the Asp-N endoproteinase, established that M.ma Apa possesses up to seven distinct O-mannosylated sites with mainly single mannose substitutions, which can be further extended at the Ser/Thr/Pro rich region near the N-terminus. This opens the way to further studies focussing on the involvement and biological functions of Apa O-mannosylation using the M.ma/zebrafish model. Copyright © 2012 Elsevier B.V. All rights reserved.
Characterization of four RecQ homologues from rice (Oryza sativa L. cv. Nipponbare)
International Nuclear Information System (INIS)
Saotome, Ai; Kimura, Seisuke; Mori, Yoko; Uchiyama, Yukinobu; Morohashi, Kengo; Sakaguchi, Kengo
2006-01-01
The RecQ family of DNA helicases is conserved throughout the biological kingdoms. In this report, we have characterized four RecQ homologues clearly expressed in rice. OsRecQ1, OsRecQ886, and OsRecQsim expressions were strongly detected in meristematic tissues. Transcription of the OsRecQ homologues was differentially induced by several types of DNA-damaging agents. The expression of four OsRecQ homologues was induced by MMS and bleomycin. OsRecQ1 and OsRecQ886 were induced by H 2 O 2 , and MitomycinC strongly induced the expression of OsRecQ1. Transient expression of OsRecQ/GFP fusion proteins demonstrated that OsRecQ2 and OsRecQ886 are found in nuclei, whereas OsRecQ1 and OsRecQsim are found in plastids. Neither OsRecQ1 nor OsRecQsim are induced by light. These results indicate that four of the RecQ homologues have different and specific functions in DNA repair pathways, and that OsRecQ1 and OsRecQsim may not involve in plastid differentiation but different aspects of a plastid-specific DNA repair system
Analysis and Solution to the Crucial Problems during Brass Instrument Playing%铜管演奏把握性问题的分析与处理
Institute of Scientific and Technical Information of China (English)
张良; 史育松
2015-01-01
The paper lists and analyzes the crucial problems during brass instruments playing. And it also sums up three factors during brass instruments which can cause the problems:playing skill ,playing psychology and physical capacity as well, and offers specific solutions to the problems.%本文列举了以往铜管演奏者在演奏中出现的把握性问题,并对其进行了分析研究,认为至少有3个方面的原因:演奏技术的问题,演奏心理的问题,体力与体能的原因。针对这3个方面的原因文章提出了具体的解决办法。
Directory of Open Access Journals (Sweden)
Grauman Peter L
2007-07-01
Full Text Available Abstract Background Frataxin is discussed as involved in the biogenesis of iron-sulfur clusters. Recently it was discovered that a frataxin homologue is a structural component of the respiratory NADH:ubiquinone oxidoreductase (complex I in Thermus thermophilus. It was not clear whether frataxin is in general a component of complex I from bacteria. The Escherichia coli homologue of frataxin is coined CyaY. Results We report that complex I is completely assembled to a stable and active enzyme complex equipped with all known iron-sulfur clusters in a cyaY mutant of E. coli. However, the amount of complex I is reduced by one third compared to the parental strain. Western blot analysis and live cell imaging of CyaY engineered with a GFP demonstrated that CyaY is located in the cytoplasm and not attached to the membrane as to be expected if it were a component of complex I. Conclusion CyaY plays a non-essential role in the assembly of complex I in E. coli. It is not a structural component but may transiently interact with the complex.
Parents' Play Beliefs and Engagement in Young Children's Play at Home
Lin, Xunyi; Li, Hui
2018-01-01
Play is a fundamental concept in early childhood development and education. As partners in the child's learning, parents play a crucial role in how play is defined, valued, and practised. The present study explores the constructs of parents' beliefs about and engagement in young children's play in two coastal cities in China. A sample of 483…
CCC- and WASH-mediated endosomal sorting of LDLR is required for normal clearance of circulating LDL
Bartuzi, Paulina; Billadeau, Daniel D.; Favier, Robert; Rong, Shunxing; Dekker, Daphne; Fedoseienko, Alina; Fieten, Hille; Wijers, Melinde; Levels, Johannes H.; Huijkman, Nicolette; Kloosterhuis, Niels; Van der Molen, Henk; Brufau, Gemma; Groen, Albert K.; Elliott, Alison M.; Kuivenhoven, Jan Albert; Plecko, Barbara; Grangl, Gernot; McGaughran, Julie; Horton, Jay D.; Burstein, Ezra; Hofker, Marten H.; van de Sluis, Bart
2016-01-01
The low-density lipoprotein receptor (LDLR) plays a pivotal role in clearing atherogenic circulating low-density lipoprotein (LDL) cholesterol. Here we show that the COMMD/CCDC22/CCDC93 (CCC) and the Wiskott-Aldrich syndrome protein and SCAR homologue (WASH) complexes are both crucial for endosomal
CCC- and WASH-mediated endosomal sorting of LDLR is required for normal clearance of circulating LDL
Bartuzi, Paulina; Billadeau, Daniel D.; Favier, Robert; Rong, Shunxing; Dekker, Daphne; Fedoseienko, Alina; Fieten, Hille; Wijers, Melinde; Levels, Johannes H.; Huijkman, Nicolette; Kloosterhuis, Niels; van der Molen, Henk; Brufau, Gemma; Groen, Albert K.; Elliott, Alison M.; Kuivenhoven, Jan Albert; Plecko, Barbara; Grangl, Gernot; McGaughran, Julie; Horton, Jay D.; Burstein, Ezra; Hofker, Marten H.; van de Sluis, Bart
The low-density lipoprotein receptor (LDLR) plays a pivotal role in clearing atherogenic circulating low-density lipoprotein (LDL) cholesterol. Here we show that the COMMD/CCDC22/CCDC93 (CCC) and the Wiskott-Aldrich syndrome protein and SCAR homologue (WASH) complexes are both crucial for endosomal
Isolation and characterization of an AGAMOUS homologue from cocoa
Chaidamsari, T.; Sugiarit, H.; Santoso, D.; Angenent, G.C.; Maagd, de R.A.
2006-01-01
We report the cloning of a cDNA from TcAG, an AG (Arabidopsis thaliana MADS-box C-type transcription factor gene AGAMOUS) homologue from cocoa (Theobroma cacao L.). TcAG was in the cocoa flower expressed primarily in stamens and ovaries, comparable to AG in Arabidopsis. Additionally, we found that
Mo, Hongyan; Wu, Qinyu; Miao, Jinhua; Luo, Congwei; Hong, Xue; Wang, Yongping; Tang, Lan; Hou, Fan Fan; Liu, Youhua; Zhou, Lili
2017-08-20
Oxidative stress plays a role in mediating podocyte injury and proteinuria. However, the underlying mechanism remains poorly understood. In this study, we investigated the potential role of C-X-C chemokine receptor type 4 (CXCR4), the receptor for stromal cell-derived factor 1α (SDF-1α), in mediating oxidative stress-induced podocyte injury. In mouse model of adriamycin nephropathy (ADR), CXCR4 expression was significantly induced in podocytes as early as 3 days. This was accompanied by an increased upregulation of oxidative stress in podocyte, as demonstrated by malondialdehyde assay, nitrotyrosine staining and secretion of 8-hydroxy-2'-deoxyguanosine in urine, and induction of NOX2 and NOX4, major subunits of NADPH oxidase. CXCR4 was also induced in human kidney biopsies with proteinuric kidney diseases and colocalized with advanced oxidation protein products (AOPPs), an established oxidative stress trigger. Using cultured podocytes and mouse model, we found that AOPPs induced significant loss of podocyte marker Wilms tumor 1 (WT1), nephrin, and podocalyxin, accompanied by upregulation of desmin both in vitro and in vivo. Furthermore, AOPPs worsened proteinuria and aggravated glomerulosclerosis in ADR. These effects were associated with marked activation of SDF-1α/CXCR4 axis in podocytes. Administration of AMD3100, a specific inhibitor of CXCR4, reduced proteinuria and ameliorated podocyte dysfunction and renal fibrosis triggered by AOPPs in mice. In glomerular miniorgan culture, AOPPs also induced CXCR4 expression and downregulated nephrin and WT1. Innovation and Conclusion: These results suggest that chemokine receptor CXCR4 plays a crucial role in mediating oxidative stress-induced podocyte injury, proteinuria, and renal fibrosis. CXCR4 could be a new target for mitigating podocyte injury, proteinuria, and glomerular sclerosis in proteinuric chronic kidney disease. Antioxid. Redox Signal. 27, 345-362.
The actin homologue MreB organizes the bacterial cell membrane
Strahl, H.; Burmann, F.; Hamoen, L.W.
2014-01-01
The eukaryotic cortical actin cytoskeleton creates specific lipid domains, including lipid rafts, which determine the distribution of many membrane proteins. Here we show that the bacterial actin homologue MreB displays a comparable activity. MreB forms membrane-associated filaments that coordinate
Toxicities of emamectin benzoate homologues and photodegradates to Lepidoptera.
Argentine, Joseph A; Jansson, Richard K; Starner, Van R; Halliday, W Ross
2002-12-01
The toxicity of a number of emamectin benzoate homologues and photodegradates to five species of Lepidoptera was investigated using diet and foliar bioassays. The emamectin benzoate homologues B1a and B1b were equally toxic in the diet and foliar assays to Spodoptera exigua (Hübner), Heliothis virescens (F.), Tricoplusia ni (Hübner), and Spodoptera frugiperda (J. E. Smith), within each of these species. Plutella xylostella (L.) was the most sensitive species to emamectin benzoate. The AB1a photodegradate of emamectin benzoate was as toxic as the parent compound in the diet assay. However, in the foliage assay AB1a was 4.4-fold less toxic to S. exigua than the parent compound. The MFB1a photodegradate of emamectin benzoate was as toxic as the parent compound to P. xylostella, and 3.1 to 6.2 times as toxic as the parent compound to the other species in the diet assay. The order of toxicity of the photodegradates were AB1a > MFB1a > FAB1a > 8,9-Z-MAB1a > PAB1a.
PDGFRα plays a crucial role in connective tissue remodeling.
Horikawa, Shinjiro; Ishii, Yoko; Hamashima, Takeru; Yamamoto, Seiji; Mori, Hisashi; Fujimori, Toshihiko; Shen, Jie; Inoue, Ran; Nishizono, Hirofumi; Itoh, Hiroshi; Majima, Masataka; Abraham, David; Miyawaki, Toshio; Sasahara, Masakiyo
2015-12-07
Platelet derived growth factor (PDGF) plays a pivotal role in the remodeling of connective tissues. Emerging data indicate the distinctive role of PDGF receptor-α (PDGFRα) in this process. In the present study, the Pdgfra gene was systemically inactivated in adult mouse (α-KO mouse), and the role of PDGFRα was examined in the subcutaneously implanted sponge matrices. PDGFRα expressed in the fibroblasts of Pdgfra-preserving control mice (Flox mice), was significantly reduced in the sponges in α-KO mice. Neovascularized areas were largely suppressed in the α-KO mice than in the Flox mice, whereas the other parameters related to the blood vessels and endothelial cells were similar. The deposition of collagen and fibronectin and the expression of collagen 1a1 and 3a1 genes were significantly reduced in α-KO mice. There was a significantly decrease in the number and dividing fibroblasts in the α-KO mice, and those of macrophages were similar between the two genotypes. Hepatocyte growth factor (Hgf) gene expression was suppressed in Pdgfra-inactivated fibroblasts and connective tissue. The findings implicate the role of PDGFRα-dependent ECM and HGF production in fibroblasts that promotes the remodeling of connective tissue and suggest that PDGFRα may be a relevant target to regulate connective tissue remodeling.
Characterization and cloning of TMV resistance gene N homologues ...
African Journals Online (AJOL)
Tobacco cultivars Nicotiana tabacum cv. Samsun NN plants carrying the N gene contain a multitude of N-related genes. We cloned a few N homologues and isolated two full-length cDNAs of NL-C26 and NL-B69 genes from N. tabacum cv. Samsun NN. Nucleotide sequence analysis showed that the coding regions of ...
Directory of Open Access Journals (Sweden)
Wang Haiyang
2002-12-01
Full Text Available Abstract Background Constitutive photomorphogenic 1 (COP1 has been defined as a central regulator of photomorphogenic development in plants, which targets key transcription factors for proteasome-dependent degradation. Although COP1 mammalian homologue has been previously reported, its function and distribution in animal kingdom are not known. Results Here we report the characterization of full-length human and mouse COP1 cDNAs and the genomic structures of the COP1 genes from several different species. Mammalian COP1 protein binds to ubiquitinated proteins in vivo and is itself ubiquitinated. Furthermore, mammalian COP1 is predominately nuclear localized and exists primarily as a complex of over 700 kDa. Through mutagenesis studies, we have defined a leucine-rich nuclear export signal (NES within the coiled-coil domain of mammalian COP1 and a nuclear localization signal (NLS, which is composed of two clusters of positive-charged amino acids, bridged by the RING finger. Disruption of the RING finger structure abolishes the nuclear import, while deletion of the entire RING finger restores the nuclear import. Conclusions Our data suggest that mammalian COP1, similar to its plant homologue, may play a role in ubiquitination. Mammalian COP1 contains a classic leucine-rich NES and a novel bipartite NLS bridged by a RING finger domain. We propose a working model in which the COP1 RING finger functions as a structural scaffold to bring two clusters of positive-charged residues within spatial proximity to mimic a bipartite NLS. Therefore, in addition to its well-characterized role in ubiquitination, the RING finger domain may also play a structural role in nuclear import.
The cell membrane plays a crucial role in survival of bacteria and archaea in extreme environments
Konings, Wil N.; Albers, Sonja-Verena; Koning, Sonja; Driessen, Arnold J.M.
2002-01-01
The cytoplasmic membrane of bacteria and archaea determine to a large extent the composition of the cytoplasm. Since the ion and in particular the proton and/or the sodium ion electrochemical gradients across the membranes are crucial for the bioenergetic conditions of these microorganisms,
DEFF Research Database (Denmark)
Farrell, Helen E; Abraham, Alexander M; Cardin, Rhonda D
2011-01-01
The human cytomegalovirus (CMV) proteins US28 and UL33 are homologous to chemokine receptors (CKRs). Knockout of the mouse CMV M33 protein (UL33 homologue) results in substantial attenuation of salivary gland infection/replication and reduced efficiency of reactivation from tissue explants. M33-m...
International Nuclear Information System (INIS)
Nomoto, Ryohei; Tezuka, Takeaki; Miyazono, Ken-ichi; Tanokura, Masaru; Horinouchi, Sueharu; Ohnishi, Yasuo
2012-01-01
A Streptomyces homologue of the mycobacterial integration host factor mIHF was heterologously produced, purified and crystallized in the presence of a 16-mer duplex DNA by the sitting-drop vapour-diffusion method. The best crystal diffracted X-rays to 2.22 Å resolution and belonged to space group C2. The mycobacterial integration host factor (mIHF) is a small nonspecific DNA-binding protein that is essential for the growth of Mycobacterium smegmatis. mIHF homologues are widely distributed among Actinobacteria, and a Streptomyces homologue of mIHF is involved in control of sporulation and antibiotic production in S. coelicolor A3(2). Despite their important biological functions, a structure of mIHF or its homologues has not been elucidated to date. Here, the S. griseus mIHF homologue (SGR6054) was expressed and purified from Escherichia coli and crystallized in the presence of a 16-mer duplex DNA by the sitting-drop vapour-diffusion method. The plate-shaped crystal belonged to space group C2, with unit-cell parameters a = 88.53, b = 69.35, c = 77.71 Å, β = 96.63°, and diffracted X-rays to 2.22 Å resolution
Energy Technology Data Exchange (ETDEWEB)
Nomoto, Ryohei; Tezuka, Takeaki; Miyazono, Ken-ichi; Tanokura, Masaru; Horinouchi, Sueharu; Ohnishi, Yasuo [Graduate School of Agricultural and Life Sciences, The University of Tokyo, 1-1-1 Yayoi, Bunkyo-ku, Tokyo 113-8657 (Japan)
2012-08-31
A Streptomyces homologue of the mycobacterial integration host factor mIHF was heterologously produced, purified and crystallized in the presence of a 16-mer duplex DNA by the sitting-drop vapour-diffusion method. The best crystal diffracted X-rays to 2.22 Å resolution and belonged to space group C2. The mycobacterial integration host factor (mIHF) is a small nonspecific DNA-binding protein that is essential for the growth of Mycobacterium smegmatis. mIHF homologues are widely distributed among Actinobacteria, and a Streptomyces homologue of mIHF is involved in control of sporulation and antibiotic production in S. coelicolor A3(2). Despite their important biological functions, a structure of mIHF or its homologues has not been elucidated to date. Here, the S. griseus mIHF homologue (SGR6054) was expressed and purified from Escherichia coli and crystallized in the presence of a 16-mer duplex DNA by the sitting-drop vapour-diffusion method. The plate-shaped crystal belonged to space group C2, with unit-cell parameters a = 88.53, b = 69.35, c = 77.71 Å, β = 96.63°, and diffracted X-rays to 2.22 Å resolution.
Cloning and characterization of maize ZmSPK1, a homologue to ...
African Journals Online (AJOL)
hope&shola
2006-03-15
Mar 15, 2006 ... homologue to nonfermenting1-related protein kinase2 ... RT-PCR analysis showed that the ZmSPK1 expression was induced by mannitol, salt and ... MAPKKK in which each component is activated by .... It has been one of the main ... Protein kinase ATP-binding region signature is shown in gray box.
From Cell Death to Metabolism: Holin-Antiholin Homologues with New Functions
DEFF Research Database (Denmark)
van den Esker, Marielle H.; Kovács, Ákos T.; Kuipers, Oscar P.
2017-01-01
, but their functions can be different, depending on the species. Using a series of biochemical and genetic approaches, in a recent article in mBio, Charbonnier et al. (mBio 8:e00976-17, 2017, https://doi.org/10.1128/mBio.00976-17) demonstrate that the antiholin homologue in Bacillus subtilis transports pyruvate...
Behaviour of the homologues of Rf and Db in complexing media
International Nuclear Information System (INIS)
Trubert, D.; Monroy Guzman, F.; Hussonnois, M.; Brillard, L.; Le Naour, C.; Servajean, V.; Constantinescu, O.; Constantinescu, M.; Ardisson, G.; Barci, V.; Weiss, B.
1999-01-01
In order to study the chemical behaviour of the trans-actinide elements, the chemical properties of their most probable homologues have been investigated by ion exchange methods in various complexing media. A new chromatographic method allowing the determination of distribution coefficients in the case o short-lived isotopes has been developed and successfully tested with the RACHEL device. (authors)
The actin homologue MreB organizes the bacterial cell membrane
Strahl, Henrik; Bürmann, Frank; Hamoen, Leendert W.
2014-01-01
The eukaryotic cortical actin cytoskeleton creates specific lipid domains, including lipid rafts, which determine the distribution of many membrane proteins. Here we show that the bacterial actin homologue MreB displays a comparable activity. MreB forms membrane-associated filaments that coordinate bacterial cell wall synthesis. We noticed that the MreB cytoskeleton influences fluorescent staining of the cytoplasmic membrane. Detailed analyses combining an array of mutants, using specific lip...
Simpson, M.; Mojibian, M.; Barriga, K.; Scott, F.W.; Fasano, A.; Rewers, M.; Norris, J.M.
2010-01-01
Aims To determine whether Glb1 homologue antibodies are associated with islet autoimmunity (IA) in children at increased risk for type 1 diabetes (T1D), and to investigate their relation with putative environmental correlates of T1D. Methods We selected a sample from the Diabetes Autoimmunity Study in the Young (DAISY), a prospective study of children at increased risk for T1D. Cases were those who were positive for insulin, glutamic acid decarboxylase (GAD), or insulinoma-associated antigen-2 (IA-2) autoantibodies on two consecutive visits and either diagnosed with diabetes mellitus or still autoantibody positive when selected. Controls were from the same increased risk group, of similar age as the cases but negative for autoantibodies. Sera from 91 IA cases and 82 controls were analyzed in a blinded manner for immunoglobulin G (IgG) antibodies to Glb1 homologue by ELISA. Results Adjusting for family history of T1D and HLA-DR4 positivity, Glb1 homologue antibodies were not associated with IA case status (OR: 1.01, 95% CI: 0.99 – 1.03). Adjusting for age, family history of T1D, and HLA-DR4 positivity, Glb1 homologue antibody levels were inversely associated with breast-feeding duration (beta = −0.08, p = 0.001) and directly associated with current intake of foods containing gluten (beta = 0.24, p = 0.007) in IA cases but not in controls. Zonulin, a biomarker of gut permeability, was directly associated with Glb1 homologue antibody levels in cases (beta = 0.73, p = 0.003) but not in controls. Conclusion Differences in correlates of Glb1 antibodies in IA cases and controls suggest an underlying difference in mucosal immune response. PMID:19622083
Crucial roles of NGF in dorsal horn plasticity in partially deafferentated cats.
Liu, Jia; Chen, Shan-Shan; Dan, Qi-Qin; Rong, Rong; Zhou, Xue; Zhang, Lian-Feng; Wang, Ting-Hua
2011-04-01
Though exogenous nerve growth factor (NGF) has been implicated in spinal cord plasticity, whether endogenous NGF plays a crucial role has not been established in vivo. This study investigated first the role of endogenous NGF in spinal dorsal horn (DH) plasticity following removal of L1-L5 and L7-S2 dorsal root ganglions (DRGs) in cats. Co-culture of chick embryo DRG with DH condition media, protein band fishing by cells as well as western blot showed that NGF could promote neurite growth in vitro. Immunohistochemistry and in situ hybridization technique revealed an increase in the NGF and NGF mRNA immunoreactive cells in the DH after partial deafferentation. Lastly, after blocking with NGF antibody, choleragen subunit B horseradish peroxidase (CB-HRP) tracing showed a reduction in the neuronal sprouting observed in the DH. Our results demonstrated that in the cat, endogenous NGF plays a crucial role in DH plasticity after partial deafferentation.
DEFF Research Database (Denmark)
Chrzanowski, L; Stasiewicz, M; Owsianiak, Mikolaj
2009-01-01
hypothesize that in the presence of diesel fuel low-water-soluble ionic liquids may become more toxic to hydrocarbon-degrading microorganisms. In this study the influence of 1-alkoxymethyl-2-methyl-5-hydroxypyridinium chloride homologues (side-chain length from C-3 to C-18) on biodegradation of diesel fuel...... by a bacterial consortium was investigated. Whereas test performed for the consortium cultivated on disodium succinate showed that toxicity of the investigated ionic liquids decreased with increase in side-chain length, only higher homologues (C-8-C-18) caused a decrease in diesel fuel biodegradation......, respectively. We conclude that in the presence of hydrocarbons acting as a solvent, the increased bioavailability of hydrophobic homologues is responsible for the decrease in biodegradation efficiency of diesel fuel....
Directory of Open Access Journals (Sweden)
Phelan Anne
2007-06-01
Full Text Available Abstract Background Mammalian angiotensin converting enzyme (ACE plays a key role in blood pressure regulation. Although multiple ACE-like proteins exist in non-mammalian organisms, to date only one other ACE homologue, ACE2, has been identified in mammals. Results Here we report the identification and characterisation of the gene encoding a third homologue of ACE, termed ACE3, in several mammalian genomes. The ACE3 gene is located on the same chromosome downstream of the ACE gene. Multiple sequence alignment and molecular modelling have been employed to characterise the predicted ACE3 protein. In mouse, rat, cow and dog, the predicted protein has mutations in some of the critical residues involved in catalysis, including the catalytic Glu in the HEXXH zinc binding motif which is Gln, and ESTs or reverse-transcription PCR indicate that the gene is expressed. In humans, the predicted ACE3 protein has an intact HEXXH motif, but there are other deletions and insertions in the gene and no ESTs have been identified. Conclusion In the genomes of several mammalian species there is a gene that encodes a novel, single domain ACE-like protein, ACE3. In mouse, rat, cow and dog ACE3, the catalytic Glu is replaced by Gln in the putative zinc binding motif, indicating that in these species ACE3 would lack catalytic activity as a zinc metalloprotease. In humans, no evidence was found that the ACE3 gene is expressed and the presence of deletions and insertions in the sequence indicate that ACE3 is a pseudogene.
Stasyk, Oleh V.; Stasyk, Olena G.; Komduur, Janet; Veenhuis, Marten; Cregg, James M.; Sibirny, Andrei A.
2004-01-01
Peroxisome biogenesis and synthesis of peroxisomal enzymes in the methylotrophic yeast Hansenula polymorpha are under the strict control of glucose repression. We identified an H. polymorpha glucose catabolite repression gene (HpGCR1) that encodes a hexose transporter homologue. Deficiency in GCR1
Guided play and free play in an enriched environment: Impact on motor development
Directory of Open Access Journals (Sweden)
Míriam Stock Palma
2014-06-01
Full Text Available The purpose of this study was to investigate the effects of guided play and free play in an enriched environmentintervention programs using motor skill development in kindergarten children. Seventy-one children attending kindergarten classes were assigned to two experimental groups and one control group. Participants performed the Test of Gross Motor Development-2 before and after the intervention period. Results revealed that both boys and girls in the guided play group showed motor skill improvement, whereas no changes were observed in motor development in the boys and girls assigned to the free play in enriched environment group, nor in those in the control group. These findings indicate that the teacher's role in the guided play intervention was crucial to help preschool children to improve their performance.
Structural studies on a non-toxic homologue of type II RIPs from ...
Indian Academy of Sciences (India)
Structural studies on a non-toxic homologue of type II RIPs from bitter gourd: Molecular basis of non-toxicity, conformational selection and glycan structure. MS accepted http://www.ias.ac.in/jbiosci. THYAGESHWAR CHANDRAN, ALOK SHARMA and M VIJAYAN. J. Biosci. 40(5), October 2015, 929–941, © Indian Academy of ...
DEFF Research Database (Denmark)
Andersen, Ditte C; Jensen, Charlotte H; Schneider, Mikael
2010-01-01
Delta like 1 homologue (Dlk1) exists in both transmembrane and soluble molecular forms, and is implicated in cellular growth and plays multiple roles in development, tissue regeneration, and cancer. Thus, DLK1 levels are critical for cell function, and abnormal DLK1 expression can be lethal...... increases with cell density, and peaks at the same stage where membrane DLK1(M) and soluble DLK1(S) are found at maximum levels. Remarkably, miR-15a represses the amount of all Dlk1 variants at the mRNA level but also the level of DLK1(M) protein while it increases the amount of DLK1(S) supporting a direct...... while increasing cell numbers, scenarios that were completely rescued by addition of purified DLK1(S). Our data thus imply that miR-15a regulates cell size and proliferation by fine-tuning Dlk1 among others, and further emphasize miR-15a and DLK1 levels to play important roles in growth signaling...
Helliwell, S. B.; Wagner, P.; Kunz, J.; Deuter-Reinhard, M.; Henriquez, R.; Hall, M. N.
1994-01-01
The Saccharomyces cerevisiae genes TOR1 and TOR2 were originally identified by mutations that confer resistance to the immunosuppressant rapamycin. TOR2 was previously shown to encode an essential 282-kDa phosphatidylinositol kinase (PI kinase) homologue. The TOR1 gene product is also a large (281 kDa) PI kinase homologue, with 67% identity to TOR2. TOR1 is not essential, but a TOR1 TOR2 double disruption uniquely confers a cell cycle (G1) arrest as does exposure to rapamycin; disruption of T...
Structure of HLA-A*1101 in complex with a hepatitis B peptide homologue
DEFF Research Database (Denmark)
Blicher, Thomas; Kastrup, Jette Sandholm; Pedersen, Lars Østergaard
2006-01-01
A high-resolution structure of the human MHC-I molecule HLA-A*1101 is presented in which it forms a complex with a sequence homologue of a peptide that occurs naturally in hepatitis B virus DNA polymerase. The sequence of the bound peptide is AIMPARFYPK, while that of the corresponding natural...
Jaiswal, Richa; Stepanik, Vince; Rankova, Aneliya; Molinar, Olivia; Goode, Bruce L; McCartney, Brooke M
2013-05-10
Vertebrate APC collaborates with Dia through its Basic domain to assemble actin filaments. Despite limited sequence homology between the vertebrate and Drosophila APC Basic domains, Drosophila APC1 collaborates with Dia to stimulate actin assembly in vitro. The mechanism of actin assembly is highly conserved over evolution. APC-Dia collaborations may be crucial in a wide range of animal cells. Adenomatous polyposis coli (APC) is a large multidomain protein that regulates the cytoskeleton. Recently, it was shown that vertebrate APC through its Basic domain directly collaborates with the formin mDia1 to stimulate actin filament assembly in the presence of nucleation barriers. However, it has been unclear whether these activities extend to homologues of APC and Dia in other organisms. Drosophila APC and Dia are each required to promote actin furrow formation in the syncytial embryo, suggesting a potential collaboration in actin assembly, but low sequence homology between the Basic domains of Drosophila and vertebrate APC has left their functional and mechanistic parallels uncertain. To address this question, we purified Drosophila APC1 and Dia and determined their individual and combined effects on actin assembly using both bulk fluorescence assays and total internal reflection fluorescence microscopy. Our data show that APC1, similar to its vertebrate homologue, bound to actin monomers and nucleated and bundled filaments. Further, Drosophila Dia nucleated actin assembly and protected growing filament barbed ends from capping protein. Drosophila APC1 and Dia directly interacted and collaborated to promote actin assembly in the combined presence of profilin and capping protein. Thus, despite limited sequence homology, Drosophila and vertebrate APCs exhibit highly related activities and mechanisms and directly collaborate with formins. These results suggest that APC-Dia interactions in actin assembly are conserved and may underlie important in vivo functions in a broad
The Orphan Nuclear Receptor TLX/NR2E1 in Neural Stem Cells and Diseases
Wang, Tao; Xiong, Jian-Qiong
2016-01-01
The human TLX gene encodes an orphan nuclear receptor predominantly expressed in the central nervous system. Tailess and Tlx, the TLX homologues in Drosophila and mouse, play essential roles in body-pattern formation and neurogenesis during early embryogenesis and perform crucial functions in maintaining stemness and controlling the differentiation of adult neural stem cells in the central nervous system, especially the visual system. Multiple target genes and signaling pathways are regulated...
DEFF Research Database (Denmark)
Karoff, Helle Skovbjerg; Ejsing-Duun, Stine; Hanghøj, Thorkild
2013-01-01
The paper develops an approach of playing and gaming activities through the perspective of both activities as mood activities . The point of departure is that a game - is a tool with which we, through our practices, achieve different moods. This based on an empirical study of children's everyday...... lives, where the differences emerge through actual practices, i.e. through the creation of meaning in the specific situations. The overall argument is that it is not that important whether it is a playing or a gaming activity - it is however crucial to be aware of how moods occur and what their optimal...... dimensions: practices and moods. Practice is the concept of all the doing in the activities. Moods are the particular concept of sense and feeling of being, which is what we are drawn to when we are playing or gaming....
Crystal structure of a bacterial homologue of glucose transporters GLUT1-4.
Sun, Linfeng; Zeng, Xin; Yan, Chuangye; Sun, Xiuyun; Gong, Xinqi; Rao, Yu; Yan, Nieng
2012-10-18
Glucose transporters are essential for metabolism of glucose in cells of diverse organisms from microbes to humans, exemplified by the disease-related human proteins GLUT1, 2, 3 and 4. Despite rigorous efforts, the structural information for GLUT1-4 or their homologues remains largely unknown. Here we report three related crystal structures of XylE, an Escherichia coli homologue of GLUT1-4, in complex with d-xylose, d-glucose and 6-bromo-6-deoxy-D-glucose, at resolutions of 2.8, 2.9 and 2.6 Å, respectively. The structure consists of a typical major facilitator superfamily fold of 12 transmembrane segments and a unique intracellular four-helix domain. XylE was captured in an outward-facing, partly occluded conformation. Most of the important amino acids responsible for recognition of D-xylose or d-glucose are invariant in GLUT1-4, suggesting functional and mechanistic conservations. Structure-based modelling of GLUT1-4 allows mapping and interpretation of disease-related mutations. The structural and biochemical information reported here constitutes an important framework for mechanistic understanding of glucose transporters and sugar porters in general.
Bate-Eya, Laurel T; Gierman, Hinco J; Ebus, Marli E; Koster, Jan; Caron, Huib N; Versteeg, Rogier; Dolman, M Emmy M; Molenaar, Jan J
2017-04-01
Neuroblastoma is predominantly characterised by chromosomal rearrangements. Next to V-Myc Avian Myelocytomatosis Viral Oncogene Neuroblastoma Derived Homolog (MYCN) amplification, chromosome 7 and 17q gains are frequently observed. We identified a neuroblastoma patient with a regional 7q36 gain, encompassing the enhancer of zeste homologue 2 (EZH2) gene. EZH2 is the histone methyltransferase of lysine 27 of histone H3 (H3K27me3) that forms the catalytic subunit of the polycomb repressive complex 2. H3K27me3 is commonly associated with the silencing of genes involved in cellular processes such as cell cycle regulation, cellular differentiation and cancer. High EZH2 expression correlated with poor prognosis and overall survival independent of MYCN amplification status. Unexpectedly, treatment of 3 EZH2-high expressing neuroblastoma cell lines (IMR32, CHP134 and NMB), with EZH2-specific inhibitors (GSK126 and EPZ6438) resulted in only a slight G1 arrest, despite maximum histone methyltransferase activity inhibition. Furthermore, colony formation in cell lines treated with the inhibitors was reduced only at concentrations much higher than necessary for complete inhibition of EZH2 histone methyltransferase activity. Knockdown of the complete protein with three independent shRNAs resulted in a strong apoptotic response and decreased cyclin D1 levels. This apoptotic response could be rescued by overexpressing EZH2ΔSET, a truncated form of wild-type EZH2 lacking the SET transactivation domain necessary for histone methyltransferase activity. Our findings suggest that high EZH2 expression, at least in neuroblastoma, has a survival function independent of its methyltransferase activity. This important finding highlights the need for studies on EZH2 beyond its methyltransferase function and the requirement for compounds that will target EZH2 as a complete protein. Copyright © 2017 Elsevier Ltd. All rights reserved.
Energy Technology Data Exchange (ETDEWEB)
Wen, Li [Department of Orthodontics, School of Stomatology, Fourth Military Medical University, Xi' an 710032 (China); Wang, Yu [Department of Oncology, Xijing Hospital, Fourth Military Medical University, Xi' an 710032 (China); Wang, Huan [Department of Orthodontics, School of Stomatology, Fourth Military Medical University, Xi' an 710032 (China); Kong, Lingmin [Department of Fundamental Medicine, Cell Engineering Research Centre, Fourth Military Medical University, Xi' an 710032 (China); Zhang, Liang [Department of Orthodontics, School of Stomatology, Fourth Military Medical University, Xi' an 710032 (China); Chen, Xin [Department of General Dentistry, The 174th Hospital of Chinese PLA, Xiamen 361003 (China); Ding, Yin, E-mail: dingyin@fmmu.edu.cn [Department of Orthodontics, School of Stomatology, Fourth Military Medical University, Xi' an 710032 (China)
2012-08-03
results suggest that VDCC{sub L} plays a crucial role in the proliferation and osteogenic differentiation of rMSCs.
Reth, Margot; Ciric, Anita; Christensen, Guttorm N; Heimstad, Eldbjørg S; Oehme, Michael
2006-08-15
Congener and homologue group patterns of chlorinated paraffins (CPs) in biota can be influenced by different processes, but these are not well studied yet. Short- (SCCPs) and medium-chain chlorinated paraffins (MCCPs) were quantified in liver from Arctic char and seabirds (little auk and kittiwake) collected at Bear Island (European Arctic) as well as in cod from Iceland and Norway. CP concentrations were between 5 and 88 ng/g wet weight (ww) for SCCPs and between 5 and 55 ng/g ww for MCCPs with one exception of 370 ng/g measured in a liver sample from little auk. The SCCP homologue group patterns were compared with those of technical mixtures and of SCCPs present in cod liver from the Baltic Sea. The latter showed a more common SCCP homologue distribution (sum of C(11) and C(12)>60%) in contrast to cod liver from the Northwest of Europe, which had a high abundance of C(10) and C(12) congeners. Seabirds from Bear Island contained an equally distributed SCCP homologue group pattern. In Arctic char, the SCCP distribution was closer to technical products, but with a high proportion (average of 18.9%) of C(10) congeners. A comparison of C(10)/C(12) ratios confirmed the higher abundance of C(10) congeners in samples from higher latitudes. For the first time, MCCPs could be detected in Arctic samples. The average proportion of C(14) congeners was 65.8%. The C(14)/C(15) abundance ratio was similar to technical mixtures. High-chlorinated CPs (Cl(>7)) were also detectable. The average chlorine content of the SCCPs was 61.9% (59.0-63.3%), and that of the MCCPs 55.8% (54.5-57.4%).
Energy Technology Data Exchange (ETDEWEB)
Tsukamoto, Yuta; Katayama, Chisako [Graduate School of Science, Kobe University, 1-1 Rokkodai-cho Nada, Kobe 657-8501 (Japan); Shinohara, Miki; Shinohara, Akira [Institute for Protein Research, Osaka University, 3-2 Yamadaoka, Suita, Osaka 565-0871 (Japan); Maekawa, Shohei [Graduate School of Science, Kobe University, 1-1 Rokkodai-cho Nada, Kobe 657-8501 (Japan); Miyamoto, Masaaki, E-mail: miya@kobe-u.ac.jp [Graduate School of Science, Kobe University, 1-1 Rokkodai-cho Nada, Kobe 657-8501 (Japan); Center for Supports to Research and Education Activities, Kobe University, 1-1 Rokkodai-cho Nada, Kobe 657-8501 (Japan)
2013-11-29
Highlights: •Multiple functions of Rab5 GTPase in fission yeast were found. •Roles of Rab5 in fission yeast were discussed. •Relation between Rab5 and actin cytoskeleton were discussed. -- Abstract: Inner-membrane transport is critical to cell function. Rab family GTPases play an important role in vesicle transport. In mammalian cells, Rab5 is reported to be involved in the regulation of endosome formation, phagocytosis and chromosome alignment. Here, we examined the role of the fission yeast Rab5 homologue Ypt5 using a point mutant allele. Mutant cells displayed abnormal cell morphology, mating, sporulation, endocytosis, vacuole fusion and responses to ion stress. Our data strongly suggest that fission yeast Rab5 is involved in the regulation of various types of cellular functions.
International Nuclear Information System (INIS)
Tsukamoto, Yuta; Katayama, Chisako; Shinohara, Miki; Shinohara, Akira; Maekawa, Shohei; Miyamoto, Masaaki
2013-01-01
Highlights: •Multiple functions of Rab5 GTPase in fission yeast were found. •Roles of Rab5 in fission yeast were discussed. •Relation between Rab5 and actin cytoskeleton were discussed. -- Abstract: Inner-membrane transport is critical to cell function. Rab family GTPases play an important role in vesicle transport. In mammalian cells, Rab5 is reported to be involved in the regulation of endosome formation, phagocytosis and chromosome alignment. Here, we examined the role of the fission yeast Rab5 homologue Ypt5 using a point mutant allele. Mutant cells displayed abnormal cell morphology, mating, sporulation, endocytosis, vacuole fusion and responses to ion stress. Our data strongly suggest that fission yeast Rab5 is involved in the regulation of various types of cellular functions
The role of the leukemia-associated ETO homologue repressors in hematopoiesis
Olsson, André
2006-01-01
The fusion protein AML1-ETO is observed in acute myeloid patients with the chromosomal translocation t(8;21). Cells with this chimeric protein have impaired granulocytic and erythroid differentiation with accumulation of myeloblasts. The transcriptional co-repressor ETO (Eight Twenty One) was identified from the cloning of AML1-ETO. Subsequently, MTGR1 (Myeloid Translocation Gene-Related protein 1) and MTG16 (Myeloid Translocation Gene on chromosome 16) were found to be homologues to ETO, all...
Liu, Tengfei; Fang, Hui; Liu, Jun; Reid, Stephen; Hou, Juan; Zhou, Tingting; Tian, Zhendong; Song, Botao; Xie, Conghua
2017-12-01
Glyceraldehyde-3-phosphate dehydrogenase (GAPDH) is an important enzyme that functions in producing energy and supplying intermediates for cellular metabolism. Recent researches indicate that GAPDHs have multiple functions beside glycolysis. However, little information is available for functions of GAPDHs in potato. Here, we identified 4 putative cytosolic GAPDH genes in potato genome and demonstrated that the StGAPC1, StGAPC2, and StGAPC3, which are constitutively expressed in potato tissues and cold inducible in tubers, encode active cytosolic GAPDHs. Cosuppression of these 3 GAPC genes resulted in low tuber GAPDH activity, consequently the accumulation of reducing sugars in cold stored tubers by altering the tuber metabolite pool sizes favoring the sucrose pathway. Furthermore, GAPCs-silenced tubers exhibited a loss of apical dominance dependent on cell death of tuber apical bud meristem (TAB-meristem). It was also confirmed that StGAPC1, StGAPC2, and StGAPC3 interacted with the autophagy-related protein 3 (ATG3), implying that the occurrence of cell death in TAB-meristem could be induced by ATG3 associated events. Collectively, the present research evidences first that the GAPC genes play crucial roles in diverse physiological and developmental processes in potato tubers. © 2017 John Wiley & Sons Ltd.
International Nuclear Information System (INIS)
Elegheert, Jonathan; Hemel, Debbie van den; Dix, Ina; Stout, Jan; Van Beeumen, Jozef; Brigé, Ann; Savvides, Savvas N.
2009-01-01
Of the four old yellow enzyme homologues found in S. oneidensis, SYE4 is the homologue most implicated in resistance to oxidative stress. SYE4 was recombinantly expressed in Escherichia coli, purified and crystallized using the hanging-drop vapour-diffusion method. Shewanella oneidensis is an environmentally versatile Gram-negative γ-proteobacterium that is endowed with an unusually large proteome of redox proteins. Of the four old yellow enzyme (OYE) homologues found in S. oneidensis, SYE4 is the homologue most implicated in resistance to oxidative stress. SYE4 was recombinantly expressed in Escherichia coli, purified and crystallized using the hanging-drop vapour-diffusion method. The crystals belonged to the orthorhombic space group P2 1 2 1 2 1 and were moderately pseudo-merohedrally twinned, emulating a P422 metric symmetry. The native crystals of SYE4 were of exceptional diffraction quality and provided complete data to 1.10 Å resolution using synchrotron radiation, while crystals of the reduced enzyme and of the enzyme in complex with a wide range of ligands typically led to high-quality complete data sets to 1.30–1.60 Å resolution, thus providing a rare opportunity to dissect the structure–function relationships of a good-sized enzyme (40 kDa) at true atomic resolution. Here, the attainment of a number of experimental milestones in the crystallographic studies of SYE4 and its complexes are reported, including isolation of the elusive hydride–Meisenheimer complex
TMBP200, a XMAP215 homologue of tobacco BY-2 cells, has an essential role in plant mitosis.
Yasuhara, Hiroki; Oe, Yuki
2011-07-01
TMBP200 from tobacco BY-2 cells is a member of the highly conserved family of microtubule-associated proteins that includes Xenopus XMAP215, human TOGp, and Arabidopsis MOR1/GEM1. XMAP215 homologues have an essential role in spindle assembly and function in animals and yeast, but their role in plant mitosis is not fully clarified. Here, we show by immunoblot analysis that TMBP200 levels in synchronously cultured BY-2 cells increased when the cells entered mitosis, thus indicating that TMBP200 plays an important role in mitosis in tobacco. To investigate the role of TMBP200 in mitosis, we employed inducible RNA interference to silence TMBP200 expression in BY-2 cells. The resulting depletion of TMBP200 caused severe defects in bipolar spindle formation and resulted in the appearance of multinucleated cells with variable-sized nuclei. This finding indicates that TMBP200 has an essential role in bipolar spindle formation and function.
Identification of a candidate CD5 homologue in the amphibian Xenopus laevis.
Jürgens, J B; Gartland, L A; Du Pasquier, L; Horton, J D; Göbel, T W; Cooper, M D
1995-11-01
We identified a novel T cell Ag in the South African clawed toad (Xenopus laevis) by a mAb designated 2B1. This Ag is present in relatively high levels on most thymocytes, approximately 65% of splenocytes, 55% of PBL, and 65% of intestinal lymphocytes, but is rarely seen on IgM+ B cells in any of these tissues. Lymphocytes bearing the 2B1 Ag proliferate in response to stimulation with Con A or PHA, whereas the 2B1- lymphocytes are reactive to LPS. Biochemical analysis indicates that this Ag is a differentially phosphorylated glycoprotein of 71 to 82 kDa. The protein core of 64 kDa bears both N- and O-linked carbohydrate side chains. The amino-terminal protein sequence of the 2B1 Ag shares significant homology with both the macrophage scavenger receptor type 1 motif and the mammalian CD5/CD6 family. The biochemical characteristics and cellular distribution of the 2B1 Ag suggest that it represents the CD5 homologue in X. laevis. While T cells constitutively express this highly conserved molecule, Xenopus B cells acquire the CD5 homologue only when they are stimulated in the presence of T cells.
Hannivoort, Rebekka A.; Dunning, Sandra; Borght, Sara Vander; Schroyen, Ben; Woudenberg, Jannes; Oakley, Fiona; Buist-Homan, Manon; van den Heuvel, Fiona A. J.; Geuken, Mariska; Geerts, Albert; Roskams, Tania; Faber, Klaas Nico; Moshage, Han
Hepatic stellate cells (HSCs) survive and proliferate in the chronically injured liver. ATP-binding cassette (ABC) transporters play a crucial role in cell viability by transporting toxic metabolites or xenobiotics out of the cell. ABC transporter expression in HSCs and its relevance to cell
Lozupone, Francesco; Perdicchio, Maurizio; Brambilla, Daria; Borghi, Martina; Meschini, Stefania; Barca, Stefano; Marino, Maria Lucia; Logozzi, Mariantonia; Federici, Cristina; Iessi, Elisabetta; de Milito, Angelo; Fais, Stefano
2009-12-01
Tumour cannibalism is a characteristic of malignancy and metastatic behaviour. This atypical phagocytic activity is a crucial survival option for tumours in conditions of low nutrient supply, and has some similarities to the phagocytic activity of unicellular microorganisms. In fact, Dictyostelium discoideum has been used widely as a model to study phagocytosis. Recently, phg1A has been described as a protein that is primarily involved in the phagocytic process of this microorganism. The closest human homologue to phg1A is transmembrane 9 superfamily protein member 4 (TM9SF4). Here, we report that TM9SF4 is highly expressed in human malignant melanoma cells deriving from metastatic lesions, whereas it is undetectable in healthy human tissues and cells. TM9SF4 is predominantly expressed in acidic vesicles of melanoma cells, in which it co-localizes with the early endosome antigens Rab5 and early endosome antigen 1. TM9SF4 silencing induced marked inhibition of cannibal activity, which is consistent with a derangement of intracellular pH gradients, with alkalinization of acidic vesicles and acidification of the cell cytosol. We propose TM9SF4 as a new marker of malignancy, representing a potential new target for anti-tumour strategies with a specific role in tumour cannibalism and in the establishment of a metastatic phenotype.
Identification of possible targets of the Aspergillus fumigatus CRZ1 homologue, CrzA
Directory of Open Access Journals (Sweden)
Goldman Gustavo H
2010-01-01
Full Text Available Abstract Background Calcineurin, a serine/threonine-specific protein phosphatase, plays an important role in the control of cell morphology and virulence in fungi. Calcineurin regulates localization and activity of a transcription factor called CRZ1. Recently, we characterize Aspergillus fumigatus CRZ1 homologue, AfCrzA. Here, we investigate which pathways are influenced by A. fumigatus AfCrzA during a short pulse of calcium by comparatively determining the transcriptional profile of A. fumigatus wild type and ΔAfcrzA mutant strains. Results We were able to observe 3,622 genes modulated in at least one timepoint in the mutant when compared to the wild type strain (3,211 and 411 at 10 and 30 minutes, respectively. Decreased mRNA abundance in the ΔcrzA was seen for genes encoding calcium transporters, transcription factors and genes that could be directly or indirectly involved in calcium metabolism. Increased mRNA accumulation was observed for some genes encoding proteins involved in stress response. AfCrzA overexpression in A. fumigatus increases the expression of several of these genes. The deleted strain of one of these genes, AfRcnA, belonging to a class of endogenous calcineurin regulators, calcipressins, had more calcineurin activity after exposure to calcium and was less sensitive to menadione 30 μM, hydrogen peroxide 2.5 mM, EGTA 25 mM, and MnCl2 25 mM. We constructed deletion, overexpression, and GFP fusion protein for the closely related A. nidulans AnRcnA. GFP::RcnA was mostly detected along the germling, did not accumulate in the nuclei and its location is not affected by the cellular response to calcium chloride. Conclusion We have performed a transcriptional profiling analysis of the A. fumigatus ΔAfcrzA mutant strain exposed to calcium stress. This provided an excellent opportunity to identify genes and pathways that are under the influence of AfCrzA. AfRcnA, one of these selected genes, encodes a modulator of calcineurin
Govindaraju, Gayathri; Jabeena, C A; Sethumadhavan, Devadathan Valiyamangalath; Rajaram, Nivethika; Rajavelu, Arumugam
2017-10-01
In eukaryotes, cytosine methylation regulates diverse biological processes such as gene expression, development and maintenance of genomic integrity. However, cytosine methylation and its functions in pathogenic apicomplexan protozoans remain enigmatic. To address this, here we investigated the presence of cytosine methylation in the nucleic acids of the protozoan Plasmodium falciparum. Interestingly, P. falciparum has TRDMT1, a conserved homologue of DNA methyltransferase DNMT2. However, we found that TRDMT1 did not methylate DNA, in vitro. We demonstrate that TRDMT1 methylates cytosine in the endogenous aspartic acid tRNA of P. falciparum. Through RNA bisulfite sequencing, we mapped the position of 5-methyl cytosine in aspartic acid tRNA and found methylation only at C38 position. P. falciparum proteome has significantly higher aspartic acid content and a higher proportion of proteins with poly aspartic acid repeats than other apicomplexan pathogenic protozoans. Proteins with such repeats are functionally important, with significant roles in host-pathogen interactions. Therefore, TRDMT1 mediated C38 methylation of aspartic acid tRNA might play a critical role by translational regulation of important proteins and modulate the pathogenicity of the malarial parasite. Copyright © 2017 Elsevier B.V. All rights reserved.
Identification of NoxD/Pro41 as the homologue of the p22phox NADPH oxidase subunit in fungi.
Lacaze, Isabelle; Lalucque, Hervé; Siegmund, Ulrike; Silar, Philippe; Brun, Sylvain
2015-03-01
NADPH oxidases (Nox) are membrane complexes that produce O2(-). Researches in mammals, plants and fungi highlight the involvement of Nox-generated ROS in cell proliferation, differentiation and defense. In mammals, the core enzyme gp91(phox)/Nox2 is associated with p22(phox) forming the flavocytochrome b558 ready for activation by a cytosolic complex. Intriguingly, no homologue of the p22(phox) gene has been found in fungal genomes, questioning how the flavoenzyme forms. Using whole genome sequencing combined with phylogenetic analysis and structural studies, we identify the fungal p22(phox) homologue as being mutated in the Podospora anserina mutant IDC(509). Functional studies show that the fungal p22(phox), PaNoxD, acts along PaNox1, but not PaNox2, a second fungal gp91(phox) homologue. Finally, cytological analysis of functional tagged versions of PaNox1, PaNoxD and PaNoxR shows clear co-localization of PaNoxD and PaNox1 and unravel a dynamic assembly of the complex in the endoplasmic reticulum and in the vacuolar system. © 2014 John Wiley & Sons Ltd.
Is the Prosthetic Homologue Necessary for Embodiment?
Dornfeld, Chelsea; Swanston, Michelle; Cassella, Joseph; Beasley, Casey; Green, Jacob; Moshayev, Yonatan; Wininger, Michael
2016-01-01
Embodiment is the process by which patients with limb loss come to accept their peripheral device as a natural extension of self. However, there is little guidance as to how exacting the prosthesis must be in order for embodiment to take place: is it necessary for the prosthetic hand to look just like the absent hand? Here, we describe a protocol for testing whether an individual would select a hand that looks like their own from among a selection of five hands, and whether the hand selection (regardless of homology) is consistent across multiple exposures to the same (but reordered) set of candidate hands. Pilot results using healthy volunteers reveals that hand selection is only modestly consistent, and that selection of the prosthetic homologue is atypical (61 of 192 total exposures). Our protocol can be executed in minutes, and makes use of readily available equipment and softwares. We present both a face-to-face and a virtual protocol, for maximum flexibility of implementation.
Inhibition of hydroxyapatite growth by casein, a potential salivary phosphoprotein homologue.
Romero, Maria J R H; Nakashima, Syozi; Nikaido, Toru; Ichinose, Shizuko; Sadr, Alireza; Tagami, Junji
2015-08-01
Salivary phosphoproteins are essential in tooth mineral regulation but are often overlooked in vitro. This study aimed to evaluate the effect of casein, as a salivary phosphoprotein homologue, on the deposition and growth of hydroxyapatite (HA) on tooth surfaces. Hydroxyapatite growth was quantified using seeded crystal systems. Artificial saliva (AS) containing HA powder and 0, 10, 20, 50, or 100 μg ml(-1) of casein, or 100 μg ml(-1) of dephosphorylated casein (Dcasein), was incubated for 0-8 h at 37°C, pH 7.2. Calcium concentrations were measured using atomic absorption spectroscopy (AAS). Surface precipitation of HA on bovine enamel and dentine blocks, incubated in similar conditions for 7 d, was examined using field emission scanning electron microscopy (FE-SEM) and transmission electron microscopy (TEM) with selected area electron diffraction (SAED). Casein adsorption was assessed using modified Lowry assays and zeta-potential measurements. The AAS results revealed a concentration-dependent inhibition of calcium consumption. Hydroxyapatite precipitation occurred when no casein was present, whereas precipitation of HA was apparently completely inhibited in casein-containing groups. Adsorption data demonstrated increasingly negative zeta-potential with increased casein concentration and an affinity constant similar to proline-rich proteins with Langmuir modelling. Casein inhibited the deposition and growth of HA primarily through the binding of esterized phosphate to HA active sites, indicating its potential as a mineral-regulating salivary phosphoprotein homologue in vitro. © 2015 Eur J Oral Sci.
Hermes, Fatemah A; Cronan, John E
2013-10-01
The covalent attachment of lipoate to the lipoyl domains (LDs) of the central metabolism enzymes pyruvate dehydrogenase (PDH) and oxoglutarate dehydrogenase (OGDH) is essential for their activation and thus for respiratory growth in Saccharomyces cerevisiae. A third lipoate-dependent enzyme system, the glycine cleavage system (GCV), is required for utilization of glycine as a nitrogen source. Lipoate is synthesized by extraction of its precursor, octanoyl-acyl carrier protein (ACP), from the pool of fatty acid biosynthetic intermediates. Alternatively, lipoate is salvaged from previously modified proteins or from growth medium by lipoate protein ligases (Lpls). The first Lpl to be characterized, LplA of Escherichia coli, catalyses two partial reactions: activation of the acyl chain by formation of acyl-AMP, followed by transfer of the acyl chain to lipoyl domains (LDs). There is a surprising diversity within the Lpl family of enzymes, several of which catalyse reactions other than ligation reactions. For example, the Bacillus subtilis Lpl homologue LipM is an octanoyltransferase that transfers the octanoyl moiety from octanoyl-ACP to GCV. Another B. subtilis Lpl homologue, LipL, transfers octanoate from octanoyl-GCV to other LDs in an amido-transfer reaction. Study of eukaryotic Lpls has lagged behind studies of the bacterial enzymes. We report that the Lip3 Lpl homologue of the yeast S. cerevisiae has octanoyl-CoA-protein transferase activity, and discuss implications of this activity on the physiological role of Lip3 in lipoate synthesis. Published 2013. This article is a U.S. Government work and is in the public domain in the USA.
Sliogeris, Marija; Almeida, Sylvia Christine
2017-09-01
Play-based approaches to science learning allow children to meaningfully draw on their everyday experiences and activities as they explore science concepts in context. Acknowledging the crucial role of the teacher in facilitating science learning through play, the purpose of this qualitative study was to examine how teacher-guided play, in conjunction with child-guided play, supports children's development of science concepts. While previous research on play-based science learning has mainly focused on preschool settings, this study explores the possibilities of play-based approaches to science in primary school contexts. Using a qualitative methodology grounded in the cultural-historical theoretical perspective, children's learning was examined during a science learning sequence that combined teacher-guided and child-guided play. This study revealed that the teacher-guided play explicitly introduced science concepts which children then used and explored in subsequent child-guided play. However, intentional teaching during the child-guided play continued to be important. Play-based approaches to science allowed children to make sense of the science concepts using familiar, everyday knowledge and activities. It became evident that the expectations and values communicated through classroom practices influenced children's learning through play.
