Novel somatic single nucleotide variants within the RNA binding protein hnRNP A1 in multiple sclerosis patients [v2; ref status: indexed, http://f1000r.es/4dh

Directory of Open Access Journals (Sweden)

Sangmin Lee

2014-09-01

Full Text Available Some somatic single nucleotide variants (SNVs are thought to be pathogenic, leading to neurological disease. We hypothesized that heterogeneous nuclear ribonuclear protein A1 (hnRNP A1, an autoantigen associated with multiple sclerosis (MS would contain SNVs. MS patients develop antibodies to hnRNP A1293-304, an epitope within the M9 domain (AA268-305 of hnRNP A1. M9 is hnRNP A1’s nucleocytoplasmic transport domain, which binds transportin-1 (TPNO-1 and allows for hnRNP A1’s transport into and out of the nucleus. Genomic DNA sequencing of M9 revealed nine novel SNVs that resulted in an amino acid substitution in MS patients that were not present in controls. SNVs occurred within the TPNO-1 binding domain (hnRNP A1268-289 and the MS IgG epitope (hnRNP A1293-304, within M9.  In contrast to the nuclear localization of wild type (WT hnRNP A1, mutant hnRNP A1 mis-localized to the cytoplasm, co-localized with stress granules and caused cellular apoptosis. Whilst WT hnRNP A1 bound TPNO-1, mutant hnRNP A1 showed reduced TPNO-1 binding. These data suggest SNVs in hnRNP A1 might contribute to pathogenesis of MS.

Novel somatic single nucleotide variants within the RNA binding protein hnRNP A1 in multiple sclerosis patients [v1; ref status: indexed, http://f1000r.es/3nv

Directory of Open Access Journals (Sweden)

Sangmin Lee

2014-06-01

Full Text Available Some somatic single nucleotide variants (SNVs are thought to be pathogenic, leading to neurological disease. We hypothesized that heterogeneous nuclear ribonuclear protein A1 (hnRNP A1, an autoantigen associated with multiple sclerosis (MS would contain SNVs. MS patients develop antibodies to hnRNP A1293-304, an epitope within the M9 domain (AA268-305 of hnRNP A1. M9 is hnRNP A1’s nucleocytoplasmic transport domain, which binds transportin-1 (TPNO-1 and allows for hnRNP A1’s transport into and out of the nucleus. Genomic DNA sequencing of M9 revealed nine novel SNVs that resulted in an amino acid substitution in MS patients that were not present in controls. SNVs occurred within the TPNO-1 binding domain (hnRNP A1268-289 and the MS IgG epitope (hnRNP A1293-304, within M9.  In contrast to the nuclear localization of wild type (WT hnRNP A1, mutant hnRNP A1 mis-localized to the cytoplasm, co-localized with stress granules and caused cellular apoptosis. Whilst WT hnRNP A1 bound TPNO-1, mutant hnRNP A1 showed reduced TPNO-1 binding. These data suggest SNVs in hnRNP A1 might contribute to pathogenesis of MS.

Rescue of Na+ and H+ binding in Na+,K+-ATPase M8 aspartate mutants by secondary mutation

DEFF Research Database (Denmark)

Holm, Rikke; Einholm, Anja P.; Andersen, Jens Peter

A mutation replacing the aspartate in transmembrane segment M8 in the a3-isoform of Na,K-ATPase with asparagine has been found in patients with rapid-onset dystonia parkinsonism or alternating hemiplegia of childhood. This aspartate may be a critical Na+ coordinating residue, but the crystal......-isoforms of Na,K-ATPase, and much smaller effects were seen for other mutations to the M8 aspartate, which were less disruptive of Na+ binding than mutations to other residues related to Na+ site III. The D928 (rat a1 numbering) mutations strongly diminished the cooperativity of Na+ binding. Moreover the p......H optimum of Na,K-ATPase activity was left-shifted, again with D928N being most disruptive. The reduced affinity for activating Na+ and for inhibitory protons, caused by D928N and D928A mutations, could be rescued by introduction of an additional mutation of a glutamate located far away from D928....

Two microcephaly-associated novel missense mutations in CASK specifically disrupt the CASK-neurexin interaction.

Science.gov (United States)

LaConte, Leslie E W; Chavan, Vrushali; Elias, Abdallah F; Hudson, Cynthia; Schwanke, Corbin; Styren, Katie; Shoof, Jonathan; Kok, Fernando; Srivastava, Sarika; Mukherjee, Konark

2018-03-01

Deletion and truncation mutations in the X-linked gene CASK are associated with severe intellectual disability (ID), microcephaly and pontine and cerebellar hypoplasia in girls (MICPCH). The molecular origin of CASK-linked MICPCH is presumed to be due to disruption of the CASK-Tbr-1 interaction. This hypothesis, however, has not been directly tested. Missense variants in CASK are typically asymptomatic in girls. We report three severely affected girls with heterozygous CASK missense mutations (M519T (2), G659D (1)) who exhibit ID, microcephaly, and hindbrain hypoplasia. The mutation M519T results in the replacement of an evolutionarily invariant methionine located in the PDZ signaling domain known to be critical for the CASK-neurexin interaction. CASK M519T is incapable of binding to neurexin, suggesting a critically important role for the CASK-neurexin interaction. The mutation G659D is in the SH3 (Src homology 3) domain of CASK, replacing a semi-conserved glycine with aspartate. We demonstrate that the CASK G659D mutation affects the CASK protein in two independent ways: (1) it increases the protein's propensity to aggregate; and (2) it disrupts the interface between CASK's PDZ (PSD95, Dlg, ZO-1) and SH3 domains, inhibiting the CASK-neurexin interaction despite residing outside of the domain deemed critical for neurexin interaction. Since heterozygosity of other aggregation-inducing mutations (e.g., CASK W919R ) does not produce MICPCH, we suggest that the G659D mutation produces microcephaly by disrupting the CASK-neurexin interaction. Our results suggest that disruption of the CASK-neurexin interaction, not the CASK-Tbr-1 interaction, produces microcephaly and cerebellar hypoplasia. These findings underscore the importance of functional validation for variant classification.

Centromere Protein (CENP)-W Interacts with Heterogeneous Nuclear Ribonucleoprotein (hnRNP) U and May Contribute to Kinetochore-Microtubule Attachment in Mitotic Cells

Science.gov (United States)

Chun, Younghwa; Kim, Raehyung; Lee, Soojin

2016-01-01

Background Recent studies have shown that heterogeneous nuclear ribonucleoprotein U (hnRNP U), a component of the hnRNP complex, contributes to stabilize the kinetochore-microtubule interaction during mitosis. CENP-W was identified as an inner centromere component that plays crucial roles in the formation of a functional kinetochore complex. Results We report that hnRNP U interacts with CENP-W, and the interaction between hnRNP U and CENP-W mutually increased each other’s protein stability by inhibiting the proteasome-mediated degradation. Further, their co-localization was observed chiefly in the nuclear matrix region and at the microtubule-kinetochore interface during interphase and mitosis, respectively. Both microtubule-stabilizing and microtubule-destabilizing agents significantly decreased the protein stability of CENP-W. Furthermore, loss of microtubules and defects in microtubule organization were observed in CENP-W-depleted cells. Conclusion Our data imply that CENP-W plays an important role in the attachment and interaction between microtubules and kinetochore during mitosis. PMID:26881882

hnRNP A2/B1 interacts with influenza A viral protein NS1 and inhibits virus replication potentially through suppressing NS1 RNA/protein levels and NS1 mRNA nuclear export

Energy Technology Data Exchange (ETDEWEB)

Wang, Yimeng; Zhou, Jianhong; Du, Yuchun, E-mail: ydu@uark.edu

2014-01-20

The NS1 protein of influenza viruses is a major virulence factor and exerts its function through interacting with viral/cellular RNAs and proteins. In this study, we identified heterogeneous nuclear ribonucleoprotein A2/B1 (hnRNP A2/B1) as an interacting partner of NS1 proteins by a proteomic method. Knockdown of hnRNP A2/B1 by small interfering RNA (siRNA) resulted in higher levels of NS vRNA, NS1 mRNA, and NS1 protein in the virus-infected cells. In addition, we demonstrated that hnRNP A2/B1 proteins are associated with NS1 and NS2 mRNAs and that knockdown of hnRNP A2/B1 promotes transport of NS1 mRNA from the nucleus to the cytoplasm in the infected cells. Lastly, we showed that knockdown of hnRNP A2/B1 leads to enhanced virus replication. Our results suggest that hnRNP A2/B1 plays an inhibitory role in the replication of influenza A virus in host cells potentially through suppressing NS1 RNA/protein levels and NS1 mRNA nucleocytoplasmic translocation. - Highlights: • Cellular protein hnRNP A2/B1 interacts with influenza viral protein NS1. • hnRNP A2/B1 suppresses the levels of NS1 protein, vRNA and mRNA in infected cells. • hnRNP A2/B1 protein is associated with NS1 and NS2 mRNAs. • hnRNP A2/B1 inhibits the nuclear export of NS1 mRNAs. • hnRNP A2/B1 inhibits influenza virus replication.

Human hnRNP Q re-localizes to cytoplasmic granules upon PMA, thapsigargin, arsenite and heat-shock treatments

International Nuclear Information System (INIS)

Quaresma, Alexandre J.C.; Bressan, G.C.; Gava, L.M.; Lanza, D.C.F.; Ramos, C.H.I; Kobarg, Joerg

2009-01-01

Eukaryotic gene expression is regulated on different levels ranging from pre-mRNA processing to translation. One of the most characterized families of RNA-binding proteins is the group of hnRNPs: heterogenous nuclear ribonucleoproteins. Members of this protein family play important roles in gene expression control and mRNAs metabolism. In the cytoplasm, several hnRNPs proteins are involved in RNA-related processes and they can be frequently found in two specialized structures, known as GW-bodies (GWbs), previously known as processing bodies: PBs, and stress granules, which may be formed in response to specific stimuli. GWbs have been early reported to be involved in the mRNA decay process, acting as a site of mRNA degradation. In a similar way, stress granules (SGs) have been described as cytoplasmic aggregates, which contain accumulated mRNAs in cells under stress conditions and present reduced or inhibited translation. Here, we characterized the hnRNP Q localization after different stress conditions. hnRNP Q is a predominantly nuclear protein that exhibits a modular organization and several RNA-related functions. Our data suggest that the nuclear localization of hnRNP Q might be modified after different treatments, such as: PMA, thapsigargin, arsenite and heat shock. Under different stress conditions, hnRNP Q can fully co-localize with the endoplasmatic reticulum specific chaperone, BiP. However, under stress, this protein only co-localizes partially with the proteins: GW182 - GWbs marker protein and TIA-1 stress granule component

Relationship between p53 dysfunction, CD38 expression, and IgV(H) mutation in chronic lymphocytic leukemia.

Science.gov (United States)

Lin, Ke; Sherrington, Paul D; Dennis, Michael; Matrai, Zoltan; Cawley, John C; Pettitt, Andrew R

2002-08-15

Established adverse prognostic factors in chronic lymphocytic leukemia (CLL) include CD38 expression, relative lack of IgV(H) mutation, and defects of the TP53 gene. However, disruption of the p53 pathway can occur through mechanisms other than TP53 mutation, and we have recently developed a simple screening test that detects p53 dysfunction due to mutation of the genes encoding either p53 or ATM, a kinase that regulates p53. The present study was conducted to examine the predictive value of this test and to establish the relationship between p53 dysfunction, CD38 expression, and IgV(H) mutation. CLL cells from 71 patients were examined for IgV(H) mutation, CD38 expression, and p53 dysfunction (detected as an impaired p53/p21 response to ionizing radiation). Survival data obtained from 69 patients were analyzed according to each of these parameters. Relative lack of IgV(H) mutation (less than 5%; n = 45), CD38 positivity (antigen expressed on more than 20% of malignant cells; n = 19), and p53 dysfunction (n = 19) were independently confirmed as adverse prognostic factors. Intriguingly, all p53-dysfunctional patients and all but one of the CD38(+) patients had less [corrected] than 5% IgV(H) mutation. Moreover, patients with p53 dysfunction and/or CD38 positivity (n = 31) accounted for the short survival of the less mutated group. These findings indicate that the poor outcome associated with having less than 5% IgV(H) mutation may be due to the overrepresentation of high-risk patients with p53 dysfunction and/or CD38 positivity within this group, and that CD38(-) patients with functionally intact p53 may have a prolonged survival regardless of the extent of IgV(H) mutation.

The role of polypyrimidine tract-binding proteins and other hnRNP proteins in plant splicing regulation

Directory of Open Access Journals (Sweden)

Andreas eWachter

2012-05-01

Full Text Available Alternative precursor mRNA splicing is a widespread phenomenon in multicellular eukaryotes and represents a major means for functional expansion of the transcriptome. While several recent studies have revealed an important link between splicing regulation and fundamental biological processes in plants, many important aspects, such as the underlying splicing regulatory mechanisms, are so far not well understood. Splicing decisions are in general based on a splicing code that is determined by the dynamic interplay of splicing-controlling factors and cis-regulatory elements. Several members of the group of heterogeneous nuclear ribonucleoprotein (hnRNP proteins are well-known regulators of splicing in animals and the comparatively few reports on some of their plant homologues revealed similar functions. This also applies to polypyrimidine tract-binding proteins (PTBs, a thoroughly investigated class of hnRNP proteins with splicing regulatory functions in both animals and plants. Further examples from plants are auto- and cross-regulatory splicing circuits of glycine-rich RNA-binding proteins (GRPs and splicing enhancement by oligouridylatebinding proteins. Besides their role in defining splice site choice, hnRNP proteins are also involved in multiple other steps of nucleic acid metabolism, highlighting the functional versatility of this group of proteins in higher eukaryotes.

p.H1069Q mutation in ATP7B and biochemical parameters of copper metabolism and clinical manifestation of Wilson's disease.

Science.gov (United States)

Gromadzka, Graznya; Schmidt, Harmut H J; Genschel, Janine; Bochow, Bettina; Rodo, M; Tarnacka, Beatek; Litwin, Thomas; Chabik, Grzegorz; Członkowska, Anna

2006-02-01

We compared the effect of the p.H1069Q mutation and other non-p.H1069Q mutations in ATP7B on the phenotypic expression of Wilson's disease (WD), and assessed whether the clinical phenotype of WD in compound heterozygotes depends on the type of mutation coexisting with the p.H1069Q. One hundred forty-two patients with clinically, biochemically, and genetically diagnosed WD were studied. The mutational analysis of ATP7B was performed by direct sequencing. A total number of 26 mutations in ATP7B were identified. The p.His1069Gln was the most common mutation (allelic frequency: 72%). Seventy-three patients were homozygous for this mutation. Of compound heterozygotes, 37 had frameshift/nonsense mutation, and 20 had other missense mutation on one of their ATP7B alleles. Twelve patients had two non-p.H1069Q mutations. Patients homozygous for the p.H1069Q mutation had the less severe disturbances of copper metabolism and the latest presentation of first WD symptoms. The most severely disturbed copper metabolism and the earliest age at initial disease manifestation was noticed in non-p.H1069Q patients. In compound heterozygotes, the type of mutation coexisting with the p.H1069Q to a small extent influenced WD phenotype. The phenotype of WD varied considerably among patients with the same genotype. The p.H1069Q mutation is associated with late WD manifestation and with a mild disruption of copper metabolism. In compound heterozygotes, the phenotype of WD to a small extent depends on the type of mutation coexisting with the p.H1069Q. Besides genotype, additional modifying factors seem to determine WD manifestations. Copyright (c) 2005 Movement Disorder Society.

VHL genetic alteration in CCRCC does not determine de-regulation of HIF, CAIX, hnRNP A2/B1 and osteopontin.

LENUS (Irish Health Repository)

Nyhan, Michelle J

2012-01-31

BACKGROUND: von Hippel-Lindau (VHL) tumour suppressor gene inactivation is associated with clear cell renal cell carcinoma (CCRCC) development. The VHL protein (pVHL) has been proposed to regulate the expression of several proteins including Hypoxia Inducible Factor-alpha (HIF-alpha), carbonic anhydrase (CA)IX, heterogeneous nuclear ribonucleoprotein (hnRNP) A2\\/B1 and osteopontin. pVHL has been characterized in vitro, however, clinical studies are limited. We evaluated the impact of VHL genetic alterations on the expression of several pVHL protein targets in paired normal and tumor tissue. METHODS: The VHL gene was sequenced in 23 CCRCC patients and VHL transcript levels were evaluated by real-time RT-PCR. Expression of pVHL\\'s protein targets were determined by Western blotting in 17 paired patient samples. RESULTS: VHL genetic alterations were identified in 43.5% (10\\/23) of CCRCCs. HIF-1alpha, HIF-2alpha and CAIX were up-regulated in 88.2% (15\\/17), 100% (17\\/17) and 88.2% (15\\/17) of tumors respectively and their expression is independent of VHL status. hnRNP A2\\/B1 and osteopontin expression was variable in CCRCCs and had no association with VHL genetic status. CONCLUSION: As expression of these proposed pVHL targets can be achieved independently of VHL mutation (and possibly by hypoxia alone), these data suggests that other pVHL targets may be more crucial in renal carcinogenesis.

Skin pH, Atopic Dermatitis, and Filaggrin Mutations

DEFF Research Database (Denmark)

Bandier, Josefine; Johansen, Jeanne Duus; Petersen, Lars Jelstrup

2014-01-01

mutations may influence skin pH. OBJECTIVE: We aimed to determine the epidermal pH in different groups stratified by filaggrin mutations and atopic dermatitis. Further, we investigated the changes in pH according to severity of mutational status among patients with dermatitis, irrespective of skin condition....... METHODS: pH was measured with a multiprobe system pH probe (PH 905), and the study population was composed of 67 individuals, who had all been genotyped for 3 filaggrin mutations (R501X, 2282del4, R2447X). RESULTS: We found no clear pattern in relation to filaggrin mutation carrier status. Individuals...... with wild-type filaggrin displayed both the most acidic and most alkaline values independent of concomitant skin disease; however, no statistical differences between the groups were found. CONCLUSIONS: The lack of significant diversity in skin pH in relation to filaggrin mutation carrier status suggests...

Oncogenic exon 2 mutations in Mediator subunit MED12 disrupt allosteric activation of cyclin C-CDK8/19.

Science.gov (United States)

Park, Min Ju; Shen, Hailian; Spaeth, Jason M; Tolvanen, Jaana H; Failor, Courtney; Knudtson, Jennifer F; McLaughlin, Jessica; Halder, Sunil K; Yang, Qiwei; Bulun, Serdar E; Al-Hendy, Ayman; Schenken, Robert S; Aaltonen, Lauri A; Boyer, Thomas G

2018-03-30

Somatic mutations in exon 2 of the RNA polymerase II transcriptional Mediator subunit MED12 occur at high frequency in uterine fibroids (UFs) and breast fibroepithelial tumors as well as recurrently, albeit less frequently, in malignant uterine leimyosarcomas, chronic lymphocytic leukemias, and colorectal cancers. Previously, we reported that UF-linked mutations in MED12 disrupt its ability to activate cyclin C (CycC)-dependent kinase 8 (CDK8) in Mediator, implicating impaired Mediator-associated CDK8 activity in the molecular pathogenesis of these clinically significant lesions. Notably, the CDK8 paralog CDK19 is also expressed in myometrium, and both CDK8 and CDK19 assemble into Mediator in a mutually exclusive manner, suggesting that CDK19 activity may also be germane to the pathogenesis of MED12 mutation-induced UFs. However, whether and how UF-linked mutations in MED12 affect CDK19 activation is unknown. Herein, we show that MED12 allosterically activates CDK19 and that UF-linked exon 2 mutations in MED12 disrupt its CDK19 stimulatory activity. Furthermore, we find that within the Mediator kinase module, MED13 directly binds to the MED12 C terminus, thereby suppressing an apparent UF mutation-induced conformational change in MED12 that otherwise disrupts its association with CycC-CDK8/19. Thus, in the presence of MED13, mutant MED12 can bind, but cannot activate, CycC-CDK8/19. These findings indicate that MED12 binding is necessary but not sufficient for CycC-CDK8/19 activation and reveal an additional step in the MED12-dependent activation process, one critically dependent on MED12 residues altered by UF-linked exon 2 mutations. These findings confirm that UF-linked mutations in MED12 disrupt composite Mediator-associated kinase activity and identify CDK8/19 as prospective therapeutic targets in UFs. © 2018 Park et al.

A Function for the hnRNP A1/A2 Proteins in Transcription Elongation.

Science.gov (United States)

Lemieux, Bruno; Blanchette, Marco; Monette, Anne; Mouland, Andrew J; Wellinger, Raymund J; Chabot, Benoit

2015-01-01

The hnRNP A1 and A2 proteins regulate processes such as alternative pre-mRNA splicing and mRNA stability. Here, we report that a reduction in the levels of hnRNP A1 and A2 by RNA interference or their cytoplasmic retention by osmotic stress drastically increases the transcription of a reporter gene. Based on previous work, we propose that this effect may be linked to a decrease in the activity of the transcription elongation factor P-TEFb. Consistent with this hypothesis, the transcription of the reporter gene was stimulated when the catalytic component of P-TEFb, CDK9, was inhibited with DRB. While low levels of A1/A2 stimulated the association of RNA polymerase II with the reporter gene, they also increased the association of CDK9 with the repressor 7SK RNA, and compromised the recovery of promoter-distal transcription on the Kitlg gene after the release of pausing. Transcriptome analysis revealed that more than 50% of the genes whose expression was affected by the siRNA-mediated depletion of A1/A2 were also affected by DRB. RNA polymerase II-chromatin immunoprecipitation assays on DRB-treated and A1/A2-depleted cells identified a common set of repressed genes displaying increased occupancy of polymerases at promoter-proximal locations, consistent with pausing. Overall, our results suggest that lowering the levels of hnRNP A1/A2 elicits defective transcription elongation on a fraction of P-TEFb-dependent genes, hence favoring the transcription of P-TEFb-independent genes.

A Function for the hnRNP A1/A2 Proteins in Transcription Elongation.

Directory of Open Access Journals (Sweden)

Bruno Lemieux

Full Text Available The hnRNP A1 and A2 proteins regulate processes such as alternative pre-mRNA splicing and mRNA stability. Here, we report that a reduction in the levels of hnRNP A1 and A2 by RNA interference or their cytoplasmic retention by osmotic stress drastically increases the transcription of a reporter gene. Based on previous work, we propose that this effect may be linked to a decrease in the activity of the transcription elongation factor P-TEFb. Consistent with this hypothesis, the transcription of the reporter gene was stimulated when the catalytic component of P-TEFb, CDK9, was inhibited with DRB. While low levels of A1/A2 stimulated the association of RNA polymerase II with the reporter gene, they also increased the association of CDK9 with the repressor 7SK RNA, and compromised the recovery of promoter-distal transcription on the Kitlg gene after the release of pausing. Transcriptome analysis revealed that more than 50% of the genes whose expression was affected by the siRNA-mediated depletion of A1/A2 were also affected by DRB. RNA polymerase II-chromatin immunoprecipitation assays on DRB-treated and A1/A2-depleted cells identified a common set of repressed genes displaying increased occupancy of polymerases at promoter-proximal locations, consistent with pausing. Overall, our results suggest that lowering the levels of hnRNP A1/A2 elicits defective transcription elongation on a fraction of P-TEFb-dependent genes, hence favoring the transcription of P-TEFb-independent genes.

Binding of the heterogeneous ribonucleoprotein K (hnRNP K to the Epstein-Barr virus nuclear antigen 2 (EBNA2 enhances viral LMP2A expression.

Directory of Open Access Journals (Sweden)

Henrik Gross

Full Text Available The Epstein-Barr Virus (EBV -encoded EBNA2 protein, which is essential for the in vitro transformation of B-lymphocytes, interferes with cellular processes by binding to proteins via conserved sequence motifs. Its Arginine-Glycine (RG repeat element contains either symmetrically or asymmetrically di-methylated arginine residues (SDMA and ADMA, respectively. EBNA2 binds via its SDMA-modified RG-repeat to the survival motor neurons protein (SMN and via the ADMA-RG-repeat to the NP9 protein of the human endogenous retrovirus K (HERV-K (HML-2 Type 1. The hypothesis of this work was that the methylated RG-repeat mimics an epitope shared with cellular proteins that is used for interaction with target structures. With monoclonal antibodies against the modified RG-repeat, we indeed identified cellular homologues that apparently have the same surface structure as methylated EBNA2. With the SDMA-specific antibodies, we precipitated the Sm protein D3 (SmD3 which, like EBNA2, binds via its SDMA-modified RG-repeat to SMN. With the ADMA-specific antibodies, we precipitated the heterogeneous ribonucleoprotein K (hnRNP K. Specific binding of the ADMA- antibody to hnRNP K was demonstrated using E. coli expressed/ADMA-methylated hnRNP K. In addition, we show that EBNA2 and hnRNP K form a complex in EBV- infected B-cells. Finally, hnRNP K, when co-expressed with EBNA2, strongly enhances viral latent membrane protein 2A (LMP2A expression by an unknown mechanism as we did not detect a direct association of hnRNP K with DNA-bound EBNA2 in gel shift experiments. Our data support the notion that the methylated surface of EBNA2 mimics the surface structure of cellular proteins to interfere with or co-opt their functional properties.

Identification of GLI Mutations in Patients With Hirschsprung Disease That Disrupt Enteric Nervous System Development in Mice.

Science.gov (United States)

Liu, Jessica Ai-Jia; Lai, Frank Pui-Ling; Gui, Hong-Sheng; Sham, Mai-Har; Tam, Paul Kwong-Hang; Garcia-Barcelo, Maria-Mercedes; Hui, Chi-Chung; Ngan, Elly Sau-Wai

2015-12-01

Hirschsprung disease is characterized by a deficit in enteric neurons, which are derived from neural crest cells (NCCs). Aberrant hedgehog signaling disrupts NCC differentiation and might cause Hirschsprung disease. We performed genetic analyses to determine whether hedgehog signaling is involved in pathogenesis. We performed deep-target sequencing of DNA from 20 patients with Hirschsprung disease (16 men, 4 women), and 20 individuals without (controls), and searched for mutation(s) in GLI1, GLI2, GLI3, SUFU, and SOX10. Biological effects of GLI mutations were tested in luciferase reporter assays using HeLa or neuroblastoma cell lines. Development of the enteric nervous system was studied in Sufu(f/f), Gli3(Δ699), Wnt1-Cre, and Sox10(NGFP) mice using immunohistochemical and whole-mount staining procedures to quantify enteric neurons and glia and analyze axon fasciculation, respectively. NCC migration was studied using time-lapse imaging. We identified 3 mutations in GLI in 5 patients with Hirschsprung disease but no controls; all lead to increased transcription of SOX10 in cell lines. SUFU, GLI, and SOX10 form a regulatory loop that controls the neuronal vs glial lineages and migration of NCCs. Sufu mutants mice had high Gli activity, due to loss of Sufu, disrupting the regulatory loop and migration of enteric NCCs, leading to defective axonal fasciculation, delayed gut colonization, or intestinal hypoganglionosis. The ratio of enteric neurons to glia correlated inversely with Gli activity. We identified mutations that increase GLI activity in patients with Hirschsprung disease. Disruption of the SUFU-GLI-SOX10 regulatory loop disrupts migration of NCCs and development of the enteric nervous system in mice. Copyright © 2015 AGA Institute. Published by Elsevier Inc. All rights reserved.

Calcium Sensing Receptor Mutations Implicated in Pancreatitis and Idiopathic Epilepsy Syndrome Disrupt an Arginine-rich Retention Motif

Science.gov (United States)

Stepanchick, Ann; McKenna, Jennifer; McGovern, Olivia; Huang, Ying; Breitwieser, Gerda E.

2010-01-01

Calcium sensing receptor (CaSR) mutations implicated in familial hypocalciuric hypercalcemia, pancreatitis and idiopathic epilepsy syndrome map to an extended arginine-rich region in the proximal carboxyl terminus. Arginine-rich motifs mediate endoplasmic reticulum retention and/or retrieval of multisubunit proteins so we asked whether these mutations, R886P, R896H or R898Q, altered CaSR targeting to the plasma membrane. Targeting was enhanced by all three mutations, and Ca2+-stimulated ERK1/2 phosphorylation was increased for R896H and R898Q. To define the role of the extended arginine-rich region in CaSR trafficking, we independently determined the contributions of R890/R891 and/or R896/K897/R898 motifs by mutation to alanine. Disruption of the motif(s) significantly increased surface expression and function relative to wt CaSR. The arginine-rich region is flanked by phosphorylation sites at S892 (protein kinase C) and S899 (protein kinase A). The phosphorylation state of S899 regulated recognition of the arginine-rich region; S899D showed increased surface localization. CaSR assembles in the endoplasmic reticulum as a covalent disulfide-linked dimer and we determined whether retention requires the presence of arginine-rich regions in both subunits. A single arginine-rich region within the dimer was sufficient to confer intracellular retention comparable to wt CaSR. We have identified an extended arginine-rich region in the proximal carboxyl terminus of CaSR (residues R890 - R898) which fosters intracellular retention of CaSR and is regulated by phosphorylation. Mutation(s) identified in chronic pancreatitis and idiopathic epilepsy syndrome therefore increase plasma membrane targeting of CaSR, likely contributing to the altered Ca2+ signaling characteristic of these diseases. PMID:20798521

Statistical study of TCV disruptivity and H-mode accessibility

International Nuclear Information System (INIS)

Martin, Y.; Deschenaux, C.; Lister, J.B.; Pochelon, A.

1997-01-01

Optimising tokamak operation consists of finding a path, in a multidimensional parameter space, which leads to the desired plasma characteristics and avoids hazards regions. Typically the desirable regions are the domain where an L-mode to H-mode transition can occur, and then, in the H-mode, where ELMs and the required high density< y can be maintained. The regions to avoid are those with a high rate of disruptivity. On TCV, learning the safe and successful paths is achieved empirically. This will no longer be possible in a machine like ITER, since only a small percentage of disrupted discharges will be tolerable. An a priori knowledge of the hazardous regions in ITER is therefore mandatory. This paper presents the results of a statistical analysis of the occurrence of disruptions in TCV. (author) 4 figs

Molecular population dynamics of DNA structures in a bcl-2 promoter sequence is regulated by small molecules and the transcription factor hnRNP LL.

Science.gov (United States)

Cui, Yunxi; Koirala, Deepak; Kang, HyunJin; Dhakal, Soma; Yangyuoru, Philip; Hurley, Laurence H; Mao, Hanbin

2014-05-01

Minute difference in free energy change of unfolding among structures in an oligonucleotide sequence can lead to a complex population equilibrium, which is rather challenging for ensemble techniques to decipher. Herein, we introduce a new method, molecular population dynamics (MPD), to describe the intricate equilibrium among non-B deoxyribonucleic acid (DNA) structures. Using mechanical unfolding in laser tweezers, we identified six DNA species in a cytosine (C)-rich bcl-2 promoter sequence. Population patterns of these species with and without a small molecule (IMC-76 or IMC-48) or the transcription factor hnRNP LL are compared to reveal the MPD of different species. With a pattern recognition algorithm, we found that IMC-48 and hnRNP LL share 80% similarity in stabilizing i-motifs with 60 s incubation. In contrast, IMC-76 demonstrates an opposite behavior, preferring flexible DNA hairpins. With 120-180 s incubation, IMC-48 and hnRNP LL destabilize i-motifs, which has been previously proposed to activate bcl-2 transcriptions. These results provide strong support, from the population equilibrium perspective, that small molecules and hnRNP LL can modulate bcl-2 transcription through interaction with i-motifs. The excellent agreement with biochemical results firmly validates the MPD analyses, which, we expect, can be widely applicable to investigate complex equilibrium of biomacromolecules. © 2014 The Author(s). Published by Oxford University Press [on behalf of Nucleic Acids Research].

High-risk Long QT Syndrome Mutations in the Kv7.1 (KCNQ1) Pore Disrupt the Molecular Basis for Rapid K+ Permeation

Science.gov (United States)

Burgess, Don E.; Bartos, Daniel C.; Reloj, Allison R.; Campbell, Kenneth S.; Johnson, Jonathan N.; Tester, David J.; Ackerman, Michael J.; Fressart, Véronique; Denjoy, Isabelle; Guicheney, Pascale; Moss, Arthur J.; Ohno, Seiko; Horie, Minoru; Delisle, Brian P.

2012-01-01

Type 1 long QT syndrome (LQT1) syndrome is caused by loss-of-function mutations in the KCNQ1, which encodes the K+ channel (Kv7.1) that underlies the slowly activating delayed rectifier K+ current in the heart. Intragenic risk stratification suggests LQT1 mutations that disrupt conserved amino acid residues in the pore are an independent risk factor for LQT1-related cardiac events. The purpose of this study is to determine possible molecular mechanisms that underlie the loss-of-function for these high-risk mutations. Extensive genotype-phenotype analyses of LQT1 patients showed that T322M-, T322A-, or G325R-Kv7.1 confer a high risk for LQT1-related cardiac events. Heterologous expression of these mutations with KCNE1 revealed they generated non-functional channels and caused dominant negative suppression of WT-Kv7.1 current. Molecular dynamic simulations (MDS) of analogous mutations in KcsA (T85M-, T85A-, and G88R-KcsA) demonstrated that they disrupted the symmetrical distribution of the carbonyl oxygen atoms in the selectivity filter, which upset the balance between the strong attractive and K+-K+ repulsive forces required for rapid K+ permeation. We conclude high-risk LQT1 mutations in the pore likely disrupt the architectural and physical properties of the K+ channel selectivity filter. PMID:23092362

High-risk long QT syndrome mutations in the Kv7.1 (KCNQ1) pore disrupt the molecular basis for rapid K(+) permeation.

Science.gov (United States)

Burgess, Don E; Bartos, Daniel C; Reloj, Allison R; Campbell, Kenneth S; Johnson, Jonathan N; Tester, David J; Ackerman, Michael J; Fressart, Véronique; Denjoy, Isabelle; Guicheney, Pascale; Moss, Arthur J; Ohno, Seiko; Horie, Minoru; Delisle, Brian P

2012-11-13

Type 1 long QT syndrome (LQT1) is caused by loss-of-function mutations in the KCNQ1 gene, which encodes the K(+) channel (Kv7.1) that underlies the slowly activating delayed rectifier K(+) current in the heart. Intragenic risk stratification suggests LQT1 mutations that disrupt conserved amino acid residues in the pore are an independent risk factor for LQT1-related cardiac events. The purpose of this study is to determine possible molecular mechanisms that underlie the loss of function for these high-risk mutations. Extensive genotype-phenotype analyses of LQT1 patients showed that T322M-, T322A-, or G325R-Kv7.1 confers a high risk for LQT1-related cardiac events. Heterologous expression of these mutations with KCNE1 revealed they generated nonfunctional channels and caused dominant negative suppression of WT-Kv7.1 current. Molecular dynamics simulations of analogous mutations in KcsA (T85M-, T85A-, and G88R-KcsA) demonstrated that they disrupted the symmetrical distribution of the carbonyl oxygen atoms in the selectivity filter, which upset the balance between the strong attractive and K(+)-K(+) repulsive forces required for rapid K(+) permeation. We conclude high-risk LQT1 mutations in the pore likely disrupt the architectural and physical properties of the K(+) channel selectivity filter.

A mutation in a functional Sp1 binding site of the telomerase RNA gene (hTERC promoter in a patient with Paroxysmal Nocturnal Haemoglobinuria

Directory of Open Access Journals (Sweden)

Mason Philip J

2004-06-01

Full Text Available Abstract Background Mutations in the gene coding for the RNA component of telomerase, hTERC, have been found in autosomal dominant dyskeratosis congenita (DC and aplastic anemia. Paroxysmal nocturnal hemoglobinuria (PNH is a clonal blood disorder associated with aplastic anemia and characterized by the presence of one or more clones of blood cells lacking glycosylphosphatidylinositol (GPI anchored proteins due to a somatic mutation in the PIGA gene. Methods We searched for mutations in DNA extracted from PNH patients by amplification of the hTERC gene and denaturing high performance liquid chromatography (dHPLC. After a mutation was found in a potential transcription factor binding site in one patient electrophoretic mobility shift assays were used to detect binding of transcription factors to that site. The effect of the mutation on the function of the promoter was tested by transient transfection constructs in which the promoter is used to drive a reporter gene. Results Here we report the finding of a novel promoter mutation (-99C->G in the hTERC gene in a patient with PNH. The mutation disrupts an Sp1 binding site and destroys its ability to bind Sp1. Transient transfection assays show that mutations in this hTERC site including C-99G cause either up- or down-regulation of promoter activity and suggest that the site regulates core promoter activity in a context dependent manner in cancer cells. Conclusions These data are the first report of an hTERC promoter mutation from a patient sample which can modulate core promoter activity in vitro, raising the possibility that the mutation may affect the transcription of the gene in hematopoietic stem cells in vivo, and that dysregulation of telomerase may play a role in the development of bone marrow failure and the evolution of PNH clones.

Clinical expression of patients with the D1152H CFTR mutation.

Science.gov (United States)

Terlizzi, Vito; Carnovale, Vincenzo; Castaldo, Giuseppe; Castellani, Carlo; Cirilli, Natalia; Colombo, Carla; Corti, Fabiola; Cresta, Federico; D'Adda, Alice; Lucarelli, Marco; Lucidi, Vincenzina; Macchiaroli, Annamaria; Madarena, Elisa; Padoan, Rita; Quattrucci, Serena; Salvatore, Donatello; Zarrilli, Federica; Raia, Valeria

2015-07-01

Discordant results were reported on the clinical expression of subjects bearing the D1152H CFTR mutation, and also for the small number of cases reported so far. A retrospective review of clinical, genetic and biochemical data was performed from individuals homozygous or compound heterozygous for the D1152H mutation followed in 12 Italian cystic fibrosis (CF) centers. 89 subjects carrying at least D1152H on one allele were identified. 7 homozygous patients had very mild clinical expression. Over half of the 74 subjects compound heterozygous for D1152H and a I-II-III class mutation had borderline or pathological sweat test and respiratory or gastrointestinal symptoms; one third had pulmonary bacteria colonization and 10/74 cases had complications (i.e. diabetes, allergic bronchopulmonary aspergillosis, and hemoptysis). However, their clinical expression was less severe as compared to a group of CF patients homozygous for the F508del mutation. Finally, 8 subjects compound heterozygous for D1152H and a IV-V class mutation showed very mild disease. The natural history of subjects bearing the D1152H mutation is widely heterogeneous and is influenced by the mutation in trans. Copyright © 2014 European Cystic Fibrosis Society. Published by Elsevier B.V. All rights reserved.

Identification of human hnRNP C1/C2 as a dengue virus NS1-interacting protein

International Nuclear Information System (INIS)

Noisakran, Sansanee; Sengsai, Suchada; Thongboonkerd, Visith; Kanlaya, Rattiyaporn; Sinchaikul, Supachok; Chen, Shui-Tein; Puttikhunt, Chunya

2008-01-01

Dengue virus nonstructural protein 1 (NS1) is a key glycoprotein involved in the production of infectious virus and the pathogenesis of dengue diseases. Very little is known how NS1 interacts with host cellular proteins and functions in dengue virus-infected cells. This study aimed at identifying NS1-interacting host cellular proteins in dengue virus-infected cells by employing co-immunoprecipitation, two-dimensional gel electrophoresis, and mass spectrometry. Using lysates of dengue virus-infected human embryonic kidney cells (HEK 293T), immunoprecipitation with an anti-NS1 monoclonal antibody revealed eight isoforms of dengue virus NS1 and a 40-kDa protein, which was subsequently identified by quadrupole time-of-flight tandem mass spectrometry (Q-TOF MS/MS) as human heterogeneous nuclear ribonucleoprotein (hnRNP) C1/C2. Further investigation by co-immunoprecipitation and co-localization confirmed the association of hnRNP C1/C2 and dengue virus NS1 proteins in dengue virus-infected cells. Their interaction may have implications in virus replication and/or cellular responses favorable to survival of the virus in host cells

A Mononucleotide Markers Panel to Identify hMLH1/hMSH2 Germline Mutations

Directory of Open Access Journals (Sweden)

M. Pedroni

2007-01-01

Full Text Available Hereditary NonPolyposis Colorectal Cancer (Lynch syndrome is an autosomal dominant disease caused by germline mutations in a class of genes deputed to maintain genomic integrity during cell replication, mutations result in a generalized genomic instability, particularly evident at microsatellite loci (Microsatellite Instability, MSI. MSI is present in 85–90% of colorectal cancers that occur in Lynch Syndrome. To standardize the molecular diagnosis of MSI, a panel of 5 microsatellite markers was proposed (known as the “Bethesda panel”. Aim of our study is to evaluate if MSI testing with two mononucleotide markers, such as BAT25 and BAT26, was sufficient to identify patients with hMLH1/hMSH2 germline mutations. We tested 105 tumours for MSI using both the Bethesda markers and the two mononucleotide markers BAT25 and BAT26. Moreover, immunohistochemical evaluation of MLH1 and MSH2 proteins was executed on the tumours with at least one unstable microsatellite, whereas germline hMLH1/hMSH2 mutations were searched for all cases showing two or more unstable microsatellites.

Disease-associated mutations disrupt functionally important regions of intrinsic protein disorder.

Directory of Open Access Journals (Sweden)

Vladimir Vacic

Full Text Available The effects of disease mutations on protein structure and function have been extensively investigated, and many predictors of the functional impact of single amino acid substitutions are publicly available. The majority of these predictors are based on protein structure and evolutionary conservation, following the assumption that disease mutations predominantly affect folded and conserved protein regions. However, the prevalence of the intrinsically disordered proteins (IDPs and regions (IDRs in the human proteome together with their lack of fixed structure and low sequence conservation raise a question about the impact of disease mutations in IDRs. Here, we investigate annotated missense disease mutations and show that 21.7% of them are located within such intrinsically disordered regions. We further demonstrate that 20% of disease mutations in IDRs cause local disorder-to-order transitions, which represents a 1.7-2.7 fold increase compared to annotated polymorphisms and neutral evolutionary substitutions, respectively. Secondary structure predictions show elevated rates of transition from helices and strands into loops and vice versa in the disease mutations dataset. Disease disorder-to-order mutations also influence predicted molecular recognition features (MoRFs more often than the control mutations. The repertoire of disorder-to-order transition mutations is limited, with five most frequent mutations (R→W, R→C, E→K, R→H, R→Q collectively accounting for 44% of all deleterious disorder-to-order transitions. As a proof of concept, we performed accelerated molecular dynamics simulations on a deleterious disorder-to-order transition mutation of tumor protein p63 and, in agreement with our predictions, observed an increased α-helical propensity of the region harboring the mutation. Our findings highlight the importance of mutations in IDRs and refine the traditional structure-centric view of disease mutations. The results of this study

BRCA2, EGFR, and NTRK mutations in mismatch repair-deficient colorectal cancers with MSH2 or MLH1 mutations.

Science.gov (United States)

Deihimi, Safoora; Lev, Avital; Slifker, Michael; Shagisultanova, Elena; Xu, Qifang; Jung, Kyungsuk; Vijayvergia, Namrata; Ross, Eric A; Xiu, Joanne; Swensen, Jeffrey; Gatalica, Zoran; Andrake, Mark; Dunbrack, Roland L; El-Deiry, Wafik S

2017-06-20

Deficient mismatch repair (MMR) and microsatellite instability (MSI) contribute to ~15% of colorectal cancer (CRCs). We hypothesized MSI leads to mutations in DNA repair proteins including BRCA2 and cancer drivers including EGFR. We analyzed mutations among a discovery cohort of 26 MSI-High (MSI-H) and 558 non-MSI-H CRCs profiled at Caris Life Sciences. Caris-profiled MSI-H CRCs had high mutation rates (50% vs 14% in non-MSI-H, P MLH1-mutant CRCs showed higher mutation rates in BRCA2 compared to non-MSH2/MLH1-mutant tumors (38% vs 6%, P MLH1-mutant CRCs included 75 unique mutations not known to occur in breast or pancreatic cancer per COSMIC v73. Only 5 deleterious BRCA2 mutations in CRC were previously reported in the BIC database as germ-line mutations in breast cancer. Some BRCA2 mutations were predicted to disrupt interactions with partner proteins DSS1 and RAD51. Some CRCs harbored multiple BRCA2 mutations. EGFR was mutated in 45.5% of MSH2/MLH1-mutant and 6.5% of non-MSH2/MLH1-mutant tumors (P MLH1-mutant CRC including NTRK1 I699V, NTRK2 P716S, and NTRK3 R745L. Our findings have clinical relevance regarding therapeutic targeting of BRCA2 vulnerabilities, EGFR mutations or other identified oncogenic drivers such as NTRK in MSH2/MLH1-mutant CRCs or other tumors with mismatch repair deficiency.

A splice acceptor mutation in C. elegans daf-19/Rfx disrupts functional specialization of male-specific ciliated neurons but does not affect ciliogenesis.

Science.gov (United States)

Wells, Kristen L; Rowneki, Mazhgan; Killian, Darrell J

2015-04-01

RFX transcription factors are master regulators of ciliogenesis in diverse animal species. The sole Caenorhabditis elegans RFX homolog, DAF-19, plays at least two roles in the formation of functional cilia. The DAF-19(C) isoform is required for ciliogenesis and the DAF-19(M) isoform is required for the functional specialization of a subset of male-specific ciliated neurons called PKD neurons. Here we report the identification of a novel mutation, daf-19(sm129), which disrupts the functional specification of PKD neurons and thus suggests that daf-19m activity is compromised. However, ciliogenesis is not disrupted in daf-19(sm129) mutants suggesting that daf-19c activity is retained. The sm129 mutation disrupts a splice acceptor site adjacent to an exon common to the daf-19c and daf-19m isoforms resulting in aberrant splicing in a proportion of transcripts. While aberrant splicing of daf-19c to upstream cryptic sites results in in-frame and functional products, a large proportion of daf-19m mRNAs include the entire upstream intron, which introduces a frameshift and stop codons. At least 15% of disease-causing mutations affect splicing of the gene bearing the mutation, thus it is important to understand the consequences of splice site mutations on gene function. However, predicting the effects of a splice site mutation remains difficult and experimental determination is still required. Using daf-19(sm129) as a model, our results suggest that this problem is exacerbated when a splice acceptor mutation is used by multiple isoforms of the same gene because the effects on each isoform can be dramatically different. Copyright © 2015 Elsevier B.V. All rights reserved.

A novel ICK mutation causes ciliary disruption and lethal endocrine-cerebro-osteodysplasia syndrome.

Science.gov (United States)

Oud, Machteld M; Bonnard, Carine; Mans, Dorus A; Altunoglu, Umut; Tohari, Sumanty; Ng, Alvin Yu Jin; Eskin, Ascia; Lee, Hane; Rupar, C Anthony; de Wagenaar, Nathalie P; Wu, Ka Man; Lahiry, Piya; Pazour, Gregory J; Nelson, Stanley F; Hegele, Robert A; Roepman, Ronald; Kayserili, Hülya; Venkatesh, Byrappa; Siu, Victoria M; Reversade, Bruno; Arts, Heleen H

2016-01-01

Endocrine-cerebro-osteodysplasia (ECO) syndrome [MIM:612651] caused by a recessive mutation (p.R272Q) in Intestinal cell kinase (ICK) shows significant clinical overlap with ciliary disorders. Similarities are strongest between ECO syndrome, the Majewski and Mohr-Majewski short-rib thoracic dysplasia (SRTD) with polydactyly syndromes, and hydrolethalus syndrome. In this study, we present a novel homozygous ICK mutation in a fetus with ECO syndrome and compare the effect of this mutation with the previously reported ICK variant on ciliogenesis and cilium morphology. Through homozygosity mapping and whole-exome sequencing, we identified a second variant (c.358G > T; p.G120C) in ICK in a Turkish fetus presenting with ECO syndrome. In vitro studies of wild-type and mutant mRFP-ICK (p.G120C and p.R272Q) revealed that, in contrast to the wild-type protein that localizes along the ciliary axoneme and/or is present in the ciliary base, mutant proteins rather enrich in the ciliary tip. In addition, immunocytochemistry revealed a decreased number of cilia in ICK p.R272Q-affected cells. Through identification of a novel ICK mutation, we confirm that disruption of ICK causes ECO syndrome, which clinically overlaps with the spectrum of ciliopathies. Expression of ICK-mutated proteins result in an abnormal ciliary localization compared to wild-type protein. Primary fibroblasts derived from an individual with ECO syndrome display ciliogenesis defects. In aggregate, our findings are consistent with recent reports that show that ICK regulates ciliary biology in vitro and in mice, confirming that ECO syndrome is a severe ciliopathy.

Discrimination of three mutational events that result in a disruption of the R122 primary autolysis site of the human cationic trypsinogen (PRSS1 by denaturing high performance liquid chromatography

Directory of Open Access Journals (Sweden)

Férec Claude

2001-11-01

Full Text Available Abstract Background R122, the primary autolysis site of the human cationic trypsinogen (PRSS1, constitutes an important "self-destruct" or "fail-safe" defensive mechanism against premature trypsin activation within the pancreas. Disruption of this site by a missense mutation, R122H, was found to cause hereditary pancreatitis. In addition to a c.365G>A (CGC>CAC single nucleotide substitution, a c.365~366GC>AT (CGC>CAT gene conversion event in exon 3 of PRSS1 was also found to result in a R122H mutation. This imposes a serious concern on the genotyping of pancreatitis by a widely used polymerase chain reaction-restriction fragment length polymorphism assay, which could only detect the commonest c.365G>A variant. Materials and methods DNA samples containing either the known c.365G>A or c.365~366GC>AT variant in exon 3 of PRSS1 were used as positive controls to establish a denaturing high performance liquid chromatography (DHPLC assay. Results DHPLC could readily discriminate the two known different mutational events resulting in the R122H mutation. More importantly, under the same experimental conditions, it identified a further mutational event that also occurs in the R122 primary autolysis site but results in a different amino acid substitution: c.364C>T (CGC>TGC; R122C. Conclusions A rapid, simple, and low-cost assay for detecting both the known and new mutations occuring in the R122 primary autolysis site of PRSS1 was established. In addition, the newly found R122C variant represents a likely pancreatitis-predisposing mutation.

Targeted disruption of Ataxia-telangiectasia mutated gene in miniature pigs by somatic cell nuclear transfer

Energy Technology Data Exchange (ETDEWEB)

Kim, Young June; Ahn, Kwang Sung; Kim, Minjeong; Kim, Min Ju; Park, Sang-Min; Ryu, Junghyun; Ahn, Jin Seop; Heo, Soon Young; Kang, Jee Hyun; Choi, You Jung [Department of Nanobiomedical Science and BK21 PLUS NBM Global Research Center for Regenerative Medicine, Dankook University, Cheonan (Korea, Republic of); Choi, Seong-Jun [Institute of Tissue Regeneration Engineering, Dankook University, Cheonan (Korea, Republic of); Shim, Hosup, E-mail: shim@dku.edu [Department of Nanobiomedical Science and BK21 PLUS NBM Global Research Center for Regenerative Medicine, Dankook University, Cheonan (Korea, Republic of); Institute of Tissue Regeneration Engineering, Dankook University, Cheonan (Korea, Republic of); Department of Physiology, Dankook University School of Medicine, Cheonan (Korea, Republic of)

2014-10-03

Highlights: • ATM gene-targeted pigs were produced by somatic cell nuclear transfer. • A novel large animal model for ataxia telangiectasia was developed. • The new model may provide an alternative to the mouse model. - Abstract: Ataxia telangiectasia (A-T) is a recessive autosomal disorder associated with pleiotropic phenotypes, including progressive cerebellar degeneration, gonad atrophy, and growth retardation. Even though A-T is known to be caused by the mutations in the Ataxia telangiectasia mutated (ATM) gene, the correlation between abnormal cellular physiology caused by ATM mutations and the multiple symptoms of A-T disease has not been clearly determined. None of the existing ATM mouse models properly reflects the extent to which neurological degeneration occurs in human. In an attempt to provide a large animal model for A-T, we produced gene-targeted pigs with mutations in the ATM gene by somatic cell nuclear transfer. The disrupted allele in the ATM gene of cloned piglets was confirmed via PCR and Southern blot analysis. The ATM gene-targeted pigs generated in the present study may provide an alternative to the current mouse model for the study of mechanisms underlying A-T disorder and for the development of new therapies.

Targeted disruption of Ataxia-telangiectasia mutated gene in miniature pigs by somatic cell nuclear transfer

International Nuclear Information System (INIS)

Kim, Young June; Ahn, Kwang Sung; Kim, Minjeong; Kim, Min Ju; Park, Sang-Min; Ryu, Junghyun; Ahn, Jin Seop; Heo, Soon Young; Kang, Jee Hyun; Choi, You Jung; Choi, Seong-Jun; Shim, Hosup

2014-01-01

Highlights: • ATM gene-targeted pigs were produced by somatic cell nuclear transfer. • A novel large animal model for ataxia telangiectasia was developed. • The new model may provide an alternative to the mouse model. - Abstract: Ataxia telangiectasia (A-T) is a recessive autosomal disorder associated with pleiotropic phenotypes, including progressive cerebellar degeneration, gonad atrophy, and growth retardation. Even though A-T is known to be caused by the mutations in the Ataxia telangiectasia mutated (ATM) gene, the correlation between abnormal cellular physiology caused by ATM mutations and the multiple symptoms of A-T disease has not been clearly determined. None of the existing ATM mouse models properly reflects the extent to which neurological degeneration occurs in human. In an attempt to provide a large animal model for A-T, we produced gene-targeted pigs with mutations in the ATM gene by somatic cell nuclear transfer. The disrupted allele in the ATM gene of cloned piglets was confirmed via PCR and Southern blot analysis. The ATM gene-targeted pigs generated in the present study may provide an alternative to the current mouse model for the study of mechanisms underlying A-T disorder and for the development of new therapies

Mutation of Gly195 of the ChlH subunit of Mg-chelatase reduces chlorophyll and further disrupts PS II assembly in a Ycf48-deficient strain of Synechocystis sp. PCC 6803

Directory of Open Access Journals (Sweden)

Tim Crawford

2016-07-01

Full Text Available Biogenesis of the photosystems in oxygenic phototrophs requires co-translational insertion of chlorophyll a. The first committed step of chlorophyll a biosynthesis is the insertion of a Mg2+ ion into the tetrapyrrole intermediate protoporphyrin IX, catalyzed by Mg-chelatase. We have identified a Synechocystis sp. PCC 6803 strain with a spontaneous mutation in chlH that results in a Gly195 to Glu substitution in a conserved region of the catalytic subunit of Mg-chelatase. Mutant strains containing the ChlH Gly195 to Glu mutation were generated using a two-step protocol that introduced the chlH gene into a putative neutral site in the chromosome prior to deletion of the native gene. The Gly195 to Glu mutation resulted in strains with decreased chlorophyll a. Deletion of the PS II assembly factor Ycf48 in a strain carrying the ChlH Gly195 to Glu mutation did not grow photoautotrophically. In addition, the ChlH-G195E:ΔYcf48 strain showed impaired PS II activity and decreased assembly of PS II centers in comparison to a ΔYcf48 strain. We suggest decreased chlorophyll in the ChlH-G195E mutant provides a background to screen for the role of assembly factors that are not essential under optimal growth conditions.

Three mutations switch H7N9 influenza to human-type receptor specificity

Energy Technology Data Exchange (ETDEWEB)

de Vries, Robert P.; Peng, Wenjie; Grant, Oliver C.; Thompson, Andrew J.; Zhu, Xueyong; Bouwman, Kim M.; de la Pena, Alba T. Torrents; van Breemen, Marielle J.; Ambepitiya Wickramasinghe, Iresha N.; de Haan, Cornelis A. M.; Yu, Wenli; McBride, Ryan; Sanders, Rogier W.; Woods, Robert J.; Verheije, Monique H.; Wilson, Ian A.; Paulson, James C.; Fernandez-Sesma, Ana

2017-06-15

The avian H7N9 influenza outbreak in 2013 resulted from an unprecedented incidence of influenza transmission to humans from infected poultry. The majority of human H7N9 isolates contained a hemagglutinin (HA) mutation (Q226L) that has previously been associated with a switch in receptor specificity from avian-type (NeuAcα2-3Gal) to human-type (NeuAcα2-6Gal), as documented for the avian progenitors of the 1957 (H2N2) and 1968 (H3N2) human influenza pandemic viruses. While this raised concern that the H7N9 virus was adapting to humans, the mutation was not sufficient to switch the receptor specificity of H7N9, and has not resulted in sustained transmission in humans. To determine if the H7 HA was capable of acquiring human-type receptor specificity, we conducted mutation analyses. Remarkably, three amino acid mutations conferred a switch in specificity for human-type receptors that resembled the specificity of the 2009 human H1 pandemic virus, and promoted binding to human trachea epithelial cells.

Three mutations switch H7N9 influenza to human-type receptor specificity.

Directory of Open Access Journals (Sweden)

Robert P de Vries

2017-06-01

Full Text Available The avian H7N9 influenza outbreak in 2013 resulted from an unprecedented incidence of influenza transmission to humans from infected poultry. The majority of human H7N9 isolates contained a hemagglutinin (HA mutation (Q226L that has previously been associated with a switch in receptor specificity from avian-type (NeuAcα2-3Gal to human-type (NeuAcα2-6Gal, as documented for the avian progenitors of the 1957 (H2N2 and 1968 (H3N2 human influenza pandemic viruses. While this raised concern that the H7N9 virus was adapting to humans, the mutation was not sufficient to switch the receptor specificity of H7N9, and has not resulted in sustained transmission in humans. To determine if the H7 HA was capable of acquiring human-type receptor specificity, we conducted mutation analyses. Remarkably, three amino acid mutations conferred a switch in specificity for human-type receptors that resembled the specificity of the 2009 human H1 pandemic virus, and promoted binding to human trachea epithelial cells.

Brain white matter 1 H MRS in Leber optic neuropathy mutation carriers

DEFF Research Database (Denmark)

Ostojic, Jelena; Jancic, Jasna; Kozic, Dusko

2009-01-01

OBJECTIVE: This study was conducted in order to test the hypothesis that proton MR spectroscopic (1H MRS) profile of Leber's hereditary optic neuropathy (LHON) mutation carriers group (including both symptomatic and asymptomatic) differs from group of healthy individuals and to determine metabolite...... or ratio that contributes most to differentiation. PATIENTS AND METHODS: We performed single voxel 1H MRS in normal appearing white matter of eighteen LHON mtDNA mutation carriers bearing one of three LHON mtDNA point mutations and in fifty control subjects. RESULTS: ANOVA showed significant difference...

Disruptive Technologies in Workmanship: pH-neutral Flux, CDM ESD Events, HDI PCBs

Science.gov (United States)

Plante, Jeannette F.

2010-01-01

This slide presentation describes what it calls "disruptive technologies", i.e., "Low-end disruption" occurs when the rate at which products improve exceeds the rate at which customers can adopt the new performance. Therefore, at some point the performance of the product overshoots the needs of certain customer segments. At this point, a disruptive technology may enter the market and provide a product which has lower performance than the incumbent but which exceeds the requirements of certain segments, thereby gaining a foothold in the market. This concept is viewed in impacting incumbent technologies Rosin Flux, with a pH-neutral water soluble Flux; electrostatic discharge models being disrupted by the charge device model (CDM) concept; and High Density Interconnect Printed Circuit Boards (HDI PCB).

A hereditary spastic paraplegia mutation in kinesin-1A/KIF5A disrupts neurofilament transport

Directory of Open Access Journals (Sweden)

Brown Anthony

2010-11-01

Full Text Available Abstract Background Hereditary spastic paraplegias are a group of neurological disorders characterized by progressive distal degeneration of the longest ascending and descending axons in the spinal cord, leading to lower limb spasticity and weakness. One of the dominantly inherited forms of this disease (spastic gait type 10, or SPG10 is caused by point mutations in kinesin-1A (also known as KIF5A, which is thought to be an anterograde motor for neurofilaments. Results We investigated the effect of an SPG10 mutation in kinesin-1A (N256S-kinesin-1A on neurofilament transport in cultured mouse cortical neurons using live-cell fluorescent imaging. N256S-kinesin-1A decreased both anterograde and retrograde neurofilament transport flux by decreasing the frequency of anterograde and retrograde movements. Anterograde velocity was not affected, whereas retrograde velocity actually increased. Conclusions These data reveal subtle complexities to the functional interdependence of the anterograde and retrograde neurofilament motors and they also raise the possibility that anterograde and retrograde neurofilament transport may be disrupted in patients with SPG10.

A novel RUNX2 missense mutation predicted to disrupt DNA binding causes cleidocranial dysplasia in a large Chinese family with hyperplastic nails

Directory of Open Access Journals (Sweden)

Wang Xiaoqin

2007-12-01

Full Text Available Abstract Background Cleidocranial dysplasia (CCD is a dominantly inherited disease characterized by hypoplastic or absent clavicles, large fontanels, dental dysplasia, and delayed skeletal development. The purpose of this study is to investigate the genetic basis of Chinese family with CCD. Methods Here, a large Chinese family with CCD and hyperplastic nails was recruited. The clinical features displayed a significant intrafamilial variation. We sequenced the coding region of the RUNX2 gene for the mutation and phenotype analysis. Results The family carries a c.T407C (p.L136P mutation in the DNA- and CBFβ-binding Runt domain of RUNX2. Based on the crystal structure, we predict this novel missense mutation is likely to disrupt DNA binding by RUNX2, and at least locally affect the Runt domain structure. Conclusion A novel missense mutation was identified in a large Chinese family with CCD with hyperplastic nails. This report further extends the mutation spectrum and clinical features of CCD. The identification of this mutation will facilitate prenatal diagnosis and preimplantation genetic diagnosis.

ERBB4 Mutations that Disrupt the Neuregulin-ErbB4 Pathway Cause Amyotrophic Lateral Sclerosis Type 19

Science.gov (United States)

Takahashi, Yuji; Fukuda, Yoko; Yoshimura, Jun; Toyoda, Atsushi; Kurppa, Kari; Moritoyo, Hiroyoko; Belzil, Veronique V.; Dion, Patrick A.; Higasa, Koichiro; Doi, Koichiro; Ishiura, Hiroyuki; Mitsui, Jun; Date, Hidetoshi; Ahsan, Budrul; Matsukawa, Takashi; Ichikawa, Yaeko; Moritoyo, Takashi; Ikoma, Mayumi; Hashimoto, Tsukasa; Kimura, Fumiharu; Murayama, Shigeo; Onodera, Osamu; Nishizawa, Masatoyo; Yoshida, Mari; Atsuta, Naoki; Sobue, Gen; Fifita, Jennifer A.; Williams, Kelly L.; Blair, Ian P.; Nicholson, Garth A.; Gonzalez-Perez, Paloma; Brown, Robert H.; Nomoto, Masahiro; Elenius, Klaus; Rouleau, Guy A.; Fujiyama, Asao; Morishita, Shinichi; Goto, Jun; Tsuji, Shoji

2013-01-01

Amyotrophic lateral sclerosis (ALS) is a devastating neurological disorder characterized by the degeneration of motor neurons and typically results in death within 3–5 years from onset. Familial ALS (FALS) comprises 5%–10% of ALS cases, and the identification of genes associated with FALS is indispensable to elucidating the molecular pathogenesis. We identified a Japanese family affected by late-onset, autosomal-dominant ALS in which mutations in genes known to be associated with FALS were excluded. A whole- genome sequencing and parametric linkage analysis under the assumption of an autosomal-dominant mode of inheritance with incomplete penetrance revealed the mutation c.2780G>A (p. Arg927Gln) in ERBB4. An extensive mutational analysis revealed the same mutation in a Canadian individual with familial ALS and a de novo mutation, c.3823C>T (p. Arg1275Trp), in a Japanese simplex case. These amino acid substitutions involve amino acids highly conserved among species, are predicted as probably damaging, and are located within a tyrosine kinase domain (p. Arg927Gln) or a C-terminal domain (p. Arg1275Trp), both of which mediate essential functions of ErbB4 as a receptor tyrosine kinase. Functional analysis revealed that these mutations led to a reduced autophosphorylation of ErbB4 upon neuregulin-1 (NRG-1) stimulation. Clinical presentations of the individuals with mutations were characterized by the involvement of both upper and lower motor neurons, a lack of obvious cognitive dysfunction, and relatively slow progression. This study indicates that disruption of the neuregulin-ErbB4 pathway is involved in the pathogenesis of ALS and potentially paves the way for the development of innovative therapeutic strategies such using NRGs or their agonists to upregulate ErbB4 functions. PMID:24119685

Aggregation of ALS-linked FUS mutant sequesters RNA binding proteins and impairs RNA granules formation

Energy Technology Data Exchange (ETDEWEB)

Takanashi, Keisuke; Yamaguchi, Atsushi, E-mail: atsyama@restaff.chiba-u.jp

2014-09-26

Highlights: • Aggregation of ALS-linked FUS mutant sequesters ALS-associated RNA-binding proteins (FUS wt, hnRNP A1, and hnRNP A2). • Aggregation of ALS-linked FUS mutant sequesters SMN1 in the detergent-insoluble fraction. • Aggregation of ALS-linked FUS mutant reduced the number of speckles in the nucleus. • Overproduced ALS-linked FUS mutant reduced the number of processing-bodies (PBs). - Abstract: Protein aggregate/inclusion is one of hallmarks for neurodegenerative disorders including amyotrophic lateral sclerosis (ALS). FUS/TLS, one of causative genes for familial ALS, encodes a multifunctional DNA/RNA binding protein predominantly localized in the nucleus. C-terminal mutations in FUS/TLS cause the retention and the inclusion of FUS/TLS mutants in the cytoplasm. In the present study, we examined the effects of ALS-linked FUS mutants on ALS-associated RNA binding proteins and RNA granules. FUS C-terminal mutants were diffusely mislocalized in the cytoplasm as small granules in transiently transfected SH-SY5Y cells, whereas large aggregates were spontaneously formed in ∼10% of those cells. hnRNP A1, hnRNP A2, and SMN1 as well as FUS wild type were assembled into stress granules under stress conditions, and these were also recruited to FUS mutant-derived spontaneous aggregates in the cytoplasm. These aggregates stalled poly(A) mRNAs and sequestered SMN1 in the detergent insoluble fraction, which also reduced the number of nuclear oligo(dT)-positive foci (speckles) in FISH (fluorescence in situ hybridization) assay. In addition, the number of P-bodies was decreased in cells harboring cytoplasmic granules of FUS P525L. These findings raise the possibility that ALS-linked C-terminal FUS mutants could sequester a variety of RNA binding proteins and mRNAs in the cytoplasmic aggregates, which could disrupt various aspects of RNA equilibrium and biogenesis.

[Analysis of H63D mutation in hemochromatosis (HFE) gene in populations of central Eurasia].

Science.gov (United States)

Khusainova, R I; Khusnutdinova, N N; Litvinov, S S; Khusnutdinova, E K

2013-02-01

An analysis of the frequency of H63D (c. 187C>G) mutations in the HFEgene in 19 populations from Central Eurasia demonstrated that the distribution of the mutation in the region of interest was not uniform and that there were the areas of H63D accumulation. The investigation of three polymorphic variants, c.340+4T>C (rs2071303, IVS2(+4)T>C), c.893-44T>C (rs1800708, IVS4(-44)T>C), and c.1007-47G>A (rs1572982, IVS5(-47)A>G), in the HFE gene in individuals homozygous for H63D mutations in the HFE gene revealed the linkage of H63D with three haplotypes, *CTA, *TG, and *TTA. These findings indicated the partial spread of the mutation in Central Eurasia from Western Europe, as well as the possible repeated appearance of the mutation on the territory on interest.

