WorldWideScience

Sample records for homologue mrna differentially

  1. Snipper, an Eri1 homologue, affects histone mRNA abundance and is crucial for normal Drosophila melanogaster development.

    Science.gov (United States)

    Alexiadis, Anastasios; Delidakis, Christos; Kalantidis, Kriton

    2017-07-01

    The conserved 3'-5' RNA exonuclease ERI1 is implicated in RNA interference inhibition, 5.8S rRNA maturation and histone mRNA maturation and turnover. The single ERI1 homologue in Drosophila melanogaster Snipper (Snp) is a 3'-5' exonuclease, but its in vivo function remains elusive. Here, we report Snp requirement for normal Drosophila development, since its perturbation leads to larval arrest and tissue-specific downregulation results in abnormal tissue development. Additionally, Snp directly interacts with histone mRNA, and its depletion results in drastic reduction in histone transcript levels. We propose that Snp protects the 3'-ends of histone mRNAs and upon its absence, histone transcripts are readily degraded. This in turn may lead to cell cycle delay or arrest, causing growth arrest and developmental perturbations. © 2017 Federation of European Biochemical Societies.

  2. The effect of delta-like 1 homologue on the proliferation and odontoblastic differentiation in human dental pulp stem cells.

    Science.gov (United States)

    Qi, Shengcai; Yan, Yanhong; Wen, Yue; Li, Jialiang; Wang, Jing; Chen, Fubo; Tang, Xiaoshan; Shang, Guangwei; Xu, Yuanzhi; Wang, Raorao

    2017-06-01

    This study aimed to investigate the functions of delta-like homologue 1 (DLK1) in the proliferation and differentiation of human dental pulp stem cells (hDPSCs). Immunohistochemical analysis was used to determine the expression of alkaline phosphatase (ALP), dentin sialophosphoprotein (DSPP), DLK1, NOTCH1 and p-ERK1/2 in the mouse first maxillary molar. Recombinant lentivirus was constructed to overexpress DLK1 stably in hDPSCs. The cell viability and proliferation of hDPSCs were examined by CCK8 and EdU incorporation assay respectively. The odontoblastic differentiation of hDPSCs was determined by detection of ALPase activity assay, ALP and alizarin red staining and the expression of mineralization-related genes including ALP, DSPP and dental matrix protein. The mRNA and protein levels of DLK1 and p-ERK1/2 protein expression were detected. ERK inhibitor was used to test the differentiation effect of DLK1 on hDPSCs. Delta-like homologue 1 was highly expressed on the odontoblasts and dental pulp cells on the first maxillary molar; the expression of p-ERK1/2 is similar with the DLK1 in the same process. The expression level of DLK1 increased significantly after the odontoblastic induction of hDPSCs. DLK1 overexpression increased the proliferation ability of hDPSCs and inhibited odontoblastic differentiation of hDPSCs. The protein level of p-ERK1/2 significantly increased in hDPSCs/dlk1-oe group. ERK signalling pathway inhibitor reversed the odontoblastic differentiation effects of DLK1 on hDPSCs. The proliferation of hDPSCs was promoted after DLK1 overexpression. DLK1 inhibited the odontoblastic differentiation of hDPSCs, which maybe through ERK signalling pathway. © 2017 John Wiley & Sons Ltd.

  3. A retinoic acid-inducible mRNA from F9 teratocarcinoma cells encodes a novel protease inhibitor homologue.

    Science.gov (United States)

    Wang, S Y; Gudas, L J

    1990-09-15

    We have previously isolated several cDNA clones specific for mRNA species that increase in abundance during the retinoic acid-associated differentiation of F9 teratocarcinoma stem cells. One of these mRNAs, J6, encodes a approximately 40 kDa protein as assayed by hybrid selection and in vitro translation (Wang, S.-Y., LaRosa, G., and Gudas, L. J. (1985) Dev. Biol. 107, 75-86). The time course of J6 mRNA expression is similar to those of both laminin B1 and collagen IV (alpha 1) messages following retinoic acid addition. To address the functional role of this protein, we have isolated a full-length cDNA clone complementary to this approximately 40-kDa protein mRNA. Sequence analysis reveals an open reading frame of 406 amino acids (Mr 45,652). The carboxyl-terminal portion of this predicted protein contains a region that is homologous to the reactive sites found among members of the serpin (serine protease inhibitor) family. The predicted reactive site (P1-P1') of this J6 protein is Arg-Ser, which is the same as that of antithrombin III. Like ovalbumin and human monocyte-derived plasminogen activator inhibitor (mPAI-2), which are members of the serpin gene family, the J6 protein appears to have no typical amino-terminal signal sequence.

  4. Deep mRNA sequencing of the Tritonia diomedea brain transcriptome provides access to gene homologues for neuronal excitability, synaptic transmission and peptidergic signalling.

    Directory of Open Access Journals (Sweden)

    Adriano Senatore

    Full Text Available The sea slug Tritonia diomedea (Mollusca, Gastropoda, Nudibranchia, has a simple and highly accessible nervous system, making it useful for studying neuronal and synaptic mechanisms underlying behavior. Although many important contributions have been made using Tritonia, until now, a lack of genetic information has impeded exploration at the molecular level.We performed Illumina sequencing of central nervous system mRNAs from Tritonia, generating 133.1 million 100 base pair, paired-end reads. De novo reconstruction of the RNA-Seq data yielded a total of 185,546 contigs, which partitioned into 123,154 non-redundant gene clusters (unigenes. BLAST comparison with RefSeq and Swiss-Prot protein databases, as well as mRNA data from other invertebrates (gastropod molluscs: Aplysia californica, Lymnaea stagnalis and Biomphalaria glabrata; cnidarian: Nematostella vectensis revealed that up to 76,292 unigenes in the Tritonia transcriptome have putative homologues in other databases, 18,246 of which are below a more stringent E-value cut-off of 1x10-6. In silico prediction of secreted proteins from the Tritonia transcriptome shotgun assembly (TSA produced a database of 579 unique sequences of secreted proteins, which also exhibited markedly higher expression levels compared to other genes in the TSA.Our efforts greatly expand the availability of gene sequences available for Tritonia diomedea. We were able to extract full length protein sequences for most queried genes, including those involved in electrical excitability, synaptic vesicle release and neurotransmission, thus confirming that the transcriptome will serve as a useful tool for probing the molecular correlates of behavior in this species. We also generated a neurosecretome database that will serve as a useful tool for probing peptidergic signalling systems in the Tritonia brain.

  5. Differential expression of PARP1 mRNA in leucocytes of patients ...

    Indian Academy of Sciences (India)

    P. 2011 Differential expression of PARP1 mRNA in leucocytes of patients with Down's syndrome. J. Genet. ... of Alzheimer disease at an earlier age than subjects with- ... family and personal informed consent. .... In effect, they report that.

  6. Bioinspired nanocomplex for spatiotemporal imaging of sequential mRNA expression in differentiating neural stem cells.

    Science.gov (United States)

    Wang, Zhe; Zhang, Ruili; Wang, Zhongliang; Wang, He-Fang; Wang, Yu; Zhao, Jun; Wang, Fu; Li, Weitao; Niu, Gang; Kiesewetter, Dale O; Chen, Xiaoyuan

    2014-12-23

    Messenger RNA plays a pivotal role in regulating cellular activities. The expression dynamics of specific mRNA contains substantial information on the intracellular milieu. Unlike the imaging of stationary mRNAs, real-time intracellular imaging of the dynamics of mRNA expression is of great value for investigating mRNA biology and exploring specific cellular cascades. In addition to advanced imaging methods, timely extracellular stimulation is another key factor in regulating the mRNA expression repertoire. The integration of effective stimulation and imaging into a single robust system would significantly improve stimulation efficiency and imaging accuracy, producing fewer unwanted artifacts. In this study, we developed a multifunctional nanocomplex to enable self-activating and spatiotemporal imaging of the dynamics of mRNA sequential expression during the neural stem cell differentiation process. This nanocomplex showed improved enzymatic stability, fast recognition kinetics, and high specificity. With a mechanism regulated by endogenous cell machinery, this nanocomplex realized the successive stimulating motif release and the dynamic imaging of chronological mRNA expression during neural stem cell differentiation without the use of transgenetic manipulation. The dynamic imaging montage of mRNA expression ultimately facilitated genetic heterogeneity analysis. In vivo lateral ventricle injection of this nanocomplex enabled endogenous neural stem cell activation and labeling at their specific differentiation stages. This nanocomplex is highly amenable as an alternative tool to explore the dynamics of intricate mRNA activities in various physiological and pathological conditions.

  7. The CD11a partner in Sus scrofa lymphocyte function-associated antigen-1 (LFA-1: mRNA cloning, structure analysis and comparison with mammalian homologues

    Directory of Open Access Journals (Sweden)

    Thomas Anne VT

    2005-10-01

    Full Text Available Abstract Background Lymphocyte function-associated antigen-1 (LFA-1, CD11a/CD18, alphaLbeta2, the most abundant and widely expressed beta2-integrin, is required for many cellular adhesive interactions during the immune response. Many studies have shown that LFA-1 is centrally involved in the pathogenesis of several diseases caused by Repeats-in-toxin (RTX -producing bacteria. Results The porcine-LFA-1 CD11a (alpha subunit coding sequence was cloned, sequenced and compared with the available mammalian homologues in this study. Despite some focal differences, it shares all the main characteristics of these latter. Interestingly, as in sheep and humans, an allelic variant with a triplet insertion resulting in an additional Gln-744 was consistently identified, which suggests an allelic polymorphism that might be biologically relevant. Conclusion Together with the pig CD18-encoding cDNA, which has been available for a long time, the sequence data provided here will allow the successful expression of porcine CD11a, thus giving the first opportunity to express the Sus scrofa beta2-integrin LFA-1 in vitro as a tool to examine the specificities of inflammation in the porcine species.

  8. Differential accumulation of nif structural gene mRNA in Azotobacter vinelandii.

    Science.gov (United States)

    Hamilton, Trinity L; Jacobson, Marty; Ludwig, Marcus; Boyd, Eric S; Bryant, Donald A; Dean, Dennis R; Peters, John W

    2011-09-01

    Northern analysis was employed to investigate mRNA produced by mutant strains of Azotobacter vinelandii with defined deletions in the nif structural genes and in the intergenic noncoding regions. The results indicate that intergenic RNA secondary structures effect the differential accumulation of transcripts, supporting the high Fe protein-to-MoFe protein ratio required for optimal diazotrophic growth.

  9. Relationship of calcitonin mRNA expression to the differentiation state of HL 60 cells.

    Science.gov (United States)

    Kiefer, P; Bacher, M; Pflüger, K H

    1994-05-01

    Raised plasma levels of immunoreactive human calcitonin (ihCT) can be found in patients with myeloid leukemia and seem to indicate a poor prognosis. High levels were found in acute undifferentiated and acute myeloblastic leukemia. To test whether CT expression could be a marker of myeloid differentiation, we used the promyelocytic leukemia cell line HL 60 which also expresses ihCT as a model system for myeloid differentiation. Exponentially growing HL 60 cells as well as differentiation induced HL 60 cells expressed a single 1.0 Kb CT transcript. The induction of HL 60 cell differentiation along the granulocytic lineage by DMSO or HMBA had no effect on the level of CT transcripts. Induction of monocytic/macrophagic differentiation by TPA resulted in a transient, about 10-fold elevated expression of CT steady state mRNA after 24 h. In contrast to TPA, induction of HL 60 cell differentiation along the monocytic pathway by Vit D3 had no detectable effect on the level of the CT in RNA expression at corresponding time points. These findings suggest that the transient induction of CT steady state mRNA expression by TPA is rather a direct effect of the phorbol ester than commitment along the monocytic line of differentiation.

  10. New potential markers of in vitro tomato morphogenesis identified by mRNA differential display.

    Science.gov (United States)

    Torelli, A; Soragni, E; Bolchi, A; Petrucco, S; Ottonello, S; Branca, C

    1996-12-01

    The identification of plant genes involved in early phases of in vitro morphogenesis can not only contribute to our understanding of the processes underlying growth regulator-controlled determination, but also provide novel markers for evaluating the outcome of in vitro regeneration experiments. To search for such genes and to monitor changes in gene expression accompanying in vitro regeneration, we have adapted the mRNA differential display technique to the comparative analysis of a model system of tomato cotyledons that can be driven selectively toward either shoot or callus formation by means of previously determined growth regulator supplementations. Hormone-independent transcriptional modulation (mainly down-regulation) has been found to be the most common event, indicating that a non-specific reprogramming of gene expression quantitatively predominates during the early phases of in vitro culture. However, cDNA fragments representative of genes that are either down-regulated or induced in a programme-specific manner could also be identified, and two of them (G35, G36) were further characterized. One of these cDNA fragments, G35, corresponds to an mRNA that is down-regulated much earlier in callus- (day 2) than in shoot-determined explants (day 6). The other, G36, identifies an mRNA that is transiently expressed in shoot-determined explants only, well before any macroscopic signs of differentiation become apparent, and thus exhibits typical features of a morphogenetic marker.

  11. Midbrain expression of Delta-like 1 homologue is regulated by GDNF and is associated with dopaminergic differentiation

    DEFF Research Database (Denmark)

    Christophersen, Nicolai S.; Gronborg, Mette; Petersen, Thomas Nordahl

    2007-01-01

    upregulation with increased positive staining of cell bodies in the SNc and fibers in the striatum. Analysis of the developmental regulation of Dlk1 in the murine ventral midbrain showed that the upregulation of Dlk1 mRNA correlated with the generation of tyrosine hydroxylase (TH)-positive neurons. Furthermore...

  12. Identification of Powdery Mildew Responsive Genes in Hevea brasiliensis through mRNA Differential Display

    Science.gov (United States)

    Li, Xiang; Bi, Zhenghong; Di, Rong; Liang, Peng; He, Qiguang; Liu, Wenbo; Miao, Weiguo; Zheng, Fucong

    2016-01-01

    Powdery mildew is an important disease of rubber trees caused by Oidium heveae B. A. Steinmann. As far as we know, none of the resistance genes related to powdery mildew have been isolated from the rubber tree. There is little information available at the molecular level regarding how a rubber tree develops defense mechanisms against this pathogen. We have studied rubber tree mRNA transcripts from the resistant RRIC52 cultivar by differential display analysis. Leaves inoculated with the spores of O. heveae were collected from 0 to 120 hpi in order to identify pathogen-regulated genes at different infection stages. We identified 78 rubber tree genes that were differentially expressed during the plant–pathogen interaction. BLAST analysis for these 78 ESTs classified them into seven functional groups: cell wall and membrane pathways, transcription factor and regulatory proteins, transporters, signal transduction, phytoalexin biosynthesis, other metabolism functions, and unknown functions. The gene expression for eight of these genes was validated by qRT-PCR in both RRIC52 and the partially susceptible Reyan 7-33-97 cultivars, revealing the similar or differential changes of gene expressions between these two cultivars. This study has improved our overall understanding of the molecular mechanisms of rubber tree resistance to powdery mildew. PMID:26840302

  13. Rapid detection, differentiation and typing of methicillin-resistant Staphylococcus aureus harbouring either mecA or the new mecA homologue mecA(LGA251).

    Science.gov (United States)

    Stegger, M; Andersen, P S; Kearns, A; Pichon, B; Holmes, M A; Edwards, G; Laurent, F; Teale, C; Skov, R; Larsen, A R

    2012-04-01

    The recent finding of a new mecA homologue, mecA(LGA251) , with only 70% nucleotide homology to the conventional mecA gene has brought the routine testing for mecA as a confirmatory test for methicillin-resistant Staphylococcus aureus (MRSA) into question. A multiplex PCR was designed to differentiate mecA(LGA251) from the known mecA together with detection of lukF-PV and the spa gene fragments, enabling direct spa typing by sequencing of the PCR amplicons. The PCR analysis and subsequent spa typing were validated on a large collection (n=185) of contemporary MRSA and methicillin-sensitive S. aureus isolates, including 127 isolates carrying mecA(LGA251) . The mecA(LGA251) gene was situated in staphylococcal cassette chromosome mec type XI elements, and sequence variation within a 631-bp fragment of mecA(LGA251) in 79 isolates indicated a very conserved gene sequence. Following a successful validation, the multiplex PCR strategy was implemented in the routine testing of MRSA for national surveillance. Over a 2-month period, among 203 samples tested, 12 new MRSA cases caused by isolates carrying mecA(LGA251) were identified, emphasizing the clinical importance of testing for these new MRSA isolates. © 2011 STATENS SERUM INSTITUT. Clinical Microbiology and Infection © 2011 European Society of Clinical Microbiology and Infectious Diseases.

  14. Use of isotope ratio mass spectrometry to differentiate between endogenous steroids and synthetic homologues in cattle: a review.

    Science.gov (United States)

    Janssens, Geert; Courtheyn, Dirk; Mangelinckx, Sven; Prévost, Stéphanie; Bichon, Emmanuelle; Monteau, Fabrice; De Poorter, Geert; De Kimpe, Norbert; Le Bizec, Bruno

    2013-04-15

    Although substantial technical advances have been achieved during the past decades to extend and facilitate the analysis of growth promoters in cattle, the detection of abuse of synthetic analogs of naturally occurring hormones has remained a challenging issue. When it became clear that the exogenous origin of steroid hormones could be traced based on the (13)C/(12)C isotope ratio of the substances, GC/C/IRMS has been successfully implemented to this aim since the end of the past century. However, due to the costly character of the instrumental setup, the susceptibility of the equipment to errors and the complex and time consuming sample preparation, this method is up until now only applied by a limited number of laboratories. In this review, the general principles as well as the practical application of GC/C/IRMS to differentiate between endogenous steroids and exogenously synthesized homologous compounds in cattle will be discussed in detail, and will be placed next to other existing and to be developed methods based on isotope ratio mass spectrometry. Finally, the link will be made with the field of sports doping, where GC/C/IRMS has been established within the World Anti-Doping Agency (WADA) approved methods as the official technique to differentiate between exogenous and endogenous steroids over the past few years. Copyright © 2013 Elsevier B.V. All rights reserved.

  15. RNase L controls terminal adipocyte differentiation, lipids storage and insulin sensitivity via CHOP10 mRNA regulation

    DEFF Research Database (Denmark)

    Fabre, Odile Martine Julie; Salehzada, T; Lambert, K

    2012-01-01

    Adipose tissue structure is altered during obesity, leading to deregulation of whole-body metabolism. Its function depends on its structure, in particular adipocytes number and differentiation stage. To better understand the mechanisms regulating adipogenesis, we have investigated the role...... is associated with CHOP10 mRNA and regulates its stability. CHOP10 expression is conserved in RNase L(-/-)-MEFs, maintaining preadipocyte state while impairing their terminal differentiation. RNase L(-/-)-MEFs have decreased lipids storage capacity, insulin sensitivity and glucose uptake. Expression of ectopic...... RNase L in RNase L(-/-)-MEFs triggers CHOP10 mRNA instability, allowing increased lipids storage, insulin response and glucose uptake. Similarly, downregulation of CHOP10 mRNA with CHOP10 siRNA in RNase L(-/-)-MEFs improves their differentiation in adipocyte. In vivo, aged RNase L(-)/(-) mice present...

  16. Use of isotope ratio mass spectrometry to differentiate between endogenous steroids and synthetic homologues in cattle: A review

    Energy Technology Data Exchange (ETDEWEB)

    Janssens, Geert, E-mail: Geert.janssens@favv.be [Federal Agency for the Safety of the Food Chain, Directorate General Laboratories, Kruidtuinlaan 55, 1000 Brussels (Belgium); Department of Sustainable Organic Chemistry and Technology, Faculty of Bioscience Engineering, Ghent University, Coupure Links 653, 9000 Ghent (Belgium); Courtheyn, Dirk [Federal Agency for the Safety of the Food Chain, Directorate General Laboratories, Kruidtuinlaan 55, 1000 Brussels (Belgium); Mangelinckx, Sven [Department of Sustainable Organic Chemistry and Technology, Faculty of Bioscience Engineering, Ghent University, Coupure Links 653, 9000 Ghent (Belgium); Prévost, Stéphanie; Bichon, Emmanuelle; Monteau, Fabrice [LUNAM Université, Oniris, Laboratoire d’Etude des Résidus et Contaminants dans les Aliments (LABERCA), F-44307 Nantes (France); De Poorter, Geert [Federal Agency for the Safety of the Food Chain, Directorate General Laboratories, Kruidtuinlaan 55, 1000 Brussels (Belgium); De Kimpe, Norbert [Department of Sustainable Organic Chemistry and Technology, Faculty of Bioscience Engineering, Ghent University, Coupure Links 653, 9000 Ghent (Belgium); Le Bizec, Bruno [LUNAM Université, Oniris, Laboratoire d’Etude des Résidus et Contaminants dans les Aliments (LABERCA), F-44307 Nantes (France)

    2013-04-15

    Graphical abstract: Scheme: Representation of the observed isotope ratios and the relation to exogenous and endogenous natural steroids. AS stands for “amount of steroid”. Highlights: ► The difference between endogenous and exogenous steroids is thoroughly laid out. ► Factors influencing the carbon ratio and the use of Δ{sup 13}C-values are explained. ► Implementation of GC/C/IRMS to detect steroid abuse in cattle is reviewed. ► Alternative methods and upcoming techniques are discussed. ► The differences and similarities with sports doping control are highlighted. -- Abstract: Although substantial technical advances have been achieved during the past decades to extend and facilitate the analysis of growth promoters in cattle, the detection of abuse of synthetic analogs of naturally occurring hormones has remained a challenging issue. When it became clear that the exogenous origin of steroid hormones could be traced based on the {sup 13}C/{sup 12}C isotope ratio of the substances, GC/C/IRMS has been successfully implemented to this aim since the end of the past century. However, due to the costly character of the instrumental setup, the susceptibility of the equipment to errors and the complex and time consuming sample preparation, this method is up until now only applied by a limited number of laboratories. In this review, the general principles as well as the practical application of GC/C/IRMS to differentiate between endogenous steroids and exogenously synthesized homologous compounds in cattle will be discussed in detail, and will be placed next to other existing and to be developed methods based on isotope ratio mass spectrometry. Finally, the link will be made with the field of sports doping, where GC/C/IRMS has been established within the World Anti-Doping Agency (WADA) approved methods as the official technique to differentiate between exogenous and endogenous steroids over the past few years.

  17. Use of isotope ratio mass spectrometry to differentiate between endogenous steroids and synthetic homologues in cattle: A review

    International Nuclear Information System (INIS)

    Janssens, Geert; Courtheyn, Dirk; Mangelinckx, Sven; Prévost, Stéphanie; Bichon, Emmanuelle; Monteau, Fabrice; De Poorter, Geert; De Kimpe, Norbert; Le Bizec, Bruno

    2013-01-01

    Graphical abstract: Scheme: Representation of the observed isotope ratios and the relation to exogenous and endogenous natural steroids. AS stands for “amount of steroid”. Highlights: ► The difference between endogenous and exogenous steroids is thoroughly laid out. ► Factors influencing the carbon ratio and the use of Δ 13 C-values are explained. ► Implementation of GC/C/IRMS to detect steroid abuse in cattle is reviewed. ► Alternative methods and upcoming techniques are discussed. ► The differences and similarities with sports doping control are highlighted. -- Abstract: Although substantial technical advances have been achieved during the past decades to extend and facilitate the analysis of growth promoters in cattle, the detection of abuse of synthetic analogs of naturally occurring hormones has remained a challenging issue. When it became clear that the exogenous origin of steroid hormones could be traced based on the 13 C/ 12 C isotope ratio of the substances, GC/C/IRMS has been successfully implemented to this aim since the end of the past century. However, due to the costly character of the instrumental setup, the susceptibility of the equipment to errors and the complex and time consuming sample preparation, this method is up until now only applied by a limited number of laboratories. In this review, the general principles as well as the practical application of GC/C/IRMS to differentiate between endogenous steroids and exogenously synthesized homologous compounds in cattle will be discussed in detail, and will be placed next to other existing and to be developed methods based on isotope ratio mass spectrometry. Finally, the link will be made with the field of sports doping, where GC/C/IRMS has been established within the World Anti-Doping Agency (WADA) approved methods as the official technique to differentiate between exogenous and endogenous steroids over the past few years

  18. A systemic evaluation of cardiac differentiation from mRNA reprogrammed human induced pluripotent stem cells.

    Directory of Open Access Journals (Sweden)

    Ashish Mehta

    Full Text Available Genetically unmodified cardiomyocytes mandated for cardiac regenerative therapy is conceivable by "foot-print free" reprogramming of somatic cells to induced pluripotent stem cells (iPSC. In this study, we report generation of foot-print free hiPSC through messenger RNA (mRNA based reprograming. Subsequently, we characterize cardiomyocytes derived from these hiPSC using molecular and electrophysiological methods to characterize their applicability for regenerative medicine. Our results demonstrate that mRNA-iPSCs differentiate ontogenetically into cardiomyocytes with increased expression of early commitment markers of mesoderm, cardiac mesoderm, followed by cardiac specific transcriptional and sarcomeric structural and ion channel genes. Furthermore, these cardiomyocytes stained positively for sarcomeric and ion channel proteins. Based on multi-electrode array (MEA recordings, these mRNA-hiPSC derived cardiomyocytes responded predictably to various pharmacologically active drugs that target adrenergic, sodium, calcium and potassium channels. The cardiomyocytes responded chronotropically to isoproterenol in a dose dependent manner, inotropic activity of nifidipine decreased spontaneous contractions. Moreover, Sotalol and E-4031 prolonged QT intervals, while TTX reduced sodium influx. Our results for the first time show a systemic evaluation based on molecular, structural and functional properties of cardiomyocytes differentiated from mRNA-iPSC. These results, coupled with feasibility of generating patient-specific iPSCs hold great promise for the development of large-scale generation of clinical grade cardiomyocytes for cardiac regenerative medicine.

  19. Profiles of mRNA expression of genes related to sex differentiation of the gonads in the chicken embryo.

    Science.gov (United States)

    Yamamoto, I; Tsukada, A; Saito, N; Shimada, K

    2003-09-01

    Sex is determined genetically in birds. The homogametic sex is male (ZZ), whereas the heterogametic sex is female (ZW). According to the genetic sex, gonads develop into testes or ovary. In this study, we performed experiments to reveal mRNA expression patterns in the gonad between d 5.5 and 8.5 of incubation and examined a possible role of Dss-Ahc critical region on the X chromosome 1 (Dax1), Steroidogenic factor 1 (Sf1), P450aromatase (P450arom), Estrogen receptor alpha (ER alpha), doublesex and mab3 related transcription factor 1 (Dmrt1), Sry-related HMG box gene 9 (Sox9), Gata binding protein 4 (Gata4), and anti-müllerian hormone (Amh) in sex differentiation in chicken embryonic gonads using RNase protection assay. In embryonic chicken gonads, Dax1 mRNA was expressed in both sexes but was higher in females than in males at d 6.5 and 7.5 of incubation. The Sf1 mRNA was expressed in both sexes, but it was expressed more in males at d 5.5 than in females but more in females than in males at d 7.5 and 8.5 of incubation. The P450arom mRNA was expressed only in female gonads from d 5.5 of incubation. The ER alpha mRNA was expressed in both sexes, but it did not show a sex difference. On the other hand, the Dmrt1 mRNA was expressed in both sexes, but it showed a male-specific expression pattern. The male-specific expression pattern was observed in Sox9 mRNA, but it was not expressed in female gonads. The Gata4 mRNA was expressed in both sexes, and sex differences were not revealed throughout the observational period. Amh mRNA was expressed in both sexes, but it had male-specific mRNA expression pattern at d 6.5 to 8.5 of incubation. These results indicate that Dax1, Sf1, and P450arom have possible roles in ovary formation, whereas Dmrt1, Sox9, and Amh are related to testis formation in differentiating chicken gonads at d 5.5 to 8.5 of incubation.

  20. Nonparametric testing for DNA copy number induced differential mRNA gene expression

    NARCIS (Netherlands)

    van Wieringen, W.N.; van de Wiel, M.A.

    2009-01-01

    The central dogma of molecular biology relates DNA with mRNA. Array CGH measures DNA copy number and gene expression microarrays measure the amount of mRNA. Methods that integrate data from these two platforms may uncover meaningful biological relationships that further our understanding of cancer.

  1. Pepsin homologues in bacteria

    Directory of Open Access Journals (Sweden)

    Bateman Alex

    2009-09-01

    Full Text Available Abstract Background Peptidase family A1, to which pepsin belongs, had been assumed to be restricted to eukaryotes. The tertiary structure of pepsin shows two lobes with similar folds and it has been suggested that the gene has arisen from an ancient duplication and fusion event. The only sequence similarity between the lobes is restricted to the motif around the active site aspartate and a hydrophobic-hydrophobic-Gly motif. Together, these contribute to an essential structural feature known as a psi-loop. There is one such psi-loop in each lobe, and so each lobe presents an active Asp. The human immunodeficiency virus peptidase, retropepsin, from peptidase family A2 also has a similar fold but consists of one lobe only and has to dimerize to be active. All known members of family A1 show the bilobed structure, but it is unclear if the ancestor of family A1 was similar to an A2 peptidase, or if the ancestral retropepsin was derived from a half-pepsin gene. The presence of a pepsin homologue in a prokaryote might give insights into the evolution of the pepsin family. Results Homologues of the aspartic peptidase pepsin have been found in the completed genomic sequences from seven species of bacteria. The bacterial homologues, unlike those from eukaryotes, do not possess signal peptides, and would therefore be intracellular acting at neutral pH. The bacterial homologues have Thr218 replaced by Asp, a change which in renin has been shown to confer activity at neutral pH. No pepsin homologues could be detected in any archaean genome. Conclusion The peptidase family A1 is found in some species of bacteria as well as eukaryotes. The bacterial homologues fall into two groups, one from oceanic bacteria and one from plant symbionts. The bacterial homologues are all predicted to be intracellular proteins, unlike the eukaryotic enzymes. The bacterial homologues are bilobed like pepsin, implying that if no horizontal gene transfer has occurred the duplication

  2. The utility of peripheral thyrotropin receptor mRNA in the management of differentiated thyroid cancer.

    Science.gov (United States)

    Aliyev, Altay; Soundararajan, Saranya; Bucak, Emre; Gupta, Manjula; Hatipoglu, Betul; Nasr, Christian; Siperstein, Allan; Berber, Eren

    2015-10-01

    Our aim was to analyze the utility of peripheral thyrotropin receptor (TSHR) messenger RNA (mRNA) in predicting and detecting the recurrence of differentiated thyroid cancer. Peripheral blood TSHR-mRNA was obtained in 103 patients before and after total thyroidectomy. An analysis was performed to correlate peripheral blood TSHR-mRNA concentration with oncologic outcomes. Tumor types were papillary (n = 92), follicular (n = 9) and Hürthle cell (n = 2) cancer. Preoperative TSHR-mRNA was ≥1.02 ng/μg in 85% (88/103). On follow-up (median 48 months), 10 patients (10 %) developed recurrence. Recurrence rate in patients with a preoperative TSHR-mRNA ≥ 1.02 ng/μg was 11% versus 0% in those with a lesser concentration. TSHR-mRNA correctly diagnosed 7 (70%) of 10 recurrences. Of 19 patients with positive thyroglobulin (Tg) antibodies, TSHR-mRNA confirmed disease-free status in 12 (63%) and recurrence in 1 (5%). For Tg, TSHR-mRNA and whole-body radioactive iodine scan, sensitivity was 70%, 70%, and 75%; specificity 94%, 76%, 97%; PPV 54%, 24%, and 67%; and NPV 97%, 96%, and 98%, respectively, in detecting recurrent disease. This study shows that patients with preoperative TSHR-mRNA ≥1.02 ng/μg may be at a greater risk for recurrence compared with those with a lesser concentration. In the presence of Tg antibodies, TSHR-mRNA accurately predicted disease status in 68% of patients. Its overall performance in detecting recurrence was similar to Tg and whole-body radioactive iodine scan, albeit with lower specificity and PPV. Copyright © 2015 Elsevier Inc. All rights reserved.

  3. Differential distribution of calcineurin Aα isoenzyme mRNA's in rat brain

    NARCIS (Netherlands)

    Buttini, M.; Limonta, S.; Luyten, M.; Boddeke, H.

    1993-01-01

    Specific antisense oligonucleotide probes for the α isoforms of the catalytic subunit (A-subunit) of calcineurin were prepared and the distribution of Aα1 and Aα2 mRNA's has been studied in rat brain using in situ hybridization histochemistry. Clear regional differences have been observed for the

  4. Differential regulation of renal cyclooxygenase mRNA by dietary salt intake

    DEFF Research Database (Denmark)

    Jensen, B L; Kurtz, A

    1997-01-01

    RNA correlated directly with salt intake. We conclude that dietary salt intake influences renal cyclooxygenase mRNAs zone-specifically with opposite responses between cortex and medulla. Cortical COX II-mediated prostaglandin formation is probably important in low salt states whereas medullary COX I......Experiments were done to investigate the influence of dietary salt intake on renal cyclooxygenase (COX) I and II mRNA levels. To this end rats were fed either a low NaCl diet (LS; 0.02% NaCl wt/wt) or a high NaCl diet (HS diet; 4% NaCl wt/wt) for 5, 10 and 20 days. After 10 days Na excretion...... differed 760-fold, plasma renin activity and renin mRNA were increased eight- and threefold in LS compared to HS animals. Total renal COX I mRNA decreased 50% following the LS diet and did not change after the HS diet. Conversely, COX II mRNA declined after HS intake and transiently increased after salt...

  5. The NO signaling pathway differentially regulates KCC3a and KCC3b mRNA expression.

    Science.gov (United States)

    Di Fulvio, Mauricio; Lauf, Peter K; Adragna, Norma C

    2003-11-01

    Nitric oxide (NO) donors and protein kinase G (PKG) acutely up-regulate K-Cl cotransporter-1 and -3 (KCC1 and KCC3) mRNA expression in vascular smooth muscle cells (VSMCs). Here, we report the presence, relative abundance, and regulation by sodium nitroprusside (SNP) of the novel KCC3a and KCC3b mRNAs, in primary cultures of rat VSMCs. KCC3a and KCC3b mRNAs were expressed in an approximate 3:1 ratio, as determined by semiquantitative RT-PCR analysis. SNP as well as YC-1 and 8-Br-cGMP, a NO-independent stimulator of soluble guanylyl cyclase (sGC) and PKG, respectively, increased KCC3a and KCC3b mRNA expression by 2.5-fold and 8.1-fold in a time-dependent manner, following a differential kinetics. Stimulation of the NO/sGC/PKG signaling pathway with either SNP, YC-1, or 8-Br-cGMP decreased the KCC3a/KCC3b ratio from 3.0+/-0.4 to 0.9+/-0.1. This is the first report on a differential regulation by the NO/sGC/PKG signaling pathway of a cotransporter and of KCC3a and KCC3b mRNA expression.

  6. Differential regulation of proopiomelanocortin (POMC mRNA expression in hypothalamus and anterior pituitary following repeated cyanamide with ethanol administration

    Directory of Open Access Journals (Sweden)

    Kinoshita Hiroshi

    2005-01-01

    Full Text Available Background/Aim. We have investigated proopiomelanocortin (POMC mRNA expression in the arcuate nucleus of the hypothalamus (ARC and the anterior lobe of the pituitary (AL following repeated cyanamide-ethanol reaction (CER. Methods. Adult male Sprague -Dawley rats (250 −290 gr were housed in a temperature and humidity controlled environment with free access to food and water. Four experimental groups were used as follows: saline (as control, cyanamide alone, ethanol alone and ethanol with cyanamide. The animals received daily intraperitoneal injections (i.p. of cyanamide (10mg/kg, 60 min before ethanol dosing with or without ethanol (1g/kg for 5 consecutive days, and were sacrificed 60 min after the last dosing of ethanol. The results were presented as the mean ± SEM for each group. All groups within each data set were compared by one-way ANOVA followed by Fisher PLSD test for multiple comparisons. A value of p<0.05 was considered significant. Results. The POMC mRNA levels in ARC were significantly decreased with cyanamide compared to the control and ethanol alone (p<0.05 and p<0.05 respectively, but increased in AL following repeated CER. Conclusion. We speculate that this differential regulation of POMC mRNA expression may be partially involved in the preventive effects on alcohol intake in response to CER.

  7. Isolation of a cotton NADP(H oxidase homologue induced by drought stress

    Directory of Open Access Journals (Sweden)

    NEPOMUCENO ALEXANDRE LIMA

    2000-01-01

    Full Text Available The aim of this study was to identify and isolate genes that are differentially expressed in four selected cotton (Gossypium hirsutum L. genotypes contrasting according to their tolerance to water deficit. The genotypes studied were Siokra L-23, Stoneville 506, CS 50 and T-1521. Physiological, morphological and developmental changes that confer drought tolerance in plants must have a molecular genetic basis. To identify and isolate the genes, the mRNA Differential Display (DD technique was used. Messenger RNAs differentially expressed during water deficit were identified, isolated, cloned and sequenced. The cloned transcript A12B15-5, a NADP(H oxidase homologue, was up regulated only during the water deficit stress and only in Siokra L-23, a drought tolerant genotype. Ribonuclease protection assay confirmed that transcription.

  8. Identification of a differentially expressed mRNA in axenic Leishmania panamensis amastigotes

    Directory of Open Access Journals (Sweden)

    José Arturo Gutiérrez

    2001-08-01

    Full Text Available Differential display technique was applied in order to identify transcripts which are present in axenic amastigotes but not in promastigotes of the Leishmania panamensis parasites. One of them was cloned and the sequence reveals an open reading frame of 364 amino acids (aprox. 40 kDa. The deduced protein is homologous to the serine/threonine protein kinases and specially to the mitogen activates protein kinases from eukaryotic species. Southern blot analysis suggest that this transcript, named lpmkh, is present in the genome of the parasite as a single copy gene. These results could imply that lpmkh could be involved in the differentiation process or the preservation of amastigotes in axenic conditions.

  9. Differential Expression of Sox11 and Bdnf mRNA Isoforms in the Injured and Regenerating Nervous Systems

    Directory of Open Access Journals (Sweden)

    Felix L. Struebing

    2017-11-01

    Full Text Available In both the central nervous system (CNS and the peripheral nervous system (PNS, axonal injury induces changes in neuronal gene expression. In the PNS, a relatively well-characterized alteration in transcriptional activation is known to promote axonal regeneration. This transcriptional cascade includes the neurotrophin Bdnf and the transcription factor Sox11. Although both molecules act to facilitate successful axon regeneration in the PNS, this process does not occur in the CNS. The present study examines the differential expression of Sox11 and Bdnf mRNA isoforms in the PNS and CNS using three experimental paradigms at different time points: (i the acutely injured CNS (retina after optic nerve crush and PNS (dorsal root ganglion after sciatic nerve crush, (ii a CNS regeneration model (retina after optic nerve crush and induced regeneration; and (iii the retina during a chronic form of central neurodegeneration (the DBA/2J glaucoma model. We find an initial increase of Sox11 in both PNS and CNS after injury; however, the expression of Bdnf isoforms is higher in the PNS relative to the CNS. Sustained upregulation of Sox11 is seen in the injured retina following regeneration treatment, while the expression of two Bdnf mRNA isoforms is suppressed. Furthermore, two isoforms of Sox11 with different 3′UTR lengths are present in the retina, and the long isoform is specifically upregulated in later stages of glaucoma. These results provide insight into the molecular cascades active during axonal injury and regeneration in mammalian neurons.

  10. Analysis of the intercaste transcriptional profile of Melipona scutellaris Latreille, 1811 (Hymenoptera, Apidae, Meliponini) by mRNA differential display.

    Science.gov (United States)

    Siquieroli, Ana Carolina S; Vieira, Carlos U; Carvalho-Zilse, Gislene A; Goulart, Luiz R; Kerr, Warwick E; Bonetti, Ana M

    2009-01-01

    In colonies of Melipona scutellaris Latreille, 1811 workers can be found with four ganglion nerve cells, a morphological characteristic of the queen. It is hypothesized that these workers, called intercastes, or phenocopies, are phenotypically-like workers, but genotypically identical to queens due to this specific trait. Workers with the same number of ganglion as queens seem to be intercastes between queens and workers. Our objective was to analyze the mRNA pro files of workers, queens, and intercastes of M. scutellaris through DDRT-PCR. Three hundred (300) pupae with white eyes were collected and externally identified according to the number of abdominal nerve ganglions: workers (5 ganglions), queens (4 ganglions) and intercastes (4 ganglions). The analysis identified differentially expressed transcripts that were present only in workers, but absent in intercastes and queens, confirming the hypothesis, by demonstrating the environmental effect on the queen genotype that generated phenotype-like workers.

  11. Analysis of the Intercaste Transcriptional Profile of Melipona scutellaris Latreille, 1811 (Hymenoptera, Apidae, Meliponini by mRNA Differential Display

    Directory of Open Access Journals (Sweden)

    ANA CAROLINA S SIQUIEROLI

    2009-01-01

    Full Text Available In colonies of Melipona scutellaris Latreille, 1811 workers can be found with four ganglion nerve cells, a morphological characteristic of the queen. It is hypothesized that these workers, called intercastes, or phenocopies, are phenotypically-like workers, but genotypically identical to queens due to this specific trait. Workers with the same number of ganglion as queens seem to be intercastes between queens and workers. Our objective was to analyze the mRNA pro files of workers, queens, and intercastes of M. scutellaris through DDRT-PCR. Three hundred (300 pupae with white eyes were collected and externally identified according to the number of abdominal nerve ganglions: workers (5 ganglions, queens (4 ganglions and intercastes (4 ganglions. The analysis identified differentially expressed transcripts that were present only in workers, but absent in intercastes and queens, confirming the hypothesis, by demonstrating the environmental effect on the queen genotype that generated phenotype-like workers.

  12. Highly efficient reprogramming to pluripotency and directed differentiation of human cells with synthetic modified mRNA.

    Science.gov (United States)

    Warren, Luigi; Manos, Philip D; Ahfeldt, Tim; Loh, Yuin-Han; Li, Hu; Lau, Frank; Ebina, Wataru; Mandal, Pankaj K; Smith, Zachary D; Meissner, Alexander; Daley, George Q; Brack, Andrew S; Collins, James J; Cowan, Chad; Schlaeger, Thorsten M; Rossi, Derrick J

    2010-11-05

    Clinical application of induced pluripotent stem cells (iPSCs) is limited by the low efficiency of iPSC derivation and the fact that most protocols modify the genome to effect cellular reprogramming. Moreover, safe and effective means of directing the fate of patient-specific iPSCs toward clinically useful cell types are lacking. Here we describe a simple, nonintegrating strategy for reprogramming cell fate based on administration of synthetic mRNA modified to overcome innate antiviral responses. We show that this approach can reprogram multiple human cell types to pluripotency with efficiencies that greatly surpass established protocols. We further show that the same technology can be used to efficiently direct the differentiation of RNA-induced pluripotent stem cells (RiPSCs) into terminally differentiated myogenic cells. This technology represents a safe, efficient strategy for somatic cell reprogramming and directing cell fate that has broad applicability for basic research, disease modeling, and regenerative medicine. Copyright © 2010 Elsevier Inc. All rights reserved.

  13. The expression of apoB mRNA editing factors is not the sole determinant for the induction of editing in differentiating Caco-2 cells

    International Nuclear Information System (INIS)

    Galloway, Chad A.; Smith, Harold C.

    2010-01-01

    Apolipoprotein B mRNA is edited at cytidine 6666 in the enterocytes lining the small intestine of all mammals; converting a CAA codon to a UAA stop codon. The conversion is ∼80% efficient in this tissue and leads to the expression of the truncated protein, ApoB48, essential for secretion of dietary lipid as chylomicrons. Caco-2 cell raft cultures have been used as an in vitro model for the induction of editing activity during human small intestinal cell differentiation. This induction of apoB mRNA editing has been ascribed to the expression of APOBEC-1. In agreement our data demonstrated differentiation-dependent induction of expression of the editing enzyme APOBEC-1 and in addition we show alternative splicing of the essential auxiliary factor ACF. However, transfection of these editing factors in undifferentiated proliferating Caco-2 cells was not sufficient to induce robust apoB mRNA editing activity. Only differentiation of Caco-2 cells could induce more physiological like levels of apoB mRNA editing. The data suggested that additional regulatory mechanism(s) were induced by differentiation that controlled the functional activity of editing factors.

  14. Improved differentiation of umbilical cord blood-derived mesenchymal stem cells into insulin-producing cells by PDX-1 mRNA transfection.

    Science.gov (United States)

    Van Pham, Phuc; Thi-My Nguyen, Phuoc; Thai-Quynh Nguyen, Anh; Minh Pham, Vuong; Nguyen-Tu Bui, Anh; Thi-Tung Dang, Loan; Gia Nguyen, Khue; Kim Phan, Ngoc

    2014-06-01

    Numerous studies have sought to identify diabetes mellitus treatment strategies with fewer side effects. Mesenchymal stem cell (MSC) therapy was previously considered as a promising therapy; however, it requires the cells to be trans-differentiated into cells of the pancreatic-endocrine lineage before transplantation. Previous studies have shown that PDX-1 expression can facilitate MSC differentiation into insulin-producing cells (IPCs), but the methods employed to date use viral or DNA-based tools to express PDX-1, with the associated risks of insertional mutation and immunogenicity. Thus, this study aimed to establish a new method to induce PDX-1 expression in MSCs by mRNA transfection. MSCs were isolated from human umbilical cord blood and expanded in vitro, with stemness confirmed by surface markers and multipotentiality. MSCs were transfected with PDX-1 mRNA by nucleofection and chemically induced to differentiate into IPCs (combinatorial group). This IPC differentiation was then compared with that of untransfected chemically induced cells (inducer group) and uninduced cells (control group). We found that PDX-1 mRNA transfection significantly improved the differentiation of MSCs into IPCs, with 8.3±2.5% IPCs in the combinatorial group, 3.21±2.11% in the inducer group and 0% in the control. Cells in the combinatorial group also strongly expressed several genes related to beta cells (Pdx-1, Ngn3, Nkx6.1 and insulin) and could produce C-peptide in the cytoplasm and insulin in the supernatant, which was dependent on the extracellular glucose concentration. These results indicate that PDX-1 mRNA may offer a promising approach to produce safe IPCs for clinical diabetes mellitus treatment. Copyright © 2014 International Society of Differentiation. Published by Elsevier B.V. All rights reserved.

  15. [Differential expression of IGF-I and its mRNA in mandibular condylar cartilage of rat--direct evidence for servosystem theory of facial growth].

    Science.gov (United States)

    Zhou, Z; Luo, S

    1998-05-01

    It was studied the expression of IGF-I and its mRNA in the condylar cartilage of 10 7-week-old SD male rats by using in situ hybridization and immunohisto-chemistry technique. The results showed both IGF-I and its gene expressed in growing rat condyle. IGF-I peptide was abundant in germinal zone, and positive reaction of its mRNA was strongest in transitional and maturational zones. These indicate that condylar cartilage has the capability of local production and secretion of IGF-I, mediating the command effect of STH, and differential expression of IGF-I and its mRNA might establish the local feedback loop, which supply a direct evidence for servosystem theory of facial growth.

  16. Epigenetic mechanisms involved in differential MDR1 mRNA expression between gastric and colon cancer cell lines and rationales for clinical chemotherapy

    Directory of Open Access Journals (Sweden)

    Kim Kyung-Jong

    2008-08-01

    Full Text Available Abstract Background The membrane transporters such as P-glycoprotein (Pgp, the MDR1 gene product, are one of causes of treatment failure in cancer patients. In this study, the epigenetic mechanisms involved in differential MDR1 mRNA expression were compared between 10 gastric and 9 colon cancer cell lines. Methods The MDR1 mRNA levels were determined using PCR and real-time PCR assays after reverse transcription. Cytotoxicity was performed using the MTT assay. Methylation status was explored by quantification PCR-based methylation and bisulfite DNA sequencing analyses. Results The MDR1 mRNA levels obtained by 35 cycles of RT-PCR in gastric cancer cells were just comparable to those obtained by 22 cycles of RT-PCR in colon cancer cells. Real-time RT-PCR analysis revealed that MDR1 mRNA was not detected in the 10 gastric cancer cell lines but variable MDR1 mRNA levels in 7 of 9 colon cancer cell lines except the SNU-C5 and HT-29 cells. MTT assay showed that Pgp inhibitors such as cyclosporine A, verapamil and PSC833 sensitized Colo320HSR (colon, highest MDR1 expression but not SNU-668 (gastric, highest and SNU-C5 (gastric, no expression to paclitaxel. Quantification PCR-based methylation analysis revealed that 90% of gastric cancer cells, and 33% of colon cancer cells were methylated, which were completely matched with the results obtained by bisulfite DNA sequencing analysis. 5-aza-2'-deoxcytidine (5AC, a DNA methyltransferase inhibitor increased the MDR1 mRNA levels in 60% of gastric cells, and in 11% of colon cancer cells. Trichostatin A (TSA, histone deacetylase inhibitor increased the MDR1 mRNA levels in 70% of gastric cancer cells and 55% of colon cancer cells. The combined treatment of 5AC with TSA increased the MDR1 mRNA levels additively in 20% of gastric cancer cells, but synergistically in 40% of gastric and 11% of colon cancer cells. Conclusion These results indicate that the MDR1 mRNA levels in gastric cancer cells are significantly

  17. Differential regulation of amyloid-β-protein mRNA expression within hippocampal neuronal subpopulations in Alzheimer disease

    International Nuclear Information System (INIS)

    Higgins, G.A.; Lewis, D.A.; Bahmanyar, S.; Goldgaber, D.; Gajdusek, D.C.; Young, W.G.; Morrison, J.H.; Wilson, M.C.

    1988-01-01

    The authors have mapped the neuroanatomical distribution of amyloid-β-protein mRNA within neuronal subpopulations of the hippocampal formation in the cynomolgus monkey (Macaca fascicularis), normal aged human, and patients with Alzheimer disease. Amyloid-β-protein mRNA appears to be expressed in all hippocampal neurons, but at different levels of abundance. In the central nervous system of monkey and normal aged human, image analysis shows that neurons of the dentate gyrus and cornu Ammonis fields contain a 2.5-times-greater hybridization signal than is present in neurons of the subiculum and entorhinal cortex. In contrast, in the Alzheimer disease hippocampal formation, the levels of amyloid-β-protein mRNA in the cornu Ammonis field 3 and parasubiculum are equivalent. These findings suggest that within certain neuronal subpopulations cell type-specific regulation of amyloid-β-protein gene expression may be altered in Alzheimer disease

  18. Differential gene expression in liver and small intestine from lactating rats compared to age-matched virgin controls detects increased mRNA of cholesterol biosynthetic genes

    Directory of Open Access Journals (Sweden)

    Jungsuwadee Paiboon

    2011-02-01

    Full Text Available Abstract Background Lactation increases energy demands four- to five-fold, leading to a two- to three-fold increase in food consumption, requiring a proportional adjustment in the ability of the lactating dam to absorb nutrients and to synthesize critical biomolecules, such as cholesterol, to meet the dietary needs of both the offspring and the dam. The size and hydrophobicity of the bile acid pool increases during lactation, implying an increased absorption and disposition of lipids, sterols, nutrients, and xenobiotics. In order to investigate changes at the transcriptomics level, we utilized an exon array and calculated expression levels to investigate changes in gene expression in the liver, duodenum, jejunum, and ileum of lactating dams when compared against age-matched virgin controls. Results A two-way mixed models ANOVA was applied to detect differentially expressed genes. Significance calls were defined as a p Cyp7a1, which catalyzes the rate limiting step in the bile acid biosynthetic pathway, was also significantly increased in liver. In addition, decreased levels of mRNA associated with T-cell signaling were found in the jejunum and ileum. Several members of the Solute Carrier (SLC and Adenosine Triphosphate Binding Cassette (ABC superfamilies of membrane transporters were found to be differentially expressed; these genes may play a role in differences in nutrient and xenobiotic absorption and disposition. mRNA expression of SLC39a4_predicted, a zinc transporter, was increased in all tissues, suggesting that it is involved in increased zinc uptake during lactation. Microarray data are available through GEO under GSE19175. Conclusions We detected differential expression of mRNA from several pathways in lactating dams, including upregulation of the cholesterol biosynthetic pathway in liver and intestine, consistent with Srebp activation. Differential T-Cell signaling in the two most distal regions of the small intestine (ileum and

  19. Differential between Protein and mRNA Expression of CCR7 and SSTR5 Receptors in Crohn's Disease Patients

    Directory of Open Access Journals (Sweden)

    Nathalie Taquet

    2009-01-01

    Full Text Available Crohn's disease (CD is a multifactorial chronic inflammatory bowel disease of unknown cause. The aim of the present study was to explore if mRNA over-expression of SSTR5 and CCR7 found in CD patients could be correlated to respective protein expression. When compared to healthy donors, SSTR5 was over-expressed 417 ± 71 times in CD peripheral blood mononuclear cells (PBMCs. Flow cytometry experiments showed no correlation between mRNA and protein expression for SSTR5 in PBMCs. In an attempt to find a reason of such a high mRNA expression, SSTR5 present on CD PBMCs were tested and found as biologically active as on healthy cells. In biopsies of CD intestinal tissue, SSTR5 was not over-expressed but CCR7, unchanged in PBMCs, was over-expressed by 10 ± 3 times in the lamina propria. Confocal microscopy showed a good correlation of CCR7 mRNA and protein expression in CD intestinal biopsies. Our data emphasize flow and image cytometry as impossible to circumvent in complement to molecular biology so to avoid false interpretation on receptor expressions. Once confirmed by further large-scale studies, our preliminary results suggest a role for SSTR5 and CCR7 in CD pathogenesis.

  20. Human Monocytes Accelerate Proliferation and Blunt Differentiation of Preadipocytes in Association With Suppression of C/Ebpα mRNA

    Science.gov (United States)

    Couturier, Jacob; Patel, Sanjeet G.; Iyer, Dinakar; Balasubramanyam, Ashok; Lewis, Dorothy E.

    2015-01-01

    Obesity, type 2 diabetes, and HIV-associated lipodystrophy are associated with abnormalities in adipocyte growth and differentiation. In persons with these conditions, adipose depots contain increased numbers of macrophages, but the origins of these cells and their specific effects are uncertain. Peripheral blood mononuclear cells (PBMC)-derived monocytes, but not T cells, cocultured via transwells with primary subcutaneous preadipocytes, increased proliferation (approximately twofold) and reduced differentiation (~50%) of preadipocytes. Gene expression analyses in proliferating preadipocytes (i.e., prior to hormonal induction of terminal differentiation) revealed that monocytes down-regulated mRNA levels of CCAAT/enhancer binding protein, alpha (C/EBPα) and up-regulated mRNA levels of G0/G1 switch 2 (G0S2) message, genes important for the regulation of adipogenesis and the cell cycle. These data indicate that circulating peripheral blood monocytes can disrupt adipogenesis by interfering with a critical step in C/EBPα and G0S2 transcription required for preadipocytes to make the transition from proliferation to differentiation. Interactions between preadipocytes and monocytes also increased the inflammatory cytokines IL-6 and IL-8, as well as a novel chemotactic cytokine, CXCL1. Additionally, the levels of both IL-6 and CXCL1 were highest when preadipocytes and monocytes were cultured together, compared to each cell in culture alone. Such cross-talk amplifies the production of mediators of tissue inflammation. PMID:21869759

  1. Rhythmic expression of Nocturnin mRNA in multiple tissues of the mouse

    Directory of Open Access Journals (Sweden)

    Green Carla B

    2001-05-01

    Full Text Available Abstract Background Nocturnin was originally identified by differential display as a circadian clock regulated gene with high expression at night in photoreceptors of the African clawed frog, Xenopus laevis. Although encoding a novel protein, the nocturnin cDNA had strong sequence similarity with a C-terminal domain of the yeast transcription factor CCR4, and with mouse and human ESTs. Since its original identification others have cloned mouse and human homologues of nocturnin/CCR4, and we have cloned a full-length cDNA from mouse retina, along with partial cDNAs from human, cow and chicken. The goal of this study was to determine the temporal pattern of nocturnin mRNA expression in multiple tissues of the mouse. Results cDNA sequence analysis revealed a high degree of conservation among vertebrate nocturnin/CCR4 homologues along with a possible homologue in Drosophila. Northern analysis of mRNA in C3H/He and C57/Bl6 mice revealed that the mNoc gene is expressed in a broad range of tissues, with greatest abundance in liver, kidney and testis. mNoc is also expressed in multiple brain regions including suprachiasmatic nucleus and pineal gland. Furthermore, mNoc exhibits circadian rhythmicity of mRNA abundance with peak levels at the time of light offset in the retina, spleen, heart, kidney and liver. Conclusion The widespread expression and rhythmicity of mNoc mRNA parallels the widespread expression of other circadian clock genes in mammalian tissues, and suggests that nocturnin plays an important role in clock function or as a circadian clock effector.

  2. Differentiation of the mRNA transcripts originating from the alpha 1- and alpha 2-globin loci in normals and alpha-thalassemics.

    OpenAIRE

    Liebhaber, S A; Kan, Y W

    1981-01-01

    The alpha-globin polypeptide is encoded by two adjacent genes, alpha 1 and alpha 2. In the normal diploid state (alpha alpha/alpha alpha) all four alpha-globin genes are expressed. Loss or dysfunction of one or more of these genes leads to deficient alpha-globin production and results in alpha-thalassemia. We present a technique to differentially assess the steady-state levels of the alpha 1- and alpha-2-globin messenger RNA (mRNA) transcripts and thus delineate the relative level of expressi...

  3. 1200 nt rat liver mRNA identified by differential hybridization exhibits coordinate regulation with 3-hydroxy-3-methylglutaryl coenzyme A (HMG CoA) reductase

    International Nuclear Information System (INIS)

    Tanaka, R.D.; Clarke, C.F.; Fogelman, A.M.; Edwards, P.A.

    1986-01-01

    Differential hybridization has been used to identify genes in rat liver that encode transcripts which are increased by the drugs cholestyramine and mevinolin and are decreased by dietary cholesterol. This approach should prove useful in isolating and identifying coordinately regulated genes involved in the isoprene biosynthetic pathway. Rat liver poly (A) + RNA was isolated from animals fed diets supplemented with either cholestyramine and mevinolin or with cholesterol. Radiolabeled cDNAs generated from these two RNA preparations were used to screen a rat cDNAs library. A preliminary screen of 10,000 recombinants has led to the identification of a clone with an insert of 1200 bp that hybridizes to a mRNA species of about 1200 nt. The level of this RNA species in rat liver is elevated by the drugs cholestyramine and mevinolin and is decreased by cholesterol feeding. This RNA species is also decreased by mevalonate administration to rats. The regulation of this 1200 nt mRNA species mirrors that of HMG CoA reductase and HMG CoA synthase. It seems very likely that this 1200 nt mRNA encodes a polypeptide which is involved in the isoprene biosynthetic pathway

  4. Highly efficient reprogramming to pluripotency and directed differentiation of human cells using synthetic modified mRNA

    OpenAIRE

    Warren, Luigi; Manos, Philip D.; Ahfeldt, Tim; Loh, Yuin-Han; Li, Hu; Lau, Frank; Ebina, Wataru; Mandal, Pankaj; Smith, Zachary D.; Meissner, Alexander; Daley, George Q.; Brack, Andrew S.; Collins, James J.; Cowan, Chad; Schlaeger, Thorsten M.

    2010-01-01

    Clinical application of induced pluripotent stem (iPS) cells is limited by the low efficiency of iPS derivation and the fact that most protocols modify the genome to effect cellular reprogramming. Moreover, safe and effective means of directing the fate of patient-specific iPS cells towards clinically useful cell types are lacking. Here we describe a simple, non-integrating strategy for reprogramming cell fate based on administration of synthetic mRNA modified to overcome innate anti-viral re...

  5. Stem cells. m6A mRNA methylation facilitates resolution of naïve pluripotency toward differentiation.

    Science.gov (United States)

    Geula, Shay; Moshitch-Moshkovitz, Sharon; Dominissini, Dan; Mansour, Abed AlFatah; Kol, Nitzan; Salmon-Divon, Mali; Hershkovitz, Vera; Peer, Eyal; Mor, Nofar; Manor, Yair S; Ben-Haim, Moshe Shay; Eyal, Eran; Yunger, Sharon; Pinto, Yishay; Jaitin, Diego Adhemar; Viukov, Sergey; Rais, Yoach; Krupalnik, Vladislav; Chomsky, Elad; Zerbib, Mirie; Maza, Itay; Rechavi, Yoav; Massarwa, Rada; Hanna, Suhair; Amit, Ido; Levanon, Erez Y; Amariglio, Ninette; Stern-Ginossar, Noam; Novershtern, Noa; Rechavi, Gideon; Hanna, Jacob H

    2015-02-27

    Naïve and primed pluripotent states retain distinct molecular properties, yet limited knowledge exists on how their state transitions are regulated. Here, we identify Mettl3, an N(6)-methyladenosine (m(6)A) transferase, as a regulator for terminating murine naïve pluripotency. Mettl3 knockout preimplantation epiblasts and naïve embryonic stem cells are depleted for m(6)A in mRNAs, yet are viable. However, they fail to adequately terminate their naïve state and, subsequently, undergo aberrant and restricted lineage priming at the postimplantation stage, which leads to early embryonic lethality. m(6)A predominantly and directly reduces mRNA stability, including that of key naïve pluripotency-promoting transcripts. This study highlights a critical role for an mRNA epigenetic modification in vivo and identifies regulatory modules that functionally influence naïve and primed pluripotency in an opposing manner. Copyright © 2015, American Association for the Advancement of Science.

  6. Differential expression of viral PAMP receptors mRNA in peripheral blood of patients with chronic hepatitis C infection

    Directory of Open Access Journals (Sweden)

    Riñón Marta

    2007-11-01

    Full Text Available Abstract Background Pathogen-associated molecular patterns (PAMP receptors play a key role in the early host response to viruses. In this work, we determined mRNA levels of two members of the Toll-like Receptors family, (TLR3 and TLR7 and the helicase RIG-I, all of three recognizing viral RNA products, in peripheral blood of healthy donors and hepatitis C virus (HCV patients, to observe if their transcripts are altered in this disease. Methods IFN-α, TLR3, TLR7 and RIG-I levels in peripheral blood from healthy controls (n = 18 and chronic HCV patients (n = 18 were quantified by real-time polymerase chain reaction. Results Our results show that IFN-α, TLR3, TLR7 and RIG-I mRNA levels are significantly down-regulated in patients with chronic HCV infection when compared with healthy controls. We also found that the measured levels of TLR3 and TLR7, but not RIG-I, correlated significantly with those of IFN-α Conclusion Monitoring the expression of RNA-sensing receptors like TLR3, TLR7 and RIG-I during the different clinical stages of infection could bring a new source of data about the prognosis of disease.

  7. Differential conserted activity induced regulation of Nogo receptors (1-3, LOTUS and Nogo mRNA in mouse brain.

    Directory of Open Access Journals (Sweden)

    Tobias E Karlsson

    Full Text Available Nogo Receptor 1 (NgR1 mRNA is downregulated in hippocampal and cortical regions by increased neuronal activity such as a kainic acid challenge or by exposing rats to running wheels. Plastic changes in cerebral cortex in response to loss of specific sensory inputs caused by spinal cord injury are also associated with downregulation of NgR1 mRNA. Here we investigate the possible regulation by neuronal activity of the homologous receptors NgR2 and NgR3 as well as the endogenous NgR1 antagonist LOTUS and the ligand Nogo. The investigated genes respond to kainic acid by gene-specific, concerted alterations of transcript levels, suggesting a role in the regulation of synaptic plasticity, Downregulation of NgR1, coupled to upregulation of the NgR1 antagonist LOTUS, paired with upregulation of NgR2 and 3 in the dentate gyrus suggest a temporary decrease of Nogo/OMgp sensitivity while CSPG and MAG sensitivity could remain. It is suggested that these activity-synchronized temporary alterations may serve to allow structural alterations at the level of local synaptic circuitry in gray matter, while maintaining white matter pathways and that subsequent upregulation of Nogo-A and NgR1 transcript levels signals the end of such a temporarily opened window of plasticity.

  8. Differential trypanosome surface coat regulation by a CCCH protein that co-associates with procyclin mRNA cis-elements.

    Directory of Open Access Journals (Sweden)

    Pegine Walrad

    2009-02-01

    Full Text Available The genome of Trypanosoma brucei is unusual in being regulated almost entirely at the post-transcriptional level. In terms of regulation, the best-studied genes are procyclins, which encode a family of major surface GPI-anchored glycoproteins (EP1, EP2, EP3, GPEET that show differential expression in the parasite's tsetse-fly vector. Although procyclin mRNA cis-regulatory sequences have provided the paradigm for post-transcriptional control in kinetoplastid parasites, trans-acting regulators of procyclin mRNAs are unidentified, despite intensive effort over 15 years. Here we identify the developmental regulator, TbZFP3, a CCCH-class predicted RNA binding protein, as an isoform-specific regulator of Procyclin surface coat expression in trypanosomes. We demonstrate (i that endogenous TbZFP3 shows sequence-specific co-precipitation of EP1 and GPEET, but not EP2 and EP3, procyclin mRNA isoforms, (ii that ectopic overexpression of TbZFP3 does not perturb the mRNA abundance of procyclin transcripts, but rather that (iii their protein expression is regulated in an isoform-specific manner, as evidenced by mass spectrometric analysis of the Procyclin expression signature in the transgenic cell lines. The TbZFP3 mRNA-protein complex (TbZFP3mRNP is identified as a trans-regulator of differential surface protein expression in trypanosomes. Moreover, its sequence-specific interactions with procyclin mRNAs are compatible with long-established predictions for Procyclin regulation. Combined with the known association of TbZFP3 with the translational apparatus, this study provides a long-sought missing link between surface protein cis-regulatory signals and the gene expression machinery in trypanosomes.

  9. Integrated analysis of miRNA and mRNA expression profiles in tilapia gonads at an early stage of sex differentiation.

    Science.gov (United States)

    Tao, Wenjing; Sun, Lina; Shi, Hongjuan; Cheng, Yunying; Jiang, Dongneng; Fu, Beide; Conte, Matthew A; Gammerdinger, William J; Kocher, Thomas D; Wang, Deshou

    2016-05-04

    MicroRNAs (miRNAs) represent a second regulatory network that has important effects on gene expression and protein translation during biological process. However, the possible role of miRNAs in the early stages of fish sex differentiation is not well understood. In this study, we carried an integrated analysis of miRNA and mRNA expression profiles to explore their possibly regulatory patterns at the critical stage of sex differentiation in tilapia. We identified 279 pre-miRNA genes in tilapia genome, which were highly conserved in other fish species. Based on small RNA library sequencing, we identified 635 mature miRNAs in tilapia gonads, in which 62 and 49 miRNAs showed higher expression in XX and XY gonads, respectively. The predicted targets of these sex-biased miRNAs (e.g., miR-9, miR-21, miR-30a, miR-96, miR-200b, miR-212 and miR-7977) included genes encoding key enzymes in steroidogenic pathways (Cyp11a1, Hsd3b, Cyp19a1a, Hsd11b) and key molecules involved in vertebrate sex differentiation (Foxl2, Amh, Star1, Sf1, Dmrt1, and Gsdf). These genes also showed sex-biased expression in tilapia gonads at 5 dah. Some miRNAs (e.g., miR-96 and miR-737) targeted multiple genes involved in steroid synthesis, suggesting a complex miRNA regulatory network during early sex differentiation in this fish. The sequence and expression patterns of most miRNAs in tilapia are conserved in fishes, indicating the basic functions of vertebrate miRNAs might share a common evolutionary origin. This comprehensive analysis of miRNA and mRNA at the early stage of molecular sex differentiation in tilapia XX and XY gonads lead to the discovery of differentially expressed miRNAs and their putative targets, which will facilitate studies of the regulatory network of molecular sex determination and differentiation in fishes.

  10. Differential Expression Analysis by RNA-Seq Reveals Perturbations in the Platelet mRNA Transcriptome Triggered by Pathogen Reduction Systems.

    Directory of Open Access Journals (Sweden)

    Abdimajid Osman

    Full Text Available Platelet concentrates (PCs are prepared at blood banks for transfusion to patients in certain clinical conditions associated with a low platelet count. To prevent transfusion-transmitted infections via PCs, different pathogen reduction (PR systems have been developed that inactivate the nucleic acids of contaminating pathogens by chemical cross-linking, a mechanism that may also affect platelets' nucleic acids. We previously reported that treatment of stored platelets with the PR system Intercept significantly reduced the level of half of the microRNAs that were monitored, induced platelet activation and compromised the platelet response to physiological agonists. Using genome-wide differential expression (DE RNA sequencing (RNA-Seq, we now report that Intercept markedly perturbs the mRNA transcriptome of human platelets and alters the expression level of >800 mRNAs (P<0.05 compared to other PR systems and control platelets. Of these, 400 genes were deregulated with DE corresponding to fold changes (FC ≥ 2. At the p-value < 0.001, as many as 147 genes were deregulated by ≥ 2-fold in Intercept-treated platelets, compared to none in the other groups. Finally, integrated analysis combining expression data for microRNA (miRNA and mRNA, and involving prediction of miRNA-mRNA interactions, disclosed several positive and inverse correlations between miRNAs and mRNAs in stored platelets. In conclusion, this study demonstrates that Intercept markedly deregulates the platelet mRNA transcriptome, concomitant with reduced levels of mRNA-regulatory miRNAs. These findings should enlighten authorities worldwide when considering the implementation of PR systems, that target nucleic acids and are not specific to pathogens, for the management of blood products.

  11. Ectopic expression and knocking-down of LINE-1 mRNA in human mesenchymal stem cells: impact on in vitro osteogenic and adipogenic differentiation

    KAUST Repository

    Atinbayeva, Nazerke

    2018-05-01

    There are two classes of transposable elements: DNA transposons and retrotransposons. DNA transposons spread in the genome by “cut and paste” mechanism. In contrast, retrotransposons use copy and paste strategy involving RNA and retrotranscriptase mediated mechanism; these include long interspersed nuclear elements-1 (LINE-1, L1) and short interspersed nuclear elements (SINE). In mammals, in order to maintain genome integrity both types of transposons are tightly repressed. However, some copies of retrotransposons are still active in germ cells contributing to natural variation. Surprisingly, recent reports indicate that also somatic cells support L1 reactivation in early development, in particular in the brain leading to mosaicism. However, whether L1 retrotransposition is a part of other cell lineage developmental programs and its functional significance in the context of cell differentiation remain to be elucidated. To address this question, I investigated whether L1 retrotransposition was occurring during in vitro osteogenic and adipogenic differentiation of bone marrow derived human mesenchymal stem cells (hMSCs). Interestingly, clinical observations have revealed loss of bone density in HIV-infected individuals treated with nucleoside analogs that inhibit HIV retrotranscriptase, as well as the endogenous one encoded by L1s. This observation made us to hypothesize that transposable elements played a positive role in post-natal bone homeostasis. I found that while adipogenesis is “retrotransposition free”, osteogenic differentiation is a “retrotransposition-prone” process and its inhibition blocks its genetic program. Indeed, L1 DNA content does not change during adipogenic differentiation and that of retrotranscriptase does not have any effect on the acquisition of a terminally differentiated phenotype. In contrast, soon after MSCs commitment into pre-osteoblasts, L1 retrotransposable elements increase their expression and actively transpose

  12. Novel subtractive transcription-based amplification of mRNA (STAR method and its application in search of rare and differentially expressed genes in AD brains

    Directory of Open Access Journals (Sweden)

    Walker P Roy

    2006-11-01

    Full Text Available Abstract Background Alzheimer's disease (AD is a complex disorder that involves multiple biological processes. Many genes implicated in these processes may be present in low abundance in the human brain. DNA microarray analysis identifies changed genes that are expressed at high or moderate levels. Complementary to this approach, we described here a novel technology designed specifically to isolate rare and novel genes previously undetectable by other methods. We have used this method to identify differentially expressed genes in brains affected by AD. Our method, termed Subtractive Transcription-based Amplification of mRNA (STAR, is a combination of subtractive RNA/DNA hybridization and RNA amplification, which allows the removal of non-differentially expressed transcripts and the linear amplification of the differentially expressed genes. Results Using the STAR technology we have identified over 800 differentially expressed sequences in AD brains, both up- and down- regulated, compared to age-matched controls. Over 55% of the sequences represent genes of unknown function and roughly half of them were novel and rare discoveries in the human brain. The expression changes of nearly 80 unique genes were further confirmed by qRT-PCR and the association of additional genes with AD and/or neurodegeneration was established using an in-house literature mining tool (LitMiner. Conclusion The STAR process significantly amplifies unique and rare sequences relative to abundant housekeeping genes and, as a consequence, identifies genes not previously linked to AD. This method also offers new opportunities to study the subtle changes in gene expression that potentially contribute to the development and/or progression of AD.

  13. OVO homologue-like 1 (Ovol1) transcription factor: a novel target of neurogenin-3 in rodent pancreas.

    Science.gov (United States)

    Vetere, A; Li, W-C; Paroni, F; Juhl, K; Guo, L; Nishimura, W; Dai, X; Bonner-Weir, S; Sharma, A

    2010-01-01

    The basic helix-loop-helix transcription factor neurogenin-3 (NGN3) commits the fates of pancreatic progenitors to endocrine cell types, but knowledge of the mechanisms regulating the choice between proliferation and differentiation of these progenitors is limited. Using a chromatin immunoprecipitation cloning approach, we searched for direct targets of NGN3 and identified a zinc-finger transcription factor, OVO homologue-like 1 (OVOL1). Transactivation experiments were carried out to elucidate the functional role of NGN3 in Ovol1 gene expression. Embryonic and adult rodents pancreases were immunostained for OVOL1, Ki67 and NGN3. We showed that NGN3 negatively regulates transcription of Ovol1 in an E-box-dependent fashion. The presence of either NGN3 or NEUROD1, but not MYOD, reduced endogenous Ovol1 mRNA. OVOL1 was detected in pancreatic tissue around embryonic day 15.5, after which OVOL1 levels dramatically increased. In embryonic pancreas, OVOL1 protein levels were low in NGN3(+) or Ki67(+) cells, but high in quiescent differentiated cells. OVOL1 presence was maintained in adult pancreas, where it was detected in islets, pancreatic ducts and some acinar cells. Additionally OVOL1 presence was lacking in proliferating ductules in regenerating pancreas and induced in cells as they began to acquire their differentiated phenotype. The timing of OVOL1 appearance in pancreas and its increased levels in differentiated cells suggest that OVOL1 promotes the transition of cells from a proliferating, less-differentiated state to a quiescent more-differentiated state. We conclude that OVOL1, a downstream target of NGN3, may play an important role in regulating the balance between proliferation and differentiation of pancreatic cells.

  14. Increased mRNA Levels of Sphingosine Kinases and S1P Lyase and Reduced Levels of S1P Were Observed in Hepatocellular Carcinoma in Association with Poorer Differentiation and Earlier Recurrence.

    Science.gov (United States)

    Uranbileg, Baasanjav; Ikeda, Hitoshi; Kurano, Makoto; Enooku, Kenichiro; Sato, Masaya; Saigusa, Daisuke; Aoki, Junken; Ishizawa, Takeaki; Hasegawa, Kiyoshi; Kokudo, Norihiro; Yatomi, Yutaka

    2016-01-01

    Although sphingosine 1-phosphate (S1P) has been reported to play an important role in cancer pathophysiology, little is known about S1P and hepatocellular carcinoma (HCC). To clarify the relationship between S1P and HCC, 77 patients with HCC who underwent surgical treatment were consecutively enrolled in this study. In addition, S1P and its metabolites were quantitated by LC-MS/MS. The mRNA levels of sphingosine kinases (SKs), which phosphorylate sphingosine to generate S1P, were increased in HCC tissues compared with adjacent non-HCC tissues. Higher mRNA levels of SKs in HCC were associated with poorer differentiation and microvascular invasion, whereas a higher level of SK2 mRNA was a risk factor for intra- and extra-hepatic recurrence. S1P levels, however, were unexpectedly reduced in HCC compared with non-HCC tissues, and increased mRNA levels of S1P lyase (SPL), which degrades S1P, were observed in HCC compared with non-HCC tissues. Higher SPL mRNA levels in HCC were associated with poorer differentiation. Finally, in HCC cell lines, inhibition of the expression of SKs or SPL by siRNA led to reduced proliferation, invasion and migration, whereas overexpression of SKs or SPL enhanced proliferation. In conclusion, increased SK and SPL mRNA expression along with reduced S1P levels were more commonly observed in HCC tissues compared with adjacent non-HCC tissues and were associated with poor differentiation and early recurrence. SPL as well as SKs may be therapeutic targets for HCC treatment.

  15. The Mycobacterium tuberculosis homologue of the Mycobacterium ...

    African Journals Online (AJOL)

    With the completion of genome sequencing of Mycobacterium tuberculosis and upsurge in the incidence of M. tuberculosis infection worldwide partly as a result of HIV pandemic, there is need for rationale approach to vaccine and chemotherapy discoveries for M. tuberculosis. The homologue of mig gene of. Mycobacterium ...

  16. Integrative testis transcriptome analysis reveals differentially expressed miRNAs and their mRNA targets during early puberty in Atlantic salmon.

    Science.gov (United States)

    Skaftnesmo, K O; Edvardsen, R B; Furmanek, T; Crespo, D; Andersson, E; Kleppe, L; Taranger, G L; Bogerd, J; Schulz, R W; Wargelius, A

    2017-10-18

    Our understanding of the molecular mechanisms implementing pubertal maturation of the testis in vertebrates is incomplete. This topic is relevant in Atlantic salmon aquaculture, since precocious male puberty negatively impacts animal welfare and growth. We hypothesize that certain miRNAs modulate mRNAs relevant for the initiation of puberty. To explore which miRNAs regulate mRNAs during initiation of puberty in salmon, we performed an integrated transcriptome analysis (miRNA and mRNA-seq) of salmon testis at three stages of development: an immature, long-term quiescent stage, a prepubertal stage just before, and a pubertal stage just after the onset of single cell proliferation activity in the testis. Differentially expressed miRNAs clustered into 5 distinct expression profiles related to the immature, prepubertal and pubertal salmon testis. Potential mRNA targets of these miRNAs were predicted with miRmap and filtered for mRNAs displaying negatively correlated expression patterns. In summary, this analysis revealed miRNAs previously known to be regulated in immature vertebrate testis (miR-101, miR-137, miR-92b, miR-18a, miR-20a), but also miRNAs first reported here as regulated in the testis (miR-new289, miR-30c, miR-724, miR-26b, miR-new271, miR-217, miR-216a, miR-135a, miR-new194 and the novel predicted n268). By KEGG enrichment analysis, progesterone signaling and cell cycle pathway genes were found regulated by these differentially expressed miRNAs. During the transition into puberty we found differential expression of miRNAs previously associated (let7a/b/c), or newly associated (miR-15c, miR-2184, miR-145 and the novel predicted n7a and b) with this stage. KEGG enrichment analysis revealed that mRNAs of the Wnt, Hedgehog and Apelin signaling pathways were potential regulated targets during the transition into puberty. Likewise, several regulated miRNAs in the pubertal stage had earlier been associated (miR-20a, miR-25, miR-181a, miR-202, let7c/d/a, miR-125b

  17. Characterization of four RecQ homologues from rice (Oryza sativa L. cv. Nipponbare)

    International Nuclear Information System (INIS)

    Saotome, Ai; Kimura, Seisuke; Mori, Yoko; Uchiyama, Yukinobu; Morohashi, Kengo; Sakaguchi, Kengo

    2006-01-01

    The RecQ family of DNA helicases is conserved throughout the biological kingdoms. In this report, we have characterized four RecQ homologues clearly expressed in rice. OsRecQ1, OsRecQ886, and OsRecQsim expressions were strongly detected in meristematic tissues. Transcription of the OsRecQ homologues was differentially induced by several types of DNA-damaging agents. The expression of four OsRecQ homologues was induced by MMS and bleomycin. OsRecQ1 and OsRecQ886 were induced by H 2 O 2 , and MitomycinC strongly induced the expression of OsRecQ1. Transient expression of OsRecQ/GFP fusion proteins demonstrated that OsRecQ2 and OsRecQ886 are found in nuclei, whereas OsRecQ1 and OsRecQsim are found in plastids. Neither OsRecQ1 nor OsRecQsim are induced by light. These results indicate that four of the RecQ homologues have different and specific functions in DNA repair pathways, and that OsRecQ1 and OsRecQsim may not involve in plastid differentiation but different aspects of a plastid-specific DNA repair system

  18. The role of the leukemia-associated ETO homologue repressors in hematopoiesis

    OpenAIRE

    Olsson, André

    2006-01-01

    The fusion protein AML1-ETO is observed in acute myeloid patients with the chromosomal translocation t(8;21). Cells with this chimeric protein have impaired granulocytic and erythroid differentiation with accumulation of myeloblasts. The transcriptional co-repressor ETO (Eight Twenty One) was identified from the cloning of AML1-ETO. Subsequently, MTGR1 (Myeloid Translocation Gene-Related protein 1) and MTG16 (Myeloid Translocation Gene on chromosome 16) were found to be homologues to ETO, all...

  19. Silver-staining mRNA differential display method and cloning of tumor related genes in HepG2 cell line%银染mRNA差异显示法克隆肝癌相关基因

    Institute of Scientific and Technical Information of China (English)

    王新; 黄裕新; 闻勤生; 王庆莉

    2001-01-01

    AIM To develop mRNA differential display polymerize chain reaction (DD-PCR) method with silver staining and to clone the liver cancer related genes in HepG2 cell line. METHODS Total RNA was extracted from the HepG2 cells and L02 cells. Their first strains of cDNA were produced by reverse transcription (RT). The cDNA were amplified by PCR using an anchored primer 5 dT11G combined with eight arbitrary primers respectively. The products of PCR were analyzed on a denaturing 60 g*L-1 polyacrylamide gel. The differential DNA bands on gel were seen by silver-staining.RESULTS Several liver cancer related genes were isolated and identified by the sensitive silver-staining mRNA differential display developed. CONCLUSION The established mRNA differential display method with silver staining is a simple, efficient means which has higher value for screening and cloning differentially expressed genes.%目的建立银染mRNA差异显示方法,筛选并克隆肝癌相关基因. 方法以建系的人肝癌细胞HepG2和正常的肝细胞L02的总RNA为模板,用5-dT11G锚定引物和8条随机引物(AP1~AP8)组合进行RT-PCR扩增,PCR产物经60 g*L-1尿素变性聚丙烯酰胺凝胶电泳分离后,凝胶银盐染色显示差异的DNA片段. 结果建立了快速敏感的银染mRNA差异显示方法,分离并克隆了一些肝癌相关基因. 结论建立的银染mRNA差异显示法简单、有效,在差异表达基因的筛选中有较高的实用价值.

  20. Ectopic expression and knocking-down of LINE-1 mRNA in human mesenchymal stem cells: impact on in vitro osteogenic and adipogenic differentiation

    KAUST Repository

    Atinbayeva, Nazerke

    2018-01-01

    on the acquisition of a terminally differentiated phenotype. In contrast, soon after MSCs commitment into pre-osteoblasts, L1 retrotransposable elements increase their expression and actively transpose. Inhibition of retrotransposition and knock down of L1 m

  1. Intrauterine growth restriction and differential patterns of hepatic growth and expression of IGF1, PCK2, and HSDL1 mRNA in the sheep fetus in late gestation.