A lesion mimic phenotype in tomato obtained by isolating and silencing an Lls1 homologue
Spassieva, S; Hille, J
Lesion mimic phenotypes serve as a tool to study the regulation of cell death in plants. In order to obtain a tomato lesion mimic phenotype, we used the conservation of the lethal leaf spot 1 (Lls1) genes between plant species. The tomato Lls1 homologue was cloned, sequenced and analyzed. It showed
Play your Brain (Russisk oversættelse)
DEFF Research Database (Denmark)
Fredens, Kjeld; Prehn, Annette
Do you want to... Turn your brain into a co-player not an opponent? Create that crucial readiness to change in yourself and others? Build a stronger repertoire in whatever you do? Then get to know the 8 keys on your inner piano. In Play Your Brain, award-winning trainer Anette Prehn...... and neuroscience researcher Kjeld Fredens introduce a groundbreaking approach to coaching yourself: through knowledge of how your brain works, combined with a playful, flexible, musical attitude in working along with it. Here are simple yet powerful tools for achieving the goals in your life and career. Whatever...... your experience in other instruments, you can become a virtuoso at playing your brain and playing your way to success...
Bernhards, Yasmine; Pöggeler, Stefanie
2011-04-01
Members of the striatin family and their highly conserved interacting protein phocein/Mob3 are key components in the regulation of cell differentiation in multicellular eukaryotes. The striatin homologue PRO11 of the filamentous ascomycete Sordaria macrospora has a crucial role in fruiting body development. Here, we functionally characterized the phocein/Mob3 orthologue SmMOB3 of S. macrospora. We isolated the gene and showed that both, pro11 and Smmob3 are expressed during early and late developmental stages. Deletion of Smmob3 resulted in a sexually sterile strain, similar to the previously characterized pro11 mutant. Fusion assays revealed that ∆Smmob3 was unable to undergo self-fusion and fusion with the pro11 strain. The essential function of the SmMOB3 N-terminus containing the conserved mob domain was demonstrated by complementation analysis of the sterile S. macrospora ∆Smmob3 strain. Downregulation of either pro11 in ∆Smmob3, or Smmob3 in pro11 mutants by means of RNA interference (RNAi) resulted in synthetic sexual defects, demonstrating for the first time the importance of a putative PRO11/SmMOB3 complex in fruiting body development.
Pediatric Hospital: The Paradigms of Play in Brazil.
de Macedo, Lino; da Silva, Gláucia Faria; Setúbal, Sandra Mutarelli
2015-01-29
The role of play in Brazilian children's hospitals is highlighted, as well as the perspective of humanization in Brazil. Some aspects of our culture are crucial to understanding the importance of play considering our society. Sabara Children's Hospital ("Hospital Infantil Sabará") in Brazil is used particularly to discuss humanization. To understand the issue of play in Brazil, it is important to discuss hospitals in their social context, their history, current roles in children's care, humanization history and child development, according to the approaches of Piaget and Winnicott that are used in our culture.
Energy Technology Data Exchange (ETDEWEB)
Choi, Suzy; Kim, Hyun Jin, E-mail: kimhyunjin@skku.edu
2014-01-03
Highlights: •Split-ubiquitin MY2H screen identified GATE16 as an interacting protein of TRPML3. •TRPML3 specifically binds to a mammalian ATG8 homologue GATE16, not to LC3B. •The interaction of TRPML3 with GATE16 facilitates autophagosome formation. •GATE16 is expressed in both autophagosome and extra-autophagosomal compartments. -- Abstract: TRPML3 is a Ca{sup 2+} permeable cation channel expressed in multiple intracellular compartments. Although TRPML3 is implicated in autophagy, how TRPML3 can regulate autophagy is not understood. To search interacting proteins with TRPML3 in autophagy, we performed split-ubiquitin membrane yeast two-hybrid (MY2H) screening with TRPML3-loop as a bait and identified GATE16, a mammalian ATG8 homologue. GST pull-down assay revealed that TRPML3 and TRPML3-loop specifically bind to GATE16, not to LC3B. Co-immunoprecipitation (co-IP) experiments showed that TRPML3 and TRPML3-loop pull down only the lipidated form of GATE16, indicating that the interaction occurs exclusively at the organellar membrane. The interaction of TRPML3 with GATE16 and GATE16-positive vesicle formation were increased in starvation induced autophagy, suggesting that the interaction facilitates the function of GATE16 in autophagosome formation. However, GATE16 was not required for TRPML3 trafficking to autophagosomes. Experiments using dominant-negative (DN) TRPML3(D458K) showed that GATE16 is localized not only in autophagosomes but also in extra-autophagosomal compartments, by contrast with LC3B. Since GATE16 acts at a later stage of the autophagosome biogenesis, our results suggest that TRPML3 plays a role in autophagosome maturation through the interaction with GATE16, by providing Ca{sup 2+} in the fusion process.
Talking about domestic abuse: Crucial conversations for health visitors.
Bradbury-Jones, Caroline
2015-12-01
Domestic abuse is a serious problem across the world and it is considered a public health issue. Nurses play a crucial role in recognising and responding to domestic abuse but they sometimes lack confidence in dealing with the issue. In this article, two recently completed studies are used to extract lessons for health visiting practice. The first study investigated primary healthcare professionals' beliefs about domestic abuse. Many healthcare professionals were confident in dealing with domestic abuse. However, there was disinclination among some to discuss the issue. People who experience abuse rarely discuss it unless asked. So the study highlighted a potential dynamic of silence between health professionals and abused people in their care. The second study investigated student nurses and student midwives experiences of learning about domestic abuse. The student nurses had learned less than the student midwives. They had not been taught about domestic abuse in university and many had not had the opportunity to learn about it in clinical placement. They reported reluctance among some mentors to discuss the issue with them, with a resulting silencing of the issue. Both of these studies have important lessons for health visiting practice regarding opening up crucial conversations about domestic abuse.
Periodontal status of teeth restored with crowns and its contralateral homologue, Valdivia- Chile.
Israel Antonio Juárez; Sofía Larroulet; Makarena Ojeda; Cristian Rosas
2015-01-01
ABSTRACT Aim: To determine periodontal status of fixes single prostheses (FSP) made during the year 2013 in Austral University of Chile, and its contralateral homologue (CH).Methods: All patients with FSP made during 2013, that met the selection criteria and agreed to participate were evaluated. During the year 2014 was measured: probing depth, attachment level; bleeding on probing and dental plaque index for each FSP and CH; and consigned biological width invasion. Were measured one FSP...
Directory of Open Access Journals (Sweden)
Bart eGeurten
2012-03-01
Full Text Available Hoverflies and blowflies have distinctly different flight styles. Yet, both species have been shown to structure their flight behaviour in a way that facilitates extraction of 3D information from the image flow on the retina (optic flow. Neuronal candidates to analyse the optic flow are the tangential cells in the third optical ganglion – the lobula complex. These neurons are directionally selective and integrate the optic flow over large parts of the visual field. Homologue tangential cells in hoverflies and blowflies have a similar morphology. Because blowflies and hoverflies have similar neuronal layout but distinctly different flight behaviours, they are an ideal substrate to pinpoint potential neuronal adaptations to the different flight styles.In this article we describe the relationship between locomotion behaviour and motion vision on three different levels:1.We compare the different flight styles based on the categorisation of flight behaviour into prototypical movements.2.We measure the species specific dynamics of the optic flow under naturalistic flight conditions. We found the translational optic flow of both species to be very different.3.We describe possible adaptations of a homologue motion sensitive neuron. We stimulate this cell in blowflies (Calliphora and hoverflies (Eristalis with naturalistic optic flow generated by both species during free flight. The characterized hoverfly tangential cell responds faster to transient changes in the optic flow than its blowfly homologue. It is discussed whether and how the different dynamical response properties aid optic flow analysis.
Characterization of a novel organic solute transporter homologue from Clonorchis sinensis.
Directory of Open Access Journals (Sweden)
Yanyan Lu
2018-04-01
Full Text Available Clonorchis sinensis is a liver fluke that can dwell in the bile ducts of mammals. Bile acid transporters function to maintain the homeostasis of bile acids in C. sinensis, as they induce physiological changes or have harmful effects on C. sinensis survival. The organic solute transporter (OST transports mainly bile acid and belongs to the SLC51 subfamily of solute carrier transporters. OST plays a critical role in the recirculation of bile acids in higher animals. In this study, we cloned full-length cDNA of the 480-amino acid OST from C. sinensis (CsOST. Genomic analysis revealed 11 exons and nine introns. The CsOST protein had a 'Solute_trans_a' domain with 67% homology to Schistosoma japonicum OST. For further analysis, the CsOST protein sequence was split into the ordered domain (CsOST-N at the N-terminus and disordered domain (CsOST-C at the C-terminus. The tertiary structure of each domain was built using a threading-based method and determined by manual comparison. In a phylogenetic tree, the CsOST-N domain belonged to the OSTα and CsOST-C to the OSTβ clade. These two domains were more highly conserved with the OST α- and β-subunits at the structure level than at sequence level. These findings suggested that CsOST comprised the OST α- and β-subunits. CsOST was localized in the oral and ventral suckers and in the mesenchymal tissues abundant around the intestine, vitelline glands, uterus, and testes. This study provides fundamental data for the further understanding of homologues in other flukes.
Characterization of a novel organic solute transporter homologue from Clonorchis sinensis
Dai, Fuhong; Lee, Ji-Yun; Pak, Jhang Ho; Sohn, Woon-Mok
2018-01-01
Clonorchis sinensis is a liver fluke that can dwell in the bile ducts of mammals. Bile acid transporters function to maintain the homeostasis of bile acids in C. sinensis, as they induce physiological changes or have harmful effects on C. sinensis survival. The organic solute transporter (OST) transports mainly bile acid and belongs to the SLC51 subfamily of solute carrier transporters. OST plays a critical role in the recirculation of bile acids in higher animals. In this study, we cloned full-length cDNA of the 480-amino acid OST from C. sinensis (CsOST). Genomic analysis revealed 11 exons and nine introns. The CsOST protein had a ‘Solute_trans_a’ domain with 67% homology to Schistosoma japonicum OST. For further analysis, the CsOST protein sequence was split into the ordered domain (CsOST-N) at the N-terminus and disordered domain (CsOST-C) at the C-terminus. The tertiary structure of each domain was built using a threading-based method and determined by manual comparison. In a phylogenetic tree, the CsOST-N domain belonged to the OSTα and CsOST-C to the OSTβ clade. These two domains were more highly conserved with the OST α- and β-subunits at the structure level than at sequence level. These findings suggested that CsOST comprised the OST α- and β-subunits. CsOST was localized in the oral and ventral suckers and in the mesenchymal tissues abundant around the intestine, vitelline glands, uterus, and testes. This study provides fundamental data for the further understanding of homologues in other flukes. PMID:29702646
Directory of Open Access Journals (Sweden)
Zhitao Qi
2015-01-01
Full Text Available Interleukin-10 (IL-10 is a pleiotropic cytokine that plays an important role in immune system. In the present study, the IL-10 gene of African clawed frog (Xenopus tropicalis was first cloned, and its expression pattern and 3D structure were also analyzed. The frog IL-10 mRNA encoded 172 amino acids which possessed several conserved features found in IL-10s from other species, including five-exon/four-intron genomic structure, conserved four cysteine residues, IL-10 family motif, and six α-helices. Real-time PCR showed that frog IL-10 mRNA was ubiquitous expressed in all examined tissues, highly in some immune related tissues including kidney, spleen, and intestine and lowly in heart, stomach, and liver. The frog IL-10 mRNA was upregulated at 24 h after LPS stimulation, indicating that it plays a part in the host immune response to bacterial infection. Another IL, termed as IL-20, was identified from the frog IL-10 locus, which might be the homologue of mammalian IL-19/20 according to the analysis results of the phylogenetic tree and the sequence identities.
Pediatric Hospital: The Paradigms of Play in Brazil
Directory of Open Access Journals (Sweden)
Lino de Macedo
2015-01-01
Full Text Available The role of play in Brazilian children’s hospitals is highlighted, as well as the perspective of humanization in Brazil. Some aspects of our culture are crucial to understanding the importance of play considering our society. Sabara Children’s Hospital (“Hospital Infantil Sabará” in Brazil is used particularly to discuss humanization. To understand the issue of play in Brazil, it is important to discuss hospitals in their social context, their history, current roles in children’s care, humanization history and child development, according to the approaches of Piaget and Winnicott that are used in our culture.
The Impact of Pretend Play on Children's Development: A Review of the Evidence
Lillard, Angeline S.; Lerner, Matthew D.; Hopkins, Emily J.; Dore, Rebecca A.; Smith, Eric D.; Palmquist, Carolyn M.
2013-01-01
Pretend play has been claimed to be crucial to children's healthy development. Here we examine evidence for this position versus 2 alternatives: Pretend play is 1 of many routes to positive developments (equifinality), and pretend play is an epiphenomenon of other factors that drive development. Evidence from several domains is considered. For…
Xu, F; Liang, X; Lin, B; Su, F
1999-03-01
Based on the linear retention equation of the logarithm of the capacity factor (logk') vs. the methanol volume fraction (psi) of aqueous binary mobile phase in soil leaching column chromatography, the intersection point rule for the logk' of homologues and weak polar chlorobenzenes, with psi, as well as with boiling point, has been derived due to existence of the similar interactions among solutes of the same series, stationary phase (soil) and eluent (methanol-water). These rules were testified by experimental data of homologues (n-alkylbenzenes, methylbenzenes) and weak polar chlorobenzenes.
Characterization of Two 20kDa-Cement Protein (cp20k) Homologues in Amphibalanus amphitrite
He, Li-Sheng
2013-05-22
The barnacle, Amphibalanus amphitrite, is a common marine fouling organism. Understanding the mechanism of barnacle adhesion will be helpful in resolving the fouling problem. Barnacle cement is thought to play a key role in barnacle attachment. Although several adult barnacle cement proteins have been identified in Megabalanus rosa, little is known about their function in barnacle settlement. In this study, two homologous 20k-cement proteins (cp20k) in Amphibalanus amphitrite, named Bamcp20k-1 and Bamcp20k-2, were characterized. The two homologues share primary sequence structure with proteins from other species including Megabalanus rosa and Fistulobalanus albicostatus. The conserved structure included repeated Cys domains and abundant charged amino acids, such as histidine. In this study we demonstrated that Bamcp20k-1 localized at the α secretory cells in the cyprid cement gland, while Bamcp20k-2 localized to the β secretory cells. The differential localizations suggest differential regulation for secretion from the secretory cells. Both Bamcp20k-1 and Bamcp20k-2 from cyprids dissolved in PBS. However, adult Bamcp20k-2, which was dominant in the basal shell of adult barnacles, was largely insoluble in PBS. Solubility increased in the presence of the reducing reagent Dithiothreitol (DTT), suggesting that the formation of disulfide bonds plays a role in Bamcp20k-2 function. In comparison, Bamcp20k-1, which was enriched in soft tissue, could not be easily detected in the shell and base by Western blot and easily dissolved in PBS. These differential solubilities and localizations indicate that Bamcp20k-1 and Bamcp20k-2 have distinct functions in barnacle cementing. © 2013 He et al.
Characterization of Two 20kDa-Cement Protein (cp20k) Homologues in Amphibalanus amphitrite
He, Li-Sheng; Zhang, Gen; Qian, Pei-Yuan
2013-01-01
The barnacle, Amphibalanus amphitrite, is a common marine fouling organism. Understanding the mechanism of barnacle adhesion will be helpful in resolving the fouling problem. Barnacle cement is thought to play a key role in barnacle attachment. Although several adult barnacle cement proteins have been identified in Megabalanus rosa, little is known about their function in barnacle settlement. In this study, two homologous 20k-cement proteins (cp20k) in Amphibalanus amphitrite, named Bamcp20k-1 and Bamcp20k-2, were characterized. The two homologues share primary sequence structure with proteins from other species including Megabalanus rosa and Fistulobalanus albicostatus. The conserved structure included repeated Cys domains and abundant charged amino acids, such as histidine. In this study we demonstrated that Bamcp20k-1 localized at the α secretory cells in the cyprid cement gland, while Bamcp20k-2 localized to the β secretory cells. The differential localizations suggest differential regulation for secretion from the secretory cells. Both Bamcp20k-1 and Bamcp20k-2 from cyprids dissolved in PBS. However, adult Bamcp20k-2, which was dominant in the basal shell of adult barnacles, was largely insoluble in PBS. Solubility increased in the presence of the reducing reagent Dithiothreitol (DTT), suggesting that the formation of disulfide bonds plays a role in Bamcp20k-2 function. In comparison, Bamcp20k-1, which was enriched in soft tissue, could not be easily detected in the shell and base by Western blot and easily dissolved in PBS. These differential solubilities and localizations indicate that Bamcp20k-1 and Bamcp20k-2 have distinct functions in barnacle cementing. © 2013 He et al.
Knappy, Chris; Barillà, Daniela; Chong, James; Hodgson, Dominic; Morgan, Hugh; Suleman, Muhammad; Tan, Christine; Yao, Peng; Keely, Brendan
2015-12-01
Higher homologues of widely reported C(86) isoprenoid diglycerol tetraether lipid cores, containing 0-6 cyclopentyl rings, have been identified in (hyper)thermophilic archaea, representing up to 21% of total tetraether lipids in the cells. Liquid chromatography-tandem mass spectrometry confirms that the additional carbon atoms in the C(87-88) homologues are located in the etherified chains. Structures identified include dialkyl and monoalkyl ('H-shaped') tetraethers containing C(40-42) or C(81-82) hydrocarbons, respectively, many representing novel compounds. Gas chromatography-mass spectrometric analysis of hydrocarbons released from the lipid cores by ether cleavage suggests that the C(40) chains are biphytanes and the C(41) chains 13-methylbiphytanes. Multiple isomers, having different chain combinations, were recognised among the dialkyl lipids. Methylated tetraethers are produced by Methanothermobacter thermautotrophicus in varying proportions depending on growth conditions, suggesting that methylation may be an adaptive mechanism to regulate cellular function. The detection of methylated lipids in Pyrobaculum sp. AQ1.S2 and Sulfolobus acidocaldarius represents the first reported occurrences in Crenarchaeota. Soils and aquatic sediments from geographically distinct mesotemperate environments that were screened for homologues contained monomethylated tetraethers, with di- and trimethylated structures being detected occasionally. The structural diversity and range of occurrences of the C(87-89) tetraethers highlight their potential as complementary biomarkers for archaea in natural environments. Copyright © 2015 John Wiley & Sons, Ltd.
Directory of Open Access Journals (Sweden)
Radoslav Delina
2012-04-01
Full Text Available In the field of digital business ecosystem, the self-regulation feature plays crucial role. ICT supports biological and sociological phenomena through efficient electronic services. One of the main roles is building and enhancing efficient relationships between actors within the ecosystem. Problem of interaction between commercial subjects depends on expected benefits. These expectations are predictors of successful result from realized transaction with potential partner. And this predictor is based on trust and trustworthiness. The paper presents trust as crucial factor for cooperation and discusses specifics of several trust building mechanisms to increase the level of trust in e-cooperation within digital business ecosystems. Based on results provided by questionnaire survey in Slovak business environment, the paper discusses the relationship between the level of respondents´ electronic business experience and their preferences for the portfolio of trust building mechanisms.
The toxic equivalency (TEQ) values of polychlorinated dibenzo-p-dioxins and polychlorinated dibenzofurans (PCDD/Fs) are predicted with a model based on the homologue concentrations measured from a laboratory-scale reactor (124 data points), a package boiler (61 data points), and ...
Design of Piano -playing Robotic Hand
Directory of Open Access Journals (Sweden)
Lin Jen-Chang
2013-09-01
Full Text Available Unlike the market slowdown of industrial robots, service & entertainment robots have been highly regarded by most robotics reseach and market research agencies. In this study we developed a music playing robot (which can also work as a service robot for public performance. The research is mainly focused on the mechanical and electrical control of piano-playing robot, the exploration of correlations among music theory, rhythm and piano keys, and eventually the research on playing skill of keyboard instrument. The piano-playing robot is capable of control linear motor, servo-motor and pneumatic devices in accordance with the notes and rhythm in order to drive the mechanical structure to proper positions for pressing the keys and generating music. The devices used for this robot are mainly crucial components produced by HIWIN Technology Corp. The design of robotic hand is based on the direction of anthropomorphic hand such that five fingers will be used for playing piano. The finger actuations include actions of finger rotation, finger pressing, and finger lifting; time required for these 3 stages must meet the requirement of rhythm. The purpose of entertainment robot can be achieved by playing electric piano with robotic hand, and we hope this research can contribute to the development of domestic entertainment music playing robots.
Chen, Yu Wai; Tajima, Toshitaka; Rees, Martin; Garcia-Maya, Mitla
2009-09-01
Human homologue A of Rad23 (hHR23A) plays dual roles in DNA repair as well as serving as a shuttle vehicle targeting polyubiquitinated proteins for degradation. Its N-terminal ubiquitin-like (UbL) domain interacts with the 19S proteasomal cap and provides the docking mechanism for protein delivery. Pyramidal crystals of the UbL domain of hHR23A were obtained by the hanging-drop vapour-diffusion method with ammonium sulfate as the crystallizing agent. The crystals diffracted to beyond 2 A resolution and belonged to the hexagonal space group P6(5)22, with unit-cell parameters a = b = 78.48, c = 63.57 A. The structure was solved by molecular replacement using the UbL domain of yeast Dsk2 as the search model.
Negotiating succession in a family business - a role play
DEFF Research Database (Denmark)
Pelzmann-Knafl, Sabine; Winkler, Ingo
2017-01-01
. The role-play offers you the possibility to flexibly address various succession-related aspects in family business. It requires a teacher, who is familiar with the family business literature and particularly the research of succession in family business. Furthermore, because role-plays have their own...... dynamics, the teacher should be familiar with applying role-plays in their teaching. In the teaching notes we offer a way to embed the role-play in a five-hour teaching and learning activity addressing the various issues of succession in family firms. You could, however, do only the role-play, for instance......Negotiating succession is crucial for a family business. This role-play will enable students to simulate a family conference of the Mayer & Huber Ltd, a German-based but internationally operating producer of mechanical and electrical locking systems for the automotive industry. During...
Targeting the Enhancer of Zeste Homologue 2 in Medulloblastoma
Alimova, Irina; Venkataraman, Sujatha; Harris, Peter; Marquez, Victor E.; Northcott, Paul A; Dubuc, Adrian; Taylor, Michael D; Foreman, Nicholas K; Vibhakar, Rajeev
2012-01-01
Enhancer of zeste homologue 2 (EZH2) is the catalytic subunit of Polycomb repressive complex 2 that catalyzes the trimethylation of histone H3 on Lys 27, and represses gene transcription. EZH2 enhances cancer-cell proliferation and regulates stem cell maintenance and differentiation. Here, we demonstrate that EZH2 is highly expressed in medulloblastoma, a highly malignant brain tumor of childhood, and this altered expression is correlated with genomic gain of chromosome 7 in a subset of medulloblastoma. Inhibition of EZH2 by RNAi suppresses medulloblastoma tumor cell growth. We show that 3-deazaneplanocin A, a chemical inhibitor of EZH2, can suppress medulloblastoma cell growth partially by inducing apoptosis. Suppression of EZH2 expression diminishes the ability of tumor cells to form spheres in culture and strongly represses the ability of known oncogenes to transform neural stem cells. These findings establish a role of EZH2 in medulloblastoma and identify EZH2 as a potential therapeutic target especially in high-risk tumors. PMID:22287205
Crucial contextual attributes of nursing leadership towards a care ethics.
Gustafsson, Lena-Karin; Stenberg, Maja
2017-06-01
It is of importance to understand and communicate caring ethics as a ground for qualitative caring environments. Research is needed on nursing attributes that are visible in nursing leadership since it may give bases for reflections related to the patterns of specific contexts. The aim of this study was to illuminate the meaning of crucial attributes in nursing leadership toward an ethical care of patients in psychiatric in-patient settings. The design of the study was descriptive and qualitative with a phenomenological hermeneutical approach. Participants and research context: The study comprised focus group interviews with nurses working in indoor psychiatric care who participated after giving informed consent. Ethical considerations: Since the topic and informants are not labeled as sensitive and subject to ethical approval, it is not covered by the ethics committee's aim and purpose according to Swedish law. However, careful procedures have been followed according to ethics expressed in the Declaration of Helsinki. When identifying the thematic structures, analysis resulted in three major themes: To supply, including the following aspects: to supply evidence, to supply common space, and to supply good structures; To support, including the following aspects: to be a role model, to show appreciation and care, and to harbor; To shield, including the following aspects: to advocate, to emit non-tolerance of unethical behavior, and to reprove. Leadership is challenging for nurses and plays an important role in ethical qualitative care. These findings should not be understood as a description about nurse manager's role, which probably has different attributes and more focus on an organizational level. Making the understanding about crucial attributes explicit, the nurse may receive confirmation and recognition of crucial attributes for ethical care in order to move toward an ethical care.
Galactose metabolism plays a crucial role in biofilm formation by Bacillus subtilis.
Chai, Yunrong; Beauregard, Pascale B; Vlamakis, Hera; Losick, Richard; Kolter, Roberto
2012-01-01
Galactose is a common monosaccharide that can be utilized by all living organisms via the activities of three main enzymes that make up the Leloir pathway: GalK, GalT, and GalE. In Bacillus subtilis, the absence of GalE causes sensitivity to exogenous galactose, leading to rapid cell lysis. This effect can be attributed to the accumulation of toxic galactose metabolites, since the galE mutant is blocked in the final step of galactose catabolism. In a screen for suppressor mutants restoring viability to a galE null mutant in the presence of galactose, we identified mutations in sinR, which is the major biofilm repressor gene. These mutations caused an increase in the production of the exopolysaccharide (EPS) component of the biofilm matrix. We propose that UDP-galactose is the toxic galactose metabolite and that it is used in the synthesis of EPS. Thus, EPS production can function as a shunt mechanism for this toxic molecule. Additionally, we demonstrated that galactose metabolism genes play an essential role in B. subtilis biofilm formation and that the expressions of both the gal and eps genes are interrelated. Finally, we propose that B. subtilis and other members of the Bacillus genus may have evolved to utilize naturally occurring polymers of galactose, such as galactan, as carbon sources. Bacteria switch from unicellular to multicellular states by producing extracellular matrices that contain exopolysaccharides. In such aggregates, known as biofilms, bacteria are more resistant to antibiotics. This makes biofilms a serious problem in clinical settings. The resilience of biofilms makes them very useful in industrial settings. Thus, understanding the production of biofilm matrices is an important problem in microbiology. In studying the synthesis of the biofilm matrix of Bacillus subtilis, we provide further understanding of a long-standing microbiological observation that certain mutants defective in the utilization of galactose became sensitive to it. In this
Directory of Open Access Journals (Sweden)
Moore Landon L
2008-02-01
Full Text Available Abstract Background The spindle checkpoint delays the onset of anaphase until all sister chromatids are aligned properly at the metaphase plate. To investigate the role san-1, the MAD3 homologue, has in Caenorhabditis elegans embryos we used RNA interference (RNAi to identify genes synthetic lethal with the viable san-1(ok1580 deletion mutant. Results The san-1(ok1580 animal has low penetrating phenotypes including an increased incidence of males, larvae arrest, slow growth, protruding vulva, and defects in vulva morphogenesis. We found that the viability of san-1(ok1580 embryos is significantly reduced when HCP-1 (CENP-F homologue, MDF-1 (MAD-1 homologue, MDF-2 (MAD-2 homologue or BUB-3 (predicted BUB-3 homologue are reduced by RNAi. Interestingly, the viability of san-1(ok1580 embryos is not significantly reduced when the paralog of HCP-1, HCP-2, is reduced. The phenotype of san-1(ok1580;hcp-1(RNAi embryos includes embryonic and larval lethality, abnormal organ development, and an increase in abnormal chromosome segregation (aberrant mitotic nuclei, anaphase bridging. Several of the san-1(ok1580;hcp-1(RNAi animals displayed abnormal kinetochore (detected by MPM-2 and microtubule structure. The survival of mdf-2(RNAi;hcp-1(RNAi embryos but not bub-3(RNAi;hcp-1(RNAi embryos was also compromised. Finally, we found that san-1(ok1580 and bub-3(RNAi, but not hcp-1(RNAi embryos, were sensitive to anoxia, suggesting that like SAN-1, BUB-3 has a functional role as a spindle checkpoint protein. Conclusion Together, these data suggest that in the C. elegans embryo, HCP-1 interacts with a subset of the spindle checkpoint pathway. Furthermore, the fact that san-1(ok1580;hcp-1(RNAi animals had a severe viability defect whereas in the san-1(ok1580;hcp-2(RNAi and san-1(ok1580;hcp-2(ok1757 animals the viability defect was not as severe suggesting that hcp-1 and hcp-2 are not completely redundant.
Geluk, Annemieke; van Meijgaarden, Krista E.; Franken, Kees L. M. C.; Subronto, Yanri W.; Wieles, Brigitte; Arend, Sandra M.; Sampaio, Elizabeth P.; de Boer, Tjitske; Faber, William R.; Naafs, Ben; Ottenhoff, Tom H. M.
2002-01-01
In this paper we describe identification and characterization of Mycobacterium leprae ESAT-6 (L-ESAT-6), the homologue of M. tuberculosis ESAT-6 (T-ESAT-6). T-ESAT-6 is expressed by all pathogenic strains belonging to the M. tuberculosis complex but is absent from virtually all other mycobacterial
Johnson, William H; Wang, Susan C; Stanley, Thanuja M; Czerwinski, Robert M; Almrud, Jeffrey J; Poelarends, Gerrit J; Murzin, Alexey G; Whitman, Christian P
2004-01-01
A series of 2-fluoro-4-alkene and 2-fluoro-4-alkyne substrate analogues were synthesized and examined as potential inhibitors of three enzymes: 4-oxalocrotonate tautomerase (4-OT) and vinylpyruvate hydratase (VPH) from the catechol meta-fission pathway and a closely related 4-OT homologue found in
International Nuclear Information System (INIS)
Brown, J.S.; Boehm, P.D.; Sauer, T.C.; Wong, W.M.C.
1993-01-01
Techniques utilizing double ratio plots of selected polynuclear aromatic hydrocarbon (PAH) alkyl homologues were used to identify and distinguish crude oils and refined petroleum products from each other and to distinguish petroleum sources in complex pollutant regimes. Petroleum samples were fractionated by high performance liquid chromatography (HPLC) into saturated and aromatic (PAH) hydrocarbon fractions. The saturated hydrocarbon fractions were then analyzed by gas chromatography/flame ionization detection (GC/FID) to obtain a resolved/unresolved alkane fingerprint of each oil. The aromatic fractions of the oils were analyzed by gas chromatography/mass spectrometry (GC/MS) for PAH and selected alkyl homologues. Comparisons of the saturated hydrocarbon fingerprints indicated that some oils were indistinguishable based on the alkane fingerprint alone. Another double ratio plot of the alkyl chrysenes and alkyl dibenzothiophenes was effective in establishing the weathering of oil in environmental samples which were processed using the same analytical techniques, since the dibenzothiophenes are degraded more rapidly than the chrysenes. The application of selected ratios in oil spill source identification in complex environmental samples from Suisin Bay California and Boston Harbor are discussed. The use of ratios to measure the extent of weathering in oil spill samples from Prince William Sound and the Gulf of Alaska is examined
The actin homologue MreB organizes the bacterial cell membrane.
Strahl, Henrik; Bürmann, Frank; Hamoen, Leendert W
2014-03-07
The eukaryotic cortical actin cytoskeleton creates specific lipid domains, including lipid rafts, which determine the distribution of many membrane proteins. Here we show that the bacterial actin homologue MreB displays a comparable activity. MreB forms membrane-associated filaments that coordinate bacterial cell wall synthesis. We noticed that the MreB cytoskeleton influences fluorescent staining of the cytoplasmic membrane. Detailed analyses combining an array of mutants, using specific lipid staining techniques and spectroscopic methods, revealed that MreB filaments create specific membrane regions with increased fluidity (RIFs). Interference with these fluid lipid domains (RIFs) perturbs overall lipid homeostasis and affects membrane protein localization. The influence of MreB on membrane organization and fluidity may explain why the active movement of MreB stimulates membrane protein diffusion. These novel MreB activities add additional complexity to bacterial cell membrane organization and have implications for many membrane-associated processes.
Mouse homologue of yeast Prp19 interacts with mouse SUG1, the regulatory subunit of 26S proteasome
International Nuclear Information System (INIS)
Sihn, Choong-Ryoul; Cho, Si Young; Lee, Jeong Ho; Lee, Tae Ryong; Kim, Sang Hoon
2007-01-01
Yeast Prp19 has been shown to involve in pre-mRNA splicing and DNA repair as well as being an ubiquitin ligase. Mammalian homologue of yeast Prp19 also plays on similar functional activities in cells. In the present study, we isolated mouse SUG1 (mSUG1) as binding partner of mouse Prp19 (mPrp19) by the yeast two-hybrid system. We confirmed the interaction of mPrp9 with mSUG1 by GST pull-down assay and co-immunoprecipitation assay. The N-terminus of mPrp19 including U-box domain was associated with the C-terminus of mSUG1. Although, mSUG1 is a regulatory subunit of 26S proteasome, mPrp19 was not degraded in the proteasome-dependent pathway. Interestingly, GFP-mPrp19 fusion protein was co-localized with mSUG1 protein in cytoplasm as the formation of the speckle-like structures in the presence of a proteasome inhibitor MG132. In addition, the activity of proteasome was increased in cells transfected with mPrp19. Taken together, these results suggest that mPrp19 involves the regulation of protein turnover and may transport its substrates to 26S proteasome through mSUG1 protein
How a Museum Discovered the Transforming Power of Play
Eberle, Scott G.
2008-01-01
In 2006 the Strong Museum in Rochester, New York reopened as the Strong National Museum of Play. Devising a new interpretive plan proved crucial to transforming the institution's mission and decisive in leading toward a $37 million expansion that drove strong gains in attendance. Still, the new interpretive direction, articulated in the museum's…
Koronowski, Kevin B; Khoury, Nathalie; Saul, Isabel; Loris, Zachary B; Cohan, Charles H; Stradecki-Cohan, Holly M; Dave, Kunjan R; Young, Juan I; Perez-Pinzon, Miguel A
2017-11-01
Resveratrol, at least in part via SIRT1 (silent information regulator 2 homologue 1) activation, protects against cerebral ischemia when administered 2 days before injury. However, it remains unclear if SIRT1 activation must occur, and in which brain cell types, for the induction of neuroprotection. We hypothesized that neuronal SIRT1 is essential for resveratrol-induced ischemic tolerance and sought to characterize the metabolic pathways regulated by neuronal Sirt1 at the cellular level in the brain. We assessed infarct size and functional outcome after transient 60 minute middle cerebral artery occlusion in control and inducible, neuronal-specific SIRT1 knockout mice. Nontargeted primary metabolomics analysis identified putative SIRT1-regulated pathways in brain. Glycolytic function was evaluated in acute brain slices from adult mice and primary neuronal-enriched cultures under ischemic penumbra-like conditions. Resveratrol-induced neuroprotection from stroke was lost in neuronal Sirt1 knockout mice. Metabolomics analysis revealed alterations in glucose metabolism on deletion of neuronal Sirt1 , accompanied by transcriptional changes in glucose metabolism machinery. Furthermore, glycolytic ATP production was impaired in acute brain slices from neuronal Sirt1 knockout mice. Conversely, resveratrol increased glycolytic rate in a SIRT1-dependent manner and under ischemic penumbra-like conditions in vitro. Our data demonstrate that resveratrol requires neuronal SIRT1 to elicit ischemic tolerance and identify a novel role for SIRT1 in the regulation of glycolytic function in brain. Identification of robust neuroprotective mechanisms that underlie ischemia tolerance and the metabolic adaptations mediated by SIRT1 in brain are crucial for the translation of therapies in cerebral ischemia and other neurological disorders. © 2017 American Heart Association, Inc.
Nilsson, G.; Svensson, G.
2001-01-01
Single crystals of four homologues in the series nBa(Nb,Zr)O3+3mNbO, with n:m=2:1, 3:1, 4:1, and 5:1, were found in the reduced Ba-Nb-Zr-O system. Single-crystal X-ray diffraction data were collected for all the crystals. For all homologues the space group was found to be P4/mmm. The structures can be described as intergrowths of Ba(Nb,Zr)O3 perovskite and NbO slabs. The refined cell parameters and compositions of the 2:1, 3:1, and 4:1 homologues are a=4.1768(5) Å and c=12.269(2) Å for Ba2Nb4.5(1)Zr0.5(1)O9, a=4.1769(5) Å and c=16.493(3) Å for Ba3+δNb4.8(2)-δ Zr1.2(2)O12-δ (δ=0.098(4)), and a=4.1747(6) Å and c= 20.619(4) Å for Ba4+δNb5.1(4)-δZr1.9(4)O15-δ (δ=0.270(9)). The refined cell parameters of the 5:1 homologue are a=4.1727(3) Å and c=24.804(3) Å. Zr replaces Nb only in the NbO6 octahedra found in the perovskite slabs.
Five analogies between a King's Speech treatment and contemporary play therapies.
Terr, Lenore C
2012-01-01
Psychiatric patients frequently respond positively to play therapy, which may rely on psychoanalytic, Jungian, cognitive-behavioral, familial, school-based, or other theories. I wished to determine if there were unifying principles that tie together these various types of play treatments. The fact-based film, The King's Speech, vividly illustrates play utilized by Lionel Logue in his speech treatment (1926-1939) of the future King of England. In the film I found five analogies to the play therapy I employ in office practice. The play scenes in The King's Speech point to five unifying principles among contemporary play therapies: (1) the crucial nature of the relationship, (2) the centrality of having fun, (3) the occasional reliance on others, (4) the interjection of pithy talk, and (5) the usefulness of a little drama. No matter what theory a play therapist ascribes to, these five unifying principles should be kept in mind during treatment.
Pazman, C; Mayes, C A; Fanto, M; Haynes, S R; Mlodzik, M
2000-04-01
The small GTPase Ras plays an important role in many cellular signaling processes. Ras activity is negatively regulated by GTPase activating proteins (GAPs). It has been proposed that RasGAP may also function as an effector of Ras activity. We have identified and characterized the Drosophila homologue of the RasGAP-binding protein G3BP encoded by rasputin (rin). rin mutants are viable and display defects in photoreceptor recruitment and ommatidial polarity in the eye. Mutations in rin/G3BP genetically interact with components of the Ras signaling pathway that function at the level of Ras and above, but not with Raf/MAPK pathway components. These interactions suggest that Rin is required as an effector in Ras signaling during eye development, supporting an effector role for RasGAP. The ommatidial polarity phenotypes of rin are similar to those of RhoA and the polarity genes, e.g. fz and dsh. Although rin/G3BP interacts genetically with RhoA, affecting both photoreceptor differentiation and polarity, it does not interact with the gain-of-function genotypes of fz and dsh. These data suggest that Rin is not a general component of polarity generation, but serves a function specific to Ras and RhoA signaling pathways.
Kim, Soo Youn; Xu, Zheng-Yi; Song, Kyungyoung; Kim, Dae Heon; Kang, Hyangju; Reichardt, Ilka; Sohn, Eun Ju; Friml, Jirí; Juergens, Gerd; Hwang, Inhwan
2013-08-01
Fertilization in flowering plants requires the temporal and spatial coordination of many developmental processes, including pollen production, anther dehiscence, ovule production, and pollen tube elongation. However, it remains elusive as to how this coordination occurs during reproduction. Here, we present evidence that endocytosis, involving heterotetrameric adaptor protein complex 2 (AP-2), plays a crucial role in fertilization. An Arabidopsis thaliana mutant ap2m displays multiple defects in pollen production and viability, as well as elongation of staminal filaments and pollen tubes, all of which are pivotal processes needed for fertilization. Of these abnormalities, the defects in elongation of staminal filaments and pollen tubes were partially rescued by exogenous auxin. Moreover, DR5rev:GFP (for green fluorescent protein) expression was greatly reduced in filaments and anthers in ap2m mutant plants. At the cellular level, ap2m mutants displayed defects in both endocytosis of N-(3-triethylammonium-propyl)-4-(4-diethylaminophenylhexatrienyl) pyridinium dibromide, a lypophilic dye used as an endocytosis marker, and polar localization of auxin-efflux carrier PIN FORMED2 (PIN2) in the stamen filaments. Moreover, these defects were phenocopied by treatment with Tyrphostin A23, an inhibitor of endocytosis. Based on these results, we propose that AP-2-dependent endocytosis plays a crucial role in coordinating the multiple developmental aspects of male reproductive organs by modulating cellular auxin level through the regulation of the amount and polarity of PINs.
Isolation of a cotton NADP(H oxidase homologue induced by drought stress
Directory of Open Access Journals (Sweden)
NEPOMUCENO ALEXANDRE LIMA
2000-01-01
Full Text Available The aim of this study was to identify and isolate genes that are differentially expressed in four selected cotton (Gossypium hirsutum L. genotypes contrasting according to their tolerance to water deficit. The genotypes studied were Siokra L-23, Stoneville 506, CS 50 and T-1521. Physiological, morphological and developmental changes that confer drought tolerance in plants must have a molecular genetic basis. To identify and isolate the genes, the mRNA Differential Display (DD technique was used. Messenger RNAs differentially expressed during water deficit were identified, isolated, cloned and sequenced. The cloned transcript A12B15-5, a NADP(H oxidase homologue, was up regulated only during the water deficit stress and only in Siokra L-23, a drought tolerant genotype. Ribonuclease protection assay confirmed that transcription.
Einstein and the "Crucial" Experiment
Holton, Gerald
1969-01-01
Examines the widespread view that it was the crucial Michelson-Morley experiment that led Einstein to formulate the special relativity theory. From Einstein's writings, evidence is presented that no such direct genetic connection exists. The author suggests that the historian of science must resist the experimenticist's fallacy of imposing a…
Yuan, Bo; Fu, Jianjie; Wang, Yawei; Jiang, Guibin
2017-01-01
Short-chain chlorinated paraffins (SCCPs) in multi-environmental matrices are studied in Taizhou, Zhejiang Province, China, which is a notorious e-waste dismantling area. The investigated matrices consist of paddy field soil, paddy seeds (Oryza sativa, separated into hulls and rice unpolished) and apple snails (Ampullariidae, inhabiting the paddy fields). The sampling area covered a 65-km radius around the contamination center. C 10 and C 11 are the two predominant homologue groups in the area, accounting for about 35.7% and 33.0% of total SCCPs, respectively. SCCPs in snails and hulls are generally higher than in soil samples (30.4-530 ng/g dw), and SCCPs in hulls are approximate five times higher than in corresponding rice samples (4.90-55.1 ng/g dw). Homologue pattern analysis indicates that paddy seeds (both hull and rice) tend to accumulate relatively high volatile SCCP homologues, especially the ones with shorter carbon chain length, while snails tend to accumulate relatively high lipophilic homologues, especially the ones with more substituted chlorines. SCCPs in both paddy seeds and snails are linearly related to those in the soil. The e-waste dismantling area, which covers a radius of approximate 20 km, shows higher pollution levels for SCCPs according to their spatial distribution in four matrices. The preliminary assessment indicates that SCCP levels in local soils pose no significant ecological risk for soil dwelling organisms, but higher risks from dietary exposure of SCCPs are suspected for people living in e-waste dismantling area. Copyright © 2016 Elsevier Ltd. All rights reserved.
García-Álvarez, Laura; Holden, Matthew T G; Lindsay, Heather; Webb, Cerian R; Brown, Derek F J; Curran, Martin D; Walpole, Enid; Brooks, Karen; Pickard, Derek J; Teale, Christopher; Parkhill, Julian; Bentley, Stephen D; Edwards, Giles F; Girvan, E Kirsty; Kearns, Angela M; Pichon, Bruno; Hill, Robert L R; Larsen, Anders Rhod; Skov, Robert L; Peacock, Sharon J; Maskell, Duncan J; Holmes, Mark A
2011-08-01
Animals can act as a reservoir and source for the emergence of novel meticillin-resistant Staphylococcus aureus (MRSA) clones in human beings. Here, we report the discovery of a strain of S aureus (LGA251) isolated from bulk milk that was phenotypically resistant to meticillin but tested negative for the mecA gene and a preliminary investigation of the extent to which such strains are present in bovine and human populations. Isolates of bovine MRSA were obtained from the Veterinary Laboratories Agency in the UK, and isolates of human MRSA were obtained from diagnostic or reference laboratories (two in the UK and one in Denmark). From these collections, we searched for mecA PCR-negative bovine and human S aureus isolates showing phenotypic meticillin resistance. We used whole-genome sequencing to establish the genetic basis for the observed antibiotic resistance. A divergent mecA homologue (mecA(LGA251)) was discovered in the LGA251 genome located in a novel staphylococcal cassette chromosome mec element, designated type-XI SCCmec. The mecA(LGA251) was 70% identical to S aureus mecA homologues and was initially detected in 15 S aureus isolates from dairy cattle in England. These isolates were from three different multilocus sequence type lineages (CC130, CC705, and ST425); spa type t843 (associated with CC130) was identified in 60% of bovine isolates. When human mecA-negative MRSA isolates were tested, the mecA(LGA251) homologue was identified in 12 of 16 isolates from Scotland, 15 of 26 from England, and 24 of 32 from Denmark. As in cows, t843 was the most common spa type detected in human beings. Although routine culture and antimicrobial susceptibility testing will identify S aureus isolates with this novel mecA homologue as meticillin resistant, present confirmatory methods will not identify them as MRSA. New diagnostic guidelines for the detection of MRSA should consider the inclusion of tests for mecA(LGA251). Department for Environment, Food and Rural Affairs
Discoverability Problem of Free-to-Play Mobile Games
Koivisto, Maija
2015-01-01
Gaining visibility is crucial to a mobile game’s success. The competitive forces in mobile games market are strong, which pose challenges for game discovery. Low barriers to entry, minimal capital requirements and equal access to distribution platforms are some of the reasons the market is now flooded with staggering amounts of invisible, undifferentiated mobile games desperate for downloads. The thesis will give a holistic view of the current discovery landscape of free-to-play mobil...
Energy Technology Data Exchange (ETDEWEB)
Lin, Jiusheng; Prahlad, Janani; Wilson, Mark A. (UNL)
2012-08-21
DJ-1 is a conserved, disease-associated protein that protects against oxidative stress and mitochondrial damage in multiple organisms. Human DJ-1 contains a functionally essential cysteine residue (Cys106) whose oxidation is important for regulating protein function by an unknown mechanism. This residue is well-conserved in other DJ-1 homologues, including two (DJ-1{alpha} and DJ-1{beta}) in Drosophila melanogaster. Because D. melanogaster is a powerful model system for studying DJ-1 function, we have determined the crystal structure and impact of cysteine oxidation on Drosophila DJ-1{beta}. The structure of D. melanogaster DJ-1{beta} is similar to that of human DJ-1, although two important residues in the human protein, Met26 and His126, are not conserved in DJ-1{beta}. His126 in human DJ-1 is substituted with a tyrosine in DJ-1{beta}, and this residue is not able to compose a putative catalytic dyad with Cys106 that was proposed to be important in the human protein. The reactive cysteine in DJ-1 is oxidized readily to the cysteine-sulfinic acid in both flies and humans, and this may regulate the cytoprotective function of the protein. We show that the oxidation of this conserved cysteine residue to its sulfinate form (Cys-SO{sub 2{sup -}}) results in considerable thermal stabilization of both Drosophila DJ-1{beta} and human DJ-1. Therefore, protein stabilization is one potential mechanism by which cysteine oxidation may regulate DJ-1 function in vivo. More generally, most close DJ-1 homologues are likely stabilized by cysteine-sulfinic acid formation but destabilized by further oxidation, suggesting that they are biphasically regulated by oxidative modification.
Roles High School Principals Play in Establishing a Successful Character Education Initiative
Francom, Jacob A.
2016-01-01
Principal leadership is crucial to the success of a high school character education initiative. The purpose of this qualitative grounded theory research was to identify the roles that high school principals play in developing, implementing, and sustaining a high functioning character education program. Data were collected through interviews and…
Identifying Onboarding Heuristics for Free-to-Play Mobile Games: A Mixed Methods Approach
DEFF Research Database (Denmark)
Thomsen, Line Ebdrup; Weigert Petersen, Falko; Mirza-Babaei, Pejman
2016-01-01
The onboarding phase of Free-to-Play mobile games, covering the first few minutes of play, typically sees a substantial retention rate amongst players. It is therefore crucial to the success of these games that the onboarding phase promotes engagement to the widest degree possible. In this paper ...... of puzzle games, base builders and arcade games, and utilize different onboarding phase design approaches. Results showcase how heuristics can be used to design engaging onboarding phases in mobile games....
Crucial test of the Dirac cosmologies
International Nuclear Information System (INIS)
Steigman, G.
1978-01-01
In a cosmology consistent with the Cosmological Principle (large scale, statistical isotropy and homogeneity of the universe), a Planck spectrum is not preserved as the universe evolves unless the number of photons in a comoving volume is conserved. It is shown that a large class of cosmological models based on Dirac's Large Numbers Hypothesis (LNH) violate this constraint. The observed isotropy and spectral distribution of the microwave background radiation thus provide a crucial test of such cosmologies. After reviewing the LNH, the general evolution of radiation spectra in cosmologies consistent with the cosmological principle is outlined. It is shown that the predicted deviations from a Planck spectrum for Dirac cosmologies (as well as for ''tired-light'' cosmologies) are enormous. The Planckian (or near-Planckian) spectral form for the microwave radiation provides a crucial test, failed by such cosmologies
Kostrouchová, Markéta; Kostrouch, David; Chughtai, Ahmed A; Kaššák, Filip; Novotný, Jan P; Kostrouchová, Veronika; Benda, Aleš; Krause, Michael W; Saudek, Vladimír; Kostrouchová, Marta; Kostrouch, Zdeněk
2017-01-01
The evolutionarily conserved Mediator complex is a critical player in regulating transcription. Comprised of approximately two dozen proteins, the Mediator integrates diverse regulatory signals through direct protein-protein interactions that, in turn, modulate the influence of Mediator on RNA Polymerase II activity. One Mediator subunit, MED28, is known to interact with cytoplasmic structural proteins, providing a potential direct link between cytoplasmic dynamics and the control of gene transcription. Although identified in many animals and plants, MED28 is not present in yeast; no bona fide MED28 has been described previously in Caenorhabditis elegans. Here, we identify bioinformatically F28F8.5, an uncharacterized predicted protein, as the nematode homologue of MED28. As in other Metazoa, F28F8.5 has dual nuclear and cytoplasmic localization and plays critical roles in the regulation of development. F28F8.5 is a vital gene and its null mutants have severely malformed gonads and do not reproduce. F28F8.5 interacts on the protein level with the Mediator subunits MDT-6 and MDT-30. Our results indicate that F28F8.5 is an orthologue of MED28 and suggest that the potential to link cytoplasmic and nuclear events is conserved between MED28 vertebrate and nematode orthologues.
NDH-Mediated Cyclic Electron Flow Around Photosystem I is Crucial for C4 Photosynthesis.
Ishikawa, Noriko; Takabayashi, Atsushi; Noguchi, Ko; Tazoe, Youshi; Yamamoto, Hiroshi; von Caemmerer, Susanne; Sato, Fumihiko; Endo, Tsuyoshi
2016-10-01
C 4 photosynthesis exhibits efficient CO 2 assimilation in ambient air by concentrating CO 2 around ribulose 1,5-bisphosphate carboxylase/oxygenase (Rubisco) through a metabolic pathway called the C 4 cycle. It has been suggested that cyclic electron flow (CEF) around PSI mediated by chloroplast NADH dehydrogenase-like complex (NDH), an alternative pathway of photosynthetic electron transport (PET), plays a crucial role in C 4 photosynthesis, although the contribution of NDH-mediated CEF is small in C 3 photosynthesis. Here, we generated NDH-suppressed transformants of a C 4 plant, Flaveria bidentis, and showed that the NDH-suppressed plants grow poorly, especially under low-light conditions. CO 2 assimilation rates were consistently decreased in the NDH-suppressed plants under low and medium light intensities. Measurements of non-photochemical quenching (NPQ) of Chl fluorescence, the oxidation state of the reaction center of PSI (P700) and the electrochromic shift (ECS) of pigment absorbance indicated that proton translocation across the thylakoid membrane is impaired in the NDH-suppressed plants. Since proton translocation across the thylakoid membrane induces ATP production, these results suggest that NDH-mediated CEF plays a role in the supply of ATP which is required for C 4 photosynthesis. Such a role is more crucial when the light that is available for photosynthesis is limited and the energy production by PET becomes rate-determining for C 4 photosynthesis. Our results demonstrate that the physiological contribution of NDH-mediated CEF is greater in C 4 photosynthesis than in C 3 photosynthesis, suggesting that the mechanism of PET in C 4 photosynthesis has changed from that in C 3 photosynthesis accompanying the changes in the mechanism of CO 2 assimilation. © The Author 2016. Published by Oxford University Press on behalf of Japanese Society of Plant Physiologists. All rights reserved. For permissions, please email: journals.permissions@oup.com.
Pipeline network expansion crucial to economic development in India
Energy Technology Data Exchange (ETDEWEB)
Jha, Kiran Kumar; Tandon, Anil; Sati, Vipin Chandra [Indian Oil Corporation Ltd., Sadiq Nagar, New Delhi (India)
2008-07-01
Oil Sector plays a crucial role in the development of a country and provides the required balance and stability to the economy. Though traditionally coal has had the largest share in the energy basket in India, oil and gas as a source of energy have gradually gained importance and it is expected that oil and gas will continue to command a significant share in the years to come. Transportation of oil and gas by pipelines, which are recognized worldwide as the most reliable and cost effective mode for transportation is a developing business in India. With the increasing demand for oil and gas, a necessity has arisen for according priority attention to develop a well-spread out pipeline network throughout the country so as to facilitate efficient transportation to various consumption centres. The country has already opened its doors to private sector within the country as well as to multinationals. Thus, considerable scope exists not only for making investments but also for consultants, equipment and material manufacturers/suppliers and contractors for providing their services to the Indian pipeline industry. With growth of the economy, the opportunities for investment in the Indian pipeline industry are likely to improve further. (author)
Rudan, Dusko
2013-12-01
The paper offers a review of the development of the concept of play and playing. The true beginnings of the development of the theories of play are set as late as in the 19th century. It is difficult to define play as such; it may much more easily be defined through its antipode--work. In the beginning, play used to be connected with education; it was not before Freud's theory of psychoanalysis and Piaget's developmental psychology that the importance of play in a child's development began to be explained in more detail. The paper further tackles the role of play in the adult age. Detailed attention is paid to psychodynamic and psychoanalytic authors, in particular D. W. Winnicott and his understanding of playing in the intermediary (transitional) empirical or experiential space. In other words, playing occupies a space and time of its own. The neuroscientific concept of playing is also tackled, in the connection with development as well.
La Russa, M; Bogen, C; Uhmeyer, A; Doebbe, A; Filippone, E; Kruse, O; Mussgnug, J H
2012-11-30
Photosynthetic organisms like plants and algae can use sunlight to produce lipids as important metabolic compounds. Plant-derived triacylglycerols (TAGs) are valuable for human and animal nutrition because of their high energy content and are becoming increasingly important for the production of renewable biofuels. Acyl-CoA:diacylglycerol acyltransferases (DGATs) have been demonstrated to play an important role in the accumulation of TAG compounds in higher plants. DGAT homologue genes have been identified in the genome of the green alga Chlamydomonas reinhardtii, however their function in vivo is still unknown. In this work, the three most promising type-2 DGAT candidate genes potentially involved in TAG lipid accumulation (CrDGAT2a, b and c) were investigated by constructing overexpression strains. For each of the genes, three strains were identified which showed enhanced mRNA levels of between 1.7 and 29.1 times that of the wild type (wt). Total lipid contents, neutral lipids and fatty acid profiles were determined and showed that an enhanced mRNA expression level of the investigated DGAT genes did not boost the intracellular TAG accumulation or resulted in alterations of the fatty acid profiles compared to wild type during standard growth condition or during nitrogen or sulfur stress conditions. We conclude that biotechnological efforts to enhance cellular TAG amount in microalgae need further insights into the complex network of lipid biosynthesis to identify potential bottlenecks of neutral lipid production. Copyright © 2012 Elsevier B.V. All rights reserved.