A novel mutation in CRYAB associated with autosomal dominant congenital nuclear cataract in a Chinese family.

Science.gov (United States)

Chen, Qiang; Ma, Junjie; Yan, Ming; Mothobi, Maneo Emily; Liu, Yuanyuan; Zheng, Fang

2009-07-10

To identify the genetic defects associated with autosomal dominant congenital nuclear cataract in a Chinese family. Clinical data were collected, and the phenotypes of the affected members in this family were recorded by slit-lamp photography. Genomic DNA was isolated from peripheral blood. Mutations were screened in cataract-associated candidate genes through polymerase chain reaction (PCR) analyses and sequencing. Structural models of the wild-type and mutant alphaB-crystallin were generated and analyzed by SWISS-MODEL. Mutation screening identified only one heterozygous G-->A transition at nucleotide 32 in the first exon of alphaB-crystallin (CRYAB), resulting in an amino acid change from arginine to histidine at codon 11 (R11H). This mutation segregated in all available affected family members but was not observed in any of the unaffected persons of the family. The putative mutation disrupted a restriction site for the enzyme, Fnu4HI, in the affected family members. The disruption, however, was not found in any of the randomly selected ophthalmologically normal individuals or in 40 unrelated senile cataract patients. Computer-assisted prediction suggested that this mutation affected the biochemical properties as well as the structure of alphaB-crystallin. These results supported the idea that the novel R11H mutation was responsible for the autosomal dominant nuclear congenital cataract in this pedigree.

TAD disruption as oncogenic driver.

Science.gov (United States)

Valton, Anne-Laure; Dekker, Job

2016-02-01

Topologically Associating Domains (TADs) are conserved during evolution and play roles in guiding and constraining long-range regulation of gene expression. Disruption of TAD boundaries results in aberrant gene expression by exposing genes to inappropriate regulatory elements. Recent studies have shown that TAD disruption is often found in cancer cells and contributes to oncogenesis through two mechanisms. One mechanism locally disrupts domains by deleting or mutating a TAD boundary leading to fusion of the two adjacent TADs. The other mechanism involves genomic rearrangements that break up TADs and creates new ones without directly affecting TAD boundaries. Understanding the mechanisms by which TADs form and control long-range chromatin interactions will therefore not only provide insights into the mechanism of gene regulation in general, but will also reveal how genomic rearrangements and mutations in cancer genomes can lead to misregulation of oncogenes and tumor suppressors. Copyright © 2016 Elsevier Ltd. All rights reserved.

A dominant mutation in mediator of paramutation2, one of three second-largest subunits of a plant-specific RNA polymerase, disrupts multiple siRNA silencing processes.

Science.gov (United States)

Sidorenko, Lyudmila; Dorweiler, Jane E; Cigan, A Mark; Arteaga-Vazquez, Mario; Vyas, Meenal; Kermicle, Jerry; Jurcin, Diane; Brzeski, Jan; Cai, Yu; Chandler, Vicki L

2009-11-01

Paramutation involves homologous sequence communication that leads to meiotically heritable transcriptional silencing. We demonstrate that mop2 (mediator of paramutation2), which alters paramutation at multiple loci, encodes a gene similar to Arabidopsis NRPD2/E2, the second-largest subunit of plant-specific RNA polymerases IV and V. In Arabidopsis, Pol-IV and Pol-V play major roles in RNA-mediated silencing and a single second-largest subunit is shared between Pol-IV and Pol-V. Maize encodes three second-largest subunit genes: all three genes potentially encode full length proteins with highly conserved polymerase domains, and each are expressed in multiple overlapping tissues. The isolation of a recessive paramutation mutation in mop2 from a forward genetic screen suggests limited or no functional redundancy of these three genes. Potential alternative Pol-IV/Pol-V-like complexes could provide maize with a greater diversification of RNA-mediated transcriptional silencing machinery relative to Arabidopsis. Mop2-1 disrupts paramutation at multiple loci when heterozygous, whereas previously silenced alleles are only up-regulated when Mop2-1 is homozygous. The dramatic reduction in b1 tandem repeat siRNAs, but no disruption of silencing in Mop2-1 heterozygotes, suggests the major role for tandem repeat siRNAs is not to maintain silencing. Instead, we hypothesize the tandem repeat siRNAs mediate the establishment of the heritable silent state-a process fully disrupted in Mop2-1 heterozygotes. The dominant Mop2-1 mutation, which has a single nucleotide change in a domain highly conserved among all polymerases (E. coli to eukaryotes), disrupts both siRNA biogenesis (Pol-IV-like) and potentially processes downstream (Pol-V-like). These results suggest either the wild-type protein is a subunit in both complexes or the dominant mutant protein disrupts both complexes. Dominant mutations in the same domain in E. coli RNA polymerase suggest a model for Mop2-1 dominance

A mutation in the tuft mouse disrupts TET1 activity and alters the expression of genes that are crucial for neural tube closure

Directory of Open Access Journals (Sweden)

Keith S. K. Fong

2016-05-01

Full Text Available Genetic variations affecting neural tube closure along the head result in malformations of the face and brain. Neural tube defects (NTDs are among the most common birth defects in humans. We previously reported a mouse mutant called tuft that arose spontaneously in our wild-type 3H1 colony. Adult tuft mice present midline craniofacial malformations with or without an anterior cephalocele. In addition, affected embryos presented neural tube closure defects resulting in insufficient closure of the anterior neuropore or exencephaly. Here, through whole-genome sequencing, we identified a nonsense mutation in the Tet1 gene, which encodes a methylcytosine dioxygenase (TET1, co-segregating with the tuft phenotype. This mutation resulted in premature termination that disrupts the catalytic domain that is involved in the demethylation of cytosine. We detected a significant loss of TET enzyme activity in the heads of tuft embryos that were homozygous for the mutation and had NTDs. RNA-Seq transcriptome analysis indicated that multiple gene pathways associated with neural tube closure were dysregulated in tuft embryo heads. Among them, the expressions of Cecr2, Epha7 and Grhl2 were significantly reduced in some embryos presenting neural tube closure defects, whereas one or more components of the non-canonical WNT signaling pathway mediating planar cell polarity and convergent extension were affected in others. We further show that the recombinant mutant TET1 protein was capable of entering the nucleus and affected the expression of endogenous Grhl2 in IMCD-3 (inner medullary collecting duct cells. These results indicate that TET1 is an epigenetic determinant for regulating genes that are crucial to closure of the anterior neural tube and its mutation has implications to craniofacial development, as presented by the tuft mouse.

Y682 mutation of amyloid precursor protein promotes endo-lysosomal dysfunction by disrupting APP-SorLA interaction

Directory of Open Access Journals (Sweden)

Luca Rosario La Rosa

2015-04-01

Full Text Available The intracellular transport and localization of amyloid precursor protein (APP are critical determinants of APP processing and β-amyloid peptide production, thus crucially important for the pathophysiology of Alzheimer’s disease (AD. Notably, the C-terminal Y682ENPTY687 domain of APP binds to specific adaptors controlling APP trafficking and sorting in neurons. Mutation on the Y682 residue to glycine (Y682G leads to altered APP sorting in hippocampal neurons that favors its accumulation in intracellular compartments and the release of soluble APPα. Such alterations induce premature aging and learning and cognitive deficits in APP Y682G mutant mice (APPYG/YG. Here, we report that Y682G mutation affects formation of the APP complex with sortilin-related receptor (SorLA, resulting in endo-lysosomal dysfunctions and neuronal degeneration. Moreover, disruption of the APP/SorLA complex changes the trafficking pathway of SorLA, with its consequent increase in secretion outside neurons. Mutations in the SorLA gene are a prognostic factor in AD, and increases in SorLA levels in cerebrospinal fluid are predictive of AD in humans. These results might open new possibilities in comprehending the role played by SorLA in its interaction with APP and in the progression of neuronal degeneration. In addition, they further underline the crucial role played by Y682 residue in controlling APP trafficking in neurons.

Adhesion of Escherichia coli under flow conditions reveals potential novel effects of FimH mutations

DEFF Research Database (Denmark)

Feenstra, T.; Schmidt Thøgersen, Mariane; Wieser, E.

2017-01-01

H mutations on bacterial adhesion using a novel adhesion assay, which models the physiological flow conditions bacteria are exposed to. We introduced 12 different point mutations in the mannose binding pocket of FimH in an E. coli strain expressing type 1 fimbriae only (MSC95-FimH). We compared the bacterial...... adhesion of each mutant across several commonly used adhesion assays, including agglutination of yeast, adhesion to mono- and tri-mannosylated substrates, and static adhesion to bladder epithelial and endothelial cells. We performed a comparison of these assays to a novel method that we developed to study...... mutations abrogated adhesion. We demonstrated that FimH residues E50 and T53 are crucial for adhesion under flow conditions. The coating of endothelial cells on biochips and modelling of physiological flow conditions enabled us to identify FimH residues crucial for adhesion. These results provide novel...

Cis-regulatory somatic mutations and gene-expression alteration in B-cell lymphomas.

Science.gov (United States)

Mathelier, Anthony; Lefebvre, Calvin; Zhang, Allen W; Arenillas, David J; Ding, Jiarui; Wasserman, Wyeth W; Shah, Sohrab P

2015-04-23

With the rapid increase of whole-genome sequencing of human cancers, an important opportunity to analyze and characterize somatic mutations lying within cis-regulatory regions has emerged. A focus on protein-coding regions to identify nonsense or missense mutations disruptive to protein structure and/or function has led to important insights; however, the impact on gene expression of mutations lying within cis-regulatory regions remains under-explored. We analyzed somatic mutations from 84 matched tumor-normal whole genomes from B-cell lymphomas with accompanying gene expression measurements to elucidate the extent to which these cancers are disrupted by cis-regulatory mutations. We characterize mutations overlapping a high quality set of well-annotated transcription factor binding sites (TFBSs), covering a similar portion of the genome as protein-coding exons. Our results indicate that cis-regulatory mutations overlapping predicted TFBSs are enriched in promoter regions of genes involved in apoptosis or growth/proliferation. By integrating gene expression data with mutation data, our computational approach culminates with identification of cis-regulatory mutations most likely to participate in dysregulation of the gene expression program. The impact can be measured along with protein-coding mutations to highlight key mutations disrupting gene expression and pathways in cancer. Our study yields specific genes with disrupted expression triggered by genomic mutations in either the coding or the regulatory space. It implies that mutated regulatory components of the genome contribute substantially to cancer pathways. Our analyses demonstrate that identifying genomically altered cis-regulatory elements coupled with analysis of gene expression data will augment biological interpretation of mutational landscapes of cancers.

HFE gene C282Y, H63D and S65C mutations frequency in the Transylvania region, Romania.

Science.gov (United States)

Trifa, Adrian P; Popp, Radu A; Militaru, Mariela S; Farcaş, Marius F; Crişan, Tania O; Gana, Ionuţ; Cucuianu, Andrei; Pop, Ioan V

2012-06-01

HFE-associated haemochromatosis is one of the most frequent autosomal recessive disorders in the Caucasian population. Although most of the cases are homozygous individuals for the C282Y mutation, another two mutations, H63D and S65C, have been reported to be associated with milder forms of the disease. This study was a first attempt to evaluate the distribution of these HFE gene mutations in the Transylvania region. Two-hundred and twenty-five healthy, unrelated volunteers originating from the Transylvania region, Romania, were screened for the HFE gene C282Y, H63D and S65C mutations, using molecular genetics assays (Polymerase Chain Reaction-Restriction Fragments Length Polymorphism). For the C282Y mutation, 7 heterozygotes (3.1%) were found, but no homozygous individual. In the case of the H63D mutation, 40 heterozygotes (17.8%) and 4 homozygotes (1.75%) for the mutant allele were evidenced. We found a compound heterozygous genotype (C282Y/H63D) in one individual (0.45%). Thus, the allele frequencies of the C282Y and H63D were 1.75% and 10.9%, respectively. Three individuals (1.3%) were found to harbour the S65C mutation in a heterozygous state, but none in a homozygous state: the allele frequency of the mutant allele was 0.75%. The distribution of the HFE gene C282Y, H63D and S65C mutations found in our group matches the tendencies observed in other European countries: a decreasing gradient from Northern to Southern Europe for the C282Y mutation; high frequency for the H63D mutation, and low frequency for the S65C mutation in most of the countries.

Human Splicing Finder: an online bioinformatics tool to predict splicing signals.

Science.gov (United States)

Desmet, François-Olivier; Hamroun, Dalil; Lalande, Marine; Collod-Béroud, Gwenaëlle; Claustres, Mireille; Béroud, Christophe

2009-05-01

Thousands of mutations are identified yearly. Although many directly affect protein expression, an increasing proportion of mutations is now believed to influence mRNA splicing. They mostly affect existing splice sites, but synonymous, non-synonymous or nonsense mutations can also create or disrupt splice sites or auxiliary cis-splicing sequences. To facilitate the analysis of the different mutations, we designed Human Splicing Finder (HSF), a tool to predict the effects of mutations on splicing signals or to identify splicing motifs in any human sequence. It contains all available matrices for auxiliary sequence prediction as well as new ones for binding sites of the 9G8 and Tra2-beta Serine-Arginine proteins and the hnRNP A1 ribonucleoprotein. We also developed new Position Weight Matrices to assess the strength of 5' and 3' splice sites and branch points. We evaluated HSF efficiency using a set of 83 intronic and 35 exonic mutations known to result in splicing defects. We showed that the mutation effect was correctly predicted in almost all cases. HSF could thus represent a valuable resource for research, diagnostic and therapeutic (e.g. therapeutic exon skipping) purposes as well as for global studies, such as the GEN2PHEN European Project or the Human Variome Project.

Variations in the detection of ZAP-70 in chronic lymphocytic leukemia: Comparison with IgV(H) mutation analysis.

Science.gov (United States)

Sheikholeslami, M R; Jilani, I; Keating, M; Uyeji, J; Chen, K; Kantarjian, H; O'Brien, S; Giles, F; Albitar, M

2006-07-15

Lack of immunoglobulin heavy chain genes (IgV(H)) mutation in patients with chronic lymphocytic leukemia (CLL) is associated with rapid disease progression and shorter survival. The zeta-chain (T-cell receptor) associated protein kinase 70 kDa (ZAP-70) has been reported to be a surrogate marker for IgV(H) mutation status, and its expression in leukemic cells correlates with unmutated IgV(H). However, ZAP-70 detection by flow cytometry varies significantly dependant on the antibodies used, the method of performing the assay, and the condition of the cells in the specimen. The clinical value of ZAP-70 testing when samples are shipped under poorly controlled conditions is not known. Furthermore, testing in a research environment may differ from testing in a routine clinical laboratory. We validated an assay for ZAP-70 by comparing results with clinical outcome and the mutation status of the IgV(H). Using stored samples, we show significant correlation between ZAP-70 expression and clinical outcome as well as IgV(H) mutation at a cut-off point of 15%. While positive samples (>15% positivity) remain positive when kept in the laboratory environment for 48 h after initial testing, results obtained from samples from CLL patients tested after shipping at room temperature for routine testing showed no correlation with IgV(H) mutation status when 15% cut-off was used. In these samples, cut-point of 10% correlated with the IgV(H) mutation (P = 0.0001). This data suggests that although ZAP-70 positivity correlates with IgV(H) mutation status and survival, variations in sample handling and preparation may influence results. We show that IgV(H) mutation results, unlike ZAP-70 remain correlated with CD38 expression and beta-2 microglobulin in shipped samples, and ZAP-70 testing should not be used as the sole criterion for stratifying patients for therapy. (c) 2006 International Society for Analytical Cytology.

Genome-Wide Mutation Rate Response to pH Change in the Coral Reef Pathogen Vibrio shilonii AK1.

Science.gov (United States)

Strauss, Chloe; Long, Hongan; Patterson, Caitlyn E; Te, Ronald; Lynch, Michael

2017-08-22

Recent application of mutation accumulation techniques combined with whole-genome sequencing (MA/WGS) has greatly promoted studies of spontaneous mutation. However, such explorations have rarely been conducted on marine organisms, and it is unclear how marine habitats have influenced genome stability. This report resolves the mutation rate and spectrum of the coral reef pathogen Vibrio shilonii , which causes coral bleaching and endangers the biodiversity maintained by coral reefs. We found that its mutation rate and spectrum are highly similar to those of other studied bacteria from various habitats, despite the saline environment. The mutational properties of this marine bacterium are thus controlled by other general evolutionary forces such as natural selection and genetic drift. We also found that as pH drops, the mutation rate decreases and the mutation spectrum is biased in the direction of generating G/C nucleotides. This implies that evolutionary features of this organism and perhaps other marine microbes might be altered by the increasingly acidic ocean water caused by excess CO 2 emission. Nonetheless, further exploration is needed as the pH range tested in this study was rather narrow and many other possible mutation determinants, such as carbonate increase, are associated with ocean acidification. IMPORTANCE This study explored the pH dependence of a bacterial genome-wide mutation rate. We discovered that the genome-wide rates of appearance of most mutation types decrease linearly and that the mutation spectrum is biased in generating more G/C nucleotides with pH drop in the coral reef pathogen V. shilonii . Copyright © 2017 Strauss et al.

Long noncoding RNA NEAT1 promotes cell proliferation and invasion by regulating hnRNP A2 expression in hepatocellular carcinoma cells

Directory of Open Access Journals (Sweden)

Mang YY

2017-02-01

Full Text Available Yuanyi Mang, Li Li, Jianghua Ran, Shengning Zhang, Jing Liu, Laibang Li, Yiming Chen, Jian Liu, Yang Gao, Gang Ren Department of Hepato-Biliary-Pancreatic Surgery, The Calmette Affiliated Hospital of Kunming Medical University, The First Hospital of Kunming, Kunming, Yunnan, People’s Republic of China Abstract: Growing evidence demonstrates that long noncoding RNAs (lncRNAs are involved in the progression of various cancers, including hepatocellular carcinoma (HCC. The role of nuclear-enriched abundant transcript 1 (NEAT1, an essential lncRNA for the formation of nuclear body paraspeckles, has not been fully explored in HCC. We aimed to determine the expression, roles and functional mechanisms of NEAT1 in the proliferation and invasion of HCC. Based on real-time polymerase chain reaction data, we suggest that NEAT1 is upregulated in HCC tissues compared with noncancerous liver tissues. The knockdown of NEAT1 altered global gene expression patterns and reduced HCC cell proliferation, invasion and migration. RNA immunoprecipitation and RNA pull-down assays confirmed that U2AF65 binds to NEAT1. Furthermore, the study indicated that NEAT1 regulated hnRNP A2 expression and that this regulation may be associated with the NEAT1–U2AF65 protein complex. Thus, the NEAT1-hnRNP A2 regulation mechanism promotes HCC pathogenesis and may provide a potential target for the prognosis and treatment of HCC. Keywords: long noncoding RNA, NEAT1, RNA-binding protein, HCC

The histone H3.3K36M mutation reprograms the epigenome of chondroblastomas

Science.gov (United States)

Fang, Dong; Gan, Haiyun; Lee, Jeong-Heon; Han, Jing; Wang, Zhiquan; Riester, Scott M.; Jin, Long; Chen, Jianji; Zhou, Hui; Wang, Jinglong; Zhang, Honglian; Yang, Na; Bradley, Elizabeth W.; Ho, Thai H.; Rubin, Brian P.; Bridge, Julia A.; Thibodeau, Stephen N; Ordog, Tamas; Chen, Yue; van Wijnen, Andre J.; Oliveira, Andre M.; Xu, Rui-Ming; Westendorf, Jennifer J.; Zhang, Zhiguo

2016-01-01

Over 90% of chondroblastomas contain a heterozygous mutation replacing lysine 36 with methionine (K36M) in the histone H3 variant H3.3. Here, we show that H3K36 methylation is reduced globally in chondroblastomas and in chondrocytes harboring the same genetic mutation due to inhibition of at least two H3K36 methyltransferases, MMSET and SETD2, by the H3.3K36M mutant proteins. Genes with altered expression as well as H3K36 di- and trimethylation in H3.3K36M cells are enriched in cancer pathways. In addition, H3.3K36M chondrocytes exhibit several hallmarks of cancer cells including increased ability to form colonies, resistance to apoptosis and defects in differentiation. Thus, H3.3K36M proteins reprogram H3K36 methylation landscape and contribute to tumorigenesis in part through altering the expression of cancer-associated genes. PMID:27229140

Understanding the cross-resistance of oseltamivir to H1N1 and H5N1 influenza A neuraminidase mutations using multidimensional computational analyses

Directory of Open Access Journals (Sweden)

Singh A

2015-07-01

Full Text Available Ashona Singh, Mahmoud E Soliman School of Health Sciences, University of KwaZulu-Natal, Westville, Durban, South Africa Abstract: This study embarks on a comprehensive description of the conformational contributions to resistance of neuraminidase (N1 in H1N1 and H5N1 to oseltamivir, using comparative multiple molecular dynamic simulations. The available data with regard to elucidation of the mechanism of resistance as a result of mutations in H1N1 and H5N1 neuraminidases is not well established. Enhanced post-dynamic analysis, such as principal component analysis, solvent accessible surface area, free binding energy calculations, and radius of gyration were performed to gain a precise insight into the binding mode and origin of resistance of oseltamivir in H1N1 and H5N1 mutants. Three significant features reflecting resistance in the presence of mutations H274Y and I222K, of the protein complexed with the inhibitor are: reduced flexibility of the a-carbon backbone; an improved ΔEele of ~15 (kcal/mol for H1N1 coupled with an increase in ΔGsol­ (~13 kcal/mol from wild-type to mutation; a low binding affinity in comparison with the wild-type of ~2 (kcal/mol and ~7 (kcal/mol with respect to each mutation for the H5N1 systems; and reduced hydrophobicity of the overall surface structure due to an impaired hydrogen bonding network. We believe the results of this study will ultimately provide a useful insight into the structural landscape of neuraminidase-associated binding of oseltamivir. Furthermore, the results can be used in the design and development of potent inhibitors of neuraminidases. Keywords: neuraminidase, molecular dynamics, resistance, mutation, binding free energy

Random mutagenesis screening indicates the absence of a separate H(+)-sensor in the pH-sensitive Kir channels.

Science.gov (United States)

Paynter, Jennifer J; Shang, Lijun; Bollepalli, Murali K; Baukrowitz, Thomas; Tucker, Stephen J

2010-01-01

Several inwardly-rectifying (Kir) potassium channels (Kir1.1, Kir4.1 and Kir4.2) are characterised by their sensitivity to inhibition by intracellular H(+) within the physiological range. The mechanism by which these channels are regulated by intracellular pH has been the subject of intense scrutiny for over a decade, yet the molecular identity of the titratable pH-sensor remains elusive. In this study we have taken advantage of the acidic intracellular environment of S. cerevisiae and used a K(+) -auxotrophic strain to screen for mutants of Kir1.1 with impaired pH-sensitivity. In addition to the previously identified K80M mutation, this unbiased screening approach identified a novel mutation (S172T) in the second transmembrane domain (TM2) that also produces a marked reduction in pH-sensitivity through destabilization of the closed-state. However, despite this extensive mutagenic approach, no mutations could be identified which removed channel pH-sensitivity or which were likely to act as a separate H(+) -sensor unique to the pH-sensitive Kir channels. In order to explain these results we propose a model in which the pH-sensing mechanism is part of an intrinsic gating mechanism common to all Kir channels, not just the pH-sensitive Kir channels. In this model, mutations which disrupt this pH-sensor would result in an increase, not reduction, in pH-sensitivity. This has major implications for any future studies of Kir channel pH-sensitivity and explains why formal identification of these pH-sensing residues still represents a major challenge.

R179H mutation in ACTA2 expanding the phenotype to include prune-belly sequence and skin manifestations.

Science.gov (United States)

Richer, J; Milewicz, D M; Gow, R; de Nanassy, J; Maharajh, G; Miller, E; Oppenheimer, L; Weiler, G; O'Connor, M

2012-03-01

Mutations in ACTA2 (smooth muscle cell-specific isoform of α-actin) lead to a predisposition to thoracic aortic aneurysms and other vascular diseases. More recently, the ACTA2 R179H mutation has been described in individuals with global smooth muscle dysfunction. We report a patient heterozygous for the mutation in ACTA2 R179H who presented with megacystis at 13 weeks gestational age and, at birth, with prune-belly sequence. He also had deep skin dimples and creases on his palms and soles, a finding not previously described but possibly related to ACTA2. To our knowledge, this is the first report of the R179H mutation in ACTA2 in a child with prune-belly sequence. We think the R179H mutation in ACTA2 should be included in the differential diagnosis of individuals presenting with the sequence without an identified mechanical obstruction. Furthermore, as ACTA2 R179H has been reported in patients with severe vasculomyopathy and premature death, we recommend that molecular testing for this mutation be considered in fetuses presenting with fetal megacystis with a normal karyotype, particularly if the bladder diameter is 15 mm or more, to allow expectant parents to make an informed decision. Copyright © 2012 Wiley Periodicals, Inc.

Association of the germline TP53 R337H mutation with breast cancer in southern Brazil

International Nuclear Information System (INIS)

Assumpção, Juliana G; Zeferino, Luiz Carlos; Dufloth, Rozany M; Brandalise, Silvia Regina; Yunes, José Andres; Seidinger, Ana Luíza; Mastellaro, Maria José; Ribeiro, Raul C; Zambetti, Gerard P; Ganti, Ramapriya; Srivastava, Kumar; Shurtleff, Sheila; Pei, Deqing

2008-01-01

The germline TP53-R337H mutation is strongly associated with pediatric adrenocortical tumors (ACT) in southern Brazil; it has low penetrance and limited tissue specificity in most families and therefore is not associated with Li-Fraumeni syndrome. However, other tumor types, mainly breast cancer, have been observed in carriers of several unrelated kindreds, raising the possibility that the R337H mutation may also contribute to breast tumorigenesis in a genetic background-specific context. We conducted a case-control study to determine the prevalence of the R337H mutation by sequencing TP53 exon 10 in 123 women with breast cancer and 223 age- and sex-matched control subjects from southern Brazil. Fisher's test was used to compare the prevalence of the R337H. The R337H mutation was found in three patients but in none of the controls (p = 0.0442). Among the carriers, two had familial history of cancer meeting the Li-Fraumeni-like criteria. Remarkably, tumors in each of these three cases underwent loss of heterozygosity by eliminating the mutant TP53 allele rather than the wild-type allele. Polymorphisms were identified within the TP53 (R72P and Ins16) and MDM2 (SNP309) genes that may further diminish TP53 tumor suppressor activity. These results demonstrate that the R337H mutation can significantly increase the risk of breast cancer in carriers, which likely depends on additional cooperating genetic factors. These findings are also important for understanding how low-penetrant mutant TP53 alleles can differentially influence tumor susceptibility

Hormad1 mutation disrupts synaptonemal complex formation, recombination, and chromosome segregation in mammalian meiosis.

Directory of Open Access Journals (Sweden)

Yong-Hyun Shin

2010-11-01

Full Text Available Meiosis is unique to germ cells and essential for reproduction. During the first meiotic division, homologous chromosomes pair, recombine, and form chiasmata. The homologues connect via axial elements and numerous transverse filaments to form the synaptonemal complex. The synaptonemal complex is a critical component for chromosome pairing, segregation, and recombination. We previously identified a novel germ cell-specific HORMA domain encoding gene, Hormad1, a member of the synaptonemal complex and a mammalian counterpart to the yeast meiotic HORMA domain protein Hop1. Hormad1 is essential for mammalian gametogenesis as knockout male and female mice are infertile. Hormad1 deficient (Hormad1(-/ (- testes exhibit meiotic arrest in the early pachytene stage, and synaptonemal complexes cannot be visualized by electron microscopy. Hormad1 deficiency does not affect localization of other synaptonemal complex proteins, SYCP2 and SYCP3, but disrupts homologous chromosome pairing. Double stranded break formation and early recombination events are disrupted in Hormad1(-/ (- testes and ovaries as shown by the drastic decrease in the γH2AX, DMC1, RAD51, and RPA foci. HORMAD1 co-localizes with γH2AX to the sex body during pachytene. BRCA1, ATR, and γH2AX co-localize to the sex body and participate in meiotic sex chromosome inactivation and transcriptional silencing. Hormad1 deficiency abolishes γH2AX, ATR, and BRCA1 localization to the sex chromosomes and causes transcriptional de-repression on the X chromosome. Unlike testes, Hormad1(-/ (- ovaries have seemingly normal ovarian folliculogenesis after puberty. However, embryos generated from Hormad1(-/ (- oocytes are hyper- and hypodiploid at the 2 cell and 8 cell stage, and they arrest at the blastocyst stage. HORMAD1 is therefore a critical component of the synaptonemal complex that affects synapsis, recombination, and meiotic sex chromosome inactivation and transcriptional silencing.

Compactness of viral genomes: effect of disperse and localized random mutations

Science.gov (United States)

Lošdorfer Božič, Anže; Micheletti, Cristian; Podgornik, Rudolf; Tubiana, Luca

2018-02-01

Genomes of single-stranded RNA viruses have evolved to optimize several concurrent properties. One of them is the architecture of their genomic folds, which must not only feature precise structural elements at specific positions, but also allow for overall spatial compactness. The latter was shown to be disrupted by random synonymous mutations, a disruption which can consequently negatively affect genome encapsidation. In this study, we use three mutation schemes with different degrees of locality to mutate the genomes of phage MS2 and Brome Mosaic virus in order to understand the observed sensitivity of the global compactness of their folds. We find that mutating local stretches of their genomes’ sequence or structure is less disruptive to their compactness compared to inducing randomly-distributed mutations. Our findings are indicative of a mechanism for the conservation of compactness acting on a global scale of the genomes, and have several implications for understanding the interplay between local and global architecture of viral RNA genomes.

Improving solubility and refolding efficiency of human V(H)s by a novel mutational approach.

Science.gov (United States)

Tanha, Jamshid; Nguyen, Thanh-Dung; Ng, Andy; Ryan, Shannon; Ni, Feng; Mackenzie, Roger

2006-11-01

The antibody V(H) domains of camelids tend to be soluble and to resist aggregation, in contrast to human V(H) domains. For immunotherapy, attempts have therefore been made to improve the properties of human V(H)s by camelization of a small set of framework residues. Here, we have identified through sequence comparison of well-folded llama V(H) domains an alternative set of residues (not typically camelid) for mutation. Thus, the solubility and thermal refolding efficiency of a typical human V(H), derived from the human antibody BT32/A6, were improved by introduction of two mutations in framework region (FR) 1 and 4 to generate BT32/A6.L1. Three more mutations in FR3 of BT32/A6.L1 further improved the thermal refolding efficiency while retaining solubility and cooperative melting profiles. To demonstrate practical utility, BT32/A6.L1 was used to construct a phage display library from which were isolated human V(H)s with good antigen binding activity and solubility. The engineered human V(H) domains described here may be useful for immunotherapy, due to their expected low immunogenicity, and in applications involving transient high temperatures, due to their efficient refolding after thermal denaturation.

Identification of a novel FAM83H mutation and microhardness of an affected molar in autosomal dominant hypocalcified amelogenesis imperfecta.

Science.gov (United States)

Hyun, H-K; Lee, S-K; Lee, K-E; Kang, H-Y; Kim, E-J; Choung, P-H; Kim, J-W

2009-11-01

To determine the underlying molecular genetic aetiology of a family with the hypocalcified form of amelogenesis imperfecta and to investigate the hardness of the enamel and dentine of a known FAM83H mutation. Mutational screening of the FAM83H on the basis of candidate gene approach was performed. All exons and exon-intron boundaries was amplified and sequenced. A microhardness test was performed to measure the Vickers microhardness value. A novel nonsense mutation (c.1354C>T, p.Q452X) was identified in the last exon of FAM83H, which resulted in soft, uncalcified enamel. The affected enamel was extremely soft (about 17% of the normal control), but the underlying dentine was as hard as the normal control. Mutational analysis revealed a novel mutation in FAM83H gene. Hardness of dentine was not affected by the mutation, whilst the enamel was extremely soft.

Dynamic of Mutational Events in Variable Number Tandem Repeats of Escherichia coli O157:H7

Directory of Open Access Journals (Sweden)

A. V. Bustamante

2013-01-01

Full Text Available VNTRs regions have been successfully used for bacterial subtyping; however, the hypervariability in VNTR loci is problematic when trying to predict the relationships among isolates. Since few studies have examined the mutation rate of these markers, our aim was to estimate mutation rates of VNTRs specific for verotoxigenic E. coli O157:H7. The knowledge of VNTR mutational rates and the factors affecting them would make MLVA more effective for epidemiological or microbial forensic investigations. For this purpose, we analyzed nine loci performing parallel, serial passage experiments (PSPEs on 9 O157:H7 strains. The combined 9 PSPE population rates for the 8 mutating loci ranged from 4.4 × 10−05 to 1.8 × 10−03 mutations/generation, and the combined 8-loci mutation rate was of 2.5 × 10−03 mutations/generation. Mutations involved complete repeat units, with only one point mutation detected. A similar proportion between single and multiple repeat changes was detected. Of the 56 repeat mutations, 59% were insertions and 41% were deletions, and 72% of the mutation events corresponded to O157-10 locus. For alleles with up to 13 UR, a constant and low mutation rate was observed; meanwhile longer alleles were associated with higher and variable mutation rates. Our results are useful to interpret data from microevolution and population epidemiology studies and particularly point out that the inclusion or not of O157-10 locus or, alternatively, a differential weighting data according to the mutation rates of loci must be evaluated in relation with the objectives of the proposed study.

Regulation of pH During Amelogenesis.

Science.gov (United States)

Lacruz, Rodrigo S; Nanci, Antonio; Kurtz, Ira; Wright, J Timothy; Paine, Michael L

2010-02-01

During amelogenesis, extracellular matrix proteins interact with growing hydroxyapatite crystals to create one of the most architecturally complex biological tissues. The process of enamel formation is a unique biomineralizing system characterized first by an increase in crystallite length during the secretory phase of amelogenesis, followed by a vast increase in crystallite width and thickness in the later maturation phase when organic complexes are enzymatically removed. Crystal growth is modulated by changes in the pH of the enamel microenvironment that is critical for proper enamel biomineralization. Whereas the genetic bases for most abnormal enamel phenotypes (amelogenesis imperfecta) are generally associated with mutations to enamel matrix specific genes, mutations to genes involved in pH regulation may result in severely affected enamel structure, highlighting the importance of pH regulation for normal enamel development. This review summarizes the intra- and extracellular mechanisms employed by the enamel-forming cells, ameloblasts, to maintain pH homeostasis and, also, discusses the enamel phenotypes associated with disruptions to genes involved in pH regulation.

Association of the germline TP53 R337H mutation with breast cancer in southern Brazil

Directory of Open Access Journals (Sweden)

Srivastava Kumar

2008-12-01

Full Text Available Abstract Background The germline TP53-R337H mutation is strongly associated with pediatric adrenocortical tumors (ACT in southern Brazil; it has low penetrance and limited tissue specificity in most families and therefore is not associated with Li-Fraumeni syndrome. However, other tumor types, mainly breast cancer, have been observed in carriers of several unrelated kindreds, raising the possibility that the R337H mutation may also contribute to breast tumorigenesis in a genetic background-specific context. Methods We conducted a case-control study to determine the prevalence of the R337H mutation by sequencing TP53 exon 10 in 123 women with breast cancer and 223 age- and sex-matched control subjects from southern Brazil. Fisher's test was used to compare the prevalence of the R337H. Results The R337H mutation was found in three patients but in none of the controls (p = 0.0442. Among the carriers, two had familial history of cancer meeting the Li-Fraumeni-like criteria. Remarkably, tumors in each of these three cases underwent loss of heterozygosity by eliminating the mutant TP53 allele rather than the wild-type allele. Polymorphisms were identified within the TP53 (R72P and Ins16 and MDM2 (SNP309 genes that may further diminish TP53 tumor suppressor activity. Conclusion These results demonstrate that the R337H mutation can significantly increase the risk of breast cancer in carriers, which likely depends on additional cooperating genetic factors. These findings are also important for understanding how low-penetrant mutant TP53 alleles can differentially influence tumor susceptibility.

Complement factor H deficiency and endocapillary glomerulonephritis due to paternal isodisomy and a novel factor H mutation

DEFF Research Database (Denmark)

Schejbel, L; Schmidt, I M; Kirchhoff, Eva Maria

2011-01-01

Complement factor H (CFH) is a regulator of the alternative complement activation pathway. Mutations in the CFH gene are associated with atypical hemolytic uremic syndrome, membranoproliferative glomerulonephritis type II and C3 glomerulonephritis. Here, we report a 6-month-old CFH-deficient child...

HFE H63D mutation frequency shows an increase in Turkish women with breast cancer

Directory of Open Access Journals (Sweden)

Guler Emine

2006-02-01

Full Text Available Abstract Background The hereditary hemochromatosis gene HFE plays a pivotal role in iron homeostasis. The association between cancer and HFE hetero- or homozygosity has previously been shown including hepatocellular and nonhepatocellular malignancies. This study was performed to compare frequencies of HFE C282Y and H63D variants in Turkish women with breast cancer and healthy controls. Methods Archived DNA samples of Hacettepe University Oncology Institute were used in this study. The HFE gene was investigated by PCR-RFLP. Results All subjects studied were free from C282Y mutation. Thirty-nine patients had H63D mutation and were all heterozygous. H63D allele frequency was 22.2% (39/176 in the breast cancer patients, and 14% (28/200 in the healthy volunteers. Statistical analysis of cases with HFE H63D phenotype showed significant difference between breast cancer and healthy volunteers (P = 0.02. Conclusion Our results suggest that HFE H63D mutation frequencies were increased in the breast cancer patients in comparison to those in the general population. Also, odds ratios (odds ratio = 2.05 computed in this study suggest that H63D has a positive association with breast cancer.

Mutation of the mouse Syce1 gene disrupts synapsis and suggests a link between synaptonemal complex structural components and DNA repair.

Directory of Open Access Journals (Sweden)

Ewelina Bolcun-Filas

2009-02-01

Full Text Available In mammals, the synaptonemal complex is a structure required to complete crossover recombination. Although suggested by cytological work, in vivo links between the structural proteins of the synaptonemal complex and the proteins of the recombination process have not previously been made. The central element of the synaptonemal complex is traversed by DNA at sites of recombination and presents a logical place to look for interactions between these components. There are four known central element proteins, three of which have previously been mutated. Here, we complete the set by creating a null mutation in the Syce1 gene in mouse. The resulting disruption of synapsis in these animals has allowed us to demonstrate a biochemical interaction between the structural protein SYCE2 and the repair protein RAD51. In normal meiosis, this interaction may be responsible for promoting homologous synapsis from sites of recombination.

HFE Mutations C282Y and H63D in Iranian Population With Type 2 Diabetes

Directory of Open Access Journals (Sweden)

Golchin

2015-04-01

Full Text Available Background Type 2 diabetes (T2D is a common metabolic disease caused by insulin secretion defects, which is associated with a variety of complications such as retinopathy, nephropathy, and neuropathy. Objectives Regarding the relationship between type 2 diabetes and hereditary chromatists, we conducted a genetic analysis on two previously reported mutations C282Y and H63D related to the HFE gene in our population. Patients and Methods Altogether, 145 patients with type 2 diabetes and 145 healthy controls were examined. A genotyping assay performed using electrophoresis of the DNA digestion products from MboI and RsaI for H63D and C282Y, respectively. Results Results showed a significant difference between case and controls regarding C282Y (P value < 0.001 and H63D genotypes (P value = 0.013. We also found a relationship between both mutations and nephropathy. Moreover, the difference between C282Y genotypes of patients with retinopathy and healthy controls were statistically significant (P value = 0.020 while there was no association between H63D and retinopathy. In addition, observed differences of both mutations were significant when nephropathic patients compared to the controls. Conclusions Our study showed a significant association between H63D and C282Y mutations and the risk of type 2 diabetes in Iranian population.

Characterization of Nucleoside Reverse Transcriptase Inhibitor-Associated Mutations in the RNase H Region of HIV-1 Subtype C Infected Individuals.

Science.gov (United States)

Ngcapu, Sinaye; Theys, Kristof; Libin, Pieter; Marconi, Vincent C; Sunpath, Henry; Ndung'u, Thumbi; Gordon, Michelle L

2017-11-08

The South African national treatment programme includes nucleoside reverse transcriptase inhibitors (NRTIs) in both first and second line highly active antiretroviral therapy regimens. Mutations in the RNase H domain have been associated with resistance to NRTIs but primarily in HIV-1 subtype B studies. Here, we investigated the prevalence and association of RNase H mutations with NRTI resistance in sequences from HIV-1 subtype C infected individuals. RNase H sequences from 112 NRTI treated but virologically failing individuals and 28 antiretroviral therapy (ART)-naive individuals were generated and analysed. In addition, sequences from 359 subtype C ART-naive sequences were downloaded from Los Alamos database to give a total of 387 sequences from ART-naive individuals for the analysis. Fisher's exact test was used to identify mutations and Bayesian network learning was applied to identify novel NRTI resistance mutation pathways in RNase H domain. The mutations A435L, S468A, T470S, L484I, A508S, Q509L, L517I, Q524E and E529D were more prevalent in sequences from treatment-experienced compared to antiretroviral treatment naive individuals, however, only the E529D mutation remained significant after correction for multiple comparison. Our findings suggest a potential interaction between E529D and NRTI-treatment; however, site-directed mutagenesis is needed to understand the impact of this RNase H mutation.

Ancestral association between HLA and HFE H63D and C282Y gene mutations from northwest Colombia.

Science.gov (United States)

Rodriguez, Libia M; Giraldo, Mabel C; Velasquez, Laura I; Alvarez, Cristiam M; Garcia, Luis F; Jimenez-Del-Rio, Marlene; Velez-Pardo, Carlos

2015-03-01

A significant association between HFE gene mutations and the HLA-A*03-B*07 and HLA-A*29-B*44 haplotypes has been reported in the Spanish population. It has been proposed that these mutations are probably connected with Celtic and North African ancestry, respectively. We aimed to find the possible ancestral association between HLA alleles and haplotypes associated with the HFE gene (C282Y and H63D) mutations in 214 subjects from Antioquia, Colombia. These were 18 individuals with presumed hereditary hemochromatosis ("HH") and 196 controls. The HLA-B*07 allele was in linkage disequilibrium (LD) with C282Y, while HLA-A*23, A*29, HLA-B*44, and B*49 were in LD with H63D. Altogether, our results show that, although the H63D mutation is more common in the Antioquia population, it is not associated with any particular HLA haplotype, whereas the C282Y mutation is associated with HLA-A*03-B*07, this supporting a northern Spaniard ancestry.

Ancestral association between HLA and HFE H63D and C282Y gene mutations from northwest Colombia

Directory of Open Access Journals (Sweden)

Libia M Rodriguez

2015-03-01

Full Text Available A significant association between HFE gene mutations and the HLA-A*03-B*07 and HLA-A*29-B*44 haplotypes has been reported in the Spanish population. It has been proposed that these mutations are probably connected with Celtic and North African ancestry, respectively. We aimed to find the possible ancestral association between HLA alleles and haplotypes associated with the HFE gene (C282Y and H63D mutations in 214 subjects from Antioquia, Colombia. These were 18 individuals with presumed hereditary hemochromatosis (“HH” and 196 controls. The HLA-B*07 allele was in linkage disequilibrium (LD with C282Y, while HLA-A*23, A*29, HLA-B*44, and B*49 were in LD with H63D. Altogether, our results show that, although the H63D mutation is more common in the Antioquia population, it is not associated with any particular HLA haplotype, whereas the C282Y mutation is associated with HLA-A*03-B*07, this supporting a northern Spaniard ancestry.

TP53 p.R337H is a conditional cancer-predisposing mutation: further evidence from a homozygous patient

International Nuclear Information System (INIS)

Giacomazzi, Juliana; Hainaut, Pierre; Ashton-Prolla, Patricia; Selistre, Simone; Duarte, Juliana; Ribeiro, Jorge Pinto; Vieira, Paulo JC; Souza Macedo, Gabriel de; Rossi, Cristina; Czepielewski, Mauro; Netto, Cristina Brinkmann Oliveira

2013-01-01

Adrenocortical carcinomas (ACCs) are among the most common childhood cancers occurring in infants affected with the Li-Fraumeni and Li- Fraumeni-like (LFS/LFL) syndromes, which are caused by dominant germline mutations in the TP53 gene. In Brazil, a particular mutation, occurring in the tetramerisation domain of the gene, p.R337H, is exceedingly common due to a founder effect and is strongly associated with ACC. In this report, we describe the phenotype and long-term clinical follow-up of a female child diagnosed with ACC and homozygous for the TP53 p.R337H founder mutation. At age 11 months, the patient was diagnosed with a virilising anaplastic adrenal cortical tumour, which was completely excised without disturbing the adrenal capsule. Family history was consistent with an LFL tumour pattern, and genotyping identified the TP53 p.R337H mutation in both alleles in genomic DNA from lymphocytes and fibroblasts. Haplotype analysis confirmed the occurrence of the mutation in the same founder haplotype previously described in other Brazilian patients. No other germline or somatic TP53 mutations or rearrangements were identified. At age 9 years, the child was asymptomatic and had no evidence of endocrine derangements. Full body and brain magnetic resonance imaging (MRI) failed to detect any suspicious proliferative lesions, and cardiopulmonary exercise testing results were within the normal reference for the child’s age, ruling out a major exercise capacity deficiency. This is the first clinical and aerobic functional capacity documentation of a patient who carries two mutant TP53 alleles and no wild-type allele. Our results support the hypothesis that TP53 p.R337H, the most common TP53 mutation ever described in any population, is a conditional mutant. Furthermore, our observations over a long period of clinical follow-up suggest that TP53 p.R337H homozygotes do not have a more severe disease phenotype than do heterozygote carriers of the same mutation. Patients with

A monoclonal antibody IMab-1 specifically recognizes IDH1{sup R132H}, the most common glioma-derived mutation

Energy Technology Data Exchange (ETDEWEB)

Kato, Yukinari, E-mail: yukinari-k@bea.hi-ho.ne.jp [Department of Pathology, Duke University Medical Center, DUMC-3156, Durham, NC 27710 (United States); The Oncology Research Center, Research Institute for Advanced Molecular Epidemiology, Yamagata University, 2-2-2 Iida-nishi, Yamagata 990-9585 (Japan); Jin, Genglin; Kuan, Chien-Tsun; McLendon, Roger E.; Yan, Hai; Bigner, Darell D. [Department of Pathology, Duke University Medical Center, DUMC-3156, Durham, NC 27710 (United States)

2009-12-18

IDH1 (isocitrate dehydrogenase 1) mutations have been identified as early and frequent genetic alterations in astrocytomas, oligodendrogliomas, and oligoastrocytomas as well as secondary glioblastomas. In contrast, primary glioblastomas very rarely contain IDH1 mutations, although primary and secondary glioblastomas are histologically indistinguishable. The IDH1 mutations are remarkably specific to a single codon in the conserved and functionally important Arg132 in IDH1. In gliomas, the most frequent IDH1 mutations (>90%) were G395A (R132H). In this study, we immunized mice with R132H-containing IDH1 (IDH1{sup R132H}) peptide. After cell fusion using Sendai virus envelope, the monoclonal antibodies (mAbs), which specifically reacted with IDH1{sup R132H}, were screened in ELISA. One of the mAbs, IMab-1 reacted with the IDH1{sup R132H} peptide, but not with wild type IDH1 (IDH1{sup wt}) peptide in ELISA. In Western-blot analysis, IMab-1 reacted with only the IDH1{sup R132H} protein, not IDH1{sup wt} protein or the other IDH1 mutants, indicating that IMab-1 is IDH1{sup R132H}-specific. Furthermore, IMab-1 specifically stained the IDH1{sup R132H}-expressing cells in astrocytomas in immunohistochemistry, whereas it did not react with IDH1{sup R132H}-negative primary glioblastoma sections. In conclusion, we established an anti-IDH1{sup R132H}-specific monoclonal antibody IMab-1, which should be significantly useful for diagnosis and biological evaluation of mutation-bearing gliomas.

Analysis of mutant frequencies and mutation spectra in hMTH1 knockdown TK6 cells exposed to UV radiation

Energy Technology Data Exchange (ETDEWEB)

Fotouhi, Asal [Center for Radiation Protection Research, Department of Molecular Biosciences, Wenner-Gren Institute, Stockholm University (Sweden); Hagos, Winta Woldai [Department of Toxicogenetics, Leiden University Medical Center, Leiden (Netherlands); Ilic, Marina; Wojcik, Andrzej; Harms-Ringdahl, Mats [Center for Radiation Protection Research, Department of Molecular Biosciences, Wenner-Gren Institute, Stockholm University (Sweden); Gruijl, Frank de [Department of Dermatology, Leiden University Medical Center, Leiden (Netherlands); Mullenders, Leon; Jansen, Jacob G. [Department of Toxicogenetics, Leiden University Medical Center, Leiden (Netherlands); Haghdoost, Siamak, E-mail: Siamak.Haghdoost@su.se [Center for Radiation Protection Research, Department of Molecular Biosciences, Wenner-Gren Institute, Stockholm University (Sweden)

2013-11-15

Highlights: • hMTH1 protects cells from mutagenesis induced by UVA and UVB, but not UVC. • No protective role of hMTH1 in cell survival post UVB and UVC irradiation. • hMTH1 prevents induction of transition-type mutations at AT and GC post UVA irradiation. • 2-OH-dATP rather than 8-oxo-dGTP in the nucleotide pool likely contributes in UVA-induced mutations. - Abstract: Ultraviolet radiation is a highly mutagenic agent that damages the DNA by the formation of mutagenic photoproducts at dipyrimidine sites and by oxidative DNA damages via reactive oxygen species (ROS). ROS can also give rise to mutations via oxidation of dNTPs in the nucleotide pool, e.g. 8-oxo-dGTP and 2-OH-dATP and subsequent incorporation during DNA replication. Here we show that expression of human MutT homolog 1 (hMTH1) which sanitizes the nucleotide pool by dephosphorylating oxidized dNTPs, protects against mutagenesis induced by long wave UVA light and by UVB light but not by short wave UVC light. Mutational spectra analyses of UVA-induced mutations at the endogenous Thymidine kinase gene in human lymphoblastoid cells revealed that hMTH1 mainly protects cells from transitions at GC and AT base pairs.

Novel mutation predicted to disrupt SGOL1 protein function | Gupta ...

African Journals Online (AJOL)

L54Q, a mutation predicted as deleterious in this study was found to be located in N-terminal coiled coil domain which is effectively involved in the proper localization of PP2A to centromere. We further examined the effect of this mutation over the translational efficiency of the SGOL1 coding gene. Our analysis revealed ...

Spectrum of CFTR gene mutations in Ecuadorian cystic fibrosis patients: the second report of the p.H609R mutation.

Science.gov (United States)

Ortiz, Sofía C; Aguirre, Santiago J; Flores, Sofía; Maldonado, Claudio; Mejía, Juan; Salinas, Lilian

2017-11-01

High heterogeneity in the CFTR gene mutations disturbs the molecular diagnosis of cystic fibrosis (CF). In order to improve the diagnosis of CF in our country, the present study aims to define a panel of common CFTR gene mutations by sequencing 27 exons of the gene in Ecuadorian Cystic Fibrosis patients. Forty-eight Ecuadorian individuals with suspected/confirmed CF diagnosis were included. Twenty-seven exons of CFTR gene were sequenced to find sequence variations. Prevalence of pathogenic variations were determined and compared with other countries' data. We found 70 sequence variations. Eight of these are CF-causing mutations: p.F508del, p.G85E, p.G330E, p.A455E, p.G970S, W1098X, R1162X, and N1303K. Also this study is the second report of p.H609R in Ecuadorian population. Mutation prevalence differences between Ecuadorian population and other Latin America countries were found. The panel of mutations suggested as an initial screening for the Ecuadorian population with cystic fibrosis should contain the mutations: p.F508del, p.G85E, p.G330E, p.A455E, p.G970S, W1098X, R1162X, and N1303K. © 2017 NETLAB Laboratorios Especializados. Molecular Genetics & Genomic Medicine published by Wiley Periodicals, Inc.

Mutational analysis of the antagonist-binding site of the histamine H(1) receptor.

Science.gov (United States)

Wieland, K; Laak, A M; Smit, M J; Kühne, R; Timmerman, H; Leurs, R

1999-10-15

We combined in a previously derived three-dimensional model of the histamine H(1) receptor (Ter Laak, A. M., Timmerman, H., Leurs, H., Nederkoorn, P. H. J., Smit, M. J., and Donne-Op den Kelder, G. M. (1995) J. Comp. Aid. Mol. Design. 9, 319-330) a pharmacophore for the H(1) antagonist binding site (Ter Laak, A. M., Venhorst, J., Timmerman, H., and Donné-Op de Kelder, G. M. (1994) J. Med. Chem. 38, 3351-3360) with the known interacting amino acid residue Asp(116) (in transmembrane domain III) of the H(1) receptor and verified the predicted receptor-ligand interactions by site-directed mutagenesis. This resulted in the identification of the aromatic amino acids Trp(167), Phe(433), and Phe(436) in transmembrane domains IV and VI of the H(1) receptor as probable interaction points for the trans-aromatic ring of the H(1) antagonists. Subsequently, a specific interaction of carboxylate moieties of two therapeutically important, zwitterionic H(1) antagonists with Lys(200) in transmembrane domain V was predicted. A Lys(200) --> Ala mutation results in a 50- (acrivastine) to 8-fold (d-cetirizine) loss of affinity of these zwitterionic antagonists. In contrast, the affinities of structural analogs of acrivastine and cetirizine lacking the carboxylate group, triprolidine and meclozine, respectively, are unaffected by the Lys(200) --> Ala mutation. These data strongly suggest that Lys(200), unique for the H(1) receptor, acts as a specific anchor point for these "second generation" H(1) antagonists.

Clarifying the impact of polycomb complex component disruption in human cancers.

Science.gov (United States)

Yamamoto, Yukiya; Abe, Akihiro; Emi, Nobuhiko

2014-04-01

The dysregulation of proper transcriptional control is a major cause of developmental diseases and cancers. Polycomb proteins form chromatin-modifying complexes that transcriptionally silence genome regions in higher eukaryotes. The BCL6 corepressor (BCOR) complex comprises ring finger protein 1B (RNF2/RING1B), polycomb group ring finger 1 (PCGF1), and lysine-specific demethylase 2B (KDM2B) and is uniquely recruited to nonmethylated CpG islands, where it removes histone H3K36me2 and induces repressive histone H2A monoubiquitylation. Germline BCOR mutations have been detected in patients with oculofaciocardiodental and Lenz microphthalmia syndromes, which are inherited conditions. Recently, several variants of BCOR and BCOR-like 1 (BCORL1) chimeric fusion transcripts were reported in human cancers, including acute promyelocytic leukemia, bone sarcoma, and hepatocellular carcinoma. In addition, massively parallel sequencing has identified inactivating somatic BCOR and BCORL1 mutations in patients with acute myeloid leukemia (AML), myelodysplastic syndrome (MDS), chronic myelomonocytic leukemia, medulloblastoma, and retinoblastoma. More importantly, patients with AML and MDS with BCOR mutations exhibit poor prognosis. This perspective highlights the detection of BCOR mutations and fusion transcripts of BCOR and BCORL1 and discusses their importance for diagnosing cancer subtypes and estimating the treatment responses of patients. Furthermore, this perspective proposes the need for additional functional studies to clarify the oncogenic mechanism by which BCOR and BCORL1 are disrupted in cancers, and how this may lead to the development of novel therapeutics. Mol Cancer Res; 12(4); 479-84. ©2014 AACR.

Disease: H00627 [KEGG MEDICUS

Lifescience Database Archive (English)

Full Text Available H00627 Premature ovarian failure Premature ovarian failure (POF) is characterized ...tal causes, medical intervention including surgeries and chemotherapies may lead to POF. Autoimmune ovarian failure... ... Research on the mechanisms of premature ovarian failure. ... JOURNAL ... J Soc Gynecol Investig 8:S10-2 (2001...the Drosophila melanogaster diaphanous gene is disrupted in a patient with premature ovarian failure: eviden...vic A ... TITLE ... NOBOX homeobox mutation causes premature ovarian failure. ... JOURNAL ... Am J Hum Genet 81:576-81 (2007) DOI:10.1086/519496

Disease: H00464 [KEGG MEDICUS

Lifescience Database Archive (English)

Full Text Available H00464 Patella dysplasias, including: Small patella syndrome (SPS); Nail-patella syndrome; Ear-patel...la-short statute syndrome Patella dysplasias are a group of disorders that include aplasia/hypoplasia of patel...lar. Small patella syndrome is a skeletal dysplasia with anomalies of the pelvis. Ossifi...cation of the ischia and inferior pubic rami is also disrupted in patients with small patel...la syndrome. Nail-patella syndrome is a condition caused by mutation in LMX1B that regulates COL4A

Hereditary cancer genes are highly susceptible to splicing mutations

Science.gov (United States)

Soemedi, Rachel; Maguire, Samantha; Murray, Michael F.; Monaghan, Sean F.

2018-01-01

Substitutions that disrupt pre-mRNA splicing are a common cause of genetic disease. On average, 13.4% of all hereditary disease alleles are classified as splicing mutations mapping to the canonical 5′ and 3′ splice sites. However, splicing mutations present in exons and deeper intronic positions are vastly underreported. A recent re-analysis of coding mutations in exon 10 of the Lynch Syndrome gene, MLH1, revealed an extremely high rate (77%) of mutations that lead to defective splicing. This finding is confirmed by extending the sampling to five other exons in the MLH1 gene. Further analysis suggests a more general phenomenon of defective splicing driving Lynch Syndrome. Of the 36 mutations tested, 11 disrupted splicing. Furthermore, analyzing past reports suggest that MLH1 mutations in canonical splice sites also occupy a much higher fraction (36%) of total mutations than expected. When performing a comprehensive analysis of splicing mutations in human disease genes, we found that three main causal genes of Lynch Syndrome, MLH1, MSH2, and PMS2, belonged to a class of 86 disease genes which are enriched for splicing mutations. Other cancer genes were also enriched in the 86 susceptible genes. The enrichment of splicing mutations in hereditary cancers strongly argues for additional priority in interpreting clinical sequencing data in relation to cancer and splicing. PMID:29505604

Hereditary cancer genes are highly susceptible to splicing mutations.

Directory of Open Access Journals (Sweden)

Christy L Rhine

2018-03-01

Full Text Available Substitutions that disrupt pre-mRNA splicing are a common cause of genetic disease. On average, 13.4% of all hereditary disease alleles are classified as splicing mutations mapping to the canonical 5' and 3' splice sites. However, splicing mutations present in exons and deeper intronic positions are vastly underreported. A recent re-analysis of coding mutations in exon 10 of the Lynch Syndrome gene, MLH1, revealed an extremely high rate (77% of mutations that lead to defective splicing. This finding is confirmed by extending the sampling to five other exons in the MLH1 gene. Further analysis suggests a more general phenomenon of defective splicing driving Lynch Syndrome. Of the 36 mutations tested, 11 disrupted splicing. Furthermore, analyzing past reports suggest that MLH1 mutations in canonical splice sites also occupy a much higher fraction (36% of total mutations than expected. When performing a comprehensive analysis of splicing mutations in human disease genes, we found that three main causal genes of Lynch Syndrome, MLH1, MSH2, and PMS2, belonged to a class of 86 disease genes which are enriched for splicing mutations. Other cancer genes were also enriched in the 86 susceptible genes. The enrichment of splicing mutations in hereditary cancers strongly argues for additional priority in interpreting clinical sequencing data in relation to cancer and splicing.

Mutation Breeding Newsletter. No. 39

International Nuclear Information System (INIS)

1992-01-01

This newsletter contains brief articles on the use of radiation to induce mutations in plants; radiation-induced mutants in Chrysanthemum; disrupting the association between oil and protein content in soybean seeds; mutation studies on bougainvillea; a new pepper cultivar; and the use of mutation induction to improve the quality of yam beans. A short review of the seminar on the use of mutation and related biotechnology for crop improvement in the Middle East and Mediterranean regions, and a description of a Co-ordinated Research Programme on the application of DNA-based marker mutations for the improvement of cereals and other sexually reproduced crop species are also included. Two tables are given: these are based on the ''FAO/IAEA Mutant Varieties Database'' and show the number of mutated varieties and the number of officially released mutant varieties in particular crops/species. Refs and tabs

Effects of the Pathogenic Mutation A117V and the Protective Mutation H111S on the Folding and Aggregation of PrP106-126: Insights from Replica Exchange Molecular Dynamics Simulations.

Directory of Open Access Journals (Sweden)

Lulu Ning

Full Text Available The fragment 106-126 of prion protein exhibits similar properties to full-length prion. Experiments have shown that the A117V mutation enhances the aggregation of PrP106-126, while the H111S mutation abolishes the assembly. However, the mechanism of the change in the aggregation behavior of PrP106-126 upon the two mutations is not fully understood. In this study, replica exchange molecular dynamics simulations were performed to investigate the conformational ensemble of the WT PrP106-126 and its two mutants A117V and H111S. The obtained results indicate that the three species are all intrinsically disordered but they have distinct morphological differences. The A117V mutant has a higher propensity to form β-hairpin structures than the WT, while the H111S mutant has a higher population of helical structures. Furthermore, the A117V mutation increases the hydrophobic solvent accessible surface areas of PrP106-126 and the H111S mutation reduces the exposure of hydrophobic residues. It can be concluded that the difference in populations of β-hairpin structures and the change of hydrophobic solvent accessible areas may induce the different aggregation behaviors of the A117V and the H111S mutated PrP106-126. Understanding why the two mutations have contrary effects on the aggregation of PrP106-126 is very meaningful for further elucidation of the mechanism underlying aggregation and design of inhibitor against aggregation process.

Somatic mutations of the histone H3K27 demethylase, UTX, in human cancer

Science.gov (United States)

van Haaften, Gijs; Dalgliesh, Gillian L; Davies, Helen; Chen, Lina; Bignell, Graham; Greenman, Chris; Edkins, Sarah; Hardy, Claire; O’Meara, Sarah; Teague, Jon; Butler, Adam; Hinton, Jonathan; Latimer, Calli; Andrews, Jenny; Barthorpe, Syd; Beare, Dave; Buck, Gemma; Campbell, Peter J; Cole, Jennifer; Dunmore, Rebecca; Forbes, Simon; Jia, Mingming; Jones, David; Kok, Chai Yin; Leroy, Catherine; Lin, Meng-Lay; McBride, David J; Maddison, Mark; Maquire, Simon; McLay, Kirsten; Menzies, Andrew; Mironenko, Tatiana; Lee, Mulderrig; Mudie, Laura; Pleasance, Erin; Shepherd, Rebecca; Smith, Raffaella; Stebbings, Lucy; Stephens, Philip; Tang, Gurpreet; Tarpey, Patrick S; Turner, Rachel; Turrell, Kelly; Varian, Jennifer; West, Sofie; Widaa, Sara; Wray, Paul; Collins, V Peter; Ichimura, Koichi; Law, Simon; Wong, John; Yuen, Siu Tsan; Leung, Suet Yi; Tonon, Giovanni; DePinho, Ronald A; Tai, Yu-Tzu; Anderson, Kenneth C; Kahnoski, Richard J.; Massie, Aaron; Khoo, Sok Kean; Teh, Bin Tean; Stratton, Michael R; Futreal, P Andrew

2010-01-01

Somatically acquired epigenetic changes are present in many cancers. Epigenetic regulation is maintained via post-translational modifications of core histones. Here, we describe inactivating somatic mutations in the histone lysine demethylase, UTX, pointing to histone H3 lysine methylation deregulation in multiple tumour types. UTX reintroduction into cancer cells with inactivating UTX mutations resulted in slowing of proliferation and marked transcriptional changes. These data identify UTX as a new human cancer gene. PMID:19330029

Two α1-Globin Gene Point Mutations Causing Severe Hb H Disease.

Science.gov (United States)

Jiang, Hua; Huang, Lv-Yin; Zhen, Li; Jiang, Fan; Li, Dong-Zhi

Hb H disease is generally a moderate form of α-thalassemia (α-thal) that rarely requires regular blood transfusions. In this study, two Chinese families with members carrying transfusion-dependent Hb H disease were investigated for rare mutations on the α-globin genes (HBA1, HBA2). In one family, Hb Zürich-Albisrieden [α59(E8)Gly→Arg; HBA1: c.178G>C] in combination with the Southeast Asian (- - SEA ) deletion was the defect responsible for the severe phenotype. In another family, a novel hemoglobin (Hb) variant named Hb Sichuan (HBA1: c.393_394insT), causes α-thal and a severe phenotype when associated with the - - SEA deletion. As these two HBA1 mutations can present as continuous blood transfusion-dependent α-thal, it is important to take this point into account for detecting the carriers, especially in couples in which one partner is already a known α 0 -thal carrier.

Novel Polymerase Gene Mutations for Human Adaptation in Clinical Isolates of Avian H5N1 Influenza Viruses.

Directory of Open Access Journals (Sweden)

Yasuha Arai

2016-04-01

Full Text Available A major determinant in the change of the avian influenza virus host range to humans is the E627K substitution in the PB2 polymerase protein. However, the polymerase activity of avian influenza viruses with a single PB2-E627K mutation is still lower than that of seasonal human influenza viruses, implying that avian viruses require polymerase mutations in addition to PB2-627K for human adaptation. Here, we used a database search of H5N1 clade 2.2.1 virus sequences with the PB2-627K mutation to identify other polymerase adaptation mutations that have been selected in infected patients. Several of the mutations identified acted cooperatively with PB2-627K to increase viral growth in human airway epithelial cells and mouse lungs. These mutations were in multiple domains of the polymerase complex other than the PB2-627 domain, highlighting a complicated avian-to-human adaptation pathway of avian influenza viruses. Thus, H5N1 viruses could rapidly acquire multiple polymerase mutations that function cooperatively with PB2-627K in infected patients for optimal human adaptation.

Distinct mutation profile and prognostic relevance in patients with hypoplastic myelodysplastic syndromes (h-MDS).

Science.gov (United States)

Yao, Chi-Yuan; Hou, Hsin-An; Lin, Tzung-Yi; Lin, Chien-Chin; Chou, Wen-Chien; Tseng, Mei-Hsuan; Chiang, Ying-Chieh; Liu, Ming-Chih; Liu, Chia-Wen; Kuo, Yuan-Yeh; Wu, Shang-Ju; Liao, Xiu-Wen; Lin, Chien-Ting; Ko, Bor-Shen; Chen, Chien-Yuan; Hsu, Szu-Chun; Li, Chi-Cheng; Huang, Shang-Yi; Yao, Ming; Tang, Jih-Luh; Tsay, Woei; Liu, Chieh-Yu; Tien, Hwei-Fang

2016-09-27

Myelodysplastic syndromes (MDS) are a heterogeneous group of hematologic malignancies. Although most MDS patients have normal or increased BM cellularity (NH-MDS), some have hypocellular BM (h-MDS). The reports concerning the differences in genetic alterations between h-MDS and NH-MDS patients are limited. In this study, 369 MDS patients diagnosed according to the WHO 2008 criteria were recruited. h-MDS patients had lower PB white blood cell and blast counts, and lower BM blast percentages, than those with NH-MDS. h-MDS was closely associated with lower-risk MDS, defined by the International Prognostic Scoring System (IPSS) and revised IPSS (IPSS-R). IPSS-R could properly predict the prognosis in h-MDS (PMDS patients. The h-MDS patients had lower incidences of RUNX1, ASXL1, DNMT3A, EZH2 and TP53 mutations than NH-MDS patients. The cumulated incidence of acute leukemic transformation at 5 years was 19.3% for h-MDS and 40.4% for NH-MDS patients (P= 0.001). Further, the patients with h-MDS had longer overall survival (OS) than those with NH-MDS (P= 0.001), and BM hypocellularity remains an independent favorable prognostic factor for OS irrespective of age, IPSS-R, and gene mutations. Our findings provide evidence that h-MDS indeed represent a distinct clinico-biological subgroup of MDS and can predict better leukemia-free survival and OS.