    Science.gov (United States)

    Gentili, Sheridan; Morrison, Janna L; McMillen, I Caroline

    2009-06-01

    Fetal adaptations to periods of substrate deprivation can result in the programming of glucose intolerance, insulin resistance, and metabolic dysfunction in later life. Placental insufficiency can be associated with either sparing or sacrifice of fetal liver growth, and these different responses may have different metabolic consequences. It is unclear what intrahepatic mechanisms determine the differential responses of the fetal liver to substrate restriction. We investigated the effects of placental restriction (PR) on liver growth and the hepatic expression of SLC2A1, IGF1, IGF2, IGF1R, IGF2R, PPARGC1A, PPARA, PRKAA1, PRKAA2, PCK2, and HSDL1 mRNA in fetal sheep at 140-145 days of gestation. A mean gestational arterial partial pressure of oxygen less than 17 mmHg was defined as hypoxic, and a relative liver of weight more than 2 SD below the mean liver weight of controls was defined as reduced liver growth. Fetuses therefore were defined as control-normoxic (C-N; n = 9), PR-normoxic (PR-N; n = 7), PR-hypoxic (PR-H; n = 8), or PR-hypoxic reduced liver growth (PR-H RLG; n = 4). Hepatic SLC2A1 mRNA expression was highest (P fetal substrate restriction may exist that protect the liver from decreased growth and, potentially, from a decreased responsiveness to the actions of insulin in postnatal life.

  2. Differential mRNA expression of seven genes involved in cholesterol metabolism and transport in the liver of atherosclerosis-susceptible and -resistant Japanese quail strains

    Directory of Open Access Journals (Sweden)

    Li Xinrui

    2012-06-01

    Full Text Available Abstract Background Two atherosclerosis-susceptible and -resistant Japanese quail (Coturnix japonica strains obtained by divergent selection are commonly used as models to study atherosclerosis, but no genetic characterization of their phenotypic differences has been reported so far. Our objective was to examine possible differences in the expression of genes involved in cholesterol metabolism and transport in the liver between these two strains and to evaluate the value of this model to analyze the gene system affecting cholesterol metabolism and transport. Methods A factorial study with both strains (atherosclerosis-susceptible versus atherosclerosis-resistant and two diets (control versus cholesterol was carried out. The mRNA concentrations of four genes involved in cholesterol biosynthesis (HMGCR, FDFT1, SQLE and DHCR7 and three genes in cholesterol transport (ABCG5, ABCG8 and APOA1 were assayed using real-time quantitative PCR. Plasma lipids were also assayed. Results Expression of ABCG5 (control diet and ABCG8 (regardless of dietary treatment and expression of HMGCR, FDFT1 and SQLE (regardless of dietary treatment were significantly higher in the atherosclerosis-resistant than in the atherosclerosis-susceptible strain. Plasma triglyceride and LDL levels, and LDL/HDL ratio were significantly higher in the atherosclerosis-susceptible than in the atherosclerosis-resistant strain fed the cholesterol diet. In the atherosclerosis-susceptible strain, ABCG5 expression regressed significantly and positively on plasma LDL level, whereas DHCR7 and SQLE expression regressed significantly and negatively on plasma triglyceride level. Conclusions Our results provide support for the hypothesis that the atherosclerosis-resistant strain metabolizes and excretes cholesterol faster than the atherosclerosis-susceptible strain. We have also demonstrated that these quail strains are a useful model to study cholesterol metabolism and transport in relation with

  3. Differential effects of voluntary wheel running and toy rotation on the mRNA expression of neurotrophic factors and FKBP5 in a post-traumatic stress disorder rat model with the shuttle-box task.

    Science.gov (United States)

    Tanichi, Masaaki; Toda, Hiroyuki; Shimizu, Kunio; Koga, Minori; Saito, Taku; Enomoto, Shingo; Boku, Shuken; Asai, Fumiho; Mitsui, Yumi; Nagamine, Masanori; Fujita, Masanori; Yoshino, Aihide

    2018-06-18

    Life-threatening experiences can result in the development of post-traumatic stress disorder. We have developed an animal model for post-traumatic stress disorder (PTSD) using a shuttle box in rats. In this paradigm, the rats were exposed to inescapable foot-shock stress (IS) in a shuttle box, and then an avoidance/escape task was performed in the same box 2 weeks after IS. A previous study using this paradigm revealed that environmental enrichment (EE) ameliorated avoidance/numbing-like behaviors, but not hyperarousal-like behaviors, and EE also elevated hippocampal brain-derived neurotrophic factor (BDNF) expression. However, the differential effects of EE components, i.e., running wheel (RW) or toy rotation, on PTSD-like behaviors has remained unclear. In this experiment, we demonstrated that RW, toy rotation, and EE (containing RW and toy rotation) ameliorated avoidance/numbing-like behaviors, induced learning of avoidance responses, and improved depressive-like behaviors in traumatized rats. The RW increased the hippocampal mRNA expression of neurotrophic factors, especially BDNF and glial-cell derived neurotrophic factor. Toy rotation influenced FK506 binding protein 5 mRNA expression, which is believed to be a regulator of the hypothalamic-pituitary-adrenal (HPA)-axis system, in the hippocampus and amygdala. This is the first report to elucidate the differential mechanistic effects of RW and toy rotation. The former appears to exert its effects via neurotrophic factors, while the latter exerts its effects via the HPA axis. Further studies will lead to a better understanding of the influence of environmental factors on PTSD. Copyright © 2018 Elsevier Inc. All rights reserved.

  4. Targeting the Enhancer of Zeste Homologue 2 in Medulloblastoma

    Science.gov (United States)

    Alimova, Irina; Venkataraman, Sujatha; Harris, Peter; Marquez, Victor E.; Northcott, Paul A; Dubuc, Adrian; Taylor, Michael D; Foreman, Nicholas K; Vibhakar, Rajeev

    2012-01-01

    Enhancer of zeste homologue 2 (EZH2) is the catalytic subunit of Polycomb repressive complex 2 that catalyzes the trimethylation of histone H3 on Lys 27, and represses gene transcription. EZH2 enhances cancer-cell proliferation and regulates stem cell maintenance and differentiation. Here, we demonstrate that EZH2 is highly expressed in medulloblastoma, a highly malignant brain tumor of childhood, and this altered expression is correlated with genomic gain of chromosome 7 in a subset of medulloblastoma. Inhibition of EZH2 by RNAi suppresses medulloblastoma tumor cell growth. We show that 3-deazaneplanocin A, a chemical inhibitor of EZH2, can suppress medulloblastoma cell growth partially by inducing apoptosis. Suppression of EZH2 expression diminishes the ability of tumor cells to form spheres in culture and strongly represses the ability of known oncogenes to transform neural stem cells. These findings establish a role of EZH2 in medulloblastoma and identify EZH2 as a potential therapeutic target especially in high-risk tumors. PMID:22287205

  5. Is the Prosthetic Homologue Necessary for Embodiment?

    Science.gov (United States)

    Dornfeld, Chelsea; Swanston, Michelle; Cassella, Joseph; Beasley, Casey; Green, Jacob; Moshayev, Yonatan; Wininger, Michael

    2016-01-01

    Embodiment is the process by which patients with limb loss come to accept their peripheral device as a natural extension of self. However, there is little guidance as to how exacting the prosthesis must be in order for embodiment to take place: is it necessary for the prosthetic hand to look just like the absent hand? Here, we describe a protocol for testing whether an individual would select a hand that looks like their own from among a selection of five hands, and whether the hand selection (regardless of homology) is consistent across multiple exposures to the same (but reordered) set of candidate hands. Pilot results using healthy volunteers reveals that hand selection is only modestly consistent, and that selection of the prosthetic homologue is atypical (61 of 192 total exposures). Our protocol can be executed in minutes, and makes use of readily available equipment and softwares. We present both a face-to-face and a virtual protocol, for maximum flexibility of implementation.

  6. Differential Expression and Regulation of Brain-Derived Neurotrophic Factor (BDNF) mRNA Isoforms in Brain Cells from Mecp2(308/y) Mouse Model.

    Science.gov (United States)

    Rousseaud, Audrey; Delépine, Chloé; Nectoux, Juliette; Billuart, Pierre; Bienvenu, Thierry

    2015-08-01

    Rett syndrome (RTT) is a severe neurodevelopmental disease caused by mutations in methyl-CpG-binding protein 2 (MECP2), which encodes a transcriptional modulator of many genes including BDNF. BDNF comprises nine distinct promoter regions, each triggering the expression of a specific transcript. The role of this diversity of transcripts remains unknown. MeCP2 being highly expressed in neurons, RTT was initially considered as a neuronal disease. However, recent studies have shown that MeCP2 was also expressed in astrocytes. Though several studies explored Bdnf IV expression in Mecp2-deficient mice, the differential expression of Bdnf isoforms in Mecp2-deficient neurons and astrocytes was never studied. By using TaqMan technology and a mouse model expressing a truncated Mecp2 (Mecp2(308/y)), we firstly showed in neurons that Bdnf transcripts containing exon I, IIb, IIc, IV, and VI are prominently expressed, whereas in astrocytes, Bdnf transcript containing exon VI is preferentially expressed, suggesting a specific regulation of Bdnf expression at the cellular level. Secondly, we confirmed the repressive role of Mecp2 only on the expression of Bdnf VI in neurons. Our data suggested that the truncated Mecp2 protein maintains its function on Bdnf expression regulation in neurons and in astrocytes. Interestingly, we observed that Bdnf transcripts (I and IXA), regulated by neural activity induced by bicuculline in Mecp2(308/y) neurons, were not affected by histone deacetylase inhibition. In contrast, Bdnf transcripts (IIb, IIc, and VI), regulated by histone deacetylation, were not affected by bicuculline treatment in wild-type and Mecp2(308/y) neurons. All these results reflect the complexity of regulation of Bdnf gene.

  7. Monolayer structures of alkyl aldehydes: Odd-membered homologues

    International Nuclear Information System (INIS)

    Phillips, T.K.; Clarke, S.M.; Bhinde, T.; Castro, M.A.; Millan, C.; Medina, S.

    2011-01-01

    Crystalline monolayers of three aldehydes with an odd number of carbon atoms in the alkyl chain (C 7 , C 9 and C 11 ) at low coverages are observed by a combination of X-ray and neutron diffraction. Analysis of the diffraction data is discussed and possible monolayer crystal structures are proposed; although unique structures could not be ascertained for all molecules. We conclude that the structures are flat on the surface, with the molecules lying in the plane of the layer. The C 11 homologue is determined to have a plane group of either p2, pgb or pgg, and for the C 7 homologue the p2 plane group is preferred.

  8. Detection of a Yersinia pestis gene homologue in rodent samples

    Directory of Open Access Journals (Sweden)

    Timothy A. Giles

    2016-08-01

    Full Text Available A homologue to a widely used genetic marker, pla, for Yersinia pestis has been identified in tissue samples of two species of rat (Rattus rattus and Rattus norvegicus and of mice (Mus musculus and Apodemus sylvaticus using a microarray based platform to screen for zoonotic pathogens of interest. Samples were from urban locations in the UK (Liverpool and Canada (Vancouver. The results indicate the presence of an unknown bacterium that shares a homologue for the pla gene of Yersinia pestis, so caution should be taken when using this gene as a diagnostic marker.

  9. Small suitability of the DLEC1, MLH1 and TUSC4 mRNA expression analysis as potential prognostic or differentiating markers for NSCLC patients in the Polish population.

    Science.gov (United States)

    Kordiak, Jacek; Czarnecka, Karolina H; Pastuszak-Lewandoska, Dorota; Antczak, Adam; Migdalska-Sęk, Monika; Nawrot, Ewa; Domańska-Senderowska, Daria; Kiszałkiewicz, Justyna; Brzeziańska-Lasota, Ewa

    2017-06-01

    According to the latest data, lung cancer is one of the most common cancer worldwide, men contributing nearly 21.2% and women 8.6% of all diagnosed cancers. Late detection of tumour drastically reduces the chance for a cure. Thus, it is important to search for candidate biomarkers for screening of early stage nonsmall cell lung carcinoma (NSCLC). Tumour suppressor genes, DLEC1, TUSC4 and MLH1, localized on 3p21 are recognized to play a role in NSCLC carcinogenesis. The aim of this study was to assess the relationship between the DLEC1, TUSC4 and MLH1 mRNA expression, and clinical features of NSCLC patients, tobacco addiction, and tumour histopathological characteristics. The DLEC1, TUSC4 and MLH1 expression was analysed in lung tumour tissue samples obtained from 69 patients diagnosed with NSCLC: squamous cell carcinoma (n = 34), adenocarcinoma (n = 24), large cell carcinoma (n = 5), carcinoma adenosquamosum (n = 5). A decreased gene expression (RQ MLH1 in 50.7% and for TUSC4 in 26% of NSCLC samples. DLEC1 was decreased in more aggressive subtypes: large cell carcinoma and adenocarcinoma-squamous cell carcinoma. The simultaneous downregulation of two of the studied genes, DLEC1 andMLH1,was observed in 30.4% of NSCLCsamples, highlighting the importance of these two genes in lung carcinogenesis. We found no correlation between the DLEC1, TUSC4 and MLH1 gene expression and NSCLC patient characteristics (gender, age and smoking) or cancer histopathology. No significant differences in the gene expression among NSCLC subtypes indicate the weakness of DLEC1, TUSC4 and MLH1 expression analysis as potential differentiating markers of NSCLC subtypes in the Polish population.

  10. Phosphatase and tensin homologue deleted on chromosome 10 ...

    African Journals Online (AJOL)

    Phosphatase and tensin homologue deleted on chromosome 10 (PTEN) is a tumor suppressor gene deleted or mutated in many human cancers such as glioblastoma, spinal tumors, prostate, bladder, adrenals, thyroid, breast, endometrium, and colon cancers. They result from loss of heterozygosity (LOH) for the PTEN ...

  11. Isolation and characterization of an AGAMOUS homologue from cocoa

    NARCIS (Netherlands)

    Chaidamsari, T.; Sugiarit, H.; Santoso, D.; Angenent, G.C.; Maagd, de R.A.

    2006-01-01

    We report the cloning of a cDNA from TcAG, an AG (Arabidopsis thaliana MADS-box C-type transcription factor gene AGAMOUS) homologue from cocoa (Theobroma cacao L.). TcAG was in the cocoa flower expressed primarily in stamens and ovaries, comparable to AG in Arabidopsis. Additionally, we found that

  12. Characterization and cloning of TMV resistance gene N homologues ...

    African Journals Online (AJOL)

    Tobacco cultivars Nicotiana tabacum cv. Samsun NN plants carrying the N gene contain a multitude of N-related genes. We cloned a few N homologues and isolated two full-length cDNAs of NL-C26 and NL-B69 genes from N. tabacum cv. Samsun NN. Nucleotide sequence analysis showed that the coding regions of ...

  13. Identification of aldehyde oxidase 1 and aldehyde oxidase homologue 1 as dioxin-inducible genes

    International Nuclear Information System (INIS)

    Rivera, Steven P.; Choi, Hyun Ho; Chapman, Brett; Whitekus, Michael J.; Terao, Mineko; Garattini, Enrico; Hankinson, Oliver

    2005-01-01

    Aldehyde oxidases are a family of highly related molybdo-flavoenzymes acting upon a variety of compounds of industrial and medical importance. We have identified aldehyde oxidase 1 (AOX1) as a 2,3,7,8-tetrachlorodibenzo-p-dioxin (dioxin) inducible gene in the mouse hepatoma cell line Hepa-1. AOX1 mRNA levels were not increased by dioxin in mutant derivatives of the Hepa-1 cell line lacking either functional aryl hydrocarbon receptor (AHR) or aryl hydrocarbon receptor nuclear translocator (ARNT) proteins, thus demonstrating that transcriptional induction of AOX1 in response to dioxin occurs through the AHR pathway. Dioxin induction of AOX1 mRNA was also observed in mouse liver. In addition, levels of AOX1 protein as well as those of aldehyde oxidase homologue 1 (AOH1), a recently identified homolog of AOX1, were elevated in mouse liver in response to dioxin. Employing an aldehyde oxidase specific substrate, AOX1/AOH1 activity was shown to be induced by dioxin in mouse liver. This activity was inhibited by a known inhibitor of aldehyde oxidases, and eliminated by including tungstate in the mouse diet, which is known to lead to inactivation of molybdoflavoenzymes, thus confirming that the enzymatic activity was attributable to AOX1/AOH1. Our observations thus identify two additional xenobiotic metabolizing enzymes induced by dioxin

  14. Identification of possible targets of the Aspergillus fumigatus CRZ1 homologue, CrzA

    Directory of Open Access Journals (Sweden)

    Goldman Gustavo H

    2010-01-01

    Full Text Available Abstract Background Calcineurin, a serine/threonine-specific protein phosphatase, plays an important role in the control of cell morphology and virulence in fungi. Calcineurin regulates localization and activity of a transcription factor called CRZ1. Recently, we characterize Aspergillus fumigatus CRZ1 homologue, AfCrzA. Here, we investigate which pathways are influenced by A. fumigatus AfCrzA during a short pulse of calcium by comparatively determining the transcriptional profile of A. fumigatus wild type and ΔAfcrzA mutant strains. Results We were able to observe 3,622 genes modulated in at least one timepoint in the mutant when compared to the wild type strain (3,211 and 411 at 10 and 30 minutes, respectively. Decreased mRNA abundance in the ΔcrzA was seen for genes encoding calcium transporters, transcription factors and genes that could be directly or indirectly involved in calcium metabolism. Increased mRNA accumulation was observed for some genes encoding proteins involved in stress response. AfCrzA overexpression in A. fumigatus increases the expression of several of these genes. The deleted strain of one of these genes, AfRcnA, belonging to a class of endogenous calcineurin regulators, calcipressins, had more calcineurin activity after exposure to calcium and was less sensitive to menadione 30 μM, hydrogen peroxide 2.5 mM, EGTA 25 mM, and MnCl2 25 mM. We constructed deletion, overexpression, and GFP fusion protein for the closely related A. nidulans AnRcnA. GFP::RcnA was mostly detected along the germling, did not accumulate in the nuclei and its location is not affected by the cellular response to calcium chloride. Conclusion We have performed a transcriptional profiling analysis of the A. fumigatus ΔAfcrzA mutant strain exposed to calcium stress. This provided an excellent opportunity to identify genes and pathways that are under the influence of AfCrzA. AfRcnA, one of these selected genes, encodes a modulator of calcineurin

  15. Identification of a candidate CD5 homologue in the amphibian Xenopus laevis.

    Science.gov (United States)

    Jürgens, J B; Gartland, L A; Du Pasquier, L; Horton, J D; Göbel, T W; Cooper, M D

    1995-11-01

    We identified a novel T cell Ag in the South African clawed toad (Xenopus laevis) by a mAb designated 2B1. This Ag is present in relatively high levels on most thymocytes, approximately 65% of splenocytes, 55% of PBL, and 65% of intestinal lymphocytes, but is rarely seen on IgM+ B cells in any of these tissues. Lymphocytes bearing the 2B1 Ag proliferate in response to stimulation with Con A or PHA, whereas the 2B1- lymphocytes are reactive to LPS. Biochemical analysis indicates that this Ag is a differentially phosphorylated glycoprotein of 71 to 82 kDa. The protein core of 64 kDa bears both N- and O-linked carbohydrate side chains. The amino-terminal protein sequence of the 2B1 Ag shares significant homology with both the macrophage scavenger receptor type 1 motif and the mammalian CD5/CD6 family. The biochemical characteristics and cellular distribution of the 2B1 Ag suggest that it represents the CD5 homologue in X. laevis. While T cells constitutively express this highly conserved molecule, Xenopus B cells acquire the CD5 homologue only when they are stimulated in the presence of T cells.

  16. An Arabidopsis chloroplast-targeted Hsp101 homologue, APG6, has an essential role in chloroplast development as well as heat-stress response.

    Science.gov (United States)

    Myouga, Fumiyoshi; Motohashi, Reiko; Kuromori, Takashi; Nagata, Noriko; Shinozaki, Kazuo

    2006-10-01

    Analysis of albino or pale-green (apg) mutants is important for identifying nuclear genes responsible for chloroplast development and pigment synthesis. We have identified 38 apg mutants by screening 11 000 Arabidopsis Ds-tagged lines. One mutant, apg6, contains a Ds insertion in a gene encoding APG6 (ClpB3), a homologue of the heat-shock protein Hsp101 (ClpB1). We isolated somatic revertants and identified two Ds-tagged and one T-DNA-tagged mutant alleles of apg6. All three alleles gave the same pale-green phenotype. These results suggest that APG6 is important for chloroplast development. The APG6 protein contains a transit peptide and is localized in chloroplasts. The plastids of apg6 pale-green cells were smaller than those of the wild type, and contained undeveloped thylakoid membranes. APG6 mRNA accumulated in response to heat shock in various organs, but not in response to other abiotic stresses. Under normal conditions, APG6 is constitutively expressed in the root tips, the organ boundary region, the reproductive tissues of mature plants where plastids exist as proplastids, and slightly in the stems and leaves. In addition, constitutive overexpression of APG6 in transgenic plants inhibited chloroplast development and resulted in a mild pale-green phenotype. The amounts of chloroplast proteins related to photosynthesis were markedly decreased in apg6 mutants. These results suggest that APG6 functions as a molecular chaperone involved in plastid differentiation mediating internal thylakoid membrane formation and conferring thermotolerance to chloroplasts during heat stress. The APG6 protein is not only involved in heat-stress response in chloroplasts, but is also essential for chloroplast development.

  17. Identification of NoxD/Pro41 as the homologue of the p22phox NADPH oxidase subunit in fungi.

    Science.gov (United States)

    Lacaze, Isabelle; Lalucque, Hervé; Siegmund, Ulrike; Silar, Philippe; Brun, Sylvain

    2015-03-01

    NADPH oxidases (Nox) are membrane complexes that produce O2(-). Researches in mammals, plants and fungi highlight the involvement of Nox-generated ROS in cell proliferation, differentiation and defense. In mammals, the core enzyme gp91(phox)/Nox2 is associated with p22(phox) forming the flavocytochrome b558 ready for activation by a cytosolic complex. Intriguingly, no homologue of the p22(phox) gene has been found in fungal genomes, questioning how the flavoenzyme forms. Using whole genome sequencing combined with phylogenetic analysis and structural studies, we identify the fungal p22(phox) homologue as being mutated in the Podospora anserina mutant IDC(509). Functional studies show that the fungal p22(phox), PaNoxD, acts along PaNox1, but not PaNox2, a second fungal gp91(phox) homologue. Finally, cytological analysis of functional tagged versions of PaNox1, PaNoxD and PaNoxR shows clear co-localization of PaNoxD and PaNox1 and unravel a dynamic assembly of the complex in the endoplasmic reticulum and in the vacuolar system. © 2014 John Wiley & Sons Ltd.

  18. A Potato cDNA Encoding a Homologue of Mammalian Multidrug Resistant P-Glycoprotein

    Science.gov (United States)

    Wang, W.; Takezawa, D.; Poovaiah, B. W.

    1996-01-01

    A homologue of the multidrug resistance (MDR) gene was obtained while screening a potato stolon tip cDNA expression library with S-15-labeled calmodulin. The mammalian MDR gene codes for a membrane-bound P-glycoprotein (170-180 kDa) which imparts multidrug resistance to cancerous cells. The potato cDNA (PMDR1) codes for a polypeptide of 1313 amino acid residues (ca. 144 kDa) and its structural features are very similar to the MDR P-glycoprotein. The N-terminal half of the PMDR1-encoded protein shares striking homology with its C-terminal half, and each half contains a conserved ATP-binding site and six putative transmembrane domains. Southern blot analysis indicated that potato has one or two MDR-like genes. PMDR1 mRNA is constitutively expressed in all organs studied with higher expression in the stem and stolon tip. The PMDR1 expression was highest during tuber initiation and decreased during tuber development.

  19. The ontogeny of nanos homologue expression in the oligochaete annelid Tubifex tubifex.

    Science.gov (United States)

    Mohri, Ki-Ichi; Nakamoto, Ayaki; Shimizu, Takashi

    2016-01-01

    We have cloned and characterized the expression of a nanos homologue (designated Ttu-nos) from the oligochaete annelid Tubifex tubifex. Ttu-nos mRNA is distributed broadly throughout the early cleavage stages. Ttu-nos is expressed in most if not all of the early blastomeres, in which Ttu-nos RNA associates with pole plasms. Ttu-nos transcripts are concentrated to 2d and 4d cells. Shortly after 2d(111) (derived from 2d cell) divides into a bilateral pair of NOPQ proteloblasts, Ttu-nos RNA vanishes from the embryo, which is soon followed by the resumption of Ttu-nos expression in nascent primary blast cells produced by teloblasts. The resumption of Ttu-nos expression occurs only in a subset of teloblast lineages (viz., M, N and Q). After Ttu-nos expression is retained in the germ band for a while, it disappears in anterior-to-posterior progression. At the end of embryogenesis, there is no trace of Ttu-nos expression. Thereafter, growing juveniles do not show any sign of Ttu-nos expression, either. The first sign of Ttu-nos expression is detected in oocytes in the ovary of young adults (ca 40 days after hatching), and its expression continues in growing oocytes that undergo yolk deposition and maturation in the ovisac. Copyright © 2015 Elsevier B.V. All rights reserved.

  20. Isolation and characterization of differentially expressed genes in ...

    African Journals Online (AJOL)

    USER

    Through reverse transcriptase-polymerase chain reaction analysis, priA homologue and AP-1 like transcription factor ... The oyster mushroom, Pleurotus ostreatus, and white button mushroom ..... differential display of RAPD. FEMS Microbiol.

  1. Homologue Pairing in Flies and Mammals: Gene Regulation When Two Are Involved

    OpenAIRE

    Apte, Manasi S.; Meller, Victoria H.

    2011-01-01

    Chromosome pairing is usually discussed in the context of meiosis. Association of homologues in germ cells enables chromosome segregation and is necessary for fertility. A few organisms, such as flies, also pair their entire genomes in somatic cells. Most others, including mammals, display little homologue pairing outside of the germline. Experimental evidence from both flies and mammals suggests that communication between homologues contributes to normal genome regulation. This paper will co...

  2. Altered MENIN expression disrupts the MAFA differentiation pathway in insulinoma.

    Science.gov (United States)

    Hamze, Z; Vercherat, C; Bernigaud-Lacheretz, A; Bazzi, W; Bonnavion, R; Lu, J; Calender, A; Pouponnot, C; Bertolino, P; Roche, C; Stein, R; Scoazec, J Y; Zhang, C X; Cordier-Bussat, M

    2013-12-01

    The protein MENIN is the product of the multiple endocrine neoplasia type I (MEN1) gene. Altered MENIN expression is one of the few events that are clearly associated with foregut neuroendocrine tumours (NETs), classical oncogenes or tumour suppressors being not involved. One of the current challenges is to understand how alteration of MENIN expression contributes to the development of these tumours. We hypothesised that MENIN might regulate factors maintaining endocrine-differentiated functions. We chose the insulinoma model, a paradigmatic example of well-differentiated pancreatic NETs, to study whether MENIN interferes with the expression of v-MAF musculoaponeurotic fibrosarcoma oncogene homologue A (MAFA), a master glucose-dependent transcription factor in differentiated β-cells. Immunohistochemical analysis of a series of human insulinomas revealed a correlated decrease in both MENIN and MAFA. Decreased MAFA expression resulting from targeted Men1 ablation was also consistently observed in mouse insulinomas. In vitro analyses using insulinoma cell lines showed that MENIN regulated MAFA protein and mRNA levels, and bound to Mafa promoter sequences. MENIN knockdown concomitantly decreased mRNA expression of both Mafa and β-cell differentiation markers (Ins1/2, Gck, Slc2a2 and Pdx1) and, in parallel, increased the proliferation rate of tumours as measured by bromodeoxyuridine incorporation. Interestingly, MAFA knockdown alone also increased proliferation rate but did not affect the expression of candidate proliferation genes regulated by MENIN. Finally, MENIN variants with missense mutations detected in patients with MEN1 lost the WT MENIN properties to regulate MAFA. Together, our findings unveil a previously unsuspected MENIN/MAFA connection regarding control of the β-cell differentiation/proliferation balance, which could contribute to tumorigenesis.

  3. Characterization of the cDNA encoding a BPI/LBP homologue in venom gland of the hundred-pace snake Deinagkistrodon acutus

    Directory of Open Access Journals (Sweden)

    Jianrao HU, Mingfu CAO, Jiong Chen

    2009-10-01

    Full Text Available Bactericidal/permeability-increasing protein (BPI and LPS-binding protein (LBP play an important role in host defence. Current evidence shows that BPI/LBP may be widely existed in different cells and tissue types of animals. A full-length cDNA clone encoding a BPI/LBP homologue (dBPI, 1757bp in size, was characterized in venom gland of the hundred-pace snake Deinagkistrodon acutus. Its deduced amino acid sequence of 417 residues had 13.8%–21.5% identity to BPI like 1(BPIL1 and BPI like 3(BPIL3 of other animals. Conserved cysteine residues which are involved in disulfide bond formation between the final strand of the N-terminal beta sheet and the long alpha helix of BPI are identified as Cys146-Cys183 of dBPI. Phylogenetic tree analysis showed that the BPI/LBP homologues formed five large clusters and dBPI was in a large cluster including BPIL1 and BPIL3. dBPI mRNA shows a tissue specific expression in venom gland. This is the first study to identify the cDNA encoding BPI/LBP homologues from reptiles [Current Zoology 55 (5: –2009].

  4. Toxicities of emamectin benzoate homologues and photodegradates to Lepidoptera.

    Science.gov (United States)

    Argentine, Joseph A; Jansson, Richard K; Starner, Van R; Halliday, W Ross

    2002-12-01

    The toxicity of a number of emamectin benzoate homologues and photodegradates to five species of Lepidoptera was investigated using diet and foliar bioassays. The emamectin benzoate homologues B1a and B1b were equally toxic in the diet and foliar assays to Spodoptera exigua (Hübner), Heliothis virescens (F.), Tricoplusia ni (Hübner), and Spodoptera frugiperda (J. E. Smith), within each of these species. Plutella xylostella (L.) was the most sensitive species to emamectin benzoate. The AB1a photodegradate of emamectin benzoate was as toxic as the parent compound in the diet assay. However, in the foliage assay AB1a was 4.4-fold less toxic to S. exigua than the parent compound. The MFB1a photodegradate of emamectin benzoate was as toxic as the parent compound to P. xylostella, and 3.1 to 6.2 times as toxic as the parent compound to the other species in the diet assay. The order of toxicity of the photodegradates were AB1a > MFB1a > FAB1a > 8,9-Z-MAB1a > PAB1a.

  5. Time- and dose-dependent differential regulation of copper-zinc superoxide dismutase and manganese superoxide dismutase enzymatic activity and mRNA level by vitamin E in rat blood cells.

    Science.gov (United States)

    Hajiani, Maliheh; Razi, Farideh; Golestani, Aboualfazl; Frouzandeh, Mehdi; Owji, Ali Akbar; Khaghani, Shahnaz; Ghannadian, Naghmeh; Shariftabrizi, Ahmad; Pasalar, Parvin

    2012-01-01

    Vitamin E is the most important lipid-soluble antioxidant. Recently, it has been proposed as a gene regulator, and its gene modulation effects have been observed at different levels of gene expression and cell signaling. This study was performed to investigate the effects of vitamin E on the activity and expression of the most important endogenous antioxidant enzyme, superoxide dismutase (SOD), in rat plasma. Twenty-eight male Sprauge-Dawley rats were divided into four groups: control group and three dosing groups. The control group received the vehicle (liquid paraffin), and the dosing groups received twice-weekly intraperitoneal injections of 10, 30, and 100 mg/kg of vitamin E ((±)-α-Tocopherol) for 6 weeks. Quantitative real-time reverse transcription-polymerase chain reaction and enzyme assays were used to assess the levels of Cu/Zn-SOD and Mn-SOD mRNA and enzyme activity levels in blood cells at 0, 2, 4, and 6 weeks following vitamin E administration. Catalase enzyme activity and total antioxidant capacity were also assessed in plasma at the same time intervals. Mn-SOD activity was significantly increased in the 100 and 30 mg/kg dosing groups after 4 and 6 weeks, with corresponding significant increase in their mRNA levels. Cu/Zn-SOD activity was not significantly changed in response to vitamin E administration at any time points, whereas Cu/Zn-SOD mRNA levels were significantly increased after longer time points with high doses (30 and 100 mg/kg) of vitamin E. Catalase enzyme activity was transiently but significantly increased after 4 weeks of vitamin E treatment in 30 and 100 mg/kg dosing groups. Total antioxidant status was significantly increased after 4 and 6 weeks in the 100 mg/kg dosing group. Only the chronic administration of higher doses of alpha-tocopherol is associated with the increased activity and expression of Mn-SOD in rats. Cu/Zn-SOD activity and expression does not dramatically change in response to vitamin E.

  6. Molecular cloning, sequence characterization and expression analysis of a CD63 homologue from the coleopteran beetle, Tenebrio molitor.

    Science.gov (United States)

    Patnaik, Bharat Bhusan; Kang, Seong Min; Seo, Gi Won; Lee, Hyo Jeong; Patnaik, Hongray Howrelia; Jo, Yong Hun; Tindwa, Hamisi; Lee, Yong Seok; Lee, Bok Luel; Kim, Nam Jung; Bang, In Seok; Han, Yeon Soo

    2013-10-15

    CD63, a member of the tetraspanin membrane protein family, plays a pivotal role in cell growth, motility, signal transduction, host-pathogen interactions and cancer. In this work, the cDNA encoding CD63 homologue (TmCD63) was cloned from larvae of a coleopteran beetle, Tenebrio molitor. The cDNA is comprised of an open reading frame of 705 bp, encoding putative protein of 235 amino acid residues. In silico analysis shows that the protein has four putative transmembrane domains and one large extracellular loop. The characteristic "Cys-Cys-Gly" motif and "Cys188" residues are highly conserved in the large extracellular loop. Phylogenetic analysis of TmCD63 revealed that they belong to the insect cluster with 50%-56% identity. Analysis of spatial expression patterns demonstrated that TmCD63 mRNA is mainly expressed in gut and Malphigian tubules of larvae and the testis of the adult. Developmental expression patterns of CD63 mRNA showed that TmCD63 transcripts are detected in late larval, pupal and adult stages. Interestingly, TmCD63 transcripts are upregulated to the maximum level of 4.5 fold, in response to DAP-type peptidoglycan during the first 6 h, although other immune elicitors also caused significant increase to the transcript level at later time-points. These results suggest that CD63 might contribute to T. molitor immune response against various microbial pathogens.

  7. Molecular Cloning, Sequence Characterization and Expression Analysis of a CD63 Homologue from the Coleopteran Beetle, Tenebrio molitor

    Directory of Open Access Journals (Sweden)

    Yeon Soo Han

    2013-10-01

    Full Text Available CD63, a member of the tetraspanin membrane protein family, plays a pivotal role in cell growth, motility, signal transduction, host-pathogen interactions and cancer. In this work, the cDNA encoding CD63 homologue (TmCD63 was cloned from larvae of a coleopteran beetle, Tenebrio molitor. The cDNA is comprised of an open reading frame of 705 bp, encoding putative protein of 235 amino acid residues. In silico analysis shows that the protein has four putative transmembrane domains and one large extracellular loop. The characteristic “Cys-Cys-Gly” motif and “Cys188” residues are highly conserved in the large extracellular loop. Phylogenetic analysis of TmCD63 revealed that they belong to the insect cluster with 50%–56% identity. Analysis of spatial expression patterns demonstrated that TmCD63 mRNA is mainly expressed in gut and Malphigian tubules of larvae and the testis of the adult. Developmental expression patterns of CD63 mRNA showed that TmCD63 transcripts are detected in late larval, pupal and adult stages. Interestingly, TmCD63 transcripts are upregulated to the maximum level of 4.5 fold, in response to DAP-type peptidoglycan during the first 6 h, although other immune elicitors also caused significant increase to the transcript level at later time-points. These results suggest that CD63 might contribute to T. molitor immune response against various microbial pathogens.

  8. Molecular Cloning, Sequence Characterization and Expression Analysis of a CD63 Homologue from the Coleopteran Beetle, Tenebrio molitor

    Science.gov (United States)

    Patnaik, Bharat Bhusan; Kang, Seong Min; Seo, Gi Won; Lee, Hyo Jeong; Patnaik, Hongray Howrelia; Jo, Yong Hun; Tindwa, Hamisi; Lee, Yong Seok; Lee, Bok Luel; Kim, Nam Jung; Bang, In Seok; Han, Yeon Soo

    2013-01-01

    CD63, a member of the tetraspanin membrane protein family, plays a pivotal role in cell growth, motility, signal transduction, host-pathogen interactions and cancer. In this work, the cDNA encoding CD63 homologue (TmCD63) was cloned from larvae of a coleopteran beetle, Tenebrio molitor. The cDNA is comprised of an open reading frame of 705 bp, encoding putative protein of 235 amino acid residues. In silico analysis shows that the protein has four putative transmembrane domains and one large extracellular loop. The characteristic “Cys-Cys-Gly” motif and “Cys188” residues are highly conserved in the large extracellular loop. Phylogenetic analysis of TmCD63 revealed that they belong to the insect cluster with 50%–56% identity. Analysis of spatial expression patterns demonstrated that TmCD63 mRNA is mainly expressed in gut and Malphigian tubules of larvae and the testis of the adult. Developmental expression patterns of CD63 mRNA showed that TmCD63 transcripts are detected in late larval, pupal and adult stages. Interestingly, TmCD63 transcripts are upregulated to the maximum level of 4.5 fold, in response to DAP-type peptidoglycan during the first 6 h, although other immune elicitors also caused significant increase to the transcript level at later time-points. These results suggest that CD63 might contribute to T. molitor immune response against various microbial pathogens. PMID:24132157

  9. Functional analysis of three type-2 DGAT homologue genes for triacylglycerol production in the green microalga Chlamydomonas reinhardtii.

    Science.gov (United States)

    La Russa, M; Bogen, C; Uhmeyer, A; Doebbe, A; Filippone, E; Kruse, O; Mussgnug, J H

    2012-11-30

    Photosynthetic organisms like plants and algae can use sunlight to produce lipids as important metabolic compounds. Plant-derived triacylglycerols (TAGs) are valuable for human and animal nutrition because of their high energy content and are becoming increasingly important for the production of renewable biofuels. Acyl-CoA:diacylglycerol acyltransferases (DGATs) have been demonstrated to play an important role in the accumulation of TAG compounds in higher plants. DGAT homologue genes have been identified in the genome of the green alga Chlamydomonas reinhardtii, however their function in vivo is still unknown. In this work, the three most promising type-2 DGAT candidate genes potentially involved in TAG lipid accumulation (CrDGAT2a, b and c) were investigated by constructing overexpression strains. For each of the genes, three strains were identified which showed enhanced mRNA levels of between 1.7 and 29.1 times that of the wild type (wt). Total lipid contents, neutral lipids and fatty acid profiles were determined and showed that an enhanced mRNA expression level of the investigated DGAT genes did not boost the intracellular TAG accumulation or resulted in alterations of the fatty acid profiles compared to wild type during standard growth condition or during nitrogen or sulfur stress conditions. We conclude that biotechnological efforts to enhance cellular TAG amount in microalgae need further insights into the complex network of lipid biosynthesis to identify potential bottlenecks of neutral lipid production. Copyright © 2012 Elsevier B.V. All rights reserved.

  10. Characterization of Translationally Controlled Tumour Protein from the Sea Anemone Anemonia viridis and Transcriptome Wide Identification of Cnidarian Homologues.

    Science.gov (United States)

    Nicosia, Aldo; Bennici, Carmelo; Biondo, Girolama; Costa, Salvatore; Di Natale, Marilena; Masullo, Tiziana; Monastero, Calogera; Ragusa, Maria Antonietta; Tagliavia, Marcello; Cuttitta, Angela

    2018-01-11

    Gene family encoding translationally controlled tumour protein (TCTP) is defined as highly conserved among organisms; however, there is limited knowledge of non-bilateria. In this study, the first TCTP homologue from anthozoan was characterised in the Mediterranean Sea anemone, Anemonia viridis . The release of the genome sequence of Acropora digitifera , Exaiptasia pallida , Nematostella vectensis and Hydra vulgaris enabled a comprehensive study of the molecular evolution of TCTP family among cnidarians. A comparison among TCTP members from Cnidaria and Bilateria showed conserved intron exon organization, evolutionary conserved TCTP signatures and 3D protein structure. The pattern of mRNA expression profile was also defined in A. viridis . These analyses revealed a constitutive mRNA expression especially in tissues with active proliferation. Additionally, the transcriptional profile of A. viridis TCTP ( AvTCTP ) after challenges with different abiotic/biotic stresses showed induction by extreme temperatures, heavy metals exposure and immune stimulation. These results suggest the involvement of AvTCTP in the sea anemone defensome taking part in environmental stress and immune responses.

  11. Characterization of Translationally Controlled Tumour Protein from the Sea Anemone Anemonia viridis and Transcriptome Wide Identification of Cnidarian Homologues

    Directory of Open Access Journals (Sweden)

    Aldo Nicosia

    2018-01-01

    Full Text Available Gene family encoding translationally controlled tumour protein (TCTP is defined as highly conserved among organisms; however, there is limited knowledge of non-bilateria. In this study, the first TCTP homologue from anthozoan was characterised in the Mediterranean Sea anemone, Anemonia viridis. The release of the genome sequence of Acropora digitifera, Exaiptasia pallida, Nematostella vectensis and Hydra vulgaris enabled a comprehensive study of the molecular evolution of TCTP family among cnidarians. A comparison among TCTP members from Cnidaria and Bilateria showed conserved intron exon organization, evolutionary conserved TCTP signatures and 3D protein structure. The pattern of mRNA expression profile was also defined in A. viridis. These analyses revealed a constitutive mRNA expression especially in tissues with active proliferation. Additionally, the transcriptional profile of A. viridis TCTP (AvTCTP after challenges with different abiotic/biotic stresses showed induction by extreme temperatures, heavy metals exposure and immune stimulation. These results suggest the involvement of AvTCTP in the sea anemone defensome taking part in environmental stress and immune responses.

  12. A La autoantigen homologue is required for the internal ribosome entry site mediated translation of giardiavirus.

    Directory of Open Access Journals (Sweden)

    Srinivas Garlapati

    2011-03-01

    Full Text Available Translation of Giardiavirus (GLV mRNA is initiated at an internal ribosome entry site (IRES in the viral transcript. The IRES localizes to a downstream portion of 5' untranslated region (UTR and a part of the early downstream coding region of the transcript. Recent studies indicated that the IRES does not require a pre-initiation complex to initiate translation but may directly recruit the small ribosome subunit with the help of a number of trans-activating protein factors. A La autoantigen homologue in the viral host Giardia lamblia, GlLa, was proposed as one of the potential trans-activating factors based on its specific binding to GLV-IRES in vitro. In this study, we further elucidated the functional role of GlLa in GLV-IRES mediated translation in Giardia by knocking down GlLa with antisense morpholino oligo, which resulted in a reduction of GLV-IRES activity by 40%. An over-expression of GlLa in Giardia moderately stimulated GLV-IRES activity by 20%. A yeast inhibitory RNA (IRNA, known to bind mammalian and yeast La autoantigen and inhibit Poliovirus and Hepatitis C virus IRES activities in vitro and in vivo, was also found to bind to GlLa protein in vitro and inhibited GLV-IRES function in vivo. The C-terminal domain of La autoantigen interferes with the dimerization of La and inhibits its function. An over-expression of the C-terminal domain (200-348aa of GlLa in Giardia showed a dominant-negative effect on GLV-IRES activity, suggesting a potential inhibition of GlLa dimerization. HA tagged GlLa protein was detected mainly in the cytoplasm of Giardia, thus supporting a primary role of GlLa in translation initiation in Giardiavirus.

  13. Characterization of Two 20kDa-Cement Protein (cp20k) Homologues in Amphibalanus amphitrite

    KAUST Repository

    He, Li-Sheng; Zhang, Gen; Qian, Pei-Yuan

    2013-01-01

    The barnacle, Amphibalanus amphitrite, is a common marine fouling organism. Understanding the mechanism of barnacle adhesion will be helpful in resolving the fouling problem. Barnacle cement is thought to play a key role in barnacle attachment. Although several adult barnacle cement proteins have been identified in Megabalanus rosa, little is known about their function in barnacle settlement. In this study, two homologous 20k-cement proteins (cp20k) in Amphibalanus amphitrite, named Bamcp20k-1 and Bamcp20k-2, were characterized. The two homologues share primary sequence structure with proteins from other species including Megabalanus rosa and Fistulobalanus albicostatus. The conserved structure included repeated Cys domains and abundant charged amino acids, such as histidine. In this study we demonstrated that Bamcp20k-1 localized at the α secretory cells in the cyprid cement gland, while Bamcp20k-2 localized to the β secretory cells. The differential localizations suggest differential regulation for secretion from the secretory cells. Both Bamcp20k-1 and Bamcp20k-2 from cyprids dissolved in PBS. However, adult Bamcp20k-2, which was dominant in the basal shell of adult barnacles, was largely insoluble in PBS. Solubility increased in the presence of the reducing reagent Dithiothreitol (DTT), suggesting that the formation of disulfide bonds plays a role in Bamcp20k-2 function. In comparison, Bamcp20k-1, which was enriched in soft tissue, could not be easily detected in the shell and base by Western blot and easily dissolved in PBS. These differential solubilities and localizations indicate that Bamcp20k-1 and Bamcp20k-2 have distinct functions in barnacle cementing. © 2013 He et al.

  14. Characterization of Two 20kDa-Cement Protein (cp20k) Homologues in Amphibalanus amphitrite

    KAUST Repository

    He, Li-Sheng

    2013-05-22

    The barnacle, Amphibalanus amphitrite, is a common marine fouling organism. Understanding the mechanism of barnacle adhesion will be helpful in resolving the fouling problem. Barnacle cement is thought to play a key role in barnacle attachment. Although several adult barnacle cement proteins have been identified in Megabalanus rosa, little is known about their function in barnacle settlement. In this study, two homologous 20k-cement proteins (cp20k) in Amphibalanus amphitrite, named Bamcp20k-1 and Bamcp20k-2, were characterized. The two homologues share primary sequence structure with proteins from other species including Megabalanus rosa and Fistulobalanus albicostatus. The conserved structure included repeated Cys domains and abundant charged amino acids, such as histidine. In this study we demonstrated that Bamcp20k-1 localized at the α secretory cells in the cyprid cement gland, while Bamcp20k-2 localized to the β secretory cells. The differential localizations suggest differential regulation for secretion from the secretory cells. Both Bamcp20k-1 and Bamcp20k-2 from cyprids dissolved in PBS. However, adult Bamcp20k-2, which was dominant in the basal shell of adult barnacles, was largely insoluble in PBS. Solubility increased in the presence of the reducing reagent Dithiothreitol (DTT), suggesting that the formation of disulfide bonds plays a role in Bamcp20k-2 function. In comparison, Bamcp20k-1, which was enriched in soft tissue, could not be easily detected in the shell and base by Western blot and easily dissolved in PBS. These differential solubilities and localizations indicate that Bamcp20k-1 and Bamcp20k-2 have distinct functions in barnacle cementing. © 2013 He et al.

  15. Homologue Pairing in Flies and Mammals: Gene Regulation When Two Are Involved

    Directory of Open Access Journals (Sweden)

    Manasi S. Apte

    2012-01-01

    Full Text Available Chromosome pairing is usually discussed in the context of meiosis. Association of homologues in germ cells enables chromosome segregation and is necessary for fertility. A few organisms, such as flies, also pair their entire genomes in somatic cells. Most others, including mammals, display little homologue pairing outside of the germline. Experimental evidence from both flies and mammals suggests that communication between homologues contributes to normal genome regulation. This paper will contrast the role of pairing in transmitting information between homologues in flies and mammals. In mammals, somatic homologue pairing is tightly regulated, occurring at specific loci and in a developmentally regulated fashion. Inappropriate pairing, or loss of normal pairing, is associated with gene misregulation in some disease states. While homologue pairing in flies is capable of influencing gene expression, the significance of this for normal expression remains unknown. The sex chromosomes pose a particularly interesting situation, as females are able to pair X chromosomes, but males cannot. The contribution of homologue pairing to the biology of the X chromosome will also be discussed.

  16. Complementation of non-tumorigenicity of HPV18-positive cervical carcinoma cells involves differential mRNA expression of cellular genes including potential tumor suppressor genes on chromosome 11q13.

    Science.gov (United States)

    Kehrmann, Angela; Truong, Ha; Repenning, Antje; Boger, Regina; Klein-Hitpass, Ludger; Pascheberg, Ulrich; Beckmann, Alf; Opalka, Bertram; Kleine-Lowinski, Kerstin

    2013-01-01

    The fusion between human tumorigenic cells and normal human diploid fibroblasts results in non-tumorigenic hybrid cells, suggesting a dominant role for tumor suppressor genes in the generated hybrid cells. After long-term cultivation in vitro, tumorigenic segregants may arise. The loss of tumor suppressor genes on chromosome 11q13 has been postulated to be involved in the induction of the tumorigenic phenotype of human papillomavirus (HPV)18-positive cervical carcinoma cells and their derived tumorigenic hybrid cells after subcutaneous injection in immunocompromised mice. The aim of this study was the identification of novel cellular genes that may contribute to the suppression of the tumorigenic phenotype of non-tumorigenic hybrid cells in vivo. We used cDNA microarray technology to identify differentially expressed cellular genes in tumorigenic HPV18-positive hybrid and parental HeLa cells compared to non-tumorigenic HPV18-positive hybrid cells. We detected several as yet unknown cellular genes that play a role in cell differentiation, cell cycle progression, cell-cell communication, metastasis formation, angiogenesis, antigen presentation, and immune response. Apart from the known differentially expressed genes on 11q13 (e.g., phosphofurin acidic cluster sorting protein 1 (PACS1) and FOS ligand 1 (FOSL1 or Fra-1)), we detected novel differentially expressed cellular genes located within the tumor suppressor gene region (e.g., EGF-containing fibulin-like extracellular matrix protein 2 (EFEMP2) and leucine rich repeat containing 32 (LRRC32) (also known as glycoprotein-A repetitions predominant (GARP)) that may have potential tumor suppressor functions in this model system of non-tumorigenic and tumorigenic HeLa x fibroblast hybrid cells. Copyright © 2013 Elsevier Inc. All rights reserved.

  17. An antisense oligodeoxynucleotide targeted against the type IIβ regulatory subunit mRNA of protein kinase inhibits cAMP-induced differentiation in HL-60 leukemia cells without affecting phorbol ester effects

    International Nuclear Information System (INIS)

    Tortora, G.; Clair, T.; Cho-Chung, Y.S.

    1990-01-01

    The type II β regulatory subunit of cAMP-dependent protein kinase (RII β ) has been hypothesized to play an important role in the growth inhibition and differentiation induced by site-selective cAMP analogs in human cancer cells, but direct proof of this function has been lacking. To address this tissue, HL-60 human promyelocytic leukemia cells were exposed to RII β antisense synthetic oligodeoxynucleotide, and the effects on cAMP-induced growth regulation were examined. Exposure of these cells to RII β antisense oligodeoxynucleotide resulted in a decrease in cAMP analog-induced growth inhibition and differentiation without apparent effect on differentiation induced by phorbol esters. This loss in cAMP growth regulatory function correlated with a decrease in basal and induced levels of RII β protein. Exposure to RII β sense, RI α and RII α antisense, or irrelevant oligodeoxynucleotides had no such effect. These results show that the RII β regulatory subunit of protein kinase plays a critical role in the cAMP-induced growth regulation of HL-60 leukemia cells

  18. Differential effects of cortisol and 11-deoxycorticosterone on ion transport protein mRNA levels in gills of two euryhaline teleosts, Mozambique tilapia (Oreochromis mossambicus) and striped bass (Morone saxatilis).

    Science.gov (United States)

    Kiilerich, Pia; Tipsmark, Christian K; Borski, Russell J; Madsen, Steffen S

    2011-04-01

    The role of cortisol as the only corticosteroid in fish osmoregulation has recently been challenged with the discovery of a mineralocorticoid-like hormone, 11-deoxycorticosterone (DOC), and necessitates new studies of the endocrinology of osmoregulation in fish. Using an in vitro gill explant incubation approach, DOC-mediated regulation of selected osmoregulatory target genes in the gill was investigated and compared with that of cortisol in two euryhaline teleosts, Mozambique tilapia (Oreochromis mossambicus) and striped bass (Morone saxatilis). The effects were tested in gills from both fresh water (FW)- and seawater (SW)-acclimated fish. Both cortisol and DOC caused an up-regulation of the Na(+),K(+)-ATPase α1 subunit in SW-acclimated tilapia but had no effect in FW-acclimated fish. Cortisol conferred an increase in Na(+),K(+),2Cl(-) cotransporter (NKCC) isoform 1a transcript levels in FW- and SW-acclimated tilapia, whereas DOC had a stimulatory effect only in SW-acclimated fish. Cortisol had no effect on NKCC isoform 1b mRNA levels at both salinities, while DOC stimulated this isoform in SW-acclimated fish. In striped bass, cortisol conferred an up-regulation of Na(+),K(+)-ATPase α1 and NKCC transcript levels in FW- and SW-acclimated fish, whereas DOC resulted in down-regulation of these transcripts in FW-acclimated fish. It was also found that both corticosteroids may rapidly (30 min) alter the mitogen-activated protein kinase signalling pathway in gill, inducing phosphorylation of extracellular signal-regulated kinase 1 (ERK1) and ERK2 in a salinity-dependent manner. The study shows a disparate organisation of corticosteroid signalling mechanisms involved in ion regulation in the two species and adds new evidence to a role of DOC as a mineralocorticoid hormone in teleosts.

  19. Expression of calmodulin mRNA in rat olfactory neuroepithelium.

    Science.gov (United States)

    Biffo, S; Goren, T; Khew-Goodall, Y S; Miara, J; Margolis, F L

    1991-04-01

    A calmodulin (CaM) cDNA was isolated by differential hybridization screening of a lambda gt10 library prepared from rat olfactory mucosa. This cDNA fragment, containing most of the open reading frame of the rat CaMI gene, was subcloned and used to characterize steady-state expression of CaM mRNA in rat olfactory neuroepithelium and bulb. Within the bulb mitral cells are the primary neuronal population expressing CaM mRNA. The major CaM mRNA expressed in the olfactory mucosa is 1.7 kb with smaller contributions from mRNAs of 4.0 and 1.4 kb. CaM mRNA was primarily associated with the olfactory neurons and, despite the cellular complexity of the tissue and the known involvement of CaM in diverse cellular processes, was only minimally evident in sustentacular cells, gland cells or respiratory epithelium. Following bulbectomy CaM mRNA declines in the olfactory neuroepithelium as does olfactory marker protein (OMP) mRNA. In contrast to the latter, CaM mRNA makes a partial recovery by one month after surgery. These results, coupled with those from in situ hybridization, indicate that CaM mRNA is expressed in both mature and immature olfactory neurons. The program regulating CaM gene expression in olfactory neurons is distinct from those controlling expression of B50/GAP43 in immature, or OMP in mature, neurons respectively.

  20. Antidepressant Binding Site in a Bacterial Homologue of Neurotransmitter Transporters

    Energy Technology Data Exchange (ETDEWEB)

    Singh,S.; Yamashita, A.; Gouaux, E.

    2007-01-01

    Sodium-coupled transporters are ubiquitous pumps that harness pre-existing sodium gradients to catalyse the thermodynamically unfavourable uptake of essential nutrients, neurotransmitters and inorganic ions across the lipid bilayer. Dysfunction of these integral membrane proteins has been implicated in glucose/galactose malabsorption, congenital hypothyroidism, Bartter's syndrome, epilepsy, depression, autism and obsessive-compulsive disorder. Sodium-coupled transporters are blocked by a number of therapeutically important compounds, including diuretics, anticonvulsants and antidepressants, many of which have also become indispensable tools in biochemical experiments designed to probe antagonist binding sites and to elucidate transport mechanisms. Steady-state kinetic data have revealed that both competitive and noncompetitive modes of inhibition exist. Antagonist dissociation experiments on the serotonin transporter (SERT) have also unveiled the existence of a low-affinity allosteric site that slows the dissociation of inhibitors from a separate high-affinity site. Despite these strides, atomic-level insights into inhibitor action have remained elusive. Here we screen a panel of molecules for their ability to inhibit LeuT, a prokaryotic homologue of mammalian neurotransmitter sodium symporters, and show that the tricyclic antidepressant (TCA) clomipramine noncompetitively inhibits substrate uptake. Cocrystal structures show that clomipramine, along with two other TCAs, binds in an extracellular-facing vestibule about 11 {angstrom} above the substrate and two sodium ions, apparently stabilizing the extracellular gate in a closed conformation. Off-rate assays establish that clomipramine reduces the rate at which leucine dissociates from LeuT and reinforce our contention that this TCA inhibits LeuT by slowing substrate release. Our results represent a molecular view into noncompetitive inhibition of a sodium-coupled transporter and define principles for the

  1. Antidepressant Binding Site in a Bacterial Homologue of Neurotransmitter Transporters

    International Nuclear Information System (INIS)

    Singh, S.; Yamashita, A.; Gouaux, E.

    2007-01-01

    Sodium-coupled transporters are ubiquitous pumps that harness pre-existing sodium gradients to catalyse the thermodynamically unfavourable uptake of essential nutrients, neurotransmitters and inorganic ions across the lipid bilayer. Dysfunction of these integral membrane proteins has been implicated in glucose/galactose malabsorption, congenital hypothyroidism, Bartter's syndrome, epilepsy, depression, autism and obsessive-compulsive disorder. Sodium-coupled transporters are blocked by a number of therapeutically important compounds, including diuretics, anticonvulsants and antidepressants, many of which have also become indispensable tools in biochemical experiments designed to probe antagonist binding sites and to elucidate transport mechanisms. Steady-state kinetic data have revealed that both competitive and noncompetitive modes of inhibition exist. Antagonist dissociation experiments on the serotonin transporter (SERT) have also unveiled the existence of a low-affinity allosteric site that slows the dissociation of inhibitors from a separate high-affinity site. Despite these strides, atomic-level insights into inhibitor action have remained elusive. Here we screen a panel of molecules for their ability to inhibit LeuT, a prokaryotic homologue of mammalian neurotransmitter sodium symporters, and show that the tricyclic antidepressant (TCA) clomipramine noncompetitively inhibits substrate uptake. Cocrystal structures show that clomipramine, along with two other TCAs, binds in an extracellular-facing vestibule about 11 (angstrom) above the substrate and two sodium ions, apparently stabilizing the extracellular gate in a closed conformation. Off-rate assays establish that clomipramine reduces the rate at which leucine dissociates from LeuT and reinforce our contention that this TCA inhibits LeuT by slowing substrate release. Our results represent a molecular view into noncompetitive inhibition of a sodium-coupled transporter and define principles for the rational

  2. Cloning of Interleukin-10 from African Clawed Frog (Xenopus tropicalis, with the Finding of IL-19/20 Homologue in the IL-10 Locus

    Directory of Open Access Journals (Sweden)

    Zhitao Qi

    2015-01-01

    Full Text Available Interleukin-10 (IL-10 is a pleiotropic cytokine that plays an important role in immune system. In the present study, the IL-10 gene of African clawed frog (Xenopus tropicalis was first cloned, and its expression pattern and 3D structure were also analyzed. The frog IL-10 mRNA encoded 172 amino acids which possessed several conserved features found in IL-10s from other species, including five-exon/four-intron genomic structure, conserved four cysteine residues, IL-10 family motif, and six α-helices. Real-time PCR showed that frog IL-10 mRNA was ubiquitous expressed in all examined tissues, highly in some immune related tissues including kidney, spleen, and intestine and lowly in heart, stomach, and liver. The frog IL-10 mRNA was upregulated at 24 h after LPS stimulation, indicating that it plays a part in the host immune response to bacterial infection. Another IL, termed as IL-20, was identified from the frog IL-10 locus, which might be the homologue of mammalian IL-19/20 according to the analysis results of the phylogenetic tree and the sequence identities.

  3. Implication of C-type natriuretic peptide-3 signaling in glycosaminoglycan synthesis and chondrocyte hypertrophy during TGF-β1 induced chondrogenic differentiation of chicken bone marrow-derived mesenchymal stem cells.

    Science.gov (United States)

    Kocamaz, Erdogan; Gok, Duygu; Cetinkaya, Ayse; Tufan, A Cevik

    2012-10-01

    This study investigated the involvement of CNP-3, chick homologue for human C-type natriuretic peptide (CNP), in TGF-β1 induced chondrogenic differentiation of chicken bone marrow-derived mesenchymal stem cells (MSCs). Chondrogenic differentiation of MSCs in pellet cultures was induced by TGF-β1. Chondrogenic differentiation and glycosaminoglycan synthesis were analyzed on the basis of basic histology, collagen type II expression, and Alcian blue staining. Antibodies against CNP and NPR-B were used to block their function during these processes. Results revealed that expression of CNP-3 and NPR-B in MSCs were regulated by TGF-β1 in monolayer cultures at mRNA level. In pellet cultures of MSCs, TGF-β1 successfully induced chondrogenic differentiation and glycosaminoglycan synthesis. Addition of CNP into the TGF-β1 supplemented chondrogenic differentiation medium further induced the glycosaminoglycan synthesis and hypertrophy of differentiated chondrocytes in these pellets. Pellets induced with TGF-β1 and treated with antibodies against CNP and NPR-B, did show collagen type II expression, however, Alcian blue staining showing glycosaminoglycan synthesis was significantly suppressed. In conclusion, CNP-3/NPR-B signaling may strongly be involved in synthesis of glycosaminoglycans of the chondrogenic matrix and hypertrophy of differentiated chondrocytes during TGF-β1 induced chondrogenic differentiation of MSCs.

  4. mRNA localization mechanisms in Trypanosoma cruzi.

    Directory of Open Access Journals (Sweden)

    Lysangela R Alves

    Full Text Available Asymmetric mRNA localization is a sophisticated tool for regulating and optimizing protein synthesis and maintaining cell polarity. Molecular mechanisms involved in the regulated localization of transcripts are widespread in higher eukaryotes and fungi, but not in protozoa. Trypanosomes are ancient eukaryotes that branched off early in eukaryote evolution. We hypothesized that these organisms would have basic mechanisms of mRNA localization. FISH assays with probes against transcripts coding for proteins with restricted distributions showed a discrete localization of the mRNAs in the cytoplasm. Moreover, cruzipain mRNA was found inside reservosomes suggesting new unexpected functions for this vacuolar organelle. Individual mRNAs were also mobilized to RNA granules in response to nutritional stress. The cytoplasmic distribution of these transcripts changed with cell differentiation, suggesting that localization mechanisms might be involved in the regulation of stage-specific protein expression. Transfection assays with reporter genes showed that, as in higher eukaryotes, 3'UTRs were responsible for guiding mRNAs to their final location. Our results strongly suggest that Trypanosoma cruzi have a core, basic mechanism of mRNA localization. This kind of controlled mRNA transport is ancient, dating back to early eukaryote evolution.

  5. Nucleolin Mediates MicroRNA-directed CSF-1 mRNA Deadenylation but Increases Translation of CSF-1 mRNA*

    Science.gov (United States)

    Woo, Ho-Hyung; Baker, Terri; Laszlo, Csaba; Chambers, Setsuko K.

    2013-01-01

    CSF-1 mRNA 3′UTR contains multiple unique motifs, including a common microRNA (miRNA) target in close proximity to a noncanonical G-quadruplex and AU-rich elements (AREs). Using a luciferase reporter system fused to CSF-1 mRNA 3′UTR, disruption of the miRNA target region, G-quadruplex, and AREs together dramatically increased reporter RNA levels, suggesting important roles for these cis-acting regulatory elements in the down-regulation of CSF-1 mRNA. We find that nucleolin, which binds both G-quadruplex and AREs, enhances deadenylation of CSF-1 mRNA, promoting CSF-1 mRNA decay, while having the capacity to increase translation of CSF-1 mRNA. Through interaction with the CSF-1 3′UTR miRNA common target, we find that miR-130a and miR-301a inhibit CSF-1 expression by enhancing mRNA decay. Silencing of nucleolin prevents the miRNA-directed mRNA decay, indicating a requirement for nucleolin in miRNA activity on CSF-1 mRNA. Downstream effects followed by miR-130a and miR-301a inhibition of directed cellular motility of ovarian cancer cells were found to be dependent on nucleolin. The paradoxical effects of nucleolin on miRNA-directed CSF-1 mRNA deadenylation and on translational activation were explored further. The nucleolin protein contains four acidic stretches, four RNA recognition motifs (RRMs), and nine RGG repeats. All three domains in nucleolin regulate CSF-1 mRNA and protein levels. RRMs increase CSF-1 mRNA, whereas the acidic and RGG domains decrease CSF-1 protein levels. This suggests that nucleolin has the capacity to differentially regulate both CSF-1 RNA and protein levels. Our finding that nucleolin interacts with Ago2 indirectly via RNA and with poly(A)-binding protein C (PABPC) directly suggests a nucleolin-Ago2-PABPC complex formation on mRNA. This complex is in keeping with our suggestion that nucleolin may work with PABPC as a double-edged sword on both mRNA deadenylation and translational activation. Our findings underscore the complexity of

  6. From Cell Death to Metabolism: Holin-Antiholin Homologues with New Functions

    DEFF Research Database (Denmark)

    van den Esker, Marielle H.; Kovács, Ákos T.; Kuipers, Oscar P.

    2017-01-01

    , but their functions can be different, depending on the species. Using a series of biochemical and genetic approaches, in a recent article in mBio, Charbonnier et al. (mBio 8:e00976-17, 2017, https://doi.org/10.1128/mBio.00976-17) demonstrate that the antiholin homologue in Bacillus subtilis transports pyruvate...

  7. Behaviour of the homologues of Rf and Db in complexing media

    International Nuclear Information System (INIS)

    Trubert, D.; Monroy Guzman, F.; Hussonnois, M.; Brillard, L.; Le Naour, C.; Servajean, V.; Constantinescu, O.; Constantinescu, M.; Ardisson, G.; Barci, V.; Weiss, B.

    1999-01-01

    In order to study the chemical behaviour of the trans-actinide elements, the chemical properties of their most probable homologues have been investigated by ion exchange methods in various complexing media. A new chromatographic method allowing the determination of distribution coefficients in the case o short-lived isotopes has been developed and successfully tested with the RACHEL device. (authors)

  8. Partial functional complementation between human and mouse cytomegalovirus chemokine receptor homologues

    DEFF Research Database (Denmark)

    Farrell, Helen E; Abraham, Alexander M; Cardin, Rhonda D

    2011-01-01

    The human cytomegalovirus (CMV) proteins US28 and UL33 are homologous to chemokine receptors (CKRs). Knockout of the mouse CMV M33 protein (UL33 homologue) results in substantial attenuation of salivary gland infection/replication and reduced efficiency of reactivation from tissue explants. M33-m...

  9. A lesion mimic phenotype in tomato obtained by isolating and silencing an Lls1 homologue

    NARCIS (Netherlands)

    Spassieva, S; Hille, J

    Lesion mimic phenotypes serve as a tool to study the regulation of cell death in plants. In order to obtain a tomato lesion mimic phenotype, we used the conservation of the lethal leaf spot 1 (Lls1) genes between plant species. The tomato Lls1 homologue was cloned, sequenced and analyzed. It showed

  10. The actin homologue MreB organizes the bacterial cell membrane

    NARCIS (Netherlands)

    Strahl, H.; Burmann, F.; Hamoen, L.W.

    2014-01-01

    The eukaryotic cortical actin cytoskeleton creates specific lipid domains, including lipid rafts, which determine the distribution of many membrane proteins. Here we show that the bacterial actin homologue MreB displays a comparable activity. MreB forms membrane-associated filaments that coordinate

  11. Cloning and characterization of maize ZmSPK1, a homologue to ...

    African Journals Online (AJOL)

    hope&shola

    2006-03-15

    Mar 15, 2006 ... homologue to nonfermenting1-related protein kinase2 ... RT-PCR analysis showed that the ZmSPK1 expression was induced by mannitol, salt and ... MAPKKK in which each component is activated by .... It has been one of the main ... Protein kinase ATP-binding region signature is shown in gray box.

  12. A Hexose Transporter Homologue Controls Glucose Repression in the Methylotrophic Yeast Hansenula polymorpha

    NARCIS (Netherlands)

    Stasyk, Oleh V.; Stasyk, Olena G.; Komduur, Janet; Veenhuis, Marten; Cregg, James M.; Sibirny, Andrei A.

    2004-01-01

    Peroxisome biogenesis and synthesis of peroxisomal enzymes in the methylotrophic yeast Hansenula polymorpha are under the strict control of glucose repression. We identified an H. polymorpha glucose catabolite repression gene (HpGCR1) that encodes a hexose transporter homologue. Deficiency in GCR1

  13. Structure of HLA-A*1101 in complex with a hepatitis B peptide homologue

    DEFF Research Database (Denmark)

    Blicher, Thomas; Kastrup, Jette Sandholm; Pedersen, Lars Østergaard

    2006-01-01

    A high-resolution structure of the human MHC-I molecule HLA-A*1101 is presented in which it forms a complex with a sequence homologue of a peptide that occurs naturally in hepatitis B virus DNA polymerase. The sequence of the bound peptide is AIMPARFYPK, while that of the corresponding natural...

  14. Structural studies on a non-toxic homologue of type II RIPs from ...

    Indian Academy of Sciences (India)

    Structural studies on a non-toxic homologue of type II RIPs from bitter gourd: Molecular basis of non-toxicity, conformational selection and glycan structure. MS accepted http://www.ias.ac.in/jbiosci. THYAGESHWAR CHANDRAN, ALOK SHARMA and M VIJAYAN. J. Biosci. 40(5), October 2015, 929–941, © Indian Academy of ...

  15. The Neurospora crassa UVS-3 epistasis group encodes homologues of the ATR/ATRIP checkpoint control system.

    Science.gov (United States)

    Kazama, Yusuke; Ishii, Chizu; Schroeder, Alice L; Shimada, Hisao; Wakabayashi, Michiyoshi; Inoue, Hirokazu

    2008-02-01

    The mutagen sensitive uvs-3 and mus-9 mutants of Neurospora show mutagen and hydroxyurea sensitivity, mutator effects and duplication instability typical of recombination repair and DNA damage checkpoint defective mutants. To determine the nature of these genes we used cosmids from a genomic library to clone the uvs-3 gene by complementation for MMS sensitivity. Mutation induction by transposon insertion and RIP defined the coding sequence. RFLP analysis confirmed that this sequence maps in the area of uvs-3 at the left telomere of LG IV. Analysis of the cDNA showed that the UVS-3 protein contains an ORF of 969 amino acids with one intron. It is homologous to UvsD of Aspergillus nidulans, a member of the ATRIP family of checkpoint proteins. It retains the N' terminal coiled-coil motif followed by four basic amino acids typical of these proteins and shows the highest homology in this region. The uvsD cDNA partially complements the defects of the uvs-3 mutation. The uvs-3 mutant shows a higher level of micronuclei in conidia and failure to halt germination and nuclear division in the presence of hydroxyurea than wild type, suggesting checkpoint defects. ATRIP proteins bind tightly to ATR PI-3 kinase (phosphatidylinositol 3-kinase) proteins. Therefore, we searched the Neurospora genome sequence for homologues of the Aspergillus nidulans ATR, UvsB. A uvsB homologous sequence was present in the right arm of chromosome I where the mus-9 gene maps. A cosmid containing this genomic DNA complemented the mus-9 mutation. The putative MUS-9 protein is 2484 amino acids long with eight introns. Homology is especially high in the C-terminal 350 amino acids that correspond to the PI-3 kinase domain. In wild type a low level of constitutive mRNA is present for both genes. It is transiently induced upon UV exposure.

  16. The SPF27 homologue Num1 connects splicing and kinesin 1-dependent cytoplasmic trafficking in Ustilago maydis.

    Directory of Open Access Journals (Sweden)

    Nikola Kellner

    2014-01-01

    Full Text Available The conserved NineTeen protein complex (NTC is an integral subunit of the spliceosome and required for intron removal during pre-mRNA splicing. The complex associates with the spliceosome and participates in the regulation of conformational changes of core spliceosomal components, stabilizing RNA-RNA- as well as RNA-protein interactions. In addition, the NTC is involved in cell cycle checkpoint control, response to DNA damage, as well as formation and export of mRNP-particles. We have identified the Num1 protein as the homologue of SPF27, one of NTC core components, in the basidiomycetous fungus Ustilago maydis. Num1 is required for polarized growth of the fungal hyphae, and, in line with the described NTC functions, the num1 mutation affects the cell cycle and cell division. The num1 deletion influences splicing in U. maydis on a global scale, as RNA-Seq analysis revealed increased intron retention rates. Surprisingly, we identified in a screen for Num1 interacting proteins not only NTC core components as Prp19 and Cef1, but several proteins with putative functions during vesicle-mediated transport processes. Among others, Num1 interacts with the motor protein Kin1 in the cytoplasm. Similar phenotypes with respect to filamentous and polar growth, vacuolar morphology, as well as the motility of early endosomes corroborate the genetic interaction between Num1 and Kin1. Our data implicate a previously unidentified connection between a component of the splicing machinery and cytoplasmic transport processes. As the num1 deletion also affects cytoplasmic mRNA transport, the protein may constitute a novel functional interconnection between the two disparate processes of splicing and trafficking.

  17. The hypoxic proteome is influenced by gene-specific changes in mRNA translation

    International Nuclear Information System (INIS)

    Koritzinsky, Marianne; Seigneuric, Renaud; Magagnin, Michael G.; Beucken, Twan van den; Lambin, Philippe; Wouters, Bradly G.

    2005-01-01

    Background and purpose: Hypoxia causes a rapid reduction in mRNA translation efficiency. This inhibition does not affect all mRNA species to the same extent and can therefore contribute significantly to hypoxia-induced differential protein expression. Our aim in this study was to characterize changes in gene expression during acute hypoxia and evaluate the contribution of regulation via mRNA translation on these changes. For each gene, the contribution of changes in mRNA abundance versus mRNA translation was determined. Materials and methods: DU145 prostate carcinoma cells were exposed to 4 h of hypoxia ( 2 ). Efficiently translated mRNAs were isolated by sedimentation through a sucrose gradient. Affymetrix microarray technology was used to evaluate both the transcriptional and translational contribution to gene expression. Results were validated by quantitative PCR. Results: One hundred and twenty genes were more than 4-fold upregulated by hypoxia in the efficiently translated fraction of mRNA, in comparison to only 76 genes at the level of transcription. Of the 50 genes demonstrating the largest changes in translation, 11 were found to be more than 2-fold over represented in the translated fraction in comparison to their overall transcriptional level. The gene with the highest translational contribution to its induction was CITED-2, which is a negative regulator of HIF-1 transcriptional activity. Conclusions: Gene-specific regulation of mRNA translation contributes significantly to differential gene expression during hypoxia

  18. Molecular cloning and expression of the human homologue of the murine gene encoding myeloid leukemia-inhibitory factor

    International Nuclear Information System (INIS)

    Gough, N.M.; Gearing, D.P.; King, J.A.; Willson, T.A.; Hilton, D.J.; Nicola, N.A.; Metcalf, D.

    1988-01-01

    A human homologue of the recently cloned murine leukemia-inhibitory factor (LIF) gene was isolated from a genomic library by using the marine cDNA as a hybridization probe. The nucleotide sequence of the human gene indicated that human LIF has 78% amino acid sequence identity with murine LIF, with no insertions or deletions, and that the region of the human gene encoding the mature protein has one intervening sequence. After oligonucleotide-mediated mutagenesis, the mature protein-coding region of the LIF gene was introduced into the yeast expression vector YEpsec1. Yeast cells transformed with the resulting recombinant could be induced with galactose to produce high levels of a factor that induced the differentiation of murine M1 leukemic cells in a manner analogous to murine LIF. This factor competed with 125 I-labeled native murine LIF for binding to specific cellular receptors on murine cells, compatible with a high degree of structural similarity between the murine and human factors

  19. Periodontal status of teeth restored with crowns and its contralateral homologue, Valdivia- Chile.

    OpenAIRE

    Israel Antonio Juárez; Sofía Larroulet; Makarena Ojeda; Cristian Rosas

    2015-01-01

    ABSTRACT Aim: To determine periodontal status of fixes single prostheses (FSP) made during the year 2013 in Austral University of Chile, and its contralateral homologue (CH).Methods: All patients with FSP made during 2013, that met the selection criteria and agreed to participate were evaluated. During the year 2014 was measured: probing depth, attachment level; bleeding on probing and dental plaque index for each FSP and CH; and consigned biological width invasion. Were measured one FSP...

  20. The actin homologue MreB organizes the bacterial cell membrane

    OpenAIRE

    Strahl, Henrik; Bürmann, Frank; Hamoen, Leendert W.

    2014-01-01

    The eukaryotic cortical actin cytoskeleton creates specific lipid domains, including lipid rafts, which determine the distribution of many membrane proteins. Here we show that the bacterial actin homologue MreB displays a comparable activity. MreB forms membrane-associated filaments that coordinate bacterial cell wall synthesis. We noticed that the MreB cytoskeleton influences fluorescent staining of the cytoplasmic membrane. Detailed analyses combining an array of mutants, using specific lip...

  1. Crystal structure of myotoxin-II: a myotoxic phospholipase A2 - homologue from Bothrops moojeni venom

    International Nuclear Information System (INIS)

    Azevedo, W.F.; Ward, R.J.; Lombardi, F.R.; Arni, R.K.; Soares, A.M.; Giglio, J.R.; Fontes, M.R.M.

    1997-01-01

    Full text. Phospho lipases A2 (PLA 2 ; E C 3.1.1.4, phosphatides s n-2 acyl hydrolases) hydrolysis the s n-2 ester bond of phospholipids showing enhanced activity at lamellar or membrane surfaces. Intracellular PLA 2 s are involved at phospholipid metabolism and signal transduction, whereas extracellular PLA 2 s are found in mammalian pancreatic juices, the venoms of snakes, lizards and insects. Based on their high primary sequence similarity, extracellular PLA 2 s are separated into Classes I, II and III. Class II PLA 2 s are found in snake venoms of Crotalidae an Viperidae species, and include the sub-family of Lys PLA 2 s homologue. he coordination of the Ca 2+ ion in the PLA 2 calcium-binding loop includes and aspartate at position 49. In the catalytically active PLA 2 s, this calcium ion plays a critical role in the stabilization of the tetrahedral transition state intermediate in the catalytic mechanism. The conservative substitution Asp49-Lys results in a decreased calcium affinity with a concomitant loss of catalytic activity, and naturally occurring PLA 2 s-homologues showing the same substitution are catalytically inactive. However, the Lys PLA 2 s possess cytolytic and myotoxic activities and furthermore retain the ability to disrupt the integrity of both plasma membranes and model lipid layers by a ca 2+ -independent mechanism for which there is no evidence of lipid hydrolysis. Lys 49 PLA 2 homologues have been isolated from several Bothrops spp. venoms including B. moojeni. Therefore, in order to improve our understanding of the molecular basis of the myotoxic and Ca 2+ independent membrane damaging activities we have determined the crystal structure of MjTX-II, a Lys 49 homologue from the venom of B. moojeni. The model presented has been determined at 2.0 A resolution and refined to a crystallographic residual of 19.7% (R f ree=28.1%). (author)

  2. Three TFL1 homologues regulate floral initiation in the biofuel plant Jatropha curcas

    Science.gov (United States)

    Li, Chaoqiong; Fu, Qiantang; Niu, Longjian; Luo, Li; Chen, Jianghua; Xu, Zeng-Fu

    2017-01-01

    Recent research revealed that TERMINAL FLOWER 1 (TFL1) homologues are involved in the critical developmental process of floral initiation in several plant species. In this study, the functions of three putative TFL1 homologues (JcTFL1a, JcTFL1b and JcTFL1c) in the biofuel plant Jatropha curcas were analysed using the transgenic approach. JcTFL1b and JcTFL1c, but not JcTFL1a, could complement the TFL1 function and rescue early flowering and determinate inflorescence phenotype in tfl1-14 Arabidopsis mutant, thus suggesting that JcTFL1b and JcTFL1c may be homologues of TFL1. Transgenic Jatropha overexpressing JcTFL1a, JcTFL1b or JcTFL1c showed late flowering, whereas only JcTFL1b and JcTFL1c overexpression delayed flowering in transgenic Arabidopsis. JcTFL1b-RNAi transgenic Jatropha consistently exhibited moderately early flowering phenotype. JcFT and JcAP1 were significantly downregulated in transgenic Jatropha overexpressing JcTFL1a, JcTFL1b or JcTFL1c, which suggested that the late flowering phenotype of these transgenic Jatropha may result from the repressed expression of JcFT and JcAP1. Our results indicate that these three JcTFL1 genes play redundant roles in repressing flowering in Jatropha. PMID:28225036

  3. Gene function in early mouse embryonic stem cell differentiation

    Directory of Open Access Journals (Sweden)

    Campbell Pearl A

    2007-03-01

    Full Text Available Abstract Background Little is known about the genes that drive embryonic stem cell differentiation. However, such knowledge is necessary if we are to exploit the therapeutic potential of stem cells. To uncover the genetic determinants of mouse embryonic stem cell (mESC differentiation, we have generated and analyzed 11-point time-series of DNA microarray data for three biologically equivalent but genetically distinct mESC lines (R1, J1, and V6.5 undergoing undirected differentiation into embryoid bodies (EBs over a period of two weeks. Results We identified the initial 12 hour period as reflecting the early stages of mESC differentiation and studied probe sets showing consistent changes of gene expression in that period. Gene function analysis indicated significant up-regulation of genes related to regulation of transcription and mRNA splicing, and down-regulation of genes related to intracellular signaling. Phylogenetic analysis indicated that the genes showing the largest expression changes were more likely to have originated in metazoans. The probe sets with the most consistent gene changes in the three cell lines represented 24 down-regulated and 12 up-regulated genes, all with closely related human homologues. Whereas some of these genes are known to be involved in embryonic developmental processes (e.g. Klf4, Otx2, Smn1, Socs3, Tagln, Tdgf1, our analysis points to others (such as transcription factor Phf21a, extracellular matrix related Lama1 and Cyr61, or endoplasmic reticulum related Sc4mol and Scd2 that have not been previously related to mESC function. The majority of identified functions were related to transcriptional regulation, intracellular signaling, and cytoskeleton. Genes involved in other cellular functions important in ESC differentiation such as chromatin remodeling and transmembrane receptors were not observed in this set. Conclusion Our analysis profiles for the first time gene expression at a very early stage of m

  4. Genetic link between Cabeza, a Drosophila homologue of Fused in Sarcoma (FUS), and the EGFR signaling pathway

    Energy Technology Data Exchange (ETDEWEB)

    Shimamura, Mai; Kyotani, Akane [Department of Applied Biology, Kyoto Institute of Technology, Matsugasaki, Sakyo-ku, Kyoto 606-8585 (Japan); Insect Biomedical Research Center, Kyoto Institute of Technology, Matsugasaki, Sakyo-ku, Kyoto 606-8585 (Japan); Azuma, Yumiko [Department of Neurology, Kyoto Prefectural University of Medicine, 465 Kajii-cho,Kamigyo-ku, Kyoto 602-8566 (Japan); Yoshida, Hideki; Binh Nguyen, Thanh [Department of Applied Biology, Kyoto Institute of Technology, Matsugasaki, Sakyo-ku, Kyoto 606-8585 (Japan); Insect Biomedical Research Center, Kyoto Institute of Technology, Matsugasaki, Sakyo-ku, Kyoto 606-8585 (Japan); Mizuta, Ikuko; Yoshida, Tomokatsu; Mizuno, Toshiki [Department of Neurology, Kyoto Prefectural University of Medicine, 465 Kajii-cho,Kamigyo-ku, Kyoto 602-8566 (Japan); Nakagawa, Masanori [North Medical Center, Kyoto Prefectural University of Medicine, 465 Kajii-cho, Kamigyo-ku, Kyoto 602-8566 (Japan); Tokuda, Takahiko, E-mail: ttokuda@koto.kpu-m.ac.jp [Department of Neurology, Kyoto Prefectural University of Medicine, 465 Kajii-cho,Kamigyo-ku, Kyoto 602-8566 (Japan); Department of Molecular Pathobiology of Brain Diseases, Graduate School of Medical Science, Kyoto Prefectural University of Medicine, 465 Kajii-cho, Kamigyo-ku, Kyoto 602-8566 (Japan); Yamaguchi, Masamitsu, E-mail: myamaguc@kit.ac.jp [Department of Applied Biology, Kyoto Institute of Technology, Matsugasaki, Sakyo-ku, Kyoto 606-8585 (Japan); Insect Biomedical Research Center, Kyoto Institute of Technology, Matsugasaki, Sakyo-ku, Kyoto 606-8585 (Japan)

    2014-08-01

    Amyotrophic Lateral Sclerosis (ALS) is a fatal neurodegenerative disease that causes progressive muscular weakness. Fused in Sarcoma (FUS) that has been identified in familial ALS is an RNA binding protein that is normally localized in the nucleus. However, its function in vivo is not fully understood. Drosophila has Cabeza (Caz) as a FUS homologue and specific knockdown of Caz in the eye imaginal disc and pupal retina using a GMR-GAL4 driver was here found to induce an abnormal morphology of the adult compound eyes, a rough eye phenotype. This was partially suppressed by expression of the apoptosis inhibitor P35. Knockdown of Caz exerted no apparent effect on differentiation of photoreceptor cells. However, immunostaining with an antibody to Cut that marks cone cells revealed fusion of these and ommatidia of pupal retinae. These results indicate that Caz knockdown induces apoptosis and also inhibits differentiation of cone cells, resulting in abnormal eye morphology in adults. Mutation in EGFR pathway-related genes, such as rhomboid-1, rhomboid-3 and mirror suppressed the rough eye phenotype induced by Caz knockdown. Moreover, the rhomboid-1 mutation rescued the fusion of cone cells and ommatidia observed in Caz knockdown flies. The results suggest that Caz negatively regulates the EGFR signaling pathway required for determination of cone cell fate in Drosophila. - Highlights: • Knockdown of Cabeza induced rough eye phenotype. • Knockdown of Cabeza induced fusion of cone cells in pupal retinae. • Knockdown of Cabeza induced apoptosis in pupal retinae. • Mutation in EGFR pathway-related genes suppressed the rough eye phenotype. • Cabeza may negatively regulate the EGFR pathway.