Patnaik, Bharat Bhusan; Kang, Seong Min; Seo, Gi Won; Lee, Hyo Jeong; Patnaik, Hongray Howrelia; Jo, Yong Hun; Tindwa, Hamisi; Lee, Yong Seok; Lee, Bok Luel; Kim, Nam Jung; Bang, In Seok; Han, Yeon Soo
2013-10-15
CD63, a member of the tetraspanin membrane protein family, plays a pivotal role in cell growth, motility, signal transduction, host-pathogen interactions and cancer. In this work, the cDNA encoding CD63 homologue (TmCD63) was cloned from larvae of a coleopteran beetle, Tenebrio molitor. The cDNA is comprised of an open reading frame of 705 bp, encoding putative protein of 235 amino acid residues. In silico analysis shows that the protein has four putative transmembrane domains and one large extracellular loop. The characteristic "Cys-Cys-Gly" motif and "Cys188" residues are highly conserved in the large extracellular loop. Phylogenetic analysis of TmCD63 revealed that they belong to the insect cluster with 50%-56% identity. Analysis of spatial expression patterns demonstrated that TmCD63 mRNA is mainly expressed in gut and Malphigian tubules of larvae and the testis of the adult. Developmental expression patterns of CD63 mRNA showed that TmCD63 transcripts are detected in late larval, pupal and adult stages. Interestingly, TmCD63 transcripts are upregulated to the maximum level of 4.5 fold, in response to DAP-type peptidoglycan during the first 6 h, although other immune elicitors also caused significant increase to the transcript level at later time-points. These results suggest that CD63 might contribute to T. molitor immune response against various microbial pathogens.
Directory of Open Access Journals (Sweden)
Yeon Soo Han
2013-10-01
Full Text Available CD63, a member of the tetraspanin membrane protein family, plays a pivotal role in cell growth, motility, signal transduction, host-pathogen interactions and cancer. In this work, the cDNA encoding CD63 homologue (TmCD63 was cloned from larvae of a coleopteran beetle, Tenebrio molitor. The cDNA is comprised of an open reading frame of 705 bp, encoding putative protein of 235 amino acid residues. In silico analysis shows that the protein has four putative transmembrane domains and one large extracellular loop. The characteristic “Cys-Cys-Gly” motif and “Cys188” residues are highly conserved in the large extracellular loop. Phylogenetic analysis of TmCD63 revealed that they belong to the insect cluster with 50%–56% identity. Analysis of spatial expression patterns demonstrated that TmCD63 mRNA is mainly expressed in gut and Malphigian tubules of larvae and the testis of the adult. Developmental expression patterns of CD63 mRNA showed that TmCD63 transcripts are detected in late larval, pupal and adult stages. Interestingly, TmCD63 transcripts are upregulated to the maximum level of 4.5 fold, in response to DAP-type peptidoglycan during the first 6 h, although other immune elicitors also caused significant increase to the transcript level at later time-points. These results suggest that CD63 might contribute to T. molitor immune response against various microbial pathogens.
Patnaik, Bharat Bhusan; Kang, Seong Min; Seo, Gi Won; Lee, Hyo Jeong; Patnaik, Hongray Howrelia; Jo, Yong Hun; Tindwa, Hamisi; Lee, Yong Seok; Lee, Bok Luel; Kim, Nam Jung; Bang, In Seok; Han, Yeon Soo
2013-01-01
CD63, a member of the tetraspanin membrane protein family, plays a pivotal role in cell growth, motility, signal transduction, host-pathogen interactions and cancer. In this work, the cDNA encoding CD63 homologue (TmCD63) was cloned from larvae of a coleopteran beetle, Tenebrio molitor. The cDNA is comprised of an open reading frame of 705 bp, encoding putative protein of 235 amino acid residues. In silico analysis shows that the protein has four putative transmembrane domains and one large extracellular loop. The characteristic “Cys-Cys-Gly” motif and “Cys188” residues are highly conserved in the large extracellular loop. Phylogenetic analysis of TmCD63 revealed that they belong to the insect cluster with 50%–56% identity. Analysis of spatial expression patterns demonstrated that TmCD63 mRNA is mainly expressed in gut and Malphigian tubules of larvae and the testis of the adult. Developmental expression patterns of CD63 mRNA showed that TmCD63 transcripts are detected in late larval, pupal and adult stages. Interestingly, TmCD63 transcripts are upregulated to the maximum level of 4.5 fold, in response to DAP-type peptidoglycan during the first 6 h, although other immune elicitors also caused significant increase to the transcript level at later time-points. These results suggest that CD63 might contribute to T. molitor immune response against various microbial pathogens. PMID:24132157
Gangloff, Y G; Pointud, J C; Thuault, S; Carré, L; Romier, C; Muratoglu, S; Brand, M; Tora, L; Couderc, J L; Davidson, I
2001-08-01
The RNA polymerase II transcription factor TFIID comprises the TATA binding protein (TBP) and a set of TBP-associated factors (TAF(II)s). TFIID has been extensively characterized for yeast, Drosophila, and humans, demonstrating a high degree of conservation of both the amino acid sequences of the constituent TAF(II)s and overall molecular organization. In recent years, it has been assumed that all the metazoan TAF(II)s have been identified, yet no metazoan homologues of yeast TAF(II)47 (yTAF(II)47) and yTAF(II)65 are known. Both of these yTAF(II)s contain a histone fold domain (HFD) which selectively heterodimerizes with that of yTAF(II)25. We have cloned a novel mouse protein, TAF(II)140, containing an HFD and a plant homeodomain (PHD) finger, which we demonstrated by immunoprecipitation to be a mammalian TFIID component. TAF(II)140 shows extensive sequence similarity to Drosophila BIP2 (dBIP2) (dTAF(II)155), which we also show to be a component of Drosophila TFIID. These proteins are metazoan homologues of yTAF(II)47 as their HFDs selectively heterodimerize with dTAF(II)24 and human TAF(II)30, metazoan homologues of yTAF(II)25. We further show that yTAF(II)65 shares two domains with the Drosophila Prodos protein, a recently described potential dTAF(II). These conserved domains are critical for yTAF(II)65 function in vivo. Our results therefore identify metazoan homologues of yTAF(II)47 and yTAF(II)65.
Horiuchi, Takayuki; Akiyama, Takuya; Inouye, Sumiko; Komano, Teruya
2002-01-01
The developmentally regulated gene dofA, identified from pulse-labeling experiments by two-dimensional gel electrophoresis, and its homologue, dofB, were cloned and characterized in Myxococcus xanthus. Deletion of dofA and dofB did not affect the vegetative growth and development of M. xanthus. dofA was specifically expressed during development, while dofB expression was observed during vegetative growth and development. The dofA-lacZ fusion was introduced into a fruA mutant and A, B, C, D, a...
Kim, Soo Youn; Xu, Zheng-Yi; Song, Kyungyoung; Kim, Dae Heon; Kang, Hyangju; Reichardt, Ilka; Sohn, Eun Ju; Friml, Jiří; Juergens, Gerd; Hwang, Inhwan
2013-01-01
Fertilization in flowering plants requires the temporal and spatial coordination of many developmental processes, including pollen production, anther dehiscence, ovule production, and pollen tube elongation. However, it remains elusive as to how this coordination occurs during reproduction. Here, we present evidence that endocytosis, involving heterotetrameric adaptor protein complex 2 (AP-2), plays a crucial role in fertilization. An Arabidopsis thaliana mutant ap2m displays multiple defects in pollen production and viability, as well as elongation of staminal filaments and pollen tubes, all of which are pivotal processes needed for fertilization. Of these abnormalities, the defects in elongation of staminal filaments and pollen tubes were partially rescued by exogenous auxin. Moreover, DR5rev:GFP (for green fluorescent protein) expression was greatly reduced in filaments and anthers in ap2m mutant plants. At the cellular level, ap2m mutants displayed defects in both endocytosis of N-(3-triethylammonium-propyl)-4-(4-diethylaminophenylhexatrienyl) pyridinium dibromide, a lypophilic dye used as an endocytosis marker, and polar localization of auxin-efflux carrier PIN FORMED2 (PIN2) in the stamen filaments. Moreover, these defects were phenocopied by treatment with Tyrphostin A23, an inhibitor of endocytosis. Based on these results, we propose that AP-2–dependent endocytosis plays a crucial role in coordinating the multiple developmental aspects of male reproductive organs by modulating cellular auxin level through the regulation of the amount and polarity of PINs. PMID:23975898
Smith, Joseph T.; Singha, Ujjal K.; Misra, Smita
2018-01-01
ABSTRACT The small Tim proteins belong to a group of mitochondrial intermembrane space chaperones that aid in the import of mitochondrial inner membrane proteins with internal targeting signals. Trypanosoma brucei, the protozoan parasite that causes African trypanosomiasis, possesses multiple small Tim proteins that include homologues of T. brucei Tim9 (TbTim9) and Tim10 (TbTim10) and a unique small Tim that shares homology with both Tim8 and Tim13 (TbTim8/13). Here, we found that these three small TbTims are expressed as soluble mitochondrial intermembrane space proteins. Coimmunoprecipitation and mass spectrometry analysis showed that the small TbTims stably associated with each other and with TbTim17, the major component of the mitochondrial inner membrane translocase in T. brucei. Yeast two-hybrid analysis indicated direct interactions among the small TbTims; however, their interaction patterns appeared to be different from those of their counterparts in yeast and humans. Knockdown of the small TbTims reduced cell growth and decreased the steady-state level of TbTim17 and T. brucei ADP/ATP carrier (TbAAC), two polytopic mitochondrial inner membrane proteins. Knockdown of small TbTims also reduced the matured complexes of TbTim17 in mitochondria. Depletion of any of the small TbTims reduced TbTim17 import moderately but greatly hampered the stability of the TbTim17 complexes in T. brucei. Altogether, our results revealed that TbTim9, TbTim10, and TbTim8/13 interact with each other, associate with TbTim17, and play a crucial role in the integrity and maintenance of the levels of TbTim17 complexes. IMPORTANCE Trypanosoma brucei is the causative agent of African sleeping sickness. The parasite’s mitochondrion represents a useful source for potential chemotherapeutic targets. Similarly to yeast and humans, mitochondrial functions depend on the import of proteins that are encoded in the nucleus and made in the cytosol. Even though the machinery involved in this
Designing movement-based play with young people using powered wheelchairs
DEFF Research Database (Denmark)
Gerling, Kathrin M; Hicks, Kieran C; Kalyn, Michael R
2016-01-01
people who have special needs) and 2) three case studies (4 participants) exploring player perspectives on a set of three wheelchair-controlled casual games. Our results show that movement-based playful experiences are engaging for young people using powered wheelchairs. However, the participatory design...... in the development of accessible, empowering movement-based games, which is crucial to the wider participation of young people using powered wheelchairs in play.......Young people using powered wheelchairs have limited access to engaging leisure activities. We address this issue through a two-stage project; 1) the participatory development of a set of wheelchair-controlled, movement-based games (with 9 participants at a school that provides education for young...
Play, Playfulness, Creativity and Innovation
Directory of Open Access Journals (Sweden)
Patrick Bateson
2014-05-01
Full Text Available Play, as defined by biologists and psychologists, is probably heterogeneous. On the other hand, playfulness may be a unitary motivational state. Playful play as opposed to activities that merge into aggression is characterized by positive mood, intrinsic motivation, occurring in a protected context and easily disrupted by stress. Playful play is a good measure of positive welfare. It can occupy a substantial part of the waking-life of a young mammal or bird. Numerous functions for play have been proposed and they are by no means mutually exclusive, but some evidence indicates that those individual animals that play most are most likely to survive and reproduce. The link of playful play to creativity and hence to innovation in humans is strong. Considerable evidence suggests that coming up with new ideas requires a different mindset from usefully implementing a new idea.
Masur, Elise Frank; Flynn, Valerie; Olson, Janet
2016-01-01
Research on immediate effects of background television during mother-infant toy play shows that an operating television in the room disrupts maternal communicative behaviors crucial for infants' vocabulary acquisition. This study is the first to examine associations between frequent background TV/video exposure during mother-infant toy play at…
Directory of Open Access Journals (Sweden)
Markéta Kostrouchová
2017-06-01
Full Text Available The evolutionarily conserved Mediator complex is a critical player in regulating transcription. Comprised of approximately two dozen proteins, the Mediator integrates diverse regulatory signals through direct protein-protein interactions that, in turn, modulate the influence of Mediator on RNA Polymerase II activity. One Mediator subunit, MED28, is known to interact with cytoplasmic structural proteins, providing a potential direct link between cytoplasmic dynamics and the control of gene transcription. Although identified in many animals and plants, MED28 is not present in yeast; no bona fide MED28 has been described previously in Caenorhabditis elegans. Here, we identify bioinformatically F28F8.5, an uncharacterized predicted protein, as the nematode homologue of MED28. As in other Metazoa, F28F8.5 has dual nuclear and cytoplasmic localization and plays critical roles in the regulation of development. F28F8.5 is a vital gene and its null mutants have severely malformed gonads and do not reproduce. F28F8.5 interacts on the protein level with the Mediator subunits MDT-6 and MDT-30. Our results indicate that F28F8.5 is an orthologue of MED28 and suggest that the potential to link cytoplasmic and nuclear events is conserved between MED28 vertebrate and nematode orthologues.
Electrostatic Stabilization Plays a Central Role in Autoinhibitory Regulation of the Na+,K+-ATPase
DEFF Research Database (Denmark)
Jiang, Qiucen; Garcia, Alvaro; Han, Minwoo
2017-01-01
The Na+,K+-ATPase is present in the plasma membrane of all animal cells. It plays a crucial role in maintaining the Na+ and K+ electrochemical potential gradients across the membrane, which are essential in numerous physiological processes, e.g., nerve, muscle, and kidney function. Its cellular a...
The urokinase receptor and its structural homologue C4.4A in human cancer
DEFF Research Database (Denmark)
Jacobsen, B; Ploug, M
2008-01-01
The urokinase-type plasminogen activator receptor (uPAR) and its structural homologue C4.4A are multidomain members of the Ly6/uPAR/alpha-neurotoxin protein domain family. Both are glycosylphosphatidylinositol-anchored membrane glycoproteins encoded by neighbouring genes located on chromosome 19q13...... that high protein expression in tumour cells of non-small cell pulmonary adenocarcinomas is associated with a particularly severe disease progression. This review will evaluate structural-functional and disease-related aspects of uPAR and C4.4A with a view to possible pharmacological targeting strategies...... in the human genome. The structural relationship between the two proteins is, however, not reflected at the functional level. Whereas uPAR has a well-established role in regulating and focalizing uPA-mediated plasminogen activation to the surface of those cells expressing the receptor, the biological function...
The paediatric Bohler's angle and crucial angle of Gissane: a case series
Directory of Open Access Journals (Sweden)
Crawford Haemish A
2011-01-01
Full Text Available Abstract Background Bohler's angle and the crucial angle of Gissane can be used to assess calcaneal fractures. While the normal adult values of these angles are widely known, the normal paediatric values have not yet been established. Our aim is to investigate Bohler's angle and the crucial angle of Gissane in a paediatric population and establish normal paediatric reference values. Method We measured Bohler's angle and the crucial angle of Gissane using normal plain ankle radiographs of 763 patients from birth to 14 years of age completed over a five year period from July 2003 to June 2008. Results In our paediatric study group, the mean Bohler's angle was 35.2 degrees and the mean crucial angle of Gissane was 111.3 degrees. In an adult comparison group, the mean Bohler's angle was 39.2 degrees and the mean crucial angle of Gissane was 113.8 degrees. The differences in Bohler's angle and the crucial angle of Gissane between these two groups were statistically significant. Conclusion We have presented the normal values of Bohler's angle and the crucial angle of Gissane in a paediatric population. These values may provide a useful comparison to assist with the management of the paediatric calcaneal fracture.
Phospholipase C δ-type consists of three isozymes: bovine PLCδ2 is a homologue of human/mouse PLCδ4
International Nuclear Information System (INIS)
Irino, Yasuhiro; Cho, Hiroyuki; Nakamura, Yoshikazu; Nakahara, Masamichi; Furutani, Masahiro; Suh, Pann-Ghill; Takenawa, Tadaomi; Fukami, Kiyoko
2004-01-01
To date, 12 phospholipase C (PLC) isozymes have been identified in mammals, and they are divided into five classes, β-, γ-, δ-, ε-, and ζ-type. PLCδ-type is reported to be composed of four isozymes, PLCδ1-δ4. Here we report that a screening for mouse PLCδ2 from a BAC library with primers that amplify a specific region of bovine PLCδ2 resulted in isolation of one clone containing the mouse PLCδ4 gene. Furthermore, a database search revealed that there is only one gene corresponding to PLCδ2 and PLCδ4 in the mouse and human genomes, indicating that bovine PLCδ2 is a homologue of human and mouse PLCδ4. However, PLCδ2 Western blot analysis with a widely used commercial anti-PLCδ2 antibody showed an expression pattern distinct from that of PLCδ4 in wild-type mice. In addition, an 80-kDa band, which was recognized by antibody against PLCδ2, was smaller than an 85-kDa band detected by anti-PLCδ4 antibody, and the 80-kDa band was detectable in lysates of brain, testis, and spleen from PLCδ4-deficient mice. We also found that immunoprecipitates from brain lysates with this PLCδ2 antibody contained no PLC activity. From these data, we conclude that bovine PLCδ2 is a homologue of human and mouse PLCδ4, and that three isozymes (δ1, δ3, and δ4) exist in the PLCδ family
Homologue Structure of the SLAC1 Anion Channel for Closing Stomata in Leaves
Energy Technology Data Exchange (ETDEWEB)
Y Chen; L Hu; M Punta; R Bruni; B Hillerich; B Kloss; B Rost; J Love; S Siegelbaum; W Hendrickson
2011-12-31
The plant SLAC1 anion channel controls turgor pressure in the aperture-defining guard cells of plant stomata, thereby regulating the exchange of water vapour and photosynthetic gases in response to environmental signals such as drought or high levels of carbon dioxide. Here we determine the crystal structure of a bacterial homologue (Haemophilus influenzae) of SLAC1 at 1.20 {angstrom} resolution, and use structure-inspired mutagenesis to analyse the conductance properties of SLAC1 channels. SLAC1 is a symmetrical trimer composed from quasi-symmetrical subunits, each having ten transmembrane helices arranged from helical hairpin pairs to form a central five-helix transmembrane pore that is gated by an extremely conserved phenylalanine residue. Conformational features indicate a mechanism for control of gating by kinase activation, and electrostatic features of the pore coupled with electrophysiological characteristics indicate that selectivity among different anions is largely a function of the energetic cost of ion dehydration.
A Potato cDNA Encoding a Homologue of Mammalian Multidrug Resistant P-Glycoprotein
Wang, W.; Takezawa, D.; Poovaiah, B. W.
1996-01-01
A homologue of the multidrug resistance (MDR) gene was obtained while screening a potato stolon tip cDNA expression library with S-15-labeled calmodulin. The mammalian MDR gene codes for a membrane-bound P-glycoprotein (170-180 kDa) which imparts multidrug resistance to cancerous cells. The potato cDNA (PMDR1) codes for a polypeptide of 1313 amino acid residues (ca. 144 kDa) and its structural features are very similar to the MDR P-glycoprotein. The N-terminal half of the PMDR1-encoded protein shares striking homology with its C-terminal half, and each half contains a conserved ATP-binding site and six putative transmembrane domains. Southern blot analysis indicated that potato has one or two MDR-like genes. PMDR1 mRNA is constitutively expressed in all organs studied with higher expression in the stem and stolon tip. The PMDR1 expression was highest during tuber initiation and decreased during tuber development.
Banerjee, Rashida; Alsalman, Amani; Alqafari, Shehana
2016-01-01
English language learners are often at risk for communication and language delays--crucial elements in the foundation of early literacy skills. Studies have shown that preschool children involved in sociodramatic play demonstrate greater proficiency and interest in language development and reading. The manuscript shares evidence-based strategies…
Górnaś, Paweł
2015-04-01
The tocochromanol profile was studied in seed oils recovered from by-products of fruit industry, five dessert and seven crab apple varieties grown in Eastern Europe (Latvia). The seed oils obtained from dessert apples were characterized by higher contents of tocopherols (191.05-379.08 mg/100g oil) when compared to seed oils recovered from crab apples (130.55-202.54 mg/100g oil). The predominant homologues of tocopherol in all the studied samples were α and β over γ and δ. However, seed oils recovered from the apple cultivars 'Antej' and 'Beforest' had a unique profile of four tocopherol homologues (α:β:γ:δ) 91.41:80.55:72.46:79.03 and 114.55:112.84:78.69:73.00 mg/100g oil, respectively. A single dilution of seed oils in 2-propanol facilitated the direct use samples in the DPPH assay as well as injection into the RP-HPLC system containing a PFP (pentafluorophenyl) column, which resulted in a rapid separation of all four tocopherol homologues with excellent repeatability and reproducibility. Copyright © 2014 Elsevier Ltd. All rights reserved.
Bakker, E; Butterbach, P; Rouppe van der Voort, J; van der Vossen, E; van Vliet, J; Bakker, J; Goverse, A
2003-05-01
Nine resistance gene homologues (RGHs) were identified in two diploid potato clones (SH and RH), with a specific primer pair based on conserved motifs in the LRR domain of the potato cyst nematode resistance gene Gpa2 and the potato virus X resistance gene Rx1. A modified AFLP method was used to facilitate the genetic mapping of the RGHs in the four haplotypes under investigation. All nine RGHs appeared to be located in the Gpa2/ Rx1 cluster on chromosome XII. Construction of a physical map using bacterial artificial chromosome (BAC) clones for both the Solanum tuberosum ssp. tuberosum and the S. tuberosum ssp. andigena haplotype of SH showed that the RGHs are located within a stretch of less than 200 kb. Sequence analysis of the RGHs revealed that they are highly similar (93 to 95%) to Gpa2 and Rx1. The sequence identities among all RGHs range from 85 to 100%. Two pairs of RGHs are identical, or nearly so (100 and 99.9%), with each member located in a different genotype. Southern-blot analysis on genomic DNA revealed no evidence for additional homologues outside the Gpa2/ Rx1 cluster on chromosome XII.
Crucial Role of Vitamin D in the Musculoskeletal System
Directory of Open Access Journals (Sweden)
Elke Wintermeyer
2016-06-01
Full Text Available Vitamin D is well known to exert multiple functions in bone biology, autoimmune diseases, cell growth, inflammation or neuromuscular and other immune functions. It is a fat-soluble vitamin present in many foods. It can be endogenously produced by ultraviolet rays from sunlight when the skin is exposed to initiate vitamin D synthesis. However, since vitamin D is biologically inert when obtained from sun exposure or diet, it must first be activated in human beings before functioning. The kidney and the liver play here a crucial role by hydroxylation of vitamin D to 25-hydroxyvitamin D in the liver and to 1,25-dihydroxyvitamin D in the kidney. In the past decades, it has been proven that vitamin D deficiency is involved in many diseases. Due to vitamin D’s central role in the musculoskeletal system and consequently the strong negative impact on bone health in cases of vitamin D deficiency, our aim was to underline its importance in bone physiology by summarizing recent findings on the correlation of vitamin D status and rickets, osteomalacia, osteopenia, primary and secondary osteoporosis as well as sarcopenia and musculoskeletal pain. While these diseases all positively correlate with a vitamin D deficiency, there is a great controversy regarding the appropriate vitamin D supplementation as both positive and negative effects on bone mineral density, musculoskeletal pain and incidence of falls are reported.
Kwak, Kyung Jin; Kim, Bo Mi; Lee, Kwanuk; Kang, Hunseung
2017-05-17
Despite increasing understanding of the importance of the splicing of U12-type introns in plant development, the key question of which U12 intron-containing genes are essential for plant development has not yet been explored. Here, we assessed the functional role of the quatre-quart1 (QQT1) gene, one of the ~230 U12 intron-containing genes in Arabidopsis thaliana. Expression of QQT1 in the U11/U12-31K small nuclear ribonucleoprotein mutant (31k) rescued the developmental-defect phenotypes of the 31k mutant, whereas the miRNA-mediated qqt1 knockdown mutants displayed severe defects in growth and development, including severely arrested stem growth, small size, and the formation of serrated leaves. The structures of the shoot apical meristems in the qqt1 mutants were abnormal and disordered. Identification of QQT1-interacting proteins via a yeast two-hybrid screening and a firefly luciferase complementation-imaging assay revealed that a variety of proteins, including many chloroplast-targeted proteins, interacted with QQT1. Importantly, the levels of chloroplast-targeted proteins in the chloroplast were reduced, and the chloroplast structure was abnormal in the qqt1 mutant. Collectively, these results provide clear evidence that QQT1 is an indispensable U12 intron-containing gene whose correct splicing is crucial for the normal development of Arabidopsis. © The Author 2017. Published by Oxford University Press on behalf of the Society for Experimental Biology.
Directory of Open Access Journals (Sweden)
Ling Nie
2016-01-01
Full Text Available Cardiac fibroblasts (CFs play a key role in cardiac fibrosis by regulating the balance between extracellular matrix synthesis and breakdown. Although phosphatase and tensin homologue on chromosome 10 (PTEN has been found to play an important role in cardiovascular disease, it is not clear whether PTEN is involved in functional regulation of CFs. In the present study, PTEN was overexpressed in neonatal rat CFs via recombinant adenovirus-mediated gene transfer. The effects of PTEN overexpression on cell-cycle progression and angiotensin II- (Ang II- mediated regulation of collagen metabolism, synthesis of matrix metalloproteinases, and Akt/P27 signaling were investigated. Compared with uninfected cells and cells infected with green fluorescent protein-expressing adenovirus (Ad-GFP, cells infected with PTEN-expressing adenovirus (Ad-PTEN significantly increased PTEN protein and mRNA levels in CFs (P<0.05. The proportion of CFs in the G1/S cell-cycle phase was significantly higher for PTEN-overexpressing cells. In addition, Ad-PTEN decreased mRNA expression and the protein synthesis rate of collagen types I and III and antagonized Ang II-induced collagen synthesis. Overexpression of PTEN also decreased Ang II-induced matrix metalloproteinase-2 (MMP-2 and tissue inhibitor of metalloproteinase-1 (TIMP-1 production as well as gelatinase activity. Moreover, Ad-PTEN decreased Akt expression and increased P27 expression independent of Ang II stimulation. These results suggest that PTEN could regulate its functional effects in neonatal rat CFs partially via the Akt/P27 signaling pathway.
DEFF Research Database (Denmark)
Karoff, Helle Skovbjerg
2013-01-01
The aim of this article is to develop a view of play as a relation between play practices and play moods based on an empirical study of children's everyday life and by using Bateson's term of ‘framing’ [(1955/2001). In Steps to an ecology of mind (pp. 75–80). Chicago: University of Chicago Press......], Schmidt's notion of ‘commonness’ [(2005). Om respekten. København: Danmarks Pædagogiske Universitets Forlag; (2011). On respect. Copenhagen: Danish School of Education University Press] and Heidegger's term ‘mood’ [(1938/1996). Time and being. Cornwall: Wiley-Blackwell.]. Play mood is a state of being...... in which we are open and ready, both to others and their production of meaning and to new opportunities for producing meaning. This play mood is created when we engage with the world during play practices. The article points out four types of play moods – devotion, intensity, tension and euphorica – which...
Designing Out the Play: Accessibility and Playfulness in Inclusive Play.
Holt, Raymond; Beckett, Angharad
2017-01-01
Play is an important part of child development, yet disabled children are often excluded from the opportunity to play, either due to lack of accessible toys and games, or social pressures. This paper presents a case study reflecting on the development of Button Bash: a switch accessible game intended to encourage inclusive play between disabled and non-disabled children. In particular, the paper focuses on how changes intended to make the game more accessible tended to make it less playful, and reflects on the relationship between playfulness and accessibility.
Ion and metabolite transport in the chloroplast of algae: lessons from land plants.
Marchand, Justine; Heydarizadeh, Parisa; Schoefs, Benoît; Spetea, Cornelia
2018-06-01
Chloroplasts are endosymbiotic organelles and play crucial roles in energy supply and metabolism of eukaryotic photosynthetic organisms (algae and land plants). They harbor channels and transporters in the envelope and thylakoid membranes, mediating the exchange of ions and metabolites with the cytosol and the chloroplast stroma and between the different chloroplast subcompartments. In secondarily evolved algae, three or four envelope membranes surround the chloroplast, making more complex the exchange of ions and metabolites. Despite the importance of transport proteins for the optimal functioning of the chloroplast in algae, and that many land plant homologues have been predicted, experimental evidence and molecular characterization are missing in most cases. Here, we provide an overview of the current knowledge about ion and metabolite transport in the chloroplast from algae. The main aspects reviewed are localization and activity of the transport proteins from algae and/or of homologues from other organisms including land plants. Most chloroplast transporters were identified in the green alga Chlamydomonas reinhardtii, reside in the envelope and participate in carbon acquisition and metabolism. Only a few identified algal transporters are located in the thylakoid membrane and play role in ion transport. The presence of genes for putative transporters in green algae, red algae, diatoms, glaucophytes and cryptophytes is discussed, and roles in the chloroplast are suggested. A deep knowledge in this field is required because algae represent a potential source of biomass and valuable metabolites for industry, medicine and agriculture.
A Novel Ras Effector Pathway Found to Play Significant Role in Tumor Suppression | Poster
By Nancy Parrish, Staff Writer; photo by Richard Frederickson, Staff Photographer Normal cells have mechanisms to prevent the development of cancer. Among these is a type of tumor suppressor mechanism known as oncogene-induced senescence, or OIS, which halts the uncontrolled growth of cells caused by mutations in oncogenes. The oncogene Ras plays a crucial role in inducing OIS
Justification of a "Crucial" Experiment: Parity Nonconservation.
Franklin, Allan; Smokler, Howard
1981-01-01
Presents history, nature of evidence evaluated, and philosophical questions to justify the view that experiments on parity nonconservation were "crucial" experiments in the sense that they decided unambiguously and within a short period of time for the appropriate scientific community, between two or more competing theories or classes of theories.…
Aetiology of phenomenon of fair play in sport through psychoanalytic discourse
Directory of Open Access Journals (Sweden)
Roman Vodeb
2003-12-01
Full Text Available When discussing fair play, sports experts nowadays mostly talk about how to "be a sport" on a sport field. It means telling and preaching to athletes to obey all the written rules of sport's ethic and those not written as well. Here we want to explore the other meaning of the term "fair play". We want to really learn about it, because fair play certainly is a psychological category. Psychoanalytic logic teaches us that roots of fair play should be sought in the infantile period of child's development. It seems, that the events caused by the Oedipus complex and the building Superego have the most sufficient impact on someone's sports behavior. Theoretically speaking, fair play cannot be considered as something gained from culture - it is mainly a construct, a symptom of returning infantile repressions in the context of father as a sexual concurrent. "Turning to the opposite side" (reaction-formation is an ego-defense mechanism that in the etiology of fair play ought to be pointed out in particularly. As we are talking about men in sports, let us tell, it is the boy's relation towards his father at the time when he's arrogating the boy's mother to himself, the most crucial for feeling and performing fair play. Fantasies and repressions, which happened in the psychical reality of a child, have the main impact on fair play in sports as well as in other situations.
Directory of Open Access Journals (Sweden)
Zengliang Ruan
Full Text Available Thioredoxins (Trx proteins are a family of small, highly-conserved and ubiquitous proteins that play significant roles in the resistance of oxidative damage. In this study, a homologue of Trx was identified from the cDNA library of tentacle of the jellyfish Cyanea capillata and named CcTrx1. The full-length cDNA of CcTrx1 was 479 bp with a 312 bp open reading frame encoding 104 amino acids. Bioinformatics analysis revealed that the putative CcTrx1 protein harbored the evolutionarily-conserved Trx active site 31CGPC34 and shared a high similarity with Trx1 proteins from other organisms analyzed, indicating that CcTrx1 is a new member of Trx1 sub-family. CcTrx1 mRNA was found to be constitutively expressed in tentacle, umbrella, oral arm and gonad, indicating a general role of CcTrx1 protein in various physiological processes. The recombinant CcTrx1 (rCcTrx1 protein was expressed in Escherichia coli BL21 (DE3, and then purified by affinity chromatography. The rCcTrx1 protein was demonstrated to possess the expected redox activity in enzymatic analysis and protection against oxidative damage of supercoiled DNA. These results indicate that CcTrx1 may function as an important antioxidant in C. capillata. To our knowledge, this is the first Trx protein characterized from jellyfish species.
Vetere, A; Li, W-C; Paroni, F; Juhl, K; Guo, L; Nishimura, W; Dai, X; Bonner-Weir, S; Sharma, A
2010-01-01
The basic helix-loop-helix transcription factor neurogenin-3 (NGN3) commits the fates of pancreatic progenitors to endocrine cell types, but knowledge of the mechanisms regulating the choice between proliferation and differentiation of these progenitors is limited. Using a chromatin immunoprecipitation cloning approach, we searched for direct targets of NGN3 and identified a zinc-finger transcription factor, OVO homologue-like 1 (OVOL1). Transactivation experiments were carried out to elucidate the functional role of NGN3 in Ovol1 gene expression. Embryonic and adult rodents pancreases were immunostained for OVOL1, Ki67 and NGN3. We showed that NGN3 negatively regulates transcription of Ovol1 in an E-box-dependent fashion. The presence of either NGN3 or NEUROD1, but not MYOD, reduced endogenous Ovol1 mRNA. OVOL1 was detected in pancreatic tissue around embryonic day 15.5, after which OVOL1 levels dramatically increased. In embryonic pancreas, OVOL1 protein levels were low in NGN3(+) or Ki67(+) cells, but high in quiescent differentiated cells. OVOL1 presence was maintained in adult pancreas, where it was detected in islets, pancreatic ducts and some acinar cells. Additionally OVOL1 presence was lacking in proliferating ductules in regenerating pancreas and induced in cells as they began to acquire their differentiated phenotype. The timing of OVOL1 appearance in pancreas and its increased levels in differentiated cells suggest that OVOL1 promotes the transition of cells from a proliferating, less-differentiated state to a quiescent more-differentiated state. We conclude that OVOL1, a downstream target of NGN3, may play an important role in regulating the balance between proliferation and differentiation of pancreatic cells.
Gupta, Atul K.; Seneviratne, J. M.; Joshi, G. K.; Kumar, Anil
2012-01-01
Signaling pathways that activate different mitogen-activated protein kinases (MAPKs) in response to certain environmental conditions, play important role in mating type switching (Fus3) and pathogenicity (Pmk1) in many fungi. In order to determine the roles of such regulatory genes in Tilletia indica, the causal pathogen of Karnal bunt (KB) of wheat, semi-quantitative and quantitative RT-PCR was carried out to isolate and determine the expression of MAP kinase homologues during fungal growth and development under in vitro culture. Maximum expression of TiFus3 and TiPmk1 genes were observed at 14th and 21st days of culture and decreased thereafter. To investigate whether the fungus alters the expression levels of same kinases upon interaction with plants, cultures were treated with 1% of host factors (extracted from S-2 stage of wheat spikes). Such treatment induced the expression of MAPks in time dependent manner compared to the absence of host factors. These results suggest that host factor(s) provide certain signal(s) which activate TiFus3 and TiPmk1 during morphogenetic development of T. indica. The results also provides a clue about the role of host factors in enhancing the disease potential due to induction of MAP kinases involved in fungal development and pathogenecity. PMID:22547988
Bartholomeusz, Trixie Ann; Molinié, Roland; Roscher, Albrecht; Felpin, François-Xavier; Gillet, Françoise; Lebreton, Jacques; Mesnard, François; Robins, Richard J
2005-08-01
The metabolism of (R,S)-N-methylanabasine and (R,S)-N-methylanatabine has been studied in a cell suspension culture of Nicotiana plumbaginifolia. Both substrates are effectively demethylated, anabasine or anatabine, respectively, accumulating in the medium. Similarly, there is strong stereoselectivity for the (R)-isomers of both substrates. The kinetics of metabolism of (R,S)-N-methylanabasine differ significantly from those of nicotine in that no further degradation of the initial demethylation product occurs. (R,S)-N-Methylanatabine, however, shows kinetics closer to those of nicotine, with loss of alkaloid from the system. Further more, (R,S)-N-methylanabasine does not diminish (S)-nicotine demethylation, indicating a lack of competition. However, the metabolism of (S)-nicotine is affected by the presence of (R,S)-N-methylanabasine. Hence, the demethylation of the piperidine homologues of nicotine is seen to be similar but not identical to that of the pyridine analogues. The implications of these different metabolic profiles in relation to the demethylation activity are discussed.
Rigden, Daniel J; Thomas, Jens M H; Simkovic, Felix; Simpkin, Adam; Winn, Martyn D; Mayans, Olga; Keegan, Ronan M
2018-03-01
Molecular replacement (MR) is the predominant route to solution of the phase problem in macromolecular crystallography. Although routine in many cases, it becomes more effortful and often impossible when the available experimental structures typically used as search models are only distantly homologous to the target. Nevertheless, with current powerful MR software, relatively small core structures shared between the target and known structure, of 20-40% of the overall structure for example, can succeed as search models where they can be isolated. Manual sculpting of such small structural cores is rarely attempted and is dependent on the crystallographer's expertise and understanding of the protein family in question. Automated search-model editing has previously been performed on the basis of sequence alignment, in order to eliminate, for example, side chains or loops that are not present in the target, or on the basis of structural features (e.g. solvent accessibility) or crystallographic parameters (e.g. B factors). Here, based on recent work demonstrating a correlation between evolutionary conservation and protein rigidity/packing, novel automated ways to derive edited search models from a given distant homologue over a range of sizes are presented. A variety of structure-based metrics, many readily obtained from online webservers, can be fed to the MR pipeline AMPLE to produce search models that succeed with a set of test cases where expertly manually edited comparators, further processed in diverse ways with MrBUMP, fail. Further significant performance gains result when the structure-based distance geometry method CONCOORD is used to generate ensembles from the distant homologue. To our knowledge, this is the first such approach whereby a single structure is meaningfully transformed into an ensemble for the purposes of MR. Additional cases further demonstrate the advantages of the approach. CONCOORD is freely available and computationally inexpensive, so
Crystallization and preliminary diffraction analysis of a DsbA homologue from Wolbachia pipientis
Energy Technology Data Exchange (ETDEWEB)
Kurz, M. [Institute for Molecular Bioscience and ARC Special Research Centre for Functional and Applied Genomics, University of Queensland, St Lucia, QLD 4072 (Australia); Iturbe-Ormaetxe, I. [School of Integrative Biology, The University of Queensland, St Lucia, QLD 4072 (Australia); Jarrott, R. [Institute for Molecular Bioscience and ARC Special Research Centre for Functional and Applied Genomics, University of Queensland, St Lucia, QLD 4072 (Australia); O’Neill, S. L. [School of Integrative Biology, The University of Queensland, St Lucia, QLD 4072 (Australia); Byriel, K. A.; Martin, J. L., E-mail: j.martin@imb.uq.edu.au; Heras, B., E-mail: j.martin@imb.uq.edu.au [Institute for Molecular Bioscience and ARC Special Research Centre for Functional and Applied Genomics, University of Queensland, St Lucia, QLD 4072 (Australia)
2008-02-01
The first crystallization of a W. pipientis protein, α-DsbA1, was achieved using hanging-drop and sitting-drop vapour diffusion. α-DsbA1 is one of two DsbA homologues encoded by the Gram-negative α-proteobacterium Wolbachia pipientis, an endosymbiont that can behave as a reproductive parasite in insects and as a mutualist in medically important filarial nematodes. The α-DsbA1 protein is thought to be important for the folding and secretion of Wolbachia proteins involved in the induction of reproductive distortions. Crystals of native and SeMet α-DsbA1 were grown by vapour diffusion and belong to the monoclinic space group C2, with unit-cell parameters a = 71.4, b = 49.5, c = 69.3 Å, β = 107.0° and one molecule in the asymmetric unit (44% solvent content). X-ray data were recorded from native crystals to a resolution of 2.01 Å using a copper anode and data from SeMet α-DsbA1 crystals were recorded to 2.45 Å resolution using a chromium anode.
Directory of Open Access Journals (Sweden)
Jacek Mlochowski
2010-11-01
Full Text Available Various N-substituted benzisoselenazol-3(2H-ones and their non-selenium-containing analogues have been synthesized and tested against selected viruses (HHV-1, EMCV and VSV to determine the extent to which selenium plays a role in antiviral activity. The data presented here show that the presence of selenium is crucial for the antiviral properties of benzisoselenazol-3(2H-ones since their isostructural analogues having different groups but lacking selenium either did not show any antiviral activity or their activity was substantially lower. The open-chain analogues of benzisoselenazol-3(2H-ones—diselenides also exhibited high antiviral activity while selenides and disulfides were completely inactive towards model viruses.
Do PhD supervisors play a role in bridging academic cultures?
DEFF Research Database (Denmark)
Elliot, Dely; Kobayashi, Sofie
Our study reports a phenomenological investigation of ten international PhD students’ and nine supervisors’ first-hand experience of being in doctoral supervisory relationships in a Danish setting. In-depth qualitative data were gathered through face-to-face individual interviews, which explored...... differences and challenges experienced as a result of diversity with respect to their educational background and practices, particularly the pedagogic variation. In the same way that the literature suggests that educators play a crucial role in mediating such diversity in the teaching and learning contexts...... relationship (that crosses over academic and non-academic concerns) and the distinct role it plays deserves further attention. Cotterall, S. (2013). More than just a brain: emotions and the doctoral experience. Higher Education Research & Development, 1-14. Wright, T. (2003). Postgraduate research students...
IR-induced autophagy plays a role in survival of HeLa cells
International Nuclear Information System (INIS)
Kang, Mi Young; Jang, Eun Yeong; Ryu, Tae Ho; Chung, Dong Min; Kim, Jin Hong; Kim, Jin Kyu
2014-01-01
Cells respond to stress with repair, or are diverted into irreversible cell cycle exit (senescence) or are eliminated through programmed cell death. There are two major morphologically distinctive forms of programmed cell death, apoptosis and autophagic cell death. Apoptosis contribute to cell death, whereas autophagy can play a dual role in mediating either cell survival or death in response to various stress stimuli. Here we analysed cellular responses induced by IR. The understanding of an appropriate cellular stress response is of crucial importance in foreseeing the cell fate. Apoptotic feagures were not detected in HeLa under our experimental irradiation condition. Autophagic cell death in HeLa may play an important role in cell protection and can result in cell survival
On whether mirror neurons play a significant role in processing affective prosody.
Ramachandra, Vijayachandra
2009-02-01
Several behavioral and neuroimaging studies have indicated that both right and left cortical structures and a few subcortical ones are involved in processing affective prosody. Recent investigations have shown that the mirror neuron system plays a crucial role in several higher-level functions such as empathy, theory of mind, language, etc., but no studies so far link the mirror neuron system with affective prosody. In this paper is a speculation that the mirror neuron system, which serves as a common neural substrate for different higher-level functions, may play a significant role in processing affective prosody via its connections with the limbic lobe. Actual research must apply electrophysiological and neuroimaging techniques to assess whether the mirror neuron systems underly affective prosody in humans.
Metheetrairut, Chanatip; Ahuja, Yuri; Slack, Frank J
2017-10-02
The heterochronic pathway in C. elegans controls the relative timing of cell fate decisions during post-embryonic development. It includes a network of microRNAs (miRNAs), such as let-7, and protein-coding genes, such as the stemness factors, LIN-28 and LIN-41. Here we identified the acn-1 gene, a homologue of mammalian angiotensin-converting enzyme (ACE), as a new suppressor of the stem cell developmental defects of let-7 mutants. Since acn-1 null mutants die during early larval development, we used RNAi to characterize the role of acn-1 in C. elegans seam cell development, and determined its interaction with heterochronic factors, including let-7 and its downstream interactors - lin-41, hbl-1, and apl-1. We demonstrate that although RNAi knockdown of acn-1 is insufficient to cause heterochronic defects on its own, loss of acn-1 suppresses the retarded phenotypes of let-7 mutants and enhances the precocious phenotypes of hbl-1, though not lin-41, mutants. Conversely, the pattern of acn-1 expression, which oscillates during larval development, is disrupted by lin-41 mutants but not by hbl-1 mutants. Finally, we show that acn-1(RNAi) enhances the let-7-suppressing phenotypes caused by loss of apl-1, a homologue of the Alzheimer's disease-causing amyloid precursor protein (APP), while significantly disrupting the expression of apl-1 during the L4 larval stage. In conclusion, acn-1 interacts with heterochronic genes and appears to function downstream of let-7 and its target genes, including lin-41 and apl-1.
Böttcher, Christine; Burbidge, Crista A; Boss, Paul K; Davies, Christopher
2013-12-23
Fruit development is controlled by plant hormones, but the role of hormone interactions during fruit ripening is poorly understood. Interactions between ethylene and the auxin indole-3-acetic acid (IAA) are likely to be crucial during the ripening process, since both hormones have been shown to be implicated in the control of ripening in a range of different fruit species. Grapevine (Vitis vinifera L.) homologues of the TRYPTOPHAN AMINOTRANSFERASE RELATED (TAR) and YUCCA families, functioning in the only characterized pathway of auxin biosynthesis, were identified and the expression of several TAR genes was shown to be induced by the pre-ripening application of the ethylene-releasing compound Ethrel. The induction of TAR expression was accompanied by increased IAA and IAA-Asp concentrations, indicative of an upregulation of auxin biosynthesis and conjugation. Exposure of ex planta, pre-ripening berries to the ethylene biosynthesis inhibitor aminoethoxyvinylglycine resulted in decreased IAA and IAA-Asp concentrations. The delayed initiation of ripening observed in Ethrel-treated berries might therefore represent an indirect ethylene effect mediated by increased auxin concentrations. During berry development, the expression of three TAR genes and one YUCCA gene was upregulated at the time of ripening initiation and/or during ripening. This increase in auxin biosynthesis gene expression was preceded by high expression levels of the ethylene biosynthesis genes 1-aminocyclopropane-1-carboxylate synthase and 1-aminocyclopropane-1-carboxylate oxidase. In grape berries, members of both gene families involved in the two-step pathway of auxin biosynthesis are expressed, suggesting that IAA is produced through the combined action of TAR and YUCCA proteins in developing berries. The induction of TAR expression by Ethrel applications and the developmental expression patterns of auxin and ethylene biosynthesis genes indicate that elevated concentrations of ethylene prior to the
Kumar, L; Sridhara, S; Singh, B P; Gangal, S V
1998-11-01
Previous studies have established the role of Imperata cylindrica (Ic) pollen in type I allergic disorders. However, no systematic information is available on the allergen composition of Ic pollen extract. To characterize the IgE-binding proteins of Ic pollen extract and to detect the presence of grass group 1, 4 and 5 allergen homologues, if any. Pollen extract of Ic was analyzed by in vivo and in vitro procedures such as intradermal tests (ID), enzyme-linked immunosorbent assay (ELISA), ELISA-inhibition, thin-layer isoelectric focusing (TLIEF), sodium dodecylsulfate polyacrylamide gel electrophoresis (SDS-PAGE) and immunoblotting. Dot blot assay was carried out to check the presence of well-known group 1, 4, and 5 allergen homologues in Ic pollen extract. Out of 303 respiratory allergies patients skin-tested, 27 showed sensitivity to Ic pollen extract. Specific IgE levels were elevated in all 15 serum samples tested. The extract prepared for this study was found to be highly potent since it required only 400 ng of homologous proteins for 50% inhibition of binding in ELISA inhibition assays. TLIEF of Ic pollen extract showed 44 silver-stained bands (pI 3.5-7.0) while SDS-PAGE resolved it into 24 Coomassie-Brilliant-Blue-stained bands (MW 100-10 kD). Immunoblotting with individual patient sera recognized 7 major IgE-binding bands (MW 85, 62, 57, 43, 40, 28 and 16 kD) in Ic pollen extract. A panel of monoclonal antibodies, specific to group 1, 4 and 5 allergens from Phleum pratense pollen extract identified group 5 and group 4 homologues in Ic pollen extract. Ic pollen extract was characterized for the protein profile by TLIEF and SDS-PAGE. IgE reactivity was determined by ELISA and immunoblot. Monoclonal antibodies to group 5 and group 4 allergens reacted weakly showing that this pollen contains group 5 and group 4 homologous allergens.
DEFF Research Database (Denmark)
Sicart (Vila), Miguel Angel
? In Play Matters, Miguel Sicart argues that to play is to be in the world; playing is a form of understanding what surrounds us and a way of engaging with others. Play goes beyond games; it is a mode of being human. We play games, but we also play with toys, on playgrounds, with technologies and design......, but not necessarily fun. Play can be dangerous, addictive, and destructive. Along the way, Sicart considers playfulness, the capacity to use play outside the context of play; toys, the materialization of play--instruments but also play pals; playgrounds, play spaces that enable all kinds of play; beauty...
Directory of Open Access Journals (Sweden)
Javiera Norambuena
Full Text Available Thiol/disulfide systems are involved in the maintenance of the redox status of proteins and other molecules that contain thiol/disulfide groups. Leptospirillum ferriphilum DSM14647, an acidophilic bacterium that uses Fe(2+ as electron donor, and withstands very high concentrations of iron and other redox active metals, is a good model to study how acidophiles preserve the thiol/disulfide balance. We studied the composition of thiol/disulfide systems and their role in the oxidative stress response in this extremophile bacterium. Bioinformatic analysis using genomic data and enzymatic assays using protein extracts from cells grown under oxidative stress revealed that the major thiol/disulfide system from L. ferriphilum are a cytoplasmic thioredoxin system (composed by thioredoxins Trx and thioredoxin reductase TR, periplasmic thiol oxidation system (DsbA/DsbB and a c-type cytochrome maturation system (DsbD/DsbE. Upon exposure of L. ferriphilum to reactive oxygen species (ROS-generating compounds, transcriptional activation of the genes encoding Trxs and the TR enzyme, which results in an increase of the corresponding activity, was observed. Altogether these data suggest that the thioredoxin-based thiol/disulfide system plays an important role in redox protection of L. ferriphilum favoring the survival of this microorganism under extreme environmental oxidative conditions.
Directory of Open Access Journals (Sweden)
Aleksander F Sikorski
2007-01-01
Full Text Available The review is focused on the domain structure and function of protein 4.1, one of the proteins belonging to the membrane skeleton. The protein 4.1 of the red blood cells (4.1R is a multifunctional protein that localizes to the membrane skeleton and stabilizes erythrocyte shape and membrane mechanical properties, such as deformability and stability, via lateral interactions with spectrin, actin, glycophorin C and protein p55. Protein 4.1 binding is modulated through the action of kinases and/or calmodulin-Ca2+. Non-erythroid cells express the 4.1R homologues: 4.1G (general type, 4.1B (brain type, and 4.1N (neuron type, and the whole group belongs to the protein 4.1 superfamily, which is characterized by the presence of a highly conserved FERM domain at the N-terminus of the molecule. Proteins 4.1R, 4.1G, 4.1N and 4.1B are encoded by different genes. Most of the 4.1 superfamily proteins also contain an actin-binding domain. To date, more than 40 members have been identified. They can be divided into five groups: protein 4.1 molecules, ERM proteins, talin-related molecules, protein tyrosine phosphatase (PTPH proteins and NBL4 proteins. We have focused our attention on the main, well known representatives of 4.1 superfamily and tried to choose the proteins which are close to 4.1R or which have distinct functions. 4.1 family proteins are not just linkers between the plasma membrane and membrane skeleton; they also play an important role in various processes. Some, such as focal adhesion kinase (FAK, non-receptor tyrosine kinase that localizes to focal adhesions in adherent cells, play the role in cell adhesion. The other members control or take part in tumor suppression, regulation of cell cycle progression, inhibition of cell proliferation, downstream signaling of the glutamate receptors, and establishment of cell polarity; some are also involved in cell proliferation, cell motility, and/or cell-to-cell communication.
Chen, H.; Rossier, C.; Lalioti, M. D.; Lynn, A.; Chakravarti, A.; Perrin, G.; Antonarakis, S. E.
1996-01-01
In an effort to contribute to the transcript map of human chromosome 21 and the understanding of the pathophysiology of trisomy 21, we have used exon trapping to identify fragments of chromosome 21 genes. Two trapped exons, from pools of chromosome 21-specific cosmids, showed homology to the Drosophila white (w) gene. We subsequently cloned the corresponding cDNA for a human homologue of the Drosophila w gene (hW) from human retina and fetal brain cDNA libraries. The gene belongs to the ATP-b...
Disruption of Circadian Rhythms: A Crucial Factor in the Etiology of Depression
Directory of Open Access Journals (Sweden)
Roberto Salgado-Delgado
2011-01-01
Full Text Available Circadian factors might play a crucial role in the etiology of depression. It has been demonstrated that the disruption of circadian rhythms by lighting conditions and lifestyle predisposes individuals to a wide range of mood disorders, including impulsivity, mania and depression. Also, associated with depression, there is the impairment of circadian rhythmicity of behavioral, endocrine, and metabolic functions. Inspite of this close relationship between both processes, the complex relationship between the biological clock and the incidence of depressive symptoms is far from being understood. The efficiency and the timing of treatments based on chronotherapy (e.g., light treatment, sleep deprivation, and scheduled medication indicate that the circadian system is an essential target in the therapy of depression. The aim of the present review is to analyze the biological and clinical data that link depression with the disruption of circadian rhythms, emphasizing the contribution of circadian desynchrony. Therefore, we examine the conditions that may lead to circadian disruption of physiology and behavior as described in depressive states, and, according to this approach, we discuss therapeutic strategies aimed at treating the circadian system and depression.
A proactive and holistic information management approach is crucial ...
African Journals Online (AJOL)
ESARBICA Journal: Journal of the Eastern and Southern Africa Regional Branch of ... holistic information management approach is crucial to e-government development ... and to develop new electronic services hence boosting innovation.
Qi, Shengcai; Yan, Yanhong; Wen, Yue; Li, Jialiang; Wang, Jing; Chen, Fubo; Tang, Xiaoshan; Shang, Guangwei; Xu, Yuanzhi; Wang, Raorao
2017-06-01
This study aimed to investigate the functions of delta-like homologue 1 (DLK1) in the proliferation and differentiation of human dental pulp stem cells (hDPSCs). Immunohistochemical analysis was used to determine the expression of alkaline phosphatase (ALP), dentin sialophosphoprotein (DSPP), DLK1, NOTCH1 and p-ERK1/2 in the mouse first maxillary molar. Recombinant lentivirus was constructed to overexpress DLK1 stably in hDPSCs. The cell viability and proliferation of hDPSCs were examined by CCK8 and EdU incorporation assay respectively. The odontoblastic differentiation of hDPSCs was determined by detection of ALPase activity assay, ALP and alizarin red staining and the expression of mineralization-related genes including ALP, DSPP and dental matrix protein. The mRNA and protein levels of DLK1 and p-ERK1/2 protein expression were detected. ERK inhibitor was used to test the differentiation effect of DLK1 on hDPSCs. Delta-like homologue 1 was highly expressed on the odontoblasts and dental pulp cells on the first maxillary molar; the expression of p-ERK1/2 is similar with the DLK1 in the same process. The expression level of DLK1 increased significantly after the odontoblastic induction of hDPSCs. DLK1 overexpression increased the proliferation ability of hDPSCs and inhibited odontoblastic differentiation of hDPSCs. The protein level of p-ERK1/2 significantly increased in hDPSCs/dlk1-oe group. ERK signalling pathway inhibitor reversed the odontoblastic differentiation effects of DLK1 on hDPSCs. The proliferation of hDPSCs was promoted after DLK1 overexpression. DLK1 inhibited the odontoblastic differentiation of hDPSCs, which maybe through ERK signalling pathway. © 2017 John Wiley & Sons Ltd.
Problematic Game Play: The Diagnostic Value of Playing Motives, Passion, and Playing Time in Men
Directory of Open Access Journals (Sweden)
Julia Kneer
2015-04-01
Full Text Available Internet gaming disorder is currently listed in the DSM—not in order to diagnose such a disorder but to encourage research to investigate this phenomenon. Even whether it is still questionable if Internet Gaming Disorder exists and can be judged as a form of addiction, problematic game play is already very well researched to cause problems in daily life. Approaches trying to predict problematic tendencies in digital game play have mainly focused on playing time as a diagnostic criterion. However, motives to engage in digital game play and obsessive passion for game play have also been found to predict problematic game play but have not yet been investigated together. The present study aims at (1 analyzing if obsessive passion can be distinguished from problematic game play as separate concepts, and (2 testing motives of game play, passion, and playing time for their predictive values for problematic tendencies. We found (N = 99 males, Age: M = 22.80, SD = 3.81 that obsessive passion can be conceptually separated from problematic game play. In addition, the results suggest that compared to solely playing time immersion as playing motive and obsessive passion have added predictive value for problematic game play. The implications focus on broadening the criteria in order to diagnose problematic playing.
Problematic game play: the diagnostic value of playing motives, passion, and playing time in men.