Epigenetics and autism spectrum disorder: A report of an autism case with mutation in H1 linker histone HIST1H1e and literature review.

Science.gov (United States)

Duffney, Lara J; Valdez, Purnima; Tremblay, Martine W; Cao, Xinyu; Montgomery, Sarah; McConkie-Rosell, Allyn; Jiang, Yong-Hui

2018-04-27

Genetic mutations in genes encoding proteins involved in epigenetic machinery have been reported in individuals with autism spectrum disorder (ASD), intellectual disability, congenital heart disease, and other disorders. H1 histone linker protein, the basic component in nucleosome packaging and chromatin organization, has not been implicated in human disease until recently. We report a de novo deleterious mutation of histone cluster 1 H1 family member e (HIST1H1E; c.435dupC; p.Thr146Hisfs*50), encoding H1 histone linker protein H1.4, in a 10-year-old boy with autism and intellectual disability diagnosed through clinical whole exome sequencing. The c.435dupC at the 3' end of the mRNA leads to a frameshift and truncation of the positive charge in the carboxy-terminus of the protein. An expression study demonstrates the mutation leads to reduced protein expression, supporting haploinsufficiency of HIST1H1E protein and loss of function as an underlying mechanism of dysfunction in the brain. Taken together with other recent cases with mutations of HIST1H1E in intellectual disability, the evidence supporting the link to causality in disease is strong. Our finding implicates the deficiency of H1 linker histone protein in autism. The systematic review of candidate genes implicated in ASD revealed that 42 of 215 (19.5%) genes are directly involved in epigenetic regulations and the majority of these genes belong to histone writers, readers, and erasers. While the mechanism of how haploinsufficiency of HIST1H1E causes autism is entirely unknown, our report underscores the importance of further study of the function of this protein and other histone linker proteins in brain development. © 2018 Wiley Periodicals, Inc.

Single mutation confers vanadate resistance to the plasma membrane H+-ATPase from the yeast Schizosaccharomyces pombe

International Nuclear Information System (INIS)

Ulaszewski, S.; Van Herck, J.C.; Dufour, J.P.; Kulpa, J.; Nieuwenhuis, B.; Goffeau, A.

1987-01-01

A single-gene nuclear mutant has been selected from the yeast Schizosaccharomyces pombe for growth resistance to Dio-9, a plasma membrane H+-ATPase inhibitor. From this mutant, called pma1, an ATPase activity has been purified. It contains a Mr = 100,000 major polypeptide which is phosphorylated by [gamma- 32 P] ATP. Proton pumping is not impaired since the isolated mutant ATPase is able, in reconstituted proteoliposomes, to quench the fluorescence of the delta pH probe 9-amino-6-chloro-2-methoxy acridine. The isolated mutant ATPase is sensitive to Dio-9 as well as to seven other plasma membrane H+-ATPase inhibitors. The mutant H+-ATPase activity tested in vitro is, however, insensitive to vanadate. Its Km for MgATP is modified and its ATPase specific activity is decreased. The pma1 mutation decreases the rate of extracellular acidification induced by glucose when cells are incubated at pH 4.5 under nongrowing conditions. During growth, the intracellular mutant pH is more acid than the wild type one. The derepression by ammonia starvation of methionine transport is decreased in the mutant. The growth rate of pma1 mutants is reduced in minimal medium compared to rich medium, especially when combined to an auxotrophic mutation. It is concluded that the H+-ATPase activity from yeast plasma membranes controls the intracellular pH as well as the derepression of amino acid, purine, and pyrimidine uptakes. The pma1 mutation modifies several transport properties of the cells including those responsible for the uptake of Dio-9 and other inhibitors

The ITER EC H and CD upper launcher: EM disruption analyses

International Nuclear Information System (INIS)

Vaccaro, A.; Aiello, G.; Grossetti, G.; Meier, A.; Scherer, T.A.; Schreck, S.; Späh, P.; Strauß, D.; Saibene, G.; Cavinato, M.

2013-01-01

In the frame of the new grant started in November 2011 between Fusion for Energy (F4E) and the ECHUL-CA consortium, the development process of the Electron Cyclotron Heating and Current Drive (EC H and CD) upper launcher (UL) in ITER has moved a step toward the final design phase. Based on the 2009 preliminary design review version, the new configuration of the UL now features a thicker single-wall mainframe (up to 90 mm), a recessed first wall panel (100 mm, to reduce the impact of halo currents) and a new arrangement of the internal shield blocks. The main design drivers for the structural components are still the electromagnetic (EM) loads, which need to be reassessed for the new configuration of the UL. In this paper the results of a new EM 20° sector model of ITER, specialized for the UL, are shown. Six different disruption scenarios are considered in this work: upward linear (36 ms) and exponential (36 ms) vertical displacement events (VDE), upward linear (36 ms) and exponential (16 ms) major disruptions (MD), category II upward slow and slow–fast VDEs. Comparing the analyses’ results allowed to define a set of structural loads to be used as a reference for the forthcoming structural calculations

UV cross-linking of polypeptides associated with 3'-terminal exons

International Nuclear Information System (INIS)

Stolow, D.T.; Berget, S.M.

1990-01-01

Association of nuclear proteins with chimeric vertebrate precursor RNAs containing both polyadenylation signals and an intron was examined by UV cross-linking. One major difference in cross-linking pattern was observed between this chimeric precursor RNA and precursors containing only polyadenylation or splicing signals. The heterogeneous nuclear ribonucleoprotein (hnRNP) polypeptide C cross-linked strongly to sequences downstream of the A addition site in polyadenylation precursor RNA containing only the polyadenylation signal from the simian virus 40 (SV40) late transcription unit. In contrast, the hnRNP C polypeptide cross-linked to chimeric RNA containing the same SV40 late poly(A) cassette very poorly, at a level less than 5% of that observed with the precursor RNA containing just the poly(A) site. Observation that cross-linking of the hnRNP C polypeptide to elements within the SV40 late poly(A) site was altered by the presence of an upstream intron suggests differences in the way nuclear factors associate with poly(A) sites in the presence and absence of an upstream intron. Cross-linking of C polypeptide to chimeric RNA increased with RNAs mutated for splicing or polyadenylation consensus sequences and under reaction conditions (high magnesium) that inhibited polyadenylation. Furthermore, cross-linking of hnRNP C polypeptide to precursors containing just the SV40 late poly(A) site was eliminated in the presence of competing poly(U); polyadenylation, however, was unaffected. Correlation of loss of activity with high levels of hnRNP C polypeptide cross-linking raises questions about the specificity of the interaction between the hnRNP C polypeptide and polyadenylation precursor RNAs in vitro

MT-CYB mutations in hypertrophic cardiomyopathy

DEFF Research Database (Denmark)

Hagen, Christian M; Aidt, Frederik H; Havndrup, Ole

2013-01-01

Mitochondrial dysfunction is a characteristic of heart failure. Mutations in mitochondrial DNA, particularly in MT-CYB coding for cytochrome B in complex III (CIII), have been associated with isolated hypertrophic cardiomyopathy (HCM). We hypothesized that MT-CYB mutations might play an important...... and m.15482T>C; p.S246P were identified. Modeling showed that the p.C93Y mutation leads to disruption of the tertiary structure of Cytb by helix displacement, interfering with protein-heme interaction. The p.S246P mutation induces a diproline structure, which alters local secondary structure and induces...... of HCM patients. We propose that further patients with HCM should be examined for mutations in MT-CYB in order to clarify the role of these variants....

Limited phenotypic variation of hypocalcified amelogenesis imperfecta in a danish five-generation family with a novel FAM83H nonsense mutation

DEFF Research Database (Denmark)

Haubek, Dorte; Gjørup, Hans; Jensen, Lillian Gryesten

2011-01-01

Limited phenotypic variation of hypocalcified amelogenesis imperfecta in a danish five-generation family with a novel FAM83H nonsense mutation......Limited phenotypic variation of hypocalcified amelogenesis imperfecta in a danish five-generation family with a novel FAM83H nonsense mutation...

Discovery of potential drugs for human-infecting H7N9 virus containing R294K mutation

Directory of Open Access Journals (Sweden)

He JY

2014-12-01

Full Text Available Jiao-Yu He,1,* Cheng Li,2,* Guo Wu3 1College of Life Sciences and Key Laboratory for Bio-resources of Ministry of Education, Sichuan University, 2College of Agronomy, Sichuan Agricultural University, 3College of Life Sciences, Sichuan Normal University, Chengdu, People’s Republic of China *These authors contributed equally to this work Background: After the first epidemic wave from February through May 2013, the influenza A (H7N9 virus emerged and has followed a second epidemic wave since June 2013. As of June 27, 2014, the outbreak of H7N9 had caused 450 confirmed cases of human infection, with 165 deaths included. The case-fatality rate of all confirmed cases is about 36%, making the H7N9 virus a significant threat to people’s health. At present, neuraminidase inhibitors are the only licensed antiviral medications available to treat H7N9 infections in humans. Oseltamivir is the most commonly used inhibitor, and it is also a front-line drug for the threatening H7N9. Unfortunately, it has been reported that patients treated with oseltamivir can induce R294K (Arg294Lys substitution in the H7N9 virus, which is a rare mutation and can reduce the antiviral efficacy of inhibitors. Even worse, deaths caused by such mutation after oseltamivir treatment have already been reported, indicating that the need to find substitutive neuraminidase inhibitors for currently available drugs to treat drug-resistant H7N9 is really pressing.Materials and methods: First, the structure of H7N9 containing the R294K substitution was downloaded from the Protein Data Bank, and structural information of approved drugs was downloaded from the ZINC (ZINC Is Not Commercial database. Taking oseltamivir carboxylate as a reference drug, we then filtered these molecules through virtual screening to find out potential inhibitors targeting the mutated H7N9 virus. For further evaluation, we carried out a 14 ns molecular dynamic simulation for each H7N9–drug complex and

Heterogeneous nuclear ribonucleoproteins H, H', and F are members of a ubiquitously expressed subfamily of related but distinct proteins encoded by genes mapping to different chromosomes

DEFF Research Database (Denmark)

Honoré, B; Rasmussen, H H; Vorum, H

1995-01-01

Molecular cDNA cloning, two-dimensional gel immunoblotting, and amino acid microsequencing identified three sequence-unique and distinct proteins that constitute a subfamily of ubiquitously expressed heterogeneous nuclear ribonucleoproteins corresponding to hnRNPs H, H', and F. These proteins share...... epitopes and sequence identity with two other proteins, isoelectric focusing sample spot numbers 2222 (37.6 kDa; pI 6.5) and 2326 (39.5 kDa; pI 6.6), indicating that the subfamily may contain additional members. The identity between hnRNPs H and H' is 96%, between H and F 78%, and between H' and F 75......%, respectively. The three proteins contain three repeats, which we denote quasi-RRMs (qRRMs) since they have a remote similarity to the RNA recognition motif (RRM). The three qRRMs of hnRNP H, with a few additional NH2-terminal amino acids, were constructed by polymerase chain reaction amplification and used...

A new look at an old virus: patterns of mutation accumulation in the human H1N1 influenza virus since 1918

Directory of Open Access Journals (Sweden)

Carter Robert W

2012-10-01

Full Text Available Abstract Background The H1N1 influenza A virus has been circulating in the human population for over 95 years, first manifesting itself in the pandemic of 1917–1918. Initial mortality was extremely high, but dropped exponentially over time. Influenza viruses have high mutation rates, and H1N1 has undergone significant genetic changes since 1918. The exact nature of H1N1 mutation accumulation over time has not been fully explored. Methods We have made a comprehensive historical analysis of mutational changes within H1N1 by examining over 4100 fully-sequenced H1N1 genomes. This has allowed us to examine the genetic changes arising within H1N1 from 1918 to the present. Results We document multiple extinction events, including the previously known extinction of the human H1N1 lineage in the 1950s, and an apparent second extinction of the human H1N1 lineage in 2009. These extinctions appear to be due to a continuous accumulation of mutations. At the time of its disappearance in 2009, the human H1N1 lineage had accumulated over 1400 point mutations (more than 10% of the genome, including approximately 330 non-synonymous changes (7.4% of all codons. The accumulation of both point mutations and non-synonymous amino acid changes occurred at constant rates (μ = 14.4 and 2.4 new mutations/year, respectively, and mutations accumulated uniformly across the entire influenza genome. We observed a continuous erosion over time of codon-specificity in H1N1, including a shift away from host (human, swine, and bird [duck] codon preference patterns. Conclusions While there have been numerous adaptations within the H1N1 genome, most of the genetic changes we document here appear to be non-adaptive, and much of the change appears to be degenerative. We suggest H1N1 has been undergoing natural genetic attenuation, and that significant attenuation may even occur during a single pandemic. This process may play a role in natural pandemic cessation and has apparently

Reduced white matter MRI transverse relaxation rate in cognitively normal H63D-HFE human carriers and H67D-HFE mice.

Science.gov (United States)

Meadowcroft, Mark D; Wang, Jianli; Purnell, Carson J; Peters, Douglas G; Eslinger, Paul J; Neely, Elizabeth B; Gill, David J; Vasavada, Megha; Ali-Rahmani, Fatima; Yang, Qing X; Connor, James R

2016-12-01

Mutations within the HFE protein gene sequence have been associated with increased risk of developing a number of neurodegenerative disorders. To this effect, an animal model has been created which incorporates the mouse homologue to the human H63D-HFE mutation: the H67D-HFE knock-in mouse. These mice exhibit alterations in iron management proteins, have increased neuronal oxidative stress, and a disruption in cholesterol regulation. However, it remains undetermined how these differences translate to human H63D carriers in regards to white matter (WM) integrity. To this endeavor, MRI transverse relaxation rate (R 2 ) parametrics were employed to test the hypothesis that WM alterations are present in H63D human carriers and are recapitulated in the H67D mice. H63D carriers exhibit widespread reductions in brain R 2 compared to non-carriers within white matter association fibers in the brain. Similar R 2 decreases within white matter tracts were observed in the H67D mouse brain. Additionally, an exacerbation of age-related R 2 decrease is found in the H67D animal model in white matter regions of interest. The decrease in R 2 within white matter tracts of both species is speculated to be multifaceted. The R 2 changes are hypothesized to be due to alterations in axonal biochemical tissue composition. The R 2 changes observed in both the human-H63D and mouse-H67D data suggest that modified white matter myelination is occurring in subjects with HFE mutations, potentially increasing vulnerability to neurodegenerative disorders.

Clinical Expression and New SPINK5 Splicing Defects in Netherton Syndrome: Unmasking a Frequent Founder Synonymous Mutation and Unconventional Intronic Mutations

DEFF Research Database (Denmark)

Lacroix, Matthieu; Lacaze-Buzy, Laetitia; Furio, Laetitia

2012-01-01

a clinical triad suggestive of NS with variations in inter- and intra-familial disease expression. We identified a new and frequent synonymous mutation c.891C>T (p.Cys297Cys) in exon 11 of the 12 NS patients. This mutation disrupts an exonic splicing enhancer sequence and causes out-of-frame skipping of exon...

Mutations in polymerase genes enhanced the virulence of 2009 pandemic H1N1 influenza virus in mice.

Directory of Open Access Journals (Sweden)

Wenfei Zhu

Full Text Available Influenza A virus can infect a wide variety of animal species with illness ranging from mild to severe, and is a continual cause for concern. Genetic mutations that occur either naturally or during viral adaptation in a poorly susceptible host are key mechanisms underlying the evolution and virulence of influenza A virus. Here, the variants containing PA-A36T or PB2-H357N observed in the mouse-adapted descendants of 2009 pandemic H1N1 virus (pH1N1, A/Sichuan/1/2009 (SC, were characterized. Both mutations enhanced polymerase activity in mammalian cells. These effects were confirmed using recombinant SC virus containing polymerase genes with wild type (WT or mutant PA or PB2. The PA-A36T mutant showed enhanced growth property compared to the WT in both human A549 cells and porcine PK15 cells in vitro, without significant effect on viral propagation in murine LA-4 cells and pathogenicity in mice; however, it did enhance the lung virus titer. PB2-H357N variant demonstrated growth ability comparable to the WT in A549 cells, but replicated well in PK15, LA-4 cells and in mice with an enhanced pathogenic phenotype. Despite such mutations are rare in nature, they could be observed in avian H5 and H7 subtype viruses which were currently recognized to pose potential threat to human. Our findings indicated that pH1N1 may adapt well in mammals when acquiring these mutations. Therefore, future molecular epidemiological surveillance should include scrutiny of both markers because of their potential impact on pathogenesis.

Haemochromatosis gene mutation H63D is a risk factor for iron ...

African Journals Online (AJOL)

Introduction: Iron overload is the main cause of morbidity and mortality in patients with β-thalassemia. The Aim: The aim of this study was to evaluate the prevalence of genetic markers (HFE mutations C282Y and H63D) among Egyptian β-thalassemic. Children and its effect on their iron status. Patients and Methods: 59 ...

Dync1h1 Mutation Causes Proprioceptive Sensory Neuron Loss and Impaired Retrograde Axonal Transport of Dorsal Root Ganglion Neurons.

Science.gov (United States)

Zhao, Jing; Wang, Yi; Xu, Huan; Fu, Yuan; Qian, Ting; Bo, Deng; Lu, Yan-Xin; Xiong, Yi; Wan, Jun; Zhang, Xiang; Dong, Qiang; Chen, Xiang-Jun

2016-07-01

Sprawling (Swl) is a radiation-induced mutation which has been identified to have a nine base pair deletion in dynein heavy chain 1 (DYNC1H1: encoded by a single gene Dync1h1). This study is to investigate the phenotype and the underlying mechanism of the Dync1h1 mutant. To display the phenotype of Swl mutant mice, we examined the embryos of homozygous (Swl/Swl) and heterozygous (Swl/+) mice and their postnatal dorsal root ganglion (DRG) of surviving Swl/+ mice. The Swl/+ mice could survive for a normal life span, while Swl/Swl could only survive till embryonic (E) 8.5 days. Excessive apoptosis of Swl/+ DRG neurons was revealed during E11.5-E15.5 days, and the peak rate was at E13.5 days. In vitro study of mutated DRG neurons showed impaired retrograde transport of dynein-driven nerve growth factor (NGF). Mitochondria, another dynein-driven cargo, demonstrated much slower retrograde transport velocity in Swl/+ neurons than in wild-type (WT) neurons. Nevertheless, the Swl, Loa, and Cra mutations did not affect homodimerization of DYNC1H1. The Swl/Swl mutation of Dync1h1 gene led to embryonic mal-development and lethality, whereas the Swl/+ DRG neurons demonstrated deficient retrograde transport in dynein-driven cargos and excessive apoptosis during mid- to late-developmental stages. The underlying mechanism of the mutation may not be due to impaired homodimerization of DYNC1H1. © 2016 John Wiley & Sons Ltd.

Frequency and Clinical Implication of the R450H Mutation in the Thyrotropin Receptor Gene in the Japanese Population Detected by Smart Amplification Process 2

Science.gov (United States)

Yanagawa, Yoshimaro; Aoki, Tomoyuki; Morimura, Tadashi; Araki, Osamu; Kimura, Takao; Ogiwara, Takayuki; Kotajima, Nobuo; Yanagawa, Masumi; Murakami, Masami

2014-01-01

In Japanese pediatric patients with thyrotropin (TSH) resistance, the R450H mutation in TSH receptor gene (TSHR) is occasionally observed. We studied the frequency and clinical implication of the R450H mutation in TSHR in the general population of Japanese adults using smart amplification process 2 (SmartAmp2). We designed SmartAmp2 primer sets to detect this mutation using a drop of whole blood. We analyzed thyroid function, antithyroid antibodies, and this mutation in 429 Japanese participants who had not been found to have thyroid disease. Two cases without antithyroid antibodies were heterozygous for the R450H mutation in TSHR. Thus, the prevalence of this mutation was 0.47% in the general population and 0.63% among those without antithyroid antibodies. Their serum TSH concentrations were higher than the average TSH concentration not only in subjects without antithyroid antibodies but also in those with antithyroid antibodies. The R450H mutation in TSHR is relatively common in the Japanese population and potentially affects thyroid function. The present study demonstrates that the SmartAmp2 method is useful to detect the R450H mutation in TSHR, which is one of the common causes of TSH resistance in the Japanese population. PMID:24895636

Conservation patterns of HIV-1 RT connection and RNase H domains: identification of new mutations in NRTI-treated patients.

Directory of Open Access Journals (Sweden)

André F A Santos

Full Text Available BACKGROUND: Although extensive HIV drug resistance information is available for the first 400 amino acids of its reverse transcriptase, the impact of antiretroviral treatment in C-terminal domains of Pol (thumb, connection and RNase H is poorly understood. METHODS AND FINDINGS: We wanted to characterize conserved regions in RT C-terminal domains among HIV-1 group M subtypes and CRF. Additionally, we wished to identify NRTI-related mutations in HIV-1 RT C-terminal domains. We sequenced 118 RNase H domains from clinical viral isolates in Brazil, and analyzed 510 thumb and connection domain and 450 RNase H domain sequences collected from public HIV sequence databases, together with their treatment status and histories. Drug-naïve and NRTI-treated datasets were compared for intra- and inter-group conservation, and differences were determined using Fisher's exact tests. One third of RT C-terminal residues were found to be conserved among group M variants. Three mutations were found exclusively in NRTI-treated isolates. Nine mutations in the connection and 6 mutations in the RNase H were associated with NRTI treatment in subtype B. Some of them lay in or close to amino acid residues which contact nucleic acid or near the RNase H active site. Several of the residues pointed out herein have been recently associated to NRTI exposure or increase drug resistance to NRTI. CONCLUSIONS: This is the first comprehensive genotypic analysis of a large sequence dataset that describes NRTI-related mutations in HIV-1 RT C-terminal domains in vivo. The findings into the conservation of RT C-terminal domains may pave the way to more rational drug design initiatives targeting those regions.

Camptothecin disrupts androgen receptor signaling and suppresses prostate cancer cell growth

International Nuclear Information System (INIS)

Liu, Shicheng; Yuan, Yiming; Okumura, Yutaka; Shinkai, Norihiro; Yamauchi, Hitoshi

2010-01-01

The androgen receptor (AR) is the main therapeutic target for treatment of metastatic prostate cancers. The present study demonstrates that the topoisomerase I inhibitor camptothecin selectively inhibits androgen-responsive growth of prostate cancer cells. Camptothecin strikingly inhibited mutated and wild-type AR protein expression in LNCaP and PC-3/AR cells. This inhibition coincided with decreased androgen-mediated AR phosphorylation at Ser 81 and reduced androgen-mediated AR transcriptional activity in a dose-dependent manner. Additionally, camptothecin disrupted the association between AR and heat shock protein 90 and impeded binding of the synthetic androgen [ 3 H]R1881 to AR in LNCaP cells. Camptothecin also blocked androgen-induced AR nuclear translocation, leading to downregulation of the AR target gene PSA. In addition to decreasing the intracellular and secreted prostate-specific antigen (PSA) levels, camptothecin markedly inhibited androgen-stimulated PSA promoter activity. Collectively, our data reveal that camptothecin not only serves as a traditional genotoxic agent but, by virtue of its ability to target and disrupt AR, may also be a novel candidate for the treatment of prostate cancer.

A histone H3K9M mutation traps histone methyltransferase Clr4 to prevent heterochromatin spreading

Energy Technology Data Exchange (ETDEWEB)

Shan, Chun-Min; Wang, Jiyong; Xu, Ke; Chen, Huijie; Yue, Jia-Xing; Andrews, Stuart; Moresco, James J.; Yates, John R.; Nagy, Peter L.; Tong, Liang; Jia, Songtao

2016-09-20

Histone lysine-to-methionine (K-to-M) mutations are associated with multiple cancers, and they function in a dominant fashion to block the methylation of corresponding lysines on wild type histones. However, their mechanisms of function are controversial. Here we show that in fission yeast, introducing the K9M mutation into one of the three histone H3 genes dominantly blocks H3K9 methylation on wild type H3 across the genome. In addition, H3K9M enhances the interaction of histone H3 tail with the H3K9 methyltransferase Clr4 in a SAM (S-adenosyl-methionine)-dependent manner, and Clr4 is trapped at nucleation sites to prevent its spreading and the formation of large heterochromatin domains. We further determined the crystal structure of an H3K9M peptide in complex with human H3K9 methyltransferase G9a and SAM, which reveales that the methionine side chain had enhanced van der Waals interactions with G9a. Therefore, our results provide a detailed mechanism by which H3K9M regulates H3K9 methylation.

Novel mutation predicted to disrupt SGOL1 protein function

African Journals Online (AJOL)

Rohit Gupta

2012-11-02

Nov 2, 2012 ... structural consequences of mutation over folding conformation of the 3rd exon. Further we carried .... Coiled Coil domain [PDB IDs: 3FGA] was retrieved from. Protein Data ... 1.0 nm of 216 SPC water molecules. We used 2CLА ...

Levels of H-ras codon 61 CAA to AAA mutation: response to 4-ABP-treatment and Pms2-deficiency.

Science.gov (United States)

Parsons, Barbara L; Delongchamp, Robert R; Beland, Frederick A; Heflich, Robert H

2006-01-01

DNA mismatch repair (MMR) deficiencies result in increased frequencies of spontaneous mutation and tumor formation. In the present study, we tested the hypothesis that a chemically-induced mutational response would be greater in a mouse with an MMR-deficiency than in the MMR-proficient mouse models commonly used to assay for chemical carcinogenicity. To accomplish this, the induction of H-ras codon 61 CAA-->AAA mutation was examined in Pms2 knockout mice (Pms2-/-, C57BL/6 background) and sibling wild-type mice (Pms2+/+). Groups of five or six neonatal male mice were treated with 0.3 micromol 4-aminobiphenyl (4-ABP) or the vehicle control, dimethylsulfoxide. Eight months after treatment, liver DNAs were isolated and analysed for levels of H-ras codon 61 CAA-->AAA mutation using allele-specific competitive blocker-PCR. In Pms2-proficient and Pms2-deficient mice, 4-ABP treatment caused an increase in mutant fraction (MF) from 1.65x10(-5) to 2.91x10(-5) and from 3.40x10(-5) to 4.70x10(-5), respectively. Pooling data from 4-ABP-treated and control mice, the approximately 2-fold increase in MF observed in Pms2-deficient as compared with Pms2-proficient mice was statistically significant (P=0.0207) and consistent with what has been reported previously in terms of induction of G:C-->T:A mutation in a Pms2-deficient background. Pooling data from both genotypes, the increase in H-ras MF in 4-ABP-treated mice, as compared with control mice, did not reach the 95% confidence level of statistical significance (P=0.0606). The 4-ABP treatment caused a 1.76-fold and 1.38-fold increase in average H-ras MF in Pms2-proficient and Pms2-deficient mice, respectively. Furthermore, the levels of induced mutation in Pms2-proficient and Pms2-deficient mice were nearly identical (1.26x10(-5) and 1.30x10(-5), respectively). We conclude that Pms2-deficiency does not result in an amplification of the H-ras codon 61 CAA-->AAA mutational response induced by 4-ABP.

A new mutation, gld, that produces lymphoproliferation and autoimmunity in C3H/HeJ mice.

Science.gov (United States)

Roths, J B; Murphy, E D; Eicher, E M

1984-01-01

A newly discovered autosomal recessive mutation, generalized lymphoproliferative disease (gld), in the C3H/HeJ strain of mice, determines the development of early onset massive lymphoid hyperplasia with autoimmunity. Significant lymph node enlargement is apparent as early as 12 wk of age. By 20 wk, lymph nodes are 50-fold heavier than those of coisogenic C3H/HeJ-+/+ mice. There is a concomitant increase in the numbers of peripheral blood lymphocytes. Analysis of C3H-gld lymph node lymphocyte subsets by immunofluorescence indicates an increase in numbers of B cells, T cells, and null (Thy-1-, sIg-) lymphocytes by 6-, 15-, and 33-fold compared with congeneic control mice. Serologically, gld/gld mice develop antinuclear antibodies (including anti-dsDNA), thymocyte-binding autoantibody, and hypergammaglobulinemia with major increases in several immunoglobulin isotypes. Mutant gld mice live only one-half as long as normal controls (12 and 23 mo, respectively). Interstitial pneumonitis was found in virtually all C3H-gld mice autopsied when moribund. Although immune complexes were detected in the glomerulus by immunofluorescence techniques, only 14% of the autopsied mice had significant lupus-like nephritis. Vascular disease was not found. The pattern of early onset massive lymph node enlargement, hypergammaglobulinemia, and production of antinuclear autoantibodies resembles the basic abnormal phenotype induced by the lpr (lymphoproliferation) mutation. The mutations gld and lpr are not allelic. Linkage studies indicate that gld is located between Pep-3 and Lp on chromosome 1. This new mutation adds another genetically well-defined model to the list of murine lymphoproliferative/autoimmune disorders that may be exploited to gain a clearer understanding of immunoregulatory defects and for identifying common pathogenetic factors involved in systemic autoimmune diseases.

Circadian Rhythm Disruption Promotes Lung Tumorigenesis.

Science.gov (United States)

Papagiannakopoulos, Thales; Bauer, Matthew R; Davidson, Shawn M; Heimann, Megan; Subbaraj, Lakshmipriya; Bhutkar, Arjun; Bartlebaugh, Jordan; Vander Heiden, Matthew G; Jacks, Tyler

2016-08-09

Circadian rhythms are 24-hr oscillations that control a variety of biological processes in living systems, including two hallmarks of cancer, cell division and metabolism. Circadian rhythm disruption by shift work is associated with greater risk for cancer development and poor prognosis, suggesting a putative tumor-suppressive role for circadian rhythm homeostasis. Using a genetically engineered mouse model of lung adenocarcinoma, we have characterized the effects of circadian rhythm disruption on lung tumorigenesis. We demonstrate that both physiologic perturbation (jet lag) and genetic mutation of the central circadian clock components decreased survival and promoted lung tumor growth and progression. The core circadian genes Per2 and Bmal1 were shown to have cell-autonomous tumor-suppressive roles in transformation and lung tumor progression. Loss of the central clock components led to increased c-Myc expression, enhanced proliferation, and metabolic dysregulation. Our findings demonstrate that both systemic and somatic disruption of circadian rhythms contribute to cancer progression. Copyright © 2016 Elsevier Inc. All rights reserved.

IgV(H) and bcl6 somatic mutation analysis reveals the heterogeneity of cutaneous B-cell lymphoma, and indicates the presence of undisclosed local antigens.

Science.gov (United States)

Franco, Renato; Camacho, Francisca I; Fernández-Vázquez, Amalia; Algara, Patrocinio; Rodríguez-Peralto, José L; De Rosa, Gaetano; Piris, Miguel A

2004-06-01

Our understanding of the ontology of B-cell lymphomas (BCL) has been improved by the study of mutational status of IgV(H) and bcl6 genes, but only a few cases of cutaneous BCL have been examined for this status. We analyzed IgV(H) and bcl6 somatic mutations in 10 cutaneous BCL, classified as follicular (three primary and one secondary), primary marginal zone (two cases), and diffuse large BCL (three primary and one secondary). We observed a lower rate (IgV(H) mutation in all marginal zone lymphomas, and a preferential usage of V(H)2-70 (one primary follicular and two primary diffuse large BCL). Fewer than expected replacement mutations in framework regions (FR) were observed in three primary follicular lymphomas (FLs) and in all diffuse large BCL, indicating a negative antigen selection pressure. Ongoing mutations were observed in eight of 10 cases. Only two primary FLs and two diffuse large BCL showed bcl6 somatic mutation. These data support the heterogeneous nature of the different cutaneous BCL, and specifically the distinction between cutaneous follicular and marginal zone lymphomas. The biased usage of V(H)2-70, the low rate of replacement mutation in the FR, and the presence of ongoing mutation imply that local antigens could modulate the growth of primary cutaneous BCL.

Association of HFE gene C282Y and H63D mutations with liver cirrhosis in the Lithuanian population

Directory of Open Access Journals (Sweden)

Simonas Juzėnas

2016-01-01

Conclusions: Heterozygous C282Y mutation of the HFE gene was associated with liver cirrhosis in the Lithuanian population. In gender-related analysis, heterozygous C282Y and homozygous H63D mutations were linked to liver cirrhosis in men, not in women.

Missense Mutation in Fam83H Gene in Iranian Patients with Amelogenesis Imperfecta.

Science.gov (United States)

Pourhashemi, S Jalal; Ghandehari Motlagh, Mehdi; Meighani, Ghasem; Ebrahimi Takaloo, Azadeh; Mansouri, Mahsa; Mohandes, Fatemeh; Mirzaii, Maryam; Khoshzaban, Ahad; Moshtaghi, Faranak; Abedkhojasteh, Hoda; Heidari, Mansour

2014-12-01

Amelogenesis Imperfecta (AI) is a disorder of tooth development where there is an abnormal formation of enamel or the external layer of teeth. The aim of this study was to screen mutations in the four most important candidate genes, ENAM, KLK4, MMP20 and FAM83H responsible for amelogenesis imperfect. Geneomic DNA was isolated from five Iranian families with 22 members affected with enamel malformations. The PCR amplifications were typically carried out for amplification the coding regions for AI patients and unaffected family members. The PCR products were subjected to direct sequencing. The pedigree analysis was performed using Cyrillic software. One family had four affected members with autosomal dominant hypocalcified amelogenesis imperfecta (ADHPCAI); pedigree analysis revealed four consanguineous families with 18 patients with autosomal recessive hypoplastic amelogenesis imperfecta (ARHPAI). One non-synonymous single-nucleotide substitution, c.1150T>A, p. Ser 342Thr was identified in the FAM83H, which resulted in ADHCAI. Furthermore, different polymorphisms or unclassified variants were detected in MMP20, ENAM and KLK4. Our results are consistent with other studies and provide further evidence for pathogenic mutations of FAM83H gene. These findings suggest different loci and genes could be implicated in the pathogenesis of AI.

hnRNPs H, H' and F behave differently with respect to posttranslational cleavage and subcellular localization

DEFF Research Database (Denmark)

Honoré, B; Vorum, H; Baandrup, U

1999-01-01

cytoplasmic localization in other cells. The different fates may reflect differences in functional roles that so far only have included nuclear functions. The presence of significant quantities of hnRNP F in the cytoplasm of many cells indicates that it also may have a functional role here. Udgivelsesdato...

Altered Mycobacterium tuberculosis Cell Wall Metabolism and Physiology Associated With RpoB Mutation H526D

Directory of Open Access Journals (Sweden)

Victoria L. Campodónico

2018-03-01

Full Text Available Background:Mycobacterium tuberculosis (Mtb rpoB mutations are associated with global metabolic remodeling. However, the net effects of rpoB mutations on Mtb physiology, metabolism and function are not completely understood. Based on previous work, we hypothesized that changes in the expression of cell wall molecules in Mtb mutant RpoB 526D lead to changes in cell wall permeability and to altered resistance to environmental stresses and drugs.Methods: The phenotypes of a fully drug-susceptible clinical strain of Mtb and its paired rifampin-monoresistant, RpoB H526D mutant progeny strain were compared.Results: The rpoB mutant showed altered colony morphology, bacillary length and cell wall thickness, which were associated with increased cell wall permeability and susceptibility to the cell wall detergent sodium dodecyl sulfate (SDS after exposure to nutrient starvation. Relative to the isogenic rifampin-susceptible strain, the RpoB H526D mutant showed altered bacterial cellular metabolic activity and an eightfold increase in susceptibility to the cell-wall acting drug vancomycin.Conclusion: Our data suggest that RpoB mutation H526D is associated with altered cell wall physiology and resistance to cell wall-related stress. These findings are expected to contribute to an improved understanding of the pathogenesis of drug-resistant M. tuberculosis infections.

Disruption of Lysosome Function Promotes Tumor Growth and Metastasis in Drosophila *

OpenAIRE

Chi, Congwu; Zhu, Huanhu; Han, Min; Zhuang, Yuan; Wu, Xiaohui; Xu, Tian

2010-01-01

Lysosome function is essential to many physiological processes. It has been suggested that deregulation of lysosome function could contribute to cancer. Through a genetic screen in Drosophila, we have discovered that mutations disrupting lysosomal degradation pathway components contribute to tumor development and progression. Loss-of-function mutations in the Class C vacuolar protein sorting (VPS) gene, deep orange (dor), dramatically promote tumor overgrowth and invasion of the RasV12 cells....

Enhanced Human-Type Receptor Binding by Ferret-Transmissible H5N1 with a K193T Mutation.

Science.gov (United States)

Peng, Wenjie; Bouwman, Kim M; McBride, Ryan; Grant, Oliver C; Woods, Robert J; Verheije, Monique H; Paulson, James C; de Vries, Robert P

2018-05-15

All human influenza pandemics have originated from avian influenza viruses. Although multiple changes are needed for an avian virus to be able to transmit between humans, binding to human-type receptors is essential. Several research groups have reported mutations in H5N1 viruses that exhibit specificity for human-type receptors and promote respiratory droplet transmission between ferrets. Upon detailed analysis, we have found that these mutants exhibit significant differences in fine receptor specificity compared to human H1N1 and H3N2 and retain avian-type receptor binding. We have recently shown that human influenza viruses preferentially bind to α2-6-sialylated branched N-linked glycans, where the sialic acids on each branch can bind to receptor sites on two protomers of the same hemagglutinin (HA) trimer. In this binding mode, the glycan projects over the 190 helix at the top of the receptor-binding pocket, which in H5N1 would create a stearic clash with lysine at position 193. Thus, we hypothesized that a K193T mutation would improve binding to branched N-linked receptors. Indeed, the addition of the K193T mutation to the H5 HA of a respiratory-droplet-transmissible virus dramatically improves both binding to human trachea epithelial cells and specificity for extended α2-6-sialylated N-linked glycans recognized by human influenza viruses. IMPORTANCE Infections by avian H5N1 viruses are associated with a high mortality rate in several species, including humans. Fortunately, H5N1 viruses do not transmit between humans because they do not bind to human-type receptors. In 2012, three seminal papers have shown how these viruses can be engineered to transmit between ferrets, the human model for influenza virus infection. Receptor binding, among others, was changed, and the viruses now bind to human-type receptors. Receptor specificity was still markedly different compared to that of human influenza viruses. Here we report an additional mutation in ferret

Disruption of transitional stages in 24-h blood pressure in renal transplant recipients

Directory of Open Access Journals (Sweden)

Marcelo E Katz

2012-03-01

Full Text Available Patients with kidney replacement exhibit disrupted circadian rhythms. Most studies measuring blood pressure use the dipper/non-dipper classification, which does not consider analysis of transitional stages between low and high blood pressure, confidence intervals nor shifts in the time of peak, while assuming subjective onsets of night and day phases. In order to better understand the nature of daily variation of blood pressure in these patients, we analyzed 24h recordings from 41 renal transplant recipients using the non-symmetrical double-logistic fitting assessment which does not assume abruptness nor symmetry in ascending and descending stages of the blood pressure profile, and a cosine best-fitting regression method (Cosinor. Compared with matched controls, double-logistic fitting showed that the times for most of transitional stages (ascending systolic and descending systolic, diastolic and mean arterial pressure had a wider distribution along the 24 h. The proportion of individuals without daily blood pressure rhythm in the transplanted group was larger only for systolic arterial pressure, and the amplitude showed no significant difference. Furthermore, the transplant recipient group had a less pronounced slope in descending systolic and ascending mean blood pressure. Cosinor analysis confirmed the phase related changes, showing a wider distribution of times of peak (acrophases. We conclude that daily disruptions in renal transplant recipients can be explained not only by absence in diurnal variation, but also in changes in waveform-related parameters of the rhythm, and that distortions in the phase of the rhythm are the most consistent finding for the patients.

Molecular analysis of congenital goitres with hypothyroidism caused by defective thyroglobulin synthesis. Identification of a novel c.7006C>T [p.R2317X] mutation and expression of minigenes containing nonsense mutations in exon 7.

Science.gov (United States)

Machiavelli, Gloria A; Caputo, Mariela; Rivolta, Carina M; Olcese, María C; Gruñeiro-Papendieck, Laura; Chiesa, Ana; González-Sarmiento, Rogelio; Targovnik, Héctor M

2010-01-01

Thyroglobulin (TG) deficiency is an autosomal-recessive disorder that results in thyroid dyshormonogenesis. A number of distinct mutations have been identified as causing human hypothyroid goitre. The purpose of this study was to identify and characterize new mutations in the TG gene in an attempt to increase the understanding of the genetic mechanism responsible for this disorder. A total of six patients from four nonconsanguineous families with marked impairment of TG synthesis were studied. Single-strand conformation polymorphism (SSCP) analysis, sequencing of DNA, genotyping, expression of chimeric minigenes and bioinformatic analysis were performed. Four different inactivating TG mutations were identified: one novel mutation (c.7006C>T [p.R2317X]) and three previously reported (c.886C>T [p.R277X], c.6701C>A [p.A2215D] and c.6725G>A [p.R2223H]). Consequently, one patient carried a compound heterozygous for p.R2223H/p.R2317X mutations; two brothers showed a homozygous p.A2215D substitution and the remaining three patients, from two families with typical phenotype, had a single p.R277X mutated allele. We also showed functional evidences that premature stop codons inserted at different positions in exon 7, which disrupt exonic splicing enhancer (ESE) sequences, do not interfere with exon definition and processing. In this study, we have identified a novel nonsense mutation p.R2317X in the acetylcholinesterase homology domain of TG. We have also observed that nonsense mutations do not interfere with the pre-mRNA splicing of exon 7. The results are in accordance with previous observations confirming the genetic heterogeneity of TG defects.

Association of HFE gene C282Y and H63D mutations with liver cirrhosis in the Lithuanian population.

Science.gov (United States)

Juzėnas, Simonas; Kupčinskas, Juozas; Valantienė, Irena; Šumskienė, Jolanta; Petrenkienė, Vitalija; Kondrackienė, Jūrate; Kučinskas, Laimutis; Kiudelis, Gediminas; Skiecevičienė, Jurgita; Kupčinskas, Limas

2016-01-01

Liver cirrhosis is the end-stage disease of chronic liver injury. Due to differences in the natural course of chronic liver diseases, identification of genetic factors that influence individual outcomes is warranted. HFE-linked hereditary hemochromatosis (HH) predisposes disease progression to cirrhosis; however, the role of heterozygous C282Y or H63D mutations in the development of cirrhosis in the presence of other etiological factors is still debated. The aim of this study was to determine the association between heterozygous C282Y and H63D mutations and non-HH liver cirrhosis in Lithuanian population. The patient cohort consisted of 209 individuals. Diagnosis of cirrhosis was confirmed by clinical, laboratory parameters, liver biopsy, and radiological imaging. Control samples were obtained from 1005 randomly selected unrelated healthy individuals. HFE gene mutations were determined using the PCR-RFLP method. The most common causes of cirrhosis were hepatitis C (33.9%), hepatitis B (13.6%), and alcohol (25.8%). C282Y allele was associated with the presence of cirrhosis (OR=2.07; P=0.005); this was also observed under recessive model for C282Y (OR=2.06, P=0.008). The prevalence of C282Y allele was higher in cirrhotic men than in controls (7.0% vs. 2.8%, P=0.002). The carriage of H63D risk allele (OR=1.54; P=0.02), heterozygous C282Y/wt and homozygous H63D/H63D genotypes were associated with liver cirrhosis in males (OR=2.48, P=0.008, and OR=4.13, P=0.005, respectively). Heterozygous C282Y mutation of the HFE gene was associated with liver cirrhosis in the Lithuanian population. In gender-related analysis, heterozygous C282Y and homozygous H63D mutations were linked to liver cirrhosis in men, not in women. Copyright © 2016 The Lithuanian University of Health Sciences. Production and hosting by Elsevier Urban & Partner Sp. z o.o. All rights reserved.

In silico analysis of conformational changes induced by mutation of aromatic binding residues: consequences for drug binding in the hERG K+ channel.

Directory of Open Access Journals (Sweden)

Kirsten Knape

Full Text Available Pharmacological inhibition of cardiac hERG K(+ channels is associated with increased risk of lethal arrhythmias. Many drugs reduce hERG current by directly binding to the channel, thereby blocking ion conduction. Mutation of two aromatic residues (F656 and Y652 substantially decreases the potency of numerous structurally diverse compounds. Nevertheless, some drugs are only weakly affected by mutation Y652A. In this study we utilize molecular dynamics simulations and docking studies to analyze the different effects of mutation Y652A on a selected number of hERG blockers. MD simulations reveal conformational changes in the binding site induced by mutation Y652A. Loss of π-π-stacking between the two aromatic residues induces a conformational change of the F656 side chain from a cavity facing to cavity lining orientation. Docking studies and MD simulations qualitatively reproduce the diverse experimentally observed modulatory effects of mutation Y652A and provide a new structural interpretation for the sensitivity differences.

Induced mutations in chickpea (Cicer arietinum L.) II. frequency and spectrum of chlorophyll mutations

International Nuclear Information System (INIS)

Kharkwal, M.C.

1998-01-01

A comparative study of frequency and spectrum of chlorophyll mutations induced by two physical (gamma rays, fast neutrons) and two chemical mutagens (NMU, EMS) in relation to the effects in M1 plants and induction of mutations in M2 was made in four chickpea (Cicer arietinum L.) varieties, two desi (G 130 & H 214) one Kabuli (C 104) and one green seeded (L 345). The treatments included three doses each of gamma rays (400, 500 & 600 Gy) and fast neutrons (5, 10 & 15 Gy) and two concentrations with two different durations of two chemical mutagens, NMU [0.01% (20h), & 0.02% (8h)] and EMS [0.1% (20h) & 0.2% (8h)]. The frequencies and spectrum of three different kinds of induced chlorophyll mutations in the order albina (43.5%), chlorina (27.3%) and xantha (24.2%) were recorded. Chemical mutagens were found to be efficient in inducing chlorophyll mutations in chickpea. Highest frequency of mutations was observed in green seeded var. L 345 (83% of M1 families and 19.9/1000 M2 plants). Kabuli var. C 104 was least responsive for chlorophyll mutations

A disease-associated frameshift mutation in caveolin-1 disrupts caveolae formation and function through introduction of a de novo ER retention signal.

Science.gov (United States)

Copeland, Courtney A; Han, Bing; Tiwari, Ajit; Austin, Eric D; Loyd, James E; West, James D; Kenworthy, Anne K

2017-11-01

Caveolin-1 (CAV1) is an essential component of caveolae and is implicated in numerous physiological processes. Recent studies have identified heterozygous mutations in the CAV1 gene in patients with pulmonary arterial hypertension (PAH), but the mechanisms by which these mutations impact caveolae assembly and contribute to disease remain unclear. To address this question, we examined the consequences of a familial PAH-associated frameshift mutation in CAV1 , P158PfsX22, on caveolae assembly and function. We show that C-terminus of the CAV1 P158 protein contains a functional ER-retention signal that inhibits ER exit and caveolae formation and accelerates CAV1 turnover in Cav1 -/- MEFs. Moreover, when coexpressed with wild-type (WT) CAV1 in Cav1 -/- MEFs, CAV1-P158 functions as a dominant negative by partially disrupting WT CAV1 trafficking. In patient skin fibroblasts, CAV1 and caveolar accessory protein levels are reduced, fewer caveolae are observed, and CAV1 complexes exhibit biochemical abnormalities. Patient fibroblasts also exhibit decreased resistance to a hypo-osmotic challenge, suggesting the function of caveolae as membrane reservoir is compromised. We conclude that the P158PfsX22 frameshift introduces a gain of function that gives rise to a dominant negative form of CAV1, defining a new mechanism by which disease-associated mutations in CAV1 impair caveolae assembly. © 2017 Copeland, Han, et al. This article is distributed by The American Society for Cell Biology under license from the author(s). Two months after publication it is available to the public under an Attribution–Noncommercial–Share Alike 3.0 Unported Creative Commons License (http://creativecommons.org/licenses/by-nc-sa/3.0).

Structural basis of dual Ca2+/pH regulation of the endolysosomal TRPML1 channel

Energy Technology Data Exchange (ETDEWEB)

Li, Minghui; Zhang, Wei K.; Benvin, Nicole M.; Zhou, Xiaoyuan; Su, Deyuan; Li, Huan; Wang, Shu; Michailidis, Ioannis E.; Tong, Liang; Li, Xueming; Yang, Jian

2017-01-23

The activities of organellar ion channels are often regulated by Ca2+ and H+, which are present in high concentrations in many organelles. Here we report a structural element critical for dual Ca2+/pH regulation of TRPML1, a Ca2+-release channel crucial for endolysosomal function. TRPML1 mutations cause mucolipidosis type IV (MLIV), a severe lysosomal storage disorder characterized by neurodegeneration, mental retardation and blindness. We obtained crystal structures of the 213-residue luminal domain of human TRPML1 containing three missense MLIV-causing mutations. This domain forms a tetramer with a highly electronegative central pore formed by a novel luminal pore loop. Cysteine cross-linking and cryo-EM analyses confirmed that this architecture occurs in the full-length channel. Structure–function studies demonstrated that Ca2+ and H+ interact with the luminal pore and exert physiologically important regulation. The MLIV-causing mutations disrupt the luminal-domain structure and cause TRPML1 mislocalization. Our study reveals the structural underpinnings of TRPML1's regulation, assembly and pathogenesis.

Mutational analysis of hepatitis B virus pre-S1 (9–24) fusogenic peptide

Energy Technology Data Exchange (ETDEWEB)

Liu, Qiushi; Somiya, Masaharu [The Institute of Scientific and Industrial Research, Osaka University, Osaka 567-0047 (Japan); Shimada, Naohiko; Sakamoto, Wakako [Department of Biomolecular Engineering, Tokyo Institute of Technology, 4259 B-57, Nagatsuta, Midori, Yokohama 226-8501 (Japan); Yoshimoto, Nobuo; Iijima, Masumi; Tatematsu, Kenji; Nakai, Tadashi; Okajima, Toshihide [The Institute of Scientific and Industrial Research, Osaka University, Osaka 567-0047 (Japan); Maruyama, Atsushi [Department of Biomolecular Engineering, Tokyo Institute of Technology, 4259 B-57, Nagatsuta, Midori, Yokohama 226-8501 (Japan); Kuroda, Shuńichi, E-mail: skuroda@sanken.osaka-u.ac.jp [The Institute of Scientific and Industrial Research, Osaka University, Osaka 567-0047 (Japan)

2016-05-27

A hollow nanoparticle known as a bio-nanocapsule (BNC) consisting of hepatitis B virus (HBV) envelope L protein and liposome (LP) can encapsulate drugs and genes and thereby deliver them in vitro and in vivo to human hepatic tissues, specifically by utilizing the HBV-derived infection machinery. Recently, we identified a low pH-dependent fusogenic domain at the N-terminal part of the pre-S1 region of the HBV L protein (amino acid residues 9 to 24; NPLGFFPDHQLDPAFG), which shows membrane destabilizing activity (i.e., membrane fusion, membrane disruption, and payload release) upon interaction with target LPs. In this study, instead of BNC and HBV, we generated LPs displaying a mutated form of the pre-S1 (9–24) peptide, and performed a membrane disruption assay using target LPs containing pyranine (fluorophore) and p-xylene-bis (N-pyridinium bromide) (DPX) as a quencher. The membrane disruption activity was found to correlate with the hydrophobicity of the whole structure, while the peptide retained a random-coil structure even under low pH condition. One large hydrophobic cluster (I) and one small hydrophobic cluster (II) residing in the peptide would be connected by the protonation of residues D16 and D20, and thereby exhibit strong membrane disruption activity in a low pH-dependent manner. Furthermore, the introduction of a positively charged residue enhanced the activity significantly, suggesting that a sole positively charged residue (H17) may be important for the interaction with target LPs by electrostatic interaction. Collectively, these results suggest that the pre-S1 (9–24) peptide may be involved in the endosomal escape of the BNC's payloads, as well as in the HBV uncoating process. -- Highlights: •Low pH-dependent fusogenic domain of hepatitis B virus pre-S1 region is analyzed. •The domain resides in pre-S1 (9–24) region, exhibiting random-coil structure. •Membrane disruption activity of the domain is mainly driven by its hydrophobicity

Reduction of Skeletal Muscle Power in Adolescent Males Carrying H63D Mutation in the HFE Gene.

Science.gov (United States)

Luszczyk, Marcin; Kaczorowska-Hac, Barbara; Milosz, Ewa; Adamkiewicz-Drozynska, Elzbieta; Ziemann, Ewa; Laskowski, Radoslaw; Flis, Damian; Rokicka-Hebel, Magdalena; Antosiewicz, Jedrzej

2017-01-01

Iron overload resulting from the mutation of genes involved in iron metabolism or excess dietary intake has been reported to negatively influence human physical performance. The aim of this study was to test the hypothesis that adolescents bearing a hemochromatosis gene (HFE) mutation in contrast to adults with the same mutation will not experience iron accumulation and their aerobic capacity will be similar to that of age-matched controls. Thirteen boys participated in the study. Seven of them are carriers of H63D mutation in the HFE gene and six were wild type. Fitness levels were assessed using the cardiopulmonary exercise test. In addition, iron status and inflammatory markers were determined. We observed that cardiovascular fitness was significantly lower in the group bearing the HFE mutation compared to the control group. Moreover, the HFE mutation group achieved lower maximal power output compared to the control group. There were no differences in blood ferritin concentrations between the two groups which indicates similar amounts of stored iron. Obtained data do not confirm our hypothesis. On the contrary, it was demonstrated that HFE mutation is associated with a lower level of aerobic capacity, even in the absence of iron accumulation.

Globo H expression is associated with driver mutations and PD-L1 expressions in stage I non-small cell lung cancer.

Science.gov (United States)

Yang, Ching-Yao; Lin, Mong-Wei; Chang, Yih-Leong; Wu, Chen-Tu

2017-12-12

Globo H is a tumor-associated carbohydrate antigen exclusively expressed in cancer cells rather than normal tissue. Globo H has been found on many cancers of epithelial origins, and become an attractive target for cancer vaccine. We aimed to study the expression of Globo H in non-small cell lung cancer (NSCLC) patients, and correlated its expression with common driver mutations, clinical outcomes, and status of immune checkpoint, programmed death-ligand 1 (PD-L1). The study enrolled 228 patients with surgically resected stage I NSCLC, including 139 patients with adenocarcinoma (ADC) and 89 patients with squamous cell carcinoma (SqCC). Using immunohistochemistry, tumors with moderate to strong membranous staining in ⩾ 1% tumor cells per section were scored as positive Globo H expression. Driver mutations including EGFR, KRAS, BRAF were detected by direct sequencing, while ALK, PI3KCA, FGFR1 and PD-L1 expression was detected by immunohistochemical (IHC) staining. Positive Globo H expression was detected in 88 of the 228 (38.6%) patients. These included 51 of 139 (36.7%) patients with ADC and 37 of 89 (41.6%) patients with SqCC. Positive Globo H expression was significantly associated with EGFR mutation and PD-L1 expression in the ADC group, and PI3KCA overexpression in the SqCC group. The survival analysis showed that Globo H expression was not an independent prognostic factor in stage I NSCLC. Globo H expression was correlated with specific driver mutations in ADC and SqCC NSCLC tumors, as well as PD-L1 status. Immunotherapy targeting Globo H may have potential application in lung cancer treatment.

Mutations in DONSON disrupt replication fork stability and cause microcephalic dwarfism.

Science.gov (United States)

Reynolds, John J; Bicknell, Louise S; Carroll, Paula; Higgs, Martin R; Shaheen, Ranad; Murray, Jennie E; Papadopoulos, Dimitrios K; Leitch, Andrea; Murina, Olga; Tarnauskaitė, Žygimantė; Wessel, Sarah R; Zlatanou, Anastasia; Vernet, Audrey; von Kriegsheim, Alex; Mottram, Rachel M A; Logan, Clare V; Bye, Hannah; Li, Yun; Brean, Alexander; Maddirevula, Sateesh; Challis, Rachel C; Skouloudaki, Kassiani; Almoisheer, Agaadir; Alsaif, Hessa S; Amar, Ariella; Prescott, Natalie J; Bober, Michael B; Duker, Angela; Faqeih, Eissa; Seidahmed, Mohammed Zain; Al Tala, Saeed; Alswaid, Abdulrahman; Ahmed, Saleem; Al-Aama, Jumana Yousuf; Altmüller, Janine; Al Balwi, Mohammed; Brady, Angela F; Chessa, Luciana; Cox, Helen; Fischetto, Rita; Heller, Raoul; Henderson, Bertram D; Hobson, Emma; Nürnberg, Peter; Percin, E Ferda; Peron, Angela; Spaccini, Luigina; Quigley, Alan J; Thakur, Seema; Wise, Carol A; Yoon, Grace; Alnemer, Maha; Tomancak, Pavel; Yigit, Gökhan; Taylor, A Malcolm R; Reijns, Martin A M; Simpson, Michael A; Cortez, David; Alkuraya, Fowzan S; Mathew, Christopher G; Jackson, Andrew P; Stewart, Grant S

2017-04-01

To ensure efficient genome duplication, cells have evolved numerous factors that promote unperturbed DNA replication and protect, repair and restart damaged forks. Here we identify downstream neighbor of SON (DONSON) as a novel fork protection factor and report biallelic DONSON mutations in 29 individuals with microcephalic dwarfism. We demonstrate that DONSON is a replisome component that stabilizes forks during genome replication. Loss of DONSON leads to severe replication-associated DNA damage arising from nucleolytic cleavage of stalled replication forks. Furthermore, ATM- and Rad3-related (ATR)-dependent signaling in response to replication stress is impaired in DONSON-deficient cells, resulting in decreased checkpoint activity and the potentiation of chromosomal instability. Hypomorphic mutations in DONSON substantially reduce DONSON protein levels and impair fork stability in cells from patients, consistent with defective DNA replication underlying the disease phenotype. In summary, we have identified mutations in DONSON as a common cause of microcephalic dwarfism and established DONSON as a critical replication fork protein required for mammalian DNA replication and genome stability.

p110α Hot Spot Mutations E545K and H1047R Exert Metabolic Reprogramming Independently of p110α Kinase Activity.

Science.gov (United States)

Chaudhari, Aditi; Krumlinde, Daniel; Lundqvist, Annika; Akyürek, Levent M; Bandaru, Sashidhar; Skålén, Kristina; Ståhlman, Marcus; Borén, Jan; Wettergren, Yvonne; Ejeskär, Katarina; Rotter Sopasakis, Victoria

2015-10-01

The phosphatidylinositol-4,5-bisphosphate 3-kinase (PI3K) catalytic subunit p110α is the most frequently mutated kinase in human cancer, and the hot spot mutations E542K, E545K, and H1047R are the most common mutations in p110α. Very little is known about the metabolic consequences of the hot spot mutations of p110α in vivo. In this study, we used adenoviral gene transfer in mice to investigate the effects of the E545K and H1047R mutations on hepatic and whole-body glucose metabolism. We show that hepatic expression of these hot spot mutations results in rapid hepatic steatosis, paradoxically accompanied by increased glucose tolerance, and marked glycogen accumulation. In contrast, wild-type p110α expression does not lead to hepatic accumulation of lipids or glycogen despite similar degrees of upregulated glycolysis and expression of lipogenic genes. The reprogrammed metabolism of the E545K and H1047R p110α mutants was surprisingly not dependent on altered p110α lipid kinase activity. Copyright © 2015, American Society for Microbiology. All Rights Reserved.

C282Y and H63D Mutation Frequencies in a Population from Central Spain

Directory of Open Access Journals (Sweden)

S. Alvarez

2001-01-01

Full Text Available Objectives: To determine the frequency of hereditary hemochromatosis gene mutations, C282Y and H63D, from 125 autochthonous blood donors originating from a Central region of Spain, to provide epidemiological data about HFE gene in the Iberian Peninsula.

IgV H mutations in blastoid mantle cell lymphoma characterize a subgroup with a tendency to more favourable clinical outcome.

Science.gov (United States)

Cogliatti, Sergio B; Bertoni, Francesco; Zimmermann, Dieter R; Henz, Samuel; Diss, Tim C; Ghielmini, Michele; Schmid, Ulrico

2005-07-01

Mantle cell lymphoma (MCL) is associated with a very unfavourable clinical course. This is particularly true for mantle cell lymphoma of the blastoid subtype (MCL-b). In order to define prognostic factors, we analysed the impact of immunoglobulin heavy chain variable (IgV H) gene somatic hypermutations on clinical outcome in a series of 21 cases of morphologically, phenotypically, and genotypically well-characterized MCL-b. Testing and estimation were performed using log-rank statistics and displayed on Kaplan-Meier graphs. Thirteen of 21 cases of MCL-b revealed a homology rate of > or = 99% compared to IgV H germ-line sequences in the databases and were scored as non-mutated. Eight of 21 cases (38%) of MCL-b were mutated. In MCL-b the mutation frequency was usually low and the mutation pattern was only rarely antigen-selected, in contrast to a control group of 11 cases with morphologically almost identical, but phenotypically and genotypically clearly distinguishable, diffuse large B cell lymphoma, derived, most likely, from germinal centre B cells. In our series of 21 MCL-b, positive IgV H mutational status, irrespective of varying homology thresholds, had no statistically significant prognostic impact on event-free or overall survival. However, mutated MCL-b tended to present more frequently at an earlier stage and without bone marrow involvement and to show lower rates of relapse and death, resulting in a more favourable clinical outcome. Copyright 2005 Pathological Society of Great Britain and Ireland. Published by John Wiley & Sons, Ltd.

Disruption of neural progenitors along the ventricular and subventricular zones in periventricular heterotopia

Science.gov (United States)

Ferland, Russell J.; Batiz, Luis Federico; Neal, Jason; Lian, Gewei; Bundock, Elizabeth; Lu, Jie; Hsiao, Yi-Chun; Diamond, Rachel; Mei, Davide; Banham, Alison H.; Brown, Philip J.; Vanderburg, Charles R.; Joseph, Jeffrey; Hecht, Jonathan L.; Folkerth, Rebecca; Guerrini, Renzo; Walsh, Christopher A.; Rodriguez, Esteban M.; Sheen, Volney L.

2009-01-01

Periventricular heterotopia (PH) is a disorder characterized by neuronal nodules, ectopically positioned along the lateral ventricles of the cerebral cortex. Mutations in either of two human genes, Filamin A (FLNA) or ADP-ribosylation factor guanine exchange factor 2 (ARFGEF2), cause PH (Fox et al. in ‘Mutations in filamin 1 prevent migration of cerebral cortical neurons in human periventricular heterotopia'. Neuron, 21, 1315–1325, 1998; Sheen et al. in ‘Mutations in ARFGEF2 implicate vesicle trafficking in neural progenitor proliferation and migration in the human cerebral cortex'. Nat. Genet., 36, 69–76, 2004). Recent studies have shown that mutations in mitogen-activated protein kinase kinase kinase-4 (Mekk4), an indirect interactor with FlnA, also lead to periventricular nodule formation in mice (Sarkisian et al. in ‘MEKK4 signaling regulates filamin expression and neuronal migration'. Neuron, 52, 789–801, 2006). Here we show that neurons in post-mortem human PH brains migrated appropriately into the cortex, that periventricular nodules were primarily composed of later-born neurons, and that the neuroependyma was disrupted in all PH cases. As studied in the mouse, loss of FlnA or Big2 function in neural precursors impaired neuronal migration from the germinal zone, disrupted cell adhesion and compromised neuroepithelial integrity. Finally, the hydrocephalus with hop gait (hyh) mouse, which harbors a mutation in Napa [encoding N-ethylmaleimide-sensitive factor attachment protein alpha (α-SNAP)], also develops a progressive denudation of the neuroepithelium, leading to periventicular nodule formation. Previous studies have shown that Arfgef2 and Napa direct vesicle trafficking and fusion, whereas FlnA associates dynamically with the Golgi membranes during budding and trafficking of transport vesicles. Our current findings suggest that PH formation arises from a final common pathway involving disruption of vesicle trafficking, leading to impaired cell

An immuno-wall microdevice exhibits rapid and sensitive detection of IDH1-R132H mutation specific to grade II and III gliomas

Science.gov (United States)

Yamamichi, Akane; Kasama, Toshihiro; Ohka, Fumiharu; Suzuki, Hiromichi; Kato, Akira; Motomura, Kazuya; Hirano, Masaki; Ranjit, Melissa; Chalise, Lushun; Kurimoto, Michihiro; Kondo, Goro; Aoki, Kosuke; Kaji, Noritada; Tokeshi, Manabu; Matsubara, Toshio; Senga, Takeshi; Kaneko, Mika K.; Suzuki, Hidenori; Hara, Masahito; Wakabayashi, Toshihiko; Baba, Yoshinobu; Kato, Yukinari; Natsume, Atsushi

2016-01-01

World Health Organization grade II and III gliomas most frequently occur in the central nervous system (CNS) in adults. Gliomas are not circumscribed; tumor edges are irregular and consist of tumor cells, normal brain tissue, and hyperplastic reactive glial cells. Therefore, the tumors are not fully resectable, resulting in recurrence, malignant progression, and eventual death. Approximately 69-80% of grade II and III gliomas harbor mutations in the isocitrate dehydrogenase 1 gene (IDH1), of which 83-90% are found to be the IDH1-R132H mutation. Detection of the IDH1-R132H mutation should help in the differential diagnosis of grade II and III gliomas from other types of CNS tumors and help determine the boundary between the tumor and normal brain tissue. In this study, we established a highly sensitive antibody-based device, referred to as the immuno-wall, to detect the IDH1-R132H mutation in gliomas. The immuno-wall causes an immunoreaction in microchannels fabricated using a photo-polymerizing polymer. This microdevice enables the analysis of the IDH1 status with a small sample within 15 min with substantially high sensitivity. Our results suggested that 10% content of the IDH1-R132H mutation in a sample of 0.33 μl volume, with 500 ng protein, or from 500 cells is theoretically sufficient for the analysis. The immuno-wall device will enable the rapid and highly sensitive detection of the IDH1-R132H mutation in routine clinical practice.