  5. Regulation of mRNA translation influences hypoxia tolerance

    International Nuclear Information System (INIS)

    Koritzinsky, M.; Wouters, B.G.; Koumenis, C.

    2003-01-01

    Hypoxia is a heterogenous but common characteristic of human tumours and poor oxygenation is associated with poor prognosis. We believe that the presence of viable hypoxic tumor cells reflects in part an adaptation and tolerance of these cells to oxygen deficiency. Since oxidative phosphorylation is compromized during hypoxia, adaptation may involve both the upregulation of glycolysis as well as downregulation of energy consumption. mRNA translation is one of the most energy costly cellular processes, and we and others have shown that global mRNA translation is rapidly inhibited during hypoxia. However, some mRNAs, including those coding for HIF-1 α and VEGF, remain efficiently translated during hypoxia. Clearly, the mechanisms responsible for the overall inhibition of translation during hypoxia does not compromize the translation of certain hypoxia-induced mRNA species. We therefore hypothesize that the inhibition of mRNA translation serves to promote hypoxia tolerance in two ways: i) through conservation of energy and ii) through differential gene expression involved in hypoxia adaptation. We have recently identified two pathways that are responsible for the global inhibition of translation during hypoxia. The phosphorylation of the eukaryotic initiation factor eIF2 α by the ER resident kinase PERK results in down-regulation of protein synthesis shortly after the onset of hypoxia. In addition, the initiation complex eIF4F is disrupted during long lasting hypoxic conditions. The identification of the molecular pathways responsible for the inhibition of overall translation during hypoxia has rendered it possible to investigate their importance for hypoxia tolerance. We have found that mouse embryo fibroblasts that are knockout for PERK and therefore not able to inhibit protein synthesis efficiently during oxygen deficiency are significantly less tolerant to hypoxia than their wildtype counterparts. We are currently also investigating the functional significance

  6. Identification and characterisation of the angiotensin converting enzyme-3 (ACE3) gene: a novel mammalian homologue of ACE

    OpenAIRE

    Rella, Monika; Elliot, Joann L; Revett, Timothy J; Lanfear, Jerry; Phelan, Anne; Jackson, Richard M; Turner, Anthony J; Hooper, Nigel M

    2007-01-01

    Abstract Background Mammalian angiotensin converting enzyme (ACE) plays a key role in blood pressure regulation. Although multiple ACE-like proteins exist in non-mammalian organisms, to date only one other ACE homologue, ACE2, has been identified in mammals. Results Here we report the identification and characterisation of the gene encoding a third homologue of ACE, termed ACE3, in several mammalian genomes. The ACE3 gene is located on the same chromosome downstream of the ACE gene. Multiple ...

  7. Nerve growth factor mRNA in brain: localization by in situ hybridization

    International Nuclear Information System (INIS)

    Rennert, P.D.; Heinrich, G.

    1986-01-01

    Nerve Growth Factor is a 118 amino acid polypeptide that plays an important role in the differentiation and survival of neurons. The recent discovery that a mRNA that encodes beta Nerve Growth Factor is present in brain suggests that the Nerve Growth Factor gene may not only regulate gene expression of peripheral but also of central neurons. To identify the site(s) of Nerve Growth Factor mRNA production in the brain and to determine which cells express the Nerve Growth Factor gene, the technique of in situ hybridization was employed. A 32P-labeled RNA probe complementary to Nerve Growth Factor mRNA hybridized to cells in the stratum granulosum of the dentate gyrus and the stratum pyramidale of the hippocampus. These observations identify for the first time cellular sites of Nerve Growth Factor gene expression in the central nervous system, and suggest that Nerve Growth Factor mRNA is produced by neurons

  8. The monomeric orphan nuclear receptor Schistosoma mansoni Ftz-F1 dimerizes specifically and functionally with the schistosome RXR homologue, SmRXR1

    International Nuclear Information System (INIS)

    Bertin, Benjamin; Caby, Stephanie; Oger, Frederik; Sasorith, Souphatta; Wurtz, Jean-Marie; Pierce, Raymond J.

    2005-01-01

    In an attempt to understand development and differentiation processes of the parasitic blood fluke Schistosoma mansoni, several members of the nuclear receptor superfamily were cloned, including SmFtz-F1 (S. mansoni Fushi Tarazu-factor 1). The Ftz-F1 nuclear receptor subfamily only contains orphan receptors that bind to their response element as monomers. Whereas SmFtz-F1 displays these basic functional properties, we have identified an original and specific interaction between SmFtz-F1 and the schistosome RXR homologue, SmRXR1. The mammalian two-hybrid assay showed that the D, E, and F domains of SmFtz-F1 were capable of interacting specifically with the E domain of SmRXR1 but not with that of mouse RXRα. Using three-dimensional LBD homology modelling and structure-guided mutagenesis, we were able to demonstrate the essential role of exposed residues located in the dimerization interfaces of both receptors in the maintenance of the interaction. Cotransfection experiments with constructions encoding full-length nuclear receptors show that SmRXR1 potentiates the transcriptional activity of SmFtz-F1 from various promoters. Nevertheless, the lack of identification of a dimeric response element for this SmFtz-F1/SmRXR1 heterodimer seems to indicate a 'tethering' mechanism. Thus, our results suggest for the first time that a member of the Ftz-F1 family could heterodimerize functionally with a homologue of the universal heterodimerization partner of nuclear receptors. This unique property confirms that SmFtz-F1 may be involved in the development and differentiation of schistosome-specific structures

  9. mRNA fragments in in vitro culture media are associated with bovine preimplantation embryonic development.

    Science.gov (United States)

    Kropp, Jenna; Khatib, Hasan

    2015-01-01

    In vitro production (IVP) systems have been used to bypass problems of fertilization and early embryonic development. However, embryos produced by IVP are commonly selected for implantation based on morphological assessment, which is not a strong indicator of establishment and maintenance of pregnancy. Thus, there is a need to identify additional indicators of embryonic developmental potential. Previous studies have identified microRNA expression in in vitro culture media to be indicative of embryo quality in both bovine and human embryos. Like microRNAs, mRNAs have been shown to be secreted from cells into the extracellular environment, but it is unknown whether or not these RNAs are secreted by embryos. Thus, the objective of the present study was to determine whether mRNAs are secreted into in vitro culture media and if their expression in the media is indicative of embryo quality. In vitro culture medium was generated and collected from both blastocyst and degenerate (those which fail to develop from the morula to blastocyst stage) embryos. Small-RNA sequencing revealed that many mRNA fragments were present in the culture media. A total of 17 mRNA fragments were differentially expressed between blastocyst and degenerate conditioned media. Differential expression was confirmed by quantitative real-time PCR for fragments of mRNA POSTN and VSNL-1, in four additional biological replicates of media. To better understand the mechanisms of mRNA secretion into the media, the expression of a predicted RNA binding protein of POSTN, PUM2, was knocked down using an antisense oligonucleotide gapmer. Supplementation of a PUM2 gapmer significantly reduced blastocyst development and decreased secretion of POSTN mRNA into the media. Overall, differential mRNA expression in the media was repeatable and sets the framework for future study of mRNA biomarkers in in vitro culture media to improve predictability of reproductive performance.

  10. Interactions between the HIV-1 Unspliced mRNA and Host mRNA Decay Machineries

    Directory of Open Access Journals (Sweden)

    Daniela Toro-Ascuy

    2016-11-01

    Full Text Available The human immunodeficiency virus type-1 (HIV-1 unspliced transcript is used both as mRNA for the synthesis of structural proteins and as the packaged genome. Given the presence of retained introns and instability AU-rich sequences, this viral transcript is normally retained and degraded in the nucleus of host cells unless the viral protein REV is present. As such, the stability of the HIV-1 unspliced mRNA must be particularly controlled in the nucleus and the cytoplasm in order to ensure proper levels of this viral mRNA for translation and viral particle formation. During its journey, the HIV-1 unspliced mRNA assembles into highly specific messenger ribonucleoproteins (mRNPs containing many different host proteins, amongst which are well-known regulators of cytoplasmic mRNA decay pathways such as up-frameshift suppressor 1 homolog (UPF1, Staufen double-stranded RNA binding protein 1/2 (STAU1/2, or components of miRNA-induced silencing complex (miRISC and processing bodies (PBs. More recently, the HIV-1 unspliced mRNA was shown to contain N6-methyladenosine (m6A, allowing the recruitment of YTH N6-methyladenosine RNA binding protein 2 (YTHDF2, an m6A reader host protein involved in mRNA decay. Interestingly, these host proteins involved in mRNA decay were shown to play positive roles in viral gene expression and viral particle assembly, suggesting that HIV-1 interacts with mRNA decay components to successfully accomplish viral replication. This review summarizes the state of the art in terms of the interactions between HIV-1 unspliced mRNA and components of different host mRNA decay machineries.

  11. Effect of Phosphatase and Tensin Homologue on Chromosome 10 on Angiotensin II-Mediated Proliferation, Collagen Synthesis, and Akt/P27 Signaling in Neonatal Rat Cardiac Fibroblasts

    Directory of Open Access Journals (Sweden)

    Ling Nie

    2016-01-01

    Full Text Available Cardiac fibroblasts (CFs play a key role in cardiac fibrosis by regulating the balance between extracellular matrix synthesis and breakdown. Although phosphatase and tensin homologue on chromosome 10 (PTEN has been found to play an important role in cardiovascular disease, it is not clear whether PTEN is involved in functional regulation of CFs. In the present study, PTEN was overexpressed in neonatal rat CFs via recombinant adenovirus-mediated gene transfer. The effects of PTEN overexpression on cell-cycle progression and angiotensin II- (Ang II- mediated regulation of collagen metabolism, synthesis of matrix metalloproteinases, and Akt/P27 signaling were investigated. Compared with uninfected cells and cells infected with green fluorescent protein-expressing adenovirus (Ad-GFP, cells infected with PTEN-expressing adenovirus (Ad-PTEN significantly increased PTEN protein and mRNA levels in CFs (P<0.05. The proportion of CFs in the G1/S cell-cycle phase was significantly higher for PTEN-overexpressing cells. In addition, Ad-PTEN decreased mRNA expression and the protein synthesis rate of collagen types I and III and antagonized Ang II-induced collagen synthesis. Overexpression of PTEN also decreased Ang II-induced matrix metalloproteinase-2 (MMP-2 and tissue inhibitor of metalloproteinase-1 (TIMP-1 production as well as gelatinase activity. Moreover, Ad-PTEN decreased Akt expression and increased P27 expression independent of Ang II stimulation. These results suggest that PTEN could regulate its functional effects in neonatal rat CFs partially via the Akt/P27 signaling pathway.

  12. The effects of valproic acid on the mRNA expression of Natriuretic ...

    African Journals Online (AJOL)

    Mona Hajikazemi

    2017-04-28

    Apr 28, 2017 ... Real Time RT-PCR was used to quantify differential mRNA expression of NPR-A and KCNQ1 genes. Two-way ANOVA and bonferroni post-tests were used to analyze data statistically. Results: We showed that VPA treatment inhibits the growth of SW-480 cells more efficiently compared to. HT-29. NPR-A ...

  13. MicroRNA-15a finetunes the level of Delta-like 1 homologue (DLK1) in proliferating 3T3-L1 preadipocytes

    DEFF Research Database (Denmark)

    Andersen, Ditte C; Jensen, Charlotte H; Schneider, Mikael

    2010-01-01

    Delta like 1 homologue (Dlk1) exists in both transmembrane and soluble molecular forms, and is implicated in cellular growth and plays multiple roles in development, tissue regeneration, and cancer. Thus, DLK1 levels are critical for cell function, and abnormal DLK1 expression can be lethal...... increases with cell density, and peaks at the same stage where membrane DLK1(M) and soluble DLK1(S) are found at maximum levels. Remarkably, miR-15a represses the amount of all Dlk1 variants at the mRNA level but also the level of DLK1(M) protein while it increases the amount of DLK1(S) supporting a direct...... while increasing cell numbers, scenarios that were completely rescued by addition of purified DLK1(S). Our data thus imply that miR-15a regulates cell size and proliferation by fine-tuning Dlk1 among others, and further emphasize miR-15a and DLK1 levels to play important roles in growth signaling...

  14. First report of a thioredoxin homologue in jellyfish: molecular cloning, expression and antioxidant activity of CcTrx1 from Cyanea capillata.

    Directory of Open Access Journals (Sweden)

    Zengliang Ruan

    Full Text Available Thioredoxins (Trx proteins are a family of small, highly-conserved and ubiquitous proteins that play significant roles in the resistance of oxidative damage. In this study, a homologue of Trx was identified from the cDNA library of tentacle of the jellyfish Cyanea capillata and named CcTrx1. The full-length cDNA of CcTrx1 was 479 bp with a 312 bp open reading frame encoding 104 amino acids. Bioinformatics analysis revealed that the putative CcTrx1 protein harbored the evolutionarily-conserved Trx active site 31CGPC34 and shared a high similarity with Trx1 proteins from other organisms analyzed, indicating that CcTrx1 is a new member of Trx1 sub-family. CcTrx1 mRNA was found to be constitutively expressed in tentacle, umbrella, oral arm and gonad, indicating a general role of CcTrx1 protein in various physiological processes. The recombinant CcTrx1 (rCcTrx1 protein was expressed in Escherichia coli BL21 (DE3, and then purified by affinity chromatography. The rCcTrx1 protein was demonstrated to possess the expected redox activity in enzymatic analysis and protection against oxidative damage of supercoiled DNA. These results indicate that CcTrx1 may function as an important antioxidant in C. capillata. To our knowledge, this is the first Trx protein characterized from jellyfish species.

  15. Purification of the spliced leader ribonucleoprotein particle from Leptomonas collosoma revealed the existence of an Sm protein in trypanosomes. Cloning the SmE homologue.

    Science.gov (United States)

    Goncharov, I; Palfi, Z; Bindereif, A; Michaeli, S

    1999-04-30

    Trans-splicing in trypanosomes involves the addition of a common spliced leader (SL) sequence, which is derived from a small RNA, the SL RNA, to all mRNA precursors. The SL RNA is present in the cell in the form of a ribonucleoprotein, the SL RNP. Using conventional chromatography and affinity selection with 2'-O-methylated RNA oligonucleotides at high ionic strength, five proteins of 70, 16, 13, 12, and 8 kDa were co-selected with the SL RNA from Leptomonas collosoma, representing the SL RNP core particle. Under conditions of lower ionic strength, additional proteins of 28 and 20 kDa were revealed. On the basis of peptide sequences, the gene coding for a protein with a predicted molecular weight of 11.9 kDa was cloned and identified as homologue of the cis-spliceosomal SmE. The protein carries the Sm motifs 1 and 2 characteristic of Sm antigens that bind to all known cis-spliceosomal uridylic acid-rich small nuclear RNAs (U snRNAs), suggesting the existence of Sm proteins in trypanosomes. This finding is of special interest because trypanosome snRNPs are the only snRNPs examined to date that are not recognized by anti-Sm antibodies. Because of the early divergence of trypanosomes from the eukaryotic lineage, the trypanosome SmE protein represents one of the primordial Sm proteins in nature.

  16. Self-amplifying mRNA vaccines.

    Science.gov (United States)

    Brito, Luis A; Kommareddy, Sushma; Maione, Domenico; Uematsu, Yasushi; Giovani, Cinzia; Berlanda Scorza, Francesco; Otten, Gillis R; Yu, Dong; Mandl, Christian W; Mason, Peter W; Dormitzer, Philip R; Ulmer, Jeffrey B; Geall, Andrew J

    2015-01-01

    This chapter provides a brief introduction to nucleic acid-based vaccines and recent research in developing self-amplifying mRNA vaccines. These vaccines promise the flexibility of plasmid DNA vaccines with enhanced immunogenicity and safety. The key to realizing the full potential of these vaccines is efficient delivery of nucleic acid to the cytoplasm of a cell, where it can amplify and express the encoded antigenic protein. The hydrophilicity and strong net negative charge of RNA impedes cellular uptake. To overcome this limitation, electrostatic complexation with cationic lipids or polymers and physical delivery using electroporation or ballistic particles to improve cellular uptake has been evaluated. This chapter highlights the rapid progress made in using nonviral delivery systems for RNA-based vaccines. Initial preclinical testing of self-amplifying mRNA vaccines has shown nonviral delivery to be capable of producing potent and robust innate and adaptive immune responses in small animals and nonhuman primates. Historically, the prospect of developing mRNA vaccines was uncertain due to concerns of mRNA instability and the feasibility of large-scale manufacturing. Today, these issues are no longer perceived as barriers in the widespread implementation of the technology. Currently, nonamplifying mRNA vaccines are under investigation in human clinical trials and can be produced at a sufficient quantity and quality to meet regulatory requirements. If the encouraging preclinical data with self-amplifying mRNA vaccines are matched by equivalently positive immunogenicity, potency, and tolerability in human trials, this platform could establish nucleic acid vaccines as a versatile new tool for human immunization. Copyright © 2015 Elsevier Inc. All rights reserved.

  17. The role of the Saccharomyces cerevisiae lipoate protein ligase homologue, Lip3, in lipoic acid synthesis.

    Science.gov (United States)

    Hermes, Fatemah A; Cronan, John E

    2013-10-01

    The covalent attachment of lipoate to the lipoyl domains (LDs) of the central metabolism enzymes pyruvate dehydrogenase (PDH) and oxoglutarate dehydrogenase (OGDH) is essential for their activation and thus for respiratory growth in Saccharomyces cerevisiae. A third lipoate-dependent enzyme system, the glycine cleavage system (GCV), is required for utilization of glycine as a nitrogen source. Lipoate is synthesized by extraction of its precursor, octanoyl-acyl carrier protein (ACP), from the pool of fatty acid biosynthetic intermediates. Alternatively, lipoate is salvaged from previously modified proteins or from growth medium by lipoate protein ligases (Lpls). The first Lpl to be characterized, LplA of Escherichia coli, catalyses two partial reactions: activation of the acyl chain by formation of acyl-AMP, followed by transfer of the acyl chain to lipoyl domains (LDs). There is a surprising diversity within the Lpl family of enzymes, several of which catalyse reactions other than ligation reactions. For example, the Bacillus subtilis Lpl homologue LipM is an octanoyltransferase that transfers the octanoyl moiety from octanoyl-ACP to GCV. Another B. subtilis Lpl homologue, LipL, transfers octanoate from octanoyl-GCV to other LDs in an amido-transfer reaction. Study of eukaryotic Lpls has lagged behind studies of the bacterial enzymes. We report that the Lip3 Lpl homologue of the yeast S. cerevisiae has octanoyl-CoA-protein transferase activity, and discuss implications of this activity on the physiological role of Lip3 in lipoate synthesis. Published 2013. This article is a U.S. Government work and is in the public domain in the USA.

  18. Enhancer of zeste homologue 2 plays an important role in neuroblastoma cell survival independent of its histone methyltransferase activity.

    Science.gov (United States)

    Bate-Eya, Laurel T; Gierman, Hinco J; Ebus, Marli E; Koster, Jan; Caron, Huib N; Versteeg, Rogier; Dolman, M Emmy M; Molenaar, Jan J

    2017-04-01

    Neuroblastoma is predominantly characterised by chromosomal rearrangements. Next to V-Myc Avian Myelocytomatosis Viral Oncogene Neuroblastoma Derived Homolog (MYCN) amplification, chromosome 7 and 17q gains are frequently observed. We identified a neuroblastoma patient with a regional 7q36 gain, encompassing the enhancer of zeste homologue 2 (EZH2) gene. EZH2 is the histone methyltransferase of lysine 27 of histone H3 (H3K27me3) that forms the catalytic subunit of the polycomb repressive complex 2. H3K27me3 is commonly associated with the silencing of genes involved in cellular processes such as cell cycle regulation, cellular differentiation and cancer. High EZH2 expression correlated with poor prognosis and overall survival independent of MYCN amplification status. Unexpectedly, treatment of 3 EZH2-high expressing neuroblastoma cell lines (IMR32, CHP134 and NMB), with EZH2-specific inhibitors (GSK126 and EPZ6438) resulted in only a slight G1 arrest, despite maximum histone methyltransferase activity inhibition. Furthermore, colony formation in cell lines treated with the inhibitors was reduced only at concentrations much higher than necessary for complete inhibition of EZH2 histone methyltransferase activity. Knockdown of the complete protein with three independent shRNAs resulted in a strong apoptotic response and decreased cyclin D1 levels. This apoptotic response could be rescued by overexpressing EZH2ΔSET, a truncated form of wild-type EZH2 lacking the SET transactivation domain necessary for histone methyltransferase activity. Our findings suggest that high EZH2 expression, at least in neuroblastoma, has a survival function independent of its methyltransferase activity. This important finding highlights the need for studies on EZH2 beyond its methyltransferase function and the requirement for compounds that will target EZH2 as a complete protein. Copyright © 2017 Elsevier Ltd. All rights reserved.

  19. Clinical significance of LUNX mRNA, CK19 mRNA, CEA mRNA expression in detecting micrometastasis from lung cancer

    International Nuclear Information System (INIS)

    Zhu Guangying; Liu Delin; Chen Jie

    2003-01-01

    Objective: To evaluate the sensitivity, specificity and clinical significance of CK19 mRNA, CEA mRNA and LUNX mRNA for detecting micrometastasis by sampling the peripheral blood and regional lymph nodes of lung cancer patients. Methods: Reverse transcriptase chain reaction (RT-PCR) was used to detect LUNX mRNA, CK19 mRNA, CEA mRNA for micrometastasis by sampling the peripheral blood of 48 lung cancer patients and 44 regional lymph nodes of such patients treated by curative resection. Peripheral blood of 30 patients with pulmonary benign lesions and 10 normal healthy volunteers and lymph nodes of 6 patients with benign pulmonary diseases served as control. Results: 1) LUNX mRNA, CK19 mRNA, CEA mRNA were expressed in all (35/35) lung cancer tissues. 2) In the peripheral blood from 48 lung cancer patients, 30 (62.5%) were positive for LUNX mRNA, 24 (50.0%) positive for CK19 mRNA and 32(66.7%) positive for CEA mRNA. The positive detection rates of micrometastasis in 44 lymph nodes from lung cancer patients were 36.4% (16 out of 44) for LUNX mRNA, 27.3% (12 out of 44) for CK19 mRNA and 40.9% (18 out of 44) for CEA mRNA. 3) In the 30 blood samples from patients with pulmonary benign diseases, 2 (6.7%) expressed CK19 mRNA, but none expressed LUNX mRNA or CEA mRNA. All the 3 molecular markers were negative in the 10 blood samples from healthy volunteers. In 11 lymph nodes from patients with pulmonary benign lesions, none was positive for any of the three markers. 4) In 44 regional lymph nodes from lung cancer patients, 6 (13.6%) were positive for metastasis by histopathological examination, with a positive rate significantly lower than that of the RT-PCR (P<0.05). 5) The micrometastatic positive rate in the peripheral blood of 40 non-small cell lung cancer (NSCLC) patients was significantly related to TNM stage (P=0.01). Conclusions: LUNX mRNA, CK19 MRNA, CEA mRNA are all appropriate target genes for the detection of micrometastasis from lung cancer. LUNX mRNA and CEA mRNA

  20. mRNA transfection of mouse and human neural stem cell cultures.

    Directory of Open Access Journals (Sweden)

    Samuel McLenachan

    Full Text Available The use of synthetic mRNA as an alternative gene delivery vector to traditional DNA-based constructs provides an effective method for inducing transient gene expression in cell cultures without genetic modification. Delivery of mRNA has been proposed as a safer alternative to viral vectors in the induction of pluripotent cells for regenerative therapies. Although mRNA transfection of fibroblasts, dendritic and embryonic stem cells has been described, mRNA delivery to neurosphere cultures has not been previously reported. Here we sought to establish an efficient method for delivering mRNA to primary neurosphere cultures. Neurospheres derived from the subventricular zone of adult mice or from human embryonic stem cells were transfected with EGFP mRNA by lipofection and electroporation. Transfection efficiency and expression levels were monitored by flow cytometry. Cell survival following transfection was examined using live cell counting and the MTT assay. Both lipofection and electroporation provided high efficiency transfection of neurospheres. In comparison with lipofection, electroporation resulted in increased transfection efficiencies, but lower expression per cell and shorter durations of expression. Additional rounds of lipofection renewed EGFP expression in neurospheres, suggesting this method may be suitable for reprogramming applications. In summary, we have developed a protocol for achieving high efficiency transfection rates in mouse and human neurosphere cell culture that can be applied for future studies of gene function studies in neural stem cells, such as defining efficient differentiation protocols for glial and neuronal linages.

  1. mRNA Transfection of Mouse and Human Neural Stem Cell Cultures

    Science.gov (United States)

    McLenachan, Samuel; Zhang, Dan; Palomo, Ana Belén Alvarez; Edel, Michael J.; Chen, Fred K.

    2013-01-01

    The use of synthetic mRNA as an alternative gene delivery vector to traditional DNA-based constructs provides an effective method for inducing transient gene expression in cell cultures without genetic modification. Delivery of mRNA has been proposed as a safer alternative to viral vectors in the induction of pluripotent cells for regenerative therapies. Although mRNA transfection of fibroblasts, dendritic and embryonic stem cells has been described, mRNA delivery to neurosphere cultures has not been previously reported. Here we sought to establish an efficient method for delivering mRNA to primary neurosphere cultures. Neurospheres derived from the subventricular zone of adult mice or from human embryonic stem cells were transfected with EGFP mRNA by lipofection and electroporation. Transfection efficiency and expression levels were monitored by flow cytometry. Cell survival following transfection was examined using live cell counting and the MTT assay. Both lipofection and electroporation provided high efficiency transfection of neurospheres. In comparison with lipofection, electroporation resulted in increased transfection efficiencies, but lower expression per cell and shorter durations of expression. Additional rounds of lipofection renewed EGFP expression in neurospheres, suggesting this method may be suitable for reprogramming applications. In summary, we have developed a protocol for achieving high efficiency transfection rates in mouse and human neurosphere cell culture that can be applied for future studies of gene function studies in neural stem cells, such as defining efficient differentiation protocols for glial and neuronal linages. PMID:24386231

  2. mRNA transfection of mouse and human neural stem cell cultures.

    Science.gov (United States)

    McLenachan, Samuel; Zhang, Dan; Palomo, Ana Belén Alvarez; Edel, Michael J; Chen, Fred K

    2013-01-01

    The use of synthetic mRNA as an alternative gene delivery vector to traditional DNA-based constructs provides an effective method for inducing transient gene expression in cell cultures without genetic modification. Delivery of mRNA has been proposed as a safer alternative to viral vectors in the induction of pluripotent cells for regenerative therapies. Although mRNA transfection of fibroblasts, dendritic and embryonic stem cells has been described, mRNA delivery to neurosphere cultures has not been previously reported. Here we sought to establish an efficient method for delivering mRNA to primary neurosphere cultures. Neurospheres derived from the subventricular zone of adult mice or from human embryonic stem cells were transfected with EGFP mRNA by lipofection and electroporation. Transfection efficiency and expression levels were monitored by flow cytometry. Cell survival following transfection was examined using live cell counting and the MTT assay. Both lipofection and electroporation provided high efficiency transfection of neurospheres. In comparison with lipofection, electroporation resulted in increased transfection efficiencies, but lower expression per cell and shorter durations of expression. Additional rounds of lipofection renewed EGFP expression in neurospheres, suggesting this method may be suitable for reprogramming applications. In summary, we have developed a protocol for achieving high efficiency transfection rates in mouse and human neurosphere cell culture that can be applied for future studies of gene function studies in neural stem cells, such as defining efficient differentiation protocols for glial and neuronal linages.

  3. Myeloperoxidase mRNA detection for lineage determination of leukemic blasts: retrospective analysis.

    Science.gov (United States)

    Crisan, D; Anstett, M J

    1995-07-01

    Myeloperoxidase (MPO) mRNA is an early myeloid marker; its detection in the morphologically and immunophenotypically primitive blasts of acute undifferentiated leukemia (AUL) establishes myeloid lineage and allows reclassification as acute myelogenous leukemia with minimal differentiation (AML-MO). We have previously reported a procedure for MPO mRNA detection by RT-PCR (reverse transcription-polymerase chain reaction) and an adaptation for use of routine hematology smears. This variant procedure allows retrospective analysis of mRNA and is used in the present study to evaluate the lineage of leukemic blasts in seven cases with morphology and cytochemistry consistent with AUL. All hematology smears used in this study were air-dried, unstained or Wright-stained and stored at room temperature for periods varying between 3 days and 2 years. MPO mRNA was detected in six cases, establishing the myeloid lineage of the blasts and the diagnosis of AML-MO. In the remaining case, the blasts were MPO mRNA negative, confirming the diagnosis of AUL. The RT-PCR procedure for retrospective mRNA analysis is useful in the clinical setting, due to its high specificity and sensitivity, speed (less than 24 h), safety (no radioactivity) and convenient use of routine hematology smears; it is particularly attractive in clinical situations when fresh or frozen specimens are no longer available at the time when the need for molecular diagnostics becomes apparent.

  4. Arc mRNA induction in striatal efferent neurons associated with response learning.

    Science.gov (United States)

    Daberkow, D P; Riedy, M D; Kesner, R P; Keefe, K A

    2007-07-01

    The dorsal striatum is involved in motor-response learning, but the extent to which distinct populations of striatal efferent neurons are differentially involved in such learning is unknown. Activity-regulated, cytoskeleton-associated (Arc) protein is an effector immediate-early gene implicated in synaptic plasticity. We examined arc mRNA expression in striatopallidal vs. striatonigral efferent neurons in dorsomedial and dorsolateral striatum of rats engaged in reversal learning on a T-maze motor-response task. Male Sprague-Dawley rats learned to turn right or left for 3 days. Half of the rats then underwent reversal training. The remaining rats were yoked to rats undergoing reversal training, such that they ran the same number of trials but ran them as continued-acquisition trials. Brains were removed and processed using double-label fluorescent in situ hybridization for arc and preproenkephalin (PPE) mRNA. In the reversal, but not the continued-acquisition, group there was a significant relation between the overall arc mRNA signal in dorsomedial striatum and the number of trials run, with rats reaching criterion in fewer trials having higher levels of arc mRNA expression. A similar relation was seen between the numbers of PPE(+) and PPE(-) neurons in dorsomedial striatum with cytoplasmic arc mRNA expression. Interestingly, in behaviourally activated animals significantly more PPE(-) neurons had cytoplasmic arc mRNA expression. These data suggest that Arc in both striatonigral and striatopallidal efferent neurons is involved in striatal synaptic plasticity mediating motor-response learning in the T-maze and that there is differential processing of arc mRNA in distinct subpopulations of striatal efferent neurons.

  5. Crystal structure of a bacterial homologue of glucose transporters GLUT1-4.

    Science.gov (United States)

    Sun, Linfeng; Zeng, Xin; Yan, Chuangye; Sun, Xiuyun; Gong, Xinqi; Rao, Yu; Yan, Nieng

    2012-10-18

    Glucose transporters are essential for metabolism of glucose in cells of diverse organisms from microbes to humans, exemplified by the disease-related human proteins GLUT1, 2, 3 and 4. Despite rigorous efforts, the structural information for GLUT1-4 or their homologues remains largely unknown. Here we report three related crystal structures of XylE, an Escherichia coli homologue of GLUT1-4, in complex with d-xylose, d-glucose and 6-bromo-6-deoxy-D-glucose, at resolutions of 2.8, 2.9 and 2.6 Å, respectively. The structure consists of a typical major facilitator superfamily fold of 12 transmembrane segments and a unique intracellular four-helix domain. XylE was captured in an outward-facing, partly occluded conformation. Most of the important amino acids responsible for recognition of D-xylose or d-glucose are invariant in GLUT1-4, suggesting functional and mechanistic conservations. Structure-based modelling of GLUT1-4 allows mapping and interpretation of disease-related mutations. The structural and biochemical information reported here constitutes an important framework for mechanistic understanding of glucose transporters and sugar porters in general.

  6. Self-assembly of diphenylalanine backbone homologues and their combination with functionalized carbon nanotubes.

    Science.gov (United States)

    Dinesh, Bhimareddy; Squillaci, Marco A; Ménard-Moyon, Cécilia; Samorì, Paolo; Bianco, Alberto

    2015-10-14

    The integration of carbon nanotubes (CNTs) into organized nanostructures is of great interest for applications in materials science and biomedicine. In this work we studied the self-assembly of β and γ homologues of diphenylalanine peptides under different solvent and pH conditions. We aimed to investigate the role of peptide backbone in tuning the formation of different types of nanostructures alone or in combination with carbon nanotubes. In spite of having the same side chain, β and γ peptides formed distinctively different nanofibers, a clear indication of the role played by the backbone homologation on the self-assembly. The variation of the pH allowed to transform the nanofibers into spherical structures. Moreover, the co-assembly of β and γ peptides with carbon nanotubes covalently functionalized with the same peptide generated unique dendritic assemblies. This comparative study on self-assembly using diphenylalanine backbone homologues and of the co-assembly with CNT covalent conjugates is the first example exploring the capacity of β and γ peptides to adopt precise nanostructures, particularly in combination with carbon nanotubes. The dendritic organization obtained by mixing carbon nanotubes and peptides might find interesting applications in tissue engineering and neuronal interfacing.

  7. Inhibition of hydroxyapatite growth by casein, a potential salivary phosphoprotein homologue.

    Science.gov (United States)

    Romero, Maria J R H; Nakashima, Syozi; Nikaido, Toru; Ichinose, Shizuko; Sadr, Alireza; Tagami, Junji

    2015-08-01

    Salivary phosphoproteins are essential in tooth mineral regulation but are often overlooked in vitro. This study aimed to evaluate the effect of casein, as a salivary phosphoprotein homologue, on the deposition and growth of hydroxyapatite (HA) on tooth surfaces. Hydroxyapatite growth was quantified using seeded crystal systems. Artificial saliva (AS) containing HA powder and 0, 10, 20, 50, or 100 μg ml(-1) of casein, or 100 μg ml(-1) of dephosphorylated casein (Dcasein), was incubated for 0-8 h at 37°C, pH 7.2. Calcium concentrations were measured using atomic absorption spectroscopy (AAS). Surface precipitation of HA on bovine enamel and dentine blocks, incubated in similar conditions for 7 d, was examined using field emission scanning electron microscopy (FE-SEM) and transmission electron microscopy (TEM) with selected area electron diffraction (SAED). Casein adsorption was assessed using modified Lowry assays and zeta-potential measurements. The AAS results revealed a concentration-dependent inhibition of calcium consumption. Hydroxyapatite precipitation occurred when no casein was present, whereas precipitation of HA was apparently completely inhibited in casein-containing groups. Adsorption data demonstrated increasingly negative zeta-potential with increased casein concentration and an affinity constant similar to proline-rich proteins with Langmuir modelling. Casein inhibited the deposition and growth of HA primarily through the binding of esterized phosphate to HA active sites, indicating its potential as a mineral-regulating salivary phosphoprotein homologue in vitro. © 2015 Eur J Oral Sci.

  8. The use of polynuclear aromatic hydrocarbon (PAH) alkyl homologues in determining petroleum source identification and weathering

    International Nuclear Information System (INIS)

    Brown, J.S.; Boehm, P.D.; Sauer, T.C.; Wong, W.M.C.

    1993-01-01

    Techniques utilizing double ratio plots of selected polynuclear aromatic hydrocarbon (PAH) alkyl homologues were used to identify and distinguish crude oils and refined petroleum products from each other and to distinguish petroleum sources in complex pollutant regimes. Petroleum samples were fractionated by high performance liquid chromatography (HPLC) into saturated and aromatic (PAH) hydrocarbon fractions. The saturated hydrocarbon fractions were then analyzed by gas chromatography/flame ionization detection (GC/FID) to obtain a resolved/unresolved alkane fingerprint of each oil. The aromatic fractions of the oils were analyzed by gas chromatography/mass spectrometry (GC/MS) for PAH and selected alkyl homologues. Comparisons of the saturated hydrocarbon fingerprints indicated that some oils were indistinguishable based on the alkane fingerprint alone. Another double ratio plot of the alkyl chrysenes and alkyl dibenzothiophenes was effective in establishing the weathering of oil in environmental samples which were processed using the same analytical techniques, since the dibenzothiophenes are degraded more rapidly than the chrysenes. The application of selected ratios in oil spill source identification in complex environmental samples from Suisin Bay California and Boston Harbor are discussed. The use of ratios to measure the extent of weathering in oil spill samples from Prince William Sound and the Gulf of Alaska is examined

  9. Biodegradation of diesel fuel by a microbial consortium in the presence of 1-alkoxymethyl-2-methyl-5-hydroxypyridinium chloride homologues

    DEFF Research Database (Denmark)

    Chrzanowski, L; Stasiewicz, M; Owsianiak, Mikolaj

    2009-01-01

    hypothesize that in the presence of diesel fuel low-water-soluble ionic liquids may become more toxic to hydrocarbon-degrading microorganisms. In this study the influence of 1-alkoxymethyl-2-methyl-5-hydroxypyridinium chloride homologues (side-chain length from C-3 to C-18) on biodegradation of diesel fuel...... by a bacterial consortium was investigated. Whereas test performed for the consortium cultivated on disodium succinate showed that toxicity of the investigated ionic liquids decreased with increase in side-chain length, only higher homologues (C-8-C-18) caused a decrease in diesel fuel biodegradation......, respectively. We conclude that in the presence of hydrocarbons acting as a solvent, the increased bioavailability of hydrophobic homologues is responsible for the decrease in biodegradation efficiency of diesel fuel....

  10. TOR1 and TOR2 are structurally and functionally similar but not identical phosphatidylinositol kinase homologues in yeast

    OpenAIRE

    Helliwell, S. B.; Wagner, P.; Kunz, J.; Deuter-Reinhard, M.; Henriquez, R.; Hall, M. N.

    1994-01-01

    The Saccharomyces cerevisiae genes TOR1 and TOR2 were originally identified by mutations that confer resistance to the immunosuppressant rapamycin. TOR2 was previously shown to encode an essential 282-kDa phosphatidylinositol kinase (PI kinase) homologue. The TOR1 gene product is also a large (281 kDa) PI kinase homologue, with 67% identity to TOR2. TOR1 is not essential, but a TOR1 TOR2 double disruption uniquely confers a cell cycle (G1) arrest as does exposure to rapamycin; disruption of T...

  11. The ApaH-like phosphatase TbALPH1 is the major mRNA decapping enzyme of trypanosomes.

    Directory of Open Access Journals (Sweden)

    Susanne Kramer

    2017-06-01

    Full Text Available 5'-3' decay is the major mRNA decay pathway in many eukaryotes, including trypanosomes. After deadenylation, mRNAs are decapped by the nudix hydrolase DCP2 of the decapping complex and finally degraded by the 5'-3' exoribonuclease. Uniquely, trypanosomes lack homologues to all subunits of the decapping complex, while deadenylation and 5'-3' degradation are conserved. Here, I show that the parasites use an ApaH-like phosphatase (ALPH1 as their major mRNA decapping enzyme. The protein was recently identified as a novel trypanosome stress granule protein and as involved in mRNA binding. A fraction of ALPH1 co-localises exclusively with the trypanosome 5'-3' exoribonuclease XRNA to a special granule at the posterior pole of the cell, indicating a connection between the two enzymes. RNAi depletion of ALPH1 is lethal and causes a massive increase in total mRNAs that are deadenylated, but have not yet started 5'-3' decay. These data suggest that ALPH1 acts downstream of deadenylation and upstream of mRNA degradation, consistent with a function in mRNA decapping. In vitro experiments show that recombinant, N-terminally truncated ALHP1 protein, but not a catalytically inactive mutant, sensitises the capped trypanosome spliced leader RNA to yeast Xrn1, but only if an RNA 5' polyphosphatase is included. This indicates that the decapping mechanism of ALPH1 differs from the decapping mechanism of Dcp2 by leaving more than one phosphate group at the mRNA's 5' end. This is the first reported function of a eukaryotic ApaH-like phosphatase, a bacterial-derived class of enzymes present in all phylogenetic super-groups of the eukaryotic kingdom. The substrates of eukaryotic ApaH-like phosphatases are unknown. However, the substrate of the related bacterial enzyme ApaH, diadenosine tetraphosphate, is highly reminiscent of a eukaryotic mRNA cap.

  12. Transcriptome Sequencing, De Novo Assembly and Differential Gene Expression Analysis of the Early Development of Acipenser baeri.

    Directory of Open Access Journals (Sweden)

    Wei Song

    Full Text Available The molecular mechanisms that drive the development of the endangered fossil fish species Acipenser baeri are difficult to study due to the lack of genomic data. Recent advances in sequencing technologies and the reducing cost of sequencing offer exclusive opportunities for exploring important molecular mechanisms underlying specific biological processes. This manuscript describes the large scale sequencing and analyses of mRNA from Acipenser baeri collected at five development time points using the Illumina Hiseq2000 platform. The sequencing reads were de novo assembled and clustered into 278167 unigenes, of which 57346 (20.62% had 45837 known homologues proteins in Uniprot protein databases while 11509 proteins matched with at least one sequence of assembled unigenes. The remaining 79.38% of unigenes could stand for non-coding unigenes or unigenes specific to A. baeri. A number of 43062 unigenes were annotated into functional categories via Gene Ontology (GO annotation whereas 29526 unigenes were associated with 329 pathways by mapping to KEGG database. Subsequently, 3479 differentially expressed genes were scanned within developmental stages and clustered into 50 gene expression profiles. Genes preferentially expressed at each stage were also identified. Through GO and KEGG pathway enrichment analysis, relevant physiological variations during the early development of A. baeri could be better cognized. Accordingly, the present study gives insights into the transcriptome profile of the early development of A. baeri, and the information contained in this large scale transcriptome will provide substantial references for A. baeri developmental biology and promote its aquaculture research.

  13. Homologue Structure of the SLAC1 Anion Channel for Closing Stomata in Leaves

    Energy Technology Data Exchange (ETDEWEB)

    Y Chen; L Hu; M Punta; R Bruni; B Hillerich; B Kloss; B Rost; J Love; S Siegelbaum; W Hendrickson

    2011-12-31

    The plant SLAC1 anion channel controls turgor pressure in the aperture-defining guard cells of plant stomata, thereby regulating the exchange of water vapour and photosynthetic gases in response to environmental signals such as drought or high levels of carbon dioxide. Here we determine the crystal structure of a bacterial homologue (Haemophilus influenzae) of SLAC1 at 1.20 {angstrom} resolution, and use structure-inspired mutagenesis to analyse the conductance properties of SLAC1 channels. SLAC1 is a symmetrical trimer composed from quasi-symmetrical subunits, each having ten transmembrane helices arranged from helical hairpin pairs to form a central five-helix transmembrane pore that is gated by an extremely conserved phenylalanine residue. Conformational features indicate a mechanism for control of gating by kinase activation, and electrostatic features of the pore coupled with electrophysiological characteristics indicate that selectivity among different anions is largely a function of the energetic cost of ion dehydration.

  14. The actin homologue MreB organizes the bacterial cell membrane.

    Science.gov (United States)

    Strahl, Henrik; Bürmann, Frank; Hamoen, Leendert W

    2014-03-07

    The eukaryotic cortical actin cytoskeleton creates specific lipid domains, including lipid rafts, which determine the distribution of many membrane proteins. Here we show that the bacterial actin homologue MreB displays a comparable activity. MreB forms membrane-associated filaments that coordinate bacterial cell wall synthesis. We noticed that the MreB cytoskeleton influences fluorescent staining of the cytoplasmic membrane. Detailed analyses combining an array of mutants, using specific lipid staining techniques and spectroscopic methods, revealed that MreB filaments create specific membrane regions with increased fluidity (RIFs). Interference with these fluid lipid domains (RIFs) perturbs overall lipid homeostasis and affects membrane protein localization. The influence of MreB on membrane organization and fluidity may explain why the active movement of MreB stimulates membrane protein diffusion. These novel MreB activities add additional complexity to bacterial cell membrane organization and have implications for many membrane-associated processes.

  15. The urokinase receptor and its structural homologue C4.4A in human cancer

    DEFF Research Database (Denmark)

    Jacobsen, B; Ploug, M

    2008-01-01

    The urokinase-type plasminogen activator receptor (uPAR) and its structural homologue C4.4A are multidomain members of the Ly6/uPAR/alpha-neurotoxin protein domain family. Both are glycosylphosphatidylinositol-anchored membrane glycoproteins encoded by neighbouring genes located on chromosome 19q13...... that high protein expression in tumour cells of non-small cell pulmonary adenocarcinomas is associated with a particularly severe disease progression. This review will evaluate structural-functional and disease-related aspects of uPAR and C4.4A with a view to possible pharmacological targeting strategies...... in the human genome. The structural relationship between the two proteins is, however, not reflected at the functional level. Whereas uPAR has a well-established role in regulating and focalizing uPA-mediated plasminogen activation to the surface of those cells expressing the receptor, the biological function...

  16. Conservation of Oxidative Protein Stabilization in an Insect Homologue of Parkinsonism-Associated Protein DJ-1

    Energy Technology Data Exchange (ETDEWEB)

    Lin, Jiusheng; Prahlad, Janani; Wilson, Mark A. (UNL)

    2012-08-21

    DJ-1 is a conserved, disease-associated protein that protects against oxidative stress and mitochondrial damage in multiple organisms. Human DJ-1 contains a functionally essential cysteine residue (Cys106) whose oxidation is important for regulating protein function by an unknown mechanism. This residue is well-conserved in other DJ-1 homologues, including two (DJ-1{alpha} and DJ-1{beta}) in Drosophila melanogaster. Because D. melanogaster is a powerful model system for studying DJ-1 function, we have determined the crystal structure and impact of cysteine oxidation on Drosophila DJ-1{beta}. The structure of D. melanogaster DJ-1{beta} is similar to that of human DJ-1, although two important residues in the human protein, Met26 and His126, are not conserved in DJ-1{beta}. His126 in human DJ-1 is substituted with a tyrosine in DJ-1{beta}, and this residue is not able to compose a putative catalytic dyad with Cys106 that was proposed to be important in the human protein. The reactive cysteine in DJ-1 is oxidized readily to the cysteine-sulfinic acid in both flies and humans, and this may regulate the cytoprotective function of the protein. We show that the oxidation of this conserved cysteine residue to its sulfinate form (Cys-SO{sub 2{sup -}}) results in considerable thermal stabilization of both Drosophila DJ-1{beta} and human DJ-1. Therefore, protein stabilization is one potential mechanism by which cysteine oxidation may regulate DJ-1 function in vivo. More generally, most close DJ-1 homologues are likely stabilized by cysteine-sulfinic acid formation but destabilized by further oxidation, suggesting that they are biphasically regulated by oxidative modification.

  17. 4-Oxalocrotonate tautomerase, its homologue YwhB, and active vinylpyruvate hydratase : Synthesis and evaluation of 2-fluoro substrate analogues

    NARCIS (Netherlands)

    Johnson, William H; Wang, Susan C; Stanley, Thanuja M; Czerwinski, Robert M; Almrud, Jeffrey J; Poelarends, Gerrit J; Murzin, Alexey G; Whitman, Christian P

    2004-01-01

    A series of 2-fluoro-4-alkene and 2-fluoro-4-alkyne substrate analogues were synthesized and examined as potential inhibitors of three enzymes: 4-oxalocrotonate tautomerase (4-OT) and vinylpyruvate hydratase (VPH) from the catechol meta-fission pathway and a closely related 4-OT homologue found in

  18. Towards structural studies of the old yellow enzyme homologue SYE4 from Shewanella oneidensis and its complexes at atomic resolution

    International Nuclear Information System (INIS)

    Elegheert, Jonathan; Hemel, Debbie van den; Dix, Ina; Stout, Jan; Van Beeumen, Jozef; Brigé, Ann; Savvides, Savvas N.

    2009-01-01

    Of the four old yellow enzyme homologues found in S. oneidensis, SYE4 is the homologue most implicated in resistance to oxidative stress. SYE4 was recombinantly expressed in Escherichia coli, purified and crystallized using the hanging-drop vapour-diffusion method. Shewanella oneidensis is an environmentally versatile Gram-negative γ-proteobacterium that is endowed with an unusually large proteome of redox proteins. Of the four old yellow enzyme (OYE) homologues found in S. oneidensis, SYE4 is the homologue most implicated in resistance to oxidative stress. SYE4 was recombinantly expressed in Escherichia coli, purified and crystallized using the hanging-drop vapour-diffusion method. The crystals belonged to the orthorhombic space group P2 1 2 1 2 1 and were moderately pseudo-merohedrally twinned, emulating a P422 metric symmetry. The native crystals of SYE4 were of exceptional diffraction quality and provided complete data to 1.10 Å resolution using synchrotron radiation, while crystals of the reduced enzyme and of the enzyme in complex with a wide range of ligands typically led to high-quality complete data sets to 1.30–1.60 Å resolution, thus providing a rare opportunity to dissect the structure–function relationships of a good-sized enzyme (40 kDa) at true atomic resolution. Here, the attainment of a number of experimental milestones in the crystallographic studies of SYE4 and its complexes are reported, including isolation of the elusive hydride–Meisenheimer complex

  19. Generation of human induced pluripotent stem cells using non-synthetic mRNA.

    Science.gov (United States)

    Rohani, L; Fabian, C; Holland, H; Naaldijk, Y; Dressel, R; Löffler-Wirth, H; Binder, H; Arnold, A; Stolzing, A

    2016-05-01

    Here we describe some of the crucial steps to generate induced pluripotent stem cells (iPSCs) using mRNA transfection. Our approach uses a V. virus-derived capping enzyme instead of a cap-analog, ensuring 100% proper cap orientation for in vitro transcribed mRNA. V. virus' 2'-O-Methyltransferase enzyme creates a cap1 structure found in higher eukaryotes and has higher translation efficiency compared to other methods. Use of the polymeric transfection reagent polyethylenimine proved superior to other transfection methods. The mRNA created via this method did not trigger an intracellular immune response via human IFN-gamma (hIFN-γ) or alpha (hIFN-α) release, thus circumventing the use of suppressors. Resulting mRNA and protein were expressed at high levels for over 48h, thus obviating daily transfections. Using this method, we demonstrated swift activation of pluripotency associated genes in human fibroblasts. Low oxygen conditions further facilitated colony formation. Differentiation into different germ layers was confirmed via teratoma assay. Reprogramming with non-synthetic mRNA holds great promise for safe generation of iPSCs of human origin. Using the protocols described herein we hope to make this method more accessible to other groups as a fast, inexpensive, and non-viral reprogramming approach. Copyright © 2016 The Authors. Published by Elsevier B.V. All rights reserved.

  20. An exploration of Glb1 Homologue AntibodyLevels in Children at Increased Risk for Type 1 Diabetes mellitus

    Science.gov (United States)

    Simpson, M.; Mojibian, M.; Barriga, K.; Scott, F.W.; Fasano, A.; Rewers, M.; Norris, J.M.

    2010-01-01

    Aims To determine whether Glb1 homologue antibodies are associated with islet autoimmunity (IA) in children at increased risk for type 1 diabetes (T1D), and to investigate their relation with putative environmental correlates of T1D. Methods We selected a sample from the Diabetes Autoimmunity Study in the Young (DAISY), a prospective study of children at increased risk for T1D. Cases were those who were positive for insulin, glutamic acid decarboxylase (GAD), or insulinoma-associated antigen-2 (IA-2) autoantibodies on two consecutive visits and either diagnosed with diabetes mellitus or still autoantibody positive when selected. Controls were from the same increased risk group, of similar age as the cases but negative for autoantibodies. Sera from 91 IA cases and 82 controls were analyzed in a blinded manner for immunoglobulin G (IgG) antibodies to Glb1 homologue by ELISA. Results Adjusting for family history of T1D and HLA-DR4 positivity, Glb1 homologue antibodies were not associated with IA case status (OR: 1.01, 95% CI: 0.99 – 1.03). Adjusting for age, family history of T1D, and HLA-DR4 positivity, Glb1 homologue antibody levels were inversely associated with breast-feeding duration (beta = −0.08, p = 0.001) and directly associated with current intake of foods containing gluten (beta = 0.24, p = 0.007) in IA cases but not in controls. Zonulin, a biomarker of gut permeability, was directly associated with Glb1 homologue antibody levels in cases (beta = 0.73, p = 0.003) but not in controls. Conclusion Differences in correlates of Glb1 antibodies in IA cases and controls suggest an underlying difference in mucosal immune response. PMID:19622083

  1. Enhancer of the rudimentary gene homologue (ERH expression pattern in sporadic human breast cancer and normal breast tissue

    Directory of Open Access Journals (Sweden)

    Knüchel Ruth

    2008-05-01

    Full Text Available Abstract Background The human gene ERH (Enhancer of the Rudimentary gene Homologue has previously been identified by in silico analysis of four million ESTs as a gene differentially expressed in breast cancer. The biological function of ERH protein has not been fully elucidated, however functions in cell cycle progression, pyrimidine metabolism a possible interaction with p21(Cip1/Waf1 via the Ciz1 zinc finger protein have been suggested. The aim of the present study was a systematic characterization of ERH expression in human breast cancer in order to evaluate possible clinical applications of this molecule. Methods The expression pattern of ERH was analyzed using multiple tissue northern blots (MTN on a panel of 16 normal human tissues and two sets of malignant/normal breast and ovarian tissue samples. ERH expression was further analyzed in breast cancer and normal breast tissues and in tumorigenic as well as non-tumorigenic breast cancer cell lines, using quantitative RT-PCR and non-radioisotopic in situ hybridization (ISH. Results Among normal human tissues, ERH expression was most abundant in testis, heart, ovary, prostate, and liver. In the two MTN sets of malignant/normal breast and ovarian tissue,ERH was clearly more abundantly expressed in all tumours than in normal tissue samples. Quantitative RT-PCR analyses showed that ERH expression was significantly more abundant in tumorigenic than in non-tumorigenic breast cancer cell lines (4.5-fold; p = 0.05, two-tailed Mann-Whitney U-test; the same trend was noted in a set of 25 primary invasive breast cancers and 16 normal breast tissue samples (2.5-fold; p = 0.1. These findings were further confirmed by non-radioisotopic ISH in human breast cancer and normal breast tissue. Conclusion ERH expression is clearly up-regulated in malignant as compared with benign breast cells both in primary human breast cancer and in cell models of breast cancer. Since similar results were obtained for ovarian

  2. mRNA processing in yeast

    International Nuclear Information System (INIS)

    Stevens, A.

    1982-01-01

    Investigations in this laboratory center on basic enzymatic reactions of RNA. Still undefined are reactions involved in the conversion of precursors of mRA (pre-mRNA) to mRNA in eukaryotes. The pre-mRNA is called heterogeneous nuclear RNA and is 2 to 6 times larger than mRNA. The conversion, called splicing, involves a removal of internal sequences called introns by endoribonuclease action followed by a rejoining of the 3'- and 5'-end fragments, called exons, by ligating activity. It has not been possible yet to study the enzymes involved in vitro. Also undefined are reactions involved in the turnover or discarding of certain of the pre-mRNA molecules. Yeast is a simple eukaryote and may be expected to have the same, but perhaps simpler, processing reactions as the higher eukaryotes. Two enzymes involved in the processing of pre-mRNA and mRNA in yeast are under investigation. Both enzymes have been partially purified from ribonucleoprotein particles of yeast. The first is a unique decapping enzyme which cleaves [ 3 H]m 7 Gppp [ 14 C]RNA-poly (A) of yeast, yielding [ 3 H]m 7 GDP and is suggested by the finding that the diphosphate product, m 7 GpppA(G), and UDP-glucose are not hydrolyzed. The second enzyme is an endoribonuclease which converts both the [ 3 H] and [ 14 C] labels of [ 3 H]m 7 Gppp[ 14 C]RNA-poly(A) from an oligo(dT)-cellulose bound form to an unbound, acid-insoluble form. Results show that the stimulation involves an interaction of the labeled RNA with the small nuclear RNA. The inhibition of the enzyme by ethidium bromide and its stimulation by small nuclear RNA suggest that it may be a processing ribonuclease, requiring specific double-stranded features in its substrate. The characterization of the unique decapping enzyme and endoribonuclease may help to understand reactions involved in the processing of pre-mRNA and mRNA in eukaryotes

  3. Keratinocyte growth factor mRNA expression in periodontal ligament fibroblasts

    DEFF Research Database (Denmark)

    Dabelsteen, S; Wandall, H H; Grøn, B

    1997-01-01

    Keratinocyte growth factor (KGF) is a fibroblast growth factor which mediates epithelial growth and differentiation. KGF is expressed in subepithelial fibroblasts, but generally not in fibroblasts of deep connective tissue, such as fascia and ligaments. Here we demonstrate that KGF mRNA is expres......Keratinocyte growth factor (KGF) is a fibroblast growth factor which mediates epithelial growth and differentiation. KGF is expressed in subepithelial fibroblasts, but generally not in fibroblasts of deep connective tissue, such as fascia and ligaments. Here we demonstrate that KGF m......RNA is expressed in periodontal ligament fibroblasts, and that the expression is increased upon serum stimulation. Fibroblasts from human periodontal ligament, from buccal mucosa, from gingiva, and from skin were established from explants. Alkaline phosphatase activity was used as an indicator of the periodontal...

  4. Genetic Modification of Human Pancreatic Progenitor Cells Through Modified mRNA.

    Science.gov (United States)

    Lu, Song; Chow, Christie C; Zhou, Junwei; Leung, Po Sing; Tsui, Stephen K; Lui, Kathy O

    2016-01-01

    In this chapter, we describe a highly efficient genetic modification strategy for human pancreatic progenitor cells using modified mRNA-encoding GFP and Neurogenin-3. The properties of modified mRNA offer an invaluable platform to drive protein expression, which has broad applicability in pathway regulation, directed differentiation, and lineage specification. This approach can also be used to regulate expression of other pivotal transcription factors during pancreas development and might have potential therapeutic values in regenerative medicine.

  5. Assessment of flhDC mRNA levels in Serratia liquefaciens swarm cells

    DEFF Research Database (Denmark)

    Tolker-Nielsen, Tim; Christensen, Allan Beck; Holmstrøm, K.

    2000-01-01

    We reported previously that artificial overexpression of the flhDC operon in liquid-grown Serratia liquefaciens resulted in the formation of filamentous, multinucleated, and hyperflagellated cells that were indistinguishable from surface-induced swarm cells (L. Eberl, G. Christiansen, S. Molin, a......, vegetative cells. This suggests that surface-induced S. liquefaciens swarm cell differentiation, although dependent on flhDC gene expression, does not occur through elevated flhDC mRNA levels....

  6. Permissive effect of dexamethasone on the increase of proenkephalin mRNA induced by depolarization of chromaffin cells

    International Nuclear Information System (INIS)

    Naranjo, J.R.; Mocchetti, I.; Schwartz, J.P.; Costa, E.

    1986-01-01

    In cultured bovine chromaffin cells, changes in the dynamic state of enkephalin stores elicited experimentally were studied by measuring cellular proenkephalin mRNA, as well as enkephalin precursors and authentic enkephalin content of cells and culture media. In parallel, tyrosine hydroxylase mRNA and catecholamine cell content were also determined. Low concentrations (0.5-100 pM) of dexamethasone increased the cell contents of proenkephalin mRNA and enkephalin-containing peptides. High concentrations of the hormone(1 μM) were required to increase the cell contents of tyrosine hydroxylase mRNA and catecholamines. Depolarization of the cells with 10 μM veratridine resulted in a depletion of enkephalin and catecholamine stores after 24 hr. The enkephalin, but not the catecholamine, content was restored by 48 hr. An increase in proenkephalin mRNA content might account for the recovery; this increase was curtailed by tetrodotoxin and enhanced by 10 pM dexamethasone. Tyrosine hydroxylase mRNA content was not significantly modified by depolarization, even in the presence of 1 μM dexamethasone. Aldosterone, progesterone, testosterone, or estradiol (1 μM) failed to change proenkephalin mRNA. Hence, dexamethasone appears to exert a specific permissive action on the stimulation of the proenkephalin gene elicited by depolarization. Though the catecholamines and enkephalins are localized in the same chromaffin granules and are coreleased by depolarization, the genes coding for the processes that are rate limiting in the production of these neuromodulators can be differentially regulated

  7. Principles of mRNA transport in yeast.

    Science.gov (United States)

    Heym, Roland Gerhard; Niessing, Dierk

    2012-06-01

    mRNA localization and localized translation is a common mechanism by which cellular asymmetry is achieved. In higher eukaryotes the mRNA transport machinery is required for such diverse processes as stem cell division and neuronal plasticity. Because mRNA localization in metazoans is highly complex, studies at the molecular level have proven to be cumbersome. However, active mRNA transport has also been reported in fungi including Saccharomyces cerevisiae, Ustilago maydis and Candida albicans, in which these events are less difficult to study. Amongst them, budding yeast S. cerevisiae has yielded mechanistic insights that exceed our understanding of other mRNA localization events to date. In contrast to most reviews, we refrain here from summarizing mRNA localization events from different organisms. Instead we give an in-depth account of ASH1 mRNA localization in budding yeast. This approach is particularly suited to providing a more holistic view of the interconnection between the individual steps of mRNA localization, from transcriptional events to cytoplasmic mRNA transport and localized translation. Because of our advanced mechanistic understanding of mRNA localization in yeast, the present review may also be informative for scientists working, for example, on mRNA localization in embryogenesis or in neurons.

  8. The phocein homologue SmMOB3 is essential for vegetative cell fusion and sexual development in the filamentous ascomycete Sordaria macrospora.

    Science.gov (United States)

    Bernhards, Yasmine; Pöggeler, Stefanie

    2011-04-01

    Members of the striatin family and their highly conserved interacting protein phocein/Mob3 are key components in the regulation of cell differentiation in multicellular eukaryotes. The striatin homologue PRO11 of the filamentous ascomycete Sordaria macrospora has a crucial role in fruiting body development. Here, we functionally characterized the phocein/Mob3 orthologue SmMOB3 of S. macrospora. We isolated the gene and showed that both, pro11 and Smmob3 are expressed during early and late developmental stages. Deletion of Smmob3 resulted in a sexually sterile strain, similar to the previously characterized pro11 mutant. Fusion assays revealed that ∆Smmob3 was unable to undergo self-fusion and fusion with the pro11 strain. The essential function of the SmMOB3 N-terminus containing the conserved mob domain was demonstrated by complementation analysis of the sterile S. macrospora ∆Smmob3 strain. Downregulation of either pro11 in ∆Smmob3, or Smmob3 in pro11 mutants by means of RNA interference (RNAi) resulted in synthetic sexual defects, demonstrating for the first time the importance of a putative PRO11/SmMOB3 complex in fruiting body development.

  9. Rasputin, the Drosophila homologue of the RasGAP SH3 binding protein, functions in ras- and Rho-mediated signaling.

    Science.gov (United States)

    Pazman, C; Mayes, C A; Fanto, M; Haynes, S R; Mlodzik, M

    2000-04-01

    The small GTPase Ras plays an important role in many cellular signaling processes. Ras activity is negatively regulated by GTPase activating proteins (GAPs). It has been proposed that RasGAP may also function as an effector of Ras activity. We have identified and characterized the Drosophila homologue of the RasGAP-binding protein G3BP encoded by rasputin (rin). rin mutants are viable and display defects in photoreceptor recruitment and ommatidial polarity in the eye. Mutations in rin/G3BP genetically interact with components of the Ras signaling pathway that function at the level of Ras and above, but not with Raf/MAPK pathway components. These interactions suggest that Rin is required as an effector in Ras signaling during eye development, supporting an effector role for RasGAP. The ommatidial polarity phenotypes of rin are similar to those of RhoA and the polarity genes, e.g. fz and dsh. Although rin/G3BP interacts genetically with RhoA, affecting both photoreceptor differentiation and polarity, it does not interact with the gain-of-function genotypes of fz and dsh. These data suggest that Rin is not a general component of polarity generation, but serves a function specific to Ras and RhoA signaling pathways.

  10. Equilibrium evaporation behavior of polonium and its homologue tellurium in liquid lead-bismuth eutectic

    International Nuclear Information System (INIS)

    Ohno, Shuji; Miyahara, Shinya; Kurata, Yuji; Katsura, Ryoei; Yoshida, Shigeru

    2006-01-01

    Experimental study using the transpiration method investigates equilibrium evaporation behavior of radionuclide polonium ( 210 Po) generated and accumulated in liquid lead-bismuth eutectic (LBE) cooled nuclear systems. The experiment consists of two series of tests: preliminary evaporation tests for homologue element tellurium (Te) in LBE, and evaporation tests for 210 Po-accumulated LBE in which test specimens are prepared by neutron irradiation. The evaporation tests of Te in LBE provide the suggestion that Te exists in a chemical form of PbTe as well as the information for confirming the validity of technique and conditions of Po test. From the evaporation tests of 210 Po in LBE, we obtain fundamental data and empirical equations such as 210 Po vapor concentration in the gas phase, 210 Po partial vapor pressure, thermodynamic activity coefficients, and gas-liquid equilibrium partition coefficient of 210 Po in LBE in the temperature range from 450 to 750degC. Additionally, radioactivity concentration of 210 Po and 210m Bi vapor in a cover gas region of a typical LBE-cooled nuclear system is specifically estimated based on the obtained experimental results, and the importance of 210 Po evaporation behavior is quantitatively demonstrated. (author)

  11. Crystal structure of a bacterial homologue of the bile acid sodium symporter ASBT

    Science.gov (United States)

    Hu, Nien-Jen; Iwata, So; Cameron, Alexander D.; Drew, David

    2011-01-01

    High cholesterol levels greatly increase the risk of cardiovascular disease. By its conversion into bile acids, about 50% of cholesterol is eliminated from the body. However bile acids released from the bile duct are constantly recycled, being reabsorbed in the intestine via the Apical Sodium dependent Bile acid Transporter (ASBT). It has been shown in animal models that plasma cholesterol levels are significantly lowered by specific inhibitors of ASBT1,2, thus ASBT is a target for hypercholesterolemia drugs. Here, we describe the crystal structure of a bacterial homologue of ASBT from Neisseria meningitidis (ASBTNM) at 2.2Å. ASBTNM contains two inverted structural repeats of five transmembrane helices. A Core domain of six helices harbours two sodium ions while the remaining helices form a Panel-like domain. Overall the architecture of the protein is remarkably similar to the sodium-proton antiporter NhaA3 despite no detectable sequence homology. A bile acid molecule is situated between the Core and Panel domains in a large hydrophobic cavity. Residues near to this cavity have been shown to affect the binding of specific inhibitors of human ASBT4. The position of the bile acid together with the molecular architecture suggests the rudiments of a possible transport mechanism. PMID:21976025

  12. Edge profiles in K shell photoabsorption spectra of gaseous hydrides of 3p elements and homologues

    Science.gov (United States)

    Hauko, R.; Gomilšek, J. Padežnik; Kodre, A.; Arčon, I.; Aquilanti, G.

    2017-10-01

    Photoabsorption spectra of gaseous hydrides of 3p elements (PH3, H2S, HCl) are measured in the energy region of photoexcitations pertaining to K edge. The analysis of the edge profile is extended to hydrides of 4p series (GeH4, AsH3, H2Se, HBr) from an earlier experiment, and to published spectra of 2p hydrides (CH4, NH3, H2O, HF) and noble gases Ar, Kr and Ne and SiH4. The edge profiles are modelled with a linear combination of lorentzian components, describing excitations to individual bound states and to continuum. Transition energies and probabilities are also calculated in the non-relativistic molecular model of the ORCA code, in good agreement with the experiment. Edge profiles in the heavier homologues are closely similar, the symmetry of the molecule governs the transitions to the lowest unoccupied orbitals. In 2p series the effect of the strong nuclear potential prevails. Transitions to higher, atomic-like levels remain very much the same as in free atoms.

  13. The human homologue of Dictyostelium discoideum phg1A is expressed by human metastatic melanoma cells.

    Science.gov (United States)

    Lozupone, Francesco; Perdicchio, Maurizio; Brambilla, Daria; Borghi, Martina; Meschini, Stefania; Barca, Stefano; Marino, Maria Lucia; Logozzi, Mariantonia; Federici, Cristina; Iessi, Elisabetta; de Milito, Angelo; Fais, Stefano

    2009-12-01

    Tumour cannibalism is a characteristic of malignancy and metastatic behaviour. This atypical phagocytic activity is a crucial survival option for tumours in conditions of low nutrient supply, and has some similarities to the phagocytic activity of unicellular microorganisms. In fact, Dictyostelium discoideum has been used widely as a model to study phagocytosis. Recently, phg1A has been described as a protein that is primarily involved in the phagocytic process of this microorganism. The closest human homologue to phg1A is transmembrane 9 superfamily protein member 4 (TM9SF4). Here, we report that TM9SF4 is highly expressed in human malignant melanoma cells deriving from metastatic lesions, whereas it is undetectable in healthy human tissues and cells. TM9SF4 is predominantly expressed in acidic vesicles of melanoma cells, in which it co-localizes with the early endosome antigens Rab5 and early endosome antigen 1. TM9SF4 silencing induced marked inhibition of cannibal activity, which is consistent with a derangement of intracellular pH gradients, with alkalinization of acidic vesicles and acidification of the cell cytosol. We propose TM9SF4 as a new marker of malignancy, representing a potential new target for anti-tumour strategies with a specific role in tumour cannibalism and in the establishment of a metastatic phenotype.

  14. The oil palm Shell gene controls oil yield and encodes a homologue of SEEDSTICK

    Science.gov (United States)

    Singh, Rajinder; Leslie Low, Eng-Ti; Ooi, Leslie Cheng-Li; Ong-Abdullah, Meilina; Chin, Ting Ngoot; Nagappan, Jayanthi; Nookiah, Rajanaidu; Amiruddin, Mohd Din; Rosli, Rozana; Abdul Manaf, Mohamad Arif; Chan, Kuang-Lim; Halim, Mohd Amin; Azizi, Norazah; Lakey, Nathan; Smith, Steven W; Budiman, Muhammad A; Hogan, Michael; Bacher, Blaire; Van Brunt, Andrew; Wang, Chunyan; Ordway, Jared M; Sambanthamurthi, Ravigadevi; Martienssen, Robert A

    2014-01-01

    A key event in the domestication and breeding of the oil palm, Elaeis guineensis, was loss of the thick coconut-like shell surrounding the kernel. Modern E. guineensis has three fruit forms, dura (thick-shelled), pisifera (shell-less) and tenera (thin-shelled), a hybrid between dura and pisifera1–4. The pisifera palm is usually female-sterile but the tenera yields far more oil than dura, and is the basis for commercial palm oil production in all of Southeast Asia5. Here, we describe the mapping and identification of the Shell gene responsible for the different fruit forms. Using homozygosity mapping by sequencing we found two independent mutations in the DNA binding domain of a homologue of the MADS-box gene SEEDSTICK (STK) which controls ovule identity and seed development in Arabidopsis. The Shell gene is responsible for the tenera phenotype in both cultivated and wild palms from sub-Saharan Africa, and our findings provide a genetic explanation for the single gene heterosis attributed to Shell, via heterodimerization. This gene mutation explains the single most important economic trait in oil palm, and has implications for the competing interests of global edible oil production, biofuels and rainforest conservation6. PMID:23883930

  15. Contribution of polycomb homologues Bmi-1 and Mel-18 to medulloblastoma pathogenesis.

    Science.gov (United States)

    Wiederschain, Dmitri; Chen, Lin; Johnson, Brett; Bettano, Kimberly; Jackson, Dowdy; Taraszka, John; Wang, Y Karen; Jones, Michael D; Morrissey, Michael; Deeds, James; Mosher, Rebecca; Fordjour, Paul; Lengauer, Christoph; Benson, John D

    2007-07-01

    Bmi-1 and Mel-18 are structural homologues that belong to the Polycomb group of transcriptional regulators and are believed to stably maintain repression of gene expression by altering the state of chromatin at specific promoters. While a number of clinical and experimental observations have implicated Bmi-1 in human tumorigenesis, the role of Mel-18 in cancer cell growth has not been investigated. We report here that short hairpin RNA-mediated knockdown of either Bmi-1 or Mel-18 in human medulloblastoma DAOY cells results in the inhibition of proliferation, loss of clonogenic survival, anchorage-independent growth, and suppression of tumor formation in nude mice. Furthermore, overexpression of both Bmi-1 and Mel-18 significantly increases the clonogenic survival of Rat1 fibroblasts. In contrast, stable downregulation of Bmi-1 or Mel-18 alone does not affect the growth of normal human WI38 fibroblasts. Proteomics-based characterization of Bmi-1 and Mel-18 protein complexes isolated from cancer cells revealed substantial similarities in their respective compositions. Finally, gene expression analysis identified a number of cancer-relevant pathways that may be controlled by Bmi-1 and Mel-18 and also showed that these Polycomb proteins regulate a set of common gene targets. Taken together, these results suggest that Bmi-1 and Mel-18 may have overlapping functions in cancer cell growth.

  16. Crystallization and preliminary diffraction analysis of a DsbA homologue from Wolbachia pipientis

    Energy Technology Data Exchange (ETDEWEB)

    Kurz, M. [Institute for Molecular Bioscience and ARC Special Research Centre for Functional and Applied Genomics, University of Queensland, St Lucia, QLD 4072 (Australia); Iturbe-Ormaetxe, I. [School of Integrative Biology, The University of Queensland, St Lucia, QLD 4072 (Australia); Jarrott, R. [Institute for Molecular Bioscience and ARC Special Research Centre for Functional and Applied Genomics, University of Queensland, St Lucia, QLD 4072 (Australia); O’Neill, S. L. [School of Integrative Biology, The University of Queensland, St Lucia, QLD 4072 (Australia); Byriel, K. A.; Martin, J. L., E-mail: j.martin@imb.uq.edu.au; Heras, B., E-mail: j.martin@imb.uq.edu.au [Institute for Molecular Bioscience and ARC Special Research Centre for Functional and Applied Genomics, University of Queensland, St Lucia, QLD 4072 (Australia)

    2008-02-01

    The first crystallization of a W. pipientis protein, α-DsbA1, was achieved using hanging-drop and sitting-drop vapour diffusion. α-DsbA1 is one of two DsbA homologues encoded by the Gram-negative α-proteobacterium Wolbachia pipientis, an endosymbiont that can behave as a reproductive parasite in insects and as a mutualist in medically important filarial nematodes. The α-DsbA1 protein is thought to be important for the folding and secretion of Wolbachia proteins involved in the induction of reproductive distortions. Crystals of native and SeMet α-DsbA1 were grown by vapour diffusion and belong to the monoclinic space group C2, with unit-cell parameters a = 71.4, b = 49.5, c = 69.3 Å, β = 107.0° and one molecule in the asymmetric unit (44% solvent content). X-ray data were recorded from native crystals to a resolution of 2.01 Å using a copper anode and data from SeMet α-DsbA1 crystals were recorded to 2.45 Å resolution using a chromium anode.

  17. Stereoselectivity of the demethylation of nicotine piperidine homologues by Nicotiana plumbaginifolia cell suspension cultures.

    Science.gov (United States)

    Bartholomeusz, Trixie Ann; Molinié, Roland; Roscher, Albrecht; Felpin, François-Xavier; Gillet, Françoise; Lebreton, Jacques; Mesnard, François; Robins, Richard J

    2005-08-01

    The metabolism of (R,S)-N-methylanabasine and (R,S)-N-methylanatabine has been studied in a cell suspension culture of Nicotiana plumbaginifolia. Both substrates are effectively demethylated, anabasine or anatabine, respectively, accumulating in the medium. Similarly, there is strong stereoselectivity for the (R)-isomers of both substrates. The kinetics of metabolism of (R,S)-N-methylanabasine differ significantly from those of nicotine in that no further degradation of the initial demethylation product occurs. (R,S)-N-Methylanatabine, however, shows kinetics closer to those of nicotine, with loss of alkaloid from the system. Further more, (R,S)-N-methylanabasine does not diminish (S)-nicotine demethylation, indicating a lack of competition. However, the metabolism of (S)-nicotine is affected by the presence of (R,S)-N-methylanabasine. Hence, the demethylation of the piperidine homologues of nicotine is seen to be similar but not identical to that of the pyridine analogues. The implications of these different metabolic profiles in relation to the demethylation activity are discussed.

  18. Validating tyrosinase homologue MelA as a photoacoustic reporter gene for imaging Escherichia coli

    Science.gov (United States)

    Paproski, Robert J.; Li, Yan; Barber, Quinn; Lewis, John D.; Campbell, Robert; Zemp, Roger

    2015-03-01

    Antibiotic drug resistance is a major worldwide issue. Development of new therapies against pathogenic bacteria requires appropriate research tools for replicating and characterizing infections. Previously fluorescence and bioluminescence modalities have been used to image infectious burden in animal models but scattering significantly limits imaging depth and resolution. We hypothesize that photoacoustic imaging, which has improved depth-toresolution ratio, could be useful for visualizing MelA-expressing bacteria since MelA is a bacterial tyrosinase homologue involved in melanin production. Using an inducible expression system, E. coli expressing MelA were visibly black in liquid culture. Phosphate buffered saline (PBS), MelA-expressing bacteria (at different dilutions in PBS), and chicken embryo blood were injected in plastic tubes which were imaged using a VisualSonics Vevo LAZR system. Photoacoustic imaging at 6 different wavelengths (680, 700, 750, 800, 850 and 900nm) enabled spectral de-mixing to distinguish melanin signals from blood. The signal to noise ratio of 9x diluted MelA bacteria was 55, suggesting that ~20 bacteria cells could be detected with our system. When MelA bacteria were injected as a 100 μL bolus into a chicken embryo, photoacoustic signals from deoxy- and oxy- hemoglobin as well as MelA-expressing bacteria could be separated and overlaid on an ultrasound image, allowing visualization of the bacterial location. Photoacoustic imaging may be a useful tool for visualizing bacterial infections and further work incorporating photoacoustic reporters into infectious bacterial strains is warranted.

  19. DNA methyltransferase homologue TRDMT1 in Plasmodium falciparum specifically methylates endogenous aspartic acid tRNA.

    Science.gov (United States)

    Govindaraju, Gayathri; Jabeena, C A; Sethumadhavan, Devadathan Valiyamangalath; Rajaram, Nivethika; Rajavelu, Arumugam

    2017-10-01

    In eukaryotes, cytosine methylation regulates diverse biological processes such as gene expression, development and maintenance of genomic integrity. However, cytosine methylation and its functions in pathogenic apicomplexan protozoans remain enigmatic. To address this, here we investigated the presence of cytosine methylation in the nucleic acids of the protozoan Plasmodium falciparum. Interestingly, P. falciparum has TRDMT1, a conserved homologue of DNA methyltransferase DNMT2. However, we found that TRDMT1 did not methylate DNA, in vitro. We demonstrate that TRDMT1 methylates cytosine in the endogenous aspartic acid tRNA of P. falciparum. Through RNA bisulfite sequencing, we mapped the position of 5-methyl cytosine in aspartic acid tRNA and found methylation only at C38 position. P. falciparum proteome has significantly higher aspartic acid content and a higher proportion of proteins with poly aspartic acid repeats than other apicomplexan pathogenic protozoans. Proteins with such repeats are functionally important, with significant roles in host-pathogen interactions. Therefore, TRDMT1 mediated C38 methylation of aspartic acid tRNA might play a critical role by translational regulation of important proteins and modulate the pathogenicity of the malarial parasite. Copyright © 2017 Elsevier B.V. All rights reserved.

  20. TRBP and eIF6 homologue in Marsupenaeus japonicus play crucial roles in antiviral response.

    Directory of Open Access Journals (Sweden)

    Shuai Wang

    Full Text Available Plants and invertebrates can suppress viral infection through RNA silencing, mediated by RNA-induced silencing complex (RISC. Trans-activation response RNA-binding protein (TRBP, consisting of three double-stranded RNA-binding domains, is a component of the RISC. In our previous paper, a TRBP homologue in Fenneropenaeus chinensis (Fc-TRBP was reported to directly bind to eukaryotic initiation factor 6 (Fc-eIF6. In this study, we further characterized the function of TRBP and the involvement of TRBP and eIF6 in antiviral RNA interference (RNAi pathway of shrimp. The double-stranded RNA binding domains (dsRBDs B and C of the TRBP from Marsupenaeus japonicus (Mj-TRBP were found to mediate the interaction of TRBP and eIF6. Gel-shift assays revealed that the N-terminal of Mj-TRBP dsRBD strongly binds to double-stranded RNA (dsRNA and that the homodimer of the TRBP mediated by the C-terminal dsRBD increases the affinity to dsRNA. RNAi against either Mj-TRBP or Mj-eIF6 impairs the dsRNA-induced sequence-specific RNAi pathway and facilitates the proliferation of white spot syndrome virus (WSSV. These results further proved the important roles of TRBP and eIF6 in the antiviral response of shrimp.