Kneer, Julia; Rieger, Diana
2015-04-30
Internet gaming disorder is currently listed in the DSM-not in order to diagnose such a disorder but to encourage research to investigate this phenomenon. Even whether it is still questionable if Internet Gaming Disorder exists and can be judged as a form of addiction, problematic game play is already very well researched to cause problems in daily life. Approaches trying to predict problematic tendencies in digital game play have mainly focused on playing time as a diagnostic criterion. However, motives to engage in digital game play and obsessive passion for game play have also been found to predict problematic game play but have not yet been investigated together. The present study aims at (1) analyzing if obsessive passion can be distinguished from problematic game play as separate concepts, and (2) testing motives of game play, passion, and playing time for their predictive values for problematic tendencies. We found (N = 99 males, Age: M = 22.80, SD = 3.81) that obsessive passion can be conceptually separated from problematic game play. In addition, the results suggest that compared to solely playing time immersion as playing motive and obsessive passion have added predictive value for problematic game play. The implications focus on broadening the criteria in order to diagnose problematic playing.
Adaptation dans les zones cruciales au regard des changements ...
International Development Research Centre (IDRC) Digital Library (Canada)
) vise à accroître la résilience des populations pauvres dans trois « zones cruciales » au regard des changements climatiques : les bassins hydrographiques, les deltas et les régions semi-arides.
Crucial roles of the protein kinases MK2 and MK3 in a mouse model of glomerulonephritis.
Directory of Open Access Journals (Sweden)
Adam J Guess
Full Text Available Elevated mitogen-activated protein kinase p38 (p38 MAPK signaling has been implicated in various experimental and human glomerulopathies, and its inhibition has proven beneficial in animal models of these diseases. p38 MAPK signaling is partially mediated through MK2 and MK3, two phylogenetically related protein kinases that are its direct substrates. The current study was designed to determine the specific roles of MK2 and MK3 in a mouse model of acute proliferative glomerulonephritis, using mice with disrupted MK2 and/or MK3 genes. We found that the absence of MK3 alone worsened the disease course and increased mortality slightly compared to wild-type mice, whereas the absence of MK2 alone exhibited no significant effect. However, in an MK3-free background, the disease course depended on the presence of MK2 in a gene dosage-dependent manner, with double knock-out mice being most susceptible to disease induction. Histological and renal functional analyses confirmed kidney damage following disease induction. Because the renal stress response plays a crucial role in kidney physiology and disease, we analyzed the stress response pattern in this disease model. We found that renal cortices of diseased mice exhibited a pronounced and specific pattern of expression and/or phosphorylation of stress proteins and other indicators of the stress response (HSPB1, HSPB6, HSPB8, CHOP, eIF2α, partially in a MK2/MK3 genotype-specific manner, and without induction of a general stress response. Similarly, the expression and activation patterns of other protein kinases downstream of p38 MAPK (MNK1, MSK1 depended partially on the MK2/MK3 genotype in this disease model. In conclusion, MK2 and MK3 together play crucial roles in the regulation of the renal stress response and in the development of glomerulonephritis, which can potentially be exploited to develop novel therapeutic approaches to treat glomerular disease.
International Nuclear Information System (INIS)
Fahleson, Tobias; Norman, Patrick; Coriani, Sonia; Rizzo, Antonio; Rikken, Geert L. J. A.
2013-01-01
We report on the results of a systematic ab initio study of the Jones birefringence of noble gases, of furan homologues, and of monosubstituted benzenes, in the gas phase, with the aim of analyzing the behavior and the trends within a list of systems of varying size and complexity, and of identifying candidates for a combined experimental/theoretical study of the effect. We resort here to analytic linear and nonlinear response functions in the framework of time-dependent density functional theory. A correlation is made between the observable (the Jones constant) and the atomic radius for noble gases, or the permanent electric dipole and a structure/chemical reactivity descriptor as the para Hammett constant for substituted benzenes
International Nuclear Information System (INIS)
Delfosse, Vanessa; Hugonnet, Jean-Emmanuel; Sougakoff, Wladimir; Mayer, Claudine
2005-01-01
The crystallization of a hypothetical penicillin-binding protein from the archaeon P. abyssi in space group C2 by hanging-drop vapour diffusion is reported. The genome of the hyperthermophilic archaeon Pyrococcus abyssi contains a gene (pab0087) encoding a penicillin-binding protein (PBP) homologue. This sequence consists of 447 residues and shows significant sequence similarity to low-molecular-weight PBPs and class C β-lactamases. The Pab0087 protein was overexpressed, purified and crystallized. Diffraction data from two different crystal forms were collected to 2.7 and 2.0 Å resolution. Both crystals belong to space group C2, with unit-cell parameters a = 160.59, b = 135.74, c = 113.02 Å, β = 117.36° and a = 166.97, b = 131.25, c = 189.39 Å, β = 113.81°, respectively. The asymmetric unit contains four and eight molecules, respectively, with fourfold non-crystallographic symmetry
Czech Academy of Sciences Publication Activity Database
Tomaštíková, Eva; Cenklová, Věra; Kohoutová, Lucie; Petrovská, Beáta; Váchová, Lenka; Halada, Petr; Kočárová, Gabriela; Binarová, Pavla
2012-01-01
Roč. 12, č. 83 (2012) ISSN 1471-2229 R&D Projects: GA ČR(CZ) GA204/07/1169; GA ČR GP204/09/P155; GA ČR GAP501/12/2333; GA MŠk(CZ) LC06034; GA MŠk LC545; GA AV ČR IAA500200719 Grant - others:GA MŠk(CZ) ED0007/01/01 Program:ED Institutional research plan: CEZ:AV0Z50380511; CEZ:AV0Z50200510 Keywords : Arabidopsis homologue of RanBPM * CTLH-complex * LisH-CTLH domain proteins Subject RIV: EB - Genetics ; Molecular Biology Impact factor: 4.354, year: 2012
Clinical Trials: A Crucial Key to Human Health Research
... Past Issues Clinical Trials: A Crucial Key to Human Health Research Past Issues / Summer 2006 Table of Contents ... Javascript on. Photo: PhotoDisc At the forefront of human health research today are clinical trials—studies that use ...
Directory of Open Access Journals (Sweden)
Juan Carlos LLibre Guerra
2008-03-01
Full Text Available Las demencias, entidades de elevada frecuencia en el adulto mayor, constituyen un creciente problema de salud en países con una alta expectativa de vida como el nuestro, no solo por su magnitud, sino por su repercusión a nivel individual, familiar y social. Se presenta un estudio descriptivo de corte transversal, realizado en el período comprendido entre enero de 2003 y enero de 2005, en las áreas de salud del municipio Marianao, con el objetivo de determinar el impacto psicosocial del síndrome demencial en cuidadores cruciales. Se visitaron 110 cuidadores de pacientes con demencia y enfermedad de Alzheimer diagnosticados de acuerdo con los criterios del DSM-IV. Los cuidadores cruciales de los pacientes con demencia correspondieron en su mayoría a mujeres casadas, esposa o hijas del paciente, en la quinta década de la vida, amas de casa, y con un nivel medio de escolaridad. El cuidador dedica alrededor de 12 h diarias al cuidado del paciente, la mayor parte en la supervisión. Se evidenció afectación psicológica en el 89 % de los cuidadores. El nivel de sobrecarga o estrés en la muestra es significativamente elevado. Los cuidadores consideran como primera prioridad información acerca de la enfermedad y atención al paciente. Se recomienda realizar un plan de intervención educativa dirigido a los cuidadores, que permita reducir la sobrecarga física, psicológica y económica del cuidado y mejorar su calidad de vida.The dementias, entities of an elevated frequency in the older adult, are an increasing health problem in countries with a high life expectancy at birth as ours, not only because of their magnitude, but also because of their repercussion at the individual, familiar and social levels. A descriptive cross-sectional study was undertaken from January 2003 to January 2005 in the health areas of Marianao municipality with the objective of determining the psychosocial impact of the demential syndrome in crucial care givers. 110
Mhamdi, Amna; Hager, Jutta; Chaouch, Sejir; Queval, Guillaume; Han, Yi; Taconnat, Ludivine; Saindrenan, Patrick; Gouia, Houda; Issakidis-Bourguet, Emmanuelle; Renou, Jean-Pierre; Noctor, Graham
2010-07-01
Glutathione is a major cellular thiol that is maintained in the reduced state by glutathione reductase (GR), which is encoded by two genes in Arabidopsis (Arabidopsis thaliana; GR1 and GR2). This study addressed the role of GR1 in hydrogen peroxide (H(2)O(2)) responses through a combined genetic, transcriptomic, and redox profiling approach. To identify the potential role of changes in glutathione status in H(2)O(2) signaling, gr1 mutants, which show a constitutive increase in oxidized glutathione (GSSG), were compared with a catalase-deficient background (cat2), in which GSSG accumulation is conditionally driven by H(2)O(2). Parallel transcriptomics analysis of gr1 and cat2 identified overlapping gene expression profiles that in both lines were dependent on growth daylength. Overlapping genes included phytohormone-associated genes, in particular implicating glutathione oxidation state in the regulation of jasmonic acid signaling. Direct analysis of H(2)O(2)-glutathione interactions in cat2 gr1 double mutants established that GR1-dependent glutathione status is required for multiple responses to increased H(2)O(2) availability, including limitation of lesion formation, accumulation of salicylic acid, induction of pathogenesis-related genes, and signaling through jasmonic acid pathways. Modulation of these responses in cat2 gr1 was linked to dramatic GSSG accumulation and modified expression of specific glutaredoxins and glutathione S-transferases, but there is little or no evidence of generalized oxidative stress or changes in thioredoxin-associated gene expression. We conclude that GR1 plays a crucial role in daylength-dependent redox signaling and that this function cannot be replaced by the second Arabidopsis GR gene or by thiol systems such as the thioredoxin system.
Antidepressant Binding Site in a Bacterial Homologue of Neurotransmitter Transporters
International Nuclear Information System (INIS)
Singh, S.; Yamashita, A.; Gouaux, E.
2007-01-01
Sodium-coupled transporters are ubiquitous pumps that harness pre-existing sodium gradients to catalyse the thermodynamically unfavourable uptake of essential nutrients, neurotransmitters and inorganic ions across the lipid bilayer. Dysfunction of these integral membrane proteins has been implicated in glucose/galactose malabsorption, congenital hypothyroidism, Bartter's syndrome, epilepsy, depression, autism and obsessive-compulsive disorder. Sodium-coupled transporters are blocked by a number of therapeutically important compounds, including diuretics, anticonvulsants and antidepressants, many of which have also become indispensable tools in biochemical experiments designed to probe antagonist binding sites and to elucidate transport mechanisms. Steady-state kinetic data have revealed that both competitive and noncompetitive modes of inhibition exist. Antagonist dissociation experiments on the serotonin transporter (SERT) have also unveiled the existence of a low-affinity allosteric site that slows the dissociation of inhibitors from a separate high-affinity site. Despite these strides, atomic-level insights into inhibitor action have remained elusive. Here we screen a panel of molecules for their ability to inhibit LeuT, a prokaryotic homologue of mammalian neurotransmitter sodium symporters, and show that the tricyclic antidepressant (TCA) clomipramine noncompetitively inhibits substrate uptake. Cocrystal structures show that clomipramine, along with two other TCAs, binds in an extracellular-facing vestibule about 11 (angstrom) above the substrate and two sodium ions, apparently stabilizing the extracellular gate in a closed conformation. Off-rate assays establish that clomipramine reduces the rate at which leucine dissociates from LeuT and reinforce our contention that this TCA inhibits LeuT by slowing substrate release. Our results represent a molecular view into noncompetitive inhibition of a sodium-coupled transporter and define principles for the rational
Antidepressant Binding Site in a Bacterial Homologue of Neurotransmitter Transporters
Energy Technology Data Exchange (ETDEWEB)
Singh,S.; Yamashita, A.; Gouaux, E.
2007-01-01
Sodium-coupled transporters are ubiquitous pumps that harness pre-existing sodium gradients to catalyse the thermodynamically unfavourable uptake of essential nutrients, neurotransmitters and inorganic ions across the lipid bilayer. Dysfunction of these integral membrane proteins has been implicated in glucose/galactose malabsorption, congenital hypothyroidism, Bartter's syndrome, epilepsy, depression, autism and obsessive-compulsive disorder. Sodium-coupled transporters are blocked by a number of therapeutically important compounds, including diuretics, anticonvulsants and antidepressants, many of which have also become indispensable tools in biochemical experiments designed to probe antagonist binding sites and to elucidate transport mechanisms. Steady-state kinetic data have revealed that both competitive and noncompetitive modes of inhibition exist. Antagonist dissociation experiments on the serotonin transporter (SERT) have also unveiled the existence of a low-affinity allosteric site that slows the dissociation of inhibitors from a separate high-affinity site. Despite these strides, atomic-level insights into inhibitor action have remained elusive. Here we screen a panel of molecules for their ability to inhibit LeuT, a prokaryotic homologue of mammalian neurotransmitter sodium symporters, and show that the tricyclic antidepressant (TCA) clomipramine noncompetitively inhibits substrate uptake. Cocrystal structures show that clomipramine, along with two other TCAs, binds in an extracellular-facing vestibule about 11 {angstrom} above the substrate and two sodium ions, apparently stabilizing the extracellular gate in a closed conformation. Off-rate assays establish that clomipramine reduces the rate at which leucine dissociates from LeuT and reinforce our contention that this TCA inhibits LeuT by slowing substrate release. Our results represent a molecular view into noncompetitive inhibition of a sodium-coupled transporter and define principles for the
The expression of the rice (Oryza sativa L.) homologue of Snm1 is induced by DNA damages
International Nuclear Information System (INIS)
Kimura, Seisuke; Saotome, Ai; Uchiyama, Yukinobu; Mori, Yoko; Tahira, Yasue; Sakaguchi, Kengo
2005-01-01
We isolated and characterized the rice homologue of the DNA repair gene Snm1 (OsSnm1). The length of the cDNA was 1862 bp; the open reading frame encoded a predicted product of 485 amino acid residues with a molecular mass of 53.2 kDa. The OsSnm1 protein contained the conserved β-lactamase domain in its internal region. OsSnm1 was expressed in all rice organs. The expression was induced by MMS, H 2 O 2 , and mitomycin C, but not by UV. Transient expression of an OsSnm1/GFP fusion protein in onion epidermal cells revealed the localization of OsSnm1 to the nucleus. These results suggest that OsSnm1 is involved not only in the repair of DNA interstrand crosslinks, but also in various other DNA repair pathways
Contribution of polycomb homologues Bmi-1 and Mel-18 to medulloblastoma pathogenesis.
Wiederschain, Dmitri; Chen, Lin; Johnson, Brett; Bettano, Kimberly; Jackson, Dowdy; Taraszka, John; Wang, Y Karen; Jones, Michael D; Morrissey, Michael; Deeds, James; Mosher, Rebecca; Fordjour, Paul; Lengauer, Christoph; Benson, John D
2007-07-01
Bmi-1 and Mel-18 are structural homologues that belong to the Polycomb group of transcriptional regulators and are believed to stably maintain repression of gene expression by altering the state of chromatin at specific promoters. While a number of clinical and experimental observations have implicated Bmi-1 in human tumorigenesis, the role of Mel-18 in cancer cell growth has not been investigated. We report here that short hairpin RNA-mediated knockdown of either Bmi-1 or Mel-18 in human medulloblastoma DAOY cells results in the inhibition of proliferation, loss of clonogenic survival, anchorage-independent growth, and suppression of tumor formation in nude mice. Furthermore, overexpression of both Bmi-1 and Mel-18 significantly increases the clonogenic survival of Rat1 fibroblasts. In contrast, stable downregulation of Bmi-1 or Mel-18 alone does not affect the growth of normal human WI38 fibroblasts. Proteomics-based characterization of Bmi-1 and Mel-18 protein complexes isolated from cancer cells revealed substantial similarities in their respective compositions. Finally, gene expression analysis identified a number of cancer-relevant pathways that may be controlled by Bmi-1 and Mel-18 and also showed that these Polycomb proteins regulate a set of common gene targets. Taken together, these results suggest that Bmi-1 and Mel-18 may have overlapping functions in cancer cell growth.
The ontogeny of nanos homologue expression in the oligochaete annelid Tubifex tubifex.
Mohri, Ki-Ichi; Nakamoto, Ayaki; Shimizu, Takashi
2016-01-01
We have cloned and characterized the expression of a nanos homologue (designated Ttu-nos) from the oligochaete annelid Tubifex tubifex. Ttu-nos mRNA is distributed broadly throughout the early cleavage stages. Ttu-nos is expressed in most if not all of the early blastomeres, in which Ttu-nos RNA associates with pole plasms. Ttu-nos transcripts are concentrated to 2d and 4d cells. Shortly after 2d(111) (derived from 2d cell) divides into a bilateral pair of NOPQ proteloblasts, Ttu-nos RNA vanishes from the embryo, which is soon followed by the resumption of Ttu-nos expression in nascent primary blast cells produced by teloblasts. The resumption of Ttu-nos expression occurs only in a subset of teloblast lineages (viz., M, N and Q). After Ttu-nos expression is retained in the germ band for a while, it disappears in anterior-to-posterior progression. At the end of embryogenesis, there is no trace of Ttu-nos expression. Thereafter, growing juveniles do not show any sign of Ttu-nos expression, either. The first sign of Ttu-nos expression is detected in oocytes in the ovary of young adults (ca 40 days after hatching), and its expression continues in growing oocytes that undergo yolk deposition and maturation in the ovisac. Copyright © 2015 Elsevier B.V. All rights reserved.
International Nuclear Information System (INIS)
Bertin, Benjamin; Caby, Stephanie; Oger, Frederik; Sasorith, Souphatta; Wurtz, Jean-Marie; Pierce, Raymond J.
2005-01-01
In an attempt to understand development and differentiation processes of the parasitic blood fluke Schistosoma mansoni, several members of the nuclear receptor superfamily were cloned, including SmFtz-F1 (S. mansoni Fushi Tarazu-factor 1). The Ftz-F1 nuclear receptor subfamily only contains orphan receptors that bind to their response element as monomers. Whereas SmFtz-F1 displays these basic functional properties, we have identified an original and specific interaction between SmFtz-F1 and the schistosome RXR homologue, SmRXR1. The mammalian two-hybrid assay showed that the D, E, and F domains of SmFtz-F1 were capable of interacting specifically with the E domain of SmRXR1 but not with that of mouse RXRα. Using three-dimensional LBD homology modelling and structure-guided mutagenesis, we were able to demonstrate the essential role of exposed residues located in the dimerization interfaces of both receptors in the maintenance of the interaction. Cotransfection experiments with constructions encoding full-length nuclear receptors show that SmRXR1 potentiates the transcriptional activity of SmFtz-F1 from various promoters. Nevertheless, the lack of identification of a dimeric response element for this SmFtz-F1/SmRXR1 heterodimer seems to indicate a 'tethering' mechanism. Thus, our results suggest for the first time that a member of the Ftz-F1 family could heterodimerize functionally with a homologue of the universal heterodimerization partner of nuclear receptors. This unique property confirms that SmFtz-F1 may be involved in the development and differentiation of schistosome-specific structures
DEFF Research Database (Denmark)
Skjødt, Mikkel-Ole; Palarasah, Yaseelan; Rasmussen, Karina Juhl
2010-01-01
The lectin complement pathway has important functions in vertebrate host defence and accumulating evidence of primordial complement components trace its emergence to invertebrate phyla. We introduce two putative mannose-binding lectin homologues (CioMBLs) from the urochordate species Ciona intest...... protease in the epithelia cells lining the stomach and intestine. In conclusion we present two urochordate MBLs and identify an associated serine protease, which support the concept of an evolutionary ancient origin of the lectin complement pathway....
Crystal structure of a bacterial homologue of the bile acid sodium symporter ASBT
Hu, Nien-Jen; Iwata, So; Cameron, Alexander D.; Drew, David
2011-01-01
High cholesterol levels greatly increase the risk of cardiovascular disease. By its conversion into bile acids, about 50% of cholesterol is eliminated from the body. However bile acids released from the bile duct are constantly recycled, being reabsorbed in the intestine via the Apical Sodium dependent Bile acid Transporter (ASBT). It has been shown in animal models that plasma cholesterol levels are significantly lowered by specific inhibitors of ASBT1,2, thus ASBT is a target for hypercholesterolemia drugs. Here, we describe the crystal structure of a bacterial homologue of ASBT from Neisseria meningitidis (ASBTNM) at 2.2Å. ASBTNM contains two inverted structural repeats of five transmembrane helices. A Core domain of six helices harbours two sodium ions while the remaining helices form a Panel-like domain. Overall the architecture of the protein is remarkably similar to the sodium-proton antiporter NhaA3 despite no detectable sequence homology. A bile acid molecule is situated between the Core and Panel domains in a large hydrophobic cavity. Residues near to this cavity have been shown to affect the binding of specific inhibitors of human ASBT4. The position of the bile acid together with the molecular architecture suggests the rudiments of a possible transport mechanism. PMID:21976025
Ben-Simhon, Zohar; Judeinstein, Sylvie; Nadler-Hassar, Talia; Trainin, Taly; Bar-Ya'akov, Irit; Borochov-Neori, Hamutal; Holland, Doron
2011-11-01
Anthocyanins are the major pigments responsible for the pomegranate (Punica granatum L.) fruit skin color. The high variability in fruit external color in pomegranate cultivars reflects variations in anthocyanin composition. To identify genes involved in the regulation of anthocyanin biosynthesis pathway in the pomegranate fruit skin we have isolated, expressed and characterized the pomegranate homologue of the Arabidopsis thaliana TRANSPARENT TESTA GLABRA1 (TTG1), encoding a WD40-repeat protein. The TTG1 protein is a regulator of anthocyanins and proanthocyanidins (PAs) biosynthesis in Arabidopsis, and acts by the formation of a transcriptional regulatory complex with two other regulatory proteins: bHLH and MYB. Our results reveal that the pomegranate gene, designated PgWD40, recovered the anthocyanin, PAs, trichome and seed coat mucilage phenotype in Arabidopsis ttg1 mutant. PgWD40 expression and anthocyanin composition in the skin were analyzed during pomegranate fruit development, in two accessions that differ in skin color intensity and timing of appearance. The results indicate high positive correlation between the total cyanidin derivatives quantity (red pigments) and the expression level of PgWD40. Furthermore, strong correlation was found between the steady state levels of PgWD40 transcripts and the transcripts of pomegranate homologues of the structural genes PgDFR and PgLDOX. PgWD40, PgDFR and PgLDOX expression also correlated with the expression of pomegranate homologues of the regulatory genes PgAn1 (bHLH) and PgAn2 (MYB). On the basis of our results we propose that PgWD40 is involved in the regulation of anthocyanin biosynthesis during pomegranate fruit development and that expression of PgWD40, PgAn1 and PgAn2 in the pomegranate fruit skin is required to regulate the expression of downstream structural genes involved in the anthocyanin biosynthesis.
Playfulness in the life of social educators: reflections on the work with children in shelters
Directory of Open Access Journals (Sweden)
Andrea Perosa Saigh Jurdi
2014-12-01
Full Text Available Social educators/caregivers are professionals who care physically and emotionally for institutionalized children, being responsible for fulfilling daily needs such as hygiene and feeding, as well as for the affection and playfulness inherent to this phase of development. This study aimed to investigate how playfulness is present in the work and everyday routines of eight social educators who care for children sheltered in a host institution in the municipality of Santos, Sao Paulo state. The methodological design was structured from weekly meetings in which the educators constructed oral narratives about play in their childhood, how it is today, their conception of play, and how play is related to their function of caregivers. We verified that play was almost nonexistent in the childhood of some of the educators investigated, but they have managed to recover its function through their children and family ties. In this institution, we observed educators with excessive responsibilities in their everyday practice and a reduced number of professionals, which hinders the adult-child relationship. We observed that, as a result, play is many times associated with professional practice. For these educators, caring for play is one of the faces of hosting and caring for the children. The role of the adult is crucial to enable the creativity of children and adults based on the experience of being with other humans.
Play and playfulness, basic features of early childhood education
Singer, E.
2013-01-01
This article argues that play and playfulness are basic features in early childhood education, but that play curricula can have serious drawbacks. The starting point is the play theory of the Dutch historian Johan Huizinga, a radical critic of the focus on the educational benefits of play. According
International Nuclear Information System (INIS)
Ohno, Shuji; Miyahara, Shinya; Kurata, Yuji; Katsura, Ryoei; Yoshida, Shigeru
2006-01-01
Experimental study using the transpiration method investigates equilibrium evaporation behavior of radionuclide polonium ( 210 Po) generated and accumulated in liquid lead-bismuth eutectic (LBE) cooled nuclear systems. The experiment consists of two series of tests: preliminary evaporation tests for homologue element tellurium (Te) in LBE, and evaporation tests for 210 Po-accumulated LBE in which test specimens are prepared by neutron irradiation. The evaporation tests of Te in LBE provide the suggestion that Te exists in a chemical form of PbTe as well as the information for confirming the validity of technique and conditions of Po test. From the evaporation tests of 210 Po in LBE, we obtain fundamental data and empirical equations such as 210 Po vapor concentration in the gas phase, 210 Po partial vapor pressure, thermodynamic activity coefficients, and gas-liquid equilibrium partition coefficient of 210 Po in LBE in the temperature range from 450 to 750degC. Additionally, radioactivity concentration of 210 Po and 210m Bi vapor in a cover gas region of a typical LBE-cooled nuclear system is specifically estimated based on the obtained experimental results, and the importance of 210 Po evaporation behavior is quantitatively demonstrated. (author)
Play and playfulness in early childhood education and care.
Directory of Open Access Journals (Sweden)
Singer E.
2015-06-01
Full Text Available Play and playfulness are basic features in early childhood education. The elements of play are pleasure, a sense of freedom, and the co-construction of shared meaning through the use of rules or rhythms. Play and learning are closely related in early childhood. But when the focus on the educational benefits of play becomes too strong, the most essential feature of play is lost: children’s pleasure. Young children in group settings often have to adapt to the teachers’ demands related to security, hygiene, and social norms and values. But the playfulness of the teachers helps to overcome differences in power in the caregiver-child relationship and prevents young children from becoming overburdened with strict rules and group discipline. Play and playfulness are a resource of shared pleasure and creativity in learning processes.
DEFF Research Database (Denmark)
Åkerstrøm Andersen, Niels; Pors, Justine Grønbæk
2014-01-01
This article studies the implications of current attempts by organizations to adapt to a world of constant change by introducing the notion of playful organizational membership. To this end we conduct a brief semantic history of organizational play and argue that when organizations play, employees...... are expected to engage in playful exploration of alternative selves. Drawing on Niklas Luhmann's theory of time and decision-making and Gregory Bateson's theory of play, the article analyses three empirical examples of how games play with conceptions of time. We explore how games represent an organizational...
Do the Uncertainty Relations Really have Crucial Significances for Physics?
Directory of Open Access Journals (Sweden)
Dumitru S.
2010-10-01
Full Text Available It is proved the falsity of idea that the Uncertainty Relations (UR have crucial significances for physics. Additionally one argues for the necesity of an UR-disconnected quantum philosophy.
Taking a bite out of "Buffy": Carnivalesque play and resistance in fan fiction
Directory of Open Access Journals (Sweden)
Amanda L. Hodges
2011-09-01
Full Text Available Popular culture provides a vital point of entry to examine discourses of hegemony and resistance at work within the growing culture of fandom. Drawing from epistemologies of feminism and poststructuralism, we deconstruct how fans read, co-construct, apply, and reenvision texts as they navigate societal notions of gender in their own constructions of subjectivity. We discuss subversive examples of sexuality and gender found in American popular culture, particularly the portrayal of femininity in the character of Faith, the bad girl from Buffy the Vampire Slayer. Such examples are important because they impart crucial hegemonic lessons that may then be played out in everyday life. By focusing on the third season of Buffy the Vampire Slayer, we examine the discourses of risk at play within the source text, fan sites, and online fan fiction. Bakhtin's ideas of carnival drive much of fan fiction, and Foucault's analysis of power relations as well as Butler's theories of performativity contribute to play that affords dynamic, critical perspectives with which to interrogate social metanarratives and their impact on the subject.
Mitochondrial uncoupling proteins and energy metabolism
Directory of Open Access Journals (Sweden)
Rosa Anna Busiello
2015-02-01
Full Text Available Understanding the metabolic factors that contribute to energy metabolism (EM is critical for the development of new treatments for obesity and related diseases. Mitochondrial oxidative phosphorylation is not perfectly coupled to ATP synthesis, and the process of proton-leak plays a crucial role. Proton-leak accounts for a significant part of the resting metabolic rate and therefore enhancement of this process represents a potential target for obesity treatment. Since their discovery, uncoupling proteins have stimulated great interest due to their involvement in mitochondrial-inducible proton-leak. Despite the widely accepted uncoupling/thermogenic effect of uncoupling protein one (UCP1, which was the first in this family to be discovered, the reactions catalyzed by its homologue UCP3 and the physiological role remain under debate.This review provides an overview of the role played by UCP1 and UCP3 in mitochondrial uncoupling/functionality as well as EM and suggests that they are a potential therapeutic target for treating obesity and its related diseases such as type II diabetes mellitus.
Energy Technology Data Exchange (ETDEWEB)
Garcia, V.
2001-12-15
The human ATM gene, whose inactivation is responsible for the human disease ataxia telangiectasia is conserved throughout the Eukaryotes and plays an important role in the cellular responses to DNA damage, in particular to DNA double-strand breaks (DSBs). Here we describe the identification of an Arabidopsis thaliana homologue of ATM (AtATM), and the molecular and cytological characterization of plants, hereafter called atm, carrying a disrupting T-DNA insertion in this gene. AtATM covers a 32 kb region on chromosome 3. The AtATM transcript has a complex structure, is 12 kb long and formed by 79 exons. The transcriptional level of AtATM is very low in all the tissues tested, and does not vary after exposure to ionizing radiations (IR). In atm plants, the protein is not detected suggesting the mutants are null. The atm mutants are partially sterile. Aberrant segregation of chromosomes during meiosis I on both male and female sides account for this sterility. However, meiotic recombination frequency is normal. Mutant plants are also hypersensitive to gamma rays and methyl methane sulfonate, but not to UV-B, pointing to a specific defect of atm mutants in the response to DNA DSBs. In plants, ionizing radiations induce a strong, rapid and transient transcriptional activation of genes involved in the cellular response to or the repair of DSBs. This transcriptional regulation of AtRAD51, AtPARP1, atGR1 and AtL1G4 is lost in the atm mutants . The absence of AtRAD51 induction associated with ionizing radiation sensitivity suggest that AtAtm play an important function in DSB repair by homologous recombination. In addition we show that homologous intra-chromosomal recombination frequency is elevated in the mutant comparing to wild-type, with or without gamma irradiation. These results show the implication of AtAtm in the genomic stability. (author)
Directory of Open Access Journals (Sweden)
Qing Kong
Full Text Available Growth, development, virulence and secondary metabolism in fungi are governed by heterotrimeric G proteins (G proteins. A Gβ-like protein called Gib2 has been shown to function as an atypical Gβ in Gpa1-cAMP signaling in Cryptococcus neoformans. We found that the previously reported CpcB (cross pathway control B protein is the ortholog of Gib2 in Aspergillus nidulans and Aspergillus fumigatus. In this report, we further characterize the roles of CpcB in governing growth, development and toxigenesis in the two aspergilli. The deletion of cpcB results in severely impaired cellular growth, delayed spore germination, and defective asexual sporulation (conidiation in both aspergilli. Moreover, CpcB is necessary for proper expression of the key developmental activator brlA during initiation and progression of conidiation in A. nidulans and A. fumigatus. Somewhat in accordance with the previous study, the absence of cpcB results in the formation of fewer, but not micro-, cleistothecia in A. nidulans in the presence of wild type veA, an essential activator of sexual development. However, the cpcB deletion mutant cleistothecia contain no ascospores, validating that CpcB is required for progression and completion of sexual fruiting including ascosporogenesis. Furthermore, unlike the canonical GβSfaD, CpcB is not needed for the biosynthesis of the mycotoxin sterigmatocystin (ST as the cpcB null mutant produced reduced amount of ST with unaltered STC gene expression. However, in A. fumigatus, the deletion of cpcB results in the blockage of gliotoxin (GT production. Further genetic analyses in A. nidulans indicate that CpcB may play a central role in vegetative growth, which might be independent of FadA- and GanB-mediated signaling. A speculative model summarizing the roles of CpcB in conjunction with SfaD in A. nidulans is presented.
Directory of Open Access Journals (Sweden)
Watanabe Haruo
2005-10-01
Full Text Available Abstract Background It has been speculated that the γ-glutamyl transpeptidase (ggt gene is present only in Neisseria meningitidis and not among related species such as Neisseria gonorrhoeae and Neisseria lactamica, because N. meningitidis is the only bacterium with GGT activity. However, nucleotide sequences highly homologous to the meningococcal ggt gene were found in the genomes of N. gonorrhoeae isolates. Results The gonococcal homologue (ggt gonococcal homologue; ggh was analyzed. The nucleotide sequence of the ggh gene was approximately 95 % identical to that of the meningococcal ggt gene. An open reading frame in the ggh gene was disrupted by an ochre mutation and frameshift mutations induced by a 7-base deletion, but the amino acid sequences deduced from the artificially corrected ggh nucleotide sequences were approximately 97 % identical to that of the meningococcal ggt gene. The analyses of the sequences flanking the ggt and ggh genes revealed that both genes were localized in a common DNA region containing the fbp-ggt (or ggh-glyA-opcA-dedA-abcZ gene cluster. The expression of the ggh RNA could be detected by dot blot, RT-PCR and primer extension analyses. Moreover, the truncated form of ggh-translational product was also found in some of the gonococcal isolates. Conclusion This study has shown that the gonococcal ggh gene is a pseudogene of the meningococcal ggt gene, which can also be designated as Ψggt. The gonococcal ggh (Ψggt gene is the first identified bacterial pseudogene that is transcriptionally active but phenotypically silent.
Directory of Open Access Journals (Sweden)
Crotty Yvonne
2017-12-01
Full Text Available The Erasmus + Play4Guidance (P4G project introduces an online business game, designed to help teach entrepreneurial, transversal and mathematical skills using a real-world business environment. This paper explains how the Business Model Canvas (BMC strategy tool facilitated student understanding of real life business development prior to playing the game. An initial mapping exercise was conducted to find out if the Business Model Canvas could transform the experience of playing the game by providing an overview of real life business strategy, and explain the crucial role that markets and customers play in business growth. As a result of the mapping exercise a workshop session was developed to ensure that students could enact the real life business scenarios presented in the game. Three different types of videos were produced and integrated into the workshop to demonstrate key entrepreneurial competencies and graphically illustrate the nine key building blocks of the BMC. Survey responses from a student cohort evidenced that the workshop was central in helping them to understand real life business strategy prior to playing the game.
Word Play: Scaffolding Language Development through Child-Directed Play
Wasik, Barbara A.; Jacobi-Vessels, Jill L.
2017-01-01
Play is an important activity in young children's lives. It is how children explore their world and build knowledge. Although free play, which is play that is totally child directed, contributes to children's learning, self-regulation and motivation, adults' participation in children's play is critical in their development, especially their…
DEFF Research Database (Denmark)
Koch, Birgit; Nybroe, Ole
2006-01-01
A expression. The mutant grew slower than the wild-type strain in minimal medium with L-serine as the sole nitrogen source, while growth rates were similar on a mixture of L-serine and L-cysteine. Reverse transcriptase polymerase chain reaction analysis indicated that the bolA homologue is the second gene...
DEFF Research Database (Denmark)
Froes, Isabel
these practices, which compose the taxonomy of tablet play. My contribution lies in identifying and proposing a series of theoretical concepts that complement recent theories related to play and digital literacy studies. The data collected through observations informed some noteworthy aspects, including how...... with tablets’ physical and digital affordances shape children’s digital play. This thesis presents how young children’s current practices when playing with tablets inform digital experiences in Denmark and Japan. Through an interdisciplinary lens and a grounded theory approach, I have identified and mapped...... vocabulary in children’s digital play experiences. These early digital experiences set the rules for the playgrounds and assert digital tablets as twenty-first-century toys, shaping young children’s playful literacy....
The case for causal influences of action videogame play upon vision and attention.
Kristjánsson, Árni
2013-05-01
Over the past decade, exciting findings have surfaced suggesting that routine action videogame play improves attentional and perceptual skills. Apparently, performance during multiple-object tracking, useful-field-of-view tests, and task switching improves, contrast sensitivity and spatial-resolution thresholds decrease, and the attentional blink and backward masking are lessened by short-term training on action videogames. These are remarkable findings showing promise for the training of attention and the treatment of disorders of attentional function. While the findings are interesting, evidence of causal influences of videogame play is not as strong as is often claimed. In many studies, observers with game play experience and those without are tested. Such studies do not address causality, since preexisting differences are not controlled for. Other studies investigate the training of videogame play, with some evidence of training benefits. Methodological shortcomings and potential confounds limit their impact, however, and they have not always been replicated. No longitudinal studies on videogame training exist, but these may be required to provide conclusive answers about any benefits of videogame training and any interaction with preexisting differences. Suggestions for methodological improvement are made here, including recommendations for longitudinal studies. Such studies may become crucial for the field of attentional training to reach its full potential.
Lawver, Timothy; Blankenship, Kelly
2008-01-01
Play therapy is a treatment modality in which the therapist engages in play with the child. Its use has been documented in a variety of settings and with a variety of diagnoses. Treating within the context of play brings the therapist and the therapy to the level of the child. By way of an introduction to this approach, a case is presented of a six-year-old boy with oppositional defiant disorder. The presentation focuses on the events and interactions of a typical session with an established patient. The primary issues of the session are aggression, self worth, and self efficacy. These themes manifest themselves through the content of the child’s play and narration of his actions. The therapist then reflects these back to the child while gently encouraging the child toward more positive play. Though the example is one of nondirective play therapy, a wide range of variation exists under the heading of play therapy. PMID:19724720
International Nuclear Information System (INIS)
Gough, N.M.; Gearing, D.P.; King, J.A.; Willson, T.A.; Hilton, D.J.; Nicola, N.A.; Metcalf, D.
1988-01-01
A human homologue of the recently cloned murine leukemia-inhibitory factor (LIF) gene was isolated from a genomic library by using the marine cDNA as a hybridization probe. The nucleotide sequence of the human gene indicated that human LIF has 78% amino acid sequence identity with murine LIF, with no insertions or deletions, and that the region of the human gene encoding the mature protein has one intervening sequence. After oligonucleotide-mediated mutagenesis, the mature protein-coding region of the LIF gene was introduced into the yeast expression vector YEpsec1. Yeast cells transformed with the resulting recombinant could be induced with galactose to produce high levels of a factor that induced the differentiation of murine M1 leukemic cells in a manner analogous to murine LIF. This factor competed with 125 I-labeled native murine LIF for binding to specific cellular receptors on murine cells, compatible with a high degree of structural similarity between the murine and human factors
Collagen V expression is crucial in regional development of the supraspinatus tendon.
Connizzo, Brianne K; Adams, Sheila M; Adams, Thomas H; Birk, David E; Soslowsky, Louis J
2016-12-01
Manipulations in cell culture and mouse models have demonstrated that reduction of collagen V results in altered fibril structure and matrix assembly. A tissue-dependent role for collagen V in determining mechanical function was recently established, but its role in determining regional properties has not been addressed. The objective of this study was to define the role(s) of collagen V expression in establishing the site-specific properties of the supraspinatus tendon. The insertion and midsubstance of tendons from wild type, heterozygous and tendon/ligament-specific null mice were assessed for crimp morphology, fibril morphology, cell morphology, as well as total collagen and pyridinoline cross-link (PYD) content. Fibril morphology was altered at the midsubstance of both groups with larger, but fewer, fibrils and no change in cell morphology or collagen compared to the wild type controls. In contrast, a significant disruption of fibril assembly was observed at the insertion site of the null group with the presence of structurally aberrant fibrils. Alterations were also present in cell density and PYD content. Altogether, these results demonstrate that collagen V plays a crucial role in determining region-specific differences in mouse supraspinatus tendon structure. © 2016 Orthopaedic Research Society. Published by Wiley Periodicals, Inc. J Orthop Res 34:2154-2161, 2016. © 2016 Orthopaedic Research Society. Published by Wiley Periodicals, Inc.
Qi, Honglan; Teesdale, Justin J; Pupillo, Rachel C; Rosenthal, Joel; Bard, Allen J
2013-09-11
Two new 2,2'-bipyridine (bpy) derivatives containing ancillary BODIPY chromophores attached at the 5- and 5'-positions (BB3) or 6- and 6'-positions (BB4) were prepared and characterized. In this work, the basic photophysics, electrochemistry, and electrogenerated chemiluminescence (ECL) of BB3 and BB4 are compared with those previously reported for a related bpy-BODIPY derivative (BB2) (J. Phys. Chem. C 2011, 115, 17993-18001). Cyclic voltammetry revealed that BB3 and BB4 display reversible 2e(-) oxidation and reduction waves, which consist of two closely spaced (50-70 mV) 1e(-) events. This redox behavior is consistent with the frontier molecular orbitals calculated for BB3 and BB4 and indicates that the 2,2'-bipyridine spacer of each bpy-BODIPY homologue does not facilitate efficient electronic communication between the tethered indacene units. In the presence of a coreactant such as tri-n-propylamine (TPA) or benzoyl peroxide (BPO), BB3 and BB4 exhibit strong ECL and produce spectra that are very similar to their corresponding photoluminescence profiles. The ECL signal obtained under annihilation conditions, however, is significantly different and is characterized by two distinct bands. One of these bands is centered at ∼570 nm and is attributed to emission via an S- or T-route. The second band occurs at longer wavelengths and is centered around ∼740 nm. The shape and concentration dependence of this long-wavelength ECL signal is not indicative of emission from an excimer or aggregate, but rather it suggests that a new emissive species is formed from the bpy-BODIPY luminophores during the annihilation process.
Qi, Honglan; Teesdale, Justin J.; Pupillo, Rachel C.
2014-01-01
Two new 2,2’-bipyridine (bpy) derivatives containing ancillary BODIPY chromophores attached at the 5- and 5’-positions (BB3) or 6- and 6’-positions (BB4) were prepared and characterized. In this work, the basic photophysics, electrochemistry and electrogenerated chemiluminescence (ECL) of BB3 and BB4 are compared with those previously reported for a related bpy-BODIPY derivative (BB2) (J. Phys. Chem. C 2011, 115, 17993–18001). Cyclic voltammetry revealed that BB3 and BB4 display reversible 2e− oxidation and reduction waves, which consist of two closely spaced (50 – 70 mV) 1e− events. This redox behavior is consistent with the frontier molecular orbitals calculated for BB3 and BB4 and indicates that the 2,2’-bipyridine spacer of each bpy- BODIPY homologue does not facilitate efficient electronic communication between the tethered indacene units. In the presence of a coreactant such as tri-n-propylamine (TPA) or benzoyl peroxide (BPO), BB3 and BB4 exhibit strong ECL and produce spectra that are very similar to their corresponding photoluminescence profiles. The ECL signal obtained under annihilation conditions, however, is significantly different and is characterized by two distinct bands. One of these bands is centered at ~570 nm and is attributed to emission via an S- or T-route. The second band, occurs at longer wavelengths and is centered around ~740 nm. The shape and concentration dependence of this long-wavelength ECL signal is not indicative of emission from an excimer or aggregate, but rather is suggests that a new emissive species is formed from the bpy-BODIPY luminophores during the annihilation process. PMID:23980850
DEFF Research Database (Denmark)
Feder, Karen
2017-01-01
Abstract The purpose of the new Design for Play initiative is to inspire and educate designers to design for the future of play. To create “play ambassadors” equipped with excellent tools, methods, approaches and mind-sets to design for the playful human being in an ever-changing world. To teach...... and inspire children to grow up to be creative designers of their own life and the world around them. The Design for Play research team will study the interplay between people, processes and products in design for play and support the development of playful designers, playful solutions and playful experiences...
Edge profiles in K shell photoabsorption spectra of gaseous hydrides of 3p elements and homologues
Hauko, R.; Gomilšek, J. Padežnik; Kodre, A.; Arčon, I.; Aquilanti, G.
2017-10-01
Photoabsorption spectra of gaseous hydrides of 3p elements (PH3, H2S, HCl) are measured in the energy region of photoexcitations pertaining to K edge. The analysis of the edge profile is extended to hydrides of 4p series (GeH4, AsH3, H2Se, HBr) from an earlier experiment, and to published spectra of 2p hydrides (CH4, NH3, H2O, HF) and noble gases Ar, Kr and Ne and SiH4. The edge profiles are modelled with a linear combination of lorentzian components, describing excitations to individual bound states and to continuum. Transition energies and probabilities are also calculated in the non-relativistic molecular model of the ORCA code, in good agreement with the experiment. Edge profiles in the heavier homologues are closely similar, the symmetry of the molecule governs the transitions to the lowest unoccupied orbitals. In 2p series the effect of the strong nuclear potential prevails. Transitions to higher, atomic-like levels remain very much the same as in free atoms.
The oil palm Shell gene controls oil yield and encodes a homologue of SEEDSTICK
Singh, Rajinder; Leslie Low, Eng-Ti; Ooi, Leslie Cheng-Li; Ong-Abdullah, Meilina; Chin, Ting Ngoot; Nagappan, Jayanthi; Nookiah, Rajanaidu; Amiruddin, Mohd Din; Rosli, Rozana; Abdul Manaf, Mohamad Arif; Chan, Kuang-Lim; Halim, Mohd Amin; Azizi, Norazah; Lakey, Nathan; Smith, Steven W; Budiman, Muhammad A; Hogan, Michael; Bacher, Blaire; Van Brunt, Andrew; Wang, Chunyan; Ordway, Jared M; Sambanthamurthi, Ravigadevi; Martienssen, Robert A
2014-01-01
A key event in the domestication and breeding of the oil palm, Elaeis guineensis, was loss of the thick coconut-like shell surrounding the kernel. Modern E. guineensis has three fruit forms, dura (thick-shelled), pisifera (shell-less) and tenera (thin-shelled), a hybrid between dura and pisifera1–4. The pisifera palm is usually female-sterile but the tenera yields far more oil than dura, and is the basis for commercial palm oil production in all of Southeast Asia5. Here, we describe the mapping and identification of the Shell gene responsible for the different fruit forms. Using homozygosity mapping by sequencing we found two independent mutations in the DNA binding domain of a homologue of the MADS-box gene SEEDSTICK (STK) which controls ovule identity and seed development in Arabidopsis. The Shell gene is responsible for the tenera phenotype in both cultivated and wild palms from sub-Saharan Africa, and our findings provide a genetic explanation for the single gene heterosis attributed to Shell, via heterodimerization. This gene mutation explains the single most important economic trait in oil palm, and has implications for the competing interests of global edible oil production, biofuels and rainforest conservation6. PMID:23883930
DEFF Research Database (Denmark)
Toft, Herdis
2018-01-01
in a play culture where children recycle them in transmitted, transformed and transgressive modes. His fairy tales function as raw materials – trash – for play-production, and these contemporary children muddle, mingle, remix their formulas and elements with other materials and adjust them to a play context......Hans Christian Andersen is a cultural icon in the Danish community, and his fairy tales are canonized as treasured Danish cultural heritage. However, situated as they are today in a crosscultural mix between folklore, booklore and medialore, they also may be analysed as useful, treasured trash...... through improvisations. So they perform what we shall name FairyPlay - just like Hans Christian Andersen himself did. We show Hans Christian Andersen as an intimate connoisseur of play culture, a homo ludens, a trash-sculptor and a thing-finder, like Pippi Longstocking and like children in play. Examples...
Analysis of a proposed crucial test of quantum mechanics
International Nuclear Information System (INIS)
Collett, M.J.; Loudon, R.
1987-01-01
An experiment based on an extension of the Einstein-Podolsky-Rosen argument has been proposed by Popper as a crucial test of the Copenhagen interpretation of quantum mechanics. Here the authors show, by a slightly more complete version of Popper's analysis, although still at a relatively primitive level of sophistication, that the proposed experiment does not in fact provide such a test. (author)
Play Therapy: Facilitative Use of Child's Play in Elementary School Counseling.
Landreth, Garry L.
1987-01-01
Reviews five major developments in play therapy: psychoanalysis, release therapy, relationship therapy, nondirective therapy, and play therapy in school settings. Suggests ways school counselors can use play therapy. Describes play therapy facilities, location selection, and play materials. Lists objectives of play therapy and how teachers can aid…
Sigma Factor SigB Is Crucial to Mediate Staphylococcus aureus Adaptation during Chronic Infections.
Directory of Open Access Journals (Sweden)
Lorena Tuchscherr
2015-04-01
Full Text Available Staphylococcus aureus is a major human pathogen that causes a range of infections from acute invasive to chronic and difficult-to-treat. Infection strategies associated with persisting S. aureus infections are bacterial host cell invasion and the bacterial ability to dynamically change phenotypes from the aggressive wild-type to small colony variants (SCVs, which are adapted for intracellular long-term persistence. The underlying mechanisms of the bacterial switching and adaptation mechanisms appear to be very dynamic, but are largely unknown. Here, we analyzed the role and the crosstalk of the global S. aureus regulators agr, sarA and SigB by generating single, double and triple mutants, and testing them with proteome analysis and in different in vitro and in vivo infection models. We were able to demonstrate that SigB is the crucial factor for adaptation in chronic infections. During acute infection, the bacteria require the simultaneous action of the agr and sarA loci to defend against invading immune cells by causing inflammation and cytotoxicity and to escape from phagosomes in their host cells that enable them to settle an infection at high bacterial density. To persist intracellularly the bacteria subsequently need to silence agr and sarA. Indeed agr and sarA deletion mutants expressed a much lower number of virulence factors and could persist at high numbers intracellularly. SigB plays a crucial function to promote bacterial intracellular persistence. In fact, ΔsigB-mutants did not generate SCVs and were completely cleared by the host cells within a few days. In this study we identified SigB as an essential factor that enables the bacteria to switch from the highly aggressive phenotype that settles an acute infection to a silent SCV-phenotype that allows for long-term intracellular persistence. Consequently, the SigB-operon represents a possible target to develop preventive and therapeutic strategies against chronic and therapy
Sigma Factor SigB Is Crucial to Mediate Staphylococcus aureus Adaptation during Chronic Infections.
Tuchscherr, Lorena; Bischoff, Markus; Lattar, Santiago M; Noto Llana, Mariangeles; Pförtner, Henrike; Niemann, Silke; Geraci, Jennifer; Van de Vyver, Hélène; Fraunholz, Martin J; Cheung, Ambrose L; Herrmann, Mathias; Völker, Uwe; Sordelli, Daniel O; Peters, Georg; Löffler, Bettina
2015-04-01
Staphylococcus aureus is a major human pathogen that causes a range of infections from acute invasive to chronic and difficult-to-treat. Infection strategies associated with persisting S. aureus infections are bacterial host cell invasion and the bacterial ability to dynamically change phenotypes from the aggressive wild-type to small colony variants (SCVs), which are adapted for intracellular long-term persistence. The underlying mechanisms of the bacterial switching and adaptation mechanisms appear to be very dynamic, but are largely unknown. Here, we analyzed the role and the crosstalk of the global S. aureus regulators agr, sarA and SigB by generating single, double and triple mutants, and testing them with proteome analysis and in different in vitro and in vivo infection models. We were able to demonstrate that SigB is the crucial factor for adaptation in chronic infections. During acute infection, the bacteria require the simultaneous action of the agr and sarA loci to defend against invading immune cells by causing inflammation and cytotoxicity and to escape from phagosomes in their host cells that enable them to settle an infection at high bacterial density. To persist intracellularly the bacteria subsequently need to silence agr and sarA. Indeed agr and sarA deletion mutants expressed a much lower number of virulence factors and could persist at high numbers intracellularly. SigB plays a crucial function to promote bacterial intracellular persistence. In fact, ΔsigB-mutants did not generate SCVs and were completely cleared by the host cells within a few days. In this study we identified SigB as an essential factor that enables the bacteria to switch from the highly aggressive phenotype that settles an acute infection to a silent SCV-phenotype that allows for long-term intracellular persistence. Consequently, the SigB-operon represents a possible target to develop preventive and therapeutic strategies against chronic and therapy-refractory infections.
DEFF Research Database (Denmark)
Johansen, Stine Liv
Children’s play must nowadays be understood as a mediatized field in society and culture. Media – understood in a very broad sense - holds severe explanatory power in describing and understanding the practice of play, since play happens both with, through and inspired by media of different sorts........ In this presentation the case of ‘playing soccer’ will be outlined through its different mediated manifestations, including soccer games and programs on TV, computer games, magazines, books, YouTube videos and soccer trading cards....
Caspase-11 Plays a Protective Role in Pulmonary Acinetobacter baumannii Infection.
Wang, Wei; Shao, Yue; Li, Shengjun; Xin, Na; Ma, Tingxian; Zhao, Chenghai; Song, Min
2017-10-01
Activation of caspase-11 by some Gram-negative bacteria triggers the caspase-1/interleukin 1β (IL-1β) pathway, independent of canonical inflammasomes. Acinetobacter baumannii is a Gram-negative, conditionally pathogenic bacterium that can cause severe pulmonary infection in hospitalized patients. A. baumannii was revealed to activate canonical and noncanonical inflammasome pathways in bone marrow-derived macrophages (BMDMs). Pulmonary infection of caspase-11 -/- mice with A. baumannii showed that caspase-11 deficiency impaired A. baumannii clearance, exacerbated pulmonary pathological changes, and enhanced susceptibility to A. baumannii These data indicate that the caspase-11-mediated innate immune response plays a crucial role in defending against A. baumannii . Copyright © 2017 American Society for Microbiology.
Brown, N K; Harvey, D J
1988-04-01
Methyl-delta-8-tetrahydrocannabinol (methyl-delta-8-THC), methyl-delta-9-THC and abn-methyl-delta-8-THC were synthesized by condensation of orcinol and (1S)-cis-verbenol and were administered to male Charles River CD-1 mice. Extracted hepatic metabolites were isolated by chromatography on Sephadex LH-20 and examined by gas chromatography/mass spectrometry as trimethylsilyl (TMS), (2H9)TMS and methyl ester/TMS derivatives. In addition, metabolic fractions were reduced with lithium aluminium deuteride to convert carboxylic acids to alcohols for structural correlation. Metabolites from methyl-delta-8-THC were similar with respect to the positions substituted to those produced by higher homologues; the major metabolite was methyl-delta-8-THC-11-oic acid. abn-Methyl-delta-8-THC was metabolized in a different manner. The location of the aromatic methyl group at the position adjacent to ring fusion appeared to inhibit metabolism at C(11) to a considerable extent and also to reduce the amount of the resulting alcohol from being oxidized to a carboxylic acid. This caused other metabolic pathways to become dominant, with the result that a compound containing a hydroxy group at the gem-methyl position was the major metabolite. Hydroxylation at this position has not been confirmed with any other cannabinoid, although it is thought to result in trace concentrations of hydroxy metabolites from some compounds. Metabolism of methyl-delta-9-THC was also similar to that of the higher homologues, with the exception that less metabolism occurred at C(8) and a higher percentage of the total metabolic fraction was accounted for by the 11-oic acid metabolite. Minor metabolites were mainly dihydroxy compounds and hydroxylated derivatives of delta-9-THC-11-oic acid.
Green, Kimberly A.; Becker, Yvonne; Fitzsimons, Helen L.
2016-01-01
Summary In both Sordaria macrospora and Neurospora crassa, components of the conserved STRIPAK (striatin‐interacting phosphatase and kinase) complex regulate cell–cell fusion, hyphal network development and fruiting body formation. Interestingly, a number of Epichloë festucae genes that are required for hyphal cell–cell fusion, such as noxA, noxR, proA, mpkA and mkkA, are also required for the establishment of a mutualistic symbiotic interaction with Lolium perenne. To determine whether MobC, a homologue of the STRIPAK complex component MOB3 in S. macrospora and N. crassa, is required for E. festucae hyphal fusion and symbiosis, a mobC deletion strain was generated. The ΔmobC mutant showed reduced rates of hyphal cell–cell fusion, formed intrahyphal hyphae and exhibited enhanced conidiation. Plants infected with ΔmobC were severely stunted. Hyphae of ΔmobC showed a proliferative pattern of growth within the leaves of Lolium perenne with increased colonization of the intercellular spaces and vascular bundles. Although hyphae were still able to form expressoria, structures allowing the colonization of the leaf surface, the frequency of formation was significantly reduced. Collectively, these results show that the STRIPAK component MobC is required for the establishment of a mutualistic symbiotic association between E. festucae and L. perenne, and plays an accessory role in the regulation of hyphal cell–cell fusion and expressorium development in E. festucae. PMID:27277141
Zhao, Ling-Ling; Hui, Kaimin; Wang, Yu-Qing; Wang, Yue; Ren, Qian; Li, Xin-Cang
2018-05-01
Galactoside-binding lectins, also known as galectins, play crucial roles in innate immune response in invertebrates. In this study, three cDNA sequences from Hyriopsis cumingii were identified and collectively called HcGalec genes. Each of the three deduced HcGalec proteins contained a galactose-binding lectin domain or a GLECT domain. All the three HcGalec genes are mainly present in the hepatopancreas and gills, and their expression is induced at 24 h after bacterial challenge. Three recombinant HcGalec proteins can bind and agglutinate (Ca 2+ -dependent) various microorganisms, including Gram-positive and Gram-negative bacteria. These proteins can attach to mannan and peptidoglycan. Meanwhile, the expression of the three HcGalec genes in the gills were significantly down-regulated after dsRNA interference (HcGalec1-RNAi, HcGalec2-RNAi, and HcGalec3-RNAi) and Vibrio parahaemolyticus injection. The expression levels of some antimicrobial peptides, including lysozyme 1 and lysozyme 2, were also markedly decreased after dsRNA interference. Overall, these results suggested that these three HcGalec proteins may function as potential receptors participating in the innate immune responses of H. cumingii against bacterial infection. Copyright © 2018 Elsevier Ltd. All rights reserved.