The Differential Role of Human Cationic Trypsinogen (PRSS1 p.R122H Mutation in Hereditary and Nonhereditary Chronic Pancreatitis: A Systematic Review and Meta-Analysis

Directory of Open Access Journals (Sweden)

Cheng Hu

2017-01-01

Full Text Available Background. Environmental factors and genetic mutations have been increasingly recognized as risk factors for chronic pancreatitis (CP. The PRSS1 p.R122H mutation was the first discovered to affect hereditary CP, with 80% penetrance. We performed here a systematic review and meta-analysis to evaluate the associations of PRSS1 p.R122H mutation with CP of diverse etiology. Methods. The PubMed, EMBASE, and MEDLINE database were reviewed. The pooled odds ratio (OR with 95% confidence intervals was used to evaluate the association of p.R122H mutation with CP. Initial analysis was conducted with all etiologies of CP, followed by a subgroup analysis for hereditary and nonhereditary CP, including alcoholic or idiopathic CP. Results. A total of eight case-control studies (1733 cases and 2415 controls were identified and included. Overall, PRSS1 p.R122H mutation was significantly associated with an increased risk of CP (OR = 4.78[1.13–20.20]. Further analysis showed p.R122H mutation strongly associated with the increased risk of hereditary CP (OR = 65.52[9.09–472.48] but not with nonhereditary CP, both alcoholic and idiopathic CP. Conclusions. Our study showing the differential role of p.R122H mutation in various etiologies of CP indicates that this complex disorder is likely influenced by multiple genetic factors as well as environmental factors.

CACNA1H Mutations Are Associated With Different Forms of Primary Aldosteronism

Directory of Open Access Journals (Sweden)

Georgios Daniil

2016-11-01

Four different heterozygous germline CACNA1H variants were identified. A de novo Cav3.2 p.Met1549Ile variant was found in early onset PA and multiplex developmental disorder. Cav3.2 p.Ser196Leu and p.Pro2083Leu were found in two patients with FH, and p.Val1951Glu was identified in one patient with APA. Electrophysiological analysis of mutant Cav3.2 channels revealed significant changes in the Ca2+ current properties for all mutants, suggesting a gain of function phenotype. Transfections of mutant Cav3.2 in H295R-S2 cells led to increased aldosterone production and/or expression of genes coding for steroidogenic enzymes after K+ stimulation. Identification of CACNA1H mutations associated with early onset PA, FH, and APA suggests that CACNA1H might be a susceptibility gene predisposing to PA with different phenotypic presentations, opening new perspectives for genetic diagnosis and management of patients with PA.

Severe Hypertriglyceridemia due to a novel p.Q240H mutation in the Lipoprotein Lipase gene.

Science.gov (United States)

Soto, Angela Ganan; McIntyre, Adam; Agrawal, Sungeeta; Bialo, Shara R; Hegele, Robert A; Boney, Charlotte M

2015-09-04

Lipoprotein Lipase (LPL) deficiency is a rare autosomal recessive disorder with a heterogeneous clinical presentation. Several mutations in the LPL gene have been identified to cause decreased activity of the enzyme. An 11-week-old, exclusively breastfed male presented with coffee-ground emesis, melena, xanthomas, lipemia retinalis and chylomicronemia. Genomic DNA analysis identified lipoprotein lipase deficiency due to compound heterozygosity including a novel p.Q240H mutation in exon 5 of the lipoprotein lipase (LPL) gene. His severe hypertriglyceridemia, including xanthomas, resolved with dietary long-chain fat restriction. We describe a novel mutation of the LPL gene causing severe hypertriglyceridemia and report the response to treatment. A review of the current literature regarding LPL deficiency syndrome reveals a few potential new therapies under investigation.

Identification of two novel mutations in the SLC45A2 gene in a Hungarian pedigree affected by unusual OCA type 4.

Science.gov (United States)

Tóth, Lola; Fábos, Beáta; Farkas, Katalin; Sulák, Adrienn; Tripolszki, Kornélia; Széll, Márta; Nagy, Nikoletta

2017-03-15

Oculocutaneous albinism (OCA) is a clinically and genetically heterogenic group of pigmentation abnormalities. OCA type IV (OCA4, OMIM 606574) develops due to homozygous or compound heterozygous mutations in the solute carrier family 45, member 2 (SLC45A2) gene. This gene encodes a membrane-associated transport protein, which regulates tyrosinase activity and, thus, melanin content by changing melanosomal pH and disrupting the incorporation of copper into tyrosinase. Here we report two Hungarian siblings affected by an unusual OCA4 phenotype. After genomic DNA was isolated from peripheral blood of the patients, the coding regions of the SLC45A2 gene were sequenced. In silico tools were applied to identify the functional impact of the newly detected mutations. Direct sequencing of the SLC45A2 gene revealed two novel, heterozygous mutations, one missense (c.1226G > A, p.Gly409Asp) and one nonsense (c.1459C > T, p.Gln437*), which were present in both patients, suggesting the mutations were compound heterozygous. In silico tools suggest that these variations are disease causing mutations. The newly identified mutations may affect the transmembrane domains of the protein, and could impair transport function, resulting in decreases in both melanosomal pH and tyrosinase activity. Our study provides expands on the mutation spectrum of the SLC45A2 gene and the genetic background of OCA4.

Detailed analysis of targeted gene mutations caused by the Platinum-Fungal TALENs in Aspergillus oryzae RIB40 strain and a ligD disruptant.

Science.gov (United States)

Mizutani, Osamu; Arazoe, Takayuki; Toshida, Kenji; Hayashi, Risa; Ohsato, Shuichi; Sakuma, Tetsushi; Yamamoto, Takashi; Kuwata, Shigeru; Yamada, Osamu

2017-03-01

Transcription activator-like effector nucleases (TALENs), which can generate DNA double-strand breaks at specific sites in the desired genome locus, have been used in many organisms as a tool for genome editing. In Aspergilli, including Aspergillus oryzae, however, the use of TALENs has not been validated. In this study, we performed genome editing of A. oryzae wild-type strain via error of nonhomologous end-joining (NHEJ) repair by transient expression of high-efficiency Platinum-Fungal TALENs (PtFg TALENs). Targeted mutations were observed as various mutation patterns. In particular, approximately half of the PtFg TALEN-mediated deletion mutants had deletions larger than 1 kb in the TALEN-targeting region. We also conducted PtFg TALEN-based genome editing in A. oryzae ligD disruptant (ΔligD) lacking the ligD gene involved in the final step of the NHEJ repair and found that mutations were still obtained as well as wild-type. In this case, the ratio of the large deletions reduced compared to PtFg TALEN-based genome editing in the wild-type. In conclusion, we demonstrate that PtFg TALENs are sufficiently functional to cause genome editing via error of NHEJ in A. oryzae. In addition, we reveal that genome editing using TALENs in A. oryzae tends to cause large deletions at the target region, which were partly suppressed by deletion of ligD. Copyright © 2016 The Society for Biotechnology, Japan. Published by Elsevier B.V. All rights reserved.

Diffuse high-grade gliomas with H3 K27M mutations carry a dismal prognosis independent of tumor location.

Science.gov (United States)

Karremann, Michael; Gielen, Gerrit H; Hoffmann, Marion; Wiese, Maria; Colditz, Niclas; Warmuth-Metz, Monika; Bison, Brigitte; Claviez, Alexander; van Vuurden, Dannis G; von Bueren, André O; Gessi, Marco; Kühnle, Ingrid; Hans, Volkmar H; Benesch, Martin; Sturm, Dominik; Kortmann, Rolf-Dieter; Waha, Andreas; Pietsch, Torsten; Kramm, Christof M

2018-01-10

The novel entity of "diffuse midline glioma, H3 K27M-mutant" has been defined in the 2016 revision of the World Health Organization (WHO) classification of tumors of the central nervous system (CNS). Tumors of this entity arise in CNS midline structures of predominantly pediatric patients and are associated with an overall dismal prognosis. They are defined by K27M mutations in H3F3A or HIST1H3B/C, encoding for histone 3 variants H3.3 and H3.1, respectively, which are considered hallmark events driving gliomagenesis. Here, we characterized 85 centrally reviewed diffuse gliomas on midline locations enrolled in the nationwide pediatric German HIT-HGG registry regarding tumor site, histone 3 mutational status, WHO grade, age, sex, and extent of tumor resection. We found 56 H3.3 K27M-mutant tumors (66%), 6 H3.1 K27M-mutant tumors (7%), and 23 H3-wildtype tumors (27%). H3 K27M-mutant gliomas shared an aggressive clinical course independent of their anatomic location. Multivariate regression analysis confirmed the significant impact of the H3 K27M mutation as the only independent parameter predictive of overall survival (P = 0.009). In H3 K27M-mutant tumors, neither anatomic midline location nor histopathological grading nor extent of tumor resection had an influence on survival. These results substantiate the clinical significance of considering diffuse midline glioma, H3 K27M-mutant, as a distinct entity corresponding to WHO grade IV, carrying a universally fatal prognosis. © The Author(s) 2017. Published by Oxford University Press on behalf of the Society for Neuro-Oncology. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com

Alpha-cardiac myosin heavy chain (MYH6) mutations affecting myofibril formation are associated with congenital heart defects.

Science.gov (United States)

Granados-Riveron, Javier T; Ghosh, Tushar K; Pope, Mark; Bu'Lock, Frances; Thornborough, Christopher; Eason, Jacqueline; Kirk, Edwin P; Fatkin, Diane; Feneley, Michael P; Harvey, Richard P; Armour, John A L; David Brook, J

2010-10-15

Congenital heart defects (CHD) are collectively the most common form of congenital malformation. Studies of human cases and animal models have revealed that mutations in several genes are responsible for both familial and sporadic forms of CHD. We have previously shown that a mutation in MYH6 can cause an autosomal dominant form of atrial septal defect (ASD), whereas others have identified mutations of the same gene in patients with hypertrophic and dilated cardiomyopathy. In the present study, we report a mutation analysis of MYH6 in patients with a wide spectrum of sporadic CHD. The mutation analysis of MYH6 was performed in DNA samples from 470 cases of isolated CHD using denaturing high-performance liquid chromatography and sequence analysis to detect point mutations and small deletions or insertions, and multiplex amplifiable probe hybridization to detect partial or complete copy number variations. One non-sense mutation, one splicing site mutation and seven non-synonymous coding mutations were identified. Transfection of plasmids encoding mutant and non-mutant green fluorescent protein-MYH6 fusion proteins in mouse myoblasts revealed that the mutations A230P and A1366D significantly disrupt myofibril formation, whereas the H252Q mutation significantly enhances myofibril assembly in comparison with the non-mutant protein. Our data indicate that functional variants of MYH6 are associated with cardiac malformations in addition to ASD and provide a novel potential mechanism. Such phenotypic heterogeneity has been observed in other genes mutated in CHD.

Impact of mutations in Toll-like receptor pathway genes on esophageal carcinogenesis.

Directory of Open Access Journals (Sweden)

Daffolyn Rachael Fels Elliott

2017-05-01

Full Text Available Esophageal adenocarcinoma (EAC develops in an inflammatory microenvironment with reduced microbial diversity, but mechanisms for these influences remain poorly characterized. We hypothesized that mutations targeting the Toll-like receptor (TLR pathway could disrupt innate immune signaling and promote a microenvironment that favors tumorigenesis. Through interrogating whole genome sequencing data from 171 EAC patients, we showed that non-synonymous mutations collectively affect the TLR pathway in 25/171 (14.6%, PathScan p = 8.7x10-5 tumors. TLR mutant cases were associated with more proximal tumors and metastatic disease, indicating possible clinical significance of these mutations. Only rare mutations were identified in adjacent Barrett's esophagus samples. We validated our findings in an external EAC dataset with non-synonymous TLR pathway mutations in 33/149 (22.1%, PathScan p = 0.05 tumors, and in other solid tumor types exposed to microbiomes in the COSMIC database (10,318 samples, including uterine endometrioid carcinoma (188/320, 58.8%, cutaneous melanoma (377/988, 38.2%, colorectal adenocarcinoma (402/1519, 26.5%, and stomach adenocarcinoma (151/579, 26.1%. TLR4 was the most frequently mutated gene with eleven mutations in 10/171 (5.8% of EAC tumors. The TLR4 mutants E439G, S570I, F703C and R787H were confirmed to have impaired reactivity to bacterial lipopolysaccharide with marked reductions in signaling by luciferase reporter assays. Overall, our findings show that TLR pathway genes are recurrently mutated in EAC, and TLR4 mutations have decreased responsiveness to bacterial lipopolysaccharide and may play a role in disease pathogenesis in a subset of patients.

Transfection with extracellularly UV-damaged DNA induces human and rat cells to express a mutator phenotype towards parvovirus H-1

International Nuclear Information System (INIS)

Dinsart, C.; Cornelis, J.J.; Klein, B.; van der Eb, A.J.; Rommelaere, J.

1984-01-01

Human and rat cells transfected with UV-irradiated linear double-stranded DNA from calf thymus displayed a mutator activity. This phenotype was identified by growing a lytic thermosensitive single-stranded DNA virus (parvovirus H-1) in those cells and determining viral reversion frequencies. Likewise, exogenous UV-irradiated closed circular DNAs, either double-stranded (simian virus 40) or single-stranded (phi X174), enhanced the ability of recipient cells to mutate parvovirus H-1. The magnitude of mutator activity expression increased along with the number of UV lesions present in the inoculated DNA up to a saturation level. Unirradiated DNA displayed little inducing capacity, irrespective of whether it was single or double stranded. Deprivation of a functional replication origin did not impede UV-irradiated simian virus 40 DNA from providing rat and human cells with a mutator function. Our data suggest that in mammalian cells a trans-acting mutagenic signal might be generated from UV-irradiated DNA without the necessity for damaged DNA to replicate

Autosomal inheritance of diabetes in two families characterized by obesity and a novel H241Q mutation in NEUROD1

DEFF Research Database (Denmark)

Gonsorcíková, Lucie; Pruhová, Stepánka; Cinek, Ondrej

2008-01-01

BACKGROUND: The aim of the study was to search for mutations in the NEUROD1 and IPF-1 genes in patients with clinical characteristics of maturity-onset diabetes of the young (MODY) but with no mutations in the HNF-4A (MODY1), GCK (MODY2) and TCF1 (MODY3) genes. METHODS: We studied 30 unrelated...... Czech probands with a clinical diagnosis of MODY (median age at testing, 18 yr; median age at the recognition of hyperglycaemia, 16 yr). The promoter, exons and exon/intron boundaries of the NEUROD1 and IPF-1 genes were examined by polymerase chain reaction-denaturing high performance liquid...... chromatography and direct sequencing. RESULTS: While no mutations were found in the IPF-1 gene, a novel H241Q substitution of NEUROD1 gene was identified in two unrelated families. In the first proband, the H241Q mutation led to early diagnosed (20 yr) hyperglycaemia followed by development of diabetic...

Choline transporter mutations in severe congenital myasthenic syndrome disrupt transporter localization.

Science.gov (United States)

Wang, Haicui; Salter, Claire G; Refai, Osama; Hardy, Holly; Barwick, Katy E S; Akpulat, Ugur; Kvarnung, Malin; Chioza, Barry A; Harlalka, Gaurav; Taylan, Fulya; Sejersen, Thomas; Wright, Jane; Zimmerman, Holly H; Karakaya, Mert; Stüve, Burkhardt; Weis, Joachim; Schara, Ulrike; Russell, Mark A; Abdul-Rahman, Omar A; Chilton, John; Blakely, Randy D; Baple, Emma L; Cirak, Sebahattin; Crosby, Andrew H

2017-11-01

The presynaptic, high-affinity choline transporter is a critical determinant of signalling by the neurotransmitter acetylcholine at both central and peripheral cholinergic synapses, including the neuromuscular junction. Here we describe an autosomal recessive presynaptic congenital myasthenic syndrome presenting with a broad clinical phenotype due to homozygous choline transporter missense mutations. The clinical phenotype ranges from the classical presentation of a congenital myasthenic syndrome in one patient (p.Pro210Leu), to severe neurodevelopmental delay with brain atrophy (p.Ser94Arg) and extend the clinical outcomes to a more severe spectrum with infantile lethality (p.Val112Glu). Cells transfected with mutant transporter construct revealed a virtually complete loss of transport activity that was paralleled by a reduction in transporter cell surface expression. Consistent with these findings, studies to determine the impact of gene mutations on the trafficking of the Caenorhabditis elegans choline transporter orthologue revealed deficits in transporter export to axons and nerve terminals. These findings contrast with our previous findings in autosomal dominant distal hereditary motor neuropathy of a dominant-negative frameshift mutation at the C-terminus of choline transporter that was associated with significantly reduced, but not completely abrogated choline transporter function. Together our findings define divergent neuropathological outcomes arising from different classes of choline transporter mutation with distinct disease processes and modes of inheritance. These findings underscore the essential role played by the choline transporter in sustaining acetylcholine neurotransmission at both central and neuromuscular synapses, with important implications for treatment and drug selection. © The Author (2017). Published by Oxford University Press on behalf of the Guarantors of Brain. All rights reserved. For Permissions, please email: journals.permissions@oup.com.

A streptomycin resistance marker in H. parasuis based on site-directed mutations in rpsL gene to perform unmarked in-frame mutations and to verify natural transformation

Directory of Open Access Journals (Sweden)

Ke Dai

2018-01-01

Full Text Available Haemophilus parasuis is a member of the family Pasteurellaceae and a major causative agent of Glässer’s disease. This bacterium is normally a benign swine commensal but may become a deadly pathogen upon penetration into multiple tissues, contributing to severe lesions in swine. We have established a successive natural transformation-based markerless mutation system in this species. However, the two-step mutation system requires screening of natural competent cells, and cannot delete genes which regulate natural competence per se. In this study, we successfully obtained streptomycin-resistant derivatives from H. parasuis wild type strain SC1401 by using ethyl methane sulfonate (EMS, CH3SO2OC2H5. Upon sequencing and site-directed mutations, we uncovered that the EMS-induced point mutation in rpsL at codon 43rd (AAA → AGA; K43R or at 88th (AAA → AGA; K88R confers a much higher streptomycin resistance than clinical isolates. We have applied the streptomycin resistance marker as a positive selection marker to perform homologous recombination through conjugation and successfully generated a double unmarked in-frame targeted mutant 1401D88△tfox△arcA. Combined with a natural transformation-based knockout system and this genetic technique, multiple deletion mutants or attenuated strains of H. parasuis can be easily constructed. Moreover, the mutant genetic marker rpsL and streptomycin resistant phenotypes can serve as an effective tool to select naturally competent strains, and to verify natural transformation quantitatively.

Identification of Factors Interacting with hMSH2 and hMLH1 in the Fetal Liver and Investigations of how Mitochondrial Dysfunction Creates a Mutator Phenotype

DEFF Research Database (Denmark)

Rasmussen, Anne Karin

mutations. Mutations in MMR genes cause hereditary non-polyposis colon cancer. In an effort to identify unidentified genes involved in MMR and tissue-specific MMRassociated factors, we employed the yeast two-hybrid system, using the human hMSH2 as bait and a human fetal liver cDNA library as prey. We...... between mitochondrial activity and genomic instability. Mitochondrial dysfunction and genetic instability are characteristic features of cancer cells. Furthermore, mitochondrial dysfunction is a key feature of aging due to accumulation of mutations in mtDNA. Our studies in a yeast model system suggest......Increased spontaneous mutation frequency is associated with increased cancer risk. However, the relative contribution of spontaneous endogenous mutagenesis to carcinogenesis is not known today. Defects in the postreplication DNA mismatch repair (MMR) pathway are recognized to increase spontaneous...

Analysis of HLA-A antigens and C282Y and H63D mutations of the HFE gene in Brazilian patients with hemochromatosis

Directory of Open Access Journals (Sweden)

Bittencourt P.L.

2002-01-01

Full Text Available The hemochromatosis gene, HFE, is located on chromosome 6 in close proximity to the HLA-A locus. Most Caucasian patients with hereditary hemochromatosis (HH are homozygous for HLA-A3 and for the C282Y mutation of the HFE gene, while a minority are compound heterozygotes for C282Y and H63D. The prevalence of these mutations in non-Caucasian patients with HH is lower than expected. The objective of the present study was to evaluate the frequencies of HLA-A antigens and the C282Y and H63D mutations of the HFE gene in Brazilian patients with HH and to compare clinical and laboratory profiles of C282Y-positive and -negative patients with HH. The frequencies of HLA-A and C282Y and H63D mutations were determined by PCR-based methods in 15 male patients (median age 44 (20-72 years with HH. Eight patients (53% were homozygous and one (7% was heterozygous for the C282Y mutation. None had compound heterozygosity for C282Y and H63D mutations. All but three C282Y homozygotes were positive for HLA-A3 and three other patients without C282Y were shown to be either heterozygous (N = 2 or homozygous (N = 1 for HLA-A3. Patients homozygous for the C282Y mutation had higher ferritin levels and lower age at onset, but the difference was not significant. The presence of C282Y homozygosity in roughly half of the Brazilian patients with HH, together with the findings of HLA-A homozygosity in C282Y-negative subjects, suggest that other mutations in the HFE gene or in other genes involved in iron homeostasis might also be linked to HH in Brazil.

Reduction of Skeletal Muscle Power in Adolescent Males Carrying H63D Mutation in the HFE Gene

Directory of Open Access Journals (Sweden)

Marcin Luszczyk

2017-01-01

Full Text Available Iron overload resulting from the mutation of genes involved in iron metabolism or excess dietary intake has been reported to negatively influence human physical performance. The aim of this study was to test the hypothesis that adolescents bearing a hemochromatosis gene (HFE mutation in contrast to adults with the same mutation will not experience iron accumulation and their aerobic capacity will be similar to that of age-matched controls. Thirteen boys participated in the study. Seven of them are carriers of H63D mutation in the HFE gene and six were wild type. Fitness levels were assessed using the cardiopulmonary exercise test. In addition, iron status and inflammatory markers were determined. We observed that cardiovascular fitness was significantly lower in the group bearing the HFE mutation compared to the control group. Moreover, the HFE mutation group achieved lower maximal power output compared to the control group. There were no differences in blood ferritin concentrations between the two groups which indicates similar amounts of stored iron. Obtained data do not confirm our hypothesis. On the contrary, it was demonstrated that HFE mutation is associated with a lower level of aerobic capacity, even in the absence of iron accumulation.

Directed mutagenesis in Candida albicans: one-step gene disruption to isolate ura3 mutants

International Nuclear Information System (INIS)

Kelly, R.; Miller, S.M.; Kurtz, M.B.; Kirsch, D.R.

1987-01-01

A method for introducing specific mutations into the diploid Candida albicans by one-step gene disruption and subsequent UV-induced recombination was developed. The cloned C. albicans URA3 gene was disrupted with the C. albicans ADE2 gene, and the linearized DNA was used for transformation of two ade2 mutants, SGY-129 and A81-Pu. Both an insertional inactivation of the URA3 gene and a disruption which results in a 4.0-kilobase deletion were made. Southern hybridization analyses demonstrated that the URA3 gene was disrupted on one of the chromosomal homologs in 15 of the 18 transformants analyzed. These analyses also revealed restriction site dimorphism of EcoRI at the URA3 locus which provides a unique marker to distinguish between chromosomal homologs. This enabled us to show that either homolog could be disrupted and that disrupted transformants of SGY-129 contained more than two copies of the URA3 locus. The A81-Pu transformants heterozygous for the ura3 mutations were rendered homozygous and Ura- by UV-induced recombination. The homozygosity of a deletion mutant and an insertion mutant was confirmed by Southern hybridization. Both mutants were transformed to Ura+ with plasmids containing the URA3 gene and in addition, were resistant to 5-fluoro-orotic acid, a characteristic of Saccharomyces cerevisiae ura3 mutants as well as of orotidine-5'-phosphate decarboxylase mutants of other organisms

Novel mutations expand the clinical spectrum of DYNC1H1-associated spinal muscular atrophy

NARCIS (Netherlands)

Scoto, Mariacristina; Rossor, Alexander M.; Harms, Matthew B.; Cirak, Sebahattin; Calissano, Mattia; Robb, Stephanie; Manzur, Adnan Y.; Martínez Arroyo, Amaia; Rodriguez Sanz, Aida; Mansour, Sahar; Fallon, Penny; Hadjikoumi, Irene; Klein, Andrea; Yang, Michele; de Visser, Marianne; Overweg-Plandsoen, W. C. G. Truus; Baas, Frank; Taylor, J. Paul; Benatar, Michael; Connolly, Anne M.; Al-Lozi, Muhammad T.; Nixon, John; de Goede, Christian G. E. L.; Foley, A. Reghan; Mcwilliam, Catherine; Pitt, Matthew; Sewry, Caroline; Phadke, Rahul; Hafezparast, Majid; Chong, W. K. Kling; Mercuri, Eugenio; Baloh, Robert H.; Reilly, Mary M.; Muntoni, Francesco

2015-01-01

To expand the clinical phenotype of autosomal dominant congenital spinal muscular atrophy with lower extremity predominance (SMA-LED) due to mutations in the dynein, cytoplasmic 1, heavy chain 1 (DYNC1H1) gene. Patients with a phenotype suggestive of a motor, non-length-dependent neuronopathy

Mutation in SUMO E3 ligase, SIZ1, disrupts the mature female gametophyte in Arabidopsis

KAUST Repository

Ling, Yu

2012-01-09

Female gametophyte is the multicellular haploid structure that can produce embryo and endosperm after fertilization, which has become an attractive model system for investigating molecular mechanisms in nuclei migration, cell specification, cell-to-cell communication and many other processes. Previous reports found that the small ubiquitin-like modifier (SUMO) E3 ligase, SIZ1, participated in many processes depending on particular target substrates and suppression of salicylic acid (SA) accumulation. Here, we report that SIZ1 mediates the reproductive process. SIZ1 showed enhanced expression in female organs, but was not detected in the anther or pollen. A defect in the siz1-2 maternal source resulted in reduced seed-set regardless of high SA concentration within the plant. Moreover, aniline blue staining and scanning electron microscopy revealed that funicular and micropylar pollen tube guidance was arrested in siz1-2 plants. Some of the embryo sacs of ovules in siz1-2 were also disrupted quickly after stage FG7. There was no significant affects of the siz1-2 mutation on expression of genes involved in female gametophyte development- or pollen tube guidance in ovaries. Together, our results suggest that SIZ1 sustains the stability and normal function of the mature female gametophyte which is necessary for pollen tube guidance. © 2012 Ling et al.

New tools for targeted disruption of cholinergic synaptic transmission in Drosophila melanogaster.

Directory of Open Access Journals (Sweden)

Monica Mejia

Full Text Available Nicotinic acetylcholine receptors (nAChRs are pentameric ligand-gated ion channels. The α7 subtype of nAChRs is involved in neurological pathologies such as Parkinson's disease, Alzheimer's disease, addiction, epilepsy and autism spectrum disorders. The Drosophila melanogaster α7 (Dα7 has the closest sequence homology to the vertebrate α7 subunit and it can form homopentameric receptors just as the vertebrate counterpart. The Dα7 subunits are essential for the function of the Giant Fiber circuit, which mediates the escape response of the fly. To further characterize the receptor function, we generated different missense mutations in the Dα7 nAChR's ligand binding domain. We characterized the effects of targeted expression of two UAS-constructs carrying a single mutation, D197A and Y195T, as well as a UAS-construct carrying a triple D77T, L117Q, I196P mutation in a Dα7 null mutant and in a wild type background. Expression of the triple mutation was able to restore the function of the circuit in Dα7 null mutants and had no disruptive effects when expressed in wild type. In contrast, both single mutations severely disrupted the synaptic transmission of Dα7-dependent but not glutamatergic or gap junction dependent synapses in wild type background, and did not or only partially rescued the synaptic defects of the null mutant. These observations are consistent with the formation of hybrid receptors, consisting of D197A or Y195T subunits and wild type Dα7 subunits, in which the binding of acetylcholine or acetylcholine-induced conformational changes of the Dα7 receptor are altered and causes inhibition of cholinergic responses. Thus targeted expression of D197A or Y195T can be used to selectively disrupt synaptic transmission of Dα7-dependent synapses in neuronal circuits. Hence, these constructs can be used as tools to study learning and memory or addiction associated behaviors by allowing the manipulation of neuronal processing in the

G protein-coupled receptor mutations and human genetic disease.

Science.gov (United States)

Thompson, Miles D; Hendy, Geoffrey N; Percy, Maire E; Bichet, Daniel G; Cole, David E C

2014-01-01

Genetic variations in G protein-coupled receptor genes (GPCRs) disrupt GPCR function in a wide variety of human genetic diseases. In vitro strategies and animal models have been used to identify the molecular pathologies underlying naturally occurring GPCR mutations. Inactive, overactive, or constitutively active receptors have been identified that result in pathology. These receptor variants may alter ligand binding, G protein coupling, receptor desensitization and receptor recycling. Receptor systems discussed include rhodopsin, thyrotropin, parathyroid hormone, melanocortin, follicle-stimulating hormone (FSH), luteinizing hormone, gonadotropin-releasing hormone (GNRHR), adrenocorticotropic hormone, vasopressin, endothelin-β, purinergic, and the G protein associated with asthma (GPRA or neuropeptide S receptor 1 (NPSR1)). The role of activating and inactivating calcium-sensing receptor (CaSR) mutations is discussed in detail with respect to familial hypocalciuric hypercalcemia (FHH) and autosomal dominant hypocalemia (ADH). The CASR mutations have been associated with epilepsy. Diseases caused by the genetic disruption of GPCR functions are discussed in the context of their potential to be selectively targeted by drugs that rescue altered receptors. Examples of drugs developed as a result of targeting GPCRs mutated in disease include: calcimimetics and calcilytics, therapeutics targeting melanocortin receptors in obesity, interventions that alter GNRHR loss from the cell surface in idiopathic hypogonadotropic hypogonadism and novel drugs that might rescue the P2RY12 receptor congenital bleeding phenotype. De-orphanization projects have identified novel disease-associated receptors, such as NPSR1 and GPR35. The identification of variants in these receptors provides genetic reagents useful in drug screens. Discussion of the variety of GPCRs that are disrupted in monogenic Mendelian disorders provides the basis for examining the significance of common

FabH Mutations Confer Resistance to FabF-Directed Antibiotics in Staphylococcus aureus

OpenAIRE

Parsons, Joshua B.; Yao, Jiangwei; Frank, Matthew W.; Rock, Charles O.

2014-01-01

Delineating the mechanisms for genetically acquired antibiotic resistance is a robust approach to target validation and anticipates the evolution of clinical drug resistance. This study defines a spectrum of mutations in fabH that render Staphylococcus aureus resistant to multiple natural products known to inhibit the elongation condensing enzyme (FabF) of bacterial type II fatty acid synthesis. Twenty independently isolated clones resistant to platensimycin, platencin, or thiolactomycin were...

Structure-Function Correlation Analysis of Connexin50 Missense Mutations Causing Congenital Cataract: Electrostatic Potential Alteration Could Determine Intracellular Trafficking Fate of Mutants

Directory of Open Access Journals (Sweden)

Devroop Sarkar

2014-01-01

Full Text Available Connexin50 (Cx50 mutations are reported to cause congenital cataract probably through the disruption of intercellular transport in the lens. Cx50 mutants that undergo mistrafficking have generally been associated with failure to form functional gap junction channels; however, sometimes even properly trafficked mutants were found to undergo similar consequences. We hereby wanted to elucidate any structural bases of the varied functional consequences of Cx50 missense mutations through in silico approach. Computational studies have been done based on a Cx50 homology model to assess conservation, solvent accessibility, and 3-dimensional localization of mutated residues as well as mutation-induced changes in surface electrostatic potential, H-bonding, and steric clash. This was supplemented with meta-analysis of published literature on the functional properties of connexin missense mutations. Analyses revealed that the mutation-induced critical alterations of surface electrostatic potential in Cx50 mutants could determine their fate in intracellular trafficking. A similar pattern was observed in case of mutations involving corresponding conserved residues in other connexins also. Based on these results the trafficking fates of 10 uncharacterized Cx50 mutations have been predicted. Further experimental analyses are needed to validate the observed correlation.

Generation of induced pluripotent stem cells (iPSC) from an atrial fibrillation patient carrying a KCNA5 p.D322H mutation

DEFF Research Database (Denmark)

Mora, Cristina; Serzanti, Marialaura; Giacomelli, Alessio

2017-01-01

. To investigate the molecular mechanisms underlying AF, we reprogrammed to pluripotency polymorphonucleated leukocytes isolated from the blood of a patient carrying a KCNA5 p.D322H mutation, using a commercially available non-integrating system. The generated iPSCs expressed pluripotency markers...... and differentiated toward cells belonging to the three embryonic germ layers. Moreover, the cells showed a normal karyotype and retained the p.D322H mutation....

CLCNKB mutations causing mild Bartter syndrome profoundly alter the pH and Ca2+ dependence of ClC-Kb channels.

Science.gov (United States)

Andrini, Olga; Keck, Mathilde; L'Hoste, Sébastien; Briones, Rodolfo; Mansour-Hendili, Lamisse; Grand, Teddy; Sepúlveda, Francisco V; Blanchard, Anne; Lourdel, Stéphane; Vargas-Poussou, Rosa; Teulon, Jacques

2014-09-01

ClC-Kb, a member of the ClC family of Cl(-) channels/transporters, plays a major role in the absorption of NaCl in the distal nephron. CLCNKB mutations cause Bartter syndrome type 3, a hereditary renal salt-wasting tubulopathy. Here, we investigate the functional consequences of a Val to Met substitution at position 170 (V170M, α helix F), which was detected in eight patients displaying a mild phenotype. Conductance and surface expression were reduced by ~40-50 %. The regulation of channel activity by external H(+) and Ca(2+) is a characteristic property of ClC-Kb. Inhibition by external H(+) was dramatically altered, with pKH shifting from 7.6 to 6.0. Stimulation by external Ca(2+) on the other hand was no longer detectable at pH 7.4, but was still present at acidic pH values. Functionally, these regulatory modifications partly counterbalance the reduced surface expression by rendering V170M hyperactive. Pathogenic Met170 seems to interact with another methionine on α helix H (Met227) since diverse mutations at this site partly removed pH sensitivity alterations of V170M ClC-Kb. Exploring other disease-associated mutations, we found that a Pro to Leu substitution at position 124 (α helix D, Simon et al., Nat Genet 1997, 17:171-178) had functional consequences similar to those of V170M. In conclusion, we report here for the first time that ClC-Kb disease-causing mutations located around the selectivity filter can result in both reduced surface expression and hyperactivity in heterologous expression systems. This interplay must be considered when analyzing the mild phenotype of patients with type 3 Bartter syndrome.

Retinal phenotype-genotype correlation of pediatric patients expressing mutations in the Norrie disease gene.

Science.gov (United States)

Wu, Wei-Chi; Drenser, Kimberly; Trese, Michael; Capone, Antonio; Dailey, Wendy

2007-02-01

To correlate the ophthalmic findings of patients with pediatric vitreoretinopathies with mutations occurring in the Norrie disease gene (NDP). One hundred nine subjects with diverse pediatric vitreoretinopathies and 54 control subjects were enrolled in the study. Diagnoses were based on retinal findings at each patient's first examination. Samples of DNA from each patient underwent polymerase chain reaction amplification and direct sequencing of the NDP gene. Eleven male patients expressing mutations in the NDP gene were identified in the test group, whereas the controls demonstrated wild-type NDP. All patients diagnosed as having Norrie disease had mutations in the NDP gene. Four of the patients with Norrie disease had mutations involving a cysteine residue in the cysteine-knot motif. Four patients diagnosed as having familial exudative vitreoretinopathy were found to have noncysteine mutations. One patient with retinopathy of prematurity had a 14-base deletion in the 5' untranslated region (exon 1), and 1 patient with bilateral persistent fetal vasculature syndrome expressed a noncysteine mutation in the second exon. Mutations disrupting the cysteine-knot motif corresponded to severe retinal dysgenesis, whereas patients with noncysteine mutations had varying degrees of avascular peripheral retina, extraretinal vasculature, and subretinal exudate. Patients exhibiting severe retinal dysgenesis should be suspected of carrying a mutation that disrupts the cysteine-knot motif in the NDP gene.

Two desmin gene mutations associated with myofibrillar myopathies in Polish families.

Directory of Open Access Journals (Sweden)

Jakub Piotr Fichna

Full Text Available Desmin is a muscle-specific intermediate filament protein which forms a network connecting the sarcomere, T tubules, sarcolemma, nuclear membrane, mitochondria and other organelles. Mutations in the gene coding for desmin (DES cause skeletal myopathies often combined with cardiomyopathy, or isolated cardiomyopathies. The molecular pathomechanisms of the disease remain ambiguous. Here, we describe and comprehensively characterize two DES mutations found in Polish patients with a clinical diagnosis of desminopathy. The study group comprised 16 individuals representing three families. Two mutations were identified: a novel missense mutation (Q348P and a small deletion of nine nucleotides (A357_E359del, previously described by us in the Polish population. A common ancestry of all the families bearing the A357_E359del mutation was confirmed. Both mutations were predicted to be pathogenic using a bioinformatics approach, including molecular dynamics simulations which helped to rationalize abnormal behavior at molecular level. To test the impact of the mutations on DES expression and the intracellular distribution of desmin muscle biopsies were investigated. Elevated desmin levels as well as its atypical localization in muscle fibers were observed. Additional staining for M-cadherin, α-actinin, and myosin heavy chains confirmed severe disruption of myofibrill organization. The abnormalities were more prominent in the Q348P muscle, where both small atrophic fibers as well large fibers with centrally localized nuclei were observed. We propose that the mutations affect desmin structure and cause its aberrant folding and subsequent aggregation, triggering disruption of myofibrils organization.

Two Desmin Gene Mutations Associated with Myofibrillar Myopathies in Polish Families

Science.gov (United States)

Berdynski, Mariusz; Sikorska, Agata; Filipek, Slawomir; Redowicz, Maria Jolanta; Kaminska, Anna; Zekanowski, Cezary

2014-01-01

Desmin is a muscle-specific intermediate filament protein which forms a network connecting the sarcomere, T tubules, sarcolemma, nuclear membrane, mitochondria and other organelles. Mutations in the gene coding for desmin (DES) cause skeletal myopathies often combined with cardiomyopathy, or isolated cardiomyopathies. The molecular pathomechanisms of the disease remain ambiguous. Here, we describe and comprehensively characterize two DES mutations found in Polish patients with a clinical diagnosis of desminopathy. The study group comprised 16 individuals representing three families. Two mutations were identified: a novel missense mutation (Q348P) and a small deletion of nine nucleotides (A357_E359del), previously described by us in the Polish population. A common ancestry of all the families bearing the A357_E359del mutation was confirmed. Both mutations were predicted to be pathogenic using a bioinformatics approach, including molecular dynamics simulations which helped to rationalize abnormal behavior at molecular level. To test the impact of the mutations on DES expression and the intracellular distribution of desmin muscle biopsies were investigated. Elevated desmin levels as well as its atypical localization in muscle fibers were observed. Additional staining for M-cadherin, α-actinin, and myosin heavy chains confirmed severe disruption of myofibrill organization. The abnormalities were more prominent in the Q348P muscle, where both small atrophic fibers as well large fibers with centrally localized nuclei were observed. We propose that the mutations affect desmin structure and cause its aberrant folding and subsequent aggregation, triggering disruption of myofibrils organization. PMID:25541946

Identification and validation of biomarkers of IgV(H) mutation status in chronic lymphocytic leukemia using microfluidics quantitative real-time polymerase chain reaction technology.

Science.gov (United States)

Abruzzo, Lynne V; Barron, Lynn L; Anderson, Keith; Newman, Rachel J; Wierda, William G; O'brien, Susan; Ferrajoli, Alessandra; Luthra, Madan; Talwalkar, Sameer; Luthra, Rajyalakshmi; Jones, Dan; Keating, Michael J; Coombes, Kevin R

2007-09-01

To develop a model incorporating relevant prognostic biomarkers for untreated chronic lymphocytic leukemia patients, we re-analyzed the raw data from four published gene expression profiling studies. We selected 88 candidate biomarkers linked to immunoglobulin heavy-chain variable region gene (IgV(H)) mutation status and produced a reliable and reproducible microfluidics quantitative real-time polymerase chain reaction array. We applied this array to a training set of 29 purified samples from previously untreated patients. In an unsupervised analysis, the samples clustered into two groups. Using a cutoff point of 2% homology to the germline IgV(H) sequence, one group contained all 14 IgV(H)-unmutated samples; the other contained all 15 mutated samples. We confirmed the differential expression of 37 of the candidate biomarkers using two-sample t-tests. Next, we constructed 16 different models to predict IgV(H) mutation status and evaluated their performance on an independent test set of 20 new samples. Nine models correctly classified 11 of 11 IgV(H)-mutated cases and eight of nine IgV(H)-unmutated cases, with some models using three to seven genes. Thus, we can classify cases with 95% accuracy based on the expression of as few as three genes.

Disruption of lysosome function promotes tumor growth and metastasis in Drosophila.

Science.gov (United States)

Chi, Congwu; Zhu, Huanhu; Han, Min; Zhuang, Yuan; Wu, Xiaohui; Xu, Tian

2010-07-09

Lysosome function is essential to many physiological processes. It has been suggested that deregulation of lysosome function could contribute to cancer. Through a genetic screen in Drosophila, we have discovered that mutations disrupting lysosomal degradation pathway components contribute to tumor development and progression. Loss-of-function mutations in the Class C vacuolar protein sorting (VPS) gene, deep orange (dor), dramatically promote tumor overgrowth and invasion of the Ras(V12) cells. Knocking down either of the two other components of the Class C VPS complex, carnation (car) and vps16A, also renders Ras(V12) cells capable for uncontrolled growth and metastatic behavior. Finally, chemical disruption of the lysosomal function by feeding animals with antimalarial drugs, chloroquine or monensin, leads to malignant tumor growth of the Ras(V12) cells. Taken together, our data provide evidence for a causative role of lysosome dysfunction in tumor growth and invasion and indicate that members of the Class C VPS complex behave as tumor suppressors.

Efficient CRISPR-Cas9-mediated generation of knockin human pluripotent stem cells lacking undesired mutations at the targeted locus.

Science.gov (United States)

Merkle, Florian T; Neuhausser, Werner M; Santos, David; Valen, Eivind; Gagnon, James A; Maas, Kristi; Sandoe, Jackson; Schier, Alexander F; Eggan, Kevin

2015-05-12

The CRISPR-Cas9 system has the potential to revolutionize genome editing in human pluripotent stem cells (hPSCs), but its advantages and pitfalls are still poorly understood. We systematically tested the ability of CRISPR-Cas9 to mediate reporter gene knockin at 16 distinct genomic sites in hPSCs. We observed efficient gene targeting but found that targeted clones carried an unexpectedly high frequency of insertion and deletion (indel) mutations at both alleles of the targeted gene. These indels were induced by Cas9 nuclease, as well as Cas9-D10A single or dual nickases, and often disrupted gene function. To overcome this problem, we designed strategies to physically destroy or separate CRISPR target sites at the targeted allele and developed a bioinformatic pipeline to identify and eliminate clones harboring deleterious indels at the other allele. This two-pronged approach enables the reliable generation of knockin hPSC reporter cell lines free of unwanted mutations at the targeted locus. Copyright © 2015 The Authors. Published by Elsevier Inc. All rights reserved.

Disruption of mitochondrial DNA replication in Drosophila increases mitochondrial fast axonal transport in vivo.

Directory of Open Access Journals (Sweden)

Rehan M Baqri

Full Text Available Mutations in mitochondrial DNA polymerase (pol gamma cause several progressive human diseases including Parkinson's disease, Alper's syndrome, and progressive external ophthalmoplegia. At the cellular level, disruption of pol gamma leads to depletion of mtDNA, disrupts the mitochondrial respiratory chain, and increases susceptibility to oxidative stress. Although recent studies have intensified focus on the role of mtDNA in neuronal diseases, the changes that take place in mitochondrial biogenesis and mitochondrial axonal transport when mtDNA replication is disrupted are unknown. Using high-speed confocal microscopy, electron microscopy and biochemical approaches, we report that mutations in pol gamma deplete mtDNA levels and lead to an increase in mitochondrial density in Drosophila proximal nerves and muscles, without a noticeable increase in mitochondrial fragmentation. Furthermore, there is a rise in flux of bidirectional mitochondrial axonal transport, albeit with slower kinesin-based anterograde transport. In contrast, flux of synaptic vesicle precursors was modestly decreased in pol gamma-alpha mutants. Our data indicate that disruption of mtDNA replication does not hinder mitochondrial biogenesis, increases mitochondrial axonal transport, and raises the question of whether high levels of circulating mtDNA-deficient mitochondria are beneficial or deleterious in mtDNA diseases.

Distinct Mechanisms of Pathogenic DJ-1 Mutations in Mitochondrial Quality Control

Directory of Open Access Journals (Sweden)

Daniela Strobbe

2018-03-01

Full Text Available The deglycase and chaperone protein DJ-1 is pivotal for cellular oxidative stress responses and mitochondrial quality control. Mutations in PARK7, encoding DJ-1, are associated with early-onset familial Parkinson’s disease and lead to pathological oxidative stress and/or disrupted protein degradation by the proteasome. The aim of this study was to gain insights into the pathogenic mechanisms of selected DJ-1 missense mutations, by characterizing protein–protein interactions, core parameters of mitochondrial function, quality control regulation via autophagy, and cellular death following dopamine accumulation. We report that the DJ-1M26I mutant influences DJ-1 interactions with SUMO-1, in turn enhancing removal of mitochondria and conferring increased cellular susceptibility to dopamine toxicity. By contrast, the DJ-1D149A mutant does not influence mitophagy, but instead impairs Ca2+ dynamics and free radical homeostasis by disrupting DJ-1 interactions with a mitochondrial accessory protein known as DJ-1-binding protein (DJBP/EFCAB6. Thus, individual DJ-1 mutations have different effects on mitochondrial function and quality control, implying mutation-specific pathomechanisms converging on impaired mitochondrial homeostasis.

Effect of neuraminidase inhibitor-resistant mutations on pathogenicity of clade 2.2 A/Turkey/15/06 (H5N1) influenza virus in ferrets.

Science.gov (United States)

Ilyushina, Natalia A; Seiler, Jon P; Rehg, Jerold E; Webster, Robert G; Govorkova, Elena A

2010-05-27

The acquisition of neuraminidase (NA) inhibitor resistance by H5N1 influenza viruses has serious clinical implications, as this class of drugs can be an essential component of pandemic control measures. The continuous evolution of the highly pathogenic H5N1 influenza viruses results in the emergence of natural NA gene variations whose impact on viral fitness and NA inhibitor susceptibility are poorly defined. We generated seven genetically stable recombinant clade 2.2 A/Turkey/15/06-like (H5N1) influenza viruses carrying NA mutations located either in the framework residues (E119A, H274Y, N294S) or in close proximity to the NA enzyme active site (V116A, I117V, K150N, Y252H). NA enzyme inhibition assays showed that NA mutations at positions 116, 117, 274, and 294 reduced susceptibility to oseltamivir carboxylate (IC(50)s increased 5- to 940-fold). Importantly, the E119A NA mutation (previously reported to confer resistance in the N2 NA subtype) was stable in the clade 2.2 H5N1 virus background and induced cross-resistance to oseltamivir carboxylate and zanamivir. We demonstrated that Y252H NA mutation contributed for decreased susceptibility of clade 2.2 H5N1 viruses to oseltamivir carboxylate as compared to clade 1 viruses. The enzyme kinetic parameters (V(max), K(m) and K(i)) of the avian-like N1 NA glycoproteins were highly consistent with their IC(50) values. None of the recombinant H5N1 viruses had attenuated virulence in ferrets inoculated with 10(6) EID(50) dose. Most infected ferrets showed mild clinical disease signs that differed in duration. However, H5N1 viruses carrying the E119A or the N294S NA mutation were lethal to 1 of 3 inoculated animals and were associated with significantly higher virus titers (Pinfluenza drugs that target different virus/host factors and can limit the emergence of resistance.

Effect of neuraminidase inhibitor-resistant mutations on pathogenicity of clade 2.2 A/Turkey/15/06 (H5N1 influenza virus in ferrets.

Directory of Open Access Journals (Sweden)

Natalia A Ilyushina

2010-05-01

Full Text Available The acquisition of neuraminidase (NA inhibitor resistance by H5N1 influenza viruses has serious clinical implications, as this class of drugs can be an essential component of pandemic control measures. The continuous evolution of the highly pathogenic H5N1 influenza viruses results in the emergence of natural NA gene variations whose impact on viral fitness and NA inhibitor susceptibility are poorly defined. We generated seven genetically stable recombinant clade 2.2 A/Turkey/15/06-like (H5N1 influenza viruses carrying NA mutations located either in the framework residues (E119A, H274Y, N294S or in close proximity to the NA enzyme active site (V116A, I117V, K150N, Y252H. NA enzyme inhibition assays showed that NA mutations at positions 116, 117, 274, and 294 reduced susceptibility to oseltamivir carboxylate (IC(50s increased 5- to 940-fold. Importantly, the E119A NA mutation (previously reported to confer resistance in the N2 NA subtype was stable in the clade 2.2 H5N1 virus background and induced cross-resistance to oseltamivir carboxylate and zanamivir. We demonstrated that Y252H NA mutation contributed for decreased susceptibility of clade 2.2 H5N1 viruses to oseltamivir carboxylate as compared to clade 1 viruses. The enzyme kinetic parameters (V(max, K(m and K(i of the avian-like N1 NA glycoproteins were highly consistent with their IC(50 values. None of the recombinant H5N1 viruses had attenuated virulence in ferrets inoculated with 10(6 EID(50 dose. Most infected ferrets showed mild clinical disease signs that differed in duration. However, H5N1 viruses carrying the E119A or the N294S NA mutation were lethal to 1 of 3 inoculated animals and were associated with significantly higher virus titers (P<0.01 and inflammation in the lungs compared to the wild-type virus. Our results suggest that highly pathogenic H5N1 variants carrying mutations within the NA active site that decrease susceptibility to NA inhibitors may possess increased

Impact of Mutations in the Hemagglutinin of H10N7 Viruses Isolated from Seals on Virus Replication in Avian and Human Cells

Directory of Open Access Journals (Sweden)

Anne Dittrich

2018-02-01

Full Text Available Wild birds are the reservoir for low-pathogenic avian influenza viruses, which are frequently transmitted to domestic birds and occasionally to mammals. In 2014, an H10N7 virus caused severe mortality in harbor seals in northeastern Europe. Although the hemagglutinin (HA of this virus was closely related to H10 of avian H10N4 virus, it possessed unique nonsynonymous mutations, particularly in the HA1 subunit in or adjacent to the receptor binding domain and proteolytic cleavage site. Here, the impact of these mutations on virus replication was studied in vitro. Using reverse genetics, an avian H10N4 virus was cloned, and nine recombinant viruses carrying one of eight unique mutations or the complete HA from the seal virus were rescued. Receptor binding affinity, replication in avian and mammalian cell cultures, cell-to-cell spread, and HA cleavability of these recombinant viruses were studied. Results show that wild-type recombinant H10N4 virus has high affinity to avian-type sialic acid receptors and no affinity to mammalian-type receptors. The H10N7 virus exhibits dual receptor binding affinity. Interestingly, Q220L (H10 numbering in the rim of the receptor binding pocket increased the affinity of the H10N4 virus to mammal-type receptors and completely abolished the affinity to avian-type receptors. No remarkable differences in cell-to-cell spread or HA cleavability were observed. All viruses, including the wild-type H10N7 virus, replicated at higher levels in chicken cells than in human cells. These results indicate that H10N7 acquired adaptive mutations (e.g., Q220L to enhance replication in mammals and retained replication efficiency in the original avian host.

Impact of Mutations in the Hemagglutinin of H10N7 Viruses Isolated from Seals on Virus Replication in Avian and Human Cells.

Science.gov (United States)

Dittrich, Anne; Scheibner, David; Salaheldin, Ahmed H; Veits, Jutta; Gischke, Marcel; Mettenleiter, Thomas C; Abdelwhab, Elsayed M

2018-02-14

Wild birds are the reservoir for low-pathogenic avian influenza viruses, which are frequently transmitted to domestic birds and occasionally to mammals. In 2014, an H10N7 virus caused severe mortality in harbor seals in northeastern Europe. Although the hemagglutinin (HA) of this virus was closely related to H10 of avian H10N4 virus, it possessed unique nonsynonymous mutations, particularly in the HA1 subunit in or adjacent to the receptor binding domain and proteolytic cleavage site. Here, the impact of these mutations on virus replication was studied in vitro. Using reverse genetics, an avian H10N4 virus was cloned, and nine recombinant viruses carrying one of eight unique mutations or the complete HA from the seal virus were rescued. Receptor binding affinity, replication in avian and mammalian cell cultures, cell-to-cell spread, and HA cleavability of these recombinant viruses were studied. Results show that wild-type recombinant H10N4 virus has high affinity to avian-type sialic acid receptors and no affinity to mammalian-type receptors. The H10N7 virus exhibits dual receptor binding affinity. Interestingly, Q220L (H10 numbering) in the rim of the receptor binding pocket increased the affinity of the H10N4 virus to mammal-type receptors and completely abolished the affinity to avian-type receptors. No remarkable differences in cell-to-cell spread or HA cleavability were observed. All viruses, including the wild-type H10N7 virus, replicated at higher levels in chicken cells than in human cells. These results indicate that H10N7 acquired adaptive mutations (e.g., Q220L) to enhance replication in mammals and retained replication efficiency in the original avian host.

Introducing Pitt-Hopkins syndrome-associated mutations of TCF4 to Drosophila daughterless

Directory of Open Access Journals (Sweden)

Laura Tamberg

2015-12-01

Full Text Available Pitt-Hopkins syndrome (PTHS is caused by haploinsufficiency of Transcription factor 4 (TCF4, one of the three human class I basic helix-loop-helix transcription factors called E-proteins. Drosophila has a single E-protein, Daughterless (Da, homologous to all three mammalian counterparts. Here we show that human TCF4 can rescue Da deficiency during fruit fly nervous system development. Overexpression of Da or TCF4 specifically in adult flies significantly decreases their survival rates, indicating that these factors are crucial even after development has been completed. We generated da transgenic fruit fly strains with corresponding missense mutations R578H, R580W, R582P and A614V found in TCF4 of PTHS patients and studied the impact of these mutations in vivo. Overexpression of wild type Da as well as human TCF4 in progenitor tissues induced ectopic sensory bristles and the rough eye phenotype. By contrast, overexpression of DaR580W and DaR582P that disrupt DNA binding reduced the number of bristles and induced the rough eye phenotype with partial lack of pigmentation, indicating that these act dominant negatively. Compared to the wild type, DaR578H and DaA614V were less potent in induction of ectopic bristles and the rough eye phenotype, respectively, suggesting that these are hypomorphic. All studied PTHS-associated mutations that we introduced into Da led to similar effects in vivo as the same mutations in TCF4 in vitro. Consequently, our Drosophila models of PTHS are applicable for further studies aiming to unravel the molecular mechanisms of this disorder.

Mutational characterization of the P3H1/CRTAP/CypB complex in recessive osteogenesis imperfecta.

Science.gov (United States)

Barbirato, C; Trancozo, M; Almeida, M G; Almeida, L S; Santos, T O; Duarte, J C G; Rebouças, M R G O; Sipolatti, V; Nunes, V R R; Paula, F

2015-12-03

Osteogenesis imperfecta (OI) is a genetic disease characterized by bone deformities and fractures. Most cases are caused by autosomal dominant mutations in the type I collagen genes COL1A1 and COL1A2; however, an increasing number of recessive mutations in other genes have been reported. The LEPRE1, CRTAP, and PPIB genes encode proteins that form the P3H1/CRTAP/CypB complex, which is responsible for posttranslational modifications of type I collagen. In general, mutations in these genes lead to severe and lethal phenotypes of recessive OI. Here, we describe sixteen genetic variations detected in LEPRE1, CRTAP, and PPIB from 25 Brazilian patients with OI. Samples were screened for mutations on single-strand conformation polymorphism gels and variants were determined by automated sequencing. Seven variants were detected in patients but were absent in control samples. LEPRE1 contained the highest number of variants, including the previously described West African allele (c.1080+1G>T) found in one patient with severe OI as well as a previously undescribed p.Trp675Leu change that is predicted to be disease causing. In CRTAP, one patient carried the c.558A>G homozygous mutation, predicted as disease causing through alteration of a splice site. Genetic variations detected in the PPIB gene are probably not pathogenic due to their localization or because of their synonymous effect. This study enhances our knowledge about the mutational pattern of the LEPRE1, CRTAP, and PPIB genes. In addition, the results strengthen the proposition that LEPRE1 should be the first gene analyzed in mutation detection studies in patients with recessive OI.

Effect of Hereditary Hemochromatosis Gene H63D and C282Y Mutations on Iron Overload in Sickle Cell Disease Patients

Directory of Open Access Journals (Sweden)

Yunus Kasım Terzi

2016-12-01

Full Text Available Objective: Hemochromatosis is an autosomal recessive disease that is one of the most important reasons for iron overload. Sickle cell disease is a hemoglobinopathy that occurs as a result of a homozygous mutation in the hemoglobin gene. Erythrocyte transfusion is frequently used in the treatment of this disease. Iron overload as a result of transfusion is important in the mortality and morbidity of sickle cell anemia patients as well as in other hemoglobinopathies. In this study, the effect of hemochromatosis gene (HFE p.H63D and p.C282Y mutations on transfusion-related cardiac and liver iron overload in sickle cell disease patients who carry homozygous hemoglobin S mutation has been investigated. Materials and Methods: This is a prospective single-center crosssectional study in patients with homozygous hemoglobin S mutation between the years 2008 and 2013. The patients were divided into two groups. The first group (group A, n=31 was receiving chelation therapy and the second group (group B, n=13 was not. Direct and indirect iron loads were analyzed by magnetic resonance imaging and biochemically, respectively. HFE gene mutations were analyzed by polymerase chain reaction-restriction fragment length polymorphism method. Statistical analyses were performed by independent samples t-test. Results: p.H63D mutation was detected in 10 (32.3% patients in group A and in only 1 patient (7.7% in group B. When the 2 groups were compared for iron overload, iron deposition in the liver was significantly higher in group B (p=0.046. In addition, in group A, iron deposition was significantly higher in HFE mutation carriers compared to patients without the mutation (p=0.05. Conclusion: Results of this study showed that HFE gene mutations are important in iron deposition in the liver in patients with sickle cell disease.

Initiating a watch list for Ebola virus antibody escape mutations

Directory of Open Access Journals (Sweden)

Craig R. Miller

2016-02-01

Full Text Available The 2014 Ebola virus (EBOV outbreak in West Africa is the largest in recorded history and resulted in over 11,000 deaths. It is essential that strategies for treatment and containment be developed to avoid future epidemics of this magnitude. With the development of vaccines and antibody-based therapies using the envelope glycoprotein (GP of the 1976 Mayinga strain, one important strategy is to anticipate how the evolution of EBOV might compromise these efforts. In this study we have initiated a watch list of potential antibody escape mutations of EBOV by modeling interactions between GP and the antibody KZ52. The watch list was generated using molecular modeling to estimate stability changes due to mutation. Every possible mutation of GP was considered and the list was generated from those that are predicted to disrupt GP-KZ52 binding but not to disrupt the ability of GP to fold and to form trimers. The resulting watch list contains 34 mutations (one of which has already been seen in humans at six sites in the GP2 subunit. Should mutations from the watch list appear and spread during an epidemic, it warrants attention as these mutations may reflect an evolutionary response from the virus that could reduce the effectiveness of interventions such as vaccination. However, this watch list is incomplete and emphasizes the need for more experimental structures of EBOV interacting with antibodies in order to expand the watch list to other epitopes. We hope that this work provokes experimental research on evolutionary escape in both Ebola and other viral pathogens.

Initiating a watch list for Ebola virus antibody escape mutations.

Science.gov (United States)

Miller, Craig R; Johnson, Erin L; Burke, Aran Z; Martin, Kyle P; Miura, Tanya A; Wichman, Holly A; Brown, Celeste J; Ytreberg, F Marty

2016-01-01

The 2014 Ebola virus (EBOV) outbreak in West Africa is the largest in recorded history and resulted in over 11,000 deaths. It is essential that strategies for treatment and containment be developed to avoid future epidemics of this magnitude. With the development of vaccines and antibody-based therapies using the envelope glycoprotein (GP) of the 1976 Mayinga strain, one important strategy is to anticipate how the evolution of EBOV might compromise these efforts. In this study we have initiated a watch list of potential antibody escape mutations of EBOV by modeling interactions between GP and the antibody KZ52. The watch list was generated using molecular modeling to estimate stability changes due to mutation. Every possible mutation of GP was considered and the list was generated from those that are predicted to disrupt GP-KZ52 binding but not to disrupt the ability of GP to fold and to form trimers. The resulting watch list contains 34 mutations (one of which has already been seen in humans) at six sites in the GP2 subunit. Should mutations from the watch list appear and spread during an epidemic, it warrants attention as these mutations may reflect an evolutionary response from the virus that could reduce the effectiveness of interventions such as vaccination. However, this watch list is incomplete and emphasizes the need for more experimental structures of EBOV interacting with antibodies in order to expand the watch list to other epitopes. We hope that this work provokes experimental research on evolutionary escape in both Ebola and other viral pathogens.

Frequency of the hemochromatosis HFE mutations C282Y, H63D, and S65C in blood donors in the Faroe Islands

DEFF Research Database (Denmark)

Milman, Nils; á Steig, Torkil; Koefoed, Pernille

2004-01-01

on the HFE gene was assessed by genotyping using the polymerase chain reaction (PCR) technique and calculated from direct allele counting. We found no C282Y homozygous subjects; 28 (14.0%) subjects were C282Y heterozygous and four subjects were C282Y/H63D compound heterozygous (2.0%). The C282Y allele......The aim of the study was to assess the frequencies of the hereditary hemochromatosis HFE mutations C282Y, H63D, and S65C in the population in the Faroe Islands. The series comprised 200 randomly selected blood donors of Faroese heritage. The frequency of the C282Y, H63D, and S65C mutations.......6%. Screening of larger groups of the Faroese population for HFE mutations especially C282Y should be considered in order to establish the penetrance....

Xeroderma Pigmentosum-Trichothiodystrophy overlap patient with novel XPD/ERCC2 mutation

Science.gov (United States)

Kralund, Henrik H.; Ousager, Lilian; Jaspers, Nicolaas G.; Raams, Anja; Pedersen, Erling B.; Gade, Else; Bygum, Anette

2013-01-01

Xeroderma Pigmentosum (XP), Trichothiodystrophy (TTD) and Cockayne Syndrome (CS) are rare, recessive disorders caused by mutational defects in the Nucleotide Excision Repair (NER) pathway and/or disruption of basic cellular DNA transcription. To date, a multitude of mutations in the XPD/ERCC2 gene have been described, many of which give rise to NER- and DNA transcription related diseases, which share certain diagnostic features and few overlap patients have been described. Despite increasing understanding of the roles of XPD/ERCC2 in mammalian cells, there is still weak predictability of somatic outcome from many of these mutations. We demonstrate a patient, believed to represent an overlap between XP and TTD/CS. In addition to other organ dysfunctions, the young man presented with Photosensitivity, Ichthyosis, Brittle hair, Impaired physical and mental development, Decreased fertility and Short stature (PIBIDS) suggestive of TTD, but lacking the almost patognomonic “tiger tail” banding of the hair under polarized light. Additionally, he developed basal cell carcinoma aged 28, as well as adult onset kidney failure, features normally not associated with TTD but rather XP/CS. His freckled appearance also suggested XP, but fibroblast cultures only demonstrated x2 UV-sensitivity with expected NER and TFIIH-activity decrease. Genetic sequencing of the XPD/ERCC2 gene established the patient as heterozygote compound with a novel, N-terminal Y18H mutation and a known C-terminal (TTD) mutation, A725P. The possible interplay between gene products and the patient phenotype is discussed. PMID:25002996

A BRCA2 mutation incorrectly mapped in the original BRCA2 reference sequence, is a common West Danish founder mutation disrupting mRNA splicing

DEFF Research Database (Denmark)

Thomassen, Mads; Pedersen, Inge Søkilde; Vogel, Ida

2011-01-01

Inherited mutations in the tumor suppressor genes BRCA1 and BRCA2 predispose carriers to breast and ovarian cancer. The authors have identified a mutation in BRCA2, 7845+1G>A (c.7617+1G>A), not previously regarded as deleterious because of incorrect mapping of the splice junction in the originally...... published genomic reference sequence. This reference sequence is generally used in many laboratories and it maps the mutation 16 base pairs inside intron 15. However, according to the recent reference sequences the mutation is located in the consensus donor splice sequence. By reverse transcriptase analysis......, loss of exon 15 in the final transcript interrupting the open reading frame was demonstrated. Furthermore, the mutation segregates with a cancer phenotype in 18 Danish families. By genetic analysis of more than 3,500 Danish breast/ovarian cancer risk families, the mutation was identified as the most...

BAG3 Directly Interacts with Mutated alphaB-Crystallin to Suppress Its Aggregation and Toxicity

NARCIS (Netherlands)

Hishiya, Akinori; Salman, Mortada Najem; Carra, Serena; Kampinga, Harm H.; Takayama, Shinichi

2011-01-01

A homozygous disruption or genetic mutation of the bag3 gene causes progressive myofibrillar myopathy in mouse and human skeletal and cardiac muscle disorder while mutations in the small heat shock protein aB-crystallin gene ( CRYAB) are reported to be responsible for myofibrillar myopathy. Here, we

Exome sequencing identifies DYNC2H1 mutations as a common cause of asphyxiating thoracic dystrophy (Jeune syndrome) without major polydactyly, renal or retinal involvement

Science.gov (United States)

Schmidts, Miriam; Arts, Heleen H; Bongers, Ernie M H F; Yap, Zhimin; Oud, Machteld M; Antony, Dinu; Duijkers, Lonneke; Emes, Richard D; Stalker, Jim; Yntema, Jan-Bart L; Plagnol, Vincent; Hoischen, Alexander; Gilissen, Christian; Forsythe, Elisabeth; Lausch, Ekkehart; Veltman, Joris A; Roeleveld, Nel; Superti-Furga, Andrea; Kutkowska-Kazmierczak, Anna; Kamsteeg, Erik-Jan; Elçioğlu, Nursel; van Maarle, Merel C; Graul-Neumann, Luitgard M; Devriendt, Koenraad; Smithson, Sarah F; Wellesley, Diana; Verbeek, Nienke E; Hennekam, Raoul C M; Kayserili, Hulya; Scambler, Peter J; Beales, Philip L; Knoers, Nine VAM; Roepman, Ronald; Mitchison, Hannah M

2013-01-01

Background Jeune asphyxiating thoracic dystrophy (JATD) is a rare, often lethal, recessively inherited chondrodysplasia characterised by shortened ribs and long bones, sometimes accompanied by polydactyly, and renal, liver and retinal disease. Mutations in intraflagellar transport (IFT) genes cause JATD, including the IFT dynein-2 motor subunit gene DYNC2H1. Genetic heterogeneity and the large DYNC2H1 gene size have hindered JATD genetic diagnosis. Aims and methods To determine the contribution to JATD we screened DYNC2H1 in 71 JATD patients JATD patients combining SNP mapping, Sanger sequencing and exome sequencing. Results and conclusions We detected 34 DYNC2H1 mutations in 29/71 (41%) patients from 19/57 families (33%), showing it as a major cause of JATD especially in Northern European patients. This included 13 early protein termination mutations (nonsense/frameshift, deletion, splice site) but no patients carried these in combination, suggesting the human phenotype is at least partly hypomorphic. In addition, 21 missense mutations were distributed across DYNC2H1 and these showed some clustering to functional domains, especially the ATP motor domain. DYNC2H1 patients largely lacked significant extra-skeletal involvement, demonstrating an important genotype–phenotype correlation in JATD. Significant variability exists in the course and severity of the thoracic phenotype, both between affected siblings with identical DYNC2H1 alleles and among individuals with different alleles, which suggests the DYNC2H1 phenotype might be subject to modifier alleles, non-genetic or epigenetic factors. Assessment of fibroblasts from patients showed accumulation of anterograde IFT proteins in the ciliary tips, confirming defects similar to patients with other retrograde IFT machinery mutations, which may be of undervalued potential for diagnostic purposes. PMID:23456818

Antagonism between DNA and H3K27 methylation at the imprinted Rasgrf1 locus

DEFF Research Database (Denmark)

Lindroth, Anders M; Park, Yoon Jung; McLean, Chelsea M

2008-01-01

At the imprinted Rasgrf1 locus in mouse, a cis-acting sequence controls DNA methylation at a differentially methylated domain (DMD). While characterizing epigenetic marks over the DMD, we observed that DNA and H3K27 trimethylation are mutually exclusive, with DNA and H3K27 methylation limited...... to the paternal and maternal sequences, respectively. The mutual exclusion arises because one mark prevents placement of the other. We demonstrated this in five ways: using 5-azacytidine treatments and mutations at the endogenous locus that disrupt DNA methylation; using a transgenic model in which the maternal...