  1. Detection of mRNA by reverse-transcription PCR as an indicator of viability in Phytophthora ramorum

    Science.gov (United States)

    A. Chimento; S.O. Cacciola; M. Garbelotto

    2011-01-01

    In the last few decades, the use of molecular tools has greatly improved the efficiency of plant disease diagnosis. However, one of the major setbacks of most molecular diagnostic approaches is their inability to differentiate between dead and viable pathogens. We propose a new strategy for the detection of plant pathogens, based on the use of mRNA as a viability...

  2. Simultaneous detection of mRNA and protein stem cell markers in live cells

    Directory of Open Access Journals (Sweden)

    Bao Gang

    2009-04-01

    Full Text Available Abstract Background Biological studies and medical application of stem cells often require the isolation of stem cells from a mixed cell population, including the detection of cancer stem cells in tumor tissue, and isolation of induced pluripotent stem cells after eliciting the expression of specific genes in adult cells. Here we report the detection of Oct-4 mRNA and SSEA-1 protein in live carcinoma stem cells using respectively molecular beacon and dye-labeled antibody, aiming to establish a new method for stem cells detection and isolation. Results Quantification of Oct-4 mRNA and protein in P19 mouse carcinoma stem cells using respectively RT-PCR and immunocytochemistry confirmed that their levels drastically decreased after differentiation. To visualize Oct-4 mRNA in live stem cells, molecular beacons were designed, synthesized and validated, and the detection specificity was confirmed using control studies. We found that the fluorescence signal from Oct-4-targeting molecular beacons provides a clear discrimination between undifferentiated and retinoic acid-induced differentiated cells. Using deconvolution fluorescence microscopy, Oct-4 mRNAs were found to reside on one side of the cytosol. We demonstrated that, using a combination of Oct-4 mRNA-targeting molecular beacon with SSEA-1 antibody in flow cytometric analysis, undifferentiated stem cells can be clearly distinguished from differentiated cells. We revealed that Oct-4 targeting molecular beacons do not seem to affect stem cell biology. Conclusion Molecular beacons have the potential to provide a powerful tool for highly specific detection and isolation of stem cells, including cancer stem cells and induced pluripotent stem (iPS cells without disturbing cell physiology. It is advantageous to perform simultaneous detection of intracellular (mRNA and cell-surface (protein stem cell markers in flow cytometric analysis, which may lead to high detection sensitivity and efficiency.

  3. Short- and medium-chain chlorinated paraffins in biota from the European Arctic -- differences in homologue group patterns.

    Science.gov (United States)

    Reth, Margot; Ciric, Anita; Christensen, Guttorm N; Heimstad, Eldbjørg S; Oehme, Michael

    2006-08-15

    Congener and homologue group patterns of chlorinated paraffins (CPs) in biota can be influenced by different processes, but these are not well studied yet. Short- (SCCPs) and medium-chain chlorinated paraffins (MCCPs) were quantified in liver from Arctic char and seabirds (little auk and kittiwake) collected at Bear Island (European Arctic) as well as in cod from Iceland and Norway. CP concentrations were between 5 and 88 ng/g wet weight (ww) for SCCPs and between 5 and 55 ng/g ww for MCCPs with one exception of 370 ng/g measured in a liver sample from little auk. The SCCP homologue group patterns were compared with those of technical mixtures and of SCCPs present in cod liver from the Baltic Sea. The latter showed a more common SCCP homologue distribution (sum of C(11) and C(12)>60%) in contrast to cod liver from the Northwest of Europe, which had a high abundance of C(10) and C(12) congeners. Seabirds from Bear Island contained an equally distributed SCCP homologue group pattern. In Arctic char, the SCCP distribution was closer to technical products, but with a high proportion (average of 18.9%) of C(10) congeners. A comparison of C(10)/C(12) ratios confirmed the higher abundance of C(10) congeners in samples from higher latitudes. For the first time, MCCPs could be detected in Arctic samples. The average proportion of C(14) congeners was 65.8%. The C(14)/C(15) abundance ratio was similar to technical mixtures. High-chlorinated CPs (Cl(>7)) were also detectable. The average chlorine content of the SCCPs was 61.9% (59.0-63.3%), and that of the MCCPs 55.8% (54.5-57.4%).

  4. Tissue-specific mRNA expression profiling in grape berry tissues

    Science.gov (United States)

    Grimplet, Jerome; Deluc, Laurent G; Tillett, Richard L; Wheatley, Matthew D; Schlauch, Karen A; Cramer, Grant R; Cushman, John C

    2007-01-01

    Background Berries of grape (Vitis vinifera) contain three major tissue types (skin, pulp and seed) all of which contribute to the aroma, color, and flavor characters of wine. The pericarp, which is composed of the exocarp (skin) and mesocarp (pulp), not only functions to protect and feed the developing seed, but also to assist in the dispersal of the mature seed by avian and mammalian vectors. The skin provides volatile and nonvolatile aroma and color compounds, the pulp contributes organic acids and sugars, and the seeds provide condensed tannins, all of which are important to the formation of organoleptic characteristics of wine. In order to understand the transcriptional network responsible for controlling tissue-specific mRNA expression patterns, mRNA expression profiling was conducted on each tissue of mature berries of V. vinifera Cabernet Sauvignon using the Affymetrix GeneChip® Vitis oligonucleotide microarray ver. 1.0. In order to monitor the influence of water-deficit stress on tissue-specific expression patterns, mRNA expression profiles were also compared from mature berries harvested from vines subjected to well-watered or water-deficit conditions. Results Overall, berry tissues were found to express approximately 76% of genes represented on the Vitis microarray. Approximately 60% of these genes exhibited significant differential expression in one or more of the three major tissue types with more than 28% of genes showing pronounced (2-fold or greater) differences in mRNA expression. The largest difference in tissue-specific expression was observed between the seed and pulp/skin. Exocarp tissue, which is involved in pathogen defense and pigment production, showed higher mRNA abundance relative to other berry tissues for genes involved with flavonoid biosynthesis, pathogen resistance, and cell wall modification. Mesocarp tissue, which is considered a nutritive tissue, exhibited a higher mRNA abundance of genes involved in cell wall function and

  5. Tissue-specific mRNA expression profiling in grape berry tissues

    Directory of Open Access Journals (Sweden)

    Cramer Grant R

    2007-06-01

    Full Text Available Abstract Background Berries of grape (Vitis vinifera contain three major tissue types (skin, pulp and seed all of which contribute to the aroma, color, and flavor characters of wine. The pericarp, which is composed of the exocarp (skin and mesocarp (pulp, not only functions to protect and feed the developing seed, but also to assist in the dispersal of the mature seed by avian and mammalian vectors. The skin provides volatile and nonvolatile aroma and color compounds, the pulp contributes organic acids and sugars, and the seeds provide condensed tannins, all of which are important to the formation of organoleptic characteristics of wine. In order to understand the transcriptional network responsible for controlling tissue-specific mRNA expression patterns, mRNA expression profiling was conducted on each tissue of mature berries of V. vinifera Cabernet Sauvignon using the Affymetrix GeneChip® Vitis oligonucleotide microarray ver. 1.0. In order to monitor the influence of water-deficit stress on tissue-specific expression patterns, mRNA expression profiles were also compared from mature berries harvested from vines subjected to well-watered or water-deficit conditions. Results Overall, berry tissues were found to express approximately 76% of genes represented on the Vitis microarray. Approximately 60% of these genes exhibited significant differential expression in one or more of the three major tissue types with more than 28% of genes showing pronounced (2-fold or greater differences in mRNA expression. The largest difference in tissue-specific expression was observed between the seed and pulp/skin. Exocarp tissue, which is involved in pathogen defense and pigment production, showed higher mRNA abundance relative to other berry tissues for genes involved with flavonoid biosynthesis, pathogen resistance, and cell wall modification. Mesocarp tissue, which is considered a nutritive tissue, exhibited a higher mRNA abundance of genes involved in cell

  6. Species-specific flight styles of flies are reflected in the response dynamics of a homologue motion sensitive neuron

    Directory of Open Access Journals (Sweden)

    Bart eGeurten

    2012-03-01

    Full Text Available Hoverflies and blowflies have distinctly different flight styles. Yet, both species have been shown to structure their flight behaviour in a way that facilitates extraction of 3D information from the image flow on the retina (optic flow. Neuronal candidates to analyse the optic flow are the tangential cells in the third optical ganglion – the lobula complex. These neurons are directionally selective and integrate the optic flow over large parts of the visual field. Homologue tangential cells in hoverflies and blowflies have a similar morphology. Because blowflies and hoverflies have similar neuronal layout but distinctly different flight behaviours, they are an ideal substrate to pinpoint potential neuronal adaptations to the different flight styles.In this article we describe the relationship between locomotion behaviour and motion vision on three different levels:1.We compare the different flight styles based on the categorisation of flight behaviour into prototypical movements.2.We measure the species specific dynamics of the optic flow under naturalistic flight conditions. We found the translational optic flow of both species to be very different.3.We describe possible adaptations of a homologue motion sensitive neuron. We stimulate this cell in blowflies (Calliphora and hoverflies (Eristalis with naturalistic optic flow generated by both species during free flight. The characterized hoverfly tangential cell responds faster to transient changes in the optic flow than its blowfly homologue. It is discussed whether and how the different dynamical response properties aid optic flow analysis.

  7. Mono-, di- and trimethylated homologues of isoprenoid tetraether lipid cores in archaea and environmental samples: mass spectrometric identification and significance.

    Science.gov (United States)

    Knappy, Chris; Barillà, Daniela; Chong, James; Hodgson, Dominic; Morgan, Hugh; Suleman, Muhammad; Tan, Christine; Yao, Peng; Keely, Brendan

    2015-12-01

    Higher homologues of widely reported C(86) isoprenoid diglycerol tetraether lipid cores, containing 0-6 cyclopentyl rings, have been identified in (hyper)thermophilic archaea, representing up to 21% of total tetraether lipids in the cells. Liquid chromatography-tandem mass spectrometry confirms that the additional carbon atoms in the C(87-88) homologues are located in the etherified chains. Structures identified include dialkyl and monoalkyl ('H-shaped') tetraethers containing C(40-42) or C(81-82) hydrocarbons, respectively, many representing novel compounds. Gas chromatography-mass spectrometric analysis of hydrocarbons released from the lipid cores by ether cleavage suggests that the C(40) chains are biphytanes and the C(41) chains 13-methylbiphytanes. Multiple isomers, having different chain combinations, were recognised among the dialkyl lipids. Methylated tetraethers are produced by Methanothermobacter thermautotrophicus in varying proportions depending on growth conditions, suggesting that methylation may be an adaptive mechanism to regulate cellular function. The detection of methylated lipids in Pyrobaculum sp. AQ1.S2 and Sulfolobus acidocaldarius represents the first reported occurrences in Crenarchaeota. Soils and aquatic sediments from geographically distinct mesotemperate environments that were screened for homologues contained monomethylated tetraethers, with di- and trimethylated structures being detected occasionally. The structural diversity and range of occurrences of the C(87-89) tetraethers highlight their potential as complementary biomarkers for archaea in natural environments. Copyright © 2015 John Wiley & Sons, Ltd.

  8. Crystal structure of pira toxin-I: a calcium-independent, myotoxic phospholipase A2 - homologue from Bothrops pirajai venom

    International Nuclear Information System (INIS)

    Canduri, R.J.; Ward, R.J.; Azevedo Junior, G.W.F. de; Arni, R.K.; Soares, A.M.; Giglio, J.R.

    1997-01-01

    Full text. Phospho lipases A2 (PLA 2 ) are small enzymes that specifically hydrolysed the sn-2 ester bond of phospholipids, preferentially in lamellar or micellar aggregates at membrane surfaces. These enzymes are widely distributed in nature and have been extensively studied. Toxic proteins from venoms from Bothrops species include catalytically active PLA 2 s and calcium independent PLA 2L ys 49 homologues. The substitution of Asp49 by Lys greatly diminishes the ability of these PLA 2 to bind calcium, an ion that plays a critical role in the stabilization of the tetrahedral transition state intermediate in the catalytic mechanism. The Lys 49 PLA 2 homologues and therefore catalytically inactive yet maintain cytolytic and myotoxic activities and furthermore retain the ability to disrupt the integrity of both plasma membranes and model lipid bilayers by a poorly understood Ca 2+ independente mechanism. Lys49 PLA 2 homologues demonstrate a specific toxic activity against skeletal muscle, affecting only muscle fibers and leaving other tissue structure such as connective tissue, nerves and vessels essentially unharmed. In order to improve our understanding of the molecular basis of the myotoxic and Ca 2+ -independent membrane damaging activities, we have determined the crystal structure of Pr TX-I, a Lys49 variant from the venom of B. pirajai. The model presented has been determined at 2.8 angstrom resolution and refined to a crystallographic residual of 19.7% (R free =29.7%). (author)

  9. Structural characterization and expression analysis of a beta-thymosin homologue (Tβ) in disk abalone, Haliotis discus discus.

    Science.gov (United States)

    Kasthuri, Saranya Revathy; Premachandra, H K A; Umasuthan, Navaneethaiyer; Whang, Ilson; Lee, Jehee

    2013-09-15

    Repertoires of proteins and small peptides play numerous physiological roles as hormones, antimicrobial peptides, and cellular signaling factors. The beta-thymosins are a group of small acidic peptides involved in processes such as actin sequestration, neuronal development, wound healing, tissue repair, and angiogenesis. Recent characterization of the beta thymosins as immunological regulators in invertebrates led to our identification and characterization of a beta-thymosin homologue (Tβ) from Haliotis discus discus. The cDNA possessed an ORF of 132 bp encoding a protein of 44 amino acids with a molecular mass of 4977 Da. The amino acid sequence shows high identity with another molluskan beta-thymosin and has a characteristic actin binding motif (LKKTET) and glutamyl donors. Phylogenetic analysis showed a close relationship with molluskan homologues, as well as its distinct identity and common ancestral origin. Genomic analysis revealed a 3 exon-2 intron structure similar to the other homologues. In silico promoter analysis also revealed significant transcription factor binding sites, providing evidence for the expression of this gene under different cellular conditions, including stress or pathogenic attack. Tissue distribution profiling revealed a ubiquitous presence in all the examined tissues, but with the highest expression in mantle and hemocyte. Immune challenge with lipopolysaccharide, poly I:C and Vibrio parahemolyticus induced beta-thymosin expression in gill and hemocytes, affirming an immune-related role in invertebrates. Copyright © 2013 Elsevier B.V. All rights reserved.

  10. VDR mRNA overexpression is associated with worse prognostic factors in papillary thyroid carcinoma

    Directory of Open Access Journals (Sweden)

    June Young Choi

    2017-03-01

    Full Text Available The purpose of this study was to assess the relationship between vitamin D receptor gene (VDR expression and prognostic factors in papillary thyroid cancer (PTC. mRNA sequencing and somatic mutation data from The Cancer Genome Atlas (TCGA were analyzed. VDR mRNA expression was compared to clinicopathologic variables by linear regression. Tree-based classification was applied to find cutoff and patients were split into low and high VDR group. Logistic regression, Kaplan–Meier analysis, differentially expressed gene (DEG test and pathway analysis were performed to assess the differences between two VDR groups. VDR mRNA expression was elevated in PTC than that in normal thyroid tissue. VDR expressions were high in classic and tall-cell variant PTC and lateral neck node metastasis was present. High VDR group was also associated with classic and tall cell subtype, AJCC stage IV and lower recurrence-free survival. DEG test reveals that 545 genes were upregulated in high VDR group. Thyroid cancer-related pathways were enriched in high VDR group in pathway analyses. VDR mRNA overexpression was correlated with worse prognostic factors such as subtypes of papillary thyroid carcinoma that are known to be worse prognosis, lateral neck node metastasis, advanced stage and recurrence-free survival.

  11. Regulation of elastin synthesis in developing sheep nuchal ligament by elastin mRNA levels

    International Nuclear Information System (INIS)

    Davidson, J.M.; Smith, K.; Shibahara, S.; Tolstoshev, P.; Crystal, R.G.

    1982-01-01

    Levels of elastin production in explant culture of fetal sheep nuchal ligament and corresponding levels of translatable elastin mRNA were determined in parallel studies during a period of rapid growth of the embryo. The identity of the explant culture and cell-free proucts was confirmed by peptide mapping, immunoprecipitation, and the characteristic lack of histidine and methionine. Elastin production was quantitated by sodium dodecyl sulfate-polyacrylamide gel electrophoresis and radioimmune precipitation. The translation products could be labeled with methionine only when NH 2 -terminally donated as f-Met-tRNA/sup Met//sub f/. Explant cultures showed a large rise in elastin production from 70 days after conception to 150 days after conception. Cell free translation of RNA demonstrated a parallel in elastin mRNA levels and in elastin mRNA per cell. It appears, therefore, that the marked emphasis the differentiating muchal ligament places on elastin production is modulated, at least in part, by the quantities of available elastin in mRNA

  12. Expression of IL-1β mRNA in mice after whole body X-irradiation

    International Nuclear Information System (INIS)

    Nemoto, Kumie; Ishihara, Hiroshi; Tanaka, Izumi; Suzuki, Gen; Tsuneoka, Kazuko; Yoshida, Kazuko; Ohtsu, Hiroshi

    1995-01-01

    IL-1β is a stimulator of hematopoietic and inflammatory systems, and also acts as a radioprotector. After whole-body exposure to sublethal doses of ionizing radiation, the IL-1β mRNA level in spleen cells increases for a short time prior to regeneration of the spleen. We analyzed spleen cells of C3H/He mice after whole-body irradiation with 3 Gy x-rays to determine the cause of this short-term increase in the transcription level. An increase in the level of the message in spleen cells, found by Northern blot hybridization, reached its peak 5 to 7 days after irradiation. There was a low correlation between the curves of the mRNA level and the ratio of monocyte/macrophage lineage cells; a typical source of the message. Spleen macrophages that produce a large amount of the message were found 7 days after irradiation in an in situ hybridization experiment in which heterogeneous spleen cell populations were used. In contrast, spleen cells had no detectable levels of macrophages rich in IL-1β mRNA before and 17 days after irradiation. Additionally, the population of message-rich cells was 9.4% of the total number of monocytes/macrophages in the spleen. These results suggest that the short-term increase in IL-1β mRNA is a result of the heterogeneous differentiation of a subpopulation of spleen macrophages before regeneration of the spleen. (author)

  13. Expression of cinnamyl alcohol dehydrogenases and their putative homologues during Arabidopsis thaliana growth and development: lessons for database annotations?

    Science.gov (United States)

    Kim, Sung-Jin; Kim, Kye-Won; Cho, Man-Ho; Franceschi, Vincent R; Davin, Laurence B; Lewis, Norman G

    2007-07-01

    A major goal currently in Arabidopsis research is determination of the (biochemical) function of each of its approximately 27,000 genes. To date, however, 12% of its genes actually have known biochemical roles. In this study, we considered it instructive to identify the gene expression patterns of nine (so-called AtCAD1-9) of 17 genes originally annotated by The Arabidopsis Information Resource (TAIR) as cinnamyl alcohol dehydrogenase (CAD, EC 1.1.1.195) homologues [see Costa, M.A., Collins, R.E., Anterola, A.M., Cochrane, F.C., Davin, L.B., Lewis N.G., 2003. An in silico assessment of gene function and organization of the phenylpropanoid pathway metabolic networks in Arabidopsis thaliana and limitations thereof. Phytochemistry 64, 1097-1112.]. In agreement with our biochemical studies in vitro [Kim, S.-J., Kim, M.-R., Bedgar, D.L., Moinuddin, S.G.A., Cardenas, C.L., Davin, L.B., Kang, C.-H., Lewis, N.G., 2004. Functional reclassification of the putative cinnamyl alcohol dehydrogenase multigene family in Arabidopsis. Proc. Natl. Acad. Sci. USA 101, 1455-1460.], and analysis of a double mutant [Sibout, R., Eudes, A., Mouille, G., Pollet, B., Lapierre, C., Jouanin, L., Séguin A., 2005. Cinnamyl Alcohol Dehydrogenase-C and -D are the primary genes involved in lignin biosynthesis in the floral stem of Arabidopsis. Plant Cell 17, 2059-2076.], both AtCAD5 (At4g34230) and AtCAD4 (At3g19450) were found to have expression patterns consistent with development/formation of different forms of the lignified vascular apparatus, e.g. lignifying stem tissues, bases of trichomes, hydathodes, abscission zones of siliques, etc. Expression was also observed in various non-lignifying zones (e.g. root caps) indicative of, perhaps, a role in plant defense. In addition, expression patterns of the four CAD-like homologues were investigated, i.e. AtCAD2 (At2g21730), AtCAD3 (At2g21890), AtCAD7 (At4g37980) and AtCAD8 (At4g37990), each of which previously had been demonstrated to have low CAD

  14. Expression and significance of cyclooxygenase-2 mRNA in benign and malignant ascites

    Science.gov (United States)

    Lu, Jing; Li, Xiao-Feng; Kong, Li-Xia; Ma, Lin; Liao, Su-Huan; Jiang, Chang-You

    2013-01-01

    AIM: To investigate the mRNA expression of cyclooxygensae-2 (COX-2) in benign and malignant ascites, and to explore the difference in COX-2 mRNA expression among different diseases. METHODS: A total of 36 samples were collected from the Fifth Affiliated Hospital of Sun Yat-Sen University and divided into two experimental groups: benign ascites (n = 21) and malignant ascites (n = 15). Benign ascites included cirrhotic ascites (n = 10) and tuberculous ascites (n = 5). Malignant ascites included oophoroma (n = 7), cancer of colon (n = 5), cancer of the liver (n = 6), gastric cancer (n = 2), and bladder carcinoma (n = 1). The mRNA expression of COX-2 in ascites was examined with reverse transcriptase polymerase chain reaction (RT-PCR) technology, and the positive rate of COX-2 mRNA was compared between different diseases. RESULTS: The positive rate of COX-2 mRNA in malignant ascites was 42.9% (9/21), which was significantly higher than in benign ascites, 6.7% (1/15), difference being significant between these two groups (χ2 = 4.051, P = 0.044). The proportion of the positive rate in the malignant ascites was as follows: ovarian cancers 57.1% (4/7), colon cancer 40.0% (2/5), liver cancer 33.3% (2/6), gastric cancer 50.0% (1/2), and bladder cancer 0.00% (0/1). However, there was no significant difference in COX-2 mRNA expression among various tumors with malignant ascites (χ2 = 1.614, P = 0.806). Among the benign ascites, COX-2 mRNA levels were different between the tuberculous ascites (0/5) and cirrhotic ascites (1/10), but there was no significant difference (P = 1.000). CONCLUSION: COX-2 mRNA, detected by RT-PCR, is useful in the differential diagnosis of benign and malignant ascites, which also has potential value in the clinical diagnosis of tumors. PMID:24187465

  15. Differential expression of ozone-induced gene during exposures to ...

    African Journals Online (AJOL)

    Differential expression of ozone-induced gene during exposures to salt stress in Polygonum sibiricum Laxm leaves, stem and underground stem. ... PcOZI-1 mRNA in untreated plants was detected at low levels in underground stem, leaves and at higher levels in stem. PcOZI-1 mRNA accumulation was transiently induced ...

  16. mRNA Cancer Vaccines-Messages that Prevail.

    Science.gov (United States)

    Grunwitz, Christian; Kranz, Lena M

    2017-01-01

    During the last decade, mRNA became increasingly recognized as a versatile tool for the development of new innovative therapeutics. Especially for vaccine development, mRNA is of outstanding interest and numerous clinical trials have been initiated. Strikingly, all of these studies have proven that large-scale GMP production of mRNA is feasible and concordantly report a favorable safety profile of mRNA vaccines. Induction of T-cell immunity is a multi-faceted process comprising antigen acquisition, antigen processing and presentation, as well as immune stimulation. The effectiveness of mRNA vaccines is critically dependent on making the antigen(s) of interest available to professional antigen-presenting cells, especially DCs. Efficient delivery of mRNA into DCs in vivo remains a major challenge in the mRNA vaccine field. This review summarizes the principles of mRNA vaccines and highlights the importance of in vivo mRNA delivery and recent advances in harnessing their therapeutic potential.

  17. Serotonin receptor, SERT mRNA and correlations with symptoms in males with alcohol dependence and suicide.

    Science.gov (United States)

    Thompson, P M; Cruz, D A; Olukotun, D Y; Delgado, P L

    2012-09-01

    This study tested the hypothesis that abnormalities in components of the serotonin (5HT) system in the prefrontal cortex are associated with suicide in alcohol-dependent subjects. Second, we assessed the relationship of lifetime impulsivity and mood symptoms with prefrontal cortex 5-HT measures. Tissue was obtained from Brodmann's areas (BA) 9 and 24 in postmortem samples of individuals who were alcohol dependent with suicide (n = 5), alcohol dependent without suicide (n = 9) and normal controls (n = 5). Serotonin receptor (5HT) and serotonin reuptake transporter (SERT) mRNA were measured. Interviews with next of kin estimated lifetime impulsivity and mood symptoms in the last week of life. Serotonin receptor 1A (5HT1A) mRNA in BA 9 was elevated in the alcohol dependence without suicide group compared with controls. In the alcohol dependence with suicide group, anxiety symptoms were associated with decreased BA 24 SERT mRNA and depressive symptoms with BA 9 5HT1A mRNA expression. In the alcohol dependent only group impulsivity is correlated with increased BA 9, and BA 24 serotonin receptor 2A mRNA. Our data suggest region-specific change, rather than global serotonin blunting is involved in alcohol dependence and suicide. It also suggests that symptoms are differentially influenced by prefrontal cortex serotonin receptor mRNA levels. © 2011 John Wiley & Sons A/S.

  18. CYP3A5 mRNA degradation by nonsense-mediated mRNA decay.

    Science.gov (United States)

    Busi, Florent; Cresteil, Thierry

    2005-09-01

    The total CYP3A5 mRNA level is significantly greater in carriers of the CYP3A5*1 allele than in CYP3A5*3 homozygotes. Most of the CYP3A5*3 mRNA includes an intronic sequence (exon 3B) containing premature termination codons (PTCs) between exons 3 and 4. Two models were used to investigate the degradation of CYP3A5 mRNA: a CYP3A5 minigene consisting of CYP3A5 exons and introns 3 to 6 transfected into MCF7 cells, and the endogenous CYP3A5 gene expressed in HepG2 cells. The 3'-untranslated region g.31611C>T mutation has no effect on CYP3A5 mRNA decay. Splice variants containing exon 3B were more unstable than wild-type (wt) CYP3A5 mRNA. Cycloheximide prevents the recognition of PTCs by ribosomes: in transfected MCF7 and HepG2 cells, cycloheximide slowed down the degradation of exon 3B-containing splice variants, suggesting the participation of nonsense-mediated decay (NMD). When PTCs were removed from pseudoexon 3B or when UPF1 small interfering RNA was used to impair the NMD mechanism, the decay of the splice variant was reduced, confirming the involvement of NMD in the degradation of CYP3A5 splice variants. Induction could represent a source of variability for CYP3A5 expression and could modify the proportion of splice variants. The extent of CYP3A5 induction was investigated after exposure to barbiturates or steroids: CYP3A4 was markedly induced in a pediatric population compared with untreated neonates. However, no effect could be detected in either the total CYP3A5 RNA, the proportion of splice variant RNA, or the protein level. Therefore, in these carriers, induction is unlikely to switch on the phenotypic CYP3A5 expression in carriers of CYP3A5*3/*3.

  19. Phagosome maturation in unicellular eukaryote Paramecium: the presence of RILP, Rab7 and LAMP-2 homologues

    Directory of Open Access Journals (Sweden)

    E Wyroba

    2009-08-01

    Full Text Available Phagosome maturation is a complex process enabling degradation of internalised particles. Our data obtained at the gene, protein and cellular level indicate that the set of components involved in this process and known up to now in mammalian cells is functioning in unicellular eukaryote. Rab7-interacting partners: homologues of its effector RILP (Rab-interacting lysosomal protein and LAMP-2 (lysosomal membrane protein 2 as well as a7 subunit of the 26S proteasome were revealed in Paramecium phagolysosomal compartment. We identified the gene/transcript fragments encoding RILP-related proteins (RILP1 and RILP2 in Paramecium by PCR/RT-PCR and sequencing. The deduced amino acid sequences of RILP1 and RILP2 show 60.5% and 58.3% similarity, respectively, to the region involved in regulating of lysosomal morphology and dynein-dynactin recruitment of human RILP. RILP colocalised with Rab7 in Paramecium lysosomes and at phagolysosomal membrane during phagocytosis of both the latex beads and bacteria. In the same compartment LAMP-2 was present and its expression during latex internalisation was 2.5-fold higher than in the control when P2 protein fractions (100 000 x g of equal load were quantified by immunoblotting. LAMP-2 crossreacting polypeptide of ~106 kDa was glycosylated as shown by fluorescent and Western analysis of the same blot preceded by PNGase F treatment. The a7 subunit of 26S proteasome was detected close to the phagosomal membrane in the small vesicles, in some of which it colocalised with Rab7. Immunoblotting confirmed presence of RILPrelated polypeptide and a7 subunit of 26S proteasome in Paramecium protein fractions. These results suggest that Rab7, RILP and LAMP-2 may be involved in phagosome maturation in Paramecium.

  20. Synthesis, electrochemistry, and electrogenerated chemiluminescence of two BODIPY-appended bipyridine homologues.

    Science.gov (United States)

    Qi, Honglan; Teesdale, Justin J; Pupillo, Rachel C; Rosenthal, Joel; Bard, Allen J

    2013-09-11

    Two new 2,2'-bipyridine (bpy) derivatives containing ancillary BODIPY chromophores attached at the 5- and 5'-positions (BB3) or 6- and 6'-positions (BB4) were prepared and characterized. In this work, the basic photophysics, electrochemistry, and electrogenerated chemiluminescence (ECL) of BB3 and BB4 are compared with those previously reported for a related bpy-BODIPY derivative (BB2) (J. Phys. Chem. C 2011, 115, 17993-18001). Cyclic voltammetry revealed that BB3 and BB4 display reversible 2e(-) oxidation and reduction waves, which consist of two closely spaced (50-70 mV) 1e(-) events. This redox behavior is consistent with the frontier molecular orbitals calculated for BB3 and BB4 and indicates that the 2,2'-bipyridine spacer of each bpy-BODIPY homologue does not facilitate efficient electronic communication between the tethered indacene units. In the presence of a coreactant such as tri-n-propylamine (TPA) or benzoyl peroxide (BPO), BB3 and BB4 exhibit strong ECL and produce spectra that are very similar to their corresponding photoluminescence profiles. The ECL signal obtained under annihilation conditions, however, is significantly different and is characterized by two distinct bands. One of these bands is centered at ∼570 nm and is attributed to emission via an S- or T-route. The second band occurs at longer wavelengths and is centered around ∼740 nm. The shape and concentration dependence of this long-wavelength ECL signal is not indicative of emission from an excimer or aggregate, but rather it suggests that a new emissive species is formed from the bpy-BODIPY luminophores during the annihilation process.

  1. Characterization of a novel organic solute transporter homologue from Clonorchis sinensis.

    Directory of Open Access Journals (Sweden)

    Yanyan Lu

    2018-04-01

    Full Text Available Clonorchis sinensis is a liver fluke that can dwell in the bile ducts of mammals. Bile acid transporters function to maintain the homeostasis of bile acids in C. sinensis, as they induce physiological changes or have harmful effects on C. sinensis survival. The organic solute transporter (OST transports mainly bile acid and belongs to the SLC51 subfamily of solute carrier transporters. OST plays a critical role in the recirculation of bile acids in higher animals. In this study, we cloned full-length cDNA of the 480-amino acid OST from C. sinensis (CsOST. Genomic analysis revealed 11 exons and nine introns. The CsOST protein had a 'Solute_trans_a' domain with 67% homology to Schistosoma japonicum OST. For further analysis, the CsOST protein sequence was split into the ordered domain (CsOST-N at the N-terminus and disordered domain (CsOST-C at the C-terminus. The tertiary structure of each domain was built using a threading-based method and determined by manual comparison. In a phylogenetic tree, the CsOST-N domain belonged to the OSTα and CsOST-C to the OSTβ clade. These two domains were more highly conserved with the OST α- and β-subunits at the structure level than at sequence level. These findings suggested that CsOST comprised the OST α- and β-subunits. CsOST was localized in the oral and ventral suckers and in the mesenchymal tissues abundant around the intestine, vitelline glands, uterus, and testes. This study provides fundamental data for the further understanding of homologues in other flukes.

  2. Characterization of a novel organic solute transporter homologue from Clonorchis sinensis

    Science.gov (United States)

    Dai, Fuhong; Lee, Ji-Yun; Pak, Jhang Ho; Sohn, Woon-Mok

    2018-01-01

    Clonorchis sinensis is a liver fluke that can dwell in the bile ducts of mammals. Bile acid transporters function to maintain the homeostasis of bile acids in C. sinensis, as they induce physiological changes or have harmful effects on C. sinensis survival. The organic solute transporter (OST) transports mainly bile acid and belongs to the SLC51 subfamily of solute carrier transporters. OST plays a critical role in the recirculation of bile acids in higher animals. In this study, we cloned full-length cDNA of the 480-amino acid OST from C. sinensis (CsOST). Genomic analysis revealed 11 exons and nine introns. The CsOST protein had a ‘Solute_trans_a’ domain with 67% homology to Schistosoma japonicum OST. For further analysis, the CsOST protein sequence was split into the ordered domain (CsOST-N) at the N-terminus and disordered domain (CsOST-C) at the C-terminus. The tertiary structure of each domain was built using a threading-based method and determined by manual comparison. In a phylogenetic tree, the CsOST-N domain belonged to the OSTα and CsOST-C to the OSTβ clade. These two domains were more highly conserved with the OST α- and β-subunits at the structure level than at sequence level. These findings suggested that CsOST comprised the OST α- and β-subunits. CsOST was localized in the oral and ventral suckers and in the mesenchymal tissues abundant around the intestine, vitelline glands, uterus, and testes. This study provides fundamental data for the further understanding of homologues in other flukes. PMID:29702646

  3. Regulation of Metalloprotease Gene Expression in Vibrio vulnificus by a Vibrio harveyi LuxR Homologue

    Science.gov (United States)

    Shao, Chung-Ping; Hor, Lien-I

    2001-01-01

    Expression of the Vibrio vulnificus metalloprotease gene, vvp, was turned up rapidly when bacterial growth reached the late log phase. A similar pattern of expression has been found in the metalloprotease gene of Vibrio cholerae, and this has been shown to be regulated by a Vibrio harveyi LuxR-like transcriptional activator. To find out whether a LuxR homologue exists in V. vulnificus, a gene library of this organism was screened by colony hybridization using a probe derived from a sequence that is conserved in various luxR-like genes of vibrios. A gene containing a 618-bp open reading frame was identified and found to be identical to the smcR gene of V. vulnificus reported previously. An isogenic SmcR-deficient (RD) mutant was further constructed by an in vivo allelic exchange technique. This mutant exhibited an extremely low level of vvp transcription compared with that of the parent strain. On the other hand, the cytolysin gene, vvhA, was expressed at a higher level in the RD mutant than in the parent strain during the log phase of growth. These data suggested that SmcR might not only be a positive regulator of the protease gene but might also be involved in negative regulation of the cytolysin gene. Virulence of the RD mutant in either normal or iron-overloaded mice challenged by intraperitoneal injection was comparable to that of the parent strain, indicating that SmcR is not required for V. vulnificus virulence in mice. PMID:11157950

  4. Development and mapping of SSR markers linked to resistance-gene homologue clusters in common bean

    Institute of Scientific and Technical Information of China (English)

    Luz; Nayibe; Garzon; Matthew; Wohlgemuth; Blair

    2014-01-01

    Common bean is an important but often a disease-susceptible legume crop of temperate,subtropical and tropical regions worldwide. The crop is affected by bacterial, fungal and viral pathogens. The strategy of resistance-gene homologue(RGH) cloning has proven to be an efficient tool for identifying markers and R(resistance) genes associated with resistances to diseases. Microsatellite or SSR markers can be identified by physical association with RGH clones on large-insert DNA clones such as bacterial artificial chromosomes(BACs). Our objectives in this work were to identify RGH-SSR in a BAC library from the Andean genotype G19833 and to test and map any polymorphic markers to identify associations with known positions of disease resistance genes. We developed a set of specific probes designed for clades of common bean RGH genes and then identified positive BAC clones and developed microsatellites from BACs having SSR loci in their end sequences. A total of 629 new RGH-SSRs were identified and named BMr(bean microsatellite RGH-associated markers). A subset of these markers was screened for detecting polymorphism in the genetic mapping population DOR364 × G19833. A genetic map was constructed with a total of 264 markers,among which were 80 RGH loci anchored to single-copy RFLP and SSR markers. Clusters of RGH-SSRs were observed on most of the linkage groups of common bean and in positions associated with R-genes and QTL. The use of these new markers to select for disease resistance is discussed.

  5. Neurophysiological Evidence That Musical Training Influences the Recruitment of Right Hemispheric Homologues for Speech Perception

    Directory of Open Access Journals (Sweden)

    McNeel Gordon Jantzen

    2014-03-01

    Full Text Available Musicians have a more accurate temporal and tonal representation of auditory stimuli than their non-musician counterparts (Kraus & Chandrasekaran, 2010; Parbery-Clark, Skoe, & Kraus, 2009; Zendel & Alain, 2008; Musacchia, Sams, Skoe, & Kraus, 2007. Musicians who are adept at the production and perception of music are also more sensitive to key acoustic features of speech such as voice onset timing and pitch. Together, these data suggest that musical training may enhance the processing of acoustic information for speech sounds. In the current study, we sought to provide neural evidence that musicians process speech and music in a similar way. We hypothesized that for musicians, right hemisphere areas traditionally associated with music are also engaged for the processing of speech sounds. In contrast we predicted that in non-musicians processing of speech sounds would be localized to traditional left hemisphere language areas. Speech stimuli differing in voice onset time was presented using a dichotic listening paradigm. Subjects either indicated aural location for a specified speech sound or identified a specific speech sound from a directed aural location. Musical training effects and organization of acoustic features were reflected by activity in source generators of the P50. This included greater activation of right middle temporal gyrus (MTG and superior temporal gyrus (STG in musicians. The findings demonstrate recruitment of right hemisphere in musicians for discriminating speech sounds and a putative broadening of their language network. Musicians appear to have an increased sensitivity to acoustic features and enhanced selective attention to temporal features of speech that is facilitated by musical training and supported, in part, by right hemisphere homologues of established speech processing regions of the brain.

  6. Synthesis, Electrochemistry and Electrogenerated Chemiluminesce of two BODIPY-Appended Bipyridine Homologues

    Science.gov (United States)

    Qi, Honglan; Teesdale, Justin J.; Pupillo, Rachel C.

    2014-01-01

    Two new 2,2’-bipyridine (bpy) derivatives containing ancillary BODIPY chromophores attached at the 5- and 5’-positions (BB3) or 6- and 6’-positions (BB4) were prepared and characterized. In this work, the basic photophysics, electrochemistry and electrogenerated chemiluminescence (ECL) of BB3 and BB4 are compared with those previously reported for a related bpy-BODIPY derivative (BB2) (J. Phys. Chem. C 2011, 115, 17993–18001). Cyclic voltammetry revealed that BB3 and BB4 display reversible 2e− oxidation and reduction waves, which consist of two closely spaced (50 – 70 mV) 1e− events. This redox behavior is consistent with the frontier molecular orbitals calculated for BB3 and BB4 and indicates that the 2,2’-bipyridine spacer of each bpy- BODIPY homologue does not facilitate efficient electronic communication between the tethered indacene units. In the presence of a coreactant such as tri-n-propylamine (TPA) or benzoyl peroxide (BPO), BB3 and BB4 exhibit strong ECL and produce spectra that are very similar to their corresponding photoluminescence profiles. The ECL signal obtained under annihilation conditions, however, is significantly different and is characterized by two distinct bands. One of these bands is centered at ~570 nm and is attributed to emission via an S- or T-route. The second band, occurs at longer wavelengths and is centered around ~740 nm. The shape and concentration dependence of this long-wavelength ECL signal is not indicative of emission from an excimer or aggregate, but rather is suggests that a new emissive species is formed from the bpy-BODIPY luminophores during the annihilation process. PMID:23980850

  7. Green tea increases anti-inflammatory tristetraprolin and decreases pro-inflammatory tumor necrosis factor mRNA levels in rats

    Directory of Open Access Journals (Sweden)

    Roussel Anne M

    2007-01-01

    Full Text Available Abstract Background Tristetraprolin (TTP/ZFP36 family proteins have anti-inflammatory activity by binding to and destabilizing pro-inflammatory mRNAs such as Tnf mRNA, and represent a potential therapeutic target for inflammation-related diseases. Tea has anti-inflammatory properties but the molecular mechanisms have not been completely elucidated. We hypothesized that TTP and/or its homologues might contribute to the beneficial effects of tea as an anti-inflammatory product. Methods Quantitative real-time PCR was used to investigate the effects of green tea (0, 1, and 2 g solid extract/kg diet on the expression of Ttp family genes (Ttp/Tis11/Zfp36, Zfp36l1/Tis11b, Zfp36l2/Tis11d, Zfp36l3, pro-inflammatory genes (Tnf, Csf2/Gm-csf, Ptgs2/Cox2, and Elavl1/Hua/Hur and Vegf genes in liver and muscle of rats fed a high-fructose diet known to induce insulin resistance, oxidative stress, inflammation, and TNF-alpha levels. Results Ttp and Zfp36l1 mRNAs were the major forms in both liver and skeletal muscle. Ttp, Zfp36l1, and Zfp36l2 mRNA levels were more abundant in the liver than those in the muscle. Csf2/Gm-csf and Zfp36l3 mRNAs were undetectable in both tissues. Tea (1 g solid extract/kg diet increased Ttp mRNA levels by 50–140% but Tnf mRNA levels decreased by 30% in both tissues, and Ptgs2/Cox2 mRNA levels decreased by 40% in the muscle. Tea (2 g solid extract/kg diet increased Elavl1/Hua/Hur mRNA levels by 40% in the liver but did not affect any of the other mRNA levels in liver or muscle. Conclusion These results show that tea can modulate Ttp mRNA levels in animals and suggest that a post-transcriptional mechanism through TTP could partially account for tea's anti-inflammatory properties. The results also suggest that drinking adequate amounts of green tea may play a role in the prevention of inflammation-related diseases.

  8. Differential display-mediated identification of three drought

    Indian Academy of Sciences (India)

    L.) O. Kuntze], a woody and perennial plant of commercial importance. Using differential display of mRNA, three drought-modulated expressed sequence tags (ESTs) were identified. Northern and BLAST analysis revealed that clone dr1 ...

  9. Presence of albumin mRNA precursors in nuclei of analbuminemic rat liver lacking cytoplasmic albumin mRNA.

    OpenAIRE

    Esumi, H; Takahashi, Y; Sekiya, T; Sato, S; Nagase, S; Sugimura, T

    1982-01-01

    Analbuminemic rats, which lack serum albumin, were previously found to have no albumin mRNA in the cytoplasm of the liver. In the present study, the existence of nuclear albumin mRNA precursors in the liver of analbuminemic rats was examined by RNA X cDNA hybridization kinetics. Albumin mRNA precursors were present in the nuclei of analbuminemic rat liver at almost normal levels, despite the absence of albumin mRNA from the cytoplasm. Nuclear RNA of analbuminemic rat liver was subjected to el...

  10. ErbB3 mRNA leukocyte levels as a biomarker for major depressive disorder

    Directory of Open Access Journals (Sweden)

    Milanesi Elena

    2012-09-01

    Full Text Available Abstract Background In recent years, the identification of peripheral biomarkers that are associated with psychiatric diseases, such as Major Depressive Disorder (MDD, has become relevant because these biomarkers may improve the efficiency of the differential diagnosis process and indicate targets for new antidepressant drugs. Two recent candidate genes, ErbB3 and Fgfr1, are growth factors whose mRNA levels have been found to be altered in the leukocytes of patients that are affected by bipolar disorder in a depressive state. On this basis, the aim of the study was to determine if ErbB3 and Fgfr1 mRNA levels could be a biomarkers of MDD. Methods We measured by Real Time PCR ErbB3 and Fgfr1 mRNA expression levels in leukocytes of MDD patients compared with controls. Successively, to assess whether ErbB3 mRNA levels were influenced by previous antidepressant treatment we stratified our patients sample in two cohorts, comparing drug-naive versus drug-free patients. Moreover, we evaluated the levels of the transcript in MDD patients after 12 weeks of antidepressant treatment, and in prefrontal cortex of rats stressed and treated with an antidepressant drug of the same class. Results These results showed that ErbB3 but not Fgfr1 mRNA levels were reduced in leukocytes of MDD patients compared to healthy subjects. Furthermore, ErbB3 levels were not affected by antidepressant treatment in either human or animal models Conclusions Our data suggest that ErbB3 might be considered as a biomarker for MDD and that its deficit may underlie the pathopsysiology of the disease and is not a consequence of treatment. Moreover the study supports the usefulness of leukocytes as a peripheral system for identifying biomarkers in psychiatric diseases.

  11. Combining miRNA and mRNA Expression Profiles in Wilms Tumor Subtypes

    Directory of Open Access Journals (Sweden)

    Nicole Ludwig

    2016-03-01

    Full Text Available Wilms tumor (WT is the most common childhood renal cancer. Recent findings of mutations in microRNA (miRNA processing proteins suggest a pivotal role of miRNAs in WT genesis. We performed miRNA expression profiling of 36 WTs of different subtypes and four normal kidney tissues using microarrays. Additionally, we determined the gene expression profile of 28 of these tumors to identify potentially correlated target genes and affected pathways. We identified 85 miRNAs and 2107 messenger RNAs (mRNA differentially expressed in blastemal WT, and 266 miRNAs and 1267 mRNAs differentially expressed in regressive subtype. The hierarchical clustering of the samples, using either the miRNA or mRNA profile, showed the clear separation of WT from normal kidney samples, but the miRNA pattern yielded better separation of WT subtypes. A correlation analysis of the deregulated miRNA and mRNAs identified 13,026 miRNA/mRNA pairs with inversely correlated expression, of which 2844 are potential interactions of miRNA and their predicted mRNA targets. We found significant upregulation of miRNAs-183, -301a/b and -335 for the blastemal subtype, and miRNAs-181b, -223 and -630 for the regressive subtype. We found marked deregulation of miRNAs regulating epithelial to mesenchymal transition, especially in the blastemal subtype, and miRNAs influencing chemosensitivity, especially in regressive subtypes. Further research is needed to assess the influence of preoperative chemotherapy and tumor infiltrating lymphocytes on the miRNA and mRNA patterns in WT.

  12. Increased IL-10 mRNA and IL-23 mRNA expression in multiple sclerosis

    DEFF Research Database (Denmark)

    Krakauer, Martin; Sorensen, P; Khademi, M

    2008-01-01

    BACKGROUND: Interferon (IFN)-beta therapy in multiple sclerosis (MS) has been suggested to promote a deviation from T lymphocyte production of pathogenic Th1 cytokines to less detrimental Th2 cytokines, but this is still controversial. We studied patterns of in vivo blood mononuclear cell (MNC...... of any Th1 or Th2 cytokines. The largest changes in cytokine mRNA levels occurred early (~9-12 h) after an IFN-beta injection. CONCLUSION: We found no evidence of a Th1- or Th2-mRNA-promoting effect of IFN-beta therapy. The therapeutic effect of IFN-beta is more likely attributable to the induction...

  13. Bombyx mori nucleopolyhedrovirus nucleic acid binding proteins BRO-B and BRO-E associate with host T-cell intracellular antigen 1 homologue BmTRN-1 to influence protein synthesis during infection.

    Science.gov (United States)

    Kotani, Eiji; Muto, Sayaka; Ijiri, Hiroshi; Mori, Hajime

    2015-07-01

    Previous reports have indicated that the Bombyx mori nucleopolyhedrovirus (BmNPV) nucleic acid binding proteins BRO-B and BRO-E are expressed during the early stage of infection and that the BRO family likely supports the regulation of mRNA; however, no study has directly examined the function of BRO family proteins in virus-permissive cells. Here, we show that BRO-B and BRO-E associate with cellular T-cell intracellular antigen 1 homologue (BmTRN-1), a translational regulator, and other cellular translation-related proteins in silkworm cells during viral infection. We created BM-N cells that expressed BRO-B/E to study molecular interactions between BmTRN-1 and BRO-B/E and how they influenced protein synthesis. Fluorescent microscopy revealed that BmTRN-1 was localized in cytoplasmic foci during BmNPV infection. Immunofluorescence studies confirmed that BmTRN-1 and BRO-B/E were colocalized in the amorphous conspicuous cytoplasmic foci. Reporter gene studies revealed that co-expression of BRO-B/E synergistically led to a significant decrease in protein synthesis from a designed transcript carrying the 5'untranslated region of a cellular mRNA with no significant change of transcript abundance. Additionally, RNA interference-mediated knockdown of BmTRN-1 resulted in a marked inhibition of the ability of BRO-B/E to regulate the transcript. These results suggested that the association of BmTRN-1 with BRO-B/E is responsible for the inhibitory regulation of certain mRNAs at the post-transcriptional level and add an additional mechanism for how baculoviruses control protein synthesis during infection.

  14. Broad anti-HIV activity of the Oscillatoria agardhii agglutinin homologue lectin family.

    Science.gov (United States)

    Férir, Geoffrey; Huskens, Dana; Noppen, Sam; Koharudin, Leonardus M I; Gronenborn, Angela M; Schols, Dominique

    2014-10-01

    Oscillatoria agardhii agglutinin homologue (OAAH) proteins belong to a recently discovered lectin family. The founding member OAA and a designed hybrid OAAH (OPA) recognize similar but unique carbohydrate structures of Man-9, compared with other antiviral carbohydrate-binding agents (CBAs). These two newly described CBAs were evaluated for their inactivating properties on HIV replication and transmission and for their potential as microbicides. Various cellular assays were used to determine antiviral activity against wild-type and certain CBA-resistant HIV-1 strains: (i) free HIV virion infection in human T lymphoma cell lines and PBMCs; (ii) syncytium formation assay using persistently HIV-infected T cells and non-infected CD4+ T cells; (iii) DC-SIGN-mediated viral capture; and (iv) transmission to uninfected CD4+ T cells. OAA and OPA were also evaluated for their mitogenic properties and potential synergistic effects using other CBAs. OAA and OPA inhibit HIV replication, syncytium formation between HIV-1-infected and uninfected T cells, DC-SIGN-mediated HIV-1 capture and transmission to CD4+ target T cells, thereby rendering a variety of HIV-1 and HIV-2 clinical isolates non-infectious, independent of their coreceptor use. Both CBAs competitively inhibit the binding of the Manα(1-2)Man-specific 2G12 monoclonal antibody (mAb) as shown by flow cytometry and surface plasmon resonance analysis. The HIV-1 NL4.3(2G12res), NL4.3(MVNres) and IIIB(GRFTres) strains were equally inhibited as the wild-type HIV-1 strains by these CBAs. Combination studies indicate that OAA and OPA act synergistically with Hippeastrum hybrid agglutinin, 2G12 mAb and griffithsin (GRFT), with the exception of OPA/GRFT. OAA and OPA are unique CBAs with broad-spectrum anti-HIV activity; however, further optimization will be necessary for microbicidal application. © The Author 2014. Published by Oxford University Press on behalf of the British Society for Antimicrobial Chemotherapy. All rights

  15. Expression patterns of Passiflora edulis APETALA1/FRUITFULL homologues shed light onto tendril and corona identities

    Directory of Open Access Journals (Sweden)

    Livia C. T. Scorza

    2017-02-01

    Full Text Available Abstract Background Passiflora (passionflowers makes an excellent model for studying plant evolutionary development. They are mostly perennial climbers that display axillary tendrils, which are believed to be modifications of the inflorescence. Passionflowers are also recognized by their unique flower features, such as the extra whorls of floral organs composed of corona filaments and membranes enclosing the nectary. Although some work on Passiflora organ ontogeny has been done, the developmental identity of both Passiflora tendrils and the corona is still controversial. Here, we combined ultrastructural analysis and expression patterns of the flower meristem and floral organ identity genes of the MADS-box AP1/FUL clade to reveal a possible role for these genes in the generation of evolutionary novelties in Passiflora. Results We followed the development of structures arising from the axillary meristem from juvenile to adult phase in P. edulis. We further assessed the expression pattern of P. edulis AP1/FUL homologues (PeAP1 and PeFUL, by RT-qPCR and in situ hybridization in several tissues, correlating it with the developmental stages of P. edulis. PeAP1 is expressed only in the reproductive stage, and it is highly expressed in tendrils and in flower meristems from the onset of their development. PeAP1 is also expressed in sepals, petals and in corona filaments, suggesting a novel role for PeAP1 in floral organ diversification. PeFUL presented a broad expression pattern in both vegetative and reproductive tissues, and it is also expressed in fruits. Conclusions Our results provide new molecular insights into the morphological diversity in the genus Passiflora. Here, we bring new evidence that tendrils are part of the Passiflora inflorescence. This points to the convergence of similar developmental processes involving the recruitment of genes related to flower identity in the origin of tendrils in different plant families. The data obtained also

  16. Validating tyrosinase homologue melA as a photoacoustic reporter gene for imaging Escherichia coli

    Science.gov (United States)

    Paproski, Robert J.; Li, Yan; Barber, Quinn; Lewis, John D.; Campbell, Robert E.; Zemp, Roger

    2015-10-01

    To understand the pathogenic processes for infectious bacteria, appropriate research tools are required for replicating and characterizing infections. Fluorescence and bioluminescence imaging have primarily been used to image infections in animal models, but optical scattering in tissue significantly limits imaging depth and resolution. Photoacoustic imaging, which has improved depth-to-resolution ratio compared to conventional optical imaging, could be useful for visualizing melA-expressing bacteria since melA is a bacterial tyrosinase homologue which produces melanin. Escherichia coli-expressing melA was visibly dark in liquid culture. When melA-expressing bacteria in tubes were imaged with a VisualSonics Vevo LAZR system, the signal-to-noise ratio of a 9× dilution sample was 55, suggesting that ˜20 bacteria cells could be detected with our system. Multispectral (680, 700, 750, 800, 850, and 900 nm) analysis of the photoacoustic signal allowed unmixing of melA-expressing bacteria from blood. To compare photoacoustic reporter gene melA (using Vevo system) with luminescent and fluorescent reporter gene Nano-lantern (using Bruker Xtreme In-Vivo system), tubes of bacteria expressing melA or Nano-lantern were submerged 10 mm in 1% Intralipid, spaced between melA-expressing bacteria even when the tubes were less than 1 mm from each other, while bioluminescence and fluorescence imaging could not resolve the two tubes of Nano-lantern-expressing bacteria even when the tubes were spaced 10 mm from each other. After injecting 100-μL of melA-expressing bacteria in the back flank of a chicken embryo, photoacoustic imaging allowed visualization of melA-expressing bacteria up to 10-mm deep into the embryo. Photoacoustic signal from melA could also be separated from deoxy- and oxy-hemoglobin signal observed within the embryo and chorioallantoic membrane. Our results suggest that melA is a useful photoacoustic reporter gene for visualizing bacteria, and further work

  17. Aplasia Ras homologue member Ⅰ overexpression inhibits tumor growth and induces apoptosis through inhibition of PI3K/Akt survival pathways in human osteosarcoma MG-63 cells in culture.

    Science.gov (United States)

    Ye, Kaishan; Wang, Shuanke; Yang, Yong; Kang, Xuewen; Wang, Jing; Han, Hua

    2015-09-01

    Aplasia Ras homologue member Ⅰ (ARHI), an imprinted tumor-suppressor gene, is downregulated in various types of cancer. However, the expression, function and specific mechanisms of ARHI in human osteosarcoma (OS) cells remain unclear. The aim of the present study was to assess the effect of ARHI on OS cell proliferation and apoptosis and its associated mechanism. In the study, ARHI mRNA and protein levels were markedly downregulated in OS cells compared with the human osteoblast precursor cell line hFOB1.19. By generating stable transfectants, ARHI was overexpressed in OS cells that had low levels of ARHI. Overexpression of ARHI inhibited cell viability and proliferation and induced apoptosis. However, caspase‑3 activity was not changed by ARHI overexpression. In addition, phosphorylated Akt protein expression decreased in the ARHI overexpression group compared to that in the control vector group. The knockdown of ARHI also resulted in the promotion of cell proliferation and the attenuation of apoptosis in MG‑63 cells. Additionally, ARHI silencing increased the level of p‑Akt. The present results indicate that ARHI inhibits OS cell proliferation and may have a key role in the development of OS.

  18. Combinatorial programming of human neuronal progenitors using magnetically-guided stoichiometric mRNA delivery.

    Science.gov (United States)

    Azimi, Sayyed M; Sheridan, Steven D; Ghannad-Rezaie, Mostafa; Eimon, Peter M; Yanik, Mehmet Fatih

    2018-05-01

    Identification of optimal transcription-factor expression patterns to direct cellular differentiation along a desired pathway presents significant challenges. We demonstrate massively combinatorial screening of temporally-varying mRNA transcription factors to direct differentiation of neural progenitor cells using a dynamically-reconfigurable magnetically-guided spotting technology for localizing mRNA, enabling experiments on millimetre size spots. In addition, we present a time-interleaved delivery method that dramatically reduces fluctuations in the delivered transcription-factor copy-numbers per cell. We screened combinatorial and temporal delivery of a pool of midbrain-specific transcription factors to augment the generation of dopaminergic neurons. We show that the combinatorial delivery of LMX1A, FOXA2 and PITX3 is highly effective in generating dopaminergic neurons from midbrain progenitors. We show that LMX1A significantly increases TH -expression levels when delivered to neural progenitor cells either during proliferation or after induction of neural differentiation, while FOXA2 and PITX3 increase expression only when delivered prior to induction, demonstrating temporal dependence of factor addition. © 2018, Azimi et al.

  19. Over-expression, purification and characterization of an Asc-1 homologue from Gloeobacter violaceus

    DEFF Research Database (Denmark)

    Wang, Xiaole; Hald, Helle; Ernst, Heidi Asschenfeldt

    2010-01-01

    The human alanine-serine-cysteine transporter 1 (Asc-1) belongs to the slc7a family of solute carrier transporters. Asc-1 mediates the uptake of D-serine in an exchanger-type fashion, coupling the process to the release of alanine and cysteine. Among the bacterial Asc-1 homologues, one transporter...... of auto-induction was crucial for obtaining high yields and purity of the transporter. The transporter was purified with yields in the range of 0.2-0.4 mg per L culture and eluted in a single peak from a size-exclusion column. The circular dichroism spectrum revealed a folded and apparently all...

  20. Mouse Homologue of the Schizophrenia Susceptibility Gene ZNF804A as a Target of Hoxc8

    Directory of Open Access Journals (Sweden)

    Hyun Joo Chung

    2010-01-01

    Full Text Available Using a ChIP-cloning technique, we identified a Zinc finger protein 804a (Zfp804a as one of the putative Hoxc8 downstream target genes. We confirmed binding of Hoxc8 to an intronic region of Zfp804a by ChIP-PCR in F9 cells as well as in mouse embryos. Hoxc8 upregulated Zfp804a mRNA levels and augmented minimal promoter activity in vitro. In E11.5 mouse embryos, Zfp804a and Hoxc8 were coexpressed. Recent genome-wide studies identified Zfp804a (or ZNF804A in humans as a plausible marker for schizophrenia, leading us to hypothesize that this embryogenic regulatory control might also exert influence in development of complex traits such as psychosis.

  1. Genome-wide analysis of miRNA and mRNA transcriptomes during amelogenesis.

    Science.gov (United States)

    Yin, Kaifeng; Hacia, Joseph G; Zhong, Zhe; Paine, Michael L

    2014-11-19

    In the rodent incisor during amelogenesis, as ameloblast cells transition from secretory stage to maturation stage, their morphology and transcriptome profiles change dramatically. Prior whole genome transcriptome analysis has given a broad picture of the molecular activities dominating both stages of amelogenesis, but this type of analysis has not included miRNA transcript profiling. In this study, we set out to document which miRNAs and corresponding target genes change significantly as ameloblasts transition from secretory- to maturation-stage amelogenesis. Total RNA samples from both secretory- and maturation-stage rat enamel organs were subjected to genome-wide miRNA and mRNA transcript profiling. We identified 59 miRNAs that were differentially expressed at the maturation stage relative to the secretory stage of enamel development (False Discovery Rate (FDR)<0.05, fold change (FC)≥1.8). In parallel, transcriptome profiling experiments identified 1,729 mRNA transcripts that were differentially expressed in the maturation stage compared to the secretory stage (FDR<0.05, FC≥1.8). Based on bioinformatics analyses, 5.8% (629 total) of these differentially expressed genes (DEGS) were highlighted as being the potential targets of 59 miRNAs that were differentially expressed in the opposite direction, in the same tissue samples. Although the number of predicted target DEGs was not higher than baseline expectations generated by examination of stably expressed miRNAs, Gene Ontology (GO) analysis showed that these 629 DEGS were enriched for ion transport, pH regulation, calcium handling, endocytotic, and apoptotic activities. Seven differentially expressed miRNAs (miR-21, miR-31, miR-488, miR-153, miR-135b, miR-135a and miR298) in secretory- and/or maturation-stage enamel organs were confirmed by in situ hybridization. Further, we used luciferase reporter assays to provide evidence that two of these differentially expressed miRNAs, miR-153 and miR-31, are potential

  2. Purification, crystallization and preliminary X-ray analysis of SGR6054, a Streptomyces homologue of the mycobacterial integration host factor mIHF

    International Nuclear Information System (INIS)

    Nomoto, Ryohei; Tezuka, Takeaki; Miyazono, Ken-ichi; Tanokura, Masaru; Horinouchi, Sueharu; Ohnishi, Yasuo

    2012-01-01

    A Streptomyces homologue of the mycobacterial integration host factor mIHF was heterologously produced, purified and crystallized in the presence of a 16-mer duplex DNA by the sitting-drop vapour-diffusion method. The best crystal diffracted X-rays to 2.22 Å resolution and belonged to space group C2. The mycobacterial integration host factor (mIHF) is a small nonspecific DNA-binding protein that is essential for the growth of Mycobacterium smegmatis. mIHF homologues are widely distributed among Actinobacteria, and a Streptomyces homologue of mIHF is involved in control of sporulation and antibiotic production in S. coelicolor A3(2). Despite their important biological functions, a structure of mIHF or its homologues has not been elucidated to date. Here, the S. griseus mIHF homologue (SGR6054) was expressed and purified from Escherichia coli and crystallized in the presence of a 16-mer duplex DNA by the sitting-drop vapour-diffusion method. The plate-shaped crystal belonged to space group C2, with unit-cell parameters a = 88.53, b = 69.35, c = 77.71 Å, β = 96.63°, and diffracted X-rays to 2.22 Å resolution

  3. Purification, crystallization and preliminary X-ray analysis of SGR6054, a Streptomyces homologue of the mycobacterial integration host factor mIHF

    Energy Technology Data Exchange (ETDEWEB)

    Nomoto, Ryohei; Tezuka, Takeaki; Miyazono, Ken-ichi; Tanokura, Masaru; Horinouchi, Sueharu; Ohnishi, Yasuo [Graduate School of Agricultural and Life Sciences, The University of Tokyo, 1-1-1 Yayoi, Bunkyo-ku, Tokyo 113-8657 (Japan)

    2012-08-31

    A Streptomyces homologue of the mycobacterial integration host factor mIHF was heterologously produced, purified and crystallized in the presence of a 16-mer duplex DNA by the sitting-drop vapour-diffusion method. The best crystal diffracted X-rays to 2.22 Å resolution and belonged to space group C2. The mycobacterial integration host factor (mIHF) is a small nonspecific DNA-binding protein that is essential for the growth of Mycobacterium smegmatis. mIHF homologues are widely distributed among Actinobacteria, and a Streptomyces homologue of mIHF is involved in control of sporulation and antibiotic production in S. coelicolor A3(2). Despite their important biological functions, a structure of mIHF or its homologues has not been elucidated to date. Here, the S. griseus mIHF homologue (SGR6054) was expressed and purified from Escherichia coli and crystallized in the presence of a 16-mer duplex DNA by the sitting-drop vapour-diffusion method. The plate-shaped crystal belonged to space group C2, with unit-cell parameters a = 88.53, b = 69.35, c = 77.71 Å, β = 96.63°, and diffracted X-rays to 2.22 Å resolution.

  4. Full-length mRNA sequencing uncovers a widespread coupling between transcription initiation and mRNA processing.

    Science.gov (United States)

    Anvar, Seyed Yahya; Allard, Guy; Tseng, Elizabeth; Sheynkman, Gloria M; de Klerk, Eleonora; Vermaat, Martijn; Yin, Raymund H; Johansson, Hans E; Ariyurek, Yavuz; den Dunnen, Johan T; Turner, Stephen W; 't Hoen, Peter A C

    2018-03-29

    The multifaceted control of gene expression requires tight coordination of regulatory mechanisms at transcriptional and post-transcriptional level. Here, we studied the interdependence of transcription initiation, splicing and polyadenylation events on single mRNA molecules by full-length mRNA sequencing. In MCF-7 breast cancer cells, we find 2700 genes with interdependent alternative transcription initiation, splicing and polyadenylation events, both in proximal and distant parts of mRNA molecules, including examples of coupling between transcription start sites and polyadenylation sites. The analysis of three human primary tissues (brain, heart and liver) reveals similar patterns of interdependency between transcription initiation and mRNA processing events. We predict thousands of novel open reading frames from full-length mRNA sequences and obtained evidence for their translation by shotgun proteomics. The mapping database rescues 358 previously unassigned peptides and improves the assignment of others. By recognizing sample-specific amino-acid changes and novel splicing patterns, full-length mRNA sequencing improves proteogenomics analysis of MCF-7 cells. Our findings demonstrate that our understanding of transcriptome complexity is far from complete and provides a basis to reveal largely unresolved mechanisms that coordinate transcription initiation and mRNA processing.

  5. Effects of the deletion of the Escherichia coli frataxin homologue CyaY on the respiratory NADH:ubiquinone oxidoreductase

    Directory of Open Access Journals (Sweden)

    Grauman Peter L

    2007-07-01

    Full Text Available Abstract Background Frataxin is discussed as involved in the biogenesis of iron-sulfur clusters. Recently it was discovered that a frataxin homologue is a structural component of the respiratory NADH:ubiquinone oxidoreductase (complex I in Thermus thermophilus. It was not clear whether frataxin is in general a component of complex I from bacteria. The Escherichia coli homologue of frataxin is coined CyaY. Results We report that complex I is completely assembled to a stable and active enzyme complex equipped with all known iron-sulfur clusters in a cyaY mutant of E. coli. However, the amount of complex I is reduced by one third compared to the parental strain. Western blot analysis and live cell imaging of CyaY engineered with a GFP demonstrated that CyaY is located in the cytoplasm and not attached to the membrane as to be expected if it were a component of complex I. Conclusion CyaY plays a non-essential role in the assembly of complex I in E. coli. It is not a structural component but may transiently interact with the complex.

  6. Research Article Molecular cloning and mRNA expression pattern of ...

    Indian Academy of Sciences (India)

    SAMSUNG

    homologue from the brain of Misgurnus anguillicaudatus using homologous cloning and ... developmental processes, including sex determination, embryonic stem cell ..... anguillicaudatus, possibly aiding in unravelling reproductive biology ... significant difference (p < 0.05) between female and male in the same tissue.

  7. Mucin gene mRNA levels in broilers challenged with eimeria and/or Clostridium perfringens.

    Science.gov (United States)

    Kitessa, Soressa M; Nattrass, Gregory S; Forder, Rebecca E A; McGrice, Hayley A; Wu, Shu-Biao; Hughes, Robert J

    2014-09-01

    The effects of Eimeria (EM) and Clostridium perfringens (CP) challenges on the mRNA levels of genes involved in mucin (Muc) synthesis (Muc2, Muc5ac, Muc13, and trefoil family factor-2 [TFF2]), inflammation (tumor necrosis factor alpha [TNF-alpha] and interleukin-18 [IL-18]), and metabolic processes (cluster of differentiation [CD]36) in the jejunum of broilers were investigated. Two parallel experiments involving 1) EM challenge and 2) EM and CP challenges were conducted. The first experiment was a 2 X 2 study with 12 birds per treatment (N = 48) involving fishmeal substitution (25%) in the diet (FM) and EM challenge. The treatments were: Control (FM-, EM-), Fishmeal (FM+, EM-), EM challenge (FM-, EM+), and fishmeal substitution and EM challenge (FM+, EM+). The second experiment was a 2 X 2 X 2 experiment with six birds per treatment (N = 48) involving fishmeal (FM-, FM+), Eimeria (EM-, EM+), and C perfringens (CP-, CP+). In both arms of the study, male broilers were given a starter diet for the whole period of 16 days, except those assigned to FM+, where 25% of the starter ration was replaced with fishmeal from days 8 to 14. EM inoculation was performed on day 9 and CP inoculation on days 14 and 15. The EM challenge birds were euthanatized for sampling on day 13; postmortem examination and sampling for the Eimeria plus C perfringens challenge arm of the study were on day 16. In the Eimeria challenge arm of the study, fishmeal supplementation significantly suppressed the mRNA levels of TNF-alpha, TFF2, and IL-18 pre-CP inoculation but simultaneously increased the levels of Muc13 and CD36 mRNAs. Birds challenged with Eimeria exhibited increased mRNA levels of Muc13, Muc5ac, TNF-alpha, and IL-18. In the Eimeria and C. perfringens challenge arm, birds exposed to EM challenge exhibited significantly lower mRNA levels of Muc2 and CD36. The mRNA levels of CD36 were also significantly suppressed by CP challenge. Our results showed that the transcription of mucin synthesis

  8. BAY11 enhances OCT4 synthetic mRNA expression in adult human skin cells.

    Science.gov (United States)

    Awe, Jason P; Crespo, Agustin Vega; Li, You; Kiledjian, Megerditch; Byrne, James A

    2013-02-06

    The OCT4 transcription factor is involved in many cellular processes, including development, reprogramming, maintaining pluripotency and differentiation. Synthetic OCT4 mRNA was recently used (in conjunction with other reprogramming factors) to generate human induced pluripotent stem cells. Here, we discovered that BAY 11-7082 (BAY11), at least partially through an NF-κB-inhibition based mechanism, could significantly increase the expression of OCT4 following transfection of synthetic mRNA (synRNA) into adult human skin cells. We tested various chemical and molecular small molecules on their ability to suppress the innate immune response seen upon synthetic mRNA transfection. Three molecules - B18R, BX795, and BAY11 - were used in immunocytochemical and proliferation-based assays. We also utilized global transcriptional meta-analysis coupled with quantitative PCR to identify relative gene expression downstream of OCT4. We found that human skin cells cultured in the presence of BAY11 resulted in reproducible increased expression of OCT4 that did not inhibit normal cell proliferation. The increased levels of OCT4 resulted in significantly increased expression of genes downstream of OCT4, including the previously identified SPP1, DUSP4 and GADD45G, suggesting the expressed OCT4 was functional. We also discovered a novel OCT4 putative downstream target gene SLC16A9 which demonstrated significantly increased expression following elevation of OCT4 levels. For the first time we have shown that small molecule-based stabilization of synthetic mRNA expression can be achieved with use of BAY11. This small molecule-based inhibition of innate immune responses and subsequent robust expression of transfected synthetic mRNAs may have multiple applications for future cell-based research and therapeutics.

  9. mRNA expression of genes regulating lipid metabolism in ringed seals (Pusa hispida) from differently polluted areas

    International Nuclear Information System (INIS)

    Castelli, Martina Galatea; Rusten, Marte; Goksøyr, Anders; Routti, Heli

    2014-01-01

    Highlights: •Genes regulating lipid metabolism were studied in ringed seals. •We compared highly contaminated Baltic seals and less contaminated Svalbard seals. •mRNA expression of hepatic PPARγ was higher in the Baltic seals. •mRNA expression of adipose PPARγ target genes was higher in the Baltic seals. •Contaminant exposure may affect lipid metabolism in the Baltic ringed seals. -- Abstract: There is a growing concern about the ability of persistent organic pollutants (POPs) to influence lipid metabolism. Although POPs are found at high concentrations in some populations of marine mammals, for example in the ringed seal (Pusa hispida) from the Baltic Sea, little is known about the effects of POPs on their lipid metabolism. An optimal regulation of lipid metabolism is crucial for ringed seals during the fasting/molting season. This is a physiologically stressful period, during which they rely on the energy stored in their fat reserves. The mRNA expression levels for seven genes involved in lipid metabolism were analyzed in liver and/or blubber tissue from molting ringed seals from the polluted Baltic Sea and a less polluted reference location, Svalbard (Norway). mRNA expression of genes encoding peroxisome proliferator-activated receptors (PPAR) α and γ and their target genes acyl-coenzyme A oxidase 1 (ACOX1) and cluster of differentiation 36 (CD36) were analyzed in liver. mRNA expression level of genes encoding PPARβ, PPARγ and their target genes encoding fatty acid binding protein 4 (FABP4) and adiponectin (ADIPOQ) were measured in inner and middle blubber layers. In addition, we evaluated the influence of molting status on hepatic mRNA expression of genes encoding PPARs and their target genes in ringed seals from Svalbard. Our results show higher mRNA expression of genes encoding hepatic PPARγ and adipose PPARβ, FABP4, and ADIPOQ in the Baltic seals compared to the Svalbard seals. A positive relationship between mRNA expressions of genes

  10. mRNA expression of genes regulating lipid metabolism in ringed seals (Pusa hispida) from differently polluted areas

    Energy Technology Data Exchange (ETDEWEB)

    Castelli, Martina Galatea [Norwegian Polar Institute, Fram Centre, 9296 Tromsø (Norway); University of Bergen, Department of Biology, 5020 Bergen (Norway); Rusten, Marte; Goksøyr, Anders [University of Bergen, Department of Biology, 5020 Bergen (Norway); Routti, Heli, E-mail: heli.routti@npolar.no [Norwegian Polar Institute, Fram Centre, 9296 Tromsø (Norway)

    2014-01-15

    Highlights: •Genes regulating lipid metabolism were studied in ringed seals. •We compared highly contaminated Baltic seals and less contaminated Svalbard seals. •mRNA expression of hepatic PPARγ was higher in the Baltic seals. •mRNA expression of adipose PPARγ target genes was higher in the Baltic seals. •Contaminant exposure may affect lipid metabolism in the Baltic ringed seals. -- Abstract: There is a growing concern about the ability of persistent organic pollutants (POPs) to influence lipid metabolism. Although POPs are found at high concentrations in some populations of marine mammals, for example in the ringed seal (Pusa hispida) from the Baltic Sea, little is known about the effects of POPs on their lipid metabolism. An optimal regulation of lipid metabolism is crucial for ringed seals during the fasting/molting season. This is a physiologically stressful period, during which they rely on the energy stored in their fat reserves. The mRNA expression levels for seven genes involved in lipid metabolism were analyzed in liver and/or blubber tissue from molting ringed seals from the polluted Baltic Sea and a less polluted reference location, Svalbard (Norway). mRNA expression of genes encoding peroxisome proliferator-activated receptors (PPAR) α and γ and their target genes acyl-coenzyme A oxidase 1 (ACOX1) and cluster of differentiation 36 (CD36) were analyzed in liver. mRNA expression level of genes encoding PPARβ, PPARγ and their target genes encoding fatty acid binding protein 4 (FABP4) and adiponectin (ADIPOQ) were measured in inner and middle blubber layers. In addition, we evaluated the influence of molting status on hepatic mRNA expression of genes encoding PPARs and their target genes in ringed seals from Svalbard. Our results show higher mRNA expression of genes encoding hepatic PPARγ and adipose PPARβ, FABP4, and ADIPOQ in the Baltic seals compared to the Svalbard seals. A positive relationship between mRNA expressions of genes

  11. Changes in the expression of collagen genes show two stages in chondrocyte differentiation in vitro

    OpenAIRE

    1988-01-01

    This report deals with the quantitation of both mRNA and transcription activity of type I collagen gene and of three cartilage-specific collagens (types II, IX, and X) during in vitro differentiation of chick chondrocytes. Differentiation was obtained by transferal to suspension culture of dedifferentiated cells passaged for 3 wk as adherent cells. The type I collagen mRNA, highly represented in the dedifferentiated cells, rapidly decreased during chondrocyte differentiation. On the contrary,...

  12. [Intersection point rule for the retention value with mobile phase composition and boiling point of the homologues and chlorobenzenes in soil leaching column chromatography].

    Science.gov (United States)

    Xu, F; Liang, X; Lin, B; Su, F

    1999-03-01

    Based on the linear retention equation of the logarithm of the capacity factor (logk') vs. the methanol volume fraction (psi) of aqueous binary mobile phase in soil leaching column chromatography, the intersection point rule for the logk' of homologues and weak polar chlorobenzenes, with psi, as well as with boiling point, has been derived due to existence of the similar interactions among solutes of the same series, stationary phase (soil) and eluent (methanol-water). These rules were testified by experimental data of homologues (n-alkylbenzenes, methylbenzenes) and weak polar chlorobenzenes.

  13. The pokeweed leaf mRNA transcriptome and its regulation by jasmonic acid.

    Directory of Open Access Journals (Sweden)

    Kira C.M. Neller

    2016-03-01

    Full Text Available The American pokeweed plant, Phytolacca americana, is recognized for synthesizing pokeweed antiviral protein (PAP, a ribosome inactivating protein (RIP that inhibits the replication of several plant and animal viruses. The plant is also a heavy metal accumulator with applications in soil remediation. However, little is known about pokeweed stress responses, as large-scale sequencing projects have not been performed for this species. Here, we sequenced the mRNA transcriptome of pokeweed in the presence and absence of jasmonic acid (JA, a hormone mediating plant defense. Trinity-based de novo assembly of mRNA from leaf tissue and BLASTx homology searches against public sequence databases resulted in the annotation of 59 096 transcripts. Differential expression analysis identified JA-responsive genes that may be involved in defense against pathogen infection and herbivory. We confirmed the existence of several PAP isoforms and cloned a potentially novel isoform of PAP. Expression analysis indicated that PAP isoforms are differentially responsive to JA, perhaps indicating specialized roles within the plant. Finally, we identified 52 305 natural antisense transcript pairs, four of which comprised PAP isoforms, suggesting a novel form of RIP gene regulation. This transcriptome-wide study of a Phytolaccaceae family member provides a source of new genes that may be involved in stress tolerance in this plant. The sequences generated in our study have been deposited in the SRA database under project # SRP069141.

  14. Alpha subunit of glycoprotein hormones in the sera of acromegalic patients and its mRNA in the tumors.

    Science.gov (United States)

    Machiavelli, G A; Artese, R; Benencia, H; Bruno, O; Guerra, L; Basso, A; Burdman, J A

    1999-04-01

    Within a population of 16 pituitary adenomas we found high levels of glycoprotein alpha subunits in the sera of patients with somatotrophic tumors. This finding was correlated with the presence of mRNA alpha subunit in these tumors indicating the adenomas themselves as the origin of the circulating alpha-subunit. Synthesis of these two hormones, which are chemically very different, by the same tumor cells indicates a high degree of differentiation of these cells. We are unable at this time to conclusively correlate differentiation of these tumors aggressively.

  15. Phosphorylation of eIF2α is required for mRNA translation inhibition and survival during moderate hypoxia

    International Nuclear Information System (INIS)

    Koritzinsky, Marianne; Rouschop, Kasper M.A.; Beucken, Twan van den; Magagnin, Michael G.; Savelkouls, Kim; Lambin, Philippe; Wouters, Bradly G.

    2007-01-01

    Abstracts: Background and purpose: Human tumors are characterized by temporal fluctuations in oxygen tension. The biological pathways that respond to the dynamic tumor microenvironment represent potential molecular targets for cancer therapy. Anoxic conditions result in eIF2α dependent inhibition of overall mRNA translation, differential gene expression, hypoxia tolerance and tumor growth. The signaling pathway which governs eIF2α phosphorylation has therefore emerged as a potential molecular target. In this study, we investigated the role of eIF2α in regulating mRNA translation and hypoxia tolerance during moderate hypoxia. Since other molecular pathways that regulate protein synthesis are frequently mutated in cancer, we also assessed mRNA translation in a panel of cell lines from different origins. Materials and methods: Immortalized human fibroblast, transformed mouse embryo fibroblasts (MEFs) and cells from six cancer cell lines were exposed to 0.2% or 0.0% oxygen. We assayed global mRNA translation efficiency by polysome analysis, as well as proliferation and clonogenic survival. The role of eIF2α was assessed in MEFs harboring a homozygous inactivating mutation (S51A) as well as in U373-MG cells overexpressing GADD34 (C-term) under a tetracycline-dependent promoter. The involvement of eIF4E regulation was investigated in HeLa cells stably expressing a short hairpin RNA (shRNA) targeting 4E-BP1. Results: All cells investigated inhibited mRNA translation severely in response to anoxia and modestly in response to hypoxia. Two independent genetic cell models demonstrated that inhibition of mRNA translation in response to moderate hypoxia was dependent on eIF2α phosphorylation. Disruption of eIF2α phosphorylation caused sensitivity to hypoxia and anoxia. Conclusions: Disruption of eIF2α phosphorylation is a potential target for hypoxia-directed molecular cancer therapy

  16. TMBP200, a XMAP215 homologue of tobacco BY-2 cells, has an essential role in plant mitosis.

    Science.gov (United States)

    Yasuhara, Hiroki; Oe, Yuki

    2011-07-01

    TMBP200 from tobacco BY-2 cells is a member of the highly conserved family of microtubule-associated proteins that includes Xenopus XMAP215, human TOGp, and Arabidopsis MOR1/GEM1. XMAP215 homologues have an essential role in spindle assembly and function in animals and yeast, but their role in plant mitosis is not fully clarified. Here, we show by immunoblot analysis that TMBP200 levels in synchronously cultured BY-2 cells increased when the cells entered mitosis, thus indicating that TMBP200 plays an important role in mitosis in tobacco. To investigate the role of TMBP200 in mitosis, we employed inducible RNA interference to silence TMBP200 expression in BY-2 cells. The resulting depletion of TMBP200 caused severe defects in bipolar spindle formation and resulted in the appearance of multinucleated cells with variable-sized nuclei. This finding indicates that TMBP200 has an essential role in bipolar spindle formation and function.