DEFF Research Database (Denmark)
Meier Sørensen, Bent; Spoelstra, Sverre
2012-01-01
The interest in organizational play is growing, both in popular business discourse and organization studies. As the presumption that play is dysfunctional for organizations is increasingly discarded, the existing positions may be divided into two camps; one proposes ‘serious play’ as an engine fo...... workplaces engage in play: play as a (serious) continuation of work, play as a (critical) intervention into work and play as an (uninvited) usurpation of work....
DEFF Research Database (Denmark)
2003-01-01
The video Playful Interaction describes a future architectural office, and envisions ideas and concepts for playful interactions between people, materials and appliances in a pervasive and augmented working environment. The video both describes existing developments, technologies and designs...... as well as ideas not yet implemented such as playful modes of interaction with an augmented ball. Playful Interaction has been used as a hybrid of a vision video and a video prototype (1). Externally the video has been used to visualising our new ideas, and internally the video has also worked to inspire...
The role of play themes in non-directive play therapy.
Ryan, Virginia; Edge, Andrew
2012-07-01
Describing the processes underlying play therapy is important for evidence based practice in child therapy. Employing play themes to describe children's play session contents is in widespread use by practitioners, but an adequate classification of these themes for non-directive play therapy practice has not yet been established. This article sets out to fill this gap by first describing how themes can be distinguished and distilled from the contents of play therapy contents. Second, a classification of main themes and sub-themes with exemplars to illustrate these concepts which is compatible with non-directive play therapy practice is set out. Finally a pilot project with experienced play therapists to test this classification in practice is suggested, along with the research questions that will need to be investigated in the shorter and longer terms.
Do the Uncertainty Relations Really have Crucial Significances for Physics?
Directory of Open Access Journals (Sweden)
Dumitru S.
2010-10-01
Full Text Available It is proved the falsity of idea that the Uncertainty Relations (UR have crucial signif- icances for physics. Additionally one argues for the necesity of an UR-disconnected quantum philosophy.
Imagination, Playfulness, and Creativity in Children's Play with Different Toys
Mo????ller, Signe?? Juhl?
2015-01-01
Based on a four-month experimental study of preschool children's play with creative-construction and social-fantasy toys, the author examines the in?uence of both types of toys on the play of preschool children. Her comparative analysis considers the impact of transformative play on the development of imagination during play activities and…
Neuhausen, J; Eichler, B
2004-01-01
The evaporation behaviour of polonium and its lighter homologues selenium and tellurium dissolved in liquid Pb-Bi-eutecticum (LBE) has been studied at various temperatures in the range from 482 K up to 1330 K under Ar/H2 and Ar/H2O-atmospheres using γ-ray spectroscopy. Polonium release in the temperature range of interest for technical applications is slow. Within short term (1h) experiments measurable amounts of polonium are evaporated only at temperatures above 973 K. Long term experiments reveal that a slow evaporation of polonium occurs at temperatures around 873 K resulting in a fractional polonium loss of the melt around 1% per day. Evaporation rates of selenium and tellurium are smaller than those of polonium. The presence of H2O does not enhance the evaporation within the error limits of our experiments. The thermodynamics and possible reaction pathways involved in polonium release from LBE are discussed.
The crucial dialogue between energy economists and oil geologists
International Nuclear Information System (INIS)
Perrodon, A.
2005-01-01
The world oil production trend in the coming years and decades is indisputably important. There are many scenarios, but their differences affect their reliability. Economists and geologists preparing such scenarios rely on data and reasoning that are often more complementary than contradictory to one another as they emphasize different points. Thus it is increasingly crucial and necessary to compare these various approaches in an honest and efficient dialogue. (author)
Playful biometrics: controversial technology through the lens of play.
Ellerbrok, Ariane
2011-01-01
This article considers the role of play in the context of technological emergence and expansion, particularly as it relates to recently emerging surveillance technologies. As a case study, I consider the trajectory of automated face recognition—a biometric technology of numerous applications, from its more controversial manifestations under the rubric of national security to a clearly emerging orientation toward play. This shift toward “playful” biometrics—or from a technology traditionally coded as “hard” to one now increasingly coded as “soft”—is critical insofar as it renders problematic the traditional modes of critique that have, up until this point, challenged the expansion of biometric systems into increasingly ubiquitous realms of everyday life. In response to this dynamic, I propose theorizing the expansion of face recognition specifically in relation to “play,” a step that allows us to broaden the critical space around newly emerging playful biometrics, as well as playful surveillance more generally. In addition, play may also have relevance for theorizing other forms of controversial technology, particularly given its potential role in processes of obfuscation, normalization, and marginalization.
Eklund, Johanna; Cabeza, Mar
2017-07-01
Protected areas (PAs) are a key tool for biodiversity conservation and play a central role in the Convention on Biological Diversity. Recently, the effectiveness of PAs has been questioned, and assessing how effective they are in enabling the future persistence of biodiversity is not trivial. Here, we focus on terrestrial PAs and clarify the terminology related to PA effectiveness, distinguishing between management and ecological aspects. We suggest that the quality of governance affects both aspects of effectiveness but recognize a lack of synthetic understanding of the topic. We present a conceptual framework linking the underlying mechanisms by which the quality of governance affects conservation outcomes in PAs and how this relates to conservation planning. We show that it is crucial to separate pressure and response and how these together will lead to the observed conservation outcomes. We urge for more focused attention on governance factors and in particular more empirical research on how to address causality and how to account for the quality of governance when prioritizing actions. Our framework is linked to the classic concepts of systematic conservation planning and clarifies the strategies available to achieve a comprehensive and effective network of PAs. © 2016 The Authors. Annals of the New York Academy of Sciences published by Wiley Periodicals, Inc. on behalf of New York Academy of Sciences.
Ren, Yipeng; Ding, Dan; Pan, Baoping; Bu, Wenjun
2017-11-01
Toll-like receptors, the best known pattern recognition receptors, play important roles in recognizing non-self molecules and binding pathogen-associated molecular patterns in the innate immune system. In the present research, the cDNA and protein characterization of the TLR signalling pathway genes including IRAK4, TRAK6 and IKKα (named CsIRAK4, CsTRAF6 and CsIKKα, respectively) with the typical motifs from Cyclina sinensis showed significant similarity with their homologues from other shellfish. Furthermore, the mRNA transcripts of these three genes are ubiquitously expressed in all tissues tested and are dominantly expressed in C. sinensis haemocytes (P sinensis by RNA interference and immune challenges. The results suggested the mRNA expression patterns of CsMyD88, CsIRAK4, CsTRAF6, CsIKKα, CsIκB, CsNF-κB, CsC-LYZ and CsAMP were all down-regulated (P sinensis haemocytes, revealing the involvement of the TLR13-MyD88-NF-κB signalling pathway in innate immunity by positively adjusting internal signalling factors and immune-related genes. In summary, a TLR13-MyD88-NF-κB signalling pathway exists and plays vital roles in innate immune responses in C. sinensis. These findings collectively lay the foundation for studying the functional characterization of internal signalling factors and establishing a regulatory network for the TLR signalling pathway in molluscs. Copyright © 2017 Elsevier Ltd. All rights reserved.
Fanatically Formative: Successful Learning during the Crucial K-3 Years
Sornson, Bob
2012-01-01
Helping children experience early learning success and acquire essential skills by third grade is a crucial part of any school reform effort. Yet, many teachers and children are overwhelmed by the ineffective curriculum-driven education system and the "rush to cover" climate in schools. "Fanatically Formative" shows how you can rediscover the joy…
ECA3, a Golgi-localized P2A-type-ATPase, plays a crucial role in manganese nutrition in Arabidopsis
DEFF Research Database (Denmark)
Mills, Rebecca F.; Doherty, Melissa Louise; Lopez Marques, Rosa Laura
2008-01-01
and development, and transport processes play a key role in regulating their cellular levels. Arabidopsis (Arabidopsis thaliana) contains four P(2A)-type ATPase genes, AtECA1 to AtECA4, which are expressed in all major organs of Arabidopsis. To elucidate the physiological role of AtECA2 and AtECA3 in Arabidopsis...... not so striking because in this case all plants were severely affected. ECA3 partially restored the growth defect on high Mn of the yeast (Saccharomyces cerevisiae) pmr1 mutant, which is defective in a Golgi Ca/Mn pump (PMR1), and the yeast K616 mutant (Deltapmc1 Deltapmr1 Deltacnb1), defective in Golgi...
International Nuclear Information System (INIS)
Hayashi, Naoyuki; Murakami, Seishi; Tsurusaki, Susumu; Nagaura, Zen-ichiro; Oki, Masaya; Nishitani, Hideo; Kobayashi, Masahiko; Shimizu, Hiroko; Yamamoto, Ken-ichi; Nishimoto, Takeharu
2007-01-01
RanGTPase is involved in many cellular processes. It functions in nuclear-cytosolic transport and centrosome formation. Ran also localizes to chromatin as RCC1 does, its guanine nucleotide exchange factor, but Ran's function on chromatin is not known. We found that gsp1, a temperature-sensitive mutant of GSP1, a Saccharomyces cerevisiae Ran homologue, suppressed the hydroxyurea (HU) and ultra violet (UV) sensitivities of the mec1 mutant. In UV-irradiated mec1 gsp1 cells, Rad53 was phosphorylated despite the lack of Mec1. This suppression depended on the TEL1 gene, given that the triple mutant, mec1 gsp1 tel1, was unable to grow. The gsp1 mutations also suppressed the HU sensitivity of the rad9 mutant in a Tel1-dependent manner, but not the HU sensitivity of the rad53 mutant. These results indicated that Rad53 was activated by the Tel1 pathway in mec1 gsp1 cells, suggesting that Gsp1 helps regulate the role switching the ATM family kinases Mec1 and Tel1
Identification of aldehyde oxidase 1 and aldehyde oxidase homologue 1 as dioxin-inducible genes
International Nuclear Information System (INIS)
Rivera, Steven P.; Choi, Hyun Ho; Chapman, Brett; Whitekus, Michael J.; Terao, Mineko; Garattini, Enrico; Hankinson, Oliver
2005-01-01
Aldehyde oxidases are a family of highly related molybdo-flavoenzymes acting upon a variety of compounds of industrial and medical importance. We have identified aldehyde oxidase 1 (AOX1) as a 2,3,7,8-tetrachlorodibenzo-p-dioxin (dioxin) inducible gene in the mouse hepatoma cell line Hepa-1. AOX1 mRNA levels were not increased by dioxin in mutant derivatives of the Hepa-1 cell line lacking either functional aryl hydrocarbon receptor (AHR) or aryl hydrocarbon receptor nuclear translocator (ARNT) proteins, thus demonstrating that transcriptional induction of AOX1 in response to dioxin occurs through the AHR pathway. Dioxin induction of AOX1 mRNA was also observed in mouse liver. In addition, levels of AOX1 protein as well as those of aldehyde oxidase homologue 1 (AOH1), a recently identified homolog of AOX1, were elevated in mouse liver in response to dioxin. Employing an aldehyde oxidase specific substrate, AOX1/AOH1 activity was shown to be induced by dioxin in mouse liver. This activity was inhibited by a known inhibitor of aldehyde oxidases, and eliminated by including tungstate in the mouse diet, which is known to lead to inactivation of molybdoflavoenzymes, thus confirming that the enzymatic activity was attributable to AOX1/AOH1. Our observations thus identify two additional xenobiotic metabolizing enzymes induced by dioxin
International Nuclear Information System (INIS)
Solontsov, A.
2015-01-01
The paper critically overviews the recent developments of the theory of spatially dispersive spin fluctuations (SF) in itinerant electron magnetism with particular emphasis on spin-fluctuation coupling or spin anharmonicity. It is argued that the conventional self-consistent renormalized (SCR) theory of spin fluctuations is usually used aside of the range of its applicability actually defined by the constraint of weak spin anharmonicity based on the random phase approximation (RPA) arguments. An essential step in understanding SF in itinerant magnets beyond RPA-like arguments was made recently within the soft-mode theory of SF accounting for strong spin anharmonicity caused by zero-point SF. In the present paper we generalize it to apply for a wider range of temperatures and regimes of SF and show it to lead to qualitatively new results caused by zero-point effects. - Highlights: • We review the spin-fluctuation theory of itinerant electron magnets with account of zero-point effects. • We generalize the existing theory to account for different regimes of spin fluctuations. • We show that zero-point spin fluctuations play a crucial role in both low- and high-temperature properties of metallic magnets. • We argue that a new scheme of calculation of ground state properties of magnets is needed including zero-point effects
The crucial role of the proto-oncogene c-mos in regulation of oocyte maturation
Directory of Open Access Journals (Sweden)
Irena Jałocha
2010-12-01
Full Text Available Meiosis arrest before fertilization is a common and unique feature of oogenesis in many animal species. On account of the unclear biological significance of meiosis arrest at various stages and for different durations in different animal species, this process and its regulation are the subject of many scientific studies. Studies on the development of ovarian teratomas proved to be helpful in defining the role of particular genes and biochemical cycles in control of the cell cycle in animals. These benign tumors are a valuable source of information on oocyte maturation. The [i]c-mos[/i] proto-oncogene, which is specifically expressed in female and male germ cells, plays a crucial role in control of meiotic cell division in mammals. Its product – Mos protein kinase – acting through mitogen-activated protein kinases (MAPKs regulates critical cellular functions required for homeostasis and decides about cell survival or apoptosis. The MAPK kinase kinase – MAPK kinase – MAPK (MKKK-MKK-MAPK phosphorelay system, in view of its role in cells, seems to be the ideal target for therapeutic intervention in cancer and other diseases. The recent research on human oocytes suggests that the basic mechanisms regulating various stages of oocyte maturation are similar to those described in animals.
DEFF Research Database (Denmark)
Sangüesa, Adrià Arbués; Moeslund, Thomas B.; Bahnsen, Chris Holmberg
2017-01-01
Advanced statistics have proved to be a crucial tool for basketball coaches in order to improve training skills. Indeed, the performance of the team can be further optimized by studying the behaviour of players under certain conditions. In the United States of America, companies such as STATS...... or Second Spectrum use a complex multi-camera setup to deliver advanced statistics to all NBA teams, but the price of this service is far beyond the budget of the vast majority of European teams. For this reason, a first prototype based on positioning sensors is presented. An experimental dataset has been...... created and meaningful basketball features have been extracted. 97.9% accuracy is obtained using Support Vector Machines when identifying 5 different classic plays: floppy offense, pick and roll, press break, post-up situation and fast breaks. After recognizing these plays in video sequences, advanced...
Gašparič, Meti Buh; Lenassi, Metka; Gostinčar, Cene; Rotter, Ana; Plemenitaš, Ana; Gunde-Cimerman, Nina; Gruden, Kristina; Zel, Jana
2013-01-01
Soil salinity and drought are among the most serious agricultural and environmental problems of today. Therefore, investigations of plant resistance to abiotic stress have received a lot of attention in recent years. In this study, we identified the complete coding sequence of a 3'-phosphoadenosine-5'-phosphatase protein, ApHal2, from the halotolerant yeast Aureobasidium pullulans. Expression of the ApHAL2 gene in a Saccharomyces cerevisiae hal2 mutant complemented the mutant auxotrophy for methionine, and rescued the growth of the hal2 mutant in media with high NaCl concentrations. A 21-amino-acids-long region of the ApHal2 enzyme was inserted into the Arabidopsis thaliana homologue of Hal2, the SAL1 phosphatase. The inserted sequence included the META motif, which has previously been implicated in increased sodium tolerance of the Hal2 homologue from a related fungal species. Transgenic Arabidopsis plants overexpressing this modified SAL1 (mSAL1) showed improved halotolerance and drought tolerance. In a medium with an elevated salt concentration, mSAL1-expressing plants were twice as likely to have roots in a higher length category in comparison with the wild-type Arabidopsis and with plants overexpressing the native SAL1, and had 5% to 10% larger leaf surface area under moderate and severe salt stress, respectively. Similarly, after moderate drought exposure, the mSAL1-expressing plants showed 14% increased dry weight after revitalisation, with no increase in dry weight of the wild-type plants. With severe drought, plants overexpressing native SAL1 had the worst rehydration success, consistent with the recently proposed role of SAL1 in severe drought. This was not observed for plants expressing mSAL1. Therefore, the presence of this fungal META motif sequence is beneficial under conditions of increased salinity and moderate drought, and shows no drawbacks for plant survival under severe drought. This demonstrates that adaptations of extremotolerant fungi should
A crucial step in cell division identified | Center for Cancer Research
When cell division doesn’t go according to plan, the resulting daughter cells can become unstable or even cancerous. A team of CCR investigators has now discovered a crucial step required for normal cell division to occur. Read more...
Viral Pseudo Enzymes Activate RIG-I via Deamidation to Evade Cytokine Production
He, Shanping; Zhao, Jun; Song, Shanshan; He, Xiaojing; Minassian, Arlet; Zhou, Yu; Zhang, Junjie; Brulois, Kevin; Wang, Yuqi; Cabo, Jackson; Zandi, Ebrahim; Liang, Chengyu; Jung, Jae U; Zhang, Xuewu; Feng, Pinghui
2015-01-01
SUMMARY RIG-I is a pattern recognition receptor that senses viral RNA and is crucial for host innate immune defense. Here we describe a mechanism of RIG-I activation through amidotransferase-mediated deamidation. We show that viral homologues of phosphoribosylformyglycinamide synthase (PFAS), although lacking intrinsic enzyme activity, recruit cellular PFAS to deamidate and activate RIG-I. Accordingly, depletion and biochemical inhibition of PFAS impair RIG-I deamidation and concomitant activation. Purified PFAS and viral homologue thereof deamidate RIG-I in vitro. Ultimately, herpesvirus hijacks activated RIG-I to avoid antiviral cytokine production; loss of RIG-I or inhibition of RIG-I deamidation results in elevated cytokine production. Together, these findings demonstrate a surprising mechanism of RIG-I activation that is mediated by an enzyme. PMID:25752576
Conversations cruciales des outils pour s'exprimer quand les enjeux sont de taille
Patterson, Kerry; McMillan, Ron; Switzler, Al; Covey, Stephen R
2009-01-01
Quand on parle de " conversations cruciales ", il nous vient spontanément des images de présidents, d'empereurs et de Premiers ministres assis autour d'une table massive en train de débattre de l'avenir du monde. Les conversations dont parle cet ouvrage ne sont pas moins cruciales, nous concernent tous et peuvent survenir à n'importe quel moment dans notre vie quotidienne. Une discussion houleuse avec le patron, une dispute violente avec un collègue ou un client, un mot de trop adressé à notre conjoint, etc. Une conversation devient cruciale quand : les opinions en jeu sont opposées ; les enjeux sont importants ; les émotions sont fortes. Ce livre vous aide à vous exprimer habilement quand les enjeux sont de taille. Il vous explique comment atteindre le but que vous vous êtes fixé en usant des meilleures techniques et en ouvrant le chemin du dialogue. Il vous fournit les outils pour gérer les conversations les plus difficiles et les plus importantes de votre vie.
[Play therapy--psychotherapy with play as the medium: II. New developments].
von Gontard, Alexander; Lehmkuhl, Gerd
2003-02-01
A wide array of new forms and combinations of play therapy have been developed. The aim of the second part of this paper is to present an overview of these newer approaches, including: focussed therapies for specific disorders; behavioural approaches like the Cognitive-Behavioral Play Therapy and the Parent-Child Interaction Therapy; various combinations with family therapy; and therapies especially for preschool children like Filial Therapy, Developmental Play Therapy and Thera-play. Following a phase of experiments and combinations, the empirical evaluation of many play-therapy forms is needed. Especially questions of the differential indication of specific play-therapies and their effectiveness in the therapeutical practice need to be studied.
Analysing playing using the note-time playing path.
de Graaff, Deborah L E; Schubert, Emery
2011-03-01
This article introduces a new method of data analysis that represents the playing of written music as a graph. The method, inspired by Miklaszewski, charts low-level note timings from a sound recording of a single-line instrument using high-precision audio-to-MIDI conversion software. Note onset times of pitch sequences are then plotted against the score-predicted timings to produce a Note-Time Playing Path (NTPP). The score-predicted onset time of each sequentially performed note (horizontal axis) unfolds in performed time down the page (vertical axis). NTPPs provide a visualisation that shows (1) tempo variations, (2) repetitive practice behaviours, (3) segmenting of material, (4) precise note time positions, and (5) time spent on playing or not playing. The NTPP can provide significant new insights into behaviour and cognition of music performance and may also be used to complement established traditional approaches such as think-alouds, interviews, and video coding.
Directory of Open Access Journals (Sweden)
Dana eZingg
2015-12-01
Full Text Available Foot-and-mouth disease (FMD is a highly contagious disease which caused several large outbreaks in Europe in the last century. The last important outbreak in Switzerland took place in 1965/66 and affected more than 900 premises and more than 50,000 animals were slaughtered. Large scale emergency vaccination of the cattle and pig population has been applied to control the epidemic. In recent years, many studies have used infectious disease models to assess the impact of different disease control measures, including models developed for diseases exotic for the specific region of interest. Often, the absence of real outbreak data makes a validation of such models impossible. This study aimed to evaluate whether a spatial, stochastic simulation model (the Davis Animal Disease Simulation model can predict the course of a Swiss FMD epidemic based on the available historic input data on population structure, contact rates, epidemiology of the virus and quality of the vaccine. In addition, the potential outcome of the 1965/66 FMD epidemic without application of vaccination was investigated. Comparing the model outcomes to reality, only the largest 10% of the simulated outbreaks approximated the number of animals being culled. However, the simulation model highly overestimated the number of culled premises. While the outbreak duration could not be well reproduced by the model compared to the 1965/66 epidemic, it was able to accurately estimate the size of the area infected. Without application of vaccination the model predicted a much higher mean number of culled animals than with vaccination, demonstrating that vaccination was likely crucial in disease control for the Swiss FMD outbreak in 1965/66. The study demonstrated the feasibility to analyze historical outbreak data with modern analytical tools. However, it also confirmed that predicted epidemics from a most carefully parametrized model cannot integrate all eventualities of a real epidemic
Carson, Valerie
2018-01-01
Screen time and physical activity behaviours develop during the crucial early childhood period (0–5 years) and impact multiple health and developmental outcomes, including psychosocial wellbeing. Social skills, one component of psychosocial wellbeing, are vital for children’s school readiness and future mental health. This study investigates potential associations of screen time and outdoor play (as a proxy for physical activity) with social skills. Cross sectional data were available for 575 mothers with a child (54% boys) aged 2–5 years. Mothers reported their child’s screen time, outdoor play time and social skills (Adaptive Social Behavior Inventory; ASBI). Multiple linear regression analyses assessed associations of screen and outdoor play time (Model 1) and compliance with screen time and physical activity recommendations (Model 2) with three ASBI subscales. Boys and girls spent a mean of 2.0 and 2.2 hours per day in screen time, and 3.3 and 2.9 hours per day in outdoor play, respectively. Girls scores for express and comply skills were significantly higher than boys (poutdoor play time was positively associated with both expressive (B = 0.20 95% CI 0.07, 0.34; p = 0.004) and compliant (B = 0.22 95% CI 0.08, 0.36; p = 0.002) scores. Findings indicate that television/DVD/video viewing may be adversely, and outdoor play favourably, associated with preschool children’s social skills. Future research is required to identify the direction of causation and explore potential mechanisms of association. PMID:29617366
An archaebacterial homologue of the essential eubacterial cell division protein FtsZ.
Baumann, P; Jackson, S P
1996-01-01
Life falls into three fundamental domains--Archaea, Bacteria, and Eucarya (formerly archaebacteria, eubacteria, and eukaryotes,. respectively). Though Archaea lack nuclei and share many morphological features with Bacteria, molecular analyses, principally of the transcription and translation machineries, have suggested that Archaea are more related to Eucarya than to Bacteria. Currently, little is known about the archaeal cell division apparatus. In Bacteria, a crucial component of the cell d...
Concepts of Play and Play Culture for the 21st Century
DEFF Research Database (Denmark)
Nørgård, Rikke Toft; Toft, Herdis; Karoff, Helle Skovbjerg
2014-01-01
, Associate professor Carsten Jessen, Aarhus University, Assistant professor Helle Skovbjerg Karoff, University of Aalborg and Assistant professor Rikke Toft Nørgård, Aarhus University. This panel represents and discusses different concepts of play and play culture in both diachronic and synchronic dimensions......BIN Norden conference 2014 Accepted panel ________________________________________ Concepts of Play and Play Culture for the 21st Century Participants in the panel are: Associate professor Herdis Toft, University of Southern Denmark (organizer), Professor Beth Juncker, University of Copenhagen....... For several centuries western theorists, for instance Baumgarten, Schiller, Huizinga, Caillois, Sutton Smith, Vygotsky, Bateson, Salen & Zimmerman, Flemming Mouritsen and later on the panel participants, have discussed the concept of play and play culture. They have presented their own theoretical...
DEFF Research Database (Denmark)
Cermak-Sassenrath, Daniel
2018-01-01
and specific ways. For instance, gambling for money, party and drinking games, professional play and show sports, art installations, violent and military propaganda computer games, pervasive/mobile gaming, live-action role playing, festivals, performances, and games such as Ghosting and Planking. It is argued......Everything gets more interesting, challenging, or intense the closer it gets to the edge, and so does play. How edgy can play become and still be play? Based on Huizinga’s notion of play, this chapter discusses how a wide range of playful activities pushes the boundaries of play in different...... that in concert with a number of characteristics that mark an activity as play, play is essentially a subjective perspective and individual decision of the player. Huizinga calls this attitude the play spirit, which informs a player’s actions and is in turn sustained by them. Edgy digital or mobile games do...
Porter, Maggie L.; Hernandez-Reif, Maria; Jessee, Peggy
2009-01-01
This article discusses the current issues in play therapy and its implications for play therapists. A brief history of play therapy is provided along with the current play therapy approaches and techniques. This article also touches on current issues or problems that play therapists may face, such as interpreting children's play, implementing…
Well Played: The Origins and Future of Playfulness
Gordon, Gwen
2014-01-01
In this article, the author synthesizes research from several disciplines to shed light on play's central role in healthy development. Gordon builds on research in attachment theory that correlates secure attachment in infancy with adult well-being to demonstrate how playfulness might be a lifelong outcome of secure attachment and a primary…
Mol Lous, A.; Wit, C.A.M. de; Bruyn, E.E.J. De; Riksen-Walraven, J.M.A.; Rost, H.
2000-01-01
The behavior of seven depressed and seven nondepressed 3- to 6-year-olds was compared in three play situations: solitary free play, interactive free play, and play narratives. Depressed children played significantly less than their nondepressed controls. This was mainly due to differences in
Numerical study of crucial parameters in tilt casting for titanium aluminides
Directory of Open Access Journals (Sweden)
Hong Wang
2011-08-01
Full Text Available Numerical modeling of the tilt casting process for TiAl alloys was investigated to achieve a tranquil mould filling and TiAl castings free of defects. Titanium alloys are very reactive in molten state, so they are widely melted in cold crucible, e.g. the Induction Skull Melting (ISM furnace. Then the crucible holding the molten metal together with the mould is rotated to transfer the metal into the mould — ISM+ tilt casting. This paper emphasizes the effect of crucial parameters on mould filling and solidification of the castings during tilt casting. All crucial parameters, such as rotation rate, rotation profile, venting, initial mould temperature, casting orientation, feeder design, change of radius in 'T' junction and mould insulation have been discussed using numerical modeling data. Simulations were performed using a 3D CFD code PHYSICA implemented with front tracking, heat transfer algorithms and a turbulence model (which accounts for an advancing solid front.
Play as Self-Realization: Toward a General Theory of Play
Henricks, Thomas S.
2014-01-01
In a wide-ranging essay that reviews the major theories of plays and relates them to significant notions of the self, the author addresses the question of why we play. He does so to argue that play is a biologically driven project of self-understanding and self-realization, one that humans--although they also share the experience with other…
Validating tyrosinase homologue MelA as a photoacoustic reporter gene for imaging Escherichia coli
Paproski, Robert J.; Li, Yan; Barber, Quinn; Lewis, John D.; Campbell, Robert; Zemp, Roger
2015-03-01
Antibiotic drug resistance is a major worldwide issue. Development of new therapies against pathogenic bacteria requires appropriate research tools for replicating and characterizing infections. Previously fluorescence and bioluminescence modalities have been used to image infectious burden in animal models but scattering significantly limits imaging depth and resolution. We hypothesize that photoacoustic imaging, which has improved depth-toresolution ratio, could be useful for visualizing MelA-expressing bacteria since MelA is a bacterial tyrosinase homologue involved in melanin production. Using an inducible expression system, E. coli expressing MelA were visibly black in liquid culture. Phosphate buffered saline (PBS), MelA-expressing bacteria (at different dilutions in PBS), and chicken embryo blood were injected in plastic tubes which were imaged using a VisualSonics Vevo LAZR system. Photoacoustic imaging at 6 different wavelengths (680, 700, 750, 800, 850 and 900nm) enabled spectral de-mixing to distinguish melanin signals from blood. The signal to noise ratio of 9x diluted MelA bacteria was 55, suggesting that ~20 bacteria cells could be detected with our system. When MelA bacteria were injected as a 100 μL bolus into a chicken embryo, photoacoustic signals from deoxy- and oxy- hemoglobin as well as MelA-expressing bacteria could be separated and overlaid on an ultrasound image, allowing visualization of the bacterial location. Photoacoustic imaging may be a useful tool for visualizing bacterial infections and further work incorporating photoacoustic reporters into infectious bacterial strains is warranted.
International Nuclear Information System (INIS)
Ahmed, Sameh; Kishikawa, Naoya; Nakashima, Kenichiro; Kuroda, Naotaka
2007-01-01
A sensitive and highly selective high-performance liquid chromatography (HPLC) method was developed for the determination of vitamin K homologues including phylloquinone (PK), menaquinone-4 (MK-4) and menaquinone-7 (MK-7) in human plasma using post-column peroxyoxalate chemiluminescence (PO-CL) detection following on-line ultraviolet (UV) irradiation. The method was based on ultraviolet irradiation (254 nm, 15 W) of vitamin K to produce hydrogen peroxide and a fluorescent product at the same time, which can be determined with PO-CL detection. The separation of vitamin K by HPLC was accomplished isocratically on an ODS column within 35 min. The method involves the use of 2-methyl-3-pentadecyl-1,4-naphthoquinone as an internal standard. The detection limits (signal-to-noise ratio = 3) were 32, 38 and 85 fmol for PK, MK-4 and MK-7, respectively. The recoveries of PK, MK-4 and MK-7 were greater than 82% and the inter- and intra-assay R.S.D. values were 1.9-5.4%. The sensitivity and selectivity of this method were sufficient for clinical and nutritional applications
Play and play occupation: a survey of paediatric occupational therapy practice in Ireland
Directory of Open Access Journals (Sweden)
Alice Moore
2017-04-01
Full Text Available Purpose - Play occupation has been identified as an essential part of children’s lives, and it subsequently features in paediatric occupational therapy. However, few studies address the current place of play and play occupation in occupational therapy practice. This study aims to address this gap in knowledge by exploring paediatric occupational therapists’ perspectives on the place of play and play occupation in occupational therapy practice in Ireland. Design/methodology/approach - A cross-sectional online survey was conducted to gather data about the current use of play in the occupational therapy for children under 12 years. Convenience sampling and snowball recruitment techniques were used to recruit paediatric occupational therapists. Data were analysed using descriptive statistics and qualitative content analysis. Findings - In total, 65 therapists responded to the survey (estimated response rate, 32%. Results are organised into four sections: demographics and practice context, play assessment practices, use of play in practice and perceived barriers to play-centred practice. Respondents reported that they valued play as a childhood occupation. However, the survey findings identified that the primary focus was on play as a means to an end. Lack of education on play (research, theory and interventions and pressures in the workplace have been identified as barriers to play-centred practice. Research limitations/implications - Findings indicate that there is a mismatch between therapists valuing play as an occupation and how play is used in occupational therapy practice. Unless clarifications are made about play occupation as being different to skills acquisition in childhood, play occupation will continue to get overlooked as an authentic concern of occupation-centred practice. Thus, play as occupation deserves further attention from educators, researchers and practitioners as a means of strengthening occupation-centred practice, in
WW II "guinea pigs" played crucial role in refining plastic surgery in Canada
Wilton, P
1998-01-01
When WW II started, Canada had only 4 plastic surgeons. One of them, Dr. Ross Tilley, would treat hundreds of Allied airmen whose bodies needed massive reconstruction because of war injuries. These men became known as the guinea pigs, and Tilley would bring the lessons he learned on them back to Canada.
Sutradhar, S.; Basu, S.; Paul, R.
2015-10-01
Cell division through proper spindle formation is one of the key puzzles in cell biology. In most mammalian cells, chromosomes spontaneously arrange to achieve a stable bipolar spindle during metaphase which eventually ensures proper segregation of the DNA into the daughter cells. In this paper, we present a robust three-dimensional mechanistic model to investigate the formation and maintenance of a bipolar mitotic spindle in mammalian cells under different physiological constraints. Using realistic parameters, we test spindle viability by measuring the spindle length and studying the chromosomal configuration. The model strikingly predicts a feature of the spindle instability arising from the insufficient intercentrosomal angular separation and impaired sliding of the interpolar microtubules. In addition, our model successfully reproduces chromosomal patterns observed in mammalian cells, when activity of different motor proteins is perturbed.
Fujiwara, Sachiko; Ohashi, Kazumasa; Mashiko, Toshiya; Kondo, Hiroshi; Mizuno, Kensaku
2016-01-01
Mechanical force–induced cytoskeletal reorganization is essential for cell and tissue remodeling and homeostasis; however, the underlying cellular mechanisms remain elusive. Solo (ARHGEF40) is a RhoA-targeting guanine nucleotide exchange factor (GEF) involved in cyclical stretch–induced human endothelial cell reorientation and convergent extension cell movement in zebrafish gastrula. In this study, we show that Solo binds to keratin-8/keratin-18 (K8/K18) intermediate filaments through multiple sites. Solo overexpression promotes the formation of thick actin stress fibers and keratin bundles, whereas knockdown of Solo, expression of a GEF-inactive mutant of Solo, or inhibition of ROCK suppresses stress fiber formation and leads to disorganized keratin networks, indicating that the Solo-RhoA-ROCK pathway serves to precisely organize keratin networks, as well as to promote stress fibers. Of importance, knockdown of Solo or K18 or overexpression of GEF-inactive or deletion mutants of Solo suppresses tensile force–induced stress fiber reinforcement. Furthermore, knockdown of Solo or K18 suppresses tensile force-induced RhoA activation. These results strongly suggest that the interplay between Solo and K8/K18 filaments plays a crucial role in tensile force–induced RhoA activation and consequent actin cytoskeletal reinforcement. PMID:26823019
Arai, Teppei; Kojima, Ryo; Motegi, Yoshiki; Kato, Jun; Kasumi, Takafumi; Ogihara, Jun
2015-12-01
The production of pigments as secondary metabolites by microbes is known to vary by species and by physiological conditions within a single strain. The fungus strain Penicillium purpurogenum IAM15392 has been found to produce violet pigment (PP-V) and orange pigment (PP-O),Monascus azaphilone pigment homologues, when grown under specific culture conditions. In this study, we analysed PP-V and PP-O production capability in seven strains of P. purpurogenum in addition to strain IAM15392 under specific culture conditions. The pigment production pattern of five strains cultivated in PP-V production medium was similar to that of strain IAM15392, and all violet pigments produced by these five strains were confirmed to be PP-V. Strains that did not produce pigment were also identified. In addition, two strains cultivated in PP-O production medium produced a violet pigment identified as PP-V. The ribosomal DNA (rDNA) internal transcribed spacer (ITS) region sequences from the eight P. purpurogenum strains were sequenced and used to construct a neighbor-joining phylogenetic tree. PP-O and PP-V production of P. purpurogenum was shown to be related to phylogenetic placement based on rDNA ITS sequence. Based on these results, two hypotheses for the alteration of pigment production of P. purpurogenum in evolution were proposed. Copyright © 2015 The British Mycological Society. Published by Elsevier Ltd. All rights reserved.
DEFF Research Database (Denmark)
Fogh, Rune; Johansen, Asger
2013-01-01
In this paper we propose The Play Grid, a model for systemizing different play types. The approach is psychological by nature and the actual Play Grid is based, therefore, on two pairs of fundamental and widely acknowledged distinguishing characteristics of the ego, namely: extraversion vs. intro...
Van Nguyen, Dung; Van Nguyen, Cuong; Bonsall, David; Ngo, Tue Tri; Carrique-Mas, Juan; Pham, Anh Hong; Bryant, Juliet E; Thwaites, Guy; Baker, Stephen; Woolhouse, Mark; Simmonds, Peter
2018-02-28
Rodents and bats are now widely recognised as important sources of zoonotic virus infections in other mammals, including humans. Numerous surveys have expanded our knowledge of diverse viruses in a range of rodent and bat species, including their origins, evolution, and range of hosts. In this study of pegivirus and human hepatitis-related viruses, liver and serum samples from Vietnamese rodents and bats were examined by PCR and sequencing. Nucleic acids homologous to human hepatitis B, C, E viruses were detected in liver samples of 2 (1.3%) of 157 bats, 38 (8.1%), and 14 (3%) of 470 rodents, respectively. Hepacivirus-like viruses were frequently detected (42.7%) in the bamboo rat, Rhizomys pruinosus , while pegivirus RNA was only evident in 2 (0.3%) of 638 rodent serum samples. Complete or near-complete genome sequences of HBV, HEV and pegivirus homologues closely resembled those previously reported from rodents and bats. However, complete coding region sequences of the rodent hepacivirus-like viruses substantially diverged from all of the currently classified variants and potentially represent a new species in the Hepacivirus genus. Of the viruses identified, their routes of transmission and potential to establish zoonoses remain to be determined.
2017-01-01
The social meanings of play sit at odds with norms of responsible and productive adult conduct. To be “caught” playing as an adult therefore risks embarrassment. Still, many designers want to create enjoyable, nonembarrassing play experiences for adults. To address this need, this article reads instances of spontaneous adult play through the lens of Erving Goffman’s theory of the interaction order to unpack conditions and strategies for nonembarrassing adult play. It identifies established frames, segregated audiences, scripts supporting smooth performance, managing audience awareness, role distancing, and, particularly, alibis for play: Adults routinely provide alternative, adult-appropriate motives to account for their play, such as child care, professional duties, creative expression, or health. Once legitimized, the norms and rules of play themselves then provide an alibi for behavior that would risk being embarrassing outside play.
Public information - the crucial element in nuclear power acceptance
International Nuclear Information System (INIS)
Hayes, R.; Middlemiss, N.
1996-01-01
The British nuclear industry approach to the public information is described as the crucial element in nuclear power acceptance. The industry need to be a reliable, trustworthy source of information. There is evidence that when issues are examined in court or in quasi-judicial contexts, the public gains a better appreciation of the issues. The media report both sides of debate more evenly. Therefore the best way to deal with the most hostile opposition may be to take into a legal framework, rather than engage in hand-to-hand battle
Public information - the crucial element in nuclear power acceptance
Energy Technology Data Exchange (ETDEWEB)
Hayes, R; Middlemiss, N [British Nuclear Industry Forum, London (United Kingdom)
1996-07-01
The British nuclear industry approach to the public information is described as the crucial element in nuclear power acceptance. The industry need to be a reliable, trustworthy source of information. There is evidence that when issues are examined in court or in quasi-judicial contexts, the public gains a better appreciation of the issues. The media report both sides of debate more evenly. Therefore the best way to deal with the most hostile opposition may be to take into a legal framework, rather than engage in hand-to-hand battle.
Alibis for Adult Play: A Goffmanian Account of Escaping Embarrassment in Adult Play.
Deterding, Sebastian
2018-05-01
The social meanings of play sit at odds with norms of responsible and productive adult conduct. To be "caught" playing as an adult therefore risks embarrassment. Still, many designers want to create enjoyable, nonembarrassing play experiences for adults. To address this need, this article reads instances of spontaneous adult play through the lens of Erving Goffman's theory of the interaction order to unpack conditions and strategies for nonembarrassing adult play. It identifies established frames, segregated audiences, scripts supporting smooth performance, managing audience awareness, role distancing, and, particularly, alibis for play: Adults routinely provide alternative, adult-appropriate motives to account for their play, such as child care, professional duties, creative expression, or health. Once legitimized, the norms and rules of play themselves then provide an alibi for behavior that would risk being embarrassing outside play.
Lü, Silin; Deng, Jiacheng; Liu, Huiying; Liu, Bo; Yang, Juan; Miao, Yutong; Li, Jing; Wang, Nan; Jiang, Changtao; Xu, Qingbo; Wang, Xian; Feng, Juan
2018-06-01
Inflammation mediated by activated T cells plays an important role in the initiation and progression of hyperhomocysteinemia (HHcy)-accelerated atherosclerosis in ApoE -/- mice. Homocysteine (Hcy) activates T cells to secrete proinflammatory cytokines, especially interferon (IFN)-γ; however, the precise mechanisms remain unclear. Metabolic reprogramming is critical for T cell inflammatory activation and effector functions. Our previous study demonstrated that Hcy regulates T cell mitochondrial reprogramming by enhancing endoplasmic reticulum (ER)-mitochondria coupling. In this study, we further explored the important role of glycolysis-mediated metabolic reprogramming in Hcy-activated CD4 + T cells. Mechanistically, Hcy-activated CD4 + T cell increased the protein expression and activity of pyruvate kinase muscle isozyme 2 (PKM2), the final rate-limiting enzyme in glycolysis, via the phosphatidylinositol 3-kinase/AKT/mechanistic target of rapamycin signaling pathway. Knockdown of PKM2 by small interfering RNA reduced Hcy-induced CD4 + T cell IFN-γ secretion. Furthermore, we generated T cell-specific PKM2 knockout mice by crossing LckCre transgenic mice with PKM2 fl/fl mice and observed that Hcy-induced glycolysis and oxidative phosphorylation were both diminished in PKM2-deficient CD4 + T cells with reduced glucose and lipid metabolites, and subsequently reduced IFN-γ secretion. T cell-depleted apolipoprotein E-deficient (ApoE -/- ) mice adoptively transferred with PKM2-deficient CD4 + T cells, compared to mice transferred with control cells, showed significantly decreased HHcy-accelerated early atherosclerotic lesion formation. In conclusion, this work indicates that the PKM2-dependent glycolytic-lipogenic axis, a novel mechanism of metabolic regulation, is crucial for HHcy-induced CD4 + T cell activation to accelerate early atherosclerosis in ApoE -/- mice. Metabolic reprogramming is crucial for Hcy-induced CD4 + T cell inflammatory activation. Hcy activates
Bashian, Kathleen Ryniker
1993-01-01
Describes a yearlong project at 12 Catholic middle schools in the Diocese of Arlington, Virginia, to incorporate the plays of William Shakespeare into the curriculum. Teachers attended university lectures and directed students in performances of the plays. Concludes that Shakespeare can be understood and enjoyed by middle school students. (BCY)
Virtual Playgrounds? Assessing the Playfulness of Massively Multiplayer Online Role-Playing Games
Graham, Kerrie Lewis
2010-01-01
Millions of children and adults devote much of their leisure time to playing massively multiplayer online role-playing games (MMORPGs). Most observers commonly categorize computer games as a play activity, but this article asks whether MMORPGs contain activities that might not be play. The author examines the phenomenon of online gaming and…
International Nuclear Information System (INIS)
Vijaysri, Sangeetha; Talasela, Latha; Mercer, Andrew A.; Mcinnes, Colin J.; Jacobs, Bertram L.; Langland, Jeffrey O.
2003-01-01
Orf virus (OV), the prototypic parapoxvirus, is resistant to the effects of interferon (IFN) and this function of OV has been mapped to the OV20.0L gene. The protein product of this gene shares 31% amino acid identity to the E3L-encoded protein of vaccinia virus (VV) that is required for the broad host range and IFN-resistant phenotype of VV in cells in culture and for virulence of the virus in vivo. In this study we investigated whether the distantly related OV E3L homologue could complement the deletion of E3L in VV. The recombinant VV (VV/ORF-E3L) expressing the OV E3L homologue in place of VV E3L was indistinguishable from wt VV in its cell-culture phenotype. But VV/ORF-E3L was over a 1000-fold less pathogenic than wt VV (LD 50 > 5 x 10 6 PFU, compared to LD 50 of wtVV = 4 x 10 3 PFU) following intranasal infection of mice. While wt VV spread to the lungs and brain and replicated to high titers in the brain of infected mice, VV/ORF-E3L could not be detected in the lungs or brain following intranasal infection. VV/ORF-E3L was at least 100,000-fold less pathogenic than wt VV on intracranial injection. Domain swap experiments demonstrate that the difference in pathogenesis maps to the C-terminal domain of these proteins. This domain has been shown to be required for the dsRNA binding function of the VV E3L
Identifying Crucial Issues in Climate Science
Ikeda, Motoyoshi; Greve, Ralf; Hara, Toshika; Watanabe, Yutaka W.; Ohmura, Atsumu; Ito, Akihiko; Kawamiya, Michio
2009-01-01
Drastic Change in the Earth System During Global Warming; Sapporo, Japan, 24 June 2008; The Nobel Peace Prize awarded to the Intergovernmental Panel on Climate Change (IPCC) and former U.S. vice president Al Gore indicates that global warming is recognized as a real phenomenon critical to human beings. However, humanity's knowledge concerning global warming is based on an uncertainty larger than 50% in the warming rate during the past century. Therefore, scientific clarification is needed to understand important mechanisms that potentially produce positive feedbacks in the Earth system-such mechanisms must be better understood before scientists can develop more reliable predictions. To plan for the future, a symposium was organized at Japan's Hokkaido University in association with the G8 Summit, where the most recent updates on the five urgent issues in climate science were discussed. These issues, considered to be crucial as severe impacts on human society continue to rise, included (1) causes and magnitude of sea level rise; (2) decay of glaciers and the Greenland and Antarctic ice sheets; (3) disappearance of the summer Arctic sea ice; (4) carbon uptake or emission by the terrestrial ecosystem; and (5) marine ecosystem change resulting in carbon emissions.
Play and Adversity: How the Playful Mammalian Brain Withstands Threats and Anxieties
Siviy, Stephen M.
2010-01-01
Most mammals play, but they do so in a dangerous world. The dynamic relationship between the stresses created by their world and the activity of play helps to explain the evolution of play in mammals, as the author demonstrates in evidence garnered from experiments that introduce elements of fear to rats at play. The author describes the resulting…
LCM-seq reveals the crucial role of LsSOC1 in heat-promoted bolting of lettuce (Lactuca sativa L.).
Chen, Zijing; Zhao, Wensheng; Ge, Danfeng; Han, Yingyan; Ning, Kang; Luo, Chen; Wang, Shenglin; Liu, Renyi; Zhang, Xiaolan; Wang, Qian
2018-05-17
Lettuce (Lactuca sativa L.) is one of the most economically important vegetables. The floral transition in lettuce is accelerated under high temperatures, which can significantly decrease yields. However, the molecular mechanism underlying the floral tranition in lettuce is poorly known. Using laser capture microdissection coupled with RNA sequencing, we isolated shoot apical meristem cells from the bolting-sensitive lettuce line S39 at four critical stages of development. Subsequently, we screened specifically for the flowering-related gene LsSOC1 during the floral transition through comparative transcriptomic analysis. Molecular biology, developmental biology, and biochemical tools were combined to investigate the biological function of LsSOC1 in lettuce. LsSOC1 knockdown by RNA interference resulted in a significant delay in the timing of bolting and insensitivity to high temperature, which indicated that LsSOC1 functions as an activator during heat-promoted bolting in lettuce. We determined that two heat-shock transcription factors, HsfA1e and HsfA4c, bound to the promoter of LsSOC1 to confirm that LsSOC1 played an important role in heat-promoted bolting. This study indicates that LsSOC1 plays a crucial role in the heat-promoted bolting process in lettuce. Further investigation of LsSOC1 may be useful for clarification of the bolting mechanism in lettuce. This article is protected by copyright. All rights reserved. This article is protected by copyright. All rights reserved.
Directory of Open Access Journals (Sweden)
Yi-Ting Lee
2016-09-01
Full Text Available We have overcome the synthetic difficulty of 9,9′,9′′,9′′′,9′′′′,9′′′′′-((phenylsilanetriyltris(benzene-5,3,1-triylhexakis(9H-carbazole (SimCP3 an advanced homologue of previously known SimCP2 as a solution-processed, high triplet gap energy host material for a blue phosphorescence dopant. A series of organic light-emitting diodes based on blue phosphorescence dopant iridium (III bis(4,6-difluorophenylpyridinatopicolate, FIrpic, were fabricated and tested to demonstrate the validity of solution-processed SimCP3 in the device fabrication.
Time perspective as a predictor of massive multiplayer online role-playing game playing.
Lukavska, Katerina
2012-01-01
This article focuses on the relationship between the time perspective (TP) personality trait and massive multiplayer online role-playing game (MMORPG) playing. We investigate the question of frequency of playing. The TP was measured with Zimbardo's TP Inventory (ZTPI), which includes five factors-past negative, past positive, present hedonistic, present fatalistic, and future. The study used data from 154 MMORPG players. We demonstrated that TP partially explained differences within a group of players with respect to the frequency of playing. Significant positive correlations were found between present factors and the amount of time spent playing MMORPGs, and significant negative correlation was found between the future factor and the time spent playing MMORPGs. Our study also revealed the influence of future-present balance on playing time. Players who scored lower in future-present balance variables (their present score was relatively high compared with their future score) reported higher values in playing time. In contrast to referential studies on TP and drug abuse and gambling, present fatalistic TP was demonstrated to be a stronger predictor of extensive playing than present hedonistic TP, which opened the question of motivation for playing. The advantage of our study compared with other personality-based studies lies in the fact that TP is a stable but malleable personality trait with a direct link to playing behavior. Therefore, TP is a promising conceptual resource for excessive playing therapy.
Directory of Open Access Journals (Sweden)
Teruo Umemoto
2012-03-01
Full Text Available Various arylsulfur pentafluorides, ArSF5, have long been desired in both academic and industrial areas, and ArSF5 compounds have attracted considerable interest in many areas such as medicines, agrochemicals, and other new materials, since the highly stable SF5 group is considered a “super-trifluoromethyl group” due to its significantly higher electronegativity and lipophilicity. This article describes the first practical method for the production of various arylsulfur pentafluorides and their higher homologues, bis- and tris(sulfur pentafluorides, from the corresponding diaryl disulfides or aryl thiols. The method consists of two steps: (Step 1 treatment of a diaryl disulfide or an aryl thiol with chlorine in the presence of an alkali metal fluoride, and (step 2 treatment of the resulting arylsulfur chlorotetrafluoride with a fluoride source, such as ZnF2, HF, and Sb(III/V fluorides. The intermediate arylsulfur chlorotetrafluorides were isolated by distillation or recrystallization and characterized. The aspects of these new reactions are revealed and reaction mechanisms are discussed. As the method offers considerable improvement over previous methods in cost, yield, practicality, applicability, and large-scale production, the new processes described here can be employed as the first practical methods for the economical production of various arylsulfur pentafluorides and their higher homologues, which could then open up a new era of “super-trifluoromethyl” arene chemistry and its applications in many areas.
Play and optimal welfare: Does play indicate the presence of positive affective states?
Ahloy-Dallaire, Jamie; Espinosa, Julia; Mason, Georgia
2017-11-16
Play is commonly used to assess affective states in both humans and non-human animals. Play appears to be most common when animals are well-fed and not under any direct threats to fitness. Could play and playfulness therefore indicate pre-existing positive emotions, and thence optimal animal welfare? We examine this question by surveying the internal and external conditions that promote or suppress play in a variety of species, starting with humans. We find that negative affective states and poor welfare usually do suppress play (although there are notable exceptions where the opposite occurs). Furthermore, research in children suggests that beyond the frequency or total duration of play, poor welfare may additionally be reflected in qualitative aspects of this heterogeneous behaviour (e.g. display of solitary over social play; and the 'fragmentation' of play bouts) that are often overlooked in animals. There are surprisingly few studies of play in subjects with pre-existing optimal welfare or in unambiguously highly positive affective states, making it currently impossible to determine whether play can distinguish optimal or good welfare from merely neutral welfare. This therefore represents an important and exciting area for future research. Copyright © 2017 Elsevier B.V. All rights reserved.
Does Playing Pay? The Fitness-Effect of Free Play during Childhood
Directory of Open Access Journals (Sweden)
Werner Greve
2014-04-01
Full Text Available Evolutionary developmental psychology claims that the sequences and processes of human development, in fact the mere fact of ontogeny itself, have to be viewed as evolutionary products. However, although the functional benefits of childish behavior (child playing for cognitive and emotional development have been shown repeatedly, claiming evolutionary adaptiveness of playing in childhood suggests that childish play supports evolutionary success in mature stages of development. This hypothesis is tested in a study with N = 134 adults (93 females; age range 20–66 years. Participants were asked to recollect their play experiences during childhood in detail, and to report their current developmental status with respect to several aspects of social success. Results show that the opportunity for and the promotion of free play in childhood significantly predict some indicators of social success. Additional analyses strive to explore mediating processes for this relationship. In particular, the mediating role of individual adaptivity (flexibility of goal adjustment is investigated. Results suggest that freely playing in childhood promotes developmental resources, in particular individual adaptivity in adulthood, which, in turn, promote developmental success.
Does playing pay? The fitness-effect of free play during childhood.
Greve, Werner; Thomsen, Tamara; Dehio, Cornelia
2014-04-29
Evolutionary developmental psychology claims that the sequences and processes of human development, in fact the mere fact of ontogeny itself, have to be viewed as evolutionary products. However, although the functional benefits of childish behavior (child playing) for cognitive and emotional development have been shown repeatedly, claiming evolutionary adaptiveness of playing in childhood suggests that childish play supports evolutionary success in mature stages of development. This hypothesis is tested in a study with N=134 adults (93 females; age range 20-66 years). Participants were asked to recollect their play experiences during childhood in detail, and to report their current developmental status with respect to several aspects of social success. Results show that the opportunity for and the promotion of free play in childhood significantly predict some indicators of social success. Additional analyses strive to explore mediating processes for this relationship. In particular, the mediating role of individual adaptivity (flexibility of goal adjustment) is investigated. Results suggest that freely playing in childhood promotes developmental resources, in particular individual adaptivity in adulthood, which, in turn, promote developmental success.
Child's Play: Therapist's Narrative
Reddy, Rajakumari P.; Hirisave, Uma
2014-01-01
Play has been recognized as an essential component to children's healthy development. Schools of play therapy differ philosophically and technically, but they all embrace the therapeutic and developmental properties of play. This case report is an illustration of how a 6-year-old child with emotional disorder was facilitated to express concerns in child-centered play therapy. The paper discusses the therapist's narration of the child's play. PMID:24860228
Landreth, Garry; Bratton, Sue
Play therapy is based on developmental principles and, thus, provides, through play, developmentally appropriate means of expression and communication for children. Therefore, skill in using play therapy is an essential tool for mental health professionals who work with children. Therapeutic play allows children the opportunity to express…
Schouten, B.A.M.
2011-01-01
Play is seen as an activity that is fun, voluntary, offers escape, and is fundamentally exciting. Play is however, more than that; it is a working model of flexibility! There is a vital link between play, psychological development and learning. Moreover, the importance of play has gained importance
Nicosia, Aldo; Bennici, Carmelo; Biondo, Girolama; Costa, Salvatore; Di Natale, Marilena; Masullo, Tiziana; Monastero, Calogera; Ragusa, Maria Antonietta; Tagliavia, Marcello; Cuttitta, Angela
2018-01-11
Gene family encoding translationally controlled tumour protein (TCTP) is defined as highly conserved among organisms; however, there is limited knowledge of non-bilateria. In this study, the first TCTP homologue from anthozoan was characterised in the Mediterranean Sea anemone, Anemonia viridis . The release of the genome sequence of Acropora digitifera , Exaiptasia pallida , Nematostella vectensis and Hydra vulgaris enabled a comprehensive study of the molecular evolution of TCTP family among cnidarians. A comparison among TCTP members from Cnidaria and Bilateria showed conserved intron exon organization, evolutionary conserved TCTP signatures and 3D protein structure. The pattern of mRNA expression profile was also defined in A. viridis . These analyses revealed a constitutive mRNA expression especially in tissues with active proliferation. Additionally, the transcriptional profile of A. viridis TCTP ( AvTCTP ) after challenges with different abiotic/biotic stresses showed induction by extreme temperatures, heavy metals exposure and immune stimulation. These results suggest the involvement of AvTCTP in the sea anemone defensome taking part in environmental stress and immune responses.