Calmodulin Mutations Associated with Recurrent Cardiac Arrest in Infants

Science.gov (United States)

Crotti, Lia; Johnson, Christopher N.; Graf, Elisabeth; De Ferrari, Gaetano M.; Cuneo, Bettina F.; Ovadia, Marc; Papagiannis, John; Feldkamp, Michael D.; Rathi, Subodh G.; Kunic, Jennifer D.; Pedrazzini, Matteo; Wieland, Thomas; Lichtner, Peter; Beckmann, Britt-Maria; Clark, Travis; Shaffer, Christian; Benson, D. Woodrow; Kääb, Stefan; Meitinger, Thomas; Strom, Tim M.; Chazin, Walter J.; Schwartz, Peter J.; George, Alfred L.

2013-01-01

Background Life-threatening disorders of heart rhythm may arise during infancy and can result in the sudden and tragic death of a child. We performed exome sequencing on two unrelated infants presenting with recurrent cardiac arrest to discover a genetic cause. Methods and Results We ascertained two unrelated infants (probands) with recurrent cardiac arrest and dramatically prolonged QTc interval who were both born to healthy parents. The two parent-child trios were investigated using exome sequencing to search for de novo genetic variants. We then performed follow-up candidate gene screening on an independent cohort of 82 subjects with congenital long-QT syndrome without an identified genetic cause. Biochemical studies were performed to determine the functional consequences of mutations discovered in two genes encoding calmodulin. We discovered three heterozygous de novo mutations in either CALM1 or CALM2, two of the three human genes encoding calmodulin, in the two probands and in two additional subjects with recurrent cardiac arrest. All mutation carriers were infants who exhibited life-threatening ventricular arrhythmias combined variably with epilepsy and delayed neurodevelopment. Mutations altered residues in or adjacent to critical calcium binding loops in the calmodulin carboxyl-terminal domain. Recombinant mutant calmodulins exhibited several fold reductions in calcium binding affinity. Conclusions Human calmodulin mutations disrupt calcium ion binding to the protein and are associated with a life-threatening condition in early infancy. Defects in calmodulin function will disrupt important calcium signaling events in heart affecting membrane ion channels, a plausible molecular mechanism for potentially deadly disturbances in heart rhythm during infancy. PMID:23388215

Disruption of Core Planar Cell Polarity Signaling Regulates Renal Tubule Morphogenesis but Is Not Cystogenic.

Science.gov (United States)

Kunimoto, Koshi; Bayly, Roy D; Vladar, Eszter K; Vonderfecht, Tyson; Gallagher, Anna-Rachel; Axelrod, Jeffrey D

2017-10-23

Oriented cell division (OCD) and convergent extension (CE) shape developing renal tubules, and their disruption has been associated with polycystic kidney disease (PKD) genes, the majority of which encode proteins that localize to primary cilia. Core planar cell polarity (PCP) signaling controls OCD and CE in other contexts, leading to the hypothesis that disruption of PCP signaling interferes with CE and/or OCD to produce PKD. Nonetheless, the contribution of PCP to tubulogenesis and cystogenesis is uncertain, and two major questions remain unanswered. Specifically, the inference that mutation of PKD genes interferes with PCP signaling is untested, and the importance of PCP signaling for cystogenic PKD phenotypes has not been examined. We show that, during proliferative stages, PCP signaling polarizes renal tubules to control OCD. However, we find that, contrary to the prevailing model, PKD mutations do not disrupt PCP signaling but instead act independently and in parallel with PCP signaling to affect OCD. Indeed, PCP signaling that is normally downregulated once development is completed is retained in cystic adult kidneys. Disrupting PCP signaling results in inaccurate control of tubule diameter, a tightly regulated parameter with important physiological ramifications. However, we show that disruption of PCP signaling is not cystogenic. Our results suggest that regulating tubule diameter is a key function of PCP signaling but that loss of this control does not induce cysts. Copyright © 2017 Elsevier Ltd. All rights reserved.

Random insertion and gene disruption via transposon mutagenesis of Ureaplasma parvum using a mini-transposon plasmid.

Science.gov (United States)

Aboklaish, Ali F; Dordet-Frisoni, Emilie; Citti, Christine; Toleman, Mark A; Glass, John I; Spiller, O Brad

2014-11-01

While transposon mutagenesis has been successfully used for Mycoplasma spp. to disrupt and determine non-essential genes, previous attempts with Ureaplasma spp. have been unsuccessful. Using a polyethylene glycol-transformation enhancing protocol, we were able to transform three separate serovars of Ureaplasma parvum with a Tn4001-based mini-transposon plasmid containing a gentamicin resistance selection marker. Despite the large degree of homology between Ureaplasma parvum and Ureaplasma urealyticum, all attempts to transform the latter in parallel failed, with the exception of a single clinical U. urealyticum isolate. PCR probing and sequencing were used to confirm transposon insertion into the bacterial genome and identify disrupted genes. Transformation of prototype serovar 3 consistently resulted in transfer only of sequence between the mini-transposon inverted repeats, but some strains showed additional sequence transfer. Transposon insertion occurred randomly in the genome resulting in unique disruption of genes UU047, UU390, UU440, UU450, UU520, UU526, UU582 for single clones from a panel of screened clones. An intergenic insertion between genes UU187 and UU188 was also characterised. Two phenotypic alterations were observed in the mutated strains: Disruption of a DEAD-box RNA helicase (UU582) altered growth kinetics, while the U. urealyticum strain lost resistance to serum attack coincident with disruption of gene UUR10_137 and loss of expression of a 41 kDa protein. Transposon mutagenesis was used successfully to insert single copies of a mini-transposon into the genome and disrupt genes leading to phenotypic changes in Ureaplasma parvum strains. This method can now be used to deliver exogenous genes for expression and determine essential genes for Ureaplasma parvum replication in culture and experimental models. Copyright © 2014 Elsevier GmbH. All rights reserved.

Prevalence of C282Y, H63D, and S65C mutations in hereditary HFE-hemochromatosis gene in Lithuanian population.

Science.gov (United States)

Kucinskas, Laimutis; Juzenas, Simonas; Sventoraityte, Jurgita; Cedaviciute, Ruta; Vitkauskiene, Astra; Kalibatas, Vytenis; Kondrackiene, Jurate; Kupcinskas, Limas

2012-04-01

HFE-hemochromatosis is a common autosomal recessive disease caused by HFE gene mutations and characterized as iron overload and failure of different organs. The aim of this study was to determine the prevalence of C282Y (c.845 G>A), H63D (c.187 C>G), and S65C (c.193A>T) alleles of HFE gene in the Lithuanian population. One thousand and eleven healthy blood donors of Lithuanian nationality were examined in four different ethnic Lithuanian regions to determine HFE gene alleles and genotype frequencies. The samples of DNA were analyzed for the presence of restriction fragment length polymorphism and validated by DNA sequencing. Among 1,011 blood donors tested, the frequency of C282Y, H63D, and S65C alleles were 2.6%, 15.9%, and 1.9%, respectively. One third of the tested subjects (n = 336) had at least one of the C282Y or H63D HFE gene mutations. The screening of Lithuanian blood donors has detected 13 (1.3%) subjects with a genotype C282Y/C282Y or C282Y/H63D responsible for the development of HFE-hemochromatosis. The prevalence of C282Y mutation was significantly higher among the inhabitants of Zemaitija (Somogitia) at the Baltic Sea area (5.9%) in comparison to the regions of continental part of Lithuania (2.4% in Dzukija, 2.3% in Aukstaitija, and 2% in Suvalkija, p HFE gene mutations in ethnic Lithuanians showed that the frequencies of H63D, C282Y, and S65C of HFE gene alleles are similar to the other North-Eastern Europeans, especially in the Baltic region (Estonia, Latvia), Poland, and part of Russia (Moscow region).

Targeted CRISPR disruption reveals a role for RNase MRP RNA in human preribosomal RNA processing.

Science.gov (United States)

Goldfarb, Katherine C; Cech, Thomas R

2017-01-01

MRP RNA is an abundant, essential noncoding RNA whose functions have been proposed in yeast but are incompletely understood in humans. Mutations in the genomic locus for MRP RNA cause pleiotropic human diseases, including cartilage hair hypoplasia (CHH). Here we applied CRISPR-Cas9 genome editing to disrupt the endogenous human MRP RNA locus, thereby attaining what has eluded RNAi and RNase H experiments: elimination of MRP RNA in the majority of cells. The resulting accumulation of ribosomal RNA (rRNA) precursor-analyzed by RNA fluorescent in situ hybridization (FISH), Northern blots, and RNA sequencing-implicates MRP RNA in pre-rRNA processing. Amelioration of pre-rRNA imbalance is achieved through rescue of MRP RNA levels by ectopic expression. Furthermore, affinity-purified MRP ribonucleoprotein (RNP) from HeLa cells cleaves the human pre-rRNA in vitro at at least one site used in cells, while RNP isolated from cells with CRISPR-edited MRP loci loses this activity, and ectopic MRP RNA expression restores cleavage activity. Thus, a role for RNase MRP in human pre-rRNA processing is established. As demonstrated here, targeted CRISPR disruption is a valuable tool for functional studies of essential noncoding RNAs that are resistant to RNAi and RNase H-based degradation. © 2017 Goldfarb and Cech; Published by Cold Spring Harbor Laboratory Press.

ZC4H2 Mutations Are Associated with Arthrogryposis Multiplex Congenita and Intellectual Disability through Impairment of Central and Peripheral Synaptic Plasticity

Science.gov (United States)

Hirata, Hiromi; Nanda, Indrajit; van Riesen, Anne; McMichael, Gai; Hu, Hao; Hambrock, Melanie; Papon, Marie-Amélie; Fischer, Ute; Marouillat, Sylviane; Ding, Can; Alirol, Servane; Bienek, Melanie; Preisler-Adams, Sabine; Grimme, Astrid; Seelow, Dominik; Webster, Richard; Haan, Eric; MacLennan, Alastair; Stenzel, Werner; Yap, Tzu Ying; Gardner, Alison; Nguyen, Lam Son; Shaw, Marie; Lebrun, Nicolas; Haas, Stefan A.; Kress, Wolfram; Haaf, Thomas; Schellenberger, Elke; Chelly, Jamel; Viot, Géraldine; Shaffer, Lisa G.; Rosenfeld, Jill A.; Kramer, Nancy; Falk, Rena; El-Khechen, Dima; Escobar, Luis F.; Hennekam, Raoul; Wieacker, Peter; Hübner, Christoph; Ropers, Hans-Hilger; Gecz, Jozef; Schuelke, Markus; Laumonnier, Frédéric; Kalscheuer, Vera M.

2013-01-01

Arthrogryposis multiplex congenita (AMC) is caused by heterogeneous pathologies leading to multiple antenatal joint contractures through fetal akinesia. Understanding the pathophysiology of this disorder is important for clinical care of the affected individuals and genetic counseling of the families. We thus aimed to establish the genetic basis of an AMC subtype that is associated with multiple dysmorphic features and intellectual disability (ID). We used haplotype analysis, next-generation sequencing, array comparative genomic hybridization, and chromosome breakpoint mapping to identify the pathogenic mutations in families and simplex cases. Suspected disease variants were verified by cosegregation analysis. We identified disease-causing mutations in the zinc-finger gene ZC4H2 in four families affected by X-linked AMC plus ID and one family affected by cerebral palsy. Several heterozygous females were also affected, but to a lesser degree. Furthermore, we found two ZC4H2 deletions and one rearrangement in two female and one male unrelated simplex cases, respectively. In mouse primary hippocampal neurons, transiently produced ZC4H2 localized to the postsynaptic compartment of excitatory synapses, and the altered protein influenced dendritic spine density. In zebrafish, antisense-morpholino-mediated zc4h2 knockdown caused abnormal swimming and impaired α-motoneuron development. All missense mutations identified herein failed to rescue the swimming defect of zebrafish morphants. We conclude that ZC4H2 point mutations, rearrangements, and small deletions cause a clinically variable broad-spectrum neurodevelopmental disorder of the central and peripheral nervous systems in both familial and simplex cases of both sexes. Our results highlight the importance of ZC4H2 for genetic testing of individuals presenting with ID plus muscle weakness and minor or major forms of AMC. PMID:23623388

Differential effects of CSF-1R D802V and KIT D816V homologous mutations on receptor tertiary structure and allosteric communication.

Directory of Open Access Journals (Sweden)

Priscila Da Silva Figueiredo Celestino Gomes

Full Text Available The colony stimulating factor-1 receptor (CSF-1R and the stem cell factor receptor KIT, type III receptor tyrosine kinases (RTKs, are important mediators of signal transduction. The normal functions of these receptors can be compromised by gain-of-function mutations associated with different physiopatological impacts. Whereas KIT D816V/H mutation is a well-characterized oncogenic event and principal cause of systemic mastocytosis, the homologous CSF-1R D802V has not been identified in human cancers. The KIT D816V oncogenic mutation triggers resistance to the RTK inhibitor Imatinib used as first line treatment against chronic myeloid leukemia and gastrointestinal tumors. CSF-1R is also sensitive to Imatinib and this sensitivity is altered by mutation D802V. Previous in silico characterization of the D816V mutation in KIT evidenced that the mutation caused a structure reorganization of the juxtamembrane region (JMR and facilitated its departure from the kinase domain (KD. In this study, we showed that the equivalent CSF-1R D802V mutation does not promote such structural effects on the JMR despite of a reduction on some key H-bonds interactions controlling the JMR binding to the KD. In addition, this mutation disrupts the allosteric communication between two essential regulatory fragments of the receptors, the JMR and the A-loop. Nevertheless, the mutation-induced shift towards an active conformation observed in KIT D816V is not observed in CSF-1R D802V. The distinct impact of equivalent mutation in two homologous RTKs could be associated with the sequence difference between both receptors in the native form, particularly in the JMR region. A local mutation-induced perturbation on the A-loop structure observed in both receptors indicates the stabilization of an inactive non-inhibited form, which Imatinib cannot bind.

Differential Effects of CSF-1R D802V and KIT D816V Homologous Mutations on Receptor Tertiary Structure and Allosteric Communication

Science.gov (United States)

Da Silva Figueiredo Celestino Gomes, Priscila; Panel, Nicolas; Laine, Elodie; Pascutti, Pedro Geraldo; Solary, Eric; Tchertanov, Luba

2014-01-01

The colony stimulating factor-1 receptor (CSF-1R) and the stem cell factor receptor KIT, type III receptor tyrosine kinases (RTKs), are important mediators of signal transduction. The normal functions of these receptors can be compromised by gain-of-function mutations associated with different physiopatological impacts. Whereas KIT D816V/H mutation is a well-characterized oncogenic event and principal cause of systemic mastocytosis, the homologous CSF-1R D802V has not been identified in human cancers. The KIT D816V oncogenic mutation triggers resistance to the RTK inhibitor Imatinib used as first line treatment against chronic myeloid leukemia and gastrointestinal tumors. CSF-1R is also sensitive to Imatinib and this sensitivity is altered by mutation D802V. Previous in silico characterization of the D816V mutation in KIT evidenced that the mutation caused a structure reorganization of the juxtamembrane region (JMR) and facilitated its departure from the kinase domain (KD). In this study, we showed that the equivalent CSF-1R D802V mutation does not promote such structural effects on the JMR despite of a reduction on some key H-bonds interactions controlling the JMR binding to the KD. In addition, this mutation disrupts the allosteric communication between two essential regulatory fragments of the receptors, the JMR and the A-loop. Nevertheless, the mutation-induced shift towards an active conformation observed in KIT D816V is not observed in CSF-1R D802V. The distinct impact of equivalent mutation in two homologous RTKs could be associated with the sequence difference between both receptors in the native form, particularly in the JMR region. A local mutation-induced perturbation on the A-loop structure observed in both receptors indicates the stabilization of an inactive non-inhibited form, which Imatinib cannot bind. PMID:24828813

Detection of EGFR mutations with mutation-specific antibodies in stage IV non-small-cell lung cancer

Directory of Open Access Journals (Sweden)

Viteri Santiago

2010-12-01

Full Text Available Abstract Background Immunohistochemistry (IHC with mutation-specific antibodies may be an ancillary method of detecting EGFR mutations in lung cancer patients. Methods EGFR mutation status was analyzed by DNA assays, and compared with IHC results in five non-small-cell lung cancer (NSCLC cell lines and tumor samples from 78 stage IV NSCLC patients. Results IHC correctly identified del 19 in the H1650 and PC9 cell lines, L858R in H1975, and wild-type EGFR in H460 and A549, as well as wild-type EGFR in tumor samples from 22 patients. IHC with the mAb against EGFR with del 19 was highly positive for the protein in all 17 patients with a 15-bp (ELREA deletion in exon 19, whereas in patients with other deletions, IHC was weakly positive in 3 cases and negative in 9 cases. IHC with the mAb against the L858R mutation showed high positivity for the protein in 25/27 (93% patients with exon 21 EGFR mutations (all with L858R but did not identify the L861Q mutation in the remaining two patients. Conclusions IHC with mutation-specific mAbs against EGFR is a promising method for detecting EGFR mutations in NSCLC patients. However these mAbs should be validated with additional studies to clarify their possible role in routine clinical practice for screening EGFR mutations in NSCLC patients.

Synonymous mutations in RNASEH2A create cryptic splice sites impairing RNase H2 enzyme function in Aicardi-Goutières syndrome.

Science.gov (United States)

Rice, Gillian I; Reijns, Martin A M; Coffin, Stephanie R; Forte, Gabriella M A; Anderson, Beverley H; Szynkiewicz, Marcin; Gornall, Hannah; Gent, David; Leitch, Andrea; Botella, Maria P; Fazzi, Elisa; Gener, Blanca; Lagae, Lieven; Olivieri, Ivana; Orcesi, Simona; Swoboda, Kathryn J; Perrino, Fred W; Jackson, Andrew P; Crow, Yanick J

2013-08-01

Aicardi-Goutières syndrome is an inflammatory disorder resulting from mutations in TREX1, RNASEH2A/2B/2C, SAMHD1, or ADAR1. Here, we provide molecular, biochemical, and cellular evidence for the pathogenicity of two synonymous variants in RNASEH2A. Firstly, the c.69G>A (p.Val23Val) mutation causes the formation of a splice donor site within exon 1, resulting in an out of frame deletion at the end of exon 1, leading to reduced RNase H2 protein levels. The second mutation, c.75C>T (p.Arg25Arg), also introduces a splice donor site within exon 1, and the internal deletion of 18 amino acids. The truncated protein still forms a heterotrimeric RNase H2 complex, but lacks catalytic activity. However, as a likely result of leaky splicing, a small amount of full-length active protein is apparently produced in an individual homozygous for this mutation. Recognition of the disease causing status of these variants allows for diagnostic testing in relevant families. © 2013 WILEY PERIODICALS, INC.

Molecular interaction between K-Ras and H-REV107 in the Ras signaling pathway.

Science.gov (United States)

Han, Chang Woo; Jeong, Mi Suk; Jang, Se Bok

2017-09-16

Ras proteins are small GTPases that serve as master moderators of a large number of signaling pathways involved in various cellular processes. Activating mutations in Ras are found in about one-third of cancers. H-REV107, a K-Ras binding protein, plays an important role in determining K-Ras function. H-REV107 is a member of the HREV107 family of class II tumor suppressor genes and a growth inhibitory Ras target gene that suppresses cellular growth, differentiation, and apoptosis. Expression of H-REV107 was strongly reduced in about 50% of human carcinoma cell lines. However, the specific molecular mechanism by which H-REV107 inhibits Ras is still unknown. In the present study, we suggest that H-REV107 forms a strong complex with activating oncogenic mutation Q61H K-Ras from various biochemical binding assays and modeled structures. In addition, the interaction sites between K-Ras and H-REV107 were predicted based on homology modeling. Here, we found that some structure-based mutants of the K-Ras disrupted the complex formation with H-REV107. Finally, a novel molecular mechanism describing K-Ras and H-REV107 binding is suggested and insights into new K-Ras effector target drugs are provided. Copyright © 2017 Elsevier Inc. All rights reserved.

The effect of point mutations on structure and mechanical properties of collagen-like fibril: A molecular dynamics study

International Nuclear Information System (INIS)

Marlowe, Ashley E.; Singh, Abhishek; Yingling, Yaroslava G.

2012-01-01

Understanding sequence dependent mechanical and structural properties of collagen fibrils is important for the development of artificial biomaterials for medical and nanotechnological applications. Moreover, point mutations are behind many collagen associated diseases, including Osteogenesis Imperfecta (OI). We conducted a combination of classical and steered atomistic molecular dynamics simulations to examine the effect of point mutations on structure and mechanical properties of short collagen fibrils which include mutations of glycine to alanine, aspartic acid, cysteine, and serine or mutations of hydroxyproline to arginine, asparagine, glutamine, and lysine. We found that all mutations disrupt structure and reduce strength of the collagen fibrils, which may affect the hierarchical packing of the fibrils. The glycine mutations were more detrimental to mechanical strength of the fibrils (WT > Ala > Ser > Cys > Asp) than that of hydroxyproline (WT > Arg > Gln > Asn > Lys). The clinical outcome for glycine mutations agrees well with the trend in reduction of fibril's tensile strength predicted by our simulations. Overall, our results suggest that the reduction in mechanical properties of collagen fibrils may be used to predict the clinical outcome of mutations. Highlights: ► All mutations disrupt structure and bonding pattern and reduce strength of the collagen fibrils. ► Gly based mutations are worst to mechanical integrity of fibrils than that of Hyp. ► Lys and Arg mutations most dramatically destabilize collagen fibril properties. ► Clinical outcome of mutations may be related to the reduced mechanical properties of fibrils.

Direct Transcriptional Consequences of Somatic Mutation in Breast Cancer

Directory of Open Access Journals (Sweden)

Adam Shlien

2016-08-01

Full Text Available Disordered transcriptomes of cancer encompass direct effects of somatic mutation on transcription, coordinated secondary pathway alterations, and increased transcriptional noise. To catalog the rules governing how somatic mutation exerts direct transcriptional effects, we developed an exhaustive pipeline for analyzing RNA sequencing data, which we integrated with whole genomes from 23 breast cancers. Using X-inactivation analyses, we found that cancer cells are more transcriptionally active than intermixed stromal cells. This is especially true in estrogen receptor (ER-negative tumors. Overall, 59% of substitutions were expressed. Nonsense mutations showed lower expression levels than expected, with patterns characteristic of nonsense-mediated decay. 14% of 4,234 rearrangements caused transcriptional abnormalities, including exon skips, exon reusage, fusions, and premature polyadenylation. We found productive, stable transcription from sense-to-antisense gene fusions and gene-to-intergenic rearrangements, suggesting that these mutation classes drive more transcriptional disruption than previously suspected. Systematic integration of transcriptome with genome data reveals the rules by which transcriptional machinery interprets somatic mutation.

Somatic frameshift mutations in the Bloom syndrome BLM gene are frequent in sporadic gastric carcinomas with microsatellite mutator phenotype

Directory of Open Access Journals (Sweden)

Matei Irina

2001-08-01

Full Text Available Abstract Background Genomic instability has been reported at microsatellite tracts in few coding sequences. We have shown that the Bloom syndrome BLM gene may be a target of microsatelliteinstability (MSI in a short poly-adenine repeat located in its coding region. To further characterize the involvement of BLM in tumorigenesis, we have investigated mutations in nine genes containing coding microsatellites in microsatellite mutator phenotype (MMP positive and negative gastric carcinomas (GCs. Methods We analyzed 50 gastric carcinomas (GCs for mutations in the BLM poly(A tract aswell as in the coding microsatellites of the TGFβ1-RII, IGFIIR, hMSH3, hMSH6, BAX, WRN, RECQL and CBL genes. Results BLM mutations were found in 27% of MMP+ GCs (4/15 cases but not in any of the MMP negative GCs (0/35 cases. The frequency of mutations in the other eight coding regions microsatellite was the following: TGFβ1-RII (60 %, BAX (27%, hMSH6 (20%,hMSH3 (13%, CBL (13%, IGFIIR (7%, RECQL (0% and WRN (0%. Mutations in BLM appear to be more frequently associated with frameshifts in BAX and in hMSH6and/or hMSH3. Tumors with BLM alterations present a higher frequency of unstable mono- and trinucleotide repeats located in coding regions as compared with mutator phenotype tumors without BLM frameshifts. Conclusions BLM frameshifts are frequent alterations in GCs specifically associated with MMP+tumors. We suggest that BLM loss of function by MSI may increase the genetic instability of a pre-existent unstable genotype in gastric tumors.

Somatic frameshift mutations in the Bloom syndrome BLM gene are frequent in sporadic gastric carcinomas with microsatellite mutator phenotype

Science.gov (United States)

Calin, George; Ranzani, Guglielmina N; Amadori, Dino; Herlea, Vlad; Matei, Irina; Barbanti-Brodano, Giuseppe; Negrini, Massimo

2001-01-01

Background Genomic instability has been reported at microsatellite tracts in few coding sequences. We have shown that the Bloom syndrome BLM gene may be a target of microsatelliteinstability (MSI) in a short poly-adenine repeat located in its coding region. To further characterize the involvement of BLM in tumorigenesis, we have investigated mutations in nine genes containing coding microsatellites in microsatellite mutator phenotype (MMP) positive and negative gastric carcinomas (GCs). Methods We analyzed 50 gastric carcinomas (GCs) for mutations in the BLM poly(A) tract aswell as in the coding microsatellites of the TGFβ1-RII, IGFIIR, hMSH3, hMSH6, BAX, WRN, RECQL and CBL genes. Results BLM mutations were found in 27% of MMP+ GCs (4/15 cases) but not in any of the MMP negative GCs (0/35 cases). The frequency of mutations in the other eight coding regions microsatellite was the following: TGFβ1-RII (60 %), BAX (27%), hMSH6 (20%),hMSH3 (13%), CBL (13%), IGFIIR (7%), RECQL (0%) and WRN (0%). Mutations in BLM appear to be more frequently associated with frameshifts in BAX and in hMSH6and/or hMSH3. Tumors with BLM alterations present a higher frequency of unstable mono- and trinucleotide repeats located in coding regions as compared with mutator phenotype tumors without BLM frameshifts. Conclusions BLM frameshifts are frequent alterations in GCs specifically associated with MMP+tumors. We suggest that BLM loss of function by MSI may increase the genetic instability of a pre-existent unstable genotype in gastric tumors. PMID:11532193

Sideways Force Produced During Disruptions

Science.gov (United States)

Strauss, H. R.; Paccagnella, R.; Breslau, J.; Jardin, S.; Sugiyama, L.

2012-10-01

We extend previous studies [1] of vertical displacement events (VDE) which can produce disruptions. The emphasis is on the non axisymmetric ``sideways'' wall force Fx. Simulations are performed using the M3D [2] code. A VDE expels magnetic flux through the resistive wall until the last closed flux surface has q VDE is presented. The wall force depends strongly on γτw, where γ is the mode growth rate and τw is the wall resistive penetration time. The force Fx is largest when γτw is a constant of order unity, which depends on the initial conditions. For large values of γτw, the wall force asymptotes to a relatively smaller value, well below the critical value ITER is designed to withstand. The principle of disruption mitigation by massive gas injection is to cause a disruption with large γτw. [4pt] [1] H. R. Strauss, R. Paccagnella, and J. Breslau,Phys. Plasmas 17, 082505 (2010) [2] W. Park, E.V. Belova, G.Y. Fu, X. Tang, H.R. Strauss, L.E. Sugiyama, Phys. Plasmas 6, 1796 (1999).

Adult Diffuse Astrocytoma in the Medulla Oblongata: Molecular Biological Analyses Including H3F3A Mutation of Histone H3.3.

Science.gov (United States)

Uekawa, Ken; Nakamura, Hideo; Shinojima, Naoki; Takezaki, Tatsuya; Yano, Shigetoshi; Kuratsu, Jun-Ichi

2016-04-01

Unlike in children, brain stem gliomas in adult are rare and still poorly understood. In addition, most adult brain stem gliomas result predominantly in the pons and are less often found in the medulla oblongata. Here, we report a case of an adult glioma in the medulla oblongata and its molecular biological features. A 46-year-old male presented with gait disturbance, paresthesia, and dysphagia. Magnetic resonance imaging (MRI) showed a diffuse hyper-intensive lesion in the medulla oblongata on a T 2 -weighted image without gadolinium contrast enhancement. We performed an open biopsy and the lesion was pathologically diagnosed as a diffuse astrocytoma. Molecular biological analyses revealed the absence of histone H3.3 mutation (H3F3A K27M), and presence of methylation of O-6-methylguanine-DNA methyltransferase (MGMT) promoter and a mutation in isocitrate dehydrogenase 1 (IDH-1). The patient received local radiotherapy and temozolomide chemotherapy. The patient's symptoms were ameliorated, and MRI showed no tumor growth at 6 months after the initial treatment. Biopsy for brain stem lesions is generally thought to have risk of complications, but if performed minimally, it is useful to diagnose and determine treatment strategy. Obtaining patient characteristics and molecular biological features will provide insight towards therapeutic treatment for adult brain stem gliomas.

Depletion of the human N-terminal acetyltransferase hNaa30 disrupts Golgi integrity and ARFRP1 localization.

Science.gov (United States)

Starheim, Kristian K; Kalvik, Thomas V; Bjørkøy, Geir; Arnesen, Thomas

2017-04-30

The organization of the Golgi apparatus (GA) is tightly regulated. Golgi stack scattering is observed in cellular processes such as apoptosis and mitosis, and has also been associated with disruption of cellular lipid metabolism and neurodegenerative diseases. Our studies show that depletion of the human N-α-acetyltransferase 30 (hNaa30) induces fragmentation of the Golgi stack in HeLa and CAL-62 cell lines. The GA associated GTPase ADP ribosylation factor related protein 1 (ARFRP1) was previously shown to require N-terminal acetylation for membrane association and based on its N-terminal sequence, it is likely to be a substrate of hNaa30. ARFRP1 is involved in endosome-to- trans -Golgi network (TGN) traffic. We observed that ARFRP1 shifted from a predominantly cis -Golgi and TGN localization to localizing both Golgi and non-Golgi vesicular structures in hNaa30-depleted cells. However, we did not observe loss of membrane association of ARFRP1. We conclude that hNaa30 depletion induces Golgi scattering and induces aberrant ARFRP1 Golgi localization. © 2017 The Author(s).

MLPA based detection of mutations in the dystrophin gene of 180 Polish families with Duchenne/Becker muscular dystrophy.

Science.gov (United States)

Zimowski, Janusz G; Massalska, Diana; Holding, Mariola; Jadczak, Sylwia; Fidziańska, Elżbieta; Lusakowska, Anna; Kostera-Pruszczyk, Anna; Kamińska, Anna; Zaremba, Jacek

2014-01-01

Duchenne/Becker muscular dystrophy (DMD/BMD) is a recessive, X-linked disorder caused by a mutation in the dystrophin gene. Deletions account for approximately 60-65% of mutations, duplications for 5-10%. The remaining cases are mainly point mutations. According to Monaco theory clinical form of the disease depends on maintaining or disrupting the reading frame. The purpose of the study was to determine frequency and location of deletions and duplications in the dystrophin gene, to determine the compliance between maintaining/disrupting the reading frame and clinical form of the disease and to check the effectiveness of MLPA (multiplex ligation-dependent probe amplification) in the detection of these mutations in hemizygous patients and heterozygous female carriers. The material is composed of combined results of molecular diagnosis carried out in years 2009-2012 in 180 unrelated patients referred with the diagnosis of DMD/BMD tested by use of MLPA. We identified 110 deletions, 22 duplication (in one patient two different duplications were detected) and 2 point mutations. Deletions involved mainly exons 45-54 and 3-21, whereas most duplications involved exons 3-18. The compliance with Monaco theory was 95% for deletions and 76% for duplications. Most of mutations in the dystrophin gene were localized in the hot spots - different for deletions and duplications. MLPA enabled their quick identification, exact localization and determination whether or not they maintained or disrupted the reading frame. MLPA was also effective in detection of deletions and duplications in female carriers. Copyright © 2014 Polish Neurological Society. Published by Elsevier Urban & Partner Sp. z o.o. All rights reserved.

Prevalence of H63D, S65C and C282Y hereditary hemochromatosis gene mutations in Slovenian population by an improved high-throughput genotyping assay

Directory of Open Access Journals (Sweden)

Rupreht Ruth

2007-11-01

Full Text Available Abstract Background Hereditary hemochromatosis (HH is a common genetic disease characterized by excessive iron overload that leads to multi-organ failure. Although the most prevalent genotype in HH is homozygosity for C282Y mutation of the HFE gene, two additional mutations, H63D and S65C, appear to be associated with a milder form of HH. The aim of this study was to develop a high-throughput assay for HFE mutations screening based on TaqMan technology and to determine the frequencies of HFE mutations in the Slovenian population. Methods Altogether, 1282 randomly selected blood donors from different Slovenian regions and 21 HH patients were analyzed for the presence of HFE mutations by an in-house developed real-time PCR assay based on TaqMan technology using shorter non-interfering fluorescent single nucleotide polymorphism (SNP-specific MGB probes. The assay was validated by RFLP analysis and DNA sequencing. Results The genotyping assay of the H63D, S65C and C282Y mutations in the HFE gene, based on TaqMan technology proved to be fast, reliable, with a high-throughput capability and 100% concordant with genotypes obtained by RFLP and DNA sequencing. The observed frequency of C282Y homozygotes in the group of HH patients was only 48%, others were of the heterogeneous HFE genotype. Among 1282 blood donors tested, the observed H63D, S65C and C282Y allele frequency were 12.8% (95% confidence interval (CI 11.5 – 14.2%, 1.8% (95% CI 1.4 – 2.5% and 3.6% (95% CI 3.0 – 4.5%, respectively. Approximately 33% of the tested subjects had at least one of the three HH mutations, and 1% of them were C282Y homozygotes or compound heterozygotes C282Y/H63D or C282Y/S65C, presenting an increased risk for iron overload disease. A significant variation in H63D allele frequency was observed for one of the Slovenian regions. Conclusion The improved real-time PCR assay for H63D, S65C and C282Y mutations detection is accurate, fast, cost-efficient and ready for

BAP1 missense mutation c.2054 A>T (p.E685V completely disrupts normal splicing through creation of a novel 5' splice site in a human mesothelioma cell line.

Directory of Open Access Journals (Sweden)

Arianne Morrison

Full Text Available BAP1 is a tumor suppressor gene that is lost or deleted in diverse cancers, including uveal mela¬noma, malignant pleural mesothelioma (MPM, clear cell renal carcinoma, and cholangiocarcinoma. Recently, BAP1 germline mutations have been reported in families with combinations of these same cancers. A particular challenge for mutation screening is the classification of non-truncating BAP1 sequence variants because it is not known whether these subtle changes can affect the protein function sufficiently to predispose to cancer development. Here we report mRNA splicing analysis on a homozygous substitution mutation, BAP1 c. 2054 A&T (p.Glu685Val, identified in an MPM cell line derived from a mesothelioma patient. The mutation occurred at the 3rd nucleotide from the 3' end of exon 16. RT-PCR, cloning and subsequent sequencing revealed several aberrant splicing products not observed in the controls: 1 a 4 bp deletion at the end of exon 16 in all clones derived from the major splicing product. The BAP1 c. 2054 A&T mutation introduced a new 5' splice site (GU, which resulted in the deletion of 4 base pairs and presumably protein truncation; 2 a variety of alternative splicing products that led to retention of different introns: introns 14-16; introns 15-16; intron 14 and intron 16; 3 partial intron 14 and 15 retentions caused by activation of alternative 3' splice acceptor sites (AG in the introns. Taken together, we were unable to detect any correctly spliced mRNA transcripts in this cell line. These results suggest that aberrant splicing caused by this mutation is quite efficient as it completely abolishes normal splicing through creation of a novel 5' splice site and activation of cryptic splice sites. These data support the conclusion that BAP1 c.2054 A&T (p.E685V variant is a pathogenic mutation and contributes to MPM through disruption of normal splicing.

Glutamine methylation in histone H2A is an RNA-polymerase-I-dedicated modification

Science.gov (United States)

Tessarz, Peter; Santos-Rosa, Helena; Robson, Sam C.; Sylvestersen, Kathrine B.; Nelson, Christopher J.; Nielsen, Michael L.; Kouzarides, Tony

2014-01-01

Nucleosomes are decorated with numerous post-translational modifications capable of influencing many DNA processes. Here we describe a new class of histone modification, methylation of glutamine, occurring on yeast histone H2A at position 105 (Q105) and human H2A at Q104. We identify Nop1 as the methyltransferase in yeast and demonstrate that fibrillarin is the orthologue enzyme in human cells. Glutamine methylation of H2A is restricted to the nucleolus. Global analysis in yeast, using an H2AQ105me-specific antibody, shows that this modification is exclusively enriched over the 35S ribosomal DNA transcriptional unit. We show that the Q105 residue is part of the binding site for the histone chaperone FACT (facilitator of chromatin transcription) complex. Methylation of Q105 or its substitution to alanine disrupts binding to FACT in vitro. A yeast strain mutated at Q105 shows reduced histone incorporation and increased transcription at the ribosomal DNA locus. These features are phenocopied by mutations in FACT complex components. Together these data identify glutamine methylation of H2A as the first histone epigenetic mark dedicated to a specific RNA polymerase and define its function as a regulator of FACT interaction with nucleosomes.

Hemochromatosis (HFE gene mutations in Brazilian chronic hemodialysis patients

Directory of Open Access Journals (Sweden)

F.V. Perícole

2005-09-01

Full Text Available Patients with chronic renal insufficiency (CRI have reduced hemoglobin levels, mostly as a result of decreased kidney production of erythropoietin, but the relation between renal insufficiency and the magnitude of hemoglobin reduction has not been well defined. Hereditary hemochromatosis is an inherited disorder of iron metabolism. The importance of the association of hemochromatosis with treatment for anemia among patients with CRI has not been well described. We analyzed the frequency of the C282Y and H63D mutations in the HFE gene in 201 Brazilian individuals with CRI undergoing hemodialysis. The analysis of the effects of HFE mutations on iron metabolism and anemia with biochemical parameters was possible in 118 patients of this study (hemoglobin, hematocrit, ferritin levels, transferrin saturation, and serum iron. A C282Y heterozygous mutation was found in 7/201 (3.4% and H63D homozygous and heterozygous mutation were found in 2/201 (1.0% and 46/201 (22.9%, respectively. The allelic frequencies of the HFE mutations (0.017 for C282Y mutation and 0.124 for H63D mutation did not differ between patients with CRI and healthy controls. Regarding the biochemical parameters, no differences were observed between HFE heterozygous and mutation-negative patients, although ferritin levels were not higher among patients with the H63D mutation (P = 0.08. From what we observed in our study, C282Y/H63D HFE gene mutations are not related to degrees of anemia or iron stores in CRI patients receiving intravenous iron supplementation (P > 0.10. Nevertheless, the present data suggest that the H63D mutation may have an important function as a modulating factor of iron overload in these patients.

Mutation analysis of 2009 pandemic influenza A(H1N1 viruses collected in Japan during the peak phase of the pandemic.

Directory of Open Access Journals (Sweden)

Jean-Étienne Morlighem

Full Text Available BACKGROUND: Pandemic influenza A(H1N1 virus infection quickly circulated worldwide in 2009. In Japan, the first case was reported in May 2009, one month after its outbreak in Mexico. Thereafter, A(H1N1 infection spread widely throughout the country. It is of great importance to profile and understand the situation regarding viral mutations and their circulation in Japan to accumulate a knowledge base and to prepare clinical response platforms before a second pandemic (pdm wave emerges. METHODOLOGY: A total of 253 swab samples were collected from patients with influenza-like illness in the Osaka, Tokyo, and Chiba areas both in May 2009 and between October 2009 and January 2010. We analyzed partial sequences of the hemagglutinin (HA and neuraminidase (NA genes of the 2009 pdm influenza virus in the collected clinical samples. By phylogenetic analysis, we identified major variants of the 2009 pdm influenza virus and critical mutations associated with severe cases, including drug-resistance mutations. RESULTS AND CONCLUSIONS: Our sequence analysis has revealed that both HA-S220T and NA-N248D are major non-synonymous mutations that clearly discriminate the 2009 pdm influenza viruses identified in the very early phase (May 2009 from those found in the peak phase (October 2009 to January 2010 in Japan. By phylogenetic analysis, we found 14 micro-clades within the viruses collected during the peak phase. Among them, 12 were new micro-clades, while two were previously reported. Oseltamivir resistance-related mutations, i.e., NA-H275Y and NA-N295S, were also detected in sporadic cases in Osaka and Tokyo.

"Targeted disruption of the epithelial-barrier by Helicobacter pylori"

Directory of Open Access Journals (Sweden)

Wroblewski Lydia E

2011-11-01

Full Text Available Abstract Helicobacter pylori colonizes the human gastric epithelium and induces chronic gastritis, which can lead to gastric cancer. Through cell-cell contacts the gastric epithelium forms a barrier to protect underlying tissue from pathogenic bacteria; however, H. pylori have evolved numerous strategies to perturb the integrity of the gastric barrier. In this review, we summarize recent research into the mechanisms through which H. pylori disrupts intercellular junctions and disrupts the gastric epithelial barrier.

IDH Mutations: Genotype-Phenotype Correlation and Prognostic Impact

Directory of Open Access Journals (Sweden)

Xiao-Wei Wang

2014-01-01

Full Text Available IDH1/2 mutation is the most frequent genomic alteration found in gliomas, affecting 40% of these tumors and is one of the earliest alterations occurring in gliomagenesis. We investigated a series of 1305 gliomas and showed that IDH mutation is almost constant in 1p19q codeleted tumors. We found that the distribution of IDH1R132H, IDH1nonR132H, and IDH2 mutations differed between astrocytic, mixed, and oligodendroglial tumors, with an overrepresentation of IDH2 mutations in oligodendroglial phenotype and an overrepresentation of IDH1nonR132H in astrocytic tumors. We stratified grade II and grade III gliomas according to the codeletion of 1p19q and IDH mutation to define three distinct prognostic subgroups: 1p19q and IDH mutated, IDH mutated—which contains mostly TP53 mutated tumors, and none of these alterations. We confirmed that IDH mutation with a hazard ratio = 0.358 is an independent prognostic factor of good outcome. These data refine current knowledge on IDH mutation prognostic impact and genotype-phenotype associations.

A mutation in the LAMC2 gene causes the Herlitz junctional epidermolysis bullosa (H-JEB in two French draft horse breeds

Directory of Open Access Journals (Sweden)

Guérin Gérard

2003-03-01

Full Text Available Abstract Epidermolysis bullosa (EB is a heterogeneous group of inherited diseases characterised by skin blistering and fragility. In humans, one of the most severe forms of EB known as Herlitz-junctional EB (H-JEB, is caused by mutations in the laminin 5 genes. EB has been described in several species, like cattle, sheep, dogs, cats and horses where the mutation, a cytosine insertion in exon 10 of the LAMC2 gene, was very recently identified in Belgian horses as the mutation responsible for JEB. In this study, the same mutation was found to be totally associated with the JEB phenotype in two French draft horse breeds, Trait Breton and Trait Comtois. This result provides breeders a molecular test to better manage their breeding strategies by genetic counselling.

Mutations in the AXIN1 gene in advanced prostate cancer

DEFF Research Database (Denmark)

Yardy, George W; Bicknell, David C; Wilding, Jennifer L

2009-01-01

The Wnt signalling pathway directs aspects of embryogenesis and is thought to contribute to maintenance of certain stem cell populations. Disruption of the pathway has been observed in many different tumour types. In bowel, stomach, and endometrial cancer, this is usually due to mutation of genes...

Characterization of endocrine disruption potentials of coastal sediments of Taean, Korea employing H295R and MVLN assays-Reconnaissance at 5years after Hebei Spirit oil spill.

Science.gov (United States)

Liu, Xiaoshan; Jung, Dawoon; Zhou, Kairu; Lee, Sangwoo; Noh, Kiwan; Khim, Jong Seong; Giesy, John P; Yim, Un Hyuk; Shim, Won Joon; Choi, Kyungho

2018-02-01

Endocrine disrupting potentials were assessed for sediment samples collected near Hebei Spirit oil spill (HSOS) site, between December 2007 and January 2012. For comparison, major crude oil (CO) of HSOS, or its weathered form were assessed. Both raw extracts (REs) and their fractionated samples were tested using H295R and MVLNluc bioassays. In H295R cells, REs of crude and weathered oil (WO), and nine of 14 sediments significantly increased E2 levels, which were correlated with the concentrations of PAHs. Steroidogenic disruption potentials of the sediments generally decreased over time. Among silica fractions of all REs, aromatic hydrocarbons (F2) and polar compounds (F3) caused greater E2 levels. While, in MVLN cell bioassay, only three of 14 sediment REs showed estrogen receptor binding potencies, and no temporal trend was observed. In conclusion, oil spill can cause endocrine disruption in the affected ecosystem through steroidogenic alteration for years, and such potencies attenuate over time. Copyright © 2017 Elsevier Ltd. All rights reserved.

Limited phenotypic variation of hypocalcified amelogenesis imperfecta in a Danish five-generation family with a novel FAM83H nonsense mutation.

Science.gov (United States)

Haubek, Dorte; Gjørup, Hans; Jensen, Lillian G; Juncker, Inger; Nyegaard, Mette; Børglum, Anders D; Poulsen, Sven; Hertz, Jens M

2011-11-01

BACKGROUND.  Autosomal dominant hypocalcified amelogenesis imperfecta (ADHCAI) is a disease with severe dental manifestations. OBJECTIVES.  The aims were by means of a genome-wide linkage scan to search for the gene underlying the ADHCAI phenotype in a Danish five-generation family and to study the phenotypic variation of the enamel in affected family members. RESULTS.  Significant linkage was found to a locus at chromosome 8q24.3 comprising the gene FAM83H identified to be responsible for ADHCAI in other families. Subsequent sequencing of FAM83H in affected family members revealed a novel nonsense mutation, p.Y302X. Limited phenotypic variation was found among affected family members with loss of translucency and discoloration of the enamel. Extensive posteruptive loss of enamel was found in all teeth of affected subjects. The tip of the cusps on the premolars and molars and a zone along the gingival margin seemed resistant to posteruptive loss of enamel. We have screened FAM83H in another five unrelated Danish patients with a phenotype of ADHCAI similar to that in the five-generation family, and identified a de novo FAM83H nonsense mutation, p.Q452X in one of these patients. CONCLUSION.  We have identified a FAM83H mutation in two of six unrelated families with ADHCAI and found limited phenotypic variation of the enamel in these patients. © 2011 The Authors. International Journal of Paediatric Dentistry © 2011 BSPD, IAPD and Blackwell Publishing Ltd.

Computational Cardiac Modeling Reveals Mechanisms of Ventricular Arrhythmogenesis in Long QT Syndrome Type 8: CACNA1C R858H Mutation Linked to Ventricular Fibrillation

Directory of Open Access Journals (Sweden)

Jieyun Bai

2017-10-01

Full Text Available Functional analysis of the L-type calcium channel has shown that the CACNA1C R858H mutation associated with severe QT interval prolongation may lead to ventricular fibrillation (VF. This study investigated multiple potential mechanisms by which the CACNA1C R858H mutation facilitates and perpetuates VF. The Ten Tusscher-Panfilov (TP06 human ventricular cell models incorporating the experimental data on the kinetic properties of L-type calcium channels were integrated into one-dimensional (1D fiber, 2D sheet, and 3D ventricular models to investigate the pro-arrhythmic effects of CACNA1C mutations by quantifying changes in intracellular calcium handling, action potential profiles, action potential duration restitution (APDR curves, dispersion of repolarization (DOR, QT interval and spiral wave dynamics. R858H “mutant” L-type calcium current (ICaL augmented sarcoplasmic reticulum calcium content, leading to the development of afterdepolarizations at the single cell level and focal activities at the tissue level. It also produced inhomogeneous APD prolongation, causing QT prolongation and repolarization dispersion amplification, rendering R858H “mutant” tissue more vulnerable to the induction of reentry compared with other conditions. In conclusion, altered ICaL due to the CACNA1C R858H mutation increases arrhythmia risk due to afterdepolarizations and increased tissue vulnerability to unidirectional conduction block. However, the observed reentry is not due to afterdepolarizations (not present in our model, but rather to a novel blocking mechanism.

The effect of point mutations on structure and mechanical properties of collagen-like fibril: A molecular dynamics study

Energy Technology Data Exchange (ETDEWEB)

Marlowe, Ashley E.; Singh, Abhishek; Yingling, Yaroslava G., E-mail: yara_yingling@ncsu.edu

2012-12-01

Understanding sequence dependent mechanical and structural properties of collagen fibrils is important for the development of artificial biomaterials for medical and nanotechnological applications. Moreover, point mutations are behind many collagen associated diseases, including Osteogenesis Imperfecta (OI). We conducted a combination of classical and steered atomistic molecular dynamics simulations to examine the effect of point mutations on structure and mechanical properties of short collagen fibrils which include mutations of glycine to alanine, aspartic acid, cysteine, and serine or mutations of hydroxyproline to arginine, asparagine, glutamine, and lysine. We found that all mutations disrupt structure and reduce strength of the collagen fibrils, which may affect the hierarchical packing of the fibrils. The glycine mutations were more detrimental to mechanical strength of the fibrils (WT > Ala > Ser > Cys > Asp) than that of hydroxyproline (WT > Arg > Gln > Asn > Lys). The clinical outcome for glycine mutations agrees well with the trend in reduction of fibril's tensile strength predicted by our simulations. Overall, our results suggest that the reduction in mechanical properties of collagen fibrils may be used to predict the clinical outcome of mutations. Highlights: Black-Right-Pointing-Pointer All mutations disrupt structure and bonding pattern and reduce strength of the collagen fibrils. Black-Right-Pointing-Pointer Gly based mutations are worst to mechanical integrity of fibrils than that of Hyp. Black-Right-Pointing-Pointer Lys and Arg mutations most dramatically destabilize collagen fibril properties. Black-Right-Pointing-Pointer Clinical outcome of mutations may be related to the reduced mechanical properties of fibrils.

Mutations in APC, CTNNB1 and K-ras genes and expression of hMLH1 in sporadic colorectal carcinomas from the Netherlands Cohort Study

International Nuclear Information System (INIS)

Lüchtenborg, Margreet; Weijenberg, Matty P; Wark, Petra A; Saritas, A Merdan; Roemen, Guido MJM; Muijen, Goos NP van; Bruïne, Adriaan P de; Brandt, Piet A van den; Goeij, Anton FPM de

2005-01-01

The early to intermediate stages of the majority of colorectal tumours are thought to be driven by aberrations in the Wnt (APC, CTNNB1) and Ras (K-ras) pathways. A smaller proportion of cancers shows mismatch repair deficiency. The aim of this study was to analyse the co-occurrence of these genetic alterations in relation to tumour and patient characteristics. In a group of 656 unselected sporadic colorectal cancer patients, aberrations in the APC, K-ras, CTNNB1 genes, and expression of hMLH1 were investigated. Additionally, tumours were divided in groups based on molecular features and compared with respect to patient's age at diagnosis, sex, family history of colorectal cancer, tumour sub-localisation, Dukes' stage and differentiation. Mutations at the phosphorylation sites (codons 31, 33, 37, and 45) in the CTNNB1 gene were observed in tumours from only 5/464 patients. Tumours with truncating APC mutations and activating K-ras mutations in codons 12 and 13 occurred at similar frequencies (37% (245/656) and 36% (235/656), respectively). Seventeen percent of tumours harboured both an APC and a K-ras mutation (109/656). Nine percent of all tumours (58/656) lacked hMLH1 expression. Patients harbouring a tumour with absent hMLH1 expression were older, more often women, more often had proximal colon tumours that showed poorer differentiation when compared to patients harbouring tumours with an APC and/or K-ras mutation. CTNNB1 mutations seem to be of minor importance in sporadic colorectal cancer. The main differences in tumour and patient characteristics are found between groups of patients based on mismatch repair deficiency

Mutations in APC, CTNNB1 and K-ras genes and expression of hMLH1 in sporadic colorectal carcinomas from the Netherlands Cohort Study

Directory of Open Access Journals (Sweden)

de Bruïne Adriaan P

2005-12-01

Full Text Available Abstract Background The early to intermediate stages of the majority of colorectal tumours are thought to be driven by aberrations in the Wnt (APC, CTNNB1 and Ras (K-ras pathways. A smaller proportion of cancers shows mismatch repair deficiency. The aim of this study was to analyse the co-occurrence of these genetic alterations in relation to tumour and patient characteristics. Methods In a group of 656 unselected sporadic colorectal cancer patients, aberrations in the APC, K-ras, CTNNB1 genes, and expression of hMLH1 were investigated. Additionally, tumours were divided in groups based on molecular features and compared with respect to patient's age at diagnosis, sex, family history of colorectal cancer, tumour sub-localisation, Dukes' stage and differentiation. Results Mutations at the phosphorylation sites (codons 31, 33, 37, and 45 in the CTNNB1 gene were observed in tumours from only 5/464 patients. Tumours with truncating APC mutations and activating K-ras mutations in codons 12 and 13 occurred at similar frequencies (37% (245/656 and 36% (235/656, respectively. Seventeen percent of tumours harboured both an APC and a K-ras mutation (109/656. Nine percent of all tumours (58/656 lacked hMLH1 expression. Patients harbouring a tumour with absent hMLH1 expression were older, more often women, more often had proximal colon tumours that showed poorer differentiation when compared to patients harbouring tumours with an APC and/or K-ras mutation. Conclusion CTNNB1 mutations seem to be of minor importance in sporadic colorectal cancer. The main differences in tumour and patient characteristics are found between groups of patients based on mismatch repair deficiency.

PB2 mutations D701N and S714R promote adaptation of an influenza H5N1 virus to a mammalian host.

Science.gov (United States)

Czudai-Matwich, Volker; Otte, Anna; Matrosovich, Mikhail; Gabriel, Gülsah; Klenk, Hans-Dieter

2014-08-01

Mutation D701N in the PB2 protein is known to play a prominent role in the adaptation of avian influenza A viruses to mammalian hosts. In contrast, little is known about the nearby mutations S714I and S714R, which have been observed in some avian influenza viruses highly pathogenic for mammals. We have generated recombinant H5N1 viruses with PB2 displaying the avian signature 701D or the mammalian signature 701N and serine, isoleucine, and arginine at position 714 and compared them for polymerase activity and virus growth in avian and mammalian cells, as well as for pathogenicity in mice. Mutation D701N led to an increase in polymerase activity and replication efficiency in mammalian cells and in mouse pathogenicity, and this increase was significantly enhanced when mutation D701N was combined with mutation S714R. Stimulation by mutation S714I was less distinct. These observations indicate that PB2 mutation S714R, in combination with the mammalian signature at position 701, has the potential to promote the adaptation of an H5N1 virus to a mammalian host. Influenza A/H5N1 viruses are avian pathogens that have pandemic potential, since they are spread over large parts of Asia, Africa, and Europe and are occasionally transmitted to humans. It is therefore of high scientific interest to understand the mechanisms that determine the host specificity and pathogenicity of these viruses. It is well known that the PB2 subunit of the viral polymerase is an important host range determinant and that PB2 mutation D701N plays an important role in virus adaptation to mammalian cells. In the present study, we show that mutation S714R is also involved in adaptation and that it cooperates with D701N in exposing a nuclear localization signal that mediates importin-α binding and entry of PB2 into the nucleus, where virus replication and transcription take place. Copyright © 2014, American Society for Microbiology. All Rights Reserved.

Characterization of pathogenic germline mutations in human Protein Kinases

Directory of Open Access Journals (Sweden)

Orengo Christine A

2011-07-01

Full Text Available Abstract Background Protein Kinases are a superfamily of proteins involved in crucial cellular processes such as cell cycle regulation and signal transduction. Accordingly, they play an important role in cancer biology. To contribute to the study of the relation between kinases and disease we compared pathogenic mutations to neutral mutations as an extension to our previous analysis of cancer somatic mutations. First, we analyzed native and mutant proteins in terms of amino acid composition. Secondly, mutations were characterized according to their potential structural effects and finally, we assessed the location of the different classes of polymorphisms with respect to kinase-relevant positions in terms of subfamily specificity, conservation, accessibility and functional sites. Results Pathogenic Protein Kinase mutations perturb essential aspects of protein function, including disruption of substrate binding and/or effector recognition at family-specific positions. Interestingly these mutations in Protein Kinases display a tendency to avoid structurally relevant positions, what represents a significant difference with respect to the average distribution of pathogenic mutations in other protein families. Conclusions Disease-associated mutations display sound differences with respect to neutral mutations: several amino acids are specific of each mutation type, different structural properties characterize each class and the distribution of pathogenic mutations within the consensus structure of the Protein Kinase domain is substantially different to that for non-pathogenic mutations. This preferential distribution confirms previous observations about the functional and structural distribution of the controversial cancer driver and passenger somatic mutations and their use as a proxy for the study of the involvement of somatic mutations in cancer development.

Circadian Disruption Changes Gut Microbiome Taxa and Functional Gene Composition.

Science.gov (United States)

Deaver, Jessica A; Eum, Sung Y; Toborek, Michal

2018-01-01

Disrupted circadian rhythms and alterations of the gut microbiome composition were proposed to affect host health. Therefore, the aim of this research was to identify whether these events are connected and if circadian rhythm disruption by abnormal light-dark (LD) cycles affects microbial community gene expression and host vulnerability to intestinal dysfunction. Mice were subjected to either a 4-week period of constant 24-h light or of normal 12-h LD cycles. Stool samples were collected at the beginning and after the circadian rhythm disruption. A metatranscriptomic analysis revealed an increase in Ruminococcus torques , a bacterial species known to decrease gut barrier integrity, and a decrease in Lactobacillus johnsonii , a bacterium that helps maintain the intestinal epithelial cell layer, after circadian rhythm disruption. In addition, genes involved in pathways promoting host beneficial immune responses were downregulated, while genes involved in the synthesis and transportation of the endotoxin lipopolysaccharide were upregulated in mice with disrupted circadian cycles. Importantly, these mice were also more prone to dysfunction of the intestinal barrier. These results further elucidate the impact of light-cycle disruption on the gut microbiome and its connection with increased incidence of disease in response to circadian rhythm disturbances.

ASSOCIATION OF HFE GENE MUTATION IN THALASSEMIA MAJOR PATIENTS

Directory of Open Access Journals (Sweden)

Amit Kumar Tiwari

2016-11-01

Full Text Available BACKGROUND Thalassemia major patients are dependent on frequent blood transfusion and consequently develop iron overload. HFE gene mutations (C282Y, H63D and S65C in hereditary haemochromatosis has been shown to be associated with iron overload. The study aims at finding the association of HFE gene mutations in β-thalassemia major patients. MATERIALS AND METHODS A descriptive observational pilot study was conducted including fifty diagnosed -thalassemia major cases. DNA analysis by PCR-RFLP method for HFE gene mutations was performed. RESULTS Only H63D mutation (out of three HFE gene mutations was detected in 8 out of 50 cases. Observed frequency of H63D mutation was 16%. While frequency of C282Y and S65C were 0% each. CONCLUSION The frequency of HFE mutation in -thalassemia major is not very common.

CCDC103 mutations cause primary ciliary dyskinesia by disrupting assembly of ciliary dynein arms

Science.gov (United States)

Panizzi, Jennifer R.; Becker-Heck, Anita; Castleman, Victoria H.; Al-Mutairi, Dalal; Liu, Yan; Loges, Niki T.; Pathak, Narendra; Austin-Tse, Christina; Sheridan, Eamonn; Schmidts, Miriam; Olbrich, Heike; Werner, Claudius; Häffner, Karsten; Hellman, Nathan; Chodhari, Rahul; Gupta, Amar; Kramer-Zucker, Albrecht; Olale, Felix; Burdine, Rebecca D.; Schier, Alexander F.; O’Callaghan, Christopher; Chung, Eddie MK; Reinhardt, Richard; Mitchison, Hannah M.; King, Stephen M.; Omran, Heymut; Drummond, Iain A.

2012-01-01

Cilia are essential for fertilization, respiratory clearance, cerebrospinal fluid circulation, and to establish laterality1. Cilia motility defects cause Primary Ciliary Dyskinesia (PCD, MIM 242650), a disorder affecting 1:15-30,000 births. Cilia motility requires the assembly of multisubunit dynein arms that drive cilia bending2. Despite progress in understanding the genetic basis of PCD, mutations remain to be identified for several PCD linked loci3. Here we show that the zebrafish cilia paralysis mutant schmalhanstn222 (smh) mutant encodes the coiled-coil domain containing 103 protein (Ccdc103), a foxj1a regulated gene. Screening 146 unrelated PCD families identified patients in six families with reduced outer dynein arms, carrying mutations in CCDC103. Dynein arm assembly in smh mutant zebrafish was rescued by wild-type but not mutant human CCDC103. Chlamydomonas Ccdc103 functions as a tightly bound, axoneme-associated protein. The results identify Ccdc103 as a novel dynein arm attachment factor that when mutated causes Primary Ciliary Dyskinesia. PMID:22581229

Cas9/sgRNA selective targeting of the P23H Rhodopsin mutant allele for treating retinitis pigmentosa by intravitreal AAV9.PHP.B-based delivery.

Science.gov (United States)

Giannelli, Serena G; Luoni, Mirko; Castoldi, Valerio; Massimino, Luca; Cabassi, Tommaso; Angeloni, Debora; Demontis, Gian Carlo; Leocani, Letizia; Andreazzoli, Massimiliano; Broccoli, Vania

2018-03-01

P23H is the most common mutation in the RHODOPSIN (RHO) gene leading to a dominant form of retinitis pigmentosa (RP), a rod photoreceptor degeneration that invariably causes vision loss. Specific disruption of the disease P23H RHO mutant while preserving the wild-type (WT) functional allele would be an invaluable therapy for this disease. However, various technologies tested in the past failed to achieve effective changes and consequently therapeutic benefits. We validated a CRISPR/Cas9 strategy to specifically inactivate the P23H RHO mutant, while preserving the WT allele in vitro. We, then, translated this approach in vivo by delivering the CRISPR/Cas9 components in murine Rho+/P23H mutant retinae. Targeted retinae presented a high rate of cleavage in the P23H but not WT Rho allele. This gene manipulation was sufficient to slow photoreceptor degeneration and improve retinal functions. To improve the translational potential of our approach, we tested intravitreal delivery of this system by means of adeno-associated viruses (AAVs). To this purpose, the employment of the AAV9-PHP.B resulted the most effective in disrupting the P23H Rho mutant. Finally, this approach was translated successfully in human cells engineered with the homozygous P23H RHO gene mutation. Overall, this is a significant proof-of-concept that gene allele specific targeting by CRISPR/Cas9 technology is specific and efficient and represents an unprecedented tool for treating RP and more broadly dominant genetic human disorders affecting the eye, as well as other tissues.

Heterogeneous nuclear ribonucleoprotein K upregulates the kinetochore complex component NUF2 and promotes the tumorigenicity of colon cancer cells

International Nuclear Information System (INIS)

Sugimasa, Hironobu; Taniue, Kenzui; Kurimoto, Akiko; Takeda, Yasuko; Kawasaki, Yoshihiro; Akiyama, Tetsu

2015-01-01

Heterogeneous nuclear ribonucleoprotein K (hnRNP K) is a multi-functional protein involved in transcription, mRNA splicing, mRNA stabilization and translation. Although hnRNP K has been suggested to play a role in the development of many cancers, its molecular function in colorectal cancer has remained elusive. Here we show that hnRNP K plays an important role in the mitotic process in HCT116 colon cancer cells. Furthermore, we demonstrate that hnRNP K directly transactivates the NUF2 gene, the product of which is a component of the NDC80 kinetochore complex and which is known to be critical for a stable spindle microtubule-kinetochore attachment. In addition, knockdown of both hnRNP K and NUF2 caused failure in metaphase chromosome alignment and drastic decrease in the growth of colon cancer cells. These results suggest that the hnRNP K-NUF2 axis is important for the mitotic process and proliferation of colon cancer cells and that this axis could be a target for the therapy of colon cancer. - Highlights: • hnRNP K is required for the tumorigenicity of colon cancer cells. • hnRNP K binds to the promoter region of NUF2 and activates its transcription. • NUF2 expression is correlated with hnRNP K expression in colorectal cancer tissue. • hnRNP K and NUF2 are required for metaphase chromosome alignment. • The hnRNP K-NUF2 axis is important for the proliferation of colon cancer cells

Heterogeneous nuclear ribonucleoprotein K upregulates the kinetochore complex component NUF2 and promotes the tumorigenicity of colon cancer cells

Energy Technology Data Exchange (ETDEWEB)

Sugimasa, Hironobu; Taniue, Kenzui [Laboratory of Molecular and Genetic Information, Institute of Molecular and Cellular Biosciences, The University of Tokyo, 1-1-1, Yayoi, Bunkyo-ku, Tokyo, 113-0032 (Japan); Kurimoto, Akiko [Laboratory of Molecular and Genetic Information, Institute of Molecular and Cellular Biosciences, The University of Tokyo, 1-1-1, Yayoi, Bunkyo-ku, Tokyo, 113-0032 (Japan); Oncology Research Laboratories, Daiichi Sankyo Co., Ltd, 1-2-58, Hiromachi, Shinagawa-ku, Tokyo, 140-8710 (Japan); Takeda, Yasuko; Kawasaki, Yoshihiro [Laboratory of Molecular and Genetic Information, Institute of Molecular and Cellular Biosciences, The University of Tokyo, 1-1-1, Yayoi, Bunkyo-ku, Tokyo, 113-0032 (Japan); Akiyama, Tetsu, E-mail: akiyama@iam.u-tokyo.ac.jp [Laboratory of Molecular and Genetic Information, Institute of Molecular and Cellular Biosciences, The University of Tokyo, 1-1-1, Yayoi, Bunkyo-ku, Tokyo, 113-0032 (Japan)

2015-03-27

Heterogeneous nuclear ribonucleoprotein K (hnRNP K) is a multi-functional protein involved in transcription, mRNA splicing, mRNA stabilization and translation. Although hnRNP K has been suggested to play a role in the development of many cancers, its molecular function in colorectal cancer has remained elusive. Here we show that hnRNP K plays an important role in the mitotic process in HCT116 colon cancer cells. Furthermore, we demonstrate that hnRNP K directly transactivates the NUF2 gene, the product of which is a component of the NDC80 kinetochore complex and which is known to be critical for a stable spindle microtubule-kinetochore attachment. In addition, knockdown of both hnRNP K and NUF2 caused failure in metaphase chromosome alignment and drastic decrease in the growth of colon cancer cells. These results suggest that the hnRNP K-NUF2 axis is important for the mitotic process and proliferation of colon cancer cells and that this axis could be a target for the therapy of colon cancer. - Highlights: • hnRNP K is required for the tumorigenicity of colon cancer cells. • hnRNP K binds to the promoter region of NUF2 and activates its transcription. • NUF2 expression is correlated with hnRNP K expression in colorectal cancer tissue. • hnRNP K and NUF2 are required for metaphase chromosome alignment. • The hnRNP K-NUF2 axis is important for the proliferation of colon cancer cells.