  17. The expression of the rice (Oryza sativa L.) homologue of Snm1 is induced by DNA damages

    International Nuclear Information System (INIS)

    Kimura, Seisuke; Saotome, Ai; Uchiyama, Yukinobu; Mori, Yoko; Tahira, Yasue; Sakaguchi, Kengo

    2005-01-01

    We isolated and characterized the rice homologue of the DNA repair gene Snm1 (OsSnm1). The length of the cDNA was 1862 bp; the open reading frame encoded a predicted product of 485 amino acid residues with a molecular mass of 53.2 kDa. The OsSnm1 protein contained the conserved β-lactamase domain in its internal region. OsSnm1 was expressed in all rice organs. The expression was induced by MMS, H 2 O 2 , and mitomycin C, but not by UV. Transient expression of an OsSnm1/GFP fusion protein in onion epidermal cells revealed the localization of OsSnm1 to the nucleus. These results suggest that OsSnm1 is involved not only in the repair of DNA interstrand crosslinks, but also in various other DNA repair pathways

  18. Investigation of evaporation characteristics of polonium and its lighter homologues selenium and tellurium from liquid Pb-Bi-eutecticum

    CERN Document Server

    Neuhausen, J; Eichler, B

    2004-01-01

    The evaporation behaviour of polonium and its lighter homologues selenium and tellurium dissolved in liquid Pb-Bi-eutecticum (LBE) has been studied at various temperatures in the range from 482 K up to 1330 K under Ar/H2 and Ar/H2O-atmospheres using γ-ray spectroscopy. Polonium release in the temperature range of interest for technical applications is slow. Within short term (1h) experiments measurable amounts of polonium are evaporated only at temperatures above 973 K. Long term experiments reveal that a slow evaporation of polonium occurs at temperatures around 873 K resulting in a fractional polonium loss of the melt around 1% per day. Evaporation rates of selenium and tellurium are smaller than those of polonium. The presence of H2O does not enhance the evaporation within the error limits of our experiments. The thermodynamics and possible reaction pathways involved in polonium release from LBE are discussed.

  19. The classification of mRNA expression levels by the phosphorylation state of RNAPII CTD based on a combined genome-wide approach

    Directory of Open Access Journals (Sweden)

    Tachibana Taro

    2011-10-01

    Full Text Available Abstract Background Cellular function is regulated by the balance of stringently regulated amounts of mRNA. Previous reports revealed that RNA polymerase II (RNAPII, which transcribes mRNA, can be classified into the pausing state and the active transcription state according to the phosphorylation state of RPB1, the catalytic subunit of RNAPII. However, genome-wide association between mRNA expression level and the phosphorylation state of RNAPII is unclear. While the functional importance of pausing genes is clear, such as in mouse Embryonic Stem cells for differentiation, understanding this association is critical for distinguishing pausing genes from active transcribing genes in expression profiling data, such as microarrays and RNAseq. Therefore, we examined the correlation between the phosphorylation of RNAPII and mRNA expression levels using a combined analysis by ChIPseq and RNAseq. Results We first performed a precise quantitative measurement of mRNA by performing an optimized calculation in RNAseq. We then visualized the recruitment of various phosphorylated RNAPIIs, such as Ser2P and Ser5P. A combined analysis using optimized RNAseq and ChIPseq for phosphorylated RNAPII revealed that mRNA levels correlate with the various phosphorylation states of RNAPII. Conclusions We demonstrated that the amount of mRNA is precisely reflected by the phased phosphorylation of Ser2 and Ser5. In particular, even the most "pausing" genes, for which only Ser5 is phosphorylated, were detectable at a certain level of mRNA. Our analysis indicated that the complexity of quantitative regulation of mRNA levels could be classified into three categories according to the phosphorylation state of RNAPII.

  20. Identification and characterisation of the angiotensin converting enzyme-3 (ACE3 gene: a novel mammalian homologue of ACE

    Directory of Open Access Journals (Sweden)

    Phelan Anne

    2007-06-01

    Full Text Available Abstract Background Mammalian angiotensin converting enzyme (ACE plays a key role in blood pressure regulation. Although multiple ACE-like proteins exist in non-mammalian organisms, to date only one other ACE homologue, ACE2, has been identified in mammals. Results Here we report the identification and characterisation of the gene encoding a third homologue of ACE, termed ACE3, in several mammalian genomes. The ACE3 gene is located on the same chromosome downstream of the ACE gene. Multiple sequence alignment and molecular modelling have been employed to characterise the predicted ACE3 protein. In mouse, rat, cow and dog, the predicted protein has mutations in some of the critical residues involved in catalysis, including the catalytic Glu in the HEXXH zinc binding motif which is Gln, and ESTs or reverse-transcription PCR indicate that the gene is expressed. In humans, the predicted ACE3 protein has an intact HEXXH motif, but there are other deletions and insertions in the gene and no ESTs have been identified. Conclusion In the genomes of several mammalian species there is a gene that encodes a novel, single domain ACE-like protein, ACE3. In mouse, rat, cow and dog ACE3, the catalytic Glu is replaced by Gln in the putative zinc binding motif, indicating that in these species ACE3 would lack catalytic activity as a zinc metalloprotease. In humans, no evidence was found that the ACE3 gene is expressed and the presence of deletions and insertions in the sequence indicate that ACE3 is a pseudogene.

  1. Ensembles generated from crystal structures of single distant homologues solve challenging molecular-replacement cases in AMPLE.

    Science.gov (United States)

    Rigden, Daniel J; Thomas, Jens M H; Simkovic, Felix; Simpkin, Adam; Winn, Martyn D; Mayans, Olga; Keegan, Ronan M

    2018-03-01

    Molecular replacement (MR) is the predominant route to solution of the phase problem in macromolecular crystallography. Although routine in many cases, it becomes more effortful and often impossible when the available experimental structures typically used as search models are only distantly homologous to the target. Nevertheless, with current powerful MR software, relatively small core structures shared between the target and known structure, of 20-40% of the overall structure for example, can succeed as search models where they can be isolated. Manual sculpting of such small structural cores is rarely attempted and is dependent on the crystallographer's expertise and understanding of the protein family in question. Automated search-model editing has previously been performed on the basis of sequence alignment, in order to eliminate, for example, side chains or loops that are not present in the target, or on the basis of structural features (e.g. solvent accessibility) or crystallographic parameters (e.g. B factors). Here, based on recent work demonstrating a correlation between evolutionary conservation and protein rigidity/packing, novel automated ways to derive edited search models from a given distant homologue over a range of sizes are presented. A variety of structure-based metrics, many readily obtained from online webservers, can be fed to the MR pipeline AMPLE to produce search models that succeed with a set of test cases where expertly manually edited comparators, further processed in diverse ways with MrBUMP, fail. Further significant performance gains result when the structure-based distance geometry method CONCOORD is used to generate ensembles from the distant homologue. To our knowledge, this is the first such approach whereby a single structure is meaningfully transformed into an ensemble for the purposes of MR. Additional cases further demonstrate the advantages of the approach. CONCOORD is freely available and computationally inexpensive, so

  2. An initial biochemical and cell biological characterization of the mammalian homologue of a central plant developmental switch, COP1

    Directory of Open Access Journals (Sweden)

    Wang Haiyang

    2002-12-01

    Full Text Available Abstract Background Constitutive photomorphogenic 1 (COP1 has been defined as a central regulator of photomorphogenic development in plants, which targets key transcription factors for proteasome-dependent degradation. Although COP1 mammalian homologue has been previously reported, its function and distribution in animal kingdom are not known. Results Here we report the characterization of full-length human and mouse COP1 cDNAs and the genomic structures of the COP1 genes from several different species. Mammalian COP1 protein binds to ubiquitinated proteins in vivo and is itself ubiquitinated. Furthermore, mammalian COP1 is predominately nuclear localized and exists primarily as a complex of over 700 kDa. Through mutagenesis studies, we have defined a leucine-rich nuclear export signal (NES within the coiled-coil domain of mammalian COP1 and a nuclear localization signal (NLS, which is composed of two clusters of positive-charged amino acids, bridged by the RING finger. Disruption of the RING finger structure abolishes the nuclear import, while deletion of the entire RING finger restores the nuclear import. Conclusions Our data suggest that mammalian COP1, similar to its plant homologue, may play a role in ubiquitination. Mammalian COP1 contains a classic leucine-rich NES and a novel bipartite NLS bridged by a RING finger domain. We propose a working model in which the COP1 RING finger functions as a structural scaffold to bring two clusters of positive-charged residues within spatial proximity to mimic a bipartite NLS. Therefore, in addition to its well-characterized role in ubiquitination, the RING finger domain may also play a structural role in nuclear import.

  3. Protein Structure and the Sequential Structure of mRNA

    DEFF Research Database (Denmark)

    Brunak, Søren; Engelbrecht, Jacob

    1996-01-01

    entries in the Brookhaven Protein Data Bank produced 719 protein chains with matching mRNA sequence, amino acid sequence, and secondary structure assignment, By neural network analysis, we found strong signals in mRNA sequence regions surrounding helices and sheets, These signals do not originate from......A direct comparison of experimentally determined protein structures and their corresponding protein coding mRNA sequences has been performed, We examine whether real world data support the hypothesis that clusters of rare codons correlate with the location of structural units in the resulting...... protein, The degeneracy of the genetic code allows for a biased selection of codons which may control the translational rate of the ribosome, and may thus in vivo have a catalyzing effect on the folding of the polypeptide chain, A complete search for GenBank nucleotide sequences coding for structural...

  4. Increased IL-10 mRNA and IL-23 mRNA expression in multiple sclerosis: interferon-beta treatment increases IL-10 mRNA expression while reducing IL-23 mRNA expression

    DEFF Research Database (Denmark)

    Krakauer, M.; Sorensen, P.; Khademi, M.

    2008-01-01

    volunteers served to confirm initial findings. mRNA was analyzed by real-time reverse transcriptase polymerase chain reaction (PCR). RESULTS: We found elevated expression of interleukin (IL)-23 and IL-10 in untreated MS patients. IFN-beta therapy increased IL-10 and decreased IL-23 expression independently...... of the regulatory cytokine IL-10. The elevated IL-23 mRNA levels in MS patients are noteworthy in view of the newly discovered IL-23-driven Th17 T-cell subset, which is crucial in animal models of MS. Since IFN-beta therapy resulted in decreased IL-23 mRNA levels, the Th17 axis could be another target of IFN...

  5. CORRELATIONS BETWEEN HOMOLOGUE CONCENTRATIONS OF PCDD/FS AND TOXIC EQUIVALENCY VALUES IN LABORATORY-, PACKAGE BOILER-, AND FIELD-SCALE INCINERATORS

    Science.gov (United States)

    The toxic equivalency (TEQ) values of polychlorinated dibenzo-p-dioxins and polychlorinated dibenzofurans (PCDD/Fs) are predicted with a model based on the homologue concentrations measured from a laboratory-scale reactor (124 data points), a package boiler (61 data points), and ...

  6. Identification and characterization of the ESAT-6 homologue of Mycobacterium leprae and T-cell cross-reactivity with Mycobacterium tuberculosis

    NARCIS (Netherlands)

    Geluk, Annemieke; van Meijgaarden, Krista E.; Franken, Kees L. M. C.; Subronto, Yanri W.; Wieles, Brigitte; Arend, Sandra M.; Sampaio, Elizabeth P.; de Boer, Tjitske; Faber, William R.; Naafs, Ben; Ottenhoff, Tom H. M.

    2002-01-01

    In this paper we describe identification and characterization of Mycobacterium leprae ESAT-6 (L-ESAT-6), the homologue of M. tuberculosis ESAT-6 (T-ESAT-6). T-ESAT-6 is expressed by all pathogenic strains belonging to the M. tuberculosis complex but is absent from virtually all other mycobacterial

  7. Differential expression of melanopsin mRNA and protein in the Brown Norwegian rats

    DEFF Research Database (Denmark)

    Hannibal, Jens; Georg, Birgitte; Fahrenkrug, Jan

    2012-01-01

    and negative masking behaviour. Previous studies have demonstrated that melanopsin expression in albino rats is regulated by light and darkness. The present study was undertaken to study the influence of light and darkness during the circadian day and after extended periods of constant light and darkness...

  8. Complexity on Acute Myeloid Leukemia mRNA Transcript Variant

    Directory of Open Access Journals (Sweden)

    Carlo Cattani

    2011-01-01

    Full Text Available This paper deals with the sequence analysis of acute myeloid leukemia mRNA. Six transcript variants of mlf1 mRNA, with more than 2000 bps, are analyzed by focusing on the autocorrelation of each distribution. Through the correlation matrix, some patches and similarities are singled out and commented, with respect to similar distributions. The comparison of Kolmogorov fractal dimension will be also given in order to classify the six variants. The existence of a fractal shape, patterns, and symmetries are discussed as well.

  9. Detection of melatonin receptor mRNA in human muscle

    International Nuclear Information System (INIS)

    Li Lei

    2004-01-01

    To verify the expression of melatonin receptor mRNA in human, muscle, muscle beside vertebrae was collected to obtain total RNA and the mRNA of melatonin receptor was detected by RT-PCR method. The electrophoretic results of RT-PCR products by mt 1 and MT 2 primer were all positive and the sequence is corresponding with human melatonin receptor cDNA. It suggests that melatonin may act on the muscle beside vertebrae directly and regulate its growth and development. (authors)

  10. A novel role for the Bombyx Slbo homologue, BmC/EBP, in insect choriogenesis.

    Science.gov (United States)

    Sourmeli, S; Papantonis, A; Lecanidou, R

    2005-11-18

    One previously unidentified cDNA clone coding for a C/EBP factor, BmC/EBP, was isolated from Bombyx mori follicular cells. This is the first time that a C/EBP factor has been isolated and characterized in Lepidoptera. We provide information concerning structural features and developmental specificity, as well as in vitro interaction properties with chorion gene promoter modules. BmC/EBP was capable of effectively recognizing homologous binding sites from chorion gene promoters derived from flies and other moths, despite significant diversity of chorion structure, gene organization, and gene expression profiles. We propose that the relative concentration of BmC/EBP, in relation to its differential binding affinity for promoter cis-elements, results in activation or repression of silkmoth chorion gene expression.

  11. New Homologues Series of Heterocyclic Schiff Base Ester: Synthesis and Characterization

    Directory of Open Access Journals (Sweden)

    Yee-Ting Chong

    2016-01-01

    Full Text Available A homologous series of liquid crystal bearing with heterocyclic thiophene Schiff base ester with alkanoyloxy chain (CH3(CH2nCOO–, where n=4, 6, 8, 10, 12, 14, 16 was successfully synthesized through the modification of some reported methods. The structural information of these compounds was isolated and characterized through some spectroscopic techniques, such as FTIR, 1H, and 13C NMR and elemental analysis. Textural observation was carried out using a polarizing optical microscope (POM over heating and cooling cycles. It was found that all synthesized compounds (3a–g exhibited an enantiotropic nematic phase upon the heating and cooling cycle with high thermal stability. Moreover, a characteristic bar transition texture was observed for compounds 3f and 3g which have shown transition of nematic-to-smectic C phase. This has been further confirmed by obtaining relative phase transition temperature using the differential scanning calorimetry (DSC.

  12. Integrating microRNA and mRNA expression profiles in response to radiation-induced injury in rat lung

    International Nuclear Information System (INIS)

    Xie, Ling; Zhou, Jundong; Zhang, Shuyu; Chen, Qing; Lai, Rensheng; Ding, Weiqun; Song, ChuanJun; Meng, XingJun; Wu, Jinchang

    2014-01-01

    Exposure to radiation provokes cellular responses, which are likely regulated by gene expression networks. MicroRNAs are small non-coding RNAs, which regulate gene expression by promoting mRNA degradation or inhibiting protein translation. The expression patterns of both mRNA and miRNA during the radiation-induced lung injury (RILI) remain less characterized and the role of miRNAs in the regulation of this process has not been studied. The present study sought to evaluate miRNA and mRNA expression profiles in the rat lung after irradiation. Male Wistar rats were subjected to single dose irradiation with 20 Gy using 6 MV x-rays to the right lung. (A dose rate of 5 Gy/min was applied). Rats were sacrificed at 3, 12 and 26 weeks after irradiation, and morphological changes in the lung were examined by haematoxylin and eosin. The miRNA and mRNA expression profiles were evaluated by microarrays and followed by quantitative RT-PCR analysis. A cDNA microarray analysis found 2183 transcripts being up-regulated and 2917 transcripts down-regulated (P ≤ 0.05, ≥2.0 fold change) in the lung tissues after irradiation. Likewise, a miRNAs microarray analysis indicated 15 miRNA species being up-regulated and 8 down-regulated (P ≤ 0.05). Subsequent bioinformatics anal -yses of the differentially expressed mRNA and miRNAs revealed that alterations in mRNA expression following irradiation were negatively correlated with miRNAs expression. Our results provide evidence indicating that irradiation induces alterations of mRNA and miRNA expression in rat lung and that there is a negative correlation of mRNA and miRNA expression levels after irradiation. These findings significantly advance our understanding of the regulatory mechanisms underlying the pathophysiology of radiation-induced lung injury. In summary, RILI does not develop gradually in a linear process. In fact, different cell types interact via cytokines in a very complex network. Furthermore, this study suggests that

  13. The role of mRNA translation in the adaptation to hypoxia

    International Nuclear Information System (INIS)

    Koritzinsky, M.; Wouters, B.G.; Koumenis, C.

    2003-01-01

    Hypoxia commonly occurs in human tumours and is associated with a poor prognosis. We and others have shown that global mRNA translation is rapidly inhibited during hypoxia. However, some mRNAs, such as those coding for HIF-1 α and VEGF, remain efficiently translated. We therefore hypothesize that the inhibition of mRNA translation serves to promote hypoxia tolerance in two ways: i) through conservation of energy and ii) through differential gene expression involved in hypoxia adaptation. We are investigating the mechanisms responsible for the down regulation of protein synthesis during hypoxia, and how specific mRNAs maintain their ability to be translated under such conditions. Our goal is to understand the significance of these regulatory mechanisms for hypoxia tolerance in vitro and tumor growth in vivo. We have previously shown that one mechanism responsible for inhibiting protein synthesis during hypoxia is the activation of PERK, which inhibits the essential translation factor eIF2 α . Here we show that PERK-/- MEFs are not able to inhibit protein synthesis efficiently during hypoxia and are significantly less tolerant to hypoxia than wt cells. We also show that other mechanisms are important for sustained low protein synthesis during chronic hypoxia. We demonstrate that the eIF4F complex is disrupted during prolonged hypoxia, and that this is mediated by 4E-BP1 and 4E-T. eIF4F is essential for translation which is dependent upon the 5'mRNA cap-structure. These studies therefore indicate a switch from the inhibition of all translation through eIF2 α during acute hypoxia, to the inhibition of only cap-dependent translation during chronic hypoxia. This model predicts the differential induction of genes that can be translated cap-independently during chronic hypoxia, which is consistent with the observed differential translation of HIF-1 α and VEGF. The functional significance of the disruption of the eIF4F complex during hypoxia is currently being addressed

  14. Cloning and mRNA expression pattern analysis under low ...

    African Journals Online (AJOL)

    This research cloned endochitinase-antifreeze protein precursor (EAPP) gene of Dong-mu 70 rye (Secale cereale) by designing special primers according to Genbank's EAPP gene sequence, and analyzing the influence of low temperature stress on the expression of mRNA with RT-PCR. The results indicated that the ...

  15. Efficient mRNA delivery with graphene oxide-polyethylenimine for generation of footprint-free human induced pluripotent stem cells.

    Science.gov (United States)

    Choi, Hye Yeon; Lee, Tae-Jin; Yang, Gwang-Mo; Oh, Jaesur; Won, Jihye; Han, Jihae; Jeong, Gun-Jae; Kim, Jongpil; Kim, Jin-Hoi; Kim, Byung-Soo; Cho, Ssang-Goo

    2016-08-10

    Clinical applications of induced pluripotent stem cells (iPSCs) require development of technologies for the production of "footprint-free" (gene integration-free) iPSCs, which avoid the potential risk of insertional mutagenesis in humans. Previously, several studies have shown that mRNA transfer can generate "footprint-free" iPSCs, but these studies did not use a delivery vehicle and thus repetitive daily transfection was required because of mRNA degradation. Here, we report an mRNA delivery system employing graphene oxide (GO)-polyethylenimine (PEI) complexes for the efficient generation of "footprint-free" iPSCs. GO-PEI complexes were found to be very effective for loading mRNA of reprogramming transcription factors and protection from mRNA degradation by RNase. Dynamic suspension cultures of GO-PEI/RNA complexes-treated cells dramatically increased the reprogramming efficiency and successfully generated rat and human iPSCs from adult adipose tissue-derived fibroblasts without repetitive daily transfection. The iPSCs showed all the hallmarks of pluripotent stem cells including expression of pluripotency genes, epigenetic reprogramming, and differentiation into the three germ layers. These results demonstrate that mRNA delivery using GO-PEI-RNA complexes can efficiently generate "footprint-free" iPSCs, which may advance the translation of iPSC technology into the clinical settings. Copyright © 2016. Published by Elsevier B.V.

  16. Identifying airway sensitizers: cytokine mRNA profiles induced by various anhydrides

    International Nuclear Information System (INIS)

    Plitnick, L.M.; Loveless, S.E.; Ladics, G.S.; Holsapple, M.P.; Smialowicz, R.J.; Woolhiser, M.R.; Anderson, P.K.; Smith, C.; Selgrade, M.J.K.

    2003-01-01

    Exposure to low molecular weight (LMW) chemicals in the workplace has been linked to a variety of respiratory effects. Within the LMW chemicals, one of the major classes involved in these effects are the acid anhydrides. The immunological basis of respiratory hypersensitivity involves CD4+ cells. By virtue of their induction of cytokines typical of CD4+ T-helper type 2 (Th2) cells--interleukin (IL)-4, 10, and 13--respiratory sensitizers may be identified and differentiated from contact sensitizers which induce Th1 cytokines (IL-2 and IFN-γ). Our previous work suggested that the ribonuclease protection assay (RPA) was useful in identifying the respiratory sensitizer, trimellitic anhydride (TMA), based on quantitative differences in Th2 cytokine mRNA as compared to the contact sensitizer dinitrochlorobenzene (DNCB). Therefore, the purpose of the studies described in this report was to expand the chemicals tested in the RPA. To this end, four acid anhydrides with known respiratory sensitization potential, TMA, maleic anhydride (MA), phthalic anhydride (PA) and hexahydrophthalic anhydride (HHPA), were tested. Although previously determined to induce immunologically equivalent responses in a local lymph node assay (LLNA), the initial dose chosen (2.5%) failed to induce Th2 cytokine mRNA expression. To determine if the lack of cytokine expression was related to dose, LLNAs were conducted at higher doses for each of the anhydrides. The highest doses evaluated (four- to six-fold higher than those used in the initial RPA) gave equivalent proliferative responses for the various anhydrides and were used for subsequent RPA testing. At these higher doses, significant increases in Th2 versus Th1 cytokine mRNA were observed for all anhydrides tested. These results suggest that the RPA has the potential to serve as a screen for the detection of LMW airway sensitizing chemicals. However, the basis for selecting immunologically equivalent doses may require some modification

  17. Constraint Differentiation

    DEFF Research Database (Denmark)

    Mödersheim, Sebastian Alexander; Basin, David; Viganò, Luca

    2010-01-01

    We introduce constraint differentiation, a powerful technique for reducing search when model-checking security protocols using constraint-based methods. Constraint differentiation works by eliminating certain kinds of redundancies that arise in the search space when using constraints to represent...... results show that constraint differentiation substantially reduces search and considerably improves the performance of OFMC, enabling its application to a wider class of problems....

  18. Differential manifolds

    CERN Document Server

    Kosinski, Antoni A

    2007-01-01

    The concepts of differential topology form the center of many mathematical disciplines such as differential geometry and Lie group theory. Differential Manifolds presents to advanced undergraduates and graduate students the systematic study of the topological structure of smooth manifolds. Author Antoni A. Kosinski, Professor Emeritus of Mathematics at Rutgers University, offers an accessible approach to both the h-cobordism theorem and the classification of differential structures on spheres.""How useful it is,"" noted the Bulletin of the American Mathematical Society, ""to have a single, sho

  19. Synthetic mRNA devices that detect endogenous proteins and distinguish mammalian cells.

    Science.gov (United States)

    Kawasaki, Shunsuke; Fujita, Yoshihiko; Nagaike, Takashi; Tomita, Kozo; Saito, Hirohide

    2017-07-07

    Synthetic biology has great potential for future therapeutic applications including autonomous cell programming through the detection of protein signals and the production of desired outputs. Synthetic RNA devices are promising for this purpose. However, the number of available devices is limited due to the difficulty in the detection of endogenous proteins within a cell. Here, we show a strategy to construct synthetic mRNA devices that detect endogenous proteins in living cells, control translation and distinguish cell types. We engineered protein-binding aptamers that have increased stability in the secondary structures of their active conformation. The designed devices can efficiently respond to target proteins including human LIN28A and U1A proteins, while the original aptamers failed to do so. Moreover, mRNA delivery of an LIN28A-responsive device into human induced pluripotent stem cells (hiPSCs) revealed that we can distinguish living hiPSCs and differentiated cells by quantifying endogenous LIN28A protein expression level. Thus, our endogenous protein-driven RNA devices determine live-cell states and program mammalian cells based on intracellular protein information. © The Author(s) 2017. Published by Oxford University Press on behalf of Nucleic Acids Research.

  20. Fip1 regulates mRNA alternative polyadenylation to promote stem cell self-renewal

    Science.gov (United States)

    Lackford, Brad; Yao, Chengguo; Charles, Georgette M; Weng, Lingjie; Zheng, Xiaofeng; Choi, Eun-A; Xie, Xiaohui; Wan, Ji; Xing, Yi; Freudenberg, Johannes M; Yang, Pengyi; Jothi, Raja; Hu, Guang; Shi, Yongsheng

    2014-01-01

    mRNA alternative polyadenylation (APA) plays a critical role in post-transcriptional gene control and is highly regulated during development and disease. However, the regulatory mechanisms and functional consequences of APA remain poorly understood. Here, we show that an mRNA 3′ processing factor, Fip1, is essential for embryonic stem cell (ESC) self-renewal and somatic cell reprogramming. Fip1 promotes stem cell maintenance, in part, by activating the ESC-specific APA profiles to ensure the optimal expression of a specific set of genes, including critical self-renewal factors. Fip1 expression and the Fip1-dependent APA program change during ESC differentiation and are restored to an ESC-like state during somatic reprogramming. Mechanistically, we provide evidence that the specificity of Fip1-mediated APA regulation depends on multiple factors, including Fip1-RNA interactions and the distance between APA sites. Together, our data highlight the role for post-transcriptional control in stem cell self-renewal, provide mechanistic insight on APA regulation in development, and establish an important function for APA in cell fate specification. PMID:24596251

  1. A mRNA and cognate microRNAs localize in the nucleolus.

    Science.gov (United States)

    Reyes-Gutierrez, Pablo; Ritland Politz, Joan C; Pederson, Thoru

    2014-01-01

    We previously discovered that a set of 5 microRNAs are concentrated in the nucleolus of rat myoblasts. We now report that several mRNAs are also localized in the nucleoli of these cells as determined by microarray analysis of RNA from purified nucleoli. Among the most abundant of these nucleolus-localized mRNAs is that encoding insulin-like growth factor 2 (IGF2), a regulator of myoblast proliferation and differentiation. The presence of IGF2 mRNA in nucleoli was confirmed by fluorescence in situ hybridization, and RT-PCR experiments demonstrated that these nucleolar transcripts are spliced, thus arriving from the nucleoplasm. Bioinformatics analysis predicted canonically structured, highly thermodynamically stable interactions between IGF2 mRNA and all 5 of the nucleolus-localized microRNAs. These results raise the possibility that the nucleolus is a staging site for setting up particular mRNA-microRNA interactions prior to export to the cytoplasm.

  2. WNT2B2 mRNA, up-regulated in primary gastric cancer, is a positive regulator of the WNT- beta-catenin-TCF signaling pathway.

    Science.gov (United States)

    Katoh, M; Kirikoshi, H; Terasaki, H; Shiokawa, K

    2001-12-21

    Genetic alterations of WNT signaling molecules lead to carcinogenesis through activation of the beta-catenin-TCF signaling pathway. We have previously cloned and characterized WNT2B/WNT13 gene on human chromosome 1p13, which is homologous to proto-oncogene WNT2 on human chromosome 7q31. WNT2B1 and WNT2B2 mRNAs, generated from the WNT2B gene due to alternative splicing of the alternative promoter type, encode almost identical polypeptides with divergence in the N-terminal region. WNT2B2 mRNA rather than WNT2B1 mRNA is preferentially expressed in NT2 cells with the potential of neuronal differentiation. Here, we describe our investigations of expression of WNT2B mRNAs in various types of human primary cancer. Matched tumor/normal expression array analysis revealed that WNT2B mRNAs were significantly up-regulated in 2 of 8 cases of primary gastric cancer. WNT2B2 mRNA rather than WNT2B1 mRNA was found to be preferentially up-regulated in a case of primary gastric cancer (signet ring cell carcinoma). Function of WNT2B1 mRNA and that of WNT2B2 mRNA were investigated by using Xenopus axis duplication assay. Injection of synthetic WNT2B1 mRNA into the ventral marginal zone of fertilized Xenopus eggs at the 4-cell stage did not induce axis duplication. In contrast, ventral injection of synthetic WNT2B2 mRNA induced axis duplication in 90% of embryos (complete axis duplication, 24%). These results strongly suggest that WNT2B2 up-regulation in some cases of gastric cancer might lead to carcinogenesis through activation of the beta-catenin-TCF signaling pathway.

  3. The effect of Dimethyl Sulfoxide on hepatogenic differentiation of Mesenchymal Stem Cells

    Directory of Open Access Journals (Sweden)

    Effat Alizadeh

    2014-05-01

    The results demonstrate that DMSO speeds up hepatic differentiation of AT-MSCs characterized by rapid changes in morphology, higher expression of hepatic marker gene (AFP in both mRNA and protein level (P

  4. HemaExplorer: a database of mRNA expression profiles in normal and malignant haematopoiesis

    DEFF Research Database (Denmark)

    Bagger, Frederik Otzen; Rapin, Nicolas; Theilgaard-Mönch, Kim

    2013-01-01

    lead to full integrity of the data in the database. The HemaExplorer has comprehensive visualization interface that can make it useful as a daily tool for biologists and cancer researchers to assess the expression patterns of genes encountered in research or literature. HemaExplorer is relevant for all......The HemaExplorer (http://servers.binf.ku.dk/hemaexplorer) is a curated database of processed mRNA Gene expression profiles (GEPs) that provides an easy display of gene expression in haematopoietic cells. HemaExplorer contains GEPs derived from mouse/human haematopoietic stem and progenitor cells...... as well as from more differentiated cell types. Moreover, data from distinct subtypes of human acute myeloid leukemia is included in the database allowing researchers to directly compare gene expression of leukemic cells with those of their closest normal counterpart. Normalization and batch correction...

  5. Gametophyte differentiation and imprinting control in plants: Crosstalk between RBR and chromatin.

    Science.gov (United States)

    Johnston, Amal J; Gruissem, Wilhelm

    2009-01-01

    The Retinoblastoma (pRb) pathway has been implicated as a convergent regulatory unit in the control of cell cycle and disease. We have shown that a crosstalk between RETINOBLASTOMA RELATED (RBR), the Arabidopsis homologue of pRb, and the genes encoding proteins of the chromatin complexes involved in DNA or histone methylation, controls gametophytic and post-fertilization differentiation events and a subset of imprinting effects. We describe here a plausible model that incorporates several components of the plant Retinoblastoma pathway, thus offering a novel paradigm that merges the traditional cell cycle and the chromatin components in the control of cell differentiation and imprinting.

  6. Differential equations

    CERN Document Server

    Barbu, Viorel

    2016-01-01

    This textbook is a comprehensive treatment of ordinary differential equations, concisely presenting basic and essential results in a rigorous manner. Including various examples from physics, mechanics, natural sciences, engineering and automatic theory, Differential Equations is a bridge between the abstract theory of differential equations and applied systems theory. Particular attention is given to the existence and uniqueness of the Cauchy problem, linear differential systems, stability theory and applications to first-order partial differential equations. Upper undergraduate students and researchers in applied mathematics and systems theory with a background in advanced calculus will find this book particularly useful. Supplementary topics are covered in an appendix enabling the book to be completely self-contained.

  7. Determination of vitamin K homologues by high-performance liquid chromatography with on-line photoreactor and peroxyoxalate chemiluminescence detection

    International Nuclear Information System (INIS)

    Ahmed, Sameh; Kishikawa, Naoya; Nakashima, Kenichiro; Kuroda, Naotaka

    2007-01-01

    A sensitive and highly selective high-performance liquid chromatography (HPLC) method was developed for the determination of vitamin K homologues including phylloquinone (PK), menaquinone-4 (MK-4) and menaquinone-7 (MK-7) in human plasma using post-column peroxyoxalate chemiluminescence (PO-CL) detection following on-line ultraviolet (UV) irradiation. The method was based on ultraviolet irradiation (254 nm, 15 W) of vitamin K to produce hydrogen peroxide and a fluorescent product at the same time, which can be determined with PO-CL detection. The separation of vitamin K by HPLC was accomplished isocratically on an ODS column within 35 min. The method involves the use of 2-methyl-3-pentadecyl-1,4-naphthoquinone as an internal standard. The detection limits (signal-to-noise ratio = 3) were 32, 38 and 85 fmol for PK, MK-4 and MK-7, respectively. The recoveries of PK, MK-4 and MK-7 were greater than 82% and the inter- and intra-assay R.S.D. values were 1.9-5.4%. The sensitivity and selectivity of this method were sufficient for clinical and nutritional applications

  8. Detection and Characterization of Homologues of Human Hepatitis Viruses and Pegiviruses in Rodents and Bats in Vietnam.

    Science.gov (United States)

    Van Nguyen, Dung; Van Nguyen, Cuong; Bonsall, David; Ngo, Tue Tri; Carrique-Mas, Juan; Pham, Anh Hong; Bryant, Juliet E; Thwaites, Guy; Baker, Stephen; Woolhouse, Mark; Simmonds, Peter

    2018-02-28

    Rodents and bats are now widely recognised as important sources of zoonotic virus infections in other mammals, including humans. Numerous surveys have expanded our knowledge of diverse viruses in a range of rodent and bat species, including their origins, evolution, and range of hosts. In this study of pegivirus and human hepatitis-related viruses, liver and serum samples from Vietnamese rodents and bats were examined by PCR and sequencing. Nucleic acids homologous to human hepatitis B, C, E viruses were detected in liver samples of 2 (1.3%) of 157 bats, 38 (8.1%), and 14 (3%) of 470 rodents, respectively. Hepacivirus-like viruses were frequently detected (42.7%) in the bamboo rat, Rhizomys pruinosus , while pegivirus RNA was only evident in 2 (0.3%) of 638 rodent serum samples. Complete or near-complete genome sequences of HBV, HEV and pegivirus homologues closely resembled those previously reported from rodents and bats. However, complete coding region sequences of the rodent hepacivirus-like viruses substantially diverged from all of the currently classified variants and potentially represent a new species in the Hepacivirus genus. Of the viruses identified, their routes of transmission and potential to establish zoonoses remain to be determined.

  9. PP-O and PP-V, Monascus pigment homologues, production, and phylogenetic analysis in Penicillium purpurogenum.

    Science.gov (United States)

    Arai, Teppei; Kojima, Ryo; Motegi, Yoshiki; Kato, Jun; Kasumi, Takafumi; Ogihara, Jun

    2015-12-01

    The production of pigments as secondary metabolites by microbes is known to vary by species and by physiological conditions within a single strain. The fungus strain Penicillium purpurogenum IAM15392 has been found to produce violet pigment (PP-V) and orange pigment (PP-O),Monascus azaphilone pigment homologues, when grown under specific culture conditions. In this study, we analysed PP-V and PP-O production capability in seven strains of P. purpurogenum in addition to strain IAM15392 under specific culture conditions. The pigment production pattern of five strains cultivated in PP-V production medium was similar to that of strain IAM15392, and all violet pigments produced by these five strains were confirmed to be PP-V. Strains that did not produce pigment were also identified. In addition, two strains cultivated in PP-O production medium produced a violet pigment identified as PP-V. The ribosomal DNA (rDNA) internal transcribed spacer (ITS) region sequences from the eight P. purpurogenum strains were sequenced and used to construct a neighbor-joining phylogenetic tree. PP-O and PP-V production of P. purpurogenum was shown to be related to phylogenetic placement based on rDNA ITS sequence. Based on these results, two hypotheses for the alteration of pigment production of P. purpurogenum in evolution were proposed. Copyright © 2015 The British Mycological Society. Published by Elsevier Ltd. All rights reserved.

  10. Immune responses of B. malayi thioredoxin (TRX) and venom allergen homologue (VAH) chimeric multiple antigen for lymphatic filariasis.

    Science.gov (United States)

    Anugraha, Gandhirajan; Jeyaprita, Parasurama Jawaharlal; Madhumathi, Jayaprakasam; Sheeba, Tamilvanan; Kaliraj, Perumal

    2013-12-01

    Although multiple vaccine strategy for lymphatic filariasis has provided tremendous hope, the choice of antigens used in combination has determined its success in the previous studies. Multiple antigens comprising key vaccine candidates from different life cycle stages would provide a promising strategy if the antigenic combination is chosen by careful screening. In order to analyze one such combination, we have used a chimeric construct carrying the well studied B. malayi antigens thioredoxin (BmTRX) and venom allergen homologue (BmVAH) as a fusion protein (TV) and evaluated its immune responses in mice model. The efficacy of fusion protein vaccine was explored in comparison with the single antigen vaccines and their cocktail. In mice, TV induced significantly high antibody titer of 1,28,000 compared to cocktail vaccine TRX+VAH (50,000) and single antigen vaccine TRX (16,000) or VAH (50,000). Furthermore, TV elicited higher level of cellular proliferative response together with elevated levels of IFN-γ, IL-4 and IL-5 indicating a Th1/Th2 balanced response. The isotype antibody profile showed significantly high level of IgG1 and IgG2b confirming the balanced response elicited by TV. Immunization with TV antigen induced high levels of both humoral and cellular immune responses compared to either cocktail or antigen given alone. The result suggests that TV is highly immunogenic in mice and hence the combination needs to be evaluated for its prophylactic potential.

  11. Mouse homologue of yeast Prp19 interacts with mouse SUG1, the regulatory subunit of 26S proteasome

    International Nuclear Information System (INIS)

    Sihn, Choong-Ryoul; Cho, Si Young; Lee, Jeong Ho; Lee, Tae Ryong; Kim, Sang Hoon

    2007-01-01

    Yeast Prp19 has been shown to involve in pre-mRNA splicing and DNA repair as well as being an ubiquitin ligase. Mammalian homologue of yeast Prp19 also plays on similar functional activities in cells. In the present study, we isolated mouse SUG1 (mSUG1) as binding partner of mouse Prp19 (mPrp19) by the yeast two-hybrid system. We confirmed the interaction of mPrp9 with mSUG1 by GST pull-down assay and co-immunoprecipitation assay. The N-terminus of mPrp19 including U-box domain was associated with the C-terminus of mSUG1. Although, mSUG1 is a regulatory subunit of 26S proteasome, mPrp19 was not degraded in the proteasome-dependent pathway. Interestingly, GFP-mPrp19 fusion protein was co-localized with mSUG1 protein in cytoplasm as the formation of the speckle-like structures in the presence of a proteasome inhibitor MG132. In addition, the activity of proteasome was increased in cells transfected with mPrp19. Taken together, these results suggest that mPrp19 involves the regulation of protein turnover and may transport its substrates to 26S proteasome through mSUG1 protein

  12. Cloning, purification, crystallization and preliminary crystallographic analysis of a penicillin-binding protein homologue from Pyrococcus abyssi

    International Nuclear Information System (INIS)

    Delfosse, Vanessa; Hugonnet, Jean-Emmanuel; Sougakoff, Wladimir; Mayer, Claudine

    2005-01-01

    The crystallization of a hypothetical penicillin-binding protein from the archaeon P. abyssi in space group C2 by hanging-drop vapour diffusion is reported. The genome of the hyperthermophilic archaeon Pyrococcus abyssi contains a gene (pab0087) encoding a penicillin-binding protein (PBP) homologue. This sequence consists of 447 residues and shows significant sequence similarity to low-molecular-weight PBPs and class C β-lactamases. The Pab0087 protein was overexpressed, purified and crystallized. Diffraction data from two different crystal forms were collected to 2.7 and 2.0 Å resolution. Both crystals belong to space group C2, with unit-cell parameters a = 160.59, b = 135.74, c = 113.02 Å, β = 117.36° and a = 166.97, b = 131.25, c = 189.39 Å, β = 113.81°, respectively. The asymmetric unit contains four and eight molecules, respectively, with fourfold non-crystallographic symmetry

  13. Enhancer of rudimentary homologue interacts with scaffold attachment factor B at the nuclear matrix to regulate SR protein phosphorylation.

    Science.gov (United States)

    Drakouli, Sotiria; Lyberopoulou, Aggeliki; Papathanassiou, Maria; Mylonis, Ilias; Georgatsou, Eleni

    2017-08-01

    Scaffold attachment factor B1 (SAFB1) is an integral component of the nuclear matrix of vertebrate cells. It binds to DNA on scaffold/matrix attachment region elements, as well as to RNA and a multitude of different proteins, affecting basic cellular activities such as transcription, splicing and DNA damage repair. In the present study, we show that enhancer of rudimentary homologue (ERH) is a new molecular partner of SAFB1 and its 70% homologous paralogue, scaffold attachment factor B2 (SAFB2). ERH interacts directly in the nucleus with the C-terminal Arg-Gly-rich region of SAFB1/2 and co-localizes with it in the insoluble nuclear fraction. ERH, a small ubiquitous protein with striking homology among species and a unique structure, has also been implicated in fundamental cellular mechanisms. Our functional analyses suggest that the SAFB/ERH interaction does not affect SAFB1/2 function in transcription (e.g. as oestrogen receptor α co-repressors), although it reverses the inhibition exerted by SAFB1/2 on the splicing kinase SR protein kinase 1 (SRPK1), which also binds on the C-terminus of SAFB1/2. Accordingly, ERH silencing decreases lamin B receptor and SR protein phosphorylation, which are major SRPK1 substrates, further substantiating the role of SAFB1 and SAFB2 in the co-ordination of nuclear function. © 2017 Federation of European Biochemical Societies.

  14. Anion exchange behaviour of Zr, Hf, Nb, Ta and Pa as homologues of RF and Db in fluoride medium

    Energy Technology Data Exchange (ETDEWEB)

    Monroy G, F. [ININ, Carretera Mexico-Toluca s/n, 52750 Ocoyoacac, Estado de Mexico (Mexico); Trubert, D.; Brillard, L.; Hussonnois, M.; Constantinescu, O.; Le Naour, C., E-mail: fabiola.monroy@inin.gob.m [Institut de Physique Nucleaire, F-91406 Orsay, France (France)

    2010-07-01

    Studies of the chemical property of trans actinide elements are very difficult due to their short half-lives and extremely small production yields. However it is still possible to obtain considerable information about their chemical properties, such as the most stable oxidation states in aqueous solution, complexing ability, etc., comparing their behaviour with their lighter homologous in the periodic table. In order to obtain a better knowledge of the behaviour of rutherfordium, RF (element 104), dub nium, Db (element 105) in HF medium, the sorption properties of Zr, Hf, Nb, Ta an Pa, homologues of RF and Db, were studied in NH{sub 4}F/HClO{sub 4} medium in this work. Stability constants of the fluoride complexes of these elements were experimentally obtained from K{sub d} obtained at different F{sup -} and H{sup +} concentrations. The anionic complexes: [Zr(Hf)F{sub 5}]{sup -}, [Zr(Hf)F{sub 6}]{sup 2-}, [Zr(Hf)F{sub 7}]{sup 3-}, [Ta(Pa)F{sub 6}]{sup -}, [Ta(Pa)F{sub 7}]{sup 2-}, [Ta(Pa)F{sub 8}]{sup 3-}, [NbOF{sub 4}]{sup -} and [NbOF{sub 5}]{sup 2-} are present as predominant species in the HF range over investigation. (Author)

  15. Temperature-sensitive defects of the GSP1gene, yeast Ran homologue, activate the Tel1-dependent pathway

    International Nuclear Information System (INIS)

    Hayashi, Naoyuki; Murakami, Seishi; Tsurusaki, Susumu; Nagaura, Zen-ichiro; Oki, Masaya; Nishitani, Hideo; Kobayashi, Masahiko; Shimizu, Hiroko; Yamamoto, Ken-ichi; Nishimoto, Takeharu

    2007-01-01

    RanGTPase is involved in many cellular processes. It functions in nuclear-cytosolic transport and centrosome formation. Ran also localizes to chromatin as RCC1 does, its guanine nucleotide exchange factor, but Ran's function on chromatin is not known. We found that gsp1, a temperature-sensitive mutant of GSP1, a Saccharomyces cerevisiae Ran homologue, suppressed the hydroxyurea (HU) and ultra violet (UV) sensitivities of the mec1 mutant. In UV-irradiated mec1 gsp1 cells, Rad53 was phosphorylated despite the lack of Mec1. This suppression depended on the TEL1 gene, given that the triple mutant, mec1 gsp1 tel1, was unable to grow. The gsp1 mutations also suppressed the HU sensitivity of the rad9 mutant in a Tel1-dependent manner, but not the HU sensitivity of the rad53 mutant. These results indicated that Rad53 was activated by the Tel1 pathway in mec1 gsp1 cells, suggesting that Gsp1 helps regulate the role switching the ATM family kinases Mec1 and Tel1

  16. Anion exchange behaviour of Zr, Hf, Nb, Ta and Pa as homologues of RF and Db in fluoride medium

    International Nuclear Information System (INIS)

    Monroy G, F.; Trubert, D.; Brillard, L.; Hussonnois, M.; Constantinescu, O.; Le Naour, C.

    2010-01-01

    Studies of the chemical property of trans actinide elements are very difficult due to their short half-lives and extremely small production yields. However it is still possible to obtain considerable information about their chemical properties, such as the most stable oxidation states in aqueous solution, complexing ability, etc., comparing their behaviour with their lighter homologous in the periodic table. In order to obtain a better knowledge of the behaviour of rutherfordium, RF (element 104), dub nium, Db (element 105) in HF medium, the sorption properties of Zr, Hf, Nb, Ta an Pa, homologues of RF and Db, were studied in NH 4 F/HClO 4 medium in this work. Stability constants of the fluoride complexes of these elements were experimentally obtained from K d obtained at different F - and H + concentrations. The anionic complexes: [Zr(Hf)F 5 ] - , [Zr(Hf)F 6 ] 2- , [Zr(Hf)F 7 ] 3- , [Ta(Pa)F 6 ] - , [Ta(Pa)F 7 ] 2- , [Ta(Pa)F 8 ] 3- , [NbOF 4 ] - and [NbOF 5 ] 2- are present as predominant species in the HF range over investigation. (Author)

  17. Interleukin-21 mRNA expression during virus infections

    DEFF Research Database (Denmark)

    Holm, Christian; Nyvold, Charlotte Guldborg; Paludan, Søren Riis

    2006-01-01

    and activational effects of IL-21 on different leukocytes come into play in vivo in an immune response has so far not been fully investigated. We show here for the first time in vivo, that IL-21 mRNA is produced in the spleen when mice are challenged with herpes simplex virus type 2 (HSV-2) or lymphocytic...... choriomeningitis virus (LCMV). We show in HSV-2 challenged mice that this production takes place in CD4+ T cell fractions and is absent in CD4+ T cell-depleted fractions. We also show that the peak of IL-21 mRNA production in both the HSV-2 and LCMV-challenged mice coincides with the onset of the adaptive immune...

  18. Collagen mRNA levels changes during colorectal cancer carcinogenesis

    DEFF Research Database (Denmark)

    Skovbjerg, Hanne; Anthonsen, Dorit; Lothe, Inger M B

    2009-01-01

    BACKGROUND: Invasive growth of epithelial cancers is a complex multi-step process which involves dissolution of the basement membrane. Type IV collagen is a major component in most basement membranes. Type VII collagen is related to anchoring fibrils and is found primarily in the basement membrane...... zone of stratified epithelia. Immunohistochemical studies have previously reported changes in steady-state levels of different alpha(IV) chains in several epithelial cancer types. In the present study we aimed to quantitatively determine the mRNA levels of type IV collagen (alpha1/alpha 4/alpha 6......) and type VII collagen (alpha1) during colorectal cancer carcinogenesis. METHODS: Using quantitative RT-PCR, we have determined the mRNA levels for alpha1(IV), alpha 4(IV), alpha 6(IV), and alpha1(VII) in colorectal cancer tissue (n = 33), adenomas (n = 29) and in normal tissue from the same individuals...

  19. Peptide inhibitors of botulinum neurotoxin by mRNA display

    International Nuclear Information System (INIS)

    Yiadom, Kwabena P.A.B.; Muhie, Seid; Yang, David C.H.

    2005-01-01

    Botulinum neurotoxins (BoNTs) are extremely toxic. The metalloproteases associated with the toxins cleave proteins essential for neurotransmitter secretion. Inhibitors of the metalloprotease are currently sought to control the toxicity of BoNTs. Toward that goal, we produced a synthetic cDNA for the expression and purification of the metalloprotease of BoNT/A in Escherichia coli as a biotin-ubiquitin fusion protein, and constructed a combinatorial peptide library to screen for BoNT/A light chain inhibitors using mRNA display. A protease assay was developed using immobilized intact SNAP-25 as the substrate. The new peptide inhibitors showed a 10-fold increase in affinity to BoNT/A light chain than the parent peptide. Interestingly, the sequences of the new peptide inhibitors showed abundant hydrophobic residues but few hydrophilic residues. The results suggest that mRNA display may provide a general approach in developing peptide inhibitors of BoNTs

  20. Differential games

    CERN Document Server

    Friedman, Avner

    2006-01-01

    This volume lays the mathematical foundations for the theory of differential games, developing a rigorous mathematical framework with existence theorems. It begins with a precise definition of a differential game and advances to considerations of games of fixed duration, games of pursuit and evasion, the computation of saddle points, games of survival, and games with restricted phase coordinates. Final chapters cover selected topics (including capturability and games with delayed information) and N-person games.Geared toward graduate students, Differential Games will be of particular interest

  1. Mirna biogenesis pathway is differentially regulated during adipose derived stromal/stem cell differentiation.

    Science.gov (United States)

    Martin, E C; Qureshi, A T; Llamas, C B; Burow, M E; King, A G; Lee, O C; Dasa, V; Freitas, M A; Forsberg, J A; Elster, E A; Davis, T A; Gimble, J M

    2018-02-07

    Stromal/stem cell differentiation is controlled by a vast array of regulatory mechanisms. Included within these are methods of mRNA gene regulation that occur at the level of epigenetic, transcriptional, and/or posttranscriptional modifications. Current studies that evaluate the posttranscriptional regulation of mRNA demonstrate microRNAs (miRNAs) as key mediators of stem cell differentiation through the inhibition of mRNA translation. miRNA expression is enhanced during both adipogenic and osteogenic differentiation; however, the mechanism by which miRNA expression is altered during stem cell differentiation is less understood. Here we demonstrate for the first time that adipose-derived stromal/stem cells (ASCs) induced to an adipogenic or osteogenic lineage have differences in strand preference (-3p and -5p) for miRNAs originating from the same primary transcript. Furthermore, evaluation of miRNA expression in ASCs demonstrates alterations in both miRNA strand preference and 5'seed site heterogeneity. Additionally, we show that during stem cell differentiation there are alterations in expression of genes associated with the miRNA biogenesis pathway. Quantitative RT-PCR demonstrated changes in the Argonautes (AGO1-4), Drosha, and Dicer at intervals of ASC adipogenic and osteogenic differentiation compared to untreated ASCs. Specifically, we demonstrated altered expression of the AGOs occurring during both adipogenesis and osteogenesis, with osteogenesis increasing AGO1-4 expression and adipogenesis decreasing AGO1 gene and protein expression. These data demonstrate changes to components of the miRNA biogenesis pathway during stromal/stem cell differentiation. Identifying regulatory mechanisms for miRNA processing during ASC differentiation may lead to novel mechanisms for the manipulation of lineage differentiation of the ASC through the global regulation of miRNA as opposed to singular regulatory mechanisms.

  2. Cup regulates oskar mRNA stability during oogenesis.

    Science.gov (United States)

    Broyer, Risa M; Monfort, Elena; Wilhelm, James E

    2017-01-01

    The proper regulation of the localization, translation, and stability of maternally deposited transcripts is essential for embryonic development in many organisms. These different forms of regulation are mediated by the various protein subunits of the ribonucleoprotein (RNP) complexes that assemble on maternal mRNAs. However, while many of the subunits that regulate the localization and translation of maternal transcripts have been identified, relatively little is known about how maternal mRNAs are stockpiled and stored in a stable form to support early development. One of the best characterized regulators of maternal transcripts is Cup - a broadly conserved component of the maternal RNP complex that in Drosophila acts as a translational repressor of the localized message oskar. In this study, we have found that loss of cup disrupts the localization of both the oskar mRNA and its associated proteins to the posterior pole of the developing oocyte. This defect is not due to a failure to specify the oocyte or to disruption of RNP transport. Rather, the localization defects are due to a drop in oskar mRNA levels in cup mutant egg chambers. Thus, in addition to its role in regulating oskar mRNA translation, Cup also plays a critical role in controlling the stability of the oskar transcript. This suggests that Cup is ideally positioned to coordinate the translational control function of the maternal RNP complex with its role in storing maternal transcripts in a stable form. Published by Elsevier Inc.

  3. Differential Geometry

    CERN Document Server

    Stoker, J J

    2011-01-01

    This classic work is now available in an unabridged paperback edition. Stoker makes this fertile branch of mathematics accessible to the nonspecialist by the use of three different notations: vector algebra and calculus, tensor calculus, and the notation devised by Cartan, which employs invariant differential forms as elements in an algebra due to Grassman, combined with an operation called exterior differentiation. Assumed are a passing acquaintance with linear algebra and the basic elements of analysis.

  4. Complex mutual regulation of facilitates chromatin transcription (FACT) subunits on both mRNA and protein levels in human cells.

    Science.gov (United States)

    Safina, Alfiya; Garcia, Henry; Commane, Mairead; Guryanova, Olga; Degan, Seamus; Kolesnikova, Kateryna; Gurova, Katerina V

    2013-08-01

    Facilitates chromatin transcription (FACT) is a chromatin remodeling complex with two subunits: SSRP1 and SPT16. Mechanisms controlling FACT levels are of interest, since the complex is not expressed in most differentiated cells, but is frequently upregulated in cancer, particularly in poorly differentiated, aggressive tumors. Moreover, inhibition of FACT expression or function in tumor cells interferes with their survival. Here we demonstrate that SSRP1 and SPT16 protein levels decline upon induction of cellular differentiation or senescence in vitro and that similar declines in protein levels for both SSRP1 and SPT16 occur upon RNAi-mediated knockdown of either SSRP1 or SPT16. The interdependence of SSRP1 and SPT16 protein levels was found to be due to their association with SSRP1 and SPT16 mRNAs, which stabilizes the proteins. In particular, presence of SSRP1 mRNA is critical for SPT16 protein stability. In addition, binding of SSRP1 and SPT16 mRNAs to the FACT complex increases the stability and efficiency of translation of the mRNAs. These data support a model in which the FACT complex is stable when SSRP1 mRNA is present, but quickly degrades when SSRP1 mRNA levels drop. In the absence of FACT complex, SSRP1 and SPT16 mRNAs are unstable and inefficiently translated, making reactivation of FACT function unlikely in normal cells. Thus, we have described a complex and unusual mode of regulation controlling cellular FACT levels that results in amplified and stringent control of FACT activity. The FACT dependence of tumor cells suggests that mechanisms controlling FACT levels could be targeted for anticancer therapy.

  5. Natural selection and algorithmic design of mRNA.

    Science.gov (United States)

    Cohen, Barry; Skiena, Steven

    2003-01-01

    Messenger RNA (mRNA) sequences serve as templates for proteins according to the triplet code, in which each of the 4(3) = 64 different codons (sequences of three consecutive nucleotide bases) in RNA either terminate transcription or map to one of the 20 different amino acids (or residues) which build up proteins. Because there are more codons than residues, there is inherent redundancy in the coding. Certain residues (e.g., tryptophan) have only a single corresponding codon, while other residues (e.g., arginine) have as many as six corresponding codons. This freedom implies that the number of possible RNA sequences coding for a given protein grows exponentially in the length of the protein. Thus nature has wide latitude to select among mRNA sequences which are informationally equivalent, but structurally and energetically divergent. In this paper, we explore how nature takes advantage of this freedom and how to algorithmically design structures more energetically favorable than have been built through natural selection. In particular: (1) Natural Selection--we perform the first large-scale computational experiment comparing the stability of mRNA sequences from a variety of organisms to random synonymous sequences which respect the codon preferences of the organism. This experiment was conducted on over 27,000 sequences from 34 microbial species with 36 genomic structures. We provide evidence that in all genomic structures highly stable sequences are disproportionately abundant, and in 19 of 36 cases highly unstable sequences are disproportionately abundant. This suggests that the stability of mRNA sequences is subject to natural selection. (2) Artificial Selection--motivated by these biological results, we examine the algorithmic problem of designing the most stable and unstable mRNA sequences which code for a target protein. We give a polynomial-time dynamic programming solution to the most stable sequence problem (MSSP), which is asymptotically no more complex

  6. [Effects of lipopolysaccharides extracted from Porphyromonas endodontalis on the expression of IL-1beta mRNA and IL-6 mRNA in osteoblasts].

    Science.gov (United States)

    Yang, Di; Li, Ren; Qiu, Li-Hong; Li, Chen

    2009-04-01

    To quantify the IL-1 beta mRNA and IL-6 mRNA expression induced by lipopolysaccharides (LPS)extracted from Porphyromonas endodontalis(P.e) in osteoblasts, and to relate P.e-LPS to bone absorption pathogenesis in lesions of chronical apical periodontitis. MG63 was treated with different concentrations of P.e-LPS(0-50 microg/mL) for different hours(0-24h). The expression of IL-1 beta mRNA and IL-6 mRNA was detected by reverse transcription polymerase chain reaction (RT-PCR).Statistical analysis was performed using one- way ANOVA and Dunnett t test with SPSS11.0 software package. The level of IL-1 beta mRNA and IL-6 mRNA increased significantly after treatment with P.e-LPS at more than 5 microg/mL (P<0.01)and for more than 1 hour (P<0.01), which indicated that P.e-LPS induced osteoblasts to express IL-1 beta mRNA and IL-6 mRNA in dose and time dependent manners. P.e-LPS may promote bone resorption in lesions of chronical apical periodontitis by inducing IL-1 beta mRNA and IL-6 mRNA expression in osteoblasts.

  7. Combinatorial Control of mRNA Fates by RNA-Binding Proteins and Non-Coding RNAs

    Directory of Open Access Journals (Sweden)

    Valentina Iadevaia

    2015-09-01

    Full Text Available Post-transcriptional control of gene expression is mediated by RNA-binding proteins (RBPs and small non-coding RNAs (e.g., microRNAs that bind to distinct elements in their mRNA targets. Here, we review recent examples describing the synergistic and/or antagonistic effects mediated by RBPs and miRNAs to determine the localisation, stability and translation of mRNAs in mammalian cells. From these studies, it is becoming increasingly apparent that dynamic rearrangements of RNA-protein complexes could have profound implications in human cancer, in synaptic plasticity, and in cellular differentiation.

  8. Increased uncoupling protein-2 mRNA abundance and glucocorticoid action in adipose tissue in the sheep fetus during late gestation is dependent on plasma cortisol and triiodothyronine

    Science.gov (United States)

    Gnanalingham, MG; Mostyn, A; Forhead, AJ; Fowden, AL; Symonds, ME; Stephenson, T

    2005-01-01

    The endocrine regulation of uncoupling protein-2 (UCP2), an inner mitochondrial protein, in fetal adipose tissue remains unclear. The present study aimed to determine if fetal plasma cortisol and triiodothyronine (T3) influenced the mRNA abundance of UCP2, glucocorticoid receptor (GR) and 11β-hydroxysteroid dehydrogenase type 1 (11βHSD1) and 2 (11βHSD2) in fetal adipose tissue in the sheep during late gestation. Perirenal–abdominal adipose tissue was sampled from ovine fetuses to which either cortisol (2–3 mg kg−1 day−1) or saline was infused for 5 days up to 127–130 days gestation, or near term fetuses (i.e. 142–145 days gestation) that were either adrenalectomised (AX) or remained intact. Fetal plasma cortisol and T3 concentrations were higher in the cortisol infused animals and lower in AX fetuses compared with their corresponding control group, and increased with gestational age. UCP2 and GR mRNA abundance were significantly lower in AX fetuses compared with age-matched controls, and increased with gestational age and by cortisol infusion. Glucocorticoid action in fetal adipose tissue was augmented by AX and suppressed by cortisol infusion, the latter also preventing the gestational increase in 11βHSD1 mRNA and decrease in 11βHSD2 mRNA. When all treatment groups were combined, both fetal plasma cortisol and T3 concentrations were positively correlated with UCP2, GR and 11βHSD2 mRNA abundance, but negatively correlated with 11βHSD1 mRNA abundance. In conclusion, plasma cortisol and T3 are both required for the late gestation rise in UCP2 mRNA and differentially regulate glucocorticoid action in fetal adipose tissue in the sheep during late gestation. PMID:15961419

  9. Genetic analysis of the spindle checkpoint genes san-1, mdf-2, bub-3 and the CENP-F homologues hcp-1 and hcp-2 in Caenorhabditis elegans

    Directory of Open Access Journals (Sweden)

    Moore Landon L

    2008-02-01

    Full Text Available Abstract Background The spindle checkpoint delays the onset of anaphase until all sister chromatids are aligned properly at the metaphase plate. To investigate the role san-1, the MAD3 homologue, has in Caenorhabditis elegans embryos we used RNA interference (RNAi to identify genes synthetic lethal with the viable san-1(ok1580 deletion mutant. Results The san-1(ok1580 animal has low penetrating phenotypes including an increased incidence of males, larvae arrest, slow growth, protruding vulva, and defects in vulva morphogenesis. We found that the viability of san-1(ok1580 embryos is significantly reduced when HCP-1 (CENP-F homologue, MDF-1 (MAD-1 homologue, MDF-2 (MAD-2 homologue or BUB-3 (predicted BUB-3 homologue are reduced by RNAi. Interestingly, the viability of san-1(ok1580 embryos is not significantly reduced when the paralog of HCP-1, HCP-2, is reduced. The phenotype of san-1(ok1580;hcp-1(RNAi embryos includes embryonic and larval lethality, abnormal organ development, and an increase in abnormal chromosome segregation (aberrant mitotic nuclei, anaphase bridging. Several of the san-1(ok1580;hcp-1(RNAi animals displayed abnormal kinetochore (detected by MPM-2 and microtubule structure. The survival of mdf-2(RNAi;hcp-1(RNAi embryos but not bub-3(RNAi;hcp-1(RNAi embryos was also compromised. Finally, we found that san-1(ok1580 and bub-3(RNAi, but not hcp-1(RNAi embryos, were sensitive to anoxia, suggesting that like SAN-1, BUB-3 has a functional role as a spindle checkpoint protein. Conclusion Together, these data suggest that in the C. elegans embryo, HCP-1 interacts with a subset of the spindle checkpoint pathway. Furthermore, the fact that san-1(ok1580;hcp-1(RNAi animals had a severe viability defect whereas in the san-1(ok1580;hcp-2(RNAi and san-1(ok1580;hcp-2(ok1757 animals the viability defect was not as severe suggesting that hcp-1 and hcp-2 are not completely redundant.

  10. Cloning of cDNA sequences of a progestin-regulated mRNA from MCF7 human breast cancer cells

    Energy Technology Data Exchange (ETDEWEB)

    Chalbos, D; Westley, B; Alibert, C; Rochefort, H

    1986-01-24

    A cDNA clone corresponding to an mRNA regulated by the progestin R5020, has been isolated by differential screening of a cDNA library from the MCF7 breast cancer cell line, which contains estrogen and progesterone receptors. This probe hybridized with a single species of poly A + RNA of 8-kb molecular weight as shown by Northern blot analysis and could also be used to total RNA preparation. This recombinant cone hybridized specifically to an mRNA coding for a 250,000 daltons protein when translated in vitro. This protein was identical to the 250 kDa progestin-regulated protein that the authors previously described as shown by immunoprecipitation with specific rabbit polyclonal antibodies. Dose-response curve and specificity studies show that the accumulation of the Pg8 mRNA and that of the 250-kDa protein was increased by 5 to 30-fold following progestin treatment and that this effect was mediated by the progesterone receptor. Time course of induction indicated that the accumulation of mRNA was rapid and preceded that of the protein. This is the first report on a cloned cDNA probe of progestin-regulated mRNA in human cell lines.

  11. A Point Mutation in the Exon Junction Complex Factor Y14 Disrupts Its Function in mRNA Cap Binding and Translation Enhancement*

    Science.gov (United States)

    Chuang, Tzu-Wei; Lee, Kuo-Ming; Lou, Yuan-Chao; Lu, Chia-Chen; Tarn, Woan-Yuh

    2016-01-01

    Eukaryotic mRNA biogenesis involves a series of interconnected steps mediated by RNA-binding proteins. The exon junction complex core protein Y14 is required for nonsense-mediated mRNA decay (NMD) and promotes translation. Moreover, Y14 binds the cap structure of mRNAs and inhibits the activity of the decapping enzyme Dcp2. In this report, we show that an evolutionarily conserved tryptophan residue (Trp-73) of Y14 is critical for its binding to the mRNA cap structure. A Trp-73 mutant (W73V) bound weakly to mRNAs and failed to protect them from degradation. However, this mutant could still interact with the NMD and mRNA degradation factors and retained partial NMD activity. In addition, we found that the W73V mutant could not interact with translation initiation factors. Overexpression of W73V suppressed reporter mRNA translation in vitro and in vivo and reduced the level of a set of nascent proteins. These results reveal a residue of Y14 that confers cap-binding activity and is essential for Y14-mediated enhancement of translation. Finally, we demonstrated that Y14 may selectively and differentially modulate protein biosynthesis. PMID:26887951

  12. A Point Mutation in the Exon Junction Complex Factor Y14 Disrupts Its Function in mRNA Cap Binding and Translation Enhancement.

    Science.gov (United States)

    Chuang, Tzu-Wei; Lee, Kuo-Ming; Lou, Yuan-Chao; Lu, Chia-Chen; Tarn, Woan-Yuh

    2016-04-15

    Eukaryotic mRNA biogenesis involves a series of interconnected steps mediated by RNA-binding proteins. The exon junction complex core protein Y14 is required for nonsense-mediated mRNA decay (NMD) and promotes translation. Moreover, Y14 binds the cap structure of mRNAs and inhibits the activity of the decapping enzyme Dcp2. In this report, we show that an evolutionarily conserved tryptophan residue (Trp-73) of Y14 is critical for its binding to the mRNA cap structure. A Trp-73 mutant (W73V) bound weakly to mRNAs and failed to protect them from degradation. However, this mutant could still interact with the NMD and mRNA degradation factors and retained partial NMD activity. In addition, we found that the W73V mutant could not interact with translation initiation factors. Overexpression of W73V suppressed reporter mRNA translation in vitro and in vivo and reduced the level of a set of nascent proteins. These results reveal a residue of Y14 that confers cap-binding activity and is essential for Y14-mediated enhancement of translation. Finally, we demonstrated that Y14 may selectively and differentially modulate protein biosynthesis. © 2016 by The American Society for Biochemistry and Molecular Biology, Inc.

  13. Exploratory Bioinformatics Study of lncRNAs in Alzheimer’s Disease mRNA Sequences with Application to Drug Development

    Directory of Open Access Journals (Sweden)

    T. Holden

    2013-01-01

    Full Text Available Long noncoding RNA (lncRNA within mRNA sequences of Alzheimer’s disease genes, namely, APP, APOE, PSEN1, and PSEN2, has been analyzed using fractal dimension (FD computation and correlation analysis. We examined lncRNA by comparing mRNA FD to corresponding coding DNA sequences (CDSs FD. APP, APOE, and PSEN1 CDSs select slightly higher FDs compared to the mRNA, while PSEN2 CDSs FDs are lower. The correlation coefficient for these sequences is 0.969. A comparative study of differentially expressed MAPK signaling pathway lncRNAs in pancreatic cancer cells shows a correlation of 0.771. Selection of higher FD CDSs could indicate interaction of Alzheimer’s gene products APP, APOE, and PSEN1. Including hypocretin sequences (where all CDSs have higher fractal dimensions than mRNA in the APP, APOE, and PSEN1 sequence analyses improves correlation, but the inclusion of erythropoietin (where all CDSs have higher FD than mRNA would suppress correlation, suggesting that HCRT, a hypothalamus neurotransmitter related to the wake/sleep cycle, might be better when compared to EPO, a glycoprotein hormone, for targeting Alzheimer’s disease drug development. Fractal dimension and entropy correlation have provided supporting evidence, consistent with evolutionary studies, for using a zebrafish model together with a mouse model, in HCRT drug development.

  14. A selection of reference genes and early-warning mRNA biomarkers for environmental monitoring using Mytilus spp. as sentinel species.

    Science.gov (United States)

    Lacroix, C; Coquillé, V; Guyomarch, J; Auffret, M; Moraga, D

    2014-09-15

    mRNA biomarkers are promising tools for environmental health assessment and reference genes are needed to perform relevant qPCR analyses in tissue samples of sentinel species. In the present study, potential reference genes and mRNA biomarkers were tested in the gills and digestive glands of native and caged mussels (Mytilus spp.) exposed to harbor pollution. Results highlighted the difficulty to find stable reference genes in wild, non-model species and suggested the use of normalization indices instead of single genes as they exhibit a higher stability. Several target genes were found differentially expressed between mussel groups, especially in gills where cyp32, π-gst and CuZn-sod mRNA levels could be biomarker candidates. Multivariate analyses confirmed the ability of mRNA levels to highlight site-effects and suggested the use of several combined markers instead of individual ones. These findings support the use of qPCR technology and mRNA levels as early-warning biomarkers in marine monitoring programs. Copyright © 2014 Elsevier Ltd. All rights reserved.

  15. Dietary fatty acids regulate hepatic low density lipoprotein (LDL) transport by altering LDL receptor protein and mRNA levels.

    Science.gov (United States)

    Horton, J D; Cuthbert, J A; Spady, D K

    1993-01-01

    The concentration of LDL in plasma is strongly influenced by the amount and the type of lipid in the diet. Recent studies in the hamster have shown that dietary fatty acids differentially affect circulating LDL levels primarily by altering receptor-dependent LDL uptake in the liver. To investigate the mechanistic basis of this effect, rates of receptor-dependent LDL transport in the liver were correlated with LDL receptor protein and mRNA levels in hamsters fed safflower oil or coconut oil and varying amounts of cholesterol. Hepatic LDL receptor activity was significantly lower in animals fed coconut oil than in animals fed safflower oil at all levels of cholesterol intake (26, 53, and 61% lower at cholesterol intakes of 0, 0.06, and 0.12%, respectively). These fatty acid-induced changes in hepatic LDL receptor activity were accompanied by parallel changes in hepatic LDL receptor protein and mRNA levels, suggesting that dietary fatty acids regulate the LDL receptor pathway largely at the mRNA level. Images PMID:8349814

  16. PPARg mRNA in the adult mouse hypothalamus: distribution and regulation in response to dietary challenges

    Directory of Open Access Journals (Sweden)

    Yang eLiu

    2015-09-01

    Full Text Available Peroxisome proliferator-activated receptor gamma (PPARg is a ligand-activated transcription factor that was originally identified as a regulator of peroxisome proliferation and adipocyte differentiation. Emerging evidence suggests that functional PPARg signaling also occurs within the hypothalamus. However, the exact distribution and identities of PPARg-expressing hypothalamic cells remains under debate. The present study systematically mapped PPARg mRNA expression in the adult mouse brain using in situ hybridization histochemistry. PPARg mRNA was found to be expressed at high levels outside the hypothalamus including the neocortex, the olfactory bulb, the organ of the vasculosum of the lamina terminalis, and the subfornical organ. Within the hypothalamus, PPARg was present at moderate levels in the suprachiasmatic nucleus and the ependymal of the 3rd ventricle. In all examined feeding-related hypothalamic nuclei, PPARg was expressed at very low levels that were close to the limit of detection. Using qPCR techniques, we demonstrated that PPARg mRNA expression was upregulated in the suprachiasmatic nucleus in response to fasting. Double in situ hybridization further demonstrated that PPARg was primarily expressed in neurons. Collectively, our observations provide a comprehensive map of PPARg distribution and regulation in the intact adult mouse hypothalamus.

  17. Cloning, sequencing, disruption and phenotypic analysis of uvsC, an Aspergillus nidulans homologue of yeast RAD51.

    Science.gov (United States)

    van Heemst, D; Swart, K; Holub, E F; van Dijk, R; Offenberg, H H; Goosen, T; van den Broek, H W; Heyting, C

    1997-05-01

    We have cloned the uvsC gene of Aspergillus nidulans by complementation of the A. nidulans uvsC114 mutant. The predicted protein UVSC shows 67.4% sequence identity to the Saccharomyces cerevisiae Rad51 protein and 27.4% sequence identity to the Escherichia coli RecA protein. Transcription of uvsC is induced by methyl-methane sulphonate (MMS), as is transcription of RAD51 of yeast. Similar levels of uvsC transcription were observed after MMS induction in a uvsC+ strain and the uvsC114 mutant. The coding sequence of the uvsC114 allele has a deletion of 6 bp, which results in deletion of two amino acids and replacement of one amino acid in the translation product. In order to gain more insight into the biological function of the uvsC gene, a uvsC null mutant was constructed, in which the entire uvsC coding sequence was replaced by a selectable marker gene. Meiotic and mitotic phenotypes of a uvsC+ strain, the uvsC114 mutant and the uvsC null mutant were compared. The uvsC null mutant was more sensitive to both UV and MMS than the uvsC114 mutant. The uvsC114 mutant arrested in meiotic prophase-I. The uvsC null mutant arrested at an earlier stage, before the onset of meiosis. One possible interpretation of these meiotic phenotypes is that the A. nidulans homologue of Rad51 of yeast has a role both in the specialized processes preceding meiosis and in meiotic prophase I.

  18. Cloning and Characterization of the Genes Encoding the Murine Homologues of the Human Melanoma Antigens MART1 and gp100

    Science.gov (United States)

    Zhai, Yifan; Yang, James C.; Spiess, Paul; Nishimura, Michael I.; Overwijk, Willem W.; Roberts, Bruce; Restifo, Nicholas P.; Rosenberg, Steven A.

    2008-01-01

    The recent identification of genes encoding melanoma-associated antigens has opened new possibilities for the development of cancer vaccines designed to cause the rejection of established tumors. To develop a syngeneic animal model for evaluating antigen-specific vaccines in cancer therapy, the murine homologues of the human melanoma antigens MART1 and gp 100, which were specifically recognized by tumor-infiltrating lymphocytes from patients with melanoma, were cloned and sequenced from a murine B16 melanoma cDNA library. The open reading frames of murine MART1 and gp 100 encode proteins of 113- and 626-amino acids with 68.8 and 77% identity to the respective human proteins. Comparison of the DNA sequences of the murine MART1 genes, derived from normal melanocytes, the immortalized nontumorgenic melanocyte line Melan-a and the B16 melanoma, showed all to be identical. Northern and Western blot analyses confirmed that both genes encoded products that were melanocyte lineage proteins. Mice immunized with murine MART1 or gp 100 using recombinant vaccinia virus failed to produce any detectable T-cell responses or protective immunity against B16 melanoma. In contrast, immunization of mice with human gp 100 using recombinant adenoviruses elicited T cells specific for hgp100, but these T cells also cross reacted with B16 tumor in vitro and induced significant but weak protection against B16 challenge. Immunization with human and mouse gp100 together [adenovirus type 2 (Ad2)-hep100 plus recombinant vaccinia virus (rVV)-mgp100], or immunization with human gp100 (Ad2-hgp100) and boosting with heterologous vector (rVV-hgp100 or rVV-mgp100) or homologous vector (Ad2-hgp100), did not significantly enhance the protective response against B16 melanoma. These results may suggest that immunization with heterologous tumor antigen, rather than self, may be more effective as an immunotherapeutic reagent in designing antigen-specific cancer vaccines. PMID:9101410

  19. A spinach O-acetylserine(thiollyase homologue, SoCSaseLP, suppresses cysteine biosynthesis catalysed by other enzyme isoforms

    Directory of Open Access Journals (Sweden)

    Miki Noda

    2016-06-01

    Full Text Available An enzyme, O-acetylserine(thiollyase (OASTL, also known as O-acetylserine sulfhydrylase or cysteine synthase (CSase, catalyses the incorporation of sulfide into O-acetylserine and produces cysteine. We previously identified a cDNA encoding an OASTL-like protein from Spinacia oleracea, (SoCSaseLP, but a recombinant SoCSaseLP produced in Escherichia coli did not show OASTL activity. The exon-intron structure of the SoCSaseLP gene shared conserved structures with other spinach OASTL genes. The SoCSaseLP and a Beta vulgaris homologue protein, KMT13462, comprise a unique clade in the phylogenetic tree of the OASTL family. Interestingly, when the SoCSaseLP gene was expressed in tobacco plants, total OASTL activity in tobacco leaves was reduced. This reduction in total OASTL activity was most likely caused by interference by SoCSaseLP with cytosolic OASTL. To investigate the possible interaction of SoCSaseLP with a spinach cytosolic OASTL isoform SoCSaseA, a pull-down assay was carried out. The recombinant glutathione S-transferase (GST-SoCSaseLP fusion protein was expressed in E. coli together with the histidine-tagged SoCSaseA protein, and the protein extract was subjected to glutathione affinity chromatography. The histidine-tagged SoCSaseA was co-purified with the GST-SoCSaseLP fusion protein, indicating the binding of SoCSaseLP to SoCSaseA. Consistent with this interaction, the OASTL activity of the co-purified SoCSaseA was reduced compared with the activity of SoCSaseA that was purified on its own. These results strongly suggest that SoCSaseLP negatively regulates the activity of other cytosolic OASTL family members by direct interaction.

  20. Neuronal SIRT1 (Silent Information Regulator 2 Homologue 1) Regulates Glycolysis and Mediates Resveratrol-Induced Ischemic Tolerance.

    Science.gov (United States)

    Koronowski, Kevin B; Khoury, Nathalie; Saul, Isabel; Loris, Zachary B; Cohan, Charles H; Stradecki-Cohan, Holly M; Dave, Kunjan R; Young, Juan I; Perez-Pinzon, Miguel A

    2017-11-01

    Resveratrol, at least in part via SIRT1 (silent information regulator 2 homologue 1) activation, protects against cerebral ischemia when administered 2 days before injury. However, it remains unclear if SIRT1 activation must occur, and in which brain cell types, for the induction of neuroprotection. We hypothesized that neuronal SIRT1 is essential for resveratrol-induced ischemic tolerance and sought to characterize the metabolic pathways regulated by neuronal Sirt1 at the cellular level in the brain. We assessed infarct size and functional outcome after transient 60 minute middle cerebral artery occlusion in control and inducible, neuronal-specific SIRT1 knockout mice. Nontargeted primary metabolomics analysis identified putative SIRT1-regulated pathways in brain. Glycolytic function was evaluated in acute brain slices from adult mice and primary neuronal-enriched cultures under ischemic penumbra-like conditions. Resveratrol-induced neuroprotection from stroke was lost in neuronal Sirt1 knockout mice. Metabolomics analysis revealed alterations in glucose metabolism on deletion of neuronal Sirt1 , accompanied by transcriptional changes in glucose metabolism machinery. Furthermore, glycolytic ATP production was impaired in acute brain slices from neuronal Sirt1 knockout mice. Conversely, resveratrol increased glycolytic rate in a SIRT1-dependent manner and under ischemic penumbra-like conditions in vitro. Our data demonstrate that resveratrol requires neuronal SIRT1 to elicit ischemic tolerance and identify a novel role for SIRT1 in the regulation of glycolytic function in brain. Identification of robust neuroprotective mechanisms that underlie ischemia tolerance and the metabolic adaptations mediated by SIRT1 in brain are crucial for the translation of therapies in cerebral ischemia and other neurological disorders. © 2017 American Heart Association, Inc.

  1. Localization of the Norrie disease gene mRNA by in situ hybridization.

    Science.gov (United States)

    Hartzer, M K; Cheng, M; Liu, X; Shastry, B S

    1999-07-15

    Norrie disease is a rare X-linked recessive neurodevelopmental disorder. The affected males manifest congenital blindness, which is often associated with hearing loss, mental retardation and psychiatric problems. Genetic linkage studies have localized the gene to the short arm of the X-chromosome and the gene has been isolated recently. The encoded protein is a member of the superfamily of growth factors containing a cystine knot motif and may be involved in cell adhesion and neurodevelopment. Molecular genetic analysis revealed a large number of missense, nonsense, deletion, and splice-site mutations among Norrie patients. In order to further determine the role of the Norrie disease gene, we studied the distribution pattern of its mRNA in the retina and in brain by in situ hybridization. The results show abundant hybridization signals in outer nuclear, inner nuclear, and ganglion cell layers of the retina in all three species (mice, rabbit, and human) examined. There was no significant expression in the vitreous body, lens, and rod outer segment. High expression levels were also observed in the cerebellar granular layer, hippocampus, olfactory bulb, cortex, and epithelium of the rabbit brain. These data suggest that the Norrie disease gene could play a critical role in the differentiation or maintenance of the differentiated state of the retina.

  2. Intergenic mRNA molecules resulting from trans-splicing.

    Science.gov (United States)

    Finta, Csaba; Zaphiropoulos, Peter G

    2002-02-22

    Accumulated recent evidence is indicating that alternative splicing represents a generalized process that increases the complexity of human gene expression. Here we show that mRNA production may not necessarily be limited to single genes, as human liver also has the potential to produce a variety of hybrid cytochrome P450 3A mRNA molecules. The four known cytochrome P450 3A genes in humans, CYP3A4, CYP3A5, CYP3A7, and CYP3A43, share a high degree of similarity, consist of 13 exons with conserved exon-intron boundaries, and form a cluster on chromosome 7. The chimeric CYP3A mRNA molecules described herein are characterized by CYP3A43 exon 1 joined at canonical splice sites to distinct sets of CYP3A4 or CYP3A5 exons. Because the CYP3A43 gene is in a head-to-head orientation with the CYP3A4 and CYP3A5 genes, bypassing transcriptional termination can not account for the formation of hybrid CYP3A mRNAs. Thus, the mechanism generating these molecules has to be an RNA processing event that joins exons of independent pre-mRNA molecules, i.e. trans-splicing. Using quantitative real-time polymerase chain reaction, the ratio of one CYP3A43/3A4 intergenic combination was estimated to be approximately 0.15% that of the CYP3A43 mRNAs. Moreover, trans-splicing has been found not to interfere with polyadenylation. Heterologous expression of the chimeric species composed of CYP3A43 exon 1 joined to exons 2-13 of CYP3A4 revealed catalytic activity toward testosterone.

  3. mRNA transfection of mouse and human neural stem cell cultures

    OpenAIRE

    McLenachan, Samuel; Zhang, D.; Palomo, A.B.; Edel, Michael John; Chen, F.K.