Directory of Open Access Journals (Sweden)
Aldo Nicosia
2018-01-01
Full Text Available Gene family encoding translationally controlled tumour protein (TCTP is defined as highly conserved among organisms; however, there is limited knowledge of non-bilateria. In this study, the first TCTP homologue from anthozoan was characterised in the Mediterranean Sea anemone, Anemonia viridis. The release of the genome sequence of Acropora digitifera, Exaiptasia pallida, Nematostella vectensis and Hydra vulgaris enabled a comprehensive study of the molecular evolution of TCTP family among cnidarians. A comparison among TCTP members from Cnidaria and Bilateria showed conserved intron exon organization, evolutionary conserved TCTP signatures and 3D protein structure. The pattern of mRNA expression profile was also defined in A. viridis. These analyses revealed a constitutive mRNA expression especially in tissues with active proliferation. Additionally, the transcriptional profile of A. viridis TCTP (AvTCTP after challenges with different abiotic/biotic stresses showed induction by extreme temperatures, heavy metals exposure and immune stimulation. These results suggest the involvement of AvTCTP in the sea anemone defensome taking part in environmental stress and immune responses.
DEFF Research Database (Denmark)
Tychsen, Anders; Hitchens, Michael; Brolund, Thea
2008-01-01
Role-playing games (RPGs) are a well-known game form, existing in a number of formats, including tabletop, live action, and various digital forms. Despite their popularity, empirical studies of these games are relatively rare. In particular there have been few examinations of the effects of the v......Role-playing games (RPGs) are a well-known game form, existing in a number of formats, including tabletop, live action, and various digital forms. Despite their popularity, empirical studies of these games are relatively rare. In particular there have been few examinations of the effects...... of the various formats used by RPGs on the gaming experience. This article presents the results of an empirical study, examining how multi-player tabletop RPGs are affected as they are ported to the digital medium. Issues examined include the use of disposition assessments to predict play experience, the effect...... of group dynamics, the influence of the fictional game characters and the comparative play experience between the two formats. The results indicate that group dynamics and the relationship between the players and their digital characters, are integral to the quality of the gaming experience in multiplayer...
Directory of Open Access Journals (Sweden)
Jianping Ge
Full Text Available L-type voltage-dependent CaV1.2 channels play an important role in the maintenance of intracellular calcium homeostasis, and influence multiple cellular processes. C-terminal cleavage of CaV1.2 channels was reported in several types of excitable cells, but its expression and possible roles in non-excitable cells is still not clear. The aim of this study was to determine whether distal C-terminal fragment of CaV1.2 channels is present in rat dental pulp stem cells and its possible role in the neural differentiation of rat dental pulp stem cells. We generated stable CaV1.2 knockdown cells via short hairpin RNA (shRNA. Rat dental pulp stem cells with deleted distal C-terminal of CaV1.2 channels lost the potential of differentiation to neural cells. Re-expression of distal C-terminal of CaV1.2 rescued the effect of knocking down the endogenous CaV1.2 on the neural differentiation of rat dental pulp stem cells, indicating that the distal C-terminal of CaV1.2 is required for neural differentiation of rat dental pulp stem cells. These results provide new insights into the role of voltage-gated Ca(2+ channels in stem cells during differentiation.
Playing with social identities
DEFF Research Database (Denmark)
Winther-Lindqvist, Ditte Alexandra
2013-01-01
as pretence, children’s play is understood as an activity involving rules of the social order (roles and positions) as well as identification processes (imagined situations). The theoretical argumentation builds on empirical examples obtained in two different Danish day-care centres. The chapter is informed...... by ethnographic observations and draws on illustrative examples with symbolic group play as well as game-play with rules (soccer) among 5 year old boys. Findings suggest that day-care children’s play, involves negotiation of roles, positioning and identification, and rules – and that these negotiations......This chapter offers support for Vygotsky’s claim that all play involves both an imagined situation as well as rules. Synthesising Schousboe’s comprehensive model of spheres of realities in playing (see Chapter 1, this volume) with Lev Vygotskys insight that all playing involve rules as well...
Directory of Open Access Journals (Sweden)
Stan A. Kuczaj
2014-05-01
Full Text Available Play is an important aspect of dolphin life, perhaps even an essential one. Play provides opportunities for dolphin calves to practice and perfect locomotor skills, including those involved in foraging and mating strategies and behaviors. Play also allows dolphin calves to learn important social skills and acquire information about the characteristics and predispositions of members of their social group, particularly their peers. In addition to helping dolphin calves learn how to behave, play also provides valuable opportunities for them to learn how to think. The ability to create and control play contexts enables dolphins to create novel experiences for themselves and their playmates under relatively safe conditions. The behavioral variability and individual creativity that characterize dolphin play yield ample opportunities for individual cognitive development as well as social learning, and sometimes result in innovations that are reproduced by other members of the group. Although adults sometimes produce innovative play, calves are the primary source of such innovations. Calves are also more likely to imitate novel play behaviors than are adults, and so calves contribute significantly to both the creation and transmission of novel play behaviors within a group. Not unexpectedly, then, the complexity of dolphin play increases with the involvement of peers. As a result, the opportunity to observe and/or interact with other dolphin calves enhances the effects of play on the acquisition and maintenance of flexible problem solving skills, the emergence and strengthening of social and communicative competencies, and the establishment of social relationships. It seems that play may have evolved to help young dolphins learn to adapt to novel situations in both their physical and social worlds, the beneficial result being a set of abilities that increases the likelihood that an individual survives and reproduces.
Marks-Tarlow, Terry
2012-01-01
The author reviews the role of play within psychotherapy. She does not discuss the formal play therapy especially popular for young children, nor play from the Jungian perspective that encourages the use of the sand tray with adults. Instead, she focuses on the informal use of play during psychotherapy as it is orchestrated intuitively. Because…
Towards a playful organization ideal-type : Values of a playful organizational culture
Warmelink, H.J.G.
2011-01-01
Numerous organizations have embarked on playful endeavors such as serious gaming (playing games with a learning/training purpose) and ‘gamification’ (applying game technology and principles to make existing practices more game-like). One could consequently theorize about the dawn of playful or
Directory of Open Access Journals (Sweden)
María Jesús Muñoz Pardo
2010-05-01
RE-play is an educational project that applies the dialogical method of initiation into architectural design, while investigating the educational conditions of creative production / collaborative. This project completes the final leg of the course program 2009 on the subject of initiation to architectural design, called Design, Analysis and Architectural Conception II, School of Architecture of Madrid. RE-play proposes a conceptual update foundations of creative play, where the "as if ..." feature of the dynamics of the game, meaning and creates culture is redefined as a "play again", according to new dialogical logic, all with regard to the principles and values the paradigm of sustainability. To promote a sustainable culture change is a priority to a dialogical model of education. However, it is sufficient to exercise this model intramural academic institutions, but the communicative dynamics of these processes must be tested in specific social contexts, because learning is crucial in social interaction.
Playing with Mathematics: Play in Early Childhood as a Context for Mathematical Learning
Mathematics Education Research Group of Australasia, 2010
2010-01-01
Play is an essential part of young children's lives. This symposium highlights the integral role of play in young children's mathematics learning and examines the teacher's role in facilitating and extending this. Papers examine key tenets of play, contributing to theoretical understandings and presenting data on teacher's perceptions of play and…
Directory of Open Access Journals (Sweden)
Anabel Cardoso Raicik
2017-12-01
Full Text Available The existence and meaning of crucial experiments are issues that do not hold consensus in science and the philosophy of science. Duhem, Popper and Lakatos, for example, present antagonistic positions among themselves and even in relation to the idea of instantia crucis made explicit by Francis Bacon in the Novum Organum. This article aims at rescuing the Baconian definition, recognizing that it is part of a distinct philosophical position of contemporary theses, and discussing some conceptions of crucial experiment both by philosophers of science and by some scholars, such as Newton. Also, point out some reflections for the teaching of sciences.
Hinkley, Trina; Brown, Helen; Carson, Valerie; Teychenne, Megan
2018-01-01
Screen time and physical activity behaviours develop during the crucial early childhood period (0-5 years) and impact multiple health and developmental outcomes, including psychosocial wellbeing. Social skills, one component of psychosocial wellbeing, are vital for children's school readiness and future mental health. This study investigates potential associations of screen time and outdoor play (as a proxy for physical activity) with social skills. Cross sectional data were available for 575 mothers with a child (54% boys) aged 2-5 years. Mothers reported their child's screen time, outdoor play time and social skills (Adaptive Social Behavior Inventory; ASBI). Multiple linear regression analyses assessed associations of screen and outdoor play time (Model 1) and compliance with screen time and physical activity recommendations (Model 2) with three ASBI subscales. Boys and girls spent a mean of 2.0 and 2.2 hours per day in screen time, and 3.3 and 2.9 hours per day in outdoor play, respectively. Girls scores for express and comply skills were significantly higher than boys (p<0.005). After applying the Benjamini-Hochberg Procedure to adjust for multiple associations, children's television/DVD/video viewing was inversely associated with their compliant scores (B = -0.35 95% CI -0.26, -0.14; p = 0.001) and outdoor play time was positively associated with both expressive (B = 0.20 95% CI 0.07, 0.34; p = 0.004) and compliant (B = 0.22 95% CI 0.08, 0.36; p = 0.002) scores. Findings indicate that television/DVD/video viewing may be adversely, and outdoor play favourably, associated with preschool children's social skills. Future research is required to identify the direction of causation and explore potential mechanisms of association.
The Correlation of Playing Role-playing Games and Students' Reading Comprehension of Narrative Text
Putra, Praditya
2014-01-01
This research investigates the correlation of playing Role-Playing Games and students' reading comprehension of narrative text. Thirty (30) ninth grade students who play Role-Playing Games participated in this study. Their frequency in playing Role-Playing Games and their ability in reading comprehension of narrative text are analyzed by using correlation research design. Correlation research design was used in this study in order to find out the tendency of relation between students' frequen...
Wyn, Mark A.; Stegink, Steven J.
2000-01-01
Introduces a role playing activity that actively engages students in the learning process of mitosis. Students play either chromosomes carrying information, or cells in the cell membrane. (Contains 11 references.) (Author/YDS)
The Power of Outdoor Play and Play in Natural Environments
Kemple, Kristen M.; Oh, JiHyun; Kenney, Elizabeth; Smith-Bonahue, Tina
2016-01-01
Young children's outdoor play serves important and diverse purposes, including physical exercise and opportunities for growth in all developmental areas. Unfortunately, the amount of time that children spend engaged in unstructured, child-directed outdoor play has diminished significantly in the past generation. In this article, the authors…
Gold, Katharina; Grothues, Dirk; Leitzmann, Michael; Gruber, Hans; Melter, Michael
2012-01-01
The following article presents an overview of current research studies on play therapy in the hospital. It highlights individual diagnoses for which play therapy has shown reasonable success. The aim of this review is to describe the current status of the scientific debate on play therapy for sick children in order to allow conclusions regarding the indications for which play therapy is or might be useful.
Broad anti-HIV activity of the Oscillatoria agardhii agglutinin homologue lectin family.
Férir, Geoffrey; Huskens, Dana; Noppen, Sam; Koharudin, Leonardus M I; Gronenborn, Angela M; Schols, Dominique
2014-10-01
Oscillatoria agardhii agglutinin homologue (OAAH) proteins belong to a recently discovered lectin family. The founding member OAA and a designed hybrid OAAH (OPA) recognize similar but unique carbohydrate structures of Man-9, compared with other antiviral carbohydrate-binding agents (CBAs). These two newly described CBAs were evaluated for their inactivating properties on HIV replication and transmission and for their potential as microbicides. Various cellular assays were used to determine antiviral activity against wild-type and certain CBA-resistant HIV-1 strains: (i) free HIV virion infection in human T lymphoma cell lines and PBMCs; (ii) syncytium formation assay using persistently HIV-infected T cells and non-infected CD4+ T cells; (iii) DC-SIGN-mediated viral capture; and (iv) transmission to uninfected CD4+ T cells. OAA and OPA were also evaluated for their mitogenic properties and potential synergistic effects using other CBAs. OAA and OPA inhibit HIV replication, syncytium formation between HIV-1-infected and uninfected T cells, DC-SIGN-mediated HIV-1 capture and transmission to CD4+ target T cells, thereby rendering a variety of HIV-1 and HIV-2 clinical isolates non-infectious, independent of their coreceptor use. Both CBAs competitively inhibit the binding of the Manα(1-2)Man-specific 2G12 monoclonal antibody (mAb) as shown by flow cytometry and surface plasmon resonance analysis. The HIV-1 NL4.3(2G12res), NL4.3(MVNres) and IIIB(GRFTres) strains were equally inhibited as the wild-type HIV-1 strains by these CBAs. Combination studies indicate that OAA and OPA act synergistically with Hippeastrum hybrid agglutinin, 2G12 mAb and griffithsin (GRFT), with the exception of OPA/GRFT. OAA and OPA are unique CBAs with broad-spectrum anti-HIV activity; however, further optimization will be necessary for microbicidal application. © The Author 2014. Published by Oxford University Press on behalf of the British Society for Antimicrobial Chemotherapy. All rights
DEFF Research Database (Denmark)
Tosca, Susana; Marquez, Israel
2017-01-01
In this paper we introduce and describe the phenomenon of videogame street art as a specific kind of street art. We consider its materiality and significance, and conceptualize it in the light of a double manifestation of play: the playful appropriation of the city by the artist and the fact...... that street art encapsulates the act of playing videogames in a visual form. Digital play spills out of our computer screens and occupies the urban space with the explicit intention of involving spectators, who are invited to play in symbolic ways that actualize nostalgic memories of gaming and can be related...
Expressivity in Open-ended Constructive Play: Building and Playing Musical Lego Instruments
DEFF Research Database (Denmark)
Jakobsen, Kasper; Stougaard, Jeppe; Petersen, Marianne Graves
2016-01-01
This paper presents the findings from a case study in designing for open-ended constructive play for children. The study is based on a workshop where more that 150 children in ages 3-13 built and played their own musical instruments from Lego. The children used different sensors for playing...
DiBianca Fasoli, Allison
2014-01-01
A popular social discourse in the United States is that play is important for children's learning and that parental involvement maximizes play's learning potential. Past research has concluded that parents who hold this view of play are more likely to play with their children than those who do not. This study investigated the prevalence…
The Study Abroad Experience: A Crucial Element in Globalizing Business School Programs
Mangiero, George A.; Kraten, Michael
2011-01-01
Globalization is a fundamental reality of modern business practice. Participation in a study abroad program is a crucial element in helping students become well rounded global business leaders; it is an increasingly important element of a well rounded business curriculum. A semester or summer abroad, properly conceived and designed, can provide…
Facilitating play through communication: significance of teeth exposure in the gorilla play face.
Waller, Bridget M; Cherry, Lyndsay
2012-02-01
Primate facial expressions (FEs) likely play an important role in primate society: through facial signals, individuals can potentially send and receive information and may benefit from coordinating their behavior accordingly. Many primates use a relaxed open mouth (ROM) facial display or “play face” (PF) during play behavior, where the mouth is open but teeth are covered. In addition to this conventional PF, however, Western Lowland gorillas (Gorilla gorilla gorilla) also use a full PF where the upper teeth are exposed. As the teeth are similarly exposed in the bared-teeth expression (which is a signal of appeasement, submission and/or affiliation), the full PF may be a blend of the PF and bared-teeth face, and have a different signal function to the PF alone. Focal animal sampling of captive Western Lowland gorillas (N=10) showed that the full PF was more often observed in intense rather than gentle play, and intense play bouts that featured the full PF were longer than those that featured only the PF. Both expressions were associated with an increase in affinitive behavior between sender and receiver postplay, but only the full PF was associated with an increase higher than that of play alone. Overall, the findings suggest that the full PF has an additional role in coordinating and maintaining play, possibly though reducing uncertainty in the receiver and confirming that play is only play.
Playfulness, Imagination, and Creativity in Play with Toys: A Cultural-Historical Approach
Møller, Signe Juhl
2016-01-01
The aim of this article is to present a wholeness perspective on the relation between creative imagination and children's activity when playing with toys. This is explored through a case retrieved from a 4-month experimental research project, specifically from a social fantasy play session. In order to analyse and examine children's play, the…
Playing with the Multiple Intelligences: How Play Helps Them Grow
Eberle, Scott G.
2011-01-01
Howard Gardner first posited a list of "multiple intelligences" as a liberating alternative to the assumptions underlying traditional IQ testing in his widely read study "Frames of Mind" (1983). Play has appeared only in passing in Gardner's thinking about intelligence, however, even though play instructs and trains the verbal, interpersonal,…
... and Work Teachers' Questionnaire Malaria Play the Mosquito Game Play the Parasite Game About the games Malaria is one of the world's most common ... last will in Paris. Play the Blood Typing Game Try to save some patients and learn about ...
DEFF Research Database (Denmark)
Hammar, Emil
Through the theories of play by Gadamer (2004) and Henricks (2006), I will show how the relationship between play and game can be understood as dialectic and disruptive, thus challenging understandings of how the procedures of games determine player activity and vice versa. As such, I posit some...... analytical consequences for understandings of digital games as procedurally fixed (Boghost, 2006; Flannagan, 2009; Bathwaite & Sharp, 2010). That is, if digital games are argued to be procedurally fixed and if play is an appropriative and dialectic activity, then it could be argued that the latter affects...... and alters the former, and vice versa. Consequently, if the appointed procedures of a game are no longer fixed and rigid in their conveyance of meaning, qua the appropriative and dissolving nature of play, then understandings of games as conveying a fixed meaning through their procedures are inadequate...
DEFF Research Database (Denmark)
Hammar, Emil
This paper aims to identify an understanding of digital games in virtual environments by using Don Ihde’s (1990) postphenomenological approach to how technology mediates the world to human beings in conjunction with Hans-Georg Gadamer’s (1993) notion of play . Through this tentatively proposed am...... amalgamation of theories I point towards an alternative understanding of the relationship between play and game as not only dialectic, but also as socially and ethically relevant qua the design and implementation of the game as technology....
Playing Against the Modern World? : Role-Playing Games in Late Modernity
Harding, Tobias
2010-01-01
Playing Reality is an anthology of articles on live role-playing, a new art from where the Nordic countries are at the front edge. This book covers a wide range of topics and genres, from practical advice, historical reviews and visions of possible futures to semiotic and philosophical analysis. They Show some of the diversity of participatory arts, and will thus be of interest for anyone in the fields of art, education or performance. It wouldn't be misleading to claim that live role-playing...
Pollination induces autophagy in petunia petals via ethylene.
Shibuya, Kenichi; Niki, Tomoko; Ichimura, Kazuo
2013-02-01
Autophagy is one of the main mechanisms of degradation and remobilization of macromolecules, and it appears to play an important role in petal senescence. However, little is known about the regulatory mechanisms of autophagy in petal senescence. Autophagic processes were observed by electron microscopy and monodansylcadaverine staining of senescing petals of petunia (Petunia hybrida); autophagy-related gene 8 (ATG8) homologues were isolated from petunia and the regulation of expression was analysed. Nutrient remobilization was also examined during pollination-induced petal senescence. Active autophagic processes were observed in the mesophyll cells of senescing petunia petals. Pollination induced the expression of PhATG8 homologues and was accompanied by an increase in ethylene production. Ethylene inhibitor treatment in pollinated flowers delayed the induction of PhATG8 homologues, and ethylene treatment rapidly upregulated PhATG8 homologues in petunia petals. Dry weight and nitrogen content were decreased in the petals and increased in the ovaries after pollination in detached flowers. These results indicated that pollination induces autophagy and that ethylene is a key regulator of autophagy in petal senescence of petunia. The data also demonstrated the translocation of nutrients from the petals to the ovaries during pollination-induced petal senescence.
Ramsey, Gaynor
1978-01-01
Play your part is a collection of then situations in which students have to take on the roles of particular people and express their opinions, feelings or arguments about the situation. Play your part is intended for use with advanced students of English.
Penerapan Metode Role Playing Dalam Meningkatkan Motivasi Belajar Anak Usia Play Group
Directory of Open Access Journals (Sweden)
Dwi Anita Alfiani
2015-06-01
Full Text Available AbstrakSalah satu faktor penting dalam kegiatan belajar (KBM untuk anak usia play group adalah guru yang memahami berbagai macam karakterisik peserta didik dan peduli terhadap kebutuhan anak didiknya.Namun Dari hasil penelitian dan kenyataan di lapangan, menunjukkan bahwa pelaksanaan kegiatan belajar mengajar (KBM untuk anak-anak usia play group masih banyak kelemahan dan kekurangannya karenanya guru juga harus mampu menguasai teknik dan metode dalam mengajar B untuk anak.Anak didik pada usia play group.Dengan demikian, metode pembelajaran merupakan alat untuk menciptakan proses belajar mengajar.Subana dan Sunarti (2000 : 20 Berpendapat metode adalah rencana penyajian bahan yang menyeluruh dengan urutan yang sistematis berdasarkan approach tertentu. Jadi metode merupakan cara melaksanakan pekerjaan, sedangkan approach, dapat tumbuh beberapan metode. Role Playing adalah suatu cara penguasaan bahan-bahan pelajaran melalui pengembangan imajinasi dan penghayatan siswa. Pengembangan imajinasi dan penghayatan dilakukan siswa dengan memerankannya sebagai tokoh hidup atau benda mati. Permainan ini pada umumnya dilakukan lebih dari satu orang, hal itu bergantung kepada apa yang diperankan.Role Playing yakni memainkan peranan dari peran-peran yang sudah pasti berdasarkan kejadian terdahulu, yang dimaksudkan untuk menciptakan kembali situasi sejarah/peristiwa masa lalu, menciptakan kemungkinan-kemungkinan kejadian masa yang akan datang, menciptakan peristiwa mutakhir yang dapat diperkaya atau mengkhayal situasi pada suatu tempat dan atau waktu tertentu. berarti metode (Role Playing adalah metode pembelajaran yang di dalamnya menampakkan adanya perilaku pura-pura dari siswa yang terlihat dan atau peniruan situasi dari tokoh-tokoh sejarah sedemikian rupa. Dengan demikian metode Bermain Peran (RolePlayingadalah metode yang melibatkan siswa untuk pura-pura memainkan peran/ tokoh yang terlibat dalam proses sejarah. Teknik ini juga digunakan untuk dapat
Crucial role of strategy updating for coexistence of strategies in interaction networks
Zhang, Jianlei; Zhang, Chunyan; Cao, Ming; Weissing, Franz J.
2015-04-01
Network models are useful tools for studying the dynamics of social interactions in a structured population. After a round of interactions with the players in their local neighborhood, players update their strategy based on the comparison of their own payoff with the payoff of one of their neighbors. Here we show that the assumptions made on strategy updating are of crucial importance for the strategy dynamics. In the first step, we demonstrate that seemingly small deviations from the standard assumptions on updating have major implications for the evolutionary outcome of two cooperation games: cooperation can more easily persist in a Prisoner's Dilemma game, while it can go more easily extinct in a Snowdrift game. To explain these outcomes, we develop a general model for the updating of states in a network that allows us to derive conditions for the steady-state coexistence of states (or strategies). The analysis reveals that coexistence crucially depends on the number of agents consulted for updating. We conclude that updating rules are as important for evolution on a network as network structure and the nature of the interaction.
DEFF Research Database (Denmark)
Froes, Isabel Cristina G.; Walker, Kevin
2011-01-01
Play is a key element in cultural development, according to the Dutch historian Johan Huizinga. Nowadays many of us interact with other people in online games and social networks, through multiple digital devices. But harnessing playful activities for museum learning is mostly undeveloped. In thi...
Giesbrecht, Sheila
2012-01-01
Play is important. Environmental educators Sobel and Louv write about the relationship between children and outside play and suggest that early transcendental experiences within nature allow children to develop empathetic orientations towards the natural world. Children who play out-of-doors develop an appreciation for the environment and…
THE NONLINEAR TRAJECTORY OF CHANGE IN PLAY PROFILES OF THREE CHILDREN IN PSYCHODYNAMIC PLAY THERAPY
Directory of Open Access Journals (Sweden)
Sibel Halfon
2016-10-01
Full Text Available Aim: Even though there is substantial evidence that play based therapies produce significant change, the specific play processes in treatment remain unexamined. For that purpose, processes of change in long-term psychodynamic play therapy are assessed through a repeated systematic assessment of three children’s Play Profiles, which reflect patterns of organization among play variables that contribute to play activity in therapy, indicative of the children’s coping strategies, and an expression of their internal world. The main aims of the study are to investigate the kinds of Play Profiles expressed in treatment, and to test whether there is emergence of new and more adaptive Play Profiles using dynamic systems theory as a methodological framework.Methods and Procedures: Each session from the long-term psychodynamic treatment (mean number of sessions = 55 of three 6 year old good outcome cases presenting with Separation Anxiety were recorded, transcribed and coded using items from the Children's Play Therapy Instrument, created to assess the play activity of children in psychotherapy, generating discrete and measurable units of play activity arranged along a continuum of four play profiles: Adaptive, Inhibited, Impulsive, and Disorganized. The play profiles were clustered through K-means Algorithm, generating 7 discrete states characterizing the course of treatment and the transitions between these states were analyzed by Markov Transition Matrix, Recurrence Quantification Analysis (RQA and odds ratios comparing the first and second halves of psychotherapy.Results: The Markov Transitions between the states scaled almost perfectly and also showed the ergodicity of the system meaning that the child can reach any state or shift to another one in play. The RQA and odds ratios showed two trends of change, first concerning the decrease in the use of less adaptive strategies, second regarding the reduction of play interruptions.Conclusions: The
The SMC5/6 complex is involved in crucial processes during human spermatogenesis
Verver, Dideke E.; Langedijk, Nathalia S. M.; Jordan, Philip W.; Repping, Sjoerd; Hamer, Geert
2014-01-01
Genome integrity is crucial for safe reproduction. Therefore, chromatin structure and dynamics should be tightly regulated during germ cell development. Chromatin structure and function are in large part determined by the structural maintenance of chromosomes (SMC) protein complexes, of which SMC5/6
Shao, Chung-Ping; Hor, Lien-I
2001-01-01
Expression of the Vibrio vulnificus metalloprotease gene, vvp, was turned up rapidly when bacterial growth reached the late log phase. A similar pattern of expression has been found in the metalloprotease gene of Vibrio cholerae, and this has been shown to be regulated by a Vibrio harveyi LuxR-like transcriptional activator. To find out whether a LuxR homologue exists in V. vulnificus, a gene library of this organism was screened by colony hybridization using a probe derived from a sequence that is conserved in various luxR-like genes of vibrios. A gene containing a 618-bp open reading frame was identified and found to be identical to the smcR gene of V. vulnificus reported previously. An isogenic SmcR-deficient (RD) mutant was further constructed by an in vivo allelic exchange technique. This mutant exhibited an extremely low level of vvp transcription compared with that of the parent strain. On the other hand, the cytolysin gene, vvhA, was expressed at a higher level in the RD mutant than in the parent strain during the log phase of growth. These data suggested that SmcR might not only be a positive regulator of the protease gene but might also be involved in negative regulation of the cytolysin gene. Virulence of the RD mutant in either normal or iron-overloaded mice challenged by intraperitoneal injection was comparable to that of the parent strain, indicating that SmcR is not required for V. vulnificus virulence in mice. PMID:11157950
Development and mapping of SSR markers linked to resistance-gene homologue clusters in common bean
Institute of Scientific and Technical Information of China (English)
Luz; Nayibe; Garzon; Matthew; Wohlgemuth; Blair
2014-01-01
Common bean is an important but often a disease-susceptible legume crop of temperate,subtropical and tropical regions worldwide. The crop is affected by bacterial, fungal and viral pathogens. The strategy of resistance-gene homologue(RGH) cloning has proven to be an efficient tool for identifying markers and R(resistance) genes associated with resistances to diseases. Microsatellite or SSR markers can be identified by physical association with RGH clones on large-insert DNA clones such as bacterial artificial chromosomes(BACs). Our objectives in this work were to identify RGH-SSR in a BAC library from the Andean genotype G19833 and to test and map any polymorphic markers to identify associations with known positions of disease resistance genes. We developed a set of specific probes designed for clades of common bean RGH genes and then identified positive BAC clones and developed microsatellites from BACs having SSR loci in their end sequences. A total of 629 new RGH-SSRs were identified and named BMr(bean microsatellite RGH-associated markers). A subset of these markers was screened for detecting polymorphism in the genetic mapping population DOR364 × G19833. A genetic map was constructed with a total of 264 markers,among which were 80 RGH loci anchored to single-copy RFLP and SSR markers. Clusters of RGH-SSRs were observed on most of the linkage groups of common bean and in positions associated with R-genes and QTL. The use of these new markers to select for disease resistance is discussed.
Play and Productivity: Enhancing the Creative Climate at Workplace Meetings with Play Cues
West, Samuel E.; Hoff, Eva; Carlsson, Ingegerd
2016-01-01
The authors investigate the links between playfulness and creative organizational climates established by other research, using play cues--objects and sweets--they provide participants halfway through workplace meetings. Their findings suggest such cues significantly enhance the creative climate and playfulness in workplace meetings without…
Božović Ratko R.
2008-01-01
Free time and play are mutually dependent categories that are always realized together. We either play because we have free time or we have free time because we play (E. Fink). Play, no matter whether it is children's or artistic play or a spontaneous sports game (excluding professional sports) most fully complements human existence and thereby realizes free time as a time in freedom and freedom of time. Therefore, free time exists and is most prominent in play. Moreover, one game releases it...
DEFF Research Database (Denmark)
Marchetti, Emanuela; Petersson, Eva
2011-01-01
What does it mean to design a playful learning tool? What is needed for a learning tool to be perceived by potential users as playful? These questions emerged reflecting on a Participatory Design process aimed at enhancing museum-learning practice from the perspective of primary school children...
Reelsen, Alexander
2015-01-01
This book is aimed at advanced developers who are looking to harness the power of Play 2.x. This book will also be useful for professionals looking to dive deeper into web development. Play 2 .x is an excellent framework to accelerate your learning of advanced topics.
A new vesicle trafficking regulator CTL1 plays a crucial role in ion homeostasis.
Gao, Yi-Qun; Chen, Jiu-Geng; Chen, Zi-Ru; An, Dong; Lv, Qiao-Yan; Han, Mei-Ling; Wang, Ya-Ling; Salt, David E; Chao, Dai-Yin
2017-12-01
Ion homeostasis is essential for plant growth and environmental adaptation, and maintaining ion homeostasis requires the precise regulation of various ion transporters, as well as correct root patterning. However, the mechanisms underlying these processes remain largely elusive. Here, we reported that a choline transporter gene, CTL1, controls ionome homeostasis by regulating the secretory trafficking of proteins required for plasmodesmata (PD) development, as well as the transport of some ion transporters. Map-based cloning studies revealed that CTL1 mutations alter the ion profile of Arabidopsis thaliana. We found that the phenotypes associated with these mutations are caused by a combination of PD defects and ion transporter misregulation. We also established that CTL1 is involved in regulating vesicle trafficking and is thus required for the trafficking of proteins essential for ion transport and PD development. Characterizing choline transporter-like 1 (CTL1) as a new regulator of protein sorting may enable researchers to understand not only ion homeostasis in plants but also vesicle trafficking in general.
TLR4 plays a crucial role in MSC-induced inhibition of NK cell function
Energy Technology Data Exchange (ETDEWEB)
Lu, Ying [No. 307 Hospital of the Chinese People' s Liberation Army, Beijing (China); Liu, Jin; Liu, Yang; Qin, Yaru [Beijing Institute of Radiation Medicine, Beijing (China); Luo, Qun [No. 307 Hospital of the Chinese People' s Liberation Army, Beijing (China); Wang, Quanli, E-mail: 13691110351@163.com [No. 307 Hospital of the Chinese People' s Liberation Army, Beijing (China); Duan, Haifeng, E-mail: duanhf0720@163.com [Beijing Institute of Radiation Medicine, Beijing (China)
2015-08-21
Mesenchymal stem cells (MSC) are a kind of stromal cell within the tumor microenvironment. In our research, MSC derived from acute myeloid leukemia patients' bone marrow (AML-MSC) and lung cancer tissues (LC-MSC) as well as normal bone marrow-derived MSC (BM-MSC) cultured in conditioned medium of HeLa cells were found to have higher expressions of Toll-like receptor (TLR4) mRNA compared with BM-MSC. The sorted TLR4-positive MSC (TLR4+ MSC) differed in cytokine (interleukin-6, interleukin-8, and monocyte chemoattractant protein-1) secretion from those of unsorted MSC. MSC was reported to inhibit natural killer (NK) cell proliferation and function. In this research, we confirmed that TLR4+ MSC aggravate this suppression. Furthermore, when TLR4 in the sorted cells were stimulated by LPS or following blocked by antibody, the suppression on NK cell proliferation and cytotoxicity were more intensive or recovered respectively. Compared to unsorted MSC, NKG2D receptor expression on NK cells were also inhibited by TLR4+ MSC. These findings suggest that activation of TLR4 pathway is important for TLR4+ MSC and MSC to obstruct anti-tumor immunity by inhibiting NK cell function, which may provide a potential stroma-targeted tumor therapy. - Highlights: • TLR4+ MSC inhibit NK cell proliferation in vivo and in vitro. • TLR4+ MSC inhibit NKG2D expression on NK cells and NK cell cytotoxicity. • The distinguished cytokine expression of TLR4+ MSC may contribute to the inhibition on NK cell function.
Takikawa, Hirohide
2012-01-01
After the demise of the social contract theory, the argument from fair play, which employs the principle of fair play, has been widely acknowledged as one of the most promising ways of justifying political obligation. First, I articulate the most promising version of the principle of fair play. Then, I show that free riders play fair, that is, that their moral fault lies not in unfairness but in the violation of a rule by appealing to the example of three-in-a-boat. Finally, I conclude that e...
Anion exchange behaviour of Zr, Hf, Nb, Ta and Pa as homologues of RF and Db in fluoride medium
International Nuclear Information System (INIS)
Monroy G, F.; Trubert, D.; Brillard, L.; Hussonnois, M.; Constantinescu, O.; Le Naour, C.
2010-01-01
Studies of the chemical property of trans actinide elements are very difficult due to their short half-lives and extremely small production yields. However it is still possible to obtain considerable information about their chemical properties, such as the most stable oxidation states in aqueous solution, complexing ability, etc., comparing their behaviour with their lighter homologous in the periodic table. In order to obtain a better knowledge of the behaviour of rutherfordium, RF (element 104), dub nium, Db (element 105) in HF medium, the sorption properties of Zr, Hf, Nb, Ta an Pa, homologues of RF and Db, were studied in NH 4 F/HClO 4 medium in this work. Stability constants of the fluoride complexes of these elements were experimentally obtained from K d obtained at different F - and H + concentrations. The anionic complexes: [Zr(Hf)F 5 ] - , [Zr(Hf)F 6 ] 2- , [Zr(Hf)F 7 ] 3- , [Ta(Pa)F 6 ] - , [Ta(Pa)F 7 ] 2- , [Ta(Pa)F 8 ] 3- , [NbOF 4 ] - and [NbOF 5 ] 2- are present as predominant species in the HF range over investigation. (Author)
Shibanaka, Y; Hayashi, H; Okada, N; Fujita, N
1991-10-31
The signal transduction of the peptide, eclosion hormone, in the silkworm Bombyx mori appears to be mediated via the second messenger cyclic GMP throughout their life cycle. Injection of 8-bromo-cGMP induced the ecdysis behavior in pharate adults with similar latency to eclosion hormone-induced ecdysis; the moulting occurred 50-70 min after the injection. The potency of 8Br-cGMP was 10(2) fold higher than that of cGMP and the efficacy was increased by the co-injection of the phosphodiesterase inhibitor IBMX. On the other hand, in the silkworm pupal ecdysis the eclosion hormone and also 8Br-cGMP induced the moulting behavior in a dose-dependent manner. The adult development of the ability to respond to 8Br-cGMP took place concomitantly with the response to the eclosion hormone. Both the developmental time courses were shifted by a shift of light and dark cycles. Accordingly, the sensitivities to the peptide and cyclic nucleotide developed correspondently under the light and dark circadian rhythm. Thus throughout the silkworm life cycle, eclosion hormone is effective to trigger the ecdysis behavior and cGMP plays a crucial role as the second messenger in the eclosion hormone-mediated signal transduction.
Bradshaw, John W S; Pullen, Anne J; Rooney, Nicola J
2015-01-01
Among the Carnivora, play behaviour is usually made up of motor patterns characteristic of predatory, agonistic and courtship behaviour. Domestic dogs are unusual in that play is routinely performed by adults, both socially, with conspecifics and with humans, and also asocially, with objects. This enhanced playfulness is commonly thought to be a side effect of paedomorphosis, the perpetuation of juvenile traits into adulthood, but here we suggest that the functions of the different types of play are sufficiently distinct that they are unlikely to have arisen through a single evolutionary mechanism. Solitary play with objects appears to be derived from predatory behaviour: preferred toys are those that can be dismembered, and a complex habituation-like feedback system inhibits play with objects that are resistant to alteration. Intraspecific social play is structurally different from interspecific play and may therefore be motivationally distinct and serve different goals; for example, dogs often compete over objects when playing with other dogs, but are usually more cooperative when the play partner is human. The majority of dogs do not seem to regard competitive games played with a human partner as "dominance" contests: rather, winning possession of objects during games appears to be simply rewarding. Play may be an important factor in sociality, since dogs are capable of extracting social information not only from games in which they participate, but also from games that they observe between third parties. We suggest that the domestic dog's characteristic playfulness in social contexts is an adaptive trait, selected during domestication to facilitate both training for specific purposes, and the formation of emotionally-based bonds between dog and owner. Play frequency and form may therefore be an indicator of the quality of dog-owner relationships. Copyright © 2014 Elsevier B.V. All rights reserved.
Smyth, Joshua M
2007-10-01
There is burgeoning interest in the study of video games. Existing work is limited by the use of correlational designs and is thus unable to make causal inferences or remove self-selection biases from observed results. The recent development of online, socially integrated video games (massively multiplayer online role-playing games [MMORPGs]) has created a new experience for gamers. This randomized, longitudinal study examined the effects of being assigned to play different video game types on game usage, health, well-being, sleep, socializing, and academics. One hundred 18- to 20-year-old participants (73% male; 68% Caucasian) were randomly assigned to play arcade, console, solo computer, or MMORPG games for 1 month. The MMORPG group differed significantly from other groups after 1 month, reporting more hours spent playing, worse health, worse sleep quality, and greater interference in "real-life" socializing and academic work. In contrast, this group also reported greater enjoyment in playing, greater interest in continuing to play, and greater acquisition of new friendships. MMORPGs represent a different gaming experience with different consequences than other types of video games and appear to pose both unique risks and benefits from their use.
Wood, Richard T A; Griffiths, Mark D
2015-12-01
This study is one of the first to explore in detail the behaviors, attitudes and motivations of players that show no signs of at-risk or problem gambling behavior (so-called 'positive players'). Via an online survey, 1484 positive players were compared with 209 problem players identified using the Lie/Bet screen. The study identified two distinct groups of positive players defined according to their motivations to play and their engagement with responsible gambling (RG) practices. Those positive players that played most frequently employed the most personal RG strategies. Reasons that positive players gave for gambling were focused on leisure (e.g., playing for fun, being entertained, and/or winning a prize). By contrast, problem gamblers were much more focused upon modifying mood states (e.g., excitement, relaxation, depression and playing when bored or upset). The present study also suggests that online gambling is not, by default, inherently riskier than gambling in more traditional ways, as online gambling was the most popular media by which positive players gambled. Furthermore, most positive players reported that it was easier to stick to their limits when playing the National Lottery online compared to traditional retail purchasing of tickets. Problem players were significantly more likely than positive players to gamble with family and friends, suggesting that, contrary to a popular RG message, social play may not be inherently safer than gambling alone. It is proposed that players (generally) may identify more with the term 'positive play' than the term 'RG' which is frequently interpreted as being aimed at people with gambling problems, rather than all players.
The "State of Play" in Australia: Early Childhood Educators and Play-Based Learning
Sumsion, Jennifer; Grieshaber, Sue; McArdle, Felicity; Shield, Paul
2014-01-01
This article provides an overview of the Education Meets Play study that will investigate early childhood educators' use of play-based learning, now mandatory under the "National Quality Standard". By building on what can be gleaned about educators' approaches to play-based learning prior to the implementation of the "Early Years…
Directory of Open Access Journals (Sweden)
Kristina Horback
2014-05-01
Full Text Available The predominant method of measuring welfare in swine focuses on overt physical ailments, such as skin lesions, lameness, and body condition. An alternative metric for assessing welfare in swine can be to measure the frequency and duration of positive behavioral states, such as play. Given that play occurs only when an animal's primary needs (food, comfort, safety, etc. have been satisfied, it has been suggested that play may be a sensitive indicator for assessing the welfare of non-human animals. Play has primarily been described in young piglets and is assessed via the occurrence of specific play markers. These play markers include overt bursts of energy like scamper, or more subtle social behaviors like nose-to-body contact. This review describes four areas of play for swine: locomotor, object, sow-piglet, and, peer play. From sporadic leaping to combative wrestling, play behavior allows for the fine-tuning of reflexive behavior which can enhance physical development, enrich cognitive abilities, and facilitate the maintenance of social bonds.
DEFF Research Database (Denmark)
Karoff, Helle Skovbjerg
2008-01-01
and the Danish University of Education (among others) have been working with different kind of products, all referred to as PlAYWARE. Playware combines modern technology and knowledge about play culture in order to produce playful experiences for its players. This paper will exemplify how the concept of play can...... from one generation to the next. Because older children are no longer present as younger children grow up, the traditional "cultural leaders" are gone. They have taken with them much of the inspiration for play as well as important knowledge about how to organise a game. In that sense we can say...
The therapeutic power of play: examining the play of young children with leukaemia.
Gariépy, N; Howe, N
2003-11-01
The therapeutic function of play has been investigated in relation to recognized stressors such as hospitalization, illness and medical treatments for ill children. While medical treatments in the past 30 years have improved survival rates, children's psychological experiences and quality of life during and after their illness have received limited attention. The present study investigated the therapeutic effects of play on 3- to 5-year-old children with leukaemia compared with a control group of healthy children. The participants with leukaemia (n = 11) were from the external oncology clinic of an urban children's hospital; control children (n = 11) attended a day care centre. Measures included children's experience of stress, social and cognitive play behaviours, and daily mood. A series of manova revealed that the children with leukaemia, compared with the control children, engaged in (a) significantly fewer total play behaviours, and in particular less (b) parallel, (c) group and (d) dramatic play. Pearson correlations revealed significant relationships between reports of 'being happy' and play only for children with leukaemia. Quantitative and qualitative analyses revealed a pattern of repetitive play activities week after week for children with leukaemia, but not controls. Findings are discussed in light of the theoretical and practical implications for children undergoing treatment for leukaemia.
Comment on a proposed ''crucial experiment'' to test Einstein's special theory of relativity
Energy Technology Data Exchange (ETDEWEB)
Rodrigues, Jr, W A [Universidade Estadual de Campinas (Brazil); Buonamano, V [Universidade Estadual de Campinas (Brazil). Instituto de Matematica
1976-08-11
A proposed ''crucial experiment'' to test Einstein's special theory of relativity is analysed and it is shown that it falls into the set of unsatisfactory proposals that attempt to make an experimental distinction between Einstein's special theory of relativity and a ''Lorentzian type'' special theory of relativity.
Play to Learn, Learn to Play: Language Learning through Gaming Culture
Ryu, Dongwan
2013-01-01
Many researchers have investigated learning through playing games. However, after playing games, players often go online to establish and participate in the online community where they enrich their game experiences, discuss game-related issues, and create fan-fictions, screenshots, or scenarios. Although these emerging activities are an essential…
Taking Play Seriously: Children and Play in Early Childhood Education--An Exciting Challenge
Lillemyr, Ole Fredrik
2009-01-01
In the book the author presents from different perspectives what is understood by the phenomenon of children's play, why it is important, and how children's play challenge and stimulate the educator or caregiver in regard of educational values and practice, with the conclusion: play has to be taken seriously. A selection of theories is introduced…
Playing with Technology: Mother-Toddler Interaction Scores Lower during Play with Electronic Toys
Wooldridge, Michaela B.; Shapka, Jennifer
2012-01-01
To investigate play with electronic toys (battery-operated or digital), 25 mother-toddler (16-24 months old) dyads were videotaped in their homes playing with sets of age-appropriate electronic and non-electronic toys for approximately 10 min each. Parent-child interactions were coded from recorded segments of both of the play conditions using the…
Mangan, Marianne
2013-01-01
Call it physical activity, call it games, or call it play. Whatever its name, it's a place we all need to return to. In the physical education, recreation, and dance professions, we need to redesign programs to address the need for and want of play that is inherent in all of us.
Pedagogical Positioning in Play--Teachers Being inside and outside of Children's Imaginary Play
Fleer, Marilyn
2015-01-01
Although there is a long tradition of play pedagogy in early childhood education, teachers have mostly taken a passive role in children's play. There are relatively few studies of the pedagogical roles adults take from inside of children's imaginary play. This paper seeks to fill this gap through presenting the findings of a study where the play…
"Prey Play": Learning about Predators and Prey through an Interactive, Role-Play Game
Deaton, Cynthia C. M.; Dodd, Kristen; Drennon, Katherine; Nagle, Jack
2012-01-01
"Prey Play" is an interactive role-play activity that provides fifth-grade students with opportunities to examine predator-prey interactions. This four-part, role-play activity allows students to take on the role of a predator and prey as they reflect on the behaviors animals exhibit as they collect food and interact with one another, as well as…
Partners in Play: An Adlerian Approach to Play Therapy. Second Edition.
Kottman, Terry
This handbook gives step-by-step instruction on using play therapy with children in school and private practice settings. The second edition builds on the fundamental instruction of the first edition and supplies play therapists with the necessary tools to strengthen therapeutic work with children-- especially those with problematic attitudes--…
Playful Learning and Montessori Education
Lillard, Angeline S.
2013-01-01
Although Montessori education is often considered a form of playful learning, Maria Montessori herself spoke negatively about a major component of playful learning--pretend play, or fantasy--for young children. In this essay, the author discusses this apparent contradiction: how and why Montessori education includes elements of playful learning…
DEFF Research Database (Denmark)
Pichlmair, Martin; Mech, Lena; Sicart, Miguel Angel
2017-01-01
This paper is concerned with designing for immediate play, the experience that a player has when joining a game designed for being played without particular preparation. Museum games, urban games, casual sports, and ad-hoc multiplayer video games are kinds of games that facilitate immediate play...... offer using examples and expert opinions. While most practices and game examples mentioned in this paper are from non-digital games, a special focus is put on the role of technology in immediately playable experiences. Still, the examined design dimensions are independent of the technological foundation...... of the game. This paper provides a starting point for designing better immediate play situations....
Enhanced reality live role playing
Söderberg, Jonas; Waern, Annika; Åkesson, Karl-Petter; Björk, Staffan; Falk, Jennica
2004-01-01
Live role-playing is a form of improvisational theatre played for the experience of the performers and without an audience. These games form a challenging application domain for ubiquitous technology. We discuss the design options for enhanced reality live role-playing and the role of technology in live role-playing games.
Evolution and functional analysis of the Pif97 gene of the Pacific oyster Crassostrea gigas
Directory of Open Access Journals (Sweden)
Xiaotong WANG, Xiaorui SONG, Tong WANG, Qihui ZHU, Guoying MIAO, Yuanxin CHEN, Xiaodong FANG, Huayong QUE, Li LI, Guofan ZHANG
2013-02-01
Full Text Available Mollusc shell matrix proteins (SMPs are important functional components embedded in the shell and play a role in shell formation. A SMP (Pif177 was identified previously from the nacreous layer of the Japanese pearl oyster Pinctada fucata, and its cleavage products (named pfPif97 and pfPif80 proteins were found to bind to the chitin framework and induce aragonite crystal formation and orient the c axis. In this study, a homologue of pfPif177 was cloned from the mantle of the Pacific oyster Crassostrea gigas, containing the homologue of pfPif97 only and not pfPif80. This finding hints at the large divergence in gene structure between the two species. This homologue (cgPif97 shares characteristics with pfPif97, and suggests that the biological functions of these two proteins may be similar. The expression pattern of cgPif97 in different tissues and development stages indicates that it may play an important role in shell formation of the adult oyster. The morphology of the inner shell surface was affected by injected siRNA of cgPif97 and the calcite laths of the shell became thinner and narrower when the siRNA dose increased, suggesting that the cgPif97 gene plays an important role in calcite shell formation in C. gigas. In conclusion, we found evidence that the Pif177 gene evolved very fast but still retains a similar function among species [Current Zoology 59 (1: 109–115, 2013].
Burrows, J.; Johnson, V.; Henckel, D.
2016-01-01
Work Hard / Play Hard was a participatory performance/workshop or CPD experience hosted by interdisciplinary arts atelier WeAreCodeX, in association with AntiUniversity.org. As a socially/economically engaged arts practice, Work Hard / Play Hard challenged employees/players to get playful, or go to work. 'The game changes you, you never change the game'. Employee PLAYER A 'The faster the better.' Employer PLAYER B
The Upside of Videogame Playing.
Jackson, Linda A
2012-12-01
In our research on the relationship between videogame playing and cognitive outcomes we found that children (n=481, 12 year olds) who played videogames more were more creative than those who played them less. Here we summarize these findings and propose new research to identify mediating cognitive factors influenced by videogame playing.
Cognitive simplicity and self-deception are crucial in martyrdom and suicide terrorism.
Fink, Bernhard; Trivers, Robert
2014-08-01
Suicide attacks and terrorism are characterized by cognitive simplicity, which is related to self-deception. In justifying violence in pursuit of ideologically and/or politically driven commitment, people with high religious commitment may be particularly prone to mechanisms of self-deception. Related megalomania and glorious self-perception are typical of self-deception, and are thus crucial in the emergence and expression of (suicide) terrorism.
Play Therapy in Elementary Schools
Landreth, Garry L.; Ray, Dee C.; Bratton, Sue C.
2009-01-01
Because the child's world is a world of action and activity, play therapy provides the psychologist in elementary-school settings with an opportunity to enter the child's world. In the play therapy relationship, toys are like the child's words and play is the child's language. Therefore, children play out their problems, experiences, concerns, and…
HIPK1 interacts with c-Myb and modulates its activity through phosphorylation
International Nuclear Information System (INIS)
Matre, Vilborg; Nordgard, Oddmund; Alm-Kristiansen, Anne Hege; Ledsaak, Marit; Gabrielsen, Odd Stokke
2009-01-01
The transcription factor v-Myb is a potent inducer of myeloid leukaemias, and its cellular homologue c-Myb plays a crucial role in the regulation of haematopoiesis. In a yeast two-hybrid (Y2H) screening we identified the nuclear kinase HIPK1 as an interaction partner for human c-Myb. The interaction involves a C-terminal region of HIPK1, while a bipartite interaction surface was identified in c-Myb, including regions in its N-terminal DNA-binding domain as well as in its C-terminal region. HIPK1 and c-Myb co-localize in distinct nuclear foci upon co-transfection. c-Myb appears to be phosphorylated by HIPK1 in its negative regulatory domain as supported by both in vivo and in vitro data. A functional assay revealed that HIPK1 repressed the ability of c-Myb to activate a chromatin embedded target gene, mim-1, in haematopoetic cells. Our findings point to a novel link between an important kinase and a key regulator of haematopoiesis.
Pretending to Play or Playing to Pretend: The Case of Autism
Kasari, Connie; Chang, Ya-Chih; Patterson, Stephanie
2013-01-01
An article by Angeline S. Lillard and others published in the January 2013 issue of "Psychological Bulletin" about the impact of pretend play on child development raised a number of issues about play studies and child psychology. The article claimed that, contrary to current theories on the subject, the evidence of many studies does not…
Halfon, Sibel; Çavdar, Alev; Orsucci, Franco; Schiepek, Gunter K; Andreassi, Silvia; Giuliani, Alessandro; de Felice, Giulio
2016-01-01
Aim: Even though there is substantial evidence that play based therapies produce significant change, the specific play processes in treatment remain unexamined. For that purpose, processes of change in long-term psychodynamic play therapy are assessed through a repeated systematic assessment of three children's "play profiles," which reflect patterns of organization among play variables that contribute to play activity in therapy, indicative of the children's coping strategies, and an expression of their internal world. The main aims of the study are to investigate the kinds of play profiles expressed in treatment, and to test whether there is emergence of new and more adaptive play profiles using dynamic systems theory as a methodological framework. Methods and Procedures: Each session from the long-term psychodynamic treatment (mean number of sessions = 55) of three 6-year-old good outcome cases presenting with Separation Anxiety were recorded, transcribed and coded using items from the Children's Play Therapy Instrument (CPTI), created to assess the play activity of children in psychotherapy, generating discrete and measurable units of play activity arranged along a continuum of four play profiles: "Adaptive," "Inhibited," "Impulsive," and "Disorganized." The play profiles were clustered through K -means Algorithm, generating seven discrete states characterizing the course of treatment and the transitions between these states were analyzed by Markov Transition Matrix, Recurrence Quantification Analysis (RQA) and odds ratios comparing the first and second halves of psychotherapy. Results: The Markov Transitions between the states scaled almost perfectly and also showed the ergodicity of the system, meaning that the child can reach any state or shift to another one in play. The RQA and odds ratios showed two trends of change, first concerning the decrease in the use of "less adaptive" strategies, second regarding the reduction of play interruptions. Conclusion
Mudalkar, Shalini; Sreeharsha, Rachapudi Venkata; Reddy, Attipalli Ramachandra
2016-05-20
Abiotic stress leads to the generation of reactive oxygen species (ROS) which further results in the production of reactive carbonyls (RCs) including methylglyoxal (MG). MG, an α, β-dicarbonyl aldehyde, is highly toxic to plants and the mechanism behind its detoxification is not well understood. Aldo-keto reductases (AKRs) play a role in detoxification of reactive aldehydes and ketones. In the present study, we cloned and characterised a putative AKR from Jatropha curcas (JcAKR). Phylogenetically, it forms a small clade with AKRs of Glycine max and Rauwolfia serpentina. JcAKR was heterologously expressed in Escherichia coli BL-21(DE3) cells and the identity of the purified protein was confirmed through MALDI-TOF analysis. The recombinant protein had high enzyme activity and catalytic efficiency in assays containing MG as the substrate. Protein modelling and docking studies revealed MG was efficiently bound to JcAKR. Under progressive drought and salinity stress, the enzyme and transcript levels of JcAKR were higher in leaves compared to roots. Further, the bacterial and yeast cells expressing JcAKR showed more tolerance towards PEG (5%), NaCl (200mM) and MG (5mM) treatments compared to controls. In conclusion, our results project JcAKR as a possible and potential target in crop improvement for abiotic stress tolerance. Copyright © 2016 Elsevier GmbH. All rights reserved.
Aerobic Games and Playful exercises in 9-YearOld Boys: Intensity and Fitness Effects
Directory of Open Access Journals (Sweden)
Gunnar E Mathisen
2016-04-01
Full Text Available Previous research on exercise for pre-adolescents with the purpose of improving aerobic fitness levels has yielded contradictory results. Sufficient training intensity, frequency and duration are the crucial factors in achieving this goal; the question, however, is whether it is possible to reach sufficient intensity levels using aerobic games and playful exercises. Variety and fun are the important factors in motivating children to participate in physical exercises and sports. Therefore, the aim of the study was to investigate the effect of high intensity exercises in pre-adolescent boys, using programs consisting of fun activities and aerobic games. The findings show that the participants achieved intensity levels above 80 % of HRpeak on average in about 60 % of the total exercise time, resulting in significantly improved aerobic fitness.
Crucial knowledge gaps in current understanding of climate change impacts on coral reef fishes
Wilson, S. K.; Adjeroud, M.; Bellwood, D. R.; Berumen, Michael L.; Booth, D.; Bozec, Y.-M.; Chabanet, P.; Cheal, A.; Cinner, J.; Depczynski, M.; Feary, D. A.; Gagliano, M.; Graham, N. A. J.; Halford, A. R.; Halpern, B. S.; Harborne, A. R.; Hoey, A. S.; Holbrook, S. J.; Jones, G. P.; Kulbiki, M.; Letourneur, Y.; De Loma, T. L.; McClanahan, T.; McCormick, M. I.; Meekan, M. G.; Mumby, P. J.; Munday, P. L.; Ohman, M. C.; Pratchett, M. S.; Riegl, B.; Sano, M.; Schmitt, R. J.; Syms, C.