Single point mutations distributed in 10 soluble and membrane regions of the Nicotiana plumbaginifolia plasma membrane PMA2 H+-ATPase activate the enzyme and modify the structure of the C-terminal region.

Science.gov (United States)

Morsomme, P; Dambly, S; Maudoux, O; Boutry, M

1998-12-25

The Nicotiana plumbaginifolia pma2 (plasma membrane H+-ATPase) gene is capable of functionally replacing the H+-ATPase genes of the yeast Saccharomyces cerevisiae, provided that the external pH is kept above 5.0. Single point mutations within the pma2 gene were previously identified that improved H+-ATPase activity and allowed yeast growth at pH 4.0. The aim of the present study was to identify most of the PMA2 positions, the mutation of which would lead to improved growth and to determine whether all these mutations result in similar enzymatic and structural modifications. We selected additional mutants in total 42 distinct point mutations localized in 30 codons. They were distributed in 10 soluble and membrane regions of the enzyme. Most mutant PMA2 H+-ATPases were characterized by a higher specific activity, lower inhibition by ADP, and lower stimulation by lysophosphatidylcholine than wild-type PMA2. The mutants thus seem to be constitutively activated. Partial tryptic digestion and immunodetection showed that the PMA2 mutants had a conformational change making the C-terminal region more accessible. These data therefore support the hypothesis that point mutations in various H+-ATPase parts displace the inhibitory C-terminal region, resulting in enzyme activation. The high density of mutations within the first half of the C-terminal region suggests that this part is involved in the interaction between the inhibitory C-terminal region and the rest of the enzyme.

Ancient Genes Establish Stress-Induced Mutation as a Hallmark of Cancer

NARCIS (Netherlands)

Cisneros, L; Bussey, K; Orr, A; Miočević, M.; Lineweaver, C; Davies, Paul

2017-01-01

Cancer is sometimes depicted as a reversion to single cell behavior in cells adapted to live in a multicellular assembly. If this is the case, one would expect that mutation in cancer disrupts functional mechanisms that suppress cell-level traits detrimental to multicellularity. Such mechanisms

The phenotype of polycythemia due to Croatian homozygous VHL (571C>G:H191D) mutation is different from that of Chuvash polycythemia (VHL 598C>T:R200W).

Science.gov (United States)

Tomasic, Nikica Ljubas; Piterkova, Lucie; Huff, Chad; Bilic, Ernest; Yoon, Donghoon; Miasnikova, Galina Y; Sergueeva, Adelina I; Niu, Xiaomei; Nekhai, Sergei; Gordeuk, Victor; Prchal, Josef T

2013-04-01

Mutations of VHL (a negative regulator of hypoxia-inducible factors) have position-dependent distinct cancer phenotypes. Only two known inherited homozygous VHL mutations exist and they cause polycythemia: Chuvash R200W and Croatian H191D. We report a second polycythemic Croatian H191D homozygote distantly related to the first propositus. Three generations of both families were genotyped for analysis of shared ancestry. Biochemical and molecular tests were performed to better define their phenotypes, with an emphasis on a comparison with Chuvash polycythemia. The VHL H191D mutation did not segregate in the family defined by the known common ancestors of the two subjects, suggesting a high prevalence in Croatians, but haplotype analysis indicated an undocumented common ancestor ∼six generations ago as the founder of this mutation. We show that erythropoietin levels in homozygous VHL H191D individuals are higher than in VHL R200W patients of similar ages, and their native erythroid progenitors, unlike Chuvash R200W, are not hypersensitive to erythropoietin. This observation contrasts with a report suggesting that polycythemia in VHL R200W and H191D homozygotes is due to the loss of JAK2 regulation from VHL R200W and H191D binding to SOCS1. In conclusion, our studies further define the hematologic phenotype of VHL H191D and provide additional evidence for phenotypic heterogeneity associated with the positional effects of VHL mutations.

Whole-exome sequencing revealed two novel mutations in Usher syndrome.

Science.gov (United States)

Koparir, Asuman; Karatas, Omer Faruk; Atayoglu, Ali Timucin; Yuksel, Bayram; Sagiroglu, Mahmut Samil; Seven, Mehmet; Ulucan, Hakan; Yuksel, Adnan; Ozen, Mustafa

2015-06-01

Usher syndrome is a clinically and genetically heterogeneous autosomal recessive inherited disorder accompanied by hearing loss and retinitis pigmentosa (RP). Since the associated genes are various and quite large, we utilized whole-exome sequencing (WES) as a diagnostic tool to identify the molecular basis of Usher syndrome. DNA from a 12-year-old male diagnosed with Usher syndrome was analyzed by WES. Mutations detected were confirmed by Sanger sequencing. The pathogenicity of these mutations was determined by in silico analysis. A maternally inherited deleterious frameshift mutation, c.14439_14454del in exon 66 and a paternally inherited non-sense c.10830G>A stop-gain SNV in exon 55 of USH2A were found as two novel compound heterozygous mutations. Both of these mutations disrupt the C terminal of USH2A protein. As a result, WES revealed two novel compound heterozygous mutations in a Turkish USH2A patient. This approach gave us an opportunity to have an appropriate diagnosis and provide genetic counseling to the family within a reasonable time. Copyright © 2015 Elsevier B.V. All rights reserved.

Heterogeneous nuclear ribonucleoprotein B1 protein impairs DNA repair mediated through the inhibition of DNA-dependent protein kinase activity

International Nuclear Information System (INIS)

Iwanaga, Kentaro; Sueoka, Naoko; Sato, Akemi; Hayashi, Shinichiro; Sueoka, Eisaburo

2005-01-01

Heterogeneous nuclear ribonucleoprotein B1, an RNA binding protein, is overexpressed from the early stage of lung cancers; it is evident even in bronchial dysplasia, a premalignant lesion. We evaluated the proteins bound with hnRNP B1 and found that hnRNP B1 interacted with DNA-dependent protein kinase (DNA-PK) complex, and recombinant hnRNP B1 protein dose-dependently inhibited DNA-PK activity in vitro. To test the effect of hnRNP B1 on DNA repair, we performed comet assay after irradiation, using normal human bronchial epithelial (HBE) cells treated with siRNA for hnRNP A2/B1: reduction of hnRNP B1 treated with siRNA for hnRNP A2/B1 induced faster DNA repair in normal HBE cells. Considering these results, we assume that overexpression of hnRNP B1 occurring in the early stage of carcinogenesis inhibits DNA-PK activity, resulting in subsequent accumulation of erroneous rejoining of DNA double-strand breaks, causing tumor progression

Lack of association of C282Y and H63D mutations in the hemochromatosis (HFE) gene with diabetes mellitus type 2 in a case-control study of women in Brazil.

Science.gov (United States)

Gomes, K B; Carvalho, M G; Coelho, F F; Rodrigues, I F; Soares, A L; Guimarães, D A; Fernandes, A P

2009-10-27

Hereditary hemochromatosis is one of the most common autosomal recessive diseases; it is characterized by excess absorption of iron. Clinically, the major challenge is to diagnose increased iron deposition before irreversible tissue damage has occurred. C282Y and H63D are the main mutations related to hereditary hemochromatosis; these mutations have been reported to be associated with increased risk of developing diabetes mellitus type 2 (DM2). We investigated whether these mutations are associated with increased risk for the development of DM2 in women in Brazil. Seventy-two women with clinical diagnosis of DM2 under treatment with hypoglycemic agents and a control group composed of 72 women with no clinical history of diabetes were studied. The C282Y and H63D mutations were determined by PCR-RFLP. Significant differences were not observed for C282Y and H63D, when we compared diabetic and non-diabetic women. We suggest that mutations C282Y and H63D in the HFE gene are not significant risk factors for the development of DM2 in Brazilian women.

Matrix metalloproteinase 12 is induced by heterogeneous nuclear ribonucleoprotein K and promotes migration and invasion in nasopharyngeal carcinoma

International Nuclear Information System (INIS)

Chung, I-Che; Li, Hsin-Pai; Chang, Yu-Sun; Chen, Lih-Chyang; Chung, An-Ko; Chao, Mei; Huang, Hsin-Yi; Hsueh, Chuen; Tsang, Ngan-Ming; Chang, Kai-Ping; Liang, Ying

2014-01-01

Overexpression of heterogeneous nuclear ribonucleoprotein K (hnRNP K), a DNA/RNA binding protein, is associated with metastasis in nasopharyngeal carcinoma (NPC). However, the mechanisms underlying hnRNP K-mediated metastasis is unclear. The aim of the present study was to determine the role of matrix metalloproteinase (MMP) in hnRNP K-mediated metastasis in NPC. We studied hnRNP K-regulated MMPs by analyzing the expression profiles of MMP family genes in NPC tissues and hnRNP K-knockdown NPC cells using Affymetrix microarray analysis and quantitative RT-PCR. The association of hnRNP K and MMP12 expression in 82 clinically proven NPC cases was determined by immunohistochemical analysis. The hnRNP K-mediated MMP12 regulation was determined by zymography and Western blot, as well as by promoter, DNA pull-down and chromatin immunoprecipitation (ChIP) assays. The functional role of MMP12 in cell migration and invasion was demonstrated by MMP12-knockdown and the treatment of MMP12-specific inhibitor, PF-356231. MMP12 was overexpressed in NPC tissues, and this high level of expression was significantly correlated with high-level expression of hnRNP K (P = 0.026). The levels of mRNA, protein and enzyme activity of MMP12 were reduced in hnRNP K-knockdown NPC cells. HnRNP K interacting with the region spanning −42 to −33 bp of the transcription start site triggered transcriptional activation of the MMP12 promoter. Furthermore, inhibiting MMP12 by MMP12 knockdown and MMP12-specific inhibitor, PF-356231, significantly reduced the migration and invasion of NPC cells. Overexpression of MMP12 was significantly correlated with hnRNP K in NPC tissues. HnRNP K can induce MMP12 expression and enzyme activity through activating MMP12 promoter, which promotes cell migration and invasion in NPC cells. In vitro experiments suggest that NPC metastasis with high MMP12 expression may be treated with PF-356231. HnRNP K and MMP12 may be potential therapeutic markers for NPC, but

Systematic Analysis of Splice-Site-Creating Mutations in Cancer.

Science.gov (United States)

Jayasinghe, Reyka G; Cao, Song; Gao, Qingsong; Wendl, Michael C; Vo, Nam Sy; Reynolds, Sheila M; Zhao, Yanyan; Climente-González, Héctor; Chai, Shengjie; Wang, Fang; Varghese, Rajees; Huang, Mo; Liang, Wen-Wei; Wyczalkowski, Matthew A; Sengupta, Sohini; Li, Zhi; Payne, Samuel H; Fenyö, David; Miner, Jeffrey H; Walter, Matthew J; Vincent, Benjamin; Eyras, Eduardo; Chen, Ken; Shmulevich, Ilya; Chen, Feng; Ding, Li

2018-04-03

For the past decade, cancer genomic studies have focused on mutations leading to splice-site disruption, overlooking those having splice-creating potential. Here, we applied a bioinformatic tool, MiSplice, for the large-scale discovery of splice-site-creating mutations (SCMs) across 8,656 TCGA tumors. We report 1,964 originally mis-annotated mutations having clear evidence of creating alternative splice junctions. TP53 and GATA3 have 26 and 18 SCMs, respectively, and ATRX has 5 from lower-grade gliomas. Mutations in 11 genes, including PARP1, BRCA1, and BAP1, were experimentally validated for splice-site-creating function. Notably, we found that neoantigens induced by SCMs are likely several folds more immunogenic compared to missense mutations, exemplified by the recurrent GATA3 SCM. Further, high expression of PD-1 and PD-L1 was observed in tumors with SCMs, suggesting candidates for immune blockade therapy. Our work highlights the importance of integrating DNA and RNA data for understanding the functional and the clinical implications of mutations in human diseases. Copyright © 2018 The Authors. Published by Elsevier Inc. All rights reserved.

Contribution of the TP53 R337H mutation to the cancer burden in southern Brazil: Insights from the study of 55 families of children with adrenocortical tumors.

Science.gov (United States)

Mastellaro, Maria J; Seidinger, Ana L; Kang, Guolian; Abrahão, Renata; Miranda, Eliana C M; Pounds, Stanley B; Cardinalli, Izilda A; Aguiar, Simone S; Figueiredo, Bonald C; Rodriguez-Galindo, Carlos; Brandalise, Silvia R; Yunes, José A; Barros-Filho, Antônio de A; Ribeiro, Raul C

2017-08-15

The tumor protein p53 (TP53) arginine-to-histidine mutation at codon 337 (R337H) predisposes children to adrenocortical tumors (ACTs) and, rarely, to other childhood tumors, but its impact on adult cancer remains undetermined. The objective of this study was to investigate the frequency and types of cancer in relatives of children with ACT who carry the TP53 R337H mutation. TP53 R337H testing was offered to relatives of probands with ACT. The parental lineage segregating the R337H mutation was identified in all families. The frequency and distribution of cancer types were compared according to R337H status. The authors' data also were compared with those publicly available for children with TP53 mutations other than R337H. The mean and median follow-up times for the probands with ACT were 11.2 years and 9.7 years (range, 3-32 years), respectively. During this time, cancer was diagnosed in 12 of 81 first-degree relatives (14.8%) carrying the R337H mutation but in only 1 of 94 noncarriers (1.1%; P = .0022). At age 45 years, the cumulative risk of cancer was 21% (95% confidence interval, 5%-33%) in carriers and 2% (95% confidence interval, 0%-4%) in noncarriers (P = .008). The frequency of cancer was higher in the R337H segregating lineages than in the nonsegregating lineages (249 of 1410 vs 66 of 984 individuals; P cancer were the most common types. TP53 R337H carriers have a lifelong predisposition to cancer with a bimodal age distribution: 1 peak, represented by ACT, occurs in the first decade of life, and another peak of diverse cancer types occurs in the fifth decade. The current findings have implications for genetic counseling and surveillance of R337H carriers. Cancer 2017;123:3150-58. © 2017 American Cancer Society. © 2017 American Cancer Society.

Targeted Disruption of V600E-Mutant BRAF Gene by CRISPR-Cpf1

Directory of Open Access Journals (Sweden)

Meijia Yang

2017-09-01

Full Text Available BRAF-V600E (1799T > A is one of the most frequently reported driver mutations in multiple types of cancers, and patients with such mutations could benefit from selectively inactivating the mutant allele. Near this mutation site, there are two TTTN and one NGG protospacer-adjacent motifs (PAMs for Cpf1 and Cas9 CRISPR nucleases, respectively. The 1799T > A substitution also leads to the occurrence of a novel NGNG PAM for the EQR variant of Cas9. We examined the editing efficacy and selectivity of Cpf1, Cas9, and EQR variant to this mutation site. Only Cpf1 demonstrated robust activity to induce specific disruption of only mutant BRAF, not wild-type sequence. Cas9 recognized and cut both normal and mutant alleles, and no obvious gene editing events were observed using EQR variant. Our results support the potential applicability of Cpf1 in precision medicine through highly specific inactivation of many other gain-of-function mutations. Keywords: Cpf1, targeted therapy, BRAF V600E

Expression and localization of heterogeneous nuclear ribonucleoprotein K in mouse ovaries and preimplantation embryos

International Nuclear Information System (INIS)

Zhang, Ping; Wang, Ningling; Lin, Xianhua; Jin, Li; Xu, Hong; Li, Rong; Huang, Hefeng

2016-01-01

Heterogeneous nuclear ribonucleoprotein K (hnRNP K), an evolutionarily conserved protein, is involved in several important cellular processes that are relevant to cell proliferation, differentiation, apoptosis, and cancer development. However, details of hnRNP K expression during mammalian oogenesis and preimplantation embryo development are lacking. The present study investigates the expression and cellular localization of K protein in the mouse ovaries and preimplantation embryos using immunostaining. We demonstrate, for the first time, that hnRNP K is abundantly expressed in the nuclei of mouse oocytes in primordial, primary and secondary follicles. In germ vesicle (GV)-stage oocytes, hnRNP K accumulates in the germinal vesicle in a spot distribution manner. After germinal vesicle breakdown, speckled hnRNP K is diffusely distributed in the cytoplasm. However, after fertilization, the K protein relocates into the female and male pronucleus and persists in the blastomere nuclei. Localization of K protein in the human ovary and ovarian granulosa cell tumor (GCT) was also investigated. Overall, this study provides important morphological evidence to better understand the possible roles of hnRNP K in mammalian oogenesis and early embryo development. - Highlights: • HnRNP K localizes in the nucleus of GV-stage oocyte in a punctate distribution. • HnRNP K strongly accumulates in zygotic pronuclei as condensed spots. • The localization of hnRNP K during oogenesis and embryogenesis is characteristic. • HnRNP K might have an important role in oogenesis and embryonic development.

Expression and localization of heterogeneous nuclear ribonucleoprotein K in mouse ovaries and preimplantation embryos

Energy Technology Data Exchange (ETDEWEB)

Zhang, Ping [The International Peace Maternity and Child Health Hospital, School of Medicine, Shanghai Jiao Tong University, Shanghai (China); Wang, Ningling [Department of Assisted Reproduction, Shanghai Ninth People' s Hospital, School of Medicine, Shanghai Jiao Tong University, Shanghai (China); Lin, Xianhua; Jin, Li [The International Peace Maternity and Child Health Hospital, School of Medicine, Shanghai Jiao Tong University, Shanghai (China); Xu, Hong, E-mail: xuhong1168@126.com [The International Peace Maternity and Child Health Hospital, School of Medicine, Shanghai Jiao Tong University, Shanghai (China); Li, Rong [The International Peace Maternity and Child Health Hospital, School of Medicine, Shanghai Jiao Tong University, Shanghai (China); Huang, Hefeng, E-mail: huanghefg@hotmail.com [The International Peace Maternity and Child Health Hospital, School of Medicine, Shanghai Jiao Tong University, Shanghai (China)

2016-02-26

Heterogeneous nuclear ribonucleoprotein K (hnRNP K), an evolutionarily conserved protein, is involved in several important cellular processes that are relevant to cell proliferation, differentiation, apoptosis, and cancer development. However, details of hnRNP K expression during mammalian oogenesis and preimplantation embryo development are lacking. The present study investigates the expression and cellular localization of K protein in the mouse ovaries and preimplantation embryos using immunostaining. We demonstrate, for the first time, that hnRNP K is abundantly expressed in the nuclei of mouse oocytes in primordial, primary and secondary follicles. In germ vesicle (GV)-stage oocytes, hnRNP K accumulates in the germinal vesicle in a spot distribution manner. After germinal vesicle breakdown, speckled hnRNP K is diffusely distributed in the cytoplasm. However, after fertilization, the K protein relocates into the female and male pronucleus and persists in the blastomere nuclei. Localization of K protein in the human ovary and ovarian granulosa cell tumor (GCT) was also investigated. Overall, this study provides important morphological evidence to better understand the possible roles of hnRNP K in mammalian oogenesis and early embryo development. - Highlights: • HnRNP K localizes in the nucleus of GV-stage oocyte in a punctate distribution. • HnRNP K strongly accumulates in zygotic pronuclei as condensed spots. • The localization of hnRNP K during oogenesis and embryogenesis is characteristic. • HnRNP K might have an important role in oogenesis and embryonic development.

A positive feedback loop links opposing functions of P-TEFb/Cdk9 and histone H2B ubiquitylation to regulate transcript elongation in fission yeast.

Directory of Open Access Journals (Sweden)

Miriam Sansó

Full Text Available Transcript elongation by RNA polymerase II (RNAPII is accompanied by conserved patterns of histone modification. Whereas histone modifications have established roles in transcription initiation, their functions during elongation are not understood. Mono-ubiquitylation of histone H2B (H2Bub1 plays a key role in coordinating co-transcriptional histone modification by promoting site-specific methylation of histone H3. H2Bub1 also regulates gene expression through an unidentified, methylation-independent mechanism. Here we reveal bidirectional communication between H2Bub1 and Cdk9, the ortholog of metazoan positive transcription elongation factor b (P-TEFb, in the fission yeast Schizosaccharomyces pombe. Chemical and classical genetic analyses indicate that lowering Cdk9 activity or preventing phosphorylation of its substrate, the transcription processivity factor Spt5, reduces H2Bub1 in vivo. Conversely, mutations in the H2Bub1 pathway impair Cdk9 recruitment to chromatin and decrease Spt5 phosphorylation. Moreover, an Spt5 phosphorylation-site mutation, combined with deletion of the histone H3 Lys4 methyltransferase Set1, phenocopies morphologic and growth defects due to H2Bub1 loss, suggesting independent, partially redundant roles for Cdk9 and Set1 downstream of H2Bub1. Surprisingly, mutation of the histone H2B ubiquitin-acceptor residue relaxes the Cdk9 activity requirement in vivo, and cdk9 mutations suppress cell-morphology defects in H2Bub1-deficient strains. Genome-wide analyses by chromatin immunoprecipitation also demonstrate opposing effects of Cdk9 and H2Bub1 on distribution of transcribing RNAPII. Therefore, whereas mutual dependence of H2Bub1 and Spt5 phosphorylation indicates positive feedback, mutual suppression by cdk9 and H2Bub1-pathway mutations suggests antagonistic functions that must be kept in balance to regulate elongation. Loss of H2Bub1 disrupts that balance and leads to deranged gene expression and aberrant cell

Heterogeneous Pulmonary Phenotypes Associated With Mutations in the Thyroid Transcription Factor Gene NKX2-1

Science.gov (United States)

Deterding, Robin R.; Wert, Susan E.; White, Frances V.; Dishop, Megan K.; Alfano, Danielle N.; Halbower, Ann C.; Planer, Benjamin; Stephan, Mark J.; Uchida, Derek A.; Williames, Lee D.; Rosenfeld, Jill A.; Lebel, Robert Roger; Young, Lisa R.; Cole, F. Sessions; Nogee, Lawrence M.

2013-01-01

Background: Mutations in the gene encoding thyroid transcription factor, NKX2-1, result in neurologic abnormalities, hypothyroidism, and neonatal respiratory distress syndrome (RDS) that together are known as the brain-thyroid-lung syndrome. To characterize the spectrum of associated pulmonary phenotypes, we identified individuals with mutations in NKX2-1 whose primary manifestation was respiratory disease. Methods: Retrospective and prospective approaches identified infants and children with unexplained diffuse lung disease for NKX2-1 sequencing. Histopathologic results and electron micrographs were assessed, and immunohistochemical analysis for surfactant-associated proteins was performed in a subset of 10 children for whom lung tissue was available. Results: We identified 16 individuals with heterozygous missense, nonsense, and frameshift mutations and five individuals with heterozygous, whole-gene deletions of NKX2-1. Neonatal RDS was the presenting pulmonary phenotype in 16 individuals (76%), interstitial lung disease in four (19%), and pulmonary fibrosis in one adult family member. Altogether, 12 individuals (57%) had the full triad of neurologic, thyroid, and respiratory manifestations, but five (24%) had only pulmonary symptoms at the time of presentation. Recurrent respiratory infections were a prominent feature in nine subjects. Lung histopathology demonstrated evidence of disrupted surfactant homeostasis in the majority of cases, and at least five cases had evidence of disrupted lung growth. Conclusions: Patients with mutations in NKX2-1 may present with pulmonary manifestations in the newborn period or during childhood when thyroid or neurologic abnormalities are not apparent. Surfactant dysfunction and, in more severe cases, disrupted lung development are likely mechanisms for the respiratory disease. PMID:23430038

The hepcidin gene promoter nc.-1010C > T; -582A > G haplotype modulates serum ferritin in individuals carrying the common H63D mutation in HFE gene.

Science.gov (United States)

Silva, Bruno; Pita, Lina; Gomes, Susana; Gonçalves, João; Faustino, Paula

2014-12-01

Hereditary hemochromatosis is an autosomal recessive disorder characterized by severe iron overload. It is usually associated with homozygosity for the HFE gene mutation c.845G > A; p.C282Y. However, in some cases, another HFE mutation (c.187C > G; p.H63D) seems to be associated with the disease. Its penetrance is very low, suggesting the possibility of other iron genetic modulators being involved. In this work, we have screened for HAMP promoter polymorphisms in 409 individuals presenting normal or increased serum ferritin levels together with normal or H63D-mutated HFE genotypes. Our results show that the hepcidin gene promoter TG haplotype, originated by linkage of the nc.-1010C > T and nc.-582A > G polymorphisms, is more frequent in the HFE_H63D individuals presenting serum ferritin levels higher than 300 μg/L than in those presenting the HFE_H63D mutation but with normal serum ferritin levels or in the normal control group.Moreover, it was observed that the TG haplotype was associated to increased serum ferritin levels in the overall pool of HFE_H63D individuals. Thus, our data suggest that screening for these polymorphisms could be of interest in order to explain the phenotype. However, this genetic condition seems to have no clinical significance.

Systematic Analysis of Splice-Site-Creating Mutations in Cancer

Directory of Open Access Journals (Sweden)

Reyka G. Jayasinghe

2018-04-01

Full Text Available Summary: For the past decade, cancer genomic studies have focused on mutations leading to splice-site disruption, overlooking those having splice-creating potential. Here, we applied a bioinformatic tool, MiSplice, for the large-scale discovery of splice-site-creating mutations (SCMs across 8,656 TCGA tumors. We report 1,964 originally mis-annotated mutations having clear evidence of creating alternative splice junctions. TP53 and GATA3 have 26 and 18 SCMs, respectively, and ATRX has 5 from lower-grade gliomas. Mutations in 11 genes, including PARP1, BRCA1, and BAP1, were experimentally validated for splice-site-creating function. Notably, we found that neoantigens induced by SCMs are likely several folds more immunogenic compared to missense mutations, exemplified by the recurrent GATA3 SCM. Further, high expression of PD-1 and PD-L1 was observed in tumors with SCMs, suggesting candidates for immune blockade therapy. Our work highlights the importance of integrating DNA and RNA data for understanding the functional and the clinical implications of mutations in human diseases. : Jayasinghe et al. identify nearly 2,000 splice-site-creating mutations (SCMs from over 8,000 tumor samples across 33 cancer types. They provide a more accurate interpretation of previously mis-annotated mutations, highlighting the importance of integrating data types to understand the functional and the clinical implications of splicing mutations in human disease. Keywords: splicing, RNA, mutations of clinical relevance

Protein Kinase C-{delta} mediates down-regulation of heterogeneous nuclear ribonucleoprotein K protein: involvement in apoptosis induction

Energy Technology Data Exchange (ETDEWEB)

Gao, Feng-Hou [NO.3 People' s Hospital affiliated to Shanghai Jiao-Tong University School of Medicine (SJTU-SM), Shanghai 201900 (China); The Department of Pathophysiology, Key Laboratory of Cell Differentiation and Apoptosis of National Ministry of Education, Shanghai Jiao-Tong University School of Medicine (SJTU-SM), Shanghai 200025 (China); Wu, Ying-Li [The Department of Pathophysiology, Key Laboratory of Cell Differentiation and Apoptosis of National Ministry of Education, Shanghai Jiao-Tong University School of Medicine (SJTU-SM), Shanghai 200025 (China); Zhao, Meng [Institute of Health Science, SJTU-SM/Shanghai Institutes for Biological Science, Chinese Academy of Sciences, Shanghai (China); Liu, Chuan-Xu; Wang, Li-Shun [The Department of Pathophysiology, Key Laboratory of Cell Differentiation and Apoptosis of National Ministry of Education, Shanghai Jiao-Tong University School of Medicine (SJTU-SM), Shanghai 200025 (China); Chen, Guo-Qiang, E-mail: chengq@shsmu.edu.cn [The Department of Pathophysiology, Key Laboratory of Cell Differentiation and Apoptosis of National Ministry of Education, Shanghai Jiao-Tong University School of Medicine (SJTU-SM), Shanghai 200025 (China); Institute of Health Science, SJTU-SM/Shanghai Institutes for Biological Science, Chinese Academy of Sciences, Shanghai (China)

2009-11-15

We reported previously that NSC606985, a camptothecin analogue, induces apoptosis of acute myeloid leukemia (AML) cells through proteolytic activation of protein kinase C delta ({Delta}PKC-{delta}). By subcellular proteome analysis, heterogeneous nuclear ribonucleoprotein K (hnRNP K) was identified as being significantly down-regulated in NSC606985-treated leukemic NB4 cells. HnRNP K, a docking protein for DNA, RNA, and transcriptional or translational molecules, is implicated in a host of processes involving the regulation of gene expression. However, the molecular mechanisms of hnRNP K reduction and its roles during apoptosis are still not understood. In the present study, we found that, following the appearance of the {Delta}PKC-{delta}, hnRNP K protein was significantly down-regulated in NSC606985, doxorubicin, arsenic trioxide and ultraviolet-induced apoptosis. We further provided evidence that {Delta}PKC-{delta} mediated the down-regulation of hnRNP K protein during apoptosis: PKC-{delta} inhibitor could rescue the reduction of hnRNP K; hnRNP K failed to be decreased in PKC-{delta}-deficient apoptotic KG1a cells; conditional induction of {Delta}PKC-{delta} in U937T cells directly down-regulated hnRNP K protein. Moreover, the proteasome inhibitor also inhibited the down-regulation of hnRNP K protein by apoptosis inducer and the conditional expression of {Delta}PKC-{delta}. More intriguingly, the suppression of hnRNP K with siRNA transfection significantly induced apoptosis. To our knowledge, this is the first demonstration that proteolytically activated PKC-{delta} down-regulates hnRNP K protein in a proteasome-dependent manner, which plays an important role in apoptosis induction.

PPIB mutations cause severe osteogenesis imperfecta.

Science.gov (United States)

van Dijk, Fleur S; Nesbitt, Isabel M; Zwikstra, Eline H; Nikkels, Peter G J; Piersma, Sander R; Fratantoni, Silvina A; Jimenez, Connie R; Huizer, Margriet; Morsman, Alice C; Cobben, Jan M; van Roij, Mirjam H H; Elting, Mariet W; Verbeke, Jonathan I M L; Wijnaendts, Liliane C D; Shaw, Nick J; Högler, Wolfgang; McKeown, Carole; Sistermans, Erik A; Dalton, Ann; Meijers-Heijboer, Hanne; Pals, Gerard

2009-10-01

Deficiency of cartilage-associated protein (CRTAP) or prolyl 3-hydroxylase 1(P3H1) has been reported in autosomal-recessive lethal or severe osteogenesis imperfecta (OI). CRTAP, P3H1, and cyclophilin B (CyPB) form an intracellular collagen-modifying complex that 3-hydroxylates proline at position 986 (P986) in the alpha1 chains of collagen type I. This 3-prolyl hydroxylation is decreased in patients with CRTAP and P3H1 deficiency. It was suspected that mutations in the PPIB gene encoding CyPB would also cause OI with decreased collagen 3-prolyl hydroxylation. To our knowledge we present the first two families with recessive OI caused by PPIB gene mutations. The clinical phenotype is compatible with OI Sillence type II-B/III as seen with COL1A1/2, CRTAP, and LEPRE1 mutations. The percentage of 3-hydroxylated P986 residues in patients with PPIB mutations is decreased in comparison to normal, but it is higher than in patients with CRTAP and LEPRE1 mutations. This result and the fact that CyPB is demonstrable independent of CRTAP and P3H1, along with reported decreased 3-prolyl hydroxylation due to deficiency of CRTAP lacking the catalytic hydroxylation domain and the known function of CyPB as a cis-trans isomerase, suggest that recessive OI is caused by a dysfunctional P3H1/CRTAP/CyPB complex rather than by the lack of 3-prolyl hydroxylation of a single proline residue in the alpha1 chains of collagen type I.

Integrated data analysis reveals potential drivers and pathways disrupted by DNA methylation in papillary thyroid carcinomas

DEFF Research Database (Denmark)

Beltrami, Caroline Moraes; Dos Reis, Mariana Bisarro; Barros-Filho, Mateus Camargo

2017-01-01

and positive correlation, respectively. Genes showing negative correlation underlined FGF and retinoic acid signaling as critical canonical pathways disrupted by DNA methylation in PTC. BRAF mutation was detected in 68% (28 of 41) of the tumors, which presented a higher level of demethylation (95...

Disruption avoidance by means of electron cyclotron waves

International Nuclear Information System (INIS)

Esposito, B; Granucci, G; Nowak, S; Lazzaro, E; Maraschek, M; Giannone, L; Gude, A; Igochine, V; McDermott, R; Poli, E; Reich, M; Sommer, F; Stober, J; Suttrop, W; Treutterer, W; Zohm, H

2011-01-01

Disruptions are very challenging to ITER operation as they may cause damage to plasma facing components due to direct plasma heating, forces on structural components due to halo and eddy currents and the production of runaway electrons. Electron cyclotron (EC) waves have been demonstrated as a tool for disruption avoidance by a large set of recent experiments performed in ASDEX Upgrade and FTU using various disruption types, plasma operating scenarios and power deposition locations. The technique is based on the stabilization of magnetohydrodynamic (MHD) modes (mainly m/n = 2/1) through the localized injection of EC power on the resonant surface. This paper presents new results obtained in ASDEX Upgrade regarding stable operation above the Greenwald density achieved after avoidance of density limit disruptions by means of ECRH and suitable density feedback control (L-mode ohmic plasmas, I p = 0.6 MA, B t = 2.5 T) and NTM-driven disruptions at high-β limit delayed/avoided by means of both co-current drive (co-ECCD) and pure heating (ECRH) with power ≤1.7 MW (H-mode NBI-heated plasmas, P NBI ∼ 7.5 MW, I p = 1 MA, B t = 2.1 T, q 95 ∼ 3.6). The localized perpendicular injection of ECRH/ECCD onto a resonant surface leads to the delay and/or complete avoidance of disruptions. The experiments indicate the existence of a power threshold for mode stabilization to occur. An analysis of the MHD mode evolution using the generalized Rutherford equation coupled to the frequency and phase evolution equations shows that control of the modes is due to EC heating close to the resonant surface. The ECRH contribution (Δ' H term) is larger than the co-ECCD one in the initial and more important phase when the discharge is 'saved'. Future research and developments of the disruption avoidance technique are also discussed.

Disruption of endocytic trafficking in frontotemporal dementia with CHMP2B mutations

DEFF Research Database (Denmark)

Urwin, Hazel; Authier, Astrid; Nielsen, Jørgen Erik

2010-01-01

Mutations in CHMP2B cause frontotemporal dementia (FTD) in a large Danish pedigree, which is termed FTD linked to chromosome 3 (FTD-3), and also in an unrelated familial FTD patient. CHMP2B is a component of the ESCRT-III complex, which is required for function of the multivesicular body (MVB), a...

Alteration of the Regiospecificity of Human Heme Oxygenase-1 by Unseating of the Heme but not Disruption of the Distal Hydrogen Bonding Network†

Science.gov (United States)

Wang, Jinling; Evans, John P.; Ogura, Hiroshi; La Mar, Gerd N.; Ortiz de Montellano, Paul R.

2008-01-01

Heme oxygenase regiospecifically oxidizes heme at the α-meso position to give biliverdin IXα, CO, and iron. The heme orientation within the active site, which is thought to determine the oxidation regiospecificity, is shown here for the human enzyme (hHO1) to be largely determined by interactions between the heme carboxylic acid groups and residues Arg183 and Lys18 but not Tyr134. Mutation of either Arg183 or Lys18 individually does not significantly alter the NADPH-cytochrome P450 reductase-dependent reaction regiochemistry, but partially shifts the oxidation to the β/δ-meso positions in the reaction supported by ascorbic acid. Mutation of Glu29 to a lysine, which places a positive charge where it can interact with a heme carboxyl if the heme rotates by ~90°, causes a slight loss of regiospecificity, but combined with the R183E and K18E mutations results primarily in β/δ-meso oxidation of the heme under all conditions. NMR analysis of heme binding to the triple K18E/E29K/R183E mutant confirms rotation of the heme in the active site. Kinetic studies demonstrate that mutations of Arg183 greatly impair the rate of the P450 reductase-dependent reaction, in accord with the earlier finding that Arg183 is involved in binding of the reductase to hHO1, but have little effect on the ascorbate reaction. Mutations of Asp140 and Tyr58 that disrupt the active site hydrogen bonding network, impair catalytic rates but do not influence the oxidation regiochemistry. The results indicate both that the oxidation regiochemistry is largely controlled by ionic interactions of the heme propionic acid groups with the protein and that shifts in regiospecificity involve rotation of the heme about an axis perpendicular to the heme plane. PMID:16388581

FOXP2 promotes the nuclear translocation of POT1, but FOXP2(R553H), mutation related to speech-language disorder, partially prevents it

Energy Technology Data Exchange (ETDEWEB)

Tanabe, Yuko [Division of Development and Differentiation, National Institute of Neuroscience, NCNP, 4-1-1 Ogawahigasi, Kodaira 187-8511 (Japan); Fujita, Eriko [Division of Development and Differentiation, National Institute of Neuroscience, NCNP, 4-1-1 Ogawahigasi, Kodaira 187-8511 (Japan); Department of Pediatrics, Jichi Medical University, 3311-1 Yakushiji, Shimotsuke, Tochigi 329-0498 (Japan); Momoi, Takashi, E-mail: momoi@iuhw.ac.jp [Division of Development and Differentiation, National Institute of Neuroscience, NCNP, 4-1-1 Ogawahigasi, Kodaira 187-8511 (Japan); Center for Medical Science, International University of Health and Welfare, 2600-1 Kitakanamaru, Otawara, Tochigi 324-8501 (Japan)

2011-07-08

Highlights: {yields} We isolated protection of telomeres 1 (POT1) as a FOXP2-associated protein by a yeast two-hybrid. {yields} FOXP2 associated and co-localized with POT1 in the nuclei. {yields} FOXP2(R553H) also co-localized with POT1 in both the cytoplasm and nuclei. {yields} FOXP2(R553H) partially prevented the nuclear translocation of POT1. {yields} FOXP2(R553H) mutation may be associated with the pathogenesis of speech-language disorder. -- Abstract: FOXP2 is a forkhead box-containing transcription factor with several recognizable sequence motifs. However, little is known about the FOXP2-associated proteins except for C-terminal binding protein (CtBP). In the present study, we attempted to isolate the FOXP2-associated protein with a yeast two-hybrid system using the C-terminal region, including the forkhead domain, as a bait probe, and identified protection of telomeres 1 (POT1) as a FOXP2-associated protein. Immunoprecipitation assay confirmed the association with FOXP2 and POT1. POT1 alone localized in the cytoplasm but co-localized with FOXP2 and the forkhead domain of FOXP2 in nuclei. However, both FOXP2 with mutated nuclear localization signals and (R553H) mutated forkhead, which is associated with speech-language disorder, prevented the nuclear translocation of POT1. These results suggest that FOXP2 is a binding partner for the nuclear translocation of POT1. As loss of POT1 function induces the cell arrest, the impaired nuclear translocation of POT1 in the developing neuronal cells may be associated with the pathogenesis of speech-language disorder with FOXP2(R553H) mutation.

FOXP2 promotes the nuclear translocation of POT1, but FOXP2(R553H), mutation related to speech-language disorder, partially prevents it

International Nuclear Information System (INIS)

Tanabe, Yuko; Fujita, Eriko; Momoi, Takashi

2011-01-01

Highlights: → We isolated protection of telomeres 1 (POT1) as a FOXP2-associated protein by a yeast two-hybrid. → FOXP2 associated and co-localized with POT1 in the nuclei. → FOXP2(R553H) also co-localized with POT1 in both the cytoplasm and nuclei. → FOXP2(R553H) partially prevented the nuclear translocation of POT1. → FOXP2(R553H) mutation may be associated with the pathogenesis of speech-language disorder. -- Abstract: FOXP2 is a forkhead box-containing transcription factor with several recognizable sequence motifs. However, little is known about the FOXP2-associated proteins except for C-terminal binding protein (CtBP). In the present study, we attempted to isolate the FOXP2-associated protein with a yeast two-hybrid system using the C-terminal region, including the forkhead domain, as a bait probe, and identified protection of telomeres 1 (POT1) as a FOXP2-associated protein. Immunoprecipitation assay confirmed the association with FOXP2 and POT1. POT1 alone localized in the cytoplasm but co-localized with FOXP2 and the forkhead domain of FOXP2 in nuclei. However, both FOXP2 with mutated nuclear localization signals and (R553H) mutated forkhead, which is associated with speech-language disorder, prevented the nuclear translocation of POT1. These results suggest that FOXP2 is a binding partner for the nuclear translocation of POT1. As loss of POT1 function induces the cell arrest, the impaired nuclear translocation of POT1 in the developing neuronal cells may be associated with the pathogenesis of speech-language disorder with FOXP2(R553H) mutation.

The albinism of the feral Asinara white donkeys (Equus asinus) is determined by a missense mutation in a highly conserved position of the tyrosinase (TYR) gene deduced protein.

Science.gov (United States)

Utzeri, V J; Bertolini, F; Ribani, A; Schiavo, G; Dall'Olio, S; Fontanesi, L

2016-02-01

A feral donkey population (Equus asinus), living in the Asinara National Park (an island north-west of Sardinia, Italy), includes a unique white albino donkey subpopulation or colour morph that is a major attraction of this park. Disrupting mutations in the tyrosinase (TYR) gene are known to cause recessive albinisms in humans (oculocutaneous albinism Type 1; OCA1) and other species. In this study, we analysed the donkey TYR gene as a strong candidate to identify the causative mutation of the albinism of these donkeys. The TYR gene was sequenced from 13 donkeys (seven Asinara white albino and six coloured animals). Seven single nucleotide polymorphisms were identified. A missense mutation (c.604C>G; p.His202Asp) in a highly conserved amino acid position (even across kingdoms), which disrupts the first copper-binding site (CuA) of functional protein, was identified in the homozygous condition (G/G or D/D) in all Asinara white albino donkeys and in the albino son of a trio (the grey parents had genotype C/G or H/D), supporting the recessive mode of inheritance of this mutation. Genotyping 82 donkeys confirmed that Asinara albino donkeys had genotype G/G whereas all other coloured donkeys had genotype C/C or C/G. Across-population association between the c.604C>G genotypes and the albino coat colour was highly significant (P = 6.17E-18). The identification of the causative mutation of the albinism in the Asinara white donkeys might open new perspectives to study the dynamics of this putative deleterious allele in a feral population and to manage this interesting animal genetic resource. © 2015 Stichting International Foundation for Animal Genetics.

Direct bacterial killing in vitro by recombinant Nod2 is compromised by Crohn's disease-associated mutations.

Directory of Open Access Journals (Sweden)

Laurent-Herve Perez

2010-06-01

Full Text Available A homeostatic relationship with the intestinal microflora is increasingly appreciated as essential for human health and wellbeing. Mutations in the leucine-rich repeat (LRR domain of Nod2, a bacterial recognition protein, are associated with development of the inflammatory bowel disorder, Crohn's disease. We investigated the molecular mechanisms underlying disruption of intestinal symbiosis in patients carrying Nod2 mutations.In this study, using purified recombinant LRR domains, we demonstrate that Nod2 is a direct antimicrobial agent and this activity is generally deficient in proteins carrying Crohn's-associated mutations. Wild-type, but not Crohn's-associated, Nod2 LRR domains directly interacted with bacteria in vitro, altered their metabolism and disrupted the integrity of the plasma membrane. Antibiotic activity was also expressed by the LRR domains of Nod1 and other pattern recognition receptors suggesting that the LRR domain is a conserved anti-microbial motif supporting innate cellular immunity.The lack of anti-bacterial activity demonstrated with Crohn's-associated Nod2 mutations in vitro, supports the hypothesis that a deficiency in direct bacterial killing contributes to the association of Nod2 polymorphisms with the disease.

Effects of sleep disruption and high fat intake on glucose metabolism in mice.

Science.gov (United States)

Ho, Jacqueline M; Barf, R Paulien; Opp, Mark R

2016-06-01

Poor sleep quality or quantity impairs glycemic control and increases risk of disease under chronic conditions. Recovery sleep may offset adverse metabolic outcomes of accumulated sleep debt, but the extent to which this occurs is unclear. We examined whether recovery sleep improves glucose metabolism in mice subjected to prolonged sleep disruption, and whether high fat intake during sleep disruption exacerbates glycemic control. Adult male C57BL/6J mice were subjected to 18-h sleep fragmentation daily for 9 days, followed by 1 day of recovery. During sleep disruption, one group of mice was fed a high-fat diet (HFD) while another group was fed standard laboratory chow. Insulin sensitivity and glucose tolerance were assessed by insulin and glucose tolerance testing at baseline, after 3 and 7 days of sleep disruption, and at the end of the protocol after 24h of undisturbed sleep opportunity (recovery). To characterize changes in sleep architecture that are associated with sleep debt and recovery, we quantified electroencephalogram (EEG) recordings during sleep fragmentation and recovery periods from an additional group of mice. We now report that 9 days of 18-h daily sleep fragmentation significantly reduces rapid eye movement sleep (REMS) and non-rapid eye movement sleep (NREMS). Mice respond with increases in REMS, but not NREMS, during the daily 6-h undisturbed sleep opportunity. However, both REMS and NREMS increase significantly during the 24-h recovery period. Although sleep disruption alone has no effect in this protocol, high fat feeding in combination with sleep disruption impairs glucose tolerance, effects that are reversed by recovery sleep. Insulin sensitivity modestly improves after 3 days of sleep fragmentation and after 24h of recovery, with significantly greater improvements in mice exposed to HFD during sleep disruption. Improvements in both glucose tolerance and insulin sensitivity are associated with NREMS rebound, raising the possibility that this

Reassortment and mutations associated with emergence and spread of oseltamivir-resistant seasonal influenza A/H1N1 viruses in 2005-2009.

Directory of Open Access Journals (Sweden)

Ji-Rong Yang

Full Text Available A dramatic increase in the frequency of the H275Y mutation in the neuraminidase (NA, conferring resistance to oseltamivir, has been detected in human seasonal influenza A/H1N1 viruses since the influenza season of 2007-2008. The resistant viruses emerged in the ratio of 14.3% and quickly reached 100% in Taiwan from September to December 2008. To explore the mechanisms responsible for emergence and spread of the resistant viruses, we analyzed the complete genome sequences of 25 viruses collected during 2005-2009 in Taiwan, which were chosen from various clade viruses, 1, 2A, 2B-1, 2B-2, 2C-1 and 2C-2 by the classification of hemagglutinin (HA sequences. Our data revealed that the dominant variant, clade 2B-1, in the 2007-2008 influenza emerged through an intra-subtype 4+4 reassortment between clade 1 and 2 viruses. The dominant variant acquired additional substitutions, including A206T in HA, H275Y and D354G in NA, L30R and H41P in PB1-F2, and V411I and P453S in basic polymerase 2 (PB2 proteins and subsequently caused the 2008-2009 influenza epidemic in Taiwan, accompanying the widespread oseltamivir-resistant viruses. We also characterized another 3+5 reassortant virus which became double resistant to oseltamivir and amantadine. Comparison of oseltamivir-resistant influenza A/H1N1 viruses belonging to various clades in our study highlighted that both reassortment and mutations were associated with emergence and spread of these viruses and the specific mutation, H275Y, conferring to antiviral resistance, was acquired in a hitch-hiking mechanism during the viral evolutionary processes.

Depletion of a Drosophila homolog of yeast Sup35p disrupts spindle assembly, chromosome segregation, and cytokinesis during male meiosis.

Science.gov (United States)

Basu, J; Williams, B C; Li, Z; Williams, E V; Goldberg, M L

1998-01-01

In the course of a genetic screen for male-sterile mutations in Drosophila affecting chromosome segregation during the meiotic divisions in spermatocytes, we identified the mutation dsup35(63D). Examination of mutant testes showed that chromosome misbehavior was a consequence of major disruptions in meiotic spindle assembly. These perturbations included problems in aster formation, separation, and migration around the nuclear envelope; aberrations in spindle organization and integrity; and disappearance of the ana/telophase central spindle, which in turn disrupts cytokinesis. The dsup35(63D) mutation is caused by a P element insertion that affects, specifically in the testis, the expression of a gene (dsup35) encoding the Drosophila homolog of the yeast Sup35p and Xenopus eRF3 proteins. These proteins are involved in the termination of polypeptide synthesis on ribosomes, but previous studies have suggested that Sup35p and closely related proteins of the same family also interact directly with microtubules. An affinity-purified antibody directed against the product of the dsup35 gene was prepared; interestingly, this antibody specifically labels primary spermatocytes in one or two discrete foci of unknown structure within the nucleoplasm. We discuss how depletion of the dsup35 gene product in spermatocytes might lead to the global disruptions in meiotic spindle assembly seen in mutant spermatocytes.

Germline Mutations of Inhibins in Early-Onset Ovarian Epithelial Tumors

Science.gov (United States)

Tournier, Isabelle; Marlin, Régine; Walton, Kelly; Charbonnier, Françoise; Coutant, Sophie; Théry, Jean-Christophe; Charbonnier, Camille; Spurrell, Cailyn; Vezain, Myriam; Ippolito, Lorena; Bougeard, Gaëlle; Roman, Horace; Tinat, Julie; Sabourin, Jean-Christophe; Stoppa-Lyonnet, Dominique; Caron, Olivier; Bressac-de Paillerets, Brigitte; Vaur, Dominique; King, Mary-Claire; Harrison, Craig; Frebourg, Thierry

2014-01-01

To identify novel genetic bases of early-onset epithelial ovarian tumors, we used the trio exome sequencing strategy in a patient without familial history of cancer who presented metastatic serous ovarian adenocarcinomas at 21 years of age. We identified a single de novo mutation (c.1157A>G/p.Asn386Ser) within the INHBA gene encoding the βA-subunit of inhibins/activins, which play a key role in ovarian development. In vitro, this mutation alters the ratio of secreted activins and inhibins. In a second patient with early-onset serous borderline papillary cystadenoma, we identified an unreported germline mutation (c.179G>T/p.Arg60Leu) of the INHA gene encoding the α-subunit, the partner of the βA-subunit. This mutation also alters the secreted activin/inhibin ratio, by disrupting both inhibin A and inhibin B biosynthesis. In a cohort of 62 cases, we detected an additional unreported germline mutation of the INHBA gene (c.839G>A/p.Gly280Glu). Our results strongly suggest that inhibin mutations contribute to the genetic determinism of epithelial ovarian tumors. PMID:24302632

FAM83H and casein kinase I regulate the organization of the keratin cytoskeleton and formation of desmosomes.

Science.gov (United States)

Kuga, Takahisa; Sasaki, Mitsuho; Mikami, Toshinari; Miake, Yasuo; Adachi, Jun; Shimizu, Maiko; Saito, Youhei; Koura, Minako; Takeda, Yasunori; Matsuda, Junichiro; Tomonaga, Takeshi; Nakayama, Yuji

2016-05-25

FAM83H is essential for the formation of dental enamel because a mutation in the FAM83H gene causes amelogenesis imperfecta (AI). We previously reported that the overexpression of FAM83H often occurs and disorganizes the keratin cytoskeleton in colorectal cancer cells. We herein show that FAM83H regulates the organization of the keratin cytoskeleton and maintains the formation of desmosomes in ameloblastoma cells. FAM83H is expressed and localized on keratin filaments in human ameloblastoma cell lines and in mouse ameloblasts and epidermal germinative cells in vivo. FAM83H shows preferential localization to keratin filaments around the nucleus that often extend to cell-cell junctions. Alterations in the function of FAM83H by its overexpression, knockdown, or an AI-causing truncated mutant prevent the proper organization of the keratin cytoskeleton in ameloblastoma cells. Furthermore, the AI-causing mutant prevents desmosomal proteins from being localized to cell-cell junctions. The effects of the AI-causing mutant depend on its binding to and possible inhibition of casein kinase I (CK-1). The suppression of CK-1 by its inhibitor, D4476, disorganizes the keratin cytoskeleton. Our results suggest that AI caused by the FAM83H mutation is mediated by the disorganization of the keratin cytoskeleton and subsequent disruption of desmosomes in ameloblasts.

Physiological Levels of Pik3ca H1047R Mutation in the Mouse Mammary Gland Results in Ductal Hyperplasia and Formation of ERα-Positive Tumors

Science.gov (United States)

Tikoo, Anjali; Roh, Vincent; Montgomery, Karen G.; Ivetac, Ivan; Waring, Paul; Pelzer, Rebecca; Hare, Lauren; Shackleton, Mark; Humbert, Patrick; Phillips, Wayne A.

2012-01-01

PIK3CA, the gene coding for the p110α subunit of phosphoinositide 3-kinase, is frequently mutated in a variety of human tumors including breast cancers. To better understand the role of mutant PIK3CA in the initiation and/or progression of breast cancer, we have generated mice with a conditional knock-in of the common activating mutation, Pik3caH1047R, into one allele of the endogenous gene in the mammary gland. These mice developed a ductal anaplasia and hyperplasia by 6 weeks of age characterized by multi-layering of the epithelial lining of the mammary ducts and expansion of the luminal progenitor (Lin−; CD29lo; CD24+; CD61+) cell population. The Pik3caH1047R expressing mice eventually develop mammary tumors with 100% penetrance but with a long latency (>12 months). This is significantly longer than has been reported for transgenic models where expression of the mutant Pik3ca is driven by an exogenous promoter. Histological analysis of the tumors formed revealed predominantly ERα-positive fibroadenomas, carcinosarcomas and sarcomas. In vitro induction of Pik3caH1047R in immortalized mammary epithelial cells also resulted in tumor formation when injected into the mammary fat pad of immunodeficient recipient mice. This novel model, which reproduces the scenario of a heterozygous somatic mutation occurring in the endogenous PIK3CA gene, will thus be a valuable tool for investigating the role of Pik3caH1047R mutation in mammary tumorigenesis both in vivo and in vitro. PMID:22666336

Physiological levels of Pik3ca(H1047R mutation in the mouse mammary gland results in ductal hyperplasia and formation of ERα-positive tumors.

Directory of Open Access Journals (Sweden)

Anjali Tikoo

Full Text Available PIK3CA, the gene coding for the p110α subunit of phosphoinositide 3-kinase, is frequently mutated in a variety of human tumors including breast cancers. To better understand the role of mutant PIK3CA in the initiation and/or progression of breast cancer, we have generated mice with a conditional knock-in of the common activating mutation, Pik3ca(H1047R, into one allele of the endogenous gene in the mammary gland. These mice developed a ductal anaplasia and hyperplasia by 6 weeks of age characterized by multi-layering of the epithelial lining of the mammary ducts and expansion of the luminal progenitor (Lin(-; CD29(lo; CD24(+; CD61(+ cell population. The Pik3ca(H1047R expressing mice eventually develop mammary tumors with 100% penetrance but with a long latency (>12 months. This is significantly longer than has been reported for transgenic models where expression of the mutant Pik3ca is driven by an exogenous promoter. Histological analysis of the tumors formed revealed predominantly ERα-positive fibroadenomas, carcinosarcomas and sarcomas. In vitro induction of Pik3ca(H1047R in immortalized mammary epithelial cells also resulted in tumor formation when injected into the mammary fat pad of immunodeficient recipient mice. This novel model, which reproduces the scenario of a heterozygous somatic mutation occurring in the endogenous PIK3CA gene, will thus be a valuable tool for investigating the role of Pik3ca(H1047R mutation in mammary tumorigenesis both in vivo and in vitro.

Metabolic Profiling of IDH Mutation and Malignant Progression in Infiltrating Glioma

Science.gov (United States)

Jalbert, Llewellyn E.; Elkhaled, Adam; Phillips, Joanna J.; Neill, Evan; Williams, Aurelia; Crane, Jason C.; Olson, Marram P.; Molinaro, Annette M.; Berger, Mitchel S.; Kurhanewicz, John; Ronen, Sabrina M.; Chang, Susan M.; Nelson, Sarah J.

2017-03-01

Infiltrating low grade gliomas (LGGs) are heterogeneous in their behavior and the strategies used for clinical management are highly variable. A key factor in clinical decision-making is that patients with mutations in the isocitrate dehydrogenase 1 and 2 (IDH1/2) oncogenes are more likely to have a favorable outcome and be sensitive to treatment. Because of their relatively long overall median survival, more aggressive treatments are typically reserved for patients that have undergone malignant progression (MP) to an anaplastic glioma or secondary glioblastoma (GBM). In the current study, ex vivo metabolic profiles of image-guided tissue samples obtained from patients with newly diagnosed and recurrent LGG were investigated using proton high-resolution magic angle spinning spectroscopy (1H HR-MAS). Distinct spectral profiles were observed for lesions with IDH-mutated genotypes, between astrocytoma and oligodendroglioma histologies, as well as for tumors that had undergone MP. Levels of 2-hydroxyglutarate (2HG) were correlated with increased mitotic activity, axonal disruption, vascular neoplasia, and with several brain metabolites including the choline species, glutamate, glutathione, and GABA. The information obtained in this study may be used to develop strategies for in vivo characterization of infiltrative glioma, in order to improve disease stratification and to assist in monitoring response to therapy.

Expression proteomics of UPF1 knockdown in HeLa cells reveals autoregulation of hnRNP A2/B1 mediated by alternative splicing resulting in nonsense-mediated mRNA decay

Directory of Open Access Journals (Sweden)

Zavolan Mihaela

2010-10-01

Full Text Available Abstract Background In addition to acting as an RNA quality control pathway, nonsense-mediated mRNA decay (NMD plays roles in regulating normal gene expression. In particular, the extent to which alternative splicing is coupled to NMD and the roles of NMD in regulating uORF containing transcripts have been a matter of debate. Results In order to achieve a greater understanding of NMD regulated gene expression we used 2D-DiGE proteomics technology to examine the changes in protein expression induced in HeLa cells by UPF1 knockdown. QPCR based validation of the corresponding mRNAs, in response to both UPF1 knockdown and cycloheximide treatment, identified 17 bona fide NMD targets. Most of these were associated with bioinformatically predicted NMD activating features, predominantly upstream open reading frames (uORFs. Strikingly, however, the majority of transcripts up-regulated by UPF1 knockdown were either insensitive to, or even down-regulated by, cycloheximide treatment. Furthermore, the mRNA abundance of several down-regulated proteins failed to change upon UPF1 knockdown, indicating that UPF1's role in regulating mRNA and protein abundance is more complex than previously appreciated. Among the bona fide NMD targets, we identified a highly conserved AS-NMD event within the 3' UTR of the HNRNPA2B1 gene. Overexpression of GFP tagged hnRNP A2 resulted in a decrease in endogenous hnRNP A2 and B1 mRNA with a concurrent increase in the NMD sensitive isoforms. Conclusions Despite the large number of changes in protein expression upon UPF1 knockdown, a relatively small fraction of them can be directly attributed to the action of NMD on the corresponding mRNA. From amongst these we have identified a conserved AS-NMD event within HNRNPA2B1 that appears to mediate autoregulation of HNRNPA2B1 expression levels.

Mutation of Semaphorin-6A disrupts limbic and cortical connectivity and models neurodevelopmental psychopathology.

LENUS (Irish Health Repository)

2011-01-01

Psychiatric disorders such as schizophrenia and autism are characterised by cellular disorganisation and dysconnectivity across the brain and can be caused by mutations in genes that control neurodevelopmental processes. To examine how neurodevelopmental defects can affect brain function and behaviour, we have comprehensively investigated the consequences of mutation of one such gene, Semaphorin-6A, on cellular organisation, axonal projection patterns, behaviour and physiology in mice. These analyses reveal a spectrum of widespread but subtle anatomical defects in Sema6A mutants, notably in limbic and cortical cellular organisation, lamination and connectivity. These mutants display concomitant alterations in the electroencephalogram and hyper-exploratory behaviour, which are characteristic of models of psychosis and reversible by the antipsychotic clozapine. They also show altered social interaction and deficits in object recognition and working memory. Mice with mutations in Sema6A or the interacting genes may thus represent a highly informative model for how neurodevelopmental defects can lead to anatomical dysconnectivity, resulting, either directly or through reactive mechanisms, in dysfunction at the level of neuronal networks with associated behavioural phenotypes of relevance to psychiatric disorders. The biological data presented here also make these genes plausible candidates to explain human linkage findings for schizophrenia and autism.

Features of 5'-splice-site efficiency derived from disease-causing mutations and comparative genomics

DEFF Research Database (Denmark)

Roca, Xavier; Olson, Andrew J; Rao, Atmakuri R

2008-01-01

Many human diseases, including Fanconi anemia, hemophilia B, neurofibromatosis, and phenylketonuria, can be caused by 5'-splice-site (5'ss) mutations that are not predicted to disrupt splicing, according to position weight matrices. By using comparative genomics, we identify pairwise dependencies...

A truncating mutation of HDAC2 in human cancers confers resistance to histone deacetylase inhibition

DEFF Research Database (Denmark)

Ropero, S; Fraga, MF; Ballestar, E

2006-01-01

Disruption of histone acetylation patterns is a common feature of cancer cells, but very little is known about its genetic basis. We have identified truncating mutations in one of the primary human histone deacetylases, HDAC2, in sporadic carcinomas with microsatellite instability and in tumors a...... deacetylase inhibitors. As such drugs may serve as therapeutic agents for cancer, our findings support the use of HDAC2 mutational status in future pharmacogenetic treatment of these individuals....

Histone Variant HTZ1 Shows Extensive Epistasis with, but Does Not Increase Robustness to, New Mutations

Science.gov (United States)

Richardson, Joshua B.; Uppendahl, Locke D.; Traficante, Maria K.; Levy, Sasha F.; Siegal, Mark L.

2013-01-01

Biological systems produce phenotypes that appear to be robust to perturbation by mutations and environmental variation. Prior studies identified genes that, when impaired, reveal previously cryptic genetic variation. This result is typically interpreted as evidence that the disrupted gene normally increases robustness to mutations, as such robustness would allow cryptic variants to accumulate. However, revelation of cryptic genetic variation is not necessarily evidence that a mutationally robust state has been made less robust. Demonstrating a difference in robustness requires comparing the ability of each state (with the gene perturbed or intact) to suppress the effects of new mutations. Previous studies used strains in which the existing genetic variation had been filtered by selection. Here, we use mutation accumulation (MA) lines that have experienced minimal selection, to test the ability of histone H2A.Z (HTZ1) to increase robustness to mutations in the yeast Saccharomyces cerevisiae. HTZ1, a regulator of chromatin structure and gene expression, represents a class of genes implicated in mutational robustness. It had previously been shown to increase robustness of yeast cell morphology to fluctuations in the external or internal microenvironment. We measured morphological variation within and among 79 MA lines with and without HTZ1. Analysis of within-line variation confirms that HTZ1 increases microenvironmental robustness. Analysis of between-line variation shows the morphological effects of eliminating HTZ1 to be highly dependent on the line, which implies that HTZ1 interacts with mutations that have accumulated in the lines. However, lines without HTZ1 are, as a group, not more phenotypically diverse than lines with HTZ1 present. The presence of HTZ1, therefore, does not confer greater robustness to mutations than its absence. Our results provide experimental evidence that revelation of cryptic genetic variation cannot be assumed to be caused by loss of

Histone variant HTZ1 shows extensive epistasis with, but does not increase robustness to, new mutations.

Directory of Open Access Journals (Sweden)

Joshua B Richardson

Full Text Available Biological systems produce phenotypes that appear to be robust to perturbation by mutations and environmental variation. Prior studies identified genes that, when impaired, reveal previously cryptic genetic variation. This result is typically interpreted as evidence that the disrupted gene normally increases robustness to mutations, as such robustness would allow cryptic variants to accumulate. However, revelation of cryptic genetic variation is not necessarily evidence that a mutationally robust state has been made less robust. Demonstrating a difference in robustness requires comparing the ability of each state (with the gene perturbed or intact to suppress the effects of new mutations. Previous studies used strains in which the existing genetic variation had been filtered by selection. Here, we use mutation accumulation (MA lines that have experienced minimal selection, to test the ability of histone H2A.Z (HTZ1 to increase robustness to mutations in the yeast Saccharomyces cerevisiae. HTZ1, a regulator of chromatin structure and gene expression, represents a class of genes implicated in mutational robustness. It had previously been shown to increase robustness of yeast cell morphology to fluctuations in the external or internal microenvironment. We measured morphological variation within and among 79 MA lines with and without HTZ1. Analysis of within-line variation confirms that HTZ1 increases microenvironmental robustness. Analysis of between-line variation shows the morphological effects of eliminating HTZ1 to be highly dependent on the line, which implies that HTZ1 interacts with mutations that have accumulated in the lines. However, lines without HTZ1 are, as a group, not more phenotypically diverse than lines with HTZ1 present. The presence of HTZ1, therefore, does not confer greater robustness to mutations than its absence. Our results provide experimental evidence that revelation of cryptic genetic variation cannot be assumed to be

Biophysical characterization of the short QT mutation hERG-N588K reveals a mixed gain-and loss-of-function

DEFF Research Database (Denmark)

Grunnet, M.; Diness, T.G.; Hansen, R.S.

2008-01-01

The short QT syndrome is a newly discovered pro-arrhythmic condition, which may cause ventricular fibrillation and sudden death. Short QT can originate from the apparent gain-of-function mutation N588K in the hERG potassium channel that conducts repolarising I(Kr) current. The present study...

Analysis of HFE and non-HFE gene mutations in Brazilian patients with hemochromatosis.

Science.gov (United States)

Bittencourt, Paulo Lisboa; Marin, Maria Lúcia Carnevale; Couto, Cláudia Alves; Cançado, Eduardo Luiz Rachid; Carrilho, Flair José; Goldberg, Anna Carla

2009-01-01

Approximately one-half of Brazilian patients with hereditary hemochromatosis (HH) are neither homozygous for the C282Y mutation nor compound heterozygous for the H63D and C282Y mutations that are associated with HH in Caucasians. Other mutations have been described in the HFE gene as well as in genes involved in iron metabolism, such as transferrin receptor 2 (TfR2) and ferroportin 1 (SCL40A1). To evaluate the role of HFE, TfR2 and SCL40A1 mutations in Brazilian subjects with HH. Nineteen male subjects (median age 42 [range: 20-72] years) with HH were evaluated using the Haemochromatosis StripAssay A. This assay is capable of detecting twelve HFE mutations, which are V53M, V59M, H63D, H63H, S65C, Q127H, P160delC, E168Q, E168X, W169X, C282Y and Q283, four TfR2 mutations, which are E60X, M172K, Y250X, AVAQ594-597del, and two SCL40A1 mutations, which are N144H and V162del. In our cohort, nine (47%) patients were homozygous for the C282Y mutation, two (11%) were heterozygous for the H63D mutation, and one each (5%) was either heterozygous for C282Y or compound heterozygous for C282Y and H63D. No other mutations in the HFE, TfR2 or SCL40A1 genes were observed in the studied patients. One-third of Brazilian subjects with the classical phenotype of HH do not carry HFE or other mutations that are currently associated with the disease in Caucasians. This observation suggests a role for other yet unknown mutations in the aforementioned genes or in other genes involved in iron homeostasis in the pathogenesis of HH in Brazil.