    2013-01-01

    The use of synthetic mRNA as an alternative gene delivery vector to traditional DNA-based constructs provides an effective method for inducing transient gene expression in cell cultures without genetic modification. Delivery of mRNA has been proposed as a safer alternative to viral vectors in the induction of pluripotent cells for regenerative therapies. Although mRNA transfection of fibroblasts, dendritic and embryonic stem cells has been described, mRNA delivery to neurosphere cultures has ...

  4. The chicken type III GnRH receptor homologue is predominantly expressed in the pituitary, and exhibits similar ligand selectivity to the type I receptor

    Science.gov (United States)

    Joseph, Nerine T; Morgan, Kevin; Sellar, Robin; McBride, Derek; Millar, Robert P; Dunn, Ian C

    2009-01-01

    Two GnRH isoforms (cGnRH-I and GnRH-II) and two GnRH receptor subtypes (cGnRH-R-I and cGnRH-R-III) occur in chickens. Differential roles for these molecules in regulating gonadotrophin secretion or other functions are unclear. To investigate this we cloned cGnRH-R-III from a broiler chicken and compared its structure, expression and pharmacological properties with cGnRH-R-I. The broiler cGnRH-R-III cDNA was 100% identical to the sequence reported in the red jungle fowl and white leghorn breed. Pituitary cGnRH-R-III mRNA was ∼1400-fold more abundant than cGnRH-R-I mRNA. Northern analysis indicated a single cGnRH-R-III transcript. A pronounced sex and age difference existed, with higher pituitary transcript levels in sexually mature females versus juvenile females. In contrast, higher expression levels occurred in juvenile males versus sexually mature males. Functional studies in COS-7 cells indicated that cGnRH-R-III has a higher binding affinity for GnRH-II than cGnRH-I (Kd: 0·57 vs 19·8 nM) with more potent stimulation of inositol phosphate production (ED50: 0·8 vs 4·38 nM). Similar results were found for cGnRH-R-I, (Kd: 0·51 vs 10·8 nM) and (ED50: 0·7 vs 2·8 nM). The initial rate of internalisation was faster for cGnRH-R-III than cGnRH-R-I (26 vs 15·8%/min). Effects of GnRH antagonists were compared at the two receptors. Antagonist #27 distinguished between cGnRH-R-I and cGnRH-R-III (IC50: 2·3 vs 351 nM). These results suggest that cGnRH-R-III is probably the major mediator of pituitary gonadotroph function, that antagonist #27 may allow delineation of receptor subtype function in vitro and in vivo and that tissue-specific recruitment of cGnRH-R isoforms has occurred during evolution. PMID:19380456

  5. A glimpse at mRNA dynamics reveals cellular domains and rapid trafficking through granules

    NARCIS (Netherlands)

    Gemert, Alice Myriam Christi van

    2011-01-01

    mRNA transport and targeting are essential to gene expression regulation. Specific mRNA sequences can bind several proteins and together form RiboNucleoProtein particles (RNP). The various proteins within the RNP determine mRNA fate: translation, transport or decay. RNP composition varies with

  6. Sexual phenotype differences in zic2 mRNA abundance in the preoptic area of a protogynous teleost, Thalassoma bifasciatum.

    Directory of Open Access Journals (Sweden)

    Katherine McCaffrey

    Full Text Available The highly conserved members of the zic family of zinc-finger transcription factors are primarily known for their roles in embryonic signaling pathways and regulation of cellular proliferation and differentiation. This study describes sexual phenotype differences in abundances of zic2 mRNA in the preoptic area of the hypothalamus, a region strongly implicated in sexual behavior and function, in an adult teleost, Thalassoma bifasciatum. The bluehead wrasse (Thalassoma bifasciatum is a valuable model for studying neuroendocrine processes because it displays two discrete male phenotypes, initial phase (IP males and territorial, terminal phase (TP males, and undergoes socially-controlled protogynous sex change. Previously generated microarray-based comparisons suggested that zic2 was upregulated in the brains of terminal phase males relative to initial phase males. To further explore this difference, we cloned a 727 bp sequence for neural zic2 from field-collected animals. Riboprobe-based in situ hybridization was employed to localize zic2 signal in adult bluehead brains and assess the relative abundance of brain zic2 mRNA across sexual phenotypes. We found zic2 mRNA expression was extremely abundant in the granular cells of the cerebellum and widespread in other brain regions including in the thalamus, hypothalamus, habenula, torus semicircularis, torus longitudinalis, medial longitudinal fascicle and telencephalic areas. Quantitative autoradiography and phosphorimaging showed zic2 mRNA hybridization signal in the preoptic area of the hypothalamus was significantly higher in terminal phase males relative to both initial phase males and females, and silver grain analysis confirmed this relationship between phenotypes. No significant difference in abundance was found in zic2 signal across phenotypes in the habenula, a brain region not implicated in the control of sexual behavior, or cerebellum.

  7. HOXB7 mRNA is overexpressed in pancreatic ductal adenocarcinomas and its knockdown induces cell cycle arrest and apoptosis

    International Nuclear Information System (INIS)

    Chile, Thais; Bacchella, Telésforo; Giorgi, Ricardo Rodrigues; Fortes, Maria Angela Henriques Zanella; Corrêa-Giannella, Maria Lúcia Cardillo; Brentani, Helena Paula; Maria, Durvanei Augusto; Puga, Renato David; Paula, Vanessa de Jesus R de; Kubrusly, Marcia Saldanha; Novak, Estela Maria

    2013-01-01

    Human homeobox genes encode nuclear proteins that act as transcription factors involved in the control of differentiation and proliferation. Currently, the role of these genes in development and tumor progression has been extensively studied. Recently, increased expression of HOXB7 homeobox gene (HOXB7) in pancreatic ductal adenocarcinomas (PDAC) was shown to correlate with an invasive phenotype, lymph node metastasis and worse survival outcomes, but no influence on cell proliferation or viability was detected. In the present study, the effects arising from the knockdown of HOXB7 in PDAC cell lines was investigated. Real time quantitative PCR (qRT-PCR) (Taqman) was employed to assess HOXB7 mRNA expression in 29 PDAC, 6 metastatic tissues, 24 peritumoral tissues and two PDAC cell lines. siRNA was used to knockdown HOXB7 mRNA in the cell lines and its consequences on apoptosis rate and cell proliferation were measured by flow cytometry and MTT assay respectively. Overexpression of HOXB7 mRNA was observed in the tumoral tissues and in the cell lines MIA PaCa-2 and Capan-1. HOXB7 knockdown elicited (1) an increase in the expression of the pro-apoptotic proteins BAX and BAD in both cell lines; (2) a decrease in the expression of the anti-apoptotic protein BCL-2 and in cyclin D1 and an increase in the number of apoptotic cells in the MIA PaCa-2 cell line; (3) accumulation of cell in sub-G1 phase in both cell lines; (4) the modulation of several biological processes, especially in MIA PaCa-2, such as proteasomal ubiquitin-dependent catabolic process and cell cycle. The present study confirms the overexpression of HOXB7 mRNA expression in PDAC and demonstrates that decreasing its protein level by siRNA could significantly increase apoptosis and modulate several biological processes. HOXB7 might be a promising target for future therapies

  8. The effect of dexamethasone and triiodothyronine on terminal differentiation of primary bovine chondrocytes and chondrogenically differentiated mesenchymal stem cells.

    Science.gov (United States)

    Randau, Thomas M; Schildberg, Frank A; Alini, Mauro; Wimmer, Matthias D; Haddouti, El-Mustapha; Gravius, Sascha; Ito, Keita; Stoddart, Martin J

    2013-01-01

    The newly evolved field of regenerative medicine is offering solutions in the treatment of bone or cartilage loss and deficiency. Mesenchymal stem cells, as well as articular chondrocytes, are potential cells for the generation of bone or cartilage. The natural mechanism of bone formation is that of endochondral ossification, regulated, among other factors, through the hormones dexamethasone and triiodothyronine. We investigated the effects of these hormones on articular chondrocytes and chondrogenically differentiated mesenchymal stem cells, hypothesizing that these hormones would induce terminal differentiation, with chondrocytes and differentiated stem cells being similar in their response. Using a 3D-alginate cell culture model, bovine chondrocytes and chondrogenically differentiated stem cells were cultured in presence of triiodothyronine or dexamethasone, and cell proliferation and extracellular matrix production were investigated. Collagen mRNA expression was measured by real-time PCR. Col X mRNA and alkaline phosphatase were monitored as markers of terminal differentiation, a prerequisite of endochondral ossification. The alginate culture system worked well, both for the culture of chondrocytes and for the chondrogenic differentiation of mesenchymal stem cells. Dexamethasone led to an increase in glycosaminoglycan production. Triiodothyronine increased the total collagen production only in chondrocytes, where it also induced signs of terminal differentiation, increasing both collagen X mRNA and alkaline phosphatase activity. Dexamethasone induced terminal differentiation in the differentiated stem cells. The immature articular chondrocytes used in this study seem to be able to undergo terminal differentiation, pointing to their possible role in the onset of degenerative osteoarthritis, as well as their potential for a cell source in bone tissue engineering. When chondrocyte-like cells, after their differentiation, can indeed be moved on towards terminal

  9. Activation of pluripotency genes in human fibroblast cells by a novel mRNA based approach.

    Directory of Open Access Journals (Sweden)

    Jordan R Plews

    2010-12-01

    Full Text Available Several methods have been used to induce somatic cells to re-enter the pluripotent state. Viral transduction of reprogramming genes yields higher efficiency but involves random insertions of viral sequences into the human genome. Although induced pluripotent stem (iPS cells can be obtained with the removable PiggyBac transposon system or an episomal system, both approaches still use DNA constructs so that resulting cell lines need to be thoroughly analyzed to confirm they are free of harmful genetic modification. Thus a method to change cell fate without using DNA will be very useful in regenerative medicine.In this study, we synthesized mRNAs encoding OCT4, SOX2, cMYC, KLF4 and SV40 large T (LT and electroporated them into human fibroblast cells. Upon transfection, fibroblasts expressed these factors at levels comparable to, or higher than those in human embryonic stem (ES cells. Ectopically expressed OCT4 localized to the cell nucleus within 4 hours after mRNA introduction. Transfecting fibroblasts with a mixture of mRNAs encoding all five factors significantly increased the expression of endogenous OCT4, NANOG, DNMT3β, REX1 and SALL4. When such transfected fibroblasts were also exposed to several small molecules (valproic acid, BIX01294 and 5'-aza-2'-deoxycytidine and cultured in human embryonic stem cell (ES medium they formed small aggregates positive for alkaline phosphatase activity and OCT4 protein within 30 days.Our results demonstrate that mRNA transfection can be a useful approach to precisely control the protein expression level and short-term expression of reprogramming factors is sufficient to activate pluripotency genes in differentiated cells.

  10. Metabolic reprogramming during neuronal differentiation.

    Science.gov (United States)

    Agostini, M; Romeo, F; Inoue, S; Niklison-Chirou, M V; Elia, A J; Dinsdale, D; Morone, N; Knight, R A; Mak, T W; Melino, G

    2016-09-01

    Newly generated neurons pass through a series of well-defined developmental stages, which allow them to integrate into existing neuronal circuits. After exit from the cell cycle, postmitotic neurons undergo neuronal migration, axonal elongation, axon pruning, dendrite morphogenesis and synaptic maturation and plasticity. Lack of a global metabolic analysis during early cortical neuronal development led us to explore the role of cellular metabolism and mitochondrial biology during ex vivo differentiation of primary cortical neurons. Unexpectedly, we observed a huge increase in mitochondrial biogenesis. Changes in mitochondrial mass, morphology and function were correlated with the upregulation of the master regulators of mitochondrial biogenesis, TFAM and PGC-1α. Concomitant with mitochondrial biogenesis, we observed an increase in glucose metabolism during neuronal differentiation, which was linked to an increase in glucose uptake and enhanced GLUT3 mRNA expression and platelet isoform of phosphofructokinase 1 (PFKp) protein expression. In addition, glutamate-glutamine metabolism was also increased during the differentiation of cortical neurons. We identified PI3K-Akt-mTOR signalling as a critical regulator role of energy metabolism in neurons. Selective pharmacological inhibition of these metabolic pathways indicate existence of metabolic checkpoint that need to be satisfied in order to allow neuronal differentiation.

  11. Prognostic significance of CDH13 hypermethylation and mRNA in NSCLC

    Directory of Open Access Journals (Sweden)

    Xue R

    2014-10-01

    Full Text Available Ruilin Xue,1 Cuili Yang,1 Fang Zhao,2 Dejia Li1 1Global Health Institute, School of Public Health, 2Zhongnan Hospital, Wuhan University, Wuhan, People's Republic of ChinaAbstract: Aberrant methylation of CpG dinucleotides is a commonly observed epigenetic modification in human cancer. Thus, detection of aberrant gene promoter methylation as a tool for diagnosis of tumors or as a prognostic marker has been widely described for many types of cancers, including nonsmall cell lung cancer (NSCLC. Emerging evidence indicates that CDH13 is a candidate tumor suppressor in several types of human tumors, including NSCLC. However, the correlation between CDH13 hypermethylation and clinicopathological characteristics of NSCLC remains unclear. In the current study, we conducted a systematic review and meta-analysis to quantitatively evaluate the effects of CDH13 hypermethylation on the incidence of NSCLC and clinicopathological characteristics. Final analysis of 803 NSCLC patients from eleven eligible studies was performed. CDH13 hypermethylation was observed to be significantly higher in NSCLC than in normal lung tissue, with the pooled odds ratio (OR from seven studies including 448 NSCLC and 345 normal lung tissue (OR, 7.85; 95% confidence interval, 5.12–12.03; P<0.00001. CDH13 hypermethylation was also associated with pathological types. The pooled OR was obtained from four studies, including 111 squamous cell carcinoma and 106 adenocarcinoma (OR, 0.35; 95% confidence interval, 0.19–0.66; P=0.001, which indicated that CDH13 hypermethylation plays a more important role in the pathogenesis of adenocarcinoma. NSCLC with CDH13 hypermethylation was found more frequently in poorly differentiated NSCLC patients. NSCLC patients with CDH13 hypermethylation had a lower survival rate than those without CDH13 hypermethylation. In addition, CDH13 mRNA high expression was found to correlate with better overall survival for all NSCLC patients followed for 20 years

  12. Matrin 3 binds and stabilizes mRNA.

    Directory of Open Access Journals (Sweden)

    Maayan Salton

    Full Text Available Matrin 3 (MATR3 is a highly conserved, inner nuclear matrix protein with two zinc finger domains and two RNA recognition motifs (RRM, whose function is largely unknown. Recently we found MATR3 to be phosphorylated by the protein kinase ATM, which activates the cellular response to double strand breaks in the DNA. Here, we show that MATR3 interacts in an RNA-dependent manner with several proteins with established roles in RNA processing, and maintains its interaction with RNA via its RRM2 domain. Deep sequencing of the bound RNA (RIP-seq identified several small noncoding RNA species. Using microarray analysis to explore MATR3's role in transcription, we identified 77 transcripts whose amounts depended on the presence of MATR3. We validated this finding with nine transcripts which were also bound to the MATR3 complex. Finally, we demonstrated the importance of MATR3 for maintaining the stability of several of these mRNA species and conclude that it has a role in mRNA stabilization. The data suggest that the cellular level of MATR3, known to be highly regulated, modulates the stability of a group of gene transcripts.

  13. Changes in apoptotic microRNA and mRNA expression profiling in Caenorhabditis elegans during the Shenzhou-8 mission

    International Nuclear Information System (INIS)

    Gao Ying; Li Shuai; Xu Dan; Wang Junjun; Sun Yeqing

    2015-01-01

    Radiation and microgravity exposure have been proven to induce abnormal apoptosis in microRNA (miRNA) and mRNA expression, but whether space conditions, including radiation and microgravity, activate miRNAs to regulate the apoptosis is undetermined. For that purpose, we investigated miRNome and mRNA expression in the ced-1 Caenorhabditis elegans mutant vs the wild-type, both of which underwent spaceflight, spaceflight 1g-centrifuge control and ground control conditions during the Shenzhou-8 mission. Results showed that no morphological changes in the worms were detected, but differential miRNA expression increased from 43 (ground control condition) to 57 and 91 in spaceflight and spaceflight control conditions, respectively. Microgravity altered miRNA expression profiling by decreasing the number and significance of differentially expressed miRNA compared with 1 g incubation during spaceflight. Alterations in the miRNAs were involved in alterations in apoptosis, neurogenesis larval development, ATP metabolism and GTPase-mediated signal transduction. Among these, 17 altered miRNAs potentially involved in apoptosis were screened and showed obviously different expression signatures between space conditions. By integrated analysis of miRNA and mRNA, miR-797 and miR-81 may be involved in apoptosis by targeting the genes ced-10 and both drp-1 and hsp-1, respectively. Compared with ground condition, space conditions regulated apoptosis though a different manner on transcription, by altering expression of seven core apoptotic genes in spaceflight condition, and eight in spaceflight control condition. Results indicate that, miRNA of Caenorhabditis elegans probably regulates apoptotic gene expression in response to space environmental stress, and shows different behavior under microgravity condition compared with 1 g condition in the presence of space radiation. (author)

  14. mRNA Fragments in In-Vitro Culture Media are Associated with Bovine Preimplantation Embryonic Development

    Directory of Open Access Journals (Sweden)

    Jenna eKropp

    2015-08-01

    Full Text Available In vitro production (IVP systems have been used to bypass problems of fertilization and early embryonic development. However, embryos produced by IVP are commonly selected for implantation based on morphological assessment, which is not a strong indicator of establishment and maintenance of pregnancy. Thus, there is a need to identify additional indicators of embryonic developmental potential. Previous studies have identified microRNA expression in in vitro culture media to be indicative of embryo quality in both bovine and human embryos. Like microRNAs, mRNAs have been shown to be secreted from cells into the extracellular environment, but it is unknown whether or not these RNAs are secreted by embryos. Thus, the objective of the present study was to determine whether mRNAs are secreted into in vitro culture media and if their expression in the media is indicative of embryo quality. In vitro culture medium was generated and collected from both blastocyst and degenerate (those which fail to develop from the morula to blastocyst stage embryos. Small-RNA sequencing revealed that many mRNA fragments were present in the culture media. A total of 17 mRNA fragments were differentially expressed between blastocyst and degenerated conditioned media. Differential expression was confirmed by quantitative real-time PCR for

  15. Increased mRNA expression of a laminin-binding protein in human colon carcinoma: Complete sequence of a full-length cDNA encoding the protein

    International Nuclear Information System (INIS)

    Yow, Hsiukang; Wong, Jau Min; Chen, Hai Shiene; Lee, C.; Steele, G.D. Jr.; Chen, Lanbo

    1988-01-01

    Reliable markers to distinguish human colon carcinoma from normal colonic epithelium are needed particularly for poorly differentiated tumors where no useful marker is currently available. To search for markers the authors constructed cDNA libraries from human colon carcinoma cell lines and screened for clones that hybridize to a greater degree with mRNAs of colon carcinomas than with their normal counterparts. Here they report one such cDNA clone that hybridizes with a 1.2-kilobase (kb) mRNA, the level of which is ∼9-fold greater in colon carcinoma than in adjacent normal colonic epithelium. Blot hybridization of total RNA from a variety of human colon carcinoma cell lines shows that the level of this 1.2-kb mRNA in poorly differentiated colon carcinomas is as high as or higher than that in well-differentiated carcinomas. Molecular cloning and complete sequencing of cDNA corresponding to the full-length open reading frame of this 1.2-kb mRNA unexpectedly show it to contain all the partial cDNA sequence encoding 135 amino acid residues previously reported for a human laminin receptor. The deduced amino acid sequence suggests that this putative laminin-binding protein from human colon carcinomas consists of 295 amino acid residues with interesting features. There is an unusual C-terminal 70-amino acid segment, which is trypsin-resistant and highly negatively charged

  16. Expression of the chitinase family glycoprotein YKL-40 in undifferentiated, differentiated and trans-differentiated mesenchymal stem cells.

    Directory of Open Access Journals (Sweden)

    Daniel J Hoover

    Full Text Available The glycoprotein YKL-40 (CHI3L1 is a secreted chitinase family protein that induces angiogenesis, cell survival, and cell proliferation, and plays roles in tissue remodeling and immune regulation. It is expressed primarily in cells of mesenchymal origin, is overexpressed in numerous aggressive carcinomas and sarcomas, but is rarely expressed in normal ectodermal tissues. Bone marrow-derived mesenchymal stem cells (MSCs can be induced to differentiate into various mesenchymal tissues and trans-differentiate into some non-mesenchymal cell types. Since YKL-40 has been used as a mesenchymal marker, we followed YKL-40 expression as undifferentiated MSCs were induced to differentiate into bone, cartilage, and neural phenotypes. Undifferentiated MSCs contain significant levels of YKL-40 mRNA but do not synthesize detectable levels of YKL-40 protein. MSCs induced to differentiate into chondrocytes and osteocytes soon began to express and secrete YKL-40 protein, as do ex vivo cultured chondrocytes and primary osteocytes. In contrast, MSCs induced to trans-differentiate into neurons did not synthesize YKL-40 protein, consistent with the general absence of YKL-40 protein in normal CNS parenchyma. However, these trans-differentiated neurons retained significant levels of YKL-40 mRNA, suggesting the mechanisms which prevented YKL-40 translation in undifferentiated MSCs remained in place, and that these trans-differentiated neurons differ in at least this way from neurons derived from neuronal stem cells. Utilization of a differentiation protocol containing β-mercaptoethanol resulted in cells that expressed significant amounts of intracellular YKL-40 protein that was not secreted, which is not seen in normal cells. Thus the synthesis of YKL-40 protein is a marker for MSC differentiation into mature mesenchymal phenotypes, and the presence of untranslated YKL-40 mRNA in non-mesenchymal cells derived from MSCs reflects differences between differentiated and

  17. Differential discriminator

    International Nuclear Information System (INIS)

    Dukhanov, V.I.; Mazurov, I.B.

    1981-01-01

    A principal flowsheet of a differential discriminator intended for operation in a spectrometric circuit with statistical time distribution of pulses is described. The differential discriminator includes four integrated discriminators and a channel of piled-up signal rejection. The presence of the rejection channel enables the discriminator to operate effectively at loads of 14x10 3 pulse/s. The temperature instability of the discrimination thresholds equals 250 μV/ 0 C. The discrimination level changes within 0.1-5 V, the level shift constitutes 0.5% for the filling ratio of 1:10. The rejection coefficient is not less than 90%. Alpha spectrum of the 228 Th source is presented to evaluate the discriminator operation with the rejector. The rejector provides 50 ns time resolution

  18. Differential topology

    CERN Document Server

    Margalef-Roig, J

    1992-01-01

    ...there are reasons enough to warrant a coherent treatment of the main body of differential topology in the realm of Banach manifolds, which is at the same time correct and complete. This book fills the gap: whenever possible the manifolds treated are Banach manifolds with corners. Corners add to the complications and the authors have carefully fathomed the validity of all main results at corners. Even in finite dimensions some results at corners are more complete and better thought out here than elsewhere in the literature. The proofs are correct and with all details. I see this book as a reliable monograph of a well-defined subject; the possibility to fall back to it adds to the feeling of security when climbing in the more dangerous realms of infinite dimensional differential geometry. Peter W. Michor

  19. Differential belongings

    DEFF Research Database (Denmark)

    Oldrup, Helene

    2014-01-01

    This paper explores suburban middle-class residents’ narratives about housing choice, everyday life and belonging in residential areas of Greater Copenhagen, Denmark, to understand how residential processes of social differentiation are constituted. Using Savage et al.’s concepts of discursive...... and not only to the area itself. In addition, rather than seeing suburban residential areas as homogenous, greater attention should be paid to differences within such areas....

  20. Characterization of cogon grass (Imperata cylindrica) pollen extract and preliminary analysis of grass group 1, 4 and 5 homologues using monoclonal antibodies to Phleum pratense.

    Science.gov (United States)

    Kumar, L; Sridhara, S; Singh, B P; Gangal, S V

    1998-11-01

    Previous studies have established the role of Imperata cylindrica (Ic) pollen in type I allergic disorders. However, no systematic information is available on the allergen composition of Ic pollen extract. To characterize the IgE-binding proteins of Ic pollen extract and to detect the presence of grass group 1, 4 and 5 allergen homologues, if any. Pollen extract of Ic was analyzed by in vivo and in vitro procedures such as intradermal tests (ID), enzyme-linked immunosorbent assay (ELISA), ELISA-inhibition, thin-layer isoelectric focusing (TLIEF), sodium dodecylsulfate polyacrylamide gel electrophoresis (SDS-PAGE) and immunoblotting. Dot blot assay was carried out to check the presence of well-known group 1, 4, and 5 allergen homologues in Ic pollen extract. Out of 303 respiratory allergies patients skin-tested, 27 showed sensitivity to Ic pollen extract. Specific IgE levels were elevated in all 15 serum samples tested. The extract prepared for this study was found to be highly potent since it required only 400 ng of homologous proteins for 50% inhibition of binding in ELISA inhibition assays. TLIEF of Ic pollen extract showed 44 silver-stained bands (pI 3.5-7.0) while SDS-PAGE resolved it into 24 Coomassie-Brilliant-Blue-stained bands (MW 100-10 kD). Immunoblotting with individual patient sera recognized 7 major IgE-binding bands (MW 85, 62, 57, 43, 40, 28 and 16 kD) in Ic pollen extract. A panel of monoclonal antibodies, specific to group 1, 4 and 5 allergens from Phleum pratense pollen extract identified group 5 and group 4 homologues in Ic pollen extract. Ic pollen extract was characterized for the protein profile by TLIEF and SDS-PAGE. IgE reactivity was determined by ELISA and immunoblot. Monoclonal antibodies to group 5 and group 4 allergens reacted weakly showing that this pollen contains group 5 and group 4 homologous allergens.

  1. Omega-3 Polyunsaturated Fatty Acids Enhance Neuronal Differentiation in Cultured Rat Neural Stem Cells

    Directory of Open Access Journals (Sweden)

    Masanori Katakura

    2013-01-01

    Full Text Available Polyunsaturated fatty acids (PUFAs can induce neurogenesis and recovery from brain diseases. However, the exact mechanisms of the beneficial effects of PUFAs have not been conclusively described. We recently reported that docosahexaenoic acid (DHA induced neuronal differentiation by decreasing Hes1 expression and increasing p27kip1 expression, which causes cell cycle arrest in neural stem cells (NSCs. In the present study, we examined the effect of eicosapentaenoic acid (EPA and arachidonic acid (AA on differentiation, expression of basic helix-loop-helix transcription factors (Hes1, Hes6, and NeuroD, and the cell cycle of cultured NSCs. EPA also increased mRNA levels of Hes1, an inhibitor of neuronal differentiation, Hes6, an inhibitor of Hes1, NeuroD, and Map2 mRNA and Tuj-1-positive cells (a neuronal marker, indicating that EPA induced neuronal differentiation. EPA increased the mRNA levels of p21cip1 and p27kip1, a cyclin-dependent kinase inhibitor, which indicated that EPA induced cell cycle arrest. Treatment with AA decreased Hes1 mRNA but did not affect NeuroD and Map2 mRNA levels. Furthermore, AA did not affect the number of Tuj-1-positive cells or cell cycle progression. These results indicated that EPA could be involved in neuronal differentiation by mechanisms alternative to those of DHA, whereas AA did not affect neuronal differentiation in NSCs.

  2. Structure of the gene encoding VGF, a nervous system-specific mRNA that is rapidly and selectively induced by nerve growth factor in PC12 cells.

    Science.gov (United States)

    Salton, S R; Fischberg, D J; Dong, K W

    1991-05-01

    Nerve growth factor (NGF) plays a critical role in the development and survival of neurons in the peripheral nervous system. Following treatment with NGF but not epidermal growth factor, rat pheochromocytoma (PC12) cells undergo neural differentiation. We have cloned a nervous system-specific mRNA, NGF33.1, that is rapidly and relatively selectively induced by treatment of PC12 cells with NGF and basic fibroblast growth factor in comparison with epidermal growth factor. Analysis of the nucleic acid and predicted amino acid sequences of the NGF33.1 cDNA clone suggested that this clone corresponded to the NGF-inducible mRNA called VGF (A. Levi, J. D. Eldridge, and B. M. Paterson, Science 229:393-395, 1985; R. Possenti, J. D. Eldridge, B. M. Paterson, A. Grasso, and A. Levi, EMBO J. 8:2217-2223, 1989). We have used the NGF33.1 cDNA clone to isolate and characterize the VGF gene, and in this paper we report the complete sequence of the VGF gene, including 853 bases of 5' flank revealed TATAA and CCAAT elements, several GC boxes, and a consensus cyclic AMP response element-binding protein binding site. The VGF promoter contains sequences homologous to other NGF-inducible, neuronal promoters. We further show that VGF mRNA is induced in PC12 cells to a greater extent by depolarization and by phorbol-12-myristate-13-acetate treatment than by 8-bromo-cyclic AMP treatment. By Northern (RNA) and RNase protection analysis, VGF mRNA is detectable in embryonic and postnatal central and peripheral nervous tissues but not in a number of nonneural tissues. In the cascade of events which ultimately leads to the neural differentiation of NGF-treated PC12 cells, the VGF gene encodes the most rapidly and selectively regulated, nervous-system specific mRNA yet identified.

  3. Meticillin-resistant Staphylococcus aureus with a novel mecA homologue in human and bovine populations in the UK and Denmark: a descriptive study.

    Science.gov (United States)

    García-Álvarez, Laura; Holden, Matthew T G; Lindsay, Heather; Webb, Cerian R; Brown, Derek F J; Curran, Martin D; Walpole, Enid; Brooks, Karen; Pickard, Derek J; Teale, Christopher; Parkhill, Julian; Bentley, Stephen D; Edwards, Giles F; Girvan, E Kirsty; Kearns, Angela M; Pichon, Bruno; Hill, Robert L R; Larsen, Anders Rhod; Skov, Robert L; Peacock, Sharon J; Maskell, Duncan J; Holmes, Mark A

    2011-08-01

    Animals can act as a reservoir and source for the emergence of novel meticillin-resistant Staphylococcus aureus (MRSA) clones in human beings. Here, we report the discovery of a strain of S aureus (LGA251) isolated from bulk milk that was phenotypically resistant to meticillin but tested negative for the mecA gene and a preliminary investigation of the extent to which such strains are present in bovine and human populations. Isolates of bovine MRSA were obtained from the Veterinary Laboratories Agency in the UK, and isolates of human MRSA were obtained from diagnostic or reference laboratories (two in the UK and one in Denmark). From these collections, we searched for mecA PCR-negative bovine and human S aureus isolates showing phenotypic meticillin resistance. We used whole-genome sequencing to establish the genetic basis for the observed antibiotic resistance. A divergent mecA homologue (mecA(LGA251)) was discovered in the LGA251 genome located in a novel staphylococcal cassette chromosome mec element, designated type-XI SCCmec. The mecA(LGA251) was 70% identical to S aureus mecA homologues and was initially detected in 15 S aureus isolates from dairy cattle in England. These isolates were from three different multilocus sequence type lineages (CC130, CC705, and ST425); spa type t843 (associated with CC130) was identified in 60% of bovine isolates. When human mecA-negative MRSA isolates were tested, the mecA(LGA251) homologue was identified in 12 of 16 isolates from Scotland, 15 of 26 from England, and 24 of 32 from Denmark. As in cows, t843 was the most common spa type detected in human beings. Although routine culture and antimicrobial susceptibility testing will identify S aureus isolates with this novel mecA homologue as meticillin resistant, present confirmatory methods will not identify them as MRSA. New diagnostic guidelines for the detection of MRSA should consider the inclusion of tests for mecA(LGA251). Department for Environment, Food and Rural Affairs

  4. Analysis of dofA, a fruA-Dependent Developmental Gene, and Its Homologue, dofB, in Myxococcus xanthus

    OpenAIRE

    Horiuchi, Takayuki; Akiyama, Takuya; Inouye, Sumiko; Komano, Teruya

    2002-01-01

    The developmentally regulated gene dofA, identified from pulse-labeling experiments by two-dimensional gel electrophoresis, and its homologue, dofB, were cloned and characterized in Myxococcus xanthus. Deletion of dofA and dofB did not affect the vegetative growth and development of M. xanthus. dofA was specifically expressed during development, while dofB expression was observed during vegetative growth and development. The dofA-lacZ fusion was introduced into a fruA mutant and A, B, C, D, a...

  5. Cloning of the cDNA for a human homologue of the Drosophila white gene and mapping to chromosome 21q22.3.

    OpenAIRE

    Chen, H.; Rossier, C.; Lalioti, M. D.; Lynn, A.; Chakravarti, A.; Perrin, G.; Antonarakis, S. E.

    1996-01-01

    In an effort to contribute to the transcript map of human chromosome 21 and the understanding of the pathophysiology of trisomy 21, we have used exon trapping to identify fragments of chromosome 21 genes. Two trapped exons, from pools of chromosome 21-specific cosmids, showed homology to the Drosophila white (w) gene. We subsequently cloned the corresponding cDNA for a human homologue of the Drosophila w gene (hW) from human retina and fetal brain cDNA libraries. The gene belongs to the ATP-b...

  6. Analysis of the 3’ untranslated regions of α-tubulin and S-crystallin mRNA and the identification of CPEB in dark- and light-adapted octopus retinas

    Science.gov (United States)

    Kelly, Shannan; Yamamoto, Hideki

    2008-01-01

    Purpose We previously reported the differential expression and translation of mRNA and protein in dark- and light-adapted octopus retinas, which may result from cytoplasmic polyadenylation element (CPE)–dependent mRNA masking and unmasking. Here we investigate the presence of CPEs in α-tubulin and S-crystallin mRNA and report the identification of cytoplasmic polyadenylation element binding protein (CPEB) in light- and dark-adapted octopus retinas. Methods 3’-RACE and sequencing were used to isolate and analyze the 3’-UTRs of α-tubulin and S-crystallin mRNA. Total retinal protein isolated from light- and dark-adapted octopus retinas was subjected to western blot analysis followed by CPEB antibody detection, PEP-171 inhibition of CPEB, and dephosphorylation of CPEB. Results The following CPE-like sequence was detected in the 3’-UTR of isolated long S-crystallin mRNA variants: UUUAACA. No CPE or CPE-like sequences were detected in the 3’-UTRs of α-tubulin mRNA or of the short S-crystallin mRNA variants. Western blot analysis detected CPEB as two putative bands migrating between 60-80 kDa, while a third band migrated below 30 kDa in dark- and light-adapted retinas. Conclusions The detection of CPEB and the identification of the putative CPE-like sequences in the S-crystallin 3’-UTR suggest that CPEB may be involved in the activation of masked S-crystallin mRNA, but not in the regulation of α-tubulin mRNA, resulting in increased S-crystallin protein synthesis in dark-adapted octopus retinas. PMID:18682811

  7. Parallel mRNA, proteomics and miRNA expression analysis in cell line models of the intestine.

    Science.gov (United States)

    O'Sullivan, Finbarr; Keenan, Joanne; Aherne, Sinead; O'Neill, Fiona; Clarke, Colin; Henry, Michael; Meleady, Paula; Breen, Laura; Barron, Niall; Clynes, Martin; Horgan, Karina; Doolan, Padraig; Murphy, Richard

    2017-11-07

    To identify miRNA-regulated proteins differentially expressed between Caco2 and HT-29: two principal cell line models of the intestine. Exponentially growing Caco-2 and HT-29 cells were harvested and prepared for mRNA, miRNA and proteomic profiling. mRNA microarray profiling analysis was carried out using the Affymetrix GeneChip Human Gene 1.0 ST array. miRNA microarray profiling analysis was carried out using the Affymetrix Genechip miRNA 3.0 array. Quantitative Label-free LC-MS/MS proteomic analysis was performed using a Dionex Ultimate 3000 RSLCnano system coupled to a hybrid linear ion trap/Orbitrap mass spectrometer. Peptide identities were validated in Proteome Discoverer 2.1 and were subsequently imported into Progenesis QI software for further analysis. Hierarchical cluster analysis for all three parallel datasets (miRNA, proteomics, mRNA) was conducted in the R software environment using the Euclidean distance measure and Ward's clustering algorithm. The prediction of miRNA and oppositely correlated protein/mRNA interactions was performed using TargetScan 6.1. GO biological process, molecular function and cellular component enrichment analysis was carried out for the DE miRNA, protein and mRNA lists via the Pathway Studio 11.3 Web interface using their Mammalian database. Differential expression (DE) profiling comparing the intestinal cell lines HT-29 and Caco-2 identified 1795 Genes, 168 Proteins and 160 miRNAs as DE between the two cell lines. At the gene level, 1084 genes were upregulated and 711 were downregulated in the Caco-2 cell line relative to the HT-29 cell line. At the protein level, 57 proteins were found to be upregulated and 111 downregulated in the Caco-2 cell line relative to the HT-29 cell line. Finally, at the miRNAs level, 104 were upregulated and 56 downregulated in the Caco-2 cell line relative to the HT-29 cell line. Gene ontology (GO) analysis of the DE mRNA identified cell adhesion, migration and ECM organization, cellular lipid

  8. Differential geometry

    CERN Document Server

    Ciarlet, Philippe G

    2007-01-01

    This book gives the basic notions of differential geometry, such as the metric tensor, the Riemann curvature tensor, the fundamental forms of a surface, covariant derivatives, and the fundamental theorem of surface theory in a selfcontained and accessible manner. Although the field is often considered a classical one, it has recently been rejuvenated, thanks to the manifold applications where it plays an essential role. The book presents some important applications to shells, such as the theory of linearly and nonlinearly elastic shells, the implementation of numerical methods for shells, and

  9. Differential equations

    CERN Document Server

    Tricomi, FG

    2013-01-01

    Based on his extensive experience as an educator, F. G. Tricomi wrote this practical and concise teaching text to offer a clear idea of the problems and methods of the theory of differential equations. The treatment is geared toward advanced undergraduates and graduate students and addresses only questions that can be resolved with rigor and simplicity.Starting with a consideration of the existence and uniqueness theorem, the text advances to the behavior of the characteristics of a first-order equation, boundary problems for second-order linear equations, asymptotic methods, and diff

  10. Differential topology

    CERN Document Server

    Guillemin, Victor

    2010-01-01

    Differential Topology provides an elementary and intuitive introduction to the study of smooth manifolds. In the years since its first publication, Guillemin and Pollack's book has become a standard text on the subject. It is a jewel of mathematical exposition, judiciously picking exactly the right mixture of detail and generality to display the richness within. The text is mostly self-contained, requiring only undergraduate analysis and linear algebra. By relying on a unifying idea-transversality-the authors are able to avoid the use of big machinery or ad hoc techniques to establish the main

  11. Genetic and physical mapping of homologues of the virus resistance gene Rx1 and the cyst nematode resistance gene Gpa2 in potato.

    Science.gov (United States)

    Bakker, E; Butterbach, P; Rouppe van der Voort, J; van der Vossen, E; van Vliet, J; Bakker, J; Goverse, A

    2003-05-01

    Nine resistance gene homologues (RGHs) were identified in two diploid potato clones (SH and RH), with a specific primer pair based on conserved motifs in the LRR domain of the potato cyst nematode resistance gene Gpa2 and the potato virus X resistance gene Rx1. A modified AFLP method was used to facilitate the genetic mapping of the RGHs in the four haplotypes under investigation. All nine RGHs appeared to be located in the Gpa2/ Rx1 cluster on chromosome XII. Construction of a physical map using bacterial artificial chromosome (BAC) clones for both the Solanum tuberosum ssp. tuberosum and the S. tuberosum ssp. andigena haplotype of SH showed that the RGHs are located within a stretch of less than 200 kb. Sequence analysis of the RGHs revealed that they are highly similar (93 to 95%) to Gpa2 and Rx1. The sequence identities among all RGHs range from 85 to 100%. Two pairs of RGHs are identical, or nearly so (100 and 99.9%), with each member located in a different genotype. Southern-blot analysis on genomic DNA revealed no evidence for additional homologues outside the Gpa2/ Rx1 cluster on chromosome XII.

  12. Phospholipase C δ-type consists of three isozymes: bovine PLCδ2 is a homologue of human/mouse PLCδ4

    International Nuclear Information System (INIS)

    Irino, Yasuhiro; Cho, Hiroyuki; Nakamura, Yoshikazu; Nakahara, Masamichi; Furutani, Masahiro; Suh, Pann-Ghill; Takenawa, Tadaomi; Fukami, Kiyoko

    2004-01-01

    To date, 12 phospholipase C (PLC) isozymes have been identified in mammals, and they are divided into five classes, β-, γ-, δ-, ε-, and ζ-type. PLCδ-type is reported to be composed of four isozymes, PLCδ1-δ4. Here we report that a screening for mouse PLCδ2 from a BAC library with primers that amplify a specific region of bovine PLCδ2 resulted in isolation of one clone containing the mouse PLCδ4 gene. Furthermore, a database search revealed that there is only one gene corresponding to PLCδ2 and PLCδ4 in the mouse and human genomes, indicating that bovine PLCδ2 is a homologue of human and mouse PLCδ4. However, PLCδ2 Western blot analysis with a widely used commercial anti-PLCδ2 antibody showed an expression pattern distinct from that of PLCδ4 in wild-type mice. In addition, an 80-kDa band, which was recognized by antibody against PLCδ2, was smaller than an 85-kDa band detected by anti-PLCδ4 antibody, and the 80-kDa band was detectable in lysates of brain, testis, and spleen from PLCδ4-deficient mice. We also found that immunoprecipitates from brain lysates with this PLCδ2 antibody contained no PLC activity. From these data, we conclude that bovine PLCδ2 is a homologue of human and mouse PLCδ4, and that three isozymes (δ1, δ3, and δ4) exist in the PLCδ family

  13. Quantitative analyses of postmortem heat shock protein mRNA profiles in the occipital lobes of human cerebral cortices: implications in cause of death.

    Science.gov (United States)

    Chung, Ukhee; Seo, Joong-Seok; Kim, Yu-Hoon; Son, Gi Hoon; Hwang, Juck-Joon

    2012-11-01

    Quantitative RNA analyses of autopsy materials to diagnose the cause and mechanism of death are challenging tasks in the field of forensic molecular pathology. Alterations in mRNA profiles can be induced by cellular stress responses during supravital reactions as well as by lethal insults at the time of death. Here, we demonstrate that several gene transcripts encoding heat shock proteins (HSPs), a gene family primarily responsible for cellular stress responses, can be differentially expressed in the occipital region of postmortem human cerebral cortices with regard to the cause of death. HSPA2 mRNA levels were higher in subjects who died due to mechanical asphyxiation (ASP), compared with those who died by traumatic injury (TI). By contrast, HSPA7 and A13 gene transcripts were much higher in the TI group than in the ASP and sudden cardiac death (SCD) groups. More importantly, relative abundances between such HSP mRNA species exhibit a stronger correlation to, and thus provide more discriminative information on, the death process than does routine normalization to a housekeeping gene. Therefore, the present study proposes alterations in HSP mRNA composition in the occipital lobe as potential forensic biological markers, which may implicate the cause and process of death.

  14. Excision of a viral reprogramming cassette by delivery of synthetic Cre mRNA

    Science.gov (United States)

    Loh, Yuin-Han; Yang, Jimmy Chen; De Los Angeles, Alejandro; Guo, Chunguang; Cherry, Anne; Rossi, Derrick J.; Park, In-Hyun; Daley, George Q.

    2012-01-01

    The generation of patient-specific induced pluripotent stem (iPS) cells provides an invaluable resource for cell therapy, in vitro modeling of human disease, and drug screening. To date, most human iPS cells have been generated with integrating retro- and lenti-viruses and are limited in their potential utility because residual transgene expression may alter their differentiation potential or induce malignant transformation. Alternatively, transgene-free methods using adenovirus and protein transduction are limited by low efficiency. This report describes a protocol for the generation of transgene-free human induced pluripotent stem cells using retroviral transfection of a single vector, which includes the coding sequences of human OCT4, SOX2, KLF4, and cMYC linked with picornaviral 2A plasmids. Moreover, after reprogramming has been achieved, this cassette can be removed using mRNA transfection of Cre recombinase. The method described herein to excise reprogramming factors with ease and efficiency facilitates the experimental generation and use of transgene-free human iPS cells. PMID:22605648

  15. GAD1 mRNA expression and DNA methylation in prefrontal cortex of subjects with schizophrenia.

    Directory of Open Access Journals (Sweden)

    Hsien-Sung Huang

    2007-08-01

    Full Text Available Dysfunction of prefrontal cortex in schizophrenia includes changes in GABAergic mRNAs, including decreased expression of GAD1, encoding the 67 kDa glutamate decarboxylase (GAD67 GABA synthesis enzyme. The underlying molecular mechanisms remain unclear. Alterations in DNA methylation as an epigenetic regulator of gene expression are thought to play a role but this hypothesis is difficult to test because no techniques are available to extract DNA from GAD1 expressing neurons efficiently from human postmortem brain. Here, we present an alternative approach that is based on immunoprecipitation of mononucleosomes with anti-methyl-histone antibodies differentiating between sites of potential gene expression as opposed to repressive or silenced chromatin. Methylation patterns of CpG dinucleotides at the GAD1 proximal promoter and intron 2 were determined for each of the two chromatin fractions separately, using a case-control design for 14 schizophrenia subjects affected by a decrease in prefrontal GAD1 mRNA levels. In controls, the methylation frequencies at CpG dinucleotides, while overall higher in repressive as compared to open chromatin, did not exceed 5% at the proximal GAD1 promoter and 30% within intron 2. Subjects with schizophrenia showed a significant, on average 8-fold deficit in repressive chromatin-associated DNA methylation at the promoter. These results suggest that chromatin remodeling mechanisms are involved in dysregulated GABAergic gene expression in schizophrenia.

  16. Inhibition of fatty acid synthase prevents preadipocyte differentiation

    International Nuclear Information System (INIS)

    Schmid, Bernhard; Rippmann, Joerg F.; Tadayyon, Moh; Hamilton, Bradford S.

    2005-01-01

    Inhibition of fatty acid synthase (FAS) reduces food intake in rodents. As adipose tissue expresses FAS, we sought to investigate the effect of reduced FAS activity on adipocyte differentiation. FAS activity was suppressed either pharmacologically or by siRNA during differentiation of 3T3-L1 cells. Cerulenin (10 μM), triclosan (50 μM), and C75 (50 μM) reduced dramatically visible lipid droplet accumulation, while incorporation of [1- 14 C]acetate into lipids was reduced by 75%, 70%, and 90%, respectively. Additionally, the substances reduced FAS, CEBPα, and PPARγ mRNA by up to 85% compared to that of control differentiated cells. Transient transfection with FAS siRNA suppressed FAS mRNA and FAS activity, and this was accompanied by reduction of CEBPα and PPARγ mRNA levels, and complete prevention of lipid accumulation. CD36, a late marker of differentiation, was also reduced. Together, these results suggest that FAS generated signals may be essential to support preadipocyte differentiation

  17. Intestinal cellular localization of PCNA protein and CYP1A mRNA in Atlantic salmon Salmo salar L. exposed to a model toxicant

    Directory of Open Access Journals (Sweden)

    Olsvik Pål A

    2009-03-01

    Full Text Available Abstract Background The aim of the study was to examine the intestinal cellular localization of proliferating cell nuclear antigen (PCNA and cytochrome P450 A1 (CYP1A expression in Atlantic salmon Salmo salar L. exposed to a model toxicant. The stress response was induced by intraperitoneal injection of four salmon with a single dose (50 mg/kg of the CYP1A inducer β-naphthoflavone (BNF and intestinal tissue (mid and distal intestine; MI and DI was sampled seven days later. Samples for histology and gene transcription analysis were collected from four exposed fish and four control fish. PCNA was assessed by immunohistochemistry, CYP1A mRNA was studied by in situ hybridization (ISH and finally the transcription of five genes was quantified by real-time quantitative RT-PCR (real-time RT-PCR; two detoxifying genes (CYP1A and glutathione S-transferase; GST, a stress marker gene (heat shock protein 70; HSP70, PCNA and a gene marker of apoptosis (caspase 6A. Results PCNA protein and CYP1A mRNA were successfully localized in the intestinal cells (MI of both experimental groups. At the cellular level, BNF significantly lowered intestinal cell proliferation and increased the CYP1A mRNA levels compared to the control group. The real-time RT-PCR data, which showed an increased mRNA expression both in the MI and DI of 139- and 62-fold, respectively, confirmed the increased cellular CYP1A mRNA levels detected using ISH. HSP70 expression was also up-regulated in the exposed fish. The other examined genes did not show any differential regulation in the experimental fish group. Conclusion This study showed that CYP1A mRNA had a specific intestinal cellular transcription pattern in Atlantic salmon exposed to BNF. At the cellular level CYP1A mRNA expression was always observed at or around the cell nucleus close to the basolateral cell membrane and at the tissue level CYP1A mRNA expression was most frequently observed in the basal and apex area of the intestinal

  18. Neurocognitive and neuroinflammatory correlates of PDYN and OPRK1 mRNA expression in the anterior cingulate in postmortem brain of HIV-infected subjects.

    Science.gov (United States)

    Yuferov, Vadim; Butelman, Eduardo R; Ho, Ann; Morgello, Susan; Kreek, Mary Jeanne

    2014-01-09

    Chronic inflammation may contribute to neuropsychological impairments in individuals with HIV, and modulation of this inflammatory response by opiate receptor ligands is important in light of the prevalence of drug use in HIV populations. Exogenous MOR and KOR agonists have differential effects on central nervous system (CNS) immunity and, while some data suggest KOR agonists are immunosuppressive, the KOR agonist dynorphin has been shown to stimulate human monocyte chemotaxis. In this study, we examined mRNA levels of endogenous opioid receptors OPRK1 and OPRM1, prodynorphin (PDYN), macrophage scavenger receptor CD163, and microglia/macrophage marker CD68 in the caudate and anterior cingulate of postmortem brains from HIV-positive and HIV-negative subjects. Brain tissues of HIV-infected (n = 24) and control subjects (n = 15) were obtained from the Manhattan HIV Brain Bank. Quantification of the gene mRNA was performed using SYBR Green RT-PCR. CD68 and CD163 were increased in HIV-positive (HIV+) compared to HIV-negative (HIV-) individuals in both brain regions. There were higher OPRK1 (P <0.005), and lower PDYN mRNA (P <0.005) levels in the anterior cingulate of HIV+ compared to HIV- subjects. This difference between the clinical groups was not found in the caudate. There was no difference in the levels of OPRM1 mRNA between HIV+ and HIV- subjects. Using linear regression analysis, we examined the relationship of OPRK1 and PDYN mRNA levels in the HIV+ subjects with seven cognitive domain T scores of a neuropsychological test battery. Within the HIV+ subjects, there was a positive correlation between anterior cingulate PDYN mRNA levels and better T-scores in the motor domain. Within the HIV+ subjects there were also positive correlations of both OPRK1 and PDYN mRNA levels with the anti-inflammatory marker CD163, but not with proinflammatory CD68 levels. In this setting, decreased PDYN mRNA may reflect a homeostatic mechanism to reduce monocyte

  19. Hypoxia inhibits hypertrophic differentiation and endochondral ossification in explanted tibiae.

    Directory of Open Access Journals (Sweden)

    Jeroen C H Leijten

    Full Text Available Hypertrophic differentiation of growth plate chondrocytes induces angiogenesis which alleviates hypoxia normally present in cartilage. In the current study, we aim to determine whether alleviation of hypoxia is merely a downstream effect of hypertrophic differentiation as previously described or whether alleviation of hypoxia and consequent changes in oxygen tension mediated signaling events also plays an active role in regulating the hypertrophic differentiation process itself.Fetal mouse tibiae (E17.5 explants were cultured up to 21 days under normoxic or hypoxic conditions (21% and 2.5% oxygen respectively. Tibiae were analyzed on growth kinetics, histology, gene expression and protein secretion.The oxygen level had a strong influence on the development of explanted fetal tibiae. Compared to hypoxia, normoxia increased the length of the tibiae, length of the hypertrophic zone, calcification of the cartilage and mRNA levels of hypertrophic differentiation-related genes e.g. MMP9, MMP13, RUNX2, COL10A1 and ALPL. Compared to normoxia, hypoxia increased the size of the cartilaginous epiphysis, length of the resting zone, calcification of the bone and mRNA levels of hyaline cartilage-related genes e.g. ACAN, COL2A1 and SOX9. Additionally, hypoxia enhanced the mRNA and protein expression of the secreted articular cartilage markers GREM1, FRZB and DKK1, which are able to inhibit hypertrophic differentiation.Collectively our data suggests that oxygen levels play an active role in the regulation of hypertrophic differentiation of hyaline chondrocytes. Normoxia stimulates hypertrophic differentiation evidenced by the expression of hypertrophic differentiation related genes. In contrast, hypoxia suppresses hypertrophic differentiation of chondrocytes, which might be at least partially explained by the induction of GREM1, FRZB and DKK1 expression.

  20. Physical change in cytoplasmic messenger ribonucleoproteins in cells treated with inhibitors of mRNA transcription

    International Nuclear Information System (INIS)

    Dreyfuss, G.; Adam, S.A.; Choi, Y.D.

    1984-01-01

    Exposure of intact cells to UV light brings about cross-linking of polyadenylated mRNA to a set of cytoplasmic proteins which are in direct contact with the mRNA in vivo. Substantial amounts of an additional protein of molecular weight 38,000 become cross-linked to the mRNA when cells are treated with inhibitors of mRNA synthesis (actinomycin D, camptothecin, and 5,6-dichloro-1-beta-D-ribofuranosyl benzimidazole) or after infection with vesicular stomatitis virus. Cordycepin, which inhibits polyadenylation but not mRNA synthesis, has no such effect. Inhibitors of protein synthesis and of rRNA synthesis are also without effect on 38K cross-linking to mRNA. The onset of the effect of inhibitors of mRNA synthesis on the UV cross-linkable interaction between mRNA and 38K is rapid and reaches a maximal level in less than 60 min, and it is completely and rapidly reversible. In cells treated with actinomycin D, the amount of 38K which becomes cross-linked to mRNA is proportional to the extent of inhibition of mRNA synthesis. The association of 38K with mRNA during transcriptional arrest does not require protein synthesis because simultaneous treatment with the protein synthesis inhibitor emetine does not interfere with it. The effectors which promote the interaction of 38K with mRNA do not affect the proteins which are in contact with polyadenylated heterogeneous nuclear RNA and do not markedly affect protein synthesis in the cell. The 38K protein can be isolated with the polyribosomal polyadenylated fraction from which it was purified, and monoclonal antibodies against it were prepared

  1. Integrated Analysis of Long Noncoding RNA and mRNA Expression Profile in Advanced Laryngeal Squamous Cell Carcinoma.

    Directory of Open Access Journals (Sweden)

    Ling Feng

    Full Text Available Long non-coding RNA (lncRNA plays an important role in tumorigenesis. However, the expression pattern and function of lncRNAs in laryngeal squamous cell carcinoma (LSCC are still unclear. To investigate the aberrantly expressed lncRNAs and mRNAs in advanced LSCC, we screened lncRNA and mRNA expression profiles in 9 pairs of primary Stage IVA LSCC tissues and adjacent non-neoplastic tissues by lncRNA and mRNA integrated microarrays. Gene Ontology and pathway analysis were performed to find out the significant function and pathway of the differentially expressed mRNAs, gene-gene functional interaction network and ceRNA network were constructed to select core mRNAs, and lncRNA-mRNA expression correlation network was built to identify the interactions between lncRNA and mRNA. qRT-PCR was performed to further validate the expressions of selected lncRNAs and mRNAs in advanced LSCC. We found 1459 differentially expressed lncRNAs and 2381 differentially expressed mRNAs, including 846 up-regulated lncRNAs and 613 down-regulated lncRNAs, 1542 up-regulated mRNAs and 839 down-regulated mRNAs. The mRNAs ITGB1, HIF1A, and DDIT4 were selected as core mRNAs, which are mainly involved in biological processes, such as matrix organization, cell cycle, adhesion, and metabolic pathway. LncRNA-mRNA expression correlation network showed LncRNA NR_027340, MIR31HG were positively correlated with ITGB1, HIF1A respectively. LncRNA SOX2-OT was negatively correlated with DDIT4. qRT-PCR further validated the expression of these lncRNAs and mRNAs. The work provides convincing evidence that the identified lncRNAs and mRNAs are potential biomarkers in advanced LSCC for further future studies.

  2. Effect of in vitro estrogenic pesticides on human oestrogen receptor α and β mRNA levels

    DEFF Research Database (Denmark)

    Theander Grünfeld, Heidi; Bonefeld-Jørgensen, Eva Cecilie

    2004-01-01

    of the ERα mRNA level, but only significantly for prochloraz, dieldrin, and tolchlofos-methyl. Alone no pesticides affected the ERβ mRNA level significantly, but chlorpyrifos increased the mRNA level weakly. Co-exposure with E2 elicited a significant increased ERβ mRNA level by prochloraz, fenarimol...

  3. Nuclear Imprisonment: Viral Strategies to Arrest Host mRNA Nuclear Export

    Science.gov (United States)

    Kuss, Sharon K.; Mata, Miguel A.; Zhang, Liang; Fontoura, Beatriz M. A.

    2013-01-01

    Viruses possess many strategies to impair host cellular responses to infection. Nuclear export of host messenger RNAs (mRNA) that encode antiviral factors is critical for antiviral protein production and control of viral infections. Several viruses have evolved sophisticated strategies to inhibit nuclear export of host mRNAs, including targeting mRNA export factors and nucleoporins to compromise their roles in nucleo-cytoplasmic trafficking of cellular mRNA. Here, we present a review of research focused on suppression of host mRNA nuclear export by viruses, including influenza A virus and vesicular stomatitis virus, and the impact of this viral suppression on host antiviral responses. PMID:23872491

  4. Cytoplasmic Control of Sense-Antisense mRNA Pairs

    Directory of Open Access Journals (Sweden)

    Flore Sinturel

    2015-09-01

    Full Text Available Transcriptome analyses have revealed that convergent gene transcription can produce many 3′-overlapping mRNAs in diverse organisms. Few studies have examined the fate of 3′-complementary mRNAs in double-stranded RNA-dependent nuclear phenomena, and nothing is known about the cytoplasmic destiny of 3′-overlapping messengers or their impact on gene expression. Here, we demonstrate that the complementary tails of 3′-overlapping mRNAs can interact in the cytoplasm and promote post-transcriptional regulatory events including no-go decay (NGD in Saccharomyces cerevisiae. Genome-wide experiments confirm that these messenger-interacting mRNAs (mimRNAs form RNA duplexes in wild-type cells and thus have potential roles in modulating the mRNA levels of their convergent gene pattern under different growth conditions. We show that the post-transcriptional fate of hundreds of mimRNAs is controlled by Xrn1, revealing the extent to which this conserved 5′-3′ cytoplasmic exoribonuclease plays an unexpected but key role in the post-transcriptional control of convergent gene expression.

  5. Cytoplasmic Control of Sense-Antisense mRNA Pairs.

    Science.gov (United States)

    Sinturel, Flore; Navickas, Albertas; Wery, Maxime; Descrimes, Marc; Morillon, Antonin; Torchet, Claire; Benard, Lionel

    2015-09-22

    Transcriptome analyses have revealed that convergent gene transcription can produce many 3'-overlapping mRNAs in diverse organisms. Few studies have examined the fate of 3'-complementary mRNAs in double-stranded RNA-dependent nuclear phenomena, and nothing is known about the cytoplasmic destiny of 3'-overlapping messengers or their impact on gene expression. Here, we demonstrate that the complementary tails of 3'-overlapping mRNAs can interact in the cytoplasm and promote post-transcriptional regulatory events including no-go decay (NGD) in Saccharomyces cerevisiae. Genome-wide experiments confirm that these messenger-interacting mRNAs (mimRNAs) form RNA duplexes in wild-type cells and thus have potential roles in modulating the mRNA levels of their convergent gene pattern under different growth conditions. We show that the post-transcriptional fate of hundreds of mimRNAs is controlled by Xrn1, revealing the extent to which this conserved 5'-3' cytoplasmic exoribonuclease plays an unexpected but key role in the post-transcriptional control of convergent gene expression. Copyright © 2015 The Authors. Published by Elsevier Inc. All rights reserved.

  6. Regulation of mRNA translation during mitosis.

    Science.gov (United States)

    Tanenbaum, Marvin E; Stern-Ginossar, Noam; Weissman, Jonathan S; Vale, Ronald D

    2015-08-25

    Passage through mitosis is driven by precisely-timed changes in transcriptional regulation and protein degradation. However, the importance of translational regulation during mitosis remains poorly understood. Here, using ribosome profiling, we find both a global translational repression and identified ~200 mRNAs that undergo specific translational regulation at mitotic entry. In contrast, few changes in mRNA abundance are observed, indicating that regulation of translation is the primary mechanism of modulating protein expression during mitosis. Interestingly, 91% of the mRNAs that undergo gene-specific regulation in mitosis are translationally repressed, rather than activated. One of the most pronounced translationally-repressed genes is Emi1, an inhibitor of the anaphase promoting complex (APC) which is degraded during mitosis. We show that full APC activation requires translational repression of Emi1 in addition to its degradation. These results identify gene-specific translational repression as a means of controlling the mitotic proteome, which may complement post-translational mechanisms for inactivating protein function.

  7. IER5 gene's mRNA expression after irradiation

    International Nuclear Information System (INIS)

    Ding Kuke; Shen Jingjing; Xu Lili; Li Yanling; Zhou Ping; Ma Binrong; Zhao Zengqiang; Sui Jianli; Zhou Pingkun

    2008-01-01

    Objective: To explore the effect of irradiation on IER5 gene expression. Methods: Two kinds of cells (AHH-1 and HeLa) and the BALB/c-nu mice inoculated with tumor cells were exposed to 60 Co γ- rays and analyzed by real-time PCR. The above-mentioned irradiated objects were firstly divided into groups by different doses and post-radiation time, then mRNA were extracted and reverse-transcripted to DNA before real-time PCR test. Results: Under the same condition, AHH-1 was more sensitive to radiation than HeLa. The dose level corresponding to the expression peak of AHH-1 was less than that of HeLa. For AHH-1 cells, the response to 2 Gy irradiation was earlier than that to 10 Gy. But there was not remarkable difference for HeLa response between 2 and 10 Gy, and the top transcriptional levels for both cells nearly simultaneously appeared at 2 h after irradiation. In addition, the IER5 gene of human liver tumor was more sensitive than that of lung cancer and brain tumor. Conclusions: IER5 might be a candidate biomarker of radiation injury, and had the potential value in radiation-therapy for liver tumor. (authors)

  8. mRNA related to insulin family in human placenta

    International Nuclear Information System (INIS)

    Younes, M.A.; D'Agostino, J.B.; Frazier, M.L.; Besch, P.K.

    1986-01-01

    The authors have previously reported that human term placenta contains mRNA displaying sequence homology to a rat preproinsulin I cDNA clone (p119). When placental poly(A + ) RNA was analyzed for homology to p119 by RNA/DNA blot hybridization, prominent hybridization was observed which was found by densitometric analysis to be three-fold higher than control. To further characterize this insulin-like message, a cDNA library was generated (approx.7000 transformants) using normal term cesarean-sectioned tissue to prepare placental poly(A + ) RNA templates. Five hundred transformants were initially screened by colony hybridization using a 32 P-labeled rat preproinsulin I cDNA as probe. Of the ten initial positives obtained, three were found to be true positives based on Southern hybridization analyses of the recombinant plasmids. Using Taq I digested pBr322 as a size marker, the cDNAs were found to be approximately 300 bp in length. Preliminary DNA sequencing using the Sanger dideoxy chain termination method has revealed that one of these clones displays significant homology to the 5' region of human insulin-like growth factors I and II

  9. mRNA related to insulin family in human placenta

    Energy Technology Data Exchange (ETDEWEB)

    Younes, M.A.; D' Agostino, J.B.; Frazier, M.L.; Besch, P.K.

    1986-03-01

    The authors have previously reported that human term placenta contains mRNA displaying sequence homology to a rat preproinsulin I cDNA clone (p119). When placental poly(A/sup +/) RNA was analyzed for homology to p119 by RNA/DNA blot hybridization, prominent hybridization was observed which was found by densitometric analysis to be three-fold higher than control. To further characterize this insulin-like message, a cDNA library was generated (approx.7000 transformants) using normal term cesarean-sectioned tissue to prepare placental poly(A/sup +/) RNA templates. Five hundred transformants were initially screened by colony hybridization using a /sup 32/P-labeled rat preproinsulin I cDNA as probe. Of the ten initial positives obtained, three were found to be true positives based on Southern hybridization analyses of the recombinant plasmids. Using Taq I digested pBr322 as a size marker, the cDNAs were found to be approximately 300 bp in length. Preliminary DNA sequencing using the Sanger dideoxy chain termination method has revealed that one of these clones displays significant homology to the 5' region of human insulin-like growth factors I and II.

  10. In human granulosa cells from small antral follicles, androgen receptor mRNA and androgen levels in follicular fluid correlate with FSH receptor mRNA

    DEFF Research Database (Denmark)

    Nielsen, M. E.; Rasmussen, I. A.; Kristensen, S. G.

    2011-01-01

    significantly with the expression of AMHRII, but did not correlate with any of the hormones in the follicular fluid. These data demonstrate an intimate association between AR expression in immature granulosa cells, and the expression of FSHR in normal small human antral follicles and between the follicular......Human small antral follicles (diameter 3-9 mm) were obtained from ovaries surgically removed for fertility preservation. From the individual aspirated follicles, granulosa cells and the corresponding follicular fluid were isolated in 64 follicles, of which 55 were available for mRNA analysis (24...... and to the follicular fluid concentrations of AMH, inhibin-B, progesterone and estradiol. AR mRNA expression in granulosa cells and the follicular fluid content of androgens both showed a highly significant positive association with the expression of FSHR mRNA in granulosa cells. AR mRNA expression also correlated...

  11. Regulation of T cell differentiation and function by EZH2

    Directory of Open Access Journals (Sweden)

    THEODOROS KARANTANOS

    2016-05-01

    Full Text Available The enhancer of zeste homologue 2 (EZH2, one of the polycomb group (PcG proteins, is the catalytic subunit of Polycomb-repressive complex 2 (PRC2 and induces the trimethylation of the histone H3 lysine 27 (H3K27me3 promoting epigenetic gene silencing. EZH2 contains a SET domain promoting the methyltransferase activity while the three other protein components of PRC2, namely EED, SUZ12 and RpAp46/48 induce compaction of the chromatin permitting EZH2 enzymatic activity. Numerous studies highlight the role of this evolutionary conserved protein as a master regulator of differentiation in humans involved in the repression of the homeotic (Hox gene and the inactivation of X-chromosome. Through its effects in the epigenetic regulation of critical genes, EZH2 has been strongly linked to cell cycle progression, stem cell pluripotency and cancer biology. Most recently, EZH2 has been associated with hematopoietic stem cell proliferation and differentiation, thymopoiesis and lymphopoiesis. Several studies have evaluated the role of EZH2 in the regulation of T cell differentiation and plasticity as well as its implications in the development of autoimmune diseases and graft versus host disease (GvHD. In this review we will briefly summarize the current knowledge regarding the role of EZH2 in the regulation of T cell differentiation, effector function and homing in the tumor microenvironment and we will discuss possible therapeutic targeting of EZH2 in order to alter T cell immune functions.

  12. Rifampin modulation of xeno- and endobiotic conjugating enzyme mRNA expression and associated microRNAs in human hepatocytes.

    Science.gov (United States)

    Gufford, Brandon T; Robarge, Jason D; Eadon, Michael T; Gao, Hongyu; Lin, Hai; Liu, Yunlong; Desta, Zeruesenay; Skaar, Todd C

    2018-04-01

    Rifampin is a pleiotropic inducer of multiple drug metabolizing enzymes and transporters. This work utilized a global approach to evaluate rifampin effects on conjugating enzyme gene expression with relevance to human xeno- and endo-biotic metabolism. Primary human hepatocytes from 7 subjects were treated with rifampin (10 μmol/L, 24 hours). Standard methods for RNA-seq library construction, EZBead preparation, and NextGen sequencing were used to measure UDP-glucuronosyl transferase UGT, sulfonyltransferase SULT, N acetyltransferase NAT, and glutathione-S-transferase GST mRNA expression compared to vehicle control (0.01% MeOH). Rifampin-induced (>1.25-fold) mRNA expression of 13 clinically important phase II drug metabolizing genes and repressed (>1.25-fold) the expression of 3 genes ( P  accounting for simultaneous induction of both CYP3A4 and UGT1A4 predicted a ~10-fold decrease in parent midazolam exposure with only a ~2-fold decrease in midazolam N-glucuronide metabolite exposure. These data reveal differential effects of rifampin on the human conjugating enzyme transcriptome and potential associations with miRNAs that form the basis for future mechanistic studies to elucidate the interplay of conjugating enzyme regulatory elements.

  13. mRNA and microRNA transcriptomics analyses in a murine model of dystrophin loss and therapeutic restoration

    Directory of Open Access Journals (Sweden)

    Thomas C. Roberts

    2016-03-01

    Full Text Available Duchenne muscular dystrophy (DMD is a pediatric, X-linked, progressive muscle-wasting disorder caused by loss of function mutations affecting the gene encoding the dystrophin protein. While the primary genetic insult in DMD is well described, many details of the molecular and cellular pathologies that follow dystrophin loss are incompletely understood. To investigate gene expression in dystrophic muscle we have applied mRNA and microRNA (miRNA microarray technology to the mdx mouse model of DMD. This study was designed to generate a complete description of gene expression changes associated with dystrophic pathology and the response to an experimental therapy which restores dystrophin protein function. These datasets have enabled (1 the determination of gene expression changes associated with dystrophic pathology, (2 identification of differentially expressed genes that are restored towards wild-type levels after therapeutic dystrophin rescue, (3 investigation of the correlation between mRNA and protein expression (determined by parallel mass spectrometry proteomics analysis, and (4 prediction of pathology associated miRNA-target interactions. Here we describe in detail how the data were generated including the basic analysis as contained in the manuscript published in Human Molecular Genetics with PMID 26385637. The data have been deposited in the Gene Expression Omnibus (GEO with the accession number GSE64420.

  14. Low levels of PRB3 mRNA are associated with dopamine-agonist resistance and tumor recurrence in prolactinomas.

    Science.gov (United States)

    Wang, Fei; Gao, Hua; Li, Chuzhong; Bai, Jiwei; Lu, Runchun; Cao, Lei; Wu, Yongtu; Hong, Lichuan; Wu, Yonggang; Lan, Xiaolei; Zhang, Yazhuo

    2014-01-01

    Prolactinomas, or prolactin-secreting adenomas, constitute the most common type of hyperfunctioning pituitary adenoma. Dopamine agonists are used as first-line medication for prolactinomas, but the tumors are resistant to the therapy in 5-18 % of patients. To explore potential mechanisms of resistance to bromocriptine (a dopamine agonist), we analyzed six responsive prolactinomas and six resistant prolactinomas by whole-exome sequencing. We identified ten genes with sequence variants that were differentially found in the two groups of tumors. The expression of these genes was then quantified by real-time reverse-transcription PCR (RT-qPCR) in the 12 prolactinomas and in six normal pituitary glands. The mRNA levels of one of the genes, PRB3, were about fourfold lower in resistant prolactinomas than in the responsive tumors (p = 0.02). Furthermore, low PRB3 expression was also associated with tumor recurrence. Our results suggest that low levels of PRB3 mRNA may have a role in dopamine-agonist resistance and tumor recurrence of prolactinomas.

  15. Transcriptome Analysis of mRNA and miRNA in Somatic Embryos of Larix leptolepis Subjected to Hydrogen Treatment

    Directory of Open Access Journals (Sweden)

    Yali Liu

    2016-11-01

    Full Text Available Hydrogen is a therapeutic antioxidant that has been used extensively in clinical trials. It also acts as a bioactive molecule that can alleviate abiotic stress in plants. However, the biological effects of hydrogen in somatic embryos and the underlying molecular basis remain largely unknown. In this study, the morphological and physiological influence of exogenous H2 treatment during somatic embryogenesis was characterized in Larix leptolepis Gordon. The results showed that exposure to hydrogen increased the proportions of active pro-embryogenic cells and normal somatic embryos. We sequenced mRNA and microRNA (miRNA libraries to identify global transcriptome changes at different time points during H2 treatment of larch pro-embryogenic masses (PEMs. A total of 45,393 mRNAs and 315 miRNAs were obtained. Among them, 4253 genes and 96 miRNAs were differentially expressed in the hydrogen-treated libraries compared with the control. Further, a large number of the differentially expressed mRNAs and miRNAs were related to reactive oxygen species (ROS homeostasis and cell cycle regulation. We also identified 4399 potential target genes for 285 of the miRNAs. The differential expression data and the mRNA-miRNA interaction network described here provide new insights into the molecular mechanisms that determine the performance of PEMs exposed to H2 during somatic embryogenesis.

  16. Coordinated Regulations of mRNA Synthesis and Decay during Cold Acclimation in Arabidopsis Cells.

    KAUST Repository

    Arae, Toshihiro

    2017-04-18

    Plants possess a cold acclimation system to acquire freezing tolerance through pre-exposure to non-freezing low temperatures. The transcriptional cascade of C-repeat binding factors (CBFs)/dehydration response element-binding factors (DREBs) is considered a major transcriptional regulatory pathway during cold acclimation. However, little is known regarding the functional significance of mRNA stability regulation in the response of gene expression to cold stress. The actual level of individual mRNAs is determined by a balance between mRNA synthesis and degradation. Therefore, it is important to assess the regulatory steps to increase our understanding of gene regulation. Here, we analyzed temporal changes in mRNA amounts and half-lives in response to cold stress in Arabidopsis cell cultures based on genome-wide analysis. In this mRNA decay array method, mRNA half-life measurements and microarray analyses were combined. In addition, temporal changes in the integrated value of transcription rates were estimated from the above two parameters using a mathematical approach. Our results showed that several cold-responsive genes, including Cold-regulated 15a, were relatively destabilized, whereas the mRNA amounts were increased during cold treatment by accelerating the transcription rate to overcome the destabilization. Considering the kinetics of mRNA synthesis and degradation, this apparently contradictory result supports that mRNA destabilization is advantageous for the swift increase in CBF-responsive genes in response to cold stress.

  17. Primary induction of vitellogenin mRNA in the rooster by 17beta-estradiol.

    Science.gov (United States)

    Burns, A T; Deeley, R G; Gordon, J I; Udell, D S; Mullinix, K P; Goldberger, R F

    1978-01-01

    We have studied the kinetics of vitellogenin mRNA accumulation in rooster liver after a primary injection of 17beta-estradiol. The levels of vitellogenin mRNA have been determined both by hybridization of total cellular RNA to vitellogenin cDNA and by translation of vitellogenin mRNA in a wheat germ cell-free system. The results obtained by both methods of analysis are in good agreement and indicate that vitellogenin mRNA is present in the liver of normal roosters at a level of 0-5 molecules per liver cell and increases in amount during the 3 days following injection of estrogen, reaching a level of almost 6000 molecules per cell at the peak of the response. The level of vitellogenin mRNA declined exponentially during the next 14 days with a half-life of 29 hr, reaching a level of less than 10 molecules per cell at 17 days after injection of the hormone. The levels of vitellogenin mRNA after stimulation with estrogen have been correlated with the in vivo rate of synthesis of the vitellogenin polypeptide. The results indicate that the rate of vitellogenin synthesis is closely correlated with the level of vitellogenin mRNA. On the basis of these findings, we conclude that vitellogenin mRNA does not exist in the liver in an untranslated form after withdrawal from estrogen. PMID:273910

  18. Survivin mRNA antagonists using locked nucleic acid, potential for molecular cancer therapy

    DEFF Research Database (Denmark)

    Fisker, Niels; Westergaard, Majken; Hansen, Henrik Frydenlund

    2007-01-01

    We have investigated the effects of different locked nucleic acid modified antisense mRNA antagonists against Survivin in a prostate cancer model. These mRNA antagonists were found to be potent inhibitors of Survivin expression at low nanomolar concentrations. Additionally there was a pronounced ...

  19. Coordinated Regulations of mRNA Synthesis and Decay during Cold Acclimation in Arabidopsis Cells.

    KAUST Repository

    Arae, Toshihiro; Isai, Shiori; Sakai, Akira; Mineta, Katsuhiko; Hirai, Masami Yokota; Suzuki, Yuya; Kanaya, Shigehiko; Yamaguchi, Junji; Naito, Satoshi; Chiba, Yukako

    2017-01-01

    stress in Arabidopsis cell cultures based on genome-wide analysis. In this mRNA decay array method, mRNA half-life measurements and microarray analyses were combined. In addition, temporal changes in the integrated value of transcription rates were

  20. In situ localization of chalcone synthase mRNA in pea root nodule development.

    NARCIS (Netherlands)

    Yang, W.C.; Canter Cremers, H.C.J.; Hogendijk, P.; Katinakis, P.; Wijffelman, C.A.; Franssen, H.J.; Kammen, van A.; Bisseling, T.

    1992-01-01

    In this paper studies on the role of flavonoids in pea root nodule development are reported. Flavonoid synthesis was followed by localizing chalcone synthase (CHS) mRNA in infected pea roots and in root nodules. In a nodule primordium, CHS mRNA is present in all cells of the primordium. Therefore it

  1. Responses of mRNA expression of PepT1 in small intestine to ...

    African Journals Online (AJOL)

    To study the effect of circulation small peptides concentration on mRNA expression in small intestine, graded amount of soybean small peptides (SSP) were infused into lactating goats through duodenal fistulas. Peptide-bound amino acid (PBAA) concentration in arterial plasma and the mRNA expression of PepT1 was ...

  2. Exogenous mRNA encoding tetanus or botulinum neurotoxins expressed in Aplysia neurons

    NARCIS (Netherlands)

    Mochida, Sumiko; Poulain, Bernard; Eisel, Ulrich; Binz, Thomas; Kurazono, Hisao; Niemann, Heiner; Tauc, Ladislav; Bullock, Theodore H.

    1990-01-01

    Injection of exogenous mRNA purified from various tissue preparations into cellular translation systems such as Xenopus oocytes has allowed expression of complex proteins (e.g., receptors for neurotransmitters). No evidence for expression of injected exogenous mRNA, however, has been reported in

  3. Advanced cell-based modeling of the royal disease: characterization of the mutated F9 mRNA.

    Science.gov (United States)

    Martorell, L; Luce, E; Vazquez, J L; Richaud-Patin, Y; Jimenez-Delgado, S; Corrales, I; Borras, N; Casacuberta-Serra, S; Weber, A; Parra, R; Altisent, C; Follenzi, A; Dubart-Kupperschmitt, A; Raya, A; Vidal, F; Barquinero, J

    2017-11-01

    Essentials The Royal disease (RD) is a form of hemophilia B predicted to be caused by a splicing mutation. We generated an iPSC-based model of the disease allowing mechanistic studies at the RNA level. F9 mRNA analysis in iPSC-derived hepatocyte-like cells showed the predicted abnormal splicing. Mutated F9 mRNA level was very low but we also found traces of wild type transcripts. Background The royal disease is a form of hemophilia B (HB) that affected many descendants of Queen Victoria in the 19th and 20th centuries. It was found to be caused by the mutation F9 c.278-3A>G. Objective To generate a physiological cell model of the disease and to study F9 expression at the RNA level. Methods Using fibroblasts from skin biopsies of a previously identified hemophilic patient bearing the F9 c.278-3A>G mutation and his mother, we generated induced pluripotent stem cells (iPSCs). Both the patient's and mother's iPSCs were differentiated into hepatocyte-like cells (HLCs) and their F9 mRNA was analyzed using next-generation sequencing (NGS). Results and Conclusion We demonstrated the previously predicted aberrant splicing of the F9 transcript as a result of an intronic nucleotide substitution leading to a frameshift and the generation of a premature termination codon (PTC). The F9 mRNA level in the patient's HLCs was significantly reduced compared with that of his mother, suggesting that mutated transcripts undergo nonsense-mediated decay (NMD), a cellular mechanism that degrades PTC-containing mRNAs. We also detected small proportions of correctly spliced transcripts in the patient's HLCs, which, combined with genetic variability in splicing and NMD machineries, could partially explain some clinical variability among affected members of the European royal families who had lifespans above the average. This work allowed the demonstration of the pathologic consequences of an intronic mutation in the F9 gene and represents the first bona fide cellular model of HB allowing the

  4. Integrated analysis of miRNA and mRNA expression in childhood medulloblastoma compared with neural stem cells.

    Directory of Open Access Journals (Sweden)

    Laura A Genovesi

    Full Text Available Medulloblastoma (MB is the most common malignant brain tumor in children and a leading cause of cancer-related mortality and morbidity. Several molecular sub-types of MB have been identified, suggesting they may arise from distinct cells of origin. Data from animal models indicate that some MB sub-types arise from multipotent cerebellar neural stem cells (NSCs. Hence, microRNA (miRNA expression profiles of primary MB samples were compared to CD133+ NSCs, aiming to identify deregulated miRNAs involved in MB pathogenesis. Expression profiling of 662 miRNAs in primary MB specimens, MB cell lines, and human CD133+ NSCs and CD133- neural progenitor cells was performed by qRT-PCR. Clustering analysis identified two distinct sub-types of MB primary specimens, reminiscent of sub-types obtained from their mRNA profiles. 21 significantly up-regulated and 12 significantly down-regulated miRNAs were identified in MB primary specimens relative to CD133+ NSCs (p<0.01. The majority of up-regulated miRNAs mapped to chromosomal regions 14q32 and 17q. Integration of the predicted targets of deregulated miRNAs with mRNA expression data from the same specimens revealed enrichment of pathways regulating neuronal migration, nervous system development and cell proliferation. Transient over-expression of a down-regulated miRNA, miR-935, resulted in significant down-regulation of three of the seven predicted miR-935 target genes at the mRNA level in a MB cell line, confirming the validity of this approach. This study represents the first integrated analysis of MB miRNA and mRNA expression profiles and is the first to compare MB miRNA expression profiles to those of CD133+ NSCs. We identified several differentially expressed miRNAs that potentially target networks of genes and signaling pathways that may be involved in the transformation of normal NSCs to brain tumor stem cells. Based on this integrative approach, our data provide an important platform for future

  5. Interactions of an Arabidopsis RanBPM homologue with LisH-CTLH domain proteins revealed high conservation of CTLH complexes in eukaryotes

    Czech Academy of Sciences Publication Activity Database

    Tomaštíková, Eva; Cenklová, Věra; Kohoutová, Lucie; Petrovská, Beáta; Váchová, Lenka; Halada, Petr; Kočárová, Gabriela; Binarová, Pavla

    2012-01-01

    Roč. 12, č. 83 (2012) ISSN 1471-2229 R&D Projects: GA ČR(CZ) GA204/07/1169; GA ČR GP204/09/P155; GA ČR GAP501/12/2333; GA MŠk(CZ) LC06034; GA MŠk LC545; GA AV ČR IAA500200719 Grant - others:GA MŠk(CZ) ED0007/01/01 Program:ED Institutional research plan: CEZ:AV0Z50380511; CEZ:AV0Z50200510 Keywords : Arabidopsis homologue of RanBPM * CTLH-complex * LisH-CTLH domain proteins Subject RIV: EB - Genetics ; Molecular Biology Impact factor: 4.354, year: 2012

  6. A density functional theory study of magneto-electric Jones birefringence of noble gases, furan homologues, and mono-substituted benzenes

    International Nuclear Information System (INIS)

    Fahleson, Tobias; Norman, Patrick; Coriani, Sonia; Rizzo, Antonio; Rikken, Geert L. J. A.