2010-01-01
Expert opinion was canvassed to identify crucial knowledge gaps in current understanding of climate change impacts on coral reef fishes. Scientists that had published three or more papers on the effects of climate and environmental factors on reef
Norscia, Ivan; Palagi, Elisabetta
2011-04-01
Easy to recognize but not easy to define, animal play is a baffling behavior because it has no obvious immediate benefits for the performers. However, the absence of immediate advantages, if true, would leave adult play (costly but maintained by evolution, spanning lemurs to Homo sapiens) unexplained. Although a commonly held view maintains that play is limited by stress, an emergent hypothesis states that play can regulate stress in the short term. Here we explored this hypothesis in a captive family group of New World monkeys, Callithrix jacchus (common marmoset). We observed six subjects and gathered data on aggressive, play, and scratching behavior via focal (6 h/individual) and all occurrences sampling (115 h). We found that play levels were highest during pre-feeding, the period of maximum anxiety due to the forthcoming competition over food. Scratching (the most reliable indicator of stress in primates) and play showed opposite trends along hierarchy, with dominants scratching more and playing less than subordinates. Finally, scratching decreased after play, whereas play appeared to be unrelated to previous scratching events, symptoms of a potential stressful state. In conclusion, both play timing and hierarchical distribution indicate that play limits stress, more than vice versa, at least in the short term.
Player Types, Play Styles, and Play Complexity: Updating the Entertainment Grid
Rademacher Mena, Ricardo Javier
2012-01-01
In a previous work the author created the Education and Entertainment Grid by combining various taxonomies from the fields of play and learning. In this paper, a section of this grid known as the Entertainment Grid will be extended by including previously unused elements of Richard Bartle's online player types and Robert Caillois' play complexity.…
The Non-linear Trajectory of Change in Play Profiles of Three Children in Psychodynamic Play Therapy
Halfon, Sibel; ?avdar, Alev; Orsucci, Franco; Schiepek, Gunter K.; Andreassi, Silvia; Giuliani, Alessandro; de Felice, Giulio
2016-01-01
Aim: Even though there is substantial evidence that play based therapies produce significant change, the specific play processes in treatment remain unexamined. For that purpose, processes of change in long-term psychodynamic play therapy are assessed through a repeated systematic assessment of three children’s “play profiles,” which reflect patterns of organization among play variables that contribute to play activity in therapy, indicative of the children’s coping strategies, and an express...
Directory of Open Access Journals (Sweden)
McNeel Gordon Jantzen
2014-03-01
Full Text Available Musicians have a more accurate temporal and tonal representation of auditory stimuli than their non-musician counterparts (Kraus & Chandrasekaran, 2010; Parbery-Clark, Skoe, & Kraus, 2009; Zendel & Alain, 2008; Musacchia, Sams, Skoe, & Kraus, 2007. Musicians who are adept at the production and perception of music are also more sensitive to key acoustic features of speech such as voice onset timing and pitch. Together, these data suggest that musical training may enhance the processing of acoustic information for speech sounds. In the current study, we sought to provide neural evidence that musicians process speech and music in a similar way. We hypothesized that for musicians, right hemisphere areas traditionally associated with music are also engaged for the processing of speech sounds. In contrast we predicted that in non-musicians processing of speech sounds would be localized to traditional left hemisphere language areas. Speech stimuli differing in voice onset time was presented using a dichotic listening paradigm. Subjects either indicated aural location for a specified speech sound or identified a specific speech sound from a directed aural location. Musical training effects and organization of acoustic features were reflected by activity in source generators of the P50. This included greater activation of right middle temporal gyrus (MTG and superior temporal gyrus (STG in musicians. The findings demonstrate recruitment of right hemisphere in musicians for discriminating speech sounds and a putative broadening of their language network. Musicians appear to have an increased sensitivity to acoustic features and enhanced selective attention to temporal features of speech that is facilitated by musical training and supported, in part, by right hemisphere homologues of established speech processing regions of the brain.
Children's expression through play therapy
Directory of Open Access Journals (Sweden)
Ljubomirović Nataša
2015-01-01
Full Text Available Play as a child's expression, is a skill through which children speaks to adults. Play therapy is a broad field of therapeutic intervention based on the play in order to help the child to cope with problems. Through play, children learn to communicate with others, to express their feelings. Through play they learn and can improve their cognitive, emotional and social capabilities. Play therapy is a nondirective technique focused on the child. It is not focused on the problem, at present even the past, but focused on the expression of the child feelings, accepting the child, rather than correction. The focus has been on the wisdom of a child, not on expertise therapists, guiding the child through play rather than instructing. The aim of play therapy is to encourage healthy growth and development, developing skills in problem solving, reduction of undesirable behavior, confidence building and the development of self-control. This method is effective for a wide range of children's problems, such as the state of stress, anxiety, problem behavior, hyperkinetic syndrome, depression, loss, trauma, the problem of bonding situations parents divorced, somatic disorders, autism spectrum disorders, social problems.
Play Behavior in Wolves: Using the '50:50' Rule to Test for Egalitarian Play Styles.
Directory of Open Access Journals (Sweden)
Jennifer L Essler
Full Text Available Social play is known as a cooperative interaction between individuals involving multiple mechanisms. However, the extent to which the equality of individuals' play styles affects the interaction has not been studied in many species. Dyadic play between wolf puppies, as well as between puppies and adults, was studied to investigate both self-handicapping and offensive behaviors to determine the extent to which wolves engage in play styles where one individual does not dominate the play. Our results did not support the hypothesized '50:50' rule, which suggests that more advantaged individuals should show higher rates of self-handicapping behaviors in order to facilitate play with others. Adult wolves performed significantly less self-handicapping behaviors than their puppy partners, and they performed significantly more offensive behaviors than their puppy partners. While the '50:50' rule was not supported at any time during our study period, dyads consisting of two puppies had significantly more equal play than dyads consisting of one puppy and one adult. These results suggest that wolf puppies are more likely to play on equal terms with similarly-aged play partners, while the dominance status of the partners dictates offensive and self-handicapping behaviors between animals of different ages.
Play Behavior in Wolves: Using the '50:50' Rule to Test for Egalitarian Play Styles.
Essler, Jennifer L; Cafazzo, Simona; Marshall-Pescini, Sarah; Virányi, Zsófia; Kotrschal, Kurt; Range, Friederike
2016-01-01
Social play is known as a cooperative interaction between individuals involving multiple mechanisms. However, the extent to which the equality of individuals' play styles affects the interaction has not been studied in many species. Dyadic play between wolf puppies, as well as between puppies and adults, was studied to investigate both self-handicapping and offensive behaviors to determine the extent to which wolves engage in play styles where one individual does not dominate the play. Our results did not support the hypothesized '50:50' rule, which suggests that more advantaged individuals should show higher rates of self-handicapping behaviors in order to facilitate play with others. Adult wolves performed significantly less self-handicapping behaviors than their puppy partners, and they performed significantly more offensive behaviors than their puppy partners. While the '50:50' rule was not supported at any time during our study period, dyads consisting of two puppies had significantly more equal play than dyads consisting of one puppy and one adult. These results suggest that wolf puppies are more likely to play on equal terms with similarly-aged play partners, while the dominance status of the partners dictates offensive and self-handicapping behaviors between animals of different ages.
Seguin, Alexandra; Santos, Renata; Pain, Debkumar; Dancis, Andrew; Camadro, Jean-Michel; Lesuisse, Emmanuel
2011-02-25
Saccharomyces cerevisiae cells lacking the yeast frataxin homologue (Δyfh1) accumulate iron in the mitochondria in the form of nanoparticles of ferric phosphate. The phosphate content of Δyfh1 mitochondria was higher than that of wild-type mitochondria, but the proportion of mitochondrial phosphate that was soluble was much lower in Δyfh1 cells. The rates of phosphate and iron uptake in vitro by isolated mitochondria were higher for Δyfh1 than wild-type mitochondria, and a significant proportion of the phosphate and iron rapidly became insoluble in the mitochondrial matrix, suggesting co-precipitation of these species after oxidation of iron by oxygen. Increasing the amount of phosphate in the medium decreased the amount of iron accumulated by Δyfh1 cells and improved their growth in an iron-dependent manner, and this effect was mostly transcriptional. Overexpressing the major mitochondrial phosphate carrier, MIR1, slightly increased the concentration of soluble mitochondrial phosphate and significantly improved various mitochondrial functions (cytochromes, [Fe-S] clusters, and respiration) in Δyfh1 cells. We conclude that in Δyfh1 cells, soluble phosphate is limiting, due to its co-precipitation with iron.
Directory of Open Access Journals (Sweden)
Dave Neale
2018-03-01
Full Text Available Play during early life is a ubiquitous activity, and an individual’s propensity for play is positively related to cognitive development and emotional well-being. Play behavior (which may be solitary or shared with a social partner is diverse and multi-faceted. A challenge for current research is to converge on a common definition and measurement system for play – whether examined at a behavioral, cognitive or neurological level. Combining these different approaches in a multimodal analysis could yield significant advances in understanding the neurocognitive mechanisms of play, and provide the basis for developing biologically grounded play models. However, there is currently no integrated framework for conducting a multimodal analysis of play that spans brain, cognition and behavior. The proposed coding framework uses grounded and observable behaviors along three dimensions (sensorimotor, cognitive and socio-emotional, to compute inferences about playful behavior in a social context, and related social interactional states. Here, we illustrate the sensitivity and utility of the proposed coding framework using two contrasting dyadic corpora (N = 5 of mother-infant object-oriented interactions during experimental conditions that were either non-conducive (Condition 1 or conducive (Condition 2 to the emergence of playful behavior. We find that the framework accurately identifies the modal form of social interaction as being either non-playful (Condition 1 or playful (Condition 2, and further provides useful insights about differences in the quality of social interaction and temporal synchronicity within the dyad. It is intended that this fine-grained coding of play behavior will be easily assimilated with, and inform, future analysis of neural data that is also collected during adult–infant play. In conclusion, here, we present a novel framework for analyzing the continuous time-evolution of adult–infant play patterns, underpinned by
Neale, Dave; Clackson, Kaili; Georgieva, Stanimira; Dedetas, Hatice; Scarpate, Melissa; Wass, Sam; Leong, Victoria
2018-01-01
Play during early life is a ubiquitous activity, and an individual's propensity for play is positively related to cognitive development and emotional well-being. Play behavior (which may be solitary or shared with a social partner) is diverse and multi-faceted. A challenge for current research is to converge on a common definition and measurement system for play - whether examined at a behavioral, cognitive or neurological level. Combining these different approaches in a multimodal analysis could yield significant advances in understanding the neurocognitive mechanisms of play, and provide the basis for developing biologically grounded play models. However, there is currently no integrated framework for conducting a multimodal analysis of play that spans brain, cognition and behavior. The proposed coding framework uses grounded and observable behaviors along three dimensions (sensorimotor, cognitive and socio-emotional), to compute inferences about playful behavior in a social context, and related social interactional states. Here, we illustrate the sensitivity and utility of the proposed coding framework using two contrasting dyadic corpora ( N = 5) of mother-infant object-oriented interactions during experimental conditions that were either non-conducive (Condition 1) or conducive (Condition 2) to the emergence of playful behavior. We find that the framework accurately identifies the modal form of social interaction as being either non-playful (Condition 1) or playful (Condition 2), and further provides useful insights about differences in the quality of social interaction and temporal synchronicity within the dyad. It is intended that this fine-grained coding of play behavior will be easily assimilated with, and inform, future analysis of neural data that is also collected during adult-infant play. In conclusion, here, we present a novel framework for analyzing the continuous time-evolution of adult-infant play patterns, underpinned by biologically informed
DEFF Research Database (Denmark)
Elkind, David; Rinaldi, Carla; Flemmert Jensen, Anne
Proceedings from the conference "Children, Time, and Play". Danish University of Education, January 30th 2003.......Proceedings from the conference "Children, Time, and Play". Danish University of Education, January 30th 2003....
What Play Therapists Do within the Therapeutic Relationship of Humanistic/Non-Directive Play Therapy
Robinson, Sally
2011-01-01
Play therapists are increasingly being employed in schools, yet there is confusion among many health, education and social care practitioners about the role of play therapists. This paper explains how play therapists position themselves and what they do through an examination of the therapeutic relationship between the therapist and child. It…
Pigs, Planes, and Play-Doh: Children's Perspectives on Play as Revealed through Their Drawings
Duncan, Pauline Agnieszka
2015-01-01
Play, an elusive concept despite the extensive literature on the subject, remains especially problematic for research focused on the perspective of children. The author discusses her study on children's perspectives about play, exploring drawing as a method for learning how young children conceptualize play within a social-semiotic framework. Her…
Vimal, Divya; Kumar, Saurabh; Pandey, Ashutosh; Sharma, Divya; Saini, Sanjay; Gupta, Snigdha; Ravi Ram, Kristipati; Chowdhuri, Debapratim Kar
2018-03-01
Mismatch repair (MMR) system, a conserved DNA repair pathway, plays crucial role in DNA recombination and is involved in gametogenesis. The impact of alterations in MMR family of proteins (bacterial MutS and MutL homologues) on mammalian fertility is well documented. However, an insight to the role of MMR in reproduction of non-mammalian organisms is limited. Hence, in the present study, we analysed the impact of mlh1 (a MutL homologue) on meiotic crossing over/recombination and fertility in a genetically tractable model, Drosophila melanogaster. Using mlh1 e00130 hypomorphic allele, we report female specific adverse reproductive outcome for reduced mlh1 in Drosophila: mlh1 e00130 homozygous females had severely reduced fertility while males were fertile. Further, mlh1 e00130 females contained small ovaries with large number of early stages as well as significantly reduced mature oocytes, and laid fewer eggs, indicating discrepancies in egg production and ovulation. These observations contrast the sex independent and/or male specific sterility and normal follicular development as well as ovulation reported so far for MMR family proteins in mammals. However, analogous to the role(s) of mlh1 in meiotic crossing over and DNA repair processes underlying mammalian fertility, ovarian follicles from mlh1 e00130 females contained significantly increased DNA double strand breaks (DSBs) and reduced synaptonemal complex foci. In addition, large proportion of fertilized eggs display discrepancies in egg activation and fail to proceed beyond stage 5 of embryogenesis. Hence, reduction of the Mlh1 protein level leads to defective oocytes that fail to complete embryogenesis after fertilization thereby reducing female fertility. Copyright © 2017 Elsevier GmbH. All rights reserved.
Biosynthesis of GDP-fucose and other sugar nucleotides in the blood stages of Plasmodium falciparum.
Sanz, Sílvia; Bandini, Giulia; Ospina, Diego; Bernabeu, Maria; Mariño, Karina; Fernández-Becerra, Carmen; Izquierdo, Luis
2013-06-07
Carbohydrate structures play important roles in many biological processes, including cell adhesion, cell-cell communication, and host-pathogen interactions. Sugar nucleotides are activated forms of sugars used by the cell as donors for most glycosylation reactions. Using a liquid chromatography-tandem mass spectrometry-based method, we identified and quantified the pools of UDP-glucose, UDP-galactose, UDP-N-acetylglucosamine, GDP-mannose, and GDP-fucose in Plasmodium falciparum intraerythrocytic life stages. We assembled these data with the in silico functional reconstruction of the parasite metabolic pathways obtained from the P. falciparum annotated genome, exposing new active biosynthetic routes crucial for further glycosylation reactions. Fucose is a sugar present in glycoconjugates often associated with recognition and adhesion events. Thus, the GDP-fucose precursor is essential in a wide variety of organisms. P. falciparum presents homologues of GDP-mannose 4,6-dehydratase and GDP-L-fucose synthase enzymes that are active in vitro, indicating that most GDP-fucose is formed by a de novo pathway that involves the bioconversion of GDP-mannose. Homologues for enzymes involved in a fucose salvage pathway are apparently absent in the P. falciparum genome. This is in agreement with in vivo metabolic labeling experiments showing that fucose is not significantly incorporated by the parasite. Fluorescence microscopy of epitope-tagged versions of P. falciparum GDP-mannose 4,6-dehydratase and GDP-L-fucose synthase expressed in transgenic 3D7 parasites shows that these enzymes localize in the cytoplasm of P. falciparum during the intraerythrocytic developmental cycle. Although the function of fucose in the parasite is not known, the presence of GDP-fucose suggests that the metabolite may be used for further fucosylation reactions.
Biosynthesis of GDP-fucose and Other Sugar Nucleotides in the Blood Stages of Plasmodium falciparum*
Sanz, Sílvia; Bandini, Giulia; Ospina, Diego; Bernabeu, Maria; Mariño, Karina; Fernández-Becerra, Carmen; Izquierdo, Luis
2013-01-01
Carbohydrate structures play important roles in many biological processes, including cell adhesion, cell-cell communication, and host-pathogen interactions. Sugar nucleotides are activated forms of sugars used by the cell as donors for most glycosylation reactions. Using a liquid chromatography-tandem mass spectrometry-based method, we identified and quantified the pools of UDP-glucose, UDP-galactose, UDP-N-acetylglucosamine, GDP-mannose, and GDP-fucose in Plasmodium falciparum intraerythrocytic life stages. We assembled these data with the in silico functional reconstruction of the parasite metabolic pathways obtained from the P. falciparum annotated genome, exposing new active biosynthetic routes crucial for further glycosylation reactions. Fucose is a sugar present in glycoconjugates often associated with recognition and adhesion events. Thus, the GDP-fucose precursor is essential in a wide variety of organisms. P. falciparum presents homologues of GDP-mannose 4,6-dehydratase and GDP-l-fucose synthase enzymes that are active in vitro, indicating that most GDP-fucose is formed by a de novo pathway that involves the bioconversion of GDP-mannose. Homologues for enzymes involved in a fucose salvage pathway are apparently absent in the P. falciparum genome. This is in agreement with in vivo metabolic labeling experiments showing that fucose is not significantly incorporated by the parasite. Fluorescence microscopy of epitope-tagged versions of P. falciparum GDP-mannose 4,6-dehydratase and GDP-l-fucose synthase expressed in transgenic 3D7 parasites shows that these enzymes localize in the cytoplasm of P. falciparum during the intraerythrocytic developmental cycle. Although the function of fucose in the parasite is not known, the presence of GDP-fucose suggests that the metabolite may be used for further fucosylation reactions. PMID:23615908
Psychiatrists' Perceptions of Role-Playing Games.
Lis, Eric; Chiniara, Carl; Biskin, Robert; Montoro, Richard
2015-09-01
The literature has seen a surge in research on the mental health impacts of technologies such as Facebook, video games, and massively-multiplayer online role-playing games such as World of Warcraft, but little is known regarding the mental health impact of non-video role-playing games, such as Dungeons & Dragons. The present study examines how psychiatrists' perceive role-playing games and whether they play them. Psychiatrists at a tertiary care centre in Canada completed a questionnaire assessing history of playing role-playing games and whether they associate them with psychopathology. Forty-eight psychiatrists responded. Twenty-three percent have played a role-playing game over their lifetimes. Twenty-two percent believed there was an association between psychopathology and role-playing games. A majority of psychiatrists who responded do not associate role-playing games with psychopathology. Implications for clinical practice and future research are discussed.
Dender, Alma; Stagnitti, Karen
2011-02-01
There is a need for culturally appropriate assessments for Australian Indigenous children. This article reports the selection of culturally appropriate and gender-neutral play materials, and changes in administration identified to develop further the Indigenous Child-Initiated Pretend Play Assessment (I-ChIPPA). Twenty-three typically developing children aged four to six years from the Pilbara region in Western Australia participated in the study. Children were presented with four sets of play materials and frequency counts were recorded for each time the child used one of the play materials in a pretend play action. Twelve of the 23 children came to play in pairs. Both boys and girls used the Pilbara toy set including the dark coloured dolls and Pilbara region animals, more frequently than the standardised play materials from the Child-Initiated Pretend Play Assessment (ChIPPA). This study reports the first steps in the development of the I-ChIPPA. Future development will include the refinement of the administration and scoring with pairs of children, and then validity testing the assessment. © 2010 The Authors. Australian Occupational Therapy Journal © 2010 Australian Association of Occupational Therapists.
Fujiwara, Sachiko; Ohashi, Kazumasa; Mashiko, Toshiya; Kondo, Hiroshi; Mizuno, Kensaku
2016-03-15
Mechanical force-induced cytoskeletal reorganization is essential for cell and tissue remodeling and homeostasis; however, the underlying cellular mechanisms remain elusive. Solo (ARHGEF40) is a RhoA-targeting guanine nucleotide exchange factor (GEF) involved in cyclical stretch-induced human endothelial cell reorientation and convergent extension cell movement in zebrafish gastrula. In this study, we show that Solo binds to keratin-8/keratin-18 (K8/K18) intermediate filaments through multiple sites. Solo overexpression promotes the formation of thick actin stress fibers and keratin bundles, whereas knockdown of Solo, expression of a GEF-inactive mutant of Solo, or inhibition of ROCK suppresses stress fiber formation and leads to disorganized keratin networks, indicating that the Solo-RhoA-ROCK pathway serves to precisely organize keratin networks, as well as to promote stress fibers. Of importance, knockdown of Solo or K18 or overexpression of GEF-inactive or deletion mutants of Solo suppresses tensile force-induced stress fiber reinforcement. Furthermore, knockdown of Solo or K18 suppresses tensile force-induced RhoA activation. These results strongly suggest that the interplay between Solo and K8/K18 filaments plays a crucial role in tensile force-induced RhoA activation and consequent actin cytoskeletal reinforcement. © 2016 Fujiwara et al. This article is distributed by The American Society for Cell Biology under license from the author(s). Two months after publication it is available to the public under an Attribution–Noncommercial–Share Alike 3.0 Unported Creative Commons License (http://creativecommons.org/licenses/by-nc-sa/3.0).
... Questionnaire Tuberculosis Play Tuberculosis Experiments & Discoveries About the game Discover and experience some of the classic methods ... last will in Paris. Play the Blood Typing Game Try to save some patients and learn about ...
DEFF Research Database (Denmark)
Gaidamauskas, Ervinas
During his PhD studies, Ervinas Gaidamauskas researched the proteins pregnancy-associated plasma protein-A (PAPP-A) and its homologue PAPP-A2 in vitro. As suggested by its name, PAPP-A plays an important role in pregnancy and fetal development. Additionally, recent studies indicate a newly...
Anion exchange behaviour of Zr, Hf, Nb, Ta and Pa as homologues of RF and Db in fluoride medium
Energy Technology Data Exchange (ETDEWEB)
Monroy G, F. [ININ, Carretera Mexico-Toluca s/n, 52750 Ocoyoacac, Estado de Mexico (Mexico); Trubert, D.; Brillard, L.; Hussonnois, M.; Constantinescu, O.; Le Naour, C., E-mail: fabiola.monroy@inin.gob.m [Institut de Physique Nucleaire, F-91406 Orsay, France (France)
2010-07-01
Studies of the chemical property of trans actinide elements are very difficult due to their short half-lives and extremely small production yields. However it is still possible to obtain considerable information about their chemical properties, such as the most stable oxidation states in aqueous solution, complexing ability, etc., comparing their behaviour with their lighter homologous in the periodic table. In order to obtain a better knowledge of the behaviour of rutherfordium, RF (element 104), dub nium, Db (element 105) in HF medium, the sorption properties of Zr, Hf, Nb, Ta an Pa, homologues of RF and Db, were studied in NH{sub 4}F/HClO{sub 4} medium in this work. Stability constants of the fluoride complexes of these elements were experimentally obtained from K{sub d} obtained at different F{sup -} and H{sup +} concentrations. The anionic complexes: [Zr(Hf)F{sub 5}]{sup -}, [Zr(Hf)F{sub 6}]{sup 2-}, [Zr(Hf)F{sub 7}]{sup 3-}, [Ta(Pa)F{sub 6}]{sup -}, [Ta(Pa)F{sub 7}]{sup 2-}, [Ta(Pa)F{sub 8}]{sup 3-}, [NbOF{sub 4}]{sup -} and [NbOF{sub 5}]{sup 2-} are present as predominant species in the HF range over investigation. (Author)
In Defense of Play: Beginning the Dialog about the Power of Play
Myck-Wayne, Janice
2010-01-01
This article provides early childhood practitioners a way to develop a common understanding of the importance of play in the early learning experience of young children. Meaningful discussion among teachers, parents, administrators, and teacher candidates regarding play in early childhood education programs is critical to ensure the growth and…
Horiuchi, Takayuki; Akiyama, Takuya; Inouye, Sumiko; Komano, Teruya
2002-12-01
The developmentally regulated gene dofA, identified from pulse-labeling experiments by two-dimensional gel electrophoresis, and its homologue, dofB, were cloned and characterized in Myxococcus xanthus. Deletion of dofA and dofB did not affect the vegetative growth and development of M. xanthus. dofA was specifically expressed during development, while dofB expression was observed during vegetative growth and development. The dofA-lacZ fusion was introduced into a fruA mutant and A, B, C, D, and E extracellular signal mutants. The pattern of dofA expression in the C signal mutant was similar to that of the wild-type strain, while dofA expression was not detected in the fruA mutant. These results are consistent with those of the pulse-labeling experiments. dofA expression was reduced in A and E signal mutants, whereas dofA expression was delayed in B and D signal mutants. The patterns of expression of the dofA gene in the fruA mutant and the five signal mutants are strikingly similar to that of the tps gene, which encodes protein S, a major component of the outer surface of the myxospore; this result suggests that the dofA and tps genes are similarly regulated. The involvement of a highly GC-rich inverted repeat sequence (underlined), CGGCCCCCGATTCGTCGGGGGCCG, in developmentally regulated dofA expression is suggested.
... Teachers' Questionnaire MRI Play MRI the Magnetic Miracle Game About the game In the MRI imaging technique, strong magnets and ... last will in Paris. Play the Blood Typing Game Try to save some patients and learn about ...
Play the Electrocardiogram Game
... and Work Teachers' Questionnaire Electrocardiogram Play the ECG Game About the game ECG is used for diagnosing heart conditions by ... last will in Paris. Play the Blood Typing Game Try to save some patients and learn about ...
Cabrera, Natasha J; Roggman, Lori
2017-11-01
Both mothers and fathers play with their children, but research on parent-child play interactions is conducted with mothers three times more often than it is with fathers. The articles in this special issue address this gap by focusing on the nature and quality of father-child play, across cultural contexts, and considering whether father play offers something unique and special for early human development, in infancy or early childhood. The studies show that fathers can be just as developmentally supportive as are mothers in terms of being playful and engaged with their children in ways that are related to greater child socioemotional competence, emotion regulation, and vocabulary, and to less aggression, anxiety, and negativity. We encourage future research to examine the cultural influences, family system dynamics, and specificity of timing and types of father-child play in relation to children's developmental competence. © 2017 Michigan Association for Infant Mental Health.
Integrated Modelling in CRUCIAL Science Education
Mahura, Alexander; Nuterman, Roman; Mukhamedzhanova, Elena; Nerobelov, Georgiy; Sedeeva, Margarita; Suhodskiy, Alexander; Mostamandy, Suleiman; Smyshlyaev, Sergey
2017-04-01
The NordForsk CRUCIAL project (2016-2017) "Critical steps in understanding land surface - atmosphere interactions: from improved knowledge to socioeconomic solutions" as a part of the Pan-Eurasian EXperiment (PEEX; https://www.atm.helsinki.fi/peex) programme activities, is looking for a deeper collaboration between Nordic-Russian science communities. In particular, following collaboration between Danish and Russian partners, several topics were selected for joint research and are focused on evaluation of: (1) urbanization processes impact on changes in urban weather and climate on urban-subregional-regional scales and at contribution to assessment studies for population and environment; (2) effects of various feedback mechanisms on aerosol and cloud formation and radiative forcing on urban-regional scales for better predicting extreme weather events and at contribution to early warning systems, (3) environmental contamination from continues emissions and industrial accidents for better assessment and decision making for sustainable social and economic development, and (4) climatology of atmospheric boundary layer in northern latitudes to improve understanding of processes, revising parameterizations, and better weather forecasting. These research topics are realized employing the online integrated Enviro-HIRLAM (Environment - High Resolution Limited Area Model) model within students' research projects: (1) "Online integrated high-resolution modelling of Saint-Petersburg metropolitan area influence on weather and air pollution forecasting"; (2) "Modeling of aerosol impact on regional-urban scales: case study of Saint-Petersburg metropolitan area"; (3) "Regional modeling and GIS evaluation of environmental pollution from Kola Peninsula sources"; and (4) "Climatology of the High-Latitude Planetary Boundary Layer". The students' projects achieved results and planned young scientists research training on online integrated modelling (Jun 2017) will be presented and
Identification of crucial microRNAs and genes in hypoxia-induced human lung adenocarcinoma cells
Directory of Open Access Journals (Sweden)
Geng Y
2016-07-01
, hsa-miR-301b was verified to regulate FOXF2, and hsa-miR-769-5p was verified to modulate ARID1A. In addition, the overexpression of hsa-miR-301b and hsa-miR-769-5p significantly affected the cell cycle of A549 cells, but not cell proliferation and apoptosis.Conclusion: miRNA expression profile was changed in hypoxia-induced lung cancer cells. Those validated miRNAs and genes may play crucial roles in the response of lung cancer cells to hypoxia. Keywords: hypoxia, lung cancer, A549, microarray, hsa-miR-301b, hsa-miR-769-5p
Motivations for Play in Computer Role-Playing Games
DEFF Research Database (Denmark)
Tychsen, Anders; Hitchens, Michael; Brolund, Thea
2008-01-01
, but rather composed of multiple motivational drivers that are heavily interrelated and act in concert. Character uniqueness and Discovery & Immersion were the highest ranked motivational categories. Different levels of detail in motivations for playing single-/multi- Player RPGs were located...
Flynn, Rachel M; Colon, Nirmaliz
2016-12-01
This pilot study examined the impact of playing an active videogame on executive functioning (EF) skills for children with special needs, who typically have lower EF skills. Acute EF change was measured in 36 children with a range of special needs, including mental health disorders and developmental disabilities. Participants were assigned to one of two active videogame conditions: playing alone and playing with a peer. Two different EF tasks were conducted pre- and postplay. Children who played alone increased their accuracy performance more than children in the paired-play condition on two measures of EF. The study explored potential covariates of prior videogame experience, age, and enjoyment, but none of these variables related to EF change. This study's findings support active videogame play as an activity that can boost EF skills for children with special needs when they play alone. Future research should continue to examine the relationships between EF and active videogame play with a peer to elucidate the contributions of social interactions.
Playful Collaboration (Or Not)
DEFF Research Database (Denmark)
Bogers, Marcel; Sproedt, Henrik
2012-01-01
This article explores how playing games can be used to teach intangible social interaction across boundaries, in particular within open collaborative innovation. We present an exploratory case study of how students learned from playing a board game in a graduate course of the international...... and interdisciplinary Innovation and Business master's program in Denmark. We identify several important themes related to the process of learning through playing and the social dynamics of open collaborative innovation, while we also highlight possible caveats of “playing” and practicing open innovation. Our findings...
A comment on a proposed ''crucial experiment'' to test Einstein's special theory of relativity
International Nuclear Information System (INIS)
Rodrigues Jr, W.A.; Buonamano, V.
1976-01-01
A proposed ''crucial experiment'' to test Einstein's special theory of relativity is analysed and it is shown that it falls into the set of unsatisfactory proposals that attempt to make an experimental distinction between Einstein's special theory of relativity and a ''Lorentzian type'' special theory of relativity
The crucial effect of early-stage gelation on the mechanical properties of cement hydrates
Ioannidou, Katerina; Kanduč, Matej; Li, Lunna; Frenkel, Daan; Dobnikar, Jure; Del Gado, Emanuela
2016-07-01
Gelation and densification of calcium-silicate-hydrate take place during cement hydration. Both processes are crucial for the development of cement strength, and for the long-term evolution of concrete structures. However, the physicochemical environment evolves during cement formation, making it difficult to disentangle what factors are crucial for the mechanical properties. Here we use Monte Carlo and Molecular Dynamics simulations to study a coarse-grained model of cement formation, and investigate the equilibrium and arrested states. We can correlate the various structures with the time evolution of the interactions between the nano-hydrates during the preparation of cement. The novel emerging picture is that the changes of the physicochemical environment, which dictate the evolution of the effective interactions, specifically favour the early gel formation and its continuous densification. Our observations help us understand how cement attains its unique strength and may help in the rational design of the properties of cement and related materials.
Play Therapy in School Counseling
Trice-Black, Shannon; Bailey, Carrie Lynn; Kiper Riechel, Morgan E.
2013-01-01
Play therapy is an empirically supported intervention used to address a number of developmental issues faced in childhood. Through the natural language of play, children and adolescents communicate feelings, thoughts, and experiences. Schools provide an ideal setting for play therapy in many ways; however, several challenges exist in implementing…
Scaffolded filmmaking in PlayOFF: A playground for worldwide film experiments
Directory of Open Access Journals (Sweden)
Heidi Philipsen
2012-11-01
Full Text Available How is it possible to make an entire short film in only 48 hours? This task was carried out in the global online film contest, called PlayOFF, held by Odense International Film Festival (OFF in August 2010 and -11. Contestants came from all over the world — from countries as different as Palestine, China and Romania. I believe this kind of contest to be a fruitful area for research, giving better understanding of how motivation, flow and creative ways of thinking can be initiated through filmmaking. Creative competences, environments, educations, classes etc. are in constant demand. Nevertheless, only a few scholars have actually studied conditions behind these elements, and even fewer have researched them in relation to filmmaking. I will seek to expand knowledge in this field which has hitherto been assigned insufficient priority in media research. How to analyse and experience films is very well described, but when it comes to the process of creating films we find almost no scientifically based research or qualifying designs for stimulating creativity. While other media researchers focus on successful films, I find it crucial to study the idea-making, team work and other conditions behind the productions. This article is based on an empirical study of film processes in PlayOFF 2010 and -11, and I will point out how these findings could be used in developing creativity. Based on my empirical studies I will suggest a learning design for scaffolded filmmaking and propose some ideas of how to transfer this knowledge to an educational context.
Impact of Changes in Playing Time on Playing-Related Musculoskeletal Pain in String Music Students.
Robitaille, Judith; Tousignant-Laflamme, Yannick; Guay, Manon
2018-03-01
During their training, musicians must develop good work habits that they will carry on throughout their professional career in order to avoid potential chronic health problems, such as musculoskeletal pain. The effect of sudden changes in instrument playing-time on the development of playing-related musculoskeletal pain (PRMP) has not been thoroughly investigated in music students playing bowed string instruments (BSI), even though they are regularly exposed to such changes to perfect their playing skills. To explore the association between sudden changes in instrument playing-time and changes in PRMP in BSI players. A prospective cohort study was completed with BSI students attending a summer music camp offering high-level training. Participants completed a self-administered 23-item questionnaire designed for the study upon arrival at camp (T1) and then 7 days later (T2). Ninety-three BSI students (16±4 yrs old) completed the questionnaires, for a 23% response rate. Their playing-time increased by 23±14 hrs between T1 and T2. Complaints in pain frequency (e.g., from never to most of the time) and intensity (19±24 mm on VAS) significantly increased between T1 and T2 and were correlated with an increase in playing-time. A sudden increase in playing-time, such as that experienced by elite BSI students attending an intensive music camp, was related to an increase in PRMP. However, in this study, changes in pain characteristics were only partly explained by the change in playing-time.
Teachers and Parents Play to Learn: Play-Based Instruction in Computer Technology
Parker, Denise
2010-01-01
Play is so important that it is declared as one of the human rights by the United Nations. Although it is focused on children, play does "not" stop there. In the 1990s the author designed and facilitated a blended curriculum for a Head Start Program. The instructional goal was to introduce and get the children to effectively and…
Directory of Open Access Journals (Sweden)
Soedjatmiko Soedjatmiko
2018-01-01
Full Text Available Background Play stimulates children’s growth and development. When mothers and their children play, a positive attitude from the mother and adequate interest from the child is required. Little is known about the play activities that effectively stimulate such positive maternal attitude and child interest. Objective To assess for associations between various play activities with maternal attitude and child interest before and after mother-child play sessions. Methods Pre-post intervention questionnaires were distributed to mothers before and after playing with their children. Children were aged 1-5 years, from two play sites (in Surabaya and Makassar, and included using purposive sampling. Eight types of toys/play activities were provided. The allocated time for answering the 17-question survey was 15 minutes. Average scores before and after the mother-child play sessions were analyzed using paired T-test. Results We collected 264 valid questionnaires, 235 in Surabaya and 29 in Makassar. Improvement of maternal attitude after the mother-child play session was found in 132 mothers [mean diff. 0.07 (SD 0.42; 95%CI -0.117 to -0.015; P=0.011]. Play activities with significant improvements in maternal attitude were jigsaw puzzle [mean diff. 0.09 (SD 0.66; 95% CI 0.007 to 0.167;P= 0.033, Lego blocks (mean diff.-0.10 (SD 0.69; 95%CI -0.186 to -0.018; P=0.017, mini-gardening (mean diff. -0.15 (SD 0.75; 95%CI -0.238 to -0.057; P=0.002, sandbox [mean diff.-0.24 (SD 0.83; 95%CI -0.339 to – 0.138; P < 0.001], fishing [mean diff. -0.17 (SD 0.68; 95%CI -0.253 to -0.088; P < 0.001], and animal figurines [mean diff. -0.21 (SD 0.75; 95%CI -0.3 to -0.117;P <0.001]. Improvement of child interest was found in 161 children [mean diff. 0.20 (SD 0.52; 95%CI -0.264 to -0.116; P<0.001]. Play activities with significant improvements in child interest were jigsaw puzzle, Lego blocks, origami, mini-gardening, fishing, and animal figurines. Conclusion Some mother
The Internet of Playful Things
DEFF Research Database (Denmark)
Wyeth, Peta; Brereton, Margot; Roe, Paul
2015-01-01
This one-day workshop brings together researchers and practitioners to share knowledge and practices on how people can connect and interact with the Internet of Things in a playful way. Open to participants with a diverse range of interests and expertise, and by exploring novel ways to playfully...... will be a road map to support the development of a Model of Playful Connectedness, focusing on how best to design and make playful networks of things, identifying the challenges that need to be addressed in order to do so....
CRUCIAL: Cryosat-2 Success over Inland Water and Land
DEFF Research Database (Denmark)
Moore, Philip; Berry, Philippa; Balmbra, Robert
2014-01-01
CRUCIAL is an ESA/STSE funded project investigating innovative land and inland water applications from Cryosat-2 with a forward-look component to the future Sentinel-3 mission. The fact that the Earth’s land surface is, in general, a relatively poor reflector of Ku band energy, with the exceptions...... of inland water, salar and ice surfaces has enabled Earth-orbiting satellite radar altimeters to be used for land surface applications including mapping and measurement of river and lake systems. Research with EnviSat Burst Echoes has shown that substantial high frequency information content is present...... of Cryosat-2 altimeter in SAR mode (I8 KHz) offers the opportunity to recover high frequency signals over much of the Earth’s land surface, enhancing the inland water height retrieval capability. Constraining this application is the limited availability of SAR Full Bit Rate (FBR) data from Cryosat-2 over...
Pretend Play and Creative Processes
Russ, Sandra W.; Wallace, Claire E.
2013-01-01
The authors contend that many cognitive abilities and affective processes important in creativity also occur in pretend play and that pretend play in childhood affects the development of creativity in adulthood. They discuss a variety of theories and observations that attempt to explain the importance of pretend play to creativity. They argue that…
Play Memories and Place Identity.
Sandberg, Anette
2003-01-01
This retrospective study examined play memories from childhood to adulthood of 478 university students between ages 20 and 62 as exhibited in drawings of play memories and questionnaire responses. The study focused on the role of the physical environment and place identity in play memories and individual identity development. Findings showed that…
Play Therapy: Basics and Beyond.
Kottman, Terry
This book provides an atheoretical orientation to basic concepts involved in play therapy and an introduction to different skills used in play therapy. The demand for mental professionals and school counselors who have training and expertise in using play as a therapeutic tool when working with children has increased tremendously. In response to…
Why People Play: Artificial Lives Acquiring Play Instinct to Stabilize Productivity
Directory of Open Access Journals (Sweden)
Shinichi Tamura
2012-01-01
Full Text Available We propose a model to generate a group of artificial lives capable of coping with various environments which is equivalent to a set of requested task, and likely to show that the plays or hobbies are necessary for the group of individuals to maintain the coping capability with various changes of the environment as a whole. This may be an another side of saying that the wide variety of the abilities in the group is necessary, and if the variety in a species decreased, its species will be extinguished. Thus, we show some simulation results, for example, in the world where more variety of abilities are requested in the plays, performance of the whole world becomes stable and improved in spite of being calculated only from job tasks, and can avoid the risk of extinction of the species. This is the good effect of the play.
Self-Play and Using an Expert to Learn to Play Backgammon with Temporal Difference Learning
Wiering, Marco A.
2010-01-01
A promising approach to learn to play board games is to use reinforcement learning algorithms that can learn a game position evaluation function. In this paper we examine and compare three different methods for generating training games: 1) Learning by self-play, 2) Learning by playing against an
Adachi, Paul J C; Willoughby, Teena
2016-02-01
Given the extreme popularity of video games among older adolescents and emerging adults, the investigation of positive outcomes of video game play during these developmental periods is crucial. An important direction for research in this area is the investigation of a link between sports video game play and involvement in real-life sports among youth. Yet, this association has not been examined in the long-term among older adolescents and emerging adults, and thus represents an exciting new area for discovery. The primary goal of the current study, therefore, was to examine the long-term association between sports video game play and involvement in real-life sports clubs among older adolescents and emerging adults. In addition, we examined whether self-esteem was an underlying mechanism of this longitudinal association. We surveyed older adolescents and emerging adults (N = 1132; 70.6 % female; M age = 19.06 years, range of 17-25 years at the first assessment) annually over 3 years about their video game play, self-esteem, and involvement in real-life sports. We found a long-term predictive effect of sports video game play on increased involvement in real-life sports over the 3 years. Furthermore, we demonstrated that self-esteem was an underlying mechanism of this long-term association. Our findings make an important contribution to an emerging body of literature on the positive outcomes of video game play, as they suggest that sports video game play may be an effective tool to promote real-life sports participation and physical activity among older adolescents and emerging adults.
Roach, Lindsay; Keats, Melanie
2018-01-01
Fundamental movement skill interventions are important for promoting physical activity, but the optimal intervention model for preschool children remains unclear. We compared two 8-week interventions, a structured skill-station and a planned active play approach, to a free-play control condition on pre- and postintervention fundamental movement skills. We also collected data regarding program attendance and perceived enjoyment. We found a significant interaction effect between intervention type and time. A Tukey honest significant difference analysis supported a positive intervention effect showing a significant difference between both interventions and the free-play control condition. There was a significant between-group difference in group attendance such that mean attendance was higher for both the free-play and planned active play groups relative to the structured skill-based approach. There were no differences in attendance between free-play and planned active play groups, and there were no differences in enjoyment ratings between the two intervention groups. In sum, while both interventions led to improved fundamental movement skills, the active play approach offered several logistical advantages. Although these findings should be replicated, they can guide feasible and sustainable fundamental movement skill programs within day care settings.
DEFF Research Database (Denmark)
Skovbjerg, Helle Marie
2017-01-01
Based on a field study in a kindergarten among children in Denmark, this paper explores playing activities on a digital swing, the SON-X Octavia (SON-X) and its Applause application. SON-X is an interactive sound unit that can be attached to any swing chain. Here, I explore the relationship between...... to highlight the features of swing play that children develop using the SON-X technology in terms of the danger-safety continuum. The feedback provided, it is found, enables children to independently manage risk and security within the limits of their playing activities; the digital swing supports play...
Directory of Open Access Journals (Sweden)
Nicoleta Stanca
2017-05-01
Full Text Available Everyting conceivable, all that has ever been imagined, can be included in our minds and souls. As psyche means “breath”, “soul” and “mind”, it points to the relevance of psychology as a study of mental, emotional and spiritual processes involved in our identity make-up. One of the main organizers of our self and psychological experiences is our relationhip with death: our fear of abandonement and of being alone when conceiving our own death, the fear of the loss of the others, leading to the fear of attachment and emotional death. Pat Kinevane, a contemporary Irish playright, deals, in his 2005 play, Forgotten, with the idea of family and social abandonment of old people in nursing homes. The interconnected stories of Dora, Eucharia, Flor and Gustus, the characters in the play, aged 80-100 years old, living in separate retirement and care facilities around Ireland, reveal these fears. Mental illness in the current explosion of anxiety is also crucial to our identity. Another play by Kinevane, Silent (2010, ends with the word silent, which indicates the insanity, invisibility and ultimately the death of the protagonist, Tino McGoldring, a homeless man tormented by the suicide of his brother. His self after the loss of his brother, wife, family, job, mind is constructed in relation to the past and the imaginary world of the Italian-American icon of the film industry of the 1920s, Rudolph Valentino.
Parent-Child Play across Cultures: Advancing Play Research
Roopnarine, Jaipaul L.; Davidson, Kimberly L.
2015-01-01
In this article, the authors argue for a greater understanding of children's play across cultures through better integration of scientific thinking about the developed and developing societies, through consideration of socialization beliefs and goals, and, finally, through the use of more complex models in research investigations. They draw on…
Validating tyrosinase homologue melA as a photoacoustic reporter gene for imaging Escherichia coli
Paproski, Robert J.; Li, Yan; Barber, Quinn; Lewis, John D.; Campbell, Robert E.; Zemp, Roger
2015-10-01
To understand the pathogenic processes for infectious bacteria, appropriate research tools are required for replicating and characterizing infections. Fluorescence and bioluminescence imaging have primarily been used to image infections in animal models, but optical scattering in tissue significantly limits imaging depth and resolution. Photoacoustic imaging, which has improved depth-to-resolution ratio compared to conventional optical imaging, could be useful for visualizing melA-expressing bacteria since melA is a bacterial tyrosinase homologue which produces melanin. Escherichia coli-expressing melA was visibly dark in liquid culture. When melA-expressing bacteria in tubes were imaged with a VisualSonics Vevo LAZR system, the signal-to-noise ratio of a 9× dilution sample was 55, suggesting that ˜20 bacteria cells could be detected with our system. Multispectral (680, 700, 750, 800, 850, and 900 nm) analysis of the photoacoustic signal allowed unmixing of melA-expressing bacteria from blood. To compare photoacoustic reporter gene melA (using Vevo system) with luminescent and fluorescent reporter gene Nano-lantern (using Bruker Xtreme In-Vivo system), tubes of bacteria expressing melA or Nano-lantern were submerged 10 mm in 1% Intralipid, spaced between melA-expressing bacteria even when the tubes were less than 1 mm from each other, while bioluminescence and fluorescence imaging could not resolve the two tubes of Nano-lantern-expressing bacteria even when the tubes were spaced 10 mm from each other. After injecting 100-μL of melA-expressing bacteria in the back flank of a chicken embryo, photoacoustic imaging allowed visualization of melA-expressing bacteria up to 10-mm deep into the embryo. Photoacoustic signal from melA could also be separated from deoxy- and oxy-hemoglobin signal observed within the embryo and chorioallantoic membrane. Our results suggest that melA is a useful photoacoustic reporter gene for visualizing bacteria, and further work
Cabrera, Natasha J; Karberg, Elizabeth; Malin, Jenessa L; Aldoney, Daniela
2017-11-01
Using data from a diverse sample of low-income families who participated in the Early Head Start Research Evaluation Project (n = 73), we explored the association between mothers' and fathers' playfulness with toddlers, toddler's affect during play, and children's language and emotion regulation at prekindergarten. There were two main findings. First, fathers' playfulness in toddlerhood was associated with children's vocabulary skills in prekindergarten whereas mothers' playfulness was related to children's emotion regulation. Cross-parental effects were found only for mothers. The association between mothers' playfulness and children's vocabulary and emotion regulation was strengthened when fathers engaged in more pretend play and when children were affectively positive during the play. These findings show that playfulness is an important source of variation in the vocabulary and emotion regulation of children growing up in low-income families. They also point to domain-specific ways that mothers and fathers promote children's regulatory and vocabulary skills, and highlight the importance of children's positive engagement in play. © 2017 Michigan Association for Infant Mental Health.
Communities of Play - a collective unfolding
DEFF Research Database (Denmark)
Thorsted, Ann Charlotte
2016-01-01
This paper discusses the role of play in organizations and its ability to create a community of play regarded as a group of people deeply engaged in play. The elaboration is based on an empirical study of adults playing in the Danish international toy company LEGO. The study confirms that play can...... support organizations in solving present day challenges, such as learning, communication, innovation and collaboration. But before talking about solving anything, this paper argues – primarily through the perspective of Gadamer – that it is equally intriguing to look into what play as a universal life....... By introducing the new term ‘community of play’ into the discussion of play among adults in organizational contexts, the paper tries to spark an existential inquiry into the more intangible and human aspects of organizations....
Looijestijn, Jasper; Diederen, Kelly M. J.; Goekoop, Rutger; Sommer, Iris E. C.; Daalman, Kirstin; Kahn, Rene S.; Hoek, Hans W.; Blom, Jan Dirk
Introduction: Verbal auditory hallucinations (VAHs) are experienced as spoken voices which seem to originate in the extracorporeal environment or inside the head. Animal and human research has identified a 'where' pathway for sound processing comprising the planum temporale, the middle frontal gyrus
Lee, Ji Yoon; Park, Changwon; Cho, Yong Pil; Lee, Eugine; Kim, Hyongbum; Kim, Pilhan; Yun, Seok H.; Yoon, Young-sup
2010-01-01
Background Emerging evidence has suggested a contribution of bone marrow (BM) cells to lymphatic vessel formation; however, the exact phenotype of the cells with lymphatic endothelial progenitor cell (LEPC) function has yet to be identified. Here we investigate the identity of BM-derived LEPCs and their role in lymphatic neovascularization. Methods and Results Culture of BM-mononuclear cells (MNCs) in the presence of VEGFA, VEGFC and EGF resulted in expression of lymphatic endothelial cell (LEC) markers. Among these cells, podoplanin+ cells were isolated by magnetic-labeled cell separation system (MACS) and characterized by FACS and immunocytochemistry. These podoplanin+ cells highly express markers for LECs, hematopoietic lineages, and stem/progenitor cells, and upon further cultivation, generate LECs. We further confirmed that podoplanin+ cells exist in small numbers in BM and peripheral blood (PB) of normal mice, but are significantly (15 fold) augmented upon lymphangiogenic stimuli such as tumor implantation. Next, to evaluate the potential of podoplanin+ cells for the formation of new lymphatic vessels in vivo, we injected culture-isolated or freshly isolated BM-derived podoplanin+ cells into wound and tumor models. Immunohistochemistry demonstrated that the injected cells were incorporated into the lymphatic vasculature, displayed LEC phenotypes, and increased lymphatic vascular density in tissues, suggesting lymphvasculogenesis. Podoplanin+ cells also expressed high levels of lymphangiogenic cytokines and increased proliferation of LECs during co-culture, suggesting a lymphangiogenic or paracrine role. Conclusions Our results provide compelling evidence that BM-derived podoplanin+ cells, a previously unrecognized cell type, function as LEPCs and participate in postnatal lymphatic neovascularization through both lymphvasculogenesis and lymphangiogenesis. PMID:20855662
The development of early sociodramatic play
Deunk, M.I.; Berenst, J.; de Glopper, C.M.
2008-01-01
In this article we study the beginnings of sociodramatic play. We examine the pretend play interactions of a Dutch girl, Peggy, and focus on her transition into sociodramatic play. Initially, Peggy interprets only some elements of her play interactions at the pretend level. At age 2;9, Peggy shows
DEFF Research Database (Denmark)
Abildgaard, Mette Simonsen; Birkbak, Andreas; Jensen, Torben Elgaard
2017-01-01
An advantage of the playground metaphor is that it comes with the activity of going out on ‘play dates’ and developing friendships. In such playful relationships, there is always something at stake, but the interaction is also fun and inherently exploratory. In the following, we take a tour of five...
DEFF Research Database (Denmark)
Houmøller, Ellen; Marchetti, Emanuela
2015-01-01
event called InnoEvent, addressed to students in the fields of multimedia and healthcare. Being interested in studying games and role-play as tools to support independent learning in the field of design thinking and team-building, following Dewey’s (1938) theory of learning experience, we ran two...... workshops based on two classic role-play games: The Silent Game (Brandt, 2006) and The Six Thinking Hats (de Bono, 1985). These games were created to support students in learning design thinking in groups and are assigned positive values in literature, hence we expected a smooth process. However, our...... experience was rather characterized by conflictual negotiations with the students. Data from our observations and from interviews with group representatives show that the students took a discontinuous learning path, characterised by a false start, failure, and a thorough reconsideration of their work...
Directory of Open Access Journals (Sweden)
Ke Teng
2016-12-01
Full Text Available Senescence is not only an important developmental process, but also a responsive regulation to abiotic and biotic stress for plants. Stay-green protein plays crucial roles in plant senescence and chlorophyll degradation. However, the underlying mechanisms were not well studied, particularly in non-model plants. In this study, a novel stay-green gene, ZjSGR, was isolated from Zoysia japonica. Subcellular localization result demonstrated that ZjSGR was localized in the chloroplasts. Quantitative real-time PCR results together with promoter activity determination using transgenic Arabidopsis confirmed that ZjSGR could be induced by darkness, ABA and MeJA. Its expression levels could also be up-regulated by natural senescence, but suppressed by SA treatments. Overexpression of ZjSGR in Arabidopsis resulted in a rapid yellowing phenotype; complementary experiments proved that ZjSGR was a functional homologue of AtNYE1 from Arabidopsis thaliana. Overexpression of ZjSGR accelerated chlorophyll degradation and impaired photosynthesis in Arabidopsis. Transmission electron microscopy observation revealed that overexpression of ZjSGR decomposed the chloroplasts structure. RNA sequencing analysis showed that ZjSGR could play multiple roles in senescence and chlorophyll degradation by regulating hormone signal transduction and the expression of a large number of senescence and environmental stress related genes. Our study provides a better understanding of the roles of SGRs, and new insight into the senescence and chlorophyll degradation mechanisms in plants.
Directory of Open Access Journals (Sweden)
Mats Bevemyr
2016-11-01
Full Text Available The Swedish preschool curriculum emphasizes children’s learning through play. This means that children’s learning in everyday practice is accomplished through a complex mixture of teacher-led activities and activities the children themselves initiate. When learning is viewed as situated and constituted through social interaction (Lave & Wenger, 1991, almost all social events have learning potential. Consequently, from an educational and a curriculum point of view it is important to raise the question of how children’s learning can be made visible, and determine what kind of learning children’s own initiated (play activities imply. The focus of the paper is on children’s (aged 3-5 years “communities of practice” at the computer during “free play” period in two various Swedish preschools settings. Events of peer interaction are analyzed in detail to illustrate what kind of learning activities are going on at the computer, and to discuss these events of potential learning in relation to the curriculum goals and the educational practice. From a curriculum point of view, the analyses show that the children’s activities at the computer involve a variety of events that might provides for learning that can be viewed as goal-oriented. From the children’s point of view, the project of socialization seems to be the most prominent goal. A crucial point for educational success, however, is to understand not only what the object of learning is, rather what motivates children’s play apprenticeship in their own “communities of practice”.
Active Gaming: The Future of Play?
Witherspoon, Lisa; Manning, John P.
2012-01-01
The authors examine technology-driven games--especially active gaming--as an evolving form of children's play. They offer an overview of play and its developmental benefits, describe the literature on the emergence of technology-driven play, and reflect on the diminishment of physical play in contemporary culture. They suggest that active gaming,…
From Team Play to Squad Play: The Militarisation of Interactions in Multiplayer FPS Video Games
Directory of Open Access Journals (Sweden)
Adam Duell
2014-11-01
Full Text Available Since the onset of E-sports we have seen the development from casual players to professional players who push the boundary of game mastery to new heights via coordinated team play. In this short paper I explore how a group of video game players adopt military-style communication methods and strategies to coordinate their actions in the popular tactical First Person Shooter (FPS video game DayZ (Bohemia Interactive, 2014. Utilising the key components of team interaction in the context of distributed and ad-hoc military teams (Pascual et al., 1997, I show how a group of players evolved their interactions from team play to squad play. I argue that squad play is an advancement of the strategic and tactical thinking embodied in team play through the adoption of real-world military interaction and communication strategies.
Play Therapy: Practice, Issues, and Trends
Homeyer, Linda E.; Morrison, Mary O.