Analysis of HFE and non-HFE gene mutations in Brazilian patients with hemochromatosis

Directory of Open Access Journals (Sweden)

Paulo Lisboa Bittencourt

2009-01-01

Full Text Available BACKGROUND: Approximately one-half of Brazilian patients with hereditary hemochromatosis (HH are neither homozygous for the C282Y mutation nor compound heterozygous for the H63D and C282Y mutations that are associated with HH in Caucasians. Other mutations have been described in the HFE gene as well as in genes involved in iron metabolism, such as transferrin receptor 2 (TfR2 and ferroportin 1 (SCL40A1. AIMS: To evaluate the role of HFE, TfR2 and SCL40A1 mutations in Brazilian subjects with HH. PATIENTS AND METHODS: Nineteen male subjects (median age 42 [range: 20-72] years with HH were evaluated using the Haemochromatosis StripAssay A®. This assay is capable of detecting twelve HFE mutations, which are V53M, V59M, H63D, H63H, S65C, Q127H, P160delC, E168Q, E168X, W169X, C282Y and Q283, four TfR2 mutations, which are E60X, M172K, Y250X, AVAQ594-597del, and two SCL40A1 mutations, which are N144H and V162del. RESULTS: In our cohort, nine (47% patients were homozygous for the C282Y mutation, two (11% were heterozygous for the H63D mutation, and one each (5% was either heterozygous for C282Y or compound heterozygous for C282Y and H63D. No other mutations in the HFE, TfR2 or SCL40A1 genes were observed in the studied patients. CONCLUSIONS: One-third of Brazilian subjects with the classical phenotype of HH do not carry HFE or other mutations that are currently associated with the disease in Caucasians. This observation suggests a role for other yet unknown mutations in the aforementioned genes or in other genes involved in iron homeostasis in the pathogenesis of HH in Brazil.

Major prognostic value of complex karyotype in addition to TP53 and IGHV mutational status in first-line chronic lymphocytic leukemia.

Science.gov (United States)

Le Bris, Yannick; Struski, Stéphanie; Guièze, Romain; Rouvellat, Caroline; Prade, Naïs; Troussard, Xavier; Tournilhac, Olivier; Béné, Marie C; Delabesse, Eric; Ysebaert, Loïc

2017-12-01

Chronic lymphocytic leukemia (CLL) is a lymphoproliferative disorder of remarkable heterogeneity as demonstrated by cytogenetics and molecular analyses. Complex karyotype (CK), TP53 deletions and/or mutations (TP53 disruption), IGVH mutational status, and, more recently, recurrent somatic mutations have been identified as prognostic markers in CLL. On a cohort of 110 patients with CLL treated with first-line fludarabin, cyclophosphamide, and rituximab treatment compared with 33 untreated (watch and wait) patients with CLL, we report more frequent complex karyotypes (34 vs 15%; P = .05), unmutated IGHV (70 vs 21%; P < .0001), ATM deletion (25 vs 6%, P = .02), and NOTCH mutation (3 vs 17%, P = .04). Among treated patients, 39 relapsed during the follow-up period. These patients were characterized before treatment by a higher incidence of trisomy 12 (38 vs 11%, P < .001) and TP53 disruption (31 vs 4%, P = .0002). A significantly shorter 5-year overall survival was found for treated patients with CK (72.4 vs 85.8%; P = .007), unmutated IGHV (70 vs 100%; P = .04), or TP53 disruption (55.7 vs 82.7%; P < .0001). Three risk groups were defined based on the status of TP53 disruption or unmutated IGVH, which differed significantly in terms of 5-year overall survival. Moreover, the presence of CK impacted pejoratively 5-year overall survival and progression-free survival in all these 3 groups. Conventional karyotyping therefore appears to be of value, CK being an additional factor, undetectable in classical FISH, in patients with CLL at the stage when therapy becomes required. Copyright © 2016 John Wiley & Sons, Ltd.

Systematic Prediction of the Impacts of Mutations in MicroRNA Seed Sequences

Directory of Open Access Journals (Sweden)

Bhattacharya Anindya

2017-05-01

Full Text Available MicroRNAs are a class of small non-coding RNAs that are involved in many important biological processes and the dysfunction of microRNA has been associated with many diseases. The seed region of a microRNA is of crucial importance to its target recognition. Mutations in microRNA seed regions may disrupt the binding of microRNAs to their original target genes and make them bind to new target genes. Here we use a knowledge-based computational method to systematically predict the functional effects of all the possible single nucleotide mutations in human microRNA seed regions. The result provides a comprehensive reference for the functional assessment of the impacts of possible natural and artificial single nucleotide mutations in microRNA seed regions.

Prothrombin 20210 G: a mutation and Factor V Leiden mutation in women with a history of severe preeclampsia and (H)ELLP syndrome

NARCIS (Netherlands)

van Pampus, M. G.; Wolf, H.; Koopman, M. M.; van den Ende, A.; Buller, H. R.; Reitsma, P. H.

2001-01-01

The 20210 G-A prothrombin gene variant and the Factor V Leiden mutation are mutations associated with venous thrombotic risk. The aim of our study was to assess the prevalence of these specific mutations in women with a history of preeclampsia or hemolysis elevated liver enzymes, and low platelet

The BDGP gene disruption project: Single transposon insertions associated with 40 percent of Drosophila genes

Energy Technology Data Exchange (ETDEWEB)

Bellen, Hugo J.; Levis, Robert W.; Liao, Guochun; He, Yuchun; Carlson, Joseph W.; Tsang, Garson; Evans-Holm, Martha; Hiesinger, P. Robin; Schulze, Karen L.; Rubin, Gerald M.; Hoskins, Roger A.; Spradling, Allan C.

2004-01-13

The Berkeley Drosophila Genome Project (BDGP) strives to disrupt each Drosophila gene by the insertion of a single transposable element. As part of this effort, transposons in more than 30,000 fly strains were localized and analyzed relative to predicted Drosophila gene structures. Approximately 6,300 lines that maximize genomic coverage were selected to be sent to the Bloomington Stock Center for public distribution, bringing the size of the BDGP gene disruption collection to 7,140 lines. It now includes individual lines predicted to disrupt 5,362 of the 13,666 currently annotated Drosophila genes (39 percent). Other lines contain an insertion at least 2 kb from others in the collection and likely mutate additional incompletely annotated or uncharacterized genes and chromosomal regulatory elements. The remaining strains contain insertions likely to disrupt alternative gene promoters or to allow gene mis-expression. The expanded BDGP gene disruption collection provides a public resource that will facilitate the application of Drosophila genetics to diverse biological problems. Finally, the project reveals new insight into how transposons interact with a eukaryotic genome and helps define optimal strategies for using insertional mutagenesis as a genomic tool.

New mutation of the MPZ gene in a family with the Dejerine-Sottas disease phenotype.

Science.gov (United States)

Floroskufi, Paraskewi; Panas, Marios; Karadima, Georgia; Vassilopoulos, Demetris

2007-05-01

Charcot-Marie-Tooth disease type 1B is associated with mutations in the myelin protein zero gene. In the present study a new myelin protein zero gene mutation (c.89T>C,Ile30Thr) was detected in a family with the Dejerine-Sottas disease phenotype. The results support the hypothesis that severe, early-onset neuropathy may be related to either an alteration of a conserved amino acid or a disruption of the tertiary structure of myelin protein zero.

Bi-allelic Mutations in PKD1L1 Are Associated with Laterality Defects in Humans.

Science.gov (United States)

Vetrini, Francesco; D'Alessandro, Lisa C A; Akdemir, Zeynep C; Braxton, Alicia; Azamian, Mahshid S; Eldomery, Mohammad K; Miller, Kathryn; Kois, Chelsea; Sack, Virginia; Shur, Natasha; Rijhsinghani, Asha; Chandarana, Jignesh; Ding, Yan; Holtzman, Judy; Jhangiani, Shalini N; Muzny, Donna M; Gibbs, Richard A; Eng, Christine M; Hanchard, Neil A; Harel, Tamar; Rosenfeld, Jill A; Belmont, John W; Lupski, James R; Yang, Yaping

2016-10-06

Disruption of the establishment of left-right (L-R) asymmetry leads to situs anomalies ranging from situs inversus totalis (SIT) to situs ambiguus (heterotaxy). The genetic causes of laterality defects in humans are highly heterogeneous. Via whole-exome sequencing (WES), we identified homozygous mutations in PKD1L1 from three affected individuals in two unrelated families. PKD1L1 encodes a polycystin-1-like protein and its loss of function is known to cause laterality defects in mouse and medaka fish models. Family 1 had one fetus and one deceased child with heterotaxy and complex congenital heart malformations. WES identified a homozygous splicing mutation, c.6473+2_6473+3delTG, which disrupts the invariant splice donor site in intron 42, in both affected individuals. In the second family, a homozygous c.5072G>C (p.Cys1691Ser) missense mutation was detected in an individual with SIT and congenital heart disease. The p.Cys1691Ser substitution affects a highly conserved cysteine residue and is predicted by molecular modeling to disrupt a disulfide bridge essential for the proper folding of the G protein-coupled receptor proteolytic site (GPS) motif. Damaging effects associated with substitutions of this conserved cysteine residue in the GPS motif have also been reported in other genes, namely GPR56, BAI3, and PKD1 in human and lat-1 in C. elegans, further supporting the likely pathogenicity of p.Cys1691Ser in PKD1L1. The identification of bi-allelic PKD1L1 mutations recapitulates previous findings regarding phenotypic consequences of loss of function of the orthologous genes in mice and medaka fish and further expands our understanding of genetic contributions to laterality defects in humans. Copyright © 2016 American Society of Human Genetics. Published by Elsevier Inc. All rights reserved.

Structural and functional analysis of rare missense mutations in human chorionic gonadotrophin β-subunit

DEFF Research Database (Denmark)

Nagirnaja, Liina; Venclovas, Česlovas; Rull, Kristiina

2012-01-01

Heterodimeric hCG is one of the key hormones determining early pregnancy success. We have previously identified rare missense mutations in hCGβ genes with potential pathophysiological importance. The present study assessed the impact of these mutations on the structure and function of hCG by appl...... of intact hCG as also supported by an in silico analysis. In summary, the accumulated data indicate that only mutations with neutral or mild functional consequences might be tolerated in the major hCGβ genes CGB5 and CGB8.......Heterodimeric hCG is one of the key hormones determining early pregnancy success. We have previously identified rare missense mutations in hCGβ genes with potential pathophysiological importance. The present study assessed the impact of these mutations on the structure and function of h......CG by applying a combination of in silico (sequence and structure analysis, molecular dynamics) and in vitro (co-immunoprecipitation, immuno- and bioassays) approaches. The carrier status of each mutation was determined for 1086 North-Europeans [655 patients with recurrent miscarriage (RM)/431 healthy controls...

E119D Neuraminidase Mutation Conferring Pan-Resistance to Neuraminidase Inhibitors in an A(H1N1)pdm09 Isolate From a Stem-Cell Transplant Recipient.

Science.gov (United States)

L'Huillier, Arnaud G; Abed, Yacine; Petty, Tom J; Cordey, Samuel; Thomas, Yves; Bouhy, Xavier; Schibler, Manuel; Simon, Audrey; Chalandon, Yves; van Delden, Christian; Zdobnov, Evgeny; Boquete-Suter, Patricia; Boivin, Guy; Kaiser, Laurent

2015-12-01

An influenza A(H1N1)pdm09 infection was diagnosed in a hematopoietic stem cell transplant recipient during conditioning regimen. He was treated with oral oseltamivir, later combined with intravenous zanamivir. The H275Y neuraminidase (NA) mutation was first detected, and an E119D NA mutation was identified during zanamivir therapy. Recombinant wild-type (WT) E119D and E119D/H275Y A(H1N1)pdm09 NA variants were generated by reverse genetics. Susceptibility to NA inhibitors (NAIs) was evaluated with a fluorometric assay using the 2'-(4-methylumbelliferyl)-α-D-N-acetylneuraminic acid (MUNANA) substrate. Susceptibility to favipiravir (T-705) was assessed using plaque reduction assays. The NA affinity and velocity values were determined with NA enzymatic studies. We identified an influenza A(H1N1)pdm09 E119D mutant that exhibited a marked increase in the 50% inhibitory concentrations against all tested NAIs (827-, 25-, 286-, and 702-fold for zanamivir, oseltamivir, peramivir, and laninamivir, respectively). The double E119D/H275Y mutation further increased oseltamivir and peramivir 50% inhibitory concentrations by 790- and >5000-fold, respectively, compared with the WT. The mutant viruses remained susceptible to favipiravir. The NA affinity and velocity values of the E119D variant decreased by 8.1-fold and 4.5-fold, respectively, compared with the WT. The actual emergence of a single NA mutation conferring pan-NAI resistance in the clinical setting reinforces the pressing need to develop new anti-influenza strategies. © The Author 2015. Published by Oxford University Press on behalf of the Infectious Diseases Society of America. All rights reserved. For Permissions, please e-mail: journals.permissions@oup.com.

A point mutation in the polymerase protein PB2 allows a reassortant H9N2 influenza isolate of wild-bird origin to replicate in human cells.

Science.gov (United States)

Hussein, Islam T.M.; Ma, Eric J.; Meixell, Brandt; Hill, Nichola J.; Lindberg, Mark S.; Albrecht , Randy A.; Bahl, Justin; Runstadler, Jonathan A.

2016-01-01

H9N2 influenza A viruses are on the list of potentially pandemic subtypes. Therefore, it is important to understand how genomic reassortment and genetic polymorphisms affect phenotypes of H9N2 viruses circulating in the wild bird reservoir. A comparative genetic analysis of North American H9N2 isolates of wild bird origin identified a naturally occurring reassortant virus containing gene segments derived from both North American and Eurasian lineage ancestors. The PB2 segment of this virus encodes 10 amino acid changes that distinguish it from other H9 strains circulating in North America. G590S, one of the 10 amino acid substitutions observed, was present in ~ 12% of H9 viruses worldwide. This mutation combined with R591 has been reported as a marker of pathogenicity for human pandemic 2009 H1N1 viruses. Screening by polymerase reporter assay of all the natural polymorphisms at these two positions identified G590/K591 and S590/K591 as the most active, with the highest polymerase activity recorded for the SK polymorphism. Rescued viruses containing these two polymorphic combinations replicated more efficiently in MDCK cells and they were the only ones tested that were capable of establishing productive infection in NHBE cells. A global analysis of all PB2 sequences identified the K591 signature in six viral HA/NA subtypes isolated from several hosts in seven geographic locations. Interestingly, introducing the K591 mutation into the PB2 of a human-adapted H3N2 virus did not affect its polymerase activity. Our findings demonstrate that a single point mutation in the PB2 of a low pathogenic H9N2 isolate could have a significant effect on viral phenotype and increase its propensity to infect mammals. However, this effect is not universal, warranting caution in interpreting point mutations without considering protein sequence context.

Mutations in GRIN2A> cause idiopathic focal epilepsy with rolandic spikes

DEFF Research Database (Denmark)

Lemke, Johannes R; Lal, Dennis; Reinthaler, Eva M

2013-01-01

significantly more frequently in the more severe phenotypes, with mutation detection rates ranging from 12/245 (4.9%) in individuals with BECTS to 9/51 (17.6%) in individuals with CSWS (P = 0.009, Cochran-Armitage test for trend). In addition, exon-disrupting microdeletions were found in 3 of 286 individuals (1...

Improved detection of genetic markers of antimicrobial resistance by hybridization probe-based melting curve analysis using primers to mask proximal mutations: examples include the influenza H275Y substitution.

Science.gov (United States)

Whiley, David M; Jacob, Kevin; Nakos, Jennifer; Bletchly, Cheryl; Nimmo, Graeme R; Nissen, Michael D; Sloots, Theo P

2012-06-01

Numerous real-time PCR assays have been described for detection of the influenza A H275Y alteration. However, the performance of these methods can be undermined by sequence variation in the regions flanking the codon of interest. This is a problem encountered more broadly in microbial diagnostics. In this study, we developed a modification of hybridization probe-based melting curve analysis, whereby primers are used to mask proximal mutations in the sequence targets of hybridization probes, so as to limit the potential for sequence variation to interfere with typing. The approach was applied to the H275Y alteration of the influenza A (H1N1) 2009 strain, as well as a Neisseria gonorrhoeae mutation associated with antimicrobial resistance. Assay performances were assessed using influenza A and N. gonorrhoeae strains characterized by DNA sequencing. The modified hybridization probe-based approach proved successful in limiting the effects of proximal mutations, with the results of melting curve analyses being 100% consistent with the results of DNA sequencing for all influenza A and N. gonorrhoeae strains tested. Notably, these included influenza A and N. gonorrhoeae strains exhibiting additional mutations in hybridization probe targets. Of particular interest was that the H275Y assay correctly typed influenza A strains harbouring a T822C nucleotide substitution, previously shown to interfere with H275Y typing methods. Overall our modified hybridization probe-based approach provides a simple means of circumventing problems caused by sequence variation, and offers improved detection of the influenza A H275Y alteration and potentially other resistance mechanisms.

Ras mutations are rare in solitary cold and toxic thyroid nodules.

Science.gov (United States)

Krohn, K; Reske, A; Ackermann, F; Müller, A; Paschke, R

2001-08-01

Activation of ras proto-oncogenes as a result of point mutations is detectable in a significant percentage of most types of tumour. Similar to neoplasms of other organs, mutations of all three ras genes can be found in thyroid tumours. H-, K- and N-ras mutations have been detected in up to 20% of follicular adenomas and adenomatous nodules which were not functionally characterized. This raises the question as to whether ras mutations are specific for hypofunctional nodules and TSH receptor mutations for hyperfunctioning nodules. To investigate ras and TSH receptor mutations with respect to functional differentiation we studied 41 scintigraphically cold nodules and 47 toxic thyroid nodules. To address the likelihood of a somatic mutation we also studied the clonal origin of these tumours. Genomic DNA was extracted from nodular and surrounding tissue. Mutational hot spots in exons 1 and 2 of the H- and K-ras gene were PCR amplified and sequenced using big dye terminator chemistry. Denaturing gradient gel electrophoresis (DGGE) was used to verify sequencing results for the H-ras gene and to analyse the N-ras gene because its greater sensitivity in detecting somatic mutations. Clonality of nodular thyroid tissue was evaluated using X-Chromosome inactivation based on PCR amplification of the human androgen receptor locus. Monoclonal origin was detectable in 14 of 23 informative samples from cold thyroid nodules. In toxic thyroid nodules the frequency of clonal tissue was 20 in 30 informative cases. Only one point mutation could be found in the N-ras gene codon 61 (Gly to Arg) in a cold adenomatous nodule which was monoclonal. In toxic thyroid nodules no ras mutation was detectable. Our study suggests that ras mutations are rare in solitary cold and toxic thyroid nodules and that the frequent monoclonal origin of these tumours implies somatic mutations in genes other than H-, K- and N-ras.

The Pyridoxal 5′-Phosphate (PLP-Dependent Enzyme Serine Palmitoyltransferase (SPT: Effects of the Small Subunits and Insights from Bacterial Mimics of Human hLCB2a HSAN1 Mutations

Directory of Open Access Journals (Sweden)

Ashley E. Beattie

2013-01-01

Full Text Available The pyridoxal 5′-phosphate (PLP-dependent enzyme serine palmitoyltransferase (SPT catalyses the first step of de novo sphingolipid biosynthesis. The core human enzyme is a membrane-bound heterodimer composed of two subunits (hLCB1 and hLCB2a/b, and mutations in both hLCB1 (e.g., C133W and C133Y and hLCB2a (e.g., V359M, G382V, and I504F have been identified in patients with hereditary sensory and autonomic neuropathy type I (HSAN1, an inherited disorder that affects sensory and autonomic neurons. These mutations result in substrate promiscuity, leading to formation of neurotoxic deoxysphingolipids found in affected individuals. Here we measure the activities of the hLCB2a mutants in the presence of ssSPTa and ssSPTb and find that all decrease enzyme activity. High resolution structural data of the homodimeric SPT enzyme from the bacterium Sphingomonas paucimobilis (Sp SPT provides a model to understand the impact of the hLCB2a mutations on the mechanism of SPT. The three human hLCB2a HSAN1 mutations map onto Sp SPT (V246M, G268V, and G385F, and these mutant mimics reveal that the amino acid changes have varying impacts; they perturb the PLP cofactor binding, reduce the affinity for both substrates, decrease the enzyme activity, and, in the most severe case, cause the protein to be expressed in an insoluble form.

Deletions and de novo mutations of SOX11 are associated with a neurodevelopmental disorder with features of Coffin–Siris syndrome

Science.gov (United States)

Hempel, Annmarie; Pagnamenta, Alistair T; Blyth, Moira; Mansour, Sahar; McConnell, Vivienne; Kou, Ikuyo; Ikegawa, Shiro; Tsurusaki, Yoshinori; Matsumoto, Naomichi; Lo-Castro, Adriana; Plessis, Ghislaine; Albrecht, Beate; Battaglia, Agatino; Taylor, Jenny C; Howard, Malcolm F; Keays, David; Sohal, Aman Singh; Kühl, Susanne J; Kini, Usha; McNeill, Alisdair

2016-01-01

Background SOX11 is a transcription factor proposed to play a role in brain development. The relevance of SOX11 to human developmental disorders was suggested by a recent report of SOX11 mutations in two patients with Coffin–Siris syndrome. Here we further investigate the role of SOX11 variants in neurodevelopmental disorders. Methods We used array based comparative genomic hybridisation and trio exome sequencing to identify children with intellectual disability who have deletions or de novo point mutations disrupting SOX11. The pathogenicity of the SOX11 mutations was assessed using an in vitro gene expression reporter system. Loss-of-function experiments were performed in xenopus by knockdown of Sox11 expression. Results We identified seven individuals with chromosome 2p25 deletions involving SOX11. Trio exome sequencing identified three de novo SOX11 variants, two missense (p.K50N; p.P120H) and one nonsense (p.C29*). The biological consequences of the missense mutations were assessed using an in vitro gene expression system. These individuals had microcephaly, developmental delay and shared dysmorphic features compatible with mild Coffin–Siris syndrome. To further investigate the function of SOX11, we knocked down the orthologous gene in xenopus. Morphants had significant reduction in head size compared with controls. This suggests that SOX11 loss of function can be associated with microcephaly. Conclusions We thus propose that SOX11 deletion or mutation can present with a Coffin–Siris phenotype. PMID:26543203

Investigating Disruption

DEFF Research Database (Denmark)

Lundgaard, Stine Schmieg; Rosenstand, Claus Andreas Foss

This book shares knowledge collected from 2015 and onward within the Consortium for Digital Disruption anchored at Aalborg University (www.dd.aau.dk). Evidenced by this publication, the field of disruptive innovation research has gone through several stages of operationalizing the theory. In recent...... years, researchers are increasingly looking back towards the origins of the theory in attempts to cure it from its most obvious flaws. This is especially true for the use of the theory in making predictions about future disruptions. In order to continue to develop a valuable theory of disruption, we...... find it useful to first review what the theory of disruptive innovation initially was, how it has developed, and where we are now. A cross section of disruptive innovation literature has been reviewed in order to form a general foundation from which we might better understand the changing world...

Heterogeneous nuclear ribonuclear protein K interacts with Sindbis virus nonstructural proteins and viral subgenomic mRNA

International Nuclear Information System (INIS)

Burnham, Andrew J.; Gong, Lei; Hardy, Richard W.

2007-01-01

Alphaviruses are a group of arthropod-borne human and animal pathogens that can cause epidemics of significant public health and economic consequence. Alphavirus RNA synthesis requires four virally encoded nonstructural proteins and probably a number of cellular proteins. Using comparative two-dimensional electrophoresis we were able to identify proteins enriched in cytoplasmic membrane fractions containing viral RNA synthetic complexes following infection with Sindbis virus. Our studies demonstrated the following: (i) the host protein hnRNP K is enriched in cytoplasmic membrane fractions following Sindbis virus infection, (ii) viral nonstructural proteins co-immunoprecipitate with hnRNP K, (iii) nsP2 and hnRNP K co-localize in the cytoplasm of Sindbis virus infected cells, (iv) Sindbis virus subgenomic mRNA, but not genomic RNA co-immunoprecipitates with hnRNP K, (v) viral RNA does not appear to be required for the interaction of hnRNP K with the nonstructural proteins. Potential functions of hnRNP K during virus replication are discussed

Study of the generation and suppression of runaway currents in provoked disruptions in J-TEXT

Energy Technology Data Exchange (ETDEWEB)

Chen, Z.Y., E-mail: zychen@mail.hust.edu.cn [State Key Laboratory of Advanced Electromagnetic Engineering and Technology, College of Electrical and Electronic Engineering, Huazhong University of Science and Technology, Wuhan, 430074 (China); Chen, Z.P., E-mail: zpchen@mail.hust.edu.cn [State Key Laboratory of Advanced Electromagnetic Engineering and Technology, College of Electrical and Electronic Engineering, Huazhong University of Science and Technology, Wuhan, 430074 (China); Zhang, Y.; Jin, W.; Fang, D.; Ba, W.G.; Wang, Z.J.; Zhang, M.; Yang, Z.J.; Ding, Y.H.; Zhuang, G. [State Key Laboratory of Advanced Electromagnetic Engineering and Technology, College of Electrical and Electronic Engineering, Huazhong University of Science and Technology, Wuhan, 430074 (China)

2012-05-14

Runaway currents following disruptions have an important effect on the first wall for the next generation tokamak. The behaviors of runaway currents following intentional provoked disruptions have been investigated in the J-TEXT tokamak. It is found that the runaway current generation following provoked disruptions depends on both the toroidal magnetic field and the plasma current. The conversion efficiency of pre-disruptive plasma currents into runaway currents is in the ranges of 30% to 60% in J-TEXT. The runaway currents can be avoided by the intensive gas puffing of H{sub 2} due to the low multiplication factor in J-TEXT. -- Highlights: ► The regime of runaway generation in disruptions in J-TEXT has been established. ► The magnetic field threshold for runaway current generation in disruptions is 2.2 T. ► The conversion efficiency of runaway current is in the ranges of 30% to 60%. ► The runaway currents can be avoided by the intensive gas puffing of H{sub 2}.

Study of the generation and suppression of runaway currents in provoked disruptions in J-TEXT

International Nuclear Information System (INIS)

Chen, Z.Y.; Chen, Z.P.; Zhang, Y.; Jin, W.; Fang, D.; Ba, W.G.; Wang, Z.J.; Zhang, M.; Yang, Z.J.; Ding, Y.H.; Zhuang, G.

2012-01-01

Runaway currents following disruptions have an important effect on the first wall for the next generation tokamak. The behaviors of runaway currents following intentional provoked disruptions have been investigated in the J-TEXT tokamak. It is found that the runaway current generation following provoked disruptions depends on both the toroidal magnetic field and the plasma current. The conversion efficiency of pre-disruptive plasma currents into runaway currents is in the ranges of 30% to 60% in J-TEXT. The runaway currents can be avoided by the intensive gas puffing of H 2 due to the low multiplication factor in J-TEXT. -- Highlights: ► The regime of runaway generation in disruptions in J-TEXT has been established. ► The magnetic field threshold for runaway current generation in disruptions is 2.2 T. ► The conversion efficiency of runaway current is in the ranges of 30% to 60%. ► The runaway currents can be avoided by the intensive gas puffing of H 2 .

Repressive mutations restore function-loss caused by the disruption of trimerization in Escherichia coli multidrug transporter AcrB

Directory of Open Access Journals (Sweden)

Zhaoshuai eWang

2015-01-01

Full Text Available AcrAB-TolC and their homologs are major multidrug efflux systems in Gram-negative bacteria. The inner membrane component AcrB functions as a trimer. Replacement of Pro223 by Gly in AcrB decreases the trimer stability and drastically reduces the drug efflux activity. The goal of this study is to identify suppressor mutations that restore function to mutant AcrBP223G and explore the mechanism of function recovery. Two methods were used to introduce random mutations into the plasmid of AcrBP223G. Mutants with elevated drug efflux activity were identified, purified, and characterized to examine their expression level, trimer stability, interaction with AcrA, and substrate binding. Nine single-site repressor mutations were identified, including T199M, D256N, A209V, G257V, M662I, Q737L, D788K, P800S, and E810K. Except for M662I, all other mutations located in the docking region of the periplasmic domain. While three mutations, T199M, A209V, and D256N, significantly increased the trimer stability, none of them restored the trimer affinity to the wild type level. M662, the only site of mutation that located in the porter domain, was involved in substrate binding. Our results suggest that the function loss resulted from compromised AcrB trimerization could be restored through various mechanisms involving the compensation of trimer stability and substrate binding.

Steroidogenic disruptive effects of the serotonin-noradrenaline reuptake inhibitors duloxetine, venlafaxine and tramadol in the H295R cell assay and in a recombinant CYP17 assay

DEFF Research Database (Denmark)

Islin, Julie; Munkboel, Cecilie Hurup; Styrishave, Bjarne

2018-01-01

The aim of this study was to determine the steroidogenic endocrine disrupting effect of the three most widely used serotonin-noradrenaline reuptake inhibitors duloxetine, venlafaxine and tramadol, using two in vitro models, the H295R assay and a recombinant CYP17 enzyme assay. Steroid hormones were...... quantified using LC-MS/MS. Duloxetine showed endocrine disrupting effects at 5-20μM with CYP17 being the main target. Venlafaxine also affected the steroidogenesis, mainly by affecting the CYP17 lyase reaction, although at much higher concentrations i.e. 100μM. Tramadol only exerted minor effects...... on the steroidogenesis with the lowest observed effect at 314μM. Based on the H295R results, the inhibition of CYP17 by duloxetine and venlafaxine was investigated in a recombinant CYP17 assay with the use of the 4 major CYP17 substrates pregnenolone, progesterone, 17α-hydroxypregnenolone and 17α...

Observations of several disruptions in PLT using soft and ultra-soft x-ray radiation

International Nuclear Information System (INIS)

Eames, D.R.; von Goeler, S.; Sauthoff, N.R.; Stodiek, W.

1979-03-01

The evolution of ultra-soft x-ray radiation (USX, hν approx. > 100 eV) is compared to that of the soft x-ray radiation (SX, hν approx. > 1000 eV) during several disruptions in PLT. Spatial resolution is obtained in both cases by arrays of silicon surface barrier detectors viewing along different chords. During some disruptions the USX behaves quite differently from the SX, and a classification is made based on the USX behavior. Different interpretations of the data are discussed, along with the possibility that these measurements may distinguish between the roles of temperature and impurity density changes during disruptions

Association between C282Y and H63D mutations of the HFE gene with hepatocellular carcinoma in European populations: a meta-analysis

Directory of Open Access Journals (Sweden)

Shen Xi-Zhong

2010-03-01

Full Text Available Abstract Background Hereditary hemochromatosis (HH is an autosomal recessive disorder mainly associated with homozygosity for the C282Y and H63D mutations in the hemochromatosis (HFE gene. The reports about the C282Y and H63D mutations and hepatocellular carninoma (HCC were controversial. To clarify the relationship between C282Y and H63D mutations and HCC, a meta-analysis including nine studies (1102 HCC cases and 3766 controls, mainly came from European populations was performed. Methods The association was measured using random-effect (RE or fixed-effect (FE odds ratios (ORs combined with 95% confidence intervals (CIs according to the studies' heterogeneity. Results Meta-analysis of nine studies showed that Y allele of C282Y was associated with HCC risk: RE OR reached 1.50 (95%CI: 1.05-2.14, p for heterogeneity = 0.02, I2 = 0.57. Subgroup analysis of seven studies also showed Y allele was associated with HCC risk in healthy populations: RE OR reached 1.61 (95%CI: 1.08-2.39, p for heterogeneity = 0.04, I2 = 0.55. We further did subgroup analysis in alcoholic liver cirrhosis (LC patients of four studies (224 cases and 380 controls and found that both the dominant model and Y allele of C282Y were associated with HCC risk (FE OR reached 4.06, 95%CI: 2.08-7.92 and 3.41, 95%CI: 1.81-6.41, respectively. There was no distinct heterogeneity among the studies (I2 = 0. Sensitivity analyses showed the results were robust in the subgroup analysis of alcoholic LC patients. Conclusions C282Y mutation was associated with HCC in European alcoholic LC patients.

Disruption of the Cdc42/Par6/aPKC or Dlg/Scrib/Lgl Polarity Complex Promotes Epithelial Proliferation via Overlapping Mechanisms.

Science.gov (United States)

Schimizzi, Gregory V; Maher, Meghan T; Loza, Andrew J; Longmore, Gregory D

2016-01-01

The establishment and maintenance of apical-basal polarity is a defining characteristic and essential feature of functioning epithelia. Apical-basal polarity (ABP) proteins are also tumor suppressors that are targeted for disruption by oncogenic viruses and are commonly mutated in human carcinomas. Disruption of these ABP proteins is an early event in cancer development that results in increased proliferation and epithelial disorganization through means not fully characterized. Using the proliferating Drosophila melanogaster wing disc epithelium, we demonstrate that disruption of the junctional vs. basal polarity complexes results in increased epithelial proliferation via distinct downstream signaling pathways. Disruption of the basal polarity complex results in JNK-dependent proliferation, while disruption of the junctional complex primarily results in p38-dependent proliferation. Surprisingly, the Rho-Rok-Myosin contractility apparatus appears to play opposite roles in the regulation of the proliferative phenotype based on which polarity complex is disrupted. In contrast, non-autonomous Tumor Necrosis Factor (TNF) signaling appears to suppress the proliferation that results from apical-basal polarity disruption, regardless of which complex is disrupted. Finally we demonstrate that disruption of the junctional polarity complex activates JNK via the Rho-Rok-Myosin contractility apparatus independent of the cortical actin regulator, Moesin.

Cocaine Disrupts Histamine H3 Receptor Modulation of Dopamine D1 Receptor Signaling: σ1-D1-H3 Receptor Complexes as Key Targets for Reducing Cocaine's Effects

Science.gov (United States)

Moreno, Estefanía; Moreno-Delgado, David; Navarro, Gemma; Hoffmann, Hanne M.; Fuentes, Silvia; Rosell-Vilar, Santi; Gasperini, Paola; Rodríguez-Ruiz, Mar; Medrano, Mireia; Mallol, Josefa; Cortés, Antoni; Casadó, Vicent; Lluís, Carme; Ferré, Sergi; Ortiz, Jordi; Canela, Enric

2014-01-01

The general effects of cocaine are not well understood at the molecular level. What is known is that the dopamine D1 receptor plays an important role. Here we show that a key mechanism may be cocaine's blockade of the histamine H3 receptor-mediated inhibition of D1 receptor function. This blockade requires the σ1 receptor and occurs upon cocaine binding to σ1-D1-H3 receptor complexes. The cocaine-mediated disruption leaves an uninhibited D1 receptor that activates Gs, freely recruits β-arrestin, increases p-ERK 1/2 levels, and induces cell death when over activated. Using in vitro assays with transfected cells and in ex vivo experiments using both rats acutely treated or self-administered with cocaine along with mice depleted of σ1 receptor, we show that blockade of σ1 receptor by an antagonist restores the protective H3 receptor-mediated brake on D1 receptor signaling and prevents the cell death from elevated D1 receptor signaling. These findings suggest that a combination therapy of σ1R antagonists with H3 receptor agonists could serve to reduce some effects of cocaine. PMID:24599455

The Response of RIF-1 Fibrosarcomas to the Vascular-Disrupting Agent ZD6126 Assessed by In Vivo and Ex Vivo1H Magnetic Resonance Spectroscopy

Directory of Open Access Journals (Sweden)

Basetti Madhu

2006-07-01

Full Text Available The response of radiation-induced fibrosarcoma1 (RIF-1 tumors treated with the vascular-disrupting agent (VDA ZD6126 was assessed by in vivo and ex vivo1H magnetic resonance spectroscopy (MRS methods. Tumors treated with 200 mg/kg ZD6126 showed a significant reduction in total choline (tCho in vivo 24 hours after treatment, whereas control tumors showed a significant increase in tCho. This response was investigated further within both ex vivo unprocessed tumor tissues and tumor tissue metabolite extracts. Ex vivo high-resolution magic angle spinning (HRMAS and 1H MRS of metabolite extracts revealed a significant reduction in phosphocholine and glycerophosphocholine in biopsies of ZD6126-treated tumors, confirming in vivo tCho response. ZD6126-induced reduction in choline compounds is consistent with a reduction in cell membrane turnover associated with necrosis and cell death following disruption of the tumor vasculature. In vivo tumor tissue water diffusion and lactate measurements showed no significant changes in response to ZD6126. Spin-spin relaxation times (T2 of water and metabolites also remained unchanged. Noninvasive 1H MRS measurement of tCho in vivo provides a potential biomarker of tumor response to VDAs in RIF-1 tumors.

Stability of transmembrane amyloid β-peptide and membrane integrity tested by molecular modeling of site-specific Aβ42 mutations.

Directory of Open Access Journals (Sweden)

Chetan Poojari

Full Text Available Interactions of the amyloid β-protein (Aβ with neuronal cell membranes, leading to the disruption of membrane integrity, are considered to play a key role in the development of Alzheimer's disease. Natural mutations in Aβ42, such as the Arctic mutation (E22G have been shown to increase Aβ42 aggregation and neurotoxicity, leading to the early-onset of Alzheimer's disease. A correlation between the propensity of Aβ42 to form protofibrils and its effect on neuronal dysfunction and degeneration has been established. Using rational mutagenesis of the Aβ42 peptide it was further revealed that the aggregation of different Aβ42 mutants in lipid membranes results in a variety of polymorphic aggregates in a mutation dependent manner. The mutant peptides also have a variable ability to disrupt bilayer integrity. To further test the connection between Aβ42 mutation and peptide-membrane interactions, we perform molecular dynamics simulations of membrane-inserted Aβ42 variants (wild-type and E22G, D23G, E22G/D23G, K16M/K28M and K16M/E22G/D23G/K28M mutants as β-sheet monomers and tetramers. The effects of charged residues on transmembrane Aβ42 stability and membrane integrity are analyzed at atomistic level. We observe an increased stability for the E22G Aβ42 peptide and a decreased stability for D23G compared to wild-type Aβ42, while D23G has the largest membrane-disruptive effect. These results support the experimental observation that the altered toxicity arising from mutations in Aβ is not only a result of the altered aggregation propensity, but also originates from modified Aβ interactions with neuronal membranes.

Genetic progression in microsatellite instability high (MSI-H) colon cancers correlates with clinico-pathological parameters: A study of the TGRbetaRII, BAX, hMSH3, hMSH6, IGFIIR and BLM genes.

Science.gov (United States)

Calin, G A; Gafà, R; Tibiletti, M G; Herlea, V; Becheanu, G; Cavazzini, L; Barbanti-Brodano, G; Nenci, I; Negrini, M; Lanza, G

2000-05-20

Colon carcinomas with microsatellite mutator phenotype exhibit specific genetic and clinico-pathological features. This report describes the analysis of 63 "microsatellite instability-high" (MSI-H) tumors for the presence of mutations in microsatellites located in the coding regions (CDRs) of 6 genes: TGFbetaRII, BAX, hMSH3, hMSH6, IGFIIR, and BLM. The following frequencies of mutations were detected: TGFbetaRII (70%), BAX (54%), hMSH3 (36.5%), IGFIIR (22%), hMSH6 (17.5%), and BLM (16%). The overall picture revealed combinations of mutations suggestive of a progressive order of accumulation, with mutations of TGFbetaRII and BAX first, followed by frameshifts in hMSH3, hMSH6, IGFIIR, and BLM. Correlations with 12 clinico-pathological parameters revealed that tumors with frameshifts in 1 or 2 CDRs were significantly better differentiated than tumors with frameshifts in more than 2 CDRs. We also found that mutations in the hMSH3 gene were significantly associated with decreased wall invasiveness and aneuploidy, and frameshifts in the BLM gene were significantly associated with the mucinous histotype. A trend toward an association between hMSH3 and IGFIIR with the medullary and conventional adenocarcinoma histotypes, respectively, was seen. Our results strengthen the concept that mutations in target genes have a role in the tumorigenic process of MSI-H tumors, and indicate that frameshifts in microsatellites located in CDRs occur in a limited number of combinations that could determine distinct clinico-pathological traits. Copyright 2000 Wiley-Liss, Inc.

Novel duplication mutation of the DYSF gene in a Pakistani family with Miyoshi Myopathy

Directory of Open Access Journals (Sweden)

Muhammad I. Ullah

2017-12-01

Full Text Available Objectives: To identify the underlying gene mutation in a large consanguineous Pakistani family. Methods: This is an observational descriptive study carried out at the Department of Biochemistry, Shifa International Hospital, Quaid-i-Azam University, and Atta-ur-Rahman School of Applied Biosciences, National University of Sciences and Technology, Islamabad, Pakistan from 2013-2016. Genomic DNA of all recruited family members was extracted and the Trusight one sequencing panel was used to assess genes associated with a neuro-muscular phenotype. Comparative modeling of mutated and wild-type protein was carried out by PyMOL tool. Results: Clinical investigations of an affected individual showed typical features of Miyoshi myopathy (MM like elevated serum creatine kinase (CK levels, distal muscle weakness, myopathic changes in electromyography (EMG and muscle histopathology. Sequencing with the Ilumina Trusight one sequencing panel revealed a novel 22 nucleotide duplication (CTTCAACTTGTTTGACTCTCCT in the DYSF gene (NM_001130987.1_c.897-918dup; p.Gly307Leufs5X, which results in a truncating frameshift mutation and perfectly segregated with the disease in this family. Protein modeling studies suggested a disruption in spatial configuration of the putative mutant protein. Conclusion: A novel duplication of 22 bases (c.897_918dup; p.Gly307Leufs5X in the DYSF gene was identified in a family suffering from Miyoshi myopathy. Protein homology analysis proposes a disruptive impact of this mutation on protein function.

TSC1/2 mutations define a molecular subset of HCC with aggressive behaviour and treatment implication.

Science.gov (United States)

Ho, Daniel W H; Chan, Lo K; Chiu, Yung T; Xu, Iris M J; Poon, Ronnie T P; Cheung, Tan T; Tang, Chung N; Tang, Victor W L; Lo, Irene L O; Lam, Polly W Y; Yau, Derek T W; Li, Miao X; Wong, Chun M; Ng, Irene O L

2017-08-01

We investigated the mutational landscape of mammalian target of rapamycin (mTOR) signalling cascade in hepatocellular carcinomas (HCCs) with chronic HBV background, aiming to evaluate and delineate mutation-dependent mechanism of mTOR hyperactivation in hepatocarcinogenesis. We performed next-generation sequencing on human HCC samples and cell line panel. Systematic mutational screening of mTOR pathway-related genes was undertaken and mutant genes were evaluated based on their recurrence. Protein expressions of tuberous sclerosis complex (TSC)1, TSC2 and pRPS6 were assessed by immunohistochemistry in human HCC samples. Rapamycin sensitivity was estimated by colony-formation assay in HCC cell lines and the treatment was further tested using our patient-derived tumour xenograft (PDTX) models. We identified and confirmed multiple mTOR components as recurrently mutated in HBV-associated HCCs. Of significance, we detected frequent (16.2%, n=18/111) mutations of TSC1 and TSC2 genes in the HCC samples. The spectrum of TSC1/2 mutations likely disrupts the endogenous gene functions in suppressing the downstream mTOR activity through different mechanisms and leads to more aggressive tumour behaviour. Mutational disruption of TSC1 and TSC2 was also observed in HCC cell lines and our PDTX models. TSC -mutant cells exhibited reduced colony-forming ability on rapamycin treatment. With the use of biologically relevant TSC2 -mutant PDTXs, we demonstrated the therapeutic benefits of the hypersensitivity towards rapamycin treatment. Taken together, our findings suggest the significance of previously undocumented mutation-dependent mTOR hyperactivation and frequent TSC1/2 mutations in HBV-associated HCCs. They define a molecular subset of HCC having genetic aberrations in mTOR signalling, with potential significance of effective specific drug therapy. Published by the BMJ Publishing Group Limited. For permission to use (where not already granted under a licence) please go to http://www.bmj.com/company/products-services/rights-and-licensing/.

Digital Disruption

DEFF Research Database (Denmark)

Rosenstand, Claus Andreas Foss

det digitale domæne ud over det niveau, der kendetegner den nuværende debat, så præsenteres der ny viden om digital disruption. Som noget nyt udlægges Clayton Christens teori om disruptiv innovation med et særligt fokus på små organisationers mulighed for eksponentiel vækst. Specielt udfoldes...... forholdet mellem disruption og den stadig accelererende digitale udvikling i konturerne til ny teoridannelse om digital disruption. Bogens undertitel ”faretruende og fascinerende forandringer” peger på, at der er behov for en nuanceret debat om digital disruption i modsætning til den tone, der er slået an i...... videre kalder et ”disruption-råd”. Faktisk er rådet skrevet ind i 2016 regeringsgrundlaget for VLK-regeringen. Disruption af organisationer er ikke et nyt fænomen; men hastigheden, hvormed det sker, er stadig accelererende. Årsagen er den globale mega-trend: Digitalisering. Og derfor er specielt digital...

A novel dominant D109A CRYAB mutation in a family with myofibrillar myopathy affects αB-crystallin structure

Directory of Open Access Journals (Sweden)

Jakub P. Fichna

2017-06-01

Molecular modeling in accordance with muscle biopsy microscopic analyses predicted that D109A mutation influence both structure and function of CRYAB due to decreased stability of oligomers leading to aggregate formation. In consequence disrupted sarcomere cytoskeleton organization might lead to muscle pathology. We also suggest that mutated RQDE sequence of CRYAB could impair CRYAB chaperone-like activity and promote aggregation of lens crystallins.

Computational analysis of a novel mutation in ETFDH gene highlights its long-range effects on the FAD-binding motif

Directory of Open Access Journals (Sweden)

Chang Jan-Gowth

2011-10-01

Full Text Available Abstract Background Multiple acyl-coenzyme A dehydrogenase deficiency (MADD is an autosomal recessive disease caused by the defects in the mitochondrial electron transfer system and the metabolism of fatty acids. Recently, mutations in electron transfer flavoprotein dehydrogenase (ETFDH gene, encoding electron transfer flavoprotein:ubiquinone oxidoreductase (ETF:QO have been reported to be the major causes of riboflavin-responsive MADD. To date, no studies have been performed to explore the functional impact of these mutations or their mechanism of disrupting enzyme activity. Results High resolution melting (HRM analysis and sequencing of the entire ETFDH gene revealed a novel mutation (p.Phe128Ser and the hotspot mutation (p.Ala84Thr from a patient with MADD. According to the predicted 3D structure of ETF:QO, the two mutations are located within the flavin adenine dinucleotide (FAD binding domain; however, the two residues do not have direct interactions with the FAD ligand. Using molecular dynamics (MD simulations and normal mode analysis (NMA, we found that the p.Ala84Thr and p.Phe128Ser mutations are most likely to alter the protein structure near the FAD binding site as well as disrupt the stability of the FAD binding required for the activation of ETF:QO. Intriguingly, NMA revealed that several reported disease-causing mutations in the ETF:QO protein show highly correlated motions with the FAD-binding site. Conclusions Based on the present findings, we conclude that the changes made to the amino acids in ETF:QO are likely to influence the FAD-binding stability.

Copper(II) complexes of alloferon 1 with point mutations (H1A) and (H9A) stability structure and biological activity.

Science.gov (United States)

Matusiak, Agnieszka; Kuczer, Mariola; Czarniewska, Elżbieta; Rosiński, Grzegorz; Kowalik-Jankowska, Teresa

2014-09-01

Mono- and polynuclear copper(II) complexes of the alloferon 1 with point mutations (H1A) A(1)GVSGH(6)GQH(9)GVH(12)G (Allo1A) and (H9A) H(1)GVSGH(6)GQA(9)GVH(12)G (Allo9A) have been studied by potentiometric, UV-visible, CD, EPR spectroscopic and mass spectrometry (MS) methods. To obtain a complete complex speciation different metal-to-ligand molar ratios ranging from 1:1 to 4:1 for Allo1A and to 3:1 for Allo9A were studied. The presence of the His residue in first position of the peptide chain changes the coordination abilities of the Allo9A peptide in comparison to that of the Allo1A. Imidazole-N3 atom of N-terminal His residue of the Allo9A peptide forms stable 6-membered chelate with the terminal amino group. Furthermore, the presence of two additional histidine residues in the Allo9A peptide (H(6),H(12)) leads to the formation of the CuL complex with 4N {NH2,NIm-H(1),NIm-H(6),NIm-H(12)} binding site in wide pH range (5-8). For the Cu(II)-Allo1A system, the results demonstrated that at physiological pH7.4 the predominant complex the CuH-1L consists of the 3N {NH2,N(-),CO,NIm} coordination mode. The inductions of phenoloxidase activity and apoptosis in vivo in Tenebrio molitor cells by the ligands and their copper(II) complexes at pH7.4 were studied. The Allo1A, Allo1K peptides and their copper(II) complexes displayed the lowest hemocytotoxic activity while the most active was the Cu(II)-Allo9A complex formed at pH7.4. The results may suggest that the N-terminal-His(1) and His(6) residues may be more important for their proapoptotic properties in insects than those at positions 9 and 12 in the peptide chain. Copyright © 2014 Elsevier Inc. All rights reserved.

MHD stability, operational limits and disruptions

International Nuclear Information System (INIS)

1999-01-01

The present physics understandings of magnetohydrodynamic (MHD) stability of tokamak plasmas, the threshold conditions for onset of MHD instability, and the resulting operational limits on attainable plasma pressure (beta limit) and density (density limit), and the consequences of plasma disruption and disruption related effects are reviewed and assessed in the context of their application to a future DT burning reactor prototype tokamak experiment such as ITER. The principal considerations covered within the MHD stability and beta limit assessments are (i) magnetostatic equilibrium, ideal MHD stability and the resulting ideal MHD beta limit; (ii) sawtooth oscillations and the coupling of sawtooth activity to other types of MHD instability; (iii) neoclassical island resistive tearing modes and the corresponding limits on beta and energy confinement; (iv) wall stabilization of ideal MHD instabilities and resistive wall instabilities; (v) mode locking effects of non-axisymmetric error fields; (vi) edge localized MHD instabilities (ELMs, etc.); and (vii) MHD instabilities and beta/pressure gradient limits in plasmas with actively modified current and magnetic shear profiles. The principal considerations covered within the density limit assessments are (i) empirical density limits; (ii) edge power balance/radiative density limits in ohmic and L-mode plasmas; and (iii) edge parameter related density limits in H-mode plasmas. The principal considerations covered in the disruption assessments are (i) disruption causes, frequency and MHD instability onset; (ii) disruption thermal and current quench characteristics; (iii) vertical instabilities (VDEs), both before and after disruption, and plasma and in-vessel halo currents; (iv) after disruption runaway electron formation, confinement and loss; (v) fast plasma shutdown (rapid externally initiated dissipation of plasma thermal and magnetic energies); (vi) means for disruption avoidance and disruption effect mitigation; and

Mutation of Tyr137 of the universal Escherichia coli fimbrial adhesin FimH relaxes the tyrosine gate prior to mannose binding

Directory of Open Access Journals (Sweden)

Said Rabbani

2017-01-01

Full Text Available The most prevalent diseases manifested by Escherichia coli are acute and recurrent bladder infections and chronic inflammatory bowel diseases such as Crohn's disease. E. coli clinical isolates express the FimH adhesin, which consists of a mannose-specific lectin domain connected via a pilin domain to the tip of type 1 pili. Although the isolated FimH lectin domain has affinities in the nanomolar range for all high-mannosidic glycans, differentiation between these glycans is based on their capacity to form predominantly hydrophobic interactions within the tyrosine gate at the entrance to the binding pocket. In this study, novel crystal structures of tyrosine-gate mutants of FimH, ligand-free or in complex with heptyl α-d-O-mannopyranoside or 4-biphenyl α-d-O-mannopyranoside, are combined with quantum-mechanical calculations and molecular-dynamics simulations. In the Y48A FimH crystal structure, a large increase in the dynamics of the alkyl chain of heptyl α-d-O-mannopyranoside attempts to compensate for the absence of the aromatic ring; however, the highly energetic and stringent mannose-binding pocket of wild-type FimH is largely maintained. The Y137A mutation, on the other hand, is the most detrimental to FimH affinity and specificity: (i in the absence of ligand the FimH C-terminal residue Thr158 intrudes into the mannose-binding pocket and (ii ethylenediaminetetraacetic acid interacts strongly with Glu50, Thr53 and Asn136, in spite of multiple dialysis and purification steps. Upon mutation, pre-ligand-binding relaxation of the backbone dihedral angles at position 137 in the tyrosine gate and their coupling to Tyr48 via the interiorly located Ile52 form the basis of the loss of affinity of the FimH adhesin in the Y137A mutant.

Gene mutations in children with chronic pancreatitis.

Science.gov (United States)

Witt, H

2001-01-01

In the last few years, several genes have been identified as being associated with hereditary and idiopathic chronic pancreatitis (CP), i.e. PRSS1, CFTR and SPINK1. In this study, we investigated 164 unrelated children and adolescents with CP for mutations in disease-associated genes by direct DNA sequencing, SSCP, RFLP and melting curve analysis. In 15 patients, we detected a PRSS1 mutation (8 with A16V, 5 with R122H, 2 with N29I), and in 34 patients, a SPINK1 mutation (30 with N34S, 4 with others). SPINK1 mutations were predominantly found in patients without a family history (29/121). Ten patients were homozygous for N34S, SPINK1 mutations were most common in 'idiopathic' CP, whereas patients with 'hereditary' CP predominantly showed a PRSS1 mutation (R122H, N29I). In patients without a family history, the most common PRSS1 mutation was A16V (7/121). In conclusion, our data suggest that CP may be inherited in a dominant, recessive or multigenetic manner as a result of mutations in the above-mentioned or as yet unidentified genes. This challenges the concept of idiopathic CP as a nongenetic disorder and the differentiation between hereditary and idiopathic CP. Therefore, we propose to classify CP as either 'primary CP' (with or without a family history) or 'secondary CP' caused by toxic, metabolic or other factors.

Kolmogorov-Smirnov statistical test for analysis of ZAP-70 expression in B-CLL, compared with quantitative PCR and IgV(H) mutation status.

Science.gov (United States)

Van Bockstaele, Femke; Janssens, Ann; Piette, Anne; Callewaert, Filip; Pede, Valerie; Offner, Fritz; Verhasselt, Bruno; Philippé, Jan

2006-07-15

ZAP-70 has been proposed as a surrogate marker for immunoglobulin heavy-chain variable region (IgV(H)) mutation status, which is known as a prognostic marker in B-cell chronic lymphocytic leukemia (CLL). The flow cytometric analysis of ZAP-70 suffers from difficulties in standardization and interpretation. We applied the Kolmogorov-Smirnov (KS) statistical test to make analysis more straightforward. We examined ZAP-70 expression by flow cytometry in 53 patients with CLL. Analysis was performed as initially described by Crespo et al. (New England J Med 2003; 348:1764-1775) and alternatively by application of the KS statistical test comparing T cells with B cells. Receiver-operating-characteristics (ROC)-curve analyses were performed to determine the optimal cut-off values for ZAP-70 measured by the two approaches. ZAP-70 protein expression was compared with ZAP-70 mRNA expression measured by a quantitative PCR (qPCR) and with the IgV(H) mutation status. Both flow cytometric analyses correlated well with the molecular technique and proved to be of equal value in predicting the IgV(H) mutation status. Applying the KS test is reproducible, simple, straightforward, and overcomes a number of difficulties encountered in the Crespo-method. The KS statistical test is an essential part of the software delivered with modern routine analytical flow cytometers and is well suited for analysis of ZAP-70 expression in CLL. (c) 2006 International Society for Analytical Cytology.

Associations between Familial Rates of Psychiatric Disorders and De Novo Genetic Mutations in Autism

Directory of Open Access Journals (Sweden)

Kyleen Luhrs

2017-01-01

Full Text Available The purpose of this study was to examine the confluence of genetic and familial risk factors in children with Autism Spectrum Disorder (ASD with distinct de novo genetic events. We hypothesized that gene-disrupting mutations would be associated with reduced rates of familial psychiatric disorders relative to structural mutations. Participants included families of children with ASD in four groups: de novo duplication copy number variations (DUP, n=62, de novo deletion copy number variations (DEL, n=74, de novo likely gene-disrupting mutations (LGDM, n=267, and children without a known genetic etiology (NON, n=2111. Familial rates of psychiatric disorders were calculated from semistructured interviews. Results indicated overall increased rates of psychiatric disorders in DUP families compared to DEL and LGDM families, specific to paternal psychiatric histories, and particularly evident for depressive disorders. Higher rates of depressive disorders in maternal psychiatric histories were observed overall compared to paternal histories and higher rates of anxiety disorders were observed in paternal histories for LGDM families compared to DUP families. These findings support the notion of an additive contribution of genetic etiology and familial factors are associated with ASD risk and highlight critical need for continued work targeting these relationships.

Disruption of a Ciliary B9 Protein Complex Causes Meckel Syndrome

Science.gov (United States)

Dowdle, William E.; Robinson, Jon F.; Kneist, Andreas; Sirerol-Piquer, M. Salomé; Frints, Suzanna G.M.; Corbit, Kevin C.; Zaghloul, Norran A.; van Lijnschoten, Gesina; Mulders, Leon; Verver, Dideke E.; Zerres, Klaus; Reed, Randall R.; Attié-Bitach, Tania; Johnson, Colin A.; García-Verdugo, José Manuel; Katsanis, Nicholas; Bergmann, Carsten; Reiter, Jeremy F.

2011-01-01

Nearly every ciliated organism possesses three B9 domain-containing proteins: MKS1, B9D1, and B9D2. Mutations in human MKS1 cause Meckel syndrome (MKS), a severe ciliopathy characterized by occipital encephalocele, liver ductal plate malformations, polydactyly, and kidney cysts. Mouse mutations in either Mks1 or B9d2 compromise ciliogenesis and result in phenotypes similar to those of MKS. Given the importance of these two B9 proteins to ciliogenesis, we examined the role of the third B9 protein, B9d1. Mice lacking B9d1 displayed polydactyly, kidney cysts, ductal plate malformations, and abnormal patterning of the neural tube, concomitant with compromised ciliogenesis, ciliary protein localization, and Hedgehog (Hh) signal transduction. These data prompted us to screen MKS patients for mutations in B9D1 and B9D2. We identified a homozygous c.301A>C (p.Ser101Arg) B9D2 mutation that segregates with MKS, affects an evolutionarily conserved residue, and is absent from controls. Unlike wild-type B9D2 mRNA, the p.Ser101Arg mutation failed to rescue zebrafish phenotypes induced by the suppression of b9d2. With coimmunoprecipitation and mass spectrometric analyses, we found that Mks1, B9d1, and B9d2 interact physically, but that the p.Ser101Arg mutation abrogates the ability of B9d2 to interact with Mks1, further suggesting that the mutation compromises B9d2 function. Our data indicate that B9d1 is required for normal Hh signaling, ciliogenesis, and ciliary protein localization and that B9d1 and B9d2 are essential components of a B9 protein complex, disruption of which causes MKS. PMID:21763481

Ablation of whirlin long isoform disrupts the USH2 protein complex and causes vision and hearing loss.

Directory of Open Access Journals (Sweden)

Jun Yang

2010-05-01

Full Text Available Mutations in whirlin cause either Usher syndrome type II (USH2, a deafness-blindness disorder, or nonsyndromic deafness. The molecular basis for the variable disease expression is unknown. We show here that only the whirlin long isoform, distinct from a short isoform by virtue of having two N-terminal PDZ domains, is expressed in the retina. Both long and short isoforms are expressed in the inner ear. The N-terminal PDZ domains of the long whirlin isoform mediates the formation of a multi-protein complex that includes usherin and VLGR1, both of which are also implicated in USH2. We localized this USH2 protein complex to the periciliary membrane complex (PMC in mouse photoreceptors that appears analogous to the frog periciliary ridge complex. The latter is proposed to play a role in photoreceptor protein trafficking through the connecting cilium. Mice carrying a targeted disruption near the N-terminus of whirlin manifest retinal and inner ear defects, reproducing the clinical features of human USH2 disease. This is in contrast to mice with mutations affecting the C-terminal portion of whirlin in which the phenotype is restricted to the inner ear. In mice lacking any one of the USH2 proteins, the normal localization of all USH2 proteins is disrupted, and there is evidence of protein destabilization. Taken together, our findings provide new insights into the pathogenic mechanism of Usher syndrome. First, the three USH2 proteins exist as an obligatory functional complex in vivo, and loss of one USH2 protein is functionally close to loss of all three. Second, defects in the three USH2 proteins share a common pathogenic process, i.e., disruption of the PMC. Third, whirlin mutations that ablate the N-terminal PDZ domains lead to Usher syndrome, but non-syndromic hearing loss will result if they are spared.

Disruption?

DEFF Research Database (Denmark)

2016-01-01

This is a short video on the theme disruption and entrepreneurship. It takes the form of an interview with John Murray......This is a short video on the theme disruption and entrepreneurship. It takes the form of an interview with John Murray...

Characterization of a disease-causing Glu119-Lys mutation in the low-density lipoprotein receptor gene in two Danish families with heterozygous familial hypercholesterolemia

DEFF Research Database (Denmark)

Jensen, H K; Jensen, T G; Jensen, L G

1994-01-01

acid residue 119 in the third repeat of the cysteine-rich ligand binding domain of the mature LDL receptor. Disruption of LDL receptor function by the Glu119-Lys mutation was confirmed by site-directed mutagenesis and expression in COS-7 cells. By Western blotting the mutation was found to affect...

Deriving a Mutation Index of Carcinogenicity Using Protein Structure and Protein Interfaces

Science.gov (United States)

Hakas, Jarle; Pearl, Frances; Zvelebil, Marketa

2014-01-01

With the advent of Next Generation Sequencing the identification of mutations in the genomes of healthy and diseased tissues has become commonplace. While much progress has been made to elucidate the aetiology of disease processes in cancer, the contributions to disease that many individual mutations make remain to be characterised and their downstream consequences on cancer phenotypes remain to be understood. Missense mutations commonly occur in cancers and their consequences remain challenging to predict. However, this knowledge is becoming more vital, for both assessing disease progression and for stratifying drug treatment regimes. Coupled with structural data, comprehensive genomic databases of mutations such as the 1000 Genomes project and COSMIC give an opportunity to investigate general principles of how cancer mutations disrupt proteins and their interactions at the molecular and network level. We describe a comprehensive comparison of cancer and neutral missense mutations; by combining features derived from structural and interface properties we have developed a carcinogenicity predictor, InCa (Index of Carcinogenicity). Upon comparison with other methods, we observe that InCa can predict mutations that might not be detected by other methods. We also discuss general limitations shared by all predictors that attempt to predict driver mutations and discuss how this could impact high-throughput predictions. A web interface to a server implementation is publicly available at http://inca.icr.ac.uk/. PMID:24454733

Mutation analysis of the WFS1 gene in seven Danish Wolfram syndrome families; four new mutations identified

DEFF Research Database (Denmark)

Hansen, Lars; Eiberg, Hans Rudolf Lytchoff; Barrett, Timothy

2005-01-01

loss (LFSNHL). WFS1 variants were identified in eight subjects from seven families with WS, leading to the identification of four novel mutations, Q194X (nonsense), H313Y (missense), L313fsX360 (duplication frame shift) and F883fsX951 (deletion frame shift), and four previously reported mutations, A133...

The mutator pathway is a feature of immunodeficiency-related lymphomas

Science.gov (United States)

Duval, Alex; Raphael, Martine; Brennetot, Caroline; Poirel, Helene; Buhard, Olivier; Aubry, Alban; Martin, Antoine; Krimi, Amor; Leblond, Veronique; Gabarre, Jean; Davi, Frederic; Charlotte, Frederic; Berger, Francoise; Gaidano, Gianluca; Capello, Daniela; Canioni, Danielle; Bordessoule, Dominique; Feuillard, Jean; Gaulard, Philippe; Delfau, Marie Helene; Ferlicot, Sophie; Eclache, Virginie; Prevot, Sophie; Guettier, Catherine; Lefevre, Pascale Cornillet; Adotti, Francoise; Hamelin, Richard

2004-01-01

The mutator phenotype caused by defects in the mismatch repair system is observed in a subset of solid neoplasms characterized by widespread microsatellite instability-high (MSI-H). It is known to be very rare in non-Hodgkin lymphomas (NHL), whereas mutator NHL is the most frequent tumor subtype in mismatch repair-deficient mice. By screening a series of 603 human NHL with specific markers of the mutator phenotype, we found here 12 MSI-H cases (12/603, 2%). Of interest, we demonstrated that this phenotype was specifically associated with immunodeficiency-related lymphomas (ID-RL), because it was observed in both posttransplant lymphoproliferative disorders (9/111, 8.1%) and HIV infection-related lymphomas (3/128, 2.3%) but not in a large series of NHL arising in the general population (0/364) (P < 0.0001). The MSI pathway is known to lead to the production of hundreds of abnormal protein neoantigens that are generated in MSI-H neoplasms by frameshift mutations of a number of genes containing coding microsatellite sequences. As expected, MSI-H ID-RL were found to harbor such genetic alterations in 12 target genes with a putative role in lymphomagenesis. The observation that the MSI-H phenotype was restricted to HIV infection-related lymphomas and posttransplant lymphoproliferative disorders suggests the existence of the highly immunogenic mutator pathway as a novel oncogenic process in lymphomagenesis whose role is favored when host immunosurveillance is reduced. Because MSI-H-positive cases were found to be either Epstein-Barr virus-positive or -negative, the mutator pathway should act synergistically or not with this other oncogenic factor, playing an important role in ID-RL. PMID:15047891

Informed Principal Model and Contract in Supply Chain with Demand Disruption Asymmetric Information

Directory of Open Access Journals (Sweden)

Huan Zhang

2016-01-01

Full Text Available Because of the frequency and disastrous influence, the supply chain disruption has caused extensive concern both in the industry and in the academia. In a supply chain with one manufacturer and one retailer, the demand of the retailer is uncertain and meanwhile may suffer disruption with a probability. Taking the demand disruption probability as the retailer’s asymmetric information, an informed principal model with the retailer as the principal is explored to make the contract. The retailer can show its information to the manufacturer through the contract. It is found out that the high-risk retailer intends to pretend to be the low-risk one. So the separating contract is given through the low-information-intensity allocation, in which the order quantity and the transferring payment for the low-risk retailer distort upwards, but those of high-risk retailer do not distort. In order to reduce the signaling cost which the low-risk retailer pays, the interim efficient model is introduced, which ends up with the order quantity and transferring payment distorting upwards again but less than before. In the numerical examples, with two different mutation probabilities, the informed principal contracts show the application of the informed principal model in the supply chain with demand disruption.

Expression and new exon mutations of the human Beta defensins and their association on colon cancer development.

Directory of Open Access Journals (Sweden)

Abdelhabib Semlali

Full Text Available The development of cancer involves genetic predisposition and a variety of environmental exposures. Genome-wide linkage analyses provide evidence for the significant linkage of many diseases to susceptibility loci on chromosome 8p23, the location of the human defensin gene cluster. Human β-defensins (hBDs are important molecules of innate immunity. This study was designed to analyze the expression and genetic variations in hBDs (hBD-1, hBD-2, hBD-3 and hBD-4 and their putative association with colon cancer. hBD gene expression and relative protein expression were evaluated by Real-Time polymerase chain reaction (qPCR and immunohistochemistry, respectively, from 40 normal patients and 40 age-matched patients with colon cancer in Saudi Arabia. In addition, hBD polymorphisms were genotyped by exon sequencing and by promoter methylation. hBD-1, hBD-2, hBD-3 and hBD-4 basal messenger RNA expression was significantly lower in tumor tissues compared with normal tissues. Several insertion mutations were detected in different exons of the analyzed hBDs. However, no methylation in any hBDs promoters was detected because of the limited number of CpG islands in these regions. We demonstrated for the first time a link between hBD expression and colon cancer. This suggests that there is a significant link between innate immunity deregulation through disruption of cationic peptides (hBDs and the potential development of colon cancer.

Splicing Analysis of Exonic OCRL Mutations Causing Lowe Syndrome or Dent-2 Disease

Directory of Open Access Journals (Sweden)

Lorena Suarez-Artiles

2018-01-01

Full Text Available Mutations in the OCRL gene are associated with both Lowe syndrome and Dent-2 disease. Patients with Lowe syndrome present congenital cataracts, mental disabilities and a renal proximal tubulopathy, whereas patients with Dent-2 disease exhibit similar proximal tubule dysfunction but only mild, or no additional clinical defects. It is not yet understood why some OCRL mutations cause the phenotype of Lowe syndrome, while others develop the milder phenotype of Dent-2 disease. Our goal was to gain new insights into the consequences of OCRL exonic mutations on pre-mRNA splicing. Using predictive bioinformatics tools, we selected thirteen missense mutations and one synonymous mutation based on their potential effects on splicing regulatory elements or splice sites. These mutations were analyzed in a minigene splicing assay. Results of the RNA analysis showed that three presumed missense mutations caused alterations in pre-mRNA splicing. Mutation c.741G>T; p.(Trp247Cys generated splicing silencer sequences and disrupted splicing enhancer motifs that resulted in skipping of exon 9, while mutations c.2581G>A; p.(Ala861Thr and c.2581G>C; p.(Ala861Pro abolished a 5′ splice site leading to skipping of exon 23. Mutation c.741G>T represents the first OCRL exonic variant outside the conserved splice site dinucleotides that results in alteration of pre-mRNA splicing. Our results highlight the importance of evaluating the effects of OCRL exonic mutations at the mRNA level.

ZAP-70 expression in B-cell chronic lymphocytic leukemia: evaluation by external (isotypic) or internal (T/NK cells) controls and correlation with IgV(H) mutations.

Science.gov (United States)

Zucchetto, Antonella; Bomben, Riccardo; Bo, Michele Dal; Nanni, Paola; Bulian, Pietro; Rossi, Francesca Maria; Del Principe, Maria Ilaria; Santini, Simone; Del Poeta, Giovanni; Degan, Massimo; Gattei, Valter

2006-07-15

Expression of T cell specific zeta-associated protein 70 (ZAP-70) by B-cell chronic lymphocytic leukemia (B-CLL) cells, as investigated by flow cytometry, has both prognostic relevance and predictive power as surrogate for immunoglobulin heavy chain variable region (IgV(H)) mutations, although a standardization of the cytometric protocol is still lacking. Flow cytometric analyses for ZAP-70 were performed in peripheral blood samples from 145 B-CLL (124 with IgV(H) mutations) by a standard three-color protocol. Identification of ZAP-70(+) cell population was based on an external negative control, i.e., the isotypic control (ISO method) or an internal positive control, i.e., the population of residual normal T/NK cells (TNK method). A comparison between these two approaches was performed. While 86/145 cases were concordant as for ZAP-70 expression according to the two methods (ISO(+)TNK(+) or ISO(-)TNK(-)), 59/145 cases had discordant ZAP-70 expression, mainly (56/59) showing a ISO(+)TNK(-) profile. These latter cases express higher levels of ZAP-70 in their normal T cell component. Moreover, discordant ISO(+)TNK(-) cases had a IgV(H) gene mutation profile similar to that of concordantly positive cases and different from ZAP-70 concordantly negative B-CLL. Analysis of ZAP-70 expression by B-CLL cells by using the ISO method allows to overcome the variability in the expression of ZAP-70 by residual T cells and yields a better correlation with IgV(H) gene mutations. A receiver operating characteristic analysis suggests to employ a higher cut-off than the commonly used 20%. A parallel evaluation of the prognostic value of ZAP-70 expression, as determined according to the ISO and TNK methods, is still needed. (c) 2006 International Society for Analytical Cytology.

Genetic evidence of 'genuine' empty follicle syndrome: a novel effective mutation in the LHCGR gene and review of the literature.

Science.gov (United States)

Yuan, Ping; He, Zuyong; Zheng, Lingyan; Wang, Wenjun; Li, Yu; Zhao, Haijing; Zhang, Victor Wei; Zhang, Qingxue; Yang, Dongzi

2017-04-01

Empty follicle syndrome (EFS) is a reproductive disorder in which no oocytes are retrieved during IVF. The existence of genuine EFS (GEFS) is still controversial, and to date, only one missense mutation of Luteinizing Hormone/Choriogonadotropin Receptor (LHCGR) has been reported to be associated with this disease. Here, we describe a GEFS patient in a non-consanguineous family from China. A 27-year-old woman presented with a 5-year history of primary infertility and LH resistance-like ovaries of unequal sizes, but with normal levels of circulating LH. In spite of a satisfactory ovarian reserve and response, no oocytes were retrieved after two cycles of IVF. Her condition did not appear to be failure of the hCG injection. It is more likely to be a genetic cause. A novel homozygous mutation in LHCGR gene, c.1345G>A (p.Ala449Thr), was detected in this patient. Each of her parents is heterozygous for this change, and the change was absent from 407 control subjects. Alanine at this amino acid position was highly conserved and replacement of threonine was predicted to disrupt the third transmembrane helix of the rhodopsin-like G protein-coupled receptor domain. Protein localization studies revealed that a portion of the mutant LHCGR protein molecules was retained intracellularly. Signalling studies demonstrated that this mutation had differing effects on the response of LHCGR to hCG or LH at different concentrations. Specifically, at a concentration 1 IU/ml), the mutant was activated by both hCG and LH. These data suggest that screening for mutations in the LHCGR gene may assist in the diagnosis of patients with GEFS. The literature describing the relationship between phenotype and genotypes in females is reviewed, and possible aetiologies and treatment options for this disease are proposed based on our and other studies. © The Author 2017. Published by Oxford University Press on behalf of the European Society of Human Reproduction and Embryology. All rights reserved

The PB2-K627E mutation attenuates H3N2 swine influenza virus in cultured cells and in mice.

Science.gov (United States)

Gong, Xiao-Qian; Ruan, Bao-Yang; Liu, Xiao-Min; Zhang, Peng; Wang, Xiu-Hui; Wang, Qi; Shan, Tong-Ling; Tong, Wu; Zhou, Yan-Jun; Li, Guo-Xin; Zheng, Hao; Tong, Guang-Zhi; Yu, Hai

2018-04-01

PB2-627K is an important amino acid that determines the virulence of some influenza A viruses. However, it has not been experimentally investigated in the H3N2 swine influenza virus. To explore the potential role of PB2-K627E substitution in H3N2 swine influenza virus, the growth properties and pathogenicity between H3N2 swine influenza virus and its PB2-K627E mutant were compared. For the first time, our results showed that PB2-K627E mutation attenuates H3N2 swine influenza virus in mammalian cells and in mice, suggesting that PB2-627K is required for viral replication and pathogenicity of H3N2 swine influenza virus. Copyright © 2017 Elsevier Ltd. All rights reserved.

Use of human tissue to assess the oncogenic activity of melanoma-associated mutations.

Science.gov (United States)

Chudnovsky, Yakov; Adams, Amy E; Robbins, Paul B; Lin, Qun; Khavari, Paul A

2005-07-01

Multiple genetic alterations occur in melanoma, a lethal skin malignancy of increasing incidence. These include mutations that activate Ras and two of its effector cascades, Raf and phosphoinositide 3-kinase (PI3K). Induction of Ras and Raf can be caused by active N-Ras and B-Raf mutants as well as by gene amplification. Activation of PI3K pathway components occurs by PTEN loss and by AKT3 amplification. Melanomas also commonly show impairment of the p16(INK4A)-CDK4-Rb and ARF-HDM2-p53 tumor suppressor pathways. CDKN2A mutations can produce p16(INK4A) and ARF protein loss. Rb bypass can also occur through activating CDK4 mutations as well as by CDK4 amplification. In addition to ARF deletion, p53 pathway disruption can result from dominant negative TP53 mutations. TERT amplification also occurs in melanoma. The extent to which these mutations can induce human melanocytic neoplasia is unknown. Here we characterize pathways sufficient to generate human melanocytic neoplasia and show that genetically altered human tissue facilitates functional analysis of mutations observed in human tumors.

How useful is esophageal high resolution manometry in diagnosing gastroesophageal junction disruption: causes affecting this disruption and its relationship with manometric alterations and gastroesophageal reflux

Directory of Open Access Journals (Sweden)

Constanza Ciriza-de-los-Ríos

2014-01-01

Full Text Available Background: High-resolution manometry (HRM is a breakthrough in the morphological study of the gastroesophageal junction (GEJ and its degrees of disruption. Objectives: a Assessment of risk factors involved in the disruption of the GEJ in patients with gastroesophageal reflux (GER symptoms; b the relationship between the type of GEJ and GER demonstrated by 24 hours pH-monitoring; and c identification of the alterations in the manometric parameters related to the morphology of the GEJ. Methods: One hundred and fifteen patients with symptoms of GER studied with HRM and classified by the type of GEJ (type I: Normal; type II: Sliding; type III: Hiatal hernia. Twenty four hour pH-monitoring without proton pump inhibitors was performed in all of them. Epidemiological aspects, manometric parameters (Chicago 2012 classification and the pH-monitoring results were evaluated. Results: Age (OR 1.033 [1.006-1.060]; p = 0.16, BMI (OR 1.097 [1.022-1.176]; p = 0. 01 and abdominal perimeter (OR 1.034 [1.005-1.063]; p = 0.0215 were independent risk factors for the GEJ type III (area under the curve 0.70. Disruption of the GEJ was associated with a lower resting pressure (p = 0.006, greater length (p < 0.001 and greater esophageal shortening (p < 0.001. Abnormal acidic reflux was found in the total period (p = 0.015, standing (p = 0.022 and supine (p = 0.001 in patients with GEJ type II and III with respect to type I. Conclusions: Increased age, overweight and central obesity pose a higher risk of GEJ type III (hiatal hernia. The greater disruption of the GEJ is associated with lower resting pressure, esophageal shortening, and higher acid exposure in the pH-monitoring.

Disruption effects on the beam size measurement

Energy Technology Data Exchange (ETDEWEB)

Raimondi, P.; Decker, F.J.; Chen, P.

1995-06-01

At the SLC Final Focus with higher currents and smaller beam sizes, the disruption parameter D{sub y} is close to one and so the pinch effect should produce a luminosity enhancement. Since a flat beam-beam function is fit to deflection scan data to measure the beam size, disruption can affect the measurement. Here the authors discuss the quantitative effects of disruption for typical SLC beam parameters. With 3.5 10{sup 10} particles per pulse, bunch length of 0.8 mm and beam sizes of 2.1 {mu}m horizontally and 0.55 {mu}m vertically, the measured vertical size can be as much as 25% bigger than the real one. Furthermore during the collision the spot size actually decrease, producing an enhancement factor H{sub D} of about 1.25. This would yield to a true luminosity which is 1.6 times that which is estimated from the beam-beam deflection fit.

Disruption effects on the beam size measurement

International Nuclear Information System (INIS)

Raimondi, P.; Decker, F.J.; Chen, P.

1995-01-01

At the SLC Final Focus with higher currents and smaller beam sizes, the disruption parameter D y is close to one and so the pinch effect should produce a luminosity enhancement. Since a flat beam-beam function is fit to deflection scan data to measure the beam size, disruption can affect the measurement. Here the authors discuss the quantitative effects of disruption for typical SLC beam parameters. With 3.5 10 10 particles per pulse, bunch length of 0.8 mm and beam sizes of 2.1 μm horizontally and 0.55 μm vertically, the measured vertical size can be as much as 25% bigger than the real one. Furthermore during the collision the spot size actually decrease, producing an enhancement factor H D of about 1.25. This would yield to a true luminosity which is 1.6 times that which is estimated from the beam-beam deflection fit

Effects of Downregulation of MicroRNA-181a on H2O2-Induced H9c2 Cell Apoptosis via the Mitochondrial Apoptotic Pathway

Directory of Open Access Journals (Sweden)

Lei Wang

2014-01-01

Full Text Available Glutathione peroxidase-1 (GPx1 is a pivotal intracellular antioxidant enzyme that enzymatically reduces hydrogen peroxide to water to limit its harmful effects. This study aims to identify a microRNA (miRNA that targets GPx1 to maintain redox homeostasis. Dual luciferase assays combined with mutational analysis and immunoblotting were used to validate the bioinformatically predicted miRNAs. We sought to select miRNAs that were responsive to oxidative stress induced by hydrogen peroxide (H2O2 in the H9c2 rat cardiomyocyte cell line. Quantitative real-time PCR (qPCR demonstrated that the expression of miR-181a in H2O2-treated H9c2 cells was markedly upregulated. The downregulation of miR-181a significantly inhibited H2O2-induced cellular apoptosis, ROS production, the increase in malondialdehyde (MDA levels, the disruption of mitochondrial structure, and the activation of key signaling proteins in the mitochondrial apoptotic pathway. Our results suggest that miR-181a plays an important role in regulating the mitochondrial apoptotic pathway in cardiomyocytes challenged with oxidative stress. MiR-181a may represent a potential therapeutic target for the treatment of oxidative stress-associated cardiovascular diseases.

Formulation and characterization of poly(propylacrylic acid)/poly(lactic-co-glycolic acid) blend microparticles for pH-dependent membrane disruption and cytosolic delivery.

Science.gov (United States)

Fernando, Lawrence P; Lewis, Jamal S; Evans, Brian C; Duvall, Craig L; Keselowsky, Benjamin G

2018-04-01

Poly(lactic-co-glycolic acid) (PLGA) is widely used as a vehicle for delivery of pharmaceutically relevant payloads. PLGA is readily fabricated as a nano- or microparticle (MP) matrix to load both hydrophobic and hydrophilic small molecular drugs as well as biomacromolecules such as nucleic acids and proteins. However, targeting such payloads to the cell cytosol is often limited by MP entrapment and degradation within acidic endolysosomes. Poly(propylacrylic acid) (PPAA) is a polyelectrolyte polymer with the membrane disruptive capability triggered at low pH. PPAA has been previously formulated in various carrier configurations to enable cytosolic payload delivery, but requires sophisticated carrier design. Taking advantage of PPAA functionality, we have incorporated PPAA into PLGA MPs as a simple polymer mixture to enhance cytosolic delivery of PLGA-encapsulated payloads. Rhodamine loaded PLGA and PPAA/PLGA blend MPs were prepared by a modified nanoprecipitation method. Incorporation of PPAA into PLGA MPs had little to no effect on the size, shape, or loading efficiency, and evidenced no toxicity in Chinese hamster ovary epithelial cells. Notably, incorporation of PPAA into PLGA MPs enabled pH-dependent membrane disruption in a hemolysis assay, and a three-fold increased endosomal escape and cytosolic delivery in dendritic cells after 2 h of MP uptake. These results demonstrate that a simple PLGA/PPAA polymer blend is readily fabricated into composite MPs, enabling cytosolic delivery of an encapsulated payload. © 2017 Wiley Periodicals, Inc. J Biomed Mater Res Part A: 106A: 1022-1033, 2018. © 2017 Wiley Periodicals, Inc.

Identification of Novel Mutations in FAH Gene and Prenatal Diagnosis of Tyrosinemia in Indian Family

Directory of Open Access Journals (Sweden)

Jayesh J. Sheth

2012-01-01

Full Text Available Carrier of tyrosinemia type I was diagnosed by sequencing FAH (fumarylacetoacetate hydrolase gene. It leads to the identification of heterozygous status for both c.648C>G (p.Ile216Met and c.1159G>A (p.Gly387Arg mutations in exons 8 and 13, respectively, in the parents. The experimental program PolyPhen, SIFT, and MT predicts former missense point mutation as “benign” that creates a potential donor splice site and later one as “probably damaging” which disrupts secondary structure of protein.

Disease-Causing Mutations in the G Protein Gαs Subvert the Roles of GDP and GTP.

Science.gov (United States)

Hu, Qi; Shokat, Kevan M

2018-05-17

The single most frequent cancer-causing mutation across all heterotrimeric G proteins is R201C in Gαs. The current model explaining the gain-of-function activity of the R201 mutations is through the loss of GTPase activity and resulting inability to switch off to the GDP state. Here, we find that the R201C mutation can bypass the need for GTP binding by directly activating GDP-bound Gαs through stabilization of an intramolecular hydrogen bond network. Having found that a gain-of-function mutation can convert GDP into an activator, we postulated that a reciprocal mutation might disrupt the normal role of GTP. Indeed, we found R228C, a loss-of-function mutation in Gαs that causes pseudohypoparathyroidism type 1a (PHP-Ia), compromised the adenylyl cyclase-activating activity of Gαs bound to a non-hydrolyzable GTP analog. These findings show that disease-causing mutations in Gαs can subvert the canonical roles of GDP and GTP, providing new insights into the regulation mechanism of G proteins. Copyright © 2018 Elsevier Inc. All rights reserved.

The E2.65A mutation disrupts dynamic binding poses of SB269652 at the dopamine D2 and D3 receptors.

Directory of Open Access Journals (Sweden)

Ravi Kumar Verma

2018-01-01

Full Text Available The dopamine D2 and D3 receptors (D2R and D3R are important targets for antipsychotics and for the treatment of drug abuse. SB269652, a bitopic ligand that simultaneously binds both the orthosteric binding site (OBS and a secondary binding pocket (SBP in both D2R and D3R, was found to be a negative allosteric modulator. Previous studies identified Glu2.65 in the SBP to be a key determinant of both the affinity of SB269652 and the magnitude of its cooperativity with orthosteric ligands, as the E2.65A mutation decreased both of these parameters. However, the proposed hydrogen bond (H-bond between Glu2.65 and the indole moiety of SB269652 is not a strong interaction, and a structure activity relationship study of SB269652 indicates that this H-bond may not be the only element that determines its allosteric properties. To understand the structural basis of the observed phenotype of E2.65A, we carried out molecular dynamics simulations with a cumulative length of ~77 μs of D2R and D3R wild-type and their E2.65A mutants bound to SB269652. In combination with Markov state model analysis and by characterizing the equilibria of ligand binding modes in different conditions, we found that in both D2R and D3R, whereas the tetrahydroisoquinoline moiety of SB269652 is stably bound in the OBS, the indole-2-carboxamide moiety is dynamic and only intermittently forms H-bonds with Glu2.65. Our results also indicate that the E2.65A mutation significantly affects the overall shape and size of the SBP, as well as the conformation of the N terminus. Thus, our findings suggest that the key role of Glu2.65 in mediating the allosteric properties of SB269652 extends beyond a direct interaction with SB269652, and provide structural insights for rational design of SB269652 derivatives that may retain its allosteric properties.

TP53 mutation p.R337H in gastric cancer tissues of a 12-year-old male child - evidence for chimerism involving a common mutant founder haplotype: case report

International Nuclear Information System (INIS)

Silva, Edaise M da; W Achatz, Maria Isabel; Martel-Planche, Ghyslaine; Montagnini, André L; Olivier, Magali; Prolla, Patricia A; Hainaut, Pierre; Soares, Fernando A

2011-01-01

Gastric adenocarcinoma is rare in children and adolescents, with about 17 cases under age 21 in the world's literature. We report a case of invasive well-differentiated metastatic gastric cancer in a Brazilian 12-year-old boy without documented familial history of cancer. The patient, diagnosed with metastatic disease, died seven months after surgery. DNA from intra-surgical specimens revealed a TP53 mutation at codon 337 (p.R337H) in samples with neoplastic cells (dysplasia, tumor and metastasis) but not in non-transformed cells (incomplete intestinal metaplasia and non-involved celiac lymph node). In all mutation-positive tissues, p.R337H occurred on the same background, a founder allele identified by a specific haplotype previously described in Brazilian Li-Fraumeni syndrome patients. The same mutant haplotype, corresponding to a founder mutation present in 0.3% of the general population in Southern Brazil, was found in the genome of the father. Presence of this inherited haplotype in the tumor as well as in the father's germline, suggests a rare case of microchimerism in this patient, who may have harbored a small number of mutant cells originating in another individual, perhaps a dizygotic twin that died early in gestation. This case represents one of the earliest ages at diagnosis of gastric cancer ever reported. It shows that cancer inheritance can occur in the absence of an obvious germline mutation, calling for caution in assessing early cancers in populations with common founder mutations such as p.R337H in Southern Brazil

Different Phenotypes of the Two Chinese Probands with the Same c.889G>A (p.C162Y Mutation in COCH Gene Verify Different Mechanisms Underlying Autosomal Dominant Nonsyndromic Deafness 9.

Directory of Open Access Journals (Sweden)

Qi Wang

Full Text Available By analyzing the different phenotypes of two Chinese DFNA9 families with the same mutation located in the intervening region between the LCCL and vWFA domains of cochlin and testing the functional changes in the mutant cochlin, we investigated the different pathogeneses for mutations in LCCL and vWFA domains.Targeted next-generation sequencing for deafness-related genes was used to identify the mutation in the proband in family #208. The probands of family #208 and family #32 with the same p.C162Y mutation were followed for more than 3 years to evaluate the progression of hearing loss and vestibular dysfunction using pure-tone audiometry, caloric testing, electrocochleogram, vestibular-evoked myogenic potential, and video head-impulse test. The disruption of normal cleavage to produce secreted LCCL domain fragments and the tendency to form aggregations of mutant cochlins were tested by in vitro cell experiments.The two families showed different clinical symptoms. Family #32 was identified as having early-onset, progressive sensorineural hearing loss, similar to the symptoms in DFNA9 patients with cochlin mutations in the vWFA domain. The proband of family #208 endured late-onset recurrent paroxysmal vertigo attacks and progressively deteriorating hearing, similar to symptoms in those with cochlin mutations in the LCCL domain. We therefore suggest that the disrupted cleavage of the LCCL domain fragment is likely to cause vestibular dysfunction, and aggregation of mutant cochlin caused by mutations in the vWFA domain is responsible for early-onset hearing loss. The p.C162Y mutation causes either disruption of LCCL domain fragment cleavage or aggregation of mutant cochlin, resulting in the different phenotypes in the two families.This study demonstrates that DFNA9 families with the same genotype may have significantly different phenotypes. The mutation site in cochlin is related to the pathological mechanism underlying the different phenotypes.

Alteration of intersubunit acid–base pair interactions at the quasi-threefold axis of symmetry of Cucumber mosaic virus disrupts aphid vector transmission

International Nuclear Information System (INIS)

Bricault, Christine A.; Perry, Keith L.

2013-01-01

In the atomic model of Cucumber mosaic virus (CMV), six amino acid residues form stabilizing salt bridges between subunits of the asymmetric unit at the quasi-threefold axis of symmetry. To evaluate the effects of these positions on virion stability and aphid vector transmissibility, six charged amino acid residues were individually mutated to alanine. All of the six engineered viruses were viable and exhibited near wild type levels of virion stability in the presence of urea. Aphid vector transmissibility was nearly or completely eliminated in the case of four of the mutants; two mutants demonstrated intermediate aphid transmissibility. For the majority of the engineered mutants, second-site mutations were observed following aphid transmission and/or mechanical passaging, and one restored transmission rates to that of the wild type. CMV capsids tolerate disruption of acid–base pairing interactions at the quasi-threefold axis of symmetry, but these interactions are essential for maintaining aphid vector transmissibility. - Highlights: ► Amino acids between structural subunits of Cucumber mosaic virus affect vector transmission. ► Mutant structural stability was retained, while aphid vector transmissibility was disrupted. ► Spontaneous, second-site mutations restored aphid vector transmissibility

Alteration of intersubunit acid–base pair interactions at the quasi-threefold axis of symmetry of Cucumber mosaic virus disrupts aphid vector transmission

Energy Technology Data Exchange (ETDEWEB)

Bricault, Christine A. [Department of Plant Pathology and Plant-Microbe Biology, 334 Plant Science Building, Cornell University, Ithaca, NY 14850 (United States); Perry, Keith L., E-mail: KLP3@cornell.edu [Department of Plant Pathology and Plant-Microbe Biology, 334 Plant Science Building, Cornell University, Ithaca, NY 14850 (United States)

2013-06-05

In the atomic model of Cucumber mosaic virus (CMV), six amino acid residues form stabilizing salt bridges between subunits of the asymmetric unit at the quasi-threefold axis of symmetry. To evaluate the effects of these positions on virion stability and aphid vector transmissibility, six charged amino acid residues were individually mutated to alanine. All of the six engineered viruses were viable and exhibited near wild type levels of virion stability in the presence of urea. Aphid vector transmissibility was nearly or completely eliminated in the case of four of the mutants; two mutants demonstrated intermediate aphid transmissibility. For the majority of the engineered mutants, second-site mutations were observed following aphid transmission and/or mechanical passaging, and one restored transmission rates to that of the wild type. CMV capsids tolerate disruption of acid–base pairing interactions at the quasi-threefold axis of symmetry, but these interactions are essential for maintaining aphid vector transmissibility. - Highlights: ► Amino acids between structural subunits of Cucumber mosaic virus affect vector transmission. ► Mutant structural stability was retained, while aphid vector transmissibility was disrupted. ► Spontaneous, second-site mutations restored aphid vector transmissibility.

Mutational spectrum of Duchenne muscular dystrophy in Spain: Study of 284 cases.

Science.gov (United States)

Vieitez, I; Gallano, P; González-Quereda, L; Borrego, S; Marcos, I; Millán, J M; Jairo, T; Prior, C; Molano, J; Trujillo-Tiebas, M J; Gallego-Merlo, J; García-Barcina, M; Fenollar, M; Navarro, C

Duchenne muscular dystrophy (DMD) is a severe X-linked recessive neuromuscular disease that affects one in 3500 live-born males. The total absence of dystrophin observed in DMD patients is generally caused by mutations that disrupt the reading frame of the DMD gene, and about 80% of cases harbour deletions or duplications of one or more exons. We reviewed 284 cases of males with a genetic diagnosis of DMD between 2007 and 2014. These patients were selected from 8 Spanish reference hospitals representing most areas of Spain. Multiplex PCR, MLPA, and sequencing were performed to identify mutations. Most of these DMD patients present large deletions (46.1%) or large duplications (19.7%) in the dystrophin gene. The remaining 34.2% correspond to point mutations, and half of these correspond to nonsense mutations. In this study we identified 23 new mutations in DMD: 7 large deletions and 16 point mutations. The algorithm for genetic diagnosis applied by the participating centres is the most appropriate for genotyping patients with DMD. The genetic specificity of different therapies currently being developed emphasises the importance of identifying the mutation appearing in each patient; 38.7% of the cases in this series are eligible to participate in current clinical trials. Copyright © 2016 Sociedad Española de Neurología. Publicado por Elsevier España, S.L.U. All rights reserved.

X-linked Alport syndrome associated with a synonymous p.Gly292Gly mutation alters the splicing donor site of the type IV collagen alpha chain 5 gene.

Science.gov (United States)

Fu, Xue Jun; Nozu, Kandai; Eguchi, Aya; Nozu, Yoshimi; Morisada, Naoya; Shono, Akemi; Taniguchi-Ikeda, Mariko; Shima, Yuko; Nakanishi, Koichi; Vorechovsky, Igor; Iijima, Kazumoto

2016-10-01

X-linked Alport syndrome (XLAS) is a progressive hereditary nephropathy caused by mutations in the type IV collagen alpha chain 5 gene (COL4A5). Although many COL4A5 mutations have previously been identified, pathogenic synonymous mutations have not yet been described. A family with XLAS underwent mutational analyses of COL4A5 by PCR and direct sequencing, as well as transcript analysis of potential splice site mutations. In silico analysis was also conducted to predict the disruption of splicing factor binding sites. Immunohistochemistry (IHC) of kidney biopsies was used to detect α2 and α5 chain expression. We identified a hemizygous point mutation, c.876A>T, in exon 15 of COL4A5 in the proband and his brother, which is predicted to result in a synonymous amino acid change, p.(Gly292Gly). Transcript analysis showed that this mutation potentially altered splicing because it disrupted the splicing factor binding site. The kidney biopsy of the proband showed lamellation of the glomerular basement membrane (GBM), while IHC revealed negative α5(IV) staining in the GBM and Bowman's capsule, which is typical of XLAS. This is the first report of a synonymous COL4A5 substitution being responsible for XLAS. Our findings suggest that transcript analysis should be conducted for the future correct assessment of silent mutations.

Chronic photoperiod disruption does not increase vulnerability to focal cerebral ischemia in young normotensive rats.

Science.gov (United States)

Ku Mohd Noor, Ku Mastura; Wyse, Cathy; Roy, Lisa A; Biello, Stephany M; McCabe, Christopher; Dewar, Deborah

2017-11-01

Photoperiod disruption, which occurs during shift work, is associated with changes in metabolism or physiology (e.g. hypertension and hyperglycaemia) that have the potential to adversely affect stroke outcome. We sought to investigate if photoperiod disruption affects vulnerability to stroke by determining the impact of photoperiod disruption on infarct size following permanent middle cerebral artery occlusion. Adult male Wistar rats (210-290 g) were housed singly under two different light/dark cycle conditions ( n = 12 each). Controls were maintained on a standard 12:12 light/dark cycle for nine weeks. For rats exposed to photoperiod disruption, every three days for nine weeks, the lights were switched on 6 h earlier than in the previous photoperiod. T 2 -weighted magnetic resonance imaging was performed at 48 h after middle cerebral artery occlusion. Disruption of photoperiod in young healthy rats for nine weeks did not alter key physiological variables that can impact on ischaemic damage, e.g. blood pressure and blood glucose immediately prior to middle cerebral artery occlusion. There was no effect of photoperiod disruption on infarct size after middle cerebral artery occlusion. We conclude that any potentially adverse effect of photoperiod disruption on stroke outcome may require additional factors such as high fat/high sugar diet or pre-existing co-morbidities.

Disruption of each of the secreted aspartyl proteinase genes SAP1, SAP2, and SAP3 of Candida albicans attenuates virulence.

OpenAIRE

Hube, B; Sanglard, D; Odds, F C; Hess, D; Monod, M; Schäfer, W; Brown, A J; Gow, N A

1997-01-01

Secreted aspartyl proteinases (Saps), encoded by a gene family with at least nine members (SAP1 to SAP9), are one of the most discussed virulence factors produced by the human pathogen Candida albicans. In order to study the role of each Sap isoenzyme in pathogenicity, we have constructed strains which harbor mutations at selected SAP genes. SAP1, SAP2, and SAP3, which are regulated differentially in vitro, were mutated by targeted gene disruption. The growth rates of all homozygous null muta...

Random mtDNA mutations modulate proliferation capacity in mouse embryonic fibroblasts

International Nuclear Information System (INIS)

Kukat, Alexandra; Edgar, Daniel; Bratic, Ivana; Maiti, Priyanka; Trifunovic, Aleksandra

2011-01-01

Highlights: → Increased mtDNA mutations in MEFs lead to high level of spontaneous immortalization. → This process is independent of endogenous ROS production. → Aerobic glycolysis significantly contributes to spontaneous immortalization of MEFs. -- Abstract: An increase in mtDNA mutation load leads to a loss of critical cells in different tissues thereby contributing to the physiological process of organismal ageing. Additionally, the accumulation of senescent cells that display changes in metabolic function might act in an active way to further disrupt the normal tissue function. We believe that this could be the important link missing in our understanding of the molecular mechanisms of premature ageing in the mtDNA mutator mice. We tested proliferation capacity of mtDNA mutator cells in vitro. When cultured in physiological levels of oxygen (3%) their proliferation capacity is somewhat lower than wild-type cells. Surprisingly, in conditions of increased oxidative stress (20% O 2 ) mtDNA mutator mouse embryonic fibroblasts exhibit continuous proliferation due to spontaneous immortalization, whereas the same conditions promote senescence in wild-type cells. We believe that an increase in aerobic glycolysis observed in mtDNA mutator mice is a major mechanism behind this process. We propose that glycolysis promotes proliferation and allows a fast turnover of metabolites, but also leads to energy crisis due to lower ATP production rate. This could lead to compromised replication and/or repair and therefore, in rare cases, might lead to mutations in tumor suppressor genes and spontaneous immortalization.

The rate of spontaneous mutations in human myeloid cells

International Nuclear Information System (INIS)

Araten, David J.; Krejci, Ondrej; DiTata, Kimberly; Wunderlich, Mark; Sanders, Katie J.; Zamechek, Leah; Mulloy, James C.

2013-01-01

Highlights: • We provide the first measurement of the mutation rate (μ) in human myeloid cells. • μ is measured to be 3.6–23 × 10 −7 per cell division. • The AML-ETO and MLL-AF9 fusions do not seem to increase μ. • Cooperating mutations in NRAS, FLT3 and p53 not seem to increase μ. • Hypermutability may be required to explain leukemogenesis. - Abstract: The mutation rate (μ) is likely to be a key parameter in leukemogenesis, but historically, it has been difficult to measure in humans. The PIG-A gene has some advantages for the detection of spontaneous mutations because it is X-linked, and therefore only one mutation is required to disrupt its function. Furthermore, the PIG-A-null phenotype is readily detected by flow cytometry. Using PIG-A, we have now provided the first in vitro measurement of μ in myeloid cells, using cultures of CD34+ cells that are transduced with either the AML-ETO or the MLL-AF9 fusion genes and expanded with cytokines. For the AML-ETO cultures, the median μ value was ∼9.4 × 10 −7 (range ∼3.6–23 × 10 −7 ) per cell division. In contrast, few spontaneous mutations were observed in the MLL-AF9 cultures. Knockdown of p53 or introduction of mutant NRAS or FLT3 alleles did not have much of an effect on μ. Based on these data, we provide a model to predict whether hypermutability must occur in the process of leukemogenesis

Limited importance of the dominant-negative effect of TP53 missense mutations

International Nuclear Information System (INIS)

Stoczynska-Fidelus, Ewelina; Liberski, Pawel P; Rieske, Piotr; Szybka, Malgorzata; Piaskowski, Sylwester; Bienkowski, Michal; Hulas-Bigoszewska, Krystyna; Banaszczyk, Mateusz; Zawlik, Izabela; Jesionek-Kupnicka, Dorota; Kordek, Radzislaw

2011-01-01

Heterozygosity of TP53 missense mutations is related to the phenomenon of the dominant-negative effect (DNE). To estimate the importance of the DNE of TP53 mutations, we analysed the percentage of cancer cases showing a single heterozygous mutation of TP53 and searched for a cell line with a single heterozygous mutation of this gene. This approach was based on the knowledge that genes with evident DNE, such as EGFR and IDH1, represent nearly 100% of single heterozygous mutations in tumour specimens and cell lines. Genetic analyses (LOH and sequencing) performed for early and late passages of several cell lines originally described as showing single heterozygous TP53 mutations (H-318, G-16, PF-382, MOLT-13, ST-486 and LS-123). Statistical analysis of IARC TP53 and SANGER databases. Genetic analyses of N-RAS, FBXW7, PTEN and STR markers to test cross-contamination and cell line identity. Cell cloning, fluorescence-activated cell sorting and SSCP performed for the PF-382 cell line. A database study revealed TP53 single heterozygous mutations in 35% of in vivo (surgical and biopsy) samples and only 10% of cultured cells (in vitro), although those numbers appeared to be overestimated. We deem that published in vivo TP53 mutation analyses are not as rigorous as studies in vitro, and we did not find any cell line showing a stable, single heterozygous mutation. G16, PF-382 and MOLT-13 cells harboured single heterozygous mutations temporarily. ST-486, H-318 and LS-123 cell lines were misclassified. Specific mutations, such as R175H, R273H, R273L or R273P, which are reported in the literature to exert a DNE, showed the lowest percentage of single heterozygous mutations in vitro (about 5%). We suggest that the currently reported percentage of TP53 single heterozygous mutations in tumour samples and cancer cell lines is overestimated. Thus, the magnitude of the DNE of TP53 mutations is questionable. This scepticism is supported by database investigations showing that retention

Germline mutation of CBL is associated with moyamoya disease in a child with juvenile myelomonocytic leukemia and Noonan syndrome-like disorder.

Science.gov (United States)

Hyakuna, Nobuyuki; Muramatsu, Hideki; Higa, Takeshi; Chinen, Yasutsugu; Wang, Xinan; Kojima, Seiji

2015-03-01

Germline mutations in CBL have been identified in patients with Noonan syndrome-like phenotypes, while juvenile myelomonocytic leukemia (JMML) harbors duplication of a germline CBL, resulting in acquired isodisomy. The association between moyamoya disease and Noonan syndrome carrying a PTPN11 mutation has recently been reported. We present a patient with JMML who developed moyamoya disease and neovascular glaucoma. Our patient exhibited a Noonan syndrome-like phenotype. Genetic analysis revealed acquired isodisomy and a germline heterozygous mutation in CBL. This is a rare case of CBL mutation associated with moyamoya disease. Prolonged RAS pathway signaling may cause disruption of cerebrovascular development. © 2014 Wiley Periodicals, Inc.

Disruptions in JET

International Nuclear Information System (INIS)

Wesson, J.A.; Gill, R.D.; Hugon, M.

1989-01-01

In JET, both high density and low-q operation are limited by disruptions. The density limit disruptions are caused initially by impurity radiation. This causes a contraction of the plasma temperature profile and leads to an MHD unstable configuration. There is evidence of magnetic island formation resulting in minor disruptions. After several minor disruptions, a major disruption with a rapid energy quench occurs. This event takes place in two stages. In the first stage there is a loss of energy from the central region. In the second stage there is a more rapid drop to a very low temperature, apparently due to a dramatic increase in impurity radiation. The final current decay takes place in the resulting cold plasma. During the growth of the MHD instability the initially rotating mode is brought to rest. This mode locking is believed to be due to an electromagnetic interaction with the vacuum vessel and external magnetic field asymmetries. The low-q disruptions are remarkable for the precision with which they occur at q ψ = 2. These disruptions do not have extended precursors or minor disruptions. The instability grows and locks rapidly. The energy quench and current decay are generally similar to those of the density limit. (author). 43 refs, 35 figs, 3 tabs

Helicobacter pylori Disrupts Host Cell Membranes, Initiating a Repair Response and Cell Proliferation

Directory of Open Access Journals (Sweden)

Hsueh-Fen Juan

2012-08-01

Full Text Available Helicobacter pylori (H. pylori, the human stomach pathogen, lives on the inner surface of the stomach and causes chronic gastritis, peptic ulcer, and gastric cancer. Plasma membrane repair response is a matter of life and death for human cells against physical and biological damage. We here test the hypothesis that H. pylori also causes plasma membrane disruption injury, and that not only a membrane repair response but also a cell proliferation response are thereby activated. Vacuolating cytotoxin A (VacA and cytotoxin-associated gene A (CagA have been considered to be major H. pylori virulence factors. Gastric cancer cells were infected with H. pylori wild type (vacA+/cagA+, single mutant (ΔvacA or ΔcagA or double mutant (ΔvacA/ΔcagA strains and plasma membrane disruption events and consequent activation of membrane repair components monitored. H. pylori disrupts the host cell plasma membrane, allowing localized dye and extracellular Ca²⁺ influx. Ca²⁺-triggered members of the annexin family, A1 and A4, translocate, in response to injury, to the plasma membrane, and cell surface expression of an exocytotic maker of repair, LAMP-2, increases. Additional forms of plasma membrane disruption, unrelated to H. pylori exposure, also promote host cell proliferation. We propose that H. pylori activation of a plasma membrane repair is pro-proliferative. This study might therefore provide new insight into potential mechanisms of H. pylori-induced gastric carcinogenesis.

Disease: H01208 [KEGG MEDICUS

Lifescience Database Archive (English)

Full Text Available d that a homozygous mutation in SPATA16 was associated with male infertility in h...uman globozoospermia. It has also been reported that a recurrent deletion of DPY19L2 causes infertility in m...hoven H, Viville S ... TITLE ... Homozygous mutation in SPATA16 is associated with male infertility in human g

Digital disruption ?syndromes.

Science.gov (United States)

Sullivan, Clair; Staib, Andrew

2017-05-18

The digital transformation of hospitals in Australia is occurring rapidly in order to facilitate innovation and improve efficiency. Rapid transformation can cause temporary disruption of hospital workflows and staff as processes are adapted to the new digital workflows. The aim of this paper is to outline various types of digital disruption and some strategies for effective management. A large tertiary university hospital recently underwent a rapid, successful roll-out of an integrated electronic medical record (EMR). We observed this transformation and propose several digital disruption "syndromes" to assist with understanding and management during digital transformation: digital deceleration, digital transparency, digital hypervigilance, data discordance, digital churn and post-digital 'depression'. These 'syndromes' are defined and discussed in detail. Successful management of this temporary digital disruption is important to ensure a successful transition to a digital platform. What is known about this topic? Digital disruption is defined as the changes facilitated by digital technologies that occur at a pace and magnitude that disrupt established ways of value creation, social interactions, doing business and more generally our thinking. Increasing numbers of Australian hospitals are implementing digital solutions to replace traditional paper-based systems for patient care in order to create opportunities for improved care and efficiencies. Such large scale change has the potential to create transient disruption to workflows and staff. Managing this temporary disruption effectively is an important factor in the successful implementation of an EMR. What does this paper add? A large tertiary university hospital recently underwent a successful rapid roll-out of an integrated electronic medical record (EMR) to become Australia's largest digital hospital over a 3-week period. We observed and assisted with the management of several cultural, behavioural and

A single mutation in Taiwanese H6N1 influenza hemagglutinin switches binding to human-type receptors

Energy Technology Data Exchange (ETDEWEB)

de Vries, Robert P.; Tzarum, Netanel; Peng, Wenjie; Thompson, Andrew J.; Ambepitiya Wickramasinghe, Iresha N.; de la Pena, Alba T. Torrents; van Breemen, Marielle J.; Bouwman, Kim M.; Zhu, Xueyong; McBride, Ryan; Yu, Wenli; Sanders, Rogier W.; Verheije, Monique H.; Wilson, Ian A.; Paulson, James C.

2017-07-10

In June 2013, the first case of human infection with an avian H6N1 virus was reported in a Taiwanese woman. Although this was a single non-fatal case, the virus continues to circulate in Taiwanese poultry. As with any emerging avian virus that infects humans, there is concern that acquisition of human-type receptor specificity could enable transmission in the human population. Despite mutations in the receptor-binding pocket of the human H6N1 isolate, it has retained avian-type (NeuAcα2-3Gal) receptor specificity. However, we show here that a single nucleotide substitution, resulting in a change from Gly to Asp at position 225 (G225D), completely switches specificity to human-type (NeuAcα2-6Gal) receptors. Significantly, G225D H6 loses binding to chicken trachea epithelium and is now able to bind to human tracheal tissue. Structural analysis reveals that Asp225 directly interacts with the penultimate Gal of the human-type receptor, stabilizing human receptor binding.

Meat and fish consumption, APC gene mutations and hMLH1 expression in colon and rectal cancer: a prospective cohort study (the Netherlands)

NARCIS (Netherlands)

Luchtenborg, M.; Weijenberg, M.P.; Goeij, de A.F.P.M.; Wark, P.A.; Brink, M.; Roemen, G.M.J.M.; Lentjes, M.H.F.M.; Bruine, de A.P.; Goldbohm, R.A.; Veer, van 't P.; Brandt, van den P.A.

2005-01-01

Objective:The aim of this study was to investigate the associations between meat and fish consumption and APC mutation status and hMLH1 expression in colon and rectal cancer. Methods:The associations were investigated in the Netherlands Cohort Study, and included 434 colon and 154 rectal cancer

HFE MUTATIONS AND IRON OVERLOAD IN PATIENTS WITH ALCOHOLIC LIVER DISEASE

Directory of Open Access Journals (Sweden)

Luis COSTA-MATOS

2013-03-01

Full Text Available Context Alcoholic liver disease (ALD is generally associated with iron overload, which may contribute to its pathogenesis, through increased oxidative stress and cellular damage. There are conflicting reports in literature about hemochromatosis (HFE gene mutations and the severity of liver disease in alcoholic patients. Objectives To compare the prevalence of mutations in the hemochromatosis (HFE gene between patients with ALD and healthy controls; to assess the relation of HFE mutations with liver iron stores and liver disease severity. Methods Liver biopsy specimens were obtained from 63 ALD patients (during routine treatment and 52 healthy controls (during elective cholecystectomy. All individuals underwent routine liver function tests and HFE genotyping (to detect wild-type sequences and C282Y, H63D, S65C, E168Q, E168X, V59M, H63H, P160delC, Q127H, Q283P, V53M and W164X mutations. Associations between HFE mutations and risk of excessive liver iron stores, abnormal serum ferritin, liver fibrosis, or necroinflammatory activity were assessed by multivariate logistic regression analysis. Results ALD patients had significantly higher serum ferritin and transferrin saturation than controls (both P<0.05, but the distribution of HFE mutations was similar between the two groups. For ALD patients, the odds ratio for having at least one HFE mutation and excessive liver iron stores was 17.23 (95% confidence interval (CI: 2.09-142.34, P = 0.008. However, the presence of at least one HFE mutation was not associated with an increased risk of liver fibrosis or necroinflammatory activity. Active alcohol ingestion showed the strongest association to increased serum ferritin (OR = 8.87, 95% CI: 2.11-34.78, P = 0.003. Conclusions ALD patients do not present with a differential profile of HFE mutations from healthy controls. In ALD patients, however, the presence of at least one HFE mutation increases the risk of having excessive liver iron stores but has no

Human germline hedgehog pathway mutations predispose to fatty liver.

Science.gov (United States)

Guillen-Sacoto, Maria J; Martinez, Ariel F; Abe, Yu; Kruszka, Paul; Weiss, Karin; Everson, Joshua L; Bataller, Ramon; Kleiner, David E; Ward, Jerrold M; Sulik, Kathleen K; Lipinski, Robert J; Solomon, Benjamin D; Muenke, Maximilian

2017-10-01

Non-alcoholic fatty liver disease (NAFLD) is the most common form of liver disease. Activation of hedgehog (Hh) signaling has been implicated in the progression of NAFLD and proposed as a therapeutic target; however, the effects of Hh signaling inhibition have not been studied in humans with germline mutations that affect this pathway. Patients with holoprosencephaly (HPE), a disorder associated with germline mutations disrupting Sonic hedgehog (SHH) signaling, were clinically evaluated for NAFLD. A combined mouse model of Hh signaling attenuation (Gli2 heterozygous null: Gli2 +/- ) and diet-induced NAFLD was used to examine aspects of NAFLD and hepatic gene expression profiles, including molecular markers of hepatic fibrosis and inflammation. Patients with HPE had a higher prevalence of liver steatosis compared to the general population, independent of obesity. Exposure of Gli2 +/- mice to fatty liver-inducing diets resulted in increased liver steatosis compared to wild-type mice. Similar to humans, this effect was independent of obesity in the mutant mice and was associated with decreased expression of pro-fibrotic and pro-inflammatory genes, and increased expression of PPARγ, a potent anti-fibrogenic and anti-inflammatory regulator. Interestingly, tumor suppressors p53 and p16INK4 were found to be downregulated in the Gli2 +/- mice exposed to a high-fat diet. Our results indicate that germline mutations disrupting Hh signaling promotes liver steatosis, independent of obesity, with reduced fibrosis. While Hh signaling inhibition has been associated with a better NAFLD prognosis, further studies are required to evaluate the long-term effects of mutations affecting this pathway. Lay summary: Non-alcoholic fatty liver disease (NAFLD) is characterized by excess fat deposition in the liver predominantly due to high calorie intake and a sedentary lifestyle. NAFLD progression is usually accompanied by activation of the Sonic hedgehog (SHH) pathway leading to fibrous

Analysis of the IgV(H) somatic mutations in splenic marginal zone lymphoma defines a group of unmutated cases with frequent 7q deletion and adverse clinical course.

Science.gov (United States)

Algara, Patricia; Mateo, Marisol S; Sanchez-Beato, Margarita; Mollejo, Manuela; Navas, Immaculada C; Romero, Lourdes; Solé, Francesc; Salido, Marta; Florensa, Lourdes; Martínez, Pedro; Campo, Elias; Piris, Miguel A

2002-02-15

This study aimed to correlate the frequency of somatic mutations in the IgV(H) gene and the use of specific segments in the V(H) repertoire with the clinical and characteristic features of a series of 35 cases of splenic marginal zone lymphoma (SMZL). The cases were studied by seminested polymerase chain reaction by using primers from the FR1 and J(H) region. The results showed unexpected molecular heterogeneity in this entity, with 49% unmutated cases (less than 2% somatic mutations). The 7q31 deletions and a shorter overall survival were more frequent in this group. Additionally a high percentage (18 of 40 sequences) of SMZL cases showed usage of the V(H)1-2 segment, thereby emphasizing the singularity of this neoplasia, suggesting that this tumor derives from a highly selected B-cell population and encouraging the search for specific antigens that are pathogenically relevant in the genesis or progression of this tumor.

Mutation Glu82Lys in lamin A/C gene is associated with cardiomyopathy and conduction defect

International Nuclear Information System (INIS)

Wang Hu; Wang Jizheng; Zheng Weiyue; Wang Xiaojian; Wang Shuxia; Song Lei; Zou Yubao; Yao Yan; Hui Rutai

2006-01-01

Dilated cardiomyopathy is a form of heart muscle disease characterized by impaired systolic function and ventricular dilation. The mutations in lamin A/C gene have been linked to dilated cardiomyopathy. We screened genetic mutations in a large Chinese family of 50 members including members with dilated cardiomyopathy and found a Glu82Lys substitution mutation in the rod domain of the lamin A/C protein in eight family members, three of them have been diagnosed as dilated cardiomyopathy, one presented with heart dilation. The pathogenic mechanism of lamin A/C gene defect is poorly understood. Glu82Lys mutated lamin A/C and wild type protein was transfected into HEK293 cells. The mutated protein was not properly localized at the inner nuclear membrane and the emerin protein, which interacts with lamin A/C, was also aberrantly distributed. The nuclear membrane structure was disrupted and heterochromatin was aggregated aberrantly in the nucleus of the HEK293 cells stably transfected with mutated lamin A/C gene as determined by transmission electron microscopy

A new type of gene-disruption cassette with a rescue gene for Pichia pastoris.

Science.gov (United States)

Shibui, Tatsuro; Hara, Hiroyoshi

2017-09-01

Pichia pastoris has been used for the production of many recombinant proteins, and many useful mutant strains have been created. However, the efficiency of mutant isolation by gene-targeting is usually low and the procedure is difficult for those inexperienced in yeast genetics. In order to overcome these issues, we developed a new gene-disruption system with a rescue gene using an inducible Cre/mutant-loxP system. With only short homology regions, the gene-disruption cassette of the system replaces its target-gene locus containing a mutation with a compensatory rescue gene. As the cassette contains the AOX1 promoter-driven Cre gene, when targeted strains are grown on media containing methanol, the DNA fragment, i.e., the marker, rescue and Cre genes, between the mutant-loxP sequences in the cassette is excised, leaving only the remaining mutant-loxP sequence in the genome, and consequently a target gene-disrupted mutant can be isolated. The system was initially validated on ADE2 gene disruption, where the disruption can easily be detected by color-change of the colonies. Then, the system was applied for knocking-out URA3 and OCH1 genes, reported to be difficult to accomplish by conventional gene-targeting methods. All three gene-disruption cassettes with their rescue genes replaced their target genes, and the Cre/mutant-loxP system worked well to successfully isolate their knock-out mutants. This study identified a new gene-disruption system that could be used to effectively and strategically knock out genes of interest, especially whose deletion is detrimental to growth, without using special strains, e.g., deficient in nonhomologous end-joining, in P. pastoris. © 2017 American Institute of Chemical Engineers Biotechnol. Prog., 33:1201-1208, 2017. © 2017 American Institute of Chemical Engineers.

Path-oriented early reaction to approaching disruptions in ASDEX Upgrade and TCV in view of the future needs for ITER and DEMO

Science.gov (United States)

Maraschek, M.; Gude, A.; Igochine, V.; Zohm, H.; Alessi, E.; Bernert, M.; Cianfarani, C.; Coda, S.; Duval, B.; Esposito, B.; Fietz, S.; Fontana, M.; Galperti, C.; Giannone, L.; Goodman, T.; Granucci, G.; Marelli, L.; Novak, S.; Paccagnella, R.; Pautasso, G.; Piovesan, P.; Porte, L.; Potzel, S.; Rapson, C.; Reich, M.; Sauter, O.; Sheikh, U.; Sozzi, C.; Spizzo, G.; Stober, J.; Treutterer, W.; ZancaP; ASDEX Upgrade Team; TCV Team; the EUROfusion MST1 Team

2018-01-01

Routine reaction to approaching disruptions in tokamaks is currently largely limited to machine protection by mitigating an ongoing disruption, which remains a basic requirement for ITER and DEMO [1]. Nevertheless, a mitigated disruption still generates stress to the device. Additionally, in future fusion devices, high-performance discharge time itself will be very valuable. Instead of reacting only on generic features, occurring shortly before the disruption, the ultimate goal is to actively avoid approaching disruptions at an early stage, sustain the discharges whenever possible and restrict mitigated disruptions to major failures. Knowledge of the most relevant root causes and the corresponding chain of events leading to disruption, the disruption path, is a prerequisite. For each disruption path, physics-based sensors and adequate actuators must be defined and their limitations considered. Early reaction facilitates the efficiency of the actuators and enhances the probability of a full recovery. Thus, sensors that detect potential disruptions in time are to be identified. Once the entrance into a disruption path is detected, we propose a hierarchy of actions consisting of (I) recovery of the discharge to full performance or at least continuation with a less disruption-prone backup scenario, (II) complete avoidance of disruption to sustain the discharge or at least delay it for a controlled termination and, (III), only as last resort, a disruption mitigation. Based on the understanding of disruption paths, a hierarchical and path-specific handling strategy must be developed. Such schemes, testable in present devices, could serve as guidelines for ITER and DEMO operation. For some disruption paths, experiments have been performed at ASDEX Upgrade and TCV. Disruptions were provoked in TCV by impurity injection into ELMy H-mode discharges and in ASDEX Upgrade by forcing a density limit in H-mode discharges. The new approach proposed in this paper is discussed for

Disruption of Trichoderma reesei cre2, encoding an ubiquitin C-terminal hydrolase, results in increased cellulase activity

Science.gov (United States)

2011-01-01

Background The filamentous fungus Trichoderma reesei (Hypocrea jecorina) is an important source of cellulases for use in the textile and alternative fuel industries. To fully understand the regulation of cellulase production in T. reesei, the role of a gene known to be involved in carbon regulation in Aspergillus nidulans, but unstudied in T. reesei, was investigated. Results The T. reesei orthologue of the A. nidulans creB gene, designated cre2, was identified and shown to be functional through heterologous complementation of a creB mutation in A. nidulans. A T. reesei strain was constructed using gene disruption techniques that contained a disrupted cre2 gene. This strain, JKTR2-6, exhibited phenotypes similar to the A. nidulans creB mutant strain both in carbon catabolite repressing, and in carbon catabolite derepressing conditions. Importantly, the disruption also led to elevated cellulase levels. Conclusions These results demonstrate that cre2 is involved in cellulase expression. Since the disruption of cre2 increases the amount of cellulase activity, without severe morphological affects, targeting creB orthologues for disruption in other industrially useful filamentous fungi, such as Aspergillus oryzae, Trichoderma harzianum or Aspergillus niger may also lead to elevated hydrolytic enzyme activity in these species. PMID:22070776

Disruption of Trichoderma reesei cre2, encoding an ubiquitin C-terminal hydrolase, results in increased cellulase activity

Directory of Open Access Journals (Sweden)

Denton Jai A

2011-11-01

Full Text Available Abstract Background The filamentous fungus Trichoderma reesei (Hypocrea jecorina is an important source of cellulases for use in the textile and alternative fuel industries. To fully understand the regulation of cellulase production in T. reesei, the role of a gene known to be involved in carbon regulation in Aspergillus nidulans, but unstudied in T. reesei, was investigated. Results The T. reesei orthologue of the A. nidulans creB gene, designated cre2, was identified and shown to be functional through heterologous complementation of a creB mutation in A. nidulans. A T. reesei strain was constructed using gene disruption techniques that contained a disrupted cre2 gene. This strain, JKTR2-6, exhibited phenotypes similar to the A. nidulans creB mutant strain both in carbon catabolite repressing, and in carbon catabolite derepressing conditions. Importantly, the disruption also led to elevated cellulase levels. Conclusions These results demonstrate that cre2 is involved in cellulase expression. Since the disruption of cre2 increases the amount of cellulase activity, without severe morphological affects, targeting creB orthologues for disruption in other industrially useful filamentous fungi, such as Aspergillus oryzae, Trichoderma harzianum or Aspergillus niger may also lead to elevated hydrolytic enzyme activity in these species.

Disruption of the LOV-Jalpha helix interaction activates phototropin kinase activity.

Science.gov (United States)

Harper, Shannon M; Christie, John M; Gardner, Kevin H

2004-12-28

Light plays a crucial role in activating phototropins, a class of plant photoreceptors that are sensitive to blue and UV-A wavelengths. Previous studies indicated that phototropin uses a bound flavin mononucleotide (FMN) within its light-oxygen-voltage (LOV) domain to generate a protein-flavin covalent bond under illumination. In the C-terminal LOV2 domain of Avena sativa phototropin 1, formation of this bond triggers a conformational change that results in unfolding of a helix external to this domain called Jalpha [Harper, S. M., et al. (2003) Science 301, 1541-1545]. Though the structural effects of illumination were characterized, it was unknown how these changes are coupled to kinase activation. To examine this, we made a series of point mutations along the Jalpha helix to disrupt its interaction with the LOV domain in a manner analogous to light activation. Using NMR spectroscopy and limited proteolysis, we demonstrate that several of these mutations displace the Jalpha helix from the LOV domain independently of illumination. When placed into the full-length phototropin protein, these point mutations display constitutive kinase activation, without illumination of the sample. These results indicate that unfolding of the Jalpha helix is the critical event in regulation of kinase signaling for the phototropin proteins.

INDUCTION OF DNA ADDUCTS, TUMORS, AND KI-RAS ONCOGENE MUTATIONS IN STRAIN A/J MOUSE LUNG BY IP. ADMINISTRATION OF DIBENZ[A,H]ANTHRACENE

Science.gov (United States)

Induction of DNA adducts, tumors, and Ki-ras oncogene mutations in strain AlJ mouse lung by ip. administration of dibenz[a,h]anthracene Previous studies of polycyclic aromatic hydrocarbon (P AH) induced lung tumors in the strain NJ mouse model system have demonstrated qua...

Mutations in TGFbeta-RII and BAX mediate tumor progression in the later stages of colorectal cancer with microsatellite instability

International Nuclear Information System (INIS)

Yashiro, Masakazu; Hirakawa, Kosei; Boland, C Richard

2010-01-01

Microsatellite instability (MSI) occurs in 15% of colorectal cancers (CRC). The genetic targets for mutation in the MSI phenotype include somatic mutations in the transforming growth factor beta receptor typeII (TGFbetaRII), BAX, hMSH3 and hMSH6. It is not clear how mutations of these genes mediate tumor progression in the MSI pathway, and the temporal sequence of these mutations remains uncertain. In this study, early stage CRCs were examined for frameshift mutations in these target genes, and compared with late stage tumors and CRC cell lines. We investigated 6 CRC cell lines and 71 sporadic CRCs, including 61 early stage cancers and 10 late stage cancers. Mutations of repetitive mononucleotide tracts in the coding regions of TGFbetaRII, BAX, hMSH3, hMSH6, IGFIIR and Fas antigen were identified by direct sequencing. Thirteen (18.3%) of 71 CRC, including 9/61 (14.7%) early stage cancers and 4/10 (40%) late stage cancers, were identified as MSI and analyzed for frameshift mutations. No mutation in the target genes was observed in any of the 9 early stage MSI CRCs. In contrast, frameshift mutations of TGFbetaRII, BAX, hMSH3 and hMSH6 were present in 3/4 late stage MSI tumors. There is a statistical association (p = 0.014) between mutation in any one gene and tumor stage. TGFbetaRII, BAX, hMSH3 and hMSH6 mutations are relatively late events in the genesis of MSI CRCs. The frameshift mutations in these target genes might mediate progression from early to late stage cancer, rather than mediating the adenoma to carcinoma transition

Disruption of Fyn SH3 domain interaction with a proline-rich motif in liver kinase B1 results in activation of AMP-activated protein kinase.

Directory of Open Access Journals (Sweden)

Eijiro Yamada

Full Text Available Fyn-deficient mice display increased AMP-activated Protein Kinase (AMPK activity as a result of Fyn-dependent regulation of Liver Kinase B1 (LKB1 in skeletal muscle. Mutation of Fyn-specific tyrosine sites in LKB1 results in LKB1 export into the cytoplasm and increased AMPK activation site phosphorylation. This study characterizes the structural elements responsible for the physical interaction between Fyn and LKB1. Effects of point mutations in the Fyn SH2/SH3 domains and in the LKB1 proline-rich motif on 1 Fyn and LKB1 binding, 2 LKB1 subcellular localization and 3 AMPK phosphorylation were investigated in C2C12 muscle cells. Additionally, novel LKB1 proline-rich motif mimicking cell permeable peptides were generated to disrupt Fyn/LKB1 binding and investigate the consequences on AMPK activity in both C2C12 cells and mouse skeletal muscle. Mutation of either Fyn SH3 domain or the proline-rich motif of LKB1 resulted in the disruption of Fyn/LKB1 binding, re-localization of 70% of LKB1 signal in the cytoplasm and a 2-fold increase in AMPK phosphorylation. In vivo disruption of the Fyn/LKB1 interaction using LKB1 proline-rich motif mimicking cell permeable peptides recapitulated Fyn pharmacological inhibition. We have pinpointed the structural elements within Fyn and LKB1 that are responsible for their binding, demonstrating the functionality of this interaction in regulating AMPK activity.

Rifampicin-Resistance Mutations in the rpoB Gene in Bacillus velezensis CC09 have Pleiotropic Effects.

Science.gov (United States)

Cai, Xun-Chao; Xi, Huan; Liang, Li; Liu, Jia-Dong; Liu, Chang-Hong; Xue, Ya-Rong; Yu, Xiang-Yang

2017-01-01

Rifampicin resistance (Rif r ) mutations in the RNA polymerase β subunit ( rpoB ) gene exhibit pleiotropic phenotypes as a result of their effects on the transcription machinery in prokaryotes. However, the differences in the effects of the mutations on the physiology and metabolism of the bacteria remain unknown. In this study, we isolated seven Rif r mutations in rpoB , including six single point mutations (H485Y, H485C, H485D, H485R, Q472R, and S490L) and one double point mutation (S490L/S617F) from vegetative cells of an endophytic strain, Bacillus velezensis CC09. Compared to the wild-type (WT) strain (CC09), the H485R and H485D mutants exhibited a higher degree of inhibition of Aspergillus niger spore germination, while the H485Y, S490L, Q472R, and S490L/S617F mutants exhibited a lower degree of inhibition due to their lower production of the antibiotic iturin A. These mutants all exhibited defective phenotypes in terms of pellicle formation, sporulation, and swarming motility. A hierarchical clustering analysis of the observed phenotypes indicated that the four mutations involving amino acid substitutions at H485 in RpoB belonged to the same cluster. In contrast, the S490L and Q472R mutations, as well as the WT strain, were in another cluster, indicating a functional connection between the mutations in B. velezensis and phenotypic changes. Our data suggest that Rif r mutations cannot only be used to study transcriptional regulation mechanisms, but can also serve as a tool to increase the production of bioactive metabolites in B. velezensis .

Mutation choice to eliminate buried free cysteines in protein therapeutics.

Science.gov (United States)

Xia, Xue; Longo, Liam M; Blaber, Michael

2015-02-01

Buried free-cysteine (Cys) residues can contribute to an irreversible unfolding pathway that promotes protein aggregation, increases immunogenic potential, and significantly reduces protein functional half-life. Consequently, mutation of buried free-Cys residues can result in significant improvement in the storage, reconstitution, and pharmacokinetic properties of protein-based therapeutics. Mutational design to eliminate buried free-Cys residues typically follows one of two common heuristics: either substitution by Ser (polar and isosteric), or substitution by Ala or Val (hydrophobic); however, a detailed structural and thermodynamic understanding of Cys mutations is lacking. We report a comprehensive structure and stability study of Ala, Ser, Thr, and Val mutations at each of the three buried free-Cys positions (Cys16, Cys83, and Cys117) in fibroblast growth factor-1. Mutation was almost universally destabilizing, indicating a general optimization for the wild-type Cys, including van der Waals and H-bond interactions. Structural response to Cys mutation characteristically involved changes to maintain, or effectively substitute, local H-bond interactions-by either structural collapse to accommodate the smaller oxygen radius of Ser/Thr, or conversely, expansion to enable inclusion of novel H-bonding solvent. Despite the diverse structural effects, the least destabilizing average substitution at each position was Ala, and not isosteric Ser. © 2014 Wiley Periodicals, Inc. and the American Pharmacists Association.

Characteristics of gene mutation in Chinese patients with hereditary hemochromatosis

Directory of Open Access Journals (Sweden)

LYU Tingxia

2016-08-01

Full Text Available ObjectiveTo investigate the characteristics of gene mutation in Chinese patients with hereditary hemochromatosis (HH. MethodsA total of 9 patients with HH who visited Beijing Friendship Hospital, Capital Medical University from January 2013 to December 2015 were enrolled. The genomic DNA was extracted, and PCR amplification and Sanger sequencing were performed for all the exons of four genotypes of HH, i.e., HFE (type Ⅰ, HJV (type ⅡA, HAMP (type ⅡB, TFR2 (type Ⅲ, and SLC40A1 (type Ⅳ to analyze gene mutations. A total of 50 healthy subjects were enrolled as control group to analyze the prevalence of identified gene mutations in a healthy population. ResultsOf all patients, 2 had H63D mutation of HFE gene in type Ⅰ HH, 1 had E3D mutation of HJV gene in type ⅡA HH, 2 had I238M mutation of TFR2 gene in type Ⅲ HH, and 1 had IVS 3+10 del GTT splice mutation of SLC40A1 gene in type Ⅳ HH. No patients had C282Y mutation of HFE gene in type Ⅰ HH which was commonly seen in European and American populations. Five patients had no missense mutation or splice mutation. In addition, it was found in a family that a HH patient had E3D mutation of HJV gene, H63D mutation of HFE gene, and I238M mutation of TFR2 gene, but the healthy brother and sister carrying two of these mutations did not had the phenotype of HH. ConclusionHH gene mutations vary significantly across patients of different races, and non-HFE-HH is dominant in the Chinese population. There may be HH genes which are different from known genes, and further investigation is needed.