    2013-01-01

    We report on the results of a systematic ab initio study of the Jones birefringence of noble gases, of furan homologues, and of monosubstituted benzenes, in the gas phase, with the aim of analyzing the behavior and the trends within a list of systems of varying size and complexity, and of identifying candidates for a combined experimental/theoretical study of the effect. We resort here to analytic linear and nonlinear response functions in the framework of time-dependent density functional theory. A correlation is made between the observable (the Jones constant) and the atomic radius for noble gases, or the permanent electric dipole and a structure/chemical reactivity descriptor as the para Hammett constant for substituted benzenes

  7. The small GTPase Rab5 homologue Ypt5 regulates cell morphology, sexual development, ion-stress response and vacuolar formation in fission yeast

    Energy Technology Data Exchange (ETDEWEB)

    Tsukamoto, Yuta; Katayama, Chisako [Graduate School of Science, Kobe University, 1-1 Rokkodai-cho Nada, Kobe 657-8501 (Japan); Shinohara, Miki; Shinohara, Akira [Institute for Protein Research, Osaka University, 3-2 Yamadaoka, Suita, Osaka 565-0871 (Japan); Maekawa, Shohei [Graduate School of Science, Kobe University, 1-1 Rokkodai-cho Nada, Kobe 657-8501 (Japan); Miyamoto, Masaaki, E-mail: miya@kobe-u.ac.jp [Graduate School of Science, Kobe University, 1-1 Rokkodai-cho Nada, Kobe 657-8501 (Japan); Center for Supports to Research and Education Activities, Kobe University, 1-1 Rokkodai-cho Nada, Kobe 657-8501 (Japan)

    2013-11-29

    Highlights: •Multiple functions of Rab5 GTPase in fission yeast were found. •Roles of Rab5 in fission yeast were discussed. •Relation between Rab5 and actin cytoskeleton were discussed. -- Abstract: Inner-membrane transport is critical to cell function. Rab family GTPases play an important role in vesicle transport. In mammalian cells, Rab5 is reported to be involved in the regulation of endosome formation, phagocytosis and chromosome alignment. Here, we examined the role of the fission yeast Rab5 homologue Ypt5 using a point mutant allele. Mutant cells displayed abnormal cell morphology, mating, sporulation, endocytosis, vacuole fusion and responses to ion stress. Our data strongly suggest that fission yeast Rab5 is involved in the regulation of various types of cellular functions.

  8. The small GTPase Rab5 homologue Ypt5 regulates cell morphology, sexual development, ion-stress response and vacuolar formation in fission yeast

    International Nuclear Information System (INIS)

    Tsukamoto, Yuta; Katayama, Chisako; Shinohara, Miki; Shinohara, Akira; Maekawa, Shohei; Miyamoto, Masaaki

    2013-01-01

    Highlights: •Multiple functions of Rab5 GTPase in fission yeast were found. •Roles of Rab5 in fission yeast were discussed. •Relation between Rab5 and actin cytoskeleton were discussed. -- Abstract: Inner-membrane transport is critical to cell function. Rab family GTPases play an important role in vesicle transport. In mammalian cells, Rab5 is reported to be involved in the regulation of endosome formation, phagocytosis and chromosome alignment. Here, we examined the role of the fission yeast Rab5 homologue Ypt5 using a point mutant allele. Mutant cells displayed abnormal cell morphology, mating, sporulation, endocytosis, vacuole fusion and responses to ion stress. Our data strongly suggest that fission yeast Rab5 is involved in the regulation of various types of cellular functions

  9. The potential role of IGF-I receptor mRNA in rats with diabetic retinopathy

    Institute of Scientific and Technical Information of China (English)

    匡洪宇; 邹伟; 刘丹; 史榕荇; 程丽华; 殷慧清; 刘晓民

    2003-01-01

    Objective To evaluate the potential role of insulin-like growth factor-1 receptor mRNA(IGF-IR mRNA) in the onset and development of retinopathy in diabetic rats.Methods A diabetic model was duplicated in Wistar rats. The early changes in the retina were examined using light and transmission electron microscopy. Expression of IGF-IR mRNA was analyzed using in situ hybridization.Results Weak expression of IGF-IR mRNA(5%) was found in retinas of normal rats, but was significantly increased (15% and 18%) in the retinas of diabetic rats after 3 and 6 months of diabetes (P<0.01). In situ hybridization and morphological study demonstrated that there was a positive correlation between IGF-IR mRNA expression and retinal changes at various stages.Conclusion Increased IGF-IR mRNA might play an important role in the onset and development of diabetic retinopathy.

  10. Simultaneous isolation of mRNA and native protein from minute samples of cells

    DEFF Research Database (Denmark)

    Petersen, Tonny Studsgaard; Andersen, Claus Yding

    2014-01-01

    Precious biological samples often lack a sufficient number of cells for multiple procedures, such as extraction of mRNA while maintaining protein in a non-denatured state suitable for subsequent characterization. Here we present a new method for the simultaneous purification of mRNA and native...... in their native state for traditional protein assays. We validated the procedure using neonatal rat ovaries and small numbers of human granulosa cells, demonstrating the extraction of mRNA suitable for gene expression analysis with simultaneous isolation of native proteins suitable for downstream characterization...... proteins from samples containing small numbers of cells. Our approach utilizes oligodeoxythymidylate [oligo(dT)25]-coated paramagnetic beads in an optimized reaction buffer to isolate mRNA comparable in quantity and quality to mRNA isolated with existing methods, while maintaining the proteins...

  11. The Orf virus E3L homologue is able to complement deletion of the vaccinia virus E3L gene in vitro but not in vivo

    International Nuclear Information System (INIS)

    Vijaysri, Sangeetha; Talasela, Latha; Mercer, Andrew A.; Mcinnes, Colin J.; Jacobs, Bertram L.; Langland, Jeffrey O.

    2003-01-01

    Orf virus (OV), the prototypic parapoxvirus, is resistant to the effects of interferon (IFN) and this function of OV has been mapped to the OV20.0L gene. The protein product of this gene shares 31% amino acid identity to the E3L-encoded protein of vaccinia virus (VV) that is required for the broad host range and IFN-resistant phenotype of VV in cells in culture and for virulence of the virus in vivo. In this study we investigated whether the distantly related OV E3L homologue could complement the deletion of E3L in VV. The recombinant VV (VV/ORF-E3L) expressing the OV E3L homologue in place of VV E3L was indistinguishable from wt VV in its cell-culture phenotype. But VV/ORF-E3L was over a 1000-fold less pathogenic than wt VV (LD 50 > 5 x 10 6 PFU, compared to LD 50 of wtVV = 4 x 10 3 PFU) following intranasal infection of mice. While wt VV spread to the lungs and brain and replicated to high titers in the brain of infected mice, VV/ORF-E3L could not be detected in the lungs or brain following intranasal infection. VV/ORF-E3L was at least 100,000-fold less pathogenic than wt VV on intracranial injection. Domain swap experiments demonstrate that the difference in pathogenesis maps to the C-terminal domain of these proteins. This domain has been shown to be required for the dsRNA binding function of the VV E3L

  12. The Ca{sup 2+} channel TRPML3 specifically interacts with the mammalian ATG8 homologue GATE16 to regulate autophagy

    Energy Technology Data Exchange (ETDEWEB)

    Choi, Suzy; Kim, Hyun Jin, E-mail: kimhyunjin@skku.edu

    2014-01-03

    Highlights: •Split-ubiquitin MY2H screen identified GATE16 as an interacting protein of TRPML3. •TRPML3 specifically binds to a mammalian ATG8 homologue GATE16, not to LC3B. •The interaction of TRPML3 with GATE16 facilitates autophagosome formation. •GATE16 is expressed in both autophagosome and extra-autophagosomal compartments. -- Abstract: TRPML3 is a Ca{sup 2+} permeable cation channel expressed in multiple intracellular compartments. Although TRPML3 is implicated in autophagy, how TRPML3 can regulate autophagy is not understood. To search interacting proteins with TRPML3 in autophagy, we performed split-ubiquitin membrane yeast two-hybrid (MY2H) screening with TRPML3-loop as a bait and identified GATE16, a mammalian ATG8 homologue. GST pull-down assay revealed that TRPML3 and TRPML3-loop specifically bind to GATE16, not to LC3B. Co-immunoprecipitation (co-IP) experiments showed that TRPML3 and TRPML3-loop pull down only the lipidated form of GATE16, indicating that the interaction occurs exclusively at the organellar membrane. The interaction of TRPML3 with GATE16 and GATE16-positive vesicle formation were increased in starvation induced autophagy, suggesting that the interaction facilitates the function of GATE16 in autophagosome formation. However, GATE16 was not required for TRPML3 trafficking to autophagosomes. Experiments using dominant-negative (DN) TRPML3(D458K) showed that GATE16 is localized not only in autophagosomes but also in extra-autophagosomal compartments, by contrast with LC3B. Since GATE16 acts at a later stage of the autophagosome biogenesis, our results suggest that TRPML3 plays a role in autophagosome maturation through the interaction with GATE16, by providing Ca{sup 2+} in the fusion process.

  13. In vivo metabolism of the methyl homologues of delta-8-tetrahydrocannabinol, delta-9-tetrahydrocannabinol and abn-delta-8-tetrahydrocannabinol in the mouse.

    Science.gov (United States)

    Brown, N K; Harvey, D J

    1988-04-01

    Methyl-delta-8-tetrahydrocannabinol (methyl-delta-8-THC), methyl-delta-9-THC and abn-methyl-delta-8-THC were synthesized by condensation of orcinol and (1S)-cis-verbenol and were administered to male Charles River CD-1 mice. Extracted hepatic metabolites were isolated by chromatography on Sephadex LH-20 and examined by gas chromatography/mass spectrometry as trimethylsilyl (TMS), (2H9)TMS and methyl ester/TMS derivatives. In addition, metabolic fractions were reduced with lithium aluminium deuteride to convert carboxylic acids to alcohols for structural correlation. Metabolites from methyl-delta-8-THC were similar with respect to the positions substituted to those produced by higher homologues; the major metabolite was methyl-delta-8-THC-11-oic acid. abn-Methyl-delta-8-THC was metabolized in a different manner. The location of the aromatic methyl group at the position adjacent to ring fusion appeared to inhibit metabolism at C(11) to a considerable extent and also to reduce the amount of the resulting alcohol from being oxidized to a carboxylic acid. This caused other metabolic pathways to become dominant, with the result that a compound containing a hydroxy group at the gem-methyl position was the major metabolite. Hydroxylation at this position has not been confirmed with any other cannabinoid, although it is thought to result in trace concentrations of hydroxy metabolites from some compounds. Metabolism of methyl-delta-9-THC was also similar to that of the higher homologues, with the exception that less metabolism occurred at C(8) and a higher percentage of the total metabolic fraction was accounted for by the 11-oic acid metabolite. Minor metabolites were mainly dihydroxy compounds and hydroxylated derivatives of delta-9-THC-11-oic acid.

  14. Drosophila homologues of adenomatous polyposis coli (APC) and the formin diaphanous collaborate by a conserved mechanism to stimulate actin filament assembly.

    Science.gov (United States)

    Jaiswal, Richa; Stepanik, Vince; Rankova, Aneliya; Molinar, Olivia; Goode, Bruce L; McCartney, Brooke M

    2013-05-10

    Vertebrate APC collaborates with Dia through its Basic domain to assemble actin filaments. Despite limited sequence homology between the vertebrate and Drosophila APC Basic domains, Drosophila APC1 collaborates with Dia to stimulate actin assembly in vitro. The mechanism of actin assembly is highly conserved over evolution. APC-Dia collaborations may be crucial in a wide range of animal cells. Adenomatous polyposis coli (APC) is a large multidomain protein that regulates the cytoskeleton. Recently, it was shown that vertebrate APC through its Basic domain directly collaborates with the formin mDia1 to stimulate actin filament assembly in the presence of nucleation barriers. However, it has been unclear whether these activities extend to homologues of APC and Dia in other organisms. Drosophila APC and Dia are each required to promote actin furrow formation in the syncytial embryo, suggesting a potential collaboration in actin assembly, but low sequence homology between the Basic domains of Drosophila and vertebrate APC has left their functional and mechanistic parallels uncertain. To address this question, we purified Drosophila APC1 and Dia and determined their individual and combined effects on actin assembly using both bulk fluorescence assays and total internal reflection fluorescence microscopy. Our data show that APC1, similar to its vertebrate homologue, bound to actin monomers and nucleated and bundled filaments. Further, Drosophila Dia nucleated actin assembly and protected growing filament barbed ends from capping protein. Drosophila APC1 and Dia directly interacted and collaborated to promote actin assembly in the combined presence of profilin and capping protein. Thus, despite limited sequence homology, Drosophila and vertebrate APCs exhibit highly related activities and mechanisms and directly collaborate with formins. These results suggest that APC-Dia interactions in actin assembly are conserved and may underlie important in vivo functions in a broad

  15. A gonococcal homologue of meningococcal γ-glutamyl transpeptidase gene is a new type of bacterial pseudogene that is transcriptionally active but phenotypically silent

    Directory of Open Access Journals (Sweden)

    Watanabe Haruo

    2005-10-01

    Full Text Available Abstract Background It has been speculated that the γ-glutamyl transpeptidase (ggt gene is present only in Neisseria meningitidis and not among related species such as Neisseria gonorrhoeae and Neisseria lactamica, because N. meningitidis is the only bacterium with GGT activity. However, nucleotide sequences highly homologous to the meningococcal ggt gene were found in the genomes of N. gonorrhoeae isolates. Results The gonococcal homologue (ggt gonococcal homologue; ggh was analyzed. The nucleotide sequence of the ggh gene was approximately 95 % identical to that of the meningococcal ggt gene. An open reading frame in the ggh gene was disrupted by an ochre mutation and frameshift mutations induced by a 7-base deletion, but the amino acid sequences deduced from the artificially corrected ggh nucleotide sequences were approximately 97 % identical to that of the meningococcal ggt gene. The analyses of the sequences flanking the ggt and ggh genes revealed that both genes were localized in a common DNA region containing the fbp-ggt (or ggh-glyA-opcA-dedA-abcZ gene cluster. The expression of the ggh RNA could be detected by dot blot, RT-PCR and primer extension analyses. Moreover, the truncated form of ggh-translational product was also found in some of the gonococcal isolates. Conclusion This study has shown that the gonococcal ggh gene is a pseudogene of the meningococcal ggt gene, which can also be designated as Ψggt. The gonococcal ggh (Ψggt gene is the first identified bacterial pseudogene that is transcriptionally active but phenotypically silent.

  16. acn-1, a C. elegans homologue of ACE, genetically interacts with the let-7 microRNA and other heterochronic genes.

    Science.gov (United States)

    Metheetrairut, Chanatip; Ahuja, Yuri; Slack, Frank J

    2017-10-02

    The heterochronic pathway in C. elegans controls the relative timing of cell fate decisions during post-embryonic development. It includes a network of microRNAs (miRNAs), such as let-7, and protein-coding genes, such as the stemness factors, LIN-28 and LIN-41. Here we identified the acn-1 gene, a homologue of mammalian angiotensin-converting enzyme (ACE), as a new suppressor of the stem cell developmental defects of let-7 mutants. Since acn-1 null mutants die during early larval development, we used RNAi to characterize the role of acn-1 in C. elegans seam cell development, and determined its interaction with heterochronic factors, including let-7 and its downstream interactors - lin-41, hbl-1, and apl-1. We demonstrate that although RNAi knockdown of acn-1 is insufficient to cause heterochronic defects on its own, loss of acn-1 suppresses the retarded phenotypes of let-7 mutants and enhances the precocious phenotypes of hbl-1, though not lin-41, mutants. Conversely, the pattern of acn-1 expression, which oscillates during larval development, is disrupted by lin-41 mutants but not by hbl-1 mutants. Finally, we show that acn-1(RNAi) enhances the let-7-suppressing phenotypes caused by loss of apl-1, a homologue of the Alzheimer's disease-causing amyloid precursor protein (APP), while significantly disrupting the expression of apl-1 during the L4 larval stage. In conclusion, acn-1 interacts with heterochronic genes and appears to function downstream of let-7 and its target genes, including lin-41 and apl-1.

  17. Impairment of FOS mRNA stabilization following translation arrest in granulocytes from myelodysplastic syndrome patients.

    Science.gov (United States)

    Feng, Xiaomin; Shikama, Yayoi; Shichishima, Tsutomu; Noji, Hideyoshi; Ikeda, Kazuhiko; Ogawa, Kazuei; Kimura, Hideo; Takeishi, Yasuchika; Kimura, Junko

    2013-01-01

    Although quantitative and qualitative granulocyte defects have been described in myelodysplastic syndromes (MDS), the underlying molecular basis of granulocyte dysfunction in MDS is largely unknown. We recently found that FOS mRNA elevation under translation-inhibiting stimuli was significantly smaller in granulocytes from MDS patients than in healthy individuals. The aim of this study is to clarify the cause of the impaired FOS induction in MDS. We first examined the mechanisms of FOS mRNA elevation using granulocytes from healthy donors cultured with the translation inhibitor emetine. Emetine increased both transcription and mRNA stability of FOS. p38 MAPK inhibition abolished the emetine-induced increase of FOS transcription but did not affect FOS mRNA stabilization. The binding of an AU-rich element (ARE)-binding protein HuR to FOS mRNA containing an ARE in 3'UTR was increased by emetine, and the knockdown of HuR reduced the FOS mRNA stabilizing effect of emetine. We next compared the emetine-induced transcription and mRNA stabilization of FOS between MDS patients and healthy controls. Increased rates of FOS transcription by emetine were similar in MDS and controls. In the absence of emetine, FOS mRNA decayed to nearly 17% of initial levels in 45 min in both groups. In the presence of emetine, however, 76.7±19.8% of FOS mRNA remained after 45 min in healthy controls, versus 37.9±25.5% in MDS (Pknowledge, this is the first report demonstrating attenuation of stress-induced FOS mRNA stabilization in MDS granulocytes.

  18. The regulation of mitochondrial transcription factor A (Tfam) expression during skeletal muscle cell differentiation.

    Science.gov (United States)

    Collu-Marchese, Melania; Shuen, Michael; Pauly, Marion; Saleem, Ayesha; Hood, David A

    2015-05-19

    The ATP demand required for muscle development is accommodated by elevations in mitochondrial biogenesis, through the co-ordinated activities of the nuclear and mitochondrial genomes. The most important transcriptional activator of the mitochondrial genome is mitochondrial transcription factor A (Tfam); however, the regulation of Tfam expression during muscle differentiation is not known. Thus, we measured Tfam mRNA levels, mRNA stability, protein expression and localization and Tfam transcription during the progression of muscle differentiation. Parallel 2-fold increases in Tfam protein and mRNA were observed, corresponding with 2-3-fold increases in mitochondrial content. Transcriptional activity of a 2051 bp promoter increased during this differentiation period and this was accompanied by a 3-fold greater Tfam mRNA stabilization. Interestingly, truncations of the promoter at 1706 bp, 978 bp and 393 bp promoter all exhibited 2-3-fold higher transcriptional activity than the 2051 bp construct, indicating the presence of negative regulatory elements within the distal 350 bp of the promoter. Activation of AMP kinase augmented Tfam transcription within the proximal promoter, suggesting the presence of binding sites for transcription factors that are responsive to cellular energy state. During differentiation, the accumulating Tfam protein was progressively distributed to the mitochondrial matrix where it augmented the expression of mtDNA and COX (cytochrome c oxidase) subunit I, an mtDNA gene product. Our data suggest that, during muscle differentiation, Tfam protein levels are regulated by the availability of Tfam mRNA, which is controlled by both transcription and mRNA stability. Changes in energy state and Tfam localization also affect Tfam expression and action in differentiating myotubes. © 2015 Authors.

  19. Hypophyseal corticosteroids stimulate somatotrope differentiation in the embryonic chicken pituitary gland.

    Science.gov (United States)

    Zheng, Jun; Takagi, Hiroyasu; Tsutsui, Chihiro; Adachi, Akihito; Sakai, Takafumi

    2008-03-01

    Although it is known that glucocorticoids induce differentiation of growth hormone (GH)-producing cells in rodents and birds, the effect of mineralocorticoids on GH mRNA expression and the origin of corticosteroids affecting somatotrope differentiation have not been elucidated. In this study, we therefore carried out experiments to determine the effect of mineralocorticoids on GH mRNA expression in the chicken anterior pituitary gland in vitro and to determine whether corticosteroids are synthesized in the chicken embryonic pituitary gland. In a pituitary culture experiment with E11 embryos, both corticosterone and aldosterone stimulated GH mRNA expression and increased the number of GH cells in both lobes of the pituitary gland in a dose-dependent manner. These effects of the corticosteroids were significantly reversed by pretreatment with mifepristone, a glucocorticoid receptor (GR) antagonist, or spironolactone, a mineralocorticoid receptor (MR) antagonist. Interestingly, an in vitro serum-free culture experiment with an E11 pituitary gland showed that the GH mRNA level spontaneously increased during cultivation for 2 days without any extra stimulation, and this increase in GH mRNA level was completely suppressed by metyrapone, a corticosterone-producing enzyme P450C11 inhibitor. Moreover, progesterone, the corticosterone precursor, also stimulated GH mRNA expression in the cultured chicken pituitary gland, and this effect was blocked by pretreatment with metyrapone. We also detected mRNA expression of enzymes of cytochrome P450 cholesterol side chain cleavage (P450scc) and 3beta-hydroxysteroid dehydrogenase1 (3beta-HSD1) in the developmental chicken pituitary gland from E14 and E18, respectively. These results suggest that mineralocorticoids as well as glucocorticoids can stimulate GH mRNA expression and that corticosteroids generated in the embryonic pituitary gland by intrinsic steroidogenic enzymes stimulate somatotrope differentiation.

  20. Initial characterization of a bolA homologue from Pseudomonas fluorescens indicates different roles for BolA-like proteins in P. fluorescens and Escherichia coli

    DEFF Research Database (Denmark)

    Koch, Birgit; Nybroe, Ole

    2006-01-01

    A expression. The mutant grew slower than the wild-type strain in minimal medium with L-serine as the sole nitrogen source, while growth rates were similar on a mixture of L-serine and L-cysteine. Reverse transcriptase polymerase chain reaction analysis indicated that the bolA homologue is the second gene...

  1. Genomic characterization and expression profiles upon bacterial infection of a novel cystatin B homologue from disk abalone (Haliotis discus discus).

    Science.gov (United States)

    Premachandra, H K A; Wan, Qiang; Elvitigala, Don Anushka Sandaruwan; De Zoysa, Mahanama; Choi, Cheol Young; Whang, Ilson; Lee, Jehee

    2012-12-01

    Cystatins are a large family of cysteine proteinase inhibitors which are involved in diverse biological and pathological processes. In the present study, we identified a gene related to cystatin superfamily, AbCyt B, from disk abalone Haliotis discus discus by expressed sequence tag (EST) analysis and BAC library screening. The complete cDNA sequence of AbCyt B is comprised of 1967 nucleotides with a 306 bp open reading frame (ORF) encoding for 101 amino acids. The amino acid sequence consists of a single cystatin-like domain, which has a cysteine proteinase inhibitor signature, a conserved Gly in N-terminal region, QVVAG motif and a variant of PW motif. No signal peptide, disulfide bonds or carbohydrate side chains were identified. Analysis of deduced amino acid sequence revealed that AbCyt B shares up to 44.7% identity and 65.7% similarity with the cystatin B genes from other organisms. The genomic sequence of AbCyt B is approximately 8.4 Kb, consisting of three exons and two introns. Phylogenetic tree analysis showed that AbCyt B was closely related to the cystatin B from pacific oyster (Crassostrea gigas) under the family 1.Functional analysis of recombinant AbCyt B protein exhibited inhibitory activity against the papain, with almost 84% inhibition at a concentration of 3.5 μmol/L. In tissue expression analysis, AbCyt B transcripts were expressed abundantly in the hemocyte, gill, mantle, and digestive tract, while weakly in muscle, testis, and hepatopancreas. After the immune challenge with Vibrio parahemolyticus, the AbCyt B showed significant (P<0.05) up-regulation of relative mRNA expression in gill and hemocytes at 24 and 6 h of post infection, respectively. These results collectively suggest that AbCyst B is a potent inhibitor of cysteine proteinases and is also potentially involved in immune responses against invading bacterial pathogens in abalone. Copyright © 2012 Elsevier Ltd. All rights reserved.

  2. Bixin regulates mRNA expression involved in adipogenesis and enhances insulin sensitivity in 3T3-L1 adipocytes through PPAR{gamma} activation

    Energy Technology Data Exchange (ETDEWEB)

    Takahashi, Nobuyuki; Goto, Tsuyoshi; Taimatsu, Aki; Egawa, Kahori; Katoh, Sota; Kusudo, Tatsuya; Sakamoto, Tomoya; Ohyane, Chie; Lee, Joo-Young; Kim, Young-il; Uemura, Taku; Hirai, Shizuka [Laboratory of Molecular Function of Food, Division of Food Science and Biotechnology, Graduate School of Agriculture, Kyoto University, Uji 611-0011 (Japan); Kawada, Teruo, E-mail: fat@kais.kyoto-u.ac.jp [Laboratory of Molecular Function of Food, Division of Food Science and Biotechnology, Graduate School of Agriculture, Kyoto University, Uji 611-0011 (Japan)

    2009-12-25

    Insulin resistance is partly due to suppression of insulin-induced glucose uptake into adipocytes. The uptake is dependent on adipocyte differentiation, which is controlled at mRNA transcription level. The peroxisome proliferator-activated receptor (PPAR), a ligand-regulated nuclear receptor, is involved in the differentiation. Many food-derived compounds serve as ligands to activate or inactivate PPAR. In this study, we demonstrated that bixin and norbixin (annatto extracts) activate PPAR{gamma} by luciferase reporter assay using GAL4-PPAR chimera proteins. To examine the effects of bixin on adipocytes, 3T3-L1 adipocytes were treated with bixin or norbixin. The treatment induced mRNA expression of PPAR{gamma} target genes such as adipocyte-specific fatty acid-binding protein (aP2), lipoprotein lipase (LPL), and adiponectin in differentiated 3T3-L1 adipocytes and enhanced insulin-dependent glucose uptake. The observations indicate that bixin acts as an agonist of PPAR{gamma} and enhances insulin sensitivity in 3T3-L1 adipocytes, suggesting that bixin is a valuable food-derived compound as a PPAR ligand to regulate lipid metabolism and to ameliorate metabolic syndrome.

  3. Evaluation of mRNA expression levels and electrophysiological function of neuron-like cells derived from canine bone marrow stromal cells.

    Science.gov (United States)

    Nakano, Rei; Edamura, Kazuya; Sugiya, Hiroshi; Narita, Takanori; Okabayashi, Ken; Moritomo, Tadaaki; Teshima, Kenji; Asano, Kazushi; Nakayama, Tomohiro

    2013-10-01

    To investigate the in vitro differentiation of canine bone marrow stromal cells (BMSCs) into functional, mature neurons. Bone marrow from 6 adult dogs. BMSCs were isolated from bone marrow and chemically induced to develop into neurons. The morphology of the BMSCs during neuronal induction was monitored, and immunocytochemical analyses for neuron markers were performed after the induction. Real-time PCR methods were used to evaluate the mRNA expression levels of markers for neural stem or progenitor cells, neurons, and ion channels, and western blotting was used to assess the expression of neuronal proteins before and after neuronal induction. The electrophysiological properties of the neuron-like cells induced from canine BMSCs were evaluated with fluorescent dye to monitor Ca(2)+ influx. Canine BMSCs developed a neuron-like morphology after neuronal induction. Immunocytochemical analysis revealed that these neuron-like cells were positive for neuron markers. After induction, the cells' mRNA expression levels of almost all neuron and ion channel markers increased, and the protein expression levels of nestin and neurofilament-L increased significantly. However, the neuron-like cells derived from canine BMSCs did not have the Ca(2)+ influx characteristic of spiking neurons. Although canine BMSCs had neuron-like morphological and biochemical properties after induction, they did not develop the electrophysiological characteristics of neurons. Thus, these results have suggested that canine BMSCs could have the capacity to differentiate into a neuronal lineage, but the differentiation protocol used may have been insufficient to induce development into functional neurons.

  4. Adipose cell differentiation: evidence for a two-step process in the polyamine-dependent Ob1754 clonal line.

    Science.gov (United States)

    Amri, E Z; Dani, C; Doglio, A; Etienne, J; Grimaldi, P; Ailhaud, G

    1986-01-01

    A subclone of preadipocyte Ob17 cells has been isolated (Ob1754 clonal line). Confluent Ob1754 cells treated with an inhibitor of spermidine and spermine synthesis, methylglyoxal bis(guanylhydrazone), were totally dependent upon putrescine addition for the expression of glycerol-3-phosphate dehydrogenase which behaved as a late marker of adipose conversion. Under these conditions, the early expression of lipoprotein lipase during growth arrest remained unchanged. Studies at the mRNA level showed that the expression of unidentified pOb24 and pGH3 mRNAs, which was parallel to that of lipoprotein lipase, is independent of polyamine addition whereas the late emergence of glycerol-3-phosphate dehydrogenase mRNA was putrescine-dependent and co-ordinated with the expression of pAL422 mRNA encoding for a myelin-P2 homologue [Bernlohr, Angus, Lane, Bolanowski & Kelly (1984) Proc. Natl. Acad. Sci. U.S.A. 81, 5468-5472]. The appearance of lipoprotein lipase preceded DNA synthesis and post-confluent mitoses which were both putrescine-dependent and which took place before the appearance of glycerol-3-phosphate dehydrogenase. Thus the adipose conversion of Ob1754 cells involves the expression of at least two separate sets of markers which are differently regulated. Images Fig. 3. Fig. 6. PMID:3800927

  5. A Mechanistic Beta-Binomial Probability Model for mRNA Sequencing Data.

    Science.gov (United States)

    Smith, Gregory R; Birtwistle, Marc R

    2016-01-01

    A main application for mRNA sequencing (mRNAseq) is determining lists of differentially-expressed genes (DEGs) between two or more conditions. Several software packages exist to produce DEGs from mRNAseq data, but they typically yield different DEGs, sometimes markedly so. The underlying probability model used to describe mRNAseq data is central to deriving DEGs, and not surprisingly most softwares use different models and assumptions to analyze mRNAseq data. Here, we propose a mechanistic justification to model mRNAseq as a binomial process, with data from technical replicates given by a binomial distribution, and data from biological replicates well-described by a beta-binomial distribution. We demonstrate good agreement of this model with two large datasets. We show that an emergent feature of the beta-binomial distribution, given parameter regimes typical for mRNAseq experiments, is the well-known quadratic polynomial scaling of variance with the mean. The so-called dispersion parameter controls this scaling, and our analysis suggests that the dispersion parameter is a continually decreasing function of the mean, as opposed to current approaches that impose an asymptotic value to the dispersion parameter at moderate mean read counts. We show how this leads to current approaches overestimating variance for moderately to highly expressed genes, which inflates false negative rates. Describing mRNAseq data with a beta-binomial distribution thus may be preferred since its parameters are relatable to the mechanistic underpinnings of the technique and may improve the consistency of DEG analysis across softwares, particularly for moderately to highly expressed genes.

  6. Developmental programming: Impact of fetal exposure to endocrine-disrupting chemicals on gonadotropin-releasing hormone and estrogen receptor mRNA in sheep hypothalamus

    International Nuclear Information System (INIS)

    Mahoney, Megan M.; Padmanabhan, Vasantha

    2010-01-01

    Bisphenol-A (BPA) and methoxychlor (MXC), two endocrine-disrupting chemicals (EDCs) with estrogenic and antiandrogenic effects, disrupt the reproductive system. BPA has profound effects on luteinizing hormone (LH) surge amplitude, and MXC has profound effects on on LH surge timing in sheep. The neural mechanisms involved in the differential disruption of the LH surge by these two EDCs remain to be elucidated. We tested the hypothesis that the differential effects of BPA and MXC on LH surge system involved changes in hypothalamic gonadotropin-releasing hormone (GnRH) and estrogen receptors (ESR), ESR1 and ESR2, mRNA expression. Pregnant sheep were given daily injections of cottonseed oil (controls), MXC, or BPA (5 mg/kg/day) from day 30 to 90 of gestation (term 147 d). Offspring from these animals were euthanized as adults, during the late follicular phase following synchronization of estrus with prostaglandin F 2α , just before the expected onset of preovulatory LH surge and changes in mRNA expression of hypothalamic GnRH, ESR1, and ESR2 quantified following in situ hybridization. GnRH mRNA expression was significantly lower in both groups of EDC-treated females compared to controls. ESR1 expression was increased in prenatal BPA- but not MXC-treated females in medial preoptic area relative to controls. In contrast, ESR2 expression was reduced in the medial preoptic area of both EDC-treated groups. Differences in expression of ESR1/ESR2 receptors may contribute to the differential effects of BPA and MXC on the LH surge system. These findings provide support that prenatal exposure to EDCs alters the neural developmental trajectory leading to long-term reproductive consequences in the adult female.

  7. Developmental programming: impact of fetal exposure to endocrine-disrupting chemicals on gonadotropin-releasing hormone and estrogen receptor mRNA in sheep hypothalamus.

    Science.gov (United States)

    Mahoney, Megan M; Padmanabhan, Vasantha

    2010-09-01

    Bisphenol-A (BPA) and methoxychlor (MXC), two endocrine-disrupting chemicals (EDCs) with estrogenic and antiandrogenic effects, disrupt the reproductive system. BPA has profound effects on luteinizing hormone (LH) surge amplitude, and MXC has profound effects on on LH surge timing in sheep. The neural mechanisms involved in the differential disruption of the LH surge by these two EDCs remain to be elucidated. We tested the hypothesis that the differential effects of BPA and MXC on LH surge system involved changes in hypothalamic gonadotropin-releasing hormone (GnRH) and estrogen receptors (ESR), ESR1 and ESR2, mRNA expression. Pregnant sheep were given daily injections of cottonseed oil (controls), MXC, or BPA (5mg/kg/day) from day 30 to 90 of gestation (term 147d). Offspring from these animals were euthanized as adults, during the late follicular phase following synchronization of estrus with prostaglandin F(2alpha), just before the expected onset of preovulatory LH surge and changes in mRNA expression of hypothalamic GnRH, ESR1, and ESR2 quantified following in situ hybridization. GnRH mRNA expression was significantly lower in both groups of EDC-treated females compared to controls. ESR1 expression was increased in prenatal BPA- but not MXC-treated females in medial preoptic area relative to controls. In contrast, ESR2 expression was reduced in the medial preoptic area of both EDC-treated groups. Differences in expression of ESR1/ESR2 receptors may contribute to the differential effects of BPA and MXC on the LH surge system. These findings provide support that prenatal exposure to EDCs alters the neural developmental trajectory leading to long-term reproductive consequences in the adult female. 2010 Elsevier Inc. All rights reserved.

  8. Bropirimine inhibits osteoclast differentiation through production of interferon-β

    International Nuclear Information System (INIS)

    Suzuki, Hiroaki; Mochizuki, Ayako; Yoshimura, Kentaro; Miyamoto, Yoichi; Kaneko, Kotaro; Inoue, Tomio; Chikazu, Daichi; Takami, Masamichi; Kamijo, Ryutaro

    2015-01-01

    Bropirimine is a synthetic agonist for toll-like receptor 7 (TLR7). In this study, we investigated the effects of bropirimine on differentiation and bone-resorbing activity of osteoclasts in vitro. Bropirimine inhibited osteoclast differentiation of mouse bone marrow-derived macrophages (BMMs) induced by receptor activator of nuclear factor κB ligand (RANKL) in a concentration-dependent manner. Furthermore, it suppressed the mRNA expression of nuclear factor of activated T-cells, cytoplasmic, calcineurin-dependent 1 (NFATc1), a master transcription factor for osteoclast differentiation, without affecting BMM viability. Bropirimine also inhibited osteoclast differentiation induced in co-cultures of mouse bone marrow cells (BMCs) and mouse osteoblastic UAMS-32 cells in the presence of activated vitamin D_3. Bropirimine partially suppressed the expression of RANKL mRNA in UAMS-32 cells induced by activated vitamin D_3. Finally, the anti-interferon-β (IFN-β) antibody restored RANKL-dependent differentiation of BMMs into osteoclasts suppressed by bropirimine. These results suggest that bropirimine inhibits differentiation of osteoclast precursor cells into osteoclasts via TLR7-mediated production of IFN-β.

  9. Bropirimine inhibits osteoclast differentiation through production of interferon-β

    Energy Technology Data Exchange (ETDEWEB)

    Suzuki, Hiroaki [Department of Biochemistry, Showa University School of Dentistry, Tokyo 142-8555 (Japan); Mochizuki, Ayako [Department of Oral Physiology, Showa University School of Dentistry, Tokyo 142-8555 (Japan); Yoshimura, Kentaro; Miyamoto, Yoichi [Department of Biochemistry, Showa University School of Dentistry, Tokyo 142-8555 (Japan); Kaneko, Kotaro [Department of Biochemistry, Showa University School of Dentistry, Tokyo 142-8555 (Japan); Department of Oral and Maxillofacial Surgery, Tokyo Medical University, Tokyo 160-0023 (Japan); Inoue, Tomio [Department of Oral Physiology, Showa University School of Dentistry, Tokyo 142-8555 (Japan); Chikazu, Daichi [Department of Oral and Maxillofacial Surgery, Tokyo Medical University, Tokyo 160-0023 (Japan); Takami, Masamichi [Department of Pharmacology, Showa University School of Dentistry, Tokyo 142-8555 (Japan); Kamijo, Ryutaro, E-mail: kamijor@dent.showa-u.ac.jp [Department of Biochemistry, Showa University School of Dentistry, Tokyo 142-8555 (Japan)

    2015-11-06

    Bropirimine is a synthetic agonist for toll-like receptor 7 (TLR7). In this study, we investigated the effects of bropirimine on differentiation and bone-resorbing activity of osteoclasts in vitro. Bropirimine inhibited osteoclast differentiation of mouse bone marrow-derived macrophages (BMMs) induced by receptor activator of nuclear factor κB ligand (RANKL) in a concentration-dependent manner. Furthermore, it suppressed the mRNA expression of nuclear factor of activated T-cells, cytoplasmic, calcineurin-dependent 1 (NFATc1), a master transcription factor for osteoclast differentiation, without affecting BMM viability. Bropirimine also inhibited osteoclast differentiation induced in co-cultures of mouse bone marrow cells (BMCs) and mouse osteoblastic UAMS-32 cells in the presence of activated vitamin D{sub 3}. Bropirimine partially suppressed the expression of RANKL mRNA in UAMS-32 cells induced by activated vitamin D{sub 3}. Finally, the anti-interferon-β (IFN-β) antibody restored RANKL-dependent differentiation of BMMs into osteoclasts suppressed by bropirimine. These results suggest that bropirimine inhibits differentiation of osteoclast precursor cells into osteoclasts via TLR7-mediated production of IFN-β.

  10. High ALK mRNA expression has a negative prognostic significance in rhabdomyosarcoma

    Science.gov (United States)

    Bonvini, P; Zin, A; Alaggio, R; Pawel, B; Bisogno, G; Rosolen, A

    2013-01-01

    Background: Anaplastic lymphoma kinase (ALK) is a receptor tyrosine kinase aberrantly expressed in cancer, but its clinical and functional importance remain controversial. Mutation or amplification of ALK, as well as its expression levels assessed by conventional immunohistochemistry methods, has been linked to prognosis in cancer, although with potential bias because of the semi-quantitative approaches. Herein, we measured ALK mRNA expression in rhabdomyosarcoma (RMS) and determined its clinical impact on patients' stratification and outcome. Methods: Specimens were obtained from RMS patients and cell lines, and ALK expression was analysed by quantitative RT–PCR, western blotting, IHC, and copy number analysis. Results: High ALK mRNA expression was detected in the vast majority of PAX3/7-FOXO1-positive tumours, whereas PAX3/7-FOXO1-negative RMS displayed considerably lower amounts of both mRNA and protein. Notably, ALK mRNA distinguished unfavourable PAX3/7-FOXO1-positive tumours from PAX3/7-FOXO1-negative RMS (Ptumour size (PALK mRNA levels were of prognostic relevance by Cox univariate regression analysis and correlated with increased risk of relapse (P=0.001) and survival (P=0.01), whereas by multivariate analysis elevated ALK mRNA expression resulted a negative prognostic marker when clinical stage was not included. Conclusion: Quantitative assessment of ALK mRNA expression helps to improve risk stratification of RMS patients and identifies tumours with adverse biological characteristics and aggressive behaviour. PMID:24149177

  11. Complement mRNA in the mammalian brain: responses to Alzheimer's disease and experimental brain lesioning.

    Science.gov (United States)

    Johnson, S A; Lampert-Etchells, M; Pasinetti, G M; Rozovsky, I; Finch, C E

    1992-01-01

    This study describes evidence in the adult human and rat brain for mRNAs that encode two complement (C) proteins, C1qB and C4. C proteins are important effectors of humoral immunity and inflammation in peripheral tissues but have not been considered as normally present in brain. Previous immunocytochemical studies showed that C proteins are associated with plaques, tangles, and dystrophic neurites in Alzheimer's disease (AD), but their source is unknown. Combined immunocytochemistry and in situ hybridization techniques show C4 mRNA in pyramidal neurons and C1qB mRNA in microglia. Primary rat neuron cultures also show C1qB mRNA. In the cortex from AD brains, there were two- to threefold increases of C1qB mRNA and C4 mRNA, and increased C1qB mRNA prevalence was in part associated with microglia. As a model for AD, we examined entorhinal cortex perforant path transection in the rat brain, which caused rapid increases of C1qB mRNA in the ipsilateral, but not contralateral, hippocampus and entorhinal cortex. The role of brain-derived acute and chronic C induction during AD and experimental lesions can now be considered in relation to functions of C proteins that pertain to cell degeneration and/or cell preservation and synaptic plasticity.

  12. The mRNA expression of XRCC repair genes in mice after γ-ray radiation

    International Nuclear Information System (INIS)

    Wang Qin; Yue Jingyin; Li Jin; Mu Chuanjie; Fan Feiyue

    2006-01-01

    Objective: To investigate the role of XRCC repair genes in radioresistance of IRM-2 inbred mice. Methods: Northern hybridization was used to measure mRNA expression of XRCC1 and XRCC5 genes in IRM-2 inbred mice. ICR/JCL and 615 after exposure to different doses of γ-ray radiation at different postirradiation time. Results: The levels of XRCC1 and XRCC5 mRNA expression in control IRM-2 mice were higher significantly than those in their control parental mice (P<0.01 and P<0.05). The mRNA expression of XRCC genes in ICR/JCL and 615 mice all increased to some extent after exposure 1, 2 and 4 Gy radiation. But the levels were significantly higher at 2h postirradiation (P<0.05) . The levels of XRCC mRNA expression in IRM-2 mice did not increase significnatly compared with the control mice after exposure 1 and 2 Gy radiation. But the levels of XRCC1 and XRCC5 mRNA expression increased markedly at 4Gy 1h postirradiation (P<0.05 and P<0.01). Conclusion: The basal levels of XRCC1 and XRCC5 mRNA expression in IRM-2 mice were high. The high level of XRCC5 mRNA expression was involved in the repair of DNA double strand breaks induced by higher dose radiation, which perhaps was one of radioresistance causes of IRM-2 mice. (authors)

  13. Single-cell mRNA transfection studies: delivery, kinetics and statistics by numbers.

    Science.gov (United States)

    Leonhardt, Carolin; Schwake, Gerlinde; Stögbauer, Tobias R; Rappl, Susanne; Kuhr, Jan-Timm; Ligon, Thomas S; Rädler, Joachim O

    2014-05-01

    In artificial gene delivery, messenger RNA (mRNA) is an attractive alternative to plasmid DNA (pDNA) since it does not require transfer into the cell nucleus. Here we show that, unlike for pDNA transfection, the delivery statistics and dynamics of mRNA-mediated expression are generic and predictable in terms of mathematical modeling. We measured the single-cell expression time-courses and levels of enhanced green fluorescent protein (eGFP) using time-lapse microscopy and flow cytometry (FC). The single-cell analysis provides direct access to the distribution of onset times, life times and expression rates of mRNA and eGFP. We introduce a two-step stochastic delivery model that reproduces the number distribution of successfully delivered and translated mRNA molecules and thereby the dose-response relation. Our results establish a statistical framework for mRNA transfection and as such should advance the development of RNA carriers and small interfering/micro RNA-based drugs. This team of authors established a statistical framework for mRNA transfection by using a two-step stochastic delivery model that reproduces the number distribution of successfully delivered and translated mRNA molecules and thereby their dose-response relation. This study establishes a nice connection between theory and experimental planning and will aid the cellular delivery of mRNA molecules. Copyright © 2014 The Authors. Published by Elsevier Inc. All rights reserved.

  14. Nonsense mutations in the human β-globin gene affect mRNA metabolism

    International Nuclear Information System (INIS)

    Baserga, S.J.; Benz, E.J. Jr.

    1988-01-01

    A number of premature translation termination mutations (nonsense mutations) have been described in the human α- and β-globin genes. Studies on mRNA isolated from patients with β 0 -thalassemia have shown that for both the β-17 and the β-39 mutations less than normal levels of β-globin mRNA accumulate in peripheral blood cells. (The codon at which the mutation occurs designates the name of the mutation; there are 146 codons in human β-globin mRNA). In vitro studies using the cloned β-39 gene have reproduced this effect in a heterologous transfection system and have suggested that the defect resides in intranuclear metabolism. The authors have asked if this phenomenon of decreased mRNA accumulation is a general property of nonsense mutations and if the effect depends on the location or the type of mutation. Toward this end, they have studied the effect of five nonsense mutations and two missense mutations on the expression of human β-globin mRNA in a heterologous transfection system. In all cases studied, the presence of a translation termination codon correlates with a decrease in the steady-state level of mRNA. The data suggest that the metabolism of a mammalian mRNA is affected by the presence of a mutation that affects translation

  15. NONOates regulate KCl cotransporter-1 and -3 mRNA expression in vascular smooth muscle cells.

    Science.gov (United States)

    Di Fulvio, Mauricio; Lauf, Peter K; Shah, Shalin; Adragna, Norma C

    2003-05-01

    Nitric oxide (NO) donors regulate KCl cotransport (KCC) activity and cotransporter-1 and -3 (KCC1 and KCC3) mRNA expression in sheep erythrocytes and in primary cultures of rat vascular smooth muscle cells (VSMCs), respectively. In this study, we used NONOates as rapid and slow NO releasers to provide direct evidence implicating NO as a regulator of KCC3 gene expression at the mRNA level. In addition, we used the expression of KCC3 mRNA to further investigate the mechanism of action of these NO donors at the cellular level. Treatment of VSMCs with rapid NO releasers, like NOC-5 and NOC-9, as well as with the direct NO-independent soluble guanylyl cyclase (sGC) stimulator YC-1, acutely increased KCC3 mRNA expression in a concentration- and time-dependent manner. The slow NO releaser NOC-18 had no effect on KCC3 gene expression. A specific NO scavenger completely prevented the NONOate-induced KCC3 mRNA expression. Inhibition of sGC with LY-83583 blocked the NONOate- and YC-1-induced KCC3 mRNA expression. This study shows that in primary cultures of rat VSMCs, the fast NO releasers NOC-9 and NOC-5, but not the slow NO releaser NOC-18, acutely upregulate KCC3 mRNA expression in a NO/sGC-dependent manner.

  16. 阴道毛滴虫Rac1蛋白的cDNA克隆和序列分析%Molecular Cloning and Characterization of a Rac1 Homologue cDNA from Trichomonas vaginalis

    Institute of Scientific and Technical Information of China (English)

    傅玉才; 章家新; 郑晓虹; 刘红

    2004-01-01

    Objective To clone and characterize a Racl homologue from Trichomonas vaginalis for studying cell cycle of the organism. Methods A cDNA library derived from T. vaginalis mRNA was constructed into λ TriplEx2 phage vector. An expression sequence tag program was launched. Sequences of cDNA clones were analyzed using NCBI BLAST algorithms, and ClustalW and Treeview programs. Results A cDNA clone with a length of 714 base pairs was isolated. The sequence analysis showed that the cDNA clone has an open reading frame with 600 bp. The deduced amino acid sequence from the open reading frame contains 200 residuals and is most homologous to Rac1 subfamily of Rho GTPases with > 60% identity. The conserved sequence elements of Rho GTPases, such as GTP-binding sites, GTPase-activating protein (GAP) interaction motifs, GTP-dissociation inhibitors (GDI) interaction motifs, guanine nucleotide exchange factor (GEF) interaction elements, etc, were detected in the amino acid sequence. The phylogenetic analysis showed that the cDNA clone is grouped in the Rac subfamily and is more closely related to Rac1 proteins of protozoa. Conclusion The cDNA clone isolated belongs to Rac subfamily of Rho GTPases and is probably a Rac1 protein of T. vaginalis.%目的获得阴道毛滴虫Rac1蛋白的cDNA克隆,研究其在细胞周期中的调解作用.方法提取阴道毛滴虫总RNA,构建cDNA表达文库,随机分离cDNA克隆并测序.用在线生物分析软件NCBI BLAST、ClustalW以及Treeview等程序进行序列分析.结果获得一株有714 bp的cDNA克隆.序列分析表明,该克隆开放阅读框具600 bp,推测肽链具200个氨基酸.该肽链与Rho家族中Rac1鸟苷三磷酸(GTP)酶同源性最高(>60%),并具多种Rho GTP酶的保守基序,如GTP结合部位、GTP酶激活蛋白作用基序、GTP分离抑制因子作用基序、鸟嘌呤核苷酸交换因子作用基序等.进化树分析显示该克隆属于Rac亚家族GTP酶,与原虫Rac1蛋白最接近.结论该克隆

  17. Staphylococcus aureus RNAIII binds to two distant regions of coa mRNA to arrest translation and promote mRNA degradation.

    Directory of Open Access Journals (Sweden)

    Clément Chevalier

    2010-03-01

    Full Text Available Staphylococcus aureus RNAIII is the intracellular effector of the quorum sensing system that temporally controls a large number of virulence factors including exoproteins and cell-wall-associated proteins. Staphylocoagulase is one major virulence factor, which promotes clotting of human plasma. Like the major cell surface protein A, the expression of staphylocoagulase is strongly repressed by the quorum sensing system at the post-exponential growth phase. Here we used a combination of approaches in vivo and in vitro to analyze the mechanism used by RNAIII to regulate the expression of staphylocoagulase. Our data show that RNAIII represses the synthesis of the protein through a direct binding with the mRNA. Structure mapping shows that two distant regions of RNAIII interact with coa mRNA and that the mRNA harbors a conserved signature as found in other RNAIII-target mRNAs. The resulting complex is composed of an imperfect duplex masking the Shine-Dalgarno sequence of coa mRNA and of a loop-loop interaction occurring downstream in the coding region. The imperfect duplex is sufficient to prevent the formation of the ribosomal initiation complex and to repress the expression of a reporter gene in vivo. In addition, the double-strand-specific endoribonuclease III cleaves the two regions of the mRNA bound to RNAIII that may contribute to the degradation of the repressed mRNA. This study validates another direct target of RNAIII that plays a role in virulence. It also illustrates the diversity of RNAIII-mRNA topologies and how these multiple RNAIII-mRNA interactions would mediate virulence regulation.

  18. A novel link between Sus1 and the cytoplasmic mRNA decay machinery suggests a broad role in mRNA metabolism

    Directory of Open Access Journals (Sweden)

    Llopis Ana

    2010-03-01

    Full Text Available Abstract Background Gene expression is achieved by the coordinated action of multiple factors to ensure a perfect synchrony from chromatin epigenetic regulation through to mRNA export. Sus1 is a conserved mRNA export/transcription factor and is a key player in coupling transcription initiation, elongation and mRNA export. In the nucleus, Sus1 is associated to the transcriptional co-activator SAGA and to the NPC associated complex termed TREX2/THSC. Through these associations, Sus1 mediates the nuclear dynamics of different gene loci and facilitate the export of the new transcripts. Results In this study, we have investigated whether the yeast Sus1 protein is linked to factors involved in mRNA degradation pathways. We provide evidence for genetic interactions between SUS1 and genes coding for components of P-bodies such as PAT1, LSM1, LSM6 and DHH1. We demonstrate that SUS1 deletion is synthetic lethal with 5'→3' decay machinery components LSM1 and PAT1 and has a strong genetic interaction with LSM6 and DHH1. Interestingly, Sus1 overexpression led to an accumulation of Sus1 in cytoplasmic granules, which can co-localise with components of P-bodies and stress granules. In addition, we have identified novel physical interactions between Sus1 and factors associated to P-bodies/stress granules. Finally, absence of LSM1 and PAT1 slightly promotes the Sus1-TREX2 association. Conclusions In this study, we found genetic and biochemical association between Sus1 and components responsible for cytoplasmic mRNA metabolism. Moreover, Sus1 accumulates in discrete cytoplasmic granules, which partially co-localise with P-bodies and stress granules under specific conditions. These interactions suggest a role for Sus1 in gene expression during cytoplasmic mRNA metabolism in addition to its nuclear function.

  19. Negative regulation of neuromedin U mRNA expression in the rat pars tuberalis by melatonin.

    Directory of Open Access Journals (Sweden)

    Sayaka Aizawa

    Full Text Available The pars tuberalis (PT is part of the anterior pituitary gland surrounding the median eminence as a thin cell layer. The characteristics of PT differ from those of the pars distalis (PD, such as cell composition and gene expression, suggesting that the PT has a unique physiological function compared to the PD. Because the PT highly expresses melatonin receptor type 1, it is considered a mediator of seasonal and/or circadian signals of melatonin. Expression of neuromedin U (NMU that is known to regulate energy balance has been previously reported in the rat PT; however, the regulatory mechanism of NMU mRNA expression and secretion in the PT are still obscure. In this study, we examined both the diurnal change of NMU mRNA expression in the rat PT and the effects of melatonin on NMU in vivo. In situ hybridization and quantitative PCR analysis of laser microdissected PT samples revealed that NMU mRNA expression in the PT has diurnal variation that is high during the light phase and low during the dark phase. Furthermore, melatonin administration significantly suppressed NMU mRNA expression in the PT in vivo. On the other hand, 48 h fasting did not have an effect on PT-NMU mRNA expression, and the diurnal change of NMU mRNA expression was maintained. We also found the highest expression of neuromedin U receptor type 2 (NMUR2 mRNA in the third ventricle ependymal cell layer, followed by the arcuate nucleus and the spinal cord. These results suggest that NMU mRNA expression in the PT is downregulated by melatonin during the dark phase and shows diurnal change. Considering that NMU mRNA in the PT showed the highest expression level in the brain, PT-NMU may act on NMUR2 in the brain, especially in the third ventricle ependymal cell layer, with a circadian rhythm.

  20. A selective splicing variant of hepcidin mRNA in hepatocellular carcinoma cell lines

    International Nuclear Information System (INIS)

    Toki, Yasumichi; Sasaki, Katsunori; Tanaka, Hiroki; Yamamoto, Masayo; Hatayama, Mayumi; Ito, Satoshi; Ikuta, Katsuya; Shindo, Motohiro; Hasebe, Takumu; Nakajima, Shunsuke; Sawada, Koji; Fujiya, Mikihiro; Torimoto, Yoshihiro; Ohtake, Takaaki; Kohgo, Yutaka

    2016-01-01

    Hepcidin is a main regulator of iron metabolism, of which abnormal expression affects intestinal absorption and reticuloendothelial sequestration of iron by interacting with ferroportin. It is also noted that abnormal iron accumulation is one of the key factors to facilitate promotion and progression of cancer including hepatoma. By RT-PCR/agarose gel electrophoresis of hepcidin mRNA in a hepatocellular carcinoma cell line HLF, a smaller mRNA band was shown in addition to the wild-type hepcidin mRNA. From sequencing analysis, this additional band was a selective splicing variant of hepcidin mRNA lacking exon 2 of HAMP gene, producing the transcript that encodes truncated peptide lacking 20 amino acids at the middle of preprohepcidin. In the present study, we used the digital PCR, because such a small amount of variant mRNA was difficult to quantitate by the conventional RT-PCR amplification. Among seven hepatoma-derived cell lines, six cell lines have significant copy numbers of this variant mRNA, but not in one cell line. In the transient transfection analysis of variant-type hepcidin cDNA, truncated preprohepcidin has a different character comparing with native preprohepcidin: its product is insensitive to digestion, and secreted into the medium as a whole preprohepcidin form without maturation. Loss or reduction of function of HAMP gene by aberrantly splicing may be a suitable phenomenon to obtain the proliferating advantage of hepatoma cells. - Highlights: • An aberrant splicing variant of hepcidin mRNA lacking exon 2 of HAMP gene. • Absolute quantification of hepcidin mRNA by digital PCR amplification. • Hepatoma-derived cell lines have significant copies of variant-type hepcidin mRNA. • Truncated preprohepcidin is secreted from cells without posttranslational cleavage.

  1. A selective splicing variant of hepcidin mRNA in hepatocellular carcinoma cell lines

    Energy Technology Data Exchange (ETDEWEB)

    Toki, Yasumichi [Division of Gastroenterology and Hematology/Oncology, Department of Medicine, Asahikawa Medical University, Hokkaido 078-8510 (Japan); Sasaki, Katsunori, E-mail: k-sasaki@asahikawa-med.ac.jp [Department of Gastrointestinal Immunology and Regenerative Medicine, Asahikawa Medical University, Hokkaido 078-8510 (Japan); Tanaka, Hiroki [Department of Legal Medicine, Asahikawa Medical University, Hokkaido 078-8510 (Japan); Yamamoto, Masayo; Hatayama, Mayumi; Ito, Satoshi; Ikuta, Katsuya; Shindo, Motohiro; Hasebe, Takumu; Nakajima, Shunsuke; Sawada, Koji; Fujiya, Mikihiro [Division of Gastroenterology and Hematology/Oncology, Department of Medicine, Asahikawa Medical University, Hokkaido 078-8510 (Japan); Torimoto, Yoshihiro [Oncology Center, Asahikawa Medical University Hospital, Hokkaido 078-8510 (Japan); Ohtake, Takaaki; Kohgo, Yutaka [Department of Gastroenterology, International University of Health and Welfare Hospital, Tochigi 329-2763 (Japan)

    2016-08-05

    Hepcidin is a main regulator of iron metabolism, of which abnormal expression affects intestinal absorption and reticuloendothelial sequestration of iron by interacting with ferroportin. It is also noted that abnormal iron accumulation is one of the key factors to facilitate promotion and progression of cancer including hepatoma. By RT-PCR/agarose gel electrophoresis of hepcidin mRNA in a hepatocellular carcinoma cell line HLF, a smaller mRNA band was shown in addition to the wild-type hepcidin mRNA. From sequencing analysis, this additional band was a selective splicing variant of hepcidin mRNA lacking exon 2 of HAMP gene, producing the transcript that encodes truncated peptide lacking 20 amino acids at the middle of preprohepcidin. In the present study, we used the digital PCR, because such a small amount of variant mRNA was difficult to quantitate by the conventional RT-PCR amplification. Among seven hepatoma-derived cell lines, six cell lines have significant copy numbers of this variant mRNA, but not in one cell line. In the transient transfection analysis of variant-type hepcidin cDNA, truncated preprohepcidin has a different character comparing with native preprohepcidin: its product is insensitive to digestion, and secreted into the medium as a whole preprohepcidin form without maturation. Loss or reduction of function of HAMP gene by aberrantly splicing may be a suitable phenomenon to obtain the proliferating advantage of hepatoma cells. - Highlights: • An aberrant splicing variant of hepcidin mRNA lacking exon 2 of HAMP gene. • Absolute quantification of hepcidin mRNA by digital PCR amplification. • Hepatoma-derived cell lines have significant copies of variant-type hepcidin mRNA. • Truncated preprohepcidin is secreted from cells without posttranslational cleavage.

  2. Identification of stress responsive genes by studying specific relationships between mRNA and protein abundance.

    Science.gov (United States)

    Morimoto, Shimpei; Yahara, Koji

    2018-03-01

    Protein expression is regulated by the production and degradation of mRNAs and proteins but the specifics of their relationship are controversial. Although technological advances have enabled genome-wide and time-series surveys of mRNA and protein abundance, recent studies have shown paradoxical results, with most statistical analyses being limited to linear correlation, or analysis of variance applied separately to mRNA and protein datasets. Here, using recently analyzed genome-wide time-series data, we have developed a statistical analysis framework for identifying which types of genes or biological gene groups have significant correlation between mRNA and protein abundance after accounting for potential time delays. Our framework stratifies all genes in terms of the extent of time delay, conducts gene clustering in each stratum, and performs a non-parametric statistical test of the correlation between mRNA and protein abundance in a gene cluster. Consequently, we revealed stronger correlations than previously reported between mRNA and protein abundance in two metabolic pathways. Moreover, we identified a pair of stress responsive genes ( ADC17 and KIN1 ) that showed a highly similar time series of mRNA and protein abundance. Furthermore, we confirmed robustness of the analysis framework by applying it to another genome-wide time-series data and identifying a cytoskeleton-related gene cluster (keratin 18, keratin 17, and mitotic spindle positioning) that shows similar correlation. The significant correlation and highly similar changes of mRNA and protein abundance suggests a concerted role of these genes in cellular stress response, which we consider provides an answer to the question of the specific relationships between mRNA and protein in a cell. In addition, our framework for studying the relationship between mRNAs and proteins in a cell will provide a basis for studying specific relationships between mRNA and protein abundance after accounting for potential

  3. T-lymphocyte cytokine mRNA expression in cystic echinococcosis.

    Science.gov (United States)

    Fauser, S; Kern, P

    1997-04-01

    In the present study we investigated cytokine mRNA expression by peripheral blood mononuclear cells (PBMC) from patients with cystic echinococcosis (CE) after stimulation with different antigens. By using reverse transcriptase polymerase chain reaction (RT-PCR) we could demonstrate that restimulation with crude Echinococcus granulosus antigen (Eg-Ag) induced or enhanced Th2 cytokine mRNA expression, especially IL-5 (by using antigen from sheep cyst fluid) in 23 out of 26 investigated CE patients and IL-10 (by using antigen from camel cyst fluid) in 10 out of 10 investigated CE patients. In contrast, IL-5 mRNA expression was absent in PBMC of healthy controls after Eg-Ag stimulation. To determine the specificity of this reaction we stimulated PBMC from 11 CE patients with crude Echinococcus multilocularis antigen (Em-Ag) and PBMC from 8 CE patients with Toxocara canis antigen (Tc-Ag). We found that the PBMC of patients showed a similar mRNA cytokine pattern on stimulation with Em-Ag when compared with Eg-Ag stimulation. The cytokine mRNA pattern on stimulation with Tc-Ag, however, resembled the cytokine mRNA pattern of unstimulated PBMC. Furthermore, the stimulation of PBMC with crude Mycobacterium tuberculosis antigen (H37Ra) and purified protein derivative (PPD) of M. tuberculosis revealed distinct IL-5 mRNA expression in all investigated CE patients, whereas in healthy controls IL-5 mRNA expression was very weak or totally absent. Thus, our results indicate an induction of Th2 cytokine mRNA expression in CE patients, which is frequently observed in parasite infections. Interestingly, this response persists after stimulation with tuberculosis antigens, which normally induce Th1 response.

  4. Concentrated Differential Privacy

    OpenAIRE

    Dwork, Cynthia; Rothblum, Guy N.

    2016-01-01

    We introduce Concentrated Differential Privacy, a relaxation of Differential Privacy enjoying better accuracy than both pure differential privacy and its popular "(epsilon,delta)" relaxation without compromising on cumulative privacy loss over multiple computations.

  5. PTEN drives Th17 cell differentiation by preventing IL-2 production.

    Science.gov (United States)

    Kim, Hyeong Su; Jang, Sung Woong; Lee, Wonyong; Kim, Kiwan; Sohn, Hyogon; Hwang, Soo Seok; Lee, Gap Ryol

    2017-11-06

    T helper 17 (Th17) cells are a CD4 + T cell subset that produces IL-17A to mediate inflammation and autoimmunity. IL-2 inhibits Th17 cell differentiation. However, the mechanism by which IL-2 is suppressed during Th17 cell differentiation remains unclear. Here, we show that phosphatase and tensin homologue (PTEN) is a key factor that regulates Th17 cell differentiation by suppressing IL-2 production. Th17-specific Pten deletion ( Pten fl/fl Il17a cre ) impairs Th17 cell differentiation in vitro and ameliorated symptoms of experimental autoimmune encephalomyelitis (EAE), a model of Th17-mediated autoimmune disease. Mechanistically, Pten deficiency up-regulates IL-2 and phosphorylation of STAT5, but reduces STAT3 phosphorylation, thereby inhibiting Th17 cell differentiation. PTEN inhibitors block Th17 cell differentiation in vitro and in the EAE model. Thus, PTEN plays a key role in Th17 cell differentiation by blocking IL-2 expression. © 2017 Kim et al.

  6. Differential in vivo regulation of TH and DBH mRNA in rat atria by maprotiline and fluoxetine

    Directory of Open Access Journals (Sweden)

    Spasojević Nataša

    2011-01-01

    Full Text Available It is well known that antidepressants affect central monoaminergic neurotransmission and that they also modulate hormone release in peripheral tissues. Repeated maprotiline (a noradrenaline reuptake inhibitor and fluoxetine (a serotonin reuptake inhibitor treatment on gene expression of the catecholamine biosynthetic enzymes were examined in rat atria and ventricles in vivo. Maprotiline decreased the gene expression of tyrosine hydroxylase (TH and dopamineβ-hydroxylase (DBH in the rat atrium. Fluoxetine increased gene expression of TH and DBH, but not of phenylethanolamine N-methyltransferase (PNMT. Chronic application of antidepressants did not change the expression of these enzymes in the ventricles. We conclude that repeated administration of fluoxetine enhances gene transcription of TH and DBH and subsequently stimulates noradrenaline synthesis in rat atria in vivo.

  7. Differential mRNA expression of renal cortical tissue inhibitor of metalloproteinase-1, -2, and -3 in experimental hydronephrosis

    NARCIS (Netherlands)

    Engelmyer, E; van Goor, H; Edwards, D R; Diamond, J R

    The pathophysiologic sequelae of both acute and chronic experimental unilateral ureteral obstruction (UUO) in the rat are the result of a variety of complex humoral and cellular interactions. The development of interstitial fibrosis is dependent on the tightly coupled regulation of synthesis and

  8. HLA-G allelic variants are associated with differences in the HLA-G mRNA isoform profile and HLA-G mRNA levels

    DEFF Research Database (Denmark)

    Hviid, Thomas Vauvert F; Hylenius, Sine; Rørbye, Christina

    2003-01-01

    between mother and fetus in several ways. Finally, the expression of membrane-bound HLA-G and soluble HLA-G has been proposed to influence the outcome of pregnancy, and an aberrant HLA-G expression in pre-eclamptic placentas and spontaneous abortions has been reported. Here, an association between certain...... HLA-G polymorphisms and the mRNA levels of the different alternatively spliced HLA-G isoforms in first trimester trophoblast cell populations is reported. Several alternatively spliced HLA-G mRNA isoforms, including a 14-bp polymorphism in the 3'UTR end (exon 8) of the HLA-G gene, are expressed...

  9. Anatomy of rat semaphorin III/collapsin-1 mRNA expression and relationship to developing nerve tracts during neuroembryogenesis

    NARCIS (Netherlands)

    Giger, Roman J; Wolfer, D P; De Wit, G M; Verhaagen, J

    1996-01-01

    Semaphorin III/collapsin-1 (semaIII/coll-1) is a chemorepellent that exhibits a repulsive effect on growth cones of dorsal root ganglion neurons. To identify structures that express semaIII/coll-1 in developing mammals, we cloned the rat homologue and performed in situ hybridization on embryonic,

  10. All-in-one detector of circulating mRNA based on a smartphone

    Science.gov (United States)

    Cmiel, Vratislav; Gumulec, Jaromir; Svoboda, Ondrej; Raudenska, Martina; Hudcova, Kristyna; Sekora, Jiri; Balogh, Jaroslav; Masarik, Michal; Provaznik, Ivo

    2016-03-01

    Metallothionein is significantly elevated in various tumors, notably in prostate cancer on both mRNA and protein level. We demonstrated a strong predictive potential of free circulating metallothionein 2A isoform mRNA for patients with this cancer. Circulating mRNA detection relies on expensive equipment and requires high level of expertise. In this work we developed compact "all-in-one" laboratory system which replace microvolume spectrophotometer, thermocycler and realtime PCR machines. We managed to design and construct a microprocessor controlled heating/cooling chamber that ensures required temperature gradient. The chamber includes implemented optical system to enable fluorescence excitation and fluorescence analysis using a smart-phone.

  11. Adipose tissue interleukin-18 mRNA and plasma interleukin-18: effect of obesity and exercise

    DEFF Research Database (Denmark)

    Leick, Lotte; Lindegaard, Birgitte; Stensvold, Dorthe

    2007-01-01

    resistance was tested. Furthermore, we speculated that acute exercise and exercise training would regulate AT IL-18 mRNA expression. RESEARCH METHODS AND PROCEDURES: Non-obese subjects with BMI women: n = 18; men; n = 11) and obese subjects with BMI >30 kg/m(2) (women: n = 6; men: n = 7...... of regular physical activity with improved insulin sensitivity.......OBJECTIVES: Obesity and a physically inactive lifestyle are associated with increased risk of developing insulin resistance. The hypothesis that obesity is associated with increased adipose tissue (AT) interleukin (IL)-18 mRNA expression and that AT IL-18 mRNA expression is related to insulin...

  12. Assessing mRNA nuclear export in mammalian cells by microinjection.

    Science.gov (United States)

    Lee, Eliza S; Palazzo, Alexander F

    2017-08-15

    The nuclear export of mRNAs is an important yet little understood part of eukaryotic gene expression. One of the easiest methods for monitoring mRNA export in mammalian tissue culture cells is through the microinjection of DNA plasmids into the nucleus and monitoring the distribution of the transcribed product over time. Here we describe how to setup a microscope equipped with a micromanipulator used in cell microinjections, and we explain how to perform a nuclear mRNA export assay and obtain the nuclear export rate for any given mRNA. Copyright © 2017 Elsevier Inc. All rights reserved.

  13. microRNA-independent recruitment of Argonaute 1 to nanos mRNA through the Smaug RNA-binding protein

    OpenAIRE

    Pinder, Benjamin D; Smibert, Craig A

    2012-01-01

    Argonaute 1 directly interacts with the RNA binding protein Smaug in Drosophila, is thereby recruited to the Smaug target nanos mRNA and is required for Smaug-mediated translational repression of the nanos mRNA.

  14. [Impacts of the formula of Suoquanwan(SQW) on expression of AQP-2 mRNA and AVPR-V2 mRNA in the kidney of rat polyuria model of Yang-deficiency].

    Science.gov (United States)

    Cao, Hong-Ying; Wu, Qing-He; Huang, Ping; He, Jin-Yang

    2009-06-01

    To observe the impacts of the formula of Suoquanwan (SQW) on the expression of AQP-2 mRNA and AVPR-V2 mRNA in the kidney of rat polyuria model of Yang-deficiency. The model rats were induced by adenine (250 mg/kg) for 4 weeks, then treated respectively with SQW or dDAVP. The expression of AQP-2 mRNA and AVPR-V2 mRNA in kidney of Yang-deficiency model by realtime fluorescence quantitative PCR method were investigated. In model rats, the expression of AQP-2 mRNA and AVPR-V2 mRNA in the kidney decreased, dDAVP and SQW high dose could increased the expression of AQP-2 mRNA and AVPR-V2 mRNA in the kidney. The others had no influence on the expression of AQP-2 mRNA and AVPR-V2 mRNA in the kidney. SQW can increase the expression of AQP-2 mRNA and AVPR-V2 mRNA in the kidney of rat polyuria model of Yang-deficiency.

  15. A Systematic Analysis on mRNA and MicroRNA Expression in Runting and Stunting Chickens

    Science.gov (United States)

    Xu, Haiping; Xu, Zhenqiang; Ma, Jinge; Li, Bixiao; Lin, Shudai; Nie, Qinghua; Luo, Qingbin; Zhang, Xiquan

    2015-01-01

    Runting and stunting syndrome (RSS), which is characterized by lower body weight, widely occurs in broilers. Some RSS chickens simply exhibit slow growth without pathological changes. An increasing number of studies indicate that broiler strains differ in susceptibility to infectious diseases, most likely due to their genetic differences. The objective of this study was to detect the differentially expressed miRNAs and mRNAs in RSS and normal chickens. By integrating miRNA with mRNA expression profiling, potential molecular mechanisms involved in RSS could be further explored. Twenty-two known miRNAs and 1,159 genes were differentially expressed in RSS chickens compared with normal chickens (P chicken liver albeit with reduced abundance. Dual-luciferase reporter assay indicated that gga-miR-30b/c directly target CARS through binding to its 3′UTR. The miR-30b/c: CARS regulation mainly occurred in liver. In thigh muscle and the hypothalamus, miR-30b/c are expressed at higher levels in RSS chickens compared with normal chickens from 2 to 6 w of age, and notably significant differences are observed at 4 w of age. PMID:26010155

  16. Alternative promoter usage generates novel shorter MAPT mRNA transcripts in Alzheimer's disease and progressive supranuclear palsy brains.

    Science.gov (United States)

    Huin, Vincent; Buée, Luc; Behal, Hélène; Labreuche, Julien; Sablonnière, Bernard; Dhaenens, Claire-Marie

    2017-10-03

    Alternative promoter usage is an important mechanism for transcriptome diversity and the regulation of gene expression. Indeed, this alternative usage may influence tissue/subcellular specificity, protein translation and function of the proteins. The existence of an alternative promoter for MAPT gene was considered for a long time to explain differential tissue specificity and differential response to transcription and growth factors between mRNA transcripts. The alternative promoter usage could explain partly the different tau proteins expression patterns observed in tauopathies. Here, we report on our discovery of a functional alternative promoter for MAPT, located upstream of the gene's second exon (exon 1). By analyzing genome databases and brain tissue from control individuals and patients with Alzheimer's disease or progressive supranuclear palsy, we identified novel shorter transcripts derived from this alternative promoter. These transcripts are increased in patients' brain tissue as assessed by 5'RACE-PCR and qPCR. We suggest that these new MAPT isoforms can be translated into normal or amino-terminal-truncated tau proteins. We further suggest that activation of MAPT's alternative promoter under pathological conditions leads to the production of truncated proteins, changes in protein localization and function, and thus neurodegeneration.

  17. Evidence for a functional link between Dd-STATa and Dd-PIAS, a Dictyostelium PIAS homologue.

    Science.gov (United States)

    Kawata, Takefumi; Hirano, Tatsunori; Ogasawara, Shun; Aoshima, Ryota; Yachi, Ayako

    2011-09-01

    Several mammalian protein families inhibit the activity of signal transducer and activator of transcription (STAT) proteins. The protein inhibitor of activated STAT (PIAS) was initially identified through its ability to interact with human STAT proteins. We isolated a gene (pisA) encoding a Dictyostelium orthologue of PIAS, Dd-PIAS, which possesses almost all the representative motifs and domains of mammalian PIAS proteins. A Dd-PIAS null mutant strain displays a normal terminal morphology but with accelerated development once cells are aggregated. In contrast, Dd-PIAS overexpressor strains demonstrate delayed aggregation, almost no slug phototaxis, impaired slug motility, and a prolonged slug migration period. This strain is a near phenocopy of the Dd-STATa null mutant, although it eventually forms a fruiting body, albeit inefficiently. The expression of several Dd-STATa-activated genes is upregulated in the Dd-PIAS null mutant and there is ectopic expression of pstAB makers. The concentration of a PIAS-green fluorescent protein (GFP) fusion protein, expressed under the PIAS promoter, is greatest in the pstO cells and gradually decreases with proximity to the tip of the slug and culminant: a pattern diametrically opposite to that of Dd-STATa. Our results suggest a functional interrelationship between Dd-PIAS and Dd-STATa that influences gene expression and development. © 2011 The Authors. Development, Growth & Differentiation © 2011 Japanese Society of Developmental Biologists.

  18. Scandium interaction with diantipyrylmethane homologues and 2-(n-sulphophenylazo)-1,8-dihydroxynaphthalene-3,6 sodium disulphonate

    Energy Technology Data Exchange (ETDEWEB)

    Ganago, L I; Alinovskaya, L A [AN Belorusskoj SSR, Minsk. Inst. Fiziki Tverdogo Tela i Poluprovodnikov

    1979-01-01

    The reactions of scandium with homologs of diantipyrilmethane (DAM)-propyldiantipyrilmethane (PDAM) and phenyldiantipyrilmethane (PhDAM) - are studied. The relationship of components in the complexes formed is found, and chemism of their formation is established. The complexes Sc-SPADNE (sodium salt 2-(n-sulphophenylazo)-1,8-dioxynaphthalene-3,6-disulphonic acid) are shown to form within a wide pH range. The maximum yield of complexes is observed at 6.0-7.5 pH. By the ion-exchange method the anion character of heteroligand scandium complexes is established. The complex Sc-SPADNE-PDAM is faster as compared with the complexes Sc-SPADNE-DAM and Sc-SPADNE-PhDAM. The decrease in amine excess and increase in the sensitivity of heteroligand formation of the complexes of scandium with SPADNE and PDAM make them better suited for analysis. The technique is developed for the determination of Sc/sub 2/O/sub 3/ in perovskites using the complete differential spectrophotometry method.

  19. Localization of insulin receptor mRNA in rat brain by in situ hybridization

    International Nuclear Information System (INIS)

    Marks, J.L.; Porte, D. Jr.; Stahl, W.L.; Baskin, D.G.

    1990-01-01

    Insulin receptor mRNA was demonstrated in rat brain slices by in situ hybridization with three 35 S-oligonucleotide probes and contact film autoradiography. Specificity was confirmed by showing that (a) excess unlabeled probe abolished the signal, (b) an oligonucleotide probe for rat neuropeptide Y mRNA showed a different distribution of hybridization signal, and (c) the distribution of insulin receptor binding was consistent with the distribution of insulin receptor mRNA. Insulin receptor mRNA was most abundant in the granule cell layers of the olfactory bulb, cerebellum and dentate gyrus, in the pyramidal cell body layers of the pyriform cortex and hippocampus, in the choroid plexus and in the arcuate nucleus of the hypothalamus

  20. FATHEAD MINNOW VITELLOGENIN: CDNA SEQUENCE AND MRNA AND PROTEIN EXPRESSION AFTER 17 BETA-ESTRADIOL TREATMENT

    Science.gov (United States)

    In the present study, a sensitive ribonuclease protection assay (RPA) for VTG mRNA was developed for the fathead minnow (Pimephales promelas), a species proposed for routine endocrine-disrupting chemical (EDC) screening.

  1. 60Co γ-irradiation enhances expression of GAP-43 mRNA in rat brain

    International Nuclear Information System (INIS)

    Su Bingyin; Cai Wenqin; Zhang Chenggang

    2001-01-01

    Objective: To study the relationship between the expression of GAP-43 mRNA and nerve regeneration in rat brain after 60 Co γ-irradiation. Methods: Wistar rats were subjected to whole-body irradiation with 8 Gy 60 Co γ-rays. The expression of GAP-43 was detected by in situ hybridization histochemistry using Dig-cRNA probe. Results: It was found that the expression of GAP-43 mRNA increased in the cerebral cortex, caudate, putamen, globus pallidum, thalamus and hypothalamus one week after 8 Gy 60 Co γ-irradiation. The peak of GAP-43 mRNA expression was observed in the fourth week and then began to decrease but still remained at a higher than normal level. However, it decreased to a low level after 7 weeks. Conclusion: Enhanced expression of GAP-43 mRNA after 60 Co γ-irradiation in rat brain is associated with nerve regeneration and reconstruction of synapse

  2. Astrocyte cultures derived from human brain tissue express angiotensinogen mRNA

    International Nuclear Information System (INIS)

    Milsted, A.; Barna, B.P.; Ransohoff, R.M.; Brosnihan, K.B.; Ferrario, C.M.

    1990-01-01

    The authors have identified human cultured cell lines that are useful for studying angiotensinogen gene expression and its regulation in the central nervous system. A model cell system of human central nervous system origin expressing angiotensinogen has not previously been available. Expression of angiotensinogen mRNA appears to be a basal property of noninduced human astrocytes, since astrocytic cell lines derived from human glioblastomas or nonneoplastic human brain tissue invariably produced angiotensinogen mRNA. In situ hybridization histochemistry revealed that angiotensinogen mRNA production was not limited to a subpopulation of astrocytes because >99% of cells in these cultures contained angiotensinogen mRNA. These cell lines will be useful in studies of the molecular mechanisms controlling angiotensin synthesis and the role of biologically active angiotensin in the human brain by allowing the authors to examine regulation of expression of the renin-angiotensin system in human astrocyte cultures

  3. Nuclear Imprisonment: Viral Strategies to Arrest Host mRNA Nuclear Export

    Directory of Open Access Journals (Sweden)

    Beatriz M. A. Fontoura

    2013-07-01

    Full Text Available Viruses possess many strategies to impair host cellular responses to infection. Nuclear export of host messenger RNAs (mRNA that encode antiviral factors is critical for antiviral protein production and control of viral infections. Several viruses have evolved sophisticated strategies to inhibit nuclear export of host mRNAs, including targeting mRNA export factors and nucleoporins to compromise their roles in nucleo-cytoplasmic trafficking of cellular mRNA. Here, we present a review of research focused on suppression of host mRNA nuclear export by viruses, including influenza A virus and vesicular stomatitis virus, and the impact of this viral suppression on host antiviral responses.

  4. Structure of an RNA dimer of a regulatory element from human thymidylate synthase mRNA

    OpenAIRE

    Dibrov, Sergey; McLean, Jaime; Hermann, Thomas

    2011-01-01

    An oligonucleotide representing a regulatory element of human thymidylate synthase mRNA has been crystallized as a dimer. The structure of the asymmetric dimer has been determined at 1.97 Å resolution.

  5. Naturally occurring BRCA2 alternative mRNA splicing events in clinically relevant samples

    DEFF Research Database (Denmark)

    Fackenthal, James D; Yoshimatsu, Toshio; Zhang, Bifeng

    2016-01-01

    patterns and thereby disrupt gene function. mRNA analyses are therefore among the tests used to interpret the clinical significance of some genetic variants. However, these could be confounded by the appearance of naturally occurring alternative transcripts unrelated to germline sequence variation...... to characterise the spectrum of naturally occurring BRCA2 mRNA alternate-splicing events. METHODS: mRNA was prepared from several blood and breast tissue-derived cells and cell lines by contributing ENIGMA laboratories. cDNA representing BRCA2 alternate splice sites was amplified and visualised using capillary...... or agarose gel electrophoresis, followed by sequencing. RESULTS: We demonstrate the existence of 24 different BRCA2 mRNA alternate-splicing events in lymphoblastoid cell lines and both breast cancer and non-cancerous breast cell lines. CONCLUSIONS: These naturally occurring alternate-splicing events...

  6. Immediate-early gene response to repeated immobilization: Fos protein and arc mRNA levels appear to be less sensitive than c-fos mRNA to adaptation.

    Science.gov (United States)

    Ons, Sheila; Rotllant, David; Marín-Blasco, Ignacio J; Armario, Antonio

    2010-06-01

    Stress exposure resulted in brain induction of immediate-early genes (IEGs), considered as markers of neuronal activation. Upon repeated exposure to the same stressor, reduction of IEG response (adaptation) has been often observed, but there are important discrepancies in literature that may be in part related to the particular IEG and methodology used. We studied the differential pattern of adaptation of the IEGs c-fos and arc (activity-regulated cytoskeleton-associated protein) after repeated exposure to a severe stressor: immobilization on wooden boards (IMO). Rats repeatedly exposed to IMO showed reduced c-fos mRNA levels in response to acute IMO in most brain areas studied: the medial prefrontal cortex (mPFC), lateral septum (LS), medial amygdala (MeA), paraventricular nucleus of the hypothalamus (PVN) and locus coeruleus. In contrast, the number of neurons showing Fos-like immunoreactivity was only reduced in the MeA and the various subregions of the PVN. IMO-induced increases in arc gene expression were restricted to telencephalic regions and reduced by repeated IMO only in the mPFC. Double-labelling in the LS of IMO-exposed rats revealed that arc was expressed in only one-third of Fos+ neurons, suggesting two populations of Fos+ neurons. These data suggest that c-fos mRNA levels are more affected by repeated IMO than corresponding protein, and that arc gene expression does not reflect adaptation in most brain regions, which may be related to its constitutive expression. Therefore, the choice of a particular IEG and the method of measurement are important for proper interpretation of the impact of chronic repeated stress on brain activation.

  7. Fibroblast growth factor-21 and omentin-1 hepatic mRNA expression and serum levels in morbidly obese women with non-alcoholic fatty liver disease.

    Science.gov (United States)

    Waluga, M; Kukla, M; Zorniak, M; Kajor, M; Liszka, L; Dyaczynski, M; Kowalski, G; Zadlo, D; Waluga, E; Olczyk, P; Buldak, R J; Berdowska, A; Hartleb, M

    2017-06-01

    Fibroblast growth factor-21 (FGF21) and omentin-1 have been recognized as potent antidiabetic agents with potential hepatoprotective activity. The aim of this study was to evaluate hepatic FGF21 and omentin-1 mRNA expression as well as their serum levels as predictive markers of liver injury and insulin resistance in morbidly obese women with non-alcoholic fatty liver disease (NAFLD). This study included 56 severely obese women who underwent intraoperative wedge liver biopsy during the bariatric surgery. Hepatic FGF21 and omentin-1 mRNA were assessed by quantitative real-time PCR, while their serum concentrations were measured with commercially available enzyme-linked immunosorbent assays. The FGF21 serum level was significantly higher in patients with a greater extent of steatosis (grade 2 and 3) compared to those without or with mild steatosis (grade 0 and 1) (P = 0.049). Receiver Operating Characteristic analysis, however, showed poor discriminant power for the FGF21 serum levels in differentiating between more and less extensive steatosis with an AUC = 0.666. There was a tendency towards higher levels of hepatic FGF21 mRNA in patients with lobular inflammation and fibrosis and towards lower levels in the case of hepatocyte ballooning and steatosis. There was a positive mutual correlation between hepatic FGF21 and omentin-1 mRNA levels (r = 0.78; P hepatic omentin-1 mRNA levels showed a tendency to be lower in patients with advanced steatosis and hepatocyte ballooning. In conclusion, our study, which focused on hepatic FGF21 and omentin-1 mRNA expression, confirmed marked expression of both molecules in the liver of morbidly obese patients with NAFLD. More extensive steatosis was associated with evident changes in the serum FGF21 concentration in morbidly obese women with NAFLD, but the difference did not reach statistical significance. The vast amount of fat, both visceral and subcutaneous, in severely obese patients may be the additional source and influence

  8. The RDE-10/RDE-11 complex triggers RNAi-induced mRNA degradation by association with target mRNA in C. elegans.

    Science.gov (United States)

    Yang, Huan; Zhang, Ying; Vallandingham, Jim; Li, Hua; Li, Hau; Florens, Laurence; Mak, Ho Yi

    2012-04-15

    The molecular mechanisms for target mRNA degradation in Caenorhabditis elegans undergoing RNAi are not fully understood. Using a combination of genetic, proteomic, and biochemical approaches, we report a divergent RDE-10/RDE-11 complex that is required for RNAi in C. elegans. Genetic analysis indicates that the RDE-10/RDE-11 complex acts in parallel to nuclear RNAi. Association of the complex with target mRNA is dependent on RDE-1 but not RRF-1, suggesting that target mRNA recognition depends on primary but not secondary siRNA. Furthermore, RDE-11 is required for mRNA degradation subsequent to target engagement. Deep sequencing reveals a fivefold decrease in secondary siRNA abundance in rde-10 and rde-11 mutant animals, while primary siRNA and microRNA biogenesis is normal. Therefore, the RDE-10/RDE-11 complex is critical for amplifying the exogenous RNAi response. Our work uncovers an essential output of the RNAi pathway in C. elegans.

  9. Regulation of mRNA Translation Is a Novel Mechanism for Phthalate Toxicity.

    Directory of Open Access Journals (Sweden)

    Jun Ling

    Full Text Available Phthalates are a group of plasticizers that are widely used in many consumer products and medical devices, thus generating a huge burden to human health. Phthalates have been known to cause a number of developmental and reproductive disorders functioning as endocrine modulators. They are also involved in carcinogenesis with mechanisms less understood. To further understand the molecular mechanisms of phthalate toxicity, in this study we reported a new effect of phthalates on mRNA translation/protein synthesis, a key regulatory step of gene expression. Butyl benzyl phthalate (BBP was found to directly inhibit mRNA translation in vitro but showed a complicated pattern of affecting mRNA translation in cells. In human kidney embryonic cell (HEK-293T, BBP increased cap-dependent mRNA translation at lower concentrations but showed inhibitory effect at higher concentrations. Cap-independent translation was not affected. On the other hand, mono (2-ethylhexyl phthalate (MEHP as a major metabolite of another important phthalate di (2-ethylhexyl phthalate (DEHP inhibited both can-dependent and -independent mRNA translation in vivo. In contrast, BBP and MEHP exhibited an overall promoting effect on mRNA translation in cancer cells. Mechanistic studies identified that the level and phosphorylation of eIF4E-BP (eIF4E binding protein and the amount of eIF4GI in eIF4F complex were altered in accordance with the effect of BBP on translation. BBP was also identified to directly bind to eIF4E, providing a further mechanism underlying the regulation of mRNA by phthalate. At the cellular level BBP inhibited normal cell growth but slightly promoted cancer cells (HT29 growth. Overall, this study provides the first evidence that phthalates can directly regulate mRNA translation as a novel mechanism to mediate their biological toxicities.

  10. Lower FOXO3 mRNA expression in granulosa cells is involved in unexplained infertility.

    Science.gov (United States)

    Yamamoto, Hikaru; Yamashita, Yoshiki; Saito, Natsuho; Hayashi, Atsushi; Hayashi, Masami; Terai, Yoshito; Ohmichi, Masahide

    2017-06-01

    The aim of this study was to investigate whether FOXO1 and FOXO3 mRNA expression in granulosa cells is the cause of unexplained infertility. Thirty-one patients aged infertility and 18 with male partner infertility as a control group) whose serum anti-Müllerian hormone level was >0.5 ng/μL were enrolled in the study. All patients underwent oocyte retrieval under a short protocol from June 2012 to October 2013. Real-time PCR was carried out using mRNA extracted from granulosa cells retrieved from mature follicles. We compared FOXO1 and FOXO3 mRNA expression ratios in granulosa cells between the unexplained infertility group and the male infertility group. The relation between FOXO1 and FOXO3 mRNA expression ratios in granulosa cells and assisted reproduction technology clinical outcome was also examined. FOXO3 mRNA expression ratio was significantly lower in the unexplained infertility group than in the male infertility group. Moreover, FOXO3 mRNA expression ratio showed a positive correlation with both the number of retrieved oocytes and serum anti-Müllerian hormone level. A positive correlation was also identified between FOXO1 mRNA expression and total dose of hMG. As well, the number of retrieved oocytes in the unexplained infertility group was statistically lower than that in the male infertility group. A lower FOXO3 mRNA expression in granulosa cells leads to poor oocyte development in patients with unexplained infertility undergoing controlled ovarian stimulation for in vitro fertilization-embryo transfer. © 2017 Japan Society of Obstetrics and Gynecology.

  11. Insertion of a specific fungal 3'-phosphoadenosine-5'-phosphatase motif into a plant homologue improves halotolerance and drought tolerance of plants.

    Science.gov (United States)

    Gašparič, Meti Buh; Lenassi, Metka; Gostinčar, Cene; Rotter, Ana; Plemenitaš, Ana; Gunde-Cimerman, Nina; Gruden, Kristina; Zel, Jana

    2013-01-01

    Soil salinity and drought are among the most serious agricultural and environmental problems of today. Therefore, investigations of plant resistance to abiotic stress have received a lot of attention in recent years. In this study, we identified the complete coding sequence of a 3'-phosphoadenosine-5'-phosphatase protein, ApHal2, from the halotolerant yeast Aureobasidium pullulans. Expression of the ApHAL2 gene in a Saccharomyces cerevisiae hal2 mutant complemented the mutant auxotrophy for methionine, and rescued the growth of the hal2 mutant in media with high NaCl concentrations. A 21-amino-acids-long region of the ApHal2 enzyme was inserted into the Arabidopsis thaliana homologue of Hal2, the SAL1 phosphatase. The inserted sequence included the META motif, which has previously been implicated in increased sodium tolerance of the Hal2 homologue from a related fungal species. Transgenic Arabidopsis plants overexpressing this modified SAL1 (mSAL1) showed improved halotolerance and drought tolerance. In a medium with an elevated salt concentration, mSAL1-expressing plants were twice as likely to have roots in a higher length category in comparison with the wild-type Arabidopsis and with plants overexpressing the native SAL1, and had 5% to 10% larger leaf surface area under moderate and severe salt stress, respectively. Similarly, after moderate drought exposure, the mSAL1-expressing plants showed 14% increased dry weight after revitalisation, with no increase in dry weight of the wild-type plants. With severe drought, plants overexpressing native SAL1 had the worst rehydration success, consistent with the recently proposed role of SAL1 in severe drought. This was not observed for plants expressing mSAL1. Therefore, the presence of this fungal META motif sequence is beneficial under conditions of increased salinity and moderate drought, and shows no drawbacks for plant survival under severe drought. This demonstrates that adaptations of extremotolerant fungi should

  12. Creatine kinase and alpha-actin mRNA levels decrease in diabetic rat hearts

    International Nuclear Information System (INIS)

    Popovich, B.; Barrieux, A.; Dillmann, W.H.

    1987-01-01

    Diabetic cardiomyopathy is associated with cardiac atrophy and isoenzyme redistribution. To determine if tissue specific changes occur in mRNAs coding for α-actin and creatine kinase (CK), they performed RNA blot analysis. Total ventricular RNA from control (C) and 4 wk old diabetic (D) rats were hybridized with 32 P cDNA probes for α-actin and CK. A tissue independent cDNA probe, CHOA was also used. Signal intensity was quantified by photodensitometry. D CK mRNA was 47 +/- 16% lower in D vs C. Insulin increases CK mRNA by 20% at 1.5 hs, and completely reverses the deficit after 4 wks. D α-actin mRNA is 66 +/- 18% lower in D vs C. Insulin normalized α-actin mRNA by 5 hs. CHOA mRNA is unchanged in D vs C, but D + insulin CHOA mRNA is 30 +/- 2% lower than C. In rats with diabetic cardiomyopathy, muscle specific CK and α-actin mRNAs are decreased. Insulin treatment reverses these changes

  13. Three-Dimensional Mapping of mRNA Export through the Nuclear Pore Complex

    Directory of Open Access Journals (Sweden)

    Steven J. Schnell

    2014-11-01

    Full Text Available The locations of transcription and translation of mRNA in eukaryotic cells are spatially separated by the nuclear envelope (NE. Plenty of nuclear pore complexes (NPCs embedded in the NE function as the major gateway for the export of transcribed mRNAs from the nucleus to the cytoplasm. Whereas the NPC, perhaps one of the largest protein complexes, provides a relatively large channel for macromolecules to selectively pass through it in inherently three-dimensional (3D movements, this channel is nonetheless below the diffraction limit of conventional light microscopy. A full understanding of the mRNA export mechanism urgently requires real-time mapping of the 3D dynamics of mRNA in the NPC of live cells with innovative imaging techniques breaking the diffraction limit of conventional light microscopy. Recently, super-resolution fluorescence microscopy and single-particle tracking (SPT techniques have been applied to the study of nuclear export of mRNA in live cells. In this review, we emphasize the necessity of 3D mapping techniques in the study of mRNA export, briefly summarize the feasibility of current 3D imaging approaches, and highlight the new features of mRNA nuclear export elucidated with a newly developed 3D imaging approach combining SPT-based super-resolution imaging and 2D-to-3D deconvolution algorithms.

  14. Noncoding RNA mediated traffic of foreign mRNA into chloroplasts reveals a novel signaling mechanism in plants.

    Directory of Open Access Journals (Sweden)

    Gustavo Gómez

    Full Text Available Communication between chloroplasts and the nucleus is one of the milestones of the evolution of plants on earth. Proteins encoded by ancestral chloroplast-endogenous genes were transferred to the nucleus during the endosymbiotic evolution and originated this communication, which is mainly dependent on specific transit-peptides. However, the identification of nuclear-encoded proteins targeted to the chloroplast lacking these canonical signals suggests the existence of an alternative cellular pathway tuning this metabolic crosstalk. Non-coding RNAS (NcRNAs are increasingly recognized as regulators of gene expression as they play roles previously believed to correspond to proteins. Avsunviroidae family viroids are the only noncoding functional RNAs that have been reported to traffic inside the chloroplasts. Elucidating mechanisms used by these pathogens to enter this organelle will unearth novel transport pathways in plant cells. Here we show that a viroid-derived NcRNA acting as a 5'UTR-end mediates the functional import of Green Fluorescent Protein (GFP mRNA into chloroplast. This claim is supported by the observation at confocal microscopy of a selective accumulation of GFP in the chloroplast of the leaves expressing the chimeric vd-5'UTR/GFP and by the detection of the GFP mRNA in chloroplasts isolated from cells expressing this construct. These results support the existence of an alternative signaling mechanism in plants between the host cell and chloroplasts, where an ncRNA functions as a key regulatory molecule to control the accumulation of nuclear-encoded proteins in this organelle. In addition, our findings provide a conceptual framework to develop new biotechnological tools in systems using plant chloroplast as bioreactors. Finally, viroids of the family Avsunviroidae have probably evolved to subvert this signaling mechanism to regulate their differential traffic into the chloroplast of infected cells.

  15. Elevated Hippocampal Cholinergic Neurostimulating Peptide precursor protein (HCNP-pp) mRNA in the amygdala in major depression.

    Science.gov (United States)

    Bassi, Sabrina; Seney, Marianne L; Argibay, Pablo; Sibille, Etienne

    2015-04-01

    The amygdala is innervated by the cholinergic system and is involved in major depressive disorder (MDD). Evidence suggests a hyper-activate cholinergic system in MDD. Hippocampal Cholinergic Neurostimulating Peptide (HCNP) regulates acetylcholine synthesis. The aim of the present work was to investigate expression levels of HCNP-precursor protein (HCNP-pp) mRNA and other cholinergic-related genes in the postmortem amygdala of MDD patients and matched controls (females: N = 16 pairs; males: N = 12 pairs), and in the mouse unpredictable chronic mild stress (UCMS) model that induced elevated anxiety-/depressive-like behaviors (females: N = 6 pairs; males: N = 6 pairs). Results indicate an up-regulation of HCNP-pp mRNA in the amygdala of women with MDD (p < 0.0001), but not males, and of UCMS-exposed mice (males and females; p = 0.037). HCNP-pp protein levels were investigated in the human female cohort, but no difference was found. There were no differences in gene expression of acetylcholinesterase (AChE), muscarinic (mAChRs) or nicotinic receptors (nAChRs) between MDD subjects and controls or UCMS and control mice, except for an up-regulation of AChE in UCMS-exposed mice (males and females; p = 0.044). Exploratory analyses revealed a baseline expression difference of cholinergic signaling-related genes between women and men (p < 0.0001). In conclusion, elevated amygdala HCNP-pp expression may contribute to mechanisms of MDD in women, potentially independently from regulating the cholinergic system. The differential expression of genes between women and men could also contribute to the increased vulnerability of females to develop MDD. Copyright © 2015 Elsevier Ltd. All rights reserved.

  16. Phorbol esters induce interleukin 2 mRNA in sensitive but not in resistant EL4 cells

    International Nuclear Information System (INIS)

    Harrison, J.R.; Lynch, K.R.; Sando, J.J.

    1986-01-01

    Phorbol ester (PE) sensitive EL4 cells are growth-inhibited and produce interleukin 2 (IL2) when treated with PE. Resistant EL4 cells lack both responses. To determine whether the defect in resistant cells occurs pre or post-transcriptionally, an assay for IL2 mRNA was developed using a synthetic oligonucleotide to mouse IL2 as a probe. Total RNA (15 μg) from cells +/- PE was electrophoresed, blotted onto a cationic nylon membrane, and probed with radiolabeled oligomer. This probe hybridized to a 1.1 kb band in RNA from PE-treated sensitive cells. This RNA was detectable within 3h of PE administration, was clearly visible by 6h, and peaked by 9 to 12h. No bands hybridizing with the IL2 probe were detected in RNA isolated from unstimulated cells or from resistant EL4 cells at any time following PE stimulation. Since levels of the protooncogene c-myc have been shown to decrease in a number of cell lines during differentiation and growth inhibition, total RNA from EL4 cells was probed with a nick-translated plasmid containing the protein coding region of the c-myc gene. In PE sensitive cells, levels of c-myc RNA are markedly reduced by 3h. In a pilot experiment with resistant cells, c-myc levels appeared to remain constant. These results demonstrate that PE induced IL2 mRNA in PE sensitive but not resistant EL4 cells. Sensitive and resistant EL4 cell lines provide a useful model for the investigation of the regulation of gene expression by PE

  17. A promoter within the E6 ORF of human papillomavirus type 16 contributes to the expression of the E7 oncoprotein from a monocistronic mRNA

    DEFF Research Database (Denmark)

    Glahder, Jacob-Andreas Harald; Hansen, Christina N; Vinther, Jeppe

    2003-01-01

    RNA that encodes E7 as the first open reading frame (ORF) has been identified. We recently identified a transcription initiation site within the E6 ORF of HPV-16 at nt 542. In the present study we have characterized the P542 promoter, which putatively controls monocistronic expression of E7. The monocistronic m...... from nt 226 to 409. Furthermore, the translation initiation of E7 is most abundant from the monocistronic mRNA. We have also shown that the P542 promoter is downregulated by the transcription factor activator protein 4 (AP-4) and the differentiation-dependent factor hSkn-1a, both binding downstream...... of the transcription initiation site. In conclusion, we have found that P542 is a relatively weak promoter compared with P97 and may be downregulated in differentiated epithelial cells....

  18. Taurine Promotes the Cartilaginous Differentiation of Human Umbilical Cord-Derived Mesenchymal Stem Cells in Vitro.

    Science.gov (United States)

    Yao, Xiuhua; Huang, Huiling; Li, Zhou; Liu, Xiaohua; Fan, Weijia; Wang, Xinping; Sun, Xuelian; Zhu, Jianmin; Zhou, Hongrui; Wei, Huaying

    2017-08-01

    Taurine has been reported to influence osteogenic differentiation, but the role of taurine on cartilaginous differentiation using human umbilical cord-derived mesenchymal stem cells (hUC-MSCs) remains unclear. In this study, we investigated the effect of taurine (0, 1, 5 and 10 mM) on the proliferation and chondrogenesis of hUC-MSCs by analyzing cell proliferation, accumulation of glycosaminoglycans and expression of cartilage specific mRNA. The results show though taurine did not affected the proliferation of hUC-MSCs, 5 mM of taurine is sufficient to enhanced the accumulation of glycosaminoglycans and up-regulate cartilage specific mRNA expression, namely collagen type II, aggrecan and SOX9. Taurine also inhibits chondrocyte dedifferentiation by reducing expression of collagen type I mRNA. Taken together, our study reveals that taurine promotes and maintains the chondrogenesis of hUC-MSCs.

  19. Effect of conjugated linoleic acids on the activity and mRNA expression of 5- and 15-lipoxygenases in human macrophages.

    Science.gov (United States)

    Stachowska, Ewa; Dziedziejko, Violetta; Safranow, Krzysztof; Jakubowska, Katarzyna; Olszewska, Maria; Machaliñski, Bogusław; Chlubek, Dariusz

    2007-06-27

    Lipoxygenases are a family of non-heme enzyme dioxygenases. The role of lipoxygenases is synthesis of hydroperoxides of fatty acids, which perform signaling functions in the body. Studies on conjugated linoleic acids (CLAs) as fatty acids with a potential anti-atherosclerotic function have recently been initiated. The aim of the study was to test the effect of CLAs and linoleic acid on 5- and 15-lipoxygenase (5-LO, 15-LO-1) enzyme activity, their mRNA expression, and concentration in the cells. It was also desired to determine whether the CLAs are substrates for the enzymes. For the experiments monocytic cell line (THP-1) and monocytes obtained from human venous blood were used. Monocytes were differentiated to macrophages: THP-1 (CD14+) by PMA administration (100 nM for 24 h) and monocytes from blood (CD14+) by 7-day cultivation with the autologous serum (10%). After differentiation, macrophages were cultured with 30 microM CLAs or linoleic acid for 48 h. The 15- and 5-lipoxygenase products were measured by HPLC method. mRNA expression and protein content were analyzed by real-time PCR and Western blot analysis. The in vitro studies proved that both CLA isomers are not substrates for 15-LO-1; in ex vivo studies hydroxydecadienoic acid (HODE) concentration was significantly reduced (p = 0.019). The trans-10,cis-12 CLA isomer reduced HODE concentration by 28% (p = 0.046) and the cis-9,trans-11 CLA isomer by 35% (p = 0.028). In macrophages obtained from THP-1 fatty acids did not change significantly mRNA expression of the majority of the investigated genes. CLAs did not change the content of 5-LO and 15-LO-1 proteins in macrophages obtained from peripheral blood. Linoleic acid induced 15-LO-1 expression (2.6 times, p < 0.05). CLAs may perform the function of an inhibitor of lipoxygenase 15-LO-1 activity in macrophages.

  20. Oestradiol reduces Liver Receptor Homolog-1 mRNA transcript stability in breast cancer cell lines

    International Nuclear Information System (INIS)

    Lazarus, Kyren A.; Zhao, Zhe; Knower, Kevin C.; To, Sarah Q.; Chand, Ashwini L.; Clyne, Colin D.

    2013-01-01

    Highlights: •LRH-1 is an orphan nuclear receptor that regulates tumor proliferation. •In breast cancer, high mRNA expression is associated with ER+ status. •In ER−ve cells, despite very low mRNA, we found abundant LRH-1 protein. •Our data show distinctly different LRH-1 protein isoforms in ER− and ER+ breast cancer cells. •This is due to differences in LRH-1 mRNA and protein stability rates. -- Abstract: The expression of orphan nuclear receptor Liver Receptor Homolog-1 (LRH-1) is elevated in breast cancer and promotes proliferation, migration and invasion in vitro. LRH-1 expression is regulated by oestrogen (E 2 ), with LRH-1 mRNA transcript levels higher in oestrogen receptor α (ERα) positive (ER+) breast cancer cells compared to ER− cells. However, the presence of LRH-1 protein in ER− cells suggests discordance between mRNA transcript levels and protein expression. To understand this, we investigated the impact of mRNA and protein stability in determining LRH-1 protein levels in breast cancer cells. LRH-1 transcript levels were significantly higher in ER+ versus ER− breast cancer cells lines; however LRH-1 protein was expressed at similar levels. We found LRH-1 mRNA and protein was more stable in ER− compared to ER+ cell lines. The tumor-specific LRH-1 variant isoform, LRH-1v4, which is highly responsive to E 2 , showed increased mRNA stability in ER− versus ER+ cells. In addition, in MCF-7 and T47-D cell lines, LRH-1 total mRNA stability was reduced with E 2 treatment, this effect mediated by ERα. Our data demonstrates that in ER− cells, increased mRNA and protein stability contribute to the abundant protein expression levels. Expression and immunolocalisation of LRH-1 in ER− cells as well as ER− tumors suggests a possible role in the development of ER− tumors. The modulation of LRH-1 bioactivity may therefore be beneficial as a treatment option in both ER− and ER+ breast cancer

  1. Oestradiol reduces Liver Receptor Homolog-1 mRNA transcript stability in breast cancer cell lines

    Energy Technology Data Exchange (ETDEWEB)

    Lazarus, Kyren A. [Cancer Drug Discovery Laboratory, Prince Henry’s Institute of Medical Research, Clayton, Victoria 3168 (Australia); Environmental and Biotechnology Centre, Swinburne University, Hawthorn, Victoria 3122 (Australia); Zhao, Zhe; Knower, Kevin C. [Cancer Drug Discovery Laboratory, Prince Henry’s Institute of Medical Research, Clayton, Victoria 3168 (Australia); To, Sarah Q. [Cancer Drug Discovery Laboratory, Prince Henry’s Institute of Medical Research, Clayton, Victoria 3168 (Australia); Department of Biochemistry and Molecular Biology, Monash University, Clayton, Victoria 3168 (Australia); Chand, Ashwini L. [Cancer Drug Discovery Laboratory, Prince Henry’s Institute of Medical Research, Clayton, Victoria 3168 (Australia); Clyne, Colin D., E-mail: Colin.clyne@princehenrys.org [Cancer Drug Discovery Laboratory, Prince Henry’s Institute of Medical Research, Clayton, Victoria 3168 (Australia); Department of Biochemistry and Molecular Biology, Monash University, Clayton, Victoria 3168 (Australia)

    2013-08-30

    Highlights: •LRH-1 is an orphan nuclear receptor that regulates tumor proliferation. •In breast cancer, high mRNA expression is associated with ER+ status. •In ER−ve cells, despite very low mRNA, we found abundant LRH-1 protein. •Our data show distinctly different LRH-1 protein isoforms in ER− and ER+ breast cancer cells. •This is due to differences in LRH-1 mRNA and protein stability rates. -- Abstract: The expression of orphan nuclear receptor Liver Receptor Homolog-1 (LRH-1) is elevated in breast cancer and promotes proliferation, migration and invasion in vitro. LRH-1 expression is regulated by oestrogen (E{sub 2}), with LRH-1 mRNA transcript levels higher in oestrogen receptor α (ERα) positive (ER+) breast cancer cells compared to ER− cells. However, the presence of LRH-1 protein in ER− cells suggests discordance between mRNA transcript levels and protein expression. To understand this, we investigated the impact of mRNA and protein stability in determining LRH-1 protein levels in breast cancer cells. LRH-1 transcript levels were significantly higher in ER+ versus ER− breast cancer cells lines; however LRH-1 protein was expressed at similar levels. We found LRH-1 mRNA and protein was more stable in ER− compared to ER+ cell lines. The tumor-specific LRH-1 variant isoform, LRH-1v4, which is highly responsive to E{sub 2}, showed increased mRNA stability in ER− versus ER+ cells. In addition, in MCF-7 and T47-D cell lines, LRH-1 total mRNA stability was reduced with E{sub 2} treatment, this effect mediated by ERα. Our data demonstrates that in ER− cells, increased mRNA and protein stability contribute to the abundant protein expression levels. Expression and immunolocalisation of LRH-1 in ER− cells as well as ER− tumors suggests a possible role in the development of ER− tumors. The modulation of LRH-1 bioactivity may therefore be beneficial as a treatment option in both ER− and ER+ breast cancer.

  2. Rift Valley fever virus NSS gene expression correlates with a defect in nuclear mRNA export.

    Science.gov (United States)

    Copeland, Anna Maria; Van Deusen, Nicole M; Schmaljohn, Connie S

    2015-12-01

    We investigated the localization of host mRNA during Rift Valley fever virus (RVFV) infection. Fluorescence in situ hybridization revealed that infection with RVFV altered the localization of host mRNA. mRNA accumulated in the nuclei of RVFV-infected but not mock-infected cells. Further, overexpression of the NSS gene, but not the N, GN or NSM genes correlated with mRNA nuclear accumulation. Nuclear accumulation of host mRNA was not observed in cells infected with a strain of RVFV lacking the gene encoding NSS, confirming that expression of NSS is likely responsible for this phenomenon. Published by Elsevier Inc.

  3. The nematode homologue of Mediator complex subunit 28, F28F8.5, is a critical regulator of C. elegans development

    Directory of Open Access Journals (Sweden)

    Markéta Kostrouchová

    2017-06-01

    Full Text Available The evolutionarily conserved Mediator complex is a critical player in regulating transcription. Comprised of approximately two dozen proteins, the Mediator integrates diverse regulatory signals through direct protein-protein interactions that, in turn, modulate the influence of Mediator on RNA Polymerase II activity. One Mediator subunit, MED28, is known to interact with cytoplasmic structural proteins, providing a potential direct link between cytoplasmic dynamics and the control of gene transcription. Although identified in many animals and plants, MED28 is not present in yeast; no bona fide MED28 has been described previously in Caenorhabditis elegans. Here, we identify bioinformatically F28F8.5, an uncharacterized predicted protein, as the nematode homologue of MED28. As in other Metazoa, F28F8.5 has dual nuclear and cytoplasmic localization and plays critical roles in the regulation of development. F28F8.5 is a vital gene and its null mutants have severely malformed gonads and do not reproduce. F28F8.5 interacts on the protein level with the Mediator subunits MDT-6 and MDT-30. Our results indicate that F28F8.5 is an orthologue of MED28 and suggest that the potential to link cytoplasmic and nuclear events is conserved between MED28 vertebrate and nematode orthologues.

  4. An Epichloë festucae homologue of MOB3, a component of the STRIPAK complex, is required for the establishment of a mutualistic symbiotic interaction with Lolium perenne

    Science.gov (United States)

    Green, Kimberly A.; Becker, Yvonne; Fitzsimons, Helen L.

    2016-01-01

    Summary In both Sordaria macrospora and Neurospora crassa, components of the conserved STRIPAK (striatin‐interacting phosphatase and kinase) complex regulate cell–cell fusion, hyphal network development and fruiting body formation. Interestingly, a number of Epichloë festucae genes that are required for hyphal cell–cell fusion, such as noxA, noxR, proA, mpkA and mkkA, are also required for the establishment of a mutualistic symbiotic interaction with Lolium perenne. To determine whether MobC, a homologue of the STRIPAK complex component MOB3 in S. macrospora and N. crassa, is required for E. festucae hyphal fusion and symbiosis, a mobC deletion strain was generated. The ΔmobC mutant showed reduced rates of hyphal cell–cell fusion, formed intrahyphal hyphae and exhibited enhanced conidiation. Plants infected with ΔmobC were severely stunted. Hyphae of ΔmobC showed a proliferative pattern of growth within the leaves of Lolium perenne with increased colonization of the intercellular spaces and vascular bundles. Although hyphae were still able to form expressoria, structures allowing the colonization of the leaf surface, the frequency of formation was significantly reduced. Collectively, these results show that the STRIPAK component MobC is required for the establishment of a mutualistic symbiotic association between E. festucae and L. perenne, and plays an accessory role in the regulation of hyphal cell–cell fusion and expressorium development in E. festucae. PMID:27277141

  5. Induction of MAP Kinase Homologues during Growth and Morphogenetic Development of Karnal Bunt (Tilletia indica) under the Influence of Host Factor(s) from Wheat Spikes

    Science.gov (United States)

    Gupta, Atul K.; Seneviratne, J. M.; Joshi, G. K.; Kumar, Anil

    2012-01-01

    Signaling pathways that activate different mitogen-activated protein kinases (MAPKs) in response to certain environmental conditions, play important role in mating type switching (Fus3) and pathogenicity (Pmk1) in many fungi. In order to determine the roles of such regulatory genes in Tilletia indica, the causal pathogen of Karnal bunt (KB) of wheat, semi-quantitative and quantitative RT-PCR was carried out to isolate and determine the expression of MAP kinase homologues during fungal growth and development under in vitro culture. Maximum expression of TiFus3 and TiPmk1 genes were observed at 14th and 21st days of culture and decreased thereafter. To investigate whether the fungus alters the expression levels of same kinases upon interaction with plants, cultures were treated with 1% of host factors (extracted from S-2 stage of wheat spikes). Such treatment induced the expression of MAPks in time dependent manner compared to the absence of host factors. These results suggest that host factor(s) provide certain signal(s) which activate TiFus3 and TiPmk1 during morphogenetic development of T. indica. The results also provides a clue about the role of host factors in enhancing the disease potential due to induction of MAP kinases involved in fungal development and pathogenecity. PMID:22547988

  6. SLAH1, a homologue of the slow type anion channel SLAC1, modulates shoot Cl − accumulation and salt tolerance in Arabidopsis thaliana

    KAUST Repository

    Qiu, Jiaen; Henderson, Sam W; Tester, Mark A.; Roy, Stuart J; Gilliham, Mathew

    2016-01-01

    Salinity tolerance is correlated with shoot chloride (Cl–) exclusion in multiple crops, but the molecular mechanisms of long-distance Cl– transport are poorly defined. Here, we characterize the in planta role of AtSLAH1 (a homologue of the slow type anion channel-associated 1 (SLAC1)). This protein, localized to the plasma membrane of root stelar cells, has its expression reduced by salt or ABA, which are key predictions for a protein involved with loading Cl– into the root xylem. Artificial microRNA knockdown mutants of AtSLAH1 had significantly reduced shoot Cl− accumulation when grown under low Cl–, whereas shoot Cl– increased and the shoot nitrate/chloride ratio decreased following AtSLAH1 constitutive or stelar-specific overexpression when grown in high Cl–. In both sets of overexpression lines a significant reduction in shoot biomass over the null segregants was observed under high Cl– supply, but not low Cl– supply. Further in planta data showed AtSLAH3 overexpression increased the shoot nitrate/chloride ratio, consistent with AtSLAH3 favouring nitrate transport. Heterologous expression of AtSLAH1 in Xenopus laevis oocytes led to no detectible transport, suggesting the need for post-translational modifications for AtSLAH1 to be active. Our in planta data are consistent with AtSLAH1 having a role in controlling root-to-shoot Cl– transport.

  7. The nematode homologue of Mediator complex subunit 28, F28F8.5, is a critical regulator of C. elegans development.

    Science.gov (United States)

    Kostrouchová, Markéta; Kostrouch, David; Chughtai, Ahmed A; Kaššák, Filip; Novotný, Jan P; Kostrouchová, Veronika; Benda, Aleš; Krause, Michael W; Saudek, Vladimír; Kostrouchová, Marta; Kostrouch, Zdeněk

    2017-01-01

    The evolutionarily conserved Mediator complex is a critical player in regulating transcription. Comprised of approximately two dozen proteins, the Mediator integrates diverse regulatory signals through direct protein-protein interactions that, in turn, modulate the influence of Mediator on RNA Polymerase II activity. One Mediator subunit, MED28, is known to interact with cytoplasmic structural proteins, providing a potential direct link between cytoplasmic dynamics and the control of gene transcription. Although identified in many animals and plants, MED28 is not present in yeast; no bona fide MED28 has been described previously in Caenorhabditis elegans. Here, we identify bioinformatically F28F8.5, an uncharacterized predicted protein, as the nematode homologue of MED28. As in other Metazoa, F28F8.5 has dual nuclear and cytoplasmic localization and plays critical roles in the regulation of development. F28F8.5 is a vital gene and its null mutants have severely malformed gonads and do not reproduce. F28F8.5 interacts on the protein level with the Mediator subunits MDT-6 and MDT-30. Our results indicate that F28F8.5 is an orthologue of MED28 and suggest that the potential to link cytoplasmic and nuclear events is conserved between MED28 vertebrate and nematode orthologues.

  8. Drosophila homologue of Diaphanous 1 (DIAPH1) controls the metastatic potential of colon cancer cells by regulating microtubule-dependent adhesion.

    Science.gov (United States)

    Lin, Yuan-Na; Bhuwania, Ridhirama; Gromova, Kira; Failla, Antonio Virgilio; Lange, Tobias; Riecken, Kristoffer; Linder, Stefan; Kneussel, Matthias; Izbicki, Jakob R; Windhorst, Sabine

    2015-07-30

    Drosophila homologue of Diaphanous 1 (DIAPH1) regulates actin polymerization and microtubule (MT) stabilization upon stimulation with lysophosphatidic acid (LPA). Recently, we showed strongly reduced lung metastasis of DIAPH1-depleted colon cancer cells but we found accumulations of DIAPH1-depleted cells in bone marrow. Here, we analyzed possible organ- or tissue-specific metastasis of DIAPH1-depleted HCT-116 cells. Our data confirmed that depletion of DIAPH1 strongly inhibited lung metastasis and revealed that, in contrast to control cells, DIAPH1-depleted cells did not form metastases in further organs. Detailed mechanistic analysis on cells that were not stimulated with LPA to activate the cytoskeleton-modulating activity of DIAPH1, revealed that even under basal conditions DIAPH1 was essential for cellular adhesion to collagen. In non-stimulated cells DIAPH1 did not control actin dynamics but, interestingly, was essential for stabilization of microtubules (MTs). Additionally, DIAPH1 controlled directed vesicle trafficking and with this, local clustering of the adhesion protein integrin-β1 at the plasma membrane. Therefore, we conclude that under non-stimulating conditions DIAPH1 controls cellular adhesion by stabilizing MTs required for local clustering of integrin-β1 at the plasma membrane. Thus, blockade of DIAPH1-tubulin interaction may be a promising approach to inhibit one of the earliest steps in the metastatic cascade of colon cancer.

  9. Analysis of dofA, a fruA-dependent developmental gene, and its homologue, dofB, in Myxococcus xanthus.

    Science.gov (United States)

    Horiuchi, Takayuki; Akiyama, Takuya; Inouye, Sumiko; Komano, Teruya

    2002-12-01

    The developmentally regulated gene dofA, identified from pulse-labeling experiments by two-dimensional gel electrophoresis, and its homologue, dofB, were cloned and characterized in Myxococcus xanthus. Deletion of dofA and dofB did not affect the vegetative growth and development of M. xanthus. dofA was specifically expressed during development, while dofB expression was observed during vegetative growth and development. The dofA-lacZ fusion was introduced into a fruA mutant and A, B, C, D, and E extracellular signal mutants. The pattern of dofA expression in the C signal mutant was similar to that of the wild-type strain, while dofA expression was not detected in the fruA mutant. These results are consistent with those of the pulse-labeling experiments. dofA expression was reduced in A and E signal mutants, whereas dofA expression was delayed in B and D signal mutants. The patterns of expression of the dofA gene in the fruA mutant and the five signal mutants are strikingly similar to that of the tps gene, which encodes protein S, a major component of the outer surface of the myxospore; this result suggests that the dofA and tps genes are similarly regulated. The involvement of a highly GC-rich inverted repeat sequence (underlined), CGGCCCCCGATTCGTCGGGGGCCG, in developmentally regulated dofA expression is suggested.

  10. SLAH1, a homologue of the slow type anion channel SLAC1, modulates shoot Cl − accumulation and salt tolerance in Arabidopsis thaliana

    KAUST Repository

    Qiu, Jiaen

    2016-06-23

    Salinity tolerance is correlated with shoot chloride (Cl–) exclusion in multiple crops, but the molecular mechanisms of long-distance Cl– transport are poorly defined. Here, we characterize the in planta role of AtSLAH1 (a homologue of the slow type anion channel-associated 1 (SLAC1)). This protein, localized to the plasma membrane of root stelar cells, has its expression reduced by salt or ABA, which are key predictions for a protein involved with loading Cl– into the root xylem. Artificial microRNA knockdown mutants of AtSLAH1 had significantly reduced shoot Cl− accumulation when grown under low Cl–, whereas shoot Cl– increased and the shoot nitrate/chloride ratio decreased following AtSLAH1 constitutive or stelar-specific overexpression when grown in high Cl–. In both sets of overexpression lines a significant reduction in shoot biomass over the null segregants was observed under high Cl– supply, but not low Cl– supply. Further in planta data showed AtSLAH3 overexpression increased the shoot nitrate/chloride ratio, consistent with AtSLAH3 favouring nitrate transport. Heterologous expression of AtSLAH1 in Xenopus laevis oocytes led to no detectible transport, suggesting the need for post-translational modifications for AtSLAH1 to be active. Our in planta data are consistent with AtSLAH1 having a role in controlling root-to-shoot Cl– transport.

  11. Identification of the Mycobacterium marinum Apa antigen O-mannosylation sites reveals important glycosylation variability with the M. tuberculosis Apa homologue.

    Science.gov (United States)

    Coddeville, Bernadette; Wu, Sz-Wei; Fabre, Emeline; Brassart, Colette; Rombouts, Yoann; Burguière, Adeline; Kremer, Laurent; Khoo, Kay-Hooi; Elass-Rochard, Elisabeth; Guérardel, Yann

    2012-10-22

    The 45/47 kDa Apa, an immuno-dominant antigen secreted by Mycobacterium tuberculosis is O-mannosylated at multiple sites. Glycosylation of Apa plays a key role in colonization and invasion of the host cells by M. tuberculosis through interactions of Apa with the host immune system C-type lectins. Mycobacterium marinum (M.ma) a fish pathogen, phylogenetically close to M. tuberculosis, induces a granulomatous response with features similar to those described for M. tuberculosis in human. Although M.ma possesses an Apa homologue, its glycosylation status is unknown, and whether this represents a crucial element in the pathophysiology induced by M.ma remains to be addressed. To this aim, we have identified two concanavalin A-reactive 45/47 kDa proteins from M.ma, which have been further purified by a two-step anion exchange chromatography process. Advanced liquid chromatography-nanoESI mass spectrometry-based proteomic analyses of peptides, derived from either tryptic digestion alone or in combination with the Asp-N endoproteinase, established that M.ma Apa possesses up to seven distinct O-mannosylated sites with mainly single mannose substitutions, which can be further extended at the Ser/Thr/Pro rich region near the N-terminus. This opens the way to further studies focussing on the involvement and biological functions of Apa O-mannosylation using the M.ma/zebrafish model. Copyright © 2012 Elsevier B.V. All rights reserved.

  12. Co-precipitation of phosphate and iron limits mitochondrial phosphate availability in Saccharomyces cerevisiae lacking the yeast frataxin homologue (YFH1).

    Science.gov (United States)

    Seguin, Alexandra; Santos, Renata; Pain, Debkumar; Dancis, Andrew; Camadro, Jean-Michel; Lesuisse, Emmanuel

    2011-02-25

    Saccharomyces cerevisiae cells lacking the yeast frataxin homologue (Δyfh1) accumulate iron in the mitochondria in the form of nanoparticles of ferric phosphate. The phosphate content of Δyfh1 mitochondria was higher than that of wild-type mitochondria, but the proportion of mitochondrial phosphate that was soluble was much lower in Δyfh1 cells. The rates of phosphate and iron uptake in vitro by isolated mitochondria were higher for Δyfh1 than wild-type mitochondria, and a significant proportion of the phosphate and iron rapidly became insoluble in the mitochondrial matrix, suggesting co-precipitation of these species after oxidation of iron by oxygen. Increasing the amount of phosphate in the medium decreased the amount of iron accumulated by Δyfh1 cells and improved their growth in an iron-dependent manner, and this effect was mostly transcriptional. Overexpressing the major mitochondrial phosphate carrier, MIR1, slightly increased the concentration of soluble mitochondrial phosphate and significantly improved various mitochondrial functions (cytochromes, [Fe-S] clusters, and respiration) in Δyfh1 cells. We conclude that in Δyfh1 cells, soluble phosphate is limiting, due to its co-precipitation with iron.

  13. Prion protein expression regulates embryonic stem cell pluripotency and differentiation.

    Directory of Open Access Journals (Sweden)

    Alberto Miranda

    2011-04-01

    Full Text Available Cellular prion protein (PRNP is a glycoprotein involved in the pathogenesis of transmissible spongiform encephalopathies (TSEs. Although the physiological function of PRNP is largely unknown, its key role in prion infection has been extensively documented. This study examines the functionality of PRNP during the course of embryoid body (EB differentiation in mouse Prnp-null (KO and WT embryonic stem cell (ESC lines. The first feature observed was a new population of EBs that only appeared in the KO line after 5 days of differentiation. These EBs were characterized by their expression of several primordial germ cell (PGC markers until Day 13. In a comparative mRNA expression analysis of genes playing an important developmental role during ESC differentiation to EBs, Prnp was found to participate in the transcription of a key pluripotency marker such as Nanog. A clear switching off of this gene on Day 5 was observed in the KO line as opposed to the WT line, in which maximum Prnp and Nanog mRNA levels appeared at this time. Using a specific antibody against PRNP to block PRNP pathways, reduced Nanog expression was confirmed in the WT line. In addition, antibody-mediated inhibition of ITGB5 (integrin αvβ5 in the KO line rescued the low expression of Nanog on Day 5, suggesting the regulation of Nanog transcription by Prnp via this Itgb5. mRNA expression analysis of the PRNP-related proteins PRND (Doppel and SPRN (Shadoo, whose PRNP function is known to be redundant, revealed their incapacity to compensate for the absence of PRNP during early ESC differentiation. Our findings provide strong evidence for a relationship between Prnp and several key pluripotency genes and attribute Prnp a crucial role in regulating self-renewal/differentiation status of ESC, confirming the participation of PRNP during early embryogenesis.

  14. Establishing in vitro Zinnia elegans cell suspension culture with high tracheary elements differentiation

    NARCIS (Netherlands)

    Twumasi, P.; Schel, J.H.N.; Ieperen, van W.; Woltering, E.J.; Emons, A.M.C.

    2009-01-01

    The Zinnia elegans mesophyll cell culture is a useful system for xylogenesis studies. The system is associated with highly synchronous tracheary element (TE) differentiation, making it more suitable for molecular studies requiring larger amounts of molecular isolates, such as mRNA and proteins and

  15. UCP2 mRNA expression is dependent on glucose metabolism in pancreatic islets

    International Nuclear Information System (INIS)

    Dalgaard, Louise T.

    2012-01-01

    Highlights: ► UCP2 mRNA levels are decreased in islets of Langerhans from glucokinase deficient mice. ► UCP2 mRNA up-regulation by glucose is dependent on glucokinase. ► Absence of UCP2 increases GSIS of glucokinase heterozygous pancreatic islets. ► This may protect glucokinase deficient mice from hyperglycemic damages. -- Abstract: Uncoupling Protein 2 (UCP2) is expressed in the pancreatic β-cell, where it partially uncouples the mitochondrial proton gradient, decreasing both ATP-production and glucose-stimulated insulin secretion (GSIS). Increased glucose levels up-regulate UCP2 mRNA and protein levels, but the mechanism for UCP2 up-regulation in response to increased glucose is unknown. The aim was to examine the effects of glucokinase (GK) deficiency on UCP2 mRNA levels and to characterize the interaction between UCP2 and GK with regard to glucose-stimulated insulin secretion in pancreatic islets. UCP2 mRNA expression was reduced in GK+/− islets and GK heterozygosity prevented glucose-induced up-regulation of islet UCP2 mRNA. In contrast to UCP2 protein function UCP2 mRNA regulation was not dependent on superoxide generation, but rather on products of glucose metabolism, because MnTBAP, a superoxide dismutase mimetic, did not prevent the glucose-induced up-regulation of UCP2. Glucose-stimulated insulin secretion was increased in UCP2−/− and GK+/− islets compared with GK+/− islets and UCP2 deficiency improved glucose tolerance of GK+/− mice. Accordingly, UCP2 deficiency increased ATP-levels of GK+/− mice. Thus, the compensatory down-regulation of UCP2 is involved in preserving the insulin secretory capacity of GK mutant mice and might also be implicated in limiting disease progression in MODY2 patients.

  16. Protein functional features are reflected in the patterns of mRNA translation speed.

    Science.gov (United States)

    López, Daniel; Pazos, Florencio

    2015-07-09

    The degeneracy of the genetic code makes it possible for the same amino acid string to be coded by different messenger RNA (mRNA) sequences. These "synonymous mRNAs" may differ largely in a number of aspects related to their overall translational efficiency, such as secondary structure content and availability of the encoded transfer RNAs (tRNAs). Consequently, they may render different yields of the translated polypeptides. These mRNA features related to translation efficiency are also playing a role locally, resulting in a non-uniform translation speed along the mRNA, which has been previously related to some protein structural features and also used to explain some dramatic effects of "silent" single-nucleotide-polymorphisms (SNPs). In this work we perform the first large scale analysis of the relationship between three experimental proxies of mRNA local translation efficiency and the local features of the corresponding encoded proteins. We found that a number of protein functional and structural features are reflected in the patterns of ribosome occupancy, secondary structure and tRNA availability along the mRNA. One or more of these proxies of translation speed have distinctive patterns around the mRNA regions coding for certain protein local features. In some cases the three patterns follow a similar trend. We also show specific examples where these patterns of translation speed point to the protein's important structural and functional features. This support the idea that the genome not only codes the protein functional features as sequences of amino acids, but also as subtle patterns of mRNA properties which, probably through local effects on the translation speed, have some consequence on the final polypeptide. These results open the possibility of predicting a protein's functional regions based on a single genomic sequence, and have implications for heterologous protein expression and fine-tuning protein function.

  17. ZMS regulation of M2 muscarinic receptor mRNA stability requires protein factor

    International Nuclear Information System (INIS)

    Zhang Yongfang; Xia Zongqin; Hu Ya'er

    2010-01-01

    Aim The aim of this work is to study the elevation mechanism of ZMS on muscarinic M2 receptor mRNA expression. Methods Actinomycin D was added to cultured CHOm2 cells to stop the de novo synthesis of M2 receptor mRNA and samples were taken at various times to determine the time course of mRNA of M2 receptor with real-time quantitative RT-PCR. Half-life of M2 receptor mRNA and the effect of ZMS on the half-life was obtained from the slope of the exponential curves. Cycloheximide was added at 4 h prior to and 24 h after the addition of ZMS to examine the effect of de novo protein synthesis on the action of ZMS. Results The half-life of m2 mRNA was prolonged by ZMS treatment without cycloheximide (4.75±0.54 h and 2.13 h±0.23 h for ZMS and vehicle treated groups, respectively, P<0.05). When cycloheximide was added to the culture medium 4h prior to the addition of ZMS, the effect of ZMS in prolonging the half-life of m2 mRNA disappeared (3.06 h±0.23 h and 3.00 h±l.20 h for cells with and without ZMS, respectively). However, when the ZMS was added to the medium 24h prior to the addition of cycloheximide, the action of ZMS was not abolished by cycloheximide (half-life was 5.43 h±1.13 h and 2.46 h±0.09 h for cells with and without ZMS, respectively). Conclusion These data suggest that de novo protein synthesis was required for the increase in M2 mRNA stability induced by ZMS. (authors)

  18. The ribosome structure controls and directs mRNA entry, translocation and exit dynamics

    International Nuclear Information System (INIS)

    Kurkcuoglu, Ozge; Doruker, Pemra; Jernigan, Robert L; Sen, Taner Z; Kloczkowski, Andrzej

    2008-01-01

    The protein-synthesizing ribosome undergoes large motions to effect the translocation of tRNAs and mRNA; here, the domain motions of this system are explored with a coarse-grained elastic network model using normal mode analysis. Crystal structures are used to construct various model systems of the 70S complex with/without tRNA, elongation factor Tu and the ribosomal proteins. Computed motions reveal the well-known ratchet-like rotational motion of the large subunits, as well as the head rotation of the small subunit and the high flexibility of the L1 and L7/L12 stalks, even in the absence of ribosomal proteins. This result indicates that these experimentally observed motions during translocation are inherently controlled by the ribosomal shape and only partially dependent upon GTP hydrolysis. Normal mode analysis further reveals the mobility of A- and P-tRNAs to increase in the absence of the E-tRNA. In addition, the dynamics of the E-tRNA is affected by the absence of the ribosomal protein L1. The mRNA in the entrance tunnel interacts directly with helicase proteins S3 and S4, which constrain the mRNA in a clamp-like fashion, as well as with protein S5, which likely orients the mRNA to ensure correct translation. The ribosomal proteins S7, S11 and S18 may also be involved in assuring translation fidelity by constraining the mRNA at the exit site of the channel. The mRNA also interacts with the 16S 3' end forming the Shine–Dalgarno complex at the initiation step; the 3' end may act as a 'hook' to reel in the mRNA to facilitate its exit

  19. Expression and clinicopathological significance of Mel-18 and Bmi-1 mRNA in gastric carcinoma.

    Science.gov (United States)

    Lu, You-Wei; Li, Jin; Guo, Wei-Jian

    2010-11-08

    The Polycomb group (PcG) genes are a class of regulators responsible for maintaining homeotic gene expression throughout cell division. PcG expression is deregulated in some types of human cancer. Both Bmi-1 and Mel-18 are of the key PcG proteins. We investigate the expression and clinicopathological roles of Mel-18 and Bmi-1 mRNA in gastric cancer. The expression of Mel-18 and Bmi-1 in a series of 71 gastric cancer tissues and paired normal mucosal tissues distant from the tumorous lesion was assayed by quantitative real time RT-PCR. The correlation between Mel-18 and Bmi-1 mRNA expression, and between Mel-18 or Bmi-1 mRNA level and clinicopathological characteristics were analyzed. Expression of Mel-18 and Bmi-1 genes was variably detected, but overexpression of Bmi-1 mRNA and decreased expression of Mel-18 mRNA were the most frequent alteration. In addition, the expression of Bmi-1 and Mel-18 mRNA inversely correlates in gastric tumors. Moreover, a significant positive correlation between Bmi-1 overexpression and tumor size, depth of invasion, or lymph node metastasis, and a significant negative correlation between Mel-18 low-expression with lymph node metastasis or the clinical stage were observed. Our data suggest that Mel-18 and Bmi-1 may play crucial but opposite roles in gastric cancer. Decreased Mel-18 and increased Bmi-1 mRNA expression was associated with the carcinogenesis and progression of gastric cancer. It is possible to list Bmi-1 and Mel-18 as biomarkers for predicting the prognosis of gastric cancer.

  20. Association of chemerin mRNA expression in human epicardial adipose tissue with coronary atherosclerosis

    Directory of Open Access Journals (Sweden)

    Wang Linjie

    2011-10-01

    Full Text Available Abstract Background Growing evidence suggests that epicardial adipose tissue (EAT may play a key role in the pathogenesis and development of coronary artery disease (CAD by producing several inflammatory adipokines. Chemerin, a novel adipokine, has been reported to be involved in regulating immune responses and glucolipid metabolism. Given these properties, chemerin may provide an interesting link between obesity, inflammation and atherosclerosis. In this study, we sought to determine the relationship of chemerin expression in EAT and the severity of coronary atherosclerosis in Han Chinese patients. Methods Serums and adipose tissue biopsies (epicardial and thoracic subcutaneous were obtained from CAD (n = 37 and NCAD (n = 16 patients undergoing elective cardiac surgery. Gensini score was used to assess the severity of CAD. Serum levels of chemerin, adiponectin and insulin were measured by ELISA. Chemerin protein expression in adipose tissue was detected by immunohistochemistry. The mRNA levels of chemerin, chemR23, adiponectin and TNF-alpha in adipose tissue were detected by RT-PCR. Results We found that EAT of CAD group showed significantly higher levels of chemerin and TNF-alpha mRNA, and significantly lower level of adiponectin mRNA than that of NCAD patients. In CAD group, significantly higher levels of chemerin mRNA and protein were observed in EAT than in paired subcutaneous adipose tissue (SAT, whereas such significant difference was not found in NCAD group. Chemerin mRNA expression in EAT was positively correlated with Gensini score (r = 0.365, P P P P P P P > 0.05. Conclusions The expressions of chemerin mRNA and protein are significantly higher in EAT from patients with CAD in Han Chinese patients. Furthermore, the severity of coronary atherosclerosis is positive correlated with the level of chemerin mRNA in EAT rather than its circulating level.

  1. Consequences of metaphase II oocyte cryopreservation on mRNA content.

    Science.gov (United States)

    Chamayou, S; Bonaventura, G; Alecci, C; Tibullo, D; Di Raimondo, F; Guglielmino, A; Barcellona, M L

    2011-04-01

    We studied the consequences of freezing/thawing processes on mRNA contents in MII oocytes after slow-freezing/rapid thawing (SF/RT) and vitrification/warming (V/W) protocols, and compared the results to fresh MII oocytes. We quantified the nuclear transcript mRNA responsible for the translation of proteins belonging either to trans-regulatory protein family or to functional structural proteins such as proteins involved in DNA structural organization (NAP1L1, TOP1, H1F0H1), chromosomal structure maintenance (SMC, SCC3, RAD21, SMC1A, SMC1B, STAG3, REC8), mitochondrial energetic pathways (ATP5GJ, SDHC), cell cycle regulation and processes (CLTA, MAPK6, CKS2) and staminal cell potency-development competence stage (DPPA3, OCT4, FOXJ2). Surplus MII oocytes were donated from patients in IVF cycles and divided in three groups of 15 oocytes. Group 1 was comprised of non-cryopreserved oocytes and Groups 2 and 3 underwent SF/RT and V/W procedures, respectively. There was an overall decrease of mRNA extracted from cryopreserved oocytes compared to control group. Only 39.4% of mRNA content were preserved after SF/RT while 63.3% of mRNA content were maintained after V/W. Oocyte cryopreservation is associated with molecular injury associated with the decrease of stored mRNA. However the V/W protocol is more conservative than SF/RT resulting in a level of mRNA sufficient to maintain biologic functions in the subsequent fertilized oocyte. Copyright © 2011 Elsevier Inc. All rights reserved.

  2. Hemoglobin mRNA Changes in the Frontal Cortex of Patients with Neurodegenerative Diseases

    Directory of Open Access Journals (Sweden)

    Silvia Vanni

    2018-01-01

    Full Text Available Background: Hemoglobin is the major protein found in erythrocytes, where it acts as an oxygen carrier molecule. In recent years, its expression has been reported also in neurons and glial cells, although its role in brain tissue remains still unknown. Altered hemoglobin expression has been associated with various neurodegenerative disorders. Here, we investigated hemoglobin mRNA levels in brains of patients affected by variant, iatrogenic, and sporadic forms of Creutzfeldt-Jakob disease (vCJD, iCJD, sCJD, respectively and in different genetic forms of prion diseases (gPrD in comparison to Alzheimer's disease (AD subjects and age-matched controls.Methods: Total RNA was obtained from the frontal cortex of vCJD (n = 20, iCJD (n = 11, sCJD (n = 23, gPrD (n = 30, and AD (n = 14 patients and age-matched controls (n = 30. RT-qPCR was performed for hemoglobin transcripts HBB and HBA1/2 using four reference genes for normalization. In addition, expression analysis of the specific erythrocyte marker ALAS2 was performed in order to account for blood contamination of the tissue samples. Hba1/2 and Hbb protein expression was then investigated with immunofluorescence and confocal microscope analysis.Results: We observed a significant up-regulation of HBA1/2 in vCJD brains together with a significant down-regulation of HBB in iCJD. In addition, while in sporadic and genetic forms of prion disease hemoglobin transcripts did not shown any alterations, both chains display a strong down-regulation in AD brains. These results were confirmed also at a protein level.Conclusions: These data indicate distinct hemoglobin transcriptional responses depending on the specific alterations occurring in different neurodegenerative diseases. In particular, the initial site of misfolding event (central nervous system vs. peripheral tissue—together with specific molecular and conformational features of the pathological agent of the disease—seem to dictate the peculiar

  3. mRNA Transcriptomics of Galectins Unveils Heterogeneous Organization in Mouse and Human Brain

    Directory of Open Access Journals (Sweden)

    Sebastian John

    2016-12-01

    preserved across both these species, however, galectin-9 showed maximal preservation only in the cerebral cortex.Conclusions: It is for the first time that a comprehensive description of galectins’ mRNA expression profile in brain is presented. Results suggests that spatial transcriptome changes in galectins may contribute to differential brain functions and evolution across species that highlights galectins as novel signatures of brain heterogeneity and functions, which if disturbed, can promote several brain disorders.

  4. Hemoglobin mRNA Changes in the Frontal Cortex of Patients with Neurodegenerative Diseases.

    Science.gov (United States)

    Vanni, Silvia; Zattoni, Marco; Moda, Fabio; Giaccone, Giorgio; Tagliavini, Fabrizio; Haïk, Stéphane; Deslys, Jean-Philippe; Zanusso, Gianluigi; Ironside, James W; Carmona, Margarita; Ferrer, Isidre; Kovacs, Gabor G; Legname, Giuseppe

    2018-01-01

    Background: Hemoglobin is the major protein found in erythrocytes, where it acts as an oxygen carrier molecule. In recent years, its expression has been reported also in neurons and glial cells, although its role in brain tissue remains still unknown. Altered hemoglobin expression has been associated with various neurodegenerative disorders. Here, we investigated hemoglobin mRNA levels in brains of patients affected by variant, iatrogenic, and sporadic forms of Creutzfeldt-Jakob disease (vCJD, iCJD, sCJD, respectively) and in different genetic forms of prion diseases (gPrD) in comparison to Alzheimer's disease (AD) subjects and age-matched controls. Methods: Total RNA was obtained from the frontal cortex of vCJD ( n = 20), iCJD ( n = 11), sCJD ( n = 23), gPrD ( n = 30), and AD ( n = 14) patients and age-matched controls ( n = 30). RT-qPCR was performed for hemoglobin transcripts HBB and HBA1/2 using four reference genes for normalization. In addition, expression analysis of the specific erythrocyte marker ALAS2 was performed in order to account for blood contamination of the tissue samples. Hba1/2 and Hbb protein expression was then investigated with immunofluorescence and confocal microscope analysis. Results: We observed a significant up-regulation of HBA1/2 in vCJD brains together with a significant down-regulation of HBB in iCJD. In addition, while in sporadic and genetic forms of prion disease hemoglobin transcripts did not shown any alterations, both chains display a strong down-regulation in AD brains. These results were confirmed also at a protein level. Conclusions: These data indicate distinct hemoglobin transcriptional responses depending on the specific alterations occurring in different neurodegenerative diseases. In particular, the initial site of misfolding event (central nervous system vs. peripheral tissue)-together with specific molecular and conformational features of the pathological agent of the disease-seem to dictate the peculiar hemoglobin

  5. Symposium on Differential Geometry and Differential Equations

    CERN Document Server

    Berger, Marcel; Bryant, Robert

    1987-01-01

    The DD6 Symposium was, like its predecessors DD1 to DD5 both a research symposium and a summer seminar and concentrated on differential geometry. This volume contains a selection of the invited papers and some additional contributions. They cover recent advances and principal trends in current research in differential geometry.

  6. The TFIID components human TAF(II)140 and Drosophila BIP2 (TAF(II)155) are novel metazoan homologues of yeast TAF(II)47 containing a histone fold and a PHD finger.

    Science.gov (United States)

    Gangloff, Y G; Pointud, J C; Thuault, S; Carré, L; Romier, C; Muratoglu, S; Brand, M; Tora, L; Couderc, J L; Davidson, I

    2001-08-01

    The RNA polymerase II transcription factor TFIID comprises the TATA binding protein (TBP) and a set of TBP-associated factors (TAF(II)s). TFIID has been extensively characterized for yeast, Drosophila, and humans, demonstrating a high degree of conservation of both the amino acid sequences of the constituent TAF(II)s and overall molecular organization. In recent years, it has been assumed that all the metazoan TAF(II)s have been identified, yet no metazoan homologues of yeast TAF(II)47 (yTAF(II)47) and yTAF(II)65 are known. Both of these yTAF(II)s contain a histone fold domain (HFD) which selectively heterodimerizes with that of yTAF(II)25. We have cloned a novel mouse protein, TAF(II)140, containing an HFD and a plant homeodomain (PHD) finger, which we demonstrated by immunoprecipitation to be a mammalian TFIID component. TAF(II)140 shows extensive sequence similarity to Drosophila BIP2 (dBIP2) (dTAF(II)155), which we also show to be a component of Drosophila TFIID. These proteins are metazoan homologues of yTAF(II)47 as their HFDs selectively heterodimerize with dTAF(II)24 and human TAF(II)30, metazoan homologues of yTAF(II)25. We further show that yTAF(II)65 shares two domains with the Drosophila Prodos protein, a recently described potential dTAF(II). These conserved domains are critical for yTAF(II)65 function in vivo. Our results therefore identify metazoan homologues of yTAF(II)47 and yTAF(II)65.

  7. Single-Crystal X-Ray Diffraction Studies of Homologues in the Series nBa(Nb,Zr)O 3+3 mNbO with n=2, 3, 4, 5 and m=1

    Science.gov (United States)

    Nilsson, G.; Svensson, G.

    2001-01-01

    Single crystals of four homologues in the series nBa(Nb,Zr)O3+3mNbO, with n:m=2:1, 3:1, 4:1, and 5:1, were found in the reduced Ba-Nb-Zr-O system. Single-crystal X-ray diffraction data were collected for all the crystals. For all homologues the space group was found to be P4/mmm. The structures can be described as intergrowths of Ba(Nb,Zr)O3 perovskite and NbO slabs. The refined cell parameters and compositions of the 2:1, 3:1, and 4:1 homologues are a=4.1768(5) Å and c=12.269(2) Å for Ba2Nb4.5(1)Zr0.5(1)O9, a=4.1769(5) Å and c=16.493(3) Å for Ba3+δNb4.8(2)-δ Zr1.2(2)O12-δ (δ=0.098(4)), and a=4.1747(6) Å and c= 20.619(4) Å for Ba4+δNb5.1(4)-δZr1.9(4)O15-δ (δ=0.270(9)). The refined cell parameters of the 5:1 homologue are a=4.1727(3) Å and c=24.804(3) Å. Zr replaces Nb only in the NbO6 octahedra found in the perovskite slabs.

  8. Short-chain chlorinated paraffins in soil, paddy seeds (Oryza sativa) and snails (Ampullariidae) in an e-waste dismantling area in China: Homologue group pattern, spatial distribution and risk assessment.

    Science.gov (United States)

    Yuan, Bo; Fu, Jianjie; Wang, Yawei; Jiang, Guibin

    2017-01-01

    Short-chain chlorinated paraffins (SCCPs) in multi-environmental matrices are studied in Taizhou, Zhejiang Province, China, which is a notorious e-waste dismantling area. The investigated matrices consist of paddy field soil, paddy seeds (Oryza sativa, separated into hulls and rice unpolished) and apple snails (Ampullariidae, inhabiting the paddy fields). The sampling area covered a 65-km radius around the contamination center. C 10 and C 11 are the two predominant homologue groups in the area, accounting for about 35.7% and 33.0% of total SCCPs, respectively. SCCPs in snails and hulls are generally higher than in soil samples (30.4-530 ng/g dw), and SCCPs in hulls are approximate five times higher than in corresponding rice samples (4.90-55.1 ng/g dw). Homologue pattern analysis indicates that paddy seeds (both hull and rice) tend to accumulate relatively high volatile SCCP homologues, especially the ones with shorter carbon chain length, while snails tend to accumulate relatively high lipophilic homologues, especially the ones with more substituted chlorines. SCCPs in both paddy seeds and snails are linearly related to those in the soil. The e-waste dismantling area, which covers a radius of approximate 20 km, shows higher pollution levels for SCCPs according to their spatial distribution in four matrices. The preliminary assessment indicates that SCCP levels in local soils pose no significant ecological risk for soil dwelling organisms, but higher risks from dietary exposure of SCCPs are suspected for people living in e-waste dismantling area. Copyright © 2016 Elsevier Ltd. All rights reserved.

  9. Two mannose-binding lectin homologues and an MBL-associated serine protease are expressed in the gut epithelia of the urochordate species Ciona intestinalis

    DEFF Research Database (Denmark)

    Skjødt, Mikkel-Ole; Palarasah, Yaseelan; Rasmussen, Karina Juhl

    2010-01-01

    The lectin complement pathway has important functions in vertebrate host defence and accumulating evidence of primordial complement components trace its emergence to invertebrate phyla. We introduce two putative mannose-binding lectin homologues (CioMBLs) from the urochordate species Ciona intest...... protease in the epithelia cells lining the stomach and intestine. In conclusion we present two urochordate MBLs and identify an associated serine protease, which support the concept of an evolutionary ancient origin of the lectin complement pathway....

  10. Automatic differentiation bibliography

    Energy Technology Data Exchange (ETDEWEB)

    Corliss, G.F. [comp.

    1992-07-01

    This is a bibliography of work related to automatic differentiation. Automatic differentiation is a technique for the fast, accurate propagation of derivative values using the chain rule. It is neither symbolic nor numeric. Automatic differentiation is a fundamental tool for scientific computation, with applications in optimization, nonlinear equations, nonlinear least squares approximation, stiff ordinary differential equation, partial differential equations, continuation methods, and sensitivity analysis. This report is an updated version of the bibliography which originally appeared in Automatic Differentiation of Algorithms: Theory, Implementation, and Application.

  11. Unique variability of tocopherol composition in various seed oils recovered from by-products of apple industry: rapid and simple determination of all four homologues (α, β, γ and δ) by RP-HPLC/FLD.

    Science.gov (United States)

    Górnaś, Paweł

    2015-04-01

    The tocochromanol profile was studied in seed oils recovered from by-products of fruit industry, five dessert and seven crab apple varieties grown in Eastern Europe (Latvia). The seed oils obtained from dessert apples were characterized by higher contents of tocopherols (191.05-379.08 mg/100g oil) when compared to seed oils recovered from crab apples (130.55-202.54 mg/100g oil). The predominant homologues of tocopherol in all the studied samples were α and β over γ and δ. However, seed oils recovered from the apple cultivars 'Antej' and 'Beforest' had a unique profile of four tocopherol homologues (α:β:γ:δ) 91.41:80.55:72.46:79.03 and 114.55:112.84:78.69:73.00 mg/100g oil, respectively. A single dilution of seed oils in 2-propanol facilitated the direct use samples in the DPPH assay as well as injection into the RP-HPLC system containing a PFP (pentafluorophenyl) column, which resulted in a rapid separation of all four tocopherol homologues with excellent repeatability and reproducibility. Copyright © 2014 Elsevier Ltd. All rights reserved.

  12. Characterization of the ptr5+ gene involved in nuclear mRNA export in fission yeast

    International Nuclear Information System (INIS)

    Watanabe, Nobuyoshi; Ikeda, Terumasa; Mizuki, Fumitaka; Tani, Tokio

    2012-01-01

    Highlights: ► We cloned the ptr5 + gene involved in nuclear mRNA export in fission yeast. ► The ptr5 + gene was found to encode nucleoporin 85 (Nup85). ► Seh1p and Mlo3p are multi-copy suppressors for the ptr5 mutation. ► Ptr5p/Nup85p functions in nuclear mRNA export through the mRNA export factor Rae1p. ► Ptr5p/Nup85p interacts genetically with pre-mRNA splicing factors. -- Abstract: To analyze the mechanisms of mRNA export from the nucleus to the cytoplasm, we have isolated eleven mutants, ptr [poly(A) + RNA transport] 1 to 11, which accumulate poly(A) + RNA in the nucleus at a nonpermissive temperature in Schizosaccharomyces pombe. Of those, the ptr5–1 mutant shows dots- or a ring-like accumulation of poly(A) + RNA at the nuclear periphery after shifting to the nonpermissive temperature. We cloned the ptr5 + gene and found that it encodes a component of the nuclear pore complex (NPC), nucleoporin 85 (Nup85). The ptr5–1 mutant shows no defects in protein transport, suggesting the specific involvement of Ptr5p/Nup85p in nuclear mRNA export in S. pombe. We identified Seh1p, a nucleoporin interacting with Nup85p, an mRNA-binding protein Mlo3p, and Sac3p, a component of the TREX-2 complex involved in coupling of nuclear mRNA export with transcription, as multi-copy suppressors for the ptr5–1 mutation. In addition, we found that the ptr5–1 mutation is synthetically lethal with a mutation of the mRNA export factor Rae1p, and that the double mutant exaggerates defective nuclear mRNA export, suggesting that Ptr5p/Nup85p is involved in nuclear mRNA export through Rae1p. Interestingly, the ptr5–1 mutation also showed synthetic effects with several prp pre-mRNA splicing mutations, suggesting a functional linkage between the NPCs and the splicing apparatus in the yeast nucleus.

  13. Extracellular tumor-related mRNA in plasma of lymphoma patients and survival implications.

    Directory of Open Access Journals (Sweden)

    Vanesa Garcia

    Full Text Available BACKGROUND: We studied anomalous extracellular mRNAs in plasma from patients with diffuse large B-cell lymphoma (DLBCL and their survival implications. mRNAs studied have been reported in the literature as markers of poor (BCL2, CCND2, MYC and favorable outcome (LMO2, BCL6, FN1 in tumors. These markers were also analyzed in lymphoma tissues to test possible associations with their presence in plasma. METHODOLOGY/PRINCIPAL FINDINGS: mRNA from 42 plasma samples and 12 tumors from patients with DLBCL was analyzed by real-time PCR. Samples post-treatment were studied. The immunohistochemistry of BCL2 and BCL6 was defined. Presence of circulating tumor cells was determined by analyzing the clonality of the immunoglobulin heavy-chain genes by PCR. In DLBCL, MYC mRNA was associated with short overall survival. mRNA targets with unfavorable outcome in tumors were associated with characteristics indicative of poor prognosis, with partial treatment response and with short progression-free survival in patients with complete response. In patients with low IPI score, unfavorable mRNA targets were related to shorter overall survival, partial response, high LDH levels and death. mRNA disappeared in post-treatment samples of patients with complete response, and persisted in those with partial response or death. No associations were found between circulating tumor cells and plasma mRNA. Absence of BCL6 protein in tumors was associated with presence of unfavorable plasma mRNA. CONCLUSIONS/SIGNIFICANCE: Through a non-invasive procedure, tumor-derived mRNAs can be obtained in plasma. mRNA detected in plasma did not proceed from circulating tumor cells. In our study, unfavorable targets in plasma were associated with poor prognosis in B-cell lymphomas, mainly MYC mRNA. Moreover, the unfavorable targets in plasma could help us to classify patients with poor outcome within the good prognosis group according to IPI.

  14. Identification of stress responsive genes by studying specific relationships between mRNA and protein abundance

    Directory of Open Access Journals (Sweden)

    Shimpei Morimoto

    2018-03-01

    Full Text Available Protein expression is regulated by the production and degradation of mRNAs and proteins but the specifics of their relationship are controversial. Although technological advances have enabled genome-wide and time-series surveys of mRNA and protein abundance, recent studies have shown paradoxical results, with most statistical analyses being limited to linear correlation, or analysis of variance applied separately to mRNA and protein datasets. Here, using recently analyzed genome-wide time-series data, we have developed a statistical analysis framework for identifying which types of genes or biological gene groups have significant correlation between mRNA and protein abundance after accounting for potential time delays. Our framework stratifies all genes in terms of the extent of time delay, conducts gene clustering in each stratum, and performs a non-parametric statistical test of the correlation between mRNA and protein abundance in a gene cluster. Consequently, we revealed stronger correlations than previously reported between mRNA and protein abundance in two metabolic pathways. Moreover, we identified a pair of stress responsive genes (ADC17 and KIN1 that showed a highly similar time series of mRNA and protein abundance. Furthermore, we confirmed robustness of the analysis framework by applying it to another genome-wide time-series data and identifying a cytoskeleton-related gene cluster (keratin 18, keratin 17, and mitotic spindle positioning that shows similar correlation. The significant correlation and highly similar changes of mRNA and protein abundance suggests a concerted role of these genes in cellular stress response, which we consider provides an answer to the question of the specific relationships between mRNA and protein in a cell. In addition, our framework for studying the relationship between mRNAs and proteins in a cell will provide a basis for studying specific relationships between mRNA and protein abundance after

  15. 2'-O-methylation in mRNA disrupts tRNA decoding during translation elongation.

    Science.gov (United States)

    Choi, Junhong; Indrisiunaite, Gabriele; DeMirci, Hasan; Ieong, Ka-Weng; Wang, Jinfan; Petrov, Alexey; Prabhakar, Arjun; Rechavi, Gideon; Dominissini, Dan; He, Chuan; Ehrenberg, Måns; Puglisi, Joseph D

    2018-03-01

    Chemical modifications of mRNA may regulate many aspects of mRNA processing and protein synthesis. Recently, 2'-O-methylation of nucleotides was identified as a frequent modification in translated regions of human mRNA, showing enrichment in codons for certain amino acids. Here, using single-molecule, bulk kinetics and structural methods, we show that 2'-O-methylation within coding regions of mRNA disrupts key steps in codon reading during cognate tRNA selection. Our results suggest that 2'-O-methylation sterically perturbs interactions of ribosomal-monitoring bases (G530, A1492 and A1493) with cognate codon-anticodon helices, thereby inhibiting downstream GTP hydrolysis by elongation factor Tu (EF-Tu) and A-site tRNA accommodation, leading to excessive rejection of cognate aminoacylated tRNAs in initial selection and proofreading. Our current and prior findings highlight how chemical modifications of mRNA tune the dynamics of protein synthesis at different steps of translation elongation.

  16. Single step production of Cas9 mRNA for zygote injection.

    Science.gov (United States)

    Redel, Bethany K; Beaton, Benjamin P; Spate, Lee D; Benne, Joshua A; Murphy, Stephanie L; O'Gorman, Chad W; Spate, Anna M; Prather, Randall S; Wells, Kevin D

    2018-03-01

    Production of Cas9 mRNA in vitro typically requires the addition of a 5´ cap and 3´ polyadenylation. A plasmid was constructed that harbored the T7 promoter followed by the EMCV IRES and a Cas9 coding region. We hypothesized that the use of the metastasis associated lung adenocarcinoma transcript 1 (Malat1) triplex structure downstream of an IRES/Cas9 expression cassette would make polyadenylation of in vitro produced mRNA unnecessary. A sequence from the mMalat1 gene was cloned downstream of the IRES/Cas9 cassette described above. An mRNA concentration curve was constructed with either commercially available Cas9 mRNA or the IRES/ Cas9/triplex, by injection into porcine zygotes. Blastocysts were genotyped to determine if differences existed in the percent of embryos modified. The concentration curve identified differences due to concentration and RNA type injected. Single step production of Cas9 mRNA provides an alternative source of Cas9 for use in zygote injections.

  17. Photodynamic antisense regulation of mRNA having a point mutation with psoralen-conjugated oligonucleotide.

    Science.gov (United States)

    Higuchi, Maiko; Yamayoshi, Asako; Kobori, Akio; Murakami, Akira

    2008-01-01

    Nucleic acid-based drugs, such as antisense oligonucleotide, ribozyme, and small interfering RNA, are specific compounds that inhibit gene expression at the post-transcriptional level. To develop more effective nucleic acid-based drugs, we focused on photo-reactive antisense oligonucleotides. We have optimized the structure of psoralen-conjugated oligonucleotide to improve their sequence selectivity and photo-crosslinking efficiency. Previously, we reported that photo reactive oligonucleotides containing 2'-O-psoralenyl-methoxyethyl adenosine (2'-Ps-eom) showed drastic photo-reactivity with a strictly sequence specific manner in vitro. In this report, we evaluated the binding ability toward intracellular target mRNA. The 2'-Ps-eom selectively photo-cross-linked to the target mRNA extracted from cells. The 2'-Ps-eom also cross-linked to target mRNA in cells. Furthermore, 2'-Ps-eom did not cross-link to mRNA having a mismatch base. These results suggest that 2'-Ps-eom is a powerful antisense molecule to inhibit the expression of mRNA having a point mutation.

  18. Enhanced Delivery and Potency of Self-Amplifying mRNA Vaccines by Electroporation in Situ

    Directory of Open Access Journals (Sweden)

    Kaustuv Banerjee

    2013-08-01

    Full Text Available Nucleic acid-based vaccines such as viral vectors, plasmid DNA (pDNA, and mRNA are being developed as a means to address limitations of both live-attenuated and subunit vaccines. DNA vaccines have been shown to be potent in a wide variety of animal species and several products are now licensed for commercial veterinary but not human use. Electroporation delivery technologies have been shown to improve the generation of T and B cell responses from synthetic DNA vaccines in many animal species and now in humans. However, parallel RNA approaches have lagged due to potential issues of potency and production. Many of the obstacles to mRNA vaccine development have recently been addressed, resulting in a revival in the use of non-amplifying and self-amplifying mRNA for vaccine and gene therapy applications. In this paper, we explore the utility of EP for the in vivo delivery of large, self-amplifying mRNA, as measured by reporter gene expression and immunogenicity of genes encoding HIV envelope protein. These studies demonstrated that EP delivery of self-amplifying mRNA elicited strong and broad immune responses in mice, which were comparable to those induced by EP delivery of pDNA.

  19. Selective translation of the measles virus nucleocapsid mRNA by La protein

    Directory of Open Access Journals (Sweden)

    Yoshihisa eInoue

    2011-08-01

    Full Text Available Measles, caused by measles virus (MeV infection, is the leading cause of death in children because of secondary infections attributable to MeV-induced immune suppression. Recently, we have shown that wild-type MeVs induce the suppression of protein synthesis in host cells (referred to as "shutoff" and that viral mRNAs are preferentially translated under shutoff conditions in infected cells. To determine the mechanism behind the preferential translation of viral mRNA, we focused on the 5 untranslated region (UTR of nucleocapsid (N mRNA. The La/SSB autoantigen (La was found to specifically bind to an N-5UTR probe. Recombinant La enhanced the translation of luciferase mRNA containing the N-5UTR (N-fLuc, and RNA interference of La suppressed N-fLuc translation. Furthermore, recombinant MeV lacking the La-binding motif in the N-5UTR displayed delayed viral protein synthesis and growth kinetics at an early phase of infection. These results suggest that La induced predominant translation of N mRNA via binding to its 5UTR under shutoff conditions. This is the first report on a cellular factor that specifically regulates paramyxovirus mRNA translation.

  20. Regulation of the growth hormone (GH) receptor and GH-binding protein mRNA

    Energy Technology Data Exchange (ETDEWEB)

    Kaji, Hidesuke; Ohashi, Shin-Ichirou; Abe, Hiromi; Chihara, Kazuo [Kobe Univ. School of Medicine, Kobe (Japan)

    1994-12-31

    In fasting rats, a transient increase in growth hormone-binding protein (GHBP) mRNA levels was observed after 1 day, in muscle, heart, and liver, but not in fat tissues. The liver GH receptor (GHR) mRNA level was significantly increased after 1 day (but not after 5 days) of bovine GH (bGH) treatment in fed rats. Both the liver GHR mRNA level and the net increment of plasma IGF-I markedly decreased after 5 days of bGH administration in fasting rats. These findings suggest that GHR and GHBP mRNAs in the liver are expressed in a different way and that the expression of GHBP mRNA is regulated differently between tissues, at least in rats. The results also suggest that refractoriness to GH in a sustained fasting state might be beneficial in preventing anabolic effects of GH. In humans, GHR mRNA in lymphocytes, from subjects with either GH-deficiency or acromeg