2008-01-01
Play therapy is an effective means of responding to the mental health needs of young children and is widely accepted as a valuable and developmentally appropriate intervention. The authors discuss the importance of play in development, the therapeutic benefits of play, the rich history of play therapy, and recent research and current issues and…
van Heemst, D; Swart, K; Holub, E F; van Dijk, R; Offenberg, H H; Goosen, T; van den Broek, H W; Heyting, C
1997-05-01
We have cloned the uvsC gene of Aspergillus nidulans by complementation of the A. nidulans uvsC114 mutant. The predicted protein UVSC shows 67.4% sequence identity to the Saccharomyces cerevisiae Rad51 protein and 27.4% sequence identity to the Escherichia coli RecA protein. Transcription of uvsC is induced by methyl-methane sulphonate (MMS), as is transcription of RAD51 of yeast. Similar levels of uvsC transcription were observed after MMS induction in a uvsC+ strain and the uvsC114 mutant. The coding sequence of the uvsC114 allele has a deletion of 6 bp, which results in deletion of two amino acids and replacement of one amino acid in the translation product. In order to gain more insight into the biological function of the uvsC gene, a uvsC null mutant was constructed, in which the entire uvsC coding sequence was replaced by a selectable marker gene. Meiotic and mitotic phenotypes of a uvsC+ strain, the uvsC114 mutant and the uvsC null mutant were compared. The uvsC null mutant was more sensitive to both UV and MMS than the uvsC114 mutant. The uvsC114 mutant arrested in meiotic prophase-I. The uvsC null mutant arrested at an earlier stage, before the onset of meiosis. One possible interpretation of these meiotic phenotypes is that the A. nidulans homologue of Rad51 of yeast has a role both in the specialized processes preceding meiosis and in meiotic prophase I.
Prokaryotic cells: structural organisation of the cytoskeleton and organelles
Directory of Open Access Journals (Sweden)
Wanderley de Souza
2012-05-01
Full Text Available For many years, prokaryotic cells were distinguished from eukaryotic cells based on the simplicity of their cytoplasm, in which the presence of organelles and cytoskeletal structures had not been discovered. Based on current knowledge, this review describes the complex components of the prokaryotic cell cytoskeleton, including (i tubulin homologues composed of FtsZ, BtuA, BtuB and several associated proteins, which play a fundamental role in cell division, (ii actin-like homologues, such as MreB and Mb1, which are involved in controlling cell width and cell length, and (iii intermediate filament homologues, including crescentin and CfpA, which localise on the concave side of a bacterium and along its inner curvature and associate with its membrane. Some prokaryotes exhibit specialised membrane-bound organelles in the cytoplasm, such as magnetosomes and acidocalcisomes, as well as protein complexes, such as carboxysomes. This review also examines recent data on the presence of nanotubes, which are structures that are well characterised in mammalian cells that allow direct contact and communication between cells.
Drakouli, Sotiria; Lyberopoulou, Aggeliki; Papathanassiou, Maria; Mylonis, Ilias; Georgatsou, Eleni
2017-08-01
Scaffold attachment factor B1 (SAFB1) is an integral component of the nuclear matrix of vertebrate cells. It binds to DNA on scaffold/matrix attachment region elements, as well as to RNA and a multitude of different proteins, affecting basic cellular activities such as transcription, splicing and DNA damage repair. In the present study, we show that enhancer of rudimentary homologue (ERH) is a new molecular partner of SAFB1 and its 70% homologous paralogue, scaffold attachment factor B2 (SAFB2). ERH interacts directly in the nucleus with the C-terminal Arg-Gly-rich region of SAFB1/2 and co-localizes with it in the insoluble nuclear fraction. ERH, a small ubiquitous protein with striking homology among species and a unique structure, has also been implicated in fundamental cellular mechanisms. Our functional analyses suggest that the SAFB/ERH interaction does not affect SAFB1/2 function in transcription (e.g. as oestrogen receptor α co-repressors), although it reverses the inhibition exerted by SAFB1/2 on the splicing kinase SR protein kinase 1 (SRPK1), which also binds on the C-terminus of SAFB1/2. Accordingly, ERH silencing decreases lamin B receptor and SR protein phosphorylation, which are major SRPK1 substrates, further substantiating the role of SAFB1 and SAFB2 in the co-ordination of nuclear function. © 2017 Federation of European Biochemical Societies.
Managed Play: The Media’s Impact on Play in the Australian Football League
Directory of Open Access Journals (Sweden)
Duncan Samuel Keith
2018-03-01
Full Text Available No industry has influenced the transformation of the Australian Football League (AFL into a professional, commercial business more than the media. Today, the AFL players are paid more than ever and are used as marketing tools to promote and sell the game, often to new fans in new markets of Australia - namely New South Wales and Queensland - who haven’t traditionally played Australian Football, preferring the rugby codes instead. But perhaps the biggest change in the AFL is that the play element is now used as function of business. Put simply, winning leads to more money. As such, the play element is now manipulated more than ever. The game has more coaches implementing more tactics, strategies, game plans and set plays than ever before. These changes can be linked back to the media’s influence on the game. This paper utilises the combined observations and theories of Johan Huizinga and Pierre Bourdieu to create a theoretical lens through which we can understand the media’s growing influence in sport and its impact on play’s transformation. The theory will then be expounded through an extensive analysis of the media’s influence in the AFL, particularly its play element. This analysis will be supported with insights and views from AFL fans, members, commentators and theorists.
Anugraha, Gandhirajan; Jeyaprita, Parasurama Jawaharlal; Madhumathi, Jayaprakasam; Sheeba, Tamilvanan; Kaliraj, Perumal
2013-12-01
Although multiple vaccine strategy for lymphatic filariasis has provided tremendous hope, the choice of antigens used in combination has determined its success in the previous studies. Multiple antigens comprising key vaccine candidates from different life cycle stages would provide a promising strategy if the antigenic combination is chosen by careful screening. In order to analyze one such combination, we have used a chimeric construct carrying the well studied B. malayi antigens thioredoxin (BmTRX) and venom allergen homologue (BmVAH) as a fusion protein (TV) and evaluated its immune responses in mice model. The efficacy of fusion protein vaccine was explored in comparison with the single antigen vaccines and their cocktail. In mice, TV induced significantly high antibody titer of 1,28,000 compared to cocktail vaccine TRX+VAH (50,000) and single antigen vaccine TRX (16,000) or VAH (50,000). Furthermore, TV elicited higher level of cellular proliferative response together with elevated levels of IFN-γ, IL-4 and IL-5 indicating a Th1/Th2 balanced response. The isotype antibody profile showed significantly high level of IgG1 and IgG2b confirming the balanced response elicited by TV. Immunization with TV antigen induced high levels of both humoral and cellular immune responses compared to either cocktail or antigen given alone. The result suggests that TV is highly immunogenic in mice and hence the combination needs to be evaluated for its prophylactic potential.
Gmitrova, Vlasta
2013-01-01
We compared the efficiency of teacher's direct and indirect intervention into pretend play. Three hundred sixty-eight kindergarten children and 92 qualified kindergarten teachers were involved in the study. In the control group, a teacher indirectly initiated a play, creating a playing corner adjusted to the theme of the pretend play and during…
Energy Technology Data Exchange (ETDEWEB)
William L. Fisher; Eugene M. Kim
2000-12-01
A detailed natural gas ultimate recovery growth (URG) analysis of the Texas Gulf Coast Basin and East Texas has been undertaken. The key to such analysis was determined to be the disaggregation of the resource base to the play level. A play is defined as a conceptual geologic unit having one or more reservoirs that can be genetically related on the basis of depositional origin of the reservoir, structural or trap style, source rocks and hydrocarbon generation, migration mechanism, seals for entrapment, and type of hydrocarbon produced. Plays are the geologically homogeneous subdivision of the universe of petroleum pools within a basin. Therefore, individual plays have unique geological features that can be used as a conceptual model that incorporates geologic processes and depositional environments to explain the distribution of petroleum. Play disaggregation revealed important URG trends for the major natural gas fields in the Texas Gulf Coast Basin and East Texas. Although significant growth and future potential were observed for the major fields, important URG trends were masked by total, aggregated analysis based on a broad geological province. When disaggregated by plays, significant growth and future potential were displayed for plays that were associated with relatively recently discovered fields, deeper reservoir depths, high structural complexities due to fault compartmentalization, reservoirs designated as tight gas/low-permeability, and high initial reservoir pressures. Continued technology applications and advancements are crucial in achieving URG potential in these plays.
Wenzel, H G; Bakken, I J; Johansson, A; Götestam, K G; Øren, Anita
2009-12-01
Computer games are the most advanced form of gaming. For most people, the playing is an uncomplicated leisure activity; however, for a minority the gaming becomes excessive and is associated with negative consequences. The aim of the present study was to investigate computer game-playing behaviour in the general adult Norwegian population, and to explore mental health problems and self-reported consequences of playing. The survey includes 3,405 adults 16 to 74 years old (Norway 2007, response rate 35.3%). Overall, 65.5% of the respondents reported having ever played computer games (16-29 years, 93.9%; 30-39 years, 85.0%; 40-59 years, 56.2%; 60-74 years, 25.7%). Among 2,170 players, 89.8% reported playing less than 1 hr. as a daily average over the last month, 5.0% played 1-2 hr. daily, 3.1% played 2-4 hr. daily, and 2.2% reported playing > 4 hr. daily. The strongest risk factor for playing > 4 hr. daily was being an online player, followed by male gender, and single marital status. Reported negative consequences of computer game playing increased strongly with average daily playing time. Furthermore, prevalence of self-reported sleeping problems, depression, suicide ideations, anxiety, obsessions/ compulsions, and alcohol/substance abuse increased with increasing playing time. This study showed that adult populations should also be included in research on computer game-playing behaviour and its consequences.
Communication in Symbolic Play.
Umek, Ljubica Marjanovic; Musek, Petra Lesnik; Kranjc, Simona
2001-01-01
Analyzed records of Slovene children's speech from a linguistic point of view and established differences in communication patterns with regard to the children's ages and the type of symbolic play. Found a shift in play from make-believe with regard to objects to roleplay related to social context. The older the child, the more language functions…
Play on: Retrospective Reports of the Persistence of Pretend Play into Middle Childhood
Smith, Eric D.; Lillard, Angeline S.
2012-01-01
Piaget (1962) asserted that children stop engaging in pretend play when they enter the concrete operational stage because they become able to accommodate reality and no longer need to assimilate it to their wishes. Consistent also with the views of Vygotsky, discussion of pretend play in developmental psychology is typically confined to early…
Competitions as a form of public gusle playing performance
Directory of Open Access Journals (Sweden)
Lajić-Mihajlović Danka
2011-01-01
Full Text Available This paper offers an ethnomusicological perspective on competitions of guslars (players of a single-stringed musical instrument gusle predominantly used to accompany the voice of a singer reciting epic poetry, here interpreted as a specific form of public music performance. First competitions were organized between World Wars (1924-1933, afterwards being established in 1971 and since then organized (with a short interruption in Serbia, Montenegro and the Republic of Srpska. Apart from gusle players and the audience participating in this interaction, these competitions introduced into the focus the very organizers as well. The importance of collectivity as an idea interwoven into epic ethos has become a powerful means of manipulation used by authorities. Their interests have been put forward primarily through the poetic content of new songs. Ideology, though, is not only reflected in the competition repertoire. It is also felt in other forms of public gusle playing practice (such as performances with miscellaneous programme, concerts etc.. The sense of competitiveness, as a type of communicational situation, is far strongly felt in the music dimension. Limited in duration, the performance was reduced to only fragments of songs, which, on the other side, caused a change in gusle playing. The traditional style implied economizing with player’s energy and dramatization tailored to suit the context of long-lasting songs, whereas per-forming of fragments resulted in a more grandiose style aimed at making momentary impression: intensive, vigorous singing in the upper vocal register, using a wide range of expressive devices within short time etc. After studying the competition rules, key formal regulations, and the organization of competitions so far, I discerned that those epic poems have been dominantly regarded as poetry. One of crucial reasons for this is wider communicability of verbal to music discourse, but also more straightforward conveyance
Level playing field with political tact
International Nuclear Information System (INIS)
Onderstal, S.; Appelman, M.
2004-01-01
Businesses, interest groups and policy administrators plead for a level playing field. However, those administrators interpret the level playing field notion in different ways and thus create confusion. In this article the level playing field is explained and a framework discussed by means of which the government can study policy problems in which the level playing field is of importance [nl
Genesereth, Michael
2014-01-01
General game players are computer systems able to play strategy games based solely on formal game descriptions supplied at ""runtime"" (n other words, they don't know the rules until the game starts). Unlike specialized game players, such as Deep Blue, general game players cannot rely on algorithms designed in advance for specific games; they must discover such algorithms themselves. General game playing expertise depends on intelligence on the part of the game player and not just intelligence of the programmer of the game player.GGP is an interesting application in its own right. It is intell
Comello, Maria Leonora G; Francis, Diane B; Marshall, Laura Heisner; Puglia, Deanna R
2016-08-01
Playing recreational videogames is a common activity, yet little is known about its role in the lives of people who are coping with serious illness. These individuals may experience depression and isolation and may turn to games to help alleviate negative experiences and support well-being. We explored these possibilities in the context of cancer survivors. The study aimed to discover motivations underlying game play and the extent to which motivations are associated with psychological health and well-being. We conducted a cross-sectional online survey of survivors who play recreational games (N = 794). Key variables were motivations and indicators of psychological health, including self-efficacy in cancer communications, resilient coping, and beliefs that one is living a fulfilling and meaningful life (flourishing). Participants were most likely to be motivated to play for stimulation and a sense of accomplishment (intrinsic rewards), followed by development of self, sense of community, and personal affirmation. Multiple regression analyses revealed positive associations between playing for intrinsic rewards and all three psychological health outcomes. Playing for a sense of community was also positively associated with coping and flourishing. Playing recreational videogames, particularly to receive intrinsic rewards and to connect with others, may play a supportive role in the psychological health of survivors. Findings suggest future areas for research and implications for development of serious games.
Play Behavior in Wolves: Using the ‘50:50’ Rule to Test for Egalitarian Play Styles
Cafazzo, Simona; Marshall-Pescini, Sarah; Virányi, Zsófia; Kotrschal, Kurt; Range, Friederike
2016-01-01
Social play is known as a cooperative interaction between individuals involving multiple mechanisms. However, the extent to which the equality of individuals’ play styles affects the interaction has not been studied in many species. Dyadic play between wolf puppies, as well as between puppies and adults, was studied to investigate both self-handicapping and offensive behaviors to determine the extent to which wolves engage in play styles where one individual does not dominate the play. Our results did not support the hypothesized ‘50:50’ rule, which suggests that more advantaged individuals should show higher rates of self-handicapping behaviors in order to facilitate play with others. Adult wolves performed significantly less self-handicapping behaviors than their puppy partners, and they performed significantly more offensive behaviors than their puppy partners. While the ‘50:50’ rule was not supported at any time during our study period, dyads consisting of two puppies had significantly more equal play than dyads consisting of one puppy and one adult. These results suggest that wolf puppies are more likely to play on equal terms with similarly-aged play partners, while the dominance status of the partners dictates offensive and self-handicapping behaviors between animals of different ages. PMID:27167522
DEFF Research Database (Denmark)
Pors, Justine Grønbæk; Åkerstrøm Andersen, Niels
2015-01-01
intact. In its final sections, the article discusses what happens to conditions of decision-making when organisations do not just see undecidability as a given condition, but as a limited resource indispensable for change and renewal. The article advances discussions of organisational play by exploring...
Farley, Thomas A; Meriwether, Rebecca A; Baker, Erin T; Rice, Janet C; Webber, Larry S
2008-03-01
Promotion of physical activity in children depends on an understanding of how children use play equipment. We conducted observations over 2 years of children in 2nd through 8th grades in a schoolyard with 5 distinct play areas with different amounts of play equipment. Children were more likely to play in areas with more installed play equipment, with densities of children in equipped areas 3.3 to 12.6 times higher than in an open grassy field. There were no significant differences by play area in the percent of children who were physically active at all, but children were more likely to be very active in areas with basketball goals and an installed play structure than in an open field. Playground equipment appeared to have a strong influence on where children played and a moderate influence on levels of activity. To maximize physical activity in children, playgrounds should be designed with ample and diverse play equipment.
Directory of Open Access Journals (Sweden)
Martin Mahro
Full Text Available In order to elucidate factors that determine substrate specificity and activity of mammalian molybdo-flavoproteins we performed site directed mutagenesis of mouse aldehyde oxidase 3 (mAOX3. The sequence alignment of different aldehyde oxidase (AOX isoforms identified variations in the active site of mAOX3 in comparison to other AOX proteins and xanthine oxidoreductases (XOR. Based on the structural alignment of mAOX3 and bovine XOR, differences in amino acid residues involved in substrate binding in XORs in comparison to AOXs were identified. We exchanged several residues in the active site to the ones found in other AOX homologues in mouse or to residues present in bovine XOR in order to examine their influence on substrate selectivity and catalytic activity. Additionally we analyzed the influence of the [2Fe-2S] domains of mAOX3 on its kinetic properties and cofactor saturation. We applied UV-VIS and EPR monitored redox-titrations to determine the redox potentials of wild type mAOX3 and mAOX3 variants containing the iron-sulfur centers of mAOX1. In addition, a combination of molecular docking and molecular dynamic simulations (MD was used to investigate factors that modulate the substrate specificity and activity of wild type and AOX variants. The successful conversion of an AOX enzyme to an XOR enzyme was achieved exchanging eight residues in the active site of mAOX3. It was observed that the absence of the K889H exchange substantially decreased the activity of the enzyme towards all substrates analyzed, revealing that this residue has an important role in catalysis.
Menand, Benoit
2002-01-01
TOR (target of rapamycin) protein kinases were identified in yeast, mammals and Drosophila as central controllers of cell growth. Thu, G1 to S phases progression through the cell cycle is blocked by rapamycin, a drug which specifically inhibits TOR activity by forming a ternary complex with the peptidyl-prolyl isomerase FKBP12 (FK506 and rapamycin binding protein), and the FKBP-rapamycin binding domain (FRB) of TOR proteins. This work presents the study, the Arabidopsis homologue of yeast and...
Playing with Daddy: Social Toy Play, Early Head Start, and Developmental Outcomes
Roggman, Lori A.; Boyce, Lisa; Cook, G. A.; Christiansen, K.; Jones, D.
2007-01-01
Research on fathers in Early Head Start (EHS) has provided an opportunity to study fathers from low-income families. We examined father-toddler social toy play in relation to EHS enrollment, fathers' psychosocial well-being, and children's developmental outcomes in a sample of 74 father-toddler dyads. Overall, our results show that father-toddler social toy play was more complex among fathers in an EHS program than among those in a comparison group. Greater complexity in father-toddler social...
Multispecies methods, technologies for play
DEFF Research Database (Denmark)
Jørgensen, Ida Kathrine Hammeleff; Wirman, Hanna
2016-01-01
This article discusses methodological considerations of user-centred design for non-human animals. These considerations are illustrated through a design research project that aims to apply digital technology to build games for orangutans’ enrichment. The article argues that design for other species......-human contributions in design. This method applies play as an interspecies co-creative act and can be used as a starting point for addressing questions of difference in play and designing games that allow for ambiguous play....
Leisure Today--the Many Faces of Play.
Hudson, Susan D.; And Others
1995-01-01
This series of papers examines the role of play from various angles, discussing play as an essential human function and universal experience, the role of play in developing cultural values and awareness, a symbolic interactionist view of play, early therapeutic recreation specialists, and the direction of commercialized play. (SM)
Gilbert, Juan E.
The acceptance of animation technologies is increasing. Video games, such as Sony PlayStation (SONY, 2002), have become part of the culture for young people from kindergarten through undergraduate school. Animation technologies have been implemented into educational systems in the form of animated pedagogical agents (Johnson, 2000). The research…
DEFF Research Database (Denmark)
Bang, Jytte Susanne
2012-01-01
The present article explores the role of music-related artefacts and technologies in children’s lives. More specifically, it analyzes how four 10- to 11-year old girls use CDs and DVD games in their music-play activities and which developmental themes and potentials may accrue from such activitie...
Edwards, Susan; Bird, Jo
2017-01-01
Early childhood education settings are characterized by the use of play-based learning and the assessment of children's play by teachers to promote further learning. A problem with technology use in early childhood settings is that little is known about how children learn to use technologies through play. This lack of knowledge makes it difficult…
Directory of Open Access Journals (Sweden)
Nandita Sahana
Full Text Available The ubiquitin/26S proteasome system plays an essential role not only in maintaining protein turnover, but also in regulating many other plant responses, including plant-pathogen interactions. Previous studies highlighted different roles of the 20S proteasome in plant defense during virus infection, either indirectly through viral suppressor-mediated degradation of Argonaute proteins, affecting the RNA interference pathway, or directly through modulation of the proteolytic and RNase activity of the 20S proteasome, a component of the 20S proteasome, by viral proteins, affecting the levels of viral proteins and RNAs. Here we show that MG132, a cell permeable proteasomal inhibitor, caused an increase in papaya ringspot virus (PRSV accumulation in its natural host papaya (Carica papaya. We also show that the PRSV HcPro interacts with the papaya homologue of the Arabidopsis PAA (α1 subunit of the 20S proteasome, but not with the papaya homologue of Arabidopsis PAE (α5 subunit of the 20S proteasome, associated with the RNase activity, although the two 20S proteasome subunits interacted with each other. Mutated forms of PRSV HcPro showed that the conserved KITC54 motif in the N-terminal domain of HcPro was necessary for its binding to PAA. Co-agroinfiltration assays demonstrated that HcPro expression mimicked the action of MG132, and facilitated the accumulation of bothtotal ubiquitinated proteins and viral/non-viral exogenous RNA in Nicotiana benthamiana leaves. These effects were not observed by using an HcPro mutant (KITS54, which impaired the HcPro - PAA interaction. Thus, the PRSV HcPro interacts with a proteasomal subunit, inhibiting the action of the 20S proteasome, suggesting that HcPro might be crucial for modulating its catalytic activities in support of virus accumulation.
Directory of Open Access Journals (Sweden)
E Wyroba
2009-08-01
Full Text Available Phagosome maturation is a complex process enabling degradation of internalised particles. Our data obtained at the gene, protein and cellular level indicate that the set of components involved in this process and known up to now in mammalian cells is functioning in unicellular eukaryote. Rab7-interacting partners: homologues of its effector RILP (Rab-interacting lysosomal protein and LAMP-2 (lysosomal membrane protein 2 as well as a7 subunit of the 26S proteasome were revealed in Paramecium phagolysosomal compartment. We identified the gene/transcript fragments encoding RILP-related proteins (RILP1 and RILP2 in Paramecium by PCR/RT-PCR and sequencing. The deduced amino acid sequences of RILP1 and RILP2 show 60.5% and 58.3% similarity, respectively, to the region involved in regulating of lysosomal morphology and dynein-dynactin recruitment of human RILP. RILP colocalised with Rab7 in Paramecium lysosomes and at phagolysosomal membrane during phagocytosis of both the latex beads and bacteria. In the same compartment LAMP-2 was present and its expression during latex internalisation was 2.5-fold higher than in the control when P2 protein fractions (100 000 x g of equal load were quantified by immunoblotting. LAMP-2 crossreacting polypeptide of ~106 kDa was glycosylated as shown by fluorescent and Western analysis of the same blot preceded by PNGase F treatment. The a7 subunit of 26S proteasome was detected close to the phagosomal membrane in the small vesicles, in some of which it colocalised with Rab7. Immunoblotting confirmed presence of RILPrelated polypeptide and a7 subunit of 26S proteasome in Paramecium protein fractions. These results suggest that Rab7, RILP and LAMP-2 may be involved in phagosome maturation in Paramecium.
Kazama, Yusuke; Ishii, Chizu; Schroeder, Alice L; Shimada, Hisao; Wakabayashi, Michiyoshi; Inoue, Hirokazu
2008-02-01
The mutagen sensitive uvs-3 and mus-9 mutants of Neurospora show mutagen and hydroxyurea sensitivity, mutator effects and duplication instability typical of recombination repair and DNA damage checkpoint defective mutants. To determine the nature of these genes we used cosmids from a genomic library to clone the uvs-3 gene by complementation for MMS sensitivity. Mutation induction by transposon insertion and RIP defined the coding sequence. RFLP analysis confirmed that this sequence maps in the area of uvs-3 at the left telomere of LG IV. Analysis of the cDNA showed that the UVS-3 protein contains an ORF of 969 amino acids with one intron. It is homologous to UvsD of Aspergillus nidulans, a member of the ATRIP family of checkpoint proteins. It retains the N' terminal coiled-coil motif followed by four basic amino acids typical of these proteins and shows the highest homology in this region. The uvsD cDNA partially complements the defects of the uvs-3 mutation. The uvs-3 mutant shows a higher level of micronuclei in conidia and failure to halt germination and nuclear division in the presence of hydroxyurea than wild type, suggesting checkpoint defects. ATRIP proteins bind tightly to ATR PI-3 kinase (phosphatidylinositol 3-kinase) proteins. Therefore, we searched the Neurospora genome sequence for homologues of the Aspergillus nidulans ATR, UvsB. A uvsB homologous sequence was present in the right arm of chromosome I where the mus-9 gene maps. A cosmid containing this genomic DNA complemented the mus-9 mutation. The putative MUS-9 protein is 2484 amino acids long with eight introns. Homology is especially high in the C-terminal 350 amino acids that correspond to the PI-3 kinase domain. In wild type a low level of constitutive mRNA is present for both genes. It is transiently induced upon UV exposure.
Directory of Open Access Journals (Sweden)
Srinivas Garlapati
2011-03-01
Full Text Available Translation of Giardiavirus (GLV mRNA is initiated at an internal ribosome entry site (IRES in the viral transcript. The IRES localizes to a downstream portion of 5' untranslated region (UTR and a part of the early downstream coding region of the transcript. Recent studies indicated that the IRES does not require a pre-initiation complex to initiate translation but may directly recruit the small ribosome subunit with the help of a number of trans-activating protein factors. A La autoantigen homologue in the viral host Giardia lamblia, GlLa, was proposed as one of the potential trans-activating factors based on its specific binding to GLV-IRES in vitro. In this study, we further elucidated the functional role of GlLa in GLV-IRES mediated translation in Giardia by knocking down GlLa with antisense morpholino oligo, which resulted in a reduction of GLV-IRES activity by 40%. An over-expression of GlLa in Giardia moderately stimulated GLV-IRES activity by 20%. A yeast inhibitory RNA (IRNA, known to bind mammalian and yeast La autoantigen and inhibit Poliovirus and Hepatitis C virus IRES activities in vitro and in vivo, was also found to bind to GlLa protein in vitro and inhibited GLV-IRES function in vivo. The C-terminal domain of La autoantigen interferes with the dimerization of La and inhibits its function. An over-expression of the C-terminal domain (200-348aa of GlLa in Giardia showed a dominant-negative effect on GLV-IRES activity, suggesting a potential inhibition of GlLa dimerization. HA tagged GlLa protein was detected mainly in the cytoplasm of Giardia, thus supporting a primary role of GlLa in translation initiation in Giardiavirus.
Is it play? Towards a reconceptualisation of role-play from an activity theory perspective.
van Oers, B.
2013-01-01
This article proposes a reconceptualisation of role play on the basis of the Cultural-Historical theory (Vygotskij -Leont'ev - El'konin). The theory conceives of play as a specific mode of activity defined by a format that includes three basic parameters (rules, degrees of freedom and involvement).
Mammalian play: training for the unexpected.
Spinka, M; Newberry, R C; Bekoff, M
2001-06-01
In this review, we present a new conceptual framework for the study of play behavior, a hitherto puzzling array of seemingly purposeless and unrelated behavioral elements that are recognizable as play throughout the mammalian lineage. Our major new functional hypothesis is that play enables animals to develop flexible kinematic and emotional responses to unexpected events in which they experience a sudden loss of control. Specifically, we propose that play functions to increase the versatility of movements used to recover from sudden shocks such as loss of balance and falling over, and to enhance the ability of animals to cope emotionally with unexpected stressful situations. To obtain this "training for the unexpected," we suggest that animals actively seek and create unexpected situations in play through self-handicapping; that is, deliberately relaxing control over their movements or actively putting themselves into disadvantageous positions and situations. Thus, play is comprised of sequences in which the players switch rapidly between well-controlled movements similar to those used in "serious" behavior and self-handicapping movements that result in temporary loss of control. We propose that this playful switching between in-control and out-of-control elements is cognitively demanding, setting phylogenetic and ontogenetic constraints on play, and is underlain by neuroendocrinological responses that produce a complex emotional state known as "having fun." Furthermore, we propose that play is often prompted by relatively novel or unpredictable stimuli, and is thus related to, although distinct from, exploration. We present 24 predictions that arise from our new theoretical framework, examining the extent to which they are supported by the existing empirical evidence and contrasting them with the predictions of four major alternative hypotheses about play. We argue that our "training for the unexpected" hypothesis can account for some previously puzzling
Lindsey, Eric W.
2014-01-01
Research Findings: Two forms of exercise play (toy mediated and non-mediated) and 2 forms of rough-and-tumble (R&T) play (chase and fighting) were examined in relation to preschoolers' peer competence. A total of 148 preschoolers (78 boys, 89 Euro-Americans) were observed during free play at their university-sponsored child care center. The…
Petrů, Milada; Spinka, Marek; Charvátová, Veronika; Lhota, Stanislav
2009-08-01
Play behavior has been viewed as a mixture of elements drawn from "serious" behavior, interspersed by ritualized play signals. Two other types of play behaviors have been overlooked: patterns that are dissimilar from any serious behavior and patterns with self-handicapping character, that is, those that put the animal into unnecessary disadvantageous positions or situations. Here the authors show that these 2 types of patterns can constitute a major part of play repertoire. From our own videorecordings and observations, we constructed play ethograms of 5 monkey species (Semnopithecus entellus, Erythrocebus patas, Chlorocebus pygerythrus, Cercopithecus neglectus, and Cercopithecus diana). The authors evaluated the self-handicapping character of each pattern and in Hanuman langurs also the (dis)similarity to serious behavior. Of the 74 patterns in the 5 species, 33 (45%) were judged to have a self-handicapping character. Of 48 patterns observed in langurs, 16 (33%) were totally dissimilar to any serious langur behavior known to us. The authors discuss the possibility that the different types of play elements may have different functions in play. Copyright 2009 APA, all rights reserved.
Free-to-Play -liiketoimintamalli
Tähtö, E. (Elias)
2016-01-01
Tiivistelmä Tutkielmani tarkoitus on tutustua erilaisiin pelejen sisäisiin mikrotransaktioihin sekä monetisaatioon. Peliteollisuuden tämän hetken suosituimpana pelimuotona on niin sanotut Free-To-Play -pelit, joiden liikevaihto perustuu täysin käyttäjien suorittamiin mikrotransaktioihin, joilla ostetaan erilaisia pelin sisäisiä hyödykkeitä. Free-to-play -malli on ansaintamallina vielä aika uusi, vaikkakin mikrotransaktioita...
DEFF Research Database (Denmark)
Eichberg, Henning
2015-01-01
Can play be defined? There is reason to raise critical questions about the established academic demand that at phenomenon – also in humanist studies – should first of all be defined, i.e. de-lineated and by neat lines limited to a “little box” that can be handled. The following chapter develops....... Human beings can very well understand play – or whatever phenomenon in human life – without defining it....
Zhang, Huoming; Wong, Yuehim; Wang, Hao; Chen, Zhangfan; Arellano, Shawn M.; Ravasi, Timothy; Qian, Peiyuan
2011-01-01
The marine invertebrate Bugula neritina has a biphasic life cycle that consists of a swimming larval stage and a sessile juvenile and adult stage. The attachment of larvae to the substratum and their subsequent metamorphosis have crucial ecological
von Gontard, Alexander; Lehmkuhl, Gerd
2003-01-01
Play therapies are psychotherapies with the medium of play primarily for children under 12 years of age, which can be differentiated according to their theoretical constructs and actual practice. Play therapies have gained importance and relevance in the 1990's, reflected in a wide range of publications. Following trends can be discerned: narrow concepts defined by individual schools of psychotherapy have been left. Different forms of play therapy, as well as behavioural and family therapy have been integrated. Focussed short-term and therapies for specific disorders have been developed. The aim of the first part of this paper is to present an overview of traditional forms of playtherapy, with a focus on the Individual Therapy of A. Adler, the Analytic Psychotherapy of C. G. Jung, Sandplay Therapy of D. Kalff and child-centered (non-directive) play therapy.
Crucial role of antibodies to pertactin in Bordetella pertussis immunity
Hellwig, SMM; Rodriguez, ME; Berbers, GAM; de Winkel, JGJV; Mooi, FR
2003-01-01
Pertussis, a serious infectious disease of the respiratory tract caused by Bordetella pertussis, is reemerging in vaccinated populations. Efforts to curtail this disease are hampered by limited insight into the basis of protective immunity. Opsonophagocytosis was recently found to play a central
Non-Digital Game Playing by Older Adults.
Mortenson, W Ben; Sixsmith, Andrew; Kaufman, David
2017-09-01
Research on video games' effect on cognition and behaviour has been extensive, yet little research has explored non-digital forms of game playing, especially among older adults. As part of a larger survey on game playing, 886 respondents (≥ age 55) filled out questionnaires about non-digital game play. The study aims were to determine perceived benefits of non-digital game play and to determine socio-demographic factors that might predict perceived benefits. Survey results indicate that non-digital game playing is social in nature and common (73% of respondents) among older adults. Older adults play for fun, but also to help maintain their cognition. Regression analyses indicated various socio-demographic factors - age, education, gender, and race - were independently associated with perceived benefits from game playing. The results thus emphasize the importance of non-digital game playing in this population and suggest that efforts to facilitate game playing may improve social interactions and quality of life.
Learning, Play, and Your Newborn
... Staying Safe Videos for Educators Search English Español Learning, Play, and Your Newborn KidsHealth / For Parents / Learning, ... Some Other Ideas Print What Is My Newborn Learning? Play is the chief way that infants learn ...
Parental Involvement In Play Therapy
Ohlson, E. Lamonte
1976-01-01
Play therapy acts as a medium of expression for children. The purpose of this article is to outline a methodological approach as well as to emphasize the necessity of including the parent in the play therapy situation. (Author)
Directory of Open Access Journals (Sweden)
Nikola Kellner
2014-01-01
Full Text Available The conserved NineTeen protein complex (NTC is an integral subunit of the spliceosome and required for intron removal during pre-mRNA splicing. The complex associates with the spliceosome and participates in the regulation of conformational changes of core spliceosomal components, stabilizing RNA-RNA- as well as RNA-protein interactions. In addition, the NTC is involved in cell cycle checkpoint control, response to DNA damage, as well as formation and export of mRNP-particles. We have identified the Num1 protein as the homologue of SPF27, one of NTC core components, in the basidiomycetous fungus Ustilago maydis. Num1 is required for polarized growth of the fungal hyphae, and, in line with the described NTC functions, the num1 mutation affects the cell cycle and cell division. The num1 deletion influences splicing in U. maydis on a global scale, as RNA-Seq analysis revealed increased intron retention rates. Surprisingly, we identified in a screen for Num1 interacting proteins not only NTC core components as Prp19 and Cef1, but several proteins with putative functions during vesicle-mediated transport processes. Among others, Num1 interacts with the motor protein Kin1 in the cytoplasm. Similar phenotypes with respect to filamentous and polar growth, vacuolar morphology, as well as the motility of early endosomes corroborate the genetic interaction between Num1 and Kin1. Our data implicate a previously unidentified connection between a component of the splicing machinery and cytoplasmic transport processes. As the num1 deletion also affects cytoplasmic mRNA transport, the protein may constitute a novel functional interconnection between the two disparate processes of splicing and trafficking.
Energy Technology Data Exchange (ETDEWEB)
Shimamura, Mai; Kyotani, Akane [Department of Applied Biology, Kyoto Institute of Technology, Matsugasaki, Sakyo-ku, Kyoto 606-8585 (Japan); Insect Biomedical Research Center, Kyoto Institute of Technology, Matsugasaki, Sakyo-ku, Kyoto 606-8585 (Japan); Azuma, Yumiko [Department of Neurology, Kyoto Prefectural University of Medicine, 465 Kajii-cho,Kamigyo-ku, Kyoto 602-8566 (Japan); Yoshida, Hideki; Binh Nguyen, Thanh [Department of Applied Biology, Kyoto Institute of Technology, Matsugasaki, Sakyo-ku, Kyoto 606-8585 (Japan); Insect Biomedical Research Center, Kyoto Institute of Technology, Matsugasaki, Sakyo-ku, Kyoto 606-8585 (Japan); Mizuta, Ikuko; Yoshida, Tomokatsu; Mizuno, Toshiki [Department of Neurology, Kyoto Prefectural University of Medicine, 465 Kajii-cho,Kamigyo-ku, Kyoto 602-8566 (Japan); Nakagawa, Masanori [North Medical Center, Kyoto Prefectural University of Medicine, 465 Kajii-cho, Kamigyo-ku, Kyoto 602-8566 (Japan); Tokuda, Takahiko, E-mail: ttokuda@koto.kpu-m.ac.jp [Department of Neurology, Kyoto Prefectural University of Medicine, 465 Kajii-cho,Kamigyo-ku, Kyoto 602-8566 (Japan); Department of Molecular Pathobiology of Brain Diseases, Graduate School of Medical Science, Kyoto Prefectural University of Medicine, 465 Kajii-cho, Kamigyo-ku, Kyoto 602-8566 (Japan); Yamaguchi, Masamitsu, E-mail: myamaguc@kit.ac.jp [Department of Applied Biology, Kyoto Institute of Technology, Matsugasaki, Sakyo-ku, Kyoto 606-8585 (Japan); Insect Biomedical Research Center, Kyoto Institute of Technology, Matsugasaki, Sakyo-ku, Kyoto 606-8585 (Japan)
2014-08-01
Amyotrophic Lateral Sclerosis (ALS) is a fatal neurodegenerative disease that causes progressive muscular weakness. Fused in Sarcoma (FUS) that has been identified in familial ALS is an RNA binding protein that is normally localized in the nucleus. However, its function in vivo is not fully understood. Drosophila has Cabeza (Caz) as a FUS homologue and specific knockdown of Caz in the eye imaginal disc and pupal retina using a GMR-GAL4 driver was here found to induce an abnormal morphology of the adult compound eyes, a rough eye phenotype. This was partially suppressed by expression of the apoptosis inhibitor P35. Knockdown of Caz exerted no apparent effect on differentiation of photoreceptor cells. However, immunostaining with an antibody to Cut that marks cone cells revealed fusion of these and ommatidia of pupal retinae. These results indicate that Caz knockdown induces apoptosis and also inhibits differentiation of cone cells, resulting in abnormal eye morphology in adults. Mutation in EGFR pathway-related genes, such as rhomboid-1, rhomboid-3 and mirror suppressed the rough eye phenotype induced by Caz knockdown. Moreover, the rhomboid-1 mutation rescued the fusion of cone cells and ommatidia observed in Caz knockdown flies. The results suggest that Caz negatively regulates the EGFR signaling pathway required for determination of cone cell fate in Drosophila. - Highlights: • Knockdown of Cabeza induced rough eye phenotype. • Knockdown of Cabeza induced fusion of cone cells in pupal retinae. • Knockdown of Cabeza induced apoptosis in pupal retinae. • Mutation in EGFR pathway-related genes suppressed the rough eye phenotype. • Cabeza may negatively regulate the EGFR pathway.
Directory of Open Access Journals (Sweden)
Megan L. Frank
2018-04-01
Full Text Available Background/Objective: Physical activity (PA is important in reducing childhood obesity, yet a majority of children are not meeting PA guidelines. Schools have been identified as a place to promote childhood PA. The purpose of this study was to determine the best type of physically active recess period to increase preschool-aged children's PA. Methods: PA was measured via accelerometers in preschool-aged children (n = 29 during three, 30-min recess conditions (control; structured play; free play on separate school days. Tertile splits were performed based on PA during the free play condition and children were divided into three groups: highly, moderately and least active. Results: For the aggregated sample, children were more (p ≤ 0.001 active during the free play (1282 ± 662 counts. min−1 and structured play (1416 ± 448 counts. min−1 recess versus the control condition (570 ± 460 counts. min−1 and activity was not different between the free play and structured conditions. However, children who were the most active during free play (1970 ± 647 counts·min−1 decreased (p ≤ 0.05 activity during structured play (1462 ± 535 counts·min−1, whereas children who were moderately active (1031 ± 112 counts·min−1 or the least (530 ± 239 counts·min−1 active during free play increased activity during structured play (1383 ± 345 counts·min−1 moderately active, 1313 ± 413 counts·min−1 least active. Conclusion: Providing a physically-active recess period will contribute to preschool-aged children meeting the recommended PA guidelines; however, different children may respond in a different way based upon the structure of the recess period.
Play Therapy: Role in Reading Improvement.
Carmichael, Karla
1991-01-01
Reviews the literature concerning the role of play therapy (particularly sandplay and nondirected play therapy) in the improvement of reading. Suggests that the role of play therapy is to support the child, encourage the child, and build self-esteem thus creating the optimal learning environment for reading improvement. (RS)
Lundgrén-Laine, Heljä; Kontio, Elina; Kauko, Tommi; Korvenranta, Heikki; Forsström, Jari; Salanterä, Sanna
2013-01-29
Although information technology adequately supports clinical care in many intensive care units (ICUs), it provides much poorer support for the managerial information needed to coordinate multi-professional care. To gain a general view of the most crucial multi-professional information needs of ICU shift leaders a national survey was conducted, focusing on the information needs of charge nurses and intensivists. Based on our previous observation study an online survey was developed, containing 122 information need statements related to the decision-making of ICU shift leaders. Information need statements were divided into six dimensions: patient admission, organisation and management of work, allocation of staff and material resources, special treatments, and patient discharge. This survey involved all ICU shift leaders (n = 738) who worked in any of the 17 highest level ICUs for adults in university hospitals in Finland during the autumn of 2009. Both charge nurses' and intensivists' crucial information needs for care coordination were evaluated. Two hundred and fifty-seven (50%) charge nurses and 96 (43%) intensivists responded to the survey. The consistency of the survey was found to be good (Cronbach's α scores between .87-.97, with a total explanatory power of 64.53%). Altogether, 57 crucial information needs for care coordination were found; 22 of which were shared between shift leaders. The most crucial of these information needs were related to organisation and management, patient admission, and allocation of staff resources. The associations between working experience, or shift leader acting frequencies, and crucial information needs were not statistically significant. However, a statistically significant difference was found between the number of ICU beds and the ICU experience of charge nurses with information needs, under the dimension of organisation and management of work. The information needs of charge nurses and intensivists differed. Charge nurses
Directory of Open Access Journals (Sweden)
Lundgrén-Laine Heljä
2013-01-01
Full Text Available Abstract Background Although information technology adequately supports clinical care in many intensive care units (ICUs, it provides much poorer support for the managerial information needed to coordinate multi-professional care. To gain a general view of the most crucial multi-professional information needs of ICU shift leaders a national survey was conducted, focusing on the information needs of charge nurses and intensivists. Methods Based on our previous observation study an online survey was developed, containing 122 information need statements related to the decision-making of ICU shift leaders. Information need statements were divided into six dimensions: patient admission, organisation and management of work, allocation of staff and material resources, special treatments, and patient discharge. This survey involved all ICU shift leaders (n = 738 who worked in any of the 17 highest level ICUs for adults in university hospitals in Finland during the autumn of 2009. Both charge nurses’ and intensivists’ crucial information needs for care coordination were evaluated. Results Two hundred and fifty-seven (50% charge nurses and 96 (43% intensivists responded to the survey. The consistency of the survey was found to be good (Cronbach’s α scores between .87–.97, with a total explanatory power of 64.53%. Altogether, 57 crucial information needs for care coordination were found; 22 of which were shared between shift leaders. The most crucial of these information needs were related to organisation and management, patient admission, and allocation of staff resources. The associations between working experience, or shift leader acting frequencies, and crucial information needs were not statistically significant. However, a statistically significant difference was found between the number of ICU beds and the ICU experience of charge nurses with information needs, under the dimension of organisation and management of work. The information
Ikeda, Shohei; Satoh, Kimio; Kikuchi, Nobuhiro; Miyata, Satoshi; Suzuki, Kota; Omura, Junichi; Shimizu, Toru; Kobayashi, Kenta; Kobayashi, Kazuto; Fukumoto, Yoshihiro; Sakata, Yasuhiko; Shimokawa, Hiroaki
2014-06-01
Right ventricular (RV) failure is the leading cause of death in various cardiopulmonary diseases, including pulmonary hypertension. It is generally considered that the RV is vulnerable to pressure overload as compared with the left ventricle (LV). However, as compared with LV failure, the molecular mechanisms of RV failure are poorly understood, and hence therapeutic targets of the disorder remain to be elucidated. Thus, we aimed to identify molecular therapeutic targets for RV failure in a mouse model of pressure overload. To induce pressure overload to respective ventricles, we performed pulmonary artery constriction or transverse aortic constriction in mice. We first performed microarray analysis and found that the molecules related to RhoA/Rho-kinase and integrin pathways were significantly upregulated in the RV with pulmonary artery constriction compared with the LV with transverse aortic constriction. Then, we examined the responses of both ventricles to chronic pressure overload in vivo. We demonstrated that compared with transverse aortic constriction, pulmonary artery constriction caused greater extents of mortality, Rho-kinase expression (especially ROCK2 isoform), and oxidative stress in pressure-overloaded RV, reflecting the weakness of the RV in response to pressure overload. Furthermore, mice with myocardial-specific overexpression of dominant-negative Rho-kinase showed resistance to pressure overload-induced hypertrophy and dysfunction associated with reduced oxidative stress. Finally, dominant-negative Rho-kinase mice showed a significantly improved long-term survival in both pulmonary artery constriction and transverse aortic constriction as compared with littermate controls. These results indicate that the Rho-kinase pathway plays a crucial role in RV hypertrophy and dysfunction, suggesting that the pathway is a novel therapeutic target of RV failure in humans. © 2014 American Heart Association, Inc.
Solitary Play: Some Functional Reconsiderations
Moore, Nancy V.; And Others
1974-01-01
Solitary play in six kindergarten children was observed and coded for frequency and type in order to resolve iscrepancies in a Sex Birth Order interaction. Several facts concerning solitary play as indicative of independence and maturity are noted. (Author/ED)
Leung, Shuk-kwan S.; Lo, Jane-Jane
2010-01-01
This article features Sweet play math, a "math by the month" activity that involves decorating and making sugar cubes. Teachers may want to substitute straws, paper squares, alphabet blocks, or such commercially made manipulatives as Unifix[R] cubes for the real sweets. Given no allergy concerns, teachers and students alike would enjoy some sweet…
Cline, Jane E.; Smith, Brandy A.
2016-01-01
The inclusion of activities to develop sensory awareness, spatial thinking, and physical dexterity, operationalized through hands-on science lessons such as water play, have long been part of early childhood education. This practical article addresses Next Generation Science Standards K-2 ETS1-3 and K-2 ETS1-2 by having four-year-old…
We're in Math Class Playing Games, Not Playing Games in Math Class
McFeetors, P. Janelle; Palfy, Kylie
2017-01-01
Early experiences of reasoning while playing games of strategy are foundational for future proofs that students will be expected to build using conventionally structured arguments. But how did game playing in school occur? How can educators be sure that mathematical reasoning is going on? The authors investigated these questions to understand how…
The MCM-associated protein MCM-BP is important for human nuclear morphology.
Jagannathan, Madhav; Sakwe, Amos M; Nguyen, Tin; Frappier, Lori
2012-01-01
Mini-chromosome maintenance complex-binding protein (MCM-BP) was discovered as a protein that is strongly associated with human MCM proteins, known to be crucial for DNA replication in providing DNA helicase activity. The Xenopus MCM-BP homologue appears to play a role in unloading MCM complexes from chromatin after DNA synthesis; however, the importance of MCM-BP and its functional contribution to human cells has been unclear. Here we show that depletion of MCM-BP by sustained expression of short hairpin RNA (shRNA) results in highly abnormal nuclear morphology and centrosome amplification. The abnormal nuclear morphology was not seen with depletion of other MCM proteins and was rescued with shRNA-resistant MCM-BP. MCM-BP depletion was also found to result in transient activation of the G2 checkpoint, slowed progression through G2 and increased replication protein A foci, indicative of replication stress. In addition, MCM-BP depletion led to increased cellular levels of MCM proteins throughout the cell cycle including soluble MCM pools. The results suggest that MCM-BP makes multiple contributions to human cells that are not limited to unloading of the MCM complex.
Lin, Yuan-Na; Bhuwania, Ridhirama; Gromova, Kira; Failla, Antonio Virgilio; Lange, Tobias; Riecken, Kristoffer; Linder, Stefan; Kneussel, Matthias; Izbicki, Jakob R; Windhorst, Sabine
2015-07-30
Drosophila homologue of Diaphanous 1 (DIAPH1) regulates actin polymerization and microtubule (MT) stabilization upon stimulation with lysophosphatidic acid (LPA). Recently, we showed strongly reduced lung metastasis of DIAPH1-depleted colon cancer cells but we found accumulations of DIAPH1-depleted cells in bone marrow. Here, we analyzed possible organ- or tissue-specific metastasis of DIAPH1-depleted HCT-116 cells. Our data confirmed that depletion of DIAPH1 strongly inhibited lung metastasis and revealed that, in contrast to control cells, DIAPH1-depleted cells did not form metastases in further organs. Detailed mechanistic analysis on cells that were not stimulated with LPA to activate the cytoskeleton-modulating activity of DIAPH1, revealed that even under basal conditions DIAPH1 was essential for cellular adhesion to collagen. In non-stimulated cells DIAPH1 did not control actin dynamics but, interestingly, was essential for stabilization of microtubules (MTs). Additionally, DIAPH1 controlled directed vesicle trafficking and with this, local clustering of the adhesion protein integrin-β1 at the plasma membrane. Therefore, we conclude that under non-stimulating conditions DIAPH1 controls cellular adhesion by stabilizing MTs required for local clustering of integrin-β1 at the plasma membrane. Thus, blockade of DIAPH1-tubulin interaction may be a promising approach to inhibit one of the earliest steps in the metastatic cascade of colon cancer.
Play under Siege: A Historical Overview
Zigler, Edward F.; Bishop-Josef, Sandra J.
2009-01-01
In this updated version of their chapter from "Children's Play: The Roots of Reading" (published by ZERO TO THREE in 2004), the authors describe the recent attack on play, in both early childhood and elementary education. They provide a historical overview of the contentious relationship between play and cognitive development. The authors stress…
Creative interactive play for disabled children
DEFF Research Database (Denmark)
Marti, Patrizia; Pollini, Alessandro; Rullo, Alessia
2009-01-01
tools as well as interactive collaborative environments may represent a unique opportunity for disable children to full engage in play and have fun. The Creative Interactive Play workshop presents a collection of innovative interactive technologies and case studies for inclusive play and discusses...... the challenges and opportunities they can bid to disabled children....
Rogers, Liz; Steffan, Dana
2009-01-01
This article describes how to use clay as a potential material for young children to explore. As teachers, the authors find that their dialogue about the potential of clay as a learning medium raises many questions: (1) What makes clay so enticing? (2) Why are teachers noticing different play and conversation around the clay table as compared to…
Playful Interfaces : Introduction and History
Nijholt, Anton; Nijholt, A.
2014-01-01
In this short survey we have some historical notes about human-computer interface development with an emphasis on interface technology that has allowed us to design playful interactions with applications. The applications do not necessarily have to be entertainment applications. We can have playful
Golden Jubilee Photos: Theorists at play
2004-01-01
Alvaro De Rújula and John Ellis, two of the best-known theorists at CERN, on stage for the 1983 Theory Division play. The stereotype of theoretical physicists has them with their heads in the clouds. But CERN theorists have turned this notion on its head with their annual satirical plays. The first, in 1978, poked fun at the conflict between two competing groups who wanted the chance to perform the second experiment with the then-new Super Proton Synchrotron (SPS). Theorist John Ellis, who has been involved with most of the plays over the years, says the theorists "came up with the idea of defusing the tension by having the play." Each year, they base the play on a theme or symbol that will resonate with people from any culture. This first play was loosely based on l'Escalade, Geneva's annual celebration of having repelled the Duke of Savoy's attack in 1602. In the 1980s they staged "CERN lake," inspired by the ballet "Swan Lake"-and by the problems in digging the Large Electron Positron (LEP) collider's tu...
Playful mediation and virtual sociality
Directory of Open Access Journals (Sweden)
Sihem NAJJAR
2010-01-01
Full Text Available As a space of sociability, virtual games, especially online role playing games, allow us to capture the interest of the playfulness in social life, but they are means by which users are able to experiment their relationship to others. The virtual games as a mediation device, constitute a "pretext" to forge friendships, develop love relationships, improve language skills, discover other cultures, etc. Based on a sociological survey of Tunisian Internet users (both sexes fans of virtual games we try to show how playful mediation is producing a multifaceted virtual sociality inherent in our contemporary societies.
Directory of Open Access Journals (Sweden)
J. den Hertog
2009-01-01
Full Text Available The Policy of Independence. The Background of a Crucial Phrase in Dutch Foreign Policy 1900-1940The phrase ‘policy of independence’ was coined by the Dutch Minister of Foreign Affairs Van Karnebeek after the First World War. It has aroused a lot of discussion ever since. The phrase is often portrayed as sign of a change from a passive policy of neutrality to a much more active foreign policy. In this article the use of the phrase and the question of continuity or discontinuity are raised. This is done first of all on the basis of some crucial episodes from the First World War and subsequently the Dutch policy towards the German emperor and crown prince, Belgium and the League of Nations. This contribution argues that throughout those years the Dutch government pursued a policy characterized by activity and adopted an attitude that adhered to international law. Even before 1914 this approach was referred to as ‘independent’. Thereafter, Van Karnebeek coined the phrase ‘policy of independence’ to give expression to this prevailing attitude.
Participatory Republics: Play and the Political
DEFF Research Database (Denmark)
Sicart, Miguel Angel
2015-01-01
In this paper we propose a critical reading of Sicart’s concept of political play, and we suggest an alternative framework that expands his work. We will apply Chantal Mouffe’s political theory to the core ideas in Play Matters, with the purpose of focusing and further developing the understanding...... of the political in the play activity....
Poels, Karolien; van den Hoogen, Wouter; Ijsselsteijn, Wijnand; de Kort, Yvonne
2012-01-01
This study investigated how player emotions during game-play, measured through self-report and physiological recordings, predict playing time and game preferences. We distinguished between short-term (immediately after game-play) and long-term (after 3 weeks) playing time and game preferences. While pleasure was most predictive for short-term playing time and game preferences, arousal, particularly for game preferences, was most predictive on the longer term. This result was found through both self-report and physiological emotion measures. This study initiates theorizing about digital gaming as a hedonic consumer product and sketches future research endeavors of this topic.
Detection of invisible and crucial events: from seismic fluctuations to the war against terrorism
Energy Technology Data Exchange (ETDEWEB)
Allegrini, Paolo; Fronzoni, Leone; Grigolini, Paolo; Latora, Vito; Mega, Mirko S.; Palatella, Luigi E-mail: luigi.palatella@df.unipi.it; Rapisarda, Andrea; Vinciguerra, Sergio
2004-04-01
We argue that the recent discovery of the non-Poissonian statistics of the seismic main-shocks is a special case of a more general approach to the detection of the distribution of the time increments between one crucial but invisible event and the next. We make the conjecture that the proposed approach can be applied to the analysis of terrorist network with significant benefits for the Intelligence Community.
Delaney, Katherine K.
2017-01-01
This study examines how acceptable play was framed for a class of pre-Kindergarten children by their teacher and classroom aide. Using comic subjectivity theory [Zupancic, A. (2008). "The odd one in: On comedy." Cambridge: MIT Press], the author explores how children's playing at pretend violence (bad guy and pretend gun play) is…
Kuss, D.J.; Louws, J.; Wiers, R.W.
2012-01-01
Recently, there have been growing concerns about excessive online gaming. Playing Massively Multiplayer Online Role-Playing Games (MMORPGs) appears to be particularly problematic, because these games require a high degree of commitment and time investment from the players to the detriment of
Play and Social Interaction in Middle Childhood
Bergen, Doris; Fromberg, Doris Pronin
2009-01-01
This article discusses traditional and contemporary definitions of middle childhood play, the value of such play for children's development and learning, the implications of home, school, and societal practices that have resulted in changing the play scenario of middle childhood, and suggestions for assuring that play's value will be maintained…
Teachers and Children Playing with Factorization
DEFF Research Database (Denmark)
Valente, Andrea; Marchetti, Emanuela
2013-01-01
adventure game and a logic puzzle game. The game design was informed by the results obtained in a 1 year field study exploring and assessing techniques for transposing dynamic and complex domain-specific knowledge into games. Empirical results suggest that children may prefer different forms of play, mainly...... two were individuated: a competitive form of play, which was mapped into the 2D adventure game, and a designerly-creative play, which was mapped into a puzzle game (Valente and Marchetti 2011). This paper presents empirical results of a qualitative test, conducted with Danish primary school students......Teachers and children playing with factorization: putting Prime Slaughter to the test. Last year the prime slaughter game was designed and implemented, to enable primary and early secondary school students to play with prime numbers and factorization, within two different game contexts: a 2